The insulation performance of reactive parylene films in implantable electronic devices
Seymour, John P.; Elkasabi, Yaseen; Chen, Hsien-yeh; Lahann, Joerg; Kipke, Daryl R.
2009-01-01
Parylene-C (poly-chloro-p-xylylene) is an appropriate material for use in an implantable, microfabricated device. It is hydrophobic, conformally deposited, has a low dielectric constant, and superb biocompatibility. Yet for many bioelectrical applications, its poor wet adhesion may be an impassable shortcoming. This research contrasts parylene-C and poly(p-xylylene) functionalized with reactive group X (PPX-X) layers using long-term electrical soak and adhesion tests. The reactive parylene was made of complementary derivatives having aldehyde and aminomethyl side groups (PPX-CHO and PPX-CH2NH2 respectively). These functional groups have previously been shown to covalently react together after heating. Electrical testing was conducted in saline at 37°C on interdigitated electrodes with either parylene-C or reactive parylene as the metal layer interface. Results showed that reactive parylene devices maintained the highest impedance. Heat-treated PPX-X device impedance was 800% greater at 10 kHz and 70% greater at 1Hz relative to heated parylene-C controls after 60 days. Heat treatment proved to be critical for maintaining high impedance of both parylene-C and the reactive parylene. Adhesion measurements showed improved wet metal adhesion for PPX-X, which corresponds well with its excellent high frequency performance. PMID:19703712
Cisar, J; Kabat, E A; Liao, J; Potter, M
1974-01-01
Four BALB/c IgA mouse myeloma proteins (W3129, W3434, QUPC 52, and UPC 102) reactive with dextran, four myeloma proteins reactive with fructosans, three IgA (W3082, UPC 61, and Y5476), and one IgG2a (UPC 10), and two human antilevans were studied immunochemically. Quantitative precipitin and inhibition assays showed that W3129, W3434, and QUPC 52 had specificities for isomaltose oligosaccharides similar to those previously found with alpha(1 --> 6)-specific human antidextrans. W3129 and W3434 were most complementary to IM5 but W3129 reacted equally with IM4 and IM3 while W3434 had a greater affinity for IM4 than IM3. QUPC 52 had a larger combining region and was most complementary to IM6. Protein UPC 102 (IgA), like MOPC 104E (IgM) (27), was most complementary to the alpha(1 --> 3)-linked trisaccharide, nigerotriose, and thus differed from J558 (29), which was inhibited best by nigeropentaose. UPC 102 was similar to J558 but they differed from MOPC 104E in their reactions with non-alpha(1 --> 3)-linked disaccharides. The fructosan-specific myeloma proteins fell into two groups with different specificities. The first group, W3082 (IgA), UPC 61 (IgA), and the previously studied J606 (IgG3) (28, 29), reacted with inulin and W3082 and UPC 61 appeared to have identical specificities for beta(2 --> 1)-linked fructofuranosyl residues with maximum complementarity for the tetrasaccharide betaDfructofuranosyl (2 --> 1)betaDfructofuranosyl(2 --> 1)betaDfructofuranosyl(2 --> 6)Dglucose while protein J606 was inhibited best by the trisaccharide betaDfructofuranosyl(2 --> 1)betaDfructofuranosyl(2 --> 6)Dglucose. W3082 and UPC 61 also differed from J606 in their behavior toward sucrose and betaDfructofuranosyl(2 --> 6)Dglucose as compared with alphaDglucosyl(1 --> 3)Dfructose (turanose). The second group containing myeloma proteins UPC 10 (IgG2a) and Y5476 (IgA) behaved similarly to human antilevans in that neither reacted with inulin nor were they inhibited by the beta(2 --> 1)-linked fructose oligosaccharides. Unlike the beta(2 --> 1)-specific proteins, they reacted with perennial rye grass levan that contained over 90% beta(2 --> 6)links. The differences in specificity and site size among homogeneous mouse myeloma proteins reactive with the same antigenic determinant are completely consistent with the concept that they represent products of homogeneous clones selected from the known heterogeneous population of antibody-forming cells.
Furuhama, A; Hasunuma, K; Aoki, Y; Yoshioka, Y; Shiraishi, H
2011-01-01
The validity of chemical reaction mechanistic domains defined by skin sensitisation in the Quantitative Structure-Activity Relationship (QSAR) ecotoxicity system, KAshinhou Tools for Ecotoxicity (KATE), March 2009 version, has been assessed and an external validation of the current KATE system carried out. In the case of the fish end-point, the group of chemicals with substructures reactive to skin sensitisation always exhibited higher root mean square errors (RMSEs) than chemicals without reactive substructures under identical C- or log P-judgements in KATE. However, in the case of the Daphnia end-point this was not so, and the group of chemicals with reactive substructures did not always have higher RMSEs: the Schiff base mechanism did not function as a high error detector. In addition to the RMSE findings, the presence of outliers suggested that the KATE classification rules needs to be reconsidered, particularly for the amine group. Examination of the dependency of the organism on the toxic action of chemicals in fish and Daphnia revealed that some of the reactive substructures could be applied to the improvement of the KATE system. It was concluded that the reaction mechanistic domains of toxic action for skin sensitisation could provide useful complementary information in predicting acute aquatic ecotoxicity, especially at the fish end-point.
Sacheli, Lucia Maria; Christensen, Andrea; Giese, Martin A; Taubert, Nick; Pavone, Enea Francesco; Aglioti, Salvatore Maria; Candidi, Matteo
2015-02-17
During social interactions people automatically apply stereotypes in order to rapidly categorize others. Racial differences are among the most powerful cues that drive these categorizations and modulate our emotional and cognitive reactivity to others. We investigated whether implicit racial bias may also shape hand kinematics during the execution of realistic joint actions with virtual in- and out-group partners. Caucasian participants were required to perform synchronous imitative or complementary reach-to-grasp movements with avatars that had different skin color (white and black) but showed identical action kinematics. Results demonstrate that stronger visuo-motor interference (indexed here as hand kinematics differences between complementary and imitative actions) emerged: i) when participants were required to predict the partner's action goal in order to on-line adapt their own movements accordingly; ii) during interactions with the in-group partner, indicating the partner's racial membership modulates interactive behaviors. Importantly, the in-group/out-group effect positively correlated with the implicit racial bias of each participant. Thus visuo-motor interference during joint action, likely reflecting predictive embodied simulation of the partner's movements, is affected by cultural inter-individual differences.
Qasem, Wafaa; Azad, Meghan B; Hossain, Zakir; Azad, Elnaz; Jorgensen, Sarah; Castillo San Juan, Sandra; Cai, Chenxi; Khafipour, Ehsan; Beta, Trust; Roberts, L Jackson; Friel, James
2017-02-14
The World Health Organization recommends exclusive breastfeeding until 6 months followed by introduction of iron-rich complementary foods (CFs). The aim of this study was to determine the impact of different iron-rich CFs on infant gut inflammation and microbiota. Eighty-seven exclusively breastfed infants were randomly assigned to receive one of the following as their first CF: iron-fortified cereal (Cer), iron-fortified cereal with fruit (Cer + Fr), or meat (M). Urine and stool samples were collected to assess reactive oxygen species (ROS) generation, gut microbiota and inflammation. Fecal iron differed across feeding groups (p < 0.001); levels were highest in the Cer group and lowest in M group. A significant increase of fecal ROS formation (p < 0.002) after the introduction of CFs was observed, but did not differ across feeding groups. Fecal calprotectin increased within all groups after the introduction of CFs (p = 0.004). Gut microbiota richness increased after introduction of M or Cer + Fr. Regardless of feeding group, Coriobacteriaceae were positively correlated with ROS and Staphylococcaceae were negatively correlated with calprotectin. Choice of first CF may influence gut inflammation and microbiota, potentially due to variations in iron absorption from different foods. Further research is warranted to fully characterize these associations and to establish implications for infant health. This study was registered in the ClinicalTrial.gov registry (Identifier No. NCT01790542 ). This study was registered in the ClinicalTrial.gov registry under the name "Assessment of Complementary Feeding of Canadian Infants" (Identifier No. NCT01790542 ) February 6, 2013.
NASA Astrophysics Data System (ADS)
Reuther, James F.; Dees, Justine L.; Kolesnichenko, Igor V.; Hernandez, Erik T.; Ukraintsev, Dmitri V.; Guduru, Rusheel; Whiteley, Marvin; Anslyn, Eric V.
2018-01-01
Naturally occurring peptides and proteins often use dynamic disulfide bonds to impart defined tertiary/quaternary structures for the formation of binding pockets with uniform size and function. Although peptide synthesis and modification are well established, controlling quaternary structure formation remains a significant challenge. Here, we report the facile incorporation of aryl aldehyde and acyl hydrazide functionalities into peptide oligomers via solid-phase copper-catalysed azide-alkyne cycloaddition (SP-CuAAC) click reactions. When mixed, these complementary functional groups rapidly react in aqueous media at neutral pH to form peptide-peptide intermolecular macrocycles with highly tunable ring sizes. Moreover, sequence-specific figure-of-eight, dumbbell-shaped, zipper-like and multi-loop quaternary structures were formed selectively. Controlling the proportions of reacting peptides with mismatched numbers of complementary reactive groups results in the formation of higher-molecular-weight sequence-defined ladder polymers. This also amplified antimicrobial effectiveness in select cases. This strategy represents a general approach to the creation of complex abiotic peptide quaternary structures.
NASA Astrophysics Data System (ADS)
Srivastava, Pratima; Ghasemi, Mahsa; Ray, Namrata; Sarkar, Amitabha; Kocabova, Jana; Lachmanova, Stepanka; Hromadova, Magdalena; Boujday, Souhir; Cauteruccio, Silvia; Thakare, Pramod; Licandro, Emanuela; Fosse, Céline; Salmain, Michèle
2016-11-01
Amine-reactive surfaces comprising N-hydroxysuccinimide ester groups as well as much more unusual Fischer alkoxymetallocarbene groups were generated on gold-coated surfaces via self-assembled monolayers of carboxy- and azido-terminated thiolates, respectively. These functions were further used to immobilize homothymine peptide nucleic acid (PNA) decamer in a covalent fashion involving the primary amine located at its N-terminus. These stepwise processes were monitored by polarization modulation reflection - absorption infrared spectroscopy (PM-RAIRS) that gave useful information on the molecular composition of the organic layers. PNA grafting and hybridization with complementary DNA strand were successfully transduced by quartz crystal microbalance (QCM) measurements. Unfortunately, attempts to transduce the hybridization optically by IR in a label-free fashion were inconclusive. Therefore we undertook to introduce an IR reporter group, namely a transition metalcarbonyl (TMC) entity at the 5‧ terminus of complementary DNA. Evidence for the formation of PNA-DNA heteroduplex was brought by the presence of ν(Ctbnd O) bands in the 2000 cm-1 region of the IR spectrum of the gold surface owing to the metalcarbonyl label.
Quantitative Reactivity Scales for Dynamic Covalent and Systems Chemistry.
Zhou, Yuntao; Li, Lijie; Ye, Hebo; Zhang, Ling; You, Lei
2016-01-13
Dynamic covalent chemistry (DCC) has become a powerful tool for the creation of molecular assemblies and complex systems in chemistry and materials science. Herein we developed for the first time quantitative reactivity scales capable of correlation and prediction of the equilibrium of dynamic covalent reactions (DCRs). The reference reactions are based upon universal DCRs between imines, one of the most utilized structural motifs in DCC, and a series of O-, N-, and S- mononucleophiles. Aromatic imines derived from pyridine-2-carboxyaldehyde exhibit capability for controlling the equilibrium through distinct substituent effects. Electron-donating groups (EDGs) stabilize the imine through quinoidal resonance, while electron-withdrawing groups (EWGs) stabilize the adduct by enhancing intramolecular hydrogen bonding, resulting in curvature in Hammett analysis. Notably, unique nonlinearity induced by both EDGs and EWGs emerged in Hammett plot when cyclic secondary amines were used. This is the first time such a behavior is observed in a thermodynamically controlled system, to the best of our knowledge. Unified quantitative reactivity scales were proposed for DCC and defined by the correlation log K = S(N) (R(N) + R(E)). Nucleophilicity parameters (R(N) and S(N)) and electrophilicity parameters (R(E)) were then developed from DCRs discovered. Furthermore, the predictive power of those parameters was verified by successful correlation of other DCRs, validating our reactivity scales as a general and useful tool for the evaluation and modeling of DCRs. The reactivity parameters proposed here should be complementary to well-established kinetics based parameters and find applications in many aspects, such as DCR discovery, bioconjugation, and catalysis.
Babcock, W.C.; Friesen, D.T.
1988-11-01
Novel semipermeable membranes and thin film composite (TFC) gas separation membranes useful in the separation of oxygen, nitrogen, hydrogen, water vapor, methane, carbon dioxide, hydrogen sulfide, lower hydrocarbons, and other gases are disclosed. The novel semipermeable membranes comprise the polycondensation reaction product of two complementary polyfunctional compounds, each having at least two functional groups that are mutually reactive in a condensation polymerization reaction, and at least one of which is selected from siloxanes, alkoxsilyls and aryloxysilyls. The TFC membrane comprises a microporous polymeric support, the surface of which has the novel semipermeable film formed thereon, preferably by interfacial polymerization.
Babcock, Walter C.; Friesen, Dwayne T.
1988-01-01
Novel semiperimeable membranes and thin film composite (TFC) gas separation membranes useful in the separation of oxygen, nitrogen, hydrogen, water vapor, methane, carbon dioxide, hydrogen sulfide, lower hydrocarbons, and other gases are disclosed. The novel semipermeable membranes comprise the polycondensation reaction product of two complementary polyfunctional compounds, each having at least two functional groups that are mutually reactive in a condensation polymerization reaction, and at least one of which is selected from siloxanes, alkoxsilyls and aryloxysilyls. The TFC membrane comprises a microporous polymeric support, the surface of which has the novel semipermeable film formed thereon, preferably by interfacial polymerization.
ERIC Educational Resources Information Center
Khakzad, Mohammad Reza; Javanbakht, Maryam; Shayegan, Mohammad Reza; Kianoush, Sina; Omid, Fatemeh; Hojati, Maryam; Meshkat, Mojtaba
2012-01-01
C-reactive protein (CRP) is a beneficial diagnostic test for the evaluation of inflammatory response. Extremely low levels of CRP can be detected using high-sensitivity CRP (hs-CRP) test. A considerable body of evidence has demonstrated that inflammatory response has an important role in the pathophysiology of autism. In this study, we evaluated…
Sánchez-Márquez, Jesús
2016-11-21
A new methodology to obtain reactivity indices has been defined. This is based on reactivity functions such as the Fukui function or the dual descriptor and makes it possible to project the information of reactivity functions over molecular orbitals instead of the atoms of the molecule (atomic reactivity indices). The methodology focuses on the molecule's natural bond orbitals (bond reactivity indices) because these orbitals (with physical meaning) have the advantage of being very localized, allowing the reaction site of an electrophile or nucleophile to be determined within a very precise molecular region. This methodology gives a reactivity index for every Natural Bond Orbital (NBO), and we have verified that they have equivalent information to the reactivity functions. A representative set of molecules has been used to test the new definitions. Also, the bond reactivity index has been related with the atomic reactivity one, and complementary information has been obtained from the comparison. Finally, a new atomic reactivity index has been defined and compared with previous definitions.
Characterizing monoclonal antibody structure by carboxyl group footprinting
Kaur, Parminder; Tomechko, Sara E; Kiselar, Janna; Shi, Wuxian; Deperalta, Galahad; Wecksler, Aaron T; Gokulrangan, Giridharan; Ling, Victor; Chance, Mark R
2015-01-01
Structural characterization of proteins and their antigen complexes is essential to the development of new biologic-based medicines. Amino acid-specific covalent labeling (CL) is well suited to probe such structures, especially for cases that are difficult to examine by alternative means due to size, complexity, or instability. We present here a detailed account of carboxyl group labeling (with glycine ethyl ester (GEE) tagging) applied to a glycosylated monoclonal antibody therapeutic (mAb). The experiments were optimized to preserve the structural integrity of the mAb, and experimental conditions were varied and replicated to establish the reproducibility of the technique. Homology-based models were generated and used to compare the solvent accessibility of the labeled residues, which include aspartic acid (D), glutamic acid (E), and the C-terminus (i.e., the target probes), with the experimental data in order to understand the accuracy of the approach. Data from the mAb were compared to reactivity measures of several model peptides to explain observed variations in reactivity. Attenuation of reactivity in otherwise solvent accessible probes is documented as arising from the effects of positive charge or bond formation between adjacent amine and carboxyl groups, the latter accompanied by observed water loss. A comparison of results with previously published data by Deperalta et al using hydroxyl radical footprinting showed that 55% (32/58) of target residues were GEE labeled in this study whereas the previous study reported 21% of the targets were labeled. Although the number of target residues in GEE labeling is fewer, the two approaches provide complementary information. The results highlight advantages of this approach, such as the ease of use at the bench top, the linearity of the dose response plots at high levels of labeling, reproducibility of replicate experiments (<2% variation in modification extent), the similar reactivity of the three target probes, and significant correlation of reactivity and solvent accessible surface area. PMID:25933350
Basso, Agustín; Attademo, Andrés M; Lajmanovich, Rafael C; Peltzer, Paola M; Junges, Celina; Cabagna, Mariana C; Fiorenza, Gabriela S; Sanchez-Hernandez, Juan Carlos
2012-01-01
In this study, we determined normal serum butyrylcholinesterase (BChE) and carboxylesterase (CbE) activities in Tupinambis merianae in order to obtain reference values for organophosphorus pesticide monitoring. Forty-two T. merianae individuals were grouped by sex and size to identify potential differences in their enzyme levels to allow for proper representation of normal values for females, males, juveniles, and hatchlings. Mean CbE was determined using two model substrates: alpha-naphtylacetate (α-NA) and p-nitrophenyl valerate (4-NPV). BChE and CbE sensitivity to malaoxon (Mx) was also evaluated as well as the possibility of BChE reactivation with pyridine-2-aldoxime methochloride (2-PAM). Mean adult females' BChE was significantly higher than adult males, juveniles, and hatchlings. No significant differences were found between groups regarding CbE. CbE (4-NPV) activity showed slightly negative correlation with lizard snout-vent length, while BChE and CbE (α-NA) showed no correlation with body size. Apparent IC(50) values for BChE and CbE (α-NA) suggested different sensitivities among groups. CbE (4-NPV) could not be inhibited. All Mx-inhibited groups treated with 2-PAM in a final concentration of 2.8 mM showed clear signs of reactivation. In conclusion, the results demonstrate that (1) plasma esterase activity did not vary with age and sex, except for BChE activity, and (2) because biological and environmental variables could be confounding factors in the response of plasma cholinesterases, complementary biomarkers like CbE inhibition and oxime-induced reactivation of esterases are strongly recommended.
Sasaki, S
2001-04-01
A number of cross-linking (alkylating) agents have been developed and incorporated into the oligonulceotides for sequence selective control of gene expression. Recently, potential application of such active oligonucleotides has been expanding from use for improvement of inhibition efficiency to new biotechnology that may enable chemical alteration of genetic information. These interests in active oligonucleotides have encouraged the generation of new cross-linking agents that exhibit high efficiency for application of either in vitro or in vivo. This mini review summarizes structures of alkylating agents, in particular, a new basic skeleton for cross-linking, a 2'-deoxyribose derivative of 2-amino-6-vinylpurine that has been recently developed by the author's group. The 2-amino-6-vinylpurine has been shown to form a complex with cytidine under acidic conditions, and brings the vinyl and the amino reactive groups into proximity to achieve efficient alkylation. A new strategy was designed so that the reactivity of 2-amino-6-vinylpurine can be induced from the corresponding phenylsulfoxide derivative within a duplex with the complementary strand. The validity of the new strategy has been proven by achievement of cytidine-selective cross-linking with remarkably efficiency.
Draper, D E
1984-01-01
Bisulfite catalyzes transamination of cytidine at the N4 position; the suitability of this reaction for attaching reporter groups to selected cytidine residues in RNA molecules has been investigated. Poly(C) is nearly quantitatively converted to the poly (N4 aminoethyl-C) derivative after 3 hrs at 42 degrees C with ethylene diamine (pK1 = 7.6) and bisulfite. This derivative reacts quantitatively with N-hydroxysuccinimide esters; the linkage of a fluorescent dye, nitrobenzofurazan, to cytidine by this reaction is demonstrated. To direct the bisulfite reaction to selected cytidines within a large RNA molecule, the RNA is hybridized to complementary DNA containing a deletion. Only the cytidines in the single strand RNA loop (corresponding to the DNA deletion) are reactive. Two cytidines in the middle of a 340 base RNA fragment from 16S ribosomal RNA have been modified by this technique. Images PMID:6198634
Ligand-accelerated non-directed C-H functionalization of arenes.
Wang, Peng; Verma, Pritha; Xia, Guoqin; Shi, Jun; Qiao, Jennifer X; Tao, Shiwei; Cheng, Peter T W; Poss, Michael A; Farmer, Marcus E; Yeung, Kap-Sun; Yu, Jin-Quan
2017-11-22
The directed activation of carbon-hydrogen bonds (C-H) is important in the development of synthetically useful reactions, owing to the proximity-induced reactivity and selectivity that is enabled by coordinating functional groups. Palladium-catalysed non-directed C-H activation could potentially enable further useful reactions, because it can reach more distant sites and be applied to substrates that do not contain appropriate directing groups; however, its development has faced substantial challenges associated with the lack of sufficiently active palladium catalysts. Currently used palladium catalysts are reactive only with electron-rich arenes, unless an excess of arene is used, which limits synthetic applications. Here we report a 2-pyridone ligand that binds to palladium and accelerates non-directed C-H functionalization with arene as the limiting reagent. This protocol is compatible with a broad range of aromatic substrates and we demonstrate direct functionalization of advanced synthetic intermediates, drug molecules and natural products that cannot be used in excessive quantities. We also developed C-H olefination and carboxylation protocols, demonstrating the applicability of our methodology to other transformations. The site selectivity in these transformations is governed by a combination of steric and electronic effects, with the pyridone ligand enhancing the influence of sterics on the selectivity, thus providing complementary selectivity to directed C-H functionalization.
Ligand-accelerated non-directed C-H functionalization of arenes
NASA Astrophysics Data System (ADS)
Wang, Peng; Verma, Pritha; Xia, Guoqin; Shi, Jun; Qiao, Jennifer X.; Tao, Shiwei; Cheng, Peter T. W.; Poss, Michael A.; Farmer, Marcus E.; Yeung, Kap-Sun; Yu, Jin-Quan
2017-11-01
The directed activation of carbon-hydrogen bonds (C-H) is important in the development of synthetically useful reactions, owing to the proximity-induced reactivity and selectivity that is enabled by coordinating functional groups. Palladium-catalysed non-directed C-H activation could potentially enable further useful reactions, because it can reach more distant sites and be applied to substrates that do not contain appropriate directing groups; however, its development has faced substantial challenges associated with the lack of sufficiently active palladium catalysts. Currently used palladium catalysts are reactive only with electron-rich arenes, unless an excess of arene is used, which limits synthetic applications. Here we report a 2-pyridone ligand that binds to palladium and accelerates non-directed C-H functionalization with arene as the limiting reagent. This protocol is compatible with a broad range of aromatic substrates and we demonstrate direct functionalization of advanced synthetic intermediates, drug molecules and natural products that cannot be used in excessive quantities. We also developed C-H olefination and carboxylation protocols, demonstrating the applicability of our methodology to other transformations. The site selectivity in these transformations is governed by a combination of steric and electronic effects, with the pyridone ligand enhancing the influence of sterics on the selectivity, thus providing complementary selectivity to directed C-H functionalization.
An Electrochemical DNA Microbiosensor Based on Succinimide-Modified Acrylic Microspheres
Ulianas, Alizar; Heng, Lee Yook; Hanifah, Sharina Abu; Ling, Tan Ling
2012-01-01
An electrochemical microbiosensor for DNA has been fabricated based on new acrylic microspheres modified with reactive N-acryloxysuccinimide (NAS) functional groups. Hydrophobic poly(n-butylacrylate-N-acryloxysuccinimide) microspheres were synthesized in an emulsion form with a simple one-step photopolymerization technique. Aminated DNA probe was attached to the succinimde functional group of the acrylic microspheres via covalent bonding. The hybridization of the immobilized DNA probe with the complementary DNA was studied by differential pulse voltametry using anthraquninone-2-sulfonic acid monohydrate sodium salt (AQMS) as the electroactive hybridization label. The influences of many factors such as duration of DNA probe immobilization and hybridization, pH, type of ions, buffer concentrations, ionic strength, operational temperature and non-complementary DNA on the biosensor performance were evaluated. Under optimized conditions, the DNA microbiosensor demonstrated a linear response range to target DNA over a wide concentration range of 1.0 × 10−16 and 1.0 × 10−8 M with a lower limit of detection (LOD) of 9.46 × 10−17 M (R2 = 0.97). This DNA microbiosensor showed good reproducibility with 2.84% RSD (relative standard deviation) (n = 3). Application of the NAS-modified acrylic microspheres in the construction of DNA microbiosensor had improved the overall analytical performance of the resultant DNA microbiosensor when compared with other reported DNA biosensors using other nano-materials for membranes and microspheres as DNA immobilization matrices. PMID:22778594
C-terminal peptide extension via gas-phase ion/ion reactions
Peng, Zhou; McLuckey, Scott A.
2015-01-01
The formation of peptide bonds is of great importance from both a biological standpoint and in routine organic synthesis. Recent work from our group demonstrated the synthesis of peptides in the gas-phase via ion/ion reactions with sulfo-NHS reagents, which resulted in conjugation of individual amino acids or small peptides to the N-terminus of an existing ‘anchor’ peptide. Here, we demonstrate a complementary approach resulting in the C-terminal extension of peptides. Individual amino acids or short peptides can be prepared as reagents by incorporating gas phase-labile protecting groups to the reactive C-terminus and then converting the N-terminal amino groups to the active ketenimine reagent. Gas-phase ion/ion reactions between the anionic reagents and doubly protonated “anchor” peptide cations results in extension of the “anchor” peptide with new amide bond formation at the C-terminus. We have demonstrated that ion/ion reactions can be used as a fast, controlled, and efficient means for C-terminal peptide extension in the gas phase. PMID:26640400
Jia, Xue-Gong; Guo, Peng; Duan, Jicheng
2017-01-01
Controlling the selectivity in cross-electrophile coupling reactions is a significant challenge, particularly when one electrophile is much more reactive. We report a general and practical strategy to address this problem in the reaction between reactive and unreactive electrophiles by a combination of nickel and Lewis acid catalysis. This strategy is used for the coupling of aryl halides with allylic alcohols to form linear allylarenes selectively. The reaction tolerates a wide range of functional groups (e.g. silanes, boronates, anilines, esters, alcohols, and various heterocycles) and works with various allylic alcohols. Complementary to most current routes for the C3 allylation of an unprotected indole, this method provides access to C2 and C4–C7 allylated indoles. Preliminary mechanistic experiments reveal that the reaction might start with an aryl nickel intermediate, which then reacts with Lewis acid activated allylic alcohols in the presence of Mn. PMID:29629130
Probing surface sites of TiO2: reactions with [HRe(CO)5] and [CH3Re(CO)5].
Lobo-Lapidus, Rodrigo J; Gates, Bruce C
2010-10-04
Two carbonyl complexes of rhenium, [HRe(CO)(5)] and [CH(3)Re(CO)(5)], were used to probe surface sites of TiO(2) (anatase). These complexes were adsorbed from the gas phase onto anatase powder that had been treated in flowing O(2) or under vacuum to vary the density of surface OH sites. Infrared (IR) spectra demonstrate the variation in the number of sites, including Ti(+3)-OH and Ti(+4)-OH. IR and extended X-ray absorption fine structure (EXAFS) spectra show that chemisorption of the rhenium complexes led to their decarbonylation, with formation of surface-bound rhenium tricarbonyls, when [HRe(CO)(5)] was adsorbed, or rhenium tetracarbonyls, when [CH(3)Re(CO)(5)] was adsorbed. These reactions were accompanied by the formation of water and surface carbonates and removal of terminal hydroxyl groups associated with Ti(+3) and Ti(+4) ions on the anatase. Data characterizing the samples after adsorption of [HRe(CO)(5)] or [CH(3)Re(CO)(5)] determined a ranking of the reactivity of the surface OH sites, with the Ti(+3)-OH groups being the more reactive towards the rhenium complexes but the less likely to be dehydroxylated. The two rhenium pentacarbonyl probes provided complementary information, suggesting that the carbonate species originate from carbonyl ligands initially bonded to the rhenium and from hydroxyl groups of the titania surface, with the reaction leading to the formation of water and bridging hydroxyl groups on the titania. The results illustrate the value of using a family of organometallic complexes as probes of oxide surface sites.
Dahlhaus, Anne; Siebenhofer, Andrea; Guethlin, Corina
2015-01-01
The aim of this study was to investigate how general practitioners react when their cancer patients show interest in complementary medicine, and how their reaction is related to their knowledge in the field. We conducted semi-structured interviews with 10 German general practitioners. Interviewees came from 5 different federal states and varied in terms of urban/rural setting, single/joint practice, additional certifications, gender and length of professional experience. Interviews were electronically recorded, transcribed and then analysed using qualitative content analysis according to Mayring. General practitioners feel largely responsible for providing information on complementary medicine to their cancer patients. However, uncertainty and a lack of knowledge concerning CAM lead mainly to reactive responses to patients' needs, and the general practitioners base their recommendations on personal experiences and attitudes. They wish to support their cancer patients and thus, in order to keep their patients' hopes up and maintain a trusting relationship, sometimes support complementary medicine, regardless of their own convictions. Although general practitioners see themselves as an important source of information on complementary medicine for their cancer patients, they also speak of their uncertainties and lack of knowledge. General practitioners would profit from training in complementary medicine enabling them to discuss this topic with their cancer patients in a proactive, open and honest manner. © 2015 S. Karger GmbH, Freiburg
Xiawa Wu; Robert J. Moon; Ashlie Martini
2013-01-01
The elastic modulus of cellulose IÃ in the axial and transverse directions was obtained from atomistic simulations using both the standard uniform deformation approach and a complementary approach based on nanoscale indentation. This allowed comparisons between the methods and closer connectivity to experimental measurement techniques. A reactive...
Arend, Peter
2016-01-01
The formation of a histo (blood) group) ABO phenotype and the exclusion of an autoreactive IgM or isoagglutinin activity arise apparently in identical glycosylation of complementary domains on cell surfaces and plasma proteins. The fundamental O-glycan emptiness of the circulating IgM, which during the neonatal amino acid sequencing of the variable regions is exerting germline-specific O-GalNAc glycan-reactive serine/threonine residues that in the plasma of the adult human blood group O individuals apparently remain associated with the open glycosidic sites on the ABOH convertible red cell surface, must raise suggestions on a transient expression of developmental glycans, which have been "lost" over the course of maturation. In fact, while the mammalian non-somatic, embryogenic stem cell (ESC)- germ cell (GC) transformation is characterized by a transient and genetically as-yet-undefined trans-species-functional O-GalNAc glycan expression, in the C57BL/10 mouse such expression was potentially identified in growth-dependent, blood group A-like GalNAc glycan-bearing, ovarian glycolipids complementary with the syngeneic anti-A reactive IgM, which does not appear in early ovariectomized animals. This non-somatically encoded, polyreactive, ancestral IgM molecule has not undergone clonal selection and does primarily not differentiate between self and non-self and might, due to amino acid hydroxyl groups, highly suggest substrate competition with subsequent O-glycosylations in ongoing ESC-GC transformations and affecting GC maturation. However, the membrane-bound somatic N/O-glycotransferases, which initiate, after formation of the zygote, the complex construction of the human ABO phenotypes in the trans cisternae of the Golgi apparatus, are associated and/or completed with soluble enzyme versions exerting identical specificities in plasma and likely competing vice versa by glycosylation of neonatal IgM amino acids, where they suggest to accomplish the clearance of anti-A autoreactivity at germline serine and threonine residues. Sustaining the lineage-maintaining position of the classic A allele and the discovery of the OA hybrid alleles at the normal ABO locus and in heterozygous ESC lines have, together with clinical observations, raised discussions about a silent A-allelic support within blood group O reproduction. However, the question of whether a fictional "continued blood group O inbreeding" ultimately occurs without the A-allelic or somatic function remains unanswered because the genetic relationship between non-somatic O-GalNAc-glycosylations that operate before sperm-egg recognition and somatic O-GalNAc-glycosylations that arise after the formation of the zygote remains to be elucidated. Copyright © 2015 Elsevier GmbH. All rights reserved.
Uniform and Complementary Social Interaction: Distinct Pathways to Solidarity
Koudenburg, Namkje; Postmes, Tom; Gordijn, Ernestine H.; van Mourik Broekman, Aafke
2015-01-01
We examine how different forms of co-action give rise to feelings of solidarity. We propose that (a) coordinated action elicits a sense of solidarity, and (b) the process through which such solidarity emerges differs for different forms of co-action. We suggest that whether solidarity within groups emerges from uniform action (e.g. synchronizing, as when people speak in unison) or from more complementary forms of action (e.g. alternating, when speaking in turns) has important consequences for the emergent position of individuals within the group. Uniform action relies on commonality, leaving little scope for individuality. In complementary action each individual makes a distinctive contribution to the group, thereby increasing a sense of personal value to the group, which should contribute to the emergence of solidarity. The predictions receive support from five studies, in which we study groups in laboratory and field settings. Results show that both complementary and uniform co-action increase a sense of solidarity compared to control conditions. However, in the complementary action condition, but not in the uniform action (or synchrony) condition, the effect on feelings of solidarity is mediated by a sense of personal value to the group. PMID:26047131
Uniform and Complementary Social Interaction: Distinct Pathways to Solidarity.
Koudenburg, Namkje; Postmes, Tom; Gordijn, Ernestine H; van Mourik Broekman, Aafke
2015-01-01
We examine how different forms of co-action give rise to feelings of solidarity. We propose that (a) coordinated action elicits a sense of solidarity, and (b) the process through which such solidarity emerges differs for different forms of co-action. We suggest that whether solidarity within groups emerges from uniform action (e.g. synchronizing, as when people speak in unison) or from more complementary forms of action (e.g. alternating, when speaking in turns) has important consequences for the emergent position of individuals within the group. Uniform action relies on commonality, leaving little scope for individuality. In complementary action each individual makes a distinctive contribution to the group, thereby increasing a sense of personal value to the group, which should contribute to the emergence of solidarity. The predictions receive support from five studies, in which we study groups in laboratory and field settings. Results show that both complementary and uniform co-action increase a sense of solidarity compared to control conditions. However, in the complementary action condition, but not in the uniform action (or synchrony) condition, the effect on feelings of solidarity is mediated by a sense of personal value to the group.
Yu, Dongmei; Wang, Yuying; Wang, Fuzhen
2007-05-01
To investigate the effect of complementary food supplements with protein and multi-micronutrients on respiratory infections and diarrhea of infants and yound children in poor rural China. In 5 poor county of Gansu Province, 1478 children aged 4 - 12 months were enrolled and divided into two groups. In addition to the usual home-made complementary food, all the children were fed one package of either formula I or formula II per day, usual home-made complementary food, all the children were fed one package of either formula I or formula II per day, protein and micronutrient were supplemented in formula I group. Every 6 months, a massive dose of vitamin A was protein and micronutrient were supplemented in formula I group. Every 6 months, a massive dose of vitamin A was supplemented to all children, weight and height measurements have been done every 3 months until they were 24 months old. During the follow-up of 12 months supplementation, prevalence of respiratory infection and diarrhea reduce significantly compared with baseline survey (P < 0.0001), there is no difference between the two group at the same survey, lasting time of respiratory infection is shortened in formula I group, and medical cost of disease in the two groups Complementary food supplements, with large-dose vitamin A, reduce prevalence of reduced significantly. Complementary food supplements, with large-dose vitamin A, reduce prevalence of respiratory infections, diarrhea and medical cost of those diseases.
Negash, Canaan; Belachew, Tefera; Henry, Carol J; Kebebu, Afework; Abegaz, Kebede; Whiting, Susan J
2014-12-01
Nutritious complementary foods are needed in countries where undernutrition and stunting are major problems, but mothers may be reluctant to change from traditional gruels. To test whether a recipe-based complementary feeding education intervention would improve knowledge and practice of mothers with young children in Hula, Ethiopia. A baseline survey of 200 eligible, randomly selected mother-child pairs gathered data on sociodemographic characteristics, food security status, knowledge and practices concerning complementary feeding, food group intakes of children aged 6 to 23 months by 24-hour recalls, and children's anthropometric measurements. Twice a month for 6 months, women in the intervention group received an education session consisting of eight specific messages using Alive and Thrive posters and a demonstration and tasting of a local barley and maize porridge recipe containing 30% broad beans. The control group lived in a different area and had no intervention. At 6 months, knowledge and practice scores regarding complementary feeding were significantly improved (p < .001) in the intervention group but not in the control group. The intervention resulted in improvement of children's dietary diversity, as well as mean intake of energy and selected nutrients, compared with children in the control group. Changes in height and weight did not differ between the two groups. Community-based nutrition education over 6 months that included demonstration of a local porridge recipe with broad beans added improved the complementary feeding practices of caregivers and the nutritional status of their young children.
Tani, Toshihiko; Takeuchi, Tsuguto
2015-06-01
Plate-like Ca 3 Ti 2 O 7 (CT) and Nd 2 Ti 2 O 7 (NT) particles were synthesized in molten salts and used as reactive templates for the preparation of highly textured (Ca 0.7 Nd 0.3 ) 0.87 TiO 3 bulk ceramics (CNT) with preferred pseudocubic 〈100〉 and 〈110〉 orientations, respectively. During flux growth CT and NT particles developed facets parallel to the pseudocubic {100} and {110} planes, respectively, in a perovskite unit cell, since those planes correspond to the interlayers of the layered perovskite-type crystal structures. Complementary reactants for the CNT stoichiometry were wet-mixed with the reactive templates and the slurries were tape-cast. Then stacked tapes were heat-treated for dense single-phase CNT ceramics with a distorted and A-site deficient regular perovskite-type structure. The CNT ceramics prepared with CT and NT reactive templates exhibited strong pseudocubic 100- and 110-family x-ray diffraction peaks, respectively, with other peaks drastically suppressed when non-perovskite sources were used as complementary reactants. The textured ceramics possess unique microstructures; as either parallel or obliquely stacked block structures with a pseudocubic {100} plane faceted. The pseudocubic {100}-and {110}-textured CNT ceramics exhibited ∼10 and ∼20% higher products of the dielectric quality factor and frequency, Q · f , respectively, than conventional ceramic sintered at the same temperature. When Q · f is compared based on the same grain size, the {100}-textured CNT exhibited 27% higher values than non-textured while relative permittivity and temperature coefficient of resonant frequency were of similar values. Simple geometrical relationships between electric field and penetrated pseudocubic { hk 0}-type grain boundaries must lead to the reduced scattering and dielectric loss.
Vazir, Shahnaz; Engle, Patrice; Balakrishna, Nagalla; Griffiths, Paula L.; Johnson, Susan L.; Creed-Kanashiro, Hilary; Rao, Sylvia Fernandez; Shroff, Monal R.; Bentley, Margaret E.
2012-01-01
Inadequate feeding and care may contribute to high rates of stunting and underweight among children in rural families in India. This cluster-randomized trial tested the hypothesis that teaching caregivers appropriate complementary feeding, and strategies for how to feed and play responsively through home-visits would increase children’s dietary intake, growth, and development compared to home-visit-complementary feeding education alone or routine care. Sixty villages in Andhra Pradesh were randomized into 3 groups1 of 20 villages with 200 mother-infant dyads in each group. The Control Group (CG), received routine Integrated Child Development Services (ICDS); the Complementary Feeding Group (CFG), received the ICDS plus the World Health Organization recommendations on breastfeeding and complementary foods; and the Responsive Complementary Feeding & Play Group (RCF&PG) received the same intervention as the CFG plus skills for responsive feeding and psychosocial stimulation. Both intervention groups received bi-weekly visits by trained village women. The groups did not differ at 3 months on socioeconomic status, maternal and child nutritional indices and maternal depression. After controlling for potential confounding factors using the mixed models approach, the twelve-month intervention to the CFG and RCF&PG significantly (p<0.05) increased median intakes of energy, protein, Vitamin-A, calcium (CFG), iron and zinc, reduced stunting (0.19, CI: 0.0–0.4) in the CFG (but not RCF&PG) and increased (p<0.01) Bayley Mental Development scores(Mean=3.1, CI: 0.8–5.3) in the RCF&PG (but not CFG) compared to CG. Community-based educational interventions can improve dietary intake, length (CFG), and mental development (RCF&PG) for children under two years in food-secure rural Indian families. PMID:22625182
Vazir, Shahnaz; Engle, Patrice; Balakrishna, Nagalla; Griffiths, Paula L; Johnson, Susan L; Creed-Kanashiro, Hilary; Fernandez Rao, Sylvia; Shroff, Monal R; Bentley, Margaret E
2013-01-01
Inadequate feeding and care may contribute to high rates of stunting and underweight among children in rural families in India. This cluster-randomized trial tested the hypothesis that teaching caregivers appropriate complementary feeding and strategies for how to feed and play responsively through home-visits would increase children's dietary intake, growth and development compared with home-visit-complementary feeding education alone or routine care. Sixty villages in Andhra Pradesh were randomized into three groups of 20 villages with 200 mother-infant dyads in each group. The control group (CG) received routine Integrated Child Development Services (ICDS); the complementary feeding group (CFG) received the ICDS plus the World Health Organization recommendations on breastfeeding and complementary foods; and the responsive complementary feeding and play group (RCF&PG) received the same intervention as the CFG plus skills for responsive feeding and psychosocial stimulation. Both intervention groups received bi-weekly visits by trained village women. The groups did not differ at 3 months on socioeconomic status, maternal and child nutritional indices, and maternal depression. After controlling for potential confounding factors using the mixed models approach, the 12-month intervention to the CFG and RCF&PG significantly (P < 0.05) increased median intakes of energy, protein, Vitamin A, calcium (CFG), iron and zinc, reduced stunting [0.19, confidence interval (CI): 0.0-0.4] in the CFG (but not RCF&PG) and increased (P < 0.01) Bayley Mental Development scores (mean = 3.1, CI: 0.8-5.3) in the RCF&PG (but not CFG) compared with CG. Community-based educational interventions can improve dietary intake, length (CFG) and mental development (RCF&PG) for children under 2 years in food-secure rural Indian families. © 2012 Blackwell Publishing Ltd.
Valicenti-McDermott, Maria; Burrows, Bethany; Bernstein, Leora; Hottinger, Kathryn; Lawson, Katharine; Seijo, Rosa; Schechtman, Merryl; Shulman, Lisa; Shinnar, Shlomo
2014-03-01
The use of complementary and alternative medicine by children with autism and the association of its use with child comorbid symptoms and parental stress was studied in an ethnically diverse population, in a cross-sectional study with structured interviews. The sample included 50 families of children with autism and 50 families of children with other developmental disabilities, matched by age/gender. Interview included the Complementary and Alternative Medicine Questionnaire, Gastrointestinal Questionnaire, Children's Sleep Habits Questionnaire, Aberrant Behavior Checklist, and Parenting Stress Index. In this ethnically diverse sample, the use of complementary and alternative medicine was significantly higher for the autism group. In the autism group, use was significantly related to child's irritability, hyperactivity, food allergies, and parental stress; in the developmental disabilities group, there was no association with child comorbid symptoms or parental stress. The results contribute information to health care providers about families of children with autism who are more likely to use complementary and alternative medicine.
Adaptive group coordination and role differentiation.
Roberts, Michael E; Goldstone, Robert L
2011-01-01
Many real world situations (potluck dinners, academic departments, sports teams, corporate divisions, committees, seminar classes, etc.) involve actors adjusting their contributions in order to achieve a mutually satisfactory group goal, a win-win result. However, the majority of human group research has involved situations where groups perform poorly because task constraints promote either individual maximization behavior or diffusion of responsibility, and even successful tasks generally involve the propagation of one correct solution through a group. Here we introduce a group task that requires complementary actions among participants in order to reach a shared goal. Without communication, group members submit numbers in an attempt to collectively sum to a randomly selected target number. After receiving group feedback, members adjust their submitted numbers until the target number is reached. For all groups, performance improves with task experience, and group reactivity decreases over rounds. Our empirical results provide evidence for adaptive coordination in human groups, and as the coordination costs increase with group size, large groups adapt through spontaneous role differentiation and self-consistency among members. We suggest several agent-based models with different rules for agent reactions, and we show that the empirical results are best fit by a flexible, adaptive agent strategy in which agents decrease their reactions when the group feedback changes. The task offers a simple experimental platform for studying the general problem of group coordination while maximizing group returns, and we distinguish the task from several games in behavioral game theory.
Federal Register 2010, 2011, 2012, 2013, 2014
2010-03-17
... Complementary and Alternative Medicine Announcement of Workshop on Control/Comparison Groups for Trials of Non... the strengths and weaknesses of the various control/comparison groups used in studies of NPI and the most appropriate use of these control/ comparison groups. This workshop will be divided into six...
DOE Office of Scientific and Technical Information (OSTI.GOV)
Castro, Nelia, E-mail: nelia.castro@ntnu.no; Sorensen, Bjorn E.; Broekmans, Maarten A.T.M.
The mineral content of 5 aggregate samples from 4 different countries, including reactive and non-reactive aggregate types, was assessed quantitatively by X-ray diffraction (XRD) using polished sections. Additionally, electron probe microanalyzer (EPMA) mapping and cathodoluminescence (CL) were used to characterize the opal-CT identified in one of the aggregate samples. Critical review of results from polished sections against traditionally powdered specimen has demonstrated that for fine-grained rocks without preferred orientation the assessment of mineral content by XRD using polished sections may represent an advantage over traditional powder specimens. Comparison of data on mineral content and silica speciation with expansion data frommore » PARTNER project confirmed that the presence of opal-CT plays an important role in the reactivity of one of the studied aggregates. Used as a complementary tool to RILEM AAR-1, the methodology suggested in this paper has the potential to improve the strength of the petrographic method.« less
Toulmin, Anita; Baltierra-Jasso, Laura E; Morten, Michael J; Sabir, Tara; McGlynn, Peter; Schröder, Gunnar F; Smith, Brian O; Magennis, Steven W
2017-09-19
DNA three-way junctions (3WJs) are branched structures that serve as important biological intermediates and as components in DNA nanostructures. We recently derived the global structure of a fully complementary 3WJ and found that it contained unpaired bases at the branchpoint, which is consistent with previous observations of branch flexibility and branchpoint reactivity. By combining high-resolution single-molecule Förster resonance energy transfer, molecular modeling, time-resolved ensemble fluorescence spectroscopy, and the first 19 F nuclear magnetic resonance observations of fully complementary 3WJs, we now show that the 3WJ structure can adopt multiple distinct conformations depending upon the sequence at the branchpoint. A 3WJ with a GC-rich branchpoint adopts an open conformation with unpaired bases at the branch and at least one additional conformation with an increased number of base interactions at the branchpoint. This structural diversity has implications for branch interactions and processing in vivo and for technological applications.
NASA Astrophysics Data System (ADS)
Barrientos, Rodell C.; Vu, Ngoc; Zhang, Qibin
2017-08-01
Glycosphingolipids are essential biomolecules widely distributed across biological kingdoms yet remain relatively underexplored owing to both compositional and structural complexity. While the glycan head group has been the subject of most studies, there is paucity of reports on the lipid moiety, particularly the location of unsaturation. In this paper, ozone-induced dissociation mass spectrometry (OzID-MS) implemented in a traveling wave-based quadrupole time-of-flight (Q-ToF) mass spectrometer was applied to study unsaturated glycosphingolipids using shotgun approach. Resulting high resolution mass spectra facilitated the unambiguous identification of diagnostic OzID product ions. Using [M+Na]+ adducts of authentic standards, we observed that the long chain base and fatty acyl unsaturation had distinct reactivity with ozone. The reactivity of unsaturation in the fatty acyl chain was about 8-fold higher than that in the long chain base, which enables their straightforward differentiation. Influence of the head group, fatty acyl hydroxylation, and length of fatty acyl chain on the oxidative cleavage of double bonds was also observed. Application of this technique to bovine brain galactocerebrosides revealed co-isolated isobaric and regioisomeric species, which otherwise would be incompletely identified using contemporary collision-induced dissociation (CID) alone. These results highlight the potential of OzID-MS in glycosphingolipids research, which not only provides complementary structural information to existing CID technique but also facilitates de novo structural determination of these complex biomolecules. [Figure not available: see fulltext.
Liao, Hung-Chang; Wang, Ya-Huei
2016-04-01
This study examined whether students studying literature in complementary learning clusters would show more improvement in medical humanities literacy, critical thinking skills, and English proficiency compared to those in conventional learning clusters. Ninety-three students participated in the study (M age = 18.2 years, SD = 0.4; 36 men, 57 women). A quasi-experimental design was used over 16 weeks, with the control group (n = 47) working in conventional learning clusters and the experimental group (n = 46) working in complementary learning clusters. Complementary learning clusters were those in which individuals had complementary strengths enabling them to learn from and offer assistance to other cluster members, hypothetically facilitating the learning process. Measures included the Medical Humanities Literacy Scale, Critical Thinking Disposition Assessment, English proficiency tests, and Analytic Critical Thinking Scoring Rubric. The results showed that complementary learning clusters have the potential to improve students' medical humanities literacy, critical thinking skills, and English proficiency. © The Author(s) 2016.
Complementary Alternation Discourse Constructions in English: A Preliminary Study
ERIC Educational Resources Information Center
Iza Erviti, Aneider
2015-01-01
This paper examines the essential features of a group of constructions that belong to the family of complementary alternation discourse constructions in English. In this group of constructions, X and Y are two situations such that Y is less likely (or more likely) to happen than X. Each member of this group (X Let Alone Y, X Much Less Y, X Never…
Zócalo, Yanina; Farro, Ignacio; Farro, Federico; Scasso, Santiago; Bia, Daniel
2015-01-01
Introduction. Flow-mediated dilation (FMD), low flow-mediated constriction (L-FMC), and reactive hyperemia-related changes in carotid-to-radial pulse wave velocity (ΔPWVcr%) could offer complementary information about both “recruitability” and “resting” endothelial function (EF). Carotid-to-femoral pulse wave velocity (PWVcf) and pulse wave analysis-derived parameters (i.e., AIx@75) are the gold standard methods for noninvasive evaluation of aortic stiffness and central hemodynamics. If healthy pregnancy is associated with both changes in resting and recruitable EF, as well as in several arterial parameters, it remains unknown and/or controversial. Objectives. To simultaneously and noninvasively assess in healthy pregnant (HP) and nonpregnant (NP) women central parameters in conjunction with “basal and recruitable” EF, employing new complementary approaches. Methods. HP (n = 11, 34.2 ± 3.3 weeks of gestation) and age- and cardiovascular risk factors-matched NP (n = 22) were included. Aortic blood pressure (BP), AIx@75, PWVcf, common carotid stiffness, and intima-media thickness, as well as FMD, L-FMC, and ΔPWVcr %, were measured. Results. Aortic BP, stiffness, and AIx@75 were reduced in HP. ΔPWVcr% and FMD were enhanced in HP in comparison to NP. No differences were found in L-FMC between groups. Conclusion. HP is associated with reduced aortic stiffness, central BP, wave reflections, and enhanced recruitable, but not resting, EF. PMID:26421317
Constructing New Bioorthogonal Reagents and Reactions.
Row, R David; Prescher, Jennifer A
2018-05-15
Chemical tools are transforming our understanding of biomolecules and living systems. Included in this group are bioorthogonal reagents-functional groups that are inert to most biological species, but can be selectively ligated with complementary probes, even in live cells and whole organisms. Applications of these tools have revealed fundamental new insights into biomolecule structure and function-information often beyond the reach of genetic approaches. In many cases, the knowledge gained from bioorthogonal probes has enabled new questions to be asked and innovative research to be pursued. Thus, the continued development and application of these tools promises to both refine our view of biological systems and facilitate new discoveries. Despite decades of achievements in bioorthogonal chemistry, limitations remain. Several reagents are too large or insufficiently stable for use in cellular environments. Many bioorthogonal groups also cross-react with one another, restricting them to singular tasks. In this Account, we describe our work to address some of the voids in the bioorthogonal toolbox. Our efforts to date have focused on small reagents with a high degree of tunability: cyclopropenes, triazines, and cyclopropenones. These motifs react selectively with complementary reagents, and their unique features are enabling new pursuits in biology. The Account is organized by common themes that emerged in our development of novel bioorthogonal reagents and reactions. First, natural product structures can serve as valuable starting points for probe design. Cyclopropene, triazine, and cyclopropenone motifs are all found in natural products, suggesting that they would be metabolically stable and compatible with a variety of living systems. Second, fine-tuning bioorthogonal reagents is essential for their successful translation to biological systems. Different applications demand different types of probes; thus, generating a collection of tools that span a continuum of reactivities and stabilities remains an important goal. We have used both computational analyses and mechanistic studies to guide the optimization of various cyclopropene and triazine probes. Along the way, we identified reagents that are chemoselective but best suited for in vitro work. Others are selective and robust enough for use in living organisms. The last section of this Account highlights the need for the continued pursuit of new reagents and reactions. Challenges exist when bioorthogonal chemistries must be used in concert, given that many exploit similar mechanisms and cannot be used simultaneously. Such limitations have precluded certain multicomponent labeling studies and other biological applications. We have relied on mechanistic and computational insights to identify mutually orthogonal sets of reactions, in addition to exploring unique genres of reactivity. The continued development of mechanistically distinct, biocompatible reactions will further diversify the bioorthogonal reaction portfolio for examining biomolecules.
Complementary feeding patterns among ethnic groups in rural western China.
Qu, Peng-Fei; Zhang, Ya; Li, Jia-Mei; Zhang, Ruo; Yang, Jiao-Mei; Lei, Fang-Liang; Li, Shan-Shan; Liu, Dan-Meng; Dang, Shao-Nong; Yan, Hong
This study investigated complementary feeding practices among four ethnic groups (Han, Uygur, Tibetan, and Zhuang) based on a cross-sectional survey in rural western China. In 2005, a stratified multistage cluster random sampling method was used to recruit 9712 children (7411 Han, 1032 Uygur, 678 Tibetan, and 591 Zhuang) between 6 and 35 months of age and their mothers from 45 counties in 10 provinces (autonomous regions, municipalities) in western China. The rates of early introduction (before 6 months) of complementary foods in four ethnic groups (Han, Uygur, Tibetan, and Zhuang) were 71.30%, 95.95%, 82.40%, and 72.30%, respectively. The Infant and Child Feeding Index (ICFI) for Uygur and Tibetan children was lower than that for Han children at all age groups. Uygur children were more likely to have unqualified ICFI compared with Han children in a multivariate logistic regression (odds ratio (OR)=5.138, 95% confidence interval (CI): 4.340-6.084). A higher level of maternal education, greater family wealth, and the availability of complementary feeding educational materials decreased the likelihood of an unqualified ICFI. The nutritional status of children (Han, Tibetan, and Zhuang) with qualified ICFI was better than that for children with unqualified ICFI. Appropriate interventions are required to improve complementary feeding practices in rural western China.
Sensitive detection of multiple pathogens using a single DNA probe.
Nordin, Noordiana; Yusof, Nor Azah; Abdullah, Jaafar; Radu, Son; Hushiarian, Roozbeh
2016-12-15
A simple but promising electrochemical DNA nanosensor was designed, constructed and applied to differentiate a few food-borne pathogens. The DNA probe was initially designed to have a complementary region in Vibrio parahaemolyticus (VP) genome and to make different hybridization patterns with other selected pathogens. The sensor was based on a screen printed carbon electrode (SPCE) modified with polylactide-stabilized gold nanoparticles (PLA-AuNPs) and methylene blue (MB) was employed as the redox indicator binding better to single-stranded DNA. The immobilization and hybridization events were assessed using differential pulse voltammetry (DPV). The fabricated biosensor was able to specifically distinguish complementary, non-complementary and mismatched oligonucleotides. DNA was measured in the range of 2.0×10(-9)-2.0×10(-13)M with a detection limit of 5.3×10(-12)M. The relative standard deviation for 6 replications of DPV measurement of 0.2µM complementary DNA was 4.88%. The fabricated DNA biosensor was considered stable and portable as indicated by a recovery of more than 80% after a storage period of 6 months at 4-45°C. Cross-reactivity studies against various food-borne pathogens showed a reliably sensitive detection of VP. Copyright © 2016 Elsevier B.V. All rights reserved.
Tani, Toshihiko; Takeuchi, Tsuguto
2015-01-01
Plate-like Ca3Ti2O7 (CT) and Nd2Ti2O7 (NT) particles were synthesized in molten salts and used as reactive templates for the preparation of highly textured (Ca0.7Nd0.3)0.87TiO3 bulk ceramics (CNT) with preferred pseudocubic 〈100〉 and 〈110〉 orientations, respectively. During flux growth CT and NT particles developed facets parallel to the pseudocubic {100} and {110} planes, respectively, in a perovskite unit cell, since those planes correspond to the interlayers of the layered perovskite-type crystal structures. Complementary reactants for the CNT stoichiometry were wet-mixed with the reactive templates and the slurries were tape-cast. Then stacked tapes were heat-treated for dense single-phase CNT ceramics with a distorted and A-site deficient regular perovskite-type structure. The CNT ceramics prepared with CT and NT reactive templates exhibited strong pseudocubic 100- and 110-family x-ray diffraction peaks, respectively, with other peaks drastically suppressed when non-perovskite sources were used as complementary reactants. The textured ceramics possess unique microstructures; as either parallel or obliquely stacked block structures with a pseudocubic {100} plane faceted. The pseudocubic {100}-and {110}-textured CNT ceramics exhibited ∼10 and ∼20% higher products of the dielectric quality factor and frequency, Q · f, respectively, than conventional ceramic sintered at the same temperature. When Q · f is compared based on the same grain size, the {100}-textured CNT exhibited 27% higher values than non-textured while relative permittivity and temperature coefficient of resonant frequency were of similar values. Simple geometrical relationships between electric field and penetrated pseudocubic {hk0}-type grain boundaries must lead to the reduced scattering and dielectric loss. PMID:27877809
Lössl, Philip; Sinz, Andrea
2016-01-01
During the last 15 years, the combination of chemical cross-linking and high-resolution mass spectrometry (MS) has matured into an alternative approach for analyzing 3D-structures of proteins and protein complexes. Using the distance constraints imposed by the cross-links, models of the protein or protein complex under investigation can be created. The majority of cross-linking studies are currently conducted with homobifunctional amine-reactive cross-linkers. We extend this "traditional" cross-linking/MS strategy by adding complementary photo-cross-linking data. For this, the diazirine-containing unnatural amino acids photo-leucine and photo-methionine are incorporated into the proteins and cross-link formation is induced by UV-A irradiation. The advantage of the photo-cross-linking strategy is that it is not restricted to lysine residues and that hydrophobic regions in proteins can be targeted, which is advantageous for investigating membrane proteins. We consider the strategy of combining cross-linkers with orthogonal reactivities and distances to be ideally suited for maximizing the amount of structural information that can be gained from a cross-linking experiment.
Spiegel, D; Stroud, P; Fyfe, A
1998-01-01
The widespread use of complementary and alternative medicine techniques, often explored by patients without discussion with their primary care physician, is seen as a request from patients for care as well as cure. In this article, we discuss the reasons for the growth of and interest in complementary and alternative medicine in an era of rapidly advancing medical technology. There is, for instance, evidence of the efficacy of supportive techniques such as group psychotherapy in improving adjustment and increasing survival time of cancer patients. We describe current and developing complementary medicine programs as well as opportunities for integration of some complementary techniques into standard medical care. PMID:9584661
Wang, Kai; Jiang, Guomin; Jia, Zhongzhi; Zhu, Xiaoli; Ni, Caifang
2018-06-01
The aim of this study was to investigate the reactivation of the hepatitis B virus (HBV) following transarterial chemoembolization (TACE) in primary hepatocellular carcinoma (HCC) patients with HBV-DNA negative and to evaluate the effects of TACE combined with antiviral therapy. This prospective study involved 98 patients with HBV-related and HBV-DNA negative HCC (HBV DNA < 10 copies/mL) underwent TACE procedures with serial HBV DNA tests. Patients were divided into the antiviral treatment group and the no-antiviral group. The antiviral group received entecavir antiviral therapy, and the other group received no antiviral therapy. Two groups of patients were compared in rate of HBV reactivation and liver function before and after only 1 session of TACE in average 1-month follow-up after operation. P < .05 indicated differences with a statistical significance. HBV reactivation occurred in 11 patients in the nonantiviral group (11/47, 23.4%) but only 3 patients in the antiviral group (3/51, 5.9%, P < .05). On multivariate analysis, HBeAg-positive status, number of tumors more than 3, and absence of antiviral therapy were the independent risk predictor of HBV reactivation. Liver function indicators did not differ significantly between the antiviral group and the nonantiviral group in 5 days after TACE. However, the level of alanine aminotransferase and bilirubin were raised and albumin was reduced at the HBV reactivation group compared with no HBV reactivation group (P < .05). At 1 month after TACE, liver function indicators did not differ significantly between the HBV reactivation group and without HBV reactivation group. HCC patients with HBV DNA negative still remain associated with risk of HBV reactivation after TACE. HBeAg-positive, number of tumors more than 3, and absence of antiviral therapy in HCC patients after TACE have a higher risk of HBV reactivation. Antiviral therapy can reduce the risk of reactivation, helping improve liver function after TACE.
Gupta, Shuchita; Agarwal, Ramesh; Aggarwal, Kailash Chandra; Chellani, Harish; Duggal, Anil; Arya, Sugandha; Bhatia, Sunita; Sankar, Mari Jeeva; Sreenivas, Vishnubhatla; Jain, Vandana; Gupta, Arun Kumar; Deorari, Ashok K; Paul, Vinod K
2017-05-01
Evidence on the optimal time to initiation of complementary feeding in preterm infants is scarce. We examined the effect of initiation of complementary feeding at 4 months versus 6 months of corrected age on weight for age at 12 months corrected age in preterm infants less than 34 weeks of gestation. In this open-label, randomised trial, we enrolled infants born at less than 34 weeks of gestation with no major malformation from three public health facilities in India. Eligible infants were tracked from birth and randomly assigned (1:1) at 4 months corrected age to receive complementary feeding at 4 months corrected age (4 month group), or continuation of milk feeding and initiation of complementary feeding at 6 months corrected age (6 month group), using computer generated randomisation schedule of variable block size, stratified by gestation (30 weeks or less, and 31-33 weeks). Iron supplementation was provided as standard. Participants and the implementation team could not be masked to group assignment, but outcome assessors were masked. Primary outcome was weight for age Z-score at 12 months corrected age (WAZ 12 ) based on WHO Multicentre Growth Reference Study growth standards. Analyses were by intention to treat. The trial is registered with Clinical Trials Registry of India, number CTRI/2012/11/003149. Between March 20, 2013, and April 24, 2015, 403 infants were randomly assigned: 206 to receive complementary feeding from 4 months and 197 to receive complementary feeding from 6 months. 22 infants in the 4 month group (four deaths, two withdrawals, 16 lost to follow-up) and eight infants in the 6 month group (two deaths, six lost to follow-up) were excluded from analysis of primary outcome. There was no difference in WAZ 12 between two groups: -1·6 (SD 1·2) in the 4 month group versus -1·6 (SD 1·3) in the 6 month group (mean difference 0·005, 95% CI -0·24 to 0·25; p=0·965). There were more hospital admissions in the 4 month group compared with the 6 month group: 2·5 episodes per 100 infant-months in the 4 month group versus 1·4 episodes per 100 infant-months in the 6 month group (incidence rate ratio 1·8, 95% CI 1·0-3·1, p=0·03). 34 (18%) of 188 infants in the 4 month group required hospital admission, compared with 18 (9%) of 192 infants in the 6 month group. Although there was no evidence of effect for the primary endpoint of WAZ 12 , the higher rate of hospital admission in the 4 month group suggests a recommendation to initiate complementary feeding at 6 months over 4 months of corrected age in infants less than 34 weeks of gestation. Indian Council of Medical Research supported the study until Nov 14, 2015. Subsequently, Shuchita Gupta's salary was supported for 2 months by an institute fellowship from All India Institute Of Medical Sciences, and a grant by Wellcome Trust thereafter. Copyright © 2017 The Author(s). Published by Elsevier Ltd. This is an Open Access article under the CC BY license. Published by Elsevier Ltd.. All rights reserved.
The self-nonself discrimination and the nature and acquisition of the antibody repertoire.
Coutinho, A
1980-01-01
Network ideas are confronted with current hypotheses for the origin of antibody diversity and self-nonself discrimination. The difficulties of reconciling the promethean evolution of the antibody system with "germ line" theories are discussed, as well as the problems of "somatic" hypotheses to explain the completeness of the antibody repertoire. The formal incompatibility of the network theory with ideas basing self-nonself discrimination on the elimination of self-reactive cells is demonstrated, as well as the difficulties of these and other environment-dependent hypotheses for lymphocyte activation, to encompass the internal activity in the immune system. It is argued, on the other hand, that the limitations of the network theory in providing a functional basis for the idiotypic network and in accounting for self-nonself discrimination, can be solved by finding in a complete repertoire of antibody-combining sites the complementary structures to growth receptors on B lymphocytes, and by using these as internal mitogens in the expansion of the precursor cell pools and in the maintenance of the mature steady states. Letting self-nonself discrimination be accounted for by such growth receptors, both the integrity of the antibody repertoire and the internal activity in the system can also be ensured. Moreover, by postulating a germ line origin for the antireceptor antibodies and by accepting idiotypic cross-reactivity between growth receptors and other germ line antibodies, the possibilities are set for a phylogenetically and ontogenically autonomous immune system embodied with the capabilities for self-expansion, diversification and selection of available repertoires. Its promethean characteristics are explained by its completeness, and this is achieved by idiotypic interactions between growth receptors and a limited number of complementary or cross-reactive germ line antibodies, naturally selected on the basis of their structural relationships with growth receptors.
Hopkins, Lindsey B; Medina, Johnna L; Baird, Scarlett O; Rosenfield, David; Powers, Mark B; Smits, Jasper A J
2016-06-01
Cortisol reactivity to stress is associated with affective eating, an important behavioral risk factor for obesity and related metabolic diseases. Yoga practice is related to decreases in stress and cortisol levels, thus emerging as a potential targeted complementary intervention for affective eating. This randomized controlled trial examined the efficacy of a heated, hatha yoga intervention for reducing cortisol reactivity to stress and affective eating. Females (N = 52; ages 25-46 years; 75% White) at risk for obesity and related illnesses were randomly assigned to 8 weeks of Bikram Yoga practice or to waitlist control. Cortisol reactivity to a laboratory stress induction were measured at Weeks 0 (pretreatment) and 9 (posttreatment). Self-reported binge eating frequency and coping motives for eating were assessed at Weeks 0, 3, 6, and 9. Among participants with elevated cortisol reactivity at pretreatment ("high reactors"), those randomized to the yoga condition evidenced greater pre- to posttreatment reductions in cortisol reactivity (p = .042, d = .85), but there were not significant condition differences for the "low reactors" (p = .178, d = .53). Yoga participants reported greater decreases in binge eating frequency (p = .040, d = .62) and eating to cope with negative affect (p = .038, d = .54). This study provides preliminary support for the efficacy of heated hatha yoga for treating physiological stress reactivity and affective eating among women at risk for obesity-related illnesses. (PsycINFO Database Record (c) 2016 APA, all rights reserved).
Stake-Nilsson, Kerstin; Hultcrantz, Rolf; Unge, Peter; Wengström, Yvonne
2012-03-01
The aim of this study was to describe the complementary and alternative medicine methods most commonly used to alleviate symptom distress in persons with functional gastrointestinal disorders. People with functional gastrointestinal disorders face many challenges in their everyday lives, and each individual has his/her own way of dealing with this illness. The experience of illness often leads persons with functional gastrointestinal disorders to complementary and alternative medicine as a viable healthcare choice. Quantitative and describing design. A study-specific complementary and alternative medicine questionnaire was used, including questions about complementary and alternative medicine methods used and the perceived effects of each method. Efficacy assessments for each method were preventive effect, partial symptom relief, total symptom relief or no effect. A total of 137 persons with functional gastrointestinal disorders answered the questionnaire, 62% (n = 85) women and 38% (n = 52) men. A total of 28 different complementary and alternative medicine methods were identified and grouped into four categories: nutritional, drug/biological, psychological activity and physical activity. All persons had tried at least one method, and most methods provided partial symptom relief. Persons with functional gastrointestinal disorders commonly use complementary and alternative medicine methods to alleviate symptoms. Nurses have a unique opportunity to expand their roles in this group of patients. Increased knowledge of complementary and alternative medicine practices would enable a more comprehensive patient assessment and a better plan for meaningful interventions that meet the needs of individual patients. © 2011 Blackwell Publishing Ltd.
Abnormal proactive and reactive cognitive control during conflict processing in major depression.
Vanderhasselt, Marie-Anne; De Raedt, Rudi; De Paepe, Annick; Aarts, Kristien; Otte, Georges; Van Dorpe, Jan; Pourtois, Gilles
2014-02-01
According to the Dual Mechanisms of Control framework, cognitive control consists of two complementary components: proactive control refers to anticipatory maintenance of goal-relevant information, whereas reactive control acts as a correction mechanism that is activated when a conflict occurs. Possibly, the well-known diminished inhibitory control in response to negative stimuli in Major Depressive Disorder (MDD) patients stems from a breakdown in proactive control, and/or anomalies in reactive cognitive control. In our study, MDD patients specifically showed increased response latencies when actively inhibiting a dominant response to a sad compared with a happy face. This condition was associated with a longer duration of a dominant ERP topography (800-900 ms poststimulus onset) and a stronger activity in the bilateral dorsal anterior cingulate cortex, reflecting abnormal reactive control when inhibiting attention to a negative stimulus. Moreover, MDD patients showed abnormalities in proactive cognitive control when preparing for the upcoming imperative stimulus (abnormal modulation of the contingent negative variation component), accompanied by more activity in brain regions belonging to the default mode network. All together, deficits to inhibit attention to negative information in MDD might originate from an abnormal use of both proactive resources and reactive control processes. PsycINFO Database Record (c) 2014 APA, all rights reserved.
Characterizing monoclonal antibody structure by carbodiimide/GEE footprinting
Kaur, Parminder; Tomechko, Sara; Kiselar, Janna; Shi, Wuxian; Deperalta, Galahad; Wecksler, Aaron T; Gokulrangan, Giridharan; Ling, Victor; Chance, Mark R
2014-01-01
Amino acid-specific covalent labeling is well suited to probe protein structure and macromolecular interactions, especially for macromolecules and their complexes that are difficult to examine by alternative means, due to size, complexity, or instability. Here we present a detailed account of carbodiimide-based covalent labeling (with GEE tagging) applied to a glycosylated monoclonal antibody therapeutic, which represents an important class of biologic drugs. Characterization of such proteins and their antigen complexes is essential to development of new biologic-based medicines. In this study, the experiments were optimized to preserve the structural integrity of the protein, and experimental conditions were varied and replicated to establish the reproducibility and precision of the technique. Homology-based models were generated and used to compare the solvent accessibility of the labeled residues, which include D, E, and the C-terminus, against the experimental surface accessibility data in order to understand the accuracy of the approach in providing an unbiased assessment of structure. Data from the protein were also compared to reactivity measures of several model peptides to explain sequence or structure-based variations in reactivity. The results highlight several advantages of this approach. These include: the ease of use at the bench top, the linearity of the dose response plots at high levels of labeling (indicating that the label does not significantly perturb the structure of the protein), the high reproducibility of replicate experiments (<2 % variation in modification extent), the similar reactivity of the 3 target probe residues (as suggested by analysis of model peptides), and the overall positive and significant correlation of reactivity and solvent accessible surface area (the latter values predicted by the homology modeling). Attenuation of reactivity, in otherwise solvent accessible probes, is documented as arising from the effects of positive charge or bond formation between adjacent amine and carboxyl groups, the latter accompanied by observed water loss. The results are also compared with data from hydroxyl radical-mediated oxidative footprinting on the same protein, showing that complementary information is gained from the 2 approaches, although the number of target residues in carbodiimide/GEE labeling is fewer. Overall, this approach is an accurate and precise method for assessing protein structure of biologic drugs. PMID:25484052
Brotherton, Carol S; Taylor, Ann Gill; Bourguignon, Cheryl; Anderson, Joel G
2014-01-01
Crohn disease is a chronic disorder characterized by episodes of epithelial inflammation in the gastrointestinal tract for which there is no cure. The prevalence of Crohn disease increased in civilized nations during the time period in which food sources were industrialized in those nations. A characteristic of industrialized diets is the conspicuous absence of cereal fiber. The purpose of this 2-group, randomized, controlled study was to investigate the effects of fiber-related dietary instructions specifying wheat bran consumption on health-related quality of life and gastrointestinal function in individuals diagnosed with Crohn disease, as measured by the Inflammatory Bowel Disease Questionnaire and the partial Harvey Bradshaw Index, respectively. Results demonstrated that consuming a wheat bran-inclusive diet was feasible and caused no adverse effects, and participants consuming whole wheat bran in the diet reported improved health-related quality of life (p = .028) and gastrointestinal function (p = .008) compared to the attention control group. The results of a secondary aim, to investigate differences in measures of systemic inflammation, found no group differences in C-reactive protein or erythrocyte sedimentation rates. This study suggests that diet modification may be a welcomed complementary therapy for individuals suffering gastrointestinal disruption associated with Crohn disease.
Mass Spectrometric Identification of Mtb81, a Novel Serological Marker for Tuberculosis
Hendrickson, Ronald C.; Douglass, John F.; Reynolds, Lisa D.; McNeill, Patricia D.; Carter, Darrick; Reed, Steven G.; Houghton, Raymond L.
2000-01-01
We have used serological proteome analysis in conjunction with tandem mass spectrometry to identify and sequence a novel protein, Mtb81, which may be useful for the diagnosis of tuberculosis (TB), especially for patients coinfected with human immunodeficiency virus (HIV). Recombinant Mtb81 was tested by an enzyme-linked immunosorbent assay to detect antibodies in 25 of 27 TB patients (92%) seropositive for HIV as well as in 38 of 67 individuals (57%) who were TB positive alone. No reactivity was observed in 11 of 11 individuals (100%) who were HIV seropositive alone. In addition, neither sera from purified protein derivative (PPD)-negative (0 of 29) nor sera from healthy (0 of 45) blood donors tested positive with Mtb81. Only 2 of 57 of PPD-positive individuals tested positive with Mtb81. Sera from individuals with smear-positive TB and seropositive for HIV but who had tested negative for TB in the 38-kDa antigen immunodiagnostic assay were also tested for reactivity against Mtb81, as were sera from individuals with lung cancer and pneumonia. Mtb81 reacted with 26 of 37 HIV+ TB+ sera (70%) in this group, compared to 2 of 37 (5%) that reacted with the 38-kDa antigen. Together, these results demonstrate that Mtb81 may be a promising complementary antigen for the serodiagnosis of TB. PMID:10835002
Reactive Oxygen Species are Ubiquitous along Subsurface Redox Gradients
NASA Astrophysics Data System (ADS)
Nico, P. S.; Yuan, X.; Davis, J. A.; Dwivedi, D.; Williams, K. H.; Bhattacharyya, A.; Fox, P. M.
2016-12-01
Reactive oxygen species (hydroxyl radical, superoxide, hydrogen peroxide, etc.) are known to be important intermediates in many biological and earth system processes. They have been particularly well studied in the realms of atmospheric chemistry and aquatic photochemistry. However, recently there is increasing evidence that they are also present in impactful quantities in dark systems as a result of both biotic and abiotic reactions. Herein we will present a complementary suite of laboratory and field studies examining the presence and production of hydrogen peroxide under relevant subsurface conditions. The laboratory work examines the redox cycling between reduced organic matter, molecular oxygen, and Fe which results in not only the production of hydrogen peroxide and oxidation of organic functional groups but also the maintenance of steady-state concentration of Fe(II) under fully oxygenated aqueous conditions. The field studies involve three distinct locations, namely a shallow subsurface aquifer, a hyporheic zone redox gradient across a river meander, and a hillside shale seep. In all cases detectable quantities (tens of nanomolar) of hydrogen peroxide were measured. In general, concentrations peak under transitional redox conditions where there is the simultaneous presence of reduced Fe, organic matter, and at least trace dissolved oxygen. Many, but not all, of the observed dynamics in hydrogen peroxide production can be reproduced by a simple kinetic model representing the reactions between Fe, organic matter, and molecular oxygen, but many questions remain regarding the role of microorganisms and other redox active chemical species in determining the detected hydrogen peroxide concentrations. The consistent detection of hydrogen peroxide at these disparate locations supports the hypothesis that hydrogen peroxide, and by extension, the entire suite of reactive oxygen species are ubiquitous along subsurface redox gradients.
Hallab, NJ; Caicedo, M; McAllister, K; Skipor, A; Amstutz, H; Jacobs, JJ
2012-01-01
Some tissues from metal-on-metal (MoM) hip arthroplasty revisions have shown evidence of adaptive-immune reactivity (i.e., excessive peri-implant lymphocyte infiltration/activation). We hypothesized that, prior to symptoms, some people with MoM hip arthroplasty will develop quantifiable metal-induced lymphocyte reactivity responses related to peripheral metal ion levels. We tested 3 cohorts (Group-1: n=21 prospective longitudinal MoM hip arthroplasty; Group-2: n=17 retrospective MoM hip arthroplasty; and Group-3: n=20 controls without implants). We compared implant position, metal-ion release, and immuno-reactivity. MoM cohorts had elevated (p<0.01) amounts of serum Co and Cr compared to controls as early as 3 mos post-op (Group-1:1.2ppb-Co, 1.5ppb-Cr; Group-2: 3.4ppb-Co,, 5.4ppb-Cr; Group-3: 0.01ppb-Co, 0.1ppb-Cr). However, only after 1 to 4 yrs post-op did 56% of Group-1 develop metal-reactivity (vs. 5%pre-op, metal-LTT, SI>2), compared with 76% of Group-2 and 15% of Group-3 controls (patch testing was a poor diagnostic indicator with only 1/21 Group-1 positive). Higher cup-abduction angles (50° vs. 40°) in Group-1 were associated with higher serum Cr (p<0.07). However, sub-optimal cup-anteversion angles (9° vs. 20°) had higher serum Co (p<0.08). Serum Cr and Co were significantly elevated in reactive vs. non-reactive Group-1 participants (p<0.04). CD4+CD69+ T-helper lymphocytes (but not CD8+) and IL-1β, IL-12 and IL-6 cytokines were all significantly elevated in metal-reactive vs. non-reactive Group-1 participants. Our results showed that lymphocyte reactivity to metals can develop within the first 1 to 4 years after MoM arthroplasty in asymptomatic patients and lags increases in metal ion levels. This increased metal reactivity was more prevalent in those individuals with extreme cup angles and higher amounts of circulating metal. PMID:22941579
Fung, Annis Lai Chu
2017-10-10
This study was the first to evaluate the effectiveness of three different group interventions to reduce children's reactive aggression based on the social information processing (SIP) model. In the first stage of screening, 3,734 children of Grades 4-6 completed the Reactive-Proactive Aggression Questionnaire (RPQ) to assess their reactive and proactive aggression. Respondents with a total score of z ≥ 1 on the RPQ were shortlisted for the second stage of screening by qualitative interview. Interviews with 475 children were conducted to select those who showed reactive aggression featuring a hostile attributional bias. Finally, 126 children (97 males and 29 females) aged 8 to 14 (M = 9.71, SD = 1.23) were selected and randomly assigned to one of the three groups: a child group, a parent group, and a parent-child group. A significant Time × Intervention effect was found for general and reactive aggression. The parent-child group and child group showed a significant drop in general aggression and reactive aggression from posttest to 6-month follow-up, after controlling for baseline scores, sex, and age. However, the parent group showed no treatment effect: reactive aggression scores were significantly higher than those in the child group at 6-month follow-up. This study has provided strong evidence that children with reactive aggression need direct and specific treatment to reconstruct the steps of the SIP involving the selection and interpretation of cues. The intervention could help to prevent severe violent crimes at the later stage of a reactive aggressor. © 2017 Family Process Institute.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Malouin, F.; Parr, T.R. Jr.; Bryan, L.E.
(35S)penicillin bound to different Haemophilus influenzae proteins in assays performed at 20, 37, or 42{degrees}C. Penicillin-binding proteins 3a, 3b, 4, and 4' formed a group characterized by their affinity for moxalactam, cefotaxime, and piperacillin. Penicillin-binding protein 4' showed specific properties that may reflect its complementary role in septation.
NASA Astrophysics Data System (ADS)
Bijeljic, Branko; Icardi, Matteo; Prodanović, Maša
2018-05-01
Substantial progress has been made over last few decades on understanding the physics of multiphase flow and reactive transport phenomena in subsurface porous media. Confluence of advances in experimental techniques (including micromodels, X-ray microtomography, Nuclear Magnetic Resonance (NMR)) as well as computational power have made it possible to observe static and dynamic multi-scale flow, transport and reactive processes, thus stimulating development of new generation of modelling tools from pore to field scale. One of the key challenges is to make experiment and models as complementary as possible, with continuously improving experimental methods in order to increase predictive capabilities of theoretical models across scales. This creates need to establish rigorous benchmark studies of flow, transport and reaction in porous media which can then serve as the basis for introducing more complex phenomena in future developments.
Lower catecholamine activity is associated with greater levels of anger in adults.
Schwartz, Joseph A; Portnoy, Jill
2017-10-01
Previous research has revealed a consistent association between heart rate at rest and during stress and behavioral problems, potentially implicating autonomic nervous system (ANS) functioning in the etiological development of antisocial behavior. A complementary line of research has focused on the potential independent and interactive role of the two subsystems that comprise the ANS, the parasympathetic nervous system (PNS) and the sympathetic nervous system (SNS), on behavioral problems. The current study aims to contribute to the existing literature by examining the influence of heart rate (HR) reactivity, high-frequency heart rate variability (HF-HRV) reactivity, and catecholamine activity on a comprehensive measure of anger in a large, nationally-representative sample of adults from the United States. Results from a series of structural equation models (SEMs) revealed that catecholamine activity was most consistently linked to anger, while associations involving HR and HF-HRV reactivity were nonsignificant. Additional analyses revealed that HF-HRV did not significantly moderate the association between catecholamine activity and anger. These findings highlight the importance of SNS activity in the development of more reactive forms of aggression such as anger. Copyright © 2017 Elsevier B.V. All rights reserved.
