Chip-scale pattern modification method for equalizing residual layer thickness in nanoimprint lithography

NASA Astrophysics Data System (ADS)

Youn, Sung-Won; Suzuki, Kenta; Hiroshima, Hiroshi

2018-06-01

A software program for modifying a mold design to obtain a uniform residual layer thickness (RLT) distribution has been developed and its validity was verified by UV-nanoimprint lithography (UV-NIL) simulation. First, the effects of granularity (G) on both residual layer uniformity and filling characteristics were characterized. For a constant complementary pattern depth and a granularity that was sufficiently larger than the minimum pattern width, filling time decreased with the decrease in granularity. For a pattern design with a wide density range and an irregular distribution, the choice of a small granularity was not always a good strategy since the etching depth required for a complementary pattern occasionally exceptionally increased with the decrease in granularity. On basis of the results obtained, the automated method was applied to a chip-scale pattern modification. Simulation results showed a marked improvement in residual layer thickness uniformity for a capacity-equalized (CE) mold. For the given conditions, the standard deviation of RLT decreased in the range from 1/3 to 1/5 in accordance with pattern designs.

The illusion of specific capture: surface and solution studies of suboptimal oligonucleotide hybridization

PubMed Central

2013-01-01

Background Hybridization based assays and capture systems depend on the specificity of hybridization between a probe and its intended target. A common guideline in the construction of DNA microarrays, for instance, is that avoiding complementary stretches of more than 15 nucleic acids in a 50 or 60-mer probe will eliminate sequence specific cross-hybridization reactions. Here we present a study of the behavior of partially matched oligonucleotide pairs with complementary stretches starting well below this threshold complementarity length – in silico, in solution, and at the microarray surface. The modeled behavior of pairs of oligonucleotide probes and their targets suggests that even a complementary stretch of sequence 12 nt in length would give rise to specific cross-hybridization. We designed a set of binding partners to a 50-mer oligonucleotide containing complementary stretches from 6 nt to 21 nt in length. Results Solution melting experiments demonstrate that stable partial duplexes can form when only 12 bp of complementary sequence are present; surface hybridization experiments confirm that a signal close in magnitude to full-strength signal can be obtained from hybridization of a 12 bp duplex within a 50mer oligonucleotide. Conclusions Microarray and other molecular capture strategies that rely on a 15 nt lower complementarity bound for eliminating specific cross-hybridization may not be sufficiently conservative. PMID:23445545

Complementary and Alternative Medicine Use in Modern Obstetrics: A Survey of the Central Association of Obstetricians & Gynecologists Members.

PubMed

Babbar, Shilpa; Williams, Karen B; Maulik, Dev

2016-10-05

The use of complementary and alternative medicine during pregnancy is currently on the rise. A validated survey was conducted at the Central Association of Obstetrician and Gynecologists annual meeting to evaluate the knowledge, attitude, and practice of general obstetricians and gynecologists and maternal-fetal medicine specialists in America. We obtained 128 responses: 73 electronically (57%) and 55 via the paper survey (43%). Forty-five percent reported personally using complementary and alternative medicine and 9% of women respondents used complementary and alternative medicine during pregnancy. Overall, 62% had advised their patients to utilize some form of complementary and alternative medicine in pregnancy. Biofeedback, massage therapy, meditation, and yoga were considered the most effective modalities in pregnancy (median [semi-interquartile range] = 2 [0.5]). Maternal-fetal medicine specialists were significantly more likely to disagree on the use of complementary and alternative medicine for risk reduction of preterm birth compared to obstetricians and gynecologists (P = .03). As the use of complementary and alternative medicine continues to rise in reproductive-age women, obstetricians will play an integral role in incorporating complementary and alternative medicine use with conventional medicine. © The Author(s) 2016.

Complementary and Alternative Medicine Use in Modern Obstetrics: A Survey of the Central Association of Obstetricians & Gynecologists Members

PubMed Central

Babbar, Shilpa; Williams, Karen B.; Maulik, Dev

2016-01-01

The use of complementary and alternative medicine during pregnancy is currently on the rise. A validated survey was conducted at the Central Association of Obstetrician and Gynecologists annual meeting to evaluate the knowledge, attitude, and practice of general obstetricians and gynecologists and maternal-fetal medicine specialists in America. We obtained 128 responses: 73 electronically (57%) and 55 via the paper survey (43%). Forty-five percent reported personally using complementary and alternative medicine and 9% of women respondents used complementary and alternative medicine during pregnancy. Overall, 62% had advised their patients to utilize some form of complementary and alternative medicine in pregnancy. Biofeedback, massage therapy, meditation, and yoga were considered the most effective modalities in pregnancy (median [semi-interquartile range] = 2 [0.5]). Maternal-fetal medicine specialists were significantly more likely to disagree on the use of complementary and alternative medicine for risk reduction of preterm birth compared to obstetricians and gynecologists (P = .03). As the use of complementary and alternative medicine continues to rise in reproductive-age women, obstetricians will play an integral role in incorporating complementary and alternative medicine use with conventional medicine. PMID:27707901

Elasto-limited plastic analysis of structures for probabilistic conditions

NASA Astrophysics Data System (ADS)

Movahedi Rad, M.

2018-06-01

With applying plastic analysis and design methods, significant saving in material can be obtained. However, as a result of this benefit excessive plastic deformations and large residual displacements might develop, which in turn might lead to unserviceability and collapse of the structure. In this study, for deterministic problem the residual deformation of structures is limited by considering a constraint on the complementary strain energy of the residual forces. For probabilistic problem the constraint for the complementary strain energy of the residual forces is given randomly and critical stresses updated during the iteration. Limit curves are presented for the plastic limit load factors. The results show that these constraints have significant effects on the load factors. The formulations of the deterministic and probabilistic problems lead to mathematical programming which are solved by the use of nonlinear algorithm.

Multimodal imaging of human cerebellum - merging X-ray phase microtomography, magnetic resonance microscopy and histology

NASA Astrophysics Data System (ADS)

Schulz, Georg; Waschkies, Conny; Pfeiffer, Franz; Zanette, Irene; Weitkamp, Timm; David, Christian; Müller, Bert

2012-11-01

Imaging modalities including magnetic resonance imaging and X-ray computed tomography are established methods in daily clinical diagnosis of human brain. Clinical equipment does not provide sufficient spatial resolution to obtain morphological information on the cellular level, essential for applying minimally or non-invasive surgical interventions. Therefore, generic data with lateral sub-micrometer resolution have been generated from histological slices post mortem. Sub-cellular spatial resolution, lost in the third dimension as a result of sectioning, is obtained using magnetic resonance microscopy and micro computed tomography. We demonstrate that for human cerebellum grating-based X-ray phase tomography shows complementary contrast to magnetic resonance microscopy and histology. In this study, the contrast-to-noise values of magnetic resonance microscopy and phase tomography were comparable whereas the spatial resolution in phase tomography is an order of magnitude better. The registered data with their complementary information permit the distinct segmentation of tissues within the human cerebellum.

Electron-beam-induced-current and active secondary-electron voltage-contrast with aberration-corrected electron probes

DOE PAGES

Han, Myung-Geun; Garlow, Joseph A.; Marshall, Matthew S. J.; ...

2017-03-23

The ability to map out electrostatic potentials in materials is critical for the development and the design of nanoscale electronic and spintronic devices in modern industry. Electron holography has been an important tool for revealing electric and magnetic field distributions in microelectronics and magnetic-based memory devices, however, its utility is hindered by several practical constraints, such as charging artifacts and limitations in sensitivity and in field of view. In this article, we report electron-beam-induced-current (EBIC) and secondary-electron voltage-contrast (SE-VC) with an aberration-corrected electron probe in a transmission electron microscope (TEM), as complementary techniques to electron holography, to measure electric fieldsmore » and surface potentials, respectively. These two techniques were applied to ferroelectric thin films, multiferroic nanowires, and single crystals. Electrostatic potential maps obtained by off-axis electron holography were compared with EBIC and SE-VC to show that these techniques can be used as a complementary approach to validate quantitative results obtained from electron holography analysis.« less

In crystallo optical spectroscopy (icOS) as a complementary tool on the macromolecular crystallography beamlines of the ESRF

PubMed Central

von Stetten, David; Giraud, Thierry; Carpentier, Philippe; Sever, Franc; Terrien, Maxime; Dobias, Fabien; Juers, Douglas H.; Flot, David; Mueller-Dieckmann, Christoph; Leonard, Gordon A.; de Sanctis, Daniele; Royant, Antoine

2015-01-01

The analysis of structural data obtained by X-ray crystallo­graphy benefits from information obtained from complementary techniques, especially as applied to the crystals themselves. As a consequence, optical spectroscopies in structural biology have become instrumental in assessing the relevance and context of many crystallographic results. Since the year 2000, it has been possible to record such data adjacent to, or directly on, the Structural Biology Group beamlines of the ESRF. A core laboratory featuring various spectrometers, named the Cryobench, is now in its third version and houses portable devices that can be directly mounted on beamlines. This paper reports the current status of the Cryobench, which is now located on the MAD beamline ID29 and is thus called the ID29S-Cryobench (where S stands for ‘spectroscopy’). It also reviews the diverse experiments that can be performed at the Cryobench, highlighting the various scientific questions that can be addressed. PMID:25615856

Artificial spatiotemporal touch inputs reveal complementary decoding in neocortical neurons.

PubMed

Oddo, Calogero M; Mazzoni, Alberto; Spanne, Anton; Enander, Jonas M D; Mogensen, Hannes; Bengtsson, Fredrik; Camboni, Domenico; Micera, Silvestro; Jörntell, Henrik

2017-04-04

Investigations of the mechanisms of touch perception and decoding has been hampered by difficulties in achieving invariant patterns of skin sensor activation. To obtain reproducible spatiotemporal patterns of activation of sensory afferents, we used an artificial fingertip equipped with an array of neuromorphic sensors. The artificial fingertip was used to transduce real-world haptic stimuli into spatiotemporal patterns of spikes. These spike patterns were delivered to the skin afferents of the second digit of rats via an array of stimulation electrodes. Combined with low-noise intra- and extracellular recordings from neocortical neurons in vivo, this approach provided a previously inaccessible high resolution analysis of the representation of tactile information in the neocortical neuronal circuitry. The results indicate high information content in individual neurons and reveal multiple novel neuronal tactile coding features such as heterogeneous and complementary spatiotemporal input selectivity also between neighboring neurons. Such neuronal heterogeneity and complementariness can potentially support a very high decoding capacity in a limited population of neurons. Our results also indicate a potential neuroprosthetic approach to communicate with the brain at a very high resolution and provide a potential novel solution for evaluating the degree or state of neurological disease in animal models.

Artificial spatiotemporal touch inputs reveal complementary decoding in neocortical neurons

PubMed Central

Oddo, Calogero M.; Mazzoni, Alberto; Spanne, Anton; Enander, Jonas M. D.; Mogensen, Hannes; Bengtsson, Fredrik; Camboni, Domenico; Micera, Silvestro; Jörntell, Henrik

2017-01-01

Investigations of the mechanisms of touch perception and decoding has been hampered by difficulties in achieving invariant patterns of skin sensor activation. To obtain reproducible spatiotemporal patterns of activation of sensory afferents, we used an artificial fingertip equipped with an array of neuromorphic sensors. The artificial fingertip was used to transduce real-world haptic stimuli into spatiotemporal patterns of spikes. These spike patterns were delivered to the skin afferents of the second digit of rats via an array of stimulation electrodes. Combined with low-noise intra- and extracellular recordings from neocortical neurons in vivo, this approach provided a previously inaccessible high resolution analysis of the representation of tactile information in the neocortical neuronal circuitry. The results indicate high information content in individual neurons and reveal multiple novel neuronal tactile coding features such as heterogeneous and complementary spatiotemporal input selectivity also between neighboring neurons. Such neuronal heterogeneity and complementariness can potentially support a very high decoding capacity in a limited population of neurons. Our results also indicate a potential neuroprosthetic approach to communicate with the brain at a very high resolution and provide a potential novel solution for evaluating the degree or state of neurological disease in animal models. PMID:28374841

Complementary Feeding: Review of Recommendations, Feeding Practices, and Adequacy of Homemade Complementary Food Preparations in Developing Countries – Lessons from Ethiopia

PubMed Central

Abeshu, Motuma Adimasu; Lelisa, Azeb; Geleta, Bekesho

2016-01-01

Breastfeeding provides the ideal food during the first 6 months of life. Complementary feeding starts when breast milk is no longer sufficient by itself, where the target age is for 6–23 months. The gap between nutritional requirement and amount obtained from breast milk increases with age. For energy, 200, 300, and 550 kcal per day is expected to be covered by complementary foods at 6–8, 9–11, and 12–23 months, respectively. In addition, the complementary foods must provide relatively large proportions of micronutrients such as iron, zinc, phosphorus, magnesium, calcium, and vitamin B6. In several parts of the developing world, complementary feeding continues as a challenge to good nutrition in children. In Ethiopia, only 4.2% of breastfed children of 6–23 months of age have a minimum acceptable diet. The gaps are mostly attributed to either poor dietary quality or poor feeding practices, if not both. Commercial fortified foods are often beyond the reach of the poor. Thus, homemade complementary foods remain commonly used. Even when based on an improved recipe, however, unfortified plant-based complementary foods provide insufficient key micronutrients (especially, iron, zinc, and calcium) during the age of 6–23 months. Thus, this review assessed complementary feeding practice and recommendation and reviewed the level of adequacy of homemade complementary foods. PMID:27800479

Hairpin Bisulfite Sequencing: Synchronous Methylation Analysis on Complementary DNA Strands of Individual Chromosomes.

PubMed

Giehr, Pascal; Walter, Jörn

2018-01-01

The accurate and quantitative detection of 5-methylcytosine is of great importance in the field of epigenetics. The method of choice is usually bisulfite sequencing because of the high resolution and the possibility to combine it with next generation sequencing. Nevertheless, also this method has its limitations. Following the bisulfite treatment DNA strands are no longer complementary such that in a subsequent PCR amplification the DNA methylation patterns information of only one of the two DNA strand is preserved. Several years ago Hairpin Bisulfite sequencing was developed as a method to obtain the pattern information on complementary DNA strands. The method requires fragmentation (usually by enzymatic cleavage) of genomic DNA followed by a covalent linking of both DNA strands through ligation of a short DNA hairpin oligonucleotide to both strands. The ligated covalently linked dsDNA products are then subjected to a conventional bisulfite treatment during which all unmodified cytosines are converted to uracils. During the treatment the DNA is denatured forming noncomplementary ssDNA circles. These circles serve as a template for a locus specific PCR to amplify chromosomal patterns of the region of interest. As a result one ends up with a linearized product, which contains the methylation information of both complementary DNA strands.

Association of Frontline Worker-Provided Services with Change in Block-Level Complementary Feeding Indicators: An Ecological Analysis from Bihar, India

PubMed Central

Das, Aritra; Mahapatra, Sanchita; Sai Mala, Guntur; Chaudhuri, Indrajit; Mahapatra, Tanmay

2016-01-01

Background Insufficiencies in complementary feeding put infants and young children at increased risk of undernutrition. Till now, most Indian studies have looked at the individual level determinants of complementary feeding practices. We aimed to evaluate the association of frontline worker (FLW) provided nutritional counselling services, with change in community level indicators of complementary feeding practices among 9–11 month old children over time. Methods The study data was obtained from five rounds of ‘Lot Quality Assurance Sampling’ survey in eight districts of Bihar, an impoverished Indian state. The surveys were conducted as evaluation exercises for the ‘Integrated Family Health Initiative (IFHI)’–a multi-faceted program aimed at improving the maternal and child health outcomes in Bihar. The main outcome indicators were—current breastfeeding, age-appropriate minimum frequency of semi-solid food, age-appropriate minimum quantity of semi-solid food, initiation of complementary feeding at the right age, and dietary diversity. Repeated measures analysis was performed to determine the association of changes in the outcome indicators with coverage of FLW-provided counselling services. Results Visits by FLW, advices on age-appropriate frequency and handwashing were significant predictors of receiving age-appropriate frequency of feeding. The determinants of receiving age-appropriate quantity were—advices on age appropriate frequency and advices on handwashing. Receiving food support from AWC and FLW visits were significantly associated with initiating complementary feeding at the right age. Conclusions The present study identified the critical elements among the different types of FLW-provided services. The study findings, from an economically and socially underdeveloped region of India, would inform the relevant programs about the nutritional counselling services that need to be emphasized upon for reducing the burden of childhood malnutrition. PMID:27832211

Complementary and Alternative Therapies for Autism Spectrum Disorder

PubMed Central

Fusar-Poli, Laura; Rocchetti, Matteo; Provenzani, Umberto; Barale, Francesco

2015-01-01

Background. Complementary and alternative medicine (CAM) represents a popular therapeutic option for patients with autism spectrum disorder (ASD). Unfortunately, there is a paucity of data regarding the efficacy of CAM in ASD. The aim of the present systematic review is to investigate trials of CAM in ASD. Material and Methods. We searched the following databases: MEDLINE, EMBASE, Cochrane Database of Systematic Reviews, CINAHL, Psychology and Behavioral Sciences Collection, Agricola, and Food Science Source. Results. Our literature search identified 2687 clinical publications. After the title/abstract screening, 139 publications were obtained for detailed evaluation. After detailed evaluation 67 studies were included, from hand search of references we retrieved 13 additional studies for a total of 80. Conclusion. There is no conclusive evidence supporting the efficacy of CAM therapies in ASD. Promising results are reported for music therapy, sensory integration therapy, acupuncture, and massage. PMID:26064157

Multiview three-dimensional display with continuous motion parallax through planar aligned OLED microdisplays.

PubMed

Teng, Dongdong; Xiong, Yi; Liu, Lilin; Wang, Biao

2015-03-09

Existing multiview three-dimensional (3D) display technologies encounter discontinuous motion parallax problem, due to a limited number of stereo-images which are presented to corresponding sub-viewing zones (SVZs). This paper proposes a novel multiview 3D display system to obtain continuous motion parallax by using a group of planar aligned OLED microdisplays. Through blocking partial light-rays by baffles inserted between adjacent OLED microdisplays, transitional stereo-image assembled by two spatially complementary segments from adjacent stereo-images is presented to a complementary fusing zone (CFZ) which locates between two adjacent SVZs. For a moving observation point, the spatial ratio of the two complementary segments evolves gradually, resulting in continuously changing transitional stereo-images and thus overcoming the problem of discontinuous motion parallax. The proposed display system employs projection-type architecture, taking the merit of full display resolution, but at the same time having a thin optical structure, offering great potentials for portable or mobile 3D display applications. Experimentally, a prototype display system is demonstrated by 9 OLED microdisplays.

Use of complementary and alternative medicine by patients with arthritis.

PubMed

Unsal, Ayla; Gözüm, Sebahat

2010-04-01

The aims of this study were to determine the prevalence of complementary and alternative medicine use in patients with arthritis, the types of complementary and alternative medicine used, pertinent socio-demographic factors associated with complementary and alternative medicine use and its perceived efficacy. Arthritis is a major health issue, and the use of complementary and alternative medicine among patients with arthritis is common. This is a descriptive cross-sectional study. Data were obtained from 250 patients with arthritis at the physiotherapy and immunology clinics Atatürk University Hospital in eastern Turkey between May-July 2005 using a questionnaire developed specifically for this study. The instrument included questions on socio-demographic information, disease specifics and complementary and alternative medicine usage. Seventy-six per cent of participants reported use of at least one form of complementary and alternative medicine in the previous year. Complementary and alternative medicine users and non-users were not significantly different in most socio-demographic characteristics including age, gender, marital status and education level with the exception of economic status. We categorised treatment into six complementary and alternative medicine categories: 62.6% of patients used thermal therapies; 41.5% used oral herbal therapies; 40.5% used hot therapies; 32.6% used externally applied (skin) therapies; 28.4% used massage and 12.6% used cold therapies. All forms of complementary and alternative medicine except thermal and oral herbal therapies were perceived as very effective by more than half of study participants. Complementary and alternative medicine therapy is widely used by patients with arthritis and has perceived beneficial effects. It is important for nurses and other health care professionals to be knowledgeable about the use of complementary and alternative medicine therapies when providing care to patients with arthritis because of possible interactions with other treatments, delays in seeking care and the potential for poor quality products. It is also essential for health professionals to discuss treatment options with patients and to monitor treatment efficacy.

Spacelab Life Sciences 1 results

NASA Technical Reports Server (NTRS)

Seddon, Rhea

1992-01-01

Results are presented from the experiments conducted by the first Shuttle/Spacelab mission dedicated entirely to the life sciences, the Spacelab Life Sciences 1, launched on June 5, 1991. The experiments carried out during the 9-day flight included investigations of changes in the human cardiovascular, pulmonary, renal/endocrine, blood, and vestibular systems that were brought about by microgravity. Results were also obtained from the preflight and postflight complementary experiments performed on rats, which assessed the suitability of rodents as animal models for humans. Most results verified, or expanded on, the accepted theories of adaptation to zero gravity.

How Effective Are Spiritual Care and Body Manipulation Therapies in Pediatric Oncology? A Systematic Review of the Literature

PubMed Central

Poder, Thomas G.; Lemieux, Renald

2014-01-01

Background: The effects of cancer and associated treatments have a considerable impact on the well-being and quality of life of pediatric oncology patients. To support children and their families, complementary and alternative medicines are seen by nurses and doctors as practical to integrate to the services offered by hospitals. Objective: The purpose of this paper is to examine if the practice of complementary and alternative medicine, specifically spiritual care and treatments based on body manipulation, is likely to improve the health and well-being of children suffering from cancer. Method: This objective is achieved through a systematic review of the literature. The level of evidence associated with each practice of complementary and alternative medicine was assessed according to the methodological design used by the studies reviewed. Results and Conclusion: Studies reviewed are of a methodological quality that could be described as fair due to the small sample size of patients and the existence of a number of biases in the conduct and analysis of these studies. However, results obtained are consistent from one study to another, allowing us to make certain recommendations. It is thus advisable to consider the introduction of hypnotherapy in pediatric oncology services. Based on the data collected, it is the complementary and alternative medicine with the most evidence in favor of effectiveness of the well-being of pediatric oncology patients, especially during painful procedures. It is also recommended to use art therapy and music therapy. Conversely, too little evidence is present to be able to recommend the use of acupuncture, chiropractic or osteopathy. PMID:24576371

Development and Translation of Hybrid Optoacoustic/Ultrasonic Tomography for Early Breast Cancer Detection

DTIC Science & Technology

2015-09-01

OAT) and laser-induced ultrasound tomography (LUT) to obtain coregistered maps of tissue optical absorption and speed of sound , displayed within the...computed tomography (UST) can provide high-resolution anatomical images of breast lesions based on three complementary acoustic properties (speed-of- sound ...tomography (UST) can provide high-resolution anatomical images of breast lesions based on three complementary acoustic properties (speed-of- sound

Prediction and measurement of radiation damage to CMOS devices on board spacecraft

NASA Technical Reports Server (NTRS)

Cliff, R. A.; Danchenko, V.; Stassinopoulos, E. G.; Sing, M.; Brucker, G. J.; Ohanian, R. S.

1976-01-01

The initial results obtained from the Complementary Metal Oxide Semiconductors Radiation Effects Measurement experiment are presented. Predictions of radiation damage to C-MOS devices are based on standard environment models and computational techniques. A comparison of the shifts in CMOS threshold potentials, that is, those measured in space to those obtained from the on the ground simulation experiment with Co 60, indicated that the measured space damage is greater than predicted by a factor of two for shields thicker than 100 mils (2.54 mm), but agrees well with predictions for the thinner shields.

Thermal properties measurements in biodiesel oils using photothermal techniques

NASA Astrophysics Data System (ADS)

Castro, M. P. P.; Andrade, A. A.; Franco, R. W. A.; Miranda, P. C. M. L.; Sthel, M.; Vargas, H.; Constantino, R.; Baesso, M. L.

2005-08-01

In this Letter, thermal lens and open cell photoacoustic techniques are used to measure the thermal properties of biodiesel oils. The absolute values of the thermal effusivity, thermal diffusivity, thermal conductivity and the temperature coefficient of the refractive index were determined for samples obtained from soy, castor bean, sunflower and turnip. The results suggest that the employed techniques may be useful as complementary methods for biodiesel certification.

A New Method for Obtaining Russell-Saunders Terms

ERIC Educational Resources Information Center

Liu, Ying; Liu, Yue; Liu, Bihui

2011-01-01

A new method for obtaining Russell-Saunders terms of atomic configurations is reported. This new method is significantly different from, while at the same time complementary to, previously published methods for obtaining atomic terms. This novel procedure is elicited by the method used to determine the splitting of S, P, D terms in weak ligand…

Balancing Hole and Electron Conduction in Ambipolar Split-Gate Thin-Film Transistors.

PubMed

Yoo, Hocheon; Ghittorelli, Matteo; Lee, Dong-Kyu; Smits, Edsger C P; Gelinck, Gerwin H; Ahn, Hyungju; Lee, Han-Koo; Torricelli, Fabrizio; Kim, Jae-Joon

2017-07-10

Complementary organic electronics is a key enabling technology for the development of new applications including smart ubiquitous sensors, wearable electronics, and healthcare devices. High-performance, high-functionality and reliable complementary circuits require n- and p-type thin-film transistors with balanced characteristics. Recent advancements in ambipolar organic transistors in terms of semiconductor and device engineering demonstrate the great potential of this route but, unfortunately, the actual development of ambipolar organic complementary electronics is currently hampered by the uneven electron (n-type) and hole (p-type) conduction in ambipolar organic transistors. Here we show ambipolar organic thin-film transistors with balanced n-type and p-type operation. By manipulating air exposure and vacuum annealing conditions, we show that well-balanced electron and hole transport properties can be easily obtained. The method is used to control hole and electron conductions in split-gate transistors based on a solution-processed donor-acceptor semiconducting polymer. Complementary logic inverters with balanced charging and discharging characteristics are demonstrated. These findings may open up new opportunities for the rational design of complementary electronics based on ambipolar organic transistors.

Proposal of indicators to evaluate complementary feeding based on World Health Organization indicators.