Reactivation of oxidized PTP1B and PTEN by Thioredoxin 1
Schwertassek, Ulla; Haque, Aftabul; Krishnan, Navasona; Greiner, Romy; Weingarten, Lars; Dick, Tobias P.; Tonks, Nicholas K.
2014-01-01
The transient inactivation of protein phosphatases contributes to the efficiency and temporal control of kinase-dependent signal transduction. In particular, members of the protein tyrosine phosphatase family are known to undergo reversible oxidation of their active site cysteine. The thiol oxidation step requires activation of co-localized NADPH oxidases and is mediated by locally produced ROS, in particular H2O2. How oxidized phosphatases are returned to the reduced active state is less well studied. Both major thiol reductive systems, the thioredoxin and the glutathione systems, have been implicated in the reactivation of phosphatases. Here, we show that the protein tyrosine phosphatase PTP1B and the dual-specificity phosphatase PTEN are preferentially reactivated by the thioredoxin system. We show that inducible depletion of TRX1 slows down PTEN re-activation in intact living cells. Finally, using a mechanism-based trapping approach we demonstrate direct thiol disulfide exchange between the active sites of thioredoxin and either phosphatase. The application of thioredoxin trapping mutants represents a complementary approach to direct assays of PTP oxidation in elucidating the significance of redox regulation of PTP function in the control of cell signaling. PMID:24976139
Pereira, Ana Carolina da Silva; Dionísio, Ana Paula; Wurlitzer, Nedio Jair; Alves, Ricardo Elesbão; de Brito, Edy Souza; e Silva, Ana Mara de Oliveira; Brasil, Isabella Montenegro; Mancini Filho, Jorge
2014-08-15
Fruits are a rich source of a variety of biologically active compounds that can have complementary and overlapping mechanisms of action, including detoxification, enzyme modulation and antioxidant effects. Although the effects of tropical fruits have been examined individually, the interactive antioxidant capacity of the bioactive compounds in these formulations has not been sufficiently explored. For this reason, this study investigated the effect of two tropical fruit juices (FA and FB) on lipid peroxidation and antioxidant enzymes in rats. Seven groups, with eight rats each, were fed a normal diet for 4 weeks, and were force-fed daily either water (control), 100, 200, or 400 mg of FA or FB per kg. The results showed that the liver superoxide dismutase and catalase activities (FA200), erythrocytes glutathione peroxidase (FB400) and thiobarbituric acid-reactive substances (FB100, FA400, FB200, FB400) were efficiently reduced by fruit juices when compared with control; whereas HDL-c increased (FB400). Copyright © 2014. Published by Elsevier Ltd.
Chu, John C K; Rovis, Tomislav
2018-01-02
The functionalization of C(sp 3 )-H bonds streamlines chemical synthesis by allowing the use of simple molecules and providing novel synthetic disconnections. Intensive recent efforts in the development of new reactions based on C-H functionalization have led to its wider adoption across a range of research areas. This Review discusses the strengths and weaknesses of three main approaches: transition-metal-catalyzed C-H activation, 1,n-hydrogen atom transfer, and transition-metal-catalyzed carbene/nitrene transfer, for the directed functionalization of unactivated C(sp 3 )-H bonds. For each strategy, the scope, the reactivity of different C-H bonds, the position of the reacting C-H bonds relative to the directing group, and stereochemical outcomes are illustrated with examples in the literature. The aim of this Review is to provide guidance for the use of C-H functionalization reactions and inspire future research in this area. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Takeshima, Teppei; Yumura, Yasushi; Yasuda, Kengo; Sanjo, Hiroyuki; Kuroda, Shinnosuke; Yamanaka, Hiroyuki; Iwasaki, Akira
2017-01-01
This study investigated the correlation between sperm motion parameters obtained by a computer-assisted semen analyzer and levels of reactive oxygen species in unwashed semen. In total, 847 patients, except for azoospermic patients were investigated. At the time of each patient's first consultation, semen parameters were measured using SMAS™ or CellSoft 3000™, and production of reactive oxygen species was measured using a computer-driven LKB Wallac Luminometer 1251 Analyzer. The patients were divided into two groups: reactive oxygen species - positive and negative. The semen parameters within each group were measured using one of the two computer-assisted semen analyzer systems and then compared. Correlations between reactive oxygen species levels and sperm motion parameters in semen from the reactive oxygen species - positive group were also investigated. Reactive oxygen species were detected in semen samples of 282 cases (33.3%). Sperm concentration (P < 0.01; P < 0.01), motility (P < 0.01; P < 0.05), and progressive motility (P < 0.01; P < 0.01) were markedly lower in the reactive oxygen species - positive group than in the reactive oxygen species - negative group. Among the sperm motion parameters in the reactive oxygen species - positive group, sperm concentration (P < 0.01; P < 0.01), motility (P < 0.05; P < 0.01), mALH (P < 0.05; P < 0.01), and progressive motility (P < 0.05; P < 0.01) also showed inverse correlations with the logarithmic transformed reactive oxygen species levels. Therefore, this study demonstrated that excessive reactive oxygen species in semen damage sperm concentration, motility, and other sperm motion parameters.
Direct Nanoscale Conversion of Biomolecular Signals into Electronic Information
2008-09-22
the electrode surface. In this experiment, the single free cysteine group featured in the GOx structure was exploited to demonstrate that orientation...first with GOx-ssDNA conjugates featuring a sequence complementary to the address strand, then with a non-complementary conjugate and finally with...fully-functional for an enzyme that features a free thiol group, or that can be engineered to incorporate a thiol onto its outer shell
Clarke, Tainya C; Nahin, Richard L; Barnes, Patricia M; Stussman, Barbara J
2016-10-01
This report examines the use of complementary health approaches among U.S. adults aged 18 and over who had a musculoskeletal pain disorder. Prevalence of use among this population subgroup is compared with use by persons without a musculoskeletal disorder. Use for any reason, as well as specifically to treat musculoskeletal pain disorders, is examined. Using the 2012 National Health Interview Survey, estimates of the use of complementary health approaches for any reason, as well as use to treat musculoskeletal pain disorders, are presented. Statistical tests were performed to assess the significance of differences between groups of complementary health approaches used among persons with specific musculoskeletal pain disorders. Musculoskeletal pain disorders included lower back pain, sciatica, neck pain, joint pain or related conditions, arthritic conditions, and other musculoskeletal pain disorders not included in any of the previous categories. Respondents could report having more than one disorder. In 2012, 54.5% of U.S. adults had a musculoskeletal pain disorder. The use of any complementary health approach for any reason among persons with a musculoskeletal pain disorder (41.6%) was significantly higher than use among persons without a musculoskeletal pain disorder (24.1%). Among adults with any musculoskeletal pain disorder, the use of natural products for any reason (24.7%) was significantly higher than the use of mind and body approaches (15.3%), practitioner-based approaches (18.2%), or whole medical system approaches (5.3%). The pattern of use of the above-mentioned groups of complementary health approaches was similar for persons without a musculoskeletal disorder. However, prevalence of use among these persons was significantly lower compared with persons with a musculoskeletal disorder. For treatment, the use of practitioner-based approaches among persons with any musculoskeletal pain disorder (9.7%) was more than three times as high as the use of any other group of approaches (0.7%-3.1%). The patterns of use of specific groups of complementary health approaches also differed among specific musculoskeletal pain disorders. All material appearing in this report is in the public domain and may be reproduced or copied without permission; citation as to source, however, is appreciated.
Egyir, Bridget K; Ramsay, Samantha A; Bilderback, Barry; Safaii, SeAnne
2016-09-01
Objective Appropriate and timely complementary feeding practices are fundamental to a child's growth, health, and development during the first 2 years of life. This study aimed to understand (1) Ghanaian mother's complementary feeding practices, and (2) their perceived and observed impacts of complementary feeding on their children. Methods Ghanaian mothers with children 4-24 months of age were recruited from four communities in the Komenda Edina Eguafo Abrem district in the Central Region of Ghana (n = 99). A qualitative methodological approach with focus group interview discussions was used. Eleven focus group interviews were conducted, and were audio recorded and transcribed. The audio transcriptions were coded and analyzed into pertinent themes, meta-themes, and theoretical concepts. Results Over 80 % (85) of mothers reported poor knowledge about the effects of complementary feeding on their children and 45 % (45) of the children were undernourished, indicating inappropriate complementary feeding practices. Some mothers held misconceptions about the effect of food on children's health. Four overarching themes were identified: (1) mothers' background knowledge about food, child health and growth outcomes, (2) mothers' motivation in feeding their children, (3) barriers to feeding, (4) foods mothers offered their children. Conclusion for Practice Nutrition education on complementary feeding is needed for Ghanaian mothers. Health facilities and community outreach programs could be a venue to provide education to mothers regarding infant and young child feeding practices in Ghana.
Results with Complementary Food Using Local Food Ingredients.
Ahmed, Tahmeed; Islam, Munirul; Choudhury, Nuzhat; Hossain, Iqbal; Huq, Sayeeda; Mahfuz, Mustafa; Sarker, Shafiqul Alam
2017-01-01
Appropriate complementary food is a must for optimum growth of infants and children. The food should be diverse and be given in sufficient quantities 2-4 times a day depending upon age. Poverty, food insecurity, and lack of awareness regarding the choice of nutritious food ingredients are deterrents to optimum complementary feeding. In Bangladesh, 77% of children do not receive appropriate complementary food and, hence, the high prevalence of childhood malnutrition. We developed ready-to-use complementary foods (RUCFs) using locally available food ingredients, rice/lentil and chickpea, which conform to standard specifications. These foods were found to be acceptable by children and their mothers compared to the Pushti packet, the cereal-based supplement used in the erstwhile National Nutrition Program of Bangladesh. In a cluster-randomized community-based trial in rural Bangladesh among more than 5,000 children, the efficacy of rice/lentil- and chickpea-based RUCFs was compared with another commonly used supplementary food called wheat-soy blend++ (WSB++) and a commercial product called Plumpy'doz. Deceleration in length for age was significantly lower (by 0.02-0.04/month) in the rice/lentil, Plumpy'doz, and chickpea groups compared to the control group at 18 months of age. Weight-for-length z-score decline was lower only in Plumpy'doz and chickpea groups. WSB++ was not different from the control group. In children who received chickpea RUCF or Plumpy'doz, the prevalence of stunting was 5-6% lower at 18 months. These foods can be used to prevent or treat malnutrition among children, particularly those from food-insecure households. © 2017 Nestec Ltd., Vevey/S. Karger AG, Basel.
Selective Organic and Organometallic Reactions in Water-Soluble Host-Guest Supramolecular Systems
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pluth, Michael D.; Raymond, Kenneth N.; Bergman, Robert G.
2008-02-16
Inspired by the efficiency and selectivity of enzymes, synthetic chemists have designed and prepared a wide range of host molecules that can bind smaller molecules with their cavities; this area has become known as 'supramolecular' or 'host-guest' chemistry. Pioneered by Lehn, Cram, Pedersen, and Breslow, and followed up by a large number of more recent investigators, it has been found that the chemical environment in each assembly - defined by the size, shape, charge, and functional group availability - greatly influences the guest-binding characteristics of these compounds. In contrast to the large number of binding studies that have been carriedmore » out in this area, the exploration of chemistry - especially catalytic chemistry - that can take place inside supramolecular host cavities is still in its infancy. For example, until the work described here was carried out, very few examples of organometallic reactivity inside supramolecular hosts were known, especially in water solution. For that reason, our group and the group directed by Kenneth Raymond decided to take advantage of our complementary expertise and attempt to carry out metal-mediated C-H bond activation reactions in water-soluble supramolecular systems. This article begins by providing background from the Raymond group in supramolecular coordination chemistry and the Bergman group in C-H bond activation. It goes on to report the results of our combined efforts in supramolecular C-H activation reactions, followed by extensions of this work into a wider range of intracavity transformations.« less
Chen, Chun-Ming; Wang, Yu-Ying; Chang, Su-Ying
2010-04-01
To explore the effect of in-home fortification of complementary feeding on intellectual development of Chinese children aged below 24 months. One thousand and four hundred seventy eight children aged 4-12 months were recruited and divided into study groups (formula 1 group and formula 2 group) and control group. In two study groups, in addition to the usual complementary food, children were fed with a sachet of fortified food supplement each day. Protein and micronutrients were provided in formula 1 group. Formula 2 group had the same energy intake as the formula 1 group . In addition to measurement of physical growth and detection of hemoglobin level, Development Quotient (DQ) or Intelligence Quotient (IQ) was assessed. The DQ of children aged below 24 months was 97.2, 95.5, and 93.8 in formula 1 group, formula 2 group and control group, respectively, and the differences were statistically significant (P < 0.05). The DQ of children in formula 1 group, formula 2 group, and control group was 92.7, 90.4, and 88.3 respectively in the first follow up showing statistically significant differences (P < 0.05). And, DQ of children in formula 1 group, formula 2 group and control group were 96.7, 94.5, and 93.7 respectively in the second follow up, showing statistically significant differences (P < 0.05). Full-IQ of children in the formula 1 group was 3.1 and 4.5 points higher than that in formula 2 group and in control group respectively. Verbal IQ of children in the formula 1 group was 2.1 and 5 points higher than that in formula 2 group and control group respectively. Performance IQ was 2.5 and 3.1 points higher than that in formula 2 group and control group respectively. All above mentioned comparisons were statistically significant. Fortification of complementary feeding showed persistent effect on intelligence development of young children which could persist to 6 years of age. The critical time for correction of anemia could be under 18 months.
Stub, Trine; Quandt, Sara A; Arcury, Thomas A; Sandberg, Joanne C; Kristoffersen, Agnete E
2017-06-08
Effective interdisciplinary communication is important to achieve better quality in health care. The aims of this study were to compare conventional and complementary providers' experience of communication about complementary therapies and conventional medicine with their cancer patients, and to investigate how they experience interdisciplinary communication and cooperation. This study analyzed data from a self-administrated questionnaire. A total of 606 different health care providers, from four counties in Norway, completed the questionnaire. The survey was developed to describe aspects of the communication pattern among oncology doctors, nurses, family physicians and complementary therapists (acupuncturists, massage therapists and reflexologists/zone-therapists). Between-group differences were analyzed using chi-square, ANOVA and Fisher's exact tests. Significance level was defined as p < 0.05 without adjustment for multiple comparisons. Conventional providers and complementary therapists had different patterns of communication with their cancer patients regarding complementary therapies. While complementary therapists advised their patients to apply both complementary and conventional modalities, medical doctors were less supportive of their patients' use of complementary therapies. Of conventional providers, nurses expressed more positive attitudes toward complementary therapies. Opportunities to improve communication between conventional and complementary providers were most strongly supported by complementary providers and nurses; medical doctors were less supportive of such attempts. A number of doctors showed lack of respect for complementary therapists, but asked for more research, guidelines for complementary modalities and training in conventional medicine for complementary therapists. For better quality of care, greater communication about complementary therapy use is needed between cancer patients and their conventional and complementary providers. In addition, more communication between conventional and complementary providers is needed. Nurses may have a crucial role in facilitating communication, as they are positive toward complementary therapies and they have more direct communication with patients about their treatment preferences.
Single Molecule Nano-Metronome
Buranachai, Chittanon; McKinney, Sean A.; Ha, Taekjip
2008-01-01
We constructed a DNA-based nano-mechanical device called the nano-metronome. Our device is made by introducing complementary single stranded overhangs at the two arms of the DNA four-way junction. The ticking rates of this stochastic metronome depend on ion concentrations and can be changed by a set of DNA-based switches to deactivate/reactivate the sticky end. Since the device displays clearly distinguishable responses even with a single basepair difference, it may lead to a single molecule sensor of minute sequence differences of a target DNA. PMID:16522050
Stability and reactivity of dimethylethoxysilane
NASA Technical Reports Server (NTRS)
Johnson, Richard E.; Ford, Douglas I.
1992-01-01
Dimethylethoxysilane (DMES) is currently used to treat the High-temperature Reusable Surface Insulation (HRSI) shuttle tiles in order to provide a hydrophobic surface on the silica. DMES is a volatile, reactive silane that incorporates two reactive sites, the ethoxy group and the silica-hydride group. The work reported in this paper focused on the reactivity of these two groups with silica, water, quantitative reagents, and within DMES itself.
Solid-state structure of a Li/F carbenoid: pentafluoroethyllithium.
Waerder, Benedikt; Steinhauer, Simon; Neumann, Beate; Stammler, Hans-Georg; Mix, Andreas; Vishnevskiy, Yury V; Hoge, Berthold; Mitzel, Norbert W
2014-10-20
Lithium carbenoids are versatile compounds for synthesis owing to their intriguing ambiphilic behavior. Although this class of compounds has been known for several years, few solid-state structures exist because of their high reactivity and often low thermal stability. Using cryo X-ray techniques, we were now able to elucidate the first solid-state structure of a Li/F alkyl carbenoid, pentafluoroethyllithium (LiC2F5), finally yielding a prototype for investigating structure-reactivity relationships for this class of molecules. The compound forms a diethyl ether-solvated dimer bridged by a rare C-F-Li link. Complementary NMR spectroscopy studies in solution show dynamic processes and indicate rapid exchange of starting material and product. Theoretical investigations help to understand the formation of the observed unusual structural motif. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Complementary π-π interactions induce multicomponent coassembly into functional fibrils.
Ryan, Derek M; Doran, Todd M; Nilsson, Bradley L
2011-09-06
Noncovalent self-assembled materials inspired by amyloid architectures are useful for biomedical applications ranging from regenerative medicine to drug delivery. The selective coassembly of complementary monomeric units to provide ordered multicomponent fibrils is a possible strategy for enhancing the sophistication of these noncovalent materials. Herein we report that complementary π-π interactions can be exploited to promote the coassembly of phenylalanine (Phe) derivatives that possess complementary aromatic side-chain functionality. Specifically, equimolar mixtures of Fmoc-Phe and Fmoc-F(5)-Phe, which possess side-chain groups with complementary quadrupole electronics, readily coassemble to form two-component fibrils and hydrogels under conditions where Fmoc-Phe alone fails to self-assemble. In addition, it was found that equimolar mixtures of Fmoc-Phe with monohalogenated (F, Cl, and Br) Fmoc-Phe derivatives also coassembled into two-component fibrils. These results collectively indicate that face-to-face quadrupole stacking between benzyl side-chain groups does not account for the molecular recognition between Phe and halogenated Phe derivatives that promote cofibrillization but that coassembly is mediated by more subtle π-π effects arising from the halogenation of the benzyl side chain. The use of complementary π-π interactions to promote the coassembly of two distinct monomeric units into ordered two-component fibrils dramatically expands the repertoire of noncovalent interactions that can be used in the development of sophisticated noncovalent materials. © 2011 American Chemical Society
Domnick, Martin; Domnick, Manju; Wiebelitz, Karl-Rüdiger; Beer, André-Michael
2017-01-01
Evidence for complementary therapies as important strategies to relieve cancer treatment-associated symptoms is increasing. Mostly, these complementary therapies start at the end of adjuvant treatments, resulting in a long delay until the well-being of patients is addressed. Further, long distances between the rehabilitation center and the patients' residence hinder patients' compliance. The multimodal outpatient LOTUS Care Cure Project (LCCP) was tested in a randomized controlled trial including patients of various cancer entities and stages while on adjuvant chemotherapy and/or radiotherapy or outpatient aftercare. The intervention group received the LCCP additionally to the conventional treatment (LCCP group, n = 50). The control group (CG) was split into 2 groups, with (CG1, n = 33) and without (CG2, n = 17) weekly talks. The primary endpoint was quality of life (QoL) after 3 months. In the LCCP group, QoL significantly improved after 3 months compared to CG2 (p = 0.022) but not compared to CG1. Other parameters showing a significant improvement were cognitive (p < 0.05, vs. CG1 and CG2) and social function (p < 0.05, vs. CG2). This pilot study describes a multimodal outpatient complementary therapy program conducted in parallel with conventional therapies and its potential to significantly improve QoL and reduce treatment-associated side effects. To substantiate these data, multicenter trials are needed. © 2017 S. Karger AG, Basel.
Stress enhances reconsolidation of declarative memory.
Bos, Marieke G N; Schuijer, Jantien; Lodestijn, Fleur; Beckers, Tom; Kindt, Merel
2014-08-01
Retrieval of negative emotional memories is often accompanied by the experience of stress. Upon retrieval, a memory trace can temporarily return into a labile state, where it is vulnerable to change. An unresolved question is whether post-retrieval stress may affect the strength of declarative memory in humans by modulating the reconsolidation process. Here, we tested in two experiments whether post-reactivation stress may affect the strength of declarative memory in humans. In both experiments, participants were instructed to learn neutral, positive and negative words. Approximately 24h later, participants received a reminder of the word list followed by exposure to the social evaluative cold pressor task (reactivation/stress group, nexp1=20; nexp2=18) or control task (reactivation/no-stress group, nexp1=23; nexp2=18). An additional control group was solely exposed to the stress task, without memory reactivation (no-reactivation/stress group, nexp1=23; nexp2=21). The next day, memory performance was tested using a free recall and a recognition task. In the first experiment we showed that participants in the reactivation/stress group recalled more words than participants in the reactivation/no-stress and no-reactivation/stress group, irrespective of valence of the word stimuli. Furthermore, participants in the reactivation/stress group made more false recognition errors. In the second experiment we replicated our observations on the free recall task for a new set of word stimuli, but we did not find any differences in false recognition. The current findings indicate that post-reactivation stress can improve declarative memory performance by modulating the process of reconsolidation. This finding contributes to our understanding why some memories are more persistent than others. Copyright © 2014. Published by Elsevier Ltd.
Dixon-Gordon, Katherine L.; Weiss, Nicole H.; Tull, Matthew T.; DiLillo, David; Messman-Moore, Terri; Gratz, Kim L.
2015-01-01
This research aimed to characterize patterns of emotional reactivity and dysregulation in borderline personality, depression, and their co-occurrence. In Study 1, 488 young adult women from the community were categorized into four groups based on self-reported major depressive disorder (MDD) and borderline personality disorder (BPD) symptoms (Low BPD/Low MDD; Low BPD/High MDD; High BPD/Low MDD; High BPD/High MDD). Immediate and prolonged subjective emotional reactivity to a laboratory stressor were assessed, and participants completed self-report and behavioral measures of emotion dysregulation. Study 2 extended these findings, examining emotional reactivity and dysregulation in a clinical population of 176 substance dependent patients with diagnoses of BPD and MDD and including a biological index of emotional reactivity. Results revealed greater prolonged fear reactivity in the High BPD/High MDD (vs. Low BPD/Low MDD) group in Study 1, and greater prolonged anxiety and negative affect reactivity in both High BPD groups (vs. Low BPD/Low MDD and Low BPD/High MDD groups) in Study 2 (but no differences in cortisol reactivity). Results also demonstrated greater subjective (but not behavioral) emotion dysregulation in the High BPD/High MDD (vs. Low BPD/Low MDD) group in Study 1 and both High BPD groups (vs. both Low BPD groups) in Study 2. Finally, the High BPD/High MDD group reported greater difficulties controlling impulsive behaviors compared with all other groups in Study 1 and the Low BPD groups in Study 2. Findings suggest that BPD pathology (but not MDD pathology alone) is characterized by greater prolonged emotional (especially anxiety/fear-related) reactivity and heightened emotion dysregulation. PMID:26343484
Godino, Cosmo; Pavon, Anna Giulia; Mangieri, Antonio; Salerno, Anna; Cera, Michela; Monello, Alberto; Chieffo, Alaide; Magni, Valeria; Cappelletti, Alberto; Margonato, Alberto; Colombo, Antonio
2017-08-01
The acute effects of statin loading dose (LD) on platelet reactivity in patients with chronic stable angina (CSA) are not completely clear. We hypothesized that LDs of atorvastatin and rosuvastatin have different pharmacodynamic acute effects on platelet aggregability in CSA patients with baseline normal platelet reactivity while on dual antiplatelet therapy (DAPT). From September 2011 to February 2014, all consecutive CSA patients on chronic DAPT (aspirin and clopidogrel) were evaluated before elective percutaneous coronary intervention (PCI). An initial assessment of platelet reactivity in response to thrombin receptor agonist, ADP, and ASP (respectively, indicative of the response to clopidogrel and aspirin) was performed with impedance aggregometry. Patients with high platelet reactivity to ADP test (area under the curve >47) were excluded. The remaining patients were randomized into 3 treatment groups: Group A, atorvastatin LD 80 mg; Group B, rosuvastatin LD 40 mg; and Group C, no statin LD (control group). A second assessment of platelet reactivity was performed ≥12 hours after statin LD. 682 patients were screened and 145 were randomized into the 3 groups. At baseline and after statin LD, no significant difference was found in platelet reactivity in response to 3 different agonists between the 3 groups. Subgroup analysis showed that platelet reactivity to ADP test was significantly lower in patients chronically treated with low-dose statins (n = 94) compared with statin-naïve patients (n = 51; 15.32 ± 1.50 vs 18.59 ± 1.30; P = 0.007). Loading dose of atorvastatin (80 mg) or rosuvastatin (40 mg) did not induce significant variation in platelet reactivity in CSA patients with baseline reduced platelet reactivity as in chronic DAPT. Our data confirm that chronic concomitant treatment with low-dose statins and clopidogrel resulted in significantly lower platelet reactivity compared with clopidogrel alone. © 2017 Wiley Periodicals, Inc.
Vilá-Héreter, Frances; Rivera-Mariani, Felix E.; Bolaños-Rosero, Benjamín
2017-01-01
Background The allergenic potential of Ganoderma applanatum basidiospores has been demonstrated previously in Puerto Rico. However, basidiomycete allergens are not available for inclusion in allergy diagnostic panels. Therefore, we sought to confirm allergic sensitization towards G. applanatum crude spore cytoplasmic extract (CSCE) through reactivity in serological assays and detection of IgE-binding polypeptides. Methods With an indirect ELISA, serological reactivity was compared between groups of individuals with different allergic profiles. Group 1 (n = 51) consisted of individuals with sIgE to allergens included in diagnostic panels; group 2 (n = 14) were individuals with no sIgE to the allergens tested; and group 3 (n = 22) were individuals with no allergic history. To visualize IgE-binding polypeptides, group 1 sera were examined with Western blot (WB). Polypeptide bands with the highest reactivity were analyzed by mass spectrometry (MS) for putative identification. Results Serological reactivity of group 1 was significantly higher than that of group 3 in indirect ELISA (p = 0.03). Sixty five percent of group 1 individuals showed reactivity to polypeptide bands in WB. Bands of 81 and 56 kDa had the highest reactivity proportions among the reactive sera, followed by a 45 kDa band. MS analysis of these three polypeptides suggests they are basidiomycete-derived enzymes with aconitate hydratase, catalase, and enolase functions. Conclusions G. applanatum spores have allergenic components recognized by Puerto Rican individuals, which could eventually be considered as markers in cases of fungal allergy and be included in diagnostic allergen panels in Puerto Rico and tropical regions. PMID:28380479
Vlieger, Arine M; Blink, Marjolein; Tromp, Ellen; Benninga, Marc A
2008-08-01
Many pediatric patients use complementary and alternative medicine, especially when facing a chronic illness for which treatment options are limited. So far, research on the use of complementary and alternative medicine in patients with functional gastrointestinal disease has been scarce. This study was designed to assess complementary and alternative medicine use in children with different gastrointestinal diseases, including functional disorders, to determine which factors predicted complementary and alternative medicine use and to assess the willingness of parents to participate in future studies on complementary and alternative medicine efficacy and safety. The prevalence of complementary and alternative medicine use was assessed by using a questionnaire for 749 children visiting pediatric gastroenterology clinics of 9 hospitals in the Netherlands. The questionnaire consisted of 35 questions on the child's gastrointestinal disease, medication use, health status, past and future complementary and alternative medicine use, reasons for its use, and the necessity of complementary and alternative medicine research. In this study population, the frequency of complementary and alternative medicine use was 37.6%. A total of 60.3% of this group had used complementary and alternative medicine specifically for their gastrointestinal disease. This specific complementary and alternative medicine use was higher in patients with functional disorders than organic disorders (25.3% vs 17.2%). Adverse effects of allopathic medication, school absenteeism, age
Oliveira, Carolina F; Botoni, Fernando A; Oliveira, Clara R A; Silva, Camila B; Pereira, Helena A; Serufo, José C; Nobre, Vandack
2013-10-01
We sought to evaluate whether procalcitonin was superior to C-reactive protein in guiding antibiotic therapy in intensive care patients with sepsis. Randomized open clinical trial. Two university hospitals in Brazil. Patients with severe sepsis or septic shock. Patients were randomized in two groups: the procalcitonin group and the C-reactive protein group. Antibiotic therapy was discontinued following a protocol based on serum levels of these markers, according to the allocation group. The procalcitonin group was considered superior if the duration of antibiotic therapy was at least 25% shorter than in the C-reactive protein group. For both groups, at least seven full-days of antibiotic therapy were ensured in patients with Sequential Organ Failure Assessment greater than 10 and/or bacteremia at inclusion, and patients with evident resolution of the infectious process had antibiotics stopped after 7 days, despite biomarkers levels. Ninety-four patients were randomized: 49 patients to the procalcitonin group and 45 patients to the C-reactive protein group. The mean age was 59.8 (SD, 16.8) years. The median duration of antibiotic therapy for the first episode of infection was 7.0 (Q1-Q3, 6.0-8.5) days in the procalcitonin group and 6.0 (Q1-Q3, 5.0-7.0) days in the C-reactive protein group (p=0.13), with a hazard ratio of 1.206 (95% CI, 0.774-1.3; p=0.13). Overall, protocol overruling occurred in only 13 (13.8%) patients. Twenty-one patients died in each group (p=0.836). C-reactive protein was as useful as procalcitonin in reducing antibiotic use in a predominantly medical population of septic patients, causing no apparent harm.
Genotype by environment interactions for behavioral reactivity in sheep.
Hazard, D; Bouix, J; Chassier, M; Delval, E; Foulquié, D; Fassier, T; Bourdillon, Y; François, D; Boissy, A
2016-04-01
In sheep, social reactivity and reactivity to humans are relevant behavioral responses that are used to investigate the behavioral adaptation of farm animals to various rearing conditions. Such traits were previously reported as heritable and associated with several QTLs. However, few behavior-related genotype by environment (G × E) interactions have been reported to date. The experiment was performed on 2,989 male and female lambs issued from 30 sires. Every sire had progeny reared under both intensive and extensive conditions. After weaning, all lambs were individually exposed to two standardized behavioral tests. A broad range of behaviors including vocalizations, locomotion, localization, vigilance, and flight distance were assessed. Two complementary statistic approaches, with and without assumptions on the biological significance of behaviors, were performed to investigate social reactivity and reactivity to humans. G × E interactions were investigated based on the genetic correlations estimated for each factor or trait between farming conditions; those significantly different from 1 indicating a G × E. Environmental effects showed that social reactivity and reactivity to humans were higher in intensively reared lambs. The heritability of factors or traits used to measure social reactivity and reactivity to humans was similar in both rearing conditions. Estimated heritabilities were high for vocalizations in response to social isolation, moderate for locomotion and vigilance in response to social isolation, and low for both flight distance to an approaching human and proximity to a motionless human. No significant G × E interaction was found for vocalizations. G × E interactions were found for locomotion, vigilance and flight distance. Genetic correlations between both environments were low to moderate for vigilance, locomotion and flight distance. Vocalization in response to social isolation with or without human presence was identified as a robust trait and could be used to improve sheep sociability, independently of the environment. A G × E interaction was observed for behavioral reactivity to humans. Although moderate, the genetic correlation for this trait between intensive and extensive conditions could be used to select sires in the same environment by taking into account the G × E and to produce in different environments progenies that are less reactive to humans.
Running, swimming and diving modifies neuroprotecting globins in the mammalian brain
Williams, Terrie M; Zavanelli, Mary; Miller, Melissa A; Goldbeck, Robert A; Morledge, Michael; Casper, Dave; Pabst, D. Ann; McLellan, William; Cantin, Lucas P; Kliger, David S
2007-01-01
The vulnerability of the human brain to injury following just a few minutes of oxygen deprivation with submergence contrasts markedly with diving mammals, such as Weddell seals (Leptonychotes weddellii), which can remain underwater for more than 90 min while exhibiting no neurological or behavioural impairment. This response occurs despite exposure to blood oxygen levels concomitant with human unconsciousness. To determine whether such aquatic lifestyles result in unique adaptations for avoiding ischaemic–hypoxic neural damage, we measured the presence of circulating (haemoglobin) and resident (neuroglobin and cytoglobin) oxygen-carrying globins in the cerebral cortex of 16 mammalian species considered terrestrial, swimming or diving specialists. Here we report a striking difference in globin levels depending on activity lifestyle. A nearly 9.5-fold range in haemoglobin concentration (0.17–1.62 g Hb 100 g brain wet wt−1) occurred between terrestrial and deep-diving mammals; a threefold range in resident globins was evident between terrestrial and swimming specialists. Together, these two globin groups provide complementary mechanisms for facilitating oxygen transfer into neural tissues and the potential for protection against reactive oxygen and nitrogen groups. This enables marine mammals to maintain sensory and locomotor neural functions during prolonged submergence, and suggests new avenues for averting oxygen-mediated neural injury in the mammalian brain. PMID:18089537
Interface Engineering to Create a Strong Spin Filter Contact to Silicon
NASA Astrophysics Data System (ADS)
Caspers, C.; Gloskovskii, A.; Gorgoi, M.; Besson, C.; Luysberg, M.; Rushchanskii, K. Z.; Ležaić, M.; Fadley, C. S.; Drube, W.; Müller, M.
2016-03-01
Integrating epitaxial and ferromagnetic Europium Oxide (EuO) directly on silicon is a perfect route to enrich silicon nanotechnology with spin filter functionality. To date, the inherent chemical reactivity between EuO and Si has prevented a heteroepitaxial integration without significant contaminations of the interface with Eu silicides and Si oxides. We present a solution to this long-standing problem by applying two complementary passivation techniques for the reactive EuO/Si interface: (i) an in situ hydrogen-Si (001) passivation and (ii) the application of oxygen-protective Eu monolayers-without using any additional buffer layers. By careful chemical depth profiling of the oxide-semiconductor interface via hard x-ray photoemission spectroscopy, we show how to systematically minimize both Eu silicide and Si oxide formation to the sub-monolayer regime-and how to ultimately interface-engineer chemically clean, heteroepitaxial and ferromagnetic EuO/Si (001) in order to create a strong spin filter contact to silicon.
Guiding principles for peptide nanotechnology through directed discovery.
Lampel, A; Ulijn, R V; Tuttle, T
2018-05-21
Life's diverse molecular functions are largely based on only a small number of highly conserved building blocks - the twenty canonical amino acids. These building blocks are chemically simple, but when they are organized in three-dimensional structures of tremendous complexity, new properties emerge. This review explores recent efforts in the directed discovery of functional nanoscale systems and materials based on these same amino acids, but that are not guided by copying or editing biological systems. The review summarises insights obtained using three complementary approaches of searching the sequence space to explore sequence-structure relationships for assembly, reactivity and complexation, namely: (i) strategic editing of short peptide sequences; (ii) computational approaches to predicting and comparing assembly behaviours; (iii) dynamic peptide libraries that explore the free energy landscape. These approaches give rise to guiding principles on controlling order/disorder, complexation and reactivity by peptide sequence design.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dimitrijevic, N.; Rozhkova, E.; Rajh, T.
Modification of TiO{sub 2} nanoparticles with dopamine enables harvesting of visible light and promotes spatial separation of charges. The formation of reactive oxygen species (OH, {sup 1}O{sub 2}, O{sub 2}{sup -}, HO{sub 2}, H{sub 2}O{sub 2}) upon illumination of TiO{sub 2}/dopamine was studied using complementary spin-trap EPR and radical-induced fluorescence techniques. The localization of holes on dopamine suppresses oxidation of adsorbed water molecules at the surface of nanoparticles, and thus formation of OH radicals. At the same time, dopamine does not affect electronic properties of photogenerated electrons and their reaction with dissolved oxygen to produce superoxide anions. Superoxide anions aremore » proposed to generate singlet oxygen through dismutation reaction, resulting in a low yield of {sup 1}O{sub 2} detected.« less
Devi, K Rekha; Ahmed, Jishan; Narain, Kanwar; Mukherjee, Kaustab; Majumdar, Gautam; Chenkual, Saia; Zonunmawia, Jason C
2017-12-01
X-ray repair cross complementary group gene is one of the most studied candidate gene involved in different types of cancers. Studies have shown that X-ray repair cross complementary genes are significantly associated with increased risk of breast cancer in females. Moreover, studies have revealed that X-ray repair cross complementary gene polymorphism significantly varies between and within different ethnic groups globally. The present case-control study was aimed to investigate the association of X-ray repair cross complementary 1A (Arg194Trp) and X-ray repair cross complementary 3 (Thr241Met) polymorphism with the risk of breast cancer in females from northeastern region of India. The present case-control study includes histopathologically confirmed and newly diagnosed 464 cases with breast cancer and 534 apparently healthy neighborhood community controls. Information on sociodemographic factors and putative risk factors were collected from each study participant by conducting face-to-face interviews. Genotyping of X-ray repair cross complementary 1A (Arg194Trp) and X-ray repair cross complementary 3 (Thr241Met) was carried out by polymerase chain reaction-restriction fragment length polymorphism. For statistical analysis, both univariate and multivariate logistic regression analyses were performed. We also performed stratified analysis to find out the association of X-ray repair cross complementary genes with the risk of breast cancer stratified based on menstrual status. This study revealed that tryptophan allele (R/W-W/W genotype) in X-ray repair cross complementary 1A (Arg194Trp) gene significantly increased the risk of breast cancer (adjusted odds ratio = 1.44, 95% confidence interval = 1.06-1.97, P < .05 for R/W-W/W genotype). Moreover, it was found that tryptophan allele (W/W genotype) at codon 194 of X-ray repair cross complementary 1A (Arg194Trp) gene significantly increased the risk of breast cancer in premenopausal females (crude odds ratio = 1.66, 95% confidence interval = 1.11-2.46, P < .05 for R/W-W/W genotype). The present study did not reveal any significant association of X-ray repair cross complementary 3 (Thr241Met) polymorphism with the risk of breast cancer. The present study has explored that X-ray repair cross complementary 1A (Arg194Trp) gene polymorphism is significantly associated with the increased risk of breast cancer in premenopausal females from northeastern region of India which may be beneficial for prognostic purposes.
Ahmed, Jishan; Narain, Kanwar; Mukherjee, Kaustab; Majumdar, Gautam; Chenkual, Saia; Zonunmawia, Jason C.
2017-01-01
X-ray repair cross complementary group gene is one of the most studied candidate gene involved in different types of cancers. Studies have shown that X-ray repair cross complementary genes are significantly associated with increased risk of breast cancer in females. Moreover, studies have revealed that X-ray repair cross complementary gene polymorphism significantly varies between and within different ethnic groups globally. The present case–control study was aimed to investigate the association of X-ray repair cross complementary 1A (Arg194Trp) and X-ray repair cross complementary 3 (Thr241Met) polymorphism with the risk of breast cancer in females from northeastern region of India. The present case–control study includes histopathologically confirmed and newly diagnosed 464 cases with breast cancer and 534 apparently healthy neighborhood community controls. Information on sociodemographic factors and putative risk factors were collected from each study participant by conducting face-to-face interviews. Genotyping of X-ray repair cross complementary 1A (Arg194Trp) and X-ray repair cross complementary 3 (Thr241Met) was carried out by polymerase chain reaction-restriction fragment length polymorphism. For statistical analysis, both univariate and multivariate logistic regression analyses were performed. We also performed stratified analysis to find out the association of X-ray repair cross complementary genes with the risk of breast cancer stratified based on menstrual status. This study revealed that tryptophan allele (R/W-W/W genotype) in X-ray repair cross complementary 1A (Arg194Trp) gene significantly increased the risk of breast cancer (adjusted odds ratio = 1.44, 95% confidence interval = 1.06-1.97, P < .05 for R/W-W/W genotype). Moreover, it was found that tryptophan allele (W/W genotype) at codon 194 of X-ray repair cross complementary 1A (Arg194Trp) gene significantly increased the risk of breast cancer in premenopausal females (crude odds ratio = 1.66, 95% confidence interval = 1.11-2.46, P < .05 for R/W-W/W genotype). The present study did not reveal any significant association of X-ray repair cross complementary 3 (Thr241Met) polymorphism with the risk of breast cancer. The present study has explored that X-ray repair cross complementary 1A (Arg194Trp) gene polymorphism is significantly associated with the increased risk of breast cancer in premenopausal females from northeastern region of India which may be beneficial for prognostic purposes. PMID:29332455
Vilá-Héreter, Frances; Rivera-Mariani, Félix E; Bolaños-Rosero, Benjamín
2017-01-01
The allergenic potential of Ganoderma applanatum basidiospores has been demonstrated previously in Puerto Rico. However, basidiomycete allergens are not available for inclusion in allergy diagnostic panels. Therefore, we sought to confirm allergic sensitization to G. applanatum crude spore cytoplasmic extract through reactivity in serological assays and detection of immunoglobulin E (IgE)-binding polypeptides. Via an indirect ELISA, serological reactivity was compared between groups of individuals with different allergic profiles. Group 1 (n = 51) consisted of individuals with sIgE to the allergens included in the diagnostic panels; group 2 (n = 14) comprised individuals with no sIgE to the allergens tested; and group 3 (n = 22) included individuals with no allergic history. To visualize IgE-binding polypeptides, group 1 sera were examined via Western blotting (WB). Polypeptide bands with the highest reactivity were analyzed by mass spectrometry (MS) for putative identification. The serological reactivity of group 1 was significantly higher than that of group 3 in an indirect ELISA (p = 0.03). Sixty-five percent of group 1 individuals showed reactivity to polypeptide bands in WB. Bands of 81 and 56 kDa had the highest reactivity proportions among the reactive sera, followed by a 45-kDa band. MS analysis of these 3 polypeptides suggests that they are basidiomycete-derived enzymes with aconitate hydratase, catalase, and enolase functions. G. applanatum spores have allergenic components recognized by Puerto Rican individuals, which could eventually be considered as markers in cases of fungal allergy and be included in diagnostic allergen panels in Puerto Rico and tropical regions. © 2017 S. Karger AG, Basel.
What is Person-Environment Congruence? Supplementary versus Complementary Models of Fit.
ERIC Educational Resources Information Center
Muchinsky, Paul M.; Monahan, Carlyn J.
1987-01-01
Proposes that there are two types of person-environment congruence: supplementary, the match between an individual and a group of people who comprise an environment, such as a fraternal organization (the rationale behind vocational counseling decisions); and complementary, the match between an individual's talents and the corresponding needs of…
Zavaleta, Nelly; Kvistgaard, Anne Staudt; Graverholt, Gitte; Respicio, Graciela; Guija, Henry; Valencia, Norma; Lönnerdal, Bo
2011-11-01
The aim of the present study was to evaluate the efficacy of a milkfat globule membrane (MFGM)-enriched protein fraction in a complementary food, on diarrhea, anemia, and micronutrient status. A randomized, double-blind controlled design to study 550 infants, 6 to 11 months old, who received daily for 6 months a complementary food (40 g/day) with the protein source being either the MFGM protein fraction or skim milk proteins (control). Health and nutritional status of infants were examined monthly in the outpatient clinic; product intake, food patterns, and diarrhea morbidity were assessed by home visits twice per week. Hemoglobin and micronutrient status were measured at 0 and 6 months of intervention. Results are presented as the entire group and as 6 to 8 and 9 to 11 months subgroups. A total of 499 infants completed the study. Global prevalence of diarrhea was 3.84% and 4.37% in the MFGM group and control group, respectively (P < 0.05). Consumption of the MFGM protein fraction reduced episodes of bloody diarrhea (odds ratio 0.54; 95% confidence interval 0.31-0.93, P = 0.025) adjusting for anemia and potable water facilities as covariates. There were no differences between groups in anemia, serum ferritin, zinc, or folate. Addition of an MFGM-enriched protein fraction to complementary food had beneficial effects on diarrhea in infants and may thus help to improve the health of vulnerable populations.
Iatrakis, G; Peitsidou, A; Papandonopolos, L; Nikolopoulou, MK; Papadopoulos, L; Vladareanu, R
2010-01-01
This is a prospective study to assess a complementary treatment for genital warts after laser vaporization. 62 patients were enrolled in two randomized groups: A1: laser vaporization alone. A2: laser vaporization, followed with Pidotimod plus vitamin C for 2 and 1/2 months. The latter treatment shortened the time of warts remission and marginally decreased the rate of the warts' recurrence: 81% versus 67% (N.S.). Despite the non–significant difference, this complementary treatment seems to have some efficiency. PMID:20945819
Oresic Bender, Kristina; Ofori, Leslie; van der Linden, Wouter A; Mock, Elliot D; Datta, Gopal K; Chowdhury, Somenath; Li, Hao; Segal, Ehud; Sanchez Lopez, Mateo; Ellman, Jonathan A; Figdor, Carl G; Bogyo, Matthew; Verdoes, Martijn
2015-04-15
The cysteine cathepsins are a group of 11 proteases whose function was originally believed to be the degradation of endocytosed material with a high degree of redundancy. However, it has become clear that these enzymes are also important regulators of both health and disease. Thus, selective tools that can discriminate between members of this highly related class of enzymes will be critical to further delineate the unique biological functions of individual cathepsins. Here we present the design and synthesis of a near-infrared quenched activity-based probe (qABP) that selectively targets cathepsin S which is highly expressed in immune cells. Importantly, this high degree of selectivity is retained both in vitro and in vivo. In combination with a new green-fluorescent pan-reactive cysteine cathepsin qABP we performed dual color labeling studies in bone marrow-derived immune cells and identified vesicles containing exclusively cathepsin S activity. This observation demonstrates the value of our complementary cathepsin probes and provides evidence for the existence of specific localization of cathepsin S activity in dendritic cells.
Armendáriz-Vidales, Georgina; Frontana, Carlos
2014-09-07
An electrochemical and theoretical analysis of a series of shikonin derivatives in aprotic media is presented. Results showed that the first electrochemical reduction signal is a reversible monoelectronic transfer, generating a stable semiquinone intermediate; the corresponding E(I)⁰ values were correlated with calculated values of electroaccepting power (ω(+)) and adiabatic electron affinities (A(Ad)), obtained with BH and HLYP/6-311++G(2d,2p) and considering the solvent effect, revealing the influence of intramolecular hydrogen bonding and the substituting group at position C-2 in the experimental reduction potential. For the second reduction step, esterified compounds isobutyryl and isovalerylshikonin presented a coupled chemical reaction following dianion formation. Analysis of the variation of the dimensionless cathodic peak potential values (ξ(p)) as a function of the scan rate (v) functions and complementary experiments in benzonitrile suggested that this process follows a dissociative electron transfer, in which the rate of heterogeneous electron transfer is slow (~0.2 cm s(-1)), and the rate constant of the chemical process is at least 10(5) larger.
Harrup, Mason K; Rollins, Harry W
2013-11-26
An additive comprising a phosphazene compound that has at least two reactive functional groups and at least one capping functional group bonded to phosphorus atoms of the phosphazene compound. One of the at least two reactive functional groups is configured to react with cellulose and the other of the at least two reactive functional groups is configured to react with a resin, such as an amine resin of a polycarboxylic acid resin. The at least one capping functional group is selected from the group consisting of a short chain ether group, an alkoxy group, or an aryloxy group. Also disclosed are an additive-resin admixture, a method of treating a wood product, and a wood product.
Wang, Yan; Li, Yanzhong; Wang, Xin
2009-12-01
To explore the pathogenesis of abnormal behavior in children with obstructive sleep apnea-hypopnea syndrome (OSAHS). The behavioral problems and C-reactive protein were measured in 40 children with OSAHS and 30 children with habitual snoring who underwent overnight Polysomnography, 40 cases of healthy children for the control group. The ratio of abnormal behavior in OSAHS and habitual snoring children was significantly higher than that of the healthy control group, while no significant difference between the two groups. The content of C-reactive protein in OSAHS children (4.24 mg/L) was significantly higher than habitual snoring (2.76 mg/L) and healthy control group (1.27 mg/L); in habitual snoring children C-reactive protein was higher than in healthy control group. The content of serum C-reactive protein in OSAHS children accompanied by abnormal behavior (4.63 mg/L) was significantly higher than that without abnormal behavior (3.23 mg/L). The content of serum C-reactive protein content in habitual snoring children accompanied by abnormal behavior (3.63 mg/L) was significantly higher than that without abnormal behavior (1.76 mg/L). OSAHS and habitual snoring children have more behavior problems. C-reactive protein levels are higher in children with OSAHS and habitual snoring, and the levels of C-reactive protein are related to the abnormal behavior in these children.
Levett, K M; Smith, C A; Bensoussan, A; Dahlen, H G
2016-09-01
to gain insight into the experiences of women, partners and midwives who participated in the Complementary Therapies for Labour and Birth Study, an evidence based complementary medicine (CM) antenatal education course. qualitative in-depth interviews and a focus group as part of the Complementary Therapies for Labour and Birth Study. thirteen low risk primiparous women and seven partners who had participated in the study group of a randomised controlled trial of the complementary therapies for labour and birth study, and 12 midwives caring for these women. The trial was conducted at two public hospitals, and through the Western Sydney University in Sydney, Australia. the Complementary Therapies for Labour and Birth (CTLB) protocol, based on the She Births® course and the Acupressure for labour and birth protocol, incorporated six evidence-based complementary medicine (CM) techniques; acupressure, relaxation, visualisation, breathing, massage, yoga techniques and incorporated facilitated partner support. Randomisation to the trial occurred at 24-36 weeks' gestation, and participants attended a two-day antenatal education programme, plus standard care, or standard care alone. the overarching theme identified in the qualitative data was making sense of labour and birth. Women used information about normal birth physiology from the course to make sense of labour, and to utilise the CM techniques to support normal birth and reduce interventions in labour. Women's, partners' and midwives' experience of the course and its use during birth gave rise to supporting themes such as: working for normal; having a toolkit; and finding what works. the Complementary Therapies for Labour and Birth Study provided women and their partners with knowledge to understand the physiology of normal labour and birth and enabled them to use evidence-based CM tools to support birth and reduce interventions. the Complementary Therapies for Labour and Birth Study introduces concepts of what constitutes normal birth and provides skills to support women, partners and midwives. It appears to be an effective form of antenatal education that supports normal birth, and maternity services need to consider how they can reform current antenatal education in line with this evidence. Crown Copyright © 2016. Published by Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lopez-Buendia, A.M.; Climent, V.; Verdu, P.
The reactivity of carbonate rock with the alkali content of cement, commonly called alkali-carbonate reaction (ACR), has been investigated. Alkali-silica reaction (ASR) can also contribute in the alkali-aggregate reaction (AAR) in carbonate rock, mainly due to micro- and crypto-crystalline quartz or clay content in carbonate aggregate. Both ACR and ASR can occur in the same system, as has been also evidenced on this paper. Carbonate aggregate samples were selected using lithological reactivity criteria, taking into account the presence of dedolomitization, partial dolomitization, micro- and crypto-crystalline quartz. Selected rocks include calcitic dolostone with chert (CDX), calcitic dolostone with dedolomitization (CDD), limestonemore » with chert (LX), marly calcitic dolostone with partial dolomitization (CD), high-porosity ferric dolostone with clays (FD). To evaluate the reactivity, aggregates were studied using expansion tests following RILEM AAR-2, AAR-5, a modification using LiOH AAR-5Li was also tested. A complementary study was done using petrographic monitoring with polarised light microscopy on aggregates immersed in NaOH and LiOH solutions after different ages. SEM-EDAX has been used to identify the presence of brucite as a product of dedolomitization. An ACR reaction showed shrinkage of the mortar bars in alkaline solutions explained by induced dedolomitization, while an ASR process typically displayed expansion. Neither shrinkage nor expansion was observed when mortar bars were immersed in solutions of lithium hydroxide. Carbonate aggregate classification with AAR pathology risk has been elaborated based on mechanical behaviours by expansion and shrinkage. It is proposed to be used as a petrographic method for AAR diagnosis to complement the RILEM AAR1 specifically for carbonate aggregate. Aggregate materials can be classified as I (non-reactive), II (potentially reactive), and III (probably reactive), considering induced dedolomitization ACR (dedolomitization degree) and ASR.« less
Radioprotective effects of Silymarin on the sperm parameters of NMRI mice irradiated with γ-rays.
Fatehi, Daryoush; Mohammadi, Mohsen; Shekarchi, Babak; Shabani, Arash; Seify, Mohammad; Rostamzadeh, Ayoob
2018-01-01
Free radicals and reactive oxygen species (ROS) are generated using various endogenous systems or from external sources such as exposure to different physiochemicals. Ionizing radiation damage to the cell can be caused by the direct or indirect effects of radiotherapy processes. Silymarin (SM), a flavanolignan compound, has been identified as a natural potent antioxidant with cytoprotection activities due to scavenging free radicals. The aim of the present study was to evaluate the radioprotective effect of SM on sperm parameters of mice induced by γ-rays. A total number of 40 adult, male NMRI mice were randomly divided into four equal groups. The control group was neither treated with SM nor irradiated by γ-rays. The second group was only irradiated with 2Gy of γ-rays. The third group was firstly treated with 50mg/kg of SM for 7 consecutive days, and one day later, last injections were irradiated by 2Gy of γ-rays. The fourth groups received only 50mg/kg of SM for 7 consecutive days. All the animals were treated intraperitoneally. Histopathological and morphometrical examinations were performed. The data were analyzed using ANOVA and Tukey post hoc test. A value of p<0.05 was considered significant. The results showed that in the radiation-only group when compared with those treated with SM and irradiated, a significant different was observed in testicular parameters and DNA damage (p<0.05). In conclusion, SM can be considered as a promising herbal radioprotective agent in complementary medicine which may play an important role to protect normal spermatocytes against possible effects of γ-radiation-induced cellular damage. Copyright © 2017 Elsevier B.V. All rights reserved.
Upchurch, Dawn M; Wexler Rainisch, Bethany K
2012-10-01
This study describes complementary and alternative medicine use among a national sample of young adults, with an emphasis on characterizing racial and ethnic differences, highlighting variation across subgroups of Hispanics. The authors examined young adults ages 18 to 27 years (n = 14 128) from wave III (2001-2002) of the National Longitudinal Study of Adolescent Health. Prevalence estimates and logistic regression results were weighted and adjusted for complex sample design. The study examined recent complementary and alternative medicine use in the past 12 months, recent use for each of 15 specific complementary and alternative medicine modalities, and the 5 most commonly used modalities (herbs, massage, chiropractic, relaxation, and vitamins). Results showed that 29% of young adults aged 18 to 27 years recently used complementary and alternative medicine. Prevalence was highest among Cuban Americans (42%) and lowest among blacks (22%). Young adults used a diversity of complementary and alternative medicine modalities and there were substantial differences in use across racial and ethnic groups.
Upchurch, Dawn M.; Wexler Rainisch, Bethany K.
2013-01-01
This study describes complementary and alternative medicine use among a national sample of young adults, with an emphasis on characterizing racial and ethnic differences, highlighting variation across subgroups of Hispanics. The authors examined young adults ages 18 to 27 years (n = 14 128) from wave III (2001–2002) of the National Longitudinal Study of Adolescent Health. Prevalence estimates and logistic regression results were weighted and adjusted for complex sample design. The study examined recent complementary and alternative medicine use in the past 12 months, recent use for each of 15 specific complementary and alternative medicine modalities, and the 5 most commonly used modalities (herbs, massage, chiropractic, relaxation, and vitamins). Results showed that 29% of young adults aged 18 to 27 years recently used complementary and alternative medicine. Prevalence was highest among Cuban Americans (42%) and lowest among blacks (22%). Young adults used a diversity of complementary and alternative medicine modalities and there were substantial differences in use across racial and ethnic groups. PMID:23869288
NASA Astrophysics Data System (ADS)
Clamens, Olivier; Lecerf, Johann; Hudelot, Jean-Pascal; Duc, Bertrand; Cadiou, Thierry; Blaise, Patrick; Biard, Bruno
2018-01-01
CABRI is an experimental pulse reactor, funded by the French Nuclear Safety and Radioprotection Institute (IRSN) and operated by CEA at the Cadarache research center. It is designed to study fuel behavior under RIA conditions. In order to produce the power transients, reactivity is injected by depressurization of a neutron absorber (3He) situated in transient rods inside the reactor core. The shapes of power transients depend on the total amount of reactivity injected and on the injection speed. The injected reactivity can be calculated by conversion of the 3He gas density into units of reactivity. So, it is of upmost importance to properly master gas density evolution in transient rods during a power transient. The 3He depressurization was studied by CFD calculations and completed with measurements using pressure transducers. The CFD calculations show that the density evolution is slower than the pressure drop. Surrogate models were built based on CFD calculations and validated against preliminary tests in the CABRI transient system. Studies also show that it is harder to predict the depressurization during the power transients because of neutron/3He capture reactions that induce a gas heating. This phenomenon can be studied by a multiphysics approach based on reaction rate calculation thanks to Monte Carlo code and study the resulting heating effect with the validated CFD simulation.
Franc, Carine; Pierre, Aurélie
2015-02-01
In January 2013, within the framework of a National Inter-professional Agreement (NIA), the French government required all employers (irrespective of the size of their business) to offer private complementary health insurance to their employees from January 2016. The generalization of group complementary health insurance to all employees will directly affect insurers, employers and employees, as well as individuals not directly concerned (students, retirees, unemployed and civil servants). In this paper, we present the issues raised by this regulation, the expected consequences and the current debate around this reform. In particular, we argue that this reform may have adverse effects on equity of access to complementary health insurance in France, since the risk structure of the market for individual health insurance will change, potentially increasing inequalities between wage-earners and others. Moreover, tax exemptions given to group contracts are problematic because public funds used to support these contracts can be higher at individual level for high-salary individuals than those allocated to improve access for the poorest. In response to the criticism and with the aim of ensuring equity in the system, the government decided to reconsider some of the fiscal advantages given to group contracts, to enhance programs and aids dedicated to the poorest and to redefine an overall context of incentives. Copyright © 2015. Published by Elsevier Ireland Ltd.
Mapping the Relationship between Glycosyl Acceptor Reactivity and Glycosylation Stereoselectivity.
van der Vorm, Stefan; van Hengst, Jacob M A; Bakker, Marloes; Overkleeft, Herman S; van der Marel, Gijsbert A; Codée, Jeroen D C
2018-03-30
The reactivity of both coupling partners-the glycosyl donor and acceptor-is decisive for the outcome of a glycosylation reaction, in terms of both yield and stereoselectivity. Where the reactivity of glycosyl donors is well understood and can be controlled through manipulation of the functional/protecting-group pattern, the reactivity of glycosyl acceptor alcohols is poorly understood. We here present an operationally simple system to gauge glycosyl acceptor reactivity, which employs two conformationally locked donors with stereoselectivity that critically depends on the reactivity of the nucleophile. A wide array of acceptors was screened and their structure-reactivity/stereoselectivity relationships established. By systematically varying the protecting groups, the reactivity of glycosyl acceptors can be adjusted to attain stereoselective cis-glucosylations. © 2018 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.
2012-01-01
Background Alkaline phosphatase (AP) is a ubiquitously expressed enzyme which can neutralize endotoxin as well as adenosine triphosphate (ATP), an endogenous danger signal released during brain injury. In this study we assessed a potential therapeutic role for AP in inhibiting neuroinflammation using three complementary approaches. Methods Mice were immunized to induce experimental autoimmune encephalomyelitis (EAE) and treated with AP for seven days during different phases of disease. In addition, serological assays to determine AP activity, endotoxin levels and endotoxin-reactive antibodies were performed in a cohort of multiple sclerosis (MS) patients and controls. Finally, the expression of AP and related enzymes CD39 and CD73 was investigated in brain tissue from MS patients and control subjects. Results AP administration during the priming phase, but not during later stages, of EAE significantly reduced neurological signs. This was accompanied by reduced proliferation of splenocytes to the immunogen, myelin oligodendrocyte glycoprotein peptide. In MS patients, AP activity and isoenzyme distribution were similar to controls. Although endotoxin-reactive IgM was reduced in primary-progressive MS patients, plasma endotoxin levels were not different between groups. Finally, unlike AP and CD73, CD39 was highly upregulated on microglia in white matter lesions of patients with MS. Conclusions Our findings demonstrate that: 1) pre-symptomatic AP treatment reduces neurological signs of EAE; 2) MS patients do not have altered circulating levels of AP or endotoxin; and 3) the expression of the AP-like enzyme CD39 is increased on microglia in white matter lesions of MS patients. PMID:23231745
Smith, Kathryn E; Hayes, Nicole A; Styer, Denise M; Washburn, Jason J
2017-11-01
Emotional reactivity is theorized to contribute to both eating disorders (ED) and nonsuicidal self-injury (NSSI). Although EDs and NSSI frequently co-occur, no study has examined emotional reactivity in individuals with both conditions. This study examined the following hypotheses in a large clinical sample (N = 648): (1) patients with co-occurring ED and NSSI would report higher emotional reactivity and more severe clinical characteristics; (2) among those with EDs, patients with bulimia nervosa (BN) would be more likely to report NSSI and evidence higher emotional reactivity compared to those with anorexia nervosa (AN); and (3) higher emotional reactivity would be associated with worse treatment outcomes. Data were collected at admission and discharge from inpatient, partial hospitalization, and intensive outpatient treatment programs for EDs or NSSI. The NSSI-only and co-occurring groups reported significantly higher emotional reactivity than the ED-only group. Among those with EDs, individuals with BN reported higher emotional reactivity and were more likely to engage in NSSI compared to those with AN. Emotional reactivity was inconsistently related to treatment outcomes among the co-occurring and ED-only groups. In sum, results highlight the importance of emotional reactivity in clinical presentations, particularly when NSSI is present. Published by Elsevier B.V.
Davis, Tchiki S; Mauss, Iris B; Lumian, Daniel; Troy, Allison S; Shallcross, Amanda J; Zarolia, Paree; Ford, Brett Q; McRae, Kateri
2014-08-01
Intentionally hurting one's body (deliberate self-harm; DSH) is theorized to be associated with high negative emotional reactivity and poor emotion regulation ability. However, little research has assessed the relationship between these potential risk factors and DSH using laboratory measures. Therefore, we conducted 2 studies using laboratory measures of negative emotional reactivity and emotion regulation ability. Study 1 assessed self-reported negative emotions during a sad film clip (reactivity) and during a sad film clip for which participants were instructed to use reappraisal (regulation). Those with a history of DSH were compared with 2 control groups without a history of DSH matched on key demographics: 1 healthy group low in depression and anxiety symptoms and 1 group matched to the DSH group on depression and anxiety symptoms. Study 2 extended Study 1 by assessing neural responding to negative images (reactivity) and negative images for which participants were instructed to use reappraisal (regulation). Those with a history of DSH were compared with a control group matched to the DSH group on demographics, depression, and anxiety symptoms. Compared with control groups, participants with a history of DSH did not exhibit greater negative emotional reactivity but did exhibit lower ability to regulate emotion with reappraisal (greater self-reported negative emotions in Study 1 and greater amygdala activation in Study 2 during regulation). These results suggest that poor emotion regulation ability, but not necessarily greater negative emotional reactivity, is a correlate of and may be a risk factor for DSH, even when controlling for mood disorder symptoms. (c) 2014 APA, all rights reserved.
Davis, Tchiki S.; Mauss, Iris B.; Lumian, Daniel; Troy, Allison S.; Shallcross, Amanda J.; Zarolia, Paree; Ford, Brett Q.; McRae, Kateri
2014-01-01
Intentionally hurting one’s own body (deliberate self-harm; DSH) is theorized to be associated with high negative emotional reactivity and poor emotion regulation ability. However, little research has assessed the relationship between these potential risk factors and DSH using laboratory measures. Therefore, we conducted two studies using laboratory measures of negative emotional reactivity and emotion regulation ability. Study 1 assessed self-reported negative emotions during a sad film clip (Reactivity) and during a sad film clip for which participants were instructed to use reappraisal (Regulation). Those with a history of DSH were compared to two control groups without a history of DSH matched on key demographics: one healthy group low in depression and anxiety symptoms and one group matched to the DSH group on depression and anxiety symptoms. Study 2 extended Study 1 by assessing neural responding to negative images (Reactivity) and negative images for which participants were instructed to use reappraisal (Regulation). Those with a history of DSH were compared to a control group matched to the DSH group on demographics, depression, and anxiety symptoms. Compared to control groups, participants with a history of DSH did not exhibit greater negative emotional reactivity but did exhibit lower ability to regulate emotion with reappraisal (greater self-reported negative emotions in Study 1 and greater amygdala activation in Study 2 during regulation). These results suggest that poor emotion regulation ability, but not necessarily greater negative emotional reactivity, is a correlate of and may be a risk factor for DSH, even when controlling for mood disorder symptoms. PMID:24865373
Pradeep, A R; Manjunath, R G Shiva; Kathariya, Rahul
2010-11-01
Increased C-reactive protein levels have been found in all active inflammations, including periodontitis. This study aims to assess the C-reactive protein levels in periodontal disease progression. Forty-five patients were divided into the following three groups (n=15) based on gingival index, probing pocket depth, and clinical attachment level: healthy (group I), gingivitis (group II), and chronic periodontitis (group III). Gingival crevicular fluid and serum samples were quantified for C-reactive protein using enzyme-linked immunosorbent assay. The mean C-reactive protein concentration in gingival crevicular fluid and serum was found to be highest in group III (1233.33ng/mL for gingival crevicular fluid, 5483.33ng/mL for serum), and least in group I (60 ng/mL and 413 ng/mL for gingival crevicular fluid and serum, respectively) The mean C-reactive protein concentration in group II (453.33ng/mL for gingival crevicular fluid and 3565.33 ng/mL for serum) was found to be intermediate. C-reactive protein levels in gingival crevicular fluid and serum increased proportionately with the severity of periodontal disease. They correlated positively with clinical parameters, including gingival index, probing pocket depth, and clinical attachment level. Thus, it can be considered as a periodontal inflammatory biomarker and deserves further consideration. © 2010 Blackwell Publishing Asia Pty Ltd.
Qiao, H-L; Li, Z; Yang, J; Tian, X; Gao, N; Jia, L-J
2009-06-01
Although skin tests are usually employed to evaluate current penicillin allergy status, a negative result does not exclude hypersensitivity. There is a need for accurate in vitro tests to exclude hypersensitivity. A radioallergosorbent test (RAST) is a potentially good supplementary approach, but there is little information on the suitability of this method to diagnose penicillin hypersensitivity in subjects with a negative skin test to benzylpenicillin. A total of 133 patients with a negative skin test to benzylpenicillin G (PG) and all of whom developed allergic reactions to PG were studied. RAST was used to detect eight kinds of specific IgE antibodies to penicillins in serum, which included four kinds of major and minor antigenic determinants to four penicillin drugs. The combination sites for the specific IgE antibodies were studied by RAST inhibition test. The rate of positive reactions for the specific IgE antibodies was 59.40% (79/133). Of the eight kinds of antigenic determinants, the positive rates for specific IgE against the major and minor determinants were 39.10% (52) and 42.86% (57) respectively. Of the four drugs, positive cases only to PG were 10 (7.5%), were significantly fewer than the cross-reacting positive cases (36) to PG (P < 0.01). In the RAST inhibition studies all drugs exhibited good inhibitory potencies, and in some instances the side-chain of the penicillins could induce specific responses with a variable degree of cross-reactivity among the different penicillins. Radioallergosorbent test is a good complementary test in persons who are skin-test negative with PG, and the sensitivity of RAST increases with increasing specificity of IgE antibodies to be detected. 6-APA and the groups, making part of the different side-chains on penicillins, all contributed to the cross-reactivity.
de Castro Zacche-Tonini, Aline; Fonseca, Giuliana Schmidt França; de Jesus, Laura Néspoli Nassar Pansini; Barros, Geisa Baptista; Coelho-Dos-Reis, Jordana Grazziela Alves; Béla, Samantha Ribeiro; Machado, Anderson Silva; Carneiro, Ana Carolina Aguiar Vasconcelos; Andrade, Gláucia Manzan Queiroz; Vasconcelos-Santos, Daniel Vitor; Januário, José Nélio; Teixeira-Carvalho, Andréa; Vitor, Ricardo Wagner Almeida; Ferro, Eloísa Amália Vieira; Mineo, José Roberto; Martins-Filho, Olindo Assis; Lemos, Elenice Moreira
2017-12-01
The aim of this study was to evaluate the performance of conventional serology (Q-Preven™ and ELFAVIDAS™) and flow cytometry-based serologic tools for early serologic diagnosis of congenital toxoplasmosis. The study groups included prospectively confirmed cases of congenital toxoplasmosis (TOXO=88) and age-matching non-infected controls (NI=15).The results demonstrated that all samples tested positive/indeterminate for anti-T. gondii IgM screening at birth using air-dried whole blood samples. Serum samples collected at 30-45days after birth tested positive for ELFAVIDAS™ IgG in both groups. While all NI tested negative for ELFAVIDAS™ IgM and IgA, only 78% and 36% of TOXO tested positive for IgM and IgA, respectively. Flow cytometry-based anti-T. gondii IgM, IgA and IgG reactivity displayed moderate performance with low sensitivity (47.6%, 72.6% and 75.0%, respectively). Regardless the remarkable specificity of IgG1, IgG2 and IgG3 subclasses for early diagnosis, weak or moderate specificity was observed (Se=73.9%, 60.2% and 83.0%, respectively). The analysis of IgG avidity indices (AI) demonstrated the highest performance among the flow cytometry-based methods (Se=96.6%; Sp=93.3%), underscoring the low avidity index (AI<60%) within TOXO (97.0%) in contrast with the high avidity index (AI>60%) in NI (93%). Analysis of anti-T. gondii IgG and IgG3 reactivity for mother:infant paired samples may represent a relevant complementary tests for early diagnosis. In conclusion, a feasible high-standard algorithm (Accuracy=97.1%) was proposed consisting of Q-Preven™ IgM screening at birth, followed by ELFAVIDAS™ IgM and flow cytometric IgG avidity analysis at 30-45days after birth as a high performance tool for early serological diagnosis of congenital toxoplasmosis. Copyright © 2017. Published by Elsevier B.V.
Elevated Striatal Reactivity Across Monetary and Social Rewards in Bipolar I Disorder
Dutra, Sunny J.; Cunningham, William A.; Kober, Hedy; Gruber, June
2016-01-01
Bipolar disorder (BD) is associated with increased reactivity to rewards and heightened positive affectivity. It is less clear to what extent this heightened reward sensitivity is evident across contexts and what the associated neural mechanisms might be. The present investigation employed both a monetary and social incentive delay task among adults with remitted BD type I (N=24) and a healthy non-psychiatric control group (HC; N=25) using fMRI. Both whole-brain and region-of-interest analyses revealed elevated ventral and dorsal striatal reactivity across monetary and social reward receipt, but not anticipation, in the BD group. Post-hoc analyses further suggested that greater striatal reactivity to reward receipt across monetary and social reward tasks predicted decreased self-reported positive affect when anticipating subsequent rewards in the HC, but not BD, group. Results point toward elevated striatal reactivity to reward receipt as a potential neural mechanism of reward reactivity. PMID:26390194
Relative reactivity of amino acids with chlorine in mixtures.
Na, Chongzheng; Olson, Terese M
2007-05-01
The relative reactivity of chlorine with amino acids is an important determinant of the resulting chlorination products in systems where chlorine is the limiting reagent, for example, in the human gastrointestinal tract after consumption of chlorine-containing water, or during food preparation with chlorinated water. Since few direct determinations of the initial reactivity of chlorine with amino acids have been made, 17 amino acids were compared in this study using competitive kinetic principles. The experimental results showed that (1) most amino acids have similar initial reactivities at neutral pH; (2) amino acids with thiol groups such as methionine and cysteine are exceptionally reactive and produce sulfoxides; (3) amino acids without thiol groups primarily undergo monochlorination of the amino nitrogen; and (4) glycine and proline are the least reactive. Dichlorination was estimated to occur with approximately 26% of the amino acid groups when the total amino acid: chlorine concentrations were equal.
Hatakeyama, Takuji; Hashimoto, Sigma; Ishizuka, Kentaro; Nakamura, Masaharu
2009-08-26
Combinations of N-heterocyclic carbenes (NHCs) and fluoride salts of the iron-group metals (Fe, Co, and Ni) have been shown to be excellent catalysts for the cross-coupling reactions of aryl Grignard reagents (Ar(1)MgBr) with aryl and heteroaryl halides (Ar(2)X) to give unsymmetrical biaryls (Ar(1)-Ar(2)). Iron fluorides in combination with SIPr, a saturated NHC ligand, catalyze the biaryl cross-coupling between various aryl chlorides and aryl Grignard reagents in high yield and high selectivity. On the other hand, cobalt and nickel fluorides in combination with IPr, an unsaturated NHC ligand, exhibit interesting complementary reactivity in the coupling of aryl bromides or iodides; in contrast, with these substrates the iron catalysts show a lower selectivity. The formation of homocoupling byproducts is suppressed markedly to less than 5% in most cases by choosing the appropriate metal fluoride/NHC combination. The present catalyst combinations offer several synthetic advantages over existing methods: practical synthesis of a broad range of unsymmetrical biaryls without the use of palladium catalysts and phosphine ligands. On the basis of stoichiometric control experiments and theoretical studies, the origin of the unique catalytic effect of the fluoride counterion can be ascribed to the formation of a higher-valent heteroleptic metalate [Ar(1)MF(2)]MgBr as the key intermediate in our proposed catalytic cycle. First, stoichiometric control experiments revealed the stark differences in chemical reactivity between the metal fluorides and metal chlorides. Second, DFT calculations indicate that the initial reduction of di- or trivalent metal fluoride in the wake of transmetalation with PhMgCl is energetically unfavorable and that formation of a divalent heteroleptic metalate complex, [PhMF(2)]MgCl (M = Fe, Co, Ni), is dominant in the metal fluoride system. The heteroleptic ate-complex serves as a key reactive intermediate, which undergoes oxidative addition with PhCl and releases the biaryl cross-coupling product Ph-Ph with reasonable energy barriers. The present cross-coupling reaction catalyzed by iron-group metal fluorides and an NHC ligand provides a highly selective and practical method for the synthesis of unsymmetrical biaryls as well as the opportunity to gain new mechanistic insights into the metal-catalyzed cross-coupling reactions.
Asgari, Mojgan; Nabi Maybodi, Mahtab; Abolhasani, Maryam
2016-01-01
Background: Flat urothelial lesions comprise a spectrum of morphologic changes ranging from reactive atypia to carcinoma in situ (CIS). Urothelial dysplasia and CIS are associated with the recurrence and progression of urothelial carcinoma. Distinguishing CIS and dysplasia from reactive atypia based on histolopathogical features alone is often difficult. Using different immunohistochemical markers such as Cytokeratin 20 (CK20), CD44, p53, and Ki-67 is recommended for differential diagnosis. The aim of this study was to evaluate the immunohistochemical pattern of these antibodies to differentiate different flat urothelial lesions. Methods: In this cross- sectional study, three groups of bladder biopsy specimens were evaluated: 20 samples with reactive urothelial lesions, 20 histologically diagnosed as CIS, and 20 morphologically normal samples. Immunohistochemical staining of CK20, p53, CD44 and Ki-67 markers was performed on paraffin-embedded blocks. The groups were compared using chi square test, and the diagnostic value of the markers were evaluated with sensitivity, specificity, positive and negative predictive values. Results: CK20 was full thickness positive in 15 (75%) CIS samples and negative in all samples of the normal and reactive groups (p<0.001); CD44 was positive in 2 (10%) cases of the CIS group and in 17 (85%) of the reactive group; this marker was negative in all the normal samples (p<0.001). P53 was positive in 12 (60%) samples of the CIS group and negative in all samples of the normal and reactive groups (p<0.001). Ki67 was positive in 13 (65%) samples of the CIS group and 1 (5%) sample of the reactive group. This marker was negative in all samples of the normal group (p<0.001). Conclusion: The results of this study revealed that CK20, CD44, P53 and Ki67 are useful in distinguishing CIS from reactive and normal samples. However, they should be used in a panel including at least three markers. Correlation with the morphologic features is necessary. PMID:27579290
Focusing and Expressive Arts Therapy as a Complementary Treatment for Women with Breast Cancer
ERIC Educational Resources Information Center
Klagsbrun, Joan; Rappaport, Laury; Speiser, Vivien Marcow; Post, Pamela; Byers, Julia; Stepakoff, Shanee; Karman, Shira
2005-01-01
This pilot study (N = 18) explored the effectiveness of focusing and expressive arts therapies intervention on the quality of life of women with breast cancer. The format was a 2-day (7 hours per day) retreat/support group in which complementary treatments (focusing, writing, art, and movement) were provided in an intensive format. Our hypothesis…
Ogata, Masao; Takano, Kuniko; Moriuchi, Yukiyoshi; Kondo, Tadakazu; Ueki, Toshimitsu; Nakano, Nobuaki; Mori, Takehiko; Uoshima, Nobuhiko; Nagafuji, Koji; Yamasaki, Satoshi; Shibasaki, Yasuhiko; Sakai, Rika; Kato, Koji; Choi, Ilseung; Jo, Yumi; Eto, Tetsuya; Kako, Shinichi; Oshima, Kumi; Fukuda, Takahiro
2018-06-01
Cord blood transplantation (CBT) is a distinct risk factor for human herpesvirus-6 (HHV-6) reactivation and HHV-6 encephalitis. In a prospective multicenter trial we investigated the effects of prophylactic foscarnet (90 mg/kg i.v. infusion from days 7 to 27 after CBT) on the occurrence of HHV-6 reactivation, HHV-6 encephalitis, and acute graft-versus-host disease (aGVHD) in CBT recipients. Between 2014 and 2016, 57 patients were included in a foscarnet-prophylaxis group. Outcomes were compared with an historical control group who received CBT between 2010 and 2014 (standard-treatment group, n = 63). The cumulative incidence of high-level HHV-6 reactivation, defined as plasma HHV-6 DNA ≥ 10 4 copies/mL, at 60 days after CBT was significantly lower in the foscarnet-prophylaxis group than in the standard-treatment group (18.3% versus 57.3%, P < .001). Multivariate analysis revealed that myeloablative preconditioning and standard treatment were significant risk factors for high-level HHV-6 reactivation. The cumulative incidence of HHV-6 encephalitis at 60 days after CBT was not different between the groups (foscarnet-prophylaxis group, 12.4%; standard-treatment group, 4.9%; P = .14). The cumulative incidences of grades II to IV and grades III to IV aGVHD at 60 days after CBT were not different between the groups (grades II to IV aGVHD: foscarnet-prophylaxis group, 42.0%; standard-treatment group, 40.5%; P = .96; grades III to IV aGVHD: foscarnet-prophylaxis group, 14.5%; standard-treatment group, 14.5%; P = 1.00). In the setting of this study foscarnet significantly suppressed systemic HHV-6 reactivation in CBT recipients but failed to prevent the development of HHV-6 encephalitis. Suppression of HHV-6 reactivation by foscarnet did not show any effects against the incidence of aGVHD. Copyright © 2018 The American Society for Blood and Marrow Transplantation. Published by Elsevier Inc. All rights reserved.
The mitigating effect of repeated memory reactivations on forgetting
NASA Astrophysics Data System (ADS)
MacLeod, Sydney; Reynolds, Michael G.; Lehmann, Hugo
2018-12-01
Memory reactivation is a process whereby cueing or recalling a long-term memory makes it enter a new active and labile state. Substantial evidence suggests that during this state the memory can be updated (e.g., adding information) and can become more vulnerable to disruption (e.g., brain insult). Memory reactivations can also prevent memory decay or forgetting. However, it is unclear whether cueing recall of a feature or component of the memory can benefit retention similarly to promoting recall of the entire memory. We examined this possibility by having participants view a series of neutral images and then randomly assigning them to one of four reactivation groups: control (no reactivation), distractor (reactivation of experimental procedures), component (image category reactivation), and descriptive (effortful description of the images). The experiment also included three retention intervals: 1 h, 9 days, and 28 days. Importantly, the participants received three reactivations equally spaced within their respective retention interval. At the end of the interval, all the participants were given an in-lab free-recall test in which they were asked to write down each image they remembered with as many details as possible. The data revealed that both the participants in the descriptive reactivation and component reactivation groups remembered significantly more than the participants in the control groups, with the effect being most pronounced in the 28-day retention interval condition. These findings suggest that memory reactivation, even component reactivation of a memory, makes memories more resistant to decay.
Altered Brain Reactivity to Game Cues After Gaming Experience.
Ahn, Hyeon Min; Chung, Hwan Jun; Kim, Sang Hee
2015-08-01
Individuals who play Internet games excessively show elevated brain reactivity to game-related cues. This study attempted to test whether this elevated cue reactivity observed in game players is a result of repeated exposure to Internet games. Healthy young adults without a history of excessively playing Internet games were recruited, and they were instructed to play an online Internet game for 2 hours/day for five consecutive weekdays. Two control groups were used: the drama group, which viewed a fantasy TV drama, and the no-exposure group, which received no systematic exposure. All participants performed a cue reactivity task with game, drama, and neutral cues in the brain scanner, both before and after the exposure sessions. The game group showed an increased reactivity to game cues in the right ventrolateral prefrontal cortex (VLPFC). The degree of VLPFC activation increase was positively correlated with the self-reported increase in desire for the game. The drama group showed an increased cue reactivity in response to the presentation of drama cues in the caudate, posterior cingulate, and precuneus. The results indicate that exposure to either Internet games or TV dramas elevates the reactivity to visual cues associated with the particular exposure. The exact elevation patterns, however, appear to differ depending on the type of media experienced. How changes in each of the regions contribute to the progression to pathological craving warrants a future longitudinal study.
Affective and cognitive reactivity to mood induction in chronic depression.