PubMed

Saldan, Paula Chuproski; Venancio, Sonia Isoyama; Saldiva, Silvia Regina Dias Medici; de Mello, Débora Falleiros

2016-09-01

This study compares complementary feeding World Health Organization (WHO) indicators with those built in accordance with Brazilian recommendations (Ten Steps to Healthy Feeding). A cross-sectional study was carried out during the National Immunization Campaign against Poliomyelitis in Guarapuava-Paraná, Brazil, in 2012. Feeding data from 1,355 children aged 6-23 months were obtained through the 24 h diet recall. Based on five indicators, the proportion of adequacy was evaluated: introduction of solid, semi-solid, or soft foods; minimum dietary diversity; meal frequency; acceptable diet; and consumption of iron-rich foods. Complementary feeding showed adequacy higher than 85% in most WHO indicators, while review by the Ten Steps assessment method showed a less favorable circumstance and a high intake of unhealthy foods. WHO indicators may not reflect the complementary feeding conditions of children in countries with low malnutrition rates and an increased prevalence of overweight/obesity. The use of indicators according to the Ten Steps can be useful to identify problems and redirect actions aimed at promoting complementary feeding. © 2016 John Wiley & Sons Australia, Ltd.

Preliminary comparative assessment of PM10 hourly measurement results from new monitoring stations type using stochastic and exploratory methodology and models

NASA Astrophysics Data System (ADS)

Czechowski, Piotr Oskar; Owczarek, Tomasz; Badyda, Artur; Majewski, Grzegorz; Rogulski, Mariusz; Ogrodnik, Paweł

2018-01-01

The paper presents selected preliminary stage key issues proposed extended equivalence measurement results assessment for new portable devices - the comparability PM10 concentration results hourly series with reference station measurement results with statistical methods. In article presented new portable meters technical aspects. The emphasis was placed on the comparability the results using the stochastic and exploratory methods methodology concept. The concept is based on notice that results series simple comparability in the time domain is insufficient. The comparison of regularity should be done in three complementary fields of statistical modeling: time, frequency and space. The proposal is based on model's results of five annual series measurement results new mobile devices and WIOS (Provincial Environmental Protection Inspectorate) reference station located in Nowy Sacz city. The obtained results indicate both the comparison methodology completeness and the high correspondence obtained new measurements results devices with reference.

Controllable Threshold Voltage in Organic Complementary Logic Circuits with an Electron-Trapping Polymer and Photoactive Gate Dielectric Layer.

PubMed

Dao, Toan Thanh; Sakai, Heisuke; Nguyen, Hai Thanh; Ohkubo, Kei; Fukuzumi, Shunichi; Murata, Hideyuki

2016-07-20

We present controllable and reliable complementary organic transistor circuits on a PET substrate using a photoactive dielectric layer of 6-[4'-(N,N-diphenylamino)phenyl]-3-ethoxycarbonylcoumarin (DPA-CM) doped into poly(methyl methacrylate) (PMMA) and an electron-trapping layer of poly(perfluoroalkenyl vinyl ether) (Cytop). Cu was used for a source/drain electrode in both the p-channel and n-channel transistors. The threshold voltage of the transistors and the inverting voltage of the circuits were reversibly controlled over a wide range under a program voltage of less than 10 V and under UV light irradiation. At a program voltage of -2 V, the inverting voltage of the circuits was tuned to be at nearly half of the supply voltage of the circuit. Consequently, an excellent balance between the high and low noise margins (NM) was produced (64% of NMH and 68% of NML), resulting in maximum noise immunity. Furthermore, the programmed circuits showed high stability, such as a retention time of over 10(5) s for the inverter switching voltage. Our findings bring about a flexible, simple way to obtain robust, high-performance organic circuits using a controllable complementary transistor inverter.

[Person-organization fit as a mediator of relationship between work environment and stress among social workers].

PubMed

Waszkowska, Małlgorzata; Andysz, Aleksandra; Merecz, Dorota

2014-01-01

Occupational stress of social workers is associated with various psychosocial hazards in the work environment. Some of them affect person-organization fit (P-O fit). The aim of the study was to verify a hypothesis on the mediating role of P-O fit in the relationship between work environment and stress. The research was based on a sample of 500 social workers directly involved in social work. The data were obtained using the Person-Organization Fit Questionnaire by Czarnota-Bojarska, the Work Environment Questionnaire developed by the Department of Occupational Psychology, Nofer Institute of Occupational Medicine, Łódź, and the Perceived Stress Scale (PSS-10) by Cohen et al. As revealed by the regression analysis of the 4 analyzed work environment factors, only organizational politics was significantly related with perceived stress. Complementary and supplementary dimensions of P-O fit and identification with organization were the mediators of the relationship between organizational policies and stress, but only complementary fit proved to be a total mediator. The results of the study suggest that person-organization fit, especially its complementary aspect, is an essential determinant of accomplishing the core functions of social work and good practice among social workers.

Sensor fusion of range and reflectance data for outdoor scene analysis

NASA Technical Reports Server (NTRS)

Kweon, In SO; Hebvert, Martial; Kanade, Takeo

1988-01-01

In recognizing objects in an outdoor scene, range and reflectance (or color) data provide complementary information. Results of experiments in recognizing outdoor scenes containing roads, trees, and cars are presented. The recognition program uses range and reflectance data obtained by a scanning laser range finder, as well as color data from a color TV camera. After segmentation of each image into primitive regions, models of objects are matched using various properties.

Additional diagnostic value of multiplane echocardiography over biplane imaging in assessment of mitral prosthetic valves.

PubMed Central

Faletra, F.; De Chiara, F.; Corno, R.; Passini, L.

1996-01-01

OBJECTIVE: To evaluate how often multiplane transoesophageal echocardiography yields new or complementary data in mitral prostheses in comparison with the exclusive use of biplane imaging. PATIENTS: 73 consecutive patients with mitral prostheses who underwent multiplane transoesophageal echocardiograpy between January 1993 and December 1994. METHODS: Biplane images (transverse and longitudinal planes) and multiplane images (transverse, longitudinal, and intermediate planes) were recorded on two separate videotapes. The data provided by multiplane transoesophageal echocardiography were evaluated as (a) new data (abnormalities missed by biplane imaging); (b) complementary data (better delineating lesions already visualised by biplane imaging); or (c) redundant data (data already provided by biplane imaging). RESULTS: Multiplane transoesophageal echocardiography revealed new abnormalities in seven patients (9.5%) (thrombi in three and paraprosthetic leaks in the remaining four) and complementary data in nine (12.3%). In patients with paraprosthetic regurgitation, the possibility of continuously visualising the sewing ring by means of sequential angulations allowed the circumferential extension of the leak to be measured. In seven patients with paravalvar regurgitation who underwent surgery, the extension of the leak as measured by the multiplane approach closely corresponded with the surgical data. CONCLUSIONS: In comparison with the exclusive use of biplane imaging, the multiplane approach added new or complementary data in a significant proportion of patients with mitral prostheses. The ability to obtain the sequential adjacent planes allowed a more reliable appraisal of the extension of the leak and other abnormalities. Images PMID:8697166

Complementary Speckle Patterns: Deterministic Interchange of Intrinsic Vortices and Maxima through Scattering Media.

PubMed

Gateau, Jérôme; Rigneault, Hervé; Guillon, Marc

2017-01-27

Intensity maxima and zeros of speckle patterns obtained behind a diffuser are experimentally interchanged by applying a spiral phase delay of charge ±1 to the impinging coherent beam. This transform arises from the expectation that tightly focused beams, which have a planar wave front around the focus, are so changed into vortex beams and vice versa. The statistics of extrema locations and the intensity distribution of the so-generated "complementary" patterns are characterized by numerical simulations. It is demonstrated experimentally that the incoherent superposition of the three "complementary speckle patterns" yield a synthetic speckle grain size enlarged by a factor of sqrt[3]. A cyclic permutation of optical vortices and intensity maxima is unexpectedly observed and discussed.

Factors associated with the timing of introduction of complementary feeding: the Generation R Study.

PubMed

Tromp, I I M; Briedé, S; Kiefte-de Jong, J C; Renders, C M; Jaddoe, V W V; Franco, O H; Hofman, A; Raat, H; Moll, H A

2013-06-01

Many parents do not follow recommendations for the timing of introduction of complementary feeding. The aim of this study was to identify determinants associated with the timing of introduction of complementary feeding in a multiethnic birth cohort. Subjects were 3561 mothers and infants participating in a prospective cohort study. The timing of introduction of complementary feeding and maternal and infant characteristics were obtained by parent-derived questionnaires. Regression analyses were performed to identify determinants for the timing of introduction of complementary feeding (<3, 3-6 and ≥ 6 months). In total, 62% of infants were introduced to complementary feeding before the age of 6 months. Determinants for very early (<3 months) introduction were being a single parent and infant day care attendance. Determinants for early (3-6 months) introduction were young maternal age, multiple parities, no infant family history of asthma, atopy and no infant history of allergy to cow's milk. Determinants for both very early and early introduction were low educational level and not fully breastfeeding for 4 months. Maternal educational level was only significantly associated with the timing of introduction in mothers of Western origin. This study confirmed determinants for the timing of introduction of complementary feeding that have been identified by previous studies, which may be appropriate targets for education and guidance. Moreover, mothers whose infants attend day care and have a family history of asthma, atopy or allergy to cow's milk may need guidance to follow infant feeding recommendations.

Comparative Evaluation of the Complementary and Alternative Medicine Therapy and Conventional Therapy Use for Musculoskeletal Disorders Management and Its Association with Job Satisfaction among Dentists of West India.

PubMed

Gupta, Devanand; Batra, Renu; Mahajan, Shveta; Bhaskar, Dara John; Jain, Ankita; Shiju, Mohammed; Yadav, Ankit; Chaturvedi, Mudita; Gill, Shruti; Verma, Renuka; Dalai, Deepak Ranjan; Gupta, Rajendra Kumar

2014-10-01

Musculoskeletal problems have become a significant issue in the profession of dentistry. There are currently no recommended effective disease-preventing and modifying remedies. High prevalence rates for musculoskeletal disorders (MSDs) among dentists have been reported in the literature. Complementary and alternative medicine can be helpful in managing and preventing the MSDs. The purpose of this study was to determine if dentists in the western part of India are using complementary and alternative medicine therapies for MSDs, and also to find if those who use complementary and alternative medicine therapies have greater job/career satisfaction compared to conventional therapy (CT) users. Dentists of western India registered under the Dental Council of India (N = 2166) were recruited for the study. Data were analyzed using univariate and bivariate analyses and logistic regression. A response rate of 73% (n = 1581) was obtained, of which 79% (n = 1249) was suffering from MSDs. The use of complementary and alternative medicine or CT was reported by 90% (n = 1124) of dentists with MSDs. Dentists using complementary and alternative medicine reported greater health (P < 0.001) and carrier satisfaction (P < 0.001) and were able to work as many hours they wanted (P < 0.001) compared to CT users. Complementary and alternative medicine therapies may improve the quality of life and enhance job satisfaction for a dentist who suffers from MSDs.

Comparative Evaluation of the Complementary and Alternative Medicine Therapy and Conventional Therapy Use for Musculoskeletal Disorders Management and Its Association with Job Satisfaction among Dentists of West India

PubMed Central

Gupta, Devanand; Batra, Renu; Mahajan, Shveta; Bhaskar, Dara John; Jain, Ankita; Shiju, Mohammed; Yadav, Ankit; Chaturvedi, Mudita; Gill, Shruti; Verma, Renuka; Dalai, Deepak Ranjan; Gupta, Rajendra Kumar

2014-01-01

Musculoskeletal problems have become a significant issue in the profession of dentistry. There are currently no recommended effective disease-preventing and modifying remedies. High prevalence rates for musculoskeletal disorders (MSDs) among dentists have been reported in the literature. Complementary and alternative medicine can be helpful in managing and preventing the MSDs. The purpose of this study was to determine if dentists in the western part of India are using complementary and alternative medicine therapies for MSDs, and also to find if those who use complementary and alternative medicine therapies have greater job/career satisfaction compared to conventional therapy (CT) users. Dentists of western India registered under the Dental Council of India (N = 2166) were recruited for the study. Data were analyzed using univariate and bivariate analyses and logistic regression. A response rate of 73% (n = 1581) was obtained, of which 79% (n = 1249) was suffering from MSDs. The use of complementary and alternative medicine or CT was reported by 90% (n = 1124) of dentists with MSDs. Dentists using complementary and alternative medicine reported greater health (P < 0.001) and carrier satisfaction (P < 0.001) and were able to work as many hours they wanted (P < 0.001) compared to CT users. Complementary and alternative medicine therapies may improve the quality of life and enhance job satisfaction for a dentist who suffers from MSDs. PMID:25379469

Video approach to chemiluminescence detection using a low-cost complementary metal oxide semiconductor (CMOS)-based camera: determination of paracetamol in pharmaceutical formulations.

PubMed

Lahuerta-Zamora, Luis; Mellado-Romero, Ana M

2017-06-01

A new system for continuous flow chemiluminescence detection, based on the use of a simple and low-priced lens-free digital camera (with complementary metal oxide semiconductor technology) as a detector, is proposed for the quantitative determination of paracetamol in commercial pharmaceutical formulations. Through the camera software, AVI video files of the chemiluminescence emission are captured and then, using friendly ImageJ public domain software (from National Institutes for Health), properly processed in order to extract the analytical information. The calibration graph was found to be linear over the range 0.01-0.10 mg L -1 and over the range 1.0-100.0 mg L -1 of paracetamol, the limit of detection being 10 μg L -1 . No significative interferences were found. Paracetamol was determined in three different pharmaceutical formulations: Termalgin®, Efferalgan® and Gelocatil®. The obtained results compared well with those declared on the formulation label and with those obtained through the official analytical method of British Pharmacopoeia. Graphical abstract Abbreviated scheme of the new chemiluminescence detection system proposed in this paper.

Recovery of Meteorological Data for the Observatory of A Guarda, Spain

PubMed Central

Añel, Juan A.; Blanco-Durán, Marcos; Gimeno, Luis; de la Torre, Laura

2012-01-01

We herein describe the recovery of a series of data on temperature, humidity, precipitation, evaporation, wind, and local weather conditions from documentary sources obtained from the Jesuit observatory of A Guarda (Galicia, Spain) for the period 1881–1896. The data were digitized and made available in accessible electronic formats. Comparisons were made with present-day meteorological data obtained from two nearby stations. We further believe that the discovery of some new complementary documentary sources made during the present research could be a basis for future data recovery efforts. Among these new results, early ozone data from the period are of outstanding importance to meteorologists. PMID:22768069

Parallel logic gates in synthetic gene networks induced by non-Gaussian noise.

PubMed

Xu, Yong; Jin, Xiaoqin; Zhang, Huiqing

2013-11-01

The recent idea of logical stochastic resonance is verified in synthetic gene networks induced by non-Gaussian noise. We realize the switching between two kinds of logic gates under optimal moderate noise intensity by varying two different tunable parameters in a single gene network. Furthermore, in order to obtain more logic operations, thus providing additional information processing capacity, we obtain in a two-dimensional toggle switch model two complementary logic gates and realize the transformation between two logic gates via the methods of changing different parameters. These simulated results contribute to improve the computational power and functionality of the networks.

Determination of PCDF/PCDD in sludges from a drinking water treatment plant influence of chlorination treatment.

PubMed

Rivera, J; Eljarrat, E; Espadaler, I; Martrat, M G; Caixach, J

1997-01-01

A preliminary study to assess the origin and evolution of polichlorodibenzofurans (PCDFs) and polichlorodibenzo-p-dioxins (PCDDs) in a drinking water treatment plant (DWTP) was undertaken. Samples of coagulation sludges and exhausted granular activated carbon (GAC) were collected from a DWTP. Owing to the similar congener profiles obtained from sludges and GAC, a subsequent study of chlorination influence was carried out. Sludge samples from a treatment with and without the chlorination step were analysed. A complementary study of the PCB content was made. The results obtained did not reveal a marked influence of chlorination in the formation of PCDFs/PCDDs.

Aeroelastic characteristics of composite bearingless rotor blades

NASA Technical Reports Server (NTRS)

Bielawa, R. L.

1976-01-01

Owing to the inherent unique structural features of composite bearingless rotors, various assumptions upon which conventional rotor aeroelastic analyses are formulated, are violated. Three such features identified are highly nonlinear and time-varying structural twist, structural redundancy in bending and torsion, and for certain configurations a strongly coupled low frequency bending-torsion mode. An examination of these aeroelastic considerations and appropriate formulations required for accurate analyses of such rotor systems is presented. Also presented are test results from a dynamically scaled model rotor and complementary analytic results obtained with the appropriately reformulated aeroelastic analysis.

Inter-particle interaction dependent evaporation-induced assembly in contact-free micro-colloidal droplets

NASA Astrophysics Data System (ADS)

Sen, Debasis; Biswas, Priyanka; Melo, J. S.

2018-04-01

Evaporation-induced assembly of constituent particles in tiny dispersion droplet allows an efficient way to realize nano-structured micro-granules with potential for various applications. Morphology of the granules, obtained by such one-step dispersion to granular transformation, is decided by several physicochemical conditions. Here we demonstrate that the inter-particle interaction plays a crucial role in deciding the assembled morphology. Resultant granules are investigated by complementary techniques, Electron microscopy and small-angle scattering.

Complementary Density Measurements for the 200W Busek Hall Thruster (PREPRINT)

DTIC Science & Technology

2006-07-12

Hall thruster are presented. Both a Faraday probe and microwave interferometry system are used to examine the density distribution of the thruster plasma at regular spatial intervals. Both experiments are performed in situ under the same conditions. The resulting density distributions obtained from both experiments are presented. Advantages and uncertainties of both methods are presented, as well as how comparison between the two data sets can account for the uncertainties of each method

A combined positron emission tomography (PET)-electron paramagnetic resonance imaging (EPRI) system: initial evaluation of a prototype scanner

NASA Astrophysics Data System (ADS)

Tseytlin, Mark; Stolin, Alexander V.; Guggilapu, Priyaankadevi; Bobko, Andrey A.; Khramtsov, Valery V.; Tseytlin, Oxana; Raylman, Raymond R.

2018-05-01

The advent of hybrid scanners, combining complementary modalities, has revolutionized the application of advanced imaging technology to clinical practice and biomedical research. In this project, we investigated the melding of two complementary, functional imaging methods: positron emission tomography (PET) and electron paramagnetic resonance imaging (EPRI). PET radiotracers can provide important information about cellular parameters, such as glucose metabolism. While EPR probes can provide assessment of tissue microenvironment, measuring oxygenation and pH, for example. Therefore, a combined PET/EPRI scanner promises to provide new insights not attainable with current imagers by simultaneous acquisition of multiple components of tissue microenvironments. To explore the simultaneous acquisition of PET and EPR images, a prototype system was created by combining two existing scanners. Specifically, a silicon photomultiplier (SiPM)-based PET scanner ring designed as a portable scanner was combined with an EPRI scanner designed for the imaging of small animals. The ability of the system to obtain simultaneous images was assessed with a small phantom consisting of four cylinders containing both a PET tracer and EPR spin probe. The resulting images demonstrated the ability to obtain contemporaneous PET and EPR images without cross-modality interference. Given the promising results from this initial investigation, the next step in this project is the construction of the next generation pre-clinical PET/EPRI scanner for multi-parametric assessment of physiologically-important parameters of tissue microenvironments.

Neutral Atomic Emissions from Comet Hale-Bopp

NASA Astrophysics Data System (ADS)

Oliversen, R. J.; Scherb, F.; Roesler, F. L.; Mierkiewicz, E. J.; Woodward, R. C.; Hilton, G. M.; Doane, N. E.

1997-07-01

High resolution (R=100,000) spectra of atomic oxygen, hydrogen, and carbon from Comet Hale-Bopp were obtained at the NSO McMath-Pierce main telescope from February 8 to April 19, 1997, using a 50 mm dual-etalon Fabry-Perot/CCD spectrometer. The field of view was 6 arcmin. Spectra with good signal-to-noise were obtained for the emission lines [O I] 6300 Angstroms, Hα (6563 Angstroms), and [C I] 9850 Angstroms. On several of these nights, complementary [O I] 6300 Angstroms observations were simultaneously obtained with the Wisconsin Hα Mapper (WHα M) at Kitt Peak. Additional [O I] 6300 Angstroms observations were also obtained in September 1996. These [C I] 9850 Angstroms observations are the first extensive data set of this cometary line. We will present an overview of our observations and preliminary results.

Use of complementary and alternative medicine for work related musculoskeletal disorders associated with job contentment in dental professionals: Indian outlook.

PubMed

Gupta, Devanand; Bhaskar, Dara John; Gupta, Kumar Rajendra; Karim, Bushra; Kanwar, Alpana; Jain, Ankita; Yadav, Ankit; Saini, Priya; Arya, Satya; Sachdeva, Neha

2014-04-01

High prevalence rates of work-related musculoskeletal disorders (WRMSD) among dentists have been reported. Complementary and alternative medicine (CAM) therapies can be helpful in managing and preventing work-related musculoskeletal disorders. The purpose of this study was to determine if dental professionals are using CAM for work-related musculoskeletal disorders. Who have greater job satisfaction: dentist who uses Complementary and alternative medicine (CAM) or conventional therapy (CT) as a treatment modality for WRMSD. Dentists who registered in Uttar Pradesh state, India under Indian Dental Council, Uttar Pradesh branch (n=1134) were surveyed. Data were analyzed using univariate and bivariate analyses and logistic regression. A response rate of 53% (n=601) was obtained, revealing that 82% (n=487) of the respondents suffered from work-related musculoskeletal disorders. The use of complementary and alternative medicine or conventional therapy was reported among 80% (n=390) of the dentists with work-related musculoskeletal disorders. Complementary and alternative medicine users reported greater overall health compared to conventional therapy users (P<0.001). Of those with work-related musculoskeletal disorders, 35.5% (n=172) considered a career change for once, and 4.0% (n=19) reported having left dentistry. Complementary and alternative medicine therapies may improve quality of life, reduce work disruptions and enhance job satisfaction for dentists who suffer from work-related musculoskeletal disorders. It is important that dentists incorporate complementary and alternative medicine strategies into practice to facilitate musculoskeletal health that will enable longer and healthier careers, increase productivity, provide safer workplace and prevent musculoskeletal disorders.

Integrating multiple molecular sources into a clinical risk prediction signature by extracting complementary information.

PubMed

Hieke, Stefanie; Benner, Axel; Schlenl, Richard F; Schumacher, Martin; Bullinger, Lars; Binder, Harald

2016-08-30

High-throughput technology allows for genome-wide measurements at different molecular levels for the same patient, e.g. single nucleotide polymorphisms (SNPs) and gene expression. Correspondingly, it might be beneficial to also integrate complementary information from different molecular levels when building multivariable risk prediction models for a clinical endpoint, such as treatment response or survival. Unfortunately, such a high-dimensional modeling task will often be complicated by a limited overlap of molecular measurements at different levels between patients, i.e. measurements from all molecular levels are available only for a smaller proportion of patients. We propose a sequential strategy for building clinical risk prediction models that integrate genome-wide measurements from two molecular levels in a complementary way. To deal with partial overlap, we develop an imputation approach that allows us to use all available data. This approach is investigated in two acute myeloid leukemia applications combining gene expression with either SNP or DNA methylation data. After obtaining a sparse risk prediction signature e.g. from SNP data, an automatically selected set of prognostic SNPs, by componentwise likelihood-based boosting, imputation is performed for the corresponding linear predictor by a linking model that incorporates e.g. gene expression measurements. The imputed linear predictor is then used for adjustment when building a prognostic signature from the gene expression data. For evaluation, we consider stability, as quantified by inclusion frequencies across resampling data sets. Despite an extremely small overlap in the application example with gene expression and SNPs, several genes are seen to be more stably identified when taking the (imputed) linear predictor from the SNP data into account. In the application with gene expression and DNA methylation, prediction performance with respect to survival also indicates that the proposed approach might work well. We consider imputation of linear predictor values to be a feasible and sensible approach for dealing with partial overlap in complementary integrative analysis of molecular measurements at different levels. More generally, these results indicate that a complementary strategy for integrating different molecular levels can result in more stable risk prediction signatures, potentially providing a more reliable insight into the underlying biology.

Displacement coefficients along the inner boundaries of radially cracked ring segments subject to forces and couples

NASA Technical Reports Server (NTRS)

Gross, B.

1978-01-01

Displacement results of plane boundary collocation analysis are given for various locations on the inner boundaries of radially cracked ring segments (C-shaped specimens) subject to two complementary types of loading. Results are presented for ratios of outer to inner radius in the range of 1.1 to 2.5 and ratios a/W in the range 0.1 to 0.8, where a is the crack length for a specimen of wall thickness W. By combination of these results the resultant displacement coefficient or the corresponding influence coefficient can be obtained for any practical load line location of a pin-loaded specimen.

Chemical constituents and their acetyl cholinesterase inhibitory and antioxidant activities from leaves of Acanthopanax henryi: potential complementary source against Alzheimer's disease.

PubMed

Zhang, Xiao Dan; Liu, Xiang Qian; Kim, Yang Hee; Whang, Wan Kyunn

2014-05-01

The aim of this study was to investigate chemical constituents of the leaves of Acanthopanax henryi, and their antioxidant, acetyl cholinesterase inhibitory activities. Caffeoyl quinic acid derivates and flavonoids were obtained from A. henry, through column chromatography technologies, and the content of major constituents was determined by the HPLC-UV method. Anti-oxidant activity of the isolated metabolites was evaluated by free radical scavenging (DPPH, ABTS radicals) and superoxide anion scavenging. The results showed that di-caffeoyl quinic acid derivates had stronger antioxidant activity than positive controls (ascorbic acid, trolox and allopurinol). Acetyl cholinesterase inhibitory activity was estimated on the constituents, among which, quercetin, 4-caffeoyl-quinic acid and 4,5-caffeoyl quinic acid were found to have strong acetyl cholinesterase inhibitory activity with IC50 values ranging from 62.6 to 121.9 μM. The present study showed that some of the tested constituents from the leaves of A. henryi exhibit strong antioxidant and acetyl cholinesterase inhibitory effects. This suggest that the leaves of A. henryi can be used as a new natural complementary source of acetyl cholinesterase inhibitors and anti-oxidant agents, thus being a promising potential complementary source against Alzheimer's disease.

Anti-complementary activity of enzyme-treated traditional Korean rice wine (Makgeolli) hydrolysates.