Guhn, Anne; Sterzer, Philipp; Haack, Friderike H; Köhler, Stephan
2018-03-15
Chronic depression (CD) is strongly associated with childhood maltreatment, which has been proposed to lead to inefficient coping styles that are characterized by abnormal affective responsiveness and dysfunctional cognitive attitudes. However, while this notion forms an important basis for psychotherapeutic strategies in the treatment of CD, there is still little direct empirical evidence for a role of altered affective and cognitive reactivity in CD. The present study therefore experimentally investigated affective and cognitive reactivity to two forms of negative mood induction in CD patients versus a healthy control sample (HC). For the general mood induction procedure, a combination of sad pictures and sad music was used, while for individualized mood induction, negative mood was induced by individualized scripts with autobiographical content. Both experiments included n = 15 CD patients versus n = 15 HC, respectively. Interactions between affective or cognitive reactivity and group were analyzed by repeated measurements ANOVAs. General mood induction neither revealed affective nor cognitive reactivity in the patient group while the control group reported the expected decrease of positive affect [interaction (IA) affective reactivity x group: p = .011, cognitive reactivity x group: n.s.]. In contrast, individualized mood induction specifically increased affective reactivity (IA: p = .037) as well as the amount of dysfunctional cognitions in patients versus controls (IA: p = .014). The experiments were not balanced in a crossover design, causal conclusions are thus limited. Additionally, the differences to non-chronic forms of depression are still outstanding. The results suggest that in patients with CD, specific emotional activation through autobiographical memories is a key factor in dysfunctional coping styles. Psychotherapeutic interventions aimed at modifying affective and cognitive reactivity are thus of high relevance in the treatment of CD. Copyright © 2018 Elsevier B.V. All rights reserved.
Syntheses and characterization of liposome-incorporated adamantyl aminoguanidines.
Šekutor, Marina; Štimac, Adela; Mlinarić-Majerski, Kata; Frkanec, Ruža
2014-08-21
A series of mono and bis-aminoguanidinium adamantane derivatives has been synthesized and incorporated into liposomes. They combine two biomedically significant molecules, the adamantane moiety and the guanidinium group. The adamantane moiety possesses the membrane compatible features while the cationic guanidinium subunit was recognized as a favourable structural feature for binding to complementary molecules comprising phosphate groups. The liposome formulations of adamantyl aminoguanidines were characterized and it was shown that the entrapment efficiency of the examined compounds is significant. In addition, it was demonstrated that liposomes with incorporated adamantyl aminoguanidines effectively recognized the complementary liposomes via the phosphate group. These results indicate that adamantane derivatives bearing guanidinium groups might be versatile tools for biomedical application, from studies of molecular recognition processes to usage in drug formulation and cell targeting.
Jost, John T; Kay, Aaron C
2005-03-01
Many have suggested that complementary gender stereotypes of men as agentic (but not communal) and women as communal (but not agentic) serve to increase system justification, but direct experimental support has been lacking. The authors exposed people to specific types of gender-related beliefs and subsequently asked them to complete measures of gender-specific or diffuse system justification. In Studies 1 and 2, activating (a) communal or complementary (communal + agentic) gender stereotypes or (b) benevolent or complementary (benevolent + hostile) sexist items increased support for the status quo among women. In Study 3, activating stereotypes of men as agentic also increased system justification among men and women, but only when women's characteristics were associated with higher status. Results suggest that complementary stereotypes psychologically offset the one-sided advantage of any single group and contribute to an image of society in which everyone benefits through a balanced dispersion of benefits. ((c) 2005 APA, all rights reserved).
Libuda, Lars; Mesch, Christina M; Stimming, Madlen; Demmelmair, Hans; Koletzko, Berthold; Warschburger, Petra; Blanke, Katharina; Reischl, Eva; Kalhoff, Hermann; Kersting, Mathilde
2016-06-01
Introduction of complementary food usually leads to decreasing intakes of long-chain n-3 polyunsaturated fatty acids (n-3 LC-PUFA), compared to full breastfeeding. In the randomised controlled PINGU intervention trial, we tested the effects of complementary foods with different contents of alpha-linolenic acid (ALA) and docosahexaenoic acid (DHA) on term infant LC-PUFA status. Healthy infants born at term were randomised to receive from the introduction of complementary feeding at the age of 4 to 6 months until age of 10 months ready-made complementary meals either with ALA-rich rapeseed oil (intervention group (IG)-R), with salmon twice weekly to provide preformed DHA (IG-F), or with linoleic acid-rich corn oil (control group, CG). Fatty acid composition was assessed in erythrocyte (RBC) and plasma glycerophospholipids. Complete data of fatty acids in RBC (plasma) were available from 158 (155) infants. After intervention, infants assigned to IG-F showed higher RBC and plasma percentages of eicosapentaenoic acid (EPA), DHA, and total n-3 LC-PUFA than CG (each p < 0.001). In IG-R, levels of ALA and the ratio of ALA to LA in plasma and RBC (all p < 0.0001) as well as RBC-EPA (p < 0.0001) were higher than in CG, while DHA levels did not differ between IG-R and CG. Regular fish consumption during complementary feeding enhances infant EPA and DHA status. The usage of rapeseed oil in small amounts concordant with EU-law for commercial meals enhances endogenic EPA-synthesis, but does not affect DHA status. Provision of oily fish with complementary feeds is advisable to prevent a decline of DHA status. www.clinicaltrials.gov , identifier: NCT01487889, title: Polyunsaturated fatty acids in child nutrition-a German multimodal optimisation study (PINGU).
Walsh, Anne; Kearney, Lauren; Dennis, Nicole
2015-09-22
Optimal infant nutrition comprises exclusive breastfeeding, with complementary foods introduced from six months of age. How parents make decisions regarding this is poorly studied. This study begins to address the dearth of research into the decision-making processes used by first-time mothers relating to the introduction of complementary foods. This qualitative explorative study was conducted using interviews (13) and focus groups (3). A semi-structured interview guide based on the Theory of Planned Behaviour (TPB). The TPB, a well-validated decision-making model, identifies the key determinants of a behaviour through behavioural beliefs, subjective norms, and perceived behavioural control over the behaviour. It is purported that these beliefs predict behavioural intention to perform the behaviour, and performing the behaviour. A purposive, convenience, sample of 21 metropolitan parents recruited through advertising at local playgroups and childcare centres, and electronically through the University community email list self-selected to participate. Data were analysed thematically within the theoretical constructs: behavioural beliefs, subjective norms and perceived behavioural control. Data relating to sources of information about the introduction of complementary foods were also collected. Overall, first-time mothers found that waiting until six months was challenging despite knowledge of the WHO recommendations and an initial desire to comply with this guideline. Beliefs that complementary foods would assist the infants' weight gain, sleeping patterns and enjoyment at meal times were identified. Barriers preventing parents complying with the recommendations included subjective and group norms, peer influences, infant cues indicating early readiness and food labelling inconsistencies. The most valued information source was from peers who had recently introduced complementary foods. First-time mothers in this study did not demonstrate a good understanding of the rationale behind the WHO recommendations, nor did they understand fully the signs of readiness of infants to commence solid foods. Factors that assisted waiting until six months were a trusting relationship with a health professional whose practice and advice was consistent with the recommendations and/or when their infant was developmentally ready for complementary foods at six months and accepted them with ease and enthusiasm. Barriers preventing parents complying with the recommendations included subjective and group norms, peer influences, infant cues indicating early readiness and food labelling inconsistencies.
Assessment of CO2 Mineralization and Dynamic Rock Properties at the Kemper Pilot CO2 Injection Site
NASA Astrophysics Data System (ADS)
Qin, F.; Kirkland, B. L.; Beckingham, L. E.
2017-12-01
CO2-brine-mineral reactions following CO2 injection may impact rock properties including porosity, permeability, and pore connectivity. The rate and extent of alteration largely depends on the nature and evolution of reactive mineral interfaces. In this work, the potential for geochemical reactions and the nature of the reactive mineral interface and corresponding hydrologic properties are evaluated for samples from the Lower Tuscaloosa, Washita-Fredericksburg, and Paluxy formations. These formations have been identified as future regionally extensive and attractive CO2 storage reservoirs at the CO2 Storage Complex in Kemper County, Mississippi, USA (Project ECO2S). Samples from these formations were obtained from the Geological Survey of Alabama and evaluated using a suite of complementary analyses. The mineral composition of these samples will be determined using petrography and powder X-ray Diffraction (XRD). Using these compositions, continuum-scale reactive transport simulations will be developed and the potential CO2-brine-mineral interactions will be examined. Simulations will focus on identifying potential reactive minerals as well as the corresponding rate and extent of reactions. The spatial distribution and accessibility of minerals to reactive fluids is critical to understanding mineral reaction rates and corresponding changes in the pore structure, including pore connectivity, porosity and permeability. The nature of the pore-mineral interface, and distribution of reactive minerals, will be determined through imaging analysis. Multiple 2D scanning electron microscopy (SEM) backscattered electron (BSE) images and energy dispersive x-ray spectroscopy (EDS) images will be used to create spatial maps of mineral distributions. These maps will be processed to evaluate the accessibility of reactive minerals and the potential for flow-path modifications following CO2 injection. The "Establishing an Early CO2 Storage Complex in Kemper, MS" project is funded by the U.S. Department of Energy's National Energy Technology Laboratory and cost-sharing partners.
Ramírez-Luzuriaga, María J; Unar-Munguía, Mishel; Rodríguez-Ramírez, Sonia; Rivera, Juan A; González de Cosío, Teresa
2016-01-01
Inadequate complementary feeding partially explains micronutrient deficiencies in the first 2 y of life. To prevent malnutrition, the Mexican government implemented the Programa de Apoyo Alimentario (PAL), which transferred either food baskets containing micronutrient-fortified milk and animal food products or cash to beneficiary families along with educational sessions. This study evaluated the impact of PAL on 2 indicators of complementary feeding: minimum dietary diversity and consumption of iron-rich or iron-fortified foods in children aged 6-23 mo. A secondary analysis of the original PAL evaluation design was conducted through a randomized community trial implemented with 3 intervention groups (food basket with education, food basket without education, and cash transfer with education) and a control. The impact of PAL after 14 mo of exposure was estimated in 2 cross-sectional groups of children aged 6-23 mo at baseline and at follow-up in a panel of 145 communities by using difference-in-difference models. Only children who lived in households and communities that were similar between treatment groups at baseline were included in the analysis. These children were identified by using a propensity score. Of the 3 intervention groups, when compared with the control, only the food basket without education group component increased the consumption of iron-rich or iron-fortified foods by 31.2 percentage points (PP) (P < 0.01) and the prevalence of minimum dietary diversity by 21.6 PP (P < 0.01). These findings suggest that in order to improve dietary quality in children, food baskets that include fortified complementary foods may be more effective than cash transfers. The fact that the 2 food basket groups differed in the observed impact does not allow for more convincing conclusions to be made about the education component of the program. This trial was registered at clinicaltrials.gov as NCT01304888. © 2016 American Society for Nutrition.
Customized Assessment Group Initiative: A Complementary Approach to Students' Learning
ERIC Educational Resources Information Center
Akindayomi, Akinloye
2015-01-01
This study, conducted in a US setting, examines the importance of group dynamics that emphasize cooperative team building through the proposed grouping strategy called Customized Assessment Group Initiative (CAGI). CAGI is a student grouping strategy designed to operationalize the mutual accountability concept central to the definition of teams by…
2011-01-01
Background Childhood undernutrition is prevalent in low and middle income countries. It is an important indirect cause of child mortality in these countries. According to an estimate, stunting (height for age Z score < -2) and wasting (weight for height Z score < -2) along with intrauterine growth restriction are responsible for about 2.1 million deaths worldwide in children < 5 years of age. This comprises 21 % of all deaths in this age group worldwide. The incidence of stunting is the highest in the first two years of life especially after six months of life when exclusive breastfeeding alone cannot fulfill the energy needs of a rapidly growing child. Complementary feeding for an infant refers to timely introduction of safe and nutritional foods in addition to breast-feeding (BF) i.e. clean and nutritionally rich additional foods introduced at about six months of infant age. Complementary feeding strategies encompass a wide variety of interventions designed to improve not only the quality and quantity of these foods but also improve the feeding behaviors. In this review, we evaluated the effectiveness of two most commonly applied strategies of complementary feeding i.e. timely provision of appropriate complementary foods (± nutritional counseling) and education to mothers about practices of complementary feeding on growth. Recommendations have been made for input to the Lives Saved Tool (LiST) model by following standardized guidelines developed by Child Health Epidemiology Reference Group (CHERG). Methods We conducted a systematic review of published randomized and quasi-randomized trials on PubMed, Cochrane Library and WHO regional databases. The included studies were abstracted and graded according to study design, limitations, intervention details and outcome effects. The primary outcomes were change in weight and height during the study period among children 6-24 months of age. We hypothesized that provision of complementary food and education of mother about complementary food would significantly improve the nutritional status of the children in the intervention group compared to control. Meta-analyses were generated for change in weight and height by two methods. In the first instance, we pooled the results to get weighted mean difference (WMD) which helps to pool studies with different units of measurement and that of different duration. A second meta-analysis was conducted to get a pooled estimate in terms of actual increase in weight (kg) and length (cm) in relation to the intervention, for input into the LiST model. Results After screening 3795 titles, we selected 17 studies for inclusion in the review. The included studies evaluated the impact of provision of complementary foods (±nutritional counseling) and of nutritional counseling alone. Both these interventions were found to result in a significant increase in weight [WMD 0.34 SD, 95% CI 0.11 – 0.56 and 0.30 SD, 95 % CI 0.05-0.54 respectively) and linear growth [WMD 0.26 SD, 95 % CI 0.08-0.43 and 0.21 SD, 95 % CI 0.01-0.41 respectively]. Pooled results for actual increase in weight in kilograms and length in centimeters showed that provision of appropriate complementary foods (±nutritional counseling) resulted in an extra gain of 0.25kg (±0.18) in weight and 0.54 cm (±0.38) in height in children aged 6-24 months. The overall quality grades for these estimates were that of ‘moderate’ level. These estimates have been recommended for inclusion in the Lives Saved Tool (LiST) model. Education of mother about complementary feeding led to an extra weight gain of 0.30 kg (±0.26) and a gain of 0.49 cm (±0.50) in height in the intervention group compared to control. These estimates had been recommended for inclusion in the LiST model with an overall quality grade assessment of ‘moderate’ level. Conclusion Provision of appropriate complementary food, with or without nutritional education, and maternal nutritional counseling alone lead to significant increase in weight and height in children 6-24 months of age. These interventions can significantly reduce the risk of stunting in developing countries and are recommended for inclusion in the LiST tool. PMID:21501443
Intervention strength does not differentially affect memory reconsolidation of strong memories.
van Schie, Kevin; van Veen, Suzanne C; Hendriks, Yanniek R; van den Hout, Marcel A; Engelhard, Iris M
2017-10-01
Recently, it has become clear that retrieval (i.e., reactivation) of consolidated memories may return these memories into a labile state before they are restored into long-term memory ('reconsolidation'). Using behavioral manipulations, reactivated memories can be disrupted via the mechanism of novel learning. In the present study, we investigated whether changing a strong memory during reconsolidation depends on the strength of novel learning. To test this, participants (N=144) in six groups acquired a relatively strong memory on Day 1 by viewing and recalling a series of pictures three times. On Day 8, these pictures were reactivated in three groups, and they were not reactivated in the other three groups. Then, participants viewed and recalled new pictures once (weak new learning) or three times (strong new learning), or they did not learn any new pictures. On Day 9, participants performed a recognition test in which their memory for Day 1 pictures was assessed. Two main results are noted. First, the groups that reactivated pictures from Day 1 and received weak or strong new learning did not differ in memory performance. Second, these two groups consistently performed similar to groups that controlled for new learning without reactivation. Because these results contradict what was expected based on the reconsolidation hypothesis, we discuss possible explanations and implications. Copyright © 2017 Elsevier Inc. All rights reserved.
Level of C - reactive protein as an indicator for prognosis of premature uterine contractions.
Najat Nakishbandy, Bayar M; Barawi, Sabat A M
2014-01-01
high concentrations of maternal C-reactive protein have been associated with adverse pregnancy outcome, and premature uterine contraction may be predicted by elevated levels of C-reactive protein. This may ultimately be simple and cost-effective enough to introduce as a low-risk screening program. an observational case control study was performed from May 1st, 2010 to December 1st, 2010 at Maternity Teaching Hospital-Erbil/ Kurdistan Region/ Iraq. The sample size was (200) cases. Hundred of them were presented with premature uterine contractions at 24(+0)-36(+6) weeks. The other hundred were control group at same gestational ages. The level of C-reactive protein was determined in both groups and both groups were followed till delivery. (93) out of (100) women with premature uterine contractions had elevated level of C-Reactive protein and 91% delivered prematurely while in the control group only (9) out of (100) women had elevated level of C-reactive protein and only 8% of them delivered preterm. Differences were statistically highly significant. C-reactive protein can be used as a biomarker in prediction of premature delivery when it is associated with premature uterine contractions. As well it can be used as a screening test to detect cases that are at risk of premature delivery.
Evaluation of a complementary cyber education program for a pathophysiology class.
Yoo, Ji-Soo; Ryue, Sook-Hee; Lee, Jung Eun; Ahn, Jeong-Ah
2009-12-01
The goal of this study was to develop and evaluate a complementary cyber education program for a required pathophysiology class for nursing students. The cyber education program comprised electronic bulletin boards, correspondence material storage, an announcement section, a report submission section, reference sites, and statistics on learning rates. Twelve online lectures complemented five lectures in the classroom. To evaluate the course's educational effectiveness, we performed an online objective questionnaire and an open questionnaire survey anonymously, and compared the complementary cyber education program with traditional classroom education. The complementary cyber education program effected significant improvements in scores for importance with regard to major, clarity of goals and education plans for courses, professor readiness, preciseness and description of lectures, amount and efficiency of assignments, and fairness in appraisal standards compared with the traditional classroom education group. This study indicates that a complementary cyber education program provides nursing students with the flexibility of time and space, the newest information through updated lectures, efficient motivational aids through intimacy between the lecturer and students, and concrete and meaningful tasks. The complementary cyber education course also increased student effort toward studying and student satisfaction with the class.
Chen, Z Y; Li, D L; Duan, X D; Peng, D Z
2016-09-20
To investigate the changes of proliferative activity and reactive oxygen species level of human epidermal cell line HaCaT after being irradiated with low-energy 633 nm red light. Irradiation distance was determined through preliminary experiment. HaCaT cells were conventionally sub-cultured with RPMI 1640 culture medium containing 10% fetal calf serum, 100 U/mL penicillin, and 100 μg/mL streptomycin. Cells of the third passage were used in the following experiments. (1) Cells were divided into blank control group and 0.082, 0.164, 0.245, 0.491, 1.472, 2.453, 4.910, and 9.810 J/cm(2) irradiation groups according to the random number table, with 3 wells in each group. Cells in blank control group were not irradiated, while cells in the latter 8 irradiation groups were irradiated with 633 nm red light for 10, 20, 30, 60, 180, 300, 600, and 1 200 s in turn. Cells were reirradiated once every 8 hours. After being irradiated for 48 hours (6 times) in irradiation groups, the proliferative activity of cells in 9 groups was determined with cell counting kit 8 and microplate reader (denoted as absorbance value). (2) Another batch of cells were grouped and irradiated as in experiment (1). After being irradiated for once in irradiation groups, cells in 9 groups were conventionally cultured for 60 min with detection reagent of reactive oxygen species. At post culture minute (PCM) 0 (immediately), 30, 60, and 120, reactive oxygen species level of cells was determined with microplate reader (denoted as absorbance value). (3) Another batch of cells were divided into blank control group, 0.082, 0.491, 2.453, and 9.810 J/cm(2) irradiation groups, and positive control group. Cells in blank control group and positive control group were not irradiated (positive control reagent of reactive oxygen species was added to cells in positive control group), and cells in irradiation groups were irradiated as in experiment (1) for once. The expression of reactive oxygen species in cells of each group was observed by confocal laser scanning microscope. Data were processed with one-way analysis of variance, analysis of variance for repeated measurement, and t test. (1) Irradiation distance was 10 cm. Proliferative activity of cells in blank control group and 0.082, 0.164, 0.245, 0.491, 1.472, 2.453, 4.910, and 9.810 J/cm(2) irradiation groups was 1.000, 1.116±0.031, 1.146±0.016, 1.162±0.041, 1.179±0.016, 1.207±0.016, 1.247±0.040, 1.097±0.059, and 0.951±0.118, respectively. Compared with that in blank control group, proliferative activity of cells in 0.082-2.453 J/cm(2) irradiation groups was significantly higher (with t values from -22.803 to -6.779, P values below 0.05). Proliferative activity of cells in 4.910 and 9.810 J/cm(2) irradiation groups was similar to that in blank control group (with t values respectively -2.854 and 0.711, P values above 0.05). (2) Compared with that in blank control group, reactive oxygen species level of cells was significantly enhanced at PCM 0 and 30 in 0.164-2.453 J/cm(2) irradiation groups (with t values from -12.453 to -4.684, P<0.05 or P<0.01), while that showed no significant change in 0.082, 4.910, and 9.810 J/cm(2) irradiation groups (with t values from -3.925 to -0.672, P values above 0.05). Compared with that in blank control group, reactive oxygen species level of cells was significantly enhanced at PCM 60 in 0.082-2.453 J/cm(2) irradiation groups (with t values from -11.387 to -4.717, P<0.05 or P<0.01). Compared with that in blank control group, reactive oxygen species level of cells was significantly enhanced at PCM 120 in 0.491-2.453 J/cm(2) irradiation groups (with t values from -10.657 to -6.644, P<0.05 or P<0.01). (3) Compared with that in blank control group, the expression of reactive oxygen species of cells was increased in 0.082, 0.491, and 2.453 J/cm(2) irradiation groups and positive control group. The expression of reactive oxygen species of cells in 9.810 J/cm(2) irradiation group was attenuated when compared with the expressions in the other irradiation groups. Reactive oxygen species expressed in mitochondria of cells in each group. Low-energy 633 nm red light can enhance the proliferation of human epidermal cell line HaCaT, and the effect is closely related to the increase of reactive oxygen species produced by mitochondria after being stimulated by red light irradiation.
Modeling of central reactivity worth measurements in Lady Godiva
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wenz, T.R.; Busch, R.D.
The central reactivity worth measurements performed in Lady Godiva were duplicated using TWODANT, a deterministic neutron transport code, and the 16-group Hansen-Roach cross-section library. The purpose of this work was to determine how well the Hansen-Roach library predicts the reactivity worths for a fast neutron system. Lady Godiva is a spherical uranium metal (93.7 wt% [sup 235]U) critical assembly with a neutron flux distribution dominant in the first five groups of the Hansen-Roach energy structure (0.1 MeV and up). Provided that the cross sections of the replacement material do not undergo large variations (less than an order of magnitude) inmore » any of the aforementioned groups, the calculated reactivities were within 10% of the experimental values. For cases where the reactivities were outside this range, a large variation in the cross section was found to exist in one of the groups, which was not fully accounted for in the Hansen-Roach group structure. However, even in the cases where the agreement between calculation and experiment was not good, the calculated reactivity appeared to be an extremum in that the effect was found to be either more negative or more positive than the experimental value.« less
González De León, Joenice; González Méndez, Ricardo; Cadilla, Carmen L; Rivera-Mariani, Félix E; Bolaños-Rosero, Benjamín
2018-01-01
Aspergillus penicillioides is a very common indoor xerophilic fungus and potential causative agent of respiratory conditions. Although people are constantly exposed to A. penicillioides, no proteins with allergenic potential have been described. Therefore, we aim to confirm allergic sensitization to A. penicillioides through reactivity in serological assays and detect immunoglobulin E (IgE)-binding proteins. In an indirect ELISA, we compared the serological reactivity to A. penicillioides between subjects with specific IgE (sIgE) (group 1, n = 54) and no sIgE reactivity (group 2, n = 15) against commercial allergens. Correlations and principal component analysis were performed to identify associations between reactivity to commercial allergens and A. penicillioides. IgE-binding proteins in A. penicillioides were visualized using Western blotting (WB) in group 1. The IgE-binding proteins with the highest reactivity were analyzed by mass spectrometry and confirmed by transcript matching. There was no statistical significance (p = 0.1656) between the study groups in serological reactivity. Correlations between reactivity to A. penicillioides, dog epithelia, Aspergillus fumigatus, and Penicillium chrysogenum were observed. WB experiments showed 6 IgE-binding proteins with molecular weights ranging from 45 to 145 kDa. Proteins of 108, 83, and 56 kDa showed higher reactivity. Mass spectrometry analysis of these 3 proteins led to the putative identification of NADP-specific glutamate dehydrogenase and catalase B. This was confirmed with transcriptome analysis. These results provide evidence of the presence of potential allergenic components in A. penicillioides. Further analysis of the putatively identified proteins should reveal their allergenic potential. © 2018 S. Karger AG, Basel.
Reactive heart rate variability in male patients with first-episode major depressive disorder.
Liang, Chih-Sung; Lee, Jia-Fu; Chen, Chia-Chi; Chang, Yue-Cune
2015-01-02
The association between cardiovascular reactivity and major depressive disorder (MDD) remains unclear. This study aimed to examine this association via reactive heart rate variability (HRV) in a well-diagnosed first-episode MDD group and a control group. A total of 160 physically healthy, drug-naive patients presenting with their first-episode MDD and 50 healthy controls were recruited. All participants underwent a 5-min electrocardiography at rest and during a mental arithmetic task. Depression severity was assessed using the Beck Depression Inventory II (BDI). HRV measures that showed between-group differences at rest did not reached significance during mental stress. In contrast, HRV measures that revealed between-group differences during stress did not reach significance at rest. In response to mental stress, HRV measures did not significantly change in both group. However, LF and HF in response to stress were different between groups. Patients with MDD revealed an increasing trend in HF and a decreasing trend in LF; conversely, healthy controls had a decreasing trend in HF and an increasing trend in LF. BDI scores correlated with changes in heart rate in the control group. The fundamental change to reactive HRV in patients with first-episode MDD appears qualitative, not quantitative. A distinctly reverse trend in reactive HRV measures were evident between these two groups. Moreover, patients with MDD showed entirely distinct changes in reactive HRV from those in resting HRV. We suggest that in patients with MDD, autonomic system shifts to sympathetic dominance at rest but toward parasympathetic dominance in response to stress. Copyright © 2014 Elsevier Inc. All rights reserved.
Lopez-Duran, Nestor L; Mayer, Stefanie E; Abelson, James L
2014-07-01
In this report, we present growth curve modeling (GCM) with landmark registration as an alternative statistical approach for the analysis of time series cortisol data. This approach addresses an often-ignored but critical source of variability in salivary cortisol analyses: individual and group differences in the time latency of post-stress peak concentrations. It allows for the simultaneous examination of cortisol changes before and after the peak while controlling for timing differences, and thus provides additional information that can help elucidate group differences in the underlying biological processes (e.g., intensity of response, regulatory capacity). We tested whether GCM with landmark registration is more sensitive than traditional statistical approaches (e.g., repeated measures ANOVA--rANOVA) in identifying sex differences in salivary cortisol responses to a psychosocial stressor (Trier Social Stress Test--TSST) in healthy adults (mean age 23). We used plasma ACTH measures as our "standard" and show that the new approach confirms in salivary cortisol the ACTH finding that males had longer peak latencies, higher post-stress peaks but a more intense post-peak decline. This finding would have been missed if only saliva cortisol was available and only more traditional analytic methods were used. This new approach may provide neuroendocrine researchers with a highly sensitive complementary tool to examine the dynamics of the cortisol response in a way that reduces risk of false negative findings when blood samples are not feasible.
Belcaro, G; Cesarone, M R; Dugall, M; Pellegrini, L; Ledda, A; Grossi, M G; Togni, S; Appendino, G
2010-06-01
A proprietary complex of curcumin with soy phosphatidylcholine (Meriva®, Indena SpA) was evaluated in a registry study to define its efficacy in 50 patients with osteoarthritis (OA) at dosages corresponding to 200 mg curcumin per diem. OA signs/symptoms were evaluated by the WOMAC scores. Mobility was studied by walking performance (treadmill), and inflammatory status was assessed by measurements of C-reactive protein (CRP). After three months of treatment, the global WOMAC score decreased by 58% (P<0.05), walking distance in the treadmill test was prolonged from 76 m to 332 m (P<0.05), and CRP levels decreased from 168 +/- 18 to 11.3 +/-. 4.1 mg/L in the subpopulation with high CRP. In comparison, the control group experienced only a modest improvement in these parameters (2% in the WOMAC score, from 82 m to 129 m in the treadmill test, and from 175 +/- 12.3 to 112 +/- 22.2 mg/L in the CRP plasma concentration), while the treatment costs (use of anti-inflammatory drugs, treatment and hospitalization) were reduced significantly in the treatment group. These results show that Meriva® is clinically effective in the management and treatment of osteoarthritis and suggest that the increased stability and better absorption of curcumin induced by complexation with phospholipids have clinical relevance, setting the stage for larger and more prolonged studies.
Zorn, Gilad; Castner, David G; Tyagi, Anuradha; Wang, Xin; Wang, Hui; Yan, Mingdi
2015-03-01
Perfluorophenylazide (PFPA) chemistry is a novel method for tailoring the surface properties of solid surfaces and nanoparticles. It is general and versatile, and has proven to be an efficient way to immobilize graphene, proteins, carbohydrates, and synthetic polymers. The main thrust of this work is to provide a detailed investigation on the chemical composition and surface density of the PFPA tailored surface. Specifically, gold surfaces were treated with PFPA-derivatized (11-mercaptoundecyl)tetra(ethylene glycol) (PFPA-MUTEG) mixed with 2-[2-(2-mercaptoethoxy)ethoxy]ethanol (MDEG) at varying solution mole ratios. Complementary analytical techniques were employed to characterize the resulting films including Fourier transform infrared spectroscopy to detect fingerprints of the PFPA group, x-ray photoelectron spectroscopy and ellipsometry to study the homogeneity and uniformity of the films, and near edge x-ray absorption fine structures to study the electronic and chemical structure of the PFPA groups. Results from these studies show that the films prepared from 90:10 and 80:20 PFPA-MUTEG/MDEG mixed solutions exhibited the highest surface density of PFPA and the most homogeneous coverage on the surface. A functional assay using surface plasmon resonance with carbohydrates covalently immobilized onto the PFPA-modified surfaces showed the highest binding affinity for lectin on the PFPA-MUTEG/MDEG film prepared from a 90:10 solution.
Cladder-Micus, M B; van Aalderen, J; Donders, A R T; Spijker, J; Vrijsen, J N; Speckens, A E M
2018-03-01
Major depressive disorder is a prevalent condition with high relapse rates. There is evidence that cognitive reactivity is an important vulnerability factor for the recurrence of depression. Mindfulness-based interventions are designed to reduce relapse rates, with cognitive reactivity as one of the proposed working mechanisms. In a randomised controlled trial we compared the effect of mindfulness-based cognitive therapy (MBCT) with treatment-as-usual (TAU) on cognitive reactivity in recurrently depressed patients (N = 115). Depressive symptoms, cognitive reactivity, and mindfulness skills were assessed pre and post treatment. Patients in the MBCT group reported a significantly greater reduction in cognitive reactivity than those in the TAU group (d = .51). The reduction of cognitive reactivity appeared to mediate the association between MBCT/TAU and decrease of depressive symptoms, using pre and post scores. The current study provides evidence that MBCT reduces cognitive reactivity and preliminary evidence that cognitive reactivity is a working mechanism of MBCT.
Interface Engineering to Create a Strong Spin Filter Contact to Silicon
Caspers, C.; Gloskovskii, A.; Gorgoi, M.; Besson, C.; Luysberg, M.; Rushchanskii, K. Z.; Ležaić, M.; Fadley, C. S.; Drube, W.; Müller, M.
2016-01-01
Integrating epitaxial and ferromagnetic Europium Oxide (EuO) directly on silicon is a perfect route to enrich silicon nanotechnology with spin filter functionality. To date, the inherent chemical reactivity between EuO and Si has prevented a heteroepitaxial integration without significant contaminations of the interface with Eu silicides and Si oxides. We present a solution to this long-standing problem by applying two complementary passivation techniques for the reactive EuO/Si interface: (i) an in situ hydrogen-Si (001) passivation and (ii) the application of oxygen-protective Eu monolayers–without using any additional buffer layers. By careful chemical depth profiling of the oxide-semiconductor interface via hard x-ray photoemission spectroscopy, we show how to systematically minimize both Eu silicide and Si oxide formation to the sub-monolayer regime–and how to ultimately interface-engineer chemically clean, heteroepitaxial and ferromagnetic EuO/Si (001) in order to create a strong spin filter contact to silicon. PMID:26975515
Integrative Health and Healing as the New Health Care Paradigm for the Military
2015-01-01
Abstract Background: The field of integrative health and healing (IH2) is emerging out of the dark recesses of “voodoo” stereotypes and into the light as a new and much needed health care paradigm. It is a philosophy of health and healing that seeks to place patients as the preeminent players in health management, disease prevention, and injury recovery. There is an emphasis of patient responsibility, which includes a holistic approach that merges allopathic with complementary medicine. Objective: The aim of this article is to explore the historical origins of integrative medicine and investigate the future role of the IH2 paradigm. Methods: This article reviews current available data and information regarding complementary and alternative medicine utilized in civilian and military populations as the basis for a new paradigm for a system of care—a system that empowers patients. Conclusions: The current U.S. health care system is reactive and disease-based, with a focus on reductionism. This system is not serving us well. IH2 is a new model of cost-effective patient-centered health care. PMID:26543516
Hydroxylation of organic polymer surface: method and application.
Yang, Peng; Yang, Wantai
2014-03-26
It may be hardly believable that inert C-H bonds on a polymeric material surface could be quickly and efficiently transformed into C-OH by a simple and mild way. Thanks to the approaches developed recently, it is now possible to transform surface H atoms of a polymeric substrate into monolayer OH groups by a simple/mild photochemical reaction. Herein the method and application of this small-molecular interfacial chemistry is highlighted. The existence of hydroxyl groups on material surfaces not only determines the physical and chemical properties of materials but also provides effective reaction sites for postsynthetic sequential modification to fulfill the requirements of various applications. However, organic synthetic materials based on petroleum, especially polyolefins comprise mainly C and H atoms and thus present serious surface problems due to low surface energy and inertness in reactivity. These limitations make it challenging to perform postsynthetic surface sequential chemical derivatization toward enhanced functionalities and properties and also cause serious interfacial problems when bonding or integrating polymer substrates with natural or inorganic materials. Polymer surface hydroxylation based on direct conversion of C-H bonds on polymer surfaces is thus of significant importance for academic and practical industrial applications. Although highly active research results have reported on small-molecular C-H bond activation in solution (thus homogeneous), most of them, featuring the use of a variety of transition metals as catalysts, present a slow reaction rate, a low atom economy and an obvious environmental pollution. In sharp contrast to these conventional C-H activation strategies, the present Spotlight describes a universal confined photocatalytic oxidation (CPO) system that is able to directly convert polymer surface C-H bonds to C-OSO3(-) and, subsequently, to C-OH through a simple hydrolysis. Generally speaking, these newly implanted hydroxyl groups preserve their own reactivity toward other complementary compounds, thus creating a novel base with distinct surface properties. Thanks to this functionalized platform, a wide range of organic, inorganic and metal materials have been attached to conventional organic polymer substrates through the rational engineering of surface molecular templates from small functional groups to macromolecules. It is expected that the proposed novel CPO method and its versatile usages in advanced material applications will offer new opportunities for a variety of scientific communities, especially for those working on surface/interface modulation.
Processable Polyimides Containing APB and Reactive End Caps
NASA Technical Reports Server (NTRS)
Jensen, Brian J.
2003-01-01
Imide copolymers that contain 1,3- bis(3-aminophenoxy)benzene (APB) and other diamines and dianhydrides and that are terminated with appropriate amounts of reactive end caps have been invented. The reactive end caps investigated thus far include 4-phenylethynyl phthalic anhydride (PEPA), 3- aminophenoxy-4-phenylethynylbenzop henone (3-APEB), maleic anhydride (MA), and 5-norbornene-2,3-dicarboxylic anhydride [also known as nadic anhydride (NA)]. The advantage of these copolyimides terminated with reactive groups, relative to other polyimides terminated with reactive groups, is a combination of (1) higher values of desired mechanical-property parameters and (2) greater ease of processing into useful parts.
... this page: //medlineplus.gov/ency/article/000440.htm Reactive arthritis To use the sharing features on this page, please enable JavaScript. Reactive arthritis is a group of conditions that may ...
Matyas, Gary R; Rice, Kenner C; Cheng, Kejun; Li, Fuying; Antoline, Joshua F G; Iyer, Malliga R; Jacobson, Arthur E; Mayorov, Alexander V; Beck, Zoltan; Torres, Oscar B; Alving, Carl R
2014-03-14
Novel synthetic compounds similar to heroin and its major active metabolites, 6-acetylmorphine and morphine, were examined as potential surrogate haptens for the ability to interface with the immune system for a heroin vaccine. Recent studies have suggested that heroin-like haptens must degrade hydrolytically to induce independent immune responses both to heroin and to the metabolites, resulting in antisera containing mixtures of antibodies (type 2 cross-reactivity). To test this concept, two unique hydrolytically stable haptens were created based on presumed structural facial similarities to heroin or to its active metabolites. After conjugation of a heroin-like hapten (DiAmHap) to tetanus toxoid and mixing with liposomes containing monophosphoryl lipid A, high titers of antibodies after two injections in mice had complementary binding sites that exhibited strong type 1 ("true") specific cross-reactivity with heroin and with both of its physiologically active metabolites. Mice immunized with each surrogate hapten exhibited reduced antinociceptive effects caused by injection of heroin. This approach obviates the need to create hydrolytically unstable synthetic heroin-like compounds to induce independent immune responses to heroin and its active metabolites for vaccine development. Facial recognition of hydrolytically stable surrogate haptens by antibodies together with type 1 cross-reactivities with heroin and its metabolites can help to guide synthetic chemical strategies for efficient development of a heroin vaccine. Copyright © 2014. Published by Elsevier Ltd.
Matyas, Gary R.; Rice, Kenner C.; Cheng, Kejun; Li, Fuying; Antoline, Joshua F. G.; Iyer, Malliga R.; Jacobson, Arthur E.; Mayorov, Alexander V.; Beck, Zoltan; Torres, Oscar; Alving, Carl R.
2014-01-01
Novel synthetic compounds similar to heroin and its major active metabolites, 6-acetylmorphine and morphine, were examined as potential surrogate haptens for the ability to interface with the immune system for a heroin vaccine. Recent studies have suggested that heroin-like haptens must degrade hydrolytically to induce independent immune responses both to heroin and to the metabolites, resulting in antisera containing mixtures of antibodies (type 2 cross-reactivity). To test this concept, two unique hydrolytically stable haptens were created based on presumed structural facial similarities to heroin or to its active metabolites. After conjugation of a heroin-like hapten (DiAmHap) to tetanus toxoid and mixing with liposomes containing monophosphoryl lipid A, high titers of antibodies after two injections in mice had complementary binding sites that exhibited strong type 1 (“true”) specific cross-reactivity with heroin and with both of its physiologically active metabolites. Mice immunized with each surrogate hapten exhibited reduced antinociceptive effects caused by injection of heroin. This approach obviates the need to create hydrolytically unstable synthetic heroin-like compounds to induce independent immune responses to heroin and its active metabolites for vaccine development. Facial recognition of hydrolytically stable surrogate haptens by antibodies together with type 1 cross-reactivities with heroin and its metabolites can help to guide synthetic chemical strategies for efficient development of a heroin vaccine. PMID:24486371
Martirez, John Mark P; Carter, Emily A
2016-02-23
The Haber-Bosch process for NH3 synthesis is arguably one of the greatest inventions of the 20th century, with a massive footprint in agriculture and, historically, warfare. Current catalysts for this reaction use Fe for N2 activation, conducted at high temperatures and pressures to improve conversion rate and efficiency. A recent finding shows that plasmonic metal nanoparticles can either generate highly reactive electrons and holes or induce resonant surface excitations through plasmonic decay, which catalyze dissociation and redox reactions under mild conditions. It is therefore appealing to consider AuM (M = Fe, Co, Ni, and Mo) alloys to combine the strongly plasmonic nature of Au and the catalytic nature of M metals toward N2 dissociation, which together might facilitate ammonia production. To this end, through density functional theory, we (i) explore the feasibility of forming these surface alloys, (ii) find a pathway that may stabilize/deactivate surface M substituents during fabrication, and (iii) define a complementary route to reactivate them under operational conditions. Finally, we evaluate their reactivity toward N2, as well as their ability to support a pathway for N2 dissociation with a low thermodynamic barrier. We find that AuFe possesses similar appealing qualities, including relative stability with respect to phase separation, reversibility of Fe oxidation and reduction, and reactivity toward N2. While AuMo achieves the best affinity toward N2, its strong propensity toward oxidation could greatly limit its use.
RF Magnetron Sputtering Deposited W/Ti Thin Film For Smart Window Applications
NASA Astrophysics Data System (ADS)
Oksuz, Lutfi; Kiristi, Melek; Bozduman, Ferhat; Uygun Oksuz, Aysegul
2014-10-01
Electrochromic (EC) devices can change reversible and persistent their optical properties in the visible region (400-800 nm) upon charge insertion/extraction according to the applied voltage. A complementary type EC is a device containing two electrochromic layers, one of which is anodically colored such as vanadium oxide (V2 O5) while the other cathodically colored such as tungsten oxide (WO3) which is separated by an ionic conduction layer (electrolyte). The use of a solid electrolyte such as Nafion eliminates the need for containment of the liquid electrolyte, which simplifies the cell design, as well as improves safety and durability. In this work, the EC device was fabricated on a ITO/glass slide. The WO3-TiO2 thin film was deposited by reactive RF magnetron sputtering using a 2-in W/Ti (9:1%wt) target with purity of 99.9% in a mixture gas of argon and oxygen. As a counter electrode layer, V2O5 film was deposited on an ITO/glass substrate using V2O3 target with the same conditions of reactive RF magnetron sputtering. Modified Nafion was used as an electrolyte to complete EC device. The transmittance spectra of the complementary EC device was measured by optical spectrophotometry when a voltage of +/-3 V was applied to the EC device by computer controlled system. The surface morphology of the films was characterized by scanning electron microscopy (SEM) and atomic force microscopy (AFM) (Fig. 2). The cyclic voltammetry (CV) for EC device was performed by sweeping the potential between +/-3 V at a scan rate of 50 mV/s.
Wu, Shouhai; Zhang, Tianpeng; Du, Jingsheng
2016-01-01
Background Combinations of adjuvant sensitizers with anticancer drugs is a promising new strategy to reverse chemoresistance. Ursolic acid (UA) is one of the natural pentacyclic triterpene compounds known to have many pharmacological characteristics such as anti-inflammatory and anticancer properties. This study investigates whether UA can sensitize hepatocellular carcinoma cells to cisplatin. Materials and methods Cells were transfected with nuclear factor erythroid-2-related factor 2 (Nrf2) small interfering RNA and Nrf2 complementary DNA by using Lipofectin 2000. The cytotoxicity of cells was investigated by Cell Counting Kit 8 assay. Cell apoptosis, cell cycle, reactive oxygen species, and mitochondrial membrane potential were detected by flow cytometry fluorescence-activated cell sorting. The protein level of Nrf2, NAD(P)H quinone oxidoreductase 1 (NQO1), glutathione S-transferase (GST), and heme oxygenase-1 (HO-1) was detected by Western blot analysis. Results The results showed that the reverse index was 2.9- and 9.69-fold by UA of 1.125 μg/mL and 2.25 μg/mL, respectively, for cisplatin to HepG2/DDP cells. UA–cisplatin combination induced cell apoptosis and reactive oxygen species, blocked the cell cycle in G0/G1 phase, and reduced the mitochondrial membrane potential. Mechanistically, UA–cisplatin dramatically decreased the expression of Nrf2 and its downstream genes. The sensibilization of UA–cisplatin combination was diminished in Nrf2 small interfering RNA-transfected HepG2/DDP cells, as well as in Nrf2 complementary DNA-transfected HepG2/DDP cells. Conclusion The results confirmed the sensibilization of UA on HepG2/DDP cells to cisplatin, which was possibly mediated via the Nrf2/antioxidant response element pathway. PMID:27822011
Arikpo, Dachi; Edet, Ededet Sewanu; Chibuzor, Moriam T; Odey, Friday; Caldwell, Deborah M
2018-05-18
Although complementary feeding is a universal practice, the methods and manner in which it is practiced vary between cultures, individuals and socioeconomic classes. The period of complementary feeding is a critical time of transition in the life of an infant, and inappropriate complementary feeding practices, with their associated adverse health consequences, remain a significant global public health problem. Educational interventions are widely acknowledged as effective in promoting public health strategy, and those aimed at improving complementary feeding practices provide information about proper complementary feeding practices to caregivers of infants/children. It is therefore important to summarise evidence on the effectiveness of educational interventions to improve the complementary feeding practices of caregivers of infants. To assess the effectiveness of educational interventions for improving the complementary feeding (weaning) practices of primary caregivers of children of complementary feeding age, and related health and growth outcomes in infants. In November 2017, we searched CENTRAL, MEDLINE, Embase, 10 other databases and two trials registers. We also searched the reference lists of relevant studies and reviews to identify any additional studies. We did not limit the searches by date, language or publication status. Randomised controlled trials (RCTs), comparing educational interventions to no intervention, usual practice, or educational interventions provided in conjunction with another intervention, so long as the educational intervention was only available in the experimental group and the adjunctive intervention was available to the control group. Study participants included caregivers of infants aged 4 to 24 months undergoing complementary feeding. Pregnant women who were expected to give birth and commence complementary feeding during the period of the study were also included. Two review authors independently extracted data on participants, settings, interventions, methodology and outcomes using a specifically-developed and piloted data extraction form. We calculated risk ratios (RR) and 95% confidence intervals (CIs) for dichotomous data, and mean differences (MD) and 95% CIs for continuous data. Where data permitted, we conducted a meta-analysis using a random-effects model. We assessed the included studies for risk of bias and also assessed the quality of evidence using the GRADE approach. We included 23 studies (from 35 reports) with a total of 11,170 caregiver-infant pairs who were randomly assigned to receive an educational intervention delivered to the caregiver or usual care. Nineteen of the included studies were community-based studies while four were facility-based studies. In addition, 13 of the included studies were cluster-randomised while the others were individually randomised. Generally, the interventions were focused on the introduction of complementary feeding at the appropriate time, the types and amount of complementary foods to be fed to infants, and hygiene. Using the GRADE criteria, we assessed the quality of the evidence as moderate, mostly due to inadequate allocation concealment and insufficient blinding.Educational interventions led to improvements in complementary feeding practices for age at introduction of complementary foods (average RR 0.88, 95% CI 0.83 to 0.94; 4 studies, 1738 children; moderate-quality evidence) and hygiene practices (average RR 1.38, 95% CI 1.23 to 1.55; 4 studies, 2029 participants; moderate-quality evidence). For duration of exclusive breastfeeding, pooled results were compatible with both a reduction and an increase in the outcome (average RR 1.58, 95% CI 0.77 to 3.22; 3 studies, 1544 children; very low-quality evidence). There was limited (low to very low-quality) evidence of an effect for all growth outcomes.Quality of evidenceThere is moderate to very low-quality evidence that educational interventions can improve complementary feeding practices but insufficient evidence to conclude that it impacts growth outcomes. Overall, we found evidence that education improves complementary feeding practices.
Kvammen, Janne A; Thomassen, Rut A; Eskerud, Mari B; Rugtveit, Jarle; Henriksen, Christine
2018-05-01
To study micronutrient status and nutritional intake from complementary feeding in children on a cows' milk exclusion (CME) diet. Fifty-seven children with cows' milk allergy, younger than 2 years, were included in a cross-sectional study. Blood was analyzed for micronutrient status. Complementary feeding was defined as all solids and liquids except of breast milk, and assessed by 3-day food diary. The results were analyzed according to 3 feeding patterns: mainly breast-fed (mBF), partially breast-fed, and no breast milk group (nBM). The children had a median age of 9 months and micronutrient status was within normal range for total homocysteine (p-tHcy), s-B12, s-folate, b-Hb, s-ferritin, s-zinc, and s-25(OH)D. There were no significant differences between feedings groups, except for B12-biomarkers. The mBF had higher p-tHcy (P < 0.000) and lower s-B12 (P = 0.002) compared nBM. Vitamin B12 deficiency (p-tHcy >6.5 μmol/L combined with s-B12 <250 pmol/L) was found in 12% of participants, most frequently among the mBF (36%) and none in nBM group (P = 0.009). Vitamin B12 intake from complementary feeding was negatively correlated with p-tHcy (r = -0.479, P = 0.001) and positively with s-B12 (r = 0.410, P = 0.003). Iron deficiency anemia was found in 5%. Iron intake correlated positively with b-Hb (r = 0.324, P = 0.02). Zinc deficiency was found in 7% and low 25(OH)D in 9%. Vitamin D intake was positively correlated with the use of supplements (r = 0.456, P = 0.001). The risk of B12 deficiency was high in mBF infants on CME diet, and complementary feeding was associated with better B12 status. Iron, zinc, and vitamin D deficiencies were present in all feeding groups. Complementary feeding should be introduced at 4 to 6 months of age. Vitamin D supplement is recommended to ensure adequate intake.
Kerbrat, P; Lhommé, C; Fervers, B; Guastalla, J P; Thomas, L; Basuyau, J P; Duvillard, P; Cohen-Solal, C; Dauplat, J; Tournemaine, N
2000-12-09
Suprapubic and transvaginal pelvic ultrasound exploration is indicated for suspected ovarian tumor (standard). Diagnosis and search for extension require surgery and pathology examination. Systematic preoperative computed tomography is not recommended (standard). Surgery for cancer of the ovary is a specialized procedure requiring skill in cancer, gynecology, visceral surgery and laparoscopic surgery. If the patient is referred to a specialized center after a primary procedure considered to be inadequate, a new procedure is recommended for staging. Residual tumor volume after the primary procedure has prognostic value. Systematic second look procedures are not recommended for routine practice (standard). For patients with grade IA G1 tumors, there is no indication for complementary treatment (standard). For patients with grade IA G2-3 or clear cell tumors, IB, IC, IIA, there is no standard. no complementary treatment, complementary chemotherapy using platinum, complementary external abdominopelvic radiotherapy. A complementary treatment is recommended for grades IC and IIA. Complementary treatment for grades IIB (no residual tissue), IIC (with residual tissue), III (no residual tissue), is based on: complementary chemotherapy with platinium, complementary external abdominopelvic radiotherapy (options). Complementary treatment for advanced forms (IIB (with residual tissue), IIC (with residual tissue), III (with residual tissue) and IV) is based on polychemotherapy with platinium (standard). platinium combined with paclitaxel (intravenous), platinium combined with cyclophosphamide and/or doxorubicin (intravenous) or intraperitoneal cisplatin combined with cyclophosphamide (intravenous). The chemotherapy work-up includes physical examination, assay of serum markers (particularly CA125) and abdominopelvic computed tomography (proof level B) (standard). Physical examination is recommended for monitoring patients in complete remission with no sign of suspected recurrence (standard). This document was reviewed in April 1977. The working group again validated the Standards, OPTIONS and Recommendations, without modifications in June 1999.
Turci, Francesco; Corazzari, Ingrid; Alberto, Gabriele; Martra, Gianmario; Fubini, Bice
2015-05-01
Lunar dust toxicity has to be evaluated in view of future manned missions to the Moon. Previous studies on lunar specimens and simulated dusts have revealed an oxidant activity assigned to HO· release. However, the mechanisms behind the reactivity of lunar dust are still quite unclear at the molecular level. In the present study, a complementary set of tests--including terephthalate (TA) hydroxylation, free radical release as measured by means of the spin-trapping/electron paramagnetic resonance (EPR) technique, and cell-free lipoperoxidation--is proposed to investigate the reactions induced by the fine fraction of a lunar dust analogue (JSC-1A-vf) in biologically relevant experimental environments. Our study proved that JSC-1A-vf is able to hydroxylate TA also in anaerobic conditions, which indicates that molecular oxygen is not involved in such a reaction. Spin-trapping/EPR measures showed that the HO· radical is not the reactive intermediate involved in the oxidative potential of JSC-1A-vf. A surface reactivity implying a redox cycle of phosphate-complexed iron via a Fe(IV) state is proposed. The role of this iron species was investigated by assessing the reactivity of JSC-1A-vf toward hydrogen peroxide (Fenton-like activity), formate ions (homolytic rupture of C-H bond), and linoleic acid (cell-free lipoperoxidation). JSC-1A-vf was active in all tests, confirming that redox centers of transition metal ions on the surface of the dust may be responsible for dust reactivity and that the TA assay may be a useful field probe to monitor the surface oxidative potential of lunar dust.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kipps, T.J.; Fong, S.; Tomhave, E.
Malignant B lymphocytes from several patients with chronic lymphocytic leukemia (CLL) were examined for reactivity with murine monoclonal antibody 17.109. This antibody, prepared against the rheumatoid factor (RF) paraprotein Sie, recognizes a cross reactive idiotype on 48% of human IgM RF paraproteins, but does not react with IgM paraproteins without RF activity or substantially with normal pooled immunoglobulin. The 17.109-reactive idiotype is a marker for a kappa III variable-region gene, designated V/sub kappa/RF, that is conserved in outbred human populations. In a limited study of 31 CLL patients, the leukemic cells from 5 of 20 patients with kappa light chain-expressingmore » CLL were recognized by the 17.109 monoclonal antibody. Despite having malignant cells specifically reactive with this antibody, patients with 17.109-positive CLL did not have elevated serum levels of circulating antibody bearing 17.109-reactive determinants. Total RNAs isolated from the CLL B lymphocytes, or from hybridomas produced by fusing the CLL cells with the WI-L2-729-HF/sub 2/ cell line, were fractionated electrophoretically and examined by blot hybridization. Under stringent hybridization conditions capable of discerning a single base-pair mismatch, RNA from the 17.109-idiotype-positive CLL cells hybridized to synthetic oligonucleotide probes corresponding to framework and complementary-determining regions in the V/sub kappa/RF gene. The high frequency of the 17.109-associated idiotype and the V/sub kappa/RF gene in CLL suggests that the disease may arise from B lymphocytes that express a restricted set of inherited immunoglobulin variable-region genes with little or no somatic mutation.« less
Homaie Rad, Enayatollah; Kavosi, Zahra; Moghadamnia, Mohammad Taghi; Arefnezhad, Masoud; Arefnezhad, Masoumeh; Felezi Nasiri, Banfashe
2017-01-01
Background: Studies have shown that people using complementary health insurances have more access to health services than others. In the present study, we aimed at finding the differences between out- of- pocket payments and health service utilizations in complementary health insurances (CHIs) users and nonusers. Methods: Propensity score matching was used to compare the 2 groups. First, confounder variables were identified, and then propensity score matching was used to compare out- of- pocket expenditures with dental, general physician, hospital inpatient, emergency services, nursing, midwifery, laboratory services, specialists and rehabilitation services utilization. Results: Our results revealed no significant differences between the 2 groups in out- of- pocket health expenditures. Also, the specialist visits, inpatient services at the hospital, and dental services were higher in people who used CHIs compared to nonusers. Conclusion: People did not change their budget share for health care services after using CHIs. The payments were equal for people who were not CHIs users due to the increase in the quantity of the services.
[Gradual effects of therapeutic touch in reducing anxiety in university students].
Gomes, Vanessa Miranda; Silva, Maria Júlia Paes da; Araújo, Eutália Aparecida Cândido
2008-01-01
This is quantitative research conducted with 42 students of a public university using the Therapeutic Touch - Krieger-Kunz Method and the application of a questionnaire validated in Brazil to assess anxiety in three sessions. Subjects were divided into two groups: experimental (1), in which the complementary therapy was used; and control (2), in which a mock of the technique, with no therapeutic intention, was applied. The objective was to identify the gradual influence of that health complementary therapy upon the students' state of anxiety. The analysis of the data showed a statistically significant reduction of the state of anxiety in both groups, with pd' 0.05.
Stress Reactivity in Insomnia.
Gehrman, Philip R; Hall, Martica; Barilla, Holly; Buysse, Daniel; Perlis, Michael; Gooneratne, Nalaka; Ross, Richard J
2016-01-01
This study examined whether individuals with primary insomnia (PI) are more reactive to stress than good sleepers (GS). PI and GS (n = 20 per group), matched on gender and age, completed three nights of polysomnography. On the stress night, participants received a mild electric shock and were told they could receive additional shocks during the night. Saliva samples were obtained for analysis of cortisol and alpha amylase along with self-report and visual analog scales (VAS). There was very little evidence of increased stress on the stress night, compared to the baseline night. There was also no evidence of greater stress reactivity in the PI group for any sleep or for salivary measures. In the GS group, stress reactivity measured by VAS scales was positively associated with an increase in sleep latency in the experimental night on exploratory analyses. Individuals with PI did not show greater stress reactivity compared to GS.
Toner, Brandy M; German, Christopher R; Dick, Gregory J; Breier, John A
2016-01-19
The reactivity and mobility of natural particles in aquatic systems have wide ranging implications for the functioning of Earth surface systems. Particles in the ocean are biologically and chemically reactive, mobile, and complex in composition. The chemical composition of marine particles is thought to be central to understanding processes that convert globally relevant elements, such as C and Fe, among forms with varying bioavailability and mobility in the ocean. The analytical tools needed to measure the complex chemistry of natural particles are the subject of this Account. We describe how a suite of complementary synchrotron radiation instruments with nano- and micrometer focusing, and X-ray absorption spectroscopy (XAS) and X-ray diffraction (XRD) capabilities are changing our understanding of deep-ocean chemistry and life. Submarine venting along mid-ocean ridges creates hydrothermal plumes where dynamic particle-forming reactions occur as vent fluids mix with deep-ocean waters. Whether plumes are net sources or sinks of elements in ocean budgets depends in large part on particle formation, reactivity, and transport properties. Hydrothermal plume particles have been shown to host microbial communities and exhibit complex size distributions, aggregation behavior, and composition. X-ray microscope and microprobe instruments can address particle size and aggregation, but their true strength is in measuring chemical composition. Plume particles comprise a stunning array of inorganic and organic phases, from single-crystal sulfides to poorly ordered nanophases and polymeric organic matrices to microbial cells. X-ray microscopes and X-ray microprobes with elemental imaging, XAS, and XRD capabilities are ideal for investigating these complex materials because they can (1) measure the chemistry of organic and inorganic constituents in complex matrices, usually within the same particle or aggregate, (2) provide strong signal-to-noise data with exceedingly small amounts of material, (3) simplify the chemical complexity of particles or sets of particles with a focused-beam, providing spatial resolution over 6 orders of magnitude (nanometer to millimeter), (4) provide elemental specificity for elements in the soft-, tender-, and hard-X-ray energies, (5) switch rapidly among elements of interest, and (6) function in the presence of water and gases. Synchrotron derived data sets are discussed in the context of important advances in deep-ocean technology, sample handling and preservation, molecular microbiology, and coupled physical-chemical-biological modeling. Particle chemistry, size, and morphology are all important in determining whether particles are reactive with dissolved constituents, provide substrates for microbial respiration and growth, and are delivered to marine sediments or dispersed by deep-ocean currents.
Limited mouth opening in oral submucous fibrosis: reasons, ramifications, and remedies.
Sharma, Mohit; Radhakrishnan, Raghu
2017-07-01
Limited mouth opening (LMO) in oral submucous fibrosis (OSF) has been attributed to both the submucosal and muscle fibrosis (MF). While reflectory trismus was proposed before as an auxiliary mechanism by another group, the stretch-mediated muscle damage (MSD), histopathological changes in blood vessels (such as endothelial dysfunction, endothelial hypertrophy, and endarteritis obliterans), and upregulated anaerobic isoforms of lactate dehydrogenase (LDH) have been proposed by us as complementary events leading to MF. Additionally, the amount of hypoxia-mediated upregulation of anaerobic isoforms of LDH determines the extent of MF. Radiotherapy (RT)-mediated release of reactive oxygen species causes vascular damage thereby worsening hypoxia. While the alteration in LDH levels secondary to hypoxia enhances fibrosis, RT worsens it. Oral squamous cell carcinoma occurring in the background of OSF is an absolute contraindication for RT as it augurs unfavorable prognosis. An algorithm to demonstrate this with evidence is clearly depicted. The role of HIF-1α in the progression of OSF and its malignant transformation, and the consideration of hyperbaric oxygen therapy as a therapeutic remedy in OSF are underscored. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Crystal structure of a gammadelta T-cell receptor specific for the human MHC class I homolog MICA.
Xu, Bin; Pizarro, Juan C; Holmes, Margaret A; McBeth, Christine; Groh, Veronika; Spies, Thomas; Strong, Roland K
2011-02-08
γδ T cells play important roles in bridging innate and adaptive immunity, but their recognition mechanisms remain poorly understood. Human γδ T cells of the V(δ)1 subset predominate in intestinal epithelia and respond to MICA and MICB (MHC class I chain-related, A and B; MIC) self-antigens, mediating responses to tumorigenesis or viral infection. The crystal structure of an MIC-reactive V(δ)1 γδ T-cell receptor (TCR) showed expected overall structural homology to antibodies, αβ, and other γδ TCRs, but complementary determining region conformations and conservation of V(δ)1 use revealed an uncharacteristically flat potential binding surface. MIC, likewise, serves as a ligand for the activating immunoreceptor natural killer group 2, D (NKG2D), also expressed on γδ T cells. Although MIC recognition drives both the TCR-dependent stimulatory and NKG2D-dependent costimulatory signals necessary for activation, interaction analyses showed that MIC binding by the two receptors was mutually exclusive. Analysis of relative binding kinetics suggested sequential recognition, defining constraints for the temporal organization of γδ T-cell/target cell interfaces.
Adolescent pedometer protocols: examining reactivity, tampering and participants' perceptions.
Scott, Joseph John; Morgan, Philip James; Plotnikoff, Ronald Cyril; Trost, Stewart Graeme; Lubans, David Revalds
2014-01-01
The aim of this study was to investigate adolescents' potential reactivity and tampering while wearing pedometers by comparing different monitoring protocols to accelerometer output. The sample included adolescents (N = 123, age range = 14-15 years) from three secondary schools in New South Wales, Australia. Schools were randomised to one of the three pedometer monitoring protocols: (i) daily sealed (DS) pedometer group, (ii) unsealed (US) pedometer group or (iii) weekly sealed (WS) pedometer group. Participants wore pedometers (Yamax Digi-Walker CW700, Yamax Corporation, Kumamoto City, Japan) and accelerometers (Actigraph GT3X+, Pensacola, USA) simultaneously for seven days. Repeated measures analysis of variance was used to examine potential reactivity. Bivariate correlations between step counts and accelerometer output were calculated to explore potential tampering. The correlation between accelerometer output and pedometer steps/day was strongest among participants in the WS group (r = 0.82, P ≤ 0.001), compared to the US (r = 0.63, P ≤ 0.001) and DS (r = 0.16, P = 0.324) groups. The DS (P ≤ 0.001) and US (P = 0.003), but not the WS (P = 0.891), groups showed evidence of reactivity. The results suggest that reactivity and tampering does occur in adolescents and contrary to existing research, pedometer monitoring protocols may influence participant behaviour.
Glinz, Dominik; Wegmüller, Rita; Ouattara, Mamadou; Diakité, Victorine G; Aaron, Grant J; Hofer, Lorenz; Zimmermann, Michael B; Adiossan, Lukas G; Utzinger, Jürg; N'Goran, Eliézer K; Hurrell, Richard F
2017-07-14
Iron deficiency anemia (IDA) is a major public health problem in sub-Saharan Africa. The efficacy of iron fortification against IDA is uncertain in malaria-endemic settings. The objective of this study was to evaluate the efficacy of a complementary food (CF) fortified with sodium iron EDTA (NaFeEDTA) plus either ferrous fumarate (FeFum) or ferric pyrophosphate (FePP) to combat IDA in preschool-age children in a highly malaria endemic region. This is a secondary analysis of a nine-month cluster-randomized controlled trial conducted in south-central Côte d'Ivoire. 378 children aged 12-36 months were randomly assigned to no food intervention ( n = 125; control group), CF fortified with 2 mg NaFeEDTA plus 3.8 mg FeFum for six days/week ( n = 126; FeFum group), and CF fortified with 2 mg NaFeEDTA and 3.8 mg FePP for six days/week ( n = 127; FePP group). The outcome measures were hemoglobin (Hb), plasma ferritin (PF), iron deficiency (PF < 30 μg/L), and anemia (Hb < 11.0 g/dL). Data were analyzed with random-effect models and PF was adjusted for inflammation. The prevalence of Plasmodium falciparum infection and inflammation during the study were 44-66%, and 57-76%, respectively. There was a significant time by treatment interaction on IDA ( p = 0.028) and a borderline significant time by treatment interaction on iron deficiency with or without anemia ( p = 0.068). IDA prevalence sharply decreased in the FeFum (32.8% to 1.2%, p < 0.001) and FePP group (23.6% to 3.4%, p < 0.001). However, there was no significant time by treatment interaction on Hb or total anemia. These data indicate that, despite the high endemicity of malaria and elevated inflammation biomarkers (C-reactive protein or α-1-acid-glycoprotein), IDA was markedly reduced by provision of iron fortified CF to preschool-age children for 9 months, with no significant differences between a combination of NaFeEDTA with FeFum or NaFeEDTA with FePP. However, there was no overall effect on anemia, suggesting most of the anemia in this setting is not due to ID. This trial is registered at clinicaltrials.gov (NCT01634945).
[Alternative and complementary medicine from the primary care physician's viewpoint].
Soós, Sándor Árpád; Eőry, Ajándék; Eőry, Ajándok; Harsányi, László; Kalabay, László
2015-07-12
The patients initiate the use of complementary and alternative medicine and this often remains hidden from their primary care physician. To explore general practitioners' knowledge and attitude towards complementary and alternative medicine, and study the need and appropriate forms of education, as well as ask their opinion on integration of alternative medicine into mainstream medicine. A voluntary anonymous questionnaire was used on two conferences for general practitioners organized by the Family Medicine Department of Semmelweis University. Complementary and alternative medicine was defined by the definition of the Hungarian Academy of Sciences and certified modalities were all listed. 194 general practitioners answered the questionnaire (39.8% response rate). 14% of the responders had licence in at least one of the complementary and alternative therapies, 45% used complementary and alternative therapy in their family in case of illness. It was the opinion of the majority (91.8%) that it was necessary to be familiar with every method used by their patients, however, 82.5% claimed not to have enough knowledge in complementary medicine. Graduate and postgraduate education in the field was thought to be necessary by 86% of the responders; increased odds for commitment in personal education was found among female general practitioners, less than 20 years professional experience and personal experience of alternative medicine. These data suggest that general practitioners would like to know more about complementary and alternative medicine modalities used by their patients. They consider education of medical professionals necessary and a special group is willing to undergo further education in the field.
Gustafson, Gwen E; Bisson, Jennifer B; MacDonald, Jillian M; Green, James A
2017-09-13
Different populations of adults (experienced vs. inexperienced caregivers, men vs. women, abusive vs. nonabusive parents, etc.) have been reported to differ in their affective reactions to the sounds of infant crying. These differences are thought to impact caregiving behavior and, in some instances, to affect long-term outcomes for infants. There can be great intra-group variation, however, even when group differences are significant; modeling developmental process will require a finer grained approach. We have undertaken a pair of studies intended to validate the Negative Affect Scale (NA) from the PANAS as a measure of individuals' affective reactivity to cry sounds. In Study 1, 306 young women who were not yet mothers listened either to infant crying or to birdsong. The results supported the NA as a measure of reactivity to crying. In Study 2, a new sample of 301 young women listened to crying in a screening task; a group of "high reactors" (n=21) and a group of "low reactors" (n=22) then participated in a simulated caregiving situation. Individuals' affective reactivity to the caregiving simulation mirrored their affective reactivity in the screening task, and rates and overall organization of caregiving behavior differed between the groups. Changes in negative affect, then, appear to be both a result of infant crying and a determinant of some aspects of caregiving behavior. Further studies will extend these laboratory results to real infants and their caregivers, and further validate the NA as a measure of individual differences in reactivity to cry sounds. Copyright © 2017 Elsevier Inc. All rights reserved.
Reactive carriers of immobilized compounds.
Coupek, J; Labský, J; Kálal, J; Turková, J; Valentová, O
1977-04-12
Sphericanl macroporous reactive carriers capable of forming covalent bonds with amino acids and proteins were prepared by the suspension copolymerization of 2-hydroxyethyl methacrylate, ethylene dimethacrylate and p-nitrophenyl esters of methacrylic acid and methacryloyl derivatives of glycine, beta-alanine and epsilon-aminocaproic acid. The effect of the spacer length, pH and the type of the buffer used, concentration of reactive groups in the copolymer, concentration of the ligand and the participation of the hydrolytic and aminolytic reaction of p-nitrophenyl functional groups in the attachment of glycine, D,L-phenylalanine and serumalbumin was studied. Macroporous copolymers containing reactive functional groups can be used as active enzyme carriers, if their activity is not blocked by the presence of p-nitrophenol split off in the attachment reaction.
Naves, Joao Helder Frederico de Faria; Rezende, Lais M; Ramos, Gabriel C; Soares, Pollyanna M; Tavares, Tatiane C F; França, Andre M S; Neves, Saira M N; Silva, Natascha A M; Lima-Ribeiro, Anna M C
2012-03-01
The aim of the current study was to verify if cattle vaccinated against leptospirosis may react in diagnostic tests for brucellosis. Sixty cows were divided into 5 groups, each comprising 12 animals. Four groups were given different vaccines against leptospirosis, while the control group received only saline. Two doses of vaccine were given, as recommended by the manufacturers. Serum samples were collected on the first day of immunization (day 0) and on postvaccination days 7, 14, 21, 28, 35, 42, 49, 56, 96, and 126. All the serum samples were tested for brucellosis and leptospirosis. Twenty animals were reactive at least once to the Rose Bengal test, but by day 96, no further reactions were elicited by this test. Twenty-six samples were reactive to the Rose Bengal test, but only 7 remained positive in confirmatory tests: 1 to the 2-mercaptoethanol test, 2 to the fluorescence polarization assay, and 6 to indirect enzyme-linked immunosorbent assays. None of the samples was reactive in the complement fixation test. None of the animals in the control group was reactive. A significant difference was found between the control group and the groups vaccinated against leptospirosis, according to Fisher exact test. However, the groups were found to respond independently of the vaccine brand. The results indicate that cattle vaccinated against leptospirosis may show reactivity on screening tests for brucellosis.
Differentiation of individual selves facilitates group-level benefits of ultrasociality.
Ainsworth, Sarah E; Baumeister, Roy F; Vohs, Kathleen D
2016-01-01
Gowdy & Krall's target article complements our recent theorizing on group behavior. In our comment, we elucidate complementary aspects of the two theories and highlight the importance of differentiation of selves for human groups to reap the benefits of ultrasociality. We propose that achieving optimal group outcomes depends on the differentiation of individual selves.
Guerra-Mora, J R; Perales-Caldera, E; Aguilar-León, D; Nava-Sanchez, C; Díaz-Cruz, A; Díaz-Martínez, N E; Santillán-Doherty, P; Torres-Villalobos, G; Bravo-Reyna, C C
Lung ischemia-reperfusion injury is characterized by formation of reactive oxygen species and cellular swelling leading to pulmonary edema and primary graft dysfunction. Phosphodiesterase 5 inhibitors could ameliorate lung ischemia-reperfusion injury by interfering in many molecular pathways. The aim of this work was to evaluate and compare the effects of sildenafil and tadalafil on edema and reactive oxygen species formation in an ex vivo nonhuman animal model of lung ischemia-reperfusion injury. Thirty-two Wistar rats were distributed, treated, perfused and the cardiopulmonary blocks were managed as follows: control group: immediate excision and reperfusion without pretreatment; ischemia reperfusion group: treatment with dimethylsulfoxide 0.9% and excision 1 hour later; sildenafil group: treatment with sildenafil (0.7 mg/kg) and excision 1 hour later; and tadalafil group: treatment with tadalafil (0.15 mg/kg) and excision 2 hours later. All cardiopulmonary blocks except control group were preserved for 8 hours and then reperfused. Pulmonary arterial pressure, pulmonary venous pressure, and capillary filtration coefficient were measured. Reactive oxygen species were measured. Edema was similar between control and sildenafil groups, but significantly greater in the ischemia-reperfusion (P ≤ .04) and tadalafil (P ≤ .003) groups compared with the sildenafil group. The malondialdehyde levels were significantly lower in the sildenafil (P ≤ .001) and tadalafil (P ≤ .001) groups than the ischemia-reperfusion group. Administration of sildenafil, but not tadalafil, decreased edema in lung ischemia-reperfusion injury. Both drugs decreased reactive oxygen species formation in a lung ischemia-reperfusion injury model. Copyright © 2017 Elsevier Inc. All rights reserved.
NASA Technical Reports Server (NTRS)
Weber, Arthur L.
2003-01-01
The rates of thermal transformation of organic molecules containing carbon, hydrogen, and oxygen were systematically examined in order to identify the kinetic constraints that governed origin-of-life organic chemistry under mild aqueous conditions. Arrhenius plots of the kinetic data were used to estimate the reaction half-life at 50 C, and to reveal the effect of functional groups on reactivity. This survey showed that hydrocarbons and organic substances containing a single oxygenated group were kinetically the most stable (i. e. acetate decarboxylation half-life was l0(exp 18) years at 50 C); whereas, organic substances containing two oxygenated groups in which one group was a beta-positioned carbonyl group were the most reactive (i. e. acetoacetate decarboxylation half-life was l0(exp-2) years at 50 C). Of all functional groups the beta-positioned carbonyl group (aldehyde or ketone) was the strongest activating group, giving rates of reaction that were up to 10(exp 24)-times faster than rates of similar molecules lacking the beta-carbonyl group. From this knowledge of organic reactivity and the inherent constraints of autocatalytic processes, we concluded that an origins-of-life process based on autocatalytic transformation of C,H,O-substrates was constrained to using the most reactive organic molecules that contain alpha- or beta-carbonyl groups, since small autocatalytic domains of plausible catalytic power that used less reactive substrates could not carry out chemical transformations fast enough to prevent catastrophic efflux (escape) of reaction intermediates. Knowledge of the kinetics of organic transformations is useful, not only in constraining the chemistry of the earliest autocatalytic process related to the origin of life, but also in establishing the relative reactivity of organic molecules on the early Earth and other planets that may or may not be related to the origin of life.
Sugar, Elizabeth A.; Brown, Robert H.; Drye, Lea T.; Irvin, Charles G.; Schwartz, Alan R.; Tepper, Robert S.; Wise, Robert A.; Yasin, Razan Z.; Busk, Michael F.
2016-01-01
Rationale: Studies have demonstrated that application of stress suppresses airway smooth muscle contractility. In animal models of asthma, continuous positive airway pressure (CPAP) reduced airway reactivity. Short-term studies of CPAP in patients with asthma showed reductions in airway reactivity. Objectives: To evaluate whether nocturnal CPAP decreased the provocative concentration of methacholine to reduce FEV1 by 20% (PC20). Methods: One hundred ninety-four individuals with asthma were randomized (1:1:1) to use CPAP with warmed, filtered, humidified air at night at pressures either less than 1 cm H2O (sham) or at 5 cm H2O or 10 cm H2O. The primary outcome was change in PC20 after 12 weeks. Measurements and Main Results: Adherence to CPAP was low in all groups. Regardless, all groups had a significant improvement in PC20, with 12 weeks/baseline PC20 ratios of 2.12, 1.73, and 1.78 for the sham, 5 cm H2O, and 10 cm H2O groups, respectively, and no significant differences between the active and sham groups. Changes in FEV1 and exhaled nitric oxide were minimal in all groups. The sham group had larger improvements in most patient-reported outcomes measuring asthma symptoms and quality of life, as well as sinus symptoms, than the 5 cm H2O group. The 10 cm H2O group showed similar but less consistent improvements in scores, which were not different from improvements in the sham group. Conclusions: Adherence to nocturnal CPAP was low. There was no evidence to support positive pressure as being effective for reducing airway reactivity in people with well-controlled asthma. Regardless, airway reactivity was improved in all groups, which may represent an effect of participating in a study and/or an effect of warm, humid, filtered air on airway reactivity. Clinical trial registered with www.clinicaltrials.gov (NCT01629823). PMID:27398992
2017-01-01
The specificity of O-methylisourea (OMIU) to bind to the ε-amino group of Lys, an important supposition for the OMIU-reactive Lys analysis of foods, feeds, ingredients, and digesta, was investigated. Crystalline l-Lys incubated under standard conditions with OMIU resulted in low homoarginine recoveries. The reaction of OMIU with the α-amino group of Lys was confirmed by MS analysis, with double derivatized Lys being identified. None of the changes in reaction conditions (OMIU pH, OMIU to Lys ratio, and reaction time) with crystalline l-Lys resulted in 100% recovery of homoarginine. The average free Lys content in ileal digesta of growing pigs and broilers was found to be 13% of total Lys, which could result in a significant underestimation of the reactive Lys content. The reaction of OMIU with α-amino groups may necessitate analysis of free Lys to accurately quantify reactive lysine in samples containing a large proportion of Lys with a free α-amino group. PMID:28059513
Hulshof, Tetske G; Rutherfurd, Shane M; Sforza, Stefano; Bikker, Paul; van der Poel, Antonius F B; Hendriks, Wouter H
2017-02-01
The specificity of O-methylisourea (OMIU) to bind to the ε-amino group of Lys, an important supposition for the OMIU-reactive Lys analysis of foods, feeds, ingredients, and digesta, was investigated. Crystalline l-Lys incubated under standard conditions with OMIU resulted in low homoarginine recoveries. The reaction of OMIU with the α-amino group of Lys was confirmed by MS analysis, with double derivatized Lys being identified. None of the changes in reaction conditions (OMIU pH, OMIU to Lys ratio, and reaction time) with crystalline l-Lys resulted in 100% recovery of homoarginine. The average free Lys content in ileal digesta of growing pigs and broilers was found to be 13% of total Lys, which could result in a significant underestimation of the reactive Lys content. The reaction of OMIU with α-amino groups may necessitate analysis of free Lys to accurately quantify reactive lysine in samples containing a large proportion of Lys with a free α-amino group.
Results of single burr hole drainage for acute subdural hematoma with non-reactive pupil.
Yanagawa, Youichi; Sakamoto, Toshihisa
2012-01-01
To investigate the effects of emergency burr hole drainage for acute subdural hematoma (ASDH) with bilateral non-reactive pupils. A retrospective study was conducted by reviewing medical records from 1998 to 2007. Patients meeting the following criteria were included: 1) head injury with unconsciousness (Glasgow Coma Scale score 8); 2) bilateral non-reactive pupils on arrival; 3) ASDH with disappearance of basal cistern on computed tomography (CT); and 4) performance of emergency single burr hole drainage. Subjects were divided into survival and non-survival groups. Pupil size on the small side was significantly smaller in the survival group than in the non-survival group. All pupils on the small side in the survival group were 4 mm. Emergency burr hole drainage should still be considered in patients with ASDH showing bilateral non-reactive pupils and one pupil 4 mm.
Bentil, Helena Joycelyn; Steiner-Asiedu, Matilda; Lartey, Anna
2016-01-01
Several studies have been done on infant feeding practices but few have focused on twins. The aim of this study was to compare the complementary feeding practices between mothers with twins and mothers with singletons. Mother-infant pairs (50 mother-twin pairs and 50 mother-singleton pairs) with children aged 6 to 23 months were recruited from two public health clinics and communities in Tema and Ashaiman. Information was collected on the background characteristics of the mothers. Recumbent length and weight of the children were measured. Dietary information on the infants was collected using 24 hour recall. The differences between two groups were tested using independent t-student test for continuous variables and chi-square test for categorical variables. The minimum dietary diversity (4+ food groups) was met by only 32% of the twins and 40% of the singletons, and 28% of the twins and 38% of the singletons met the requirement for minimum acceptable diet (minimum dietary diversity and the minimum meal frequency). Minimum meal frequency was met by 78% of the twins and 76% of the singletons. There were no significant differences between the two groups of infants. Prevalence of undernutrition was not significantly different among the two groups (twins versus singletons: underweight-26% versus 24%, stunting-20% versus 24% and wasting-14% versus 10%. Complementary feeding practices were suboptimal in both groups of mothers requiring interventions to improve infant feeding practices.
Hagen, Bas; Ali, Sara; Overkleeft, Herman S; van der Marel, Gijsbert A; Codée, Jeroen D C
2017-01-20
The synthesis of complex oligosaccharides is often hindered by a lack of knowledge on the reactivity and selectivity of their constituent building blocks. We investigated the reactivity and selectivity of 2-azidofucosyl (FucN 3 ) donors, valuable synthons in the synthesis of 2-acetamido-2-deoxyfucose (FucNAc) containing oligosaccharides. Six FucN 3 donors, bearing benzyl, benzoyl, or tert-butyldimethylsilyl protecting groups at the C3-O and C4-O positions, were synthesized, and their reactivity was assessed in a series of glycosylations using acceptors of varying nucleophilicity and size. It was found that more reactive nucleophiles and electron-withdrawing benzoyl groups on the donor favor the formation of β-glycosides, while poorly reactive nucleophiles and electron-donating protecting groups on the donor favor α-glycosidic bond formation. Low-temperature NMR activation studies of Bn- and Bz-protected donors revealed the formation of covalent FucN 3 triflates and oxosulfonium triflates. From these results, a mechanistic explanation is offered in which more reactive acceptors preferentially react via an S N 2-like pathway, while less reactive acceptors react via an S N 1-like pathway. The knowledge obtained in this reactivity study was then applied in the construction of α-FucN 3 linkages relevant to bacterial saccharides. Finally, a modular synthesis of the Staphylococcus aureus type 5 capsular polysaccharide repeating unit, a trisaccharide consisting of two FucNAc units, is described.