PubMed

Bae, Song Hwan; Choi, Jang Won; Ra, Kyung Soo; Yu, Kwang-Won; Shin, Kwang-Soon; Park, Sung Sun; Suh, Hyung Joo

2012-06-01

Makgeolli brewed from rice contains about 150 g kg(-1) alcohol and has a fragrance as well as an acidic and sweet taste. During the brewing process, by-products such as rice bran and brewery cake are produced. At the end of fermentation the matured mash is transferred to a filter cloth and the Makgeolli is squeezed out from the cake, leaving the lees of the mash. These by-products have continued to increase every year, resulting in an ecological problem. It is therefore important to develop new uses for them. The objective of this study was to use the by-products from the brewing of Makgeolli as a valuable functional food or nutraceutical. The anti-complementary activities of crude polysaccharides isolated from Cytolase hydrolysates of Makgeolli lees at concentrations of 1000 and 500 µg mL(-1) were 84.15 and 78.70% respectively. The activity of polysaccharide krestin (PSK) was 60.00% at 1000 µg mL(-1). The active polysaccharide obtained with Cytolase comprised mainly glucose and mannose (molar ratio 1.00:0.62). Glucose- and mannose-rich crude polysaccharides were isolated from the Cytolase hydrolysate of Makgeolli lees. The polysaccharides retain anti-complementary activity to enhance the immune system as a functional food or nutraceutical. Copyright © 2011 Society of Chemical Industry.

Hyperspectral Analysis of Soil Total Nitrogen in Subsided Land Using the Local Correlation Maximization-Complementary Superiority (LCMCS) Method.

PubMed

Lin, Lixin; Wang, Yunjia; Teng, Jiyao; Xi, Xiuxiu

2015-07-23

The measurement of soil total nitrogen (TN) by hyperspectral remote sensing provides an important tool for soil restoration programs in areas with subsided land caused by the extraction of natural resources. This study used the local correlation maximization-complementary superiority method (LCMCS) to establish TN prediction models by considering the relationship between spectral reflectance (measured by an ASD FieldSpec 3 spectroradiometer) and TN based on spectral reflectance curves of soil samples collected from subsided land which is determined by synthetic aperture radar interferometry (InSAR) technology. Based on the 1655 selected effective bands of the optimal spectrum (OSP) of the first derivate differential of reciprocal logarithm ([log{1/R}]'), (correlation coefficients, p < 0.01), the optimal model of LCMCS method was obtained to determine the final model, which produced lower prediction errors (root mean square error of validation [RMSEV] = 0.89, mean relative error of validation [MREV] = 5.93%) when compared with models built by the local correlation maximization (LCM), complementary superiority (CS) and partial least squares regression (PLS) methods. The predictive effect of LCMCS model was optional in Cangzhou, Renqiu and Fengfeng District. Results indicate that the LCMCS method has great potential to monitor TN in subsided lands caused by the extraction of natural resources including groundwater, oil and coal.

Martian carbon dioxide: Clues from isotopes in SNC meteorites

NASA Technical Reports Server (NTRS)

Karlsson, H. R.; Clayton, R. N.; Mayeda, T. K.; Jull, A. J. T.; Gibson, E. K., Jr.

1993-01-01

Attempts to unravel the origin and evolution of the atmosphere and hydrosphere on Mars from isotopic data have been hampered by the impreciseness of the measurements made by the Viking Lander and by Earth-based telescopes. The SNC meteorites which are possibly pieces of the Martian surface offer a unique opportunity to obtain more precise estimates of the planet's volatile inventory and isotopic composition. Recently, we reported results on oxygen isotopes of water extracted by pyrolysis from samples of Shergotty, Zagami, Nakhla, Chassigny, Lafayette, and EETA-79001. Now we describe complementary results on the stable isotopic composition of carbon dioxide extracted simultaneously from those same samples. We will also report on C-14 abundances obtained by accelerator mass spectrometry (AMS) for some of these CO2 samples.

How effective are spiritual care and body manipulation therapies in pediatric oncology? A systematic review of the literature.

PubMed

Poder, Thomas G; Lemieux, Renald

2013-12-10

The effects of cancer and associated treatments have a considerable impact on the well-being and quality of life of pediatric oncology patients. To support children and their families, complementary and alternative medicines are seen by nurses and doctors as practical to integrate to the services offered by hospitals. The purpose of this paper is to examine if the practice of complementary and alternative medicine, specifically spiritual care and treatments based on body manipulation, is likely to improve the health and well-being of children suffering from cancer. This objective is achieved through a systematic review of the literature. The level of evidence associated with each practice of complementary and alternative medicine was assessed according to the methodological design used by the studies reviewed. Studies reviewed are of a methodological quality that could be described as fair due to the small sample size of patients and the existence of a number of biases in the conduct and analysis of these studies. However, results obtained are consistent from one study to another, allowing us to make certain recommendations. It is thus advisable to consider the introduction of hypnotherapy in pediatric oncology services. Based on the data collected, it is the complementary and alternative medicine with the most evidence in favor of effectiveness of the well-being of pediatric oncology patients, especially during painful procedures. It is also recommended to use art therapy and music therapy. Conversely, too little evidence is present to be able to recommend the use of acupuncture, chiropractic or osteopathy.

Modeling the Behavior of an Underwater Acoustic Relative Positioning System Based on Complementary Set of Sequences

PubMed Central

Aparicio, Joaquín; Jiménez, Ana; Álvarez, Fernando J.; Ureña, Jesús; De Marziani, Carlos; Diego, Cristina

2011-01-01

The great variability usually found in underwater media makes modeling a challenging task, but helpful for better understanding or predicting the performance of future deployed systems. In this work, an underwater acoustic propagation model is presented. This model obtains the multipath structure by means of the ray tracing technique. Using this model, the behavior of a relative positioning system is presented. One of the main advantages of relative positioning systems is that only the distances between all the buoys are needed to obtain their positions. In order to obtain the distances, the propagation times of acoustic signals coded by Complementary Set of Sequences (CSS) are used. In this case, the arrival instants are obtained by means of correlation processes. The distances are then used to obtain the position of the buoys by means of the Multidimensional Scaling Technique (MDS). As an early example of an application using this relative positioning system, a tracking of the position of the buoys at different times is performed. With this tracking, the surface current of a particular region could be studied. The performance of the system is evaluated in terms of the distance from the real position to the estimated one. PMID:22247661

Complementary use of PIXE-alpha and XRF portable systems for the non-destructive and in situ characterization of gemstones in museums

NASA Astrophysics Data System (ADS)

Pappalardo, L.; Karydas, A. G.; Kotzamani, N.; Pappalardo, G.; Romano, F. P.; Zarkadas, Ch.

2005-09-01

Gemstones on gold Hellenistic (late 4th century BC, 1st AD) jewelry, exhibited at the Benaki Museum of Athens, were analyzed in situ by means of two non-destructive and portable analytical techniques. The composition of major and minor elements was determined using a new portable PIXE-alpha spectrometer. The analytical features of this spectrometer allow the determination of matrix elements from Na to Zn through the K-lines and the determination of higher atomic number elements via the L- or M-lines. The red stones analyzed were revealed as red garnets, displaying a compositional range from Mg-rich garnet to Fe-rich garnet. The complementary use of a portable XRF spectrometer provided additional information on some trace elements (Cr and Y), which are considered to be important for the chemical separation between different garnet groups. A comparison of our results with recent literature data offers useful indications about the possible geographical provenance of the stones. The analytical techniques, their complementarity and the results obtained are presented and discussed.

Potential role of IgG avidity for diagnosing toxoplasmosis.

PubMed Central

Joynson, D H; Payne, R A; Rawal, B K

1990-01-01

Sera from 20 cases of toxoplasmic lymphadenopathy were examined by an enzyme linked immunosorbent assay toxoplasma IgG avidity (ELISA) at two laboratories. The results obtained were largely in agreement and showed that sera from patients with acute infection had low avidity IgG (30% or less), whereas sera from patients with chronic infection had high avidity IgG (40% or more). It is suggested that this type of assay could have a useful complementary role in antenatal testing for toxoplasmosis. PMID:2132560

Potential role of IgG avidity for diagnosing toxoplasmosis.

PubMed

Joynson, D H; Payne, R A; Rawal, B K

1990-12-01

Sera from 20 cases of toxoplasmic lymphadenopathy were examined by an enzyme linked immunosorbent assay toxoplasma IgG avidity (ELISA) at two laboratories. The results obtained were largely in agreement and showed that sera from patients with acute infection had low avidity IgG (30% or less), whereas sera from patients with chronic infection had high avidity IgG (40% or more). It is suggested that this type of assay could have a useful complementary role in antenatal testing for toxoplasmosis.

The polarimeter and the multispectral radiometer as remote probes of aerosols

NASA Technical Reports Server (NTRS)

Kuriyan, J. G.

1975-01-01

Attempts made to establish the viability of the polarimeter as a ground based remote probe of atmospheric aerosols under varying meteorological conditions are reported. Extension radiometer data are also given and a comparison was made with polarimeter data to determine if one could complement/supplement the other. The analyses show that the two instruments are complementary devices and any information obtained from one will greatly facilitate the analysis of the other. Detailed results are given in graphical form.

Study of flexural rigidity of weavable powder-coated towpreg

NASA Technical Reports Server (NTRS)

Hirt, Douglas E.; Marchello, Joseph M.; Baucom, Robert M.

1990-01-01

An effort has been made to weave powder-impregnated tow into a two-dimensional preform, controlling process variables to obtain high flexural rigidity in the warp direction and greater flexibility in the fill direction. The resulting prepregs have been consolidated into laminates with LaRC-TPI matrices. Complementary SEM and DSC studies have been performed to deepen understanding of the relationship between tow flexibility and heat treatment. Attention is also given to the oven temperature and residence time variables' effects on power/fiber fusion.

Indigenous food ingredients for complementary food formulations to combat infant malnutrition in Benin: a review.

PubMed

Chadare, Flora J; Madode, Yann E; Fanou-Fogny, Nadia; Kindossi, Janvier M; Ayosso, Juvencio Og; Honfo, S Hermann; Kayodé, Ap Polycarpe; Linnemann, Anita R; Hounhouigan, D Joseph

2018-01-01

This paper reviews indigenous Beninese food resources as potential ingredients for complementary infant foods with the aim to develop affordable formulations for low-income households in each agro-ecological zone of the country. Potential ingredients were selected on their documented nutritional value. The selected foods encompass 347 food resources, namely 297 plant products from home gardens or collected from natural vegetation and 50 animals, either domesticated or from the wild. The compiled data reveal that the distribution of the available food resources was unbalanced between agro-ecological zones. Only a few animal ingredients are obtainable in northern Benin. Most resources are seasonal, but their availability may be extended. A high variation was observed in energy and nutrient contents. Antinutritional factors were identified in some resources, but processing techniques were reported to reduce their presence in meals. In general, ingredients from local tree foods (Adansonia digitata, Parkia biglobosa) were adequate as sources of nutrients for complementary infant foods. Based on this review, local foods for the development of complementary food formulas for Beninese infants and children may be selected for each agro-ecological zone. The approach used is exemplary for other sub-Saharan African countries in need of complementary infant foods. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

Complementary nonparametric analysis of covariance for logistic regression in a randomized clinical trial setting.

PubMed

Tangen, C M; Koch, G G

1999-03-01

In the randomized clinical trial setting, controlling for covariates is expected to produce variance reduction for the treatment parameter estimate and to adjust for random imbalances of covariates between the treatment groups. However, for the logistic regression model, variance reduction is not obviously obtained. This can lead to concerns about the assumptions of the logistic model. We introduce a complementary nonparametric method for covariate adjustment. It provides results that are usually compatible with expectations for analysis of covariance. The only assumptions required are based on randomization and sampling arguments. The resulting treatment parameter is a (unconditional) population average log-odds ratio that has been adjusted for random imbalance of covariates. Data from a randomized clinical trial are used to compare results from the traditional maximum likelihood logistic method with those from the nonparametric logistic method. We examine treatment parameter estimates, corresponding standard errors, and significance levels in models with and without covariate adjustment. In addition, we discuss differences between unconditional population average treatment parameters and conditional subpopulation average treatment parameters. Additional features of the nonparametric method, including stratified (multicenter) and multivariate (multivisit) analyses, are illustrated. Extensions of this methodology to the proportional odds model are also made.

Introduction of inappropriate complementary feeding in the first year of life and associated factors in children with low socioeconomic status.

PubMed

Dallazen, Camila; Silva, Sara Araújo da; Gonçalves, Vivian Siqueira Santos; Nilson, Eduardo Augusto Fernandes; Crispim, Sandra Patricia; Lang, Regina Maria Ferreira; Moreira, Júlia Dubois; Tietzmann, Daniela Cardoso; Vítolo, Márcia Regina

2018-02-19

The study aimed to identify factors associated with the introduction of inappropriate complementary feeding in the first year of life in children living in municipalities (counties) with low socioeconomic statusl. This was a cross-sectional multicenter study in 1,567 children 12 to 59 months of age in 48 municipalities participating in the Brazil Without Poverty plan in the South of Brazil. A structured questionnaire was applied to the children's parents to obtain socio-demographic information and the age at which inappropriate complementary foods were introduced for the first time in complementary feeding. Prevalence of introduction of sugar before four months of age was 35.5% (n = 497; 95%CI: 33.1-38.0). The prevalence rates for the introduction of cookies/crackers, creamy yogurt, and jelly before six months of age were 20.4% (n = 287; 95%CI: 18.3-22.3), 24.8% (n = 349; 95%CI: 22.4-27.1), and 13.8% (n = 192; 95%CI: 12.0-15.7), respectively. Associations were identified between low maternal schooling (PR = 1.25; 95%CI: 1.03-1.51) and low monthly family income (PR = 1.22; CI95%: 1.01-1.48) and the introduction of inappropriate complementary feeding. The study identified the introduction of inappropriate complementary feeding in the first year of life among children in municipalities with high socioeconomic vulnerability in the South of Brazil, associated with low maternal schooling and low monthly family income.

Three dimensional-stacked complementary thin-film transistors using n-type Al:ZnO and p-type NiO thin-film transistors.

PubMed

Lee, Ching-Ting; Chen, Chia-Chi; Lee, Hsin-Ying

2018-03-05

The three dimensional inverters were fabricated using novel complementary structure of stacked bottom n-type aluminum-doped zinc oxide (Al:ZnO) thin-film transistor and top p-type nickel oxide (NiO) thin-film transistor. When the inverter operated at the direct voltage (V DD ) of 10 V and the input voltage from 0 V to 10 V, the obtained high performances included the output swing of 9.9 V, the high noise margin of 2.7 V, and the low noise margin of 2.2 V. Furthermore, the high performances of unskenwed inverter were demonstrated by using the novel complementary structure of the stacked n-type Al:ZnO thin-film transistor and p-type nickel oxide (NiO) thin-film transistor.

Vitamin D toxicity of dietary origin in cats fed a natural complementary kitten food

PubMed Central

Crossley, Victoria J; Bovens, Catherine PV; Pineda, Carmen; Hibbert, Angie; Finch, Natalie C

2017-01-01

Case series summary This case series describes two young sibling cats and an additional unrelated cat, from two separate households, that developed hypercalcaemia associated with hypervitaminosis D. Excessive vitamin D concentrations were identified in a natural complementary tinned kitten food that was fed to all three cats as part of their diet. In one of the cases, there was clinical evidence of soft tissue mineralisation. The hypercalcaemia and soft tissue mineralisation resolved following withdrawal of the affected food and medical management of the hypercalcaemia. Relevance and novel information This case series demonstrates the importance of obtaining a thorough dietary history in patients presenting with hypercalcaemia and the measurement of vitamin D metabolites when investigating such cases. Complementary foods may have the potential to induce nutritional toxicity even when fed with complete, nutritionally balanced diets. PMID:29270305

Complementary and alternative medicine usage and its determinant factors among Iranian infertile couples.

PubMed

Dehghan, Mahlagha; Mokhtarabadi, Sima; Heidari, Fatemeh Ghaedi

2018-04-04

Background The aim of this study was to determine the status of utilizing some complementary and alternative medicine techniques in infertile couples. Methods This was a cross-sectional study conducted on 250 infertile couples referred to a hospital in Kerman using convenience sampling. A researcher-made questionnaire was used to study the prevalence and user satisfaction of complementary and alternative medicines. Results Results indicated that 49.6% of the infertile couples used at least one of the complementary and alternative medicines during the past year. Most individuals used spiritual techniques (71.8% used praying and 70.2% used Nazr) and medicinal plants (54.8%). Safety is the most important factor affecting the satisfaction of infertile couples with complementary treatments (couples think that such treatments are safe (54.8%)). Discussion Concerning high prevalence of complementary and alternative treatments in infertile couples, incorporating such treatments into the healthcare education and promoting the awareness of infertile individuals seem crucial.

Investigation of InP/InGaAs metamorphic co-integrated complementary doping-channel field-effect transistors for logic application

NASA Astrophysics Data System (ADS)

Tsai, Jung-Hui

2014-01-01

DC performance of InP/InGaAs metamorphic co-integrated complementary doping-channel field-effect transistors (DCFETs) grown on a low-cost GaAs substrate is first demonstrated. In the complementary DCFETs, the n-channel device was fabricated on the InxGa1-xP metamorphic linearly graded buffer layer and the p-channel field-effect transistor was stacked on the top of the n-channel device. Particularly, the saturation voltage of the n-channel device is substantially reduced to decrease the VOL and VIH values attributed that two-dimensional electron gas is formed and could be modulated in the n-InGaAs channel. Experimentally, a maximum extrinsic transconductance of 215 (17) mS/mm and a maximum saturation current density of 43 (-27) mA/mm are obtained in the n-channel (p-channel) device. Furthermore, the noise margins NMH and NML are up to 0.842 and 0.330 V at a supply voltage of 1.5 V in the complementary logic inverter application.

Purification and characterization of complement-activating acidic polysaccharides from the fruits of Capsicum annuum.

PubMed

Paik, Soon-Young; Ra, Kyung Soo; Chang, In Seop; Park, Yoon Chang; Park, Hee Sung; Baik, Hyung Suk; Yun, Jong Won; Choi, Jang Won

2003-03-31

Hot water-soluble crude polysaccharide (HCAP-0) that was obtained from the fruits of Capsicum annuum showed potent anti-complementary activity. The activity was unchanged by pronase digestion, but decreased by periodate oxidation. The HCAP-0 was fractionated by DEAE ion-exchange chromatography to give two major fractions, HCAP-II and III. These two fractions were finally purified by gel filtration to give HCAP-IIa, HCAPIIIa1, and IIIa2 fractions that had high anti-complementary activities. The HCAP-IIIa1 and IIIa2 consisted of homogeneous polysaccharides. The anti-complementary activities were unaffected by treatment with polymyxin B, indicating that the modes of complement activation were not due to preexisting lipopolysaccharide. The molecular weight and sugar content of HCAP-IIIa2 had potent anti-complementary activity. The highest yields were 55 kDa and 75.9%, and the molar ratio of galactose (Ara:Gal, 1.0:4.6) was higher than other sugars. The crossed immuno-electrophoresis showed that both classical and alternative pathways were activated by HCAP-IIIa2.

Complementary and Alternative Medicine Use and Adherence to Asthma Medications among Latino and Non-Latino White Families

PubMed Central

McQuaid, Elizabeth L.; Fedele, David A.; Adams, Sue K.; Koinis-Mitchell, Daphne; Mitchell, Jessica; Kopel, Sheryl J.; Seifer, Ronald; Jandasek, Barbara; Fritz, Gregory K.; Canino, Glorisa

2013-01-01

Objective The current study sought to evaluate patterns of complementary and alternative medicine (CAM) use in a sample of Latino and Non-Latino white (NLW) children with asthma, to determine whether parental beliefs about conventional medications and barriers to obtaining these medications were related to CAM use, and to assess whether CAM use was associated with decreased adherence to controller medications. Methods Participants included 574 families of children with asthma from Non-Latino White, Puerto Rican, and Dominican backgrounds from RI and from Island Puerto Rico. All parents completed a brief checklist of barriers to medication use and an assessment of CAM approaches. A subsample of 259 families had controller medication use monitored objectively for approximately one month by MDILog (fluticasone propionate), TrackCap (montelukast), or dosage counter (fluticasone/salmeterol combination). Results Prevalence of CAM use was high among Latino families. Perceived barriers to obtaining medication were related to increased CAM use in Puerto Rican families from RI. Elevated medication concerns were positively associated with CAM use among NLW and Island PR families. CAM use was positively related to objective adherence within NLW families, and unrelated in other groups. Conclusions CAM use is common among Latino families with asthma. Among some families, CAM use may be initiated as a way to cope with barriers to obtaining medication or when parents have concerns about conventional medications. Families who report CAM use do not appear to be substituting CAM for conventional asthma medication. PMID:24602583

Jet Mixing Enhancement by Feedback Control

NASA Technical Reports Server (NTRS)

Glauser, Mark; Taylor, Jeffrey

1999-01-01

The objective of this work has been to produce methodologies for high speed jet noise reduction based on natural mechanisms and enhanced feedback control to affect frequencies and structures in a prescribed manner. In this effort the two-point hot wire measurements obtained in the Langley jet facility by Ukeiley were used in conjuction with linear stochastic estimation (LSE) to implement the LSE component of the complementary technique. This method combines the Proper Orthogonal Decomposition (POD) and LSE to provide an experimental low dimensional time dependent description of the flow field. From such a description it should be possible to identify short time high strain rate events in the jet which contribute to the noise. The main task completed for this effort is summarized: LSE experiments were performed at the downstream locations where the two point hot wire measurements have been obtained by Ukeiley. These experiments involved sampling simultaneously hot wire signals from a relatively course spatial grid in gamma and theta. From this simultaneous data, coupled with the two-point measurements of Ukeiley via the LSE components of the complementary technique, an experimental low dimensional description of the jet at 4, 5, 6, 7 and 8 diameters downstream was obtained for Mach numbers of 0.3 and 0.6. We first present an overview of the theory involved. We finish up with a statement of the work performed and finally provide charts from a 1999 APS talk which summarizes the results.

The Use of Complementary and Alternative Medicine in a General Population in South Korea: Results from a National Survey in 2006

PubMed Central

Ock, Sun Myeong; Choi, Jun Yeong; Cha, Young Soo; Lee, JungBok; Huh, Chang Hun; Lee, Soon Young; Lee, Sung Jae

2009-01-01

The purpose of this survey was to obtain information on the prevalence, costs, and patterns of use of complementary and alternative medicine (CAM) in a general population in the Republic of Korea. In 2006, we conducted nationwide and population-weighted personal interviews with 6,021 adults ranging from 30 to 69 yr of age; the final sample consisted of 3,000 people with a 49.8% response rate. In addition to their general socio-demographics, the respondents were asked about their use of CAM during the previous 12-month period, costs, sources of information, and reasons for use. The prevalence of use overall was 74.8%, while biologically based CAM therapies were the most likely type of use (65.4%). The median annual out-of-pocket expenditures for CAM therapies was about US$203. The primary reason for using CAM was for disease prevention and health promotion (78.8%). The main source of advice about CAM therapies use was most likely to be from family and friends (66.9%). Our study suggests that CAM use has been and continues to be very popular in South Korea. Conventional western medical doctors and governments should obtain more evidence and become more interested in CAM therapies. PMID:19270805

ICT, complementary investment, and firm performance in China

NASA Astrophysics Data System (ADS)

Sun, Linlin; Ding, Juan; Fan, Maoqing

2011-12-01

Using China firm data about ICT, we provide some insight into the link between ICT, productivity and complementary investment. The results show that the contribution of ICT capital deepening is raised when firms combine ICT use and some complementary investment (human capital, innovation and organization change).

American Academy of Pediatrics. The use of complementary and alternative medicine in pediatrics.

PubMed

Kemper, Kathi J; Vohra, Sunita; Walls, Richard

2008-12-01

The American Academy of Pediatrics is dedicated to optimizing the well-being of children and advancing family-centered health care. Related to these goals, the American Academy of Pediatrics recognizes the increasing use of complementary and alternative medicine in children and, as a result, the need to provide information and support for pediatricians. From 2000 to 2002, the American Academy of Pediatrics convened and charged the Task Force on Complementary and Alternative Medicine to address issues related to the use of complementary and alternative medicine in children and to develop resources to educate physicians, patients, and families. One of these resources is this report describing complementary and alternative medicine services, current levels of utilization and financial expenditures, and associated legal and ethical considerations. The subject of complementary and alternative medicine is large and diverse, and consequently, an in-depth discussion of each method of complementary and alternative medicine is beyond the scope of this report. Instead, this report will define terms; describe epidemiology; outline common types of complementary and alternative medicine therapies; review medicolegal, ethical, and research implications; review education and training for complementary and alternative medicine providers; provide resources for learning more about complementary and alternative medicine; and suggest communication strategies to use when discussing complementary and alternative medicine with patients and families.

Ground Characterization Studies in Canakkale Pilot Site of LIQUEFACT Project

NASA Astrophysics Data System (ADS)

Ozcep, F.; Oztoprak, S.; Aysal, N.; Bozbey, I.; Tezel, O.; Ozer, C.; Sargin, S.; Bekin, E.; Almasraf, M.; Cengiz Cinku, M.; Ozdemir, K.

2017-12-01

The our aim is to outline the ground characterisation studies in Canakkale test site. Study is based on the EU H2020 LIQUEFACT project entitled "Liquefact: Assessment and mitigation of liquefaction potential across Europe: a holistic approach to protect structures / infrastructures for improved resilience to earthquake-induced liquefaction disasters". Objectives and extent of ground characterization for Canakkale test site includes pre-existing soil investigation studies and complementary field studies. There were several SPT and geophysical tests carried out in the study area. Within the context of the complementary tests, six (6) study areas in the test site were chosen and complementary tests were carried out in these areas. In these areas, additional boreholes were opened and SPT tests were performed. It was decided that additional CPT (CPTU and SCPT) and Marchetti Dilatometer (DMT) tests should be carried out within the scope of the complementary testing. Seismic refraction, MASW and micro tremor measurements had been carried out in pre-existing studies. Shear wave velocities obtained from MASW measurements were evaluated to the most rigorous level. These tests were downhole seismic, PS-logging, seismic refraction, 2D-ReMi, MASW, micro tremor (H/V Nakamura method), 2D resistivity and resonance acoustic profiling (RAP). RAP is a new technique which will be explained briefly in the relevant section. Dynamic soil properties had not been measured in pre-existing studies, therefore these properties were investigated within the scope of the complementary tests. Selection of specific experimental tests of the complementary campaign was based on cost-benefit considerations Within the context of complementary field studies, dynamic soil properties were measured using resonant column and cyclic direct shear tests. Several sieve analyses and Atterberg Limits tests which were documented in the pre-existing studies were evaluated. In the complementary study carried out, additional sieve analyses and Atterberg Limit tests were carried out. It was aimed to make some correlations between geophysical measurements and other field measurements; such as SPT, blow count values.