Wigman, J T W; van Os, J; Borsboom, D; Wardenaar, K J; Epskamp, S; Klippel, A; Viechtbauer, W; Myin-Germeys, I; Wichers, M
2015-08-01
It has been suggested that the structure of psychopathology is best described as a complex network of components that interact in dynamic ways. The goal of the present paper was to examine the concept of psychopathology from a network perspective, combining complementary top-down and bottom-up approaches using momentary assessment techniques. A pooled Experience Sampling Method (ESM) dataset of three groups (individuals with a diagnosis of depression, psychotic disorder or no diagnosis) was used (pooled N = 599). The top-down approach explored the network structure of mental states across different diagnostic categories. For this purpose, networks of five momentary mental states ('cheerful', 'content', 'down', 'insecure' and 'suspicious') were compared between the three groups. The complementary bottom-up approach used principal component analysis to explore whether empirically derived network structures yield meaningful higher order clusters. Individuals with a clinical diagnosis had more strongly connected moment-to-moment network structures, especially the depressed group. This group also showed more interconnections specifically between positive and negative mental states than the psychotic group. In the bottom-up approach, all possible connections between mental states were clustered into seven main components that together captured the main characteristics of the network dynamics. Our combination of (i) comparing network structure of mental states across three diagnostically different groups and (ii) searching for trans-diagnostic network components across all pooled individuals showed that these two approaches yield different, complementary perspectives in the field of psychopathology. The network paradigm therefore may be useful to map transdiagnostic processes.
C-reactive protein and reactive oxygen metabolites in subjects with metabolic syndrome.
Kotani, K; Sakane, N
2012-01-01
This cross-sectional study investigated the correlation between diacron reactive oxygen metabolites (d-ROMs) and high-sensitivity C-reactive protein (hs-CRP) in subjects with or without metabolic syndrome. Cardiometabolic risk factors, d-ROMs and hs-CRP were determined in 457 women: 123 with metabolic syndrome and 334 without metabolic syndrome. The correlation between d-ROMs and hs-CRP levels was compared between the two groups. The group with metabolic syndrome had significantly higher d-ROMs and hs-CRP levels than the group without metabolic syndrome. While the d-ROMs level was significantly and positively correlated with the hs-CRP level in both groups, the correlation level between the two groups was significantly different. Multiple linear regression analysis adjusted for other cardiometabolic risk factors also showed significant positive correlation between dROMs and hs-CRP levels in both groups. Subjects with metabolic syndrome may have a closer relationship between inflammation and oxidative stress than subjects without metabolic syndrome, possibly reflecting their increased predisposition to atherosclerosis. Further studies are necessary to confirm the observed relationship.
Shiban, Youssef; Brütting, Johanna; Pauli, Paul; Mühlberger, Andreas
2015-03-01
The current study is the first to examine whether reactivation of fear memory prior to exposure therapy reduces relapse in a randomized clinical sample. In a standardized treatment protocol combining virtual reality and in-vivo exposure, patients underwent a fear reactivation procedure using a virtual spider 10 min prior to a virtual reality (VR) exposure (reactivation group: RG, n = 15). A control group (CG, n = 17) was exposed to a virtual plant 10 min prior to the VR exposure. Outcome measures were a VR spontaneous recovery test (SRT) and in-vivo a behavioral avoidance test assessed 24 h after VR exposure. One week later an in-vivo exposure session followed. Additionally, a follow-up using psychometric assessment was conducted six months after the first session. Both groups benefitted significantly and equally from the combined treatment, and importantly, the SRT revealed no return of fear in both groups. Furthermore, follow-up tests showed long-term treatment effects with no group differences. Due to different study components (VR treatment and in-vivo), we were not able to determine which treatment module was mainly responsible for the long-term treatment effect. Furthermore, no direct measure of memory destabilization was possible in this study. Our treatment package was highly effective in reducing phobic fear up to 6 months following treatment. Explicit fear reactivation prior to exposure was not beneficial in VR exposure treatment, possibly due to a failure to induce a memory destabilization or due to an implicit fear reactivation prior to treatment in both groups.
Postocclusive reactive hyperemia in hand-arm vibration syndrome.
Stoyneva, Zlatka
2016-01-01
To assess laser Doppler-recorded postocclusive reactive hyperemic responses in vibration-induced Raynaud's phenomenon and compare it with primary and secondary to sclerodermy Raynaud's phenomenon. Thirty patients with vibration-induced Raynaud's phenomenon and 30 healthy controls and patients with primary and secondary to sclerodermy Raynaud's phenomenon were investigated. Fingerpulp skin blood flow was monitored by laser Doppler flowmetry during postocclusive reactive hyperemia test. Lower initial perfusion values were established in all the patients with Raynaud's phenomenon compared to the healthy controls (p < 0.0001). The postocclusive reactive hyperemic peak was lower in all the Raynaud's phenomenon groups compared to the controls (p < 0.0001). The postocclusive and basal perfusions were lower in the secondary Raynaud's phenomenon groups compared to the control and the primary Raynaud's phenomenon groups (p < 0.0001). The velocities to postocclusive hyperemic peak were lower in all the Raynaud's phenomenon patients (p < 0.0001), so were in the vibration-induced (p < 0.002) and the sclerodermy Raynaud's phenomenon (p < 0.004) groups in relation to the primary Raynaud's phenomenon group. The perfusion values and the velocities were significantly influenced by the initial superficial skin temperatures and perfusions, while the velocities were dependent also on gender, and the hyperemic peak on age. Postocclusive reactive hyperemia is abnormal in all Raynaud's phenomenon patients. Laser Doppler-recorded reactive hyperemia test contributes to diagnosing Raynaud's phenomenon and has proved to be valuable for group analysis. The applied method is not sensitive enough to discriminate adequately the type of Raynaud's phenomenon among individual cases. This work is available in Open Access model and licensed under a CC BY-NC 3.0 PL license.
Dail, Mary Beth; Meek, Edward Caldwell; Chambers, Howard Wayne; Chambers, Janice Elaine
2018-05-03
Novel-substituted phenoxyalkyl pyridinium oxime acetylcholinesterase (AChE) reactivators (US patent 9,227,937) that showed convincing evidence of penetration into the brains of intact rats were developed by our laboratories. The oximes separated into three groups based on their levels of brain AChE reactivation following exposure of rats to the sarin surrogate nitrophenyl isopropyl methylphosphonate (NIMP). P-glycoprotein (P-gp) is a major blood-brain barrier (BBB) transporter and requires ATP for efflux. To determine if P-gp affinity screening could be used to reduce animal use, we measured in vitro oxime-stimulated ATPase activity to see if the in vivo reactivation efficacies related to the oximes' functions as P-gp substrates. High efficacy oximes were expected to be poor P-gp substrates, thus remaining in the brain longer. The high efficacy oximes (24-35% brain AChE reactivation) were worse P-gp substrates than the low efficacy oximes (0-7% brain AChE reactivation). However, the oxime group with medium in vivo reactivation of 10-17% were even worse P-gp substrates than the high efficacy group so their reactivation ability was not reflected by P-gp export. The results suggest that in vitro P-gp ATPase activity can remove the low efficacy oximes from in vivo testing, but is not sufficient to differentiate between the top two tiers.
Prenatal Drug Exposure and Adolescent Cortisol Reactivity: Association with Behavioral Concerns.
Buckingham-Howes, Stacy; Mazza, Dayna; Wang, Yan; Granger, Douglas A; Black, Maureen M
2016-09-01
To examine stress reactivity in a sample of adolescents with prenatal drug exposure (PDE) by examining the consequences of PDE on stress-related adrenocortical reactivity, behavioral problems, and drug experimentation during adolescence. Participants (76 PDE, 61 non-drug exposed [NE]; 99% African-American; 50% male; mean age = 14.17 yr, SD = 1.17) provided a urine sample, completed a drug use questionnaire, and provided saliva samples (later assayed for cortisol) before and after a mild laboratory stress task. Caregivers completed the Behavior Assessment System for Children, Second Edition (BASC II) and reported their relationship to the adolescent. The NE group was more likely to exhibit task-related cortisol reactivity compared to the PDE group. Overall behavior problems and drug experimentation were comparable across groups with no differences between PDE and NE groups. In unadjusted mediation analyses, cortisol reactivity mediated the association between PDE and BASC II aggression scores (95% bootstrap confidence interval [CI], 0.04-4.28), externalizing problems scores (95% bootstrap CI, 0.03-4.50), and drug experimentation (95% bootstrap CI, 0.001-0.54). The associations remain with the inclusion of gender as a covariate but not when age is included. Findings support and expand current research in cortisol reactivity and PDE by demonstrating that cortisol reactivity attenuates the association between PDE and behavioral problems (aggression) and drug experimentation. If replicated, PDE may have long-lasting effects on stress-sensitive physiological mechanisms associated with behavioral problems (aggression) and drug experimentation in adolescence.
Ho, Rainbow T H; Chan, Jessie S M; Wang, Chong-Wen; Lau, Benson W M; So, Kwok Fai; Yuen, Li Ping; Sham, Jonathan S T; Chan, Cecilia L W
2012-10-01
Chronic fatigue is common in the general population. Complementary therapies are often used by patients with chronic fatigue or chronic fatigue syndrome to manage their symptoms. This study aimed to assess the effect of a 4-month qigong intervention program among patients with chronic fatigue or chronic fatigue syndrome. Sixty-four participants were randomly assigned to either an intervention group or a wait list control group. Outcome measures included fatigue symptoms, physical functioning, mental functioning, and telomerase activity. Fatigue symptoms and mental functioning were significantly improved in the qigong group compared to controls. Telomerase activity increased in the qigong group from 0.102 to 0.178 arbitrary units (p < 0.05). The change was statistically significant when compared to the control group (p < 0.05). Qigong exercise may be used as an alternative and complementary therapy or rehabilitative program for chronic fatigue and chronic fatigue syndrome.
Gupta, Bharat; Patil, Neha; Yadav, Manoj; Tripathi, Shashank; Sinha, Saurabh; Sharma, Saurabh; Gupta, Saurabh
2015-01-01
Background Periodontitis can be defined as a local inflammatory process which mediates destruction of periodontal tissues & is triggered by bacterial insult. In periodontal infections, the levels of C reactive proteins are elevated as compared to the levels in a periodontally healthy individual. The study was done to determine the relative levels of serum CRP in aggressive, chronic and periodontally healthy subjects and to evaluate the effect of surgical periodontal therapy on serum C-reactive protein levels. Materials and Methods Serum samples were collected from 150 participants (50 healthy control patients (non-periodontitis), 50 patients with chronic periodontitis and aggressive periodontitis. Serum C- reactive protein levels were assessed by means of immunoturbidimetric assay at baseline for subjects in all the 3 groups and 3 months after completion of surgical therapy. Results The mean baseline C-reactive protein (CRP) concentrations in the Groups I, II and III were 1.65±0.57 mg/L, 3.03±2.14 mg/L and 3.09±2.27 mg/L respectively. After treatment, the mean C-reactive protein (CRP) levels in Groups II and III reduced from 3.03±1.67 mg/L to 1.46±1.67 mg/L and from 3.09±1.21 to 1.43±1.21 mg/L respectively. Similar results were found for probing depth and all indexes in Group II and III after treatment. Also, the mean attachment loss in Groups II and III reduced, so the results were highly significant. Conclusion Successful periodontal treatment results in significant decrease in serum C-reactive protein (CRP) levels in otherwise healthy subjects. PMID:26557605
Evaluation of molecular basis of cross reactivity between rye and Bermuda grass pollen allergens.
Tiwari, Ruby; Bhalla, Prem L; Singh, Mohan B
2009-12-01
Allergenic cross reactivity between the members of the Pooids (Lolium perenne, Phleum pratense, and Poa pratensis) and Chloridoids (Cynodon dactylon and Paspalum notatum) is well established. Studies using crude extracts in the past have demonstrated limited cross reactivity between the Pooids and the Chloridoids suggesting separate diagnosis and therapy. However, little is known regarding the molecular basis for the limited cross reactivity observed between the 2 groups of grasses. The present study was undertaken to gain insights into the molecular basis of cross allergenicity between the major allergens from rye and Bermuda grass pollens. Immunoblot inhibition tests were carried out to determine the specificity of the proteins involved in cross reactivity. Crude pollen extract and bacterially expressed and purified recombinant Lol p 1and Lol p 5 from rye grass were subjected to cross inhibition experiments with crude and purified recombinant Cyn d 1 from Bermuda grass using sera from patients allergic to rye grass pollen. The immunoblot inhibition studies revealed a high degree of cross inhibition between the group 1 allergens. In contrast, a complete lack of inhibition was observed between Bermuda grass group 1 allergen rCyn d 1, and rye grass group 5 allergen rLol p 5. Crude rye grass extract strongly inhibited IgE reactivity to Bermuda grass, whereas crude Bermuda grass pollen extract showed a weaker inhibition. Our data suggests that a possible explanation for the limited cross reactivity between the Pooids and Chloridoids may, in part, be due to the absence of group 5 allergen from Chloridoid grasses. This approach of using purified proteins may be applied to better characterize the cross allergenicity patterns between different grass pollen allergens.
Ghafari, Somayeh; Ahmadi, Fazlolah; Nabavi, Masoud; Anoshirvan, Kazemnejad; Memarian, Robabe; Rafatbakhsh, Mohamad
2009-08-01
To identify the effects of applying Progressive Muscle Relaxation Technique on Quality of Life of patients with multiple Sclerosis. In view of the growing caring options in Multiple Sclerosis, improvement of quality of life has become increasingly relevant as a caring intervention. Complementary therapies are widely used by multiple sclerosis patients and Progressive Muscle Relaxation Technique is a form of complementary therapies. Quasi-experimental study. Multiple Sclerosis patients (n = 66) were selected with no probability sampling then assigned to experimental and control groups (33 patients in each group). Means of data collection included: Individual Information Questionnaire, SF-8 Health Survey, Self-reported checklist. PMRT performed for 63 sessions by experimental group during two months but no intervention was done for control group. Statistical analysis was done by SPSS software. Student t-test showed that there was no significant difference between two groups in mean scores of health-related quality of life before the study but this test showed a significant difference between two groups, one and two months after intervention (p < 0.05). anova test with repeated measurements showed that there is a significant difference in mean score of whole and dimensions of health-related quality of life between two groups in three times (p < 0.05). Although this study provides modest support for the effectiveness of Progressive Muscle Relaxation Technique on quality of life of multiple sclerosis patients, further research is required to determine better methods to promote quality of life of patients suffer multiple sclerosis and other chronic disease. Progressive Muscle Relaxation Technique is practically feasible and is associated with increase of life quality of multiple sclerosis patients; so that health professionals need to update their knowledge about complementary therapies.
Effects of a prevention program for divorced families on youth cortisol reactivity 15 years later.
Luecken, Linda J; Hagan, Melissa J; Mahrer, Nicole E; Wolchik, Sharlene A; Sandler, Irwin N; Tein, Jenn-Yun
2015-01-01
We examined whether an empirically based, randomised controlled trial of a preventive intervention for divorced mothers and children had a long-term impact on offspring cortisol regulation. Divorced mothers and children (age 9-12) were randomly assigned to a literature control condition or the 11-week New Beginnings Program, a family-focused group preventive intervention for mothers and children in newly divorced families. Fifteen years after the trial, offspring salivary cortisol (n = 161) was measured before and after a social stress task. Multilevel mixed models were used to predict cortisol from internalizing symptoms, externalizing symptoms, group assignment and potential moderators of intervention effects. Across the sample, higher externalizing symptoms were associated with lower cortisol reactivity. There was a significant group-by-age interaction such that older offspring in the control group had higher reactivity relative to the intervention group, and younger offspring in the control group exhibited a decline across the task relative to younger offspring in the intervention group. Preventive interventions for youth from divorced families may have a long-term impact on cortisol reactivity to stress. Results highlight the importance of examining moderators of program effects.
Effects of a prevention program for divorced families on youth cortisol reactivity 15 years later
Luecken, Linda J.; Hagan, Melissa J.; Mahrer, Nicole E.; Wolchik, Sharlene A.; Sandler, Irwin N.; Tein, Jenn-Yun
2015-01-01
Objective We examined whether an empirically-based, randomized controlled trial of a preventive intervention for divorced mothers and children had a long-term impact on offspring cortisol regulation. Design Divorced mothers and children (age 9-12) were randomly assigned to a literature control condition or the 11-week New Beginnings Program (NBP), a family-focused group preventive intervention for mothers and children in newly divorced families. Main Outcome Measures Fifteen years after the trial, offspring salivary cortisol (n=161) was measured before and after a social stress task. Results Multilevel mixed models were used to predict cortisol from internalizing symptoms, externalizing symptoms, group assignment and potential moderators of intervention effects. Across the sample, higher externalizing symptoms were associated with lower cortisol reactivity. There was a significant group by age interaction such that older offspring in the control group had higher reactivity relative to the intervention group, and younger offspring in the control group exhibited a decline across the task relative to younger offspring in the intervention group. Conclusions Preventive interventions for youth from divorced families may have a long-term impact on cortisol reactivity to stress. Results highlight the importance of examining moderators of program effects. PMID:25367835
NASA Astrophysics Data System (ADS)
Wang, Wentao; Palui, Goutam; Ji, Xin; Aldeek, Fadi; Mattoussi, Hedi
2014-03-01
We prepared a set of multi-coordinating and reactive amphiphilic polymer ligands and used them for surface-functionalizing magnetic iron oxide nanoparticles. The amphiphilic oligomers were prepared by coupling (via one step nucleophilic addition) several dopamine anchoring groups, polyethylene glycol moieties and reactive groups onto a poly(isobutylene-alt-maleic anhydride) chain. The availability of several anchoring groups in the same ligand greatly enhances the ligand affinity to the nanoparticle surfaces, via multiplecoordination, while the hydrophilic and reactive groups promote colloidal stability in buffer media and allow subsequent conjugation to target biomolecules. The hydrophilic nanoparticles capped with these polymers maintain compact size and exhibit great long term colloidal stability.
Elevated striatal reactivity across monetary and social rewards in bipolar I disorder.
Dutra, Sunny J; Cunningham, William A; Kober, Hedy; Gruber, June
2015-11-01
Bipolar disorder (BD) is associated with increased reactivity to rewards and heightened positive affectivity. It is less clear to what extent this heightened reward sensitivity is evident across contexts and what the associated neural mechanisms might be. The present investigation used both a monetary and social incentive delay task among adults with remitted BD Type I (n = 24) and a healthy nonpsychiatric control group (HC; n = 25) using fMRI. Both whole-brain and region-of-interest analyses revealed elevated reactivity to reward receipt in the striatum, a region implicated in incentive sensitivity, in the BD group. Post hoc analyses revealed that greater striatal reactivity to reward receipt, across monetary and social reward tasks, predicted decreased self-reported positive affect when anticipating subsequent rewards in the HC but not in the BD group. Results point toward elevated striatal reactivity to reward receipt as a potential neural mechanism of persistent reward pursuit in BD. (c) 2015 APA, all rights reserved).
Complementary optical rogue waves in parametric three-wave mixing.
Chen, Shihua; Cai, Xian-Ming; Grelu, Philippe; Soto-Crespo, J M; Wabnitz, Stefan; Baronio, Fabio
2016-03-21
We investigate the resonant interaction of two optical pulses of the same group velocity with a pump pulse of different velocity in a weakly dispersive quadratic medium and report on the complementary rogue wave dynamics which are unique to such a parametric three-wave mixing. Analytic rogue wave solutions up to the second order are explicitly presented and their robustness is confirmed by numerical simulations, in spite of the onset of modulation instability activated by quantum noise.
Hamilton, Kyra; Daniels, Lynne; White, Katherine M; Murray, Nicole; Walsh, Anne
2011-06-01
In Australia and other developed countries there is poor adherence to guidelines recommending the introduction of complementary feeding to infants at 6 months of age. We aimed to investigate, via adopting a theory of planned behaviour framework and incorporating additional normative and demographic influences, mothers' complementary feeding intentions and behaviour. Participants were 375 primiparas who completed an initial questionnaire (infant age 13±3 weeks) that assessed the theory of planned behaviour constructs of attitude, subjective norm, and perceived behavioural control, as well as group norm and additional maternal and infant variables of mothers' age, education level, weight status perception, current maternal feeding practices, and infant birth weight. Approximately, 3 months after completion of the main questionnaire, mothers completed a follow-up questionnaire that assessed the age in months at which the infant was first introduced to solids. The theory of planned behaviour variables of attitude and subjective norm, along with group norm, predicted intentions, with intention, mothers' age (older more likely), and weight status perception (overweight less likely) predicting behaviour. Overall, the results highlight the importance of attitudes, normative influences, and individual characteristics in complementary feeding decision-making which should be considered when designing interventions aimed at improving adherence to current maternal feeding guidelines. Crown Copyright © 2011. Published by Elsevier Ltd. All rights reserved.
Vautard, Frederic; Ozcan, Soydan
2017-04-11
A functionalized carbon fiber having covalently bound on its surface a sizing agent containing epoxy groups, at least some of which are engaged in covalent bonds with crosslinking molecules, wherein each of said crosslinking molecules possesses at least two epoxy-reactive groups and at least one free functional group reactive with functional groups of a polymer matrix in which the carbon fiber is to be incorporated, wherein at least a portion of said crosslinking molecules are engaged, via at least two of their epoxy-reactive groups, in crosslinking bonds between at least two epoxy groups of the sizing agent. Composites comprised of these functionalized carbon fibers embedded in a polymeric matrix are also described. Methods for producing the functionalized carbon fibers and composites thereof are also described.
Hallab, Nadim James; Caicedo, Marco; Epstein, Rachael; McAllister, Kyron; Jacobs, Joshua J
2009-01-01
Hypersensitivity to metallic implants remains relatively unpredictable and poorly understood. We initially hypothesized that metal-induced lymphocyte proliferation responses to soluble metal challenge (ions) are mediated exclusively by early T-cell activation (not B-cells), typical of a Delayed-Type-Hypersensitivity response. We tested this by comparing proliferation (6-days) of primary lymphocytes with early T-cell and B-cell activation (48-hours) in three groups of subjects likely to demonstrate elevated metal-reactivity: Group 1(n=12) history of metal-sensitivity with no implant; Group 2a(n=6) well performing metal-on-metal THRs, and Group 2b(n=20) subjects with poorly performing metal-on-polymer total joint arthroplasties (TJA). Group 1 showed 100%(12/12) metal reactivity (Stimulation Index>2) to Ni. Group 2a&2b were 83%(5/6) and 75%(15/22) metal reactive (to Co, Cr or Ni) respectively. Of the n=32 metal reactive subjects to Co, Cr or Ni (SI>2), n=22/32 demonstrated >2-fold elevations in % of T-cell or B-cell activation (CD25+,CD69+) to metal challenge compared to untreated control. 18/22 metal-activated subjects demonstrated an exclusively T-cell or B-cell activation response to metal challenge, where 6/18 demonstrated exclusively B-cell activation and 12/18 demonstrated a T-cell only response, as measured by surface activation markers CD25+ and CD69+. However, there was no direct correlation (R2<0.1) between lymphocyte proliferation and % T-cell or B-cell activation (CD25+:CD69+). Proliferation assays (LTT) showed greater ability to detect metal reactivity than did subject-dependent results of flow-cytometry analysis of T-cell or B-cell activation. The high incidence of lymphocyte reactivity and activation, indicate that more complex than initially hypothesized immune responses may contribute to the etiology of debris induced osteolysis in metal-sensitive individuals. PMID:19235773
Socio-demographic predictors of person-organization fit.
Merecz-Kot, Dorota; Andysz, Aleksandra
2017-02-21
The aim of this study was to explore the relationship between socio-demographic characteristics and the level of complementary and supplementary person-organization fit (P-O fit). The study sample was a group of 600 Polish workers, urban residents aged 19-65. Level of P-O fit was measured using the Subjective Person-Organization Fit Questionnaire by Czarnota-Bojarska. The binomial multivariate logistic regression was applied. The analyzes were performed separately for the men and women. Socio-demographic variables explained small percentage of the outcome variability. Gender differences were found. In the case of men shift work decreased complementary and supplementary fit, while long working hours decreased complementary fit. In the women, age was a stimulant of a complementary fit, involuntary job losses predicted both complementary and supplementary misfit. Additionally, relational responsibilities increased probability of supplementary P-O fit in the men. Going beyond personality and competences as the factors affecting P-O fit will allow development of a more accurate prediction of P-O fit. Int J Occup Med Environ Health 2017;30(1):133-139. This work is available in Open Access model and licensed under a CC BY-NC 3.0 PL license.
Microsphere coated substrate containing reactive aldehyde groups
NASA Technical Reports Server (NTRS)
Yen, Richard C. K. (Inventor); Rembaum, Alan (Inventor)
1984-01-01
A synthetic organic resin is coated with a continuous layer of contiguous, tangential, individual microspheres having a uniform diameter preferably between 100 Angstroms and 2000 Angstroms. The microspheres are an addition polymerized polymer of an unsaturated aldehyde containing 4 to 20 carbon atoms and are covalently bonded to the substrate by means of high energy radiation grafting. The microspheres contain reactive aldehyde groups and can form conjugates with proteins such as enzymes or other aldehyde reactive materials.
Increased Sensitization to Mold Allergens Measured by Intradermal Skin Testing following Hurricanes
Hurst, David
2017-01-01
Objective. To report on changes in sensitivity to mold allergens determined by changes in intradermal skin testing reactivity, after exposure to two severe hurricanes. Methods. A random, retrospective allergy charts review divided into 2 groups of 100 patients each: Group A, patients tested between 2003 and 2010 prior to hurricanes, and Group B, patients tested in 2014 and 2015 following hurricanes. Reactivity to eighteen molds was determined by intradermal skin testing. Test results, age, and respiratory symptoms were recorded. Chi-square test determined reactivity/sensitivity differences between groups. Results. Posthurricane patients had 34.6 times more positive results (p < 0.0001) at weaker dilutions, all tested molds were found to be more reactive, and 95% had at least one positive test versus only 62% before the hurricanes (p < 0.0001); average mold reactivity was 55% versus 16% while 17% of patients reacted to the entire panel versus none before the hurricanes (p < 0.0001). The posthurricane population was younger (p < 0.001) and included more patients with asthma or lower respiratory symptoms (p < 0.05). Conclusion. Reactivity and sensitization to mold allergens increased compared to patients before the hurricanes. This supports climatologists' hypothesis that environmental changes resulting from hurricanes can be a health risk as reflected in increased allergic sensitivities and symptoms and has significant implications for physicians treating patients from affected areas. PMID:28491100
Increased Sensitization to Mold Allergens Measured by Intradermal Skin Testing following Hurricanes.
Saporta, Diego; Hurst, David
2017-01-01
Objective . To report on changes in sensitivity to mold allergens determined by changes in intradermal skin testing reactivity, after exposure to two severe hurricanes. Methods . A random, retrospective allergy charts review divided into 2 groups of 100 patients each: Group A, patients tested between 2003 and 2010 prior to hurricanes, and Group B, patients tested in 2014 and 2015 following hurricanes. Reactivity to eighteen molds was determined by intradermal skin testing. Test results, age, and respiratory symptoms were recorded. Chi-square test determined reactivity/sensitivity differences between groups. Results . Posthurricane patients had 34.6 times more positive results ( p < 0.0001) at weaker dilutions, all tested molds were found to be more reactive, and 95% had at least one positive test versus only 62% before the hurricanes ( p < 0.0001); average mold reactivity was 55% versus 16% while 17% of patients reacted to the entire panel versus none before the hurricanes ( p < 0.0001). The posthurricane population was younger ( p < 0.001) and included more patients with asthma or lower respiratory symptoms ( p < 0.05). Conclusion . Reactivity and sensitization to mold allergens increased compared to patients before the hurricanes. This supports climatologists' hypothesis that environmental changes resulting from hurricanes can be a health risk as reflected in increased allergic sensitivities and symptoms and has significant implications for physicians treating patients from affected areas.
Effect of a Simulated Active Commute to School on Cardiovascular Stress Reactivity
Lambiase, Maya J.; Barry, Heather M.; Roemmich, James. N.
2010-01-01
Purpose Stress-induced cardiovascular reactivity is associated with the pathogenesis of cardiovascular disease. This study tested whether a simulated active commute to school dampened cardiovascular reactivity to a cognitive stressor typical to what children might experience during school. Methods Forty children (20 girls and 20 boys) ages 10 to 14 y were randomly assigned to simulated sedentary drive to school or active commute (walking) groups. The walking group completed a self-paced 1.6 km walk on a treadmill while images from a real 1.6 km walk through a pleasant neighborhood that finished at a school were projected in front of them. The drive to school group sat in a chair and watched the same slideshow of images of the neighborhood environment. Standardized residualized gain scores of cardiovascular reactivity during a cognitive stressor, the Stroop task, were calculated and used as dependent variables. Results Children in the walking group self-selected a walking intensity of 60.6 ± 1.6 %HR max and covered the 1.6 km distance in 21.5 ± 0.5 min. Children in the walking group had lower HR (2 ± 1 vs 11 ± 1 beats˙min−1, P < 0.001), systolic BP (4 ± 1 vs 12 ± 1 mmHg, P < 0.001), pulse pressure (−4 ± 1 vs 6 ± 1 mmHg, P < 0.001), and perceived stress (1.4 ± 0.1 vs 3.0 ± 0.1 cm, P < 0.001) reactivities to cognitive stress than the control group. Conclusion Active commuting to school may dampen cardiovascular reactivity and perceived stress when confronted with stressful cognitive challenges during the school day. This may help reduce the risk for cardiovascular disease later in life. PMID:20139790
Sun, Ying-Ji; Huang, Qian-Qian; Zhang, Jian-Jun
2014-03-17
A series of mononuclear Co(II)-flavonolate complexes [Co(II)L(R)(fla)] (L(R)H = 2-{[bis(pyridin-2-ylmethyl)amino]methyl}-p/m-R-benzoic acid; R = p-OMe (1), p-Me (2), m-Br (4), and m-NO2 (5); fla = flavonolate) were designed and synthesized as structural and functional models for the ES (enzyme-substrate) complexes to mimic the active site of the Co(II)-containing quercetin 2,3-dioxygenase (Co-2,3-QD). The metal center Co(II) ion in each complex shows a similar distorted octahedral geometry. The model complexes display high enzyme-type dioxygenation reactivity (oxidative O-heterocyclic ring opening of the coordinated substrate flavonolate) at low temperature, presumably due to the attached carboxylate group in the ligands. The reactivity exhibits a substituent group dependent order of -OMe (1) > -Me (2) > -H (3)14b > -Br (4) > -NO2 (5), and the Hammett plot is linear (ρ = -0.78). This can be explained as the electronic nature of the substituent group in the ligands may influence the conformation and redox potential of the bound flavonolate and finally bring different reactivity. The structures, properties, and reactivity of the model complexes show some dependence on the substituent group in the supporting model ligands, and there is some relationship among them. This study is the first example of a series of structural and functional ES models of Co-2,3-QD, with focus on the effects of the electronic nature of substituted groups and the carboxylate group of the ligands to the dioxygenation reactivity, that will provide important insights into the structure-property-reactivity relationship and the catalytic role of Co-2,3-QD.
The effects of an enrichment training program for youth football attackers
Santos, Sara; Gonçalves, Bruno; Travassos, Bruno; Wong, Del P.; Schöllhorn, Wolfgang; Sampaio, Jaime
2018-01-01
The aim of this study was to identify the effects of a complementary training program based on differential learning approach in the physical, technical, creative and positioning performance of youth football attackers. Fifteen players were allocated into the control (U15C = 9, age: 13.9±0.5 years; U17C = 6, age: 16.1±0.7 years) and the experimental (U15E = 9, age: 14.2±0.8 years; U17E = 6, age: 15.8±0.5 years) groups. The experimental groups participated in 10-weeks of a complementary training program based on differential learning approach to improve physical literacy and players’ tactical behavior. Variables studied encompassed: motor (vertical jump, speed and repeated change-of direction), technical (pass, dribble and shot), creative (fluency, attempts, versatility) and positioning-related variables (stretch index, spatial exploration index and regularity of the lateral and longitudinal movements). Results revealed that U15E improved both the jump and repeated change-of-direction performance, while the U17E have only improved the jump performance. The U15E showed improvements in all technical variables (small to large effects), and in the fluency and versatility (moderate effects), while the U17 have only improved the successful shots (large effects). From a positional perspective, there was a moderate increase in the stretch index, and decreased longitudinal and lateral regularity (small to moderate effects) in the U15E compared to the U15C. In turn, the U17E revealed a moderate increase of the spatial exploration index and a small decrease in the stretch index. Overall, the results suggest that the complementary training program was effective for the development of the overall performance of the U15E attackers, while more time and/or variability may be needed for older age groups. Nevertheless, the overall higher values found in experimental groups, may suggest that this type of complementary training program improves performance. PMID:29897985
Kessler, Anne; Campo, Joseph J; Harawa, Visopo; Mandala, Wilson L; Rogerson, Stephen J; Mowrey, Wenzhu B; Seydel, Karl B; Kim, Kami
2018-04-25
Antibody immunity is thought to be essential to prevent severe Plasmodium falciparum infection, but the exact correlates of protection are unknown. Over time, children in endemic areas acquire non-sterile immunity to malaria that correlates with development of antibodies to merozoite invasion proteins and parasite proteins expressed on the surface of infected erythrocytes. A 1000 feature P. falciparum 3D7 protein microarray was used to compare P. falciparum-specific seroreactivity during acute infection and 30 days after infection in 23 children with uncomplicated malaria (UM) and 25 children with retinopathy-positive cerebral malaria (CM). All children had broad P. falciparum antibody reactivity during acute disease. IgM reactivity decreased and IgG reactivity increased in convalescence. Antibody reactivity to CIDR domains of "virulent" PfEMP1 proteins was low with robust reactivity to the highly conserved, intracellular ATS domain of PfEMP1 in both groups. Although children with UM and CM differed markedly in parasite burden and PfEMP1 exposure during acute disease, neither acute nor convalescent PfEMP1 seroreactivity differed between groups. Greater seroprevalence to a conserved Group A-associated ICAM binding extracellular domain was observed relative to linked extracellular CIDRα1 domains in both case groups. Pooled immune IgG from Malawian adults revealed greater reactivity to PfEMP1 than observed in children. Children with uncomplicated and cerebral malaria have similar breadth and magnitude of P. falciparum antibody reactivity. The utility of protein microarrays to measure serological recognition of polymorphic PfEMP1 antigens needs to be studied further, but the study findings support the hypothesis that conserved domains of PfEMP1 are more prominent targets of cross reactive antibodies than variable domains in children with symptomatic malaria. Protein microarrays represent an additional tool to identify cross-reactive Plasmodium antigens including PfEMP1 domains that can be investigated as strain-transcendent vaccine candidates.
Growth behind the Mirror: The Family Therapy Consortium's Group Process.
ERIC Educational Resources Information Center
Wendorf, Donald J.; And Others
1985-01-01
Charts the development of the Family Therapy Consortium, a group that provides supervision and continuing education in family therapy and explores the peer supervision process at work in the consortium. The focus is on individual and group development, which are seen as complementary aspects of the same growth process. (Author/NRB)
NASA Astrophysics Data System (ADS)
He, Chenchen; Kimutai, Bett; Hamlow, Lucas; Roy, Harrison; Nei, Y.-W.; Bao, Xun; Gao, Juehan; Martens, Jonathan K.; Berden, Giel; Oomens, Jos; Maitre, Philippe; Steinmetz, Vincent; McNary, Christopher P.; Armentrout, Peter B.; Chow, C. S.; Rodgers, M. T.
2016-06-01
Cisplatin [(NH_3)_2PtCl_2], the first FDA-approved platinum-based anticancer drug, has been widely used in cancer chemotherapy. Its pharmacological mechanism has been identified as its ability to coordinate to genomic DNA with guanine as its major target. Amino acid-linked cisplatin derivatives are being investigated as alternatives for cisplatin that may exhibit altered binding selectivity such as that found for ornithine-linked cisplatin (Ornplatin, [(Orn)PtCl_2]), which exhibits a preference for adenine over guanine in RNA. Infrared multiple photon dissociation (IRMPD) action spectroscopy experiments and complementary electronic structure calculations are performed on a series of Ornplatin complexes to elucidate the nature of binding of the Orn amino acid to the Pt center and how that binding is influenced by the local environment. The complexes examined in the work include: [(Orn-H)PtCl_2]-, [(Orn)PtCl]+, [(Orn)Pt(H_2O)Cl]+, and [(Orn)PtCl_2+Na]+. In contrast to that found previously for the glycine-linked cisplatin complex (Glyplatin), which binds via the backbone amino and carboxylate groups, binding of Orn in these complexes is found to involve both the backbone and sidechain amino groups. Extensive broadening of the IRMPD spectrum for the [(Orn)Pt(H_2O)Cl]+ complex suggests that either multiple structures are contributing to the measured spectrum or strong intra-molecular hydrogen-binding interactions are present. The results for Ornplatin lead to an interesting discussion about the differences in selectivity and reactivity versus cisplatin.
Che, Xia; Wang, Xin; Zhang, Junyan; Peng, Chengfeng; Zhen, Yilan; Shao, Xu; Zhang, Gongliang; Dong, Liuyi
2016-01-01
The aim of this study was to explore the cardioprotective effect of vitexin on chronic myocardial ischemia/reperfusion injury in rats and potential mechanisms. A chronic myocardial ischemia/reperfusion injury model was established by ligating left anterior descending coronary for 60 minutes, and followed by reperfusion for 14 days. After 2 weeks ischemia/reperfusion, cardiac function was measured to assess myocardial injury. The level of ST segment was recorded in different periods by electrocardiograph. The change of left ventricular function and myocardial reaction degree of fibrosis of heart was investigated by hematoxylin and eosin (HE) staining and Sirius red staining. Endothelium-dependent relaxations due to acetylcholine were observed in isolated rat thoracic aortic ring preparation. The blood samples were collected to measure the levels of MDA, the activities of SOD and NADPH in serum. Epac1, Rap1, Bax and Bcl-2 were examined by using Western Blotting. Vitexin exerted significant protective effect on chronic myocardial ischemia/reperfusion injury, improved obviously left ventricular diastolic function and reduced myocardial reactive fibrosis degree in rats of myocardial ischemia. Medium and high-dose vitexin groups presented a significant decrease in Bax, Epac1 and Rap1 production and increase in Bcl-2 compared to the I/R group. It may be related to preventing myocardial cells from apoptosis, improving myocardial diastolic function and inhibiting lipid peroxidation. Vitexin is a cardioprotective herb, which may be a promising useful complementary and alternative medicine for patients with coronary heart disease.
Inducible Alkylation of DNA by a Quinone Methide-Peptide Nucleic Acid Conjugate†
Liu, Yang; Rokita, Steven E.
2012-01-01
The reversibility of alkylation by a quinone methide intermediate (QM) avoids the irreversible consumption that plagues most reagents based on covalent chemistry and allows for site specific reaction that is controlled by the thermodynamics rather than kinetics of target association. This characteristic was originally examined with an oligonucleotide QM conjugate but broad application depends on alternative derivatives that are compatible with a cellular environment. Now, a peptide nucleic acid (PNA) derivative has been constructed and shown to exhibit an equivalent ability to delivery the reactive QM in a controlled manner. This new conjugate demonstrates high selectivity for a complementary sequence of DNA even when challenged with an alternative sequence containing a single T/T mismatch. Alkylation of non-complementary sequences is only possible when a template strand is present to co-localize the conjugate and its target. For efficient alkylation in this example, a single-stranded region of the target is required adjacent to the QM conjugate. Most importantly, the intrastrand self adducts formed between the PNA and its attached QM remained active and reversible over more than eight days in aqueous solution prior to reaction with a chosen target added subsequently. PMID:22243337
Ryu, Ji-Hwan; Ha, Eun-Mi; Oh, Chun-Taek; Seol, Jae-Hong; Brey, Paul T; Jin, Ingnyol; Lee, Dong Gun; Kim, Jaesang; Lee, Daekee; Lee, Won-Jae
2006-08-09
In the Drosophila gut, reactive oxygen species (ROS)-dependent immunity is critical to host survival. This is in contrast to the NF-kappaB pathway whose physiological function in the microbe-laden epithelia has yet to be convincingly demonstrated despite playing a critical role during systemic infections. We used a novel in vivo approach to reveal the physiological role of gut NF-kappaB/antimicrobial peptide (AMP) system, which has been 'masked' in the presence of the dominant intestinal ROS-dependent immunity. When fed with ROS-resistant microbes, NF-kappaB pathway mutant flies, but not wild-type flies, become highly susceptible to gut infection. This high lethality can be significantly reduced by either re-introducing Relish expression to Relish mutants or by constitutively expressing a single AMP to the NF-kappaB pathway mutants in the intestine. These results imply that the local 'NF-kappaB/AMP' system acts as an essential 'fail-safe' system, complementary to the ROS-dependent gut immunity, during gut infection with ROS-resistant pathogens. This system provides the Drosophila gut immunity the versatility necessary to manage sporadic invasion of virulent pathogens that somehow counteract or evade the ROS-dependent immunity.
ERIC Educational Resources Information Center
Currie, Michael; Startup, Mike
2012-01-01
This study evaluates efficacy and effectiveness of "Doing Anger Differently" (DAD), a group treatment for reactively aggressive 12-15 year old males. DAD uses percussion exercises to aid treatment. Study 1 compared a ten-week treatment with a waitlist control at pre, post and 6 month (treatment group only) follow-up. Study 2 replicated Study 1,…
Edagawa, Eijiro; Matsuda, Yasunori; Gyobu, Ken; Lee, Shigeru; Kishida, Satoru; Fujiwara, Yushi; Hashiba, Ryoya; Osugi, Harushi; Suehiro, Shigefumi
2015-06-01
Esophageal anastomotic leakage is one of the most fatal complications after esophagectomy and increases the hospitalization length. We aimed to identify a convenient clinical marker of anastomotic leakage in the early postoperative period. In total, 108 patients who underwent esophagectomy were retrospectively screened, and 96 were used to validate the overall results. All 108 patients underwent physical examinations and determination of their white blood cell count, C-reactive protein level, platelet count, fibrinogen level, fibrin degradation product level, and antithrombin III level until postoperative day 6. Anastomotic leakage occurred in 21 of the 108 patients (median detection, 8 days). The C-reactive protein level on postoperative day 3 and fibrinogen level on postoperative day 4 in the leakage group were significantly higher than those in the nonleakage group. Receiver operating characteristic curves for detection of anastomotic leakage were constructed; the cutoff value of C-reactive protein on postoperative day 3 was 8.62 mg/dL, and that of fibrinogen on postoperative day 4 was 712 mg/dL. Anastomotic leakage occurred in 23 of the 96 patients in the validation group. There was a significant difference between the leakage and nonleakage groups when the C-reactive protein threshold on postoperative day 3 was set at 8.62 mg/dL. However, there was no difference between the groups when the fibrinogen threshold on postoperative day 4 was set at 712 mg/dL. The C-reactive protein level on postoperative day 3 is a valuable predictor of anastomotic leakage after esophagectomy and might allow for earlier management of this complication.
Fitzgerald, Jacklynn M; Phan, K Luan; Kennedy, Amy E; Shankman, Stewart A; Langenecker, Scott A; Klumpp, Heide
2017-08-15
Emotion dysregulation is prominent in generalized anxiety disorder (GAD), characterized clinically by exaggerated reactivity to negative stimuli and difficulty in down-regulating this response. Although limited research implicates frontolimbic disturbances in GAD, whether neural aberrations occur during emotional reactivity, regulation, or both is not well understood. During functional magnetic resonance imaging (fMRI), 30 individuals with GAD and 30 healthy controls (HC) completed a well-validated explicit emotion regulation task designed to measure emotional reactivity and regulation of reactivity. During the task, participants viewed negative images ('Look-Negative' condition) and, on some trials, used a cognitive strategy to reduce negative affective response ('Reappraise' condition). Results from an Analysis of Variance corrected for whole brain multiple comparisons showed a significant group x condition interaction in the left amygdala and left inferior frontal gyrus (IFG). Results from post-hoc analyses showed that the GAD group engaged these regions to a greater extent than HCs during Look-Negative but not Reappraise. Behaviorally, the GAD group reported feeling more negative than the HC group in each condition, although both groups reported reduced negative affect following regulation. As comorbidity was permitted, the presence of concurrent disorders, like other anxiety disorders and depression, detracts our ability to classify neural engagement particular to GAD alone. Individuals with GAD exhibited over-engagement of amygdala and frontal regions during the viewing of negative images, compared to HCs. Together, these aberrations may indicate that deficits in emotional reactivity rather than regulation contribute to emotion dysregulation in those with GAD. Copyright © 2017. Published by Elsevier B.V.
Fan, Dimin; O'Brien Johnson, Graham; Tratnyek, Paul G; Johnson, Richard L
2016-09-06
The high reactivity of nano zerovalent iron (nZVI) leads to inefficient treatment due to competition with various natural reductant demand (NRD) processes, especially the reduction of water to hydrogen. Here we show that this limitation can be alleviated by sulfidation (i.e., modification by reducing sulfur compounds). nZVI synthesized on carboxylmethylcelluose (CMC-nZVI) was sulfidated with either sulfide or dithionite. The reactivity of the resulting materials was examined with three complementary assays: (i) direct measurement of hydrogen production, (ii) reduction of a colorimetric redox probe (indigo disulfonate, I2S), and (iii) dechlorination of trichloroethylene (TCE). The results indicate that sulfidation at S/Fe molar ratios of ≥0.3, effectively eliminates reaction with water, but retains significant reactivity with TCE. However, sulfidation with sulfide leaves most of the nZVI as Fe(0), whereas dithionite converts a majority of the nZVI to FeS (thus consuming much of the reducing capacity originally provided by the Fe(0)). Simplified numerical models show that the reduction kinetics of I2S and TCE are mainly dependent on the initial reducing equivalents and that the TCE reduction rate is affected by the aging of FeS. Overall, the results suggest that pretreatment of nZVI with reducing sulfur compounds could result in substantial improvement in nZVI selectivity.
Huang, Ying; Rong, Chunying; Zhang, Ruiqin; Liu, Shubin
2017-01-01
Wave function theory (WFT) and density functional theory (DFT)-the two most popular solutions to electronic structure problems of atoms and molecules-share the same origin, dealing with the same subject yet using distinct methodologies. For example, molecular orbitals are artifacts in WFT, whereas in DFT, electron density plays the dominant role. One question that needs to be addressed when using these approaches to appreciate properties related to molecular structure and reactivity is if there is any link between the two. In this work, we present a piece of strong evidence addressing that very question. Using five polymeric systems as illustrative examples, we reveal that using quantities from DFT such as Shannon entropy, Fisher information, Ghosh-Berkowitz-Parr entropy, Onicescu information energy, Rényi entropy, etc., one is able to accurately evaluate orbital-related properties in WFT like frontier orbital energies and the HOMO (highest occupied molecular orbital)/LUMO (lowest unoccupied molecular orbital) gap. We verified these results at both the whole molecule level and the atoms-in-molecules level. These results provide compelling evidence suggesting that WFT and DFT are complementary to each other, both trying to comprehend the same properties of the electronic structure and molecular reactivity from different perspectives using their own characteristic vocabulary. Hence, there should be a bridge or bridges between the two approaches.
Burgess, Elizabeth A; Hunt, Kathleen E; Kraus, Scott D; Rolland, Rosalind M
2017-10-01
Until now, physiological stress assessment of large whales has predominantly focused on adrenal glucocorticoid (GC) measures. Elevated GC concentrations in feces (fGC) are known to reflect stressful disturbances, such as fishing gear entanglement and human-generated underwater noise, in North Atlantic right whales (Eubalaena glacialis). However, there can be considerable variation in GC production as a function of sex and life history stage, which may confound the interpretation of fGC levels. Additionally, GC antibodies used in immunoassays can cross-react with other fecal metabolites (i.e., non-target steroids), potentially influencing fGC data. Here, aldosterone concentrations (fALD; aldosterone and related metabolites) were measured in fecal samples from right whales (total n=315 samples), including samples from identified individuals of known life history (n=82 individual whales), to evaluate its utility as a complementary biomarker to fGC for identifying adrenal activation. Concentrations of fALD were positively correlated with fGCs in right whales (r=0.59, P<0.001), suggesting concurrent secretion of these hormones by the adrenal gland. However, fALD levels were less influenced by concentrations of reproductive steroids in feces, minimizing the potential confounder of assay cross-reactivity in samples with highly skewed hormone ratios. Across different life history states for right whales, fALD concentrations showed similar patterns to those reported for fGC, with higher levels in pregnant females (35.9±7.6ng/g) followed by reproductively mature males (9.5±0.9ng/g) (P<0.05), providing further evidence of elevated adrenal activation in these groups of whales. The addition of fALD measurement as a biomarker of adrenal activation may help distinguish between intrinsic and external causes of stress hormone elevations in large whales, as well as other free-living wildlife species, providing a more comprehensive approach for associating adrenal activation with specific natural and anthropogenic stressors. Copyright © 2017 Elsevier Inc. All rights reserved.
Do, Nga T T; Ta, Ngan T D; Tran, Ninh T H; Than, Hung M; Vu, Bich T N; Hoang, Long B; van Doorn, H Rogier; Vu, Dung T V; Cals, Jochen W L; Chandna, Arjun; Lubell, Yoel; Nadjm, Behzad; Thwaites, Guy; Wolbers, Marcel; Nguyen, Kinh V; Wertheim, Heiman F L
2016-09-01
Inappropriate antibiotic use for acute respiratory tract infections is common in primary health care, but distinguishing serious from self-limiting infections is difficult, particularly in low-resource settings. We assessed whether C-reactive protein point-of-care testing can safely reduce antibiotic use in patients with non-severe acute respiratory tract infections in Vietnam. We did a multicentre open-label randomised controlled trial in ten primary health-care centres in northern Vietnam. Patients aged 1-65 years with at least one focal and one systemic symptom of acute respiratory tract infection were assigned 1:1 to receive either C-reactive protein point-of-care testing or routine care, following which antibiotic prescribing decisions were made. Patients with severe acute respiratory tract infection were excluded. Enrolled patients were reassessed on day 3, 4, or 5, and on day 14 a structured telephone interview was done blind to the intervention. Randomised assignments were concealed from prescribers and patients but not masked as the test result was used to assist treatment decisions. The primary outcome was antibiotic use within 14 days of follow-up. All analyses were prespecified in the protocol and the statistical analysis plan. All analyses were done on the intention-to-treat population and the analysis of the primary endpoint was repeated in the per-protocol population. This trial is registered under number NCT01918579. Between March 17, 2014, and July 3, 2015, 2037 patients (1028 children and 1009 adults) were enrolled and randomised. One adult patient withdrew immediately after randomisation. 1017 patients were assigned to receive C-reactive protein point-of-care testing, and 1019 patients were assigned to receive routine care. 115 patients in the C-reactive protein point-of-care group and 72 patients in the routine care group were excluded in the intention-to-treat analysis due to missing primary endpoint. The number of patients who used antibiotics within 14 days was 581 (64%) of 902 patients in the C-reactive protein group versus 738 (78%) of 947 patients in the control group (odds ratio [OR] 0·49, 95% CI 0·40-0·61; p<0·0001). Highly significant differences were seen in both children and adults, with substantial heterogeneity of the intervention effect across the 10 sites (I(2)=84%, 95% CI 66-96). 140 patients in the C-reactive protein group and 137 patients in the routine care group missed the urine test on day 3, 4, or 5. Antibiotic activity in urine on day 3, 4, or 5 was found in 267 (30%) of 877 patients in the C-reactive protein group versus 314 (36%) of 882 patients in the routine treatment group (OR 0·78, 95% CI 0·63-0·95; p=0·015). Time to resolution of symptoms was similar in both groups. Adverse events were rare, with no deaths and a total of 14 hospital admissions (six in the C-reactive protein group and eight in the control group). C-reactive protein point-of-care testing reduced antibiotic use for non-severe acute respiratory tract infection without compromising patients' recovery in primary health care in Vietnam. Health-care providers might have become familiar with the clinical picture of low C-reactive protein, leading to reduction in antibiotic prescribing in both groups, but this would have led to a reduction in observed effect, rather than overestimation. Qualitative analysis is needed to address differences in context in order to implement this strategy to improve rational antibiotic use for patients with acute respiratory infection in low-income and middle-income countries. Wellcome Trust, UK, and Global Antibiotic Resistance Partnership, USA. Copyright © 2016 The Author(s). Published by Elsevier Ltd. This is an Open Access article under the CC BY-NC-ND license. Published by Elsevier Ltd.. All rights reserved.
Zhou, Jun; Lv, Siying; Zhang, Dan; Xia, Fei; Hu, Wenhao
2017-03-03
It has been long recognized that, in chemical glycosylation, the anomeric reactivity of glycosyl donor can be influenced greatly by protecting groups. As opposed to the effects of protecting groups, we report herein a finding on how O-glycosyl substituent can affect the reactivity of oligosaccharyl donor, which in turn should have impact on convergent assembly of oligosaccharide. During our synthetic efforts toward Pichia holstii oligomannoside, a type of α-1,3-linked dimannosyl thioglycosides was found to exhibit unexpected low reactivity toward the activation of NIS/TMSOTf. This observation prompted us to perform a series of comparative reactivity studies, which attributed the donor deactivation to the presence of 3-O-glycosyl substituent, by comparison with O-acetyl group and O-glycosidic linkages at C-4/C-6 positions. To rationalize the unusual phenomenon, we hypothesize that O-glycosyl moiety at C-3 could destabilize the oxocarbenium ion intermediate by additionally increasing the O2-C2-C3-O3 torsional strain, which was further supported by DFT calculation of the hypothetical 4 H 3 -like oxocarbeniums. The observed deactivating influence provides a basis for estimation of donor reactivity and logical selection of synthetic strategy in oligosaccharide synthesis. Following this finding, we opted to use an iterative strategy for the synthesis of targeted pentamannoside 1 by using monomeric thiomannosides that ensured sufficient reactivity.
Kim, Juhee; Mathai, Rose Ann
2015-09-01
The environment or setting to which an infant is exposed is crucial to establishing healthy eating habits and to preventing obesity. This study aimed to compare infant feeding practices and complementary food type between parent care (PC) and childcare (CC) settings among infants receiving the Special Supplemental Nutrition Program for Women, Infants, and Children (WIC). This study sampled 105 dyads of mothers and infants between 2 to 8 months of age from a WIC office in Central Illinois. Mothers completed a cross-sectional survey to assess their infant feeding practices and demographic characteristics. CC was defined as infants receiving 10 hours or more per week of care from a nonparental caregiver. Almost half of the infants (44%) were enrolled in CC. Infants in CC had an average of 29 hours of care per week compared with 0.64 hours in the PC group (p<0.01). There were no differences between the two groups in age, sex, race/ethnicity, preterm birth, and birth weight. Overall, there were no significant differences in breastfeeding initiation and duration. The average age at formula introduction was earlier for PC infants (0.90 ± 1.16 months) than for CC infants (1.66 ± 1.64 months) (p = 0.03). PC infants stopped breastfeeding at 1.96 ± 1.15 months compared with 2.31 ± 1.64 months for CC infants (p = 0.080). Among complementary foods introduced to infants, the primary food type was infant cereal, followed by baby food of fruits and vegetables, 100% fruit juice, and meat-based baby food. The timing of introduction and the types of complementary foods were similar between study groups. CC use is not a significant influence on breastfeeding rates, introduction of complementary foods, and types of complementary foods; however, it does influence when formula is introduced. The findings support the need for infant nutrition education and breastfeeding promotion targeting WIC mothers, regardless of their pattern of CC.
Rissanen, Ritva; Arving, Cecilia; Ahlgren, Johan; Nordin, Karin
2014-09-01
Fatigue and emotional reactivity are common among women suffering from breast cancer and might detrimentally affect these women's quality of life. This study evaluates if the stress management delivered either in a group or individual setting would improve fatigue and emotional reactivity among women with a newly diagnosed breast cancer. Participants (n = 304) who reported elevated levels of distress at three-month post-inclusion were randomised between stress management in a group (GSM) (n = 77) or individual (ISM) (n = 78) setting. Participation was declined by 149 women. Participants completed the Multidimensional Fatigue Inventory (MFI-20) and the Everyday Life Stress Scale (ELSS) at the time of inclusion, 3- and 12-month post-inclusion. Analyses were made according to intention to treat and per-protocol principles. Mann-Whitney tests were used to examine differences between the two intervention groups. No significant differences were detected between the GSM and ISM groups on fatigue or emotional reactivity. In addition, there were no changes over time for these outcomes. There were no differences between the two intervention arms with reference to fatigue or emotional reactivity; however, a clinically interesting finding was the low number of women who were interested in participating in a psychosocial intervention. This finding may have clinical implications when psychosocial support is offered to women with a newly diagnosed breast cancer and also in the planning of future studies.
Menopausal Symptoms and Complementary Health Practices: What the Science Says
... had significantly greater levels of satisfaction than the control group. A 2008 randomized trial found that hypnosis appears ... that acupuncture was no better than sham acupuncture (control) for the treatment of hot flashes. Both groups (sham acupuncture and true acupuncture) had a significant ...
Miyaji, Akane; Ikemura, Tsukasa; Hayashi, Naoyuki
2018-04-14
The CO2 reactivity is often used to assess vascular function, but it is still unclear whether this reactivity is affected by aging. To investigate the effects of aging on the CO2 reactivity in ocular and cerebral vessels, both of which are highly sensitive to hypercapnia, we compared the CO2 reactivity in the retinal artery (RA), retinal and choroidal vessels (RCV), optic nerve head (ONH), and middle cerebral artery (MCA) between young and middle-aged subjects. We measured the CO2 reactivity in 14 young and 11 middle-aged males using laser-speckle flowgraphy during a 3-min inhalation of CO2-rich air. The CO2 reactivity in the RA and ONH were lower in the middle-aged group than in the young group, but no significant effect of age was observed in the RCV or MCA. The CO2 reactivity in the RA and ONH were correlated significantly with age, whereas those in the RCV or MCA were not. These findings suggest that there are regional differences in the effect of age on the CO2 reactivity among not only ocular and cerebral vessels, but also the retinal and choroidal vessels, even though these vessels are in neighboring areas.
Amygdala reactivity to fearful faces correlates positively with impulsive aggression.
da Cunha-Bang, Sofi; Fisher, Patrick M; Hjordt, Liv V; Holst, Klaus; Knudsen, Gitte M
2018-01-07
Facial expressions robustly activate the amygdala, a brain structure playing a critical role in aggression. Whereas previous studies suggest that amygdala reactivity is related to various measures of impulsive aggression, we here estimate a composite measure of impulsive aggression and evaluate whether it is associated with amygdala reactivity to angry and fearful faces. We estimated amygdala reactivity with functional magnetic resonance imaging in 47 men with varying degree of aggressive traits (19 incarcerated violent offenders and 28 healthy controls). We modeled a composite "impulsive aggression" trait construct (LV agg ) using a linear structural equation model, with a single latent variable capturing the shared correlation between five self-report measures of trait aggression, anger and impulsivity. We tested for associations between amygdala reactivity and the LV agg , adjusting for age and group. The LV agg was significantly positively associated with amygdala reactivity to fearful (p = 0.001), but not angry faces (p = 0.9). We found no group difference in amygdala reactivity to fearful or angry faces. The findings suggest that that amygdala reactivity to fearful faces is represented by a composite index of impulsive aggression and provide evidence that impulsive aggression is associated with amygdala reactivity in response to submissive cues, i.e., fearful faces.
High-resolution crystal structure and IgE recognition of the major grass pollen allergen Phl p 3.
Devanaboyina, S C; Cornelius, C; Lupinek, C; Fauland, K; Dall'Antonia, F; Nandy, A; Hagen, S; Flicker, S; Valenta, R; Keller, W
2014-12-01
Group 2 and 3 grass pollen allergens are major allergens with high allergenic activity and exhibit structural similarity with the C-terminal portion of major group 1 allergens. In this study, we aimed to determine the crystal structure of timothy grass pollen allergen, Phl p 3, and to study its IgE recognition and cross-reactivity with group 2 and group 1 allergens. The three-dimensional structure of Phl p 3 was solved by X-ray crystallography and compared with the structures of group 1 and 2 grass pollen allergens. Cross-reactivity was studied using a human monoclonal antibody which inhibits allergic patients' IgE binding and by IgE inhibition experiments with patients' sera. Conformational Phl p 3 IgE epitopes were predicted with the algorithm SPADE, and Phl p 3 variants containing single point mutations in the predicted IgE binding sites were produced to analyze allergic patients' IgE binding. Phl p 3 is a globular β-sandwich protein showing structural similarity to Phl p 2 and the Phl p 1-C-terminal domain. Phl p 3 showed IgE cross-reactivity with group 2 allergens but not with group 1 allergens. SPADE identified two conformational IgE epitope-containing areas, of which one overlaps with the epitope defined by the monoclonal antibody. The mutation of arginine 68 to alanine completely abolished binding of the blocking antibody. This mutation and a mutation of D13 in the predicted second IgE epitope area also reduced allergic patients' IgE binding. Group 3 and group 2 grass pollen allergens are cross-reactive allergens containing conformational IgE epitopes. They lack relevant IgE cross-reactivity with group 1 allergens and therefore need to be included in diagnostic tests and allergen-specific treatments in addition to group 1 allergens. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
NASA Astrophysics Data System (ADS)
Soriano-Correa, Catalina; Raya, Angélica; Barrientos-Salcedo, Carolina; Esquivel, Rodolfo O.
2014-06-01
Activity of steroid hormones is dependent upon a number of factors, as solubility, transport and metabolism. The functional differences caused by structural modifications could exert an influence on the chemical reactivity and biological effect. The goal of this work is to study the influence of the physicochemical and aromatic properties on the chemical reactivity and its relation with the carcinogenic risk that can associate with the anticoagulant effect of 17β-aminoestrogens using quantum-chemical descriptors at the DFT-B3LYP, BH&HLYP and M06-2X levels. The relative acidity of (H1) of the hydroxyl group increases with electron-withdrawing groups. Electron-donor groups favor the basicity. The steric hindrance of the substituents decreases the aromatic character and consequently diminution the carcinogenic effect. Density descriptors: hardness, electrophilic index, atomic charges, molecular orbitals, electrostatic potential and their geometric parameters permit analyses of the chemical reactivity and physicochemical features and to identify some reactive sites of 17β-aminoestrogens.
ERIC Educational Resources Information Center
Skinner, Vicki J.; Braunack-Mayer, Annette; Winning, Tracey A.
2016-01-01
A problem-based learning (PBL) assumption is that silence is incompatible with collaborative learning. Although sociocultural studies have reinterpreted silence as collaborative, we must understand how silence occurs in PBL groups. This essay presents students' explanations of dominance, leadership, and silence as PBL group roles. An ethnographic…
Rensing, N; Westermann, A; Möller, D; von Piekartz, H
2015-12-01
Studies have shown changes in the technical and physical demands in modern handball. The game has increased considerably in speed, power and dynamics. Jump training has, therefore, become ever more important in the training of the athletes. These developments contribute to the fact that handball is now one of the most injury-prone types of sport, with the lower extremities being most frequently affected. Reactive jump training is not only used in training by now, but also increasingly in injury prevention. The aim of this study was to investigate the effectiveness of reactive jump training with handball players. 21 regional league handball players were randomly divided into an intervention group (n = 12) and a control group (n = 9). The intervention group completed a six-week reactive jump training programme while the control group went through a non-specific training programme. Jump height (squat and counter movement jump), isokinetic and isometric maximum power as well as muscle activity served as measuring parameters. A comparison of the intervention and control groups revealed that the reactive jump training led to significant improvements in jump height. The isometric and isokinetic maximum power measurements and the electromyographic activities of the triceps surae muscle demonstrated an improvement in the values within the intervention group. However, this improvement was not significant compared with the control group. Likewise both jumps correlated with the muscle activity of the soleus muscle as shown by electromyography. A moderate correlation was noticed between the isokinetic maximum power measurement and the electromyographic activity of the soleus and gastrocnemius medialis muscles. Furthermore, the correlations of the isometric and isokinetic maximum power meas-urements resulted in a strong correlation coefficient. This study revealed a significant increase in jump height after reactive jump training. There was no significant difference in power development between the two groups. However, we were able to demonstrate correlations which would make it seem reasonable and interesting to investigate the question more closely. An interesting field of research could be the question of the effectiveness of reactive jump training in the areas of rehabilitation and injury prevention. © Georg Thieme Verlag KG Stuttgart · New York.
Salomon, Kristen; Bylsma, Lauren M; White, Kristi E; Panaite, Vanessa; Rottenberg, Jonathan
2013-10-01
Prior work has repeatedly demonstrated that people who have current major depression exhibit blunted cardiovascular reactivity to acute stressors (e.g., Salomon et al., 2009). A key question regards the psychobiological basis for these deficits, including whether such deficits are depressed mood-state dependent or whether these effects are trait-like and are observed outside of depression episodes in vulnerable individuals. To examine this issue, we assessed cardiovascular reactivity to a speech stressor task and a forehead cold pressor in 50 individuals with current major depressive disorder (MDD), 25 with remitted major depression (RMD), and 45 healthy controls. Heart rate (HR), blood pressure and impedance cardiography were assessed and analyses controlled for BMI and sex. Significant group effects were found for SBP, HR, and PEP for the speech preparation period and HR, CO, and PEP during the speech. For each of these parameters, only the MDD group exhibited attenuated reactivity as well as impaired SBP recovery. Reactivity and recovery in the RMD group more closely resembled the healthy controls. Speeches given by the MDD group were rated as less persuasive than the RMD or healthy controls' speeches. No significant differences were found for the cold pressor. Blunted cardiovascular reactivity and impaired recovery in current major depression may be mood-state dependent phenomena and may be more reflective of motivational deficits than deficits in the physiological integrity of the cardiovascular system. Copyright © 2013 Elsevier B.V. All rights reserved.
Salomon, Kristen; Bylsma, Lauren M.; White, Kristi E.; Panaite, Vanessa; Rottenberg, Jonathan
2015-01-01
Prior work has repeatedly demonstrated that people who have current major depression exhibit blunted cardiovascular reactivity to acute stressors (e.g., Salomon et al., 2009). A key question regards the psychobiological basis for these deficits, including whether such deficits are depressed mood-state dependent or whether these effects are trait-like and are observed outside of depression episodes invulnerable individuals. To examine this issue, we assessed cardiovascular reactivity to a speech stressor task and a forehead cold pressor in 50 individuals with current major depressive disorder (MDD), 25 with remitted major depression (RMD), and 45 healthy controls. Heart rate (HR), blood pressure and impedance cardiography were assessed and analyses controlled for BMI and sex. Significant group effects were found for SBP, HR, and PEP for the speech preparation period and HR, CO, and PEP during the speech. For each of these parameters, only the MDD group exhibited attenuated reactivity as well as impaired SBP recovery. Reactivity and recovery in the RMD group more closely resembled the healthy controls. Speeches given by the MDD group were rated as less persuasive than the RMD or healthy controls' speeches. No significant differences were found for the cold pressor. Blunted cardiovascular reactivity and impaired recovery in current major depression may be mood-state dependent phenomena and may be more reflective of motivational deficits than deficits in the physiological integrity of the cardiovascular system. PMID:23756147
The Vanguard Faculty program: research training for complementary and alternative medicine faculty.
Connelly, Erin N; Elmer, Patricia J; Morris, Cynthia D; Zwickey, Heather
2010-10-01
The increasing use of complementary and alternative medicine (CAM) treatment is paralleled by a growing demand for an evidence-based approach to CAM practice. In 2007, the Helfgott Research Institute at the National College of Natural Medicine (NCNM), in partnership with Oregon Health & Science University (OHSU), both in Portland, OR, began a National Institutes of Health-funded initiative to increase the quality and quantity of evidence-based medicine (EBM) content in the curricula at NCNM. One key strategy of the Research in Complementary and Alternative Medicine Program (R-CAMP) initiative was to create a faculty development program that included four components: intensive training in EBM; professional skills enhancement; peer and mentored support; and, ultimately, utilization of these skills to incorporate EBM into the curricula. This initiative is centered on a core group of faculty at NCNM, called the Vanguard Faculty, who receives early, intensive training in EBM and works to incorporate this training into classes. Training consists of an intensive, week-long course, monthly group meetings, and periodic individualized meetings. Vanguard Faculty members also receive mentorship and access to resources to pursue individualized faculty development, research or scholarly activities. Early evaluations indicate that this effort has been successful in increasing EBM content in the curricula at NCNM. This article describes the Vanguard Faculty program in an effort to share the successes and challenges of implementing a wide-ranging faculty development and curricular initiative at a complementary and alternative medicine institution.
Malecka, Kamila; Michalczuk, Lech; Radecka, Hanna; Radecki, Jerzy
2014-10-09
A DNA biosensor for detection of specific oligonucleotides sequences of Plum Pox Virus (PPV) in plant extracts and buffer is proposed. The working principles of a genosensor are based on the ion-channel mechanism. The NH2-ssDNA probe was deposited onto a glassy carbon electrode surface to form an amide bond between the carboxyl group of oxidized electrode surface and amino group from ssDNA probe. The analytical signals generated as a result of hybridization were registered in Osteryoung square wave voltammetry in the presence of [Fe(CN)6]3-/4- as a redox marker. The 22-mer and 42-mer complementary ssDNA sequences derived from PPV and DNA samples from plants infected with PPV were used as targets. Similar detection limits of 2.4 pM (31.0 pg/mL) and 2.3 pM (29.5 pg/mL) in the concentration range 1-8 pM were observed in the presence of the 22-mer ssDNA and 42-mer complementary ssDNA sequences of PPV, respectively. The genosensor was capable of discriminating between samples consisting of extracts from healthy plants and leaf extracts from infected plants in the concentration range 10-50 pg/mL. The detection limit was 12.8 pg/mL. The genosensor displayed good selectivity and sensitivity. The 20-mer partially complementary DNA sequences with four complementary bases and DNA samples from healthy plants used as negative controls generated low signal.
Farsad-Naeimi, Alireza; Alizadeh, Mohammad; Esfahani, Ali; Darvish Aminabad, Esmaeil
2018-04-25
A growing body of evidence indicates that inflammation is associated with tumorigenesis, metastasis and chemotherapeutic resistance in patients with colorectal cancer (CRC). Natural flavonoids are promising agents for inflammation-related tumor progression in patients with CRC. This study aimed to assess the efficacy of flavonoid fisetin supplementation on the inflammatory status and matrix metalloproteinase (MMP) levels in these patients. In this double-blind, randomized placebo-controlled clinical trial, 37 CRC patients undergoing chemotherapy were assigned to receive either 100 mg fisetin (n = 18) or placebo (n = 19) for seven consecutive weeks. The supplementation began one week before chemotherapy and continued until the end of the second chemotherapy cycle. Levels of interleukin (IL)-8, IL-10, high-sensitivity C-reactive protein (hs-CRP), MMP-7, and MMP-9 were measured in plasma using ELISA, before and after the intervention. The trial was registered at http://www.irct.ir (code: IRCT2015110511288N9). The participants were 55.59 ± 15.46 years old with 62.16% being male. After the intervention, the plasma levels of IL-8 and hs-CRP reduced significantly in the fisetin group (p < 0.04 and p < 0.01, respectively). Additionally, fisetin supplementation suppressed the values of MMP-7 levels (p < 0.02). However, significant changes were observed only in IL-8 concentrations in the fisetin group when compared with the placebo group (p < 0.03). The changes in the levels of other metabolic factors were not statistically significant. According to the results, fisetin could improve the inflammatory status in CRC patients, suggesting it as a novel complementary antitumor agent for these patients and warranting further studies.
Jain, Rishabh; Agarwal, Ankit; Kierski, Patricia R.; Schurr, Michael J.; Murphy, Christopher J.; McAnulty, Jonathan F.; Abbott, Nicholas L.
2012-01-01
The development of versatile methods that provide spatial and temporal control over the presentation of physical and biochemical cues on wound beds can lead to new therapeutic approaches that expedite wound healing by favorably influencing cellular behaviors. Towards that goal, we report that native chemical functional groups presented by wound beds can be utilized for direct covalent attachment of polymeric microbeads. Specifically, we demonstrated the covalent attachment of maleimide-functionalized and catechol-functionalized microbeads, made of either polystyrene (non-degradable) or poly(lactic-co-glycolic acid) ((PLGA), degradable), to sulfhydryl and amine groups present on porcine dermis used here as an ex vivo model wound bed. A pronounced increase (10–70 fold) in the density and persistence of the covalently reactive microbeads was observed relative to microbeads that adsorb via non-covalent interactions. Complementary characterization of the surface chemistry of the ex vivo wound beds using Raman microspectroscopy provides support for our conclusion that the increased adherence of the maleimide-functionalized beads results from their covalent bond formation with sulfhydryl groups on the wound bed. The attachment of maleimide-functionalized microbeads to wounds created in live wild-type and diabetic mice led to observations of differential immobilization of microbeads on them and were consistent with anticipated differences in the presentation of sulfhydryl groups on the two different wound types. Finally, the incorporation of maleimide-functionalized microbeads in wounds created in wild-type mice did not impair the rate of wound closure relative to an untreated wound. Overall, the results presented in this paper enable a general and facile approach to the engineering of wound beds in which microbeads are covalently immobilized to wound beds. Such immobilized microbeads could be used in future studies to release bioactive factors (e.g., antimicrobial agents or growth factors) and/or introduce topographical cues that promote cell behaviors underlying healing and wound closure. PMID:23088838
[Complementary and alternative medicine: use in Montes Claros, Minas Gerais].
Neto, Joao Felício Rodrigues; Faria, Anderson Antônio de; Figueiredo, Maria Fernanda Santos
2009-01-01
To determine prevalence of utilization and social and economic profile of those using complementary and alternative medicine in the medium sized Brazilian city of Montes Claros, MG. A transversal descriptive study was conducted. The sample of 3090 people was probabilistic, by clusters using the household as the sample unit for interview of both genders, older than 18 years. Data were collected by semi-structured questionnaires. Utilization of complementary and alternative medicine was of 8.9% when only those involving costs such as homeopathy, acupuncture, chiropractics, techniques of relaxation/ meditation and massage are considered and of 70.0%, when all therapies found were included. Prevalent were prayers to God (52.0%), popular medicines (30.9%), physical exercises (25.5%), faith healers (15.0%), popular diets (7.1%), massage (4.9%), relaxation/meditation (2.8%), homeopathy (2.4%), and groups of self-help (1.9%), chiropractics (1.7%), acupuncture (1.5%) and orthomolecular medicine (0.2%). Women, Catholic, married of higher income and education were positively associated with utilization of therapies involving expenses. Complementary and alternative medicine is used by a significant number of those interviewed. Gender, religion, marital status, income and education were positively associated with utilization of complementary and alternative medicine. Access of those with less income and education could increase the utilization of the options that involve expenses.
Football Pools and the Reactivity Series of Metals.
ERIC Educational Resources Information Center
Heselden, Russ
2001-01-01
Describes an activity which presents the reactivity of metals series as a football pool with more reactive metals at the top of the table and unreactive metals at the bottom. Describes how the activity can be applied in different ways for different ability groups. (Author/MM)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Grady, Brian P.
2015-03-11
The scientific objective of this proposal was to obtain a fundamental atomic- to macro-scale understanding of the sorptivity, structure and dynamics of simple and complex hydrocarbon (HC) fluids at mineral surfaces or within nanoporous matrices over temperatures, pressures and compositions encountered in near-surface and shallow crustal environments. The research supported by this award was complementary to that conducted by the group of Prof. David cole at Ohio State University. The scope of the present award was to utilize molecular-level modeling to provide critically important insights into the interfacial properties of mineral-volatile systems, assist in the interpretation of experimental data andmore » predict fluid behavior beyond the limits of current experimental capability. During the past three years the effort has focused primarily on the behavior of C-H volatiles including methane (CH 4) and propane (C 3H 8), mixed-volatile systems including hydrocarbon - CO 2 with and without H 2O present. The long-range goal is to quantitatively link structure, dynamics and reactivity in complex mineral-/C-H-O systems from the atomic to the molecular to the macroscopic levels. The results are relevant to areas of growing importance such as gas shale, HC-bearing hydrothermal systems, and CO 2 storage.« less
Sattler, Tine; Sekulić, Damir; Spasić, Miodrag; Perić, Mia; Krolo, Ante; Uljević, Ognjen; Kondrič, Miran
2015-01-01
There is an evident lack of studies examining the factors associated with reactive agility performances. The aim of this study was to evaluate the association between anthropometrics, body composition, jumping capacity, reactive strength, and balance with a stop-and-go change of direction speed (CODS) and reactive agility. The total sample comprised 39 male (body height: 182.95 ± 5.19 cm; body mass: 80.66 ± 7.69 kg) and 34 female (body height: 171.45 ± 6.81 cm; body mass: 61.95 ± 6.70 kg) college-level athletes (21.9 ± 1.9 years of age). The variables included body height, body mass, the percentage of body fat (BF%), balance as measured by an overall-stability index, the countermovement jump (CMJ), a reactive-strength index (RSI), stop-and-go reactive agility, and stop-and-go CODS. To define the associations between motor and anthropometric variables with CODS and reactive agility, the participants were clustered into three achievement groups based on their CODS and reactive agility performances. The ANOVA showed a significant difference between the CODS-based achievement groups for the CMJ (F test = 3.45 and 3.60 for males and females, respectively; p < 0.05), the RSI (F test = 6.94 and 5.29 for males and females, respectively; p < 0.05), and balance (F test = 3.47; p < 0.05 for males). In females, the reactive agility achievement groups differed significantly in the RSI (F test = 6.46; p < 0.05), the CMJ (F test = 4.35; p < 0.05) and BF% (F test = 4.07; p < 0.05), which is further confirmed by discriminant canonical analysis (Can R = 0.74; p < 0.05). The results confirm the need for independent evaluation and training for both CODS and reactive agility performance in sports. PMID:26557198
Study and modification of the reactivity of carbon fibers
NASA Technical Reports Server (NTRS)
Walker, P. L., Jr.; Ismail, I. M.; Mahajan, O. P.; Eapen, T. A.
1980-01-01
The reactivity to air of polyactylonitrile-based carbon fiber cloth was enhanced by the addition of metals to the cloth. The cloth was oxidized in 54 wt% nitric acid in order to increase the surface area of the cloth and to add carbonyl groups to the surface. Metal addition was then achieved by soaking the cloth in metal acetate solution to effect exchange between the metal carbon and hydrogen on the carbonyl groups. The addition of potassium, sodium, calcium and barium enhanced fiber cloth reactivity to air at 573 K. Extended studies using potassium addition showed that success in enhancing fiber cloth reactivity to air depends on: extent of cloth oxidation in nitric acid, time of exchange in potassium acetate solution and the thoroughness of removing metal acetate from the fiber pore structure following exchange. Cloth reactivity increases essentially linearly with increase in potassium addition via exchange.
Cardiovascular responses to stress in Singapore and India.
Kaur, Divjyot; Bishop, George D
2013-02-01
Epidemiological studies have shown significant ethnic differences in coronary heart disease death rates with South Asians showing significantly greater coronary heart disease mortality than other groups. This research examined ethnic differences in cardiovascular reactivity (CVR) among Chinese, Malays and Indians in Singapore as well as a sample of Indians living in India. Experiment 1 examined differences across 303 Chinese, Malay and Indian undergraduates in Singapore, while Experiment 2 looked at differences in CVR between Indian participants from Singapore, and 145 Indians living in India. Systolic and diastolic blood pressure (SBP, DBP), heart rate (HR), cardiac index (CI) and total peripheral resistance index (TPRI) were measured during baselines and five laboratory tasks. Ethnicity main effects for SBP and CI reactivity were obtained in Experiment 1, with Indians showing significantly lower BP and CI reactivity than the Chinese and Malays. Significant main effects for sex were found with females showing lower reactivity than males for TPRI, and greater reactivity than males for HR and CI. Experiment 2 found that participants from India showed higher reactivity for SBP, HR and CI, while Indian participants from Singapore showed higher TPRI reactivity. These differences, however, often varied by task. These results point to differences in CVR among ethnic groups in Singapore as well as between Indians living in India and those living in Singapore. These differences may reflect cultural differences and need to be explored further with respect to their relationship to different rates of coronary heart disease among these groups. Copyright © 2012 Elsevier B.V. All rights reserved.
Hell, Franz; Taylor, Paul C J; Mehrkens, Jan H; Bötzel, Kai
2018-05-01
Inhibitory control is an important executive function that is necessary to suppress premature actions and to block interference from irrelevant stimuli. Current experimental studies and models highlight proactive and reactive mechanisms and claim several cortical and subcortical structures to be involved in response inhibition. However, the involved structures, network mechanisms and the behavioral relevance of the underlying neural activity remain debated. We report cortical EEG and invasive subthalamic local field potential recordings from a fully implanted sensing neurostimulator in Parkinson's patients during a stimulus- and response conflict task with and without deep brain stimulation (DBS). DBS made reaction times faster overall while leaving the effects of conflict intact: this lack of any effect on conflict may have been inherent to our task encouraging a high level of proactive inhibition. Drift diffusion modelling hints that DBS influences decision thresholds and drift rates are modulated by stimulus conflict. Both cortical EEG and subthalamic (STN) LFP oscillations reflected reaction times (RT). With these results, we provide a different interpretation of previously conflict-related oscillations in the STN and suggest that the STN implements a general task-specific decision threshold. The timecourse and topography of subthalamic-cortical oscillatory connectivity suggest the involvement of motor, frontal midline and posterior regions in a larger network with complementary functionality, oscillatory mechanisms and structures. While beta oscillations are functionally associated with motor cortical-subthalamic connectivity, low frequency oscillations reveal a subthalamic-frontal-posterior network. With our results, we suggest that proactive as well as reactive mechanisms and structures are involved in implementing a task-related dynamic inhibitory signal. We propose that motor and executive control networks with complementary oscillatory mechanisms are tonically active, react to stimuli and release inhibition at the response when uncertainty is resolved and return to their default state afterwards. Copyright © 2018 Elsevier Inc. All rights reserved.
Vaezi, Mohammad; Kasaeian, Amir; Souri, Maryam; Soufiyan, Faeze; Shokri Boosjin, Amir; Setarehdan, Seyed Amin; Alimoghaddam, Kamran; Ghavamzadeh, Ardeshir
2017-07-01
Background : This study evaluated CMV serostatus in donors and recipients of hematopoietic stem cell transplantation (HSCT) and its effects on CMV reactivation of patients and all aspects of CMV on HSCT outcomes. Materials and Methods : Seven hundred and five adult acute leukemia patients (AML=408 and AML=297) who had undergone HSCT were included in this retrospective study. We categorized donor-recipient pairs in three risk groups: positive donors (D+) were studied as high-risk group, including either R+ or R-(n=485), R-D- as low-risk group (n=32) and R+D- as intermediate group (n=15). Results: There was no statistically difference in CMV reactivation among these risk groups (P=0.14).CMV infection rate was lower in R+D+ than R+D-(p=0.050). Multivariate analysis showed that patients developing CMV infection had lower overall survival (p=0.04, HR: 1.43, CI=1.00- 2.05) and higher non- relapse mortality (P=0.01, HR: 1.62, CI=1.11-2.38). Relapse rate did not change in CMV reactivated patients (P=0.94). Conclusion: The results of the study indicated that asCMV reactivation occurred more in R+D- patients compared to R+D+ ones, and was associated with inferior OS and higher NRM it could be suggested that in contrast to general belief, if the recipient is seropositive , seropositive donor is preferred to a seronegative one.
Bollineni, Ravi Chand; Fedorova, Maria; Hoffmann, Ralf
2013-09-07
Mass spectrometry (MS) of 'carbonylated proteins' often involves derivatization of reactive carbonyl groups to facilitate their enrichment, identification and quantification. Among the many reported reagents, 2,4-dinitrophenylhydrazine (DNPH), biotin hydrazide (BHZ) and O-(biotinylcarbazoylmethyl) hydroxylamine (ARP) are the most frequently used. Despite their common use in carbonylation research, their reactivity towards protein-bound carbonyls has not been quantitatively evaluated in detail, to the best of our knowledge. Thus we studied the reactivity and specificity of these reagents towards different classes of reactive carbonyl groups (e.g. aldehydes, ketones and lactams), each being represented by a synthetic peptide carrying an accordingly modified residue. All three tagging reagents were selective for aliphatic aldehydes and ketones. Lactams and carbonyl-containing tryptophan oxidation products, however, were labelled only at low levels or not at all. Whereas DNPH derivatization was efficient under the published standard conditions, the derivatization conditions for BHZ and ARP had to be altered. Acidic conditions provided quantitative labelling yields for ARP. Peptides derivatized with DNPH, BHZ and ARP fragmented efficiently in tandem mass spectrometry, when the experimental conditions were chosen carefully for each reagent. Importantly, the tested carbonylated peptides did not cross-react with amino groups in other proteins present during sample preparations or enzymatic digestion. Thus, it appears favourable to digest proteins first and then derivatise the reactive carbonyl groups more efficiently at the peptide level under acidic conditions. The carbonylated model peptides used in this study might be valid internal standards for carbonylation proteomics.
Tvarijonaviciute, Asta; Aznar-Cayuela, Cristina; Rubio, Camila P; Ceron, José J; López-Jornet, Pia
2017-05-01
The aim of this study was to evaluate oxidative stress factors and C-reactive protein in the saliva of patients with oral lichen planus (OLP) and burning mouth syndrome (BMS). This consecutive, cross-sectional study included 20 patients with OLP, 19 with burning mouth syndrome (BMS), and 31 control subjects. The oral cavity of each patient was examined and patients responded to a quality of life questionnaire (OHIP-14) and the xerostomia inventory. The following parameters were measured in whole non-stimulated saliva: trolox equivalent antioxidant capacity (TEAC); total antioxidant capacity (TAC); cupric reducing antioxidant capacity (CUPRAC); ferric reducing ability of plasma (FRAP); C-reactive protein (CRP); nitric oxide; nitrates; and nitrites. The OLP group presented statistically significant differences in reactive oxygen species (ROS) (29 600 cps) in comparison with the control group (39 679 cps) (P < 0.05). In the BMS group, ROS was 29 707 cps with significant difference in comparison with the control group (P < 0.05). Significantly higher salivary nitric oxide (145.7 μmol) and nitrite (141.0 μmol) levels were found in OLP patients in comparison with control group (P < 0.05). Increases in nitric oxide and C-reactive protein were found in the saliva of OLP patients in comparison with BMS and control patients. Further studies are required to confirm these findings. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
ERIC Educational Resources Information Center
Pappas, James P.; Linden, James D.
Recent studies have shown that incarcerated primary sociopathic subjects, selected by the Activities Preference Questionnaire (APQ), demonstrate atypical anxiety reactivity when compared with other incarcerated or normal subjects. This study attempted to extend the experimental data relating anxiety reactivity and sociopathy. Three groups of…
75 FR 60089 - Federal Advisory Committee; Defense Health Board (DHB) Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2010-09-29
... Evidence-Based Metrics Recommendations. The Board will vote on recommendations regarding proposed revisions... Medication and Complementary and Alternative Medicine Use Work Groups, and Military Occupational...
Suri, Devika J; Tano-Debrah, Kwaku; Ghosh, Shibani A
2014-09-01
Nutritionally adequate complementary foods made from locally available ingredients are of high priority in developing countries, including Ghana. The majority of complementary foods in these countries are cereal-based and are unable to meet the nutrient intakes recommended by the World Health Organization. To evaluate the nutrient content and protein quality of local cereal-legume blends for complementary foods against recommendations and to determine the quantities of additional ingredients required to meet needs by using linear programming. Nine cereal-legume combinations (maize, sorghum, or millet combined with cowpea, peanut, or soybean) and koko (a traditional Ghanaian maize-based complementary food) were evaluated based on the macronutrient targets for a daily ration of complementary food for the age group 12 to 24 months: 264 kcal, 6.5 g of protein, and 8.2 to 11.7 g of fat. Protein quality was assessed by the Protein Digestibility Corrected Amino Acid Score (PDCAAS). Linear programming was then used to determine the amounts of additional oil, sugar, and lysine needed to meet macronutrient requirements. No traditional cereal-legume food met all complementary food macronutrient requirements on its own. Cereal-legume blends made with peanut or cowpeas were low in quality protein, while those with soybean were low in fat. Lysine was the limiting amino acid (PDCAAS 0.50 to 0.82) in all blends. Adding lysine increased utilizable protein by 1% to 10% in soybean blends, 35% to 40% in peanut blends, and 14% to 24% in cowpea blends. Peanut-maize, peanut-millet, and all soybean-cereal blends were able to meet macronutrient targets; most micronutrients remained below recommended levels. Traditional cereal-legume blends made from locally available ingredients do not meet energy, quality protein, and fat recommendations for complementary foods; however, such complementary food blends may be optimized to meet nutrient requirements by using linear programming as a tool to determine the exact levels of fortificants to be added (including, but not limited to, added fat, amino acids, and micronutrients).
Wang, Wei; Hu, Fa-Yun; Wu, Xin-Tong; An, Dong-Mei; Yan, Bo; Zhou, Dong
2014-08-01
The cross-allergic reactions among aromatic antiepileptic drugs (AEDs) are common, but little is known about the genetic mechanisms. The aim of this study was to investigate the genetic associations of the human leukocyte antigen (HLA) genes with the cross-reactivity of cutaneous adverse drug reactions (cADRs) induced by different aromatic AEDs. We reviewed 60 Chinese patients with a history of cADRs induced by an aromatic AED, and which re-challenged other aromatic AEDs as an alternative to the causative AED owing to some particular reasons. According to whether developing another episode of cADRs, these patients were automatically divided into the cross-reactivity group and tolerant control group. High-resolution HLA-A, -B, -DRB1 genotyping were performed for each patient. One out of 10 patients (10%, 1/10) carried the HLA-A*2402 allele in the cross-reactivity group. However, 23 patients (46%, 23/50) carried this allele in the tolerant control group. The difference of the HLA-A*2402 allele between the two groups is statistically significant (P=0.040, OR=0.130, 95% CI: 0.015-1.108). In addition, the frequency differences of other HLA alleles between the two groups, including the HLA-B*1502 allele, did not reach statistical significance (P>0.05). The HLA genes contribute to the genetic susceptibility of the cross-reactivity of cADRs among aromatic AEDs. Our results suggest that HLA-B*1502 is not a major responsible allele for the cross-reactivity of cADRs to aromatic AEDs, but the HLA-A*2402 allele may be a protective marker for the cross-allergic reactions among aromatic AEDs in Han Chinese. Further studies are warranted to test the potential predictive value of the HLA-A*2402 allele in future. Copyright © 2014. Published by Elsevier B.V.
Hilal, Talal; Slone, Stacey; Peterson, Shawn; Bodine, Charles; Gul, Zartash
2017-06-01
The association between cytomegalovirus (CMV) reactivation and relapse risk has not been evaluated in relation to T cell depletion strategies. We evaluated 93 patients who underwent allogeneic hematopoietic stem cell transplantation (HSCT) and analyzed the association between T cell depletion strategies with the cumulative incidence of relapse and CMV reactivation. A total of 33% of patients who received ATG vs. 34% who received alemtuzumab developed CMV reactivation. The cumulative incidence of relapse was 3% at 1year and 20% at 3 years in patients with CMV reactivation vs. 30% at 1year and 38% at 3 years in patients without CMV reactivation (p=0.02). When analyzed separately, this effect persisted in the myeloid, but not the lymphoid group. There was a numerical trend towards increased non-relapse mortality (NRM) in patients with CMV reactivation, especially in the myeloid group. The choice of T cell depleting agent and the rate of CMV reactivation were not associated with different overall survival (OS) rates. These results suggest that the choice of T cell depletion strategy may have similar effects on rates of CMV reactivation, disease relapse, and survival. Further studies examining these variables in patients not exposed to in-vivo T cell depleting agents may be of interest. Copyright © 2017 Elsevier Ltd. All rights reserved.
Thakare, Kaustubh S; Deo, Vikas; Bhongade, Manohar L
2010-01-01
Several studies suggested an association between periodontal disease and cardiovascular disease (CVD). C- reactive protein is elevated in periodontitis patients and has been found to be a predictor of increased risk for cardiovascular disease. Since, CRP is known to play a role in pathogenesis of atherosclerosis, the present study was undertaken to evaluate the serum levels of CRP in periodontitis patients with or without atherosclerosis. A total of 45 patients, 15 chronic periodontitis patients with atherosclerosis (Group A), 15 chronic periodontitis patients with no history of any systemic disease (Group B), and 15 clinically healthy individuals with no history of periodontal or systemic disease (Group C) within age range of 30 to 55 years were selected for the study. PI, PBI, PPD, CAL and radiographic marginal alveolar bone level were assessed in all the three groups. CRP levels were assessed with 'Turbi-latex' kit using turbidimetric analysis. The mean CAL recorded was 4.9mm in group A, 4.6mm in group B and 1.9 mm in group C. The mean radiographic marginal bone level was 45 to 50% in group A, 45 to 50% in group B and 90 to 95% in group C. Mean serum C-reactive protein level was significantly higher in group A (8.9 mg/l), as compared to group B (4.9 mg/l) as well as group C (0.9 mg/l). Within the limits of this study it was concluded that periodontitis may add to the inflammatory burden of the individual and may result in increased risk of atherosclerosis based on serum C-reactive protein concentrations.
Paltrinieri, Saverio; Ravicini, Sara; Rossi, Gabriele; Roura, Xavier
2010-12-01
Leishmania infantum interferes with the oxidative metabolism of phagocytes. In order to assess whether derivatives of reactive oxygen metabolites (d-ROMs) decrease due to infection or increase due to inflammation, d-ROMs were measured in serum collected from control dogs (Group 1; n = 12), from dogs seropositive for Leishmania either symptomatic (Group 2; n = 27) or not (Group 3; n = 14), and from dogs with other diseases (Group 4; n = 16). The concentrations of d-ROMs in the four groups, expressed in Carratelli Units (U CARR) were, respectively, 75.4 ± 39.5 (median, 81.6), 108.2 ± 96.3 (73.4), 73.5 ± 62.2 (62.0), 127.7 ± 97.3 (94.3). There were no significant differences between groups, but dogs with values higher than the reference interval were found, mostly in Groups 2 and 4 (which had serum C-reactive protein levels consistent with inflammation), whilst low values were occasionally found in Groups 2 and 3. Inflammation may mask decreases in d-ROMs induced by Leishmania infection. Copyright © 2009 Elsevier Ltd. All rights reserved.
Planned and reactive agility performance in semiprofessional and amateur basketball players.
Lockie, Robert G; Jeffriess, Matthew D; McGann, Tye S; Callaghan, Samuel J; Schultz, Adrian B
2014-09-01
Research indicates that planned and reactive agility are different athletic skills. These skills have not been adequately assessed in male basketball players. To define whether 10-m-sprint performance and planned and reactive agility measured by the Y-shaped agility test can discriminate between semiprofessional and amateur basketball players. Ten semiprofessional and 10 amateur basketball players completed 10-m sprints and planned- and reactive-agility tests. The Y-shaped agility test involved subjects sprinting 5 m through a trigger timing gate, followed by a 45° cut and 5-m sprint to the left or right through a target gate. In the planned condition, subjects knew the cut direction. For reactive trials, subjects visually scanned to find the illuminated gate. A 1-way analysis of variance (P < .05) determined between-groups differences. Data were pooled (N = 20) for a correlation analysis (P < .05). The reactive tests differentiated between the groups; semiprofessional players were 6% faster for the reactive left (P = .036) and right (P = .029) cuts. The strongest correlations were between the 10-m sprints and planned-agility tests (r = .590-.860). The reactive left cut did not correlate with the planned tests. The reactive right cut moderately correlated with the 10-m sprint and planned right cut (r = .487-.485). The results reemphasized that planned and reactive agility are separate physical qualities. Reactive agility discriminated between the semiprofessional and amateur basketball players; planned agility did not. To distinguish between male basketball players of different ability levels, agility tests should include a perceptual and decision-making component.
Lionetti, Francesca; Aron, Arthur; Aron, Elaine N; Burns, G Leonard; Jagiellowicz, Jadzia; Pluess, Michael
2018-01-22
According to empirical studies and recent theories, people differ substantially in their reactivity or sensitivity to environmental influences with some being generally more affected than others. More sensitive individuals have been described as orchids and less-sensitive ones as dandelions. Applying a data-driven approach, we explored the existence of sensitivity groups in a sample of 906 adults who completed the highly sensitive person (HSP) scale. According to factor analyses, the HSP scale reflects a bifactor model with a general sensitivity factor. In contrast to prevailing theories, latent class analyses consistently suggested the existence of three rather than two groups. While we were able to identify a highly sensitive (orchids, 31%) and a low-sensitive group (dandelions, 29%), we also detected a third group (40%) characterised by medium sensitivity, which we refer to as tulips in keeping with the flower metaphor. Preliminary cut-off scores for all three groups are provided. In order to characterise the different sensitivity groups, we investigated group differences regarding the Big Five personality traits, as well as experimentally assessed emotional reactivity in an additional independent sample. According to these follow-up analyses, the three groups differed in neuroticism, extraversion and emotional reactivity to positive mood induction with orchids scoring significantly higher in neuroticism and emotional reactivity and lower in extraversion than the other two groups (dandelions also differed significantly from tulips). Findings suggest that environmental sensitivity is a continuous and normally distributed trait but that people fall into three distinct sensitive groups along a sensitivity continuum.
Vivas, David; García-Rubira, Juan C; Bernardo, Esther; Angiolillo, Dominick J; Martín, Patricia; Calle-Pascual, Alfonso; Núñez-Gil, Iván; Macaya, Carlos; Fernández-Ortiz, Antonio
2011-05-01
Hyperglycaemia has been associated with increased platelet reactivity and impaired prognosis in patients with acute coronary syndrome (ACS). Whether platelet reactivity can be reduced by lowering glucose in this setting is unknown. The aim of this study was to assess the functional impact of intensive glucose control with insulin on platelet reactivity in patients admitted with ACS and hyperglycaemia. This is a prospective, randomised trial evaluating the effects of either intensive glucose control (target glucose 80-120 mg/dl) or conventional control (target glucose 180 mg/dl or less) with insulin on platelet reactivity in patients with ACS and hyperglycaemia. The primary endpoint was platelet aggregation following stimuli with 20 μM ADP at 24 h and at hospital discharge. Aggregation following collagen, epinephrine and thrombin receptor-activated peptide, as well as P2Y₁₂ reactivity index and surface expression of glycoprotein IIb/IIIa and P-selectin were also measured. Of the 115 patients who underwent random assignment, 59 were assigned to intensive and 56 to conventional glucose control. Baseline platelet functions and inhospital management were similar in both groups. Maximal aggregation after ADP stimulation at hospital discharge was lower in the intensive group (47.9 ± 13.2% vs 59.1 ± 17.3%; p=0.002), whereas no differences were found at 24 h. Similarly all other parameters of platelet reactivity measured at hospital discharge were significantly reduced in the intensive glucose control group. In this randomised trial, early intensive glucose control with insulin in patients with ACS presenting with hyperglycaemia was found to decrease platelet reactivity. Clinical Trial Registration Number http://www.controlledtrials.com/ISRCTN35708451/ISRCTN35708451.
Clinical relevance of trace element measurement in patients on initiation of parenteral nutrition.
Salota, Rashim; Omar, Sohail; Sherwood, Roy A; Raja, Kishor; Vincent, Royce P
2016-11-01
Background and Aims Serum zinc, copper and selenium are measured in patients prior to commencing on parenteral nutrition; however, their interpretation can be difficult due to acute phase reactions. We assessed (i) the relationship of raised C-reactive protein with trace elements and albumin (ii) benefits of measuring trace elements when C-reactive protein is raised in patients requiring short-term parenteral nutrition. Methods Samples were collected for zinc, copper, selenium and albumin at baseline and then every two weeks and correlated with C-reactive protein results in patients on parenteral nutrition. Results were categorized into four groups based on the C-reactive protein concentrations: (i) <20 mg/L, (ii) 20-39 mg/L, (iii) 40-79 mg/L and (iv) ≥80 mg/L. Results In 166 patients, zinc, selenium and albumin correlated (Spearman's) negatively with C-reactive protein; r = -0.26, P < 0.001 (95% CI -0.40 to -0.11), r = -0.44, P < 0.001 (-0.56 to -0.29) and r = -0.22 P = 0.005 (-0.36 to -0.07), respectively. Copper did not correlate with C-reactive protein (r = 0.09, P = 0.25 [-0.07 to 0.25]). Comparison of trace elements between the four groups showed no difference in zinc and copper (both P > 0.05), whereas selenium and albumin were lower in the group with C-reactive protein > 40 mg/L ( P < 0.05). Conclusion In patients on short-term parenteral nutrition, measurement of C-reactive protein is essential when interpreting zinc and selenium but not copper results. Routine measurement of trace elements prior to commencing parenteral nutrition has to be considered on an individual basis in patients with inflammation.
Behavioral Reactivity and Approach-Withdrawal Bias in Infancy
Hane, Amie Ashley; Fox, Nathan A.; Henderson, Heather A.; Marshall, Peter J.
2008-01-01
Seven hundred and seventy nine infants were screened at 4 months of age for motor and emotional reactivity. At age 9 months, infants who showed extreme patterns of motor and negative (n = 75) or motor and positive (n = 73) reactivity and an unselected control group (n = 86) were administered the Laboratory Temperament Assessment Battery (Lab-TAB), and baseline electroencephalogram (EEG) data were collected. Negatively reactive infants showed significantly more avoidance than positively reactive infants and displayed a pattern of right frontal EEG asymmetry. Positively reactive infants exhibited significantly more approach behavior than controls and exhibited a pattern of left frontal asymmetry. Results support the notion that approach-withdrawal bias underlies reactivity in infancy. PMID:18793079
C- and N-Metalated Nitriles: The Relationship between Structure and Selectivity.
Yang, Xun; Fleming, Fraser F
2017-10-17
Metalated nitriles are exceptional nucleophiles capable of forging highly hindered stereocenters in cases where enolates are unreactive. The excellent nucleophilicity emanates from the powerful inductive stabilization of adjacent negative charge by the nitrile, which has a miniscule steric demand. Inductive stabilization is the key to understanding the reactivity of metalated nitriles because this permits a continuum of structures that range from N-metalated ketenimines to nitrile anions. Solution and solid-state analyses reveal two different metal coordination sites, the formally anionic carbon and the nitrile nitrogen, with the site of metalation depending intimately on the solvent, counterion, temperature, and ligands. The most commonly encountered structures, C- and N-metalated nitriles, have either sp 3 or sp 2 hybridization at the nucleophilic carbon, which essentially translates into two distinct organometallic species with similar but nonidentical stereoselectivity, regioselectivity, and reactivity preferences. The hybridization differences are particularly important in S N i displacements of cyclic nitriles because the orbital orientations create very precise trajectories that control the cyclization selectivity. Harnessing the orbital differences between C- and N-metalated nitriles allows selective cyclization to afford nitrile-containing cis- or trans-hydrindanes, decalins, or bicyclo[5.4.0]undecanes. Similar orbital constraints favor preferential S N i displacements with allylic electrophiles on sp 3 centers over sp 2 centers. The strategy permits stereoselective displacements on secondary centers to set contiguous tertiary and quaternary stereocenters or even contiguous vicinal quaternary centers. Stereoselective alkylations of acyclic nitriles are inherently more challenging because of the difficulty in creating steric differentiation in a dynamic system with rotatable bonds. However, judicious substituent placement of vicinal dimethyl groups and a trisubstituted alkene sufficiently constrains C- and N-metalated nitriles to install quaternary stereocenters with excellent 1,2-induction. The structural differences between C- and N-metalated nitriles permit a rare series of chemoselective alkylations with bifunctional electrophiles. C-Magnesiated nitriles preferentially react with carbonyl electrophiles, whereas N-lithiated nitriles favor S N 2 displacement of alkyl halides. The chemoselective alkylations potentially provide a strategy for late-stage alkylations of polyfunctional electrophiles en route to bioactive targets. In this Account, the bonding of metalated nitriles is summarized as a prelude to the different strategies for selectively preparing C- and N-metalated nitriles. With this background, the Account then transitions to applications in which C- or N-metalated nitriles allow complementary diastereoselectivity in alkylations and arylations, and regioselective alkylations and arylations, with acyclic and cyclic nitriles. In the latter sections, a series of regiodivergent cyclizations are described that provide access to cis- and trans-hydrindanes and decalins, structural motifs embedded within a plethora of natural products. The last section describes chemoselective alkylations and acylations of C- and N-metalated nitriles that offer the tantalizing possibility of selectively manipulating functional groups in bioactive medicinal leads without recourse to protecting groups. Collectively, the unusual reactivity profiles of C- and N-metalated nitriles provide new strategies for rapidly and selectively accessing valuable synthetic precursors.
A phenotype of early infancy predicts reactivity of the amygdala in male adults.
Schwartz, C E; Kunwar, P S; Greve, D N; Kagan, J; Snidman, N C; Bloch, R B
2012-10-01
One of the central questions that has occupied those disciplines concerned with human development is the nature of continuities and discontinuities from birth to maturity. The amygdala has a central role in the processing of novelty and emotion in the brain. Although there is considerable variability among individuals in the reactivity of the amygdala to novel and emotional stimuli, the origin of these individual differences is not well understood. Four-month old infants called high reactive (HR) demonstrate a distinctive pattern of vigorous motor activity and crying to specific unfamiliar visual, auditory and olfactory stimuli in the laboratory. Low-reactive infants show the complementary pattern. Here, we demonstrate that the HR infant phenotype predicts greater amygdalar reactivity to novel faces almost two decades later in adults. A prediction of individual differences in brain function at maturity can be made on the basis of a single behavioral assessment made in the laboratory at 4 months of age. This is the earliest known human behavioral phenotype that predicts individual differences in patterns of neural activity at maturity. These temperamental differences rooted in infancy may be relevant to understanding individual differences in vulnerability and resilience to clinical psychiatric disorder. Males who were HR infants showed particularly high levels of reactivity to novel faces in the amygdala that distinguished them as adults from all other sex/temperament subgroups, suggesting that their amygdala is particularly prone to engagement by unfamiliar faces. These findings underline the importance of taking gender into account when studying the developmental neurobiology of human temperament and anxiety disorders. The genetic study of behavioral and biologic intermediate phenotypes (or 'endophenotypes') indexing anxiety-proneness offers an important alternative to examining phenotypes based on clinically defined disorder. As the HR phenotype is characterized by specific patterns of reactivity to elemental visual, olfactory and auditory stimuli, well before complex social behaviors such as shyness or fearful interaction with strangers can be observed, it may be closer to underlying neurobiological mechanisms than behavioral profiles observed later in life. This possibility, together with the fact that environmental factors have less time to impact the 4-month phenotype, suggests that this temperamental profile may be a fruitful target for high-risk genetic studies.
The Scripps Research Institute (La Jolla, CA)
Schultz, Peter G.; Wang, Lei
2010-01-05
The invention provides proteins attached to solid supports, and methods of preparing such solid support-bound proteins are provided. The proteins are attached to solid supports by means of an unnatural amino acid incorporated into the protein, which unnatural amino acid includes a reactive group that can react with a second reactive group that is attached to a solid support.
Sensory Clusters of Adults with and without Autism Spectrum Conditions
ERIC Educational Resources Information Center
Elwin, Marie; Schröder, Agneta; Ek, Lena; Wallsten, Tuula; Kjellin, Lars
2017-01-01
We identified clusters of atypical sensory functioning adults with ASC by hierarchical cluster analysis. A new scale for commonly self-reported sensory reactivity was used as a measure. In a low frequency group (n = 37), all subscale scores were relatively low, in particular atypical sensory/motor reactivity. In the intermediate group (n = 17)…
Solid polymer battery electrolyte and reactive metal-water battery
Harrup, Mason K.; Peterson, Eric S.; Stewart, Frederick F.
2000-01-01
In one implementation, a reactive metal-water battery includes an anode comprising a metal in atomic or alloy form selected from the group consisting of periodic table Group 1A metals, periodic table Group 2A metals and mixtures thereof. The battery includes a cathode comprising water. Such also includes a solid polymer electrolyte comprising a polyphosphazene comprising ligands bonded with a phosphazene polymer backbone. The ligands comprise an aromatic ring containing hydrophobic portion and a metal ion carrier portion. The metal ion carrier portion is bonded at one location with the polymer backbone and at another location with the aromatic ring containing hydrophobic portion. The invention also contemplates such solid polymer electrolytes use in reactive metal/water batteries, and in any other battery.
Ogino, Takamichi; Ueda, Takayuki; Ogami, Koichiro; Koike, Takashi; Sakurai, Kaoru
2017-01-01
We examined how chewing rate and the extent of reactive hyperemia affect the blood flow in denture-supporting mucosa during chewing. The left palatal mucosa was loaded under conditions of simulated chewing or simulated clenching for 30s, and the blood flow during loading was recorded. We compared the relative blood flow during loading under conditions that recreated different chewing rates by combining duration of chewing cycle (DCC) and occlusal time (OT): fast chewing group, typical chewing group, slow chewing group and clenching group. The relationship between relative blood flow during simulated chewing and the extent of reactive hyperemia was also analyzed. When comparing the different chewing rate, the relative blood flow was highest in fast chewing rate, followed by typical chewing rate and slow chewing rate. Accordingly, we suggest that fast chewing increases the blood flow more than typical chewing or slow chewing. There was a significant correlation between the amount of blood flow during simulated chewing and the extent of reactive hyperemia. Within the limitations of this study, we concluded that slow chewing induced less blood flow than typical or fast chewing in denture-supporting mucosa and that people with less reactive hyperemia had less blood flow in denture-supporting mucosa during chewing. Copyright © 2016 Japan Prosthodontic Society. Published by Elsevier Ltd. All rights reserved.
Complementary feeding recommendations based on locally available foods in Indonesia.
Fahmida, Umi; Santika, Otte; Kolopaking, Risatianti; Ferguson, Elaine
2014-12-01
Affordable, locally contextual complementary feeding recommendations (CFRs) that take into account cultural diversity and differences in food availability will be more likely to result in long-term improvements in complementary feeding practices than general recommendations. More objective approaches, such as linear programming (LP), have been recommended to identify optimal but CFRs to meet nutrient requirements given local food availability, food patterns, food portions, and cost. To present results of our previous studies in which we developed CFRs using LP and to provide an example of how these CFRs can be put into practice in a community intervention trial in Indonesia. Dietary data were obtained using single 24-hour dietary recall or 1-day weighed diet record combined with 1-day 24-hour recall and 5-day food intake tally. With the use of the LP approach, nutrient intakes were optimized while ensuring that a realistic diet was selected by using constraints such as the diet's energy content, food patterns, food portions, and cost. The price per 100 g of edible portion was obtained from market surveys in two or three local markets in each study area. LP analysis was performed using Super Solver in MS Excel or Optifood software. Iron, zinc, calcium, and niacin were problem nutrients in all age groups of children (6 to 8, 9 to 11, and 12 to 23 months) in both rural and periurban areas, except among children of higher socioeconomic status in urban areas. Thiamin and folate were also problem nutrients found in some settings. Animal-source foods (meat, fish, poultry, and eggs [MFPE] and fortified foods were the nutrient-dense foods identified by LP to fill the nutrient gaps of these problem nutrients. Iron, calcium, zinc, niacin, and potentially folate and thiamine are typical "problem nutrients" in complementary foods of Indonesian children. However, the extent of dietary inadequacy varies across age groups, area, and socioeconomic level. MFPE and fortified foods can improve micronutrient adequacy in complementary feeding diets and should be promoted in CFRs.
Emotional and physiological reactivity in Complicated Grief.
LeBlanc, Nicole J; Unger, Leslie D; McNally, Richard J
2016-04-01
Grief is a psychobiological response to the loss of a loved one. Some grief theorists suggest that this predictable response may arise from withdrawal of psychobiological regulation previously provided by the deceased (e.g. assistance with emotion regulation). Accordingly, recovery from loss may require bereaved individuals to re-establish self-regulatory control to avoid developing Complicated Grief (CG). This model implies that adults with CG may exhibit aberrant emotional responding to environmental stimuli. The present study was designed to test this hypothesis. We recruited a sample of 23 bereaved adults with CG and 26 healthy bereaved adults to complete an emotional reactivity paradigm. Participants watched a series of emotional film clips and provided measures of their self-reported emotional response. We also assessed their heart rate, respiratory sinus arrhythmia (RSA), and skin conductance level in response to these clips. Though emotional and physiological differences between the groups were rare, the CG group exhibited attenuated RSA reactivity to some emotional film clips, suggesting blunted parasympathetic nervous system reactivity in those with the disorder. Limitations include the modest sample size and unequal group sizes. Individuals with CG do not exhibit pervasive differences in emotional and physiological reactivity compared to healthy bereaved individuals. However, we did observe evidence of blunted parasympathetic nervous system reactivity in individuals with CG, which may mediate emotional inflexibility among those who develop the disorder. Copyright © 2016 Elsevier B.V. All rights reserved.
Strebel, S; Kaufmann, M; Guardiola, P M; Schaefer, H G
1994-05-01
Carbon dioxide reactivity, as measured by transcranial Doppler ultrasonography, was determined during total intravenous anesthesia with propofol or midazolam in comparison with an awake control group. Thirty ASA physical status I neurosurgical patients undergoing lumbar laminectomy participated in the study. In randomized order they were subjected to a CO2 reactivity challenge, either under an intravenous anesthesia technique or in the awake state. CO2 reactivity was calculated in each study group as a relative change in middle cerebral artery (MCA) flow velocity per mm Hg change in end-tidal CO2 (PETCO2) (%/mm Hg). The cerebrovascular response to changes in CO2 was preserved during intravenous anesthesia. There was a significant difference (P < 0.05) in the reactivity slopes between the awake and the anesthetized patients with a small but not significant difference between the propofol and the midazolam group. We conclude that hypocarbia is effective in reducing cerebral blood flow velocity (CBFV) during intravenous anesthesia, either with propofol or midazolam.
Plasma treatment of polymers for improved adhesion
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kelber, J.A.
1988-01-01
A variety of plasma treatments of polymer surfaces for improved adhesion are reviewed: noble and reactive gas treatment of fluoropolymers; noble and reactive treatment of polyolefins, and plasma-induced amination of polymer fibers. The plasma induced surface chemical and morphological changes are discussed, as are the mechanisms of adhesion to polymeric adhesives, particularly epoxy. Noble gas plasma etching of flouropolymers produces a partially defluorinated, textured surface. The mechanical interlocking of this textured surface is the primary cause of improved adhesion to epoxy. Reactive gas plasmas also induce defluorination, but oxygen containing gases cause continual ablation of the fluoropolymer surface. Noble andmore » reactive gas (exept for hydrogen) etching of polyolefins results in surface oxidation and improved adhesion via hydrogen bonding of these oxygen containing groups across the interface. The introduction of amine groups to a polymer surface by amonia or amine plasma treatment generally results in improved adhesion to epoxy. However, amine-epoxy ring interactions can be severely effected by steric factors due to chemical groups surrounding the amine. 41 refs.« less
Complementary, Alternative, or Integrative Health: What's In a Name?
... Natural Products This group includes a variety of products, such as herbs (also known as botanicals), vitamins and minerals , and probiotics . They are widely marketed, readily available to consumers, ...
Appetitive Motivation and Negative Emotion Reactivity among Remitted Depressed Youth
ERIC Educational Resources Information Center
Hankin, Benjamin L.; Wetter, Emily K.; Flory, Kate
2012-01-01
Depression has been characterized as involving altered appetitive motivation and emotional reactivity. Yet no study has examined objective indices of emotional reactivity when the appetitive/approach system is suppressed in response to failure to attain a self-relevant goal and desired reward. Three groups of youth (N = 98, ages 9-15; remitted…
Mineral precipitates in zero-valent iron PRBs can be classified by formation processes into three groups: 1) those that result from changes in chemical conditions (i.e., change in pH, e.g., calcite); 2) those that are a consequence of microbial activity (i.e., sulfate reduction, ...
49 CFR 173.224 - Packaging and control and emergency temperatures for self-reactive materials.
Code of Federal Regulations, 2014 CFR
2014-10-01
... 49 Transportation 2 2014-10-01 2014-10-01 false Packaging and control and emergency temperatures... temperatures for self-reactive materials. (a) General. When the § 172.101 table of this subchapter specifies... packagings meeting Packing Group I are not authorized. Self-reactive materials which require temperature...
49 CFR 173.224 - Packaging and control and emergency temperatures for self-reactive materials.
Code of Federal Regulations, 2010 CFR
2010-10-01
... 49 Transportation 2 2010-10-01 2010-10-01 false Packaging and control and emergency temperatures... temperatures for self-reactive materials. (a) General. When the § 172.101 table of this subchapter specifies... packagings meeting Packing Group I are not authorized. Self-reactive materials which require temperature...
49 CFR 173.224 - Packaging and control and emergency temperatures for self-reactive materials.
Code of Federal Regulations, 2011 CFR
2011-10-01
... 49 Transportation 2 2011-10-01 2011-10-01 false Packaging and control and emergency temperatures... temperatures for self-reactive materials. (a) General. When the § 172.101 table of this subchapter specifies... packagings meeting Packing Group I are not authorized. Self-reactive materials which require temperature...
49 CFR 173.224 - Packaging and control and emergency temperatures for self-reactive materials.
Code of Federal Regulations, 2012 CFR
2012-10-01
... 49 Transportation 2 2012-10-01 2012-10-01 false Packaging and control and emergency temperatures... temperatures for self-reactive materials. (a) General. When the § 172.101 table of this subchapter specifies... packagings meeting Packing Group I are not authorized. Self-reactive materials which require temperature...
49 CFR 173.224 - Packaging and control and emergency temperatures for self-reactive materials.
Code of Federal Regulations, 2013 CFR
2013-10-01
... 49 Transportation 2 2013-10-01 2013-10-01 false Packaging and control and emergency temperatures... temperatures for self-reactive materials. (a) General. When the § 172.101 table of this subchapter specifies... packagings meeting Packing Group I are not authorized. Self-reactive materials which require temperature...
Ng, Jeremy Y; Boon, Heather S; Thompson, Alison K; Whitehead, Cynthia R
2016-05-20
Medical pluralism has flourished throughout the Western world in spite of efforts to legitimize Western biomedical healthcare as "conventional medicine" and thereby relegate all non-physician-related forms of healthcare to an "other" category. These "other" practitioners have been referred to as "unconventional", "alternative" and "complementary", among other terms throughout the past half century. This study investigates the discourses surrounding the changes in the terms, and their meanings, used to describe unconventional medicine in North America. Terms identified by the literature as synonymous to unconventional medicine were searched using the Scopus database. A textual analysis following the method described by Kripendorff 2013 was subsequently performed on the five most highly-cited unconventional medicine-related peer-reviewed literature published between 1970 and 2013. Five commonly-used, unconventional medicine-related terms were identified. Authors using "complementary and alternative", "complementary", "alternative", or "unconventional" tended to define them by what they are not (e.g., therapies not taught/used in conventional medicine, therapy demands not met by conventional medicine, and therapies that lack research on safety, efficacy and effectiveness). Authors defined "integrated/integrative" medicine by what it is (e.g., a new model of healthcare, the combining of both conventional and unconventional therapies, accounting for the whole person, and preventative maintenance of health). Authors who defined terms by "what is not" stressed that the purpose of conducting research in this area was solely to create knowledge. Comparatively, authors who defined terms by "what is" sought to advocate for the evidence-based combination of unconventional and conventional medicines. Both author groups used scientific rhetoric to define unconventional medical practices. This emergence of two groups of authors who used two different sets of terms to refer to the concept of "unconventional medicine" may explain why some journals, practitioner associations and research/practice centres may choose to use both "what is not" and "what is" terms in their discourse to attract interest from both groups. Since each of the two groups of terms (and authors who use them) has different meanings and goals, the evolution of this discourse will continue to be an interesting phenomenon to explore in the future.
Taming the Reactivity of Glycosyl Iodides To Achieve Stereoselective Glycosidation.
Gervay-Hague, Jacquelyn
2016-01-19
Although glycosyl iodides have been known for more than 100 years, it was not until the 21st century that their full potential began to be harnessed for complex glycoconjugate synthesis. Mechanistic studies in the late 1990s probed glycosyl iodide formation by NMR spectroscopy and revealed important reactivity features embedded in protecting-group stereoelectronics. Differentially protected sugars having an anomeric acetate were reacted with trimethylsilyl iodide (TMSI) to generate the glycosyl iodides. In the absence of C-2 participation, generation of the glycosyl iodide proceeded by inversion of the starting anomeric acetate stereochemistry. Once formed, the glycosyl iodide readily underwent in situ anomerization, and in the presence of excess iodide, equilibrium concentrations of α- and β-iodides were established. Reactivity profiles depended upon the identity of the sugar and the protecting groups adorning it. Consistent with the modern idea of disarmed versus armed sugars, ester protecting groups diminished the reactivity of glycosyl iodides and ether protecting groups enhanced the reactivity. Thus, acetylated sugars were slower to form the iodide and anomerize than their benzylated analogues, and these disarmed glycosyl iodides could be isolated and purified, whereas armed ether-protected iodides could only be generated and reacted in situ. All other things being equal, the β-iodide was orders of magnitude more reactive than the thermodynamically more stable α-iodide, consistent with the idea of in situ anomerization introduced by Lemieux in the mid-20th century. Glycosyl iodides are far more reactive than the corresponding bromides, and with the increased reactivity comes increased stereocontrol, particularly when forming α-linked linear and branched oligosaccharides. Reactions with per-O-silylated glycosyl iodides are especially useful for the synthesis of α-linked glycoconjugates. Silyl ether protecting groups make the glycosyl iodide so reactive that even highly functionalized aglycon acceptors add. Following the coupling event, the TMS ethers are readily removed by methanolysis, and since all of the byproducts are volatile, multiple reactions can be performed in a single reaction vessel without isolation of intermediates. In this fashion, per-O-TMS monosaccharides can be converted to biologically relevant α-linked glycolipids in one pot. The stereochemical outcome of these reactions can also be switched to β-glycoside formation by addition of silver to chelate the iodide, thus favoring SN2 displacement of the α-iodide. While iodides derived from benzyl and silyl ether-protected oligosaccharides are susceptible to interglycosidic bond cleavage when treated with TMSI, the introduction of a single acetate protecting group prevents this unwanted side reaction. Partial acetylation of armed glycosyl iodides also attenuates HI elimination side reactions. Conversely, fully acetylated glycosyl iodides are deactivated and require metal catalysis in order for glycosidation to occur. Recent findings indicate that I2 activation of per-O-acetylated mono-, di-, and trisaccharides promotes glycosidation of cyclic ethers to give β-linked iodoalkyl glycoconjugates in one step. Products of these reactions have been converted into multivalent carbohydrate displays. With these synthetic pathways elucidated, chemical reactivity can be exquisitely controlled by the judicious selection of protecting groups to achieve high stereocontrol in step-economical processes.
Jaime-Pérez, José Carlos; Chapa-Rodríguez, Adrián; Rodríguez-Martínez, Marisol; Colunga-Pedraza, Perla Rocío; Marfil-Rivera, Luis Javier; Gómez-Almaguer, David
2012-01-01
Complementary and alternative medicine includes a diverse group of medical and healthcare systems, practices and products not considered part of conventional medicine. Although there is information on unconventional practices in oncological diseases, specific data regarding the use of complementary and alternative medicine by hematology patients is scarce. The aim of this study is to document the prevalence of this modality of unconventional therapy in patients with malignant and benign hematological diseases, particularly children with acute lymphoblastic leukemia. An observational study of adult patients and guardians of children with malignant or benign hematological diseases was carried out by applying a structured questionnaire detailing the use and results of the most prevalent complementary and alternative medicine practices. One hundred and twenty patients were included; 104 had malignant and 16 had benign hematological diseases. The use of complementary and alternative medicine was greater in benign diseases but the difference was not statistically significant (64.7% versus 41.7%; p-value = 0.08). Patients and guardians with high school or college educations used these alternative practices more than patients with less schooling (60.7% versus 54.7%; p-value = 0.032). The use of folk remedies was most prevalent followed by herbal preparations and spiritual healing. Sixty-four percent of patients that used these unconventional practices reported improvement in their symptoms and increased capacity to perform daily activities. No significant difference was documented between patients with malignant or benign hematological diseases using these alternative practices. The majority of complementary and alternative medicine users reported improvement of the disease or chemotherapy-related symptoms.
Evaluation of programs to improve complementary feeding in infants and young children.
Frongillo, Edward A
2017-10-01
Evaluation of complementary feeding programs is needed to enhance knowledge on what works, to document responsible use of resources, and for advocacy. Evaluation is done during program conceptualization and design, implementation, and determination of effectiveness. This paper explains the role of evaluation in the advancement of complementary feeding programs, presenting concepts and methods and illustrating them through examples. Planning and investments for evaluations should occur from the beginning of the project life cycle. Essential to evaluation is articulation of a program theory on how change would occur and what program actions are required for change. Analysis of program impact pathways makes explicit the dynamic connections in the program theory and accounts for contextual factors that could influence program effectiveness. Evaluating implementation functioning is done through addressing questions about needs, coverage, provision, and utilization using information obtained from process evaluation, operations research, and monitoring. Evaluating effectiveness is done through assessing impact, efficiency, coverage, process, and causality. Plausibility designs ask whether the program seemed to have an effect above and beyond external influences, often using a nonrandomized control group and baseline and end line measures. Probability designs ask whether there was an effect using a randomized control group. Evaluations may not be able to use randomization, particularly for programs implemented at a large scale. Plausibility designs, innovative designs, or innovative combinations of designs sometimes are best able to provide useful information. Further work is needed to develop practical designs for evaluation of large-scale country programs on complementary feeding. © 2017 John Wiley & Sons Ltd.
Hardy, Jonathan I; Hendricks, Anke; Loeffler, Anette; Chang, Yu-Mei; Verheyen, Kristien L; Garden, Oliver A; Bond, Ross
2014-10-01
Despite conflicting data on their utility and no reports on interlaboratory reproducibility, serum food-specific antibodies are commonly assayed in first-opinion canine practice. To determine both the variability of test results between two laboratories and the frequencies and magnitudes of food reactivity in dogs of different disease status. Sera were obtained from eight dogs with cutaneous adverse food reaction (Group A), 22 with nonfood-induced atopic dermatitis (Group B), 30 with an allergic/inflammatory phenotype (Group C), 12 with miscellaneous skin diseases (Group D) and nine healthy dogs (Group E). Paired sera were submitted to two laboratories (A and B) for assays of food-specific IgE and IgG antibodies. Numbers of positive IgE and IgG tests determined by each laboratory in Groups A, B, D and E were comparable (Group C not included). Significant differences in the magnitude of IgE reactivity between groups for each allergen were seen only for lamb (Laboratory A, P = 0.003); lamb reactivity in Group D exceeded Group E (P = 0.004) but was comparable between all other groups. Agreement (kappa statistic) between the two laboratories' tests was 'moderate' for one antigen (potato IgE), 'fair' for four (corn IgE, rice IgE and IgG and soya bean IgG), 'slight' for eight (six IgE and two IgG) and 'less than chance' for the remaining six antigens (three IgE and three IgG). These laboratories' tests appear to have dubious predictive clinical utility because they neither correlate nor distinguish between dogs of different disease status. © 2014 ESVD and ACVD.
Porfyridis, Ilias; Georgiadis, Georgios; Vogazianos, Paris; Mitis, Georgios; Georgiou, Andreas
2014-04-01
Patients with nursing home acquired pneumonia (NHAP) present a distinct group of lower respiratory track infections with different risk factors, clinical presentation, and mortality rates. To evaluate the diagnostic value of clinical pulmonary infection score (CPIS), C-reactive protein, and procalcitonin and to compare the accuracy of pneumonia severity scores (confusion, urea nitrogen, breathing frequency, blood pressure, ≥ 65 y of age [CURB-65]; pneumonia severity index; NHAP index; systolic blood pressure, multilobar involvement, albumin, breathing frequency, tachycardia, confusion, oxygen, arterial pH [SMART-COP]; and systolic blood pressure, oxygen, age > 65 y, breathing frequency [SOAR]) in predicting in-patient mortality from NHAP. Nursing home residents admitted to the hospital with acute respiratory illness were enrolled in the study. Subjects were classified as having NHAP (Group A) or other pulmonary disorders (Group B). Clinical, imaging, and laboratory data were assessed to compute CPIS and severity scores. C-reactive protein and procalcitonin were measured by immunonephelometry and immunoassay, respectively. Fifty-eight subjects were diagnosed with NHAP (Group A) and 29 with other pulmonary disorders (Group B). The mean C-reactive protein ± SD was 16.38 ± 8.6 mg/dL in Group A and 5.2 ± 5.6 mg/dL in Group B (P < .001). The mean procalcitonin ± SD was 1.52 ± 2.75 ng/mL in Group A and 0.24 ± 0.21 ng/mL in Group B (P = .001). The mean CPIS ± SD was 5.4 ± 1.2 in Group A and 2.3 ± 1.5 in Group B (P < .001). At a cutoff value of 0.475 ng/mL, procalcitonin had a sensitivity of 83% and a specificity of 72%. At a cutoff value of 8.05 mg/dL, C-reactive protein had a sensitivity of 81% and a specificity of 79%. Procalcitonin and C-reactive protein levels were significantly higher in Gram-positive NHAP. The in-patient mortality was 17.2% in Group A. Procalcitonin levels were 4.67 ± 5.4 ng/mL in non-survivors and 0.86 ± 0.9 ng/mL in survivors (P < .001). The area under the curve for procalcitonin in predicting in-patient mortality was 0.84 (95% CI 0.70-0.98, P = .001). A procalcitonin level upon admission > 1.1 ng/mL was an independent predictor of in-patient mortality. Of the pneumonia severity scores, CURB-65 showed greater accuracy in predicting in-patient mortality (area under the curve of 0.68, 95% CI 0.53-0.84, P = .06). CPIS, procalcitonin, and C-reactive protein are reliable for the diagnosis of NHAP. Procalcitonin and CURB-65 are accurate in predicting in-patient mortality in NHAP.
Combined Volatolomics for Monitoring of Human Body Chemistry
Broza, Yoav Y.; Zuri, Liat; Haick, Hossam
2014-01-01
Analysis of volatile organic compounds (VOCs) is a promising approach for non-invasive, fast and potentially inexpensive diagnostics. Here, we present a new methodology for profiling the body chemistry by using the volatile fraction of molecules in various body fluids. Using mass spectrometry and cross-reactive nanomaterial-based sensors array, we demonstrate that simultaneous VOC detection from breath and skin would provide complementary, non-correlated information of the body's volatile metabolites profile. Eventually with further wide population validation studies, such a methodology could provide more accurate monitoring of pathological changes compared to the information provided by a single body fluid. The qualitative and quantitative methods presented here offers a variety of options for novel mapping of the metabolic properties of complex organisms, including humans. PMID:24714440
Combined volatolomics for monitoring of human body chemistry.
Broza, Yoav Y; Zuri, Liat; Haick, Hossam
2014-04-09
Analysis of volatile organic compounds (VOCs) is a promising approach for non-invasive, fast and potentially inexpensive diagnostics. Here, we present a new methodology for profiling the body chemistry by using the volatile fraction of molecules in various body fluids. Using mass spectrometry and cross-reactive nanomaterial-based sensors array, we demonstrate that simultaneous VOC detection from breath and skin would provide complementary, non-correlated information of the body's volatile metabolites profile. Eventually with further wide population validation studies, such a methodology could provide more accurate monitoring of pathological changes compared to the information provided by a single body fluid. The qualitative and quantitative methods presented here offers a variety of options for novel mapping of the metabolic properties of complex organisms, including humans.
The Effectiveness of Lecture-Integrated, Web-Supported Case Studies in Large Group Teaching
ERIC Educational Resources Information Center
Azzawi, May; Dawson, Maureen M.
2007-01-01
The effectiveness of lecture-integrated and web-supported case studies in supporting a large and academically diverse group of undergraduate students was evaluated in the present study. Case studies and resource (web)-based learning were incorporated as two complementary interactive learning strategies into the traditional curriculum. A truncated…
Fottler, Myron D; Dickson, Duncan; Ford, Robert C; Bradley, Kenneth; Johnson, Lee
2006-02-01
The measurement of patient satisfaction is crucial to enhancing customer service and competitive advantage in the health-care industry. While there are numerous approaches to such measurement, this paper provides a case study which compares and contrasts patient and staff perceptions of customer service using both survey and focus group data. Results indicate that there is a high degree of correlation between staff and patient perceptions of customer service based on both survey and focus group data. However, the staff and patient subgroups also provided complementary information regarding patient perceptions of their service experience. Staff members tended to have more negative perceptions of service attributes than did the patients themselves. The focus group results provide complementary information to survey results in terms of greater detail and more managerially relevant information. While these results are derived from a pilot study, they suggest that diversification of data sources beyond patient surveys may enhance the utility of customer service information. If further research can affirm these findings, they create exciting possibilities for gathering valid, reliable and cost-effective customer service information.
NASA Astrophysics Data System (ADS)
Furer, V. L.; Vandyukov, A. E.; Majoral, J. P.; Caminade, A. M.; Gottis, S.; Laurent, R.; Kovalenko, V. I.
2015-07-01
Fourier transform IR spectra of the first generation dendrons built from thiophosphoryl core with terminal Psbnd Cl groups, vinyl (G1) and azide (G2) functional group at the level of the core have been recorded. The optimized geometries of low energy isomers of G1 and G2 have been calculated by density functional (DFT) method at the PBE/TZ2P level of theory. DFT is used for analyzing the properties of each structural part (core, branches, surface). It was found that the repeated branching units of G1 and G2 contain planar sbnd Osbnd C6H4sbnd CHdbnd Nsbnd N(CH3)sbnd Prbond2 fragments. DFT results for the structure of G1 and G2 are in good agreement with X-ray diffraction measurements. A complete vibrational assignment is proposed for different parts of G1 and G2. The global and local reactivity descriptors have been used to characterize the reactivity pattern of the core functional and terminal groups. Natural bond orbital (NBO) analysis has been applied to comparative study of charge delocalization. Our study reveals why azide group linked to phosphorus has a different reactivity when compared to organic azides.
del Río, Jonathan Sabaté; Yehia Adly, Nouran; Acero-Sánchez, Josep Lluis; Henry, Olivier Y F; O'Sullivan, Ciara K
2014-04-15
Solid-phase isothermal DNA amplification was performed exploiting the homology protein recombinase A (recA). The system was primarily tested on maleimide activated microtitre plates as a proof-of-concept and later translated to an electrochemical platform. In both cases, forward primer for Francisella tularensis holarctica genomic DNA was surface immobilised via a thiol or an amino moiety and then elongated during the recA mediated amplification, carried out in the presence of specific target sequence and reverse primers. The formation of the subsequent surface tethered amplicons was either colorimetrically or electrochemically monitored using a horseradish peroxidase (HRP)-labelled DNA secondary probe complementary to the elongated strand. The amplification time was optimised to amplify even low amounts of DNA copies in less than an hour at a constant temperature of 37°C, achieving a limit of detection of 1.3×10(-13) M (4×10(6) copies in 50 μL) for the colorimetric assay and 3.3×10(-14) M (2×10(5) copies in 10 μL) for the chronoamperometric assay. The system was demonstrated to be highly specific with negligible cross-reactivity with non-complementary targets or primers. © 2013 Elsevier B.V. All rights reserved.
Hvasanov, David; Nam, Ekaterina V; Peterson, Joshua R; Pornsaksit, Dithepon; Wiedenmann, Jörg; Marquis, Christopher P; Thordarson, Pall
2014-10-17
Despite the importance of protein dimers and dimerization in biology, the formation of protein dimers through synthetic covalent chemistry has not found widespread use. In the case of maleimide-cysteine-based dimerization of proteins, we show here that when the proteins have the same charge, dimerization appears to be inherently difficult with yields around 1% or less, regardless of the nature of the spacer used or whether homo- or heteroprotein dimers are targeted. In contrast, if the proteins have opposing (complementary) charges, the formation of heteroprotein dimers proceeds much more readily, and in the case of one high molecular weight (>80 kDa) synthetic dimer between cytochrome c and bovine serum albumin, a 30% yield of the purified, isolated dimer was achieved. This represents at least a 30-fold increase in yield for protein dimers formed from proteins with complementary charges, compared to when the proteins have the same charge, under otherwise similar conditions. These results illustrate the role of ionic supramolecular interactions in controlling the reactivity of proteins toward bis-functionalized spacers. The strategy here for effective synthetic dimerization of proteins could be very useful for developing novel approaches to study the important role of protein-protein interactions in chemical biology.
Che, Xia; Wang, Xin; Zhang, Junyan; Peng, Chengfeng; Zhen, Yilan; Shao, Xu; Zhang, Gongliang; Dong, Liuyi
2016-01-01
Purpose: The aim of this study was to explore the cardioprotective effect of vitexin on chronic myocardial ischemia/reperfusion injury in rats and potential mechanisms. Methods: A chronic myocardial ischemia/reperfusion injury model was established by ligating left anterior descending coronary for 60 minutes, and followed by reperfusion for 14 days. After 2 weeks ischemia/reperfusion, cardiac function was measured to assess myocardial injury. The level of ST segment was recorded in different periods by electrocardiograph. The change of left ventricular function and myocardial reaction degree of fibrosis of heart was investigated by hematoxylin and eosin (HE) staining and Sirius red staining. Endothelium-dependent relaxations due to acetylcholine were observed in isolated rat thoracic aortic ring preparation. The blood samples were collected to measure the levels of MDA, the activities of SOD and NADPH in serum. Epac1, Rap1, Bax and Bcl-2 were examined by using Western Blotting. Results: Vitexin exerted significant protective effect on chronic myocardial ischemia/reperfusion injury, improved obviously left ventricular diastolic function and reduced myocardial reactive fibrosis degree in rats of myocardial ischemia. Medium and high-dose vitexin groups presented a significant decrease in Bax, Epac1 and Rap1 production and increase in Bcl-2 compared to the I/R group. It may be related to preventing myocardial cells from apoptosis, improving myocardial diastolic function and inhibiting lipid peroxidation. Conclusions: Vitexin is a cardioprotective herb, which may be a promising useful complementary and alternative medicine for patients with coronary heart disease. PMID:27648122
Traversetti, Lorenzo; Scalici, Massimiliano; Ginepri, Valeria; Manfrin, Alessandro; Ceschin, Simona
2014-05-01
The main aim of this study was to improve the knowledge about the concordance among macrophytes and macroinvertebrates to provide complementary information and facilitate the procedures for quality assessment of river ecosystems. Macrophytes and macroinvertebrates were collected in 11 sampling sites along a central Apennine calcareous river in October 2008 and June 2009. The concordance between the two biomonitoring groups was tested according to several environmental parameters. The comparison of data matrix similarities by Mantel test showed differences in the assemblage of macrophytes and macroinvertebrates along the river since correlation values were 0.04, p > 0.05 in October 2008 and 0.39, p > 0.05 in June 2009. The study revealed lack of concordance between the two groups, emphasizing that the information provided by macrophytes and macroinvertebrates does not overlap in terms of response to environmental parameters. Indeed, the two different biological groups resulted useful descriptors of different parameters. Together, they could represent a complementary tool to reflect the river environmental quality.
Daniels, Lisa; Heath, Anne-Louise M; Williams, Sheila M; Cameron, Sonya L; Fleming, Elizabeth A; Taylor, Barry J; Wheeler, Ben J; Gibson, Rosalind S; Taylor, Rachael W
2015-11-12
In 2002, the World Health Organization recommended that the age for starting complementary feeding should be changed from 4 to 6 months of age to 6 months. Although this change in age has generated substantial debate, surprisingly little attention has been paid to whether advice on how to introduce complementary foods should also be changed. It has been proposed that by 6 months of age most infants will have developed sufficient motor skills to be able to feed themselves rather than needing to be spoon-fed by an adult. This has the potential to predispose infants to better growth by fostering better energy self-regulation, however no randomised controlled trials have been conducted to determine the benefits and risks of such a "baby-led" approach to complementary feeding. This is of particular interest given the widespread use of "Baby-Led Weaning" by parents internationally. The Baby-Led Introduction to SolidS (BLISS) study aims to assess the efficacy and acceptability of a modified version of Baby-Led Weaning that has been altered to address potential concerns with iron status, choking and growth faltering. The BLISS study will recruit 200 families from Dunedin, New Zealand, who book into the region's only maternity hospital. Parents will be randomised into an intervention (BLISS) or control group for a 12-month intervention with further follow-up at 24 months of age. Both groups will receive the standard Well Child care provided to all parents in New Zealand. The intervention group will receive additional parent contacts (n = 8) for support and education on BLISS from before birth to 12 months of age. Outcomes of interest include body mass index at 12 months of age (primary outcome), energy self-regulation, iron and zinc intake and status, diet quality, choking, growth faltering and acceptability to parents. This study is expected to provide insight into the feasibility of a baby-led approach to complementary feeding and the extent to which this method of feeding affects infant body weight, diet quality and iron and zinc status. Results of this study will provide important information for health care professionals, parents and health policy makers. Australian New Zealand Clinical Trials Registry ACTRN12612001133820 .
Farmer, Cristan A; Kaat, Aaron J; Mazurek, Micah O; Lainhart, Janet E; DeWitt, Mary Beth; Cook, Edwin H; Butter, Eric M; Aman, Michael G
2016-02-01
The measurement of aggression in its different forms (e.g., physical and verbal) and functions (e.g., impulsive and instrumental) is given little attention in subjects with developmental disabilities (DD). In this study, we confirm the factor structure of the Children's Scale for Hostility and Aggression: Reactive/Proactive (C-SHARP) and demonstrate measurement invariance (consistent performance across clinical groups) between clinic-referred groups with and without autism spectrum disorder (ASD). We also provide evidence of the construct validity of the C-SHARP. Caregivers provided C-SHARP, Child Behavior Checklist (CBCL), and Proactive/Reactive Rating Scale (PRRS) ratings for 644 children, adolescents, and young adults 2-21 years of age. Five types of measurement invariance were evaluated within a confirmatory factor analytic framework. Associations among the C-SHARP, CBCL, and PRRS were explored. The factor structure of the C-SHARP had a good fit to the data from both groups, and strict measurement invariance between ASD and non-ASD groups was demonstrated (i.e., equivalent structure, factor loadings, item intercepts and residuals, and latent variance/covariance between groups). The C-SHARP Problem Scale was more strongly associated with CBCL Externalizing than with CBCL Internalizing, supporting its construct validity. Subjects classified with the PRRS as both Reactive and Proactive had significantly higher C-SHARP Proactive Scores than those classified as Reactive only, who were rated significantly higher than those classified by the PRRS as Neither Reactive nor Proactive. A similar pattern was observed for the C-SHARP Reactive Score. This study provided evidence of the validity of the C-SHARP through confirmation of its factor structure and its relationship with more established scales. The demonstration of measurement invariance demonstrates that differences in C-SHARP factor scores were the result of differences in the construct rather than to error or unmeasured/nuisance variables. These data suggest that the C-SHARP is useful for quantifying subtypes of aggressive behavior in children, adolescents, and young adults with DD.
Selling Complementary Patents: Experimental Investigation
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bjornstad, David J; Santore, Rudy; McKee, Michael
2010-02-01
Production requiring licensing groups of complementary patents implements a coordination game among patent holders, who can price patents by choosing among combinations of fixed and royalty fees. Summed across patents, these fees become the total producer cost of the package of patents. Royalties, because they function as excise taxes, add to marginal costs, resulting in higher prices and reduced quantities of the downstream product and lower payoffs to the patent holders. Using fixed fees eliminates this inefficiency but yields a more complex coordination game in which there are multiple equilibria, which are very fragile in that small mistakes can leadmore » the downstream firm to not license the technology, resulting in inefficient outcomes. We report on a laboratory market investigation of the efficiency effects of coordinated pricing of patents in a patent pool. We find that pool-like pricing agreements can yield fewer coordination failures in the pricing of complementary patents.« less
do Nascimento, Keyla Cristiane; Backes, Dirce Stein; Koerich, Magda Santos; Erdmann, Alacoque Lorenzini
2008-12-01
This study is the result of an extended project, named: The systematization of nursing care in the perspective of complex thinking. The objective of this qualitative study is to better comprehend the meaning of the systematization of nursing care among healthcare professionals. The Data-Based Theory was used as a methodological reference. Data were collected by interviewing three sample groups, in a total of fifteen healthcare professionals. Data codification and analysis led us to the central theme: Viewing the Systematization of Nursing Care (SNC) as an Interactive and Complex Phenomenon. This theme is complemented by two phenomena. In this article, we discuss the phenomenon: Verifying the necessity of on interactive, complementary, and multi-professional process. The Systematization of Nursing Care is part of a process that has been developing over time by nurses committed to improve the care given to the patient, since they view the necessity for interactive, complementary, and multi-professional care.
How to survive (and enjoy) doing a thesis: the experiences of a methodological working group.
Giddings, Lynne S; Wood, Pamela J
2006-03-01
'Doing a thesis', whether for Masters or PhD, can be a lonely and tortuous journey. This article offers a complementary process to the traditional apprenticeship supervision model. It describes the experiences of students who during their thesis research met monthly in a grounded theory working group. They reflected on their experiences during a focus group interview. After describing the background to how the group started in 1999 and exploring some of the ideas in the literature concerning the thesis experience, the article presents the interview. To focus the presentation, specific questions are used as category headings. Overall, the participants found attending the group was a "life-line" that gave them "hope" and was complementary to the supervision process. Through the support of peers, guidance from those ahead in the process, and consultancy with teachers and visiting methodological scholars, these students not only successfully completed their theses, but reported that they had some enjoyment along the way. This is the fifteenth in a series of articles which have been based on interviews with nursing and midwifery researchers, and were primarily designed to offer the beginning researcher a first-hand account of the experience of using particular methodologies.
McNally, Richard J.; Heeren, Alexandre; Robinaugh, Donald J.
2017-01-01
ABSTRACT Background: The network approach to mental disorders offers a novel framework for conceptualizing posttraumatic stress disorder (PTSD) as a causal system of interacting symptoms. Objective: In this study, we extended this work by estimating the structure of relations among PTSD symptoms in adults reporting personal histories of childhood sexual abuse (CSA; N = 179). Method: We employed two complementary methods. First, using the graphical LASSO, we computed a sparse, regularized partial correlation network revealing associations (edges) between pairs of PTSD symptoms (nodes). Next, using a Bayesian approach, we computed a directed acyclic graph (DAG) to estimate a directed, potentially causal model of the relations among symptoms. Results: For the first network, we found that physiological reactivity to reminders of trauma, dreams about the trauma, and lost of interest in previously enjoyed activities were highly central nodes. However, stability analyses suggest that these findings were unstable across subsets of our sample. The DAG suggests that becoming physiologically reactive and upset in response to reminders of the trauma may be key drivers of other symptoms in adult survivors of CSA. Conclusions: Our study illustrates the strengths and limitations of these network analytic approaches to PTSD. PMID:29038690
NASA Astrophysics Data System (ADS)
Sagdeo, P. R.; Shinde, D. D.; Misal, J. S.; Kamble, N. M.; Tokas, R. B.; Biswas, A.; Poswal, A. K.; Thakur, S.; Bhattacharyya, D.; Sahoo, N. K.; Sabharwal, S. C.
2010-02-01
Titania-silica (TiO2/SiO2) optical multilayer structures have been conventionally deposited by reactive sputtering of metallic targets. In order to overcome the problems of arcing, target poisoning and low deposition rates encountered there, the application of oxide targets was investigated in this work with asymmetric bipolar pulsed dc magnetron sputtering. In order to evaluate the usefulness of this deposition methodology, an electric field optimized Fabry Perot mirror for He-Cd laser (λ = 441.6 nm) spectroscopy was deposited and characterized. For comparison, this mirror was also deposited by the reactive electron beam (EB) evaporation technique. The mirrors developed by the two complementary techniques were investigated for their microstructural and optical reflection properties invoking atomic force microscopy, ellipsometry, grazing incidence reflectometry and spectrophotometry. From these measurements the layer geometry, optical constants, mass density, topography, surface and interface roughness and disorder parameters were evaluated. The microstructural properties and spectral functional characteristics of the pulsed dc sputtered multilayer mirror were found to be distinctively superior to the EB deposited mirror. The knowledge gathered during this study has been utilized to develop a 21-layer high-pass edge filter for radio photoluminescence dosimetry.
Brumley, Michele R; Guertin, Pierre A; Taccola, Giuliano
2017-01-01
Locomotion is one of the most complex motor behaviors. Locomotor patterns change during early life, reflecting development of numerous peripheral and hierarchically organized central structures. Among them, the spinal cord is of particular interest since it houses the central pattern generator (CPG) for locomotion. This main command center is capable of eliciting and coordinating complex series of rhythmic neural signals sent to motoneurons and to corresponding target-muscles for basic locomotor activity. For a long-time, the CPG has been considered a black box. In recent years, complementary insights from in vitro and in vivo animal models have contributed significantly to a better understanding of its constituents, properties and ways to recover locomotion after a spinal cord injury (SCI). This review discusses key findings made by comparing the results of in vitro isolated spinal cord preparations and spinal-transected in vivo models from neonatal animals. Pharmacological, electrical, and sensory stimulation approaches largely used to further understand CPG function may also soon become therapeutic tools for potent CPG reactivation and locomotor movement induction in persons with SCI or developmental neuromuscular disorder. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Estradiol and inflammatory markers in older men.
Maggio, Marcello; Ceda, Gian Paolo; Lauretani, Fulvio; Bandinelli, Stefania; Metter, E Jeffrey; Artoni, Andrea; Gatti, Elisa; Ruggiero, Carmelinda; Guralnik, Jack M; Valenti, Giorgio; Ling, Shari M; Basaria, Shehzad; Ferrucci, Luigi
2009-02-01
Aging is characterized by a mild proinflammatory state. In older men, low testosterone levels have been associated with increasing levels of proinflammatory cytokines. It is still unclear whether estradiol (E2), which generally has biological activities complementary to testosterone, affects inflammation. We analyzed data obtained from 399 men aged 65-95 yr enrolled in the Invecchiare in Chianti study with complete data on body mass index (BMI), serum E2, testosterone, IL-6, soluble IL-6 receptor, TNF-alpha, IL-1 receptor antagonist, and C-reactive protein. The relationship between E2 and inflammatory markers was examined using multivariate linear models adjusted for age, BMI, smoking, physical activity, chronic disease, and total testosterone. In age-adjusted analysis, log (E2) was positively associated with log (IL-6) (r = 0.19; P = 0.047), and the relationship was statistically significant (P = 0.032) after adjustments for age, BMI, smoking, physical activity, chronic disease, and serum testosterone levels. Log (E2) was not significantly associated with log (C-reactive protein), log (soluble IL-6 receptor), or log (TNF-alpha) in both age-adjusted and fully adjusted analyses. In older men, E2 is weakly positively associated with IL-6, independent of testosterone and other confounders including BMI.
Virtual Cross-Linking of the Active Nemorubicin Metabolite PNU-159682 to Double-Stranded DNA.
Scalabrin, Matteo; Quintieri, Luigi; Palumbo, Manlio; Riccardi Sirtori, Federico; Gatto, Barbara
2017-02-20
The DNA alkylating mechanism of PNU-159682 (PNU), a highly potent metabolite of the anthracycline nemorubicin, was investigated by gel-electrophoretic, HPLC-UV, and micro-HPLC/mass spectrometry (MS) measurements. PNU quickly reacted with double-stranded oligonucleotides, but not with single-stranded sequences, to form covalent adducts which were detectable by denaturing polyacrylamide gel electrophoresis (DPAGE). Ion-pair reverse-phase HPLC-UV analysis on CG rich duplex sequences having a 5'-CCCGGG-3' central core showed the formation of two types of adducts with PNU, which were stable and could be characterized by micro-HPLC/MS. The first type contained one alkylated species (and possibly one reversibly bound species), and the second contained two alkylated species per duplex DNA. The covalent adducts were found to produce effective bridging of DNA complementary strands through the formation of virtual cross-links reminiscent of those produced by classical anthracyclines in the presence of formaldehyde. Furthermore, the absence of reactivity of PNU with CG-rich sequence containing a TA core (CGTACG), and the minor reactivity between PNU and CGC sequences (TACGCG·CGCGTA) pointed out the importance of guanine sequence context in modulating DNA alkylation.
Rapid host immune response and viral dynamics in herpes simplex virus-2 infection
Schiffer, Joshua T; Corey, Lawrence
2014-01-01
Herpes Simplex Virus-2 (HSV-2) is episodically shed throughout the human genital tract. While high viral load correlates with development of genital ulcers, shedding also commonly occurs even when ulcers are not present, allowing for silent transmission during coitus and contributing to high seroprevalence of HSV-2 worldwide. Frequent viral reactivation occurs despite diverse and complementary host and viral mechanisms within ganglionic tissue that predispose towards latency, suggesting that viral replication may be constantly occurring in a small minority of neurons within the ganglia. Within genital mucosa, the in vivo expansion and clearance rates of HSV-2 are extremely rapid. Resident dendritic cells and memory HSV-specific T cells persist at prior sites of genital tract reactivation, and in conjunction with prompt innate recognition of infected cells, lead to rapid containment of infected cells. Shedding episodes vary greatly in duration and severity within a single person over time: this heterogeneity appears best explained by variation in the densities of host immunity across the genital tract. The fact that immune responses usually control viral replication in genital skin prior to development of lesions provides optimism that enhancing such responses could lead to effective vaccines and immunotherapies. PMID:23467247
Isotopic and noble gas geochemistry in geothermal research
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kennedy, B.M.; DePaolo, D.J.
1997-12-31
The objective of this program is to provide, through isotopic analyses of fluids, fluid inclusions, and rocks and minerals coupled with improved methods for geochemical data analysis, needed information regarding sources of geothermal heat and fluids, the spatial distribution of fluid types, subsurface flow, water-rock reaction paths and rates, and the temporal evolution of geothermal systems. Isotopic studies of geothermal fluids have previously been limited to the light stable isotopes of H, C, and O. However, other isotopic systems such as the noble gases (He, Ne, Ar, Kr and Xe) and reactive elements (e.g. B, N, S, Sr and Pb)more » are complementary and may even be more important in some geothermal systems. The chemistry and isotopic composition of a fluid moving through the crust will change in space and time in response to varying chemical and physical parameters or by mixing with additional fluids. The chemically inert noble gases often see through these variations, making them excellent tracers for heat and fluid sources. Whereas, the isotopic compositions of reactive elements are useful tools in characterizing water-rock interaction and modeling the movement of fluids through a geothermal reservoir.« less
Parascandolo, Alessia; Laukkanen, Mikko O
2018-04-05
Reduction/oxidation (redox) balance could be defined as an even distribution of reduction and oxidation complementary processes and their reaction end products. There is a consensus that aberrant levels of reactive oxygen species (ROS), commonly observed in cancer, stimulate primary cell immortalization and progression of carcinogenesis. However, the mechanism how different ROS regulate redox balance is not completely understood. Recent Advances: In the current review, we have summarized the main signaling cascades inducing NADPH oxidase NOX1-5 and superoxide dismutase (SOD) 1-3 expression and their connection to cell proliferation, immortalization, transformation, and CD34 + cell differentiation in thyroid, colon, lung, breast, and hematological cancers. Interestingly, many of the signaling pathways activating redox enzymes or mediating the effect of ROS are common, such as pathways initiated from G protein-coupled receptors and tyrosine kinase receptors involving protein kinase A, phospholipase C, calcium, and small GTPase signaling molecules. The clarification of interaction of signal transduction pathways could explain how cells regulate redox balance and may even provide means to inhibit the accumulation of harmful levels of ROS in human pathologies. Antioxid. Redox Signal. 00, 000-000.
Bahadori, Shahnaz; Ahmadzadeh, Arman; Shams Ardekani, Mohammad Reza; Kamalinejad, Mohammad; Keshavarz, Mansoor; Salamzadeh, Jamshid
2016-01-01
Rheumatoid arthritis (RA) patients are vulnerable to cardiovascular morbidity and mortality in which atherosclerosis plays a major role. In this study, the lipid profile and fasting blood sugar (FBS) of RA patients receiving a complementary medicine of olive and fig, as add-on therapy for routine disease-modifying antirheumatic drugs (DMARDs) regimen containing low dose methotrexate (MTX), were studied. A randomized controlled clinical trial was designed. Adult RA patients were randomly allocated in two groups receiving routine DMARDs regimen (control group) and routine DMARDs regimen plus the herbal supplementary formulation of olive oil, fig and olive fruits (intervention group). Patients were followed every 4 weeks for total study period of 16 weeks. In addition to demographic and medical history of the patients, the total cholesterol (TC), low-density lipoprotein cholesterol (LDL-C), high-density lipoprotein cholesterol (HDL-C), triglyceride (TG), the atherogenic index of plasma (AIP) defined as log(TG/HDL-C), and the fasting blood sugar (FBS) were determined and recorded. 56 patients (control = 27 and intervention = 29), with mean ± sd age of 50.9 ± 12.3 years completed the study. Average MTX dose received by intervention and control groups were 24.30 ± 18.39 and 17.61 ± 15.53 mg/week, respectively (p = 0.11). Repeated measures analysis of variance (ANOVA) revealed that differences between lipid profile indicators and FBS in the two study groups were not statistically significant (P>0.05). No additional substantial adverse reaction was seen in the study groups. Our findings are more reassuring for patients and their doctors to trust on the safety of the investigated complementary preparation to be used as add-on therapy to manage rheumatoid arthritis.
... to Cancer Off-Label Drug Use Access to Experimental Drugs Complementary & Alternative Medicine (CAM) CAM for Patients ... called acupuncture points . Acupuncture may be used to control pain, including pain related to ... Support groups help many patients. Religious counseling may ...
76 FR 5340 - Federal Advisory Committee; Defense Health Board (DHB) Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2011-01-31
... Board: Trauma and Injury, Psychotropic Medication and Complementary and Alternative Medicine Work Groups... recommendation regarding the proposed research priorities of the Trauma and Injury Subcommittee. Pursuant to 5 U...
Savings estimate for a Medicare insured group
Birnbaum, Howard; Holland, Stephen K.; Lenhart, Gregory; Reilly, Helena L.; Hoffman, Kevin; Pardo, Dennis P.
1991-01-01
Estimates of the savings potential of a managed-care program for a Medicare retiree population in Michigan under a hypothetical Medicare insured group (MIG) are presented in this article. In return for receiving an experience-rated capitation payment, a MIG would administer all Medicare and employer complementary benefits for its enrollees. A study of the financial and operational feasibility of implementing a MIG for retirees of a national corporation involving an analysis of 1986 claims data finds that selected managed-care initiatives implemented by a MIG would generate an annual savings of 3.8 percent of total (Medicare plus complementary) expenditures. Although savings are less than the 5 percent to be retained by Medicare, this finding illustrates the potential for savings from managed-care initiatives to Medicare generally and to MIGs elsewhere, where savings may be greater if constraints are less restrictive. PMID:10113700
Serrano, Carolina; Lostalé, Fernando; Rodríguez-Panadero, Francisco; Blas, Ignacio de; Laborda, Alicia; de Gregorio, Miguel Angel
2016-03-01
The objective of this study was to assess tracheal reactivity after the deployment of different self-expandable metal stents (SEMS). Forty female New Zealand rabbits were divided into four groups. Three groups received three different SEMS: steel (ST), nitinol (NiTi), or nitinol drug-eluting stent (DES); the fourth group was the control group (no stent). Stents were deployed percutaneously under fluoroscopic guidance. Animals were assessed by multi-slice, computed tomography (CT) scans, and tracheas were collected for anatomical pathology (AP) study. Data from CT and AP were statistically analyzed and correlated. The DES group had the longest stenosis (20.51±14.08mm vs. 5.84±12.43 and 6.57±6.54mm in NiTi and ST, respectively, day 30; P<.05), and higher granuloma formation on CT (50% of cases). The NiTi group showed the lowest grade of stenosis (2.86±6.91% vs. 11.28±13.98 and 15.54±25.95% in DES and ST, respectively; P<.05). The AP study revealed that the ST group developed intense proliferative reactivity compared to the other groups. In the DES group, a destructive response was observed in 70% of the animals, while the NiTi was the least reactive stent. CT was more effective in detecting wall thickening (positive correlation of 68.9%; P<.001) than granuloma (not significant). The ST group developed granulomas and significant stenosis. NiTi was the least reactive stent, while DES caused significant lesions that may be related to drug dosage. This type of DES stent is therefore not recommended for the treatment of tracheobronchial stenosis. Copyright © 2015 SEPAR. Published by Elsevier Espana. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kim, Ji Hoon; Park, Joong-Won; Kim, Tae Hyun
Purpose: To investigate whether three-dimensional conformal radiotherapy (3D-CRT) influences hepatitis B virus (HBV) reactivation and chronic hepatitis B (CHB) exacerbation in patients with HBV-related hepatocellular carcinoma (HCC). Methods and Materials: Of the 48 HCC patients with HBV who underwent 3D-CRT to the liver, 16 underwent lamivudine therapy before and during 3D-CRT (Group 1) and 32 did not receive antiviral therapy before 3D-CRT (Group 2). To analyze spontaneous HBV reactivation, we included a control group of 43 HCC patients who did not receive any specific treatment for HCC or CHB. Results: The cumulative rate of radiation-induced liver disease for Groups 1more » and 2 was 12.5% (2 of 16) and 21.8% (7 of 32), respectively (p > 0.05). The cumulative rate of HBV reactivation was significantly greater in Group 2 (21.8%, 7 of 32) than in Group 1 (0%, 0/16) or the control group (2.3%, 1 of 43; p < 0.05 each). The cumulative rate of CHB exacerbation, however, did not differ significantly between Groups 2 (12.5%, 4 of 32) and 1 (0%, 0 of 16) or the control group (2.3%, 1 of 43; p > 0.05 each). The CHB exacerbations in the 4 Group 2 patients had radiation-induced liver disease features but were differentiated by serum HBV DNA changes. Two of these patients required antiviral therapy and effectively recovered with lamivudine therapy. Conclusions: In patients with HBV-related HCC undergoing 3D-CRT, HBV reactivation and consequent CHB exacerbation should be considered in the differential diagnosis of radiation-induced liver disease, and antiviral therapy might be considered for the prevention of liver function deterioration after RT.« less
Measures of total stress-induced blood pressure responses are associated with vascular damage.
Nazzaro, Pietro; Seccia, Teresa; Vulpis, Vito; Schirosi, Gabriella; Serio, Gabriella; Battista, Loredana; Pirrelli, Anna
2005-09-01
The role of cardiovascular reactivity to study hypertension, and the assessment methods, are still controversial. We aimed to verify the association of hypertension and vascular damage with several measures of cardiovascular response. We studied 40 patients with normal-high (132 +/- 1/87 +/- 1 mm Hg) blood pressure (Group 1) and 80 untreated hypertensive subjects. Postischemic forearm vascular resistance (mFVR) served to differentiate hypertensive subjects (142 +/- 2/92 +/- 1 mm Hg v 143 +/- 2/94 +/- 2 mm Hg, P = NS) with a lower (Group 2) and higher (Group 3) hemodynamic index of vascular damage (4.8 +/- .05 v 6.3 +/- .09, P < .001). Reactivity was induced by Stroop (5') and cold pressor (90") tests. We measured muscular contraction and skin conductance as indices of emotional arousal, blood pressure, heart rate, forearm blood flow, and vascular resistance. Reactivity measures included: a) change from baseline, b) residualized score, c) cumulative change from baseline and residualized score, and d) total reactivity as area-under-the-curve (AUC), including changes occurring during baseline and recovery phases. The AUC of systolic blood pressure, diastolic blood pressure, and mFVR progressively increased in the groups (P < .001). Corrections of anthropometric and metabolic confounders were introduced in the Pearson equation between mFVR and reactivity measures. The AUC of SBP, DBP, and forearm blood flow and resistance demonstrated the highest (P < .001) correlation. On multiple regression analysis, AUC of SBP (beta = 0.634) and forearm blood flow (beta = -0.337) were predictive (P < .001) of vascular damage. Total blood pressure stress response, as AUC, including baseline and recovery phases, was significantly better associated with hypertension and vascular damage than the other reactivity measures studied.
A new discussion of the cutaneous vascular reactivity in sensitive skin: A sub-group of SS?