Transport coefficients of dense fluids composed of globular molecules. Equilibrium molecular dynamics investigations using more-center Lennard-Jones potentials

NASA Astrophysics Data System (ADS)

Hoheisel, C.

1988-09-01

Equilibrium molecular dynamics calculations with constraints have been performed for model liquids SF6 and CF4. The computations were carried out with four- and six-center Lennard-Jones potentials and up to 2×105 integration steps. Shear, bulk viscosity and the thermal conductivity have been calculated with use of Green-Kubo relations in the formulation of ``molecule variables.'' Various thermodynamic states were investigated. For SF6, a detailed comparison with experimental data was possible. For CF4, the MD results could only be compared with experiment for one liquid state. For the latter liquid, a complementary comparison was performed using MD results obtained with a one-center Lennard-Jones potential. A limited test of the particle number dependence of the results is presented. Partial and total correlations functions are shown and discussed with respect to findings obtained for the one-center Lennard-Jones liquid.

Discovering hidden biodiversity: the use of complementary monitoring of fish diet based on DNA barcoding in freshwater ecosystems.

PubMed

Jo, Hyunbin; Ventura, Marc; Vidal, Nicolas; Gim, Jeong-Soo; Buchaca, Teresa; Barmuta, Leon A; Jeppesen, Erik; Joo, Gea-Jae

2016-01-01

Ecological monitoring contributes to the understanding of complex ecosystem functions. The diets of fish reflect the surrounding environment and habitats and may, therefore, act as useful integrating indicators of environmental status. It is, however, often difficult to visually identify items in gut contents to species level due to digestion of soft-bodied prey beyond visual recognition, but new tools rendering this possible are now becoming available. We used a molecular approach to determine the species identities of consumed diet items of an introduced generalist feeder, brown trout (Salmo trutta), in 10 Tasmanian lakes and compared the results with those obtained from visual quantification of stomach contents. We obtained 44 unique taxa (OTUs) belonging to five phyla, including seven classes, using the barcode of life approach from cytochrome oxidase I (COI). Compared with visual quantification, DNA analysis showed greater accuracy, yielding a 1.4-fold higher number of OTUs. Rarefaction curve analysis showed saturation of visually inspected taxa, while the curves from the DNA barcode did not saturate. The OTUs with the highest proportions of haplotypes were the families of terrestrial insects Formicidae, Chrysomelidae, and Torbidae and the freshwater Chironomidae. Haplotype occurrence per lake was negatively correlated with lake depth and transparency. Nearly all haplotypes were only found in one fish gut from a single lake. Our results indicate that DNA barcoding of fish diets is a useful and complementary method for discovering hidden biodiversity.

Potential of mean force of DNA guided assemblies past Debye-Hückel regime

NASA Astrophysics Data System (ADS)

Girard, Martin; Seo, Soyoung; Li, Yaohua; Mirkin, Chad; Olvera de La Cruz, Monica

Many of the bioinspired systems make use of biopolymers such as polypeptides or DNA. The latter is widely used in self-assembled systems, from colloidal crystals to origami construction. In these systems, salt is commonly required to screen the electrostatic repulsion between the strands. In the classical Debye-Hückel picture, salt ions are point particles and the screening distance is a decreasing monotonic function of salt concentration. This picture breaks down at moderate salt concentrations, where the behavior becomes non-monotonic. In this talk, we will show results for potential of mean force of DNA grafted colloids obtained through multiscale molecular dynamics. In this picture, the highly charged DNA causes non-trivial behavior at moderate salt concentrations (c 0 . 3 - 0 . 7 M), namely increase of repulsion for non-complementary DNA strands while repulsion decreases for complementary strands. We will show spatial cluster distribution as function of size and charge as well as implications for experimental systems.

Fusion of 4D echocardiography and cine cardiac magnetic resonance volumes using a salient spatio-temporal analysis

NASA Astrophysics Data System (ADS)

Atehortúa, Angélica; Garreau, Mireille; Romero, Eduardo

2017-11-01

An accurate left (LV) and right ventricular (RV) function quantification is important to support evaluation, diagnosis and prognosis of cardiac pathologies such as the cardiomyopathies. Currently, diagnosis by ultrasound is the most cost-effective examination. However, this modality is highly noisy and operator dependent, hence prone to errors. Therefore, fusion with other cardiac modalities may provide complementary information and improve the analysis of the specific pathologies like cardiomyopathies. This paper proposes an automatic registration between two complementary modalities, 4D echocardiography and Magnetic resonance images, by mapping both modalities to a common space of salience where an optimal registration between them is estimated. The obtained matrix transformation is then applied to the MRI volume which is superimposed to the 4D echocardiography. Manually selected marks in both modalities are used to evaluate the precision of the superimposition. Preliminary results, in three evaluation cases, show the distance between these marked points and the estimated with the transformation is about 2 mm.

Thesis survey results in the field of nursing regarding the use of complementary and alternative medical treatments in Turkey.

PubMed

Arslan, Gulsah Gurol; Denat, Yildiz; Dikmen, Yurdanur

2017-09-01

This descriptive literature review was planned to identify the prevalence of Complementary and Alternative Medicine (CAM) usage, frequency of usage, types/fields of use in master's theses and PhD dissertations based on the CAM methods, which are commonly used in nursing practice in Turkey. Data was collected in Turkey from February to March 2014 through a review of the National Thesis Centre (NTC) Archives at the Chairmanship of the Council of Higher Education and by obtaining the nursing theses/dissertations on CAM done between 1996 and 2013. Data were analysed by distribution of frequencies and percentages for publication year, number in sampling, method, case group, CAM type, and purpose of use/effectiveness. A total of 88 theses/dissertations were located. It was found that a majority of the theses/dissertations investigated were interventional. Investigation of the purpose of CAM use in theses/dissertations showed that the studies examined the effects of CAM on symptom control.

Analyzing the research in Integrative & Complementary Medicine by means of science mapping.

PubMed

Moral-Muñoz, J A; Cobo, M J; Peis, E; Arroyo-Morales, M; Herrera-Viedma, E

2014-04-01

The research in the Complementary and Alternative Medicine (CAM) field is analyzed according to the journals indexed in ISI Web of Science. Science Mapping Analysis (SMA) is used to provide and overview of the conceptual evolution of the CAM field. The software SciMAT is used to detect and visualize the hidden themes and their evolution over a consecutive span of years. It combines SMA and performance analysis. Twenty one journals related to CAM were analyzed, in four consecutive periods from 1974 to 2011. Strategic diagrams and the thematic evolution of CAM, together with performance indicators (h-index), were obtained. The results show that CAM research has focused on seven main thematic areas: MEDICINAL-PLANTS, CHIROPRACTIC-AND-LOW-BACK-PAIN, ACUPUNCTURE-AND-PAIN, CELL-PROCESSES-AND-DISEASES, LIPID-PEROXIDATION and DIABETES-AND-INSULIN. The research output could be used by the scientific community to identify thematic areas on which interest is focused. Copyright © 2014 Elsevier Ltd. All rights reserved.

Applicability of active infrared thermography for screening of human breast: a numerical study

NASA Astrophysics Data System (ADS)

Dua, Geetika; Mulaveesala, Ravibabu

2018-03-01

Active infrared thermography is a fast, painless, noncontact, and noninvasive imaging method, complementary to mammography, ultrasound, and magnetic resonance imaging methods for early diagnosis of breast cancer. This technique plays an important role in early detection of breast cancer to women of all ages, including pregnant or nursing women, with different sizes of breast, irrespective of either fatty or dense breast. This proposed complementary technique makes use of infrared emission emanating from the breast. Emanating radiations from the surface of the breast under test are detected with an infrared camera to map the thermal gradients over it, in order to reveal hidden tumors inside it. One of the reliable active infrared thermographic technique, linear frequency modulated thermal wave imaging is adopted to detect tumors present inside the breast. Further, phase and amplitude images are constructed using frequency and time-domain data analysis schemes. Obtained results show the potential of the proposed technique for early diagnosis of breast cancer in fatty as well as dense breasts.

Accelerated life testing and temperature dependence of device characteristics in GaAs CHFET devices

NASA Technical Reports Server (NTRS)

Gallegos, M.; Leon, R.; Vu, D. T.; Okuno, J.; Johnson, A. S.

2002-01-01

Accelerated life testing of GaAs complementary heterojunction field effect transistors (CHFET) was carried out. Temperature dependence of single and synchronous rectifier CHFET device characteristics were also obtained.

Displacement coefficients along the inner boundaries of radially cracked ring segments subject to forces and couples

NASA Technical Reports Server (NTRS)

Gross, B.

1977-01-01

Displacement results of plane boundary collocation analysis are given for various locations on the inner boundaries of radially cracked ring segments (C-shaped specimens) subject to two complementary types of loading. Results are presented for ratios of outer to inner radius R sub o/R sub i in the range of 1.1 to 2.5, and ratios a/W in the range 0.1 to 0.8 where a is the crack length for a specimen of wall thickness W. By combination of these results the resultant displacement coefficient delta or the corresponding influence coefficient, can be obtained for any practical load line location of a pin loaded specimen.

Nanocrystal-based complementary inverters constructed on flexible plastic substrates.

PubMed

Jang, Jaewon; Cho, Kyoungah; Yun, Junggwon; Kim, Sangsig

2013-05-01

We demonstrate a nanocrystal (NC)-based complementary inverter constructed on a flexible plastic substrate. The NC-based complementary inverter consists of n-type HgSe NC- and p-type HgTe NC-based thin-film transistors (TFTs). Solid films on a plastic substrate obtained from HgSe and HgTe nanocrystals by thermal transformation are utilized as the n- and p-channel layers in these TFTs, respectively. The electrical properties of these component TFTs on unstrained and strained substrates are characterized and the performance of the inverter on the flexible substrate is investigated. The inverter on the unstrained substrate exhibits a logic gain of about 8, a logic swing of 90%, and a noise margin of 2.0 V. The characteristics of the inverter are changed under tensile and compressive strains, but not very significantly. Moreover, a comparison of the electrical characteristics of the n- and p-channel TFTs and the inverter is made in this paper.

Electron microscopic visualization of complementary labeled DNA with platinum-containing guanine derivative.

PubMed

Loukanov, Alexandre; Filipov, Chavdar; Mladenova, Polina; Toshev, Svetlin; Emin, Saim

2016-04-01

The object of the present report is to provide a method for a visualization of DNA in TEM by complementary labeling of cytosine with guanine derivative, which contains platinum as contrast-enhanced heavy element. The stretched single-chain DNA was obtained by modifying double-stranded DNA. The labeling method comprises the following steps: (i) stretching and adsorption of DNA on the support film of an electron microscope grid (the hydrophobic carbon film holding negative charged DNA); (ii) complementary labeling of the cytosine bases from the stretched single-stranded DNA pieces on the support film with platinum containing guanine derivative to form base-specific hydrogen bond; and (iii) producing a magnified image of the base-specific labeled DNA. Stretched single-stranded DNA on a support film is obtained by a rapid elongation of DNA pieces on the surface between air and aqueous buffer solution. The attached platinum-containing guanine derivative serves as a high-dense marker and it can be discriminated from the surrounding background of support carbon film and visualized by use of conventional TEM observation at 100 kV accelerated voltage. This method allows examination of specific nucleic macromolecules through atom-by-atom analysis and it is promising way toward future DNA-sequencing or molecular diagnostics of nucleic acids by electron microscopic observation. © 2016 Wiley Periodicals, Inc.

Antagonistic Activity of Lactobacillus plantarum C11: Two New Two-Peptide Bacteriocins, Plantaricins EF and JK, and the Induction Factor Plantaricin A

PubMed Central

Anderssen, Erlend L.; Diep, Dzung Bao; Nes, Ingolf F.; Eijsink, Vincent G. H.; Nissen-Meyer, Jon

1998-01-01

Six bacteriocinlike peptides (plantaricin A [PlnA], PlnE, PlnF, PlnJ, PlnK, and PlnN) produced by Lactobacillus plantarum C11 were detected by amino acid sequencing and mass spectrometry. Since purification to homogeneity was problematic, all six peptides were obtained by solid-phase peptide synthesis and were tested for bacteriocin activity. It was found that L. plantarum C11 produces two two-peptide bacteriocins (PlnEF and PlnJK); a strain-specific antagonistic activity was detected at nanomolar concentrations when PlnE and PlnF were combined and when PlnJ and PlnK were combined. Complementary peptides were at least 103 times more active when they were combined than when they were present individually, and optimal activity was obtained when the complementary peptides were present in approximately equal amounts. The interaction between complementary peptides was specific, since neither PlnE nor PlnF could complement PlnJ or PlnK, and none of these peptides could complement the peptides constituting the two-peptide bacteriocin lactococcin G. Interestingly, PlnA, which acts as an extracellular signal (pheromone) that triggers bacteriocin production, also possessed a strain-specific antagonistic activity. No bacteriocin activity could be detected for PlnN. PMID:9603847

Racial and Ethnic Profiles of Complementary and Alternative Medicine Use Among Young Adults in the United States: Findings From the National Longitudinal Study of Adolescent Health.

PubMed

Upchurch, Dawn M; Wexler Rainisch, Bethany K

2012-10-01

This study describes complementary and alternative medicine use among a national sample of young adults, with an emphasis on characterizing racial and ethnic differences, highlighting variation across subgroups of Hispanics. The authors examined young adults ages 18 to 27 years (n = 14 128) from wave III (2001-2002) of the National Longitudinal Study of Adolescent Health. Prevalence estimates and logistic regression results were weighted and adjusted for complex sample design. The study examined recent complementary and alternative medicine use in the past 12 months, recent use for each of 15 specific complementary and alternative medicine modalities, and the 5 most commonly used modalities (herbs, massage, chiropractic, relaxation, and vitamins). Results showed that 29% of young adults aged 18 to 27 years recently used complementary and alternative medicine. Prevalence was highest among Cuban Americans (42%) and lowest among blacks (22%). Young adults used a diversity of complementary and alternative medicine modalities and there were substantial differences in use across racial and ethnic groups.

Racial and Ethnic Profiles of Complementary and Alternative Medicine Use Among Young Adults in the United States: Findings From the National Longitudinal Study of Adolescent Health

PubMed Central

Upchurch, Dawn M.; Wexler Rainisch, Bethany K.

2013-01-01

This study describes complementary and alternative medicine use among a national sample of young adults, with an emphasis on characterizing racial and ethnic differences, highlighting variation across subgroups of Hispanics. The authors examined young adults ages 18 to 27 years (n = 14 128) from wave III (2001–2002) of the National Longitudinal Study of Adolescent Health. Prevalence estimates and logistic regression results were weighted and adjusted for complex sample design. The study examined recent complementary and alternative medicine use in the past 12 months, recent use for each of 15 specific complementary and alternative medicine modalities, and the 5 most commonly used modalities (herbs, massage, chiropractic, relaxation, and vitamins). Results showed that 29% of young adults aged 18 to 27 years recently used complementary and alternative medicine. Prevalence was highest among Cuban Americans (42%) and lowest among blacks (22%). Young adults used a diversity of complementary and alternative medicine modalities and there were substantial differences in use across racial and ethnic groups. PMID:23869288

Use of Complementary and Alternative Medicine in the United States

MedlinePlus

... is Most Frequently Used Among Children (2007) Additional Reports NCCIH plans to collaborate with NCHS on further ... improving health and health care. To Obtain the Report The report's citation is Barnes PM, Bloom B, ...

Use of complementary and alternative medicine by pediatric patients with functional and organic gastrointestinal diseases: results from a multicenter survey.

PubMed

Vlieger, Arine M; Blink, Marjolein; Tromp, Ellen; Benninga, Marc A

2008-08-01

Many pediatric patients use complementary and alternative medicine, especially when facing a chronic illness for which treatment options are limited. So far, research on the use of complementary and alternative medicine in patients with functional gastrointestinal disease has been scarce. This study was designed to assess complementary and alternative medicine use in children with different gastrointestinal diseases, including functional disorders, to determine which factors predicted complementary and alternative medicine use and to assess the willingness of parents to participate in future studies on complementary and alternative medicine efficacy and safety. The prevalence of complementary and alternative medicine use was assessed by using a questionnaire for 749 children visiting pediatric gastroenterology clinics of 9 hospitals in the Netherlands. The questionnaire consisted of 35 questions on the child's gastrointestinal disease, medication use, health status, past and future complementary and alternative medicine use, reasons for its use, and the necessity of complementary and alternative medicine research. In this study population, the frequency of complementary and alternative medicine use was 37.6%. A total of 60.3% of this group had used complementary and alternative medicine specifically for their gastrointestinal disease. This specific complementary and alternative medicine use was higher in patients with functional disorders than organic disorders (25.3% vs 17.2%). Adverse effects of allopathic medication, school absenteeism, age

Hyperspectral Analysis of Soil Total Nitrogen in Subsided Land Using the Local Correlation Maximization-Complementary Superiority (LCMCS) Method

PubMed Central

Lin, Lixin; Wang, Yunjia; Teng, Jiyao; Xi, Xiuxiu

2015-01-01

The measurement of soil total nitrogen (TN) by hyperspectral remote sensing provides an important tool for soil restoration programs in areas with subsided land caused by the extraction of natural resources. This study used the local correlation maximization-complementary superiority method (LCMCS) to establish TN prediction models by considering the relationship between spectral reflectance (measured by an ASD FieldSpec 3 spectroradiometer) and TN based on spectral reflectance curves of soil samples collected from subsided land which is determined by synthetic aperture radar interferometry (InSAR) technology. Based on the 1655 selected effective bands of the optimal spectrum (OSP) of the first derivate differential of reciprocal logarithm ([log{1/R}]′), (correlation coefficients, p < 0.01), the optimal model of LCMCS method was obtained to determine the final model, which produced lower prediction errors (root mean square error of validation [RMSEV] = 0.89, mean relative error of validation [MREV] = 5.93%) when compared with models built by the local correlation maximization (LCM), complementary superiority (CS) and partial least squares regression (PLS) methods. The predictive effect of LCMCS model was optional in Cangzhou, Renqiu and Fengfeng District. Results indicate that the LCMCS method has great potential to monitor TN in subsided lands caused by the extraction of natural resources including groundwater, oil and coal. PMID:26213935

Digital PIV Measurements in the Diffuser of a High Speed Centrifugal Compressor

NASA Technical Reports Server (NTRS)

Wernet, Mark P.

1998-01-01

Particle Imaging Velocimetry (PIV) is a powerful measurement technique which can be used as an alternative or complementary approach to Laser Doppler Velocimetry (LDV) in a wide range of research applications. PIV data are measured simultaneously at multiple points in space, which enables the investigation of the non-stationary spatial structures typically encountered in turbomachinery. Obtaining ample optical access, sufficiently high seed particle concentrations and accurate synchronization of image acquisition relative to impeller position are the most formidable tasks in the successful implementation of PIV in turbomachinery. Preliminary results from the successful application of the standard 2-D digital PIV technique in the diffuser of a high speed centrifugal compressor are presented. Instantaneous flow. measurements were also obtained during compressor surge.

Electron impact ionization of O2 and the interference effect from forward-backward asymmetry

NASA Astrophysics Data System (ADS)

Chowdhury, Madhusree Roy; Tribedi, Lokesh C.

2017-08-01

Absolute double differential cross sections (DDCSs) of secondary electrons emitted from O2 under the impact of 7 keV electrons were measured for different emission angles between 30° and 145° having energies from 1-600 eV. The forward-backward angular asymmetry was observed from angular distribution of the DDCS of secondary electrons. The asymmetry parameter, thus obtained from the DDCS of two complementary angles, showed a clear signature of interference oscillation. The Cohen-Fano model of Young type electron interference at a molecular double slit is found to provide a good fit to the observed oscillatory structures. The present observation is in qualitative agreement with the recent results obtained from photoionization.

Ordered Self-Assembled Monolayers of Peptide Nucleic Acids with DNA Recognition Capability

NASA Astrophysics Data System (ADS)

Briones, C.; Mateo-Marti, E.; Gómez-Navarro, C.; Parro, V.; Román, E.; Martín-Gago, J. A.

2004-11-01

We report on the formation of ordered self-assembled monolayers (SAMs) of single-stranded peptide nucleic acids (ssPNA). In spite of their remarkable length (7nm) thiolated PNAs assemble standing up on gold surfaces similarly to the SAMs of short alkanethiols. SAMs of ssPNA recognize complementary nucleic acids, acting as specific biosensors that discriminate even a point mutation in target ssDNA. These results are obtained by surface characterization techniques that avoid labeling of the target molecule: x-ray photoemission, x-ray absorption and atomic force microscopy.

Shear coaxial injector atomization phenomena for combusting and non-combusting conditions

NASA Technical Reports Server (NTRS)

Pal, S.; Moser, M. D.; Ryan, H. M.; Foust, M. J.; Santoro, R. J.

1992-01-01

Measurements of LOX drop size and velocity in a uni-element liquid propellant rocket chamber are presented. The use of the Phase Doppler Particle Analyzer in obtaining temporally-averaged probability density functions of drop size in a harsh rocket environment has been demonstrated. Complementary measurements of drop size/velocity for simulants under cold flow conditions are also presented. The drop size/velocity measurements made for combusting and cold flow conditions are compared, and the results indicate that there are significant differences in the two flowfields.

End-of-fabrication CMOS process monitor

NASA Technical Reports Server (NTRS)

Buehler, M. G.; Allen, R. A.; Blaes, B. R.; Hannaman, D. J.; Lieneweg, U.; Lin, Y.-S.; Sayah, H. R.

1990-01-01

A set of test 'modules' for verifying the quality of a complementary metal oxide semiconductor (CMOS) process at the end of the wafer fabrication is documented. By electrical testing of specific structures, over thirty parameters are collected characterizing interconnects, dielectrics, contacts, transistors, and inverters. Each test module contains a specification of its purpose, the layout of the test structure, the test procedures, the data reduction algorithms, and exemplary results obtained from 3-, 2-, or 1.6-micrometer CMOS/bulk processes. The document is intended to establish standard process qualification procedures for Application Specific Integrated Circuits (ASIC's).

[Rectal endometriosis: An exceptional etiology of acute intestinal occlusion].

PubMed

Doh, Kwame; Thiam, Ibou; Ka, Sidy; Dial, Cherif; Woto-Gaye, Gisèle

2016-12-01

The intestinal occlusion acute is an emergency and therapeutic diagnostic. A rectal tumor is rarely the cause in a young adult. We are carrying the case of a patient of 43years old, received at emergency on a board of intestinal occlusion acute due to a rectal tumor of a fortuitous discovery during the operation. The final diagnosis after a histopathologic examination was for the less unexpected. It was rectal endometriosis in its tumor-like. A complementary medical care obtains satisfactory results. Copyright © 2016. Published by Elsevier Masson SAS.

Experimental Test of Entropic Noise-Disturbance Uncertainty Relations for Spin-1/2 Measurements.

PubMed

Sulyok, Georg; Sponar, Stephan; Demirel, Bülent; Buscemi, Francesco; Hall, Michael J W; Ozawa, Masanao; Hasegawa, Yuji

2015-07-17

Information-theoretic definitions for noise and disturbance in quantum measurements were given in [Phys. Rev. Lett. 112, 050401 (2014)] and a state-independent noise-disturbance uncertainty relation was obtained. Here, we derive a tight noise-disturbance uncertainty relation for complementary qubit observables and carry out an experimental test. Successive projective measurements on the neutron's spin-1/2 system, together with a correction procedure which reduces the disturbance, are performed. Our experimental results saturate the tight noise-disturbance uncertainty relation for qubits when an optimal correction procedure is applied.

Pharmaceutical Compounds Studied Using NEXAFS

NASA Astrophysics Data System (ADS)

Murray Booth, A.; Braun, Simon; Lonsbourough, Tom; Purton, John; Patel, Sunil; Schroeder, Sven L. M.

2007-02-01

Total Electron Yield (TEY) oxygen K-edge NEXAFS detects the presence of strongly adsorbed water molecules on poloxamer-coated pharmaceutical actives, which provides a useful spectroscopic indicator for bioavailability. The results are supported by complementary XPS measurements. Carbon K-edge spectra obtained in a high-pressure NEXAFS cell were used in situ to establish how a polymer coating spread on a drug surface by using humidity induced dispersion of the coating. Finally, we demonstrate how combined Carbon and Oxygen K-edge measurements can be used to characterize amorphous surface layers on micronised crystals of a drug compound.

An Evidence-Based Course in Complementary Medicines

PubMed Central

Hughes, Jeff

2012-01-01

Objective. To evaluate the impact of an evidence-based course in complementary medicines on the attitudes, knowledge, and professional practice behavior of undergraduate pharmacy students. Design. A required 12-week evidence-based complementary medicine course was designed and introduced into the third-year undergraduate pharmacy curriculum. The course included a combination of traditional lectures, interactive tutorial sessions, and a range of formal assessments. Assessment. Pre- and post-course survey instruments were administered to assess changes in students’ attitudes, perceptions, knowledge, and the likelihood they would recommend the use of complementary medicines in a pharmacy practice environment. Conclusion. Completion of a required evidence-based complementary medicines course resulted in a positive change in pharmacy students’ perceptions of the value of various complementary medicines as well as in their willingness to recommend them, and provided students with the required knowledge to make patient-centered recommendations for use of complementary medicines in a professional pharmacy practice setting. These findings support the need for greater evidence-based complementary medicine education within pharmacy curricula to meet consumer demand and to align with pharmacists’ professional responsibilities. PMID:23275665

A uniformly valid approximation algorithm for nonlinear ordinary singular perturbation problems with boundary layer solutions.

PubMed

Cengizci, Süleyman; Atay, Mehmet Tarık; Eryılmaz, Aytekin

2016-01-01

This paper is concerned with two-point boundary value problems for singularly perturbed nonlinear ordinary differential equations. The case when the solution only has one boundary layer is examined. An efficient method so called Successive Complementary Expansion Method (SCEM) is used to obtain uniformly valid approximations to this kind of solutions. Four test problems are considered to check the efficiency and accuracy of the proposed method. The numerical results are found in good agreement with exact and existing solutions in literature. The results confirm that SCEM has a superiority over other existing methods in terms of easy-applicability and effectiveness.

Micro-electro-mechanically switchable near infrared complementary metamaterial absorber

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pitchappa, Prakash; Pei Ho, Chong; Institute of Microelectronics

2014-05-19

We experimentally demonstrate a micro-electro-mechanically switchable near infrared complementary metamaterial absorber by integrating the metamaterial layer to be the out of plane movable microactuator. The metamaterial layer is electrostatically actuated by applying voltage across the suspended complementary metamaterial layer and the stationary bottom metallic reflector. Thus, the effective spacing between the metamaterial layer and bottom metal reflector is varied as a function of applied voltage. With the reduction of effective spacing between the metamaterial and reflector layers, a strong spectral blue shift in the peak absorption wavelength can be achieved. With spacing change of 300 nm, the spectral shift of 0.7 μmmore » in peak absorption wavelength was obtained for near infrared spectral region. The electro-optic switching performance of the device was characterized, and a striking switching contrast of 1500% was achieved at 2.1 μm. The reported micro-electro-mechanically tunable complementary metamaterial absorber device can potentially enable a wide range of high performance electro-optical devices, such as continuously tunable filters, modulators, and electro-optic switches that form the key components to facilitate future photonic circuit applications.« less

Fuel economy and exhaust emissions characteristics of diesel vehicles: Test results of a prototype fiat 131TC 2.4 liter automobile

NASA Technical Reports Server (NTRS)

Quayle, S. S.

1982-01-01

The results obtained from fuel economy and emission tests conducted on a prototype Fiat 131 turbocharged diesel vehicle are presented. The vehicle was tested on a chassis dynamometer over selected drive cycles and steady-state conditions. Two fuels were used, a United States number 2 diesel and a European diesel fuel. Particulate emission rates were calculated from dilution tunnel measurements and large volume particulate samples were collected for biological and chemical analysis. It was determined that turbocharging accompanied by complementary modifications results in small but substantial improvements in regulated emissions, fuel economy, and performance. Notably, particulate levels were reduced by 30 percent.

Relationship between person-organization fit and objective and subjective health status (person-organization fit and health).

PubMed

Merecz, Dorota; Andysz, Aleksandra

2012-06-01

[corrected] Person-Environment fit (P-E fit) paradigm, seems to be especially useful in explaining phenomena related to work attitudes and occupational health. The study explores the relationship between a specific facet of P-E fit as Person-Organization fit (P-O fit) and health. Research was conducted on the random sample of 600 employees. Person-Organization Fit Questionnaire was used to asses the level of Person-Organization fit; mental health status was measured by General Health Questionnaire (GHQ-28); and items from Work Ability Index allowed for evaluation of somatic health. Data was analyzed using non parametric statistical tests. The predictive value of P-O fit for various aspects of health was checked by means of linear regression models. A comparison between the groups distinguished on the basis of their somatic and mental health indicators showed significant differences in the level of overall P-O fit (χ(2) = 23.178; p < 0.001) and its subdimensions: for complementary fit (χ(2) = 29.272; p < 0.001), supplementary fit (χ(2) = 23.059; p < 0.001), and identification with organization (χ(2) = 8.688; p = 0.034). From the perspective of mental health, supplementary P-O fit seems to be important for men's well-being and explains almost 9% of variance in GHQ-28 scores, while in women, complementary fit (5% explained variance in women's GHQ score) and identification with organization (1% explained variance in GHQ score) are significant predictors of mental well-being. Interestingly, better supplementary and complementary fit are related to better mental health, but stronger identification with organization in women produces adverse effect on their mental health. The results show that obtaining the optimal level of P-O fit can be beneficial not only for the organization (e.g. lower turnover, better work effectiveness and commitment), but also for the employees themselves. Optimal level of P-O fit can be considered as a factor maintaining workers' health. However, prospective research is needed to confirm the results obtained in this exploratory study.

Thyroid paraganglioma. Report of 3 cases and description of an immunohistochemical profile useful in the differential diagnosis with medullary thyroid carcinoma, based on complementary DNA array results.

PubMed

Castelblanco, Esmeralda; Gallel, Pilar; Ros, Susana; Gatius, Sonia; Valls, Joan; De-Cubas, Aguirre A; Maliszewska, Agnieszka; Yebra-Pimentel, M Teresa; Menarguez, Javier; Gamallo, Carlos; Opocher, Giuseppe; Robledo, Mercedes; Matias-Guiu, Xavier

2012-07-01

Thyroid paraganglioma is a rare disorder that sometimes poses problems in differential diagnosis with medullary thyroid carcinoma. So far, differential diagnosis is solved with the help of some markers that are frequently expressed in medullary thyroid carcinoma (thyroid transcription factor 1, calcitonin, and carcinoembryonic antigen). However, some of these markers are not absolutely specific of medullary thyroid carcinoma and may be expressed in other tumors. Here we report 3 new cases of thyroid paraganglioma and describe our strategy to design a diagnostic immunohistochemical battery. First, we performed a comparative analysis of the expression profile of head and neck paragangliomas and medullary thyroid carcinoma, obtained after complementary DNA array analysis of 2 series of fresh-frozen samples of paragangliomas and medullary thyroid carcinoma, respectively. Seven biomarkers showing differential expression were selected (nicotinamide adenine dinucleotide dehydrogenase 1 alpha subcomplex, 4-like 2, NDUFA4L2; cytochrome c oxidase subunit IV isoform 2; vesicular monoamine transporter 2; calcitonin gene-related protein/calcitonin; carcinoembryonic antigen; and thyroid transcription factor 1) for immunohistochemical analysis. Two tissue microarrays were constructed from 2 different series of paraffin-embedded samples of paragangliomas and medullary thyroid carcinoma. We provide a classifying rule for differential diagnosis that combines negativity or low staining for calcitonin gene-related protein (histologic score, <10) or calcitonin (histologic score, <50) together with positivity of any of NADH dehydrogenase 1 alpha subcomplex, 4-like 2; cytochrome c oxidase subunit IV isoform 2; or vesicular monoamine transporter 2 to predict paragangliomas, showing a prediction error of 0%. Finally, the immunohistochemical battery was checked in paraffin-embedded blocks from 4 examples of thyroid paraganglioma (1 previously reported case and 3 new cases), showing also a prediction error of 0%. Our results suggest that the comparative expression profile, obtained by complementary DNA arrays, seems to be a good tool to design immunohistochemical batteries used in differential diagnosis. Copyright © 2012 Elsevier Inc. All rights reserved.

Short communication: Semiquantitative assessment of 99mTc-EDDA/HYNIC-TOC scintigraphy in differentiation of solitary pulmonary nodules--a complementary role to visual analysis.

PubMed

Płachcińska, Anna; Mikołajczak, Renata; Kozak, Józef; Rzeszutek, Katarzyna; Kuśmierek, Jacek

2006-02-01

The aim of this study was the assessment of a value of a semiquantitative analysis of scintigrams obtained with (99m)Tc-EDDA/HYNIC-TOC as a radiopharmaceutical (RPH) in differential diagnosis of solitary pulmonary nodules (SPNs), as a method complementary to visual evaluation of scintigrams. Scintigraphic images of 59 patients (33 males and 26 females between 34 and 78 years of age, mean value, 57) with SPN on chest radiographs (39 malignant and 20 benign) were retrospectively assessed semiquantitatively. Visual scintigram analysis was made earlier, prospectively. Nodule diameters ranged from 1 to 4 (mean 2.2) cm. A single photon emission computed tomography (SPECT) acquisition was performed at 2-4 hours after administration of 740 to 925 MBq of a RPH. Verification of scintigraphic results was based on a pathological examination of tumor samples (histopathology or cytology) and, in some cases, on bacteriological studies. As an additional criterion for tumor benignity, its stable size in a time interval not shorter than 3 years was accepted. A simple, semiquantitative method for assessment of radiopharmaceutical uptake in SPNs was used, based on "count sample" taken from tumor center (T) in relation to radiopharmaceutical concentration in the background (B) measured in the contralateral lung. A criterion for optimal differentiation between malignant and benign nodules (T/B ratio threshold value) was introduced, based on a receiver operating characteristic (ROC) curve. Additionally, a value of T/B ratio was searched for, excluding tumor benignity with high probability. Visual analysis of scintigrams revealed enhanced uptake of RPH at 36 of 39 (92%) sites, corresponding to locations of malignant nodules (including 34 of 35-97% cases of lung cancer). In 13 of 20 (65%) benign nodules, true negative results were obtained. Accuracy of the method equalled 83%. Optimal differentiation between malignant and benign nodules was found for a value of a T/B ratio amounting to 2. The semiquantitative method gave true positive results in 35 of 39 (90%) malignant nodules (as in visual method in 34 of 35-97% cases of lung cancer). True negative results were obtained in 17 of 20 (85%) benign cases. Accuracy of the method reached 88%. A T/B ratio exceeding 4 excluded tumor benignity with high probability. A simple method, of quantitatively assessing 99mTc-EDDA/HYNICTOC uptake in solitary pulmonary nodules by means of a T/B ratio can play a role that is complementary to the visual evaluation of scintigrams. It improves low specificity of the method in the detection of malignant nodules, without significant reduction of its sensitivity and provides a T/B ratio excluding tumor benignity with high probability.

Comparative higher-order structure analysis of antibody biosimilars using combined bottom-up and top-down hydrogen-deuterium exchange mass spectrometry.

PubMed

Pan, Jingxi; Zhang, Suping; Borchers, Christoph H

2016-12-01

Hydrogen/deuterium exchange (HDX) coupled with mass spectrometry (MS) is a powerful technique for higher-order structural characterization of antibodies. Although the peptide-based bottom-up HDX approach and the protein-based top-down HDX approach have complementary advantages, the work done so far on biosimilars has involved only one or the other approach. Herein we have characterized the structures of two bevacizumab (BEV) biosimilars and compared them to the reference BEV using both methods. A sequence coverage of 87% was obtained for the heavy chain and 74% for the light chain in the bottom-up approach. The deuterium incorporation behavior of the peptic peptides from the three BEVs were compared side by side and showed no differences at various HDX time points. Top-down experiments were carried out using subzero temperature LC-MS, and the deuterium incorporation of the intact light chain and heavy chain were obtained. Top-down ETD was also performed to obtain amino acid-level HDX information that covered 100% of the light chain, but only 50% coverage is possible for the heavy chain. Consistent with the intact subunit level data, no differences were observed in the amino acid level HDX data. All these results indicate that there are no differences between the three BEV samples with respect to their high-order structures. The peptide level information from the bottom-up approach, and the residue level and intact subunit level information from the top-down approach were complementary and covered the entire antibody. Copyright © 2016 Elsevier B.V. All rights reserved.

Use of complementary and alternative medicine in children and adolescents with autism spectrum disorder: A systematic review.

PubMed

Höfer, Juliana; Hoffmann, Falk; Bachmann, Christian

2017-05-01

Despite limited evidence, complementary and alternative medicine treatments are popular in autism spectrum disorder. The aim of this review was to summarize the available evidence on complementary and alternative medicine use frequency in autism spectrum disorder. A systematic search of three electronic databases was performed. All research studies in English or German reporting data on the frequency of complementary and alternative medicine use in individuals with autism spectrum disorder were included. Two independent reviewers searched the literature, extracted information on study design and results, and assessed study quality using an established quality assessment tool. Twenty studies with a total of 9540 participants were included. The prevalence of any complementary and alternative medicine use ranged from 28% to 95% (median: 54%). Special diets or dietary supplements (including vitamins) were the most frequent complementary and alternative medicine treatments, ranking first in 75% of studies. There was some evidence for a higher prevalence of complementary and alternative medicine use in autism spectrum disorder compared to other psychiatric disorders and the general population. Approximately half of children and adolescents with autism spectrum disorder use complementary and alternative medicine. Doctors should be aware of this and should discuss complementary and alternative medicine use with patients and their carers, especially as the evidence is mixed and some complementary and alternative medicine treatments are potentially harmful.

Utility of intravascular ultrasound examination during carotid stenting.

PubMed

Joan, M Mellado; Moya, B Gómez; Agustí, F Pañella; Vidal, R García; Arjona, Y Abril; Alija, M P Fariñas; Paredero, V Martín

2009-01-01

Intravascular ultrasound (IVUS) examination may provide useful information during endovascular procedures. However, its actual clinical utility for carotid stenting remains unclear. We evaluated the usefulness of IVUS as a complementary tool during endovascular procedures in the carotid arteries and its impact on the modification of the therapeutic strategy. Between April 2006 and April 2007, 18 symptomatic patients (nine with transient ischemic attack, nine with stroke) underwent angioplasty and stenting of >70% stenosis of the internal carotid artery (ICA). Target lesions were identified with preoperative duplex scanning and further confirmed at angiography. Intraoperative IVUS examination was performed in all patients. Multilevel measurement of the artery as well as virtual histology images, before and after stenting, were obtained. The technique was 100% successful. There were no complications at the femoral puncture site and no neurological or other events. Compared with angiography, IVUS findings showed an average arterial diameter that was greater than 1.64+/-0.22mm. Based on virtual histology information, endovascular treatment was excluded in two patients and carotid endarterectomy was performed. Type or size of the stent was modified after IVUS examination in eight cases. IVUS examination provides complementary information to that obtained using conventional diagnostic procedures. It may be useful for characterizing the composition and measurement of the target lesion, choosing the type and size of the stent, and evaluating the results after the procedure.

Experiment/Analytical Characterization of the RBCC Rocket-Ejector Mode

NASA Technical Reports Server (NTRS)

Ruf, J. H.; Lehman, M.; Pal, S.; Santoro, R. J.; West, J.; Turner, James E. (Technical Monitor)

2000-01-01

Experimental and complementary CFD results from the study of the rocket-ejector mode of a Rocket Based Combined Cycle (RBCC) engine are presented and discussed. The experiments involved systematic flowfield measurements in a two-dimensional, variable geometry rocket-ejector system. The rocket-ejector system utilizes a single two-dimensional, gaseous oxygen/gaseous hydrogen rocket as the ejector. To gain a thorough understanding of the rocket-ejector's internal fluid mechanic/combustion phenomena, experiments were conducted with both direct-connect and sea-level static configurations for a range of rocket operating conditions. Overall system performance was obtained through global measurements of wall static pressure profiles, heat flux profiles and engine thrust, whereas detailed mixing and combustion information was obtained through Raman spectroscopy measurements of major species (oxygen, hydrogen, nitrogen and water vapor). The experimental results for both the direct-connect and sea-level static configurations are compared with CFD predictions of the flowfield.

Assessment of precipitation in alloy steel using nonlinear Rayleigh surface waves

NASA Astrophysics Data System (ADS)

Thiele, Sebastian; Matlack, Kathryn H.; Kim, Jin-Yeon; Qu, Jianmin; Wall, James J.; Jacobs, Laurence J.

2014-02-01

Nonlinear ultrasonic waves have shown to be sensitive to various microstructural changes in metals including coherent precipitates; these precipitates introduce a strain field in the lattice structure. The thermal aging of certain alloy steels leads to the formation of coherent precipitates, which pin dislocations and contribute to the generation of a second harmonic component. A precipitate hardenable material namely 17-4 PH stainless steel is thermally treated in this research to obtain different precipitation stages, and then the influence of precipitates on the acoustic nonlinearity parameter is assessed. Conclusions about the microstrucutural changes in the material are drawn based on the results from a nonlinear Rayleigh surface wave measurement and complementary thermo-electric power, hardness and ultrasonic velocity measurements. The results show that the nonlinear parameter is sensitive to coherent precipitates in the material and moreover that precipitation characteristics can be characterized based on the obtained experimental data.

Somatic association of telocentric chromosomes carrying homologous centromeres in common wheat.

PubMed

Mello-Sampayo, T

1973-01-01

Measurements of distances between telocentric chromosomes, either homologous or representing the opposite arms of a metacentric chromosome (complementary telocentrics), were made at metaphase in root tip cells of common wheat carrying two homologous pairs of complementary telocentrics of chromosome 1 B or 6 B (double ditelosomic 1 B or 6 B). The aim was to elucidate the relative locations of the telocentric chromosomes within the cell. The data obtained strongly suggest that all four telocentrics of chromosome 1 B or 6 B are spacially and simultaneously co-associated. In plants carrying two complementary (6 B (S) and 6 B (L)) and a non-related (5 B (L)) telocentric, only the complementary chromosomes were found to be somatically associated. It is thought, therefore, that the somatic association of chromosomes may involve more than two chromosomes in the same association and, since complementary telocentrics are as much associated as homologous, that the homology between centromeres (probably the only homologous region that exists between complementary telocentrics) is a very important condition for somatic association of chromosomes. The spacial arrangement of chromosomes was studied at anaphase and prophase and the polar orientation of chromosomes at prophase was found to resemble anaphase orientation. This was taken as good evidence for the maintenance of the chromosome arrangement - the Rabl orientation - and of the peripheral location of the centromere and its association with the nuclear membrane. Within this general arrangement homologous telocentric chromosomes were frequently seen to have their centromeres associated or directed towards each other. The role of the centromere in somatic association as a spindle fibre attachment and chromosome binder is discussed. It is suggested that for non-homologous chromosomes to become associated in root tips, the only requirement needed should be the homology of centromeres such as exists between complementary telocentrics, or, as a possible alternative, common repeated sequences of DNA molecules around the centromere region.

Determinants of inappropriate timing of introducing solid, semi-solid or soft food to infants in Pakistan: secondary data analysis of Demographic and Health Survey 2006-2007.

PubMed

Hazir, Tabish; Senarath, Upul; Agho, Kingsley; Akram, Dure-Samin; Kazmi, Narjis; Abbasi, Saleem; Dibley, Michael J

2012-01-01

Inappropriate timing of introducing complementary food deprives the infant of optimum nutrition, leading to undernutrition, and increased mortality and morbidity. The aim of this analysis was to identify determinants of inappropriate timing of introduction of solid, semi-solid and soft foods in Pakistan. Data on 941 infants 3.00 to 8.99 months were obtained from the Pakistan Demographic and Health Survey 2006-2007. The prevalence of introduction of foods among infants aged 3.00-5.99 months and 6.00-8.99 months was examined against a set of individual, household and community level variables using univariate analysis. Adjusted odds ratio (AOR) for early introduction in age 3.00-5.99 months and non-introduction in 6.00-8.99 months of age were calculated using backward stepwise logistic regression models. The prevalence of early introduction of complementary foods among 3.00- to 5.99-month-old and timely introduction among 6.00- to 8.99-month-old infants were 10.6% and 39.2%, respectively. Multivariate analyses revealed that mothers who had four or more antenatal clinic visits (AOR=2.68) and who lived in the provinces of Sindh (AOR=2.89) and Baluchistan (AOR=6.75) were more likely to introduce complementary foods early. Mothers from middle-level households (AOR=7.82), poorer households (AOR=4.84) and poorest households (AOR=5.72) were significantly more likely to delay introduction of complementary foods. In conclusion more than half (60.8%) of Pakistani infants do not receive complementary foods at recommended time. Public health interventions to improve the timing of introduction of complementary food are needed at national level with special focus on high risk groups. © 2011 Blackwell Publishing Ltd.

METABOLOMIC STUDIES OF ENDOCRINE DISRUPTION IN SMALL FISH MODELS

EPA Science Inventory

Metabolomics is now being widely used to obtain complementary information to genomic and proteomic studies. To better understand temporal, compensatory and dose responses to endocrine-disrupting chemicals (EDCs) within the hypothalamic-pituitary¬gonadal (HPG) axis, we have carrie...

Levels of Evidence: Integrative Therapies Human Studies (PDQ®)—Health Professional Version

Cancer.gov

Levels of Evidence for Integrative, Alternative, and Complementary Therapies is about how to weigh the strength of the evidence obtained in cited research studies. Get detailed information this formal ranking system in this summary for clinicians.

Reconfigurable Complementary Logic Circuits with Ambipolar Organic Transistors

PubMed Central

Yoo, Hocheon; Ghittorelli, Matteo; Smits, Edsger C. P.; Gelinck, Gerwin H.; Lee, Han-Koo; Torricelli, Fabrizio; Kim, Jae-Joon

2016-01-01

Ambipolar organic electronics offer great potential for simple and low-cost fabrication of complementary logic circuits on large-area and mechanically flexible substrates. Ambipolar transistors are ideal candidates for the simple and low-cost development of complementary logic circuits since they can operate as n-type and p-type transistors. Nevertheless, the experimental demonstration of ambipolar organic complementary circuits is limited to inverters. The control of the transistor polarity is crucial for proper circuit operation. Novel gating techniques enable to control the transistor polarity but result in dramatically reduced performances. Here we show high-performance non-planar ambipolar organic transistors with electrical control of the polarity and orders of magnitude higher performances with respect to state-of-art split-gate ambipolar transistors. Electrically reconfigurable complementary logic gates based on ambipolar organic transistors are experimentally demonstrated, thus opening up new opportunities for ambipolar organic complementary electronics. PMID:27762321

Reconfigurable Complementary Logic Circuits with Ambipolar Organic Transistors.

PubMed

Yoo, Hocheon; Ghittorelli, Matteo; Smits, Edsger C P; Gelinck, Gerwin H; Lee, Han-Koo; Torricelli, Fabrizio; Kim, Jae-Joon

2016-10-20

Ambipolar organic electronics offer great potential for simple and low-cost fabrication of complementary logic circuits on large-area and mechanically flexible substrates. Ambipolar transistors are ideal candidates for the simple and low-cost development of complementary logic circuits since they can operate as n-type and p-type transistors. Nevertheless, the experimental demonstration of ambipolar organic complementary circuits is limited to inverters. The control of the transistor polarity is crucial for proper circuit operation. Novel gating techniques enable to control the transistor polarity but result in dramatically reduced performances. Here we show high-performance non-planar ambipolar organic transistors with electrical control of the polarity and orders of magnitude higher performances with respect to state-of-art split-gate ambipolar transistors. Electrically reconfigurable complementary logic gates based on ambipolar organic transistors are experimentally demonstrated, thus opening up new opportunities for ambipolar organic complementary electronics.

Transcriptome analysis by strand-specific sequencing of complementary DNA

PubMed Central

Parkhomchuk, Dmitri; Borodina, Tatiana; Amstislavskiy, Vyacheslav; Banaru, Maria; Hallen, Linda; Krobitsch, Sylvia; Lehrach, Hans; Soldatov, Alexey

2009-01-01

High-throughput complementary DNA sequencing (RNA-Seq) is a powerful tool for whole-transcriptome analysis, supplying information about a transcript's expression level and structure. However, it is difficult to determine the polarity of transcripts, and therefore identify which strand is transcribed. Here, we present a simple cDNA sequencing protocol that preserves information about a transcript's direction. Using Saccharomyces cerevisiae and mouse brain transcriptomes as models, we demonstrate that knowing the transcript's orientation allows more accurate determination of the structure and expression of genes. It also helps to identify new genes and enables studying promoter-associated and antisense transcription. The transcriptional landscapes we obtained are available online. PMID:19620212

Transcriptome analysis by strand-specific sequencing of complementary DNA.

PubMed

Parkhomchuk, Dmitri; Borodina, Tatiana; Amstislavskiy, Vyacheslav; Banaru, Maria; Hallen, Linda; Krobitsch, Sylvia; Lehrach, Hans; Soldatov, Alexey

2009-10-01

High-throughput complementary DNA sequencing (RNA-Seq) is a powerful tool for whole-transcriptome analysis, supplying information about a transcript's expression level and structure. However, it is difficult to determine the polarity of transcripts, and therefore identify which strand is transcribed. Here, we present a simple cDNA sequencing protocol that preserves information about a transcript's direction. Using Saccharomyces cerevisiae and mouse brain transcriptomes as models, we demonstrate that knowing the transcript's orientation allows more accurate determination of the structure and expression of genes. It also helps to identify new genes and enables studying promoter-associated and antisense transcription. The transcriptional landscapes we obtained are available online.

Dietary Protein Intake in Young Children in Selected Low-Income Countries Is Generally Adequate in Relation to Estimated Requirements for Healthy Children, Except When Complementary Food Intake Is Low.

PubMed

Arsenault, Joanne E; Brown, Kenneth H

2017-05-01

Background: Previous research indicates that young children in low-income countries (LICs) generally consume greater amounts of protein than published estimates of protein requirements, but this research did not account for protein quality based on the mix of amino acids and the digestibility of ingested protein. Objective: Our objective was to estimate the prevalence of inadequate protein and amino acid intake by young children in LICs, accounting for protein quality. Methods: Seven data sets with information on dietary intake for children (6-35 mo of age) from 6 LICs (Peru, Guatemala, Ecuador, Bangladesh, Uganda, and Zambia) were reanalyzed to estimate protein and amino acid intake and assess adequacy. The protein digestibility-corrected amino acid score of each child's diet was calculated and multiplied by the original (crude) protein intake to obtain an estimate of available protein intake. Distributions of usual intake were obtained to estimate the prevalence of inadequate protein and amino acid intake for each cohort according to Estimated Average Requirements. Results: The prevalence of inadequate protein intake was highest in breastfeeding children aged 6-8 mo: 24% of Bangladeshi and 16% of Peruvian children. With the exception of Bangladesh, the prevalence of inadequate available protein intake decreased by age 9-12 mo and was very low in all sites (0-2%) after 12 mo of age. Inadequate protein intake in children <12 mo of age was due primarily to low energy intake from complementary foods, not inadequate protein density. Conclusions: Overall, most children consumed protein amounts greater than requirements, except for the younger breastfeeding children, who were consuming low amounts of complementary foods. These findings reinforce previous evidence that dietary protein is not generally limiting for children in LICs compared with estimated requirements for healthy children, even after accounting for protein quality. However, unmeasured effects of infection and intestinal dysfunction on the children's protein requirements could modify this conclusion.

Resourcing the clinical complementary medicine information needs of Australian medical students: Results of a grounded theory study.