Chen, S Y; Yin, J; Wang, X M; Liu, Y Q; Gao, Y R; Liu, X P
2018-02-02
Sensitive skin (SS) seems not to be a one-dimensional condition and many scholars concentrate on skin barrier disruption or sensorineural change, but few focus on its increased vascular reactivity. This study explored the possibility of using the different selection methods and measurement methods to verify a high vascular reactivity in SS without an impaired cutaneous barrier function. Sixty "self-perceived sensitive skin" volunteers were enlisted and each one completed three kinds of screening tests: assess cutaneous sensory using questionnaire survey and Lactic Acid Sting Test (LAST); assess barrier function using Sodium lauryl sulphate (SLS) skin irritation test and assess cutaneous vascular reactivity using 98% DMSO test and non-invasive measurement. Volunteers were divided into different groups based on response to SLS. The DMSO clinical score and the biophysical parameters obtained by non-invasive measurement were subsequently analysed. (1) The positive correlations could be seen between sum LAST score and sum DMSO score regardless of the observation time; (2) The biological parameters (CBF、a*values and L* values) are all keeping with DMSO score; (3) If the participants were divided into SLS reactors and non-reactors, a composition ratio of DMSO score was significant difference in these two groups and in SLS non-reactors, there were still seven participants showed high reaction to DMSO. There is a sub-group of SS for characteristics of a high vascular reactivity without an impaired cutaneous barrier function. The DMSO test and novel non-invasive measurements which are conducive to assess cutaneous vascular reactivity, combined with SLS skin irritation test could help us to screen this kind of SS. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Hagenaars, Muriel A; Holmes, Emily A; Klaassen, Fayette; Elzinga, Bernet
2017-01-01
Background : Intrusive trauma memories are a key symptom of posttraumatic stress disorder (PTSD), so disrupting their recurrence is highly important. Intrusion development was hindered by visuospatial interventions administered up to 24 hours after analogue trauma. It is unknown whether interventions can be applied later, and whether modality or working-memory load are crucial factors. Objectives : This study tested: (1) whether a visuospatial task would lead to fewer intrusions compared to a reactivation-only group when applied after memory reactivation four days after analogue trauma exposure (extended replication), (2) whether both tasks (i.e. one aimed to be visuospatial, one more verbal) would lead to fewer intrusions than the reactivation-only group (intervention effect), and (3) whether supposed task modality (visuospatial or verbal) is a critical component (modality effect). Method : Fifty-four participants were randomly assigned to reactivation+Tetris (visuospatial), reactivation+Word games (verbal), or reactivation-only (no task). They watched an aversive film (day 0) and recorded intrusive memories of the film in diary A. On day 4, memory was reactivated, after which participants played Tetris, Word games, or had no task for 10 minutes. They then kept a second diary (B). Informative hypotheses were evaluated using Bayes factors. Results : Reactivation+Tetris and reactivation+Word games resulted in relatively fewer intrusions from the last day of diary A to the first day of diary B than reactivation-only (objective 1 and 2). Thus, both tasks were effective even when applied days after analogue trauma. Reactivation-only was not effective. Reactivation+Word games appeared to result in fewer intrusions than reactivation+Tetris (objective 3; modality effect), but this evidence was weak. Explorative analyses showed that Word games were more difficult than Tetris. Conclusions : Applying a task four days after the trauma film (during memory reconsolidation) was effective. The modality versus working-memory load issue is inconclusive.
NASA Astrophysics Data System (ADS)
Nagel, Jürgen; Zimmermann, Philipp; Schubert, Oliver; Simon, Frank; Schlenstedt, Kornelia
2017-11-01
A method for the fabrication of polystyrene parts, modified with carboxylic groups during Fused Filament Fabrication (FFF), is being introduced. This method is based on the application of a thin layer of a reactive polymer carrying carboxylic groups on a substrate surface. A polystyrene film is printed on top of this layer. During contact between the hot melt and the reactive layer, a Friedel-Crafts type acylation using a green catalyst takes place, which attaches the reactive polymer to the polystyrene surface. The modified surface is homogeneous, hydrophilic and able to bind copper ions. The method could be used to fabricate unique parts of polystyrene with tailored surface functionalisation. It could be applied for laboratory use, e.g. for the manufacture of lab-on-a-chip devices.
Mundus, D; Wollenzien, P
1998-11-01
Site-specific photo crosslinking has been used to investigate the RNA neighborhood of 16S rRNA positions U788/ U789 in Escherichia coli 30S subunits. For these studies, site-specific psoralen (SSP) which contains a sulfhydryl group on a 17 A side chain was first added to nucleotides U788/U789 using a complementary guide DNA by annealing and phototransfer. Modified RNA was purified from the DNA and unmodified RNA. For some experiments, the SSP, which normally crosslinks at an 8 A distance, was derivitized with azidophenacylbromide (APAB) resulting in the photoreactive azido moiety at a maximum of 25 A from the 4' position on psoralen (SSP25APA). 16S rRNA containing SSP, SSP25APA or control 16S rRNA were reconstituted and 30S particles were isolated. The reconstituted subunits containing SSP or SSP25APA had normal protein composition, were active in tRNA binding and had the usual pattern of chemical reactivity except for increased kethoxal reactivity at G791 and modest changes in four other regions. Irradiation of the derivatized 30S subunits in activation buffer produced several intramolecular RNA crosslinks that were visualized and separated by gel electrophoresis and characterized by primer extension. Four major crosslink sites made by the SSP reagent were identified at positions U561/U562, U920/U921, C866 and U723; a fifth major crosslink at G693 was identified when the SSP25APA reagent was used. A number of additional crosslinks of lower frequency were seen, particularly with the APA reagent. These data indicate a central location close to the decoding region and central pseudoknot for nucleotides U788/U789 in the activated 30S subunit.
RSA Reactivity in Current and Remitted Major Depressive Disorder
Bylsma, Lauren M.; Salomon, Kristen; Taylor-Clift, April; Morris, Bethany H.; Rottenberg, Jonathan
2014-01-01
Objective Low resting respiratory sinus arrhythmia (RSA) levels and blunted RSA reactivity are thought to index impaired emotion regulation capacity. Major Depressive Disorder (MDD) has been associated with abberant RSA reactivity and recovery to a speech stressor task relative to healthy controls. Whether impaired RSA functioning reflects aspects of the depressed mood state or a stable vulnerability marker for depression is unknown. Methods We compared resting RSA and RSA reactivity between individuals with MDD (n=49), remitted depression (RMD, n=24), and healthy controls (n=45). ECG data were collected during a resting baseline, a paced-breathing baseline, and two reactivity tasks (speech stressor, cold exposure). Results A group by time quadratic effect emerged (F=4.36(2,109), p=.015) for RSA across phases of the speech stressor (baseline, instruction, preparation, speech, recovery). Follow-up analyses revealed that those with MDD uniquely exhibited blunted RSA reactivity, whereas RMD and controls both exhibited normal task-related vagal withdrawal and post-task recovery. The group by time interaction remained after covariation for age, sex, waist circumference, physical activity, and respiration, but not sleep quality. Conclusions These results provide new evidence that abberant RSA reactivity marks features that track the depressed state, such as poor sleep, rather than a stable trait evident among asymtomatic persons. PMID:24367127
Chentsova-Dutton, Yulia E; Chu, Joyce P; Tsai, Jeanne L; Rottenberg, Jonathan; Gross, James J; Gotlib, Ian H
2007-11-01
Studies of Western samples (e.g., European Americans [EAs]) suggest that depressed individuals tend to show diminished emotional reactivity (J. G. Gehricke & A. J. Fridlund, 2002; G. E. Schwartz, P. L. Fair, P. Salt, M. R. Mandel, & G. L. Klerman, 1976a, 1976b). Do these findings generalize to individuals oriented to other cultures (e.g., East Asian cultures)? The authors compared the emotional reactions (i.e., reports of emotional experience, facial behavior, and physiological reactivity) of depressed and nondepressed EAs and Asian Americans of East Asian descent (AAs) to sad and amusing films. Their results were consistent with previous findings: Depressed EAs showed a pattern of diminished reactivity to the sad film (less crying, less intense reports of sadness) compared with nondepressed participants. In contrast, depressed AAs showed a pattern of heightened emotional reactivity (greater crying) compared with nondepressed participants. Across cultural groups, depressed and nondepressed participants did not differ in their reports of amusement or facial behavior during the amusing film. Physiological reactivity to the film clips did not differ between depressed and control participants for either cultural group. Thus, although depression may influence particular aspects of emotional reactivity across cultures (e.g., crying), the specific direction of this influence may depend on prevailing cultural norms regarding emotional expression. (c) 2007 APA
Sharma, Anupriya; Ramesh, Amitha; Thomas, Biju
2009-09-01
Circulating C-reactive protein (CRP) levels are a marker of systemic inflammation and are associated with periodontal disease, a chronic bacterial infection associated with elevation of proinflammatory cytokines and prostaglandins. CRP has been associated with adverse pregnancy outcomes, including preterm delivery, preeclampsia, and intrauterine growth restriction. Furthermore, periodontal disease has been associated with increased risk of preterm low birth weight, low birth weight, and preterm birth. The present study was conducted to assess plasma CRP levels in pregnant women with and without periodontal disease; to evaluate the effect of periodontal therapy on the incidence of preterm delivery; and to compare the incidence of preterm delivery in pregnant women with and without periodontal disease. A total of 90 pregnant women aged between 18-35 years with gestational age between 12-28 weeks were recruited and divided into three equal groups (control group, study group, treatment group) of 30 each. Blood samples were taken for estimation of C-reactive protein levels from all groups at 12-20 weeks of gestation, determined using ultrasensitive turbidimetric immunoassay (QUANTIA-CRP US). The treatment group comprised plaque control, scaling, and root planning and daily rinsing with 0.2% chlorhexidine mouth before 28 weeks of gestation. The mean value of C-reactive protein levels in subjects with periodontal disease was higher compared to control group i.e., 1.20 +/- 0.247 mg/dl and 1.22 +/- 0.250 mg/dl, respectively, compared to 0.713 +/- 0.139 mg/ dl (P = 0.001). The mean value of CRP levels before treatment was greater than the mean value after treatment i.e., 1.22 +/- 0.25 compared to 0.84 +/- 0.189 (P < 0.001). The incidence of preterm delivery (< 37 weeks) was 31.7% in the periodontal disease group (study group) compared to 8.3% in the control group (P = 0.001). The incidence of preterm delivery in the treatment group was 15.0% compared to 31.7% in the nontreatment group (study group). The findings from the study suggest that periodontal disease in pregnant women is associated with increased C- reactive protein levels in early pregnancy, incidence of preterm delivery is higher in pregnant women with periodontal disease compared to healthy controls, periodontal therapy during pregnancy reduces plasma CRP levels and there is decrease in incidence of preterm delivery after periodontal therapy.
NASA Technical Reports Server (NTRS)
Weber, Arthur L.
2004-01-01
The rates of thermal transformation of organic molecules containing carbon, hydrogen, and oxygen were systematically examined in order to identify the kinetic constraints that governed origin-of-life organic chemistry under mild aqueous conditions. Arrhenius plots of the kinetic data were used to estimate the reaction of half-lifes at 50 degrees C. This survey showed that hydrocarbons and organic substances containing a single oxygenated group were kinetically the most stable; whereas organic substances containing two oxygenated groups in which one group was an alpha- or beta-positioned carbonyl group were the most reactive. Compounds with an alpha- or beta-positioned carbonyl group (aldehyde or ketone) had rates of reaction that were up to 10(24)-times faster than rates of similar molecules lacking the carbonyl group. This survey of organic reactivity, together with estimates of the molecular containment properties of lipid vesicles and liquid spherules, indicates that an origins process in a small domain that used C,H,O-intermediates had to be catalytic and use the most reactive organic molecules to prevent escape of its reaction intermediates.
Chemical modification of M13 bacteriophage and its application in cancer cell imaging.
Li, Kai; Chen, Yi; Li, Siqi; Nguyen, Huong Giang; Niu, Zhongwei; You, Shaojin; Mello, Charlene M; Lu, Xiaobing; Wang, Qian
2010-07-21
The M13 bacteriophage has been demonstrated to be a robust scaffold for bionanomaterial development. In this paper, we report on the chemical modifications of three kinds of reactive groups, i.e., the amino groups of lysine residues or N-terminal, the carboxylic acid groups of aspartic acid or glutamic acid residues, and the phenol group of tyrosine residues, on M13 surface. The reactivity of each group was identified through conjugation with small fluorescent molecules. Furthermore, the regioselectivity of each reaction was investigated by HPLC-MS-MS. By optimizing the reaction condition, hundreds of fluorescent moieties could be attached to create a highly fluorescent M13 bacteriophage. In addition, cancer cell targeting motifs such as folic acid could also be conjugated onto the M13 surface. Therefore, dual-modified M13 particles with folic acid and fluorescent molecules were synthesized via the selective modification of two kinds of reactive groups. Such dual-modified M13 particles showed very good binding affinity to human KB cancer cells, which demonstrated the potential applications of M13 bacteriophage in bioimaging and drug delivery.
Solberg, E E; Ingjer, F; Holen, A; Sundgot-Borgen, J; Nilsson, S; Holme, I
2000-08-01
To compare the efficacy in runners of two relaxation techniques with regard to exercise reactivity and recovery after exercise. Thirty one adult male runners were studied prospectively for six months in three groups practising either meditation (n = 11) or autogenic training (n = 11) or serving as controls (n = 10). Before and after the six months relaxation intervention, indicators of reactivity to exercise and metabolism after exercise (blood lactate concentration, heart rate (HR), and oxygen consumption (VO2)), were tested immediately after and 10 minutes after exercise. Resting HR was also assessed weekly at home during the trial. State anxiety was measured before and after the intervention. After the relaxation training, blood lactate concentration after exercise was significantly (p<0.01) decreased in the meditation group compared with the control group. No difference was observed in lactate responses between the autogenic training group and the control group. There were no significant differences among the groups with regard to HR, VO2, or levels of anxiety. Meditation training may reduce the lactate response to a standardised exercise bout.
Cortisol effects on fear memory reconsolidation in women.
Meir Drexler, Shira; Merz, Christian J; Hamacher-Dang, Tanja C; Wolf, Oliver T
2016-07-01
Previous work from our group has shown that cortisol enhances fear reconsolidation in men. Whether similar effects can be observed in women remains an open question. The effects of cortisol on the reconsolidation of fear memories were investigated in women. Based on results in men, we expected a specific enhancing effect of cortisol administration on the reactivated fear memory. In addition, possible interactions with oral contraceptive use were tested. We incorporated a differential fear conditioning paradigm in a 3-day reconsolidation design. A fear memory, which was created on the first day, was reactivated on the second day following cortisol administration in the target group. One control group was given cortisol without reactivation, and the other participated in the reactivation session following placebo intake. On the third day, the return of fear for all stimuli following reinstatement was tested. Skin conductance response served as measure of conditioned response. In contrast to the hypothesis, cortisol in combination with reactivation did not enhance fear reconsolidation. No differences between the three experimental groups were apparent. In addition, hormonal contraceptive use had no effect on any of the learning phases and did not interact with the cortisol manipulation. The lack of an effect in women might be the result of alternating concentrations of sex hormones during different phases of the menstrual cycle or following oral contraceptive use. Considering the higher vulnerability of women to stress-related mental disorders, further investigations in women are of great importance for both theory and treatment.
Cho, Ah-Jin; Park, Kee Chan; Kwon, Jang-Yeon
2015-01-01
For several years, graphene has been the focus of much attention due to its peculiar characteristics, and it is now considered to be a representative 2-dimensional (2D) material. Even though many research groups have studied on the graphene, its intrinsic nature of a zero band-gap, limits its use in practical applications, particularly in logic circuits. Recently, transition metal dichalcogenides (TMDs), which are another type of 2D material, have drawn attention due to the advantage of having a sizable band-gap and a high mobility. Here, we report on the design of a complementary inverter, one of the most basic logic elements, which is based on a MoS2 n-type transistor and a WSe2 p-type transistor. The advantages provided by the complementary metal-oxide-semiconductor (CMOS) configuration and the high-performance TMD channels allow us to fabricate a TMD complementary inverter that has a high-gain of 13.7. This work demonstrates the operation of the MoS2 n-FET and WSe2 p-FET on the same substrate, and the electrical performance of the CMOS inverter, which is based on a different driving current, is also measured.
Comparison of the effects of sibutramine versus sibutramine plus metformin in obese women.
Sari, Ramazan; Eray, Esin; Ozdem, Sabahat; Akbas, Halide; Coban, Erkan
2010-09-01
Sibutramine and metformin are drugs commonly used to obtain weight loss. We aimed to compare the effects of sibutramine alone with that of sibutramine plus metformin combination on weight loss, insulin sensitivity, leptin and C reactive protein in obese women. Seventy obese women were included. After a diet period of month (baseline), each individual was randomly assigned to receive 15 mg sibutramine (sibutramine group; n = 36) or 15 mg sibutramine plus 1,700 mg metformin per day (sibutramine plus metformin group; n = 34) during the next 12 months. Body weight, insulin resistance by the homeostasis model assessment model (HOMA-IR), leptin and C reactive protein were measured at baseline, after 3 months and after 12 months. Mean weight losses in sibutramine and sibutramine plus metformin groups were 5.3 +/- 4.0% (P < 0.001) and 6.8 +/- 3.9% (P < 0.001) after 3 months, and 10.5 +/- 4.4% (P < 0.001) and 15.7 +/- 4.6% (P = 0.007) after 12 months, respectively. HOMA-IR value also decreased in both sibutramine (P = 0.045 and P = 0.002) and sibutramine plus metformin groups (P = 0.04 and P = 0.015) after 3 and 12 months, respectively. Similarly, serum leptin levels decreased in both sibutramine (P = 0.04, P = 0.01) and sibutramine plus metformin groups (P = 0.023, P = 0.025) after 3 and 12 months, respectively. There was also significant reductions in serum C reactive protein levels in both sibutramine (P = 0.045, P = 0.02) and sibutramine plus metformin groups (P = 0.007, P = 0.001) after 3 and 12 months, respectively. These decrements of body weight, HOMA-IR, serum leptin and C reactive protein levels were not statistical significance between these two groups both after 3 and 12 months (P > 0.05). Combination of sibutramine with metformin did not result in any further effects on weight loss, insulin resistance, leptin and C reactive protein levels when compared to sibutramine alone.
Bidirectional Cardio-Respiratory Interactions in Heart Failure.
Radovanović, Nikola N; Pavlović, Siniša U; Milašinović, Goran; Kirćanski, Bratislav; Platiša, Mirjana M
2018-01-01
We investigated cardio-respiratory coupling in patients with heart failure by quantification of bidirectional interactions between cardiac (RR intervals) and respiratory signals with complementary measures of time series analysis. Heart failure patients were divided into three groups of twenty, age and gender matched, subjects: with sinus rhythm (HF-Sin), with sinus rhythm and ventricular extrasystoles (HF-VES), and with permanent atrial fibrillation (HF-AF). We included patients with indication for implantation of implantable cardioverter defibrillator or cardiac resynchronization therapy device. ECG and respiratory signals were simultaneously acquired during 20 min in supine position at spontaneous breathing frequency in 20 healthy control subjects and in patients before device implantation. We used coherence, Granger causality and cross-sample entropy analysis as complementary measures of bidirectional interactions between RR intervals and respiratory rhythm. In heart failure patients with arrhythmias (HF-VES and HF-AF) there is no coherence between signals ( p < 0.01), while in HF-Sin it is reduced ( p < 0.05), compared with control subjects. In all heart failure groups causality between signals is diminished, but with significantly stronger causality of RR signal in respiratory signal in HF-VES. Cross-sample entropy analysis revealed the strongest synchrony between respiratory and RR signal in HF-VES group. Beside respiratory sinus arrhythmia there is another type of cardio-respiratory interaction based on the synchrony between cardiac and respiratory rhythm. Both of them are altered in heart failure patients. Respiratory sinus arrhythmia is reduced in HF-Sin patients and vanished in heart failure patients with arrhythmias. Contrary, in HF-Sin and HF-VES groups, synchrony increased, probably as consequence of some dominant neural compensatory mechanisms. The coupling of cardiac and respiratory rhythm in heart failure patients varies depending on the presence of atrial/ventricular arrhythmias and it could be revealed by complementary methods of time series analysis.
Marissen, Marlies A E; Franken, Ingmar H A; Blanken, Peter; van den Brink, Wim; Hendriks, Vincent M
2007-01-01
Persistent cue reactivity to drug-related stimuli is a well-known phenomenon among abstinent drug users and has been found to be a predictor of relapse. Cue exposure therapy (CET) aims to reduce this cue reactivity by exposing abstinent drug users to conditioned drug-related stimuli while preventing their habitual response, i.e. drug use. 127 abstinent heroin-dependent Dutch inpatients were randomized to CET (n = 65; 55 completers) and placebo psychotherapy treatment (PPT) (n = 62; 59 completers). It was examined whether CET would lead to a decrease in drug-related cue reactivity (using mixed-design ANOVA) and subsequently to lower dropout and relapse rates (using logistic regression) compared to PPT. Both groups responded with a similar decrease in self-reported cue reactivity (craving, mood). The CET group did show a significant decrease in physiological reactivity (skin conductance) compared to PPT. However, dropout and relapse rates were, contrary to our expectations, significantly higher in the CET group. This is the first randomized controlled trial showing that CET, compared to a non-specific psychotherapy, might increase dropout and relapse rates among abstinent heroin-dependent clients in a drug-free setting. Caution is warranted when applying CET in this specific context. Copyright 2007 S. Karger AG, Basel.
Rodrigues, Samya Mere L; Ximenes, Carolina F; de Batista, Priscila R; Simões, Fabiana V; Coser, Pedro Henrique P; Sena, Gabriela C; Podratz, Priscila L; de Souza, Leticia N G; Vassallo, Dalton V; Graceli, Jones B; Stefanon, Ivanita
2014-03-21
Organotin compounds such as tributyltin (TBT) are used as antifouling paints by shipping companies. TBT inhibits the aromatase responsible for the transformation of testosterone into estrogen. Our hypothesis is that TBT modulates the vascular reactivity of female rats. Female Wistar rats were treated daily (Control; CONT) or TBT (100 ng/kg) for 15 days. Rings from thoracic aortas were incubated with phenylephrine (PHE, 10(-10)-10(-4) M) in the presence and absence of endothelium, and in the presence of N(G)-Nitro-L-Arginine Methyl Ester (L-NAME), tetraethylammonium (TEA) and apocynin. TBT decreased plasma levels of estrogen and the vascular response to PHE. In the TBT group, the vascular reactivity was increased in the absence of endothelium, L-NAME and TEA. The decrease in PHE reactivity during incubation with apocynin was more evident in the TBT group. The sensitivity to acetylcholine (ACh) and sodium nitroprusside (SNP) was reduced in the TBT group. TBT increased collagen, reduced α1-smooth muscle actin. Female rats treated with TBT for 15 days showed morphology alteration of the aorta and decreased their vascular reactivity, probably due to mechanisms dependent on nitric oxide (NO) bioavailability, K(+) channels and an increase in oxidative stress. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Profiles of Reactivity in Cocaine-Exposed Children
Schuetze, Pamela; Molnar, Danielle S.; Eiden, Rina D.
2012-01-01
This study explored the possibility that specific, theoretically consistent profiles of reactivity could be identified in a sample of cocaine-exposed infants and whether these profiles were associated with a range of infant and/or maternal characteristics. Cluster analysis was used to identify distinct groups of infants based on physiological, behavioral and maternal reported measures of reactivity. Five replicable clusters were identified which corresponded to 1) Dysregulated/High Maternal Report Reactors, 2) Low Behavioral Reactors, 3) High Reactors, 4) Optimal Reactors and 5) Dysregulated/Low Maternal Report Reactors. These clusters were associated with differences in prenatal cocaine exposure status, birthweight, maternal depressive symptoms, and maternal negative affect during mother-infant interactions. These results support the presence of distinct reactivity profiles among high risk infants recruited on the basis of prenatal cocaine exposure and demographically similar control group infants not exposed to cocaine. PMID:23204615
The role of macrophages and eosinophils in reactive lesions of the oral cavity.
Aghbali, Amir Ala; Akbarzadeh, Ayshin; Kouhsoltani, Maryam
2018-01-01
Many studies have reported that macrophages and eosinophils are involved in the pathogenesis of several diseases. To the best of our knowledge, this is the first study comparing macrophages and eosinophils in oral reactive lesions. In this study, we aimed to determine the contribution of macrophages and eosinophils to the pathogenesis of oral reactive lesions and the relationships between these biomarkers and the diverse histopathologic features. Seventy-five paraffin-embedded tissue samples were assessed in this study. Five categories (15 cases for each group), including peripheral ossifying fibroma, pyogenic granuloma, fibroma, inflammatory fibrous hyperplasia, and peripheral giant-cell granuloma, were considered. Anti-CD68 immunohistochemical and hematoxylin-eosin staining was carried out. We found that macrophages, but not eosinophils, were a significant internal component of oral reactive lesions. Macrophages were observed in high densities in all studied groups and diffusely distributed or clustered throughout these lesions. The number of macrophages was increased in peripheral giant-cell granuloma compared with other groups. Our findings suggest that macrophages are involved in the pathogenesis and the variation of microscopic features of oral reactive lesions. However, further clinical studies should be conducted to identify the biological process behind macrophages and the molecular interactions of these cells, with the ultimate aim of suggesting a new potential therapeutic target for these lesions. We found that eosinophils were not involved in the fibrotic process and the variation of microscopic features in oral reactive lesions. Our results showed that peripheral giant-cell granulomas highly demonstrated histiocytic characteristics.
2014-01-01
Background Flaxseed oil has the highest concentration of omega-3 α-linolenic acid, which has been associated with cardiovascular benefit. However, the mechanism underlying the vascular effects induced through flaxseed oil is not well known. Thus, in the present study, we investigated the effects of flaxseed oil on vascular function in isolated rat aortic rings. Methods Wistar rats were treated daily with flaxseed oil or a control (mineral oil) intramuscular (i.m.) for fifteen days. Isolated aortic segments were used to evaluate cyclooxygenase-2 (COX-2) protein expression, superoxide anion levels and vascular reactivity experiments. Results Flaxseed oil treatment increased the vasoconstrictor response of aortic rings to phenylephrine. Endothelium removal increased the response to phenylephrine in aortic segments isolated from both groups, but the effect was smaller in the treated group. L-NAME incubation similarly increased the phenylephrine response in segments from both groups. The TXA2 synthase inhibitor furegrelate, the selective COX-2 inhibitor NS 398, the TP receptor antagonist SQ 29.548, the reactive oxygen species (ROS) scavenger apocynin, the superoxide anion scavengers tiron and the phospholipase A2 inhibitor dexamethasone partially reversed the flaxseed oil-induced increase in reactivity to phenylephrine. Conclusions These findings suggest that flaxseed oil treatment increased vascular reactivity to phenylephrine through an increase in ROS production and COX-2-derived TXA2 production. The results obtained in the present study provide new insight into the effects of flaxseed oil treatment (i.m.) on vascular function. PMID:24993607
Insights into the reactivation of cobalamin-dependent methionine synthase
Koutmos, Markos; Datta, Supratim; Pattridge, Katherine A.; Smith, Janet L.; Matthews, Rowena G.
2009-01-01
Cobalamin-dependent methionine synthase (MetH) is a modular protein that catalyzes the transfer of a methyl group from methyltetrahydrofolate to homocysteine to produce methionine and tetrahydrofolate. The cobalamin cofactor, which serves as both acceptor and donor of the methyl group, is oxidized once every ≈2,000 catalytic cycles and must be reactivated by the uptake of an electron from reduced flavodoxin and a methyl group from S-adenosyl-L-methionine (AdoMet). Previous structures of a C-terminal fragment of MetH (MetHCT) revealed a reactivation conformation that juxtaposes the cobalamin- and AdoMet-binding domains. Here we describe 2 structures of a disulfide stabilized MetHCT (s-sMetHCT) that offer further insight into the reactivation of MetH. The structure of s-sMetHCT with cob(II)alamin and S-adenosyl-L-homocysteine represents the enzyme in the reactivation step preceding electron transfer from flavodoxin. The structure supports earlier suggestions that the enzyme acts to lower the reduction potential of the Co(II)/Co(I) couple by elongating the bond between the cobalt and its upper axial water ligand, effectively making the cobalt 4-coordinate, and illuminates the role of Tyr-1139 in the stabilization of this 4-coordinate state. The structure of s-sMetHCT with aquocobalamin may represent a transient state at the end of reactivation as the newly remethylated 5-coordinate methylcobalamin returns to the 6-coordinate state, triggering the rearrangement to a catalytic conformation. PMID:19846791
Mares, Sarah; Robinson, Gary
2012-04-01
Little is written about the process of delivering mainstream, evidence-based therapeutic interventions for Aboriginal children and families in remote communities. Patterns of interaction between parents and children and expectations about parenting and professional roles and responsibilities vary across cultural contexts. This can be a challenging experience for professionals accustomed to work in urban settings. Language is only a part of cultural difference, and the outsider in a therapeutic group in an Aboriginal community is outside not only in language but also in access to community relationships and a place within those relationships. This paper uses examples from Let's Start, a therapeutic parent-child intervention to describe the impact of distance, culture and relationships in a remote Aboriginal community, on the therapeutic framework, group processes and relationships. Cultural and contextual factors influence communication, relationships and group processes in a therapeutic group program for children and parents in a remote Aboriginal community. Group leaders from within and from outside the community, are likely to have complementary skills. Cultural and contextual factors influence communication, relationships and group processes in a therapeutic group program for children and parents in a remote Aboriginal community. Group leaders from within and from outside the community, are likely to have complementary skills. Program adaptation, evaluation and staff training and support need to take these factors into account to ensure cultural accessibility without loss of therapeutic fidelity and efficacy.
2015-01-01
Predators affect plant fitness when they forage on them and reduce the action of herbivores. Our study evaluates the complementary effects of spiders and ants that visit the extrafloral nectaries of Eriotheca gracilipes (Malvaceae) on the production of fruits and viable seeds of these savanna trees. Four experimental groups were established: control group – with free access of spiders and ants; exclusion group – spiders and ants excluded; ant group – absence of spiders; and spider group – absence of ants. The presence of ants reduced the spider richness; however, the presence of spiders did not affect the ant richness. A significantly higher number of fruits per buds were found in the presence of spiders alone or spiders and ants together (control group) compared with the absence of both predators (exclusion group). The number of seeds per fruits and seed viability were higher in the control group. This is the first study showing that spiders and ants may exert a positive and complementary effect on the reproductive value of an extrafloral nectaried plant. Mostly the impact of ants and/or spiders on herbivores is considered, whereas our study reinforces the importance of evaluating the effect of multiple predators simultaneously, exploring how the interactions among predators with distinct skills may affect the herbivores and the plants on which they forage. PMID:26168036
Stefani, Vanessa; Pires, Tayna Lopes; Torezan-Silingardi, Helena Maura; Del-Claro, Kleber
2015-01-01
Predators affect plant fitness when they forage on them and reduce the action of herbivores. Our study evaluates the complementary effects of spiders and ants that visit the extrafloral nectaries of Eriotheca gracilipes (Malvaceae) on the production of fruits and viable seeds of these savanna trees. Four experimental groups were established: control group - with free access of spiders and ants; exclusion group - spiders and ants excluded; ant group - absence of spiders; and spider group - absence of ants. The presence of ants reduced the spider richness; however, the presence of spiders did not affect the ant richness. A significantly higher number of fruits per buds were found in the presence of spiders alone or spiders and ants together (control group) compared with the absence of both predators (exclusion group). The number of seeds per fruits and seed viability were higher in the control group. This is the first study showing that spiders and ants may exert a positive and complementary effect on the reproductive value of an extrafloral nectaried plant. Mostly the impact of ants and/or spiders on herbivores is considered, whereas our study reinforces the importance of evaluating the effect of multiple predators simultaneously, exploring how the interactions among predators with distinct skills may affect the herbivores and the plants on which they forage.
Lulebo, Aimée M; Mapatano, Mala A; Mutombo, Paulin B; Mafuta, Eric M; Samba, Gédéon; Coppieters, Yves
2017-04-08
In the Democratic Republic of the Congo the control of hypertension is poor, characterized by an increasing number of reported cases of hypertension related complications. Poor control of hypertension is associated with non-adherence to antihypertensive medication. It is well established that the use of complementary and alternative medicine is one of the main factors of non-adherence to antihypertensive medication. The aim of this study is to determine the prevalence and factors associated with the use of complementary and alternative medicine. A cross-sectional study was carried out at the Kinshasa Primary Health-care (KPHC) facilities network in November 2014. A structured interview questionnaire was administrated to a total of 280hypertensive patients. Complementary and alternative medicine were defined according to the National Institute of Health classification as a group of diverse medical and healthcare systems, practices, and products that are not presently considered to be part of conventional medicine. Data were summarized using proportion and mean (with standard deviation). The student's t test and χ 2 test were used respectively for mean and proportion comparison. Logistic regression analysis identified determinants of the use of complementary and alternative medicine. The prevalence of use of complementary and alternative medicine was 26.1% (95% CI: 20.7% - 31.8%).Determinants of use of complementary and alternative medicine included misperception about hypertension curability (OR = 2.1; 95%CI: 1.1-3.7) and experience of medication side effects (OR = 2.9; 95%CI: 1.7-5.1). The use of CAM for hypertensive patients is a major problem; antihypertensives with fewer side effects must be emphasized. Religious leaders must become involved in the communication for behavioral change activities to improve the quality of life for hypertensive patients.
Exploring the Impact of Changes in Group Composition on Trends in Specialization
ERIC Educational Resources Information Center
Armstrong, Todd A.
2008-01-01
Stander and colleagues, in 1989, noted that change in specialization may be caused by two distinct but potentially complementary processes: (a) a change in group composition, where change in specialization is the product of the attrition of offenders who vary systematically in their tendency to specialize; and (b) a change in the tendency to…
Social selection is a powerful explanation for prosociality.
Nesse, Randolph M
2016-01-01
Cultural group selection helps explain human cooperation, but social selection offers a complementary, more powerful explanation. Just as sexual selection shapes extreme traits that increase matings, social selection shapes extreme traits that make individuals preferred social partners. Self-interested partner choices create strong and possibly runaway selection for prosocial traits, without requiring group selection, kin selection, or reciprocity.
What could infant and young child nutrition learn from sweatshops?
2011-01-01
Background Adequate infant and young child nutrition demands high rates of breastfeeding and good access to nutrient rich complementary foods, requiring public sector action to promote breastfeeding and home based complementary feeding, and private sector action to refrain from undermining breastfeeding and to provide affordable, nutrient rich complementary foods. Unfortunately, due to a lack of trust, the public and private sectors, from both the North and the South, do not work well together in achieving optimal infant and young child nutrition. Discussion As the current debate in infant and young child nutrition is reminiscent of the "sweatshop" debate fifteen years ago, we argue that lessons from the sweatshops debate regarding cooperation between public and private sectors - and specific organizational experiences such as the Ethical Trading Initiative in which companies, trade unions, and civil society organizations work together to enhance implementation of labour standards and address alleged allegations - could serve as a model for improving cooperation and trust between public, civil society and private groups, and ultimately health, in infant and young child nutrition. Summary Lessons from the sweatshops debate could serve as a model to promote cooperation and trust between public and private groups, such that they learn to work together towards their common goal of improving infant and young child nutrition. PMID:21545745
What could infant and young child nutrition learn from sweatshops?
Singer, Peter A; Ansett, Sean; Sagoe-Moses, Isabella
2011-05-05
Adequate infant and young child nutrition demands high rates of breastfeeding and good access to nutrient rich complementary foods, requiring public sector action to promote breastfeeding and home based complementary feeding, and private sector action to refrain from undermining breastfeeding and to provide affordable, nutrient rich complementary foods. Unfortunately, due to a lack of trust, the public and private sectors, from both the North and the South, do not work well together in achieving optimal infant and young child nutrition. As the current debate in infant and young child nutrition is reminiscent of the "sweatshop" debate fifteen years ago, we argue that lessons from the sweatshops debate regarding cooperation between public and private sectors - and specific organizational experiences such as the Ethical Trading Initiative in which companies, trade unions, and civil society organizations work together to enhance implementation of labour standards and address alleged allegations - could serve as a model for improving cooperation and trust between public, civil society and private groups, and ultimately health, in infant and young child nutrition. Lessons from the sweatshops debate could serve as a model to promote cooperation and trust between public and private groups, such that they learn to work together towards their common goal of improving infant and young child nutrition.
Analysis by gender and Visual Imagery Reactivity of conventional and imagery Rorschach.
Yanovski, A; Menduke, H; Albertson, M G
1995-06-01
Examined here are the effects of gender and Visual Imagery Reactivity in 80 consecutively selected psychiatric outpatients. The participants were grouped by gender and by the amounts of responsiveness to preceding therapy work using imagery (Imagery Nonreactors and Reactors). In the group of Imagery Nonreactors were 13 men and 22 women, and in the Reactor group were 17 men and 28 women. Compared were the responses to standard Rorschach (Conventional condition) with visual associations to memory images of Rorschach inkblots (Imagery condition). Responses were scored using the Visual Imagery Reactivity (VIR) scoring system, a general, test-nonspecific scoring method. Nonparametric statistical analysis showed that critical indicators of Imagery Reactivity encoded as High Affect/Conflict score and its derivatives associated with sexual or bizarre content were not significantly associated with gender; neither was Neutral Content score which categorizes "non-Reactivity." These results support the notion that system's criteria of Visual Imagery Reactivity can be applied equally to both men and women for the classification of Imagery Reactors and Nonreactors. Discussed are also the speculative consequences of extending the tolerance range of significance levels for the interaction between Reactivity and sex above the customary limit of p < .05 in borderline cases. The results of such an analysis may imply a trend towards more rigid defensiveness under Imagery and toward lesser verbal productivity in response to either the Conventional or the Imagery task among women who are Nonreactors. In Reactors, men produced significantly more Sexual Reference scores (in the subcategory not associated with High Affect/Conflict) than women, but this could be attributed to the effect of tester's and subjects' gender combined.
Cubero Gómez, José M; Acosta Martínez, Juan; Mendias Benítez, Crsitina; Díaz De La Llera, Luis S; Fernández-Quero, Mónica; Guisado Rasco, Agustí; Villa Gil-Ortega, Manuel; Sánchez González, Ángel
2015-12-01
Diabetic patients with an acute coronary syndrome undergoing percutaneous coronary intervention frequently exhibit high platelet reactivity while on clopidogrel. We hypothesized that in diabetic patients undergoing percutaneous coronary intervention, who exhibit high-platelet-reactivity after standard treatment with clopidogrel, a 60-mg prasugrel loading dose is superior to standard treatment with clopidogrel for optimal P2Y12 inhibition within the first 24-36 h post-angioplasty. VERDI was a prospective, randomized, single-centre, single-blind, parallel-design study (NCT01684813). Consecutive diabetic patients with an non-ST-segment elevation acute coronary syndrome undergoing percutaneous coronary intervention and loaded with clopidogrel were considered for platelet reactivity assessment immediately before angioplasty with the VerifyNow assay measured in P2Y12 reaction units (PRU). Fifty of 63 screened patients (79.4%) had high platelet reactivity (PRU ≥ 208) and were randomized to receive a 60-mg prasugrel loading dose (n = 25) versus clopidogrel standard dose (n = 25). Platelet function was assessed again 24 hours post-angioplasty. Prasugrel achieved greater platelet inhibition than clopidogrel 24 hours post-angioplasty (median [interquartile range], 38 [9-72] vs 285 [240-337], respectively; P < 0.001). The non-high-platelet-reactivity rate (PRU < 208) at 24 h post-angioplasty (primary end point) was higher with prasugrel; 25 patients (100%) in the prasugrel group achieved optimal antiaggregation vs 4 patients (16%) in the clopidogrel group (P < 0.001). No significant acute bleeding was documented in either group. Among type 2 diabetic patients suffering an acute coronary syndrome with high-platelet-reactivity undergoing percutaneous coronary intervention, switching from clopidogrel to prasugrel was superior to standard treatment with clopidogrel for the achievement of optimal antiaggregation within the first 24 hours post-angioplasty.
Chorna, Olena; Solomon, Jessica E; Slaughter, James C; Stark, Ann R; Maitre, Nathalie L
2014-11-01
Sensory experience is the basis for learning in infancy. In older children, abnormal sensory reactivity is associated with behavioural and developmental disorders. We hypothesised that in preterm infants, abnormal sensory reactivity during infancy would be associated with perinatal characteristics and correlate with 2-year neurodevelopmental outcomes. We conducted a prospective observational study of infants with birth weight ≤1500 g using the Test of Sensory Function in Infants (TSFI) in the first year. Infants with gestational age ≤30 weeks were tested with the Bayley Scales of Infant and Toddler Development III (BSID III) at 24 months. Of the 72 participants evaluated at 4-12 months corrected age (median 8 months), 59 (82%) had a least one TSFI score concerning for abnormal sensory reactivity. Lower gestational age was associated with abnormal reactivity to deep pressure and vestibular stimulation (p<0.001). Poor ocular-motor control predicted worse cognitive and motor scores in early childhood (OR 16.7; p=0.004), but was tightly correlated to the presence of severe white matter injury. Poor adaptive motor function in response to tactile stimuli predicted worse BSID III motor (p=0.01) and language scores (p=0.04) at 2 years, even after adjusting for confounders. Abnormal sensory reactivity is common in preterm infants; is associated with immaturity at birth, severe white matter injury and lower primary caregiver education; and predicts neurodevelopmental delays. Early identification of abnormal sensory reactivity of very preterm infants may promote parental support and education and may facilitate improved neurodevelopment. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.
Giustiniano, Mariateresa; Basso, Andrea; Mercalli, Valentina; Massarotti, Alberto; Novellino, Ettore; Tron, Gian Cesare; Zhu, Jieping
2017-03-06
The term functionalized isocyanides refers to all those isocyanides in which a neighbouring functional group can finely tune the reactivity of the isocyano group or can be exploited in post-functionalization processes. In this manuscript, we have reviewed all the isocyanides in which the pendant functional group causes either deviation from or reinforces the normal reactivity of the isocyano group and categorized them to highlight their common features and differences. An analysis of their synthetic potential and the possible unexplored directions for future research studies is also addressed.
Kuznetsov, Alexey; Gulevich, Anton V; Wink, Donald J; Gevorgyan, Vladimir
2014-08-18
A novel mode of reactivity for the diazo group, the 1,3-addition of a nucleophile and an electrophile to the diazo group, has been realized in the intramolecular aminoalkylation of β-amino-α-diazoesters to form tetrasubstituted 1,2,3-triazolines. The reaction exhibited a broad scope, good functional group tolerance, and excellent diastereoselectivity. In addition, a new Au-catalyzed intramolecular transannulation reaction of the obtained propargyl triazolines to give pyrroles has been discovered. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Shah, Dheeraj; Singh, Meenakshi; Gupta, Piyush; Faridi, M M A
2014-03-01
The aim of the present study was to evaluate whether the order of complementary feeding in relation to breast-feeding affects breast milk, semisolid, or total energy intake in infants. The present study was designed as a randomized crossover trial. The study was conducted in a tertiary care hospital. The study participants were 25 healthy infants between the ages of 7 and 11 months who were exclusively breast-fed for at least 6 months and were now receiving complementary foods for at least 1 month in addition to breast-feeding. Infants were randomized to follow a sequence of either complementary feeding before breast-feeding (sequence A) or complementary feeding after breast-feeding (sequence B) for the first day (24 hours) of the study period using simple randomization. For the next day, the sequence was reversed for each child. All babies received 3 actively fed complementary food meals per day (morning, afternoon, and evening). A semisolid study diet was prepared in the hospital by cooking rice and pulse with oil using a standard method, ensuring the energy density of at least 0.6 kcal/g. The infants were allowed ad libitum breast-feeding during the observation period. Semisolid intake was directly measured and breast milk intake was quantified by test weighing method. Energy intake from complementary foods was calculated from the product of energy density of the diet served on that day and the total amount consumed. The total energy intake and energy intake from breast milk and complementary foods between the 2 sequences were compared. The mean (standard deviation) energy intake from breast milk during 12 hours of daytime by following sequence A (complementary feeding before breast-feeding) was 132.0 (67.4) kcal in comparison with 135.9 (56.2) kcal in sequence B, which was not statistically different (P = 0.83). The mean (standard deviation) energy consumed from semisolids in sequences A and B was also comparable (88.6 [75.5] kcal vs. 85.5 [89.7] kcal; P = 0.58). The total energy intake during daytime in sequence A was 220.6 (96.2) kcal in comparison with 221.5 (94.0) kcal in sequence B, which was also comparable (P = 0.97). The results related to energy intake through breast milk and total energy intake were not different when insensible losses during feeding were adjusted in both groups. Altering the sequence of complementary feeding in relation to breast-feeding does not affect total energy intake.
ERIC Educational Resources Information Center
Luby, Joan L.; Essex, Marilyn J.; Armstrong, Jeffrey M.; Klein, Marjorie H.; Zahn-Waxler, Carolyn; Sullivan, Jill P.; Goldsmith, H. Hill
2009-01-01
We investigated whether differences in positive and negative emotional reactivity could be found in depressed preschoolers and preschoolers at risk for later internalizing symptoms relative to nondepressed/low risk comparison groups. Observational measures of emotional reactivity, used to derive a score of the balance between anger and sadness,…
Validity and Reliability of the Reactive-Proactive Aggression Questionnaire in Turkish Adolescents
ERIC Educational Resources Information Center
Cenkseven-Önder, Fulya; Avci, Rasit; Çolakkadioglu, Oguzhan
2016-01-01
The aim of this study was to adapt the Reactive-Proactive Aggression Questionnaire (RPQ), developed to measure two dimensions of aggression which are reactive and proactive, to Turkish and test the validity and reliability of the Turkish form. The study group consisted of 278 students in four junior high schools in Adana, Turkey, and 485 students…
Carver, Charles S.; Johnson, Sheri L.; Joormann, Jutta
2012-01-01
Objective Dual process theories of behavior have been used to suggest that vulnerability to depression involves elevated reactivity to emotions. This study tests that idea, examining self-reported reactivity. Design Comparison between persons with at least one lifetime episode of major depressive disorder (lifetime MDD) and those without this diagnosis, controlling for symptoms of alcohol use (a potential externalizing confound) and current symptoms of depression (a potential state-dependent confound). Methods Undergraduates (N = 120) completed a clinical interview to diagnose lifetime MDD and a series of self-reports bearing on diverse aspects of self-control, including reactivity to emotion. Thirty-four were diagnosed with lifetime MDD; 86 did not meet criteria for MDD. The groups were then compared on three factors underlying the scales assessing self-control. Results The MDD group had higher scores than controls on the two factors that reflect impulsive reactivity to diverse emotions, including emotions that are positive in valence. These effects were not explained by associations with either externalizing symptoms or current depressive symptoms. Conclusions Reflexive reactivity to emotions characterizes depression, in addition to some externalizing problems, and it may deserve study as a potential transdiagnostic feature. PMID:23865405
Hazir, Tabish; Senarath, Upul; Agho, Kingsley; Akram, Dure-Samin; Kazmi, Narjis; Abbasi, Saleem; Dibley, Michael J
2012-01-01
Inappropriate timing of introducing complementary food deprives the infant of optimum nutrition, leading to undernutrition, and increased mortality and morbidity. The aim of this analysis was to identify determinants of inappropriate timing of introduction of solid, semi-solid and soft foods in Pakistan. Data on 941 infants 3.00 to 8.99 months were obtained from the Pakistan Demographic and Health Survey 2006-2007. The prevalence of introduction of foods among infants aged 3.00-5.99 months and 6.00-8.99 months was examined against a set of individual, household and community level variables using univariate analysis. Adjusted odds ratio (AOR) for early introduction in age 3.00-5.99 months and non-introduction in 6.00-8.99 months of age were calculated using backward stepwise logistic regression models. The prevalence of early introduction of complementary foods among 3.00- to 5.99-month-old and timely introduction among 6.00- to 8.99-month-old infants were 10.6% and 39.2%, respectively. Multivariate analyses revealed that mothers who had four or more antenatal clinic visits (AOR=2.68) and who lived in the provinces of Sindh (AOR=2.89) and Baluchistan (AOR=6.75) were more likely to introduce complementary foods early. Mothers from middle-level households (AOR=7.82), poorer households (AOR=4.84) and poorest households (AOR=5.72) were significantly more likely to delay introduction of complementary foods. In conclusion more than half (60.8%) of Pakistani infants do not receive complementary foods at recommended time. Public health interventions to improve the timing of introduction of complementary food are needed at national level with special focus on high risk groups. © 2011 Blackwell Publishing Ltd.
Jaime-Pérez, José Carlos; Chapa-Rodríguez, Adrián; Rodríguez-Martínez, Marisol; Colunga-Pedraza, Perla Rocío; Marfil-Rivera, Luis Javier; Gómez-Almaguer, David
2012-01-01
Background Complementary and alternative medicine includes a diverse group of medical and healthcare systems, practices and products not considered part of conventional medicine. Although there is information on unconventional practices in oncological diseases, specific data regarding the use of complementary and alternative medicine by hematology patients is scarce. Objective The aim of this study is to document the prevalence of this modality of unconventional therapy in patients with malignant and benign hematological diseases, particularly children with acute lymphoblastic leukemia. Methods An observational study of adult patients and guardians of children with malignant or benign hematological diseases was carried out by applying a structured questionnaire detailing the use and results of the most prevalent complementary and alternative medicine practices. Results One hundred and twenty patients were included; 104 had malignant and 16 had benign hematological diseases. The use of complementary and alternative medicine was greater in benign diseases but the difference was not statistically significant (64.7% versus 41.7%; p-value = 0.08). Patients and guardians with high school or college educations used these alternative practices more than patients with less schooling (60.7% versus 54.7%; p-value = 0.032). The use of folk remedies was most prevalent followed by herbal preparations and spiritual healing. Sixty-four percent of patients that used these unconventional practices reported improvement in their symptoms and increased capacity to perform daily activities. Conclusion No significant difference was documented between patients with malignant or benign hematological diseases using these alternative practices. The majority of complementary and alternative medicine users reported improvement of the disease or chemotherapy-related symptoms. PMID:23049401
Electrophilic Triterpenoid Enones: A Comparative Thiol-Trapping and Bioactivity Study.
Del Prete, Danilo; Taglialatela-Scafati, Orazio; Minassi, Alberto; Sirignano, Carmina; Cruz, Cristina; Bellido, Maria L; Muñoz, Eduardo; Appendino, Giovanni
2017-08-25
Bardoxolone methyl (1) is the quintessential member of triterpenoid cyanoacrylates, an emerging class of bioactive compounds capable of transient covalent binding to thiols. The mechanistic basis for this unusual "pulsed reactivity" profile and the mode of its biological translation are unknown. To provide clues on these issues, a series of Δ 1 -dehydrooleanolates bearing an electron-withdrawing group at C-2 (7a-m) were prepared from oleanolic acid (3a) and comparatively investigated in terms of reactivity with thiols and bioactivity against a series of electrophile-sensitive transcription factors (Nrf2, NF-κB, STAT3). The emerging picture suggests that the triterpenoid scaffold sharply decreases the reactivity of the enone system by steric encumbrance and that only strongly electrophilic and sterically undemanding substituents such as a cyanide or a carboxylate group can re-establish Michael reactivity, albeit in a transient way for the cyanide group. In general, a substantial dissection between the thiol-trapping ability and the modulation of biological end-points sensitive to thiol alkylation was observed, highlighting the role of shape complementarity for the activity of triterpenoid thia-Michael acceptors.
Analysis of sensory processing in preterm infants.
Cabral, Thais Invenção; da Silva, Louise Gracelli Pereira; Martinez, Cláudia Maria Simões; Tudella, Eloisa
2016-12-01
Premature birth suggests condition of biological vulnerability, predisposing to neurological injuries, requiring hospitalization in Neonatal Intensive Care Units, which, while contributing to increase the survival rates, expose infants to sensory stimuli harmful to the immature organism. To evaluate the sensory processing at 4 and 6months' corrected age. This was a descriptive cross-sectional study with a sample of 30 infants divided into an experimental group composed of preterm infants (n=15), and a control group composed of full-term infants (n=15). The infants were assessed using the Test of Sensory Functions in Infants. The preterm infants showed poor performance in the total score of the test in reactivity to tactile deep pressure and reactivity to vestibular stimulation. When groups were compared, significant differences in the total score (p=0.0113) and in the reactivity to tactile deep pressure (p<0.0001) were found. At 4 and 6months of corrected age, the preterm infants showed alterations in sensory processing. These changes were most evident in reactivity to tactile deep pressure and vestibular stimulation. Copyright © 2016. Published by Elsevier Ireland Ltd.
NASA Astrophysics Data System (ADS)
Bhaumik, Nilendu Sekhar; Konar, Adwaita; Roy, Alok Nath; Samanta, Ashis Kumar
2017-12-01
Jute fabric was treated with mixed natural amino acids obtained from waste soya bean seed extract for chemical modification of jute for its cataionization and to enhance its dyeability with anionic dyes (like direct, reactive and acid dye) as well enabling soya modified jute for salt free dyeing with anionic reactive dyes maintaining its eco-friendliness. Colour interaction parameters including surface colour strength were assessed and compared for both bleached and soya-modified jute fabric for reactive dyeing and compared with direct and acid dye. Improvement in K/S value (surface colour strength) was observed for soya-modified jute even in absence of salt applied in dye bath for reactive dyes as well as for direct and acid dyes. In addition, reactive dye also shows good dyeability even in acid bath in salt free conditions. Colour fastness to wash was evaluated for bleached and soya-modified jute fabric after dyeing with direct, acid and reactive dyes are reported. Treatment of jute with soya-extracted mixed natural amino acids showed anchoring of some amino/aldemine groups on jute cellulosic polymer evidenced from Fourier Transform Infra-Red (FTIR) Spectroscopy. This amino or aldemine group incorporation in bleached jute causes its cationization and hence when dyed in acid bath for reactive dye (instead of conventional alkali bath) showed dye uptake for reactive dyes. Study of surface morphology by Scanning Electron Microscopy (SEM) of said soya-modified jute as compared to bleached jute was studied and reported.
Dostanić, J; Lončarević, D; Zlatar, M; Vlahović, F; Jovanović, D M
2016-10-05
A series of arylazo pyridone dyes was synthesized by changing the type of the substituent group in the diazo moiety, ranging from strong electron-donating to strong electron-withdrawing groups. The structural and electronic properties of the investigated dyes was calculated at the M062X/6-31+G(d,p) level of theory. The observed good linear correlations between atomic charges and Hammett σp constants provided a basis to discuss the transmission of electronic substituent effects through a dye framework. The reactivity of synthesized dyes was tested through their decolorization efficiency in TiO2 photocatalytic system (Degussa P-25). Quantitative structure-activity relationship analysis revealed a strong correlation between reactivity of investigated dyes and Hammett substituent constants. The reaction was facilitated by electron-withdrawing groups, and retarded by electron-donating ones. Quantum mechanical calculations was used in order to describe the mechanism of the photocatalytic oxidation reactions of investigated dyes and interpret their reactivities within the framework of the Density Functional Theory (DFT). According to DFT based reactivity descriptors, i.e. Fukui functions and local softness, the active site moves from azo nitrogen atom linked to benzene ring to pyridone carbon atom linked to azo bond, going from dyes with electron-donating groups to dyes with electron-withdrawing groups. Copyright © 2016 Elsevier B.V. All rights reserved.
Sex differences in physiological and affective responses to stress in remitted depression.
Bagley, Sara L; Weaver, Terri L; Buchanan, Tony W
2011-08-03
Major depressive disorder (MDD) is associated with alterations in stress physiology. Severe melancholic depression is characterized by hypercortisolism, but community dwelling mildly depressed individuals and those with remitted MDD have shown reduced or normal reactivity to stress. There are also pronounced sex differences both in the incidence of MDD and in stress reactivity. To explore the relationships among depression history, sex differences, and stress, we examined stress reactivity in people with and without a history of MDD. Twenty-two participants with remitted MDD (12 men and 10 women) and 36 never depressed comparison participants (22 men and 14 women) participated in the study. Cortisol and alpha-amylase (sAA) were sampled from saliva before, 10 min after, and 30 min after the Trier Social Stress Test (TSST). Participants filled out the Positive Affect Negative Affect Schedule (PANAS) before and after they underwent the TSST. Women with remitted MDD showed reduced cortisol response to the TSST compared with the never MDD women, while men with remitted MDD showed comparable cortisol reactivity to the never depressed men. The groups did not differ on sAA reactivity to stress. The remitted MDD group (overall and men and women separately) reported greater negative affect both before and after stress compared to the never depressed group. Women from both groups reported greater post-stress negative affect than men. In contrast, men from both groups reported higher positive affect before and after stress than women. Given that the sex difference findings were not dependent on depression history, self-reported affective differences in response to stress may predate depressive symptoms and contribute to sex differences in depression incidence. Copyright © 2011 Elsevier Inc. All rights reserved.
Wang, Jian; Huang, Ying; Zhang, Xue-Li; Huang, Xia; Xu, Xiao-Wen; Liang, Fan-Mei
2016-04-01
To study the skin prick test (SPT) reactivity to house dust mite allergens in overweight and normal weight children with allergic asthma before and after standard subcutaneous specific immunotherapy. Two hundred and fifteen children with allergic asthma who had positive SPT responses to Dermatophagoides pteronyssinus (DP) and Dermatophagoides farinae (DF) were enrolled. According to the weight index, they were classified into overweight (n=63) and normal weight groups (n=152). Skin indices (SI) to DP and DF were compared between the two groups at 6 months and 1 year after standard subcutaneous specific immunotherapy. The overweight group had a significantly larger histamine wheal diameter than the normal weight group after controlling the variation in testing time (P<0.05). After controlling the variation in weights, there were significant differences in the SIs to DP and DF before specific immunotherapy and at 6 months and 1 year after specific immunotherapy. At 6 months and 1 year after specific immunotherapy, the SIs to DP and DF were significantly reduced in both groups (P<0.05), and the overweight group had greater decreases in the SIs to DP and DF than the normal weight group. The overweight children with allergic asthma have stronger responses to histamine than the normal weight patients. Specific immunotherapy can reduce the reactivity to dust mite allergens in children with allergic asthma. Within one year after specific immunotherapy, the overweight children with allergic asthma have a significantly greater decrease in the reactivity to dust mite allergens than the normal weight patients.
Tovey, Philip; Broom, Alex; Chatwin, John; Hafeez, Muhammad; Ahmad, Salma
2005-09-01
Virtually no research has been conducted on patient assessments of traditional medicines and allopathic medicines for cancer care in poorer countries marked by pluralistic medical environments. Pakistan represents an excellent case for such a study because of the coexistence of culturally and historically specific indigenous traditional medicine, the strong presence of allopathic medicine, and, to a lesser extent, the availability of some globalized complementary and alternative medicines. To gain a preliminary understanding of cancer patients' perceptions of effectiveness and satisfaction with traditional medicine, globalized complementary and alternative medicine, and allopathy in the context of a pluralistic medical environment. Structured survey of 362 cancer patients, from diverse regions in the Punjab province and Northwest Frontier province, who were being treated in 4 different hospitals in Lahore, Pakistan. Use of traditional medicine remains high among cancer patients, with traditional healers used by the majority of those surveyed. Although patients' perceptions of the overall effectiveness of traditional medicines for treating cancer are low, those patients who do use traditional medicines still have high levels of satisfaction with these modalities. This is distinct from levels of satisfaction with, and perceptions of effectiveness of, Western cancer treatments, which were synonymous in this group of patients. Important differences in patient perceptions were found within groups (eg, between different forms of traditional healers) as well as between them. This study showed considerable support for complementary and alternative medicine/traditional medicine but also significant variation in usage of and perceptions of local traditional medicines. More research needs to be done to explore the social processes underlying this variation in cancer patients' preferences for particular traditional medicines.
Fahmida, Umi; Santika, Otte
2016-07-01
Inadequate nutrient intake as part of a complementary feeding diet is attributable to poor feeding practices and poor access to nutritious foods. Household socio-economic situation (SES) has an influence on food expenditure and access to locally available, nutrient-dense foods and fortified foods. This study aimed to develop and compare complementary feeding recommendations (CFR) for 12-23-month-old children in different SES and evaluate the contribution of fortified foods in meeting nutrient requirements. A cross-sectional survey was conducted in low and medium SES households (n 114/group) in urban Bandung district, West Java province, Indonesia. Food pattern, portion size and affordability were assessed, and CFR were developed for the low SES (LSES) and middle SES (MSES) using a linear programming (LP) approach; two models - with and without fortified foods - were run using LP, and the contribution of fortified foods in the final CFR was identified. Milk products, fortified biscuits and manufactured infant cereals were the most locally available and consumed fortified foods in the market. With the inclusion of fortified foods, problem nutrients were thiamin in LSES and folate and thiamin in MSES groups. Without fortified foods, more problem nutrients were identified in LSES, that is, Ca, Fe, Zn, niacin and thiamin. As MSES consumed more fortified foods, removing fortified foods was not possible, because most of the micronutrient-dense foods were removed from their food basket. There were comparable nutrient adequacy and problem nutrients between LSES and MSES when fortified foods were included. Exclusion of fortified foods in LSES was associated with more problem nutrients in the complementary feeding diet.
Krishnaswamy, Shobhana; Shashidhar, Mysore S
2018-04-06
Intermolecular acyl transfer reactivity in several molecular crystals was studied, and the outcome of the reactivity was analyzed in the light of structural information obtained from the crystals of the reactants. Minor changes in the molecular structure resulted in significant variations in the noncovalent interactions and packing of molecules in the crystal lattice, which drastically affected the facility of the intermolecular acyl transfer reactivity in these crystals. Analysis of the reactivity vs crystal structure data revealed dependence of the reactivity on electrophile···nucleophile interactions and C-H···π interactions between the reacting molecules. The presence of these noncovalent interactions augmented the acyl transfer reactivity, while their absence hindered the reactivity of the molecules in the crystal. The validity of these correlations allows the prediction of intermolecular acyl transfer reactivity in crystals and co-crystals of unknown reactivity. This crystal structure-reactivity correlation parallels the molecular structure-reactivity correlation in solution-state reactions, widely accepted as organic functional group transformations, and sets the stage for the development of a similar approach for reactions in the solid state.
Low-valent group 14 element hydride chemistry: towards catalysis.
Hadlington, Terrance J; Driess, Matthias; Jones, Cameron
2018-06-05
The chemistry of group 14 element(ii) hydride complexes has rapidly expanded since the first stable example of such a compound was reported in 2000. Since that time it has become apparent that these systems display remarkable reactivity patterns, in some cases mimicking those of late transition-metal (TM) hydride compounds. This is especially so for the hydroelementation of unsaturated organic substrates. Recently, this aspect of their reactivity has been extended to the use of group 14 element(ii) hydrides as efficient, "TM-like" catalysts in organic synthesis. This review will detail how the chemistry of these hydride compounds has advanced since their early development. Throughout, there is a focus on the importance of ligand effects in these systems, and how ligand design can greatly modify a coordinated complex's electronic structure, reactivity, and catalytic efficiency.
Automatized Assessment of Protective Group Reactivity: A Step Toward Big Reaction Data Analysis.
Lin, Arkadii I; Madzhidov, Timur I; Klimchuk, Olga; Nugmanov, Ramil I; Antipin, Igor S; Varnek, Alexandre
2016-11-28
We report a new method to assess protective groups (PGs) reactivity as a function of reaction conditions (catalyst, solvent) using raw reaction data. It is based on an intuitive similarity principle for chemical reactions: similar reactions proceed under similar conditions. Technically, reaction similarity can be assessed using the Condensed Graph of Reaction (CGR) approach representing an ensemble of reactants and products as a single molecular graph, i.e., as a pseudomolecule for which molecular descriptors or fingerprints can be calculated. CGR-based in-house tools were used to process data for 142,111 catalytic hydrogenation reactions extracted from the Reaxys database. Our results reveal some contradictions with famous Greene's Reactivity Charts based on manual expert analysis. Models developed in this study show high accuracy (ca. 90%) for predicting optimal experimental conditions of protective group deprotection.
Emotional facial recognition in proactive and reactive violent offenders.
Philipp-Wiegmann, Florence; Rösler, Michael; Retz-Junginger, Petra; Retz, Wolfgang
2017-10-01
The purpose of this study is to analyse individual differences in the ability of emotional facial recognition in violent offenders, who were characterised as either reactive or proactive in relation to their offending. In accordance with findings of our previous study, we expected higher impairments in facial recognition in reactive than proactive violent offenders. To assess the ability to recognize facial expressions, the computer-based Facial Emotional Expression Labeling Test (FEEL) was performed. Group allocation of reactive und proactive violent offenders and assessment of psychopathic traits were performed by an independent forensic expert using rating scales (PROREA, PCL-SV). Compared to proactive violent offenders and controls, the performance of emotion recognition in the reactive offender group was significantly lower, both in total and especially in recognition of negative emotions such as anxiety (d = -1.29), sadness (d = -1.54), and disgust (d = -1.11). Furthermore, reactive violent offenders showed a tendency to interpret non-anger emotions as anger. In contrast, proactive violent offenders performed as well as controls. General and specific deficits in reactive violent offenders are in line with the results of our previous study and correspond to predictions of the Integrated Emotion System (IES, 7) and the hostile attribution processes (21). Due to the different error pattern in the FEEL test, the theoretical distinction between proactive and reactive aggression can be supported based on emotion recognition, even though aggression itself is always a heterogeneous act rather than a distinct one-dimensional concept.
... people in this age group. Quality Concerns About Probiotic Products Some probiotic products have been found to contain smaller numbers of ... and practices. Don’t use a complementary health product, such as probiotics, as a reason to postpone seeing your health ...
Irritable Bowel Syndrome and Complementary Health Practices
... series of yoga classes, compared with a waitlist control group. They were still feeling better at the study’s ... 18(7):589–600. Ruepert L, Quartero AO, de Wit NJ, et al. Bulking agents, antispasmodics and ...
Interprofessional education: merging nursing, midwifery and CAM.
Netherwood, Maggie; Derham, Ruth
To ascertain the value of bringing together undergraduate students from nursing, midwifery, and complementary and alternative medicine (CAM) to determine what they could learn from each other. Interprofessional education (IPE) is a growing field promoting interaction between professional groups, collaborative working and quality of health. In conventional health, IPE has a role to play in undergraduate education. No studies have been undertaken to investigate the integration of CAM students and conventional undergraduate healthcare students. In a mixed-method study, in 2010, a sample of third-year students enrolled on adult nursing, midwifery, homeopathy and complementary therapies degree courses took part in two workshops and a focus-group discussion. Six themes were identified from qualitative data analysis: interaction; breaking down prejudices; knowledge of self; knowledge of others; common aims; and organisational limitations. The common aim of patient-centred care allowed students to recognise the benefits of a more integrated health system.
Nutritional status of infants and young children and characteristics of their diets.
Lutter, Chessa K; Rivera, Juan A
2003-09-01
Adoption of the recommended breast-feeding and complementary feeding behaviors and access to the appropriate quality and quantity of foods are essential components of optimal nutrition for infants and young children between ages 6 and 24 mo. Iron, zinc and vitamin B-6 are deficient in complementary food diets in Bangladesh, Ghana, Guatemala, Mexico and Peru. Low intakes of iron are consistent with a high prevalence of anemia seen in this age group. The adequacy of observed intakes for calcium, vitamin A, thiamin, folate and vitamin C depends on the age range in question and the set of requirements used in the assessment. The lipid content of many complementary food diets is low. In addition to providing essential fatty acids, lipids are needed for the absorption of fat-soluble vitamins and also enhance the texture, flavor and aroma of foods, which may lead to increased intake. The relative roles of palatability, micronutrient deficiency and morbidity-induced anorexia in the appetite of infants and young children are not known. However, even among children who were growth retarded and had a total energy deficit compared with requirements, up to 25% of food offered was not consumed. This indicates that dietary quality rather than quantity is the key aspect of complementary food diets that needs to be improved. Targeted fortification or the production of complementary foods fortified with micronutrients and of an adequate macro- and micronutrient composition is one approach to help meet nutritional requirements during the vulnerable period of 6-24 mo.
Givati, Assaf
2015-01-01
Complementary and alternative medicine practitioners have often utilised 'holism' as a key identification mark of their practice, distancing themselves from 'the reductionist biomedicine'. However, the past couple of decades have witnessed increased engagement of several complementary and alternative medicines in professionalisation, which includes a degree of biomedical alignment while 'reducing' holistic claims in order to provide practice with a 'credible outlook' and move closer to the mainstream, a development which challenges the role of holism in complementary and alternative medicine practices. This article explores the strategies by which two groups of complementary and alternative medicine practitioners, namely, non-medically qualified acupuncturists and homeopaths in the United Kingdom, pragmatically accommodate holistic notions as a professional resource, a process of negotiation between maintaining their holistic premise, on the one hand, and the drive to professionalise and enhance their societal status, on the other. Based on in-depth interviews with non-medically qualified acupuncture and homeopathy practitioners and school principals, textual analysis of practitioners' web sites and observation of practice, the findings demonstrate the dynamic approach to 'holism' in complementary and alternative medicine practice. This discourse, through which practitioners use a range of strategies in order to 'narrow' or 'expand' their holistic expression, can be described as 'pragmatic holism', by which they try to make gains from the formalisation/standardisation processes, without losing the therapies' holistic outlook and appeal. © The Author(s) 2014.
Novel cyanine dyes with vinylsulfone group for labeling biomolecules.
Park, Jin Woo; Kim, YoungSoo; Lee, Kee-Jung; Kim, Dong Jin
2012-03-21
Novel vinylsulfone cyanine dyes (em. 550-850 nm) were designed and synthesized for fluorescent labeling of biomolecules via 1,2-addition reaction in aqueous conditions. Due to the virtue of chemical structures of both fluorophore and reactive group, these dyes could be significantly stable and reactive in various aqueous/organic conditions. A wide variety of pH, temperature, buffer concentration, and protein were tested for the optimal labeling condition.
Wyatt, Gwen; Sikorskii, Alla; You, Mei
2013-01-01
According to the National Center for Complementary and Alternative Medicine (NCCAM), about one-third of American cancer patients have used complementary and alternative medicine (CAM). The objective of this secondary analysis was an assessment of the use of other CAM by women with advanced breast cancer who were undergoing chemotherapy and who participated in a randomized clinical trial (RCT) studying the safety and efficacy of reflexology. For this secondary analysis, the research team hypothesized an increased CAM use due to exposure to the reflexology trial. For this secondary analysis, the team conducted telephone interviews at baseline, wk 5, and wk 11 to assess the use of 23 common CAM therapies. The study took place at 14 medical oncology clinics across the Midwestern United States. Participants included women with advanced breast cancer who were undergoing chemotherapy and/or hormonal therapy. In the study related to this secondary analysis, the research team randomly assigned the women to one of three primary groups: (1) reflexology; (2) lay foot manipulation (LFM); and (3) control. In addition, the research team used two test groups to establish the study's protocol: (1) test reflexology and (2) test LFM. For this secondary analysis, the research team considered the two reflexology groups (test and intervention) and the two LFM groups (test and intervention) to be the active groups, comparing their use of CAM to the control group's use at the selected time points. The research team used a linear, mixed-effects model to analyze the number of therapies used at the three time points. The team performed t tests to compare therapy use at baseline for those women who completed the study vs those who dropped out. The team used the CAM-use instrument. In total, 385 women participated. The research team found no differences in CAM use for the active groups vs the control group over time or in those women who stayed in the study vs those who dropped out. The team found an increase in CAM use at wk 5 compared to baseline, followed by a decrease at wk 11; however, the time trends were the same in the active groups and the control group In women with advanced breast cancer, researchers can rely upon one assessment of CAM use during an RCT of a CAM therapy.
Arnrup, Kristina; Broberg, Anders G; Berggren, Ulf; Bodin, Lennart
2007-11-01
Current treatment of children with dental behaviour management problems (DBMP) is based on the presupposition that their difficulties are caused by dental fear, but is this always the case? The aim of this study was to study temperamental reactivity, negative emotionality, and other personal characteristics in relation to DBMP in 8- to 12-year-old children. Forty-six children referred because of DBMP (study group) and 110 children in ordinary dental care (reference group) participated. The EASI tempramental survey assessed temperamental reactivity and negative emotionality, the Child Behaviour Questionnaire internalizing and externalizing behaviour problems, and the Children's Fear Survey Schedule general and dental fears. Cluster analyses and tree-based modelling were used for data analysis. Among the five clusters identified, one could be characterized as 'balanced temperament'. Thirty-five per cent of the reference group compared to only 7% of the study group belonged to this cluster. Negative emotionality was the most important sorting variable. Children referred because of DBMP differed from children in ordinary dental care, not only in dental fear level, but also in personal characteristics. Few of the referred children were characterized by a balanced temperament profile. It is important to consider the dual impact of emotion dysregulation and emotional reactivity in the development of DBMP.
Hydrazide and hydrazine reagents as reactive matrices for MALDI-MS to detect gaseous aldehydes.
Shigeri, Yasushi; Ikeda, Shinya; Yasuda, Akikazu; Ando, Masanori; Sato, Hiroaki; Kinumi, Tomoya
2014-08-01
The reagents 19 hydrazide and 14 hydrazine were examined to function as reactive matrices for matrix-assisted laser desorption/ionization mass spectrometry (MALDI-MS) to detect gaseous aldehydes. Among them, two hydrazide (2-hydroxybenzohydrazide and 3-hydroxy-2-naphthoic acid hydrazide) and two hydrazine reagents [2-hydrazinoquinoline and 2,4-dinitrophenylhydrazine (DNPH)] were found to react efficiently with carbonyl groups of gaseous aldehydes (formaldehyde, acetaldehyde and propionaldehyde); these are the main factors for sick building syndrome and operate as reactive matrices for MALDI-MS. Results from accurate mass measurements by JMS-S3000 Spiral-TOF suggested that protonated ion peaks corresponding to [M + H](+) from the resulting derivatives were observed in all cases with the gaseous aldehydes in an incubation, time-dependent manner. The two hydrazide and two hydrazine reagents all possessed absorbances at 337 nm (wavelength of MALDI nitrogen laser), with, significant electrical conductivity of the matrix crystal and functional groups, such as hydroxy group and amino group, being important for desorption/ionization efficiency in MALDI-MS. To our knowledge, this is the first report that gaseous molecules could be derivatized and detected directly in a single step by MALDI-MS using novel reactive matrices that were derivatizing agents with the ability to enhance desorption/ionization efficiency. Copyright © 2014 John Wiley & Sons, Ltd.
Surface reactivity measurements as required for grouping and read-across: An advanced FRAS protocol
NASA Astrophysics Data System (ADS)
Gandon, Arnaud; Werle, Kai; Neubauer, Nicole; Wohlleben, Wendel
2017-06-01
Oxidative stress is a widely accepted paradigm associated with different adverse outcomes of particulate matter, including nanomaterials. It has frequently been identified in in vitro and in vivo studies and different assays have been developed for this purpose. Here we describe a newly developed multi-dose protocol of the FRAS assay (Ferric Reduction Ability of Serum). The purpose of this SOP is the measurement of the surface reactivity of nanomaterials under physiological conditions. Antioxidative components as present in human blood serum (HBS) serve as reporter molecules. The assay separates the oxidative damage from the read-out of the reporter molecules. The results show significantly enhanced repeatability with better sensitivity towards low reactivity, enabling application of FRAS both to a rough grouping by reactive vs. passive nanomaterials and further to substantiation of read-across by enhanced resolution of the similarity between different nanoforms of the same substance.
["Group" and organization: a dimension of collaboration of anthropology and epidemiology].
Song, Lei-ming; Wang, Ning
2012-04-01
"Group" is a key concept in epidemiological research and "organization" is a core concept in anthropology. Group takes focus on the specific characteristics of the subjects, while organization takes focus on the relationship between the objects. For the characteristics and relationship of the objects that interacting with each other, the two concepts could be complementary in specific studies, and this will be the basic dimension of Interdisciplinary collaboration of anthropology and epidemiology.
Maingi, Mildred; Kimiywe, Judith; Iron-Segev, Sharon
2018-05-08
Appropriate infant and young child nutrition is critical for proper growth and development. In order to promote optimal nutrition at an early age, the World Health Organization (WHO) and UNICEF have developed the Baby Friendly Hospital Initiative (BFHI) to address poor breastfeeding practices in maternity wards. However, impact is limited in less developed countries like Kenya, where more than half of all births are home deliveries. Therefore, Kenya has explored the adoption of Baby Friendly Community Initiative (BFCI) in its rural settings. In contrast to the BFHI, the BFCI supports breastfeeding and optimal infant feeding in community. BFCI has been implemented in Koibatek, in rural Kenya. This study aimed at assessing the effectiveness of BFCI on complementary feeding practices of children aged 6-23 months, by comparing intervention and control groups. This was a randomized control study design that included 270 mother-infant pairs enrolled in the Baby Friendly Community Initiative (BFCI) project in Koibatek. Evaluation was carried out using structured questionnaires. A statistically significantly higher proportion of children in the intervention group compared to the control group attained minimum dietary diversity (77% vs. 58%; p = 0.001), minimum meal frequency (96% vs. 89%; p = 0.046) and minimum acceptable diet (77% vs. 61%; p = 0.005). The odds of attaining minimum dietary diversity, minimum meal frequency and minimum acceptable diet were statistically significantly higher for the intervention group compared to control group (OR: 4.95; 95%CI 2.44-10.03, p = < 0.001; OR: 14.84; 95%CI 2.75-79.9, p = 0.002; OR: 4.61; 95%CI 2.17-9.78, p = < 0.001 respectively). The BFCI intervention was successful in improving complementary feeding practices. Strengthening and prioritizing BFCI interventions could have a significant impact on child health outcomes in rural Kenya. ISRCTN03467700 . Registration 24 September 2014. Retrospectively registered.
Krebs, Nancy F; Westcott, Jamie E; Culbertson, Diana L; Sian, Lei; Miller, Leland V; Hambidge, K Michael
2012-01-01
Background: The low zinc intake from human milk at ∼6 mo of age predicts the dependence on complementary foods (CF) to meet the zinc requirements of older breastfed-only infants. Objective: The objective of this study was to compare major variables of zinc homeostasis and zinc status in 9-mo-old breastfed infants who were randomly assigned to different complementary food regimens. Design: Forty-five exclusively breastfed 5-mo-old infants were randomly assigned to receive commercially available pureed meats, iron-and-zinc–fortified infant cereal (IZFC), or whole-grain, iron-only–fortified infant cereal (IFC) as the first and primary CF until completion of zinc metabolic studies between 9 and 10 mo of age. A zinc stable-isotope methodology was used to measure the fractional absorption of zinc (FAZ) in human milk and CF by dual-isotope ratios in urine. Calculated variables included the dietary intake from duplicate diets and 4-d test weighing, the total absorbed zinc (TAZ) from FAZ × diet zinc, and the exchangeable zinc pool size (EZP) from isotope enrichment in urine. Results: Mean daily zinc intakes were significantly greater for the meat and IZFC groups than for the IFC group (P < 0.001); only intakes in meat and IZFC groups met estimated average requirements. Mean (±SEM) TAZ amounts were 0.80 ± 0.08, 0.71 ± 0.09, and 0.52 ± 0.05 mg/d for the meat, IZFC, and IFC groups, respectively (P = 0.027). Zinc from human milk contributed <25% of TAZ for all groups. The EZP correlated with both zinc intake (r = 0.43, P < 0.01) and TAZ (r = 0.54, P < 0.001). Conclusion: Zinc requirements for older breastfed-only infants are unlikely to be met without the regular consumption of either meats or zinc-fortified foods. PMID:22648720
Maternal Brain-Reactive Antibodies and Autism Spectrum Disorder
2015-10-01
Autism spectrum disorder (ASD) occurs in 1 in 68 births, preferentially affecting males. It encompasses a group of neurodevelopmental ...AWARD NUMBER: W81XWH-14-1-0369 TITLE: Maternal Brain-Reactive Antibodies and Autism Spectrum Disorder PRINCIPAL INVESTIGATOR: Betty Diamond...Sep 2015 4. TITLE AND SUBTITLE Maternal Brain-Reactive Antibodies and Autism Spectrum 5a. CONTRACT NUMBER Disorder 5b. GRANT NUMBER W81XWH-14-1
ERIC Educational Resources Information Center
Cartwright, Rosalind D.
2004-01-01
The group of papers on memory reactivation and consolidation during sleep included in this volume represents cutting edge work in both animals and humans. They support that the two types of sleep serve different necessary functions. The role of slow wave sleep (SWS) is reactivation of the hippocampal-neocortical circuits activated during a waking…
DOE Office of Scientific and Technical Information (OSTI.GOV)
Brozek, Eric M. ..; Washton, Nancy M.; Mueller, Karl T.