PubMed

Templeman, Kate; Robinson, Anske; McKenna, Lisa

2016-09-01

The aim of this study was to identify Australian medical students' complementary medicine information needs. Thirty medical students from 10 medical education faculties across Australian universities were recruited. Data were generated using in-depth semi-structured interviews and constructivist grounded theory method was used to analyze and construct data. Students sought complementary medicine information from a range of inadequate sources, such as pharmacological texts, Internet searches, peer-reviewed medical journals, and drug databases. The students identified that many complementary medicine resources may not be regarded as objective, reliable, differentiated, or comprehensive, leaving much that medical education needs to address. Most students sought succinct, easily accessible, evidence-based information to inform safe and appropriate clinical decisions about complementary medicines. A number of preferred resources were identified that can be recommended and actively promoted to medical students. Therefore, specific, evidence-based complementary medicine databases and secondary resources should be subscribed and recommended to medical schools and students, to assist meeting professional responsibilities regarding complementary medicines. These findings may help inform the development of appropriate medical information resources regarding complementary medicines. © 2016 John Wiley & Sons Australia, Ltd.

Measuring What Medical Students Think about Complementary and Alternative Medicine (CAM): A Pilot Study of the "Complementary and Alternative Medicine Survey"

ERIC Educational Resources Information Center

Frye, Ann W.; Sierpina, Victor S.; Boisaubin, Eugene V.; Bulik, Robert J.

2006-01-01

With increasing national and international support for the development of Complementary and Alternative Medicine (CAM) curricula in American medical schools, it is essential to measure what learners know and believe about CAM in order to assess outcomes of new teaching efforts. This paper describes the development and initial results of a survey…

Desorption atmospheric pressure photoionization high-resolution mass spectrometry: a complementary approach for the chemical analysis of atmospheric aerosols.

PubMed

Parshintsev, Jevgeni; Vaikkinen, Anu; Lipponen, Katriina; Vrkoslav, Vladimir; Cvačka, Josef; Kostiainen, Risto; Kotiaho, Tapio; Hartonen, Kari; Riekkola, Marja-Liisa; Kauppila, Tiina J

2015-07-15

On-line chemical characterization methods of atmospheric aerosols are essential to increase our understanding of physicochemical processes in the atmosphere, and to study biosphere-atmosphere interactions. Several techniques, including aerosol mass spectrometry, are nowadays available, but they all suffer from some disadvantages. In this research, desorption atmospheric pressure photoionization high-resolution (Orbitrap) mass spectrometry (DAPPI-HRMS) is introduced as a complementary technique for the fast analysis of aerosol chemical composition without the need for sample preparation. Atmospheric aerosols from city air were collected on a filter, desorbed in a DAPPI source with a hot stream of toluene and nitrogen, and ionized using a vacuum ultraviolet lamp at atmospheric pressure. To study the applicability of the technique for ambient aerosol analysis, several samples were collected onto filters and analyzed, with the focus being on selected organic acids. To compare the DAPPI-HRMS data with results obtained by an established method, each filter sample was divided into two equal parts, and the second half of the filter was extracted and analyzed by liquid chromatography/mass spectrometry (LC/MS). The DAPPI results agreed with the measured aerosol particle number. In addition to the targeted acids, the LC/MS and DAPPI-HRMS methods were found to detect different compounds, thus providing complementary information about the aerosol samples. DAPPI-HRMS showed several important oxidation products of terpenes, and numerous compounds were tentatively identified. Thanks to the soft ionization, high mass resolution, fast analysis, simplicity and on-line applicability, the proposed methodology has high potential in the field of atmospheric research. Copyright © 2015 John Wiley & Sons, Ltd.

Numerical approach to describe complementary drying of banana slices osmotically dehydrated

NASA Astrophysics Data System (ADS)

da Silva Júnior, Aluízio Freire; da Silva, Wilton Pereira; de Farias Aires, Juarez Everton; Farias Aires, Kalina Lígia C. A.

2018-02-01

In this work, diffusion model was used to describe the water loss in the complementary drying process of cylindrical slices of banana pretreated by osmotic dehydration. A numerical solution has been proposed for the diffusion equation in cylindrical coordinates, which was obtained through the Finite Volume Method. The diffusion equation was discretized assuming that the effective water diffusivity and the dimensions of a finite cylinder may vary; also considering the boundary condition of the third kind. The banana slices were cut in length of about 1.00 cm and average radius 1.70 cm before osmotic pretreatment, and completed the pretreatment with length of about 0.74 cm and average radius 1.40 cm. The complementary drying was carried out in a kiln with circulation and air exchange. Drying temperatures were the same as used in the osmotic pretreatment (40 to 70 °C). The proposed model described well the water loss, with good statistical indicators for all fits.

Applicability of active infrared thermography for screening of human breast: a numerical study.

PubMed

Dua, Geetika; Mulaveesala, Ravibabu

2018-03-01

Active infrared thermography is a fast, painless, noncontact, and noninvasive imaging method, complementary to mammography, ultrasound, and magnetic resonance imaging methods for early diagnosis of breast cancer. This technique plays an important role in early detection of breast cancer to women of all ages, including pregnant or nursing women, with different sizes of breast, irrespective of either fatty or dense breast. This proposed complementary technique makes use of infrared emission emanating from the breast. Emanating radiations from the surface of the breast under test are detected with an infrared camera to map the thermal gradients over it, in order to reveal hidden tumors inside it. One of the reliable active infrared thermographic technique, linear frequency modulated thermal wave imaging is adopted to detect tumors present inside the breast. Further, phase and amplitude images are constructed using frequency and time-domain data analysis schemes. Obtained results show the potential of the proposed technique for early diagnosis of breast cancer in fatty as well as dense breasts. (2018) COPYRIGHT Society of Photo-Optical Instrumentation Engineers (SPIE).

Peptide adsorption on the hydrophobic surface: A free energy perspective

NASA Astrophysics Data System (ADS)

Sheng, Yuebiao; Wang, Wei; Chen, P.

2011-05-01

Protein adsorption is a very attractive topic which relates to many novel applications in biomaterials, biotechnology and nanotechnology. Ionic complementary peptides are a group of novel nano-biomaterials with many biomedical applications. In this work, molecular dynamics simulations of the ionic-complementary peptide EAK16-II on a hydrophobic graphite surface were performed under neutral, acidic and basic solution conditions. Adsorption free energy contour maps were obtained by analyzing the dynamical trajectories. Hydrophobic interactions were found to govern the adsorption of the first peptide molecule, and both hydrophobic and electrostatic interactions contributed to the adsorption of the second peptide molecule. Especially under acidic and basic solution conditions, interplay existed among chain-chain hydrophobic, chain-surface hydrophobic and chain-chain electrostatic interactions during the adsorption of the second peptide molecule. Non-charged residues were found to lie on the graphite surface, while charged residue side-chains oriented towards the solution after the peptide deposited on the surface. These results provide a basis for understanding peptide adsorption on the hydrophobic surface under different solution conditions, which is useful for novel applications such as bioactive implant devices and drug delivery material design.

Hypnotherapy: Fact or Fiction: A Review in Palliative Care and Opinions of Health Professionals

PubMed Central

Desai, Geetha; Chaturvedi, Santosh K; Ramachandra, Srinivasa

2011-01-01

Context: Complementary medicine like hypnotherapy is often used for pain and palliative care. Health professionals vary in views about hypnotherapy, its utility, value, and attitudes. Aims: To understand the opinions of health professionals on hypnotherapy. Settings and Design: A semi-qualitative method to survey opinions of the health professionals from various disciplines attending a programme on hypnotherapy was conducted. Materials and Methods: The survey form consisted of 32 statements about hypnosis and hypnotherapy. Participants were asked to indicate whether they agreed, disagreed, or were not sure about each statement. A qualitative feedback form was used to obtain further views about hypnotherapy. Statistical Analysis Used: Percentage, frequency distribution. Results: The sample consisted of 21 participants from various disciplines. Two-thirds of the participants gave correct responses to statements on dangerousness of hypnosis (90%), weak mind and hypnosis (86%), and hypnosis as therapy (81%). The participants gave incorrect responses about losing control in hypnosis (57%), hypnosis being in sleep (62%), and becoming dependent on hypnotist (62%). Participants were not sure if one could not hear the hypnotist one is not hypnotized (43%) about the responses on gender and hypnosis (38%), hypnosis leading to revealing secrets (23%). Conclusions: Despite patients using complementary medicine services, often health professionals are unaware of the issues associated with these services. These myths may interfere in using hypnotherapy as therapeutic tool in palliative care. It is important for health professionals to have an appropriate and evidence-based understanding about the complementary therapies including hypnotherapy. PMID:21976856

In Vivo Differentiation of Complementary Contrast Media at Dual-Energy CT

PubMed Central

Mongan, John; Rathnayake, Samira; Fu, Yanjun; Wang, Runtang; Jones, Ella F.; Gao, Dong-Wei

2012-01-01

Purpose: To evaluate the feasibility of using a commercially available clinical dual-energy computed tomographic (CT) scanner to differentiate the in vivo enhancement due to two simultaneously administered contrast media with complementary x-ray attenuation ratios. Materials and Methods: Approval from the institutional animal care and use committee was obtained, and National Institutes of Health guidelines for the care and use of laboratory animals were observed. Dual-energy CT was performed in a set of iodine and tungsten solution phantoms and in a rabbit in which iodinated intravenous and bismuth subsalicylate oral contrast media were administered. In addition, a second rabbit was studied after intravenous administration of iodinated and tungsten cluster contrast media. Images were processed to produce virtual monochromatic images that simulated the appearance of conventional single-energy scans, as well as material decomposition images that separate the attenuation due to each contrast medium. Results: Clear separation of each of the contrast media pairs was seen in the phantom and in both in vivo animal models. Separation of bowel lumen from vascular contrast medium allowed visualization of bowel wall enhancement that was obscured by intraluminal bowel contrast medium on conventional CT scans. Separation of two vascular contrast media in different vascular phases enabled acquisition of a perfectly coregistered CT angiogram and venous phase–enhanced CT scan simultaneously in a single examination. Conclusion: Commercially available clinical dual-energy CT scanners can help differentiate the enhancement of selected pairs of complementary contrast media in vivo. © RSNA, 2012 PMID:22778447

Timing and Determinants of the Introduction of Complementary Foods in Kuwait: Results of a Prospective Cohort Study.

PubMed

Scott, Jane A; Dashti, Manal; Al-Sughayer, Mona; Edwards, Christine A

2015-08-01

The early introduction of complementary foods is common in Middle Eastern countries but little is known about the determinants of this practice in this region. This prospective cohort study conducted from October 2007 to October 2008 investigated the determinants of the very early (before 17 weeks) introduction of complementary foods in Kuwait and compared rates of this practice against rates reported in the mid-1990s. A total of 373 women were recruited from maternity hospitals in Kuwait City and followed to 26 weeks postpartum. Data on complementary feeding practices were available from 303 women. Multivariate logistic regression was used to estimate the association of very early introduction of complementary foods with infant sex and maternal characteristics including age, years of education, employment intentions at 6 months postpartum, parity, prepregnancy body mass index, and prepregnancy smoking status. All infants had received complementary foods by 26 weeks of age, with 30.4% receiving complementary foods before 17 weeks of age. Women born in other Arabic countries were less likely to introduce complementary foods before 17 weeks (adjusted odds ratio [adj OR] = 0.40; 95% confidence interval [CI], 0.22-0.73) than women born in Kuwait. Women who were exclusively formula feeding at 6 weeks postpartum were less likely to introduce complementary foods before 17 weeks (adj OR = 0.40; 95% CI, 0.23-0.71) than women who were still breastfeeding. Compared to the mid-1990s, fewer infants in Kuwait were receiving complementary foods before 17 weeks. Nevertheless, all infants had received complementary foods by 6 months of age. © The Author(s) 2015.

Phenol-enriched olive oils improve HDL antioxidant content in hypercholesterolemic subjects. A randomized, double-blind, cross-over, controlled trial.

PubMed

Farràs, Marta; Fernández-Castillejo, Sara; Rubió, Laura; Arranz, Sara; Catalán, Úrsula; Subirana, Isaac; Romero, Mari-Paz; Castañer, Olga; Pedret, Anna; Blanchart, Gemma; Muñoz-Aguayo, Daniel; Schröder, Helmut; Covas, Maria-Isabel; de la Torre, Rafael; Motilva, Maria-José; Solà, Rosa; Fitó, Montserrat

2018-01-01

At present, high-density lipoprotein (HDL) function is thought to be more relevant than HDL cholesterol quantity. Consumption of olive oil phenolic compounds (PCs) has beneficial effects on HDL-related markers. Enriched food with complementary antioxidants could be a suitable option to obtain additional protective effects. Our aim was to ascertain whether virgin olive oils (VOOs) enriched with (a) their own PC (FVOO) and (b) their own PC plus complementary ones from thyme (FVOOT) could improve HDL status and function. Thirty-three hypercholesterolemic individuals ingested (25 ml/day, 3 weeks) (a) VOO (80 ppm), (b) FVOO (500 ppm) and (c) FVOOT (500 ppm) in a randomized, double-blind, controlled, crossover trial. A rise in HDL antioxidant compounds was observed after both functional olive oil interventions. Nevertheless, α-tocopherol, the main HDL antioxidant, was only augmented after FVOOT versus its baseline. In conclusion, long-term consumption of phenol-enriched olive oils induced a better HDL antioxidant content, the complementary phenol-enriched olive oil being the one which increased the main HDL antioxidant, α-tocopherol. Complementary phenol-enriched olive oil could be a useful dietary tool for improving HDL richness in antioxidants. Copyright © 2017. Published by Elsevier Inc.

Phytochemical investigation and proximate analysis on the leaves of Cnidoscolus aconitifolius.

PubMed

Oyagbemi, Ademola A; Odetola, Adebimpe A; Azeez, Odunayo I

2011-03-01

The study was designed to carry out the phytochemical screening and the proximate analysis of Cnidoscolus aconitifolius leaves. The results obtained showed the presence of tannins, saponin, alkaloids, and flavonoids with the absence of glycosides. The proximate analysis and mineral composition of C. aconitifolius leaves showed high levels of crude protein, ash, and fiber, in that order, and low fat content with concomitant presence of minerals such as sodium, manganese, magnesium, potassium, calcium, iron, phosphate, and zinc. The leaves of C. aconitifolius have high nutrient potentials and could be used as nutraceuticals in complementary foods, especially in sub-Saharan Africa.

Optimizing the multicycle subrotational internal cooling of diatomic molecules

NASA Astrophysics Data System (ADS)

Aroch, A.; Kallush, S.; Kosloff, R.

2018-05-01

Subrotational cooling of the AlH+ ion to the miliKelvin regime, using optimally shaped pulses, is computed. The coherent electromagnetic fields induce purity-conserved transformations and do not change the sample temperature. A decrease in a sample temperature, manifested by an increase of purity, is achieved by the complementary uncontrolled spontaneous emission which changes the entropy of the system. We employ optimal control theory to find a pulse that stirs the system into a population configuration that will result in cooling, upon multicycle excitation-emission steps. The obtained optimal transformation was shown capable to cool molecular ions to the subkelvins regime.

Quiet Clean Short-Haul Experimental Engine (QCSEE): Acoustic treatment development and design

NASA Technical Reports Server (NTRS)

Clemons, A.

1979-01-01

Acoustic treatment designs for the quiet clean short-haul experimental engines are defined. The procedures used in the development of each noise-source suppressor device are presented and discussed in detail. A complete description of all treatment concepts considered and the test facilities utilized in obtaining background data used in treatment development are also described. Additional supporting investigations that are complementary to the treatment development work are presented. The expected suppression results for each treatment configuration are given in terms of delta SPL versus frequency and in terms of delta PNdB.

NMR-BASED METABOLOMIC STUDIES OF ENDOCRINE DISRUPTION IN SMALL FISH MODELS

EPA Science Inventory

Metabolomics is now being widely used to obtain complementary information to genomic and proteomic studies. Among the various approaches used in metabolomics, NMR spectroscopy is particularly powerful, in part because it is relatively non-selective, and is amenable to the study o...

Atomic characterization of Si nanoclusters embedded in SiO2 by atom probe tomography

PubMed Central

2011-01-01

Silicon nanoclusters are of prime interest for new generation of optoelectronic and microelectronics components. Physical properties (light emission, carrier storage...) of systems using such nanoclusters are strongly dependent on nanostructural characteristics. These characteristics (size, composition, distribution, and interface nature) are until now obtained using conventional high-resolution analytic methods, such as high-resolution transmission electron microscopy, EFTEM, or EELS. In this article, a complementary technique, the atom probe tomography, was used for studying a multilayer (ML) system containing silicon clusters. Such a technique and its analysis give information on the structure at the atomic level and allow obtaining complementary information with respect to other techniques. A description of the different steps for such analysis: sample preparation, atom probe analysis, and data treatment are detailed. An atomic scale description of the Si nanoclusters/SiO2 ML will be fully described. This system is composed of 3.8-nm-thick SiO layers and 4-nm-thick SiO2 layers annealed 1 h at 900°C. PMID:21711666

Surface acoustic waves in one-dimensional piezoelectric-metallic phononic crystal: Effect of a cap layer.

PubMed

Alami, M; El Boudouti, E H; Djafari-Rouhani, B; El Hassouani, Y; Talbi, A

2018-06-18

We study the propagation of transverse acoustic waves associated with the surface of a semi-infinite superlattice (SL) composed of piezoelectric-metallic layers and capped with a piezoelectric layer. We present closed-form expressions for localized surface waves, the so-called Bleustein-Gulyaev (BG) waves depending on whether the cap layer is open-circuited or short-circuited. These expressions are obtained by means of the Green's function method which enables to deduce also the densities of states. These theoretical results are illustrated by a few numerical applications to SLs made of piezoelectric layers of hexagonal symmetry belonging to the 6 mm class such as PZT4 and ZnO in contact with metallic layers such as Fe, Al, Au, Cu and boron-doped-diamond. We demonstrate a rule about the existence of surface modes when considering two complementary semi-infinite SLs obtained by the cleavage of an infinite SL along a plane parallel to the piezoelectric layers. Indeed, when the surface layers are open-circuited, one obtains one surface mode per gap, this mode is associated with one of the two complementary SLs. However, when the surface layers are short-circuited, this rule is not fulfilled and one can obtain zero, one or two modes inside each gap of the two complementary SLs depending on the position of the plane where the cleavage is produced. We show that in addition to the BG surface waves localized at the surface of the cap layer, there may exist true guided waves and pseudo-guided waves (i.e. leaky waves) induced by the cap layer either inside the gaps or inside the bands of the SL respectively. Also, we highlight the possibility of existence of interface modes between the SL and a cap layer as well as an interaction between these modes and the BG surface mode when both modes fall in the same band gaps of the SL. The strength of the interaction depends on the width of the cap layer. Finally, we show that the electromechanical coupling coefficient (ECC) is very sensitive to the cap layer thickness, in particular we calculate and discuss the behavior of the ECC as a function of the adlayer thickness for the low velocity surface modes of the SL which exhibit the highest ECC values. The effect of the nature of the metallic layers inside the SL on the ECC is also investigated. The different surface modes discussed in this work should have applications in sensing applications. Copyright © 2018. Published by Elsevier B.V.

[Methodological approach to the use of artificial neural networks for predicting results in medicine].

PubMed

Trujillano, Javier; March, Jaume; Sorribas, Albert

2004-01-01

In clinical practice, there is an increasing interest in obtaining adequate models of prediction. Within the possible available alternatives, the artificial neural networks (ANN) are progressively more used. In this review we first introduce the ANN methodology, describing the most common type of ANN, the Multilayer Perceptron trained with backpropagation algorithm (MLP). Then we compare the MLP with the Logistic Regression (LR). Finally, we show a practical scheme to make an application based on ANN by means of an example with actual data. The main advantage of the RN is its capacity to incorporate nonlinear effects and interactions between the variables of the model without need to include them a priori. As greater disadvantages, they show a difficult interpretation of their parameters and large empiricism in their process of construction and training. ANN are useful for the computation of probabilities of a given outcome based on a set of predicting variables. Furthermore, in some cases, they obtain better results than LR. Both methodologies, ANN and LR, are complementary and they help us to obtain more valid models.

Analysis of material flow in a utillzation technology of low grade manganese ore and sulphur coal complementary

NASA Astrophysics Data System (ADS)

Wang, Bo-Zhi; Deng, Biao; Su, Shi-Jun; Ding, Sang-Lan; Sun, Wei-Yi

2018-03-01

Electrolytic manganese is conventionally produced through low-grade manganese ore leaching in SO2, with the combustion of high sulfur coal. Subsequently the coal ash and manganese slag, produced by the combustion of high sulfur coal and preparation of electrolytic manganese, can be used as raw ingredients for the preparation of sulphoaluminate cement. In order to realize the `coal-electricity-sulfur-manganese-building material' system of complementary resource utilization, the conditions of material inflow and outflow in each process were determined using material flow analysis. The material flow models in each unit and process can be obtained by analyzed of material flow for new technology, and the input-output model could be obtained. Through the model, it is possible to obtain the quantity of all the input and output material in the condition of limiting the quantity of a substance. Taking one ton electrolytic manganese as a basis, the quantity of other input material and cements can be determined with the input-output model. The whole system had thusly achieved a cleaner production level. Therefore, the input-output model can be used for guidance in practical production.

Nutritional and sensory evaluation of a complementary food formulated from rice, faba beans, sweet potato flour, and peanut oil.

PubMed

Mahmoud, Amal H; El Anany, Ayman Mohammed

2014-12-01

Childhood malnutrition is a common disorder in developing countries. To formulate a complementary food from rice, germinated-decoated faba bean, orange-fleshed sweet potato flour, and peanut oil (RFPP formula) for infants aged 6 to 24 months. The nutritional and sensory characteristics of the RFPP complementary food in comparison with those of a commercial complementary food were determined using standard official procedures. The levels of protein (17.89 g/100 g), fat (10.35 g/100 g), carbohydrate (67.82 g/100 g), and energy (435.99 kcal/100 g) of the RFPP complementary food met the specifications of the Codex standard (1991) and the Egyptian Standard No. 3284 (2005). The essential amino acid contents of the RFPP complementary food were higher than the amino acid profile of the Food and Agriculture Organization/World Health Organization/United Nations University (2002) reference protein for children 0.5 to 1 and 1 to 2 years of age. The RFPP complementary food had high levels (54.00%) of monounsaturated fatty acids. However, the highest level of saturated fatty acids (51.10%) was recorded for the commercial complementary food. The sensory evaluation results, using a nine-point hedonic scale ranging from 1 (dislike extremely) to 9 (like extremely), show that the RFPP complementary food was acceptable in appearance (7.20), color (6.35), aroma (6.75), taste (7.25), and mouthfeel (7.10) and had an overall acceptability of 6.40. The RFPP formulated complementary food was acceptable and adequate in nutrients for weaning purposes.

Using Complementary Learning Clusters in Studying Literature to Enhance Students' Medical Humanities Literacy, Critical Thinking, and English Proficiency.

PubMed

Liao, Hung-Chang; Wang, Ya-Huei

2016-04-01

This study examined whether students studying literature in complementary learning clusters would show more improvement in medical humanities literacy, critical thinking skills, and English proficiency compared to those in conventional learning clusters. Ninety-three students participated in the study (M age = 18.2 years, SD = 0.4; 36 men, 57 women). A quasi-experimental design was used over 16 weeks, with the control group (n = 47) working in conventional learning clusters and the experimental group (n = 46) working in complementary learning clusters. Complementary learning clusters were those in which individuals had complementary strengths enabling them to learn from and offer assistance to other cluster members, hypothetically facilitating the learning process. Measures included the Medical Humanities Literacy Scale, Critical Thinking Disposition Assessment, English proficiency tests, and Analytic Critical Thinking Scoring Rubric. The results showed that complementary learning clusters have the potential to improve students' medical humanities literacy, critical thinking skills, and English proficiency. © The Author(s) 2016.

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3;-terminus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yeo, Hyun Koo; Lee, Jae Young

2012-04-18

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.

Analysis of bacterial populations in the environment using two-dimensional gel electrophoresis of genomic DNA and complementary DNA.

PubMed

Liu, Guo-Hua; Nakamura, Tatsuo; Amemiya, Takashi; Rajendran, Narasimmalu; Itoh, Kiminori

2011-01-01

Two-dimensional gel electrophoresis (2-DGE) mapping of genomic DNA and complementary DNA (cDNA) amplicons was attempted to analyze total and active bacterial populations within soil and activated sludge samples. Distinct differences in the number and species of bacterial populations and those that were metabolically active at the time of sampling were visually observed especially for the soil community. Statistical analyses and sequencing based on the 2-DGE data further revealed the relationships between total and active bacterial populations within each community. This high-resolution technique would be useful for obtaining a better understanding of bacterial population structures in the environment.

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus.

PubMed

Yeo, Hyun Koo; Lee, Jae Young

2010-05-01

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .

Two-Level Chebyshev Filter Based Complementary Subspace Method: Pushing the Envelope of Large-Scale Electronic Structure Calculations.

PubMed

Banerjee, Amartya S; Lin, Lin; Suryanarayana, Phanish; Yang, Chao; Pask, John E

2018-06-12

We describe a novel iterative strategy for Kohn-Sham density functional theory calculations aimed at large systems (>1,000 electrons), applicable to metals and insulators alike. In lieu of explicit diagonalization of the Kohn-Sham Hamiltonian on every self-consistent field (SCF) iteration, we employ a two-level Chebyshev polynomial filter based complementary subspace strategy to (1) compute a set of vectors that span the occupied subspace of the Hamiltonian; (2) reduce subspace diagonalization to just partially occupied states; and (3) obtain those states in an efficient, scalable manner via an inner Chebyshev filter iteration. By reducing the necessary computation to just partially occupied states and obtaining these through an inner Chebyshev iteration, our approach reduces the cost of large metallic calculations significantly, while eliminating subspace diagonalization for insulating systems altogether. We describe the implementation of the method within the framework of the discontinuous Galerkin (DG) electronic structure method and show that this results in a computational scheme that can effectively tackle bulk and nano systems containing tens of thousands of electrons, with chemical accuracy, within a few minutes or less of wall clock time per SCF iteration on large-scale computing platforms. We anticipate that our method will be instrumental in pushing the envelope of large-scale ab initio molecular dynamics. As a demonstration of this, we simulate a bulk silicon system containing 8,000 atoms at finite temperature, and obtain an average SCF step wall time of 51 s on 34,560 processors; thus allowing us to carry out 1.0 ps of ab initio molecular dynamics in approximately 28 h (of wall time).