A series of silsesquioxane nanoparticles containing reactive internal organic functionalities throughout the entire particle body have been synthesized using a surfactant-free method with organosilanes as the sole precursors and a base catalyst. The organic functional groups incorporated are vinyl, allyl, mercapto, cyanoethyl, and cyanopropyl groups. The sizes and morphologies of the particles were characterized using SEM and nitrogen adsorption, while the compositions were confirmed using TGA, FT-IR, solid state NMR, and elemental analysis. The accessibility and reactivity of the functional groups inside the particles were demonstrated by performing bromination and reduction reactions in the interior of the particles.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Park, Jinhee; Chen, Ying-Pin; Perry, Zachary
A series of molybdenum- and copper-based MOPs were synthesized through coordination-driven process of a bridging ligand (3,3 -PDBAD, L1) and dimetal paddlewheel clusters. Three conformers of the ligand exist with an ideal bridging angle between the two carboxylate groups of 0° (H2α-L1), 120° (H2β-L1), and of 90° (H2γ-L1), respectively. At ambient or lower temperature, H2L1 and Mo2(OAc)4 or Cu2(OAc)4 were crystallized into a molecular square with γ-L1 and Mo2/Cu2 units. With proper temperature elevation, not only the molecular square with γ-L1 but also a lantern-shaped cage with α-L1 formed simultaneously. Similar to how Watson–Crick pairs stabilize the helical structure ofmore » duplex DNA, the core–shell molecular assembly possesses favorable H-bonding interaction sites. This is dictated by the ligand conformation in the shell, coding for the formation and providing stabilization of the central lantern shaped core, which was not observed without this complementary interaction. On the basis of the crystallographic implications, a heterobimetallic cage was obtained through a postsynthetic metal ion metathesis, showing different reactivity of coordination bonds in the core and shell. As an innovative synthetic strategy, the site-selective metathesis broadens the structural diversity and properties of coordination assemblies.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Park, J; Chen, YP; Perry, Z
A series of molybdenum- and copper-based MOPs were synthesized through coordination-driven process of a bridging ligand (3,3'-PDBAD, L-1) and dimetal paddlewheel clusters. Three conformers of the ligand exist with an ideal bridging angle between the two carboxylate groups of 0 degrees (H-2 zeta-L(1)), 120 degrees (H-2 beta-L-1), and of 90 degrees (H-2 beta-L-1), respectively. At ambient or lower temperature, (HL1)-L-2 and Mo-2(OAc)(4) or Cu-2(OAc)(4) were crystallized into a molecular square with ?-L-1 and Mo-2/Cu-2 units. With proper temperature elevation, not only the molecular square with ?-L-1 but also a lantern-shaped cage with a-L-1 formed simultaneously. Similar to how Watson-Crick pairsmore » stabilize the helical structure of duplex DNA, the core-shell molecular assembly possesses favorable H-bonding interaction sites. This is dictated by the ligand conformation in the shell, coding for the formation and providing stabilization of the central lantern shaped core, which was not observed without this complementary interaction. On the basis of the crystallographic implications, a heterobimetallic cage was obtained through a postsynthetic metal ion metathesis, showing different reactivity of coordination bonds in the core and shell. As an innovative synthetic strategy, the site-selective metathesis broadens the structural diversity and properties of coordination assemblies.« less
da Silva, Elsa F F; Pimenta, Frederico M; Pedersen, Brian W; Blaikie, Frances H; Bosio, Gabriela N; Breitenbach, Thomas; Westberg, Michael; Bregnhøj, Mikkel; Etzerodt, Michael; Arnaut, Luis G; Ogilby, Peter R
2016-02-01
Selected singlet oxygen photosensitizers have been examined from the perspective of obtaining a molecule that is sufficiently stable under conditions currently employed to study singlet oxygen behavior in single mammalian cells. Reasonable predictions about intracellular sensitizer stability can be made based on solution phase experiments that approximate the intracellular environment (e.g., solutions containing proteins). Nevertheless, attempts to construct a stable sensitizer based solely on the expected reactivity of a given functional group with singlet oxygen are generally not sufficient for experiments in cells; it is difficult to construct a suitable chromophore that is impervious to all of the secondary and/or competing degradative processes that are present in the intracellular environment. On the other hand, prospects are reasonably positive when one considers the use of a sensitizer encapsulated in a specific protein; the local environment of the chromophore is controlled, degradation as a consequence of bimolecular reactions can be mitigated, and genetic engineering can be used to localize the encapsulated sensitizer in a given cellular domain. Also, the option of directly exciting oxygen in sensitizer-free experiments provides a useful complementary tool. These latter systems bode well with respect to obtaining more accurate control of the "dose" of singlet oxygen used to perturb a cell; a parameter that currently limits mechanistic studies of singlet-oxygen-mediated cell signaling.
Andrei, Virgil; Bethke, Kevin; Madzharova, Fani; Bronneberg, Aafke Cecile; Kneipp, Janina; Rademann, Klaus
2017-09-27
Although the deposition of alternating layers from poly(3,4-ethylenedioxythiophene):poly(styrenesulfonate) (PEDOT:PSS) and polyaniline (PANI) salts has recently provided a breakthrough in the field of conductive polymers, the cause for the conductivity improvement has remained unclear. In this work, we report a cooperative doping effect between alternating PANI base and PEDOT:PSS layers, resulting in electrical conductivities of 50-100 S cm -1 and power factors of up to 3.0 ± 0.5 μW m -1 K -2 , which surpass some of the recent values obtained for protonated PANI/PEDOT:PSS multilayers by a factor of 20. In this case, the simultaneous improvement in the electrical conductivity of both types of layers is caused by the in situ protonation of PANI, which corresponds to the removal of the excess acidic PSS chains from the PEDOT:PSS grains. The interplay between the functional groups' reactivity and the supramolecular chain reorganization leads to an array of preparation-dependent phenomena, including a stepwise increase in the film thickness, an alternation in the electrical conductivity, and the formation of a diverse surface landscape. The latter effect can be traced to a buildup of strain within the layers, which results in either the formation of folds or the shrinkage of the film. These results open new paths for designing nanostructured thin-film thermoelectrics.
Karasova, Jana Zdarova; Kassa, Jiri; Jung, Young-Sik; Musilek, Kamil; Pohanka, Miroslav; Kuca, Kamil
2008-01-01
The therapeutical efficacies of eleven oxime-based acetylcholinesterase reactivators were compared in an in vivo (rat model) study of treatment of intoxication caused by tabun. In this group there were some currently available oximes (obidoxime, trimedoxime and HI-6) and the rest were newly synthesized compounds. The best reactivation efficacy for acetylcholinesterase in blood (expressed as percent of reactivation) among the currently available oximes was observed after administration of trimedoxime (16%) and of the newly synthesized K127 (22432) (25%). The reactivation of butyrylcholinesterase in plasma was also studied; the best reactivators were trimedoxime, K117 (22435), and K127 (22432), with overall reactivation efficacies of approximately 30%. Partial protection of brain ChE against tabun inhibition was observed after administration of trimedoxime (acetylcholinesterase 20%; butyrylcholinesterase 30%) and obidoxime (acetylcholinesterase 12%; butyrylcholinesterase 16%). PMID:19330072
Carver, Charles S; Johnson, Sheri L; Joormann, Jutta
2013-09-01
Dual-process theories of behaviour have been used to suggest that vulnerability to depression involves elevated reactivity to emotions. This study tests that idea, examining self-reported reactivity. Comparison between persons with at least one lifetime episode of major depressive disorder (lifetime MDD) and those without this diagnosis, controlling for symptoms of alcohol use (a potential externalizing confound) and current symptoms of depression (a potential state-dependent confound). Undergraduates (N = 120) completed a clinical interview to diagnose lifetime MDD and a series of self-reports bearing on diverse aspects of self-control, including reactivity to emotion. Thirty-four people were diagnosed with lifetime MDD; 86 did not meet criteria for MDD. The groups were then compared on three factors underlying the scales assessing self-control. The MDD group had higher scores than controls on the two factors that reflect impulsive reactivity to diverse emotions, including emotions that are positive in valence. These effects were not explained by associations with either externalizing symptoms or current depressive symptoms. Reflexive reactivity to emotions characterizes depression, in addition to some externalizing problems, and it may deserve study as a potential trans-diagnostic feature. Reflexive reactivity to emotions characterizes persons diagnosed with major depressive disorder. Findings suggest desirability of focusing treatment partly on management of reflexive reactions to emotions. Measures were self-reports, rather than behavioural responses to emotions. © 2013 The British Psychological Society.
Martínez-Araya, Jorge Ignacio
2013-07-01
The intrinsic reactivity of cyanide when interacting with a silver cation was rationalized using the dual descriptor (DD) as a complement to the molecular electrostatic potential (MEP) in order to predict interactions at the local level. It was found that DD accurately explains covalent interactions that cannot be explained by MEP, which focuses on essentially ionic interactions. This allowed the rationalization of the reaction mechanism that yields silver cyanide in the gas phase. Other similar reaction mechanisms involving a silver cation interacting with water, ammonia, and thiosulfate were also explained by the combination of MEP and DD. This analysis provides another example of the usefulness of DD as a tool for gaining a deeper understanding of any reaction mechanism that is mainly governed by covalent interactions.
Using farmers' attitude and social pressures to design voluntary Bluetongue vaccination strategies.
Sok, J; Hogeveen, H; Elbers, A R W; Oude Lansink, A G J M
2016-10-01
Understanding the context and drivers of farmers' decision-making is critical to designing successful voluntary disease control interventions. This study uses a questionnaire based on the Reasoned Action Approach framework to assess the determinants of farmers' intention to participate in a hypothetical reactive vaccination scheme against Bluetongue. Results suggest that farmers' attitude and social pressures best explained intention. A mix of policy instruments can be used in a complementary way to motivate voluntary vaccination based on the finding that participation is influenced by both internal and external motivation. Next to informational and incentive-based instruments, social pressures, which stem from different type of perceived norms, can spur farmers' vaccination behaviour and serve as catalysts in voluntary vaccination schemes. Copyright © 2016 Elsevier B.V. All rights reserved.
Aggressive behavior in children: the role of temperament and family socialization.
González-Peña, Paloma; Egido, Begoña Delgado; Carrasco, Miguel Á; Tello, Francisco Pablo Holgado
2013-01-01
This study's objective is to analyze temperament and parenting variables as they relate to proactive and reactive aggression in children. To be specific, profiles based on these variables were analyzed in children with high levels of proactive versus reactive aggression. The sample was made up of two groups: 482 children (52.3% boys) between 1 and 3 years-old, and 422 children (42.42% boys) 3 to 6 years-old. Statistical analyses of the two age groups included: Pearson's correlations to explore the relationships among variables, Cluster Analysis to create groups with different levels of aggression, and finally discriminant analysis to determine which variables discriminate between groups. The results show that high levels of frustration/negative affect in the 1-3 year-old group and low effortful control in children 3 to 6 years old are the most relevant variables in differentiating between aggressive and non-aggressive subjects. Nevertheless, differential profiles of subjects with high levels of proactive versus reactive aggression were not observed. The implications of these different types of aggression in terms of development and prevention are discussed.
Kuo, Janice R; Fitzpatrick, Skye; Metcalfe, Rebecca K; McMain, Shelley
2016-03-01
Borderline personality disorder (BPD) is conceptualized as a disorder of heightened emotional reactivity and difficulties with emotion regulation. However, findings regarding emotional reactivity in BPD are mixed and there are limited studies examining emotion regulation capabilities in this population. Twenty-five individuals with BPD and 30 healthy controls (HCs) engaged in a baseline assessment followed by the presentation of neutral and BPD-relevant negative images. Participants were instructed to react as they naturally would to the image, or to use a mindfulness-based or distraction-based strategy to feel less negative. Self-reported and physiological (i.e., heart rate, electrodermal activity, and respiratory sinus arrhythmia) measures were collected. Compared with the HCs, the BPD group exhibited elevated heart rate and reduced respiratory sinus arrhythmia at baseline. However, there were no differences in emotional reactivity in self-report or physiological indices between the two groups. In addition, the BPD group did not exhibit deficits in the ability to implement either emotion regulation strategy, with the exception that the BPD group reported less positive emotions while distracting compared with the HCs. This study is limited by a small sample size and the inclusion of a medicated BPD sample. Emotion dysregulation in BPD might be better accounted for by abnormal baseline emotional functioning rather than heightened emotional reactivity or deficits in emotion regulation. Treatments for BPD might be enhanced by directly targeting resting state emotional functioning rather than emotional reactions or regulatory attempts. Copyright © 2015 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Cernuto, Andrea; Lopes, Allan; Romanzin, Claire; Cunha de Miranda, Barbara; Ascenzi, Daniela; Tosi, Paolo; Tonachini, Glauco; Maranzana, Andrea; Polášek, Miroslav; Žabka, Jan; Alcaraz, Christian
2017-10-01
The methyl carbocation is ubiquitous in gaseous environments, such as planetary ionospheres, cometary comae, and the interstellar medium, as well as combustion systems and plasma setups for technological applications. Here we report on a joint experimental and theoretical study on the mechanism of the reaction CH3 + + CH3CCCH3 (but-2-yne, also known as dimethylacetylene), by combining guided ion beam mass spectrometry experiments with ab initio calculations of the potential energy hypersurface. Such a reaction is relevant in understanding the chemical evolution of Saturn's largest satellite, Titan. Two complementary setups have been used: in one case, methyl cations are generated via electron ionization, while in the other case, direct vacuum ultraviolet photoionization with synchrotron radiation of methyl radicals is used to study internal energy effects on the reactivity. Absolute reactive cross sections have been measured as a function of collision energy, and product branching ratios have been derived. The two most abundant products result from electron and hydride transfer, occurring via direct and barrierless mechanisms, while other channels are initiated by the electrophilic addition of the methyl cation to the triple bond of but-2-yne. Among the minor channels, special relevance is placed on the formation of C5H7 +, stemming from H2 loss from the addition complex. This is the only observed condensation product with the formation of new C—C bonds, and it might represent a viable pathway for the synthesis of complex organic species in astronomical environments and laboratory plasmas.
Serology of Paracoccidioidomycosis Due to Paracoccidioides lutzii
Gegembauer, Gregory; Araujo, Leticia Mendes; Pereira, Edy Firmina; Rodrigues, Anderson Messias; Paniago, Anamaria Mello Miranda; Hahn, Rosane Christine; de Camargo, Zoilo Pires
2014-01-01
Paracoccidioides lutzii is a new agent of paracoccidioidomycosis (PCM) and has its epicenter localized to the Central-West region of Brazil. Serological diagnosis of PCM caused by P. lutzii has not been established. This study aimed to develop new antigenic preparations from P. lutzii and to apply them in serological techniques to improve the diagnosis of PCM due to P. lutzii. Paracoccidioides lutzii exoantigens, cell free antigen (CFA), and a TCA-precipitated antigen were evaluated in immunodiffusion (ID) tests using a total of 89 patient sera from the Central-West region of Brazil. Seventy-two sera were defined as reactive for P. brasiliensis using traditional antigens (AgPbB339 and gp43). Non-reactive sera for traditional antigens (n = 17) were tested with different P. lutzii preparations and P. lutzii CFA showed 100% reactivity. ELISA was found to be a very useful test to titer anti-P. lutzii antibodies using P. lutzii-CFA preparations. Sera from patients with PCM due to P. lutzii presented with higher antibody titers than PCM due to P. brasiliensis and heterologous sera. In western blot, sera from patients with PCM due to P. lutzii were able to recognize antigenic molecules from the P. lutzii-CFA antigen, but sera from patients with PCM due to P. brasiliensis could not recognize any P. lutzii molecules. Due to the facility of preparing P. lutzii CFA antigens we recommend its use in immunodiffusion tests for the diagnosis of PCM due to P. lutzii. ELISA and western blot can be used as complementary tests. PMID:25032829
Insights into the reactivation of cobalamin-dependent methionine synthase
DOE Office of Scientific and Technical Information (OSTI.GOV)
Koutmos, Markos; Datta, Supratim; Pattridge, Katherine A.
2009-12-10
Cobalamin-dependent methionine synthase (MetH) is a modular protein that catalyzes the transfer of a methyl group from methyltetrahydrofolate to homocysteine to produce methionine and tetrahydrofolate. The cobalamin cofactor, which serves as both acceptor and donor of the methyl group, is oxidized once every {approx}2,000 catalytic cycles and must be reactivated by the uptake of an electron from reduced flavodoxin and a methyl group from S-adenosyl-L-methionine (AdoMet). Previous structures of a C-terminal fragment of MetH (MetH{sup CT}) revealed a reactivation conformation that juxtaposes the cobalamin- and AdoMet-binding domains. Here we describe 2 structures of a disulfide stabilized MetH{sup CT} ({sub s-s}MetH{supmore » CT}) that offer further insight into the reactivation of MetH. The structure of {sub s-s}MetH{sup CT} with cob(II)alamin and S-adenosyl-L-homocysteine represents the enzyme in the reactivation step preceding electron transfer from flavodoxin. The structure supports earlier suggestions that the enzyme acts to lower the reduction potential of the Co(II)/Co(I) couple by elongating the bond between the cobalt and its upper axial water ligand, effectively making the cobalt 4-coordinate, and illuminates the role of Tyr-1139 in the stabilization of this 4-coordinate state. The structure of {sub s-s}MetH{sub CT} with aquocobalamin may represent a transient state at the end of reactivation as the newly remethylated 5-coordinate methylcobalamin returns to the 6-coordinate state, triggering the rearrangement to a catalytic conformation.« less
Reactivity to low-flow as a potential determinant for brachial artery flow-mediated vasodilatation.
Aizawa, Kunihiko; Elyas, Salim; Adingupu, Damilola D; Casanova, Francesco; Gooding, Kim M; Strain, W David; Shore, Angela C; Gates, Phillip E
2016-06-01
Previous studies have reported a vasoconstrictor response in the radial artery during a cuff-induced low-flow condition, but a similar low-flow condition in the brachial artery results in nonuniform reactivity. This variable reactivity to low-flow influences the subsequent flow-mediated dilatation (FMD) response following cuff-release. However, it is uncertain whether reactivity to low-flow is important in data interpretation in clinical populations and older adults. This study aimed to determine the influence of reactivity to low-flow on the magnitude of brachial artery FMD response in middle-aged and older individuals with diverse cardiovascular risk profiles. Data were analyzed from 165 individuals, divided into increased cardiovascular risk (CVR: n = 115, 85M, 67.0 ± 8.8 years) and healthy control (CTRL: n = 50, 30M, 63.2 ± 7.2 years) groups. Brachial artery diameter and blood velocity data obtained from Doppler ultrasound were used to calculate FMD, reactivity to low-flow and estimated shear rate (SR) using semiautomated edge-detection software. There was a significant association between reactivity to low-flow and FMD in overall (r = 0.261), CTRL (r = 0.410) and CVR (r = 0.189, all P < 0.05) groups. Multivariate regression analysis found that reactivity to low-flow, peak SR, and baseline diameter independently contributed to FMD along with sex, the presence of diabetes, and smoking (total R(2) = 0.450). There was a significant association between reactivity to low-flow and the subsequent FMD response in the overall dataset, and reactivity to low-flow independently contributed to FMD These findings suggest that reactivity to low-flow plays a key role in the subsequent brachial artery FMD response and is important in the interpretation of FMD data. © 2016 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of the American Physiological Society and The Physiological Society.
Gani, Dhruva Kumar; Lakshmi, Deepa; Krishnan, Rama; Emmadi, Pamela
2009-05-01
The aim of the present study was to investigate systemic levels of inflammatory markers of cardiovascular diseases like C-reactive protein and interleukin-6 in patients with chronic periodontitis, in comparison to periodontally healthy individuals. A total of 42 individuals, both males and females above the age of 30 years, were included in the study. Healthy controls (Group I, n = 14), chronic localized periodontitis (Group II, n = 14), and chronic generalized periodontitis (Group III, n = 14), all without any medical disorder, were recruited. Peripheral blood samples were taken and C-reactive protein (CRP) levels were estimated in the serum samples by using the Particle-Enhanced Turbidimetric Immunoassay (PETIA) technique. Serum samples of Interleukin-6 (IL-6) were assayed by using the Chemiluminescent Immunoassay (IMMULITE) technique. When mean CRP levels were compared between the groups, group III showed statistical significance when compared to group I (P = 0.04). Group III had a higher median IL-6 level (6.35 pg/mL) than Group II (< 5.0 pg/mL) and group I (< 5.0 pg/mL). Differences in median values of IL-6 were not statistically significant in any group (P = 0.29). Periodontitis results in higher systemic levels of CRP and IL-6. These elevated inflammatory factors may increase inflammatory activity in atherosclerotic lesions and potentially increasing the risk for cardiovascular events.
Unconventional therapies in asthma: an overview.
Lewith, G T; Watkins, A D
1996-11-01
Acupuncture, homoeopathy, mind-body therapies, and nutritional, herbal, and environmental medicine have all been used in the management of patients with asthma. This paper reviews the evidence base for the use of these unconventional or complementary therapies. Although there is a paucity of large randomized, controlled trials in this area, there is sufficient evidence to suggest that many of these therapies can produce objective and subjective benefit in selected groups of patients. In view of the increasing popularity of complementary medicine among patients and general practitioners, there is now an urgent need for high-quality research to determine how, or whether, these therapies may be interwoven with the more orthodox treatments currently available.
6 Things to Know about Type 2 Diabetes and Dietary Supplements
... Things To Know About Type 2 Diabetes and Dietary Supplements Share: Diabetes is a group of chronic diseases ... Researchers are studying several complementary health approaches, including dietary supplements, to see if they can help people manage ...
IBD and Complementary and Alternative Medicine (CAM)
... for cures; participate in a clinical trial of experimental treatments. Interactive Disease Tracker Use GI Buddy to ... a variety of ways. They may help to control symptoms and ease pain, enhance ... groups, are now offered as conventional therapies. Manipulative and ...
Cardiopulmonary Syndrome Overview
... to Cancer Off-Label Drug Use Access to Experimental Drugs Complementary & Alternative Medicine (CAM) CAM for Patients ... pressure on the heart. Treatment may be to control the symptoms of ... vena cava syndrome (SVCS) is a group of signs and symptoms that occur when the ...
The Synthesis of Beta-Peptides Containing Guanidino Groups
NASA Technical Reports Server (NTRS)
Wen, Ke; Han, Hyunsoo; Hoffman, Timothy Z.; Janda, Kim D.; Orgel, Leslie E.
2003-01-01
The synthesis of the beta-peptide 1 by the postsynthetic modification of the corresponding amino-containing peptide 3 is described. The potential of 1 to act as a template for the ligation of complementary negatively-charged peptides is discussed.
Northover, Clare; Thapar, Anita; Langley, Kate; Fairchild, Graeme; van Goozen, Stephanie H M
2016-08-30
Reported findings on cortisol reactivity to stress in young people with ADHD are very variable. This inconsistency may be explained by high rates of comorbidity with Conduct Disorder (CD). The present study examined cortisol responses to a psychosocial stressor in a large sample of adolescent males with ADHD (n=202), with or without a comorbid diagnosis of Conduct Disorder (CD). Associations between stress reactivity and callous-unemotional traits and internalizing symptoms were also assessed. The ADHD only (n=95) and ADHD+CD (n=107) groups did not differ in baseline cortisol, but the ADHD+CD group showed significantly reduced cortisol stress reactivity relative to the ADHD only group. Regression analyses indicated that ADHD symptom severity predicted reduced baseline cortisol, whereas CD symptom severity predicted increased baseline cortisol (ADHD β=-0.24, CD β=0.16, R=0.26) and reduced cortisol stress reactivity (β=-0.17, R=0.17). Callous-unemotional traits and internalizing symptoms were not significantly related to baseline or stress-induced cortisol. Impaired cortisol reactivity is hypothesised to reflect fearlessness and is associated with deficient emotion regulation and inhibition of aggressive and antisocial behaviour. Consequently, it may partly explain the greater severity of problems seen in those with comorbid ADHD and CD. Copyright © 2016 The Authors. Published by Elsevier Ireland Ltd.. All rights reserved.
Wang, Baoe; Guo, Xiu
2011-06-01
Reactive blue 49 was removed from aqueous solution by biosorption using powder waste sludge composed of Saccharomyces cerevisiae from the beer-brewing industry. The effect of initial pH, temperature and the biosorption thermodynamics, equilibrium, kinetics was investigated in this study. It was found that the biosorption capacity was at maximum at initial pH 3, that the effect of temperature on biosorption of reactive blue 49 was only slight in relation to the large biosorption capacity (25°C, 361 mg g(-1)) according as the biosorption capacity decreased only 43 mg g(-1) at the temperature increased from 25 to 50°C. The biosorption was spontaneous, exothermic in nature and the dye molecules movements decreased slightly in random at the solid/liquid interface during the biosorption of dye on biosorbents. The biosorption equilibrium data could be described by Freundich isotherm model. The biosorption rates were found to be consistent with a pseudo-second-order kinetics model. The functional group interaction analysis between waste beer yeast sludge and reactive blue 49 by the aid of Fourier transform infrared (abbr. FTIR) spectroscopy indicated that amino components involved in protein participated in the biosorption process, which may be achieved by the mutual electrostatic adsorption process between the positively charged amino groups in waste beer yeast sludge with negatively charged sulfonic groups in reactive blue 49.
Feng, Pan; Zheng, Yong
2016-01-01
Investigations of fear conditioning have elucidated the neural mechanisms of fear acquisition, consolidation and extinction, but it is not clear how the neural activation following fear reminder influence the following extinction. To address this question, we measured human brain activity following fear reminder using resting-state functional magnetic resonance imaging, and investigated whether the extinction effect can be predicted by resting-state functional connectivity (RSFC). Behaviorally, we found no significant differences of fear ratings between the reminder group and the no reminder group at the fear acquisition and extinction stages, but spontaneous recovery during re-extinction stage appeared only in the no reminder group. Imaging data showed that functional connectivity between ventromedial prefrontal cortex (vmPFC) and amygdala in the reminder group was greater than that in the no reminder group after fear memory reactivation. More importantly, the functional connectivity between amygdala and vmPFC of the reminder group after fear memory reactivation was positively correlated with extinction effect. These results suggest RSFC between amygdala and the vmPFC following fear reminder can predict fear extinction, which provide important insight into the neural mechanisms of fear memory after fear memory reactivation. PMID:27013104
Solberg, E; Ingjer, F; Holen, A; Sundgot-Borgen, J; Nilsson, S; Holme, I
2000-01-01
Objective—To compare the efficacy in runners of two relaxation techniques with regard to exercise reactivity and recovery after exercise. Methods—Thirty one adult male runners were studied prospectively for six months in three groups practising either meditation (n = 11) or autogenic training (n = 11) or serving as controls (n = 10). Before and after the six months relaxation intervention, indicators of reactivity to exercise and metabolism after exercise (blood lactate concentration, heart rate (HR), and oxygen consumption (VO2)), were tested immediately after and 10 minutes after exercise. Resting HR was also assessed weekly at home during the trial. State anxiety was measured before and after the intervention. Results—After the relaxation training, blood lactate concentration after exercise was significantly (p<0.01) decreased in the meditation group compared with the control group. No difference was observed in lactate responses between the autogenic training group and the control group. There were no significant differences among the groups with regard to HR, VO2, or levels of anxiety. Conclusion—Meditation training may reduce the lactate response to a standardised exercise bout. Key Words: autogenic training; lactate; meditation; recovery; relaxation; psychology PMID:10953899
Levett, Kate M; Smith, C A; Bensoussan, A; Dahlen, H G
2016-07-12
To evaluate the effect of an antenatal integrative medicine education programme in addition to usual care for nulliparous women on intrapartum epidural use. Open-label, assessor blind, randomised controlled trial. 2 public hospitals in Sydney, Australia. 176 nulliparous women with low-risk pregnancies, attending hospital-based antenatal clinics. The Complementary Therapies for Labour and Birth protocol, based on the She Births and acupressure for labour and birth courses, incorporated 6 evidence-based complementary medicine techniques: acupressure, visualisation and relaxation, breathing, massage, yoga techniques, and facilitated partner support. Randomisation occurred at 24-36 weeks' gestation, and participants attended a 2-day antenatal education programme plus standard care, or standard care alone. Rate of analgesic epidural use. Secondary: onset of labour, augmentation, mode of birth, newborn outcomes. There was a significant difference in epidural use between the 2 groups: study group (23.9%) standard care (68.7%; risk ratio (RR) 0.37 (95% CI 0.25 to 0.55), p≤0.001). The study group participants reported a reduced rate of augmentation (RR=0.54 (95% CI 0.38 to 0.77), p<0.0001); caesarean section (RR=0.52 (95% CI 0.31 to 0.87), p=0.017); length of second stage (mean difference=-0.32 (95% CI -0.64 to 0.002), p=0.05); any perineal trauma (0.88 (95% CI 0.78 to 0.98), p=0.02) and resuscitation of the newborn (RR=0.47 (95% CI 0.25 to 0.87), p≤0.015). There were no statistically significant differences found in spontaneous onset of labour, pethidine use, rate of postpartum haemorrhage, major perineal trauma (third and fourth degree tears/episiotomy), or admission to special care nursery/neonatal intensive care unit (p=0.25). The Complementary Therapies for Labour and Birth study protocol significantly reduced epidural use and caesarean section. This study provides evidence for integrative medicine as an effective adjunct to antenatal education, and contributes to the body of best practice evidence. ACTRN12611001126909. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/
Brumback, Ty; Squeglia, Lindsay M; Jacobus, Joanna; Pulido, Carmen; Tapert, Susan F; Brown, Sandra A
2015-07-01
Heavy drinking during adolescence is associated with increased reactivity to alcohol related stimuli and to differential neural development. Alcohol cue reactivity has been widely studied among adults with alcohol use disorders, but little is known about the neural substrates of cue reactivity in adolescent drinkers. The current study aimed to identify changes in blood-oxygen level dependent (BOLD) signal during a cue reactivity task pre- and post-monitored abstinence from alcohol. Demographically matched adolescents (16.0-18.9 years, 54% female) with histories of heavy episodic drinking (HD; n=22) and light or non-drinking control teens (CON; n=16) were recruited to participate in a month-long study. All participants completed a functional Magnetic Resonance Imaging (fMRI) scan with an alcohol cue reactivity task and substance use assessments at baseline and after 28 days of monitored abstinence from alcohol and drugs (i.e., urine toxicology testing every 48-72 h). Repeated-measure analysis of variance (ANOVA) examined main effects of group, time, and group×time interactions on BOLD signal response in regions of interest defined by functional differences at baseline. The HD group exhibited greater (p<.01) BOLD activation than CON to alcohol cues relative to neutral cues in all regions of interest (ROIs; bilateral striatum/globus pallidus, left anterior cingulate, bilateral cerebellum, and parahippocampal gyrus extending to the thalamus/substantia nigra) across time points. Group×time effects showed that HD exhibited greater BOLD activation to alcohol cues than CON at baseline in left anterior cingulate cortex and in the right cerebellar region, but these decreased to non-significance after one month of monitored abstinence. In all ROIs examined, HD exhibited greater BOLD response than CON to alcohol relative to neutral beverage picture cues at baseline, indicating heightened cue reactivity to alcohol cues in heavy drinking adolescents prior to the onset of any alcohol use diagnosis. Across the majority of these brain regions, differences in BOLD response were no longer apparent following a month of abstinence, suggesting a decrease in alcohol cue reactivity among adolescent non-dependent heavy drinkers as a consequence of abstaining from alcohol. These results highlight the malleability of adolescent brain function despite no formal intervention targeting cue reactivity. Increased understanding of the neural underpinnings of cue reactivity could have implications for prevention and intervention strategies in adolescent heavy alcohol users. Copyright © 2015 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Moyer, Brandon S.
CATALYTIC STEREOSELECTIVE INSTALLATION OF BORON VIA C-C BOND FORMATION. Enantiomerically pure chiral boron-containing molecules provide enabling platforms for chemical synthesis in that they are configurationally stable, they function as useful synthons for various functional groups, and their transformations into those diverse functionalities are stereospecific. With consensus that chiral alkyl sp3 C-B bond-containing compounds are desirable building blocks, and given that most enantioselective preparations to date focus on installing a stereodefined C-B bond, our group sought to develop catalytic methods to generate and use chiral alpha-boron-containing nucleophiles that would enable the direct formation of a new C-C bond. To this extent, we exploited the utility of alkyl 1,1-diboron reagents, which have been shown to readily undergo facile activation and transmetalation in the presence of alkoxide bases to form chiral alpha-boryl nucleophiles. The result of these investigations was the development of the first catalytic enantio- and diastereoselective synthesis of syn-1,2-hydroxyboronates via addition to aldehydes (Ch. 1). The reactions are promoted by a readily available chiral monodentate phosphoramidite-Cu(I) complex in the presence of an alkyl 1,1-diboron reagent. The products contain two contiguous stereogenic centers and are obtained in up to 91% yield, >98:2 d.r., and 98:2 e.r. The reaction is tolerant of aryl and vinyl aldehydes, and the 1,2-hydroxyboronate products can be transformed into versatile derivatives. Mechanistic experiments indicate that control of absolute stereochemistry resides at the alpha-boryl component. Further investigations resulted in the development of a substantially more reactive Ag(I) catalytic protocol for the diastereoselective synthesis of complementary anti-1,2-hydroxyboronates with up to 99:1 d.r. (Ch. 2). We found that the increased reactivity of Ag(I), in conjunction with stoichiometric KOtBu, allowed for a substantial broadening of substituted 1,1-diboronates that participate in the reaction. In addition, alkyl aldehydes were found to be suitable electrophiles with n-BuLi as an activator. STEREOSELECTIVE SYNTHESIS OF N-HETEROCYCLIC SCAFFOLDS VIA MAIN GROUP LEWIS ACID CATALYSIS. Silylium ions (formally [R 3Si]+) have long been the subject of investigations and significant debate in both theoretical and experimental chemistry, but few catalytic, synthetic applications have been reported due to the exceptionally high reactivity and Lewis acidity of these elusive species. Chapter 3 discusses the application of easily accessible silylium ion catalysts to the stereoselective synthesis of various N-heterocyclic pyrrolidine and piperidine scaffolds. The tested substrates are derived from the chiral pool and can be obtained in three high-yielding steps from amino alcohols; subsequent stereoselective silylium ion-catalyzed Prins-cyclization and trapping with R3Si-Nu nucleophiles (e.g. Nu = H, allyl, azide, and enol ethers) results in novel nitrogen-containing polycyclic scaffolds with potential medicinal chemistry applications. An appendix to this chapter (A) discusses the substrate scope of the unpublished discovery that the Lewis acid B(C6F5)3 catalyzes a stereospecific Prins cyclization followed by an elimination (formally a carbonyl-ene reaction) to form trans-tetrahydropyridine products in exceptionally high yield and diastereoselectivity.
Carthy, Tal; Benaroya-Milshtein, Noa; Valevski, Avi; Apter, Alan
2017-02-01
Emotional dysregulation is an important element in the pathophysiology of childhood anxiety disorders and can distinguish anxious subjects from controls. Treatment with selective serotonin inhibitors (SSRIs) has been found to lessen anxiety, but its effects on emotional reactivity and regulation are less documented. The aim of the study was to prospectively assess changes in emotional reactivity and regulation in response to citalopram in children and adolescents with anxiety disorders, with special focus on the mechanism of reappraisal. The sample included 70 children and adolescents (38 boys, 32 girls) 10-17 years of age, divided into three groups: Those with anxiety disorder treated with citalopram for 8 weeks (n = 35); untreated subjects with anxiety disorder on the waiting list for cognitive behavioral therapy (CBT) (n = 15); and subjects without anxiety disorder (controls) (n = 20). Emotional reactivity and regulation (i.e., reappraisal), were assessed at baseline and after 8 weeks (follow-up) with validated computer-based instruments, Reactivity and Regulation-Situations (REAR-S) and Reactivity and Regulation-Images (REAR-I). Citalopram-treated subjects showed significantly greater improvement in reappraisal ability than CBT-waitlisted subjects. Improvement in the ability to reappraise threatening images correlated significantly with the decrease in anxiety. There was a decrease in negative emotional reactivity between assessments, which was positively correlated with clinical improvement. Higher intensity of baseline reactivity (on the REAR-S) predicted more severe symptoms at follow-up. Citalopram therapy improves reappraisal ability in children and adolescents with anxiety. However, the improvement in other examined emotional reactivity indices occurred in both medicated and waitlisted groups. It is possible that these findings may have implications for understanding the pathophysiology of anxiety in children and adolescents.
Sharma, Anupriya; Ramesh, Amitha; Thomas, Biju
2009-01-01
Background and Objectives: Circulating C-reactive protein (CRP) levels are a marker of systemic inflammation and are associated with periodontal disease, a chronic bacterial infection associated with elevation of proinflammatory cytokines and prostaglandins. CRP has been associated with adverse pregnancy outcomes, including preterm delivery, preeclampsia, and intrauterine growth restriction. Furthermore, periodontal disease has been associated with increased risk of preterm low birth weight, low birth weight, and preterm birth. The present study was conducted to assess plasma CRP levels in pregnant women with and without periodontal disease; to evaluate the effect of periodontal therapy on the incidence of preterm delivery; and to compare the incidence of preterm delivery in pregnant women with and without periodontal disease. Materials and Methods: A total of 90 pregnant women aged between 18-35 years with gestational age between 12-28 weeks were recruited and divided into three equal groups (control group, study group, treatment group) of 30 each. Blood samples were taken for estimation of C-reactive protein levels from all groups at 12-20 weeks of gestation, determined using ultrasensitive turbidimetric immunoassay (QUANTIA-CRP US). The treatment group comprised plaque control, scaling, and root planning and daily rinsing with 0.2% chlorhexidine mouth before 28 weeks of gestation. Results: The mean value of C-reactive protein levels in subjects with periodontal disease was higher compared to control group i.e., 1.20 ± 0.247 mg/dl and 1.22 ± 0.250 mg/dl, respectively, compared to 0.713 ± 0.139 mg/ dl (P = 0.001). The mean value of CRP levels before treatment was greater than the mean value after treatment i.e., 1.22 ± 0.25 compared to 0.84 ± 0.189 (P < 0.001). The incidence of preterm delivery (< 37 weeks) was 31.7% in the periodontal disease group (study group) compared to 8.3% in the control group (P = 0.001). The incidence of preterm delivery in the treatment group was 15.0% compared to 31.7% in the nontreatment group (study group). Conclusion: The findings from the study suggest that periodontal disease in pregnant women is associated with increased C- reactive protein levels in early pregnancy, incidence of preterm delivery is higher in pregnant women with periodontal disease compared to healthy controls, periodontal therapy during pregnancy reduces plasma CRP levels and there is decrease in incidence of preterm delivery after periodontal therapy. PMID:20379412
Effects of Reiki With Music Compared to Music Only Among People Living With HIV.
Bremner, Marie N; Blake, Barbara J; Wagner, V Doreen; Pearcey, Sharon M
2016-01-01
Persons living with HIV (PLWH) often seek complementary treatments to improve their overall health and well-being. Reiki, an ancient healing practice, has been found to be effective in reducing symptoms of stress, anxiety, pain, and depression. The purpose of this pilot study was to evaluate the effectiveness of Reiki as a complementary treatment for PLWH. Using a two-group mixed-methods experimental design, 37 participants were randomized to either a 6-week Reiki with Music Group or a Music Only Group. Self-reported and physiologic measures were obtained at baseline, 6 weeks, and 10 weeks. Significant improvements in relief of pain and stress in those receiving RMG were found. At the 6-week assessment, semi-structured interviews were conducted with all participants. Qualitative findings indicated that Reiki and music therapy helped reduce stress, anxiety, and depression. Evidence-based data regarding the effectiveness of Reiki will help nurses help patients better manage HIV-related symptoms. Copyright © 2016 Association of Nurses in AIDS Care. Published by Elsevier Inc. All rights reserved.
Francis, Manjusha; Williams, Sheela
2014-01-01
Oral mucositis is a common, debilitating complication of cancer patients undergoing chemotherapy and radiotherapy, occurring in about 40 percent cases. Mucositis may limit the patient's ability to tolerate chemotherapy or radiation therapy, and nutrition status is compromised. The aim of the study was to assess the effect of Indian turmeric powder with honey as a complementary therapy on treatment induced oral mucositis. In the study, quasi experimental non-equivalent control group pre test post-test design was used and non-probability purposive sampling technique was adopted to select 60 cancer patients with treatment induced oral mucositis, 30 each in experimental and control group. The independent 't' value for post-test 2 and 3 (post-test 2: 2.86 for WHO OMAS and 4.58 for MPJ OMAS, post test 2: 5.42 for WHO OMAS and 7.2 for MPJ OMAS; p < 0.05) were significant between experimental and control group. It is inferred that the application of Indian turmeric and honey on treatment-induced oral mucositis is effective.
Warm partner contact is related to lower cardiovascular reactivity.
Grewen, Karen M; Anderson, Bobbi J; Girdler, Susan S; Light, Kathleen C
2003-01-01
The authors investigated the relationship between brief warm social and physical contact among cohabitating couples and blood pressure (BP) reactivity to stress in a sample of healthy adults (66 African American, 117 Caucasian; 74 women, 109 men). Prior to stress, the warm contact group underwent a 10-minute period of handholding while viewing a romantic video. Followed by a 20-second hug with their partner, while the no contact group rested quietly for 10 minutes and 20 seconds. In response to a public speaking task, individuals receiving prestress partner contact demonstrated lower systolic BP diastolic BP, and heart rate increases compared with the no contact group. The effects of warm contact were comparable for men and women and were greater for African Americans compared with Caucasians. These findings suggest that affectionate relationships with a supportive partner may contribute to lower reactivity to stressful life events and may partially mediate the benefit of marital support on better cardiovascular health.
NASA Technical Reports Server (NTRS)
Gelb, W. G.; Brandts, J. F.; Nordin, J. H.
1973-01-01
Honeybee and rabbit muscle GPDH were studied to obtain information at the chemical level regarding anomolous saturation kinetics of the honeybee enzyme. Results demonstrate that the enzyme's sulfhydryl groups are implicated in the process. Measured by DTNB titration, native honeybee GPDH has one less active SH than the native rabbit muscle enzyme and displays changes in overall sulfhydryl reactivity after preincubation with G-3-P or G-3-P plus NAD+. The total DTNB reactive sulfhydryls of rabbit muscle GPDH are not changed by preincubation with NAD+ or G-3-P; honeybee GPDH, under certain conductions of preincubation with these ligands, shows a decrease of two total DTNB reactive SH groups. This difference has been confirmed by an independent experiment in which the two enzymes were carboxymethylated with C-14 bromoacetic acid.
Voth, Eva M; Claes, Laurence; Georgiadou, Ekaterini; Selle, Janine; Trotzke, Patrick; Brand, Matthias; de Zwaan, Martina; Müller, Astrid
2014-10-01
To examine reactive and regulative temperament in patients with compulsive buying (CB) by means of self-report measures and performance-based tasks and to explore the relationship between both measurement approaches. The study included 31 treatment-seeking patients with CB (25 women, 6 men) and an age and gender matched non-clinical control group without CB (CG). All participants answered the Compulsive Buying Scale (CBS). Reactive temperament was assessed using the Behavioral Inhibition System/Behavioral Activation System Scales (BIS/BAS) and the Iowa Gambling Task (IGT). Regulative temperament was measured using the Effortful Control subscale of the Adult Temperament Questionnaire (ATQ-EC) and a computerized version of the Stroop Task. To control the results for depression, the Patient Health Questionnaire-Depression Scale (PHQ-9) was administered. Crude group comparisons revealed higher BIS and BAS scores, poorer IGT performance and lower ATQ-EC scores in the CB-group compared to the CG. The groups did not differ in their performance on the Stroop task. After controlling for depressive symptoms that were significantly higher in the CB-group, only the group differences in BAS reactivity remained significant. No significant associations were found between questionnaires and performance-based tasks. Overall, the findings indicate that CB in the present clinical sample of treatment-seeking patients was mainly associated with higher approach tendencies and more depressive symptoms. The lacking correlation between self-reports and performance-based tasks is in line with prior research and suggests that both methodologies tap into different aspects of temperament. Copyright © 2014 Elsevier Inc. All rights reserved.
Protein lysine-Nζ alkylation and O-phosphorylation mediated by DTT-generated reactive oxygen species
Kumar, Nigam; Ippel, Hans; Weber, Christian; Hackeng, Tilman; Mayo, Kevin H
2013-01-01
Reactive oxygen species (ROS) play crucial roles in physiology and pathology. In this report, we use NMR spectroscopy and mass spectrometry (MS) to demonstrate that proteins (galectin-1, ubiquitin, RNase, cytochrome c, myoglobin, and lysozyme) under reducing conditions with dithiothreitol (DTT) become alkylated at lysine-Nζ groups and O-phosphorylated at serine and threonine residues. These adduction reactions only occur in the presence of monophosphate, potassium, trace metals Fe/Cu, and oxygen, and are promoted by reactive oxygen species (ROS) generated via DTT oxidation. Superoxide mediates the chemistry, because superoxide dismutase inhibits the reaction, and hydroxyl and phosphoryl radicals are also likely involved. While lysine alkylation accounts for most of the adduction, low levels of phosphorylation are also observed at some serine and threonine residues, as determined by western blotting and MS fingerprinting. The adducted alkyl group is found to be a fragment of DTT that forms a Schiff base at lysine Nζ groups. Although its exact chemical structure remains unknown, the DTT fragment includes a SH group and a –CHOH–CH2– group. Chemical adduction appears to be promoted in the context of a well-folded protein, because some adducted sites in the proteins studied are considerably more reactive than others and the reaction occurs to a lesser extent with shorter, unfolded peptides and not at all with small organic molecules. A structural signature involving clusters of positively charged and other polar groups appears to facilitate the reaction. Overall, our findings demonstrate a novel reaction for DTT-mediated ROS chemistry with proteins. PMID:23315912
Keleş Altun, İlkay; Uysal, Emel; Özkorumak Karagüzel, Evrim
2017-01-01
Obsessive compulsive disorder (OCD) is characterized by obsessions and compulsions. Obsessions have been classified as autogenous obsessions and reactive obsessions on the basis of the cognitive theory of Lee and Kwon. The aim of this study was to investigate the differences between autogenous groups (AG) and reactive groups (RG) in terms of metacognition and automatic thoughts, for the purpose of investigating the differences of cognitive appraisals. One hundred and thirty-three patients diagnosed with OCD were included in the study as the patient group. A control group was formed of 133 age, gender and education-matched healthy individuals. The OCD group patients were separated into subgroups according to the primary obsessions. The sociodemographic data, and the Yale-Brown Obsessive Compulsive Scale, Metacognition Questionnaire-30 (MCQ-30), Automatic Thoughts Questionnaire (ATQ), Beck Depression Inventory (BDI) and Beck Anxiety Inventory (BAI) scores of the AG, RG, and control groups were compared. The MCQ-30 (total) and the subscales of MCQ-30 and ATQ scale points were seen to be significantly higher in the AG than in the RG and significantly higher in the RG than in the control group. In the reactive obsession group, the predictive variables of the ATQ points were determined to be MCQ-30 (total), BDI and BAI. In the autogenous obsession group, the predictive variables of the ATQ points were determined to be BDI and BAI. In the current study, differences were determined between the AG and the RG in respect of metacognitions and automatic thoughts. In light of these results, the recommended grouping can be considered useful in the identification of OCD sub-types. There is a need for further studies to identify more homogenous sub-types of OCD. Future multi-centered studies of sub-typing with larger samples using more specific instruments to sub-type and dimensional evaluation will be useful for detailed evaluation and better understanding of the subject.
Quantifying reactivity for electrophilic aromatic substitution reactions with Hirshfeld charge.
Liu, Shubin
2015-03-26
An electrophilic aromatic substitution is a process where one atom or group on an aromatic ring is replaced by an incoming electrophile. The reactivity and regioselectivity of this category of reactions is significantly impacted by the group that is already attached to the aromatic ring. Groups promoting substitution at the ortho/para and meta position are called ortho/para and meta directing groups, respectively. Earlier, we have shown that regioselectivity of the electrophilic aromatic substitution is dictated by the nucleophilicity of the substituted aromatic ring, which is proportional to the Hirshfeld charge on the regioselective site. Ortho/para directing groups have the largest negative charge values at the ortho/para positions, whereas meta directing groups often have the largest negative charge value at the meta position. The electron donation or acceptance feature of a substitution group is irrelevant to the regioselectivity. In this contribution, we extend our previous study by quantifying the reactivity for this kind of reactions. To that end, we examine the transition-state structure and activation energy of an identity reaction for a series of monosubstituted-benzene molecules reacting with hydrogen fluoride using BF3 as the catalyst in the gas phase. A total of 18 substitution groups will be considered, nine of which are ortho/para directing and the other nine groups meta directing. From this study, we found that the barrier height of these reactions strongly correlates with the Hirshfeld charge on the regioselective site for both ortho/para and meta directing groups, with the correlation coefficient R(2) both better than 0.96. We also discovered a less accurate correlation between the barrier height and HOMO energy. These results reconfirm the validity and effectiveness of employing the Hirshfeld charge as a reliable descriptor of both reactivity and regioselectivity for this vastly important category of chemical transformations.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Smith, Michael Edward
1993-10-01
The thesis is divided into the following 4 chapters: synthesis, characterization, and reactivity of trinuclear pentamethylcyclopentadienyl cobalt and nickel clusters with triply-bridging methylidyne groups; chemical and physical properties of pentamethylcyclopentadienyl acetylacetonate complexes of Co(II) and Ni(II); synthesis, characterization, and reactivity of pentamethylcyclopentadienyl halide complexes of Co and Ni; and crystallographic studies of distortions in metallocenes with C 5-symmetrical cyclopentadienyl rings.
Distinct Cross-reactive B-Cell Responses to Live Attenuated and Inactivated Influenza Vaccines
Sasaki, Sanae; Holmes, Tyson H.; Albrecht, Randy A.; García-Sastre, Adolfo; Dekker, Cornelia L.; He, Xiao-Song; Greenberg, Harry B.
2014-01-01
Background. The immunological bases for the efficacies of the 2 currently licensed influenza vaccines, live attenuated influenza vaccine (LAIV) and inactivated influenza vaccine (IIV), are not fully understood. The goal of this study was to identify specific B-cell responses correlated with the known efficacies of these 2 vaccines. Methods. We compared the B-cell and antibody responses after immunization with 2010/2011 IIV or LAIV in young adults, focusing on peripheral plasmablasts 6–8 days after vaccination. Results. The quantities of vaccine-specific plasmablasts and plasmablast-derived polyclonal antibodies (PPAbs) in IIV recipients were significantly higher than those in LAIV recipients. No significant difference was detected in the avidity of vaccine-specific PPAbs between the 2 vaccine groups. Proportionally, LAIV induced a greater vaccine-specific immunoglobulin A plasmablast response, as well as a greater plasmablast response to the conserved influenza nuclear protein, than IIV. The cross-reactive plasmablast response to heterovariant strains, as indicated by the relative levels of cross-reactive plasmablasts and the cross-reactive PPAb binding reactivity, was also greater in the LAIV group. Conclusions. Distinct quantitative and qualitative patterns of plasmablast responses were induced by LAIV and IIV in young adults; a proportionally greater cross-reactive response was induced by LAIV. PMID:24676204
Guo, Li; Wang, Dayan; Zhou, Hongli; Wu, Chao; Gao, Xin; Xiao, Yan; Ren, Lili; Paranhos-Baccalà, Gláucia; Shu, Yuelong; Jin, Qi; Wang, Jianwei
2016-01-01
The number of human avian H7N9 influenza infections has been increasing in China. Understanding their antigenic and serologic relationships is crucial for developing diagnostic tools and vaccines. Here, we evaluated the cross-reactivities and neutralizing activities among H7 subtype influenza viruses and between H7N9 and heterosubtype influenza A viruses. We found strong cross-reactivities between H7N9 and divergent H7 subtypic viruses, including H7N2, H7N3, and H7N7. Antisera against H7N2, H7N3, and H7N7 could also effectively neutralize two distinct H7N9 strains. Two-way cross-reactivities exist within group 2, including H3 and H4, whereas one-way cross-reactivities were found across other groups, including H1, H10, H9, and H13. Our data indicate that the hemaglutinins from divergent H7 subtypes may facilitate the development of vaccines for distinct H7N9 infections. Moreover, serologic diagnoses for H7N9 infections need to consider possible interference from the cross-reactivity of H7N9 with other subtype influenza viruses. PMID:26907865
Brindle, Ryan C; Duggan, Katherine A; Cribbet, Matthew R; Kline, Christopher E; Krafty, Robert T; Thayer, Julian F; Mulukutla, Suresh R; Hall, Martica H
2018-04-01
Exaggerated cardiovascular reactivity to acute psychological stress has been associated with increased carotid intima-media thickness (IMT). However, interstudy variability in this relationship suggests the presence of moderating factors. The current study aimed to test the hypothesis that poor nocturnal sleep, defined as short total sleep time or low slow-wave sleep, would moderate the relationship between cardiovascular reactivity and IMT. Participants (N = 99, 65.7% female, age = 59.3 ± 9.3 years) completed a two-night laboratory sleep study and cardiovascular examination where sleep and IMT were measured. The multisource interference task was used to induce acute psychological stress, while systolic and diastolic blood pressure and heart rate were monitored. Moderation was tested using the PROCESS framework in SPSS. Slow-wave sleep significantly moderated the relationship between all cardiovascular stress reactivity variables and IMT (all pinteraction ≤ .048, all ΔRinteraction ≥ .027). Greater stress reactivity was associated with higher IMT values in the low slow-wave sleep group and lower IMT values in the high slow-wave sleep group. No moderating effects of total sleep time were observed. The results provide evidence that nocturnal slow-wave sleep moderates the relationship between cardiovascular stress reactivity and IMT and may buffer the effect of daytime stress-related disease processes.
Guo, Li; Wang, Dayan; Zhou, Hongli; Wu, Chao; Gao, Xin; Xiao, Yan; Ren, Lili; Paranhos-Baccalà, Gláucia; Shu, Yuelong; Jin, Qi; Wang, Jianwei
2016-02-24
The number of human avian H7N9 influenza infections has been increasing in China. Understanding their antigenic and serologic relationships is crucial for developing diagnostic tools and vaccines. Here, we evaluated the cross-reactivities and neutralizing activities among H7 subtype influenza viruses and between H7N9 and heterosubtype influenza A viruses. We found strong cross-reactivities between H7N9 and divergent H7 subtypic viruses, including H7N2, H7N3, and H7N7. Antisera against H7N2, H7N3, and H7N7 could also effectively neutralize two distinct H7N9 strains. Two-way cross-reactivities exist within group 2, including H3 and H4, whereas one-way cross-reactivities were found across other groups, including H1, H10, H9, and H13. Our data indicate that the hemaglutinins from divergent H7 subtypes may facilitate the development of vaccines for distinct H7N9 infections. Moreover, serologic diagnoses for H7N9 infections need to consider possible interference from the cross-reactivity of H7N9 with other subtype influenza viruses.
Thompson, Renee J.; Mata, Jutta; Jaeggi, Susanne M.; Buschkuehl, Martin; Jonides, John; Gotlib, Ian H.
2013-01-01
Investigators have begun to examine the temporal dynamics of affect in individuals diagnosed with Major Depressive Disorder (MDD), focusing on instability, inertia, and reactivity of emotion. How these dynamics differ between individuals with MDD and healthy controls have not before been examined in a single study. In the present study, 53 adults with MDD and 53 healthy adults carried hand-held electronic devices for approximately seven days and were prompted randomly eight times per day to report their levels of current negative affect (NA), positive affect (PA), and the occurrence of significant events. In terms of NA, compared with healthy controls, depressed participants reported greater instability and greater reactivity to positive events, but comparable levels of inertia and reactivity to negative events. Neither average levels of NA nor NA reactivity to, frequency or intensity of, events accounted for the group difference in instability of NA. In terms of PA, the MDD and control groups did not differ significantly in their instability, inertia, or reactivity to positive or negative events. These findings highlight the importance of emotional instability in MDD, particularly with respect to NA, and contribute to a more nuanced understanding of the everyday emotional experiences of depressed individuals. PMID:22708886
Hoenders, H J Rogier; Appelo, Martin T; van den Brink, Erik H; Hartogs, Bregje M A; de Jong, Joop T V M
2011-12-01
Complementary and alternative medicine (CAM) is subject to heated debates and prejudices. Studies show that CAM is widely used by psychiatric patients, usually without the guidance of a therapist and without the use of a solid working method, leading to potential health risks. The purpose of this study is to facilitate the judicious use of CAM alongside conventional psychiatry in an outpatient psychiatric clinic. A search was made through scientific and legal articles and discussion in focus groups. In the Centre for Integrative Psychiatry (CIP) of Lentis in The Netherlands, some carefully selected CAM are offered under strict conditions, alongside conventional treatments. Because of the controversy and the potential health risks, Lentis designed a protocol that is presented. The CIP hopes, by using this protocol, to better serve and respect the individual needs and preferences of the diversity of psychiatric patients in our Dutch multicultural society, and better protect them from harm.
Makiguchi, Wataru; Tanabe, Junki; Yamada, Hidekazu; Iida, Hiroki; Taura, Daisuke; Ousaka, Naoki; Yashima, Eiji
2015-01-01
Self-recognition and self-discrimination within complex mixtures are of fundamental importance in biological systems, which entirely rely on the preprogrammed monomer sequences and homochirality of biological macromolecules. Here we report artificial chirality- and sequence-selective successive self-sorting of chiral dimeric strands bearing carboxylic acid or amidine groups joined by chiral amide linkers with different sequences through homo- and complementary-duplex formations. A mixture of carboxylic acid dimers linked by racemic-1,2-cyclohexane bis-amides with different amide sequences (NHCO or CONH) self-associate to form homoduplexes in a completely sequence-selective way, the structures of which are different from each other depending on the linker amide sequences. The further addition of an enantiopure amide-linked amidine dimer to a mixture of the racemic carboxylic acid dimers resulted in the formation of a single optically pure complementary duplex with a 100% diastereoselectivity and complete sequence specificity stabilized by the amidinium–carboxylate salt bridges, leading to the perfect chirality- and sequence-selective duplex formation. PMID:26051291
Complementary p- and n-type polymer doping for ambient stable graphene inverter.
Yun, Je Moon; Park, Seokhan; Hwang, Young Hwan; Lee, Eui-Sup; Maiti, Uday; Moon, Hanul; Kim, Bo-Hyun; Bae, Byeong-Soo; Kim, Yong-Hyun; Kim, Sang Ouk
2014-01-28
Graphene offers great promise to complement the inherent limitations of silicon electronics. To date, considerable research efforts have been devoted to complementary p- and n-type doping of graphene as a fundamental requirement for graphene-based electronics. Unfortunately, previous efforts suffer from undesired defect formation, poor controllability of doping level, and subtle environmental sensitivity. Here we present that graphene can be complementary p- and n-doped by simple polymer coating with different dipolar characteristics. Significantly, spontaneous vertical ordering of dipolar pyridine side groups of poly(4-vinylpyridine) at graphene surface can stabilize n-type doping at room-temperature ambient condition. The dipole field also enhances and balances the charge mobility by screening the impurity charge effect from the bottom substrate. We successfully demonstrate ambient stable inverters by integrating p- and n-type graphene transistors, which demonstrated clear voltage inversion with a gain of 0.17 at a 3.3 V input voltage. This straightforward polymer doping offers diverse opportunities for graphene-based electronics, including logic circuits, particularly in mechanically flexible form.
[Visfatin in obese patients, relation with cardiovascular risk factors, a cross sectional study].
de Luis, Daniel A; Ballesteros, María; Ruiz, Enrique; Muñoz, Carmen; Penacho, Angeles; Iglesias, Pedro; Guzmán, Antonio López; Abreu, Cristina; Maldonado, Alfonso; Delgado, Manuel; Martín, Lucía San; Puigdevall, Victor; Romero, Enrique; Sagrado, Manuel González; Izaola, Olatz; Conde, Rosa
2011-07-23
Obesity and insulin resistance are associated with cardiovascular risk factors. The aim of the present study was to explore the relation of visfatin with insulin resistance, cardiovascular risk factors and anthropometry in obese patients without comorbidities. A population of 270 obese patients was analyzed in a prospective way. In all patients we performed a biochemical analysis (lipid profile, insulin, HOMA and visfatina), and a nutritional evaluation (dietary intake, conventional anthropometry and bioimpedance). Patients were divided in two groups by median visfatin value (8,32 ng/ml), group I (patients with the low values, average value 7,11 (0,7) ng/ml) and group II (patients with the high values, average value 13,5 (10,1) ng/ml). Patients in the group I had higher weight, body mass index, waist circumference, and waist to hip ratio than patients in group II. Patients in group I had lower LDL-cholesterol and C reactive protein than patients in group II. Correlation analysis showed a positive correlation between visfatin levels and LDL cholesterol (r=0.194; p<0.05) and C reactive protein (r=0.266; p<0.05) and a negative corelation with weight (r=-0.162; p<0.05). In the logistic analysis with age-, sex- and dietary intake- adjusted basal visfatin concentration as a dependent variable, the next variables remained in the model; weight with an odds ratio (OR) 0,97 (IC95% 0,95-0,99), LDL cholesterol 1,012(1,010-1.023) and C reactive protein 1,15 (1.03-1.3). LDL cholesterol and c reactive protein levels are positively correlated with visfatin levels. Weight is negatively correlated with visfatin levels, in an independent way and adjusted by age, sex and dietary intake. Copyright © 2010 Elsevier España, S.L. All rights reserved.
Evaluation of the chemical reactivity in lignin precursors using the Fukui function.
Martinez, Carmen; Rivera, José L; Herrera, Rafael; Rico, José L; Flores, Nelly; Rutiaga, José G; López, Pablo
2008-02-01
The hydroxycinnamyl alcohols: p-coumarol, coniferol and sinapol are considered the basic units and precursors of lignins models. In this work, the specific reactivity of these molecules was studied. We investigate their intrinsic chemical reactivity in terms of the Fukui function, applying the principle of hard and soft acids and bases (HSAB) in the framework of the density functional theory (DFT). Comparisons of their nucleophilic, electrophilic and free radical reactivity show their most probably sites to form linkages among them. It is found that the most reactive sites, for reactions involving free radicals, are the carbons at the beta-position in the p-coumarol and sinapol molecules, whilst the regions around the carbon-oxygen bond of the phenoxyl group are the most reactive in coniferol.
Potentially Reactive Forms of Silica in Volcanic Rocks Using Different Analytical Approaches
NASA Astrophysics Data System (ADS)
Esteves, Hugo; Fernandes, Isabel; Janeiro, Ana; Santos Silva, António; Pereira, Manuel; Medeiros, Sara; Nunes, João Carlos
2017-12-01
Several concrete structures show signs of deterioration resulting from internal chemical reactions, such as the alkali-silica reaction (ASR). It is well known that these swelling reactions occur in the presence of moisture, between some silica mineral phases present in the aggregates and the alkalis of the concrete, leading to the degradation of concrete structures and consequently compromising their safety. In most of the cases, rehabilitation, demolition or even rebuilding of such structures is needed and the effective costs can be very high. Volcanic rocks are commonly used as aggregates in concrete, and they are sometimes the only option due to the unavailability of other rock types. These rocks may contain different forms of silica that are deleterious to concrete, such as opal, chalcedony, cristobalite, tridymite and micro- to cryptocrystalline quartz, as well as Si-rich volcanic glass. Volcanic rocks are typically very finegrained and their constituting minerals are usually not distinguished under optical microscopy, thus leading to using complementary methods. The objective of this research is to find the more adequate analytical methods to identify silica phases that might be present in volcanic aggregates and cause ASR. The complementary methods used include X-Ray Diffraction (XRD), mineral acid digestion and Scanning Electron Microscopy with Energy Dispersive X-Ray Spectrometry (SEM/EDS), as well as Electron Probe Micro-Analysis (EPMA).
Chou, Su-Tze; Chang, Wen-Lun; Chang, Chen-Tien; Hsu, Shih-Lan; Lin, Yu-Che; Shih, Ying
2013-01-01
Essential oils extracted from aromatic plants exhibit important biological activities and have become increasingly important for the development of aromatherapy for complementary and alternative medicine. The essential oil extracted from Cinnamomum cassia Presl (CC-EO) has various functional properties; however, little information is available regarding its anti-tyrosinase and anti-melanogenic activities. In this study, 16 compounds in the CC-EO have been identified; the major components of this oil are cis-2-methoxycinnamic acid (43.06%) and cinnamaldehyde (42.37%). CC-EO and cinnamaldehyde exhibited anti-tyrosinase activities; however, cis-2-methoxycinnamic acid did not demonstrate tyrosinase inhibitory activity. In murine B16 melanoma cells stimulated with α-melanocyte-stimulating hormone (α-MSH), CC-EO and cinnamaldehyde not only reduced the melanin content and tyrosinase activity of the cells but also down-regulated tyrosinase expression without exhibiting cytotoxicity. Moreover, CC-EO and cinnamaldehyde decreased thiobarbituric acid-reactive substance (TBARS) levels and restored glutathione (GSH) and catalase activity in the α-MSH-stimulated B16 cells. These results demonstrate that CC-EO and its major component, cinnamaldehyde, possess potent anti-tyrosinase and anti-melanogenic activities that are coupled with antioxidant properties. Therefore, CC-EO may be a good source of skin-whitening agents and may have potential as an antioxidant in the future development of complementary and alternative medicine-based aromatherapy. PMID:24051402
Norman, Kenneth A; Newman, Ehren L; Perotte, Adler J
2005-11-01
The stability-plasticity problem (i.e. how the brain incorporates new information into its model of the world, while at the same time preserving existing knowledge) has been at the forefront of computational memory research for several decades. In this paper, we critically evaluate how well the Complementary Learning Systems theory of hippocampo-cortical interactions addresses the stability-plasticity problem. We identify two major challenges for the model: Finding a learning algorithm for cortex and hippocampus that enacts selective strengthening of weak memories, and selective punishment of competing memories; and preventing catastrophic forgetting in the case of non-stationary environments (i.e. when items are temporarily removed from the training set). We then discuss potential solutions to these problems: First, we describe a recently developed learning algorithm that leverages neural oscillations to find weak parts of memories (so they can be strengthened) and strong competitors (so they can be punished), and we show how this algorithm outperforms other learning algorithms (CPCA Hebbian learning and Leabra at memorizing overlapping patterns. Second, we describe how autonomous re-activation of memories (separately in cortex and hippocampus) during REM sleep, coupled with the oscillating learning algorithm, can reduce the rate of forgetting of input patterns that are no longer present in the environment. We then present a simple demonstration of how this process can prevent catastrophic interference in an AB-AC learning paradigm.
Turk-Browne, Nicholas B.; Botvinick, Matthew M.; Norman, Kenneth A.
2017-01-01
A growing literature suggests that the hippocampus is critical for the rapid extraction of regularities from the environment. Although this fits with the known role of the hippocampus in rapid learning, it seems at odds with the idea that the hippocampus specializes in memorizing individual episodes. In particular, the Complementary Learning Systems theory argues that there is a computational trade-off between learning the specifics of individual experiences and regularities that hold across those experiences. We asked whether it is possible for the hippocampus to handle both statistical learning and memorization of individual episodes. We exposed a neural network model that instantiates known properties of hippocampal projections and subfields to sequences of items with temporal regularities. We found that the monosynaptic pathway—the pathway connecting entorhinal cortex directly to region CA1—was able to support statistical learning, while the trisynaptic pathway—connecting entorhinal cortex to CA1 through dentate gyrus and CA3—learned individual episodes, with apparent representations of regularities resulting from associative reactivation through recurrence. Thus, in paradigms involving rapid learning, the computational trade-off between learning episodes and regularities may be handled by separate anatomical pathways within the hippocampus itself. This article is part of the themed issue ‘New frontiers for statistical learning in the cognitive sciences’. PMID:27872368
Schapiro, Anna C; Turk-Browne, Nicholas B; Botvinick, Matthew M; Norman, Kenneth A
2017-01-05
A growing literature suggests that the hippocampus is critical for the rapid extraction of regularities from the environment. Although this fits with the known role of the hippocampus in rapid learning, it seems at odds with the idea that the hippocampus specializes in memorizing individual episodes. In particular, the Complementary Learning Systems theory argues that there is a computational trade-off between learning the specifics of individual experiences and regularities that hold across those experiences. We asked whether it is possible for the hippocampus to handle both statistical learning and memorization of individual episodes. We exposed a neural network model that instantiates known properties of hippocampal projections and subfields to sequences of items with temporal regularities. We found that the monosynaptic pathway-the pathway connecting entorhinal cortex directly to region CA1-was able to support statistical learning, while the trisynaptic pathway-connecting entorhinal cortex to CA1 through dentate gyrus and CA3-learned individual episodes, with apparent representations of regularities resulting from associative reactivation through recurrence. Thus, in paradigms involving rapid learning, the computational trade-off between learning episodes and regularities may be handled by separate anatomical pathways within the hippocampus itself.This article is part of the themed issue 'New frontiers for statistical learning in the cognitive sciences'. © 2016 The Author(s).
Jiang, Xiao-Min; Qian, Xue-Song; Gao, Xiao-Fei; Ge, Zhen; Tian, Nai-Liang; Kan, Jing; Zhang, Jun-Jie
2018-05-05
The relationship between obstructive sleep apnea (OSA) and platelet reactivity in patients undergoing percutaneous coronary intervention (PCI) has not been defined. The present prospective, single-center study explored the relationship between platelet reactivity and OSA in patients with PCI. A total of 242 patients were finally included in the study. OSA was screened overnight by polysomnography. Platelet reactivity was assessed with a sequential platelet counting method, and the platelet maximum aggregation ratio (MAR) and average aggregation ratio were calculated. All patients were assigned per apnea-hypopnea index (AHI) to non-OSA (n = 128) and OSA (n = 114) groups. The receiver operating characteristic curve analysis was used to evaluate the accuracy of AHI for high platelet reactivity (HPR) on aspirin and clopidogrel, and multivariable logistic regression was used to determine the independent predictors of HPR on aspirin and clopidogrel. Median AHI was significantly higher in the OSA group than in the non-OSA group (34.5 events/h vs. 8.1 events/h, Z = -13.422, P < 0.001). Likewise, median arachidonic acid- and adenosine diphosphate-induced maximum aggregation rate (MAR) in the OSA group was significantly higher than those in the non-OSA group (21.1% vs. 17.7%, Z = -3.525, P < 0.001 and 45.8% vs. 32.2%, Z = -5.708, P < 0.001, respectively). Multivariable logistic regression showed that OSA was the only independent predictor for HPR on aspirin (odds ratio [OR]: 1.055, 95% confidence interval [CI]: 1.033-1.077, P < 0.001) and clopidogrel (OR: 1.036, 95% CI: 1.017-1.056, P < 0.001). The cutoff value of AHI for HPR on aspirin was 45.2 events/h (sensitivity 47.1% and specificity 91.3%), whereas cutoff value of AHI for HPR on clopidogrel was 21.3 events/h (sensitivity 68.3% and specificity 67.7%). Platelet reactivity appeared to be higher in OSA patients with PCI despite having received a loading dose of aspirin and clopidogrel, and OSA might be an independent predictor of HPR on aspirin and clopidogrel.
Swenson, D H; Lawley, P D
1978-01-01
1. The ethyl phosphotriester of thymidylyl(3'-5')thymidine, dTp(Et)dT, was identified as a product from reaction of DNA with N-ethyl-N-nitrosourea, by procedures parallel to those reported previously for the methyl homologue produced by N-methyl-N-nitrosourea. 2. Enzymic degradation to yield alkyl phosphotriesters from DNA alkylated by these carcinogens and by dimethyl sulphate and ethyl methanesulphonate was studied quantitatively, and the relative yields of the triesters dTp(Alk)dT were determined. The relative reactivity of the phosphodiester group dTpdT to each of the four carcinogens was thus obtained, and compared with that of DNA overall, or with that of the N-7 atom of guanine in DNA. Relative reactivity of the phosphodiester group was lowest towards dimethyl sulphate, the least electrophilic of the reagents used, and was highest towards N-ethyl-N-nitrosourea, the most electrophilic reagent. 3. The nature of the alkyl group transferred also influenced reactivity of the phosphodiester site, since this site was relatively more reactive towards ethylation than would be predicted simply from the known Swain-Scott s values of the alkylating agents. It was therefore suggested that the steric accessibility of the weakly nucleophilic phosphodiester group on the outside of the DNA macromolecule favours its reaction with ethylating, as opposed to methylating, reagents. 4. Taking a value of the Swain-Scott nucleophilicity (n) of 2.5 for an average DNA nucleotide unit [Walles & Ehrenberg (1969) Acta Chem. Scand. 23, 1080-1084], a value of n of about 1 for the phosphodiester group was deduced, and this value was found to be 2-3 units less than that for the N-7 atom of guanine in DNA. 5. The reactivity of DNA overall was markedly high towards the alkylnitrosoureas, despite their relatively low s values. This was ascribed to an electrostatic factor that favoured reaction of the negatively charged polymer with alkyldiazonium cation intermediates. PMID:208508
Reactive Landing of Dendrimer Ions onto Activated Self-assembled Monolayer Surfaces
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hu, Qichi; Laskin, Julia
2014-02-06
The reactivity of gaseous, amine-terminated polyamidoamine (PAMAM) dendrimer ions with activated self-assembled monolayer (SAM) surfaces terminated with N-hydroxysuccinimidyl ester groups (NHS-SAM) is examined using mass-selected ion deposition combined with in situ infrared reflection absorption spectroscopy (IRRAS). The reaction extent is determined from depletion of the infrared band at 1753 cm-1, corresponding to the stretching vibration of the NHS carbonyl groups following ion deposition. For reaction yields below 10%, NHS band depletion follows a linear dependence on the ion dose. By comparing the kinetics plots obtained for 1,12-dodecanediamine and different generations of dendrimer ions (G0–G3) containing 4, 8, 16, and 32more » terminal amino group, we demonstrate that the relative reaction efficiency increases linearly with the number of NH2 groups in the molecule. This finding is rationalized assuming the formation of multiple amide bonds upon collision of higher-generation dendrimers with NHS-SAM. Furthermore, by comparing the NHS band depletion following deposition of [M+4H]4+ ions of the G2 dendrimer at 30, 80, and 120 eV, we demonstrate that the ion’s kinetic energy has no measurable effect on reaction efficiency. Similarly, the ion’s charge state only has a minor effect on the reactive landing efficiency of dendrimer ions. Our results indicate that reactive landing is an efficient approach for highly selective covalent immobilization of complex multifunctional molecules onto organic surfaces terminated with labile functional groups.« less
Huang, Tse-Hao; Peng, Ho-Jen; Su, Song-Nan; Liaw, Shwu-Huey
2012-10-01
The structure of Cyn d 4, the group 4 allergen from Bermuda grass, is reported at 2.15 Å resolution and is the first crystal structure of a naturally isolated pollen allergen. A conserved N-terminal segment that is only present in the large isoallergens forms extensive interactions with surrounding residues and hence greatly enhances the structural stability of the protein. Cyn d 4 contains an FAD cofactor that is covalently linked to His88 and Cys152. To date, all identified bicovalent flavoproteins are oxidases and their substrates are either sugars or secondary metabolites. A deep large hydrophobic substrate-binding cleft is present. Thus, Cyn d 4 may be an oxidase that is involved in the biosynthesis of a pollen-specific metabolite. Cyn d 4 shares ~70% sequence identity with the Pooideae group 4 allergens. Various cross-reactivities between grass pollen group 4 allergens have previously been demonstrated using sera from allergic patients. The protein surface displays an unusually large number of positively charged clusters, reflecting the high pI of ~10. 38 decapeptides that cover the solvent-accessible sequences did not show any significant IgE-binding activity using sera with high Cyn d 4 reactivity from four patients, suggesting that the IgE epitopes of Cyn d 4 are predominantly conformational in nature. Several group 4 structures were then modelled and their potential cross-reactive and species-specific IgE epitopes were proposed.
Callado, Maria Roseli Monteiro; Lima, José Rubens Costa; Nobre, Christiane Aguiar; Vieira, Walber Pinto
2011-01-01
To identify tuberculosis infection in rheumatic patients on infliximab by use of PPD testing prior to immunobiologic therapy. This study comprised 157 patients undergoing infliximab treatment and 734 other patients undergoing laboratory screening for tuberculosis infection originating from several services. The Mantoux technique was used for PPD testing, and an induration of at least 5 mm was considered reactive status. In the infliximab group, 13% of the patients reacted to PPD, while, in the other group, 27% of the patients reacted to PPD (χ² = 13; P = 0.0003). These patients were divided into categories: adults with chronic diseases, PPD reactivity of 22%; and other controls, PPD reactivity of 31%. This shows the heterogeneous response of that population (χ² = 7; P < 0.009). In the infliximab group, subdivided according to pathologies [rheumatoid arthritis (RA), ankylosing spondylitis (AS), and psoriatic arthritis (PA)], different reactivity rates were observed, the lowest value occurring among RA patients: (RA x AS: OR = 0.13; CI: 0.03-0.47; χ ² = 12; P = 0.0004) and (RA x PA: OR = 0.16; CI: 0.02-1.04; χ² Yates corrected = 3.6; P = 0.05). The PPD reactivity in the RA subgroup (4%) was also lower as compared with that of the chronic patients group (22%) (OR = 0.16; CI: 0.05-0.49; χ² = 14; P = 0.0002), even when reclassified into four subgroups: rheumatology (OR = 0.19; CI: 0.04-0.72), kidney transplantation (OR = 0.16; CI: 0.05-0.51), infectology (OR = 0.21; CI: 0.05-0.75), and other conditions (OR = 0.13; CI: 0.04-0.44). The low prevalence of PPD reaction in this Brazilian population, mainly in chronic patients, with the worst performance among RA patients, showed that the test has limited value for diagnosis of tuberculosis infection in candidates to infliximab therapy.
Sequence-Selective Formation of Synthetic H-Bonded Duplexes
2017-01-01
Oligomers equipped with a sequence of phenol and pyridine N-oxide groups form duplexes via H-bonding interactions between these recognition units. Reductive amination chemistry was used to synthesize all possible 3-mer sequences: AAA, AAD, ADA, DAA, ADD, DAD, DDA, and DDD. Pairwise interactions between the oligomers were investigated using NMR titration and dilution experiments in toluene. The measured association constants vary by 3 orders of magnitude (102 to 105 M–1). Antiparallel sequence-complementary oligomers generally form more stable complexes than mismatched duplexes. Mismatched duplexes that have an excess of H-bond donors are stabilized by the interaction of two phenol donors with one pyridine N-oxide acceptor. Oligomers that have a H-bond donor and acceptor on the ends of the chain can fold to form intramolecular H-bonds in the free state. The 1,3-folding equilibrium competes with duplex formation and lowers the stability of duplexes involving these sequences. As a result, some of the mismatch duplexes are more stable than some of the sequence-complementary duplexes. However, the most stable mismatch duplexes contain DDD and compete with the most stable sequence-complementary duplex, AAA·DDD, so in mixtures that contain all eight sequences, sequence-complementary duplexes dominate. Even higher fidelity sequence selectivity can be achieved if alternating donor–acceptor sequences are avoided. PMID:28857551
Levett, Kate M; Smith, C A; Bensoussan, A; Dahlen, H G
2016-01-01
Objective To evaluate the effect of an antenatal integrative medicine education programme in addition to usual care for nulliparous women on intrapartum epidural use. Design Open-label, assessor blind, randomised controlled trial. Setting 2 public hospitals in Sydney, Australia. Population 176 nulliparous women with low-risk pregnancies, attending hospital-based antenatal clinics. Methods and intervention The Complementary Therapies for Labour and Birth protocol, based on the She Births and acupressure for labour and birth courses, incorporated 6 evidence-based complementary medicine techniques: acupressure, visualisation and relaxation, breathing, massage, yoga techniques, and facilitated partner support. Randomisation occurred at 24–36 weeks’ gestation, and participants attended a 2-day antenatal education programme plus standard care, or standard care alone. Main outcome measures Rate of analgesic epidural use. Secondary: onset of labour, augmentation, mode of birth, newborn outcomes. Results There was a significant difference in epidural use between the 2 groups: study group (23.9%) standard care (68.7%; risk ratio (RR) 0.37 (95% CI 0.25 to 0.55), p≤0.001). The study group participants reported a reduced rate of augmentation (RR=0.54 (95% CI 0.38 to 0.77), p<0.0001); caesarean section (RR=0.52 (95% CI 0.31 to 0.87), p=0.017); length of second stage (mean difference=−0.32 (95% CI −0.64 to 0.002), p=0.05); any perineal trauma (0.88 (95% CI 0.78 to 0.98), p=0.02) and resuscitation of the newborn (RR=0.47 (95% CI 0.25 to 0.87), p≤0.015). There were no statistically significant differences found in spontaneous onset of labour, pethidine use, rate of postpartum haemorrhage, major perineal trauma (third and fourth degree tears/episiotomy), or admission to special care nursery/neonatal intensive care unit (p=0.25). Conclusions The Complementary Therapies for Labour and Birth study protocol significantly reduced epidural use and caesarean section. This study provides evidence for integrative medicine as an effective adjunct to antenatal education, and contributes to the body of best practice evidence. Trial registration number ACTRN12611001126909. PMID:27406639
Effect of cefodizime and ceftriaxone on phagocytic function in patients with severe infections.
Wenisch, C; Parschalk, B; Hasenhündl, M; Wiesinger, E; Graninger, W
1995-01-01
Thirty patients with severe bacterial infections were treated with 50 mg of cefodizime per kg of body weight once daily or 50 mg of ceftriaxone per kg once daily for 10 +/- 3 days. The effect of cefodizime and ceftriaxone on the phagocytic capacity and generation of reactive oxygen intermediates after phagocytosis by granulocytes was assessed prior to, during, and after therapy. Flow cytometry was used to study phagocytic capacity by measuring the uptake of fluorescein-labeled bacteria. The generation of reactive oxygen intermediates after phagocytosis was estimated by the quantification of the intracellular conversion of dihydrorhodamine 123 to rhodamine 123. Prior to therapy, patients in both groups exhibited a decreased capacity to phagocytize Escherichia coli and subsequently to generate reactive oxygen intermediates. Granulocyte function increased after the initiation of therapy and normalized within 7 days for the ceftriaxone-treated patients and within 3 days for the cefodizime group (P < 0.05). In the cefodizime group, an enhancement of phagocytic capacity was observed 14 days after the initiation of therapy (P < 0.05). Prior to therapy, phagocytic capacity was significantly correlated with the generation of reactive oxygen products (r = 0.674 and P < 0.005). PMID:7793871
Gender Differences in Emotional Reactivity of Depressed and At Risk Preschoolers
Luby, Joan L.; Essex, Marilyn J.; Armstrong, Jeffrey M.; Klein, Marjorie H.; Zahn-Waxler, Carolyn; Sullivan, Jill P.; Goldsmith, H. Hill
2009-01-01
We investigated whether differences in positive and negative emotional reactivity could be found in depressed preschoolers and preschoolers at risk for later internalizing symptoms relative to non-depressed/low risk comparison groups. Observational measures of emotional reactivity, used to derive a score of the balance between anger and sadness, were obtained and analyzed in independent samples. One study utilized cross-sectional data from preschoolers with a current depressive syndrome and two non-depressed comparison groups. The other study utilized longitudinal data that assessed emotional reactivity at preschool age and later mental health symptoms during the transition to primary school, allowing a retrospective determination of risk. Depressed and at risk boys displayed more anger than sadness in contrast to girls in the same groups and in contrast to no disorder/low risk controls. This finding was detected in depressed and “at risk for internalizing” boys who were not comorbid for externalizing problems. The validity of these findings, which are consistent with the developmental and theoretical literature, is enhanced by their emergence in two independent samples. Results suggest possible gender specificity in the manifestations of early onset depression. PMID:20183639
Vaessen, Thomas; Kasanova, Zuzana; Hernaus, Dennis; Lataster, Johan; Collip, Dina; van Nierop, Martine; Myin-Germeys, Inez
2018-06-07
Results from experimental studies suggest that psychosis and psychosis liability are associated with increased cortisol levels and blunted cortisol reactivity, and that use of antipsychotics may reduce these aberrations. Here, we report on overall cortisol, diurnal slope, and cortisol stress reactivity in everyday life in psychosis and psychosis liability using the experience sampling method (ESM). Our sample consisted of individuals diagnosed with psychotic disorder currently on (MPD; n = 53) or off antipsychotic medication (NMPD; n = 20), first-degree relatives of psychotic patients (REL; n = 47), and healthy volunteers (HV; n = 67). Saliva samples were collected throughout the day on six consecutive days and analyzed for cortisol levels. Simultaneously, stressfulness of the current activity was assessed with ESM questionnaires. We found no group differences in overall cortisol level between groups, but REL had a steeper diurnal slope than HV; in MPD a trend was found in the same direction. Regarding reactivity to stressful activities, results indicated attenuation of the cortisol response in both patient groups compared to HV. These results do not confirm reports of increased cortisol levels in psychosis, but provide evidence of stress-related cortisol alterations in everyday life. Copyright © 2018 Elsevier Ltd. All rights reserved.