Interpreting contact angle results under air, water and oil for the same surfaces

NASA Astrophysics Data System (ADS)

Ozkan, Orkun; Yildirim Erbil, H.

2017-06-01

Under-water and under-oil superhydropobicity and superhydrophilicity have gained significant attention over the last few years. In this study, contact angles on five flat surfaces (polypropylene, poly(methyl methacrylate), polycarbonate, TEFLON-FEP and glass slide) were measured in water drop-in-air, air bubble-under-water, oil drop-in-air, air bubble-under-oil, oil drop-under-water and water drop-under-oil conditions. Heptane, octane, nonane, decane, dodecane, and hexadecane hydrocarbons were used as oils. Immiscible water/oil pairs were previously mutually saturated to provide thermodynamical equilibrium conditions and their surface and interfacial tensions were determined experimentally. These pairs were used in the two-liquid contact angle measurements. Surface free energies of the solid surfaces in air were determined independently by using the van Oss-Good method, using the contact angle results of pure water, ethylene glycol, formamide, methylene iodide and α-bromonaphalene. In addition, Zisman’s ‘critical surface tension’ values were also determined for comparison. In theory, the summation of contact angle results in a complementary case would give a total of 180° for ideal surfaces. However, it was determined that there are large deviations from this rule in practical cases and these deviations depend on surface free energies of solids. Three complementary cases of (water-in-air with air bubble-under-water); (oil-in-air with air bubble-under-oil); and (oil-under-water with water-under-oil) were investigated in particular to determine the deviations from ideality. A novel approach, named ‘complementary hysteresis’ [γ WA(cosθ 1  -  cosθ 2) and γ OW(cosθ 6  -  cosθ 5)] was developed where γ WA and γ OW represent the interfacial tensions of water/air and oil/water, and θ 1, θ 2, θ 5, and θ 6 were the contact angles of water/air, air bubble/water, oil/water and water/oil respectively. It was experimentally determined that complementary hysteresis varies almost linearly with the surface free energy of the flat solid samples. This is the first report showing the relation of the surface free energy of a solid which is determined under-air with the contact angles obtained on the same solid in different three-phase systems.

Preliminary results of human PrPC protein studied by spectroscopic techniques

NASA Astrophysics Data System (ADS)

Nowakowski, Michał; Czapla-Masztafiak, Joanna; Kozak, Maciej; Zhukov, Igor; Zhukova, Lilia; Szlachetko, Jakub; Kwiatek, Wojciech M.

2017-11-01

Neurodegenerative diseases are one of the malfunctions of human nervous system, being a class of complex and prominent pathologies. The human prion Protease Resistant Protein (PrP) is protein regulating copper metabolism in mammalian cells through binding of Cu(II) ions to specific fragments. Nowadays misfolding of this protein is associated with development of prion diseases. Therefore, it is crucial to obtain structural information about coordination of Cu(II) by PrP protein. Herein, we report X-ray absorption spectroscopy (XAS) measurements, carried out on SuperXAS beamline (SLS, PSI Villigen) on PrPC-Cu(II) complexes. Obtained results were compared with theoretical predictions done by FEFF 9.6 software. Complementary to XAS data, Atomic Force Microscopy (AFM) measurements were conducted to obtain low resolution structural information about prepared sample that allow to develop protocol of fixing PrPC molecules on solid substrate used for further experiments. It has been established that folded C-terminal domain of PrPC protein has around 5 nm in diameter. Presented results showed that both XAS and AFM methods are useful tools in detailed examination of complexes of human PrPC either with Cu(II) or with other divalent metal ions.

Complementary Feeding Knowledge, Practices, and Dietary Diversity among Mothers of Under-Five Children in an Urban Community in Lagos State, Nigeria

PubMed Central

Olatona, Foluke Adenike; Adenihun, Jesupelumi Oreoluwa; Aderibigbe, Sunday Adedeji; Adeniyi, Oluwafunmilayo Funke

2017-01-01

Background and Objectives: Inappropriate complementary feeding is a major cause of child malnutrition and death. This study determined the complementary feeding knowledge, practices, minimum dietary diversity, and acceptable diet among mothers of under-five children in an urban Local Government Area of Lagos State, Southwest Nigeria. Methods: This descriptive cross-sectional study was conducted in Eti-Osa area of Lagos State, Nigeria. Multi-stage sampling technique was employed to select 355 mothers and infants. Data was collected using a pre-tested interviewer administered questionnaire and 24-hour diet recall was used to assess dietary diversity. Data was analyzed using Epi-Info. Results: Knowledge of complementary feeding was low (14.9%) and was associated with older mothers’ age, being married, and higher level of education. The prevalence of timely initiation of complementary feeding (47.9%), dietary diversity (16.0%) and minimum acceptable diet for children between 6 and 9 months (16%) were low. Overall, appropriate complementary feeding practice was low (47.0%) and associated with higher level of mothers’ education and occupation. Conclusions and Global Health Implications: Complementary feeding knowledge and practices were poor among mothers of under-5 especially the non-literate. Reduction of child malnutrition through appropriate complementary feeding remains an important global health goal. Complementary feeding education targeting behavioral change especially among young, single and uneducated mothers in developing countries is important to reduce child morbidity and mortality. PMID:28798893

Influence of apical enlargement and complementary canal preparation with the Self-Adjusting File on endotoxin reduction in retreatment cases.

PubMed

Silva, E J N L; Ferreira, V M; Silva, C C; Herrera, D R; De-Deus, G; Gomes, B P

2017-07-01

To compare the effectiveness of large apical preparations and complementary canal preparation with the Self-Adjusting File (SAF) in removing endotoxins from the root canal of teeth with apical periodontitis. Ten single-rooted and single-canaled teeth with post-treatment apical periodontitis were selected. Endotoxin samples were taken after removal of the root filling (S1), after chemomechanical preparation (CMP) using 2.5% NaOCl and an R25 file (S2), after CMP using 2.5% NaOCl and an R40 file (S3) and after complementary CMP using the SAF system (S4). Limulus amebocyte lysate (LAL) was used to measure endotoxin levels. The Friedman and Wilcoxon tests were used to compare endotoxin levels at each clinical intervention (P < 0.05). After root filling removal, endotoxin was detected in 100% of the root canals (S1, 4.84 EU mL -1 ). CMP with the R25 file was able to significantly reduce endotoxin levels (P < 0.05). Increased levels of endotoxin removal were achieved by apical preparation with the R40 file (P < 0.05). Complementary CMP with SAF did not significantly reduce endotoxin levels (P > 0.05) following the use of the R40 instrument. Apical enlargement protocols were effective in significantly reducing endotoxin levels. Complementary preparation with the SAF system failed to eliminate residual endotoxin contents beyond those obtained with the R40 instrument. © 2016 International Endodontic Journal. Published by John Wiley & Sons Ltd.

Unfolding and Targeting Thermodynamics of a DNA Intramolecular Complex with Joined Triplex-Duplex Domains.

PubMed

Johnson, Sarah E; Reiling-Steffensmeier, Calliste; Lee, Hui-Ting; Marky, Luis A

2018-01-25

Our laboratory is interested in developing methods that can be used for the control of gene expression. In this work, we are investigating the reaction of an intramolecular complex containing a triplex-duplex junction with partially complementary strands. We used a combination of isothermal titration calorimetry (ITC), differential scanning calorimetry (DSC), and spectroscopy techniques to determine standard thermodynamic profiles for these targeting reactions. Specifically, we have designed single strands to target one loop (CTTTC) or two loops (CTTTC and GCAA) of this complex. Both reactions yielded exothermic enthalpies of -66.3 and -82.8 kcal/mol by ITC, in excellent agreement with the reaction enthalpies of -72.7 and -88.7 kcal/mol, respectively, obtained from DSC Hess cycles. The favorable heat contributions result from the formation of base-pair stacks involving mainly the unpaired bases of the loops. This shows that each complementary strand is able to invade and disrupt the secondary structure. The simultaneous targeting of two loops yielded a more favorable reaction free energy, by approximately -8 kcal/mol, which corresponds to the formation of roughly four base-pair stacks involving the unpaired bases of the 5'-GCAA loop. The main conclusion is that the targeting of loops with a large number of unpaired bases results in a more favorable reaction free energy.

Factors related to the parallel use of complementary and alternative medicine with conventional medicine among patients with chronic conditions in South Korea.

PubMed

Choi, Byunghee; Han, Dongwoon; Na, Seonsam; Lim, Byungmook

2017-06-01

This study aims to examine the characteristics and behavioral patterns of patients with chronic conditions behind their parallel use of the conventional medicine (CM) and the complementary and alternative medicine (CAM) that includes traditional Korean Medicine (KM). This cross-sectional study used the self-administered anonymous survey method to obtain the results from inpatients who were staying in three hospitals in Gyeongnam province in Korea. Of the 423 participants surveyed, 334 participants (79.0%) used some form of CAM among which KM therapies were the most common modalities. The results of a logistic regression analysis showed that the parallel use pattern was most apparent in the groups aged over 40. Patients with hypertension or joint diseases were seen to have higher propensity to show the parallel use patterns, whereas patients with diabetes were not. In addition, many sociodemographic and health-related characteristics are related to the patterns of the parallel use of CAM and CM. In the rural area of Korea, most inpatients who used CM for the management of chronic conditions used CAM in parallel. KM was the most common in CAM modalities, and the aspect of parallel use varied according to the disease conditions.

Cysteine-rich secretory proteins (CRISP) and their role in mammalian fertilization.

PubMed

Cohen, Débora J; Maldera, Julieta A; Weigel Muñoz, Mariana; Ernesto, Juan I; Vasen, Gustavo; Cuasnicu, Patricia S

2011-01-01

Epididymal protein CRISPI is a member of the CRISP (Cysteine-RIch Secretory proteins) family and is involved in sperm-egg fusion through its interaction with complementary sites on the egg surface. Results from our laboratory have shown that this binding ability resides in a 12-amino-acid region corresponding to a highly conserved motif of the CRISP family, named Signature 2 (S2). In addition to this, our results revealed that CRISP1 could also be involved in the previous step of sperm binding to the zona pellucida, identifying a novel role for this protein in fertilization. As another approach to elucidate the participation of CRISP1 in fertilization, a mouse line containing a targeted disruption of CRISP1 was generated. Although CRISP1-deficient mice exhibited normal fertility, CRISP1-defficient sperm presented a decreased level of protein tyrosine phosphorylation during capacitation, and an impaired ability to fertilize both zona-intact and zona-free eggs in vitro, confirming the proposed roles for the protein in fertilization. Evidence obtained in our laboratory indicated that testicular CRISP2 would also be involved in sperm-egg fusion. Competition assays between CRISP1 and CRISP2, as well as the comparison of their corresponding S2 regions, suggest that both proteins bind to common complementary sites in the egg. Together, these results suggest a functional cooperation between CRISP1 and CRISP2 to ensure the success of fertilization.

Clinical Usefulness of a One-Tube Nested Reverse Transcription Quantitative Polymerase Chain Reaction Assay for Evaluating Human Epidermal Growth Factor Receptor 2 mRNA Overexpression in Formalin-Fixed and Paraffin-Embedded Breast Cancer Tissue Samples.

PubMed

Wang, Hye-Young; Ahn, Sungwoo; Park, Sunyoung; Kim, SeungIl; Lee, Hyeyoung

2017-01-01

Currently, the two main methods used to analyze human epidermal growth factor receptor 2 (HER2) amplification or overexpression have a limited accuracy and high costs. These limitations can be overcome by the development of complementary quantitative methods. In this study, we analyzed HER2 mRNA expression in clinical formalin-fixed and paraffin-embedded (FFPE) samples using a one-tube nested reverse transcription quantitative polymerase chain reaction (RT-qPCR) assay. We measured expression relative to 3 reference genes and compared the results to those obtained by conventional immunohistochemistry (IHC) and fluorescence in situ hybridization (FISH) assays with 226 FFPE breast cancer tissue samples. The one-tube nested RT-qPCR assay proved to be highly sensitive and specific based on comparisons with IHC (96.9 and 97.7%, respectively) and FISH (92.4 and 92.9%, respectively) obtained with the validation set. Comparisons with clinicopathological data revealed significant associations between HER2 overexpression and TNM stage (p < 0.01), histological type (p < 0.01), ER status (p < 0.001), PR status (p < 0.05), HER2 status (p < 0.001), and molecular subtypes (p < 0.001). Based on these findings, our one-tube nested RT-qPCR assay is a potentially useful and complementary screening tool for the detection of HER2 mRNA overexpression. © 2016 S. Karger AG, Basel.

Visualization and characterization of engineered nanoparticles in complex environmental and food matrices using atmospheric scanning electron microscopy.

PubMed

Luo, P; Morrison, I; Dudkiewicz, A; Tiede, K; Boyes, E; O'Toole, P; Park, S; Boxall, A B

2013-04-01

Imaging and characterization of engineered nanoparticles (ENPs) in water, soils, sediment and food matrices is very important for research into the risks of ENPs to consumers and the environment. However, these analyses pose a significant challenge as most existing techniques require some form of sample manipulation prior to imaging and characterization, which can result in changes in the ENPs in a sample and in the introduction of analytical artefacts. This study therefore explored the application of a newly designed instrument, the atmospheric scanning electron microscope (ASEM), which allows the direct characterization of ENPs in liquid matrices and which therefore overcomes some of the limitations associated with existing imaging methods. ASEM was used to characterize the size distribution of a range of ENPs in a selection of environmental and food matrices, including supernatant of natural sediment, test medium used in ecotoxicology studies, bovine serum albumin and tomato soup under atmospheric conditions. The obtained imaging results were compared to results obtained using conventional imaging by transmission electron microscope (TEM) and SEM as well as to size distribution data derived from nanoparticle tracking analysis (NTA). ASEM analysis was found to be a complementary technique to existing methods that is able to visualize ENPs in complex liquid matrices and to provide ENP size information without extensive sample preparation. ASEM images can detect ENPs in liquids down to 30 nm and to a level of 1 mg L(-1) (9×10(8) particles mL(-1) , 50 nm Au ENPs). The results indicate ASEM is a highly complementary method to existing approaches for analyzing ENPs in complex media and that its use will allow those studying to study ENP behavior in situ, something that is currently extremely challenging to do. © 2013 The Authors Journal of Microscopy © 2013 Royal Microscopical Society.

Comparison of impedimetric detection of DNA hybridization on the various biosensors based on modified glassy carbon electrodes with PANHS and nanomaterials of RGO and MWCNTs.

PubMed

Benvidi, Ali; Tezerjani, Marzieh Dehghan; Jahanbani, Shahriar; Mazloum Ardakani, Mohammad; Moshtaghioun, Seyed Mohammad

2016-01-15

In this research, we have developed lable free DNA biosensors based on modified glassy carbon electrodes (GCE) with reduced graphene oxide (RGO) and carbon nanotubes (MWCNTs) for detection of DNA sequences. This paper compares the detection of BRCA1 5382insC mutation using independent glassy carbon electrodes (GCE) modified with RGO and MWCNTs. A probe (BRCA1 5382insC mutation detection (ssDNA)) was then immobilized on the modified electrodes for a specific time. The immobilization of the probe and its hybridization with the target DNA (Complementary DNA) were performed under optimum conditions using different electrochemical techniques such as cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS). The proposed biosensors were used for determination of complementary DNA sequences. The non-modified DNA biosensor (1-pyrenebutyric acid-N- hydroxysuccinimide ester (PANHS)/GCE), revealed a linear relationship between ∆Rct and logarithm of the complementary target DNA concentration ranging from 1.0×10(-16)molL(-1) to 1.0×10(-10)mol L(-1) with a correlation coefficient of 0.992, for DNA biosensors modified with multi-wall carbon nanotubes (MWCNTs) and reduced graphene oxide (RGO) wider linear range and lower detection limit were obtained. For ssDNA/PANHS/MWCNTs/GCE a linear range 1.0×10(-17)mol L(-1)-1.0×10(-10)mol L(-1) with a correlation coefficient of 0.993 and for ssDNA/PANHS/RGO/GCE a linear range from 1.0×10(-18)mol L(-1) to 1.0×10(-10)mol L(-1) with a correlation coefficient of 0.985 were obtained. In addition, the mentioned biosensors were satisfactorily applied for discriminating of complementary sequences from noncomplementary sequences, so the mentioned biosensors can be used for the detection of BRCA1-associated breast cancer. Copyright © 2015. Published by Elsevier B.V.

Niche engineering reveals complementary resource use

USDA-ARS?s Scientific Manuscript database

Greater resource use by diverse communities might result from species occupying different, complementary niches. Niche partitioning is difficult to directly demonstrate, however, because differences among species in the resources they use are often difficult to separate from other species-specific t...

Simulations Using Random-Generated DNA and RNA Sequences

ERIC Educational Resources Information Center

Bryce, C. F. A.

1977-01-01

Using a very simple computer program written in BASIC, a very large number of random-generated DNA or RNA sequences are obtained. Students use these sequences to predict complementary sequences and translational products, evaluate base compositions, determine frequencies of particular triplet codons, and suggest possible secondary structures.…

Nurses' Needs for Education on Cancer and End-of-life Care.

ERIC Educational Resources Information Center

Meraviglia, Martha G.; McGuire, Catherine; Chesley, Dorothy A.

2003-01-01

From a random sample of Texas registered nurses, 352 respondents (8.3%) primarily obtained continuing education from workshops, inservice education, and independent studies, citing cost, location, content, and length of course as influencing factors. Their cancer educational needs included clinical trials, genetics, complementary therapies, and…

Development of the adult and child complementary medicine questionnaires fielded on the National Health Interview Survey

PubMed Central

2013-01-01

The 2002, 2007, and 2012 complementary medicine questionnaires fielded on the National Health Interview Survey provide the most comprehensive data on complementary medicine available for the United States. They filled the void for large-scale, nationally representative, publicly available datasets on the out-of-pocket costs, prevalence, and reasons for use of complementary medicine in the U.S. Despite their wide use, this is the first article describing the multi-faceted and largely qualitative processes undertaken to develop the surveys. We hope this in-depth description enables policy makers and researchers to better judge the content validity and utility of the questionnaires and their resultant publications. PMID:24267412

Development of the adult and child complementary medicine questionnaires fielded on the National Health Interview Survey.

PubMed

Stussman, Barbara J; Bethell, Christina D; Gray, Caroline; Nahin, Richard L

2013-11-23

The 2002, 2007, and 2012 complementary medicine questionnaires fielded on the National Health Interview Survey provide the most comprehensive data on complementary medicine available for the United States. They filled the void for large-scale, nationally representative, publicly available datasets on the out-of-pocket costs, prevalence, and reasons for use of complementary medicine in the U.S. Despite their wide use, this is the first article describing the multi-faceted and largely qualitative processes undertaken to develop the surveys. We hope this in-depth description enables policy makers and researchers to better judge the content validity and utility of the questionnaires and their resultant publications.

Complementary and Alternative Medicine Use in Dermatology in the United States

PubMed Central

Landis, Erin T.; Davis, Scott A.; Taylor, Sarah

2014-01-01

Abstract Background: Complementary and alternative medicine (CAM) has an increasing presence in dermatology. Complementary therapies have been studied in many skin diseases, including atopic dermatitis and psoriasis. Objectives: This study sought to assess oral CAM use in dermatology relative to medicine as a whole in the United States, using the National Ambulatory Medical Care Survey. Design: Variables studied include patient demographic characteristics, diagnoses, and CAM documented at the visits. A brief literature review of the top 5 CAM treatments unique to dermatology visits was performed. Results: Most CAM users in both dermatology and medicine as a whole were female and white and were insured with private insurance or Medicare. Fish oil, glucosamine, glucosamine chondroitin, and omega-3 were the most common complementary supplements used in both samples. Conclusions: CAM use in dermatology appears to be part of a larger trend in medicine. Knowledge of common complementary therapies can help dermatologists navigate this expanding field. PMID:24517329

Should Bouchet's hypothesis be taken into account in rainfall-runoff modelling? An assessment over 308 catchments

NASA Astrophysics Data System (ADS)

Oudin, Ludovic; Michel, Claude; Andréassian, Vazken; Anctil, François; Loumagne, Cécile

2005-12-01

An implementation of the complementary relationship hypothesis (Bouchet's hypothesis) for estimating regional evapotranspiration within two rainfall-runoff models is proposed and evaluated in terms of streamflow simulation efficiency over a large sample of 308 catchments located in Australia, France and the USA. Complementary relationship models are attractive approaches to estimating actual evapotranspiration because they rely solely on climatic variables. They are even more interesting since they are supported by a conceptual description underlying the interactions between the evapotranspirating surface and the atmospheric boundary layer, which was highlighted by Bouchet (1963). However, these approaches appear to be in contradiction with the methods prevailing in rainfall-runoff models, which compute actual evapotranspiration using soil moisture accounting procedures. The approach adopted in this article is to introduce the estimation of actual evapotranspiration provided by complementary relationship models (complementary relationship for areal evapotranspiration and advection aridity) into two rainfall-runoff models. Results show that directly using the complementary relationship approach to estimate actual evapotranspiration does not give better results than the soil moisture accounting procedures. Finally, we discuss feedback mechanisms between potential evapotranspiration and soil water availability, and their possible impact on rainfall-runoff modelling. Copyright

Fluorimetric determinations of nucleic acids using iron, osmium and samarium complexes of 4,7-diphenyl-1,10-phenanthroline

NASA Astrophysics Data System (ADS)

Salem, A. A.

2006-09-01

New sensitive, reliable and reproducible fluorimetric methods for determining microgram amounts of nucleic acids based on their reactions with Fe(II), Os(III) or Sm(III) complexes of 4,7-diphenyl-1,10-phenanthroline are proposed. Two complementary single stranded synthetic DNA sequences based on calf thymus as well as their hybridized double stranded were used. Nucleic acids were found to react instantaneously at room temperature in Tris-Cl buffer pH 7, with the investigated complexes resulting in decreasing their fluorescence emission. Two fluorescence peaks around 388 and 567 nm were obtained for the three complexes using excitation λmax of 280 nm and were used for this investigation. Linear calibration graphs in the range 1-6 μg/ml were obtained. Detection limits of 0.35-0.98 μg/ml were obtained. Using the calibration graphs for the synthetic dsDNA, relative standard deviations of 2.0-5.0% were obtained for analyzing DNA in the extraction products from calf thymus and human blood. Corresponding Recovery% of 80-114 were obtained. Student's t-values at 95% confidence level showed insignificant difference between the real and measured values. Results obtained by these methods were compared with the ethidium bromide method using the F-test and satisfactory results were obtained. The association constants and number of binding sites of synthetic ssDNA and dsDNA with the three complexes were estimated using Rosenthanl graphic method. The interaction mechanism was discussed and an intercalation mechanism was suggested for the binding reaction between nucleic acids and the three complexes.

Developmental Readiness of Normal Full Term Infants To Progress from Exclusive Breastfeeding to the Introduction of Complementary Foods: Reviews of the Relevant Literature Concerning Infant Immunologic, Gastrointestinal, Oral Motor and Maternal Reproductive and Lactational Development.

ERIC Educational Resources Information Center

Naylor, Audrey J., Ed.; Morrow, Ardythe L., Ed.

This review of the developmental readiness of normal, full-term infants to progress from exclusive breastfeeding to the introduction of complementary foods is the result of the international debate regarding the best age to introduce complementary foods into the diet of the breastfed human infant. After a list of definitions, four papers focus on:…

Finding My Needle in the Haystack: Effective Personalized Re-ranking of Search Results in Prospector

NASA Astrophysics Data System (ADS)

König, Florian; van Velsen, Lex; Paramythis, Alexandros

This paper provides an overview of Prospector, a personalized Internet meta-search engine, which utilizes a combination of ontological information, ratings-based models of user interests, and complementary theme-oriented group models to recommend (through re-ranking) search results obtained from an underlying search engine. Re-ranking brings “closer to the top” those items that are of particular interest to a user or have high relevance to a given theme. A user-based, real-world evaluation has shown that the system is effective in promoting results of interest, but lags behind Google in user acceptance, possibly due to the absence of features popularized by said search engine. Overall, users would consider employing a personalized search engine to perform searches with terms that require disambiguation and / or contextualization.

Probing the Conformational Landscape of Polyether Building Blocks in Supersonic Jets

NASA Astrophysics Data System (ADS)

Bocklitz, Sebastian; Hewett, Daniel M.; Zwier, Timothy S.; Suhm, Martin A.

2016-06-01

Polyethylene oxides (Polyethylene glycoles) and their phenoxy-capped analogs represent a prominent class of important polymers that are highly used as precursor molecules in supramolecular reactions. After a detailed study on the simplest representative (1,2-dimethoxyethane) [1], we present results on oligoethylene oxides with increasing chain lengths obtained by spontaneous Raman scattering in a supersonic jet. Through variation of stagnation pressure, carrier gas, nozzle distance and temperature we gain information on the conformational landscape as well as the mutual interconversion of low energy conformers. The obtained results are compared to state-of-the-art quantum chemical calculations. Additionally, we present UV as well as IR-UV and UV-UV double resonance studies on 1-methoxy-2-phenoxyethane in a supersonic jet. These complementary techniques allow for conformationally selective electronic and vibrational spectra in a closely related conformational landscape. [1] S. Bocklitz, M. A. Suhm, Constraining the Conformational Landscape of a Polyether Building Block by Raman Jet Spectroscopy, Z. Phys. Chem. 2015, 229, 1625-1648.

NHS-based Tandem Mass Tagging of Proteins at the Level of Whole Cells: A Critical Evaluation in Comparison to Conventional TMT-Labeling Approaches for Quantitative Proteome Analysis.