Kober, Hedy; Brewer, Judson A; Height, Keri L; Sinha, Rajita
2017-05-01
Stress and negative affect are known contributors to drug use and relapse, and several known treatments for addictions include strategies for managing them. In the current study, we administered a well-established stress provocation during functional magnetic resonance imaging (fMRI) to 23 participants who completed either mindfulness training (MT; N=11) or the American Lung Association's Freedom From Smoking (FFS; N=12), which is a cognitive-behavioral treatment (CBT) for smoking cessation. Across the entire sample, we found that stress reactivity in several brain regions including the amygdala and anterior/mid insula was related to reductions in smoking after treatment, as well as at 3-month post-treatment follow-up. Moreover, conjunction analysis revealed that these same regions also differentiated between treatment groups such that the MT group showed lower stress-reactivity compared to the FFS/CBT group. This suggests that reduction in stress reactivity may be one of the mechanisms that underlie the efficacy of MT in reducing smoking over time. The findings have important implications for our understanding of stress, the neural and psychological mechanisms that underlie mindfulness-based treatments, and for smoking cessation treatments more broadly. Copyright © 2016 Elsevier Inc. All rights reserved.
Psychotherapy: The Powerful Placebo.
ERIC Educational Resources Information Center
Wilkins, Wallace
1984-01-01
Discusses research designs in which psychotherapy treatments are compared to placebo conditions, and suggests that chemotherapy and psychotherapy research efforts are complementary rather than analogous. Recommends the elimination of placebo groups in psychotherapy research. Discusses the negative connotation of psychotherapy as a placebo. (JAC)
Dyspnea during Advanced Cancer
... to Cancer Off-Label Drug Use Access to Experimental Drugs Complementary & Alternative Medicine (CAM) CAM for Patients ... pressure on the heart. Treatment may be to control the symptoms of ... vena cava syndrome (SVCS) is a group of signs and symptoms that occur when the ...
Selman, L E; Williams, J; Simms, V
2012-01-01
To inform service provision and future research, we evaluated two complementary therapy services: yoga classes and dance therapy [The Lebed Method (TLM)]. Both were run as 6-week group courses. Patients completed the Measure Yourself Concerns and Wellbeing questionnaire pre- and post-course. Mean change over time was calculated for patient-nominated concern and well-being scores. Qualitative data regarding factors affecting health other than the therapy and benefits of the service were analysed using content analysis. Eighteen patients participated (mean age 63.8 years; 16 female; 14 cancer diagnoses); 10 were doing yoga, five TLM, and three both yoga and TLM; 14 completed more than one assessed course. Patients' most prevalent concerns were: mobility/fitness (n= 20), breathing problems (n= 20), arm, shoulder and neck problems (n= 18), difficulty relaxing (n= 8), back/postural problems (n= 8), fear/anxiety (n= 5). Factors affecting patients' health other than the therapy were prevalent and predominantly negative (e.g. treatment side effects). Patients reported psycho-spiritual, physical and social benefits. Concern scores improved significantly (P < 0.001) for both therapies; improved well-being was clinically significant for yoga. Evaluations of group complementary therapy services are feasible, can be conducted effectively and have implications for future research. Yoga and TLM may be of benefit in this population. © 2011 Blackwell Publishing Ltd.
Jönsson, Tommy; Ahrén, Bo; Pacini, Giovanni; Sundler, Frank; Wierup, Nils; Steen, Stig; Sjöberg, Trygve; Ugander, Martin; Frostegård, Johan; Göransson, Leif; Lindeberg, Staffan
2006-11-02
A Paleolithic diet has been suggested to be more in concordance with human evolutionary legacy than a cereal based diet. This might explain the lower incidence among hunter-gatherers of diseases of affluence such as type 2 diabetes, obesity and cardiovascular disease. The aim of this study was to experimentally study the long-term effect of a Paleolithic diet on risk factors for these diseases in domestic pigs. We examined glucose tolerance, post-challenge insulin response, plasma C-reactive protein and blood pressure after 15 months on Paleolithic diet in comparison with a cereal based swine feed. Upon weaning twenty-four piglets were randomly allocated either to cereal based swine feed (Cereal group) or cereal free Paleolithic diet consisting of vegetables, fruit, meat and a small amount of tubers (Paleolithic group). At 17 months of age an intravenous glucose tolerance test was performed and pancreas specimens were collected for immunohistochemistry. Group comparisons of continuous variables were made by use of the t-test. P < 0.05 was chosen for statistical significance. Simple and multivariate correlations were evaluated by use of linear regression analysis. At the end of the study the Paleolithic group weighed 22% less and had 43% lower subcutaneous fat thickness at mid sternum. No significant difference was seen in fasting glucose between groups. Dynamic insulin sensitivity was significantly higher (p = 0.004) and the insulin response was significantly lower in the Paleolithic group (p = 0.001). The geometric mean of C-reactive protein was 82% lower (p = 0.0007) and intra-arterial diastolic blood pressure was 13% lower in the Paleolithic group (p = 0.007). In evaluations of multivariate correlations, diet emerged as the strongest explanatory variable for the variations in dynamic insulin sensitivity, insulin response, C-reactive protein and diastolic blood pressure when compared to other relevant variables such as weight and subcutaneous fat thickness at mid sternum. There was no obvious immunohistochemical difference in pancreatic islets between the groups, but leukocytes were clearly more frequent in sampled pancreas from the Cereal group. This study in domestic pigs suggests that a Paleolithic diet conferred higher insulin sensitivity, lower C-reactive protein and lower blood pressure when compared to a cereal based diet.
Jönsson, Tommy; Ahrén, Bo; Pacini, Giovanni; Sundler, Frank; Wierup, Nils; Steen, Stig; Sjöberg, Trygve; Ugander, Martin; Frostegård, Johan; Göransson, Leif; Lindeberg, Staffan
2006-01-01
Background A Paleolithic diet has been suggested to be more in concordance with human evolutionary legacy than a cereal based diet. This might explain the lower incidence among hunter-gatherers of diseases of affluence such as type 2 diabetes, obesity and cardiovascular disease. The aim of this study was to experimentally study the long-term effect of a Paleolithic diet on risk factors for these diseases in domestic pigs. We examined glucose tolerance, post-challenge insulin response, plasma C-reactive protein and blood pressure after 15 months on Paleolithic diet in comparison with a cereal based swine feed. Methods Upon weaning twenty-four piglets were randomly allocated either to cereal based swine feed (Cereal group) or cereal free Paleolithic diet consisting of vegetables, fruit, meat and a small amount of tubers (Paleolithic group). At 17 months of age an intravenous glucose tolerance test was performed and pancreas specimens were collected for immunohistochemistry. Group comparisons of continuous variables were made by use of the t-test. P < 0.05 was chosen for statistical significance. Simple and multivariate correlations were evaluated by use of linear regression analysis. Results At the end of the study the Paleolithic group weighed 22% less and had 43% lower subcutaneous fat thickness at mid sternum. No significant difference was seen in fasting glucose between groups. Dynamic insulin sensitivity was significantly higher (p = 0.004) and the insulin response was significantly lower in the Paleolithic group (p = 0.001). The geometric mean of C-reactive protein was 82% lower (p = 0.0007) and intra-arterial diastolic blood pressure was 13% lower in the Paleolithic group (p = 0.007). In evaluations of multivariate correlations, diet emerged as the strongest explanatory variable for the variations in dynamic insulin sensitivity, insulin response, C-reactive protein and diastolic blood pressure when compared to other relevant variables such as weight and subcutaneous fat thickness at mid sternum. There was no obvious immunohistochemical difference in pancreatic islets between the groups, but leukocytes were clearly more frequent in sampled pancreas from the Cereal group. Conclusion This study in domestic pigs suggests that a Paleolithic diet conferred higher insulin sensitivity, lower C-reactive protein and lower blood pressure when compared to a cereal based diet. PMID:17081292
Stephenson, Kevin B; Agapova, Sophia E; Divala, Oscar; Kaimila, Yankho; Maleta, Kenneth M; Thakwalakwa, Chrissie; Ordiz, M Isabel; Trehan, Indi; Manary, Mark J
2017-12-01
Background: Growth faltering is common in rural African children and is attributed to inadequate dietary intake and environmental enteric dysfunction (EED). Objective: We tested the hypothesis that complementary feeding with cowpea or common bean flour would reduce growth faltering and EED in 6-mo-old rural Malawians compared with the control group receiving a corn-soy blend. Design: A prospective, double-blind, randomized controlled clinical trial was conducted in which children received daily feeding for 6 mo (200 kcal/d when 6-9 mo old and 300 kcal/d when 10-12 mo old). The primary outcomes were change in length-for-age z score (LAZ) and improvements in EED, as measured by percentage of lactulose excretion (%L). %L <0.2% was considered normal. Anthropometric measurements and %L through urine were compared between each legume group and the control group with Student's t test. Results: Of the 355 infants enrolled, 291 infants completed the trial, and 288 were breastfed throughout the duration of the study. Cowpea and common bean added 4.6-5.2 g protein/d and 4-5 g indigestible carbohydrate/d to the diet. LAZ and weight-for-height z score were reduced in all 3 groups from 6 to 12 mo of age. The changes in LAZ [mean (95% CI)] for the cowpea, common bean, and control groups from 6 to 9 mo were -0.14 (-0.24, -0.04), -0.27 (-0.38, -0.16), and -0.27 (-0.35, -0.19), respectively. LAZ was reduced less in infants receiving cowpea than in those receiving control food from 6 to 9 mo ( P = 0.048). The absolute value of %L did not differ between the dietary groups at 9 mo of age (mean ± SD: 0.30 ± 0.43, 0.23 ± 0.21, and 0.26 ± 0.31 for cowpea, common bean, and control, respectively), nor did the change in %L from 6 to 9 mo. Conclusion: Addition of cowpea to complementary feeding in Malawian infants resulted in less linear growth faltering. This trial was registered at clinicaltrials.gov as NCT02472262. © 2017 American Society for Nutrition.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Myneni, Satish C. B.; Fein, Jeremy; Mishra, Bhoopesh
Bacteria are ubiquitous in a wide-range of low temperature aqueous systems, and can strongly affect the distribution and transport of metals and radionuclides in the environment. However, the role of metal adsorption onto bacteria, via the reactive cell wall functional groups, has been largely overlooked. Previous macroscale metal sorption, and XAS studies have shown that carboxyl and phosphoryl functional groups to be the important metal binding groups on bacterial cell walls and the sulfhydryl groups were not considered. The goal of our investigation was to evaluate the density of the sulfhydryl sites on different bacterial cell membranes that are commonmore » to soil systems, the binding affinities of these reactive groups towards Hg, and how this binding modifies the speciation of Hg in the natural waters.« less
Global tropospheric hydroxyl distribution, budget and reactivity
NASA Astrophysics Data System (ADS)
Lelieveld, Jos; Gromov, Sergey; Pozzer, Andrea; Taraborrelli, Domenico
2016-10-01
The self-cleaning or oxidation capacity of the atmosphere is principally controlled by hydroxyl (OH) radicals in the troposphere. Hydroxyl has primary (P) and secondary (S) sources, the former mainly through the photodissociation of ozone, the latter through OH recycling in radical reaction chains. We used the recent Mainz Organics Mechanism (MOM) to advance volatile organic carbon (VOC) chemistry in the general circulation model EMAC (ECHAM/MESSy Atmospheric Chemistry) and show that S is larger than previously assumed. By including emissions of a large number of primary VOC, and accounting for their complete breakdown and intermediate products, MOM is mass-conserving and calculates substantially higher OH reactivity from VOC oxidation compared to predecessor models. Whereas previously P and S were found to be of similar magnitude, the present work indicates that S may be twice as large, mostly due to OH recycling in the free troposphere. Further, we find that nighttime OH formation may be significant in the polluted subtropical boundary layer in summer. With a mean OH recycling probability of about 67 %, global OH is buffered and not sensitive to perturbations by natural or anthropogenic emission changes. Complementary primary and secondary OH formation mechanisms in pristine and polluted environments in the continental and marine troposphere, connected through long-range transport of O3, can maintain stable global OH levels.
Taylor, Martin J; Jiang, Li; Reichert, Joachim; Papageorgiou, Anthoula C; Beaumont, Simon K; Wilson, Karen; Lee, Adam F; Barth, Johannes V; Kyriakou, Georgios
2017-04-20
Furfural is a key bioderived platform chemical whose reactivity under hydrogen atmospheres affords diverse chemical intermediates. Here, temperature-programmed reaction spectrometry and complementary scanning tunneling microscopy (STM) are employed to investigate furfural adsorption and reactivity over a Pt(111) model catalyst. Furfural decarbonylation to furan is highly sensitive to reaction conditions, in particular, surface crowding and associated changes in the adsorption geometry: furfural adopts a planar geometry on clean Pt(111) at low coverage, tilting at higher coverage to form a densely packed furfural adlayer. This switch in adsorption geometry strongly influences product selectivity. STM reveals the formation of hydrogen-bonded networks for planar furfural, which favor decarbonylation on clean Pt(111) and hydrogenolysis in the presence of coadsorbed hydrogen. Preadsorbed hydrogen promotes furfural hydrogenation to furfuryl alcohol and its subsequent hydrogenolysis to methyl furan, while suppressing residual surface carbon. Furfural chemistry over Pt is markedly different from that over Pd, with weaker adsorption over the former affording a simpler product distribution than the latter; Pd catalyzes a wider range of chemistry, including ring-opening to form propene. Insight into the role of molecular orientation in controlling product selectivity will guide the design and operation of more selective and stable Pt catalysts for furfural hydrogenation.
Estradiol and Inflammatory Markers in Older Men
Maggio, Marcello; Ceda, Gian Paolo; Lauretani, Fulvio; Bandinelli, Stefania; Metter, E. Jeffrey; Artoni, Andrea; Gatti, Elisa; Ruggiero, Carmelinda; Guralnik, Jack M.; Valenti, Giorgio; Ling, Shari M.; Basaria, Shehzad; Ferrucci, Luigi
2009-01-01
Background: Aging is characterized by a mild proinflammatory state. In older men, low testosterone levels have been associated with increasing levels of proinflammatory cytokines. It is still unclear whether estradiol (E2), which generally has biological activities complementary to testosterone, affects inflammation. Methods: We analyzed data obtained from 399 men aged 65–95 yr enrolled in the Invecchiare in Chianti study with complete data on body mass index (BMI), serum E2, testosterone, IL-6, soluble IL-6 receptor, TNF-α, IL-1 receptor antagonist, and C-reactive protein. The relationship between E2 and inflammatory markers was examined using multivariate linear models adjusted for age, BMI, smoking, physical activity, chronic disease, and total testosterone. Results: In age-adjusted analysis, log (E2) was positively associated with log (IL-6) (r = 0.19; P = 0.047), and the relationship was statistically significant (P = 0.032) after adjustments for age, BMI, smoking, physical activity, chronic disease, and serum testosterone levels. Log (E2) was not significantly associated with log (C-reactive protein), log (soluble IL-6 receptor), or log (TNF-α) in both age-adjusted and fully adjusted analyses. Conclusions: In older men, E2 is weakly positively associated with IL-6, independent of testosterone and other confounders including BMI. PMID:19050054
2017-01-01
Furfural is a key bioderived platform chemical whose reactivity under hydrogen atmospheres affords diverse chemical intermediates. Here, temperature-programmed reaction spectrometry and complementary scanning tunneling microscopy (STM) are employed to investigate furfural adsorption and reactivity over a Pt(111) model catalyst. Furfural decarbonylation to furan is highly sensitive to reaction conditions, in particular, surface crowding and associated changes in the adsorption geometry: furfural adopts a planar geometry on clean Pt(111) at low coverage, tilting at higher coverage to form a densely packed furfural adlayer. This switch in adsorption geometry strongly influences product selectivity. STM reveals the formation of hydrogen-bonded networks for planar furfural, which favor decarbonylation on clean Pt(111) and hydrogenolysis in the presence of coadsorbed hydrogen. Preadsorbed hydrogen promotes furfural hydrogenation to furfuryl alcohol and its subsequent hydrogenolysis to methyl furan, while suppressing residual surface carbon. Furfural chemistry over Pt is markedly different from that over Pd, with weaker adsorption over the former affording a simpler product distribution than the latter; Pd catalyzes a wider range of chemistry, including ring-opening to form propene. Insight into the role of molecular orientation in controlling product selectivity will guide the design and operation of more selective and stable Pt catalysts for furfural hydrogenation. PMID:29225721
Hybrid inverter for HVDC/weak AC system interconnection
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tam, K.S.
1985-01-01
The concept of the hybrid converter is introduced. By independently controlling a naturally commutated converter (NCC) and an artificially commutated converter (ACC), real power and reactive power can be controlled independently. Alternatively, the ac bus voltage can be regulated without affecting the real power transfer. Independent control is feasible only within certain operating boundaries. Twelve pulse operation, sequential control, and complementary circuits may be viewed as variations of the hybrid converter. The concept of the hybrid converter is demonstrated by digital simulation. At the current state of technology, the NCC is best implemented by a 6-pulse bridge using thyristors asmore » the switching elements. A survey of power electronics applicable to HVDC applications reveals that the capacitively commutated current-sourced converters are either technically or economically better than the other alternatives for the implementation of the ACC. The digital simulation results show that the problems of operating an HVDC system into a weak ac system can be solved by using a hybrid inverter. A new control scheme, the zero Q control, is developed. With no reactive power interaction between the dc system and the ac system, the stability of the HVDC/weak ac system operation is significantly improved. System start-up and fault recovery is fast and stable.« less
Johnson, Grant E.; Gunaratne, K. Don Dasitha; Laskin, Julia
2014-01-01
Soft landing of mass-selected ions onto surfaces is a powerful approach for the highly-controlled preparation of materials that are inaccessible using conventional synthesis techniques. Coupling soft landing with in situ characterization using secondary ion mass spectrometry (SIMS) and infrared reflection absorption spectroscopy (IRRAS) enables analysis of well-defined surfaces under clean vacuum conditions. The capabilities of three soft-landing instruments constructed in our laboratory are illustrated for the representative system of surface-bound organometallics prepared by soft landing of mass-selected ruthenium tris(bipyridine) dications, [Ru(bpy)3]2+ (bpy = bipyridine), onto carboxylic acid terminated self-assembled monolayer surfaces on gold (COOH-SAMs). In situ time-of-flight (TOF)-SIMS provides insight into the reactivity of the soft-landed ions. In addition, the kinetics of charge reduction, neutralization and desorption occurring on the COOH-SAM both during and after ion soft landing are studied using in situ Fourier transform ion cyclotron resonance (FT-ICR)-SIMS measurements. In situ IRRAS experiments provide insight into how the structure of organic ligands surrounding metal centers is perturbed through immobilization of organometallic ions on COOH-SAM surfaces by soft landing. Collectively, the three instruments provide complementary information about the chemical composition, reactivity and structure of well-defined species supported on surfaces. PMID:24961913
Patterning of supported gold monolayers via chemical lift-off lithography
Slaughter, Liane S; Cheung, Kevin M; Kaappa, Sami; Cao, Huan H; Yang, Qing; Young, Thomas D; Serino, Andrew C; Malola, Sami; Olson, Jana M; Link, Stephan
2017-01-01
The supported monolayer of Au that accompanies alkanethiolate molecules removed by polymer stamps during chemical lift-off lithography is a scarcely studied hybrid material. We show that these Au–alkanethiolate layers on poly(dimethylsiloxane) (PDMS) are transparent, functional, hybrid interfaces that can be patterned over nanometer, micrometer, and millimeter length scales. Unlike other ultrathin Au films and nanoparticles, lifted-off Au–alkanethiolate thin films lack a measurable optical signature. We therefore devised fabrication, characterization, and simulation strategies by which to interrogate the nanoscale structure, chemical functionality, stoichiometry, and spectral signature of the supported Au–thiolate layers. The patterning of these layers laterally encodes their functionality, as demonstrated by a fluorescence-based approach that relies on dye-labeled complementary DNA hybridization. Supported thin Au films can be patterned via features on PDMS stamps (controlled contact), using patterned Au substrates prior to lift-off (e.g., selective wet etching), or by patterning alkanethiols on Au substrates to be reactive in selected regions but not others (controlled reactivity). In all cases, the regions containing Au–alkanethiolate layers have a sub-nanometer apparent height, which was found to be consistent with molecular dynamics simulations that predicted the removal of no more than 1.5 Au atoms per thiol, thus presenting a monolayer-like structure. PMID:29259879
Gibson, Rosalind S; Abebe, Yewelsew; Hambidge, K Michael; Arbide, Isabel; Teshome, Aklilu; Stoecker, Barbara J
2009-07-01
Whether current child feeding practices and behaviours among rural households in Sidama, Southern Ethiopia conform to the World Health Organization (WHO) guiding principles for complementary feeding is uncertain. We assessed socio-demographic status, anthropometry, breastfeeding, complementary feeding practices and behaviours, and motor development milestones in a convenience sample of 97 breastfed children aged 6-23 months from three rural Sidama communities. Energy and nutrient intakes from complementary foods were also calculated from 1-day in-home weighed records. Prevalence of stunting ranged from 25% for infants aged 6-8 months to 52% for children aged 12-23 months, whereas for wasting, the corresponding prevalence was 10% and 14%, respectively. Very few children were exclusively breastfed up to 6 months of age (n = 2), or received solids/semi-solids for the recommended minimum number of times containing the recommended number of food groups. Responsive feeding was not practised and no cellular animal products were consumed. Median intakes of energy, and intakes and densities of micronutrients from complementary foods (but not protein) were below WHO recommendations, assuming average breast milk intakes; greatest shortfalls were for retinol, vitamin C and calcium densities. Mothers of stunted children were shorter and lighter, and from households of lower socio-economic status than non-stunted children (P < 0.05). Acquisition of some motor development milestones was delayed in stunted infants compared with their non-stunted counter-parts. In conclusion, interventions that address the WHO guiding principles for complementary feeding practices and behaviours, as well as prenatal influences on growth, are urgently required in this setting.
Hamilton, Jill B; Worthy, Valarie C; Kurtz, Melissa J; Cudjoe, Joycelyn; Johnstone, Peter A
Acupuncture, acupressure, yoga, meditation, cognitive-behavioral techniques, and, to a lesser extent, music are among those integrative and complementary therapies with known beneficial effects on psychological symptoms. However, noticeably absent from this research is the use of religious song as a type of integrative and complementary therapy. The aim of this study was to explore how religious songs were used to alleviate psychological symptoms associated with a cancer diagnosis among a sample of older African American cancer survivors. Thirty-one older African American cancer survivors residing in the Southeastern US participated in a qualitative descriptive study involving criterion sampling, open-ended semistructured interviews, and qualitative content analysis. Participants used religious songs in response to feeling depressed, low, or sad; feeling weak and seeking strength to endure treatment; and feeling worried, anxious, or fearful. Religious songs were also a source of support and hope. Types of religious songs included instructive, thanksgiving and praise, memory of forefathers, communication with God, and life after death. Religious songs appear to be an important form of religious expression in this population and used to manage psychological symptoms. Integrative and complementary oncology therapy has generally focused on yoga, meditation, acupuncture, and cognitive-behavioral techniques. However, religious songs are an important strategy used among older African American cancer patients. Religious songs can be readily integrated into cancer care. The incorporation of religious songs into spiritually based support groups and other integrative and complementary therapies might enhance health outcomes among this medically underserved cancer population.
Evaluation of mast cell counts and microvessel density in reactive lesions of the oral cavity.
Kouhsoltani, Maryam; Moradzadeh Khiavi, Monir; Tahamtan, Shabnam
2016-01-01
Background. Reliable immunohistochemical assays to assess the definitive role of mast cells (MCs) and angiogenesis in the pathogenesis of oral reactive lesions are generally not available. The aim of the present study was to evaluate mast cell counts (MCC) and microvessel density (MVD) in oral reactive lesions and determine the correlation between MCC and MVD. Methods. Seventy-five cases of reactive lesions of the oral cavity, including pyogenic granuloma, fibroma, peripheral giant cell granuloma, inflammatory fibrous hyperplasia, peripheral ossifying fibroma (15 for each category) were immunohisto-chemically stained with MC tryptase and CD31. Fifteen cases of normal gingival tissue were considered as the control group. The mean MCC and MVD in superficial and deep connective tissues were assessed and total MCC and MVD was computed for each lesion. Results . Statistically significant differences were observed in MCC and MVD between the study groups (P < 0.001). MC tryptase and CD31 expression increased in the superficial connective tissue of each lesion in comparison to the deep con-nective tissue. A significant negative correlation was not found between MCC and MVD in oral reactive lesions (P < 0.001, r = -0.458). Conclusion. Although MCs were present in the reactive lesions of the oral cavity, a direct correlation between MCC and MVD was not found in these lesions. Therefore, a significant interaction between MCs and endothelial cells and an active role for MCs in the growth of oral reactive lesions was not found in this study.
A Spectrum of Monoclonal Antibodies Reactive with Human Mammary Tumor Cells
NASA Astrophysics Data System (ADS)
Colcher, D.; Horan Hand, P.; Nuti, M.; Schlom, J.
1981-05-01
Splenic lymphocytes of mice, immunized with membrane-enriched fractions of metastatic human mammary carcinoma tissues, were fused with the NS-1 non-immunoglobulin-secreting murine myeloma cell line. This resulted in the generation of hybridoma cultures secreting immunoglobulins reactive in solid-phase radioimmunoassays with extracts of metastatic mammary carcinoma cells from involved livers, but not with extracts of apparently normal human liver. As a result of further screening of immunoglobulin reactivities and double cloning of cultures, 11 monoclonal antibodies were chosen that demonstrated reactivities with human mammary tumor cells and not with apparently normal human tissues. These monoclonal antibodies could be placed into at least five major groups on the basis of their differential binding to the surface of various live human mammary tumor cells in culture, to extracts of mammary tumor tissues, or to tissue sections of mammary tumor cells studied by the immunoperoxidase technique. Whereas a spectrum of reactivities to mammary tumors was observed with the 11 monoclonal antibodies, no reactivity was observed to apparently normal cells of the following human tissues: breast, lymph node, lung, skin, testis, kidney, thymus, bone marrow, spleen, uterus, thyroid, intestine, liver, bladder, tonsils, stomach, prostate, and salivary gland. Several of the antibodies also demonstrated a ``pancarcinoma'' reactivity, showing binding to selected non-breast carcinomas. None of the monoclonal antibodies showed binding to purified ferritin or carcinoembryonic antigen. Monoclonal antibodies of all five major groups, however, demonstrated binding to human metastatic mammary carcinoma cells both in axillary lymph nodes and at distal sites.
Wenisch, C; Bartunek, A; Zedtwitz-Liebenstein, K; Hiesmayr, M; Parschalk, B; Pernerstorfer, T; Graninger, W
1997-01-01
The effects of cefodizime and cefuroxime on neutrophil phagocytosis and reactive oxygen production in 54 patients undergoing elective coronary artery bypass grafting were studied. Both drugs were administered twice at a dosage of 40 mg/kg of body weight (pre- and intraoperative). Phagocytic capacity was assessed by measuring the uptake of fluorescein isothiocyanate-labeled Escherichia coli and Staphylococcus aureus by flow cytometry. Reactive oxygen generation after phagocytosis was estimated by determining the amount of dihydrorhodamine 123 converted to rhodamine 123 intracellularly. In both groups the mean phagocytic ability for E. coli and S. aureus decreased during surgery (-21 and -8%, respectively, for the cefodizime group and -39 and -38%, respectively, for the cefuroxime group; P < 0.05 for all). In the cefodizime group a normalization of mean E. coli and S. aureus neutrophil phagocytosis was seen on day 5 (+9 and -4% compared to preoperative values; P > 0.35 for both), whereas in cefuroxime-treated patients phagocytic ability remained depressed (-37 and -31%; P < 0.04 for both). In both groups mean neutrophil reactive oxygen intermediate (ROI) production after E. coli and S. aureus phagocytosis increased during cardiopulmonary bypass (+44 and +83%, respectively, in the cefodizime group and +58 and +73%, respectively, in the cefuroxime group; P < 0.05 for all). One day after surgery E. coli- and S. aureus-driven neutrophil ROI production was not different from the preoperative values (-2 and +12%, respectively, for the cefodizime group and +7 and +15%, respectively, for the cefuroxime group; P > 0.15 for all). Postoperative serum levels of the C-reactive protein on days 2 and 7 were lower in cefodizime-treated patients (19 +/- 6 and 4 +/- 2 mg/liter versus 23 +/- 6 and 11 +/- 5 mg/liter; P < 0.05 for both). In addition to cefodizime's antimicrobial activity during perioperative prophylaxis, its use in coronary artery bypass grafting can prevent procedure-related prolonged postoperative neutrophil phagocytosis impairment. PMID:9210690
Daily life stress reactivity in remitted versus non-remitted depressed individuals.
van Winkel, M; Nicolson, N A; Wichers, M; Viechtbauer, W; Myin-Germeys, I; Peeters, F
2015-06-01
Little is known about how daily life mood reactivity to minor stressors (stress reactivity) might change following major depressive disorder (MDD) treatment. We investigate whether (i) mood states and appraisals of daily stressors change after treatment; (ii) stress reactivity to event, activity, or social stress differs; (iii) stress reactivity depends on severity of residual depressive symptoms; and (iv) stress reactivity in individuals with remitted or non-remitted depression differ from that of never-depressed individuals. Thirty depressed individuals participated in an experience sampling study before and after a treatment period of 18 months; 39 healthy individuals formed a comparison group. Reactivity of positive affect (PA) and negative affect (NA) to daily stressors were measured. More residual symptoms were associated with larger NA responses to stress. Compared to healthy controls, participants with non-remitted MDD showed higher NA-reactivity to all stressors. In contrast, stress reactivity to event and activity stressors was normalized in remitted patients. However, they still showed heightened NA-reactivity to social stress. Greater stress reactivity to event and activity stress appears to be state-dependent. The heightened social stress reactivity in remitted patients suggests that sensitivity to social stress may reflect an underlying vulnerability in MDD. Copyright © 2015 Elsevier Masson SAS. All rights reserved.
Cook, Ronald Lee; Elliott, Brian John; Luebben, Silvia DeVito; Myers, Andrew William; Smith, Bryan Matthew
2005-05-03
A new class of surface modified particles and a multi-step Michael-type addition surface modification process for the preparation of the same is provided. The multi-step Michael-type addition surface modification process involves two or more reactions to compatibilize particles with various host systems and/or to provide the particles with particular chemical reactivities. The initial step comprises the attachment of a small organic compound to the surface of the inorganic particle. The subsequent steps attach additional compounds to the previously attached organic compounds through reactive organic linking groups. Specifically, these reactive groups are activated carbon—carbon pi bonds and carbon and non-carbon nucleophiles that react via Michael or Michael-type additions.
Silicone-containing composition
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mohamed, Mustafa
A silicone-containing composition comprises the reaction product of a first component and an excess of an isocyanate component relative to the first component to form an isocyanated intermediary. The first component is selected from one of a polysiloxane and a silicone resin. The first component includes a carbon-bonded functional group selected from one of a hydroxyl group and an amine group. The isocyanate component is reactive with the carbon-bonded functional group of the first component. The isocyanated intermediary includes a plurality of isocyanate functional groups. The silicone-containing composition comprises the further reaction product of a second component, which is selectedmore » from the other of the polysiloxane and the silicone resin. The second component includes a plurality of carbon-bonded functional groups reactive with the isocyanate functional groups of the isocyanated intermediary for preparing the silicone-containing composition.« less
Lanthanide alkyl and silyl compounds: Synthesis, reactivity and catalysts for green
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pindwal, Aradhana
2016-01-01
The last few decades have witnessed enormous research in the field of organometallic lanthanide chemistry. Our research group has developed a few rare earth alkyl compounds containing tris(dimethylsilyl)methyl ligand and explored their reactivity. This thesis focusses on extending the study of lanthanide alkyl and silyl compounds to develop strategies for their synthesis and explore their reactivity and role as catalysts in processes such as hydrosilylation and cross-dehydrocoupling.
Stub, Trine; Foss, Nina; Liodden, Ingrid
2017-05-12
Complementary therapists spend considerable time with their patients, especially in the first consultation. The communication between patients and their therapists is important for raising consciousness and activation of the patient's self-healing power. Thus, the aims in this study were to delineate what complementary therapists regard as essential in patient consultations, their view of the healing process, and how the therapists understand the placebo effect and its position in the healing process. Semi-structured individual interviews (n = 4), focus group interview (n = 1) and participant observation were conducted among four different complementary therapists in a Norwegian community. The text data was transcribed verbatim and the analysis of the material was conducted according to conventional and direct content analysis. Some codes were predefined and others were defined during the analysis. The pilot study showed that the implemented methods seems feasible and fit well with the aims of this study. Complementary therapists (chiropractor, naprapath (musculoskeletal therapist), acupuncturist and acupuncturist/homeopath) representing four different complementary modalities participated. A combination of the conversation and examination during the first consultation formed the basis for the therapist's choice of treatment. A successful consultation was characterized by a fruitful relationship between the therapist and the patient. Moreover, the therapist needs to be humble and show the patient respect. Patients' positive beliefs and expectations about the treatment play a significant role in the healing process. The more hope the therapist can bring about, the more easily the patient can start believing that it is possible to get well. This was a pilot study. Therefore the findings should be appreciated as limited and preliminary. Therapists' and patients' mutual understanding and treatment goals were essential for a successful consultation. The therapists emphasized their professional skills and therapeutic competence as important when building fruitful relationships with their patients. Exerting authority and making the patient feel confident were essential factors for a successful healing process. The complementary therapists understood the placebo effect as the patient's self-healing power, resulting from establishing trust and belief in the treatment process.
Hernandez-Suarez, Dagmar F; Núñez-Medina, Hector; Scott, Stuart A; Lopez-Candales, Angel; Wiley, Jose M; Garcia, Mario J; Melin, Kyle; Nieves-Borrero, Karid; Rodriguez-Ruiz, Christina; Marshall, Lorraine; Duconge, Jorge
2018-03-28
Antiplatelet therapy with clopidogrel is recommended to reduce cardiovascular events in patients with peripheral artery disease (PAD); however, clopidogrel efficacy has not been adequately studied in this patient population. Therefore, we aimed to determine the effects of cilostazol therapy on platelet reactivity among PAD patients on clopidogrel. We performed a cross-sectional pilot study of 46 Puerto Rican patients diagnosed with PAD. The cohort was divided based on use of clopidogrel and cilostazol (n=24) or clopidogrel alone (n=22). Platelet function was measured ex vivo using the VerifyNow P2Y12 assay. Genomic DNA was extracted from peripheral blood samples using the QIAamp DNA Blood Midi Kit, which was subjected to candidate variant genotyping (CYP2C19, ABCB1, PON1 and P2RY12) using TaqMan quantitative polymerase chain reaction assays. All analyses were performed using SAS version 9.4 (SAS Institute). Among all enrolled patients, 18 (39%) had high on-treatment platelet reactivity (HTPR). The mean platelet reactivity was 207±53 (range, 78-325) with higher P2Y12 reaction units in the non-cilostazol group, 224±45 vs. 191±55 on the cilostazol group (p=0.03). No significant differences were observed in the clinical or genetic variables between the two groups. A multiple regression analysis determined that history of diabetes mellitus (p=0.03), use of cilostazol (p=0.03) and hematocrit (p=0.02) were independent predictors of platelet reactivity. In Puerto Rican PAD patients on clopidogrel therapy, history of diabetes mellitus, use of cilostazol and hematocrit are independent predictors of platelet reactivity. Adjunctive cilostazol therapy may enhance clopidogrel efficacy among PAD patients with HTPR.
Inverse relationship between erythrocyte size and platelet reactivity in elderly.
Milovanovic, M; Nilsson, S; Winblad, B; Jelic, V; Behbahani, H; Shahnaz, T; Oweling, M; Järemo, P
2017-03-01
Previous work indicates that erythrocytes (RBCs) accumulate β-amyloid X-40 (Aβ 40 ) in individuals with Alzheimer disease (AD) and to a lesser extent in healthy elderly. The toxin damages RBCs and increases their mean corpuscular volume (MCV). Furthermore, AD platelets demonstrate lower reactivity. This study investigated interactions between RBCs and platelets. Older individuals with moderate hypertension (n = 57) were classified into two groups, depending on MCV in whole blood: The MCV high group comprised individuals with higher MCV (n = 27; 97 ± 3(SD) fl) and MCV low group had relatively lower MCV (n = 30; 90 ± 3(SD) fl). Flow cytometry was used to determine platelet reactivity, i.e., the surface binding of fibrinogen after provocation. Adenosine diphosphate (ADP) and a thrombin receptor-activating protein (TRAP-6) were used as agonists. Subsequently, blood cells were divided according to density into 17 subfractions. Intra-RBC Aβ 40 content was analyzed and in all platelet populations surface-bound fibrinogen was determined to estimate platelet in vivo activity. We found Aβ 40 inside RBCs of approximately 50% of participants, but the toxin did not affect MCV and platelet reactivity. In contrast, MCV associated inversely with platelet reactivity as judged from surface-attached fibrinogen after ADP (1.7 μmol/L) (p < 0.05) and TRAP-6 provocation (57 μmol/L (p = 0.01) and 74 μmol/L (p < 0.05)). In several density fractions (nos. 3, 4, 8, 11-13 (p < 0.05) and nos. 5-7 (p < 0.01)) MCV linked inversely with platelet-attached fibrinogen. In our community-dwelling sample, enhanced MCV associated with decreased platelet reactivity and lower in vivo platelet activity. It resembles RBCs and platelet behavior in AD-type dementia.
Liu, Qi-Kui; Ma, Jian-Ping; Dong, Yu-Bin
2010-05-26
A series of reactive group functionalized aromatics, namely 2-furaldehyde, 3-furaldehyde, 2-thenaldehyde, 3-thenaldehyde, o-toluidine, m-toluidine, p-toluidine, and aniline, can be absorbed by a CdL(2) (1; L = 4-amino-3,5-bis(4-pyridyl-3-phenyl)-1,2,4-triazole) porous framework in both vapor and liquid phases to generate new G(n) [symbol: see text] CdL(2) (n = 1, 2) host-guest complexes. In addition, the CdL(2) framework can be a shield to protect the active functional group (-CHO and -NH(2)) substituted guests from reaction with the outside medium containing their reaction partners. That is, aldehyde-substituted guests within the CdL(2) host become "stable" in the aniline phase and vice versa. Moreover, 1 displays a very strict selectivity for these reactive group substituted aromatic isomers and can completely separate these guest isomers under mild conditions (i.e., 2-furaldehyde vs 3-furaldehyde, 2-thenaldehyde vs 3-thenaldehyde, and o-toluidine vs m-toluidine vs p-toluidine). All adsorptions and separations are directly performed on the single crystals of 1. More interestingly, these reactive group substituted aromatics readily transform to the corresponding radicals within the CdL(2) host upon ambient light or UV light (355 nm) irradiation. Furthermore, the generated organic radicals are alive for 1 month within the interior cavity in air under ambient conditions. Simple organic radicals are highly reactive short-lived species, and they cannot be generally isolated and conserved under ambient conditions. Thus, the CdL(2) host herein could be considered as a radical generator and storage vessel.
Stress disrupts the reconsolidation of fear memories in men.
Meir Drexler, Shira; Wolf, Oliver T
2017-03-01
Reconsolidation is a post-retrieval process of restabilization of the memory trace. Previous findings from our group suggest that cortisol, a glucocorticoid hormone secreted in response to stress, enhances the reconsolidation of fear memories in healthy men. Cortisol effect was found to be very specific, enhancing only the fear memory that was reactivated (i.e. retrieved), but not the non-reactivated memory. In the current study we aimed to investigate the effects of psychosocial stress, a more ecologically valid intervention, on fear memory reconsolidation in men. Using a similar design, we expected stress induction to have comparable effects to those of cortisol intake. During the three testing days, the participants went through (1) fear acquisition, (2) stress induction and memory reactivation (or the corresponding control conditions), (3) fear extinction, reinstatement and reinstatement test. Salivary cortisol, blood pressure measures and subjective ratings confirmed the success of the stress induction. Skin conductance response, serving as a measure of conditioned fear, confirmed acquisition, fear retrieval, and extinction in all groups. In the three control groups (where either reactivation, stress, or both components were missing) reinstatement effects were seen as expected. Yet in contrast to the hypothesis, the target group (i.e. combining reactivation and stress) showed no reinstatement to any of the stimuli. Stress induction is thus suggested to have a general impairing effect on the reconsolidation of fear memories. The unique characteristic of the stress response and experience compared to a pharmacological intervention are proposed as possible explanations to the findings. This disruptive effect of stress on fear memory reconsolidation may have potential therapeutic implications. Copyright © 2016 Elsevier Ltd. All rights reserved.
Stupin, Ana; Rasic, Lidija; Matic, Anita; Stupin, Marko; Kralik, Zlata; Kralik, Gordana; Grcevic, Manuela; Drenjancevic, Ines
2018-04-10
Whilst the beneficial effect of omega-3 polyunsaturated fatty acids (PUFAs) supplementation on cardiovascular (CV) system is well supported in CV patients, the effect of consumption of omega-3 PUFAs enriched functional food in healthy individuals is still not fully elucidated. This study aimed to determine the effect of consumption of omega-3 PUFAs enriched hen eggs on microvascular reactivity (primary outcome), blood pressure (BP) and serum lipid profile in young healthy individuals. Control group (N=16) ate three ordinary hen eggs (277 mg omega-3 PUFAs/day), and OMEGA-3 group (N=20) ate three omega-3 PUFAs enriched eggs containing 259 mg of omega-3 PUFAs/egg daily (ALA 167 mg/egg, EPA 7 mg/egg, DHA 84 mg/egg) for 3 weeks (777 mg omega-3 PUFAs/day). Post-occlusive reactive hyperemia (PORH) in skin microcirculation assessed by laser Doppler flowmetry, serum lipid profile, fasting blood glucose, high-sensitivity C-reactive protein (hsCRP) and arterial BP were measured in all subjects before and after the protocol. PORH was significantly enhanced, and triglycerides, hsCRP and BP were significantly decreased in OMEGA-3 group compared to baseline measurement, while there was no significant difference in Control group after the protocol compared to baseline. This is the first study to demonstrate that consumption of a mixture of omega-3 PUFAs (ALA+EPA+DHA), provided via enriched hen eggs, elicits changes in microvascular reactivity, BP and triglycerides level in healthy subjects that are associated with CV benefits, thus suggesting that daily consumption of omega-3 PUFAs enriched eggs in healthy individuals may potentially contribute to CV risk factors attenuation and disease prevention.
Peterson, Jonathan W.; Gu, Baohua; Seymour, Michael D.
2015-06-15
Fluoroquinolone antibiotics (FQs) are important drugs used in human and veterinary medicine. Their detection in natural waters and waste water treatment plants, along with increased resistance to FQs among some bacteria, have generated an increased interest in the fate of these drugs in the environment. Partitioning of FQs between an aqueous solution and attendant substrates depends, in part, on the surface reactivity of the adsorbent, commonly a function of particle size, surface charge, and functional groups. In this paper, this study investigated the surface interactions between the FQ drug ofloxacin (OFL) and titanium oxide (TiO 2), a common catalyst andmore » widely-observed constituent in many consumer products. Raman and fluorescence spectroscopic techniques, as well as LC/MS, were used to determine the OFL moieties present on TiO 2 surfaces and in attendant solutions. Raman spectra indicate that the C==O (ketone) group of the quinolone core, the NH + of the piperazinyl ring, and CH 3 of benzoxazine core are the most active in sorption onto the TiO 2 surface. Raman spectra also show that the sorbed benzoxazine–quinolone core and piperazinyl moieties are readily desorbed from the surface by re-suspending samples in water. Importantly, we found that OFL could be degraded by reacting with TiO 2 even in the dark. Complementary LC/MS analysis of the attendant supernatants indicates the presence of de-piperazinylated and de-carboxylated OFL breakdown products in supernatant solutions. Together, both Raman and LC/MS analyses indicate that TiO 2 breaks the compound into piperazinyl and carboxylate groups which attach to the surface, whereas de-carboxylated and hydroxylated quinolone moieties remain in solution. Finally, the present study thus identifies the sorption mechanisms and breakdown products of OFL during dark reactions with TiO 2, which is critically important for understanding the fate and transport of OFL as it enters the soil and aquatic environment.« less
Mraz, M; Lacinova, Z; Drapalova, J; Haluzikova, D; Horinek, A; Matoulek, M; Trachta, P; Kavalkova, P; Svacina, S; Haluzik, M
2011-04-01
Low-grade inflammation links obesity, type 2 diabetes mellitus (T2DM), and cardiovascular diseases. To explore the expression profile of genes involved in inflammatory pathways in adipose tissue and peripheral monocytes (PM) of obese patients with and without T2DM at baseline and after dietary intervention. Two-week intervention study with very-low-calorie diet (VLCD). University hospital. Twelve obese females with T2DM, 8 obese nondiabetic females (OB) and 15 healthy age-matched females. Two weeks of VLCD (2500 kJ/d). Metabolic parameters, circulating cytokines, hormones, and mRNA expression of 39 genes in sc adipose tissue (SCAT) and PM. Both T2DM and OB group had significantly increased serum concentrations of circulating proinflammatory factors (C-reactive protein, TNFα, IL-6, IL-8), mRNA expression of macrophage antigen CD68 and proinflammatory chemokines (CCL-2, -3, -7, -8, -17, -22) in SCAT and complementary chemokine receptors (CCR-1, -2, -3, -5) and other proinflammatory receptors (toll-like receptor 2 and 4, TNF receptor superfamily 1A and 1B, IL-6R) in PM, with OB group showing less pronounced chemoattracting and proinflammatory profile compared to T2DM group. In T2DM patients VLCD decreased body weight, improved metabolic profile, and decreased mRNA expression of up-regulated CCRs in PM and chemokines [CCL 8, chemokine (C-X-C motif) ligand 10] in SCAT. VLCD markedly increased mRNA expression of T-lymphocyte attracting chemokine CCL-17 in SCAT. Obese patients with and without T2DM have increased mRNA expression of chemotactic and proinflammatory factors in SCAT and expression of corresponding receptors in PM. Two weeks of VLCD significantly improved this profile in T2DM patients.
Sørensen, J; Primdahl, J; Horn, H C; Hørslev-Petersen, K
2015-01-01
To compare the cost-effectiveness of three types of follow-up for outpatients with stable low-activity rheumatoid arthritis (RA). In total, 287 patients were randomized to either planned rheumatologist consultations, shared care without planned consultations, or planned nurse consultations. Effectiveness measures included disease activity (Disease Activity Score based on 28 joint counts and C-reactive protein, DAS28-CRP), functional status (Health Assessment Questionnaire, HAQ), and health-related quality of life (EuroQol EQ-5D). Cost measures included activities in outpatient clinics and general practice, prescription and non-prescription medicine, dietary supplements, other health-care resources, and complementary and alternative care. Measures of effectiveness and costs were collected by self-reported questionnaires at inclusion and after 12 and 24 months. Incremental cost-effectiveness rates (ICERs) were estimated in comparison with rheumatologist consultations. Changes in disease activity, functional status, and health-related quality of life were not statistically significantly different for the three groups, although the mean scores were better for the shared care and nurse care groups compared with the rheumatologist group. Shared care and nurse care were non-significantly less costly than rheumatologist care. As both shared care and nurse care were associated with slightly better EQ-5D improvements and lower costs, they dominated rheumatologist care. At EUR 10,000 per quality-adjusted life year (QALY) threshold, shared care and nurse care were cost-effective with more than 90% probability. Nurse care was cost-effective in comparison with shared care with 75% probability. Shared care and nurse care seem to cost less but provide broadly similar health outcomes compared with rheumatologist outpatient care. However, it is still uncertain whether nurse care and shared care are cost-effective in comparison with rheumatologist outpatient care.
2014-01-01
Background In this clinical trial we compared the effects of broccoli sprouts powder, as an alternative and complementary treatment, to those of standard triple therapy, as a common medical treatment, on cardiovascular risk factors following the H.pylori eradication in patients with type 2 diabetes. Methods Eighty-six type 2 diabetic patients with positive H.pylori stool antigen test (HpSAg) were randomized to receive one of the three following regimens: STT) Standard triple therapy (omeprazole 20 mg, clarithromycin 500 mg, amoxicillin 1000 mg, twice a day for 14 days), BSP) 6 g/d broccoli sprouts powder for 28 days, and combination of these as STT + BSP. After 4 weeks of treatment, H.pylori eradication rates were assessed by HpSAg. Anthropometric measures, blood pressure, serum lipids and lipoproteins as well as serum high sensitive- C reactive protein were also assessed at baseline and at the second examination. Results Seventy-seven participants completed the study [STT (n = 28), BSP (n = 25), STT + BSP (n = 24)]. The H.pylori eradication rates were 89.3%, 56.0% and 91.7% in STT, BSP and STT + BSP groups, respectively. After the treatment, both systolic and diastolic blood pressure significantly decreased in STT + BSP group (P < 0.05). Serum triglycerides and TG/HDL-C ratio increased in STT patients group (<0.05). Serum hs-CRP levels significantly decreased in the patients who were treated with BSP per se (3.0 ± 2.5 at baseline vs. 2.3 ± 2.1 after the treatment, P < 0.05). Conclusion Compared to standard triple therapy, BSP regimen in addition to considerable effects on H.pylori eradication had also favorable properties on cardiovascular risk factors following the H.pylori eradication. PMID:24940565
Peterson, Jonathan W; Gu, Baohua; Seymour, Michael D
2015-11-01
Fluoroquinolone antibiotics (FQs) are important drugs used in human and veterinary medicine. Their detection in natural waters and waste water treatment plants, along with increased resistance to FQs among some bacteria, have generated an increased interest in the fate of these drugs in the environment. Partitioning of FQs between an aqueous solution and attendant substrates depends, in part, on the surface reactivity of the adsorbent, commonly a function of particle size, surface charge, and functional groups. This study investigated the surface interactions between the FQ drug ofloxacin (OFL) and titanium oxide (TiO2), a common catalyst and widely-observed constituent in many consumer products. Raman and fluorescence spectroscopic techniques, as well as LC/MS, were used to determine the OFL moieties present on TiO2 surfaces and in attendant solutions. Raman spectra indicate that the CO (ketone) group of the quinolone core, the NH(+) of the piperazinyl ring, and CH3 of benzoxazine core are the most active in sorption onto the TiO2 surface. Raman spectra also show that the sorbed benzoxazine-quinolone core and piperazinyl moieties are readily desorbed from the surface by re-suspending samples in water. Importantly, we found that OFL could be degraded by reacting with TiO2 even in the dark. Complementary LC/MS analysis of the attendant supernatants indicates the presence of de-piperazinylated and de-carboxylated OFL breakdown products in supernatant solutions. Together, both Raman and LC/MS analyses indicate that TiO2 breaks the compound into piperazinyl and carboxylate groups which attach to the surface, whereas de-carboxylated and hydroxylated quinolone moieties remain in solution. The present study thus identifies the sorption mechanisms and breakdown products of OFL during dark reactions with TiO2, which is critically important for understanding the fate and transport of OFL as it enters the soil and aquatic environment. Copyright © 2015 Elsevier B.V. All rights reserved.
Phosphoryl Guanidines: A New Type of Nucleic Acid Analogues
Kupryushkin, M. S.; Pyshnyi, D. V.; Stetsenko, D. A.
2014-01-01
A new type of nucleic acid analogues with a phosphoryl guanidine group is described. Oxidation of polymer-supported dinucleoside 2-cyanoethyl phosphite by iodine in the presence of 1,1,3,3-tetramethyl guanidine yields a dinucleotide with an internucleoside tetramethyl phosphoryl guanidine (Tmg) group as the main product. The Tmg group is stable under conditions of solid-phase DNA synthesis and subsequent cleavage and deprotection with ammonia. Oligonucleotides with one or more Tmg groups bind their complementary DNA or RNA with affinity similar to that of natural oligodeoxyribonucleotides. PMID:25558402
Kawerk, N; Succari-Aderschlag, M; Foglietti, M J
1991-10-14
Total serum alpha 1-acid glycoprotein (AGP) concentration and concanavalin A-dependent microheterogeneity were studied in 31 healthy elderly subjects (18 men, 13 women, 71 to 76 yr old). Crossed affino-immunoelectrophoresis (CAIE) revealed three microheterogeneity variants of AGP: non-reactive, weakly reactive and strongly reactive with ConA. Two patterns were found in both elderly men and women, i.e. a normal pattern and one with an increase in the non-reactive form. Mean serum AGP levels in the elderly subjects with slightly higher than in a reference group of younger subjects. The Con A non-reactive form of AGP was increased in 42% of the elderly population. An increase in the non-reactive form of AGP in CAIE should be considered as general expression of chronic inflammation which is of no clinical relevance.
Gani, Dhruva Kumar; Lakshmi, Deepa; Krishnan, Rama; Emmadi, Pamela
2009-01-01
Aims and Objectives: The aim of the present study was to investigate systemic levels of inflammatory markers of cardiovascular diseases like C-reactive protein and interleukin-6 in patients with chronic periodontitis, in comparison to periodontally healthy individuals. Materials and Methods: A total of 42 individuals, both males and females above the age of 30 years, were included in the study. Healthy controls (Group I, n = 14), chronic localized periodontitis (Group II, n = 14), and chronic generalized periodontitis (Group III, n = 14), all without any medical disorder, were recruited. Peripheral blood samples were taken and C-reactive protein (CRP) levels were estimated in the serum samples by using the Particle-Enhanced Turbidimetric Immunoassay (PETIA) technique. Serum samples of Interleukin-6 (IL-6) were assayed by using the Chemiluminescent Immunoassay (IMMULITE) technique. Results: When mean CRP levels were compared between the groups, group III showed statistical significance when compared to group I (P = 0.04). Group III had a higher median IL-6 level (6.35 pg/mL) than Group II (< 5.0 pg/mL) and group I (< 5.0 pg/mL). Differences in median values of IL-6 were not statistically significant in any group (P = 0.29). Conclusion: Periodontitis results in higher systemic levels of CRP and IL-6. These elevated inflammatory factors may increase inflammatory activity in atherosclerotic lesions and potentially increasing the risk for cardiovascular events. PMID:20407653
Phylogenetic Analysis of Marine Picoplankton Using Tau RNA Sequences.
1991-02-01
Pacific Ocean (Aloha Station). DNA prepared from both populations was analyzed by hybridization using kingdom -specific probes complementary to 16S rRNA...euba:-teria. Few eukaryotes, no archaebacteria detected (at low resolution). "* Fluorescendly labeled phylogenetir group-specific oligon ucleotfides
Hong, Heeok; Kim, Chun-Soo; Maeng, Sungho
2009-01-01
This study was to investigate the role of complementary and alternative medicine in the prevention and treatment of benign prostatic hyperplasia. For this purpose, a randomized, double-blind, placebo-controlled trial was performed over 12 months on 47 benign prostatic hyperplasia patients with average age of 53.3 years and international prostate symptom score over 8. Subjects received either sweet potato starch (group A, placebo, 320 mg/day), pumpkin seed oil (group B, 320 mg/day), saw palmetto oil (group C, 320 mg/day) or pumpkin seed oil plus saw palmetto oil (group D, each 320 mg/day). International prostate symptom score, quality of life, serum prostate specific antigen, prostate volume and maximal urinary flow rate were measured. In groups B, C and D, the international prostate symptom score were reduced by 3 months. Quality of life score was improved after 6 months in group D, while those of groups B and C were improved after 3 months, compared to the baseline value. Serum prostate specific antigen was reduced only in group D after 3 months, but no difference was observed in prostate volume in all treatment groups. Maximal urinary flow rate were gradually improved in groups B and C, with statistical significance after 6 months in group B and after 12 months in group C. None of the parameters were significantly improved by combined treatment with pumpkin seed oil and saw palmetto oil. From these results, it is suggested that administrations of pumpkin seed oil and saw palmetto oil are clinically safe and may be effective as complementary and alternative medicine treatments for benign prostatic hyperplasia.
Hong, Heeok; Kim, Chun-Soo
2009-01-01
This study was to investigate the role of complementary and alternative medicine in the prevention and treatment of benign prostatic hyperplasia. For this purpose, a randomized, double-blind, placebo-controlled trial was performed over 12 months on 47 benign prostatic hyperplasia patients with average age of 53.3 years and international prostate symptom score over 8. Subjects received either sweet potato starch (group A, placebo, 320 mg/day), pumpkin seed oil (group B, 320 mg/day), saw palmetto oil (group C, 320 mg/day) or pumpkin seed oil plus saw palmetto oil (group D, each 320 mg/day). International prostate symptom score, quality of life, serum prostate specific antigen, prostate volume and maximal urinary flow rate were measured. In groups B, C and D, the international prostate symptom score were reduced by 3 months. Quality of life score was improved after 6 months in group D, while those of groups B and C were improved after 3 months, compared to the baseline value. Serum prostate specific antigen was reduced only in group D after 3 months, but no difference was observed in prostate volume in all treatment groups. Maximal urinary flow rate were gradually improved in groups B and C, with statistical significance after 6 months in group B and after 12 months in group C. None of the parameters were significantly improved by combined treatment with pumpkin seed oil and saw palmetto oil. From these results, it is suggested that administrations of pumpkin seed oil and saw palmetto oil are clinically safe and may be effective as complementary and alternative medicine treatments for benign prostatic hyperplasia. PMID:20098586
VARIATION IN THE GROUP-SPECIFIC CARBOHYDRATE OF GROUP A STREPTOCOCCI
McCarty, Maclyn
1956-01-01
Soil organisms have been isolated which elaborate induced enzymes capable of attacking group A and variant (V) streptococcal carbohydrates. The V enzyme hydrolyzes V carbohydrate extensively to dialyzable split products with resultant total loss of precipitating activity with homologous antisera. The split products inhibit the reaction between intact V carbohydrate and its antiserum: evidence is presented which indicates that rhamnose oligosaccharides are responsible for the inhibitory effect. The serological specificity of the V carbohydrate thus appears to be primarily dependent on a rhamnose-rhamnose linkage. The effect of the A enzyme on A carbohydrate is characterized by the removal of 50 to 70 per cent of the total glucosamine in the form of free N-acetyl-glucosamine. As a result of this treatment, the residual carbohydrate loses its reactivity with specific group A antisera and at the same time develops markedly increased cross-reactivity with V antisera. This cross-reactivity is in turn eliminated by treatment with V enzyme. The evidence suggests that the specificity of group A carbohydrate is determined to a large extent by side chains of N-acetyl-glucosamine which also serve to mask underlying rhamnose-rhamnose linkages with V specificity. PMID:13367334
Tunjungputri, Rahajeng N; van de Heijden, Wouter; Urbanus, Rolf T; de Groot, Philip G; van der Ven, Andre; de Mast, Quirijn
2017-09-01
Platelets may play a role in the high risk for vascular complications in Gram-positive sepsis. We compared the platelet reactivity of 15 patients with Gram-positive sepsis, 17 with Gram-negative sepsis and 20 healthy controls using a whole blood flow cytometry-based assay. Patients with Gram-positive sepsis had the highest median fluorescence intensity (MFI) of the platelet membrane expression of P-selectin upon stimulation with high dose adenosine diphosphate (ADP; P = 0.002 vs. Gram-negative and P = 0.005 vs. control groups) and cross-linked collagen-related peptide (CRP-XL; P = 0.02 vs. Gram-negative and P = 0.0001 vs. control groups). The Gram-positive group also demonstrated significantly higher ADP-induced fibrinogen binding (P = 0.001), as wll as platelet-monocyte complex formation (P = 0.02), compared to the Gram-negative group and had the highest plasma levels of platelet factor 4, β-thromboglobulin and soluble P-selectin. In contrast, thrombin-antithrombin complex and C-reactive protein levels were comparable in both patient groups. In conclusion, common Gram-positive pathogens induce platelet hyperreactivity, which may contribute to a higher risk for vascular complications.
de la Torre, R; Badia, R; Gonzàlez, G; García, M; Pretel, M J; Farré, M; Segura, J
1996-01-01
We investigated the usefulness of immunological methods for presumptive detection of stimulants found in sports drug testing. The ingestion of substances that show no cross-reactivity in tests commercially available for the detection of amphetamines can produce positive results in the urine. Human metabolism contributes to the positive results of some urine samples when the parent compound does not cross-react with the antibodies of the assay. Urine samples from healthy volunteers given stimulants were tested by chromatographic methods and by two different fluorescence polarization immunoassays (FPIA) from Abbott Laboratories for the analysis of amphetamines. According to the results obtained, we classified stimulants into four groups: detectable stimulants that gave rise to amphetamine by human metabolism (group 1); detectable ephedrines and related compounds, appearing in the urine either as parent compounds or originated by metabolism (group 2); detectable stimulants that displayed actual cross-reactivity with amphetamine tests (group 3); and stimulants not detected by FPIA (group 4). Most of the true doping cases due to the ingestion of stimulants may be detected by FPIA. The specificity of the results may be increased by combining immunological assays with different antibodies.
Physiological Reactivity and Recent Life-Stress Experience.
ERIC Educational Resources Information Center
Pardine, Peter; Napoli, Anthony
1983-01-01
Assessed differences in cardiovascular reactivity between high and low life-stress students (N=26). Results indicated high life-stress individuals maintained their elevated stressor levels throughout recovery from a laboratory stressor, and showed significantly higher systolic recovery levels compared to the low stress group. (JAC)
DIETARY BAKED EGG ACCELERATES RESOLUTION OF EGG ALLERGY IN CHILDREN
Leonard, Stephanie A.; Sampson, Hugh A.; Sicherer, Scott H.; Noone, Sally; Moshier, Erin L.; Godbold, James; Nowak-Wȩgrzyn, Anna
2012-01-01
Background Baked egg is tolerated by a majority of egg-allergic children. Objective To characterize immunologic changes associated with ingestion of baked egg and evaluate the role that baked egg diets plays in the development of tolerance to regular egg. Methods Egg-allergic subjects who tolerated baked egg challenge incorporated baked egg into their diet. Immunologic parameters were measured at follow-up visits. A comparison group strictly avoiding egg was used to evaluate the natural history of the development of tolerance. Results Of the 79 subjects in the intent-to-treat group followed for a median of 37.8 months, 89% now tolerate baked egg and 53% now tolerate regular egg. Of 23 initial baked egg-reactive subjects, 14 (61%) subsequently tolerated baked egg and 6 (26%) now tolerate regular egg. Within the initially baked egg-reactive group, subjects with persistent reactivity to baked egg had higher median baseline egg white (EW)-specific IgE levels (13.5 kUA/L) than those who subsequently tolerated baked egg (4.4 kUA/L; P=0.04) and regular egg (3.1 kUA/L, P=0.05). In subjects ingesting baked egg, EW-induced SPT wheal diameter and EW-, ovalbumin-, and ovomucoid-specific IgE levels decreased significantly, while ovalbumin- and ovomucoid-specific IgG4 levels increased significantly. Subjects in the per-protocol group were 14.6 times more likely to develop regular egg tolerance than subjects in the comparison group (P < 0.0001), and they developed tolerance earlier (median 50.0 versus 78.7 months; P<0.0001). Conclusion Initiation of a baked egg diet accelerates the development of regular egg tolerance compared to strict avoidance. Higher serum EW-specific IgE level is associated with persistent baked and regular egg reactivity, while initial baked egg reactivity is not. PMID:22846751
Dietary baked egg accelerates resolution of egg allergy in children.
Leonard, Stephanie A; Sampson, Hugh A; Sicherer, Scott H; Noone, Sally; Moshier, Erin L; Godbold, James; Nowak-Węgrzyn, Anna
2012-08-01
Baked egg is tolerated by a majority of egg-allergic children. To characterize immunologic changes associated with ingestion of baked egg and evaluate the role that baked egg diets play in the development of tolerance to regular egg. Egg-allergic subjects who tolerated baked egg challenge incorporated baked egg into their diet. Immunologic parameters were measured at follow-up visits. A comparison group strictly avoiding egg was used to evaluate the natural history of the development of tolerance. Of the 79 subjects in the intent-to-treat group followed for a median of 37.8 months, 89% now tolerate baked egg and 53% now tolerate regular egg. Of 23 initially baked egg-reactive subjects, 14 (61%) subsequently tolerated baked egg and 6 (26%) now tolerate regular egg. Within the initially baked egg-reactive group, subjects with persistent reactivity to baked egg had higher median baseline egg white (EW)-specific IgE levels (13.5 kU(A)/L) than those who subsequently tolerated baked egg (4.4 kU(A)/L; P= .04) and regular egg (3.1 kU(A)/L; P= .05). In subjects ingesting baked egg, EW-induced skin prick test wheal diameter and EW-, ovalbumin-, and ovomucoid-specific IgE levels decreased significantly, while ovalbumin- and ovomucoid-specific IgG(4) levels increased significantly. Subjects in the per-protocol group were 14.6 times more likely than subjects in the comparison group (P< .0001) to develop regular egg tolerance, and they developed tolerance earlier (median 50.0 vs 78.7 months; P< .0001). Initiation of a baked egg diet accelerates the development of regular egg tolerance compared with strict avoidance. Higher serum EW-specific IgE level is associated with persistent baked and regular egg reactivity, while initial baked egg reactivity is not. Copyright © 2012 American Academy of Allergy, Asthma & Immunology. Published by Mosby, Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Moosburger-Will, Judith; Bauer, Matthias; Laukmanis, Eva; Horny, Robert; Wetjen, Denise; Manske, Tamara; Schmidt-Stein, Felix; Töpker, Jochen; Horn, Siegfried
2018-05-01
Different aspects of the interaction of carbon fibers and epoxy-based polymer sizings are investigated, e.g. the wetting behavior, the strength of adhesion between fiber and sizing, and the thermal stability of the sizing layer. The influence of carbon fiber surface chemistry and sizing reactivity is investigated using fibers of different degree of anodic oxidation and sizings with different number of reactive epoxy groups per molecule. Wetting of the carbon fibers by the sizing dispersion is found to be specified by both, the degree of fiber activation and the sizing reactivity. In contrast, adhesion strength between fibers and sizing is dominated by the surface chemistry of the carbon fibers. Here, the number of surface oxygen groups seems to be the limiting factor. We also find that the sizing and the additional functionalities induced by anodic oxidation are removed by thermal treatment at 600 °C, leaving the carbon fiber in its original state after carbonization.
Dimensional Changes of Fresh Sockets With Reactive Soft Tissue Preservation: A Cone Beam CT Study.
Crespi, Roberto; Capparé, Paolo; Crespi, Giovanni; Gastaldi, Giorgio; Gherlone, Enrico Felice
2017-06-01
The aim of this study was to assess dimensional changes of the fresh sockets grafted with collagen sheets and maintenance of reactive soft tissue, using cone beam computed tomography (CBCT). Tooth extractions were performed with maximum preservation of the alveolar housing, reactive soft tissue was left into the sockets and collagen sheets filled bone defects. Cone beam computed tomography were performed before and 3 months after extractions. One hundred forty-five teeth, 60 monoradiculars and 85 molars, were extracted. In total, 269 alveoli were evaluated. In Group A, not statistically significant differences were found between monoradiculars, whereas statistically significant differences (P < 0.05) were found between molars, both for mesial and distal alveoli. In Group B, not statistically significant differences were found between maxillary and mandibular bone changes values (P > 0.05) for all types of teeth. This study reported an atraumatic tooth extraction, reactive soft tissue left in situ, and grafted collagen sponge may be helpful to reduce fresh socket collapse after extraction procedures.
Yuan, Jiajin; Ding, Nanxiang; Liu, Yingying; Yang, Jiemin
2015-01-01
Reappraisal of negative events is known to be useful in decreasing their emotional impact. However, existent evidence for this conclusion mostly relies on conscious, deliberate reappraisal that comes with the cost of cognitive efforts. The aim of the present study was to compare emotion regulation effects of conscious and unconscious reappraisal, which has been shown to be less costly in previous studies. Subjects randomly assigned to an unconscious reappraisal, conscious reappraisal, and control condition performed a frustrating arithmetic task. Subjective emotional experience and heart-rate reactivity were recorded. Participants primed with unconscious reappraisal showed the same decrease in heart-rate reactivity as those explicitly instructed to reappraise. In addition, the unconscious reappraisal group did not show reductions in subjective negative emotion, whereas this was significantly decreased in the conscious reappraisal group. Heart-rate reactivity was positively correlated with negative emotion ratings and negatively correlated with the positive emotion ratings. These results suggest that unconscious reappraisal is only effective in decreasing physiological consequences of frustrating emotion, but not in reducing subjective experience.
Ellis, John A.; Gow, Sheryl P.; Lee, Lindsey B.; Lacoste, Stacey; Ball, Eileen C.
2017-01-01
In order to determine the comparative efficacy of injectable and intranasal vaccines to stimulate Bordetella bronchiseptica (Bb)-reactive anamnestic antibodies, a trial was conducted using 144 adult household dogs of various breeds and ages, which had been previously administered intranasal Bb vaccine approximately 12 months before enrollment. Dogs were randomized into 2 groups and blood, nasal swabs, and pharyngeal swabs were collected prior to the administration of single component Bb vaccines intranasally or parenterally. Ten to 14 days later all dogs were resampled to measure changes in systemic and local antibody to Bb. There were no differences in the changes in Bb-reactive serum IgG and nasal IgA between the groups, whereas intranasally vaccinated dogs had significantly higher Bb-reactive serum IgA. These data indicate that both of the current generation of intranasal (modified-live) and injectable (acellular) Bb vaccines can stimulate anamnestic local and systemic antibody responses in previously vaccinated, Bb-seropositive adult household dogs. PMID:28761185
Zhao, Xiaohong; Zhang, Yanjuan; Hu, Huayu; Huang, Zuqiang; Yang, Mei; Chen, Dong; Huang, Kai; Huang, Aimin; Qin, Xingzhen; Feng, Zhenfei
2016-10-01
Lignin was treated by mechanical activation (MA) in a customized stirring ball mill, and the structure and reactivity in further esterification were studied. The chemical structure and morphology of MA-treated lignin and the esterified products were analyzed by chemical analysis combined with UV/vis spectrometer, FTIR,NMR, SEM and particle size analyzer. The results showed that MA contributed to the increase of aliphatic hydroxyl, phenolic hydroxyl, carbonyl and carboxyl groups but the decrease of methoxyl groups. Moreover, MA led to the decrease of particle size and the increase of specific surface area and roughness of surface in lignin. The reactivity of lignin was enhanced significantly for the increase of hydroxyl content and the improvement of mass transfer in chemical reaction caused by the changes of molecular structure and morphological structure. The process of MA is green and simple, and is an effective method for enhancing the reactivity of lignin. Copyright © 2016 Elsevier B.V. All rights reserved.
Thompson, Alina; Lipp, Ottmar V
2017-05-01
Extant literature suggests that extinction training delivered during the memory reconsolidation period is superior to traditional extinction training in the reduction of fear recovery, as it targets the original fear memory trace. At present it is debated whether different types of fear memories are differentially sensitive to behavioral manipulations of reconsolidation. Here, we examined post-reconsolidation recovery of fear as a function of conditioned stimulus (CS) fear-relevance, using the unconditioned stimulus (US) to reactivate and destabilize conditioned fear memories. Participants (N = 56; 25 male; M = 24.39 years, SD = 7.71) in the US-reactivation and control group underwent differential fear conditioning to fear-relevant (spiders/snakes) and fear-irrelevant (geometric shapes) CSs on Day 1. On Day 2, participants received either reminded (US-reactivation) or non-reminded extinction training. Tests of fear recovery, conducted 24 h later, revealed recovery of differential electrodermal responding to both classes of CSs in the control group, but not in the US-reactivation group. These findings indicate that the US reactivation-extinction procedure eliminated recovery of extinguished responding not only to fear-irrelevant, but also to fear-relevant CSs. Contrasting previous reports, our findings show that post-reconsolidation recovery of conditioned responding is not a function of CS fear-relevance and that persistent reduction of fear, conditioned to fear-relevant CSs, can be achieved through behavioral manipulations of reconsolidation. Copyright © 2017 Elsevier Ltd. All rights reserved.
Stress reactivity in childhood functional abdominal pain or irritable bowel syndrome.
Gulewitsch, M D; Weimer, K; Enck, P; Schwille-Kiuntke, J; Hautzinger, M; Schlarb, A A
2017-01-01
Frequent abdominal pain (AP) in childhood has been shown to be associated with elevated experience of stress and with deficits in stress coping, but psychophysiological stress reactivity has been studied rarely. We examined whether children with frequent AP show altered reactions of the parasympathetic nervous system and the hypothalamic-pituitary-adrenal (HPA) axis during and following an afternoon laboratory social stress task in comparison to healthy children and children with anxiety disorders. Twenty-four children with frequent AP (18 with functional AP and six with irritable bowel syndrome; M = 9.9 years), and 24 healthy controls underwent stressful free speech and arithmetic tasks. Twelve children with anxiety disorders served as second comparison sample. Groups were compared regarding parasympathetic reaction and saliva cortisol concentration. We found no differences in parasympathetic withdrawal between the groups. Concerning the HPA axis, we detected an attenuated cortisol reactivity in children with AP compared to both other groups. This study provides preliminary evidence that childhood AP is not associated with altered parasympathetic withdrawal during stress. It seems to be related to a down-regulated reactivity of the HPA axis. This pattern was ascertained in comparison to healthy children and also in comparison to children with anxiety disorders. Childhood abdominal pain could be related to down-regulated HPA axis reactivity to stress but not to altered parasympathetic reaction. Children with abdominal pain and children with anxiety disorders exhibit a divergent stress-related HPA axis reaction. © 2016 European Pain Federation - EFIC®.
Riby, Deborah M; Whittle, Lisa; Doherty-Sneddon, Gwyneth
2012-01-01
The human face is a powerful elicitor of emotion, which induces autonomic nervous system responses. In this study, we explored physiological arousal and reactivity to affective facial displays shown in person and through video-mediated communication. We compared measures of physiological arousal and reactivity in typically developing individuals and those with the developmental disorders Williams syndrome (WS) and autism spectrum disorder (ASD). Participants attended to facial displays of happy, sad, and neutral expressions via live and video-mediated communication. Skin conductance level (SCL) indicated that live faces, but not video-mediated faces, increased arousal, especially for typically developing individuals and those with WS. There was less increase of SCL, and physiological reactivity was comparable for live and video-mediated faces in ASD. In typical development and WS, physiological reactivity was greater for live than for video-mediated communication. Individuals with WS showed lower SCL than typically developing individuals, suggesting possible hypoarousal in this group, even though they showed an increase in arousal for faces. The results are discussed in terms of the use of video-mediated communication with typically and atypically developing individuals and atypicalities of physiological arousal across neurodevelopmental disorder groups.
Martínez-Cifuentes, Maximiliano; Weiss-López, Boris; Araya-Maturana, Ramiro
2016-12-02
In this work, a computational study of a series of N -substitued-4-piperidones curcumin analogues is presented. The molecular structure of the neutral molecules and their radical anions, as well as their reactivity, are investigated. N -substituents include methyl and benzyl groups, while substituents on the aromatic rings cover electron-donor and electron-acceptor groups. Substitutions at the nitrogen atom do not significantly affect the geometry and frontier molecular orbitals (FMO) energies of these molecules. On the other hand, substituents on the aromatic rings modify the distribution of FMO. In addition, they influence the capability of these molecules to attach an additional electron, which was studied through adiabatic (AEA) and vertical electron affinities (VEA), as well as vertical detachment energy (VDE). To study electrophilic properties of these structures, local reactivity indices, such as Fukui ( f ⁺) and Parr ( P ⁺) functions, were calculated, and show the influence of the aromatic rings substituents on the reactivity of α,β-unsaturated ketones towards nucleophilic attack. This study has potential implications for the design of curcumin analogues based on a 4-piperidone core with desired reactivity.
Cacciarini, Martina; Nativi, Cristina; Norcini, Martina; Staderini, Samuele; Francesconi, Oscar; Roelens, Stefano
2011-02-21
The contribution from several H-bonding groups and the impact of geometric requirements on the binding ability of benzene-based tripodal receptors toward carbohydrates have been investigated by measuring the affinity of a set of structures toward octyl β-D-glucopyranoside, selected as a representative monosaccharide. The results reported in the present study demonstrate that a judicious choice of correct geometry and appropriate functional groups is critical to achieve the complementary hydrogen bonding interactions required for an effective carbohydrate recognition.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zizin, M. N.; Zimin, V. G.; Zizina, S. N., E-mail: zizin@adis.vver.kiae.ru
2010-12-15
The ShIPR intellectual code system for mathematical simulation of nuclear reactors includes a set of computing modules implementing the preparation of macro cross sections on the basis of the two-group library of neutron-physics cross sections obtained for the SKETCH-N nodal code. This library is created by using the UNK code for 3D diffusion computation of first VVER-1000 fuel loadings. Computation of neutron fields in the ShIPR system is performed using the DP3 code in the two-group diffusion approximation in 3D triangular geometry. The efficiency of all groups of control rods for the first fuel loading of the third unit ofmore » the Kalinin Nuclear Power Plant is computed. The temperature, barometric, and density effects of reactivity as well as the reactivity coefficient due to the concentration of boric acid in the reactor were computed additionally. Results of computations are compared with the experiment.« less
Association of canine obesity with reduced serum levels of C-reactive protein.
Veiga, Angela P M; Price, Christopher A; de Oliveira, Simone T; Dos Santos, Andréa P; Campos, Rómulo; Barbosa, Patricia R; González, Félix H D
2008-03-01
The prevalence of obesity is increasing in dogs as well as in humans. C-reactive protein (CRP) is an important tool for the detection of inflammation and/or early tissue damage and is linked to obesity in humans. The objective of the present study was to determine if serum CRP levels are altered in obese dogs. Fifteen lean (control group) and 16 overweight (obese group) dogs were examined. Blood samples were collected under fasted conditions for serum determination of CRP, glucose, insulin, cholesterol, triglyceride, and fructosamine. Results indicated that obese dogs were insulin resistant because serum insulin and insulin/glucose ratios were higher than in lean dogs (P < or = 0.05). Serum CRP concentrations were lower in obese dogs than in controls (P < or = 0.001). C-reactive protein was negatively correlated with insulin/glucose ratio (R = -0.42) and cholesterol (R = -0.39; P < or = 0.05). Furthermore, levels of cholesterol, triglycerides, and fructosamine were increased in the obese group compared with the control group. Based on these results, it can be postulated that CRP production is inhibited by obesity and insulin resistance in dogs.
NASA Astrophysics Data System (ADS)
Zizin, M. N.; Zimin, V. G.; Zizina, S. N.; Kryakvin, L. V.; Pitilimov, V. A.; Tereshonok, V. A.
2010-12-01
The ShIPR intellectual code system for mathematical simulation of nuclear reactors includes a set of computing modules implementing the preparation of macro cross sections on the basis of the two-group library of neutron-physics cross sections obtained for the SKETCH-N nodal code. This library is created by using the UNK code for 3D diffusion computation of first VVER-1000 fuel loadings. Computation of neutron fields in the ShIPR system is performed using the DP3 code in the two-group diffusion approximation in 3D triangular geometry. The efficiency of all groups of control rods for the first fuel loading of the third unit of the Kalinin Nuclear Power Plant is computed. The temperature, barometric, and density effects of reactivity as well as the reactivity coefficient due to the concentration of boric acid in the reactor were computed additionally. Results of computations are compared with the experiment.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yeo, Hyun Koo; Lee, Jae Young
2012-04-18
The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.
Yeo, Hyun Koo; Lee, Jae Young
2010-05-01
The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .
Kang, Yunhee; Kim, Jane; Seo, Eunkyo
2018-01-01
Few studies have explored the potential of social capital in improving child nutritional status; however, most components of pathways between social capital and nutritional status have remained unexplained. Complementary feeding practice is a strong mediator of child nutritional status. This study examined the association between complementary feeding practice and maternal social capital in rural Ethiopia, using cross-sectional data of infant aged 6-12 months and their mother pairs (n = 870). The Short Social Capital Assessment Tool was used to assess maternal structural (i.e., community group membership, having emotional/economic support from individuals, and citizenship activities) and cognitive social capital (i.e., trust, social harmony, and sense of belonging) in the past 12 months. Infant's dietary diversity score (DDS, range: 0-7), minimum dietary diversity (MDD), and minimum meal frequency (MMF) were assessed using a 24-hr dietary recall. Multivariable ordinal/binary logistic regression analyses were conducted. Having support from two or more individuals was associated with higher DDS (OR = 1.84) and meeting a minimum level of dietary diversity (MDD: OR = 5.20) but not with MMF, compared to those having no support. Having two or more group memberships was associated with higher DDS (OR = 2.2) but not with MDD or MMF, compared to those without group membership. Citizenship activities showed mixed associations with MMF and no association with DDS or MDD. Cognitive social capital showed no association with DDS or MDD and lower odds of meeting MMF (OR = 0.56). These mixed results call for further studies to examine other potential pathways (e.g., hygiene and caring behaviours) in which social capital could improve child nutritional status. © 2017 John Wiley & Sons Ltd.