PubMed

Megger, Dominik A; Pott, Leona L; Rosowski, Kristin; Zülch, Birgit; Tautges, Stephanie; Bracht, Thilo; Sitek, Barbara

2017-01-01

Tandem mass tags (TMT) are usually introduced at the levels of isolated proteins or peptides. Here, for the first time, we report the labeling of whole cells and a critical evaluation of its performance in comparison to conventional labeling approaches. The obtained results indicated that TMT protein labeling using intact cells is generally possible, if it is coupled to a subsequent enrichment using anti-TMT antibody. The quantitative results were similar to those obtained after labeling of isolated proteins and both were found to be slightly complementary to peptide labeling. Furthermore, when using NHS-based TMT, no specificity towards cell surface proteins was observed in the case of cell labeling. In summary, the conducted study revealed first evidence for the general possibility of TMT cell labeling and highlighted limitations of NHS-based labeling reagents. Future studies should therefore focus on the synthesis and investigation of membrane impermeable TMTs to increase specificity towards cell surface proteins.

Use of Complementary and Alternative Medicine Treatments by Patients with Obstructive Sleep Apnea Hypopnea Syndrome

PubMed Central

Sood, Amit; Narayanan, Sujata; Wahner-Roedler, Dietlind L.; Knudsen, Kayla; Sood, Richa; Loehrer, Laura L.; Hanson, Andrew C.; Kuzniar, Tomasz J.; Olson, Eric J.

2007-01-01

Study Objectives: To assess the proportion of patients with obstructive sleep apnea hypopnea syndrome (OSAHS) reporting previous or current use and interest in future use of complementary and alternative medicine (CAM) therapies. Design: Cross-sectional, point-of-care, anonymous survey. Setting: Sleep disorders center at a Midwest tertiary care center. Participants: Six hundred forty-six consecutive patients undergoing polysomnography. Measurements: The survey instrument comprised 45 items specifically related to CAM therapies, in addition to obtaining baseline data. Results: Response rate was 81% (522/646). A total of 406/522 (78%) patients were diagnosed with OSAHS. Mean age ± SD was 57 ± 14 years, and 267 participants (66%) were men. Overall, 237 (58%) participants reported ever using CAM. Ever and current CAM use specifically for improving sleep was reported by 20% and 7% of the participants, respectively. Twenty-six percent of participants reported ever using biologic products, and 52% reported ever using nonbiologic CAM treatments. A high proportion (58%) of the participants showed interest in future CAM use for improving sleep. Conclusion: A high proportion of patients with OSAHS report previous or current use, and interest in future use, of CAM treatments. This underscores the need to conduct further research in this field. Citation: Sood A; Narayanan S; Wahner-Roedler DL; Knudsen K; Sood R; Loehrer LL; Hanson AC; Kuzniar TJ; Olson EJ. Use of complementary and alternative medicine treatments by patients with obstructive sleep apnea hypopnea syndrome. J Clin Sleep Med 2007;3(6):575-579. PMID:17993037

Poly(adenylic acid) complementary DNA real-time polymerase chain reaction in pancreatic ductal juice in patients undergoing pancreaticoduodenectomy.

PubMed

Oliveira-Cunha, Melissa; Byers, Richard J; Siriwardena, Ajith K

2010-03-01

There is a need to develop methods of early diagnosis for pancreatic cancer. Pancreatic juice is easily collected by endoscopic retrograde cholangiopancreatography and may facilitate diagnosis using molecular markers. The aim of this work was to explore the feasibility of measurement of gene expression in RNA isolated from ductal juice. Intraoperative sampling of pancreatic juice was undertaken in 27 patients undergoing pancreaticoduodenectomy for suspected tumor. Total RNA was extracted and used as template for poly(adenylic acid) (poly[A]) polymerase chain reaction (PCR) to generate a globally amplified complementary DNA pool representative of all expressed messenger RNAs. Real-time PCR was performed for trefoil factor 2 (TFF2), carboxypeptidase B1 (CPB1), and kallikrein-related peptidase 3 (KLK3) in a subset of samples; all samples were normalized for 3 reference genes (glyceraldehyde-3-phosphate dehydrogenase [GAPDH], PSMB6, and beta-2-microglobulin [B2M]). The median volume of the pancreatic juice obtained was 1245 microL (range, 50-5000 microL). The RNA integrity number ranged from 1.9 to 10. Reverse transcriptase PCR was positive for pancreas-specific genes (TFF2 and CPB1) and negative for prostatic-specific antigen in all samples. These results demonstrate that RNA analysis of pancreatic juice is feasible using a combination of poly(A) PCR and real-time PCR. In addition, the poly(A) complementary DNA generated can be probed for multiple genes and is indefinitely renewable, thereby representing a molecular block of importance for future research.

Medical Student Attitudes toward Complementary, Alternative and Integrative Medicine

PubMed Central

Abbott, Ryan B.; Hui, Ka-Kit; Hays, Ron D.; Mandel, Jess; Goldstein, Michael; Winegarden, Babbi; Glaser, Dale; Brunton, Laurence

2011-01-01

While the use of complementary, alternative and integrative medicine (CAIM) is substantial, it continues to exist at the periphery of allopathic medicine. Understanding the attitudes of medical students toward CAIM will be useful in understanding future integration of CAIM and allopathic medicine. This study was conducted to develop and evaluate an instrument and assess medical students' attitudes toward CAIM. The Complementary, Alternative and Integrative Medicine Attitudes Questionnaire (CAIMAQ) was developed by a panel of experts in CAIM, allopathic medicine, medical education and survey development. A total of 1770 CAIMAQ surveys (51% of US medical schools participated) were obtained in a national sample of medical students in 2007. Factor analysis of the CAIMAQ revealed five distinct attitudinal domains: desirability of CAIM therapies, progressive patient/physician health care roles, mind-body-spirit connection, principles of allostasis and a holistic understanding of disease. The students held the most positive attitude for the “mind-body-spirit connection” and the least positive for the “desirability of CAIM therapies”. This study provided initial support for the reliability of the CAIMAQ. The survey results indicated that in general students responded more positively to the principles of CAIM than to CAIM treatment. A higher quality of CAIM-related medical education and expanded research into CAIM therapies would facilitate appropriate integration of CAIM into medical curricula. The most significant limitation of this study is a low response rate, and further work is required to assess more representative populations in order to determine whether the relationships found in this study are generalizable. PMID:21826186

Nurses' beliefs, experiences and practice regarding complementary and alternative medicine in Taiwan.

PubMed

Smith, Graeme D; Wu, Shu-Chen

2012-09-01

To gain an insight into this issue, this study used a qualitative approach and aims to explore and describe nurses' beliefs, experiences and practice regarding complementary and alternative medicine in Taiwan. The integration of complementary and alternative medicine with conventional medicine has become more common worldwide in recent years. An increase in patient use and an expansion of nurses using complementary and alternative medicine has spawned further investigation. Most published studies have concentrated on the usage of complementary and alternative medicine in western societies and have focused principally on physicians' attitudes and practice patterns in this regard. Despite the large amount of time and the unique relationship that nurses share with their patients, little research has investigated the nurse's attitudes and practice regarding complementary and alternative medicine. Moreover, there has been no previous research into understanding this issue from the Taiwanese nursing perspective. A qualitative research design. By using an exploratory, descriptive, qualitative approach, data were collected from 11 registered nurses. The methods of the data collection were in-depth, semi-structured interviews, field notes and memos and the data were analysed using the constant comparative method. Three major categories emerged from the data; namely, a 'lack of clear definition', 'limited experience' and 'high interest' towards complementary and alternative medicine. These results suggest that the definition of complementary and alternative medicine is often unclear for nurses in Taiwan. Due to the organisational policies and personal knowledge base, very few nurses integrate complementary and alternative medicine into their daily practice. However, the nurses in Taiwan show a great desire to participate in complementary and alternative medicine continuing education programmes. This study is not only significant in filling the gap in the existing literature, but is also important in understanding this issue from the nurses' perspective, to offer a series of recommendations for policy, nursing education, nursing practice and suggestions for further research. This study highlights the importance of nursing attitude in the use of complementary and alternative medicine. Clinical nurses have the potential to provide appropriate information to their patients to ensure safe complementary and alternative medicine use. © 2012 Blackwell Publishing Ltd.

A review of nurses' knowledge, attitudes, and ability to communicate the risks and benefits of complementary and alternative medicine.

PubMed

Chang, Hsiao-Yun; Chang, Huai-Lu

2015-06-01

This study reviewed existing literature to investigate how frequently nurses include complementary and alternative forms of medicine in their clinical practice. In so doing, we investigated nurses' knowledge of and attitudes towards complementary and alternative medicine as well as their ability to communicate the risks and benefits of these therapies with patients. Little information is available concerning nurses' knowledge and attitudes towards complementary and alternative medicine or how they incorporate these therapies into their practice. In addition, little is known about the ability of nurses to communicate the risks and benefits of complementary and alternative medicine to their patients. This study used a scoping review method to map and synthesise existing literature. Both electronic and manual searches were used to identify relevant studies published between January 2007 and January 2014. The review was conducted in five stages: (1) identification of research question(s), (2) locate studies, (3) selection of studies, (4) charting of data, and (5) collating, summarising, and reporting of results. Fifteen papers met the inclusion criteria for this review, among which 53·7% referenced how frequently nurses include complementary and alternative medicine in their practice. We found that 66·4% of nurses had positive attitudes towards complementary and alternative medicine; however, 77·4% did not possess a comprehensive understanding of the associated risks and benefits. In addition, nearly half of the respondents (47·3-67·7%) reported feeling uncomfortable discussing complementary and alternative medicine therapies with their patients. The lack of knowledge about complementary and alternative medicine among nurses is a cause for concern, particularly in light of its widespread application. Findings from this study suggest that health care professionals need to promote evidence informed decision-making in complementary and alternative medicine practice and be knowledgeable enough to discuss complementary and alternative medicine therapies. Without involvement of complementary and alternative medicine communication on the part of our profession, we may put our patients at risk of uninformed and without medical guidance. © 2015 John Wiley & Sons Ltd.

Complementary alternative medicine use in children with type 1 diabetes mellitus in Erzurum, Turkey.

PubMed

Arýkan, Duygu; Sívríkaya, Sibel Karaca; Olgun, Nermin

2009-08-01

The aims of this study were: (i) to determine the types of complementary and alternative medicine use among children with type I diabetes mellitus as reported by parents and (ii) to describe sociodemographic and medical factors associated with the use of such treatments in families residing in Eastern Turkey. Type 1 diabetes mellitus is a tremendously challenging and complex disease for children and families to manage. Therefore, the use of complementary and alternative medicines among children with type 1 diabetes is becoming increasingly popular. Survey. Parents of 100 paediatric patients (who were diagnosed with type 1 diabetes at least 6 months prior to the study) who visited the participating paediatric endocrinology multidisciplinary centres and clinics for diabetes management were included in the study. Data were collected by using a semi-structured questionnaire. Results. Fifty-two per cent of the parents reported the use of one or more complementary alternative medicine therapies. Most such users (59.6%) were using oral herbal preparations; including morus alba (leaves) aloe vera and stinging nettle. Since we found that 78.6% of those using herbals were satisfied with their results and 69.2% were planning to continue use, it is important for healthcare providers to have relevant knowledge about complementary alternative medicine use and learn about its efficacy and effects (positive and adverse) of these treatments. Relevance to clinical practice. Botanical substitute for insulin seems unlikely, but complementary alternative treatments may provide valuable clues for the development of new oral hypoglycaemic agents and simple dietary agents. It is important for healthcare providers to have up-to-date knowledge about the use and effects of complementary alternative medicines in the outpatient clinical care setting.

[Algorithms of artificial neural networks--practical application in medical science].

PubMed

Stefaniak, Bogusław; Cholewiński, Witold; Tarkowska, Anna

2005-12-01

Artificial Neural Networks (ANN) may be a tool alternative and complementary to typical statistical analysis. However, in spite of many computer applications of various ANN algorithms ready for use, artificial intelligence is relatively rarely applied to data processing. This paper presents practical aspects of scientific application of ANN in medicine using widely available algorithms. Several main steps of analysis with ANN were discussed starting from material selection and dividing it into groups, to the quality assessment of obtained results at the end. The most frequent, typical reasons for errors as well as the comparison of ANN method to the modeling by regression analysis were also described.

Comparative study of inorganic elements determined in whole blood from Dmd(mdx)/J mice strain by EDXRF and NAA analytical techniques.

PubMed

Redígolo, M M; Sato, I M; Metairon, S; Zamboni, C B

2016-04-01

Several diseases can be diagnosed observing the variation of specific elements concentration in body fluids. In this study the concentration of inorganic elements in blood samples of dystrophic (Dmd(mdx)/J) and C57BL/6J (control group) mice strain were determined. The results obtained from Energy Dispersive X-ray Fluorescence (EDXRF) were compared with Neutron Activation Analysis (NAA) technique. Both analytical techniques showed to be appropriate and complementary offering a new contribution for veterinary medicine as well as detailed knowledge of this pathology. Copyright © 2016 Elsevier Ltd. All rights reserved.

Effective pathway of charge transfer in DNA duplex

NASA Astrophysics Data System (ADS)

Kim, Seongjin; Yi, Juyeon; Hwang, Sun-Yong

2009-03-01

We examine the most efficient route for charge propagation in DNA duplex. We find a direct path along one strand and a detour using the complementary strand compete with each other. Charge tends to take the path along the strand whose energy levels are close to its energy, and yet there exists a crossover length Nc so that for a transfer over a distance shorter than Nc the direct path is always advantageous. We obtain the analytic results for the behavior together with various decay types such as a constant decay, an exponential decay, and a crossover between them, whose validity is confirmed by the numerical calculation.

CONDENSED MATTER: ELECTRONIC STRUCTURE, ELECTRICAL, MAGNETIC, AND OPTICAL PROPERTIES: Switching Characteristics of Phase Change Memory Cell Integrated with Metal-Oxide Semiconductor Field Effect Transistor

NASA Astrophysics Data System (ADS)

Xu, Cheng; Liu, Bo; Chen, Yi-Feng; Liang, Shuang; Song, Zhi-Tang; Feng, Song-Lin; Wan, Xu-Dong; Yang, Zuo-Ya; Xie, Joseph; Chen, Bomy

2008-05-01

A Ge2Sb2Te5 based phase change memory device cell integrated with metal-oxide semiconductor field effect transistor (MOSFET) is fabricated using standard 0. 18 μm complementary metal-oxide semiconductor process technology. It shows steady switching characteristics in the dc current-voltage measurement. The phase changing phenomenon from crystalline state to amorphous state with a voltage pulse altitude of 2.0 V and pulse width of 50 ns is also obtained. These results show the feasibility of integrating phase change memory cell with MOSFET.

Understanding the dust properties in nearby galaxies

NASA Astrophysics Data System (ADS)

Decleir, Marjorie; Baes, Maarten; De Looze, Ilse; Camps, Peter

2018-04-01

Dust is a crucial component in the interstellar medium of galaxies. It regulates several physical and chemical processes. Dust grains are also efficient at absorbing and scattering ultraviolet/optical photons and then re-radiating the absorbed energy in the infrared/submm wavelength range. The spatial distribution and properties of dust in galaxies can hence be investigated in two complementary ways: by its attenuation effects at short wavelengths, and by its thermal emission at long wavelengths. Both approaches have their advantages and challenges. In this contribution, we discuss a number of recent interesting results on interstellar dust in nearby galaxies, obtained by our research group at Ghent University.

Observations of z-dependent microbunching harmonic intensities using COTR in a SASE FEL.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lumpkin, A. H.; Biedron, S. G.; Dejus, R. J.

The nonlinear generation of harmonics in a self-amplified spontaneous emission (SASE) free-electron laser (FEL) continues to be of interest. Complementary to such studies is the search for information on the electron beam microbunching harmonic components, which are revealed by coherent optical transition radiation (COTR) experiments. An initial z-dependent set of data has been obtained with the fundamental at 530 nm and the second harmonic at 265 nm. The latter data were collected after every other undulator in a nine-undulator string. These results are compared to estimates based on GINGER and an analytical model for nonlinear harmonic generation.

Physician and patient attitudes towards complementary and alternative medicine in obstetrics and gynecology

PubMed Central

Furlow, Mandi L; Patel, Divya A; Sen, Ananda; Liu, J Rebecca

2008-01-01

Background In the U.S., complementary and alternative medicine (CAM) use is most prevalent among reproductive age, educated women. We sought to determine general attitudes and approaches to CAM among obstetric and gynecology patients and physicians. Methods Obstetrician-gynecologist members of the American Medical Association in the state of Michigan and obstetric-gynecology patients at the University of Michigan were surveyed. Physician and patient attitudes and practices regarding CAM were characterized. Results Surveys were obtained from 401 physicians and 483 patients. Physicians appeared to have a more positive attitude towards CAM as compared to patients, and most reported routinely endorsing, providing or referring patients for at least one CAM modality. The most commonly used CAM interventions by patients were divergent from those rated highest among physicians, and most patients did not consult with a health care provider prior to starting CAM. Conclusion Although obstetrics/gynecology physicians and patients have a positive attitude towards CAM, physician and patients' view of the most effective CAM therapies were incongruent. Obstetrician/gynecologists should routinely ask their patients about their use of CAM with the goal of providing responsible, evidence-based advice to optimize patient care. PMID:18582380

Ambiguities and completeness of SAS data analysis: investigations of apoferritin by SAXS/SANS EID and SEC-SAXS methods

NASA Astrophysics Data System (ADS)

Zabelskii, D. V.; Vlasov, A. V.; Ryzhykau, Yu L.; Murugova, T. N.; Brennich, M.; Soloviov, D. V.; Ivankov, O. I.; Borshchevskiy, V. I.; Mishin, A. V.; Rogachev, A. V.; Round, A.; Dencher, N. A.; Büldt, G.; Gordeliy, V. I.; Kuklin, A. I.

2018-03-01

The method of small angle scattering (SAS) is widely used in the field of biophysical research of proteins in aqueous solutions. Obtaining low-resolution structure of proteins is still a highly valuable method despite the advances in high-resolution methods such as X-ray diffraction, cryo-EM etc. SAS offers the unique possibility to obtain structural information under conditions close to those of functional assays, i.e. in solution, without different additives, in the mg/mL concentration range. SAS method has a long history, but there are still many uncertainties related to data treatment. We compared 1D SAS profiles of apoferritin obtained by X-ray diffraction (XRD) and SAS methods. It is shown that SAS curves for X-ray diffraction crystallographic structure of apoferritin differ more significantly than it might be expected due to the resolution of the SAS instrument. Extrapolation to infinite dilution (EID) method does not sufficiently exclude dimerization and oligomerization effects and therefore could not guarantee total absence of dimers account in the final SAS curve. In this study, we show that EID SAXS, EID SANS and SEC-SAXS methods give complementary results and when they are used all together, it allows obtaining the most accurate results and high confidence from SAS data analysis of proteins.

Dietary Protein Intake in Young Children in Selected Low-Income Countries Is Generally Adequate in Relation to Estimated Requirements for Healthy Children, Except When Complementary Food Intake Is Low123

PubMed Central

Arsenault, Joanne E; Brown, Kenneth H

2017-01-01

Background: Previous research indicates that young children in low-income countries (LICs) generally consume greater amounts of protein than published estimates of protein requirements, but this research did not account for protein quality based on the mix of amino acids and the digestibility of ingested protein. Objective: Our objective was to estimate the prevalence of inadequate protein and amino acid intake by young children in LICs, accounting for protein quality. Methods: Seven data sets with information on dietary intake for children (6–35 mo of age) from 6 LICs (Peru, Guatemala, Ecuador, Bangladesh, Uganda, and Zambia) were reanalyzed to estimate protein and amino acid intake and assess adequacy. The protein digestibility–corrected amino acid score of each child’s diet was calculated and multiplied by the original (crude) protein intake to obtain an estimate of available protein intake. Distributions of usual intake were obtained to estimate the prevalence of inadequate protein and amino acid intake for each cohort according to Estimated Average Requirements. Results: The prevalence of inadequate protein intake was highest in breastfeeding children aged 6–8 mo: 24% of Bangladeshi and 16% of Peruvian children. With the exception of Bangladesh, the prevalence of inadequate available protein intake decreased by age 9–12 mo and was very low in all sites (0–2%) after 12 mo of age. Inadequate protein intake in children <12 mo of age was due primarily to low energy intake from complementary foods, not inadequate protein density. Conclusions: Overall, most children consumed protein amounts greater than requirements, except for the younger breastfeeding children, who were consuming low amounts of complementary foods. These findings reinforce previous evidence that dietary protein is not generally limiting for children in LICs compared with estimated requirements for healthy children, even after accounting for protein quality. However, unmeasured effects of infection and intestinal dysfunction on the children’s protein requirements could modify this conclusion. PMID:28202639

Higher similarity in beta topography between tasks than subjects.

PubMed

Basile, Luis F H; Sato, João R; Pasquini, Henrique A; Velasques, Bruna; Ribeiro, Pedro; Anghinah, Renato

2018-05-01

We have recently provided evidence for highly idiosyncratic topographic distributions of beta oscillations (as well as slow potentials) across individuals. More recently, by emphasizing the analysis of similarity instead of differences across tasks, we concluded that differences between an attention task and quiet resting may be negligible or at least unsystematic across subjects. Due to the possibility that individual differences could be due to noise in a wide sense or some inherent instability of beta activity, we designed a replication study to explicitly test whether pairs of individuals matched for head size and shape would still present less similar beta topography than each individual between sessions or tasks. We used independent component analysis (ICA) for an exhaustive decomposition of beta activity in a visual attention task and in quiet resting, recorded by 256-channel EEG in 20 subjects, on two separate days. We evaluated whether each ICA component obtained in one task and in one given individual could be explained by a linear regression model based on the topographic patterns of the complementary task (correlation between one component with a linear combination of components from complementary conditions), of the same task in a second session and of a matched individual. Results again showed a high topographic similarity between conditions, as previously seen between reasoning and simple visual attention beta correlates. From an overall number of 16 components representing brain activity obtained for the tasks (out of 60 originally computed where the remaining were considered noise), over 92% could satisfactorily be explained by the complementary task. Although the similarity between sessions was significantly smaller than between tasks on each day, the similarity between sessions was statistically higher than that between subjects in a highly significant way. We discuss the possible biases of group spatial averaging and the emphasis on differences as opposed to similarities, and noise in a wide sense, as the main causes of hardly replicable findings on task-related forms of activity and the inconclusive state of a universal functional mapping of cortical association areas.

Crystalline cellulose elastic modulus predicted by atomistic models of uniform deformation and nanoscale indentation

Treesearch

Xiawa Wu; Robert J. Moon; Ashlie Martini

2013-01-01

The elastic modulus of cellulose Iß in the axial and transverse directions was obtained from atomistic simulations using both the standard uniform deformation approach and a complementary approach based on nanoscale indentation. This allowed comparisons between the methods and closer connectivity to experimental measurement techniques. A reactive...

Use of combined biogeochemical model approaches and empirical data to assess critical loads of nitrogen

Treesearch

Mark Fenn; Charles Driscoll; Quingtao Zhou; Leela Rao; Thomas Meixner; Edith Allen; Fengming Yuan; Timothy Sullivan

2015-01-01

Empirical and dynamic biogeochemical modelling are complementary approaches for determining the critical load (CL) of atmospheric nitrogen (N) or other constituent deposition that an ecosystem can tolerate without causing ecological harm. The greatest benefits are obtained when these approaches are used in combination. Confounding environmental factors can complicate...

Approaches for Combining Multiple Measures of Teacher Performance: Reliability, Validity, and Implications for Evaluation Policy

ERIC Educational Resources Information Center

Martínez, José Felipe; Schweig, Jonathan; Goldschmidt, Pete

2016-01-01

A key question facing teacher evaluation systems is how to combine multiple measures of complex constructs into composite indicators of performance. We use data from the Measures of Effective Teaching (MET) study to investigate the measurement properties of composite indicators obtained under various conjunctive, disjunctive (or complementary),…

Nanoparticle Solutions for Printed Electronics

DTIC Science & Technology

2013-09-19

the printed semiconductor materials and their nanoparticle and colloidal precursors. Without this basic knowledge, further development and the...titania, silica ) were investigated in the production of complementary inks for complex devices. These were either obtained commercially in...layers were also deposited on borosilicate glass and silicon wafers. In the photovoltaic program, hybrid inorganic-organic semiconductor combinations

Chaotic vortex filaments in a Bose–Einstein condensate and in superfluid helium

NASA Astrophysics Data System (ADS)

Nemirovskii, S. K.

2018-05-01

A statement of the quantum turbulence problem in both a Bose–Einstein condensate (BEC) and superfluid helium is formulated. In superfluid helium use is made of a so-called vortex filament method, in which quantum vortices are represented by stringlike objects, i.e. vortex lines. The dynamics of the vortex lines is determined by deterministic equations of motion, supplemented by random reconnections. Unlike He II, the laws of the dynamics of quantum vortices in BEC are based on the nonlinear Schrödinger equation. This makes it possible to obtain a microscopic description of the collision of vortices, the structure of a vortex filament, etc. A comparative analysis of these complementary approaches is carried out. It is shown that there are some features that do not automatically transfer the results obtained for BEC to vortices in He II and vice versa.

Seasat microwave wind and rain observations in severe tropical and midlatitude marine storms

NASA Technical Reports Server (NTRS)

Black, P. G.; Hawkins, J. D.; Gentry, R. C.; Cardone, V. J.

1985-01-01

Initial results of studies concerning Seasat measurements in and around tropical and severe midlatitude cyclones over the open ocean are presented, together with an assessment of their accuracy and usefulness. Complementary measurements of surface wind speed and direction, rainfall rate, and the sea surface temperature obtained with the Seasat-A Satellite Scatterometer (SASS), the Scanning Multichannel Microwave Radiometer (SMMR), and the Seasat SAR are analyzed. The Seasat data for the Hurrricanes Fico, Ella, and Greta and the QE II storm are compared with data obtained from aircraft, buoys, and ships. It is shown that the SASS-derived wind speeds are accurate to within 10 percent, and the directions are accurate to within 20 percent. In general, the SASS estimates tend to measure light winds too high and intense winds too low. The errors of the SMMR-derived measurements of the winds in hurricanes tend to be higher than those of the SASS-derived measurements.

White Light Emission from Cucurbituril-Based Host-Guest Interaction in the Solid State: New Function of the Macrocyclic Host.

PubMed

Xia, Yu; Chen, Shiyan; Ni, Xin-Long

2018-04-18

Energy transfer and interchange are central for fabricating white light-emitting organic materials. However, increasing the efficiency of light energy transfer remains a considerable challenge because of the occurrence of "cross talk". In this work, by exploiting the unique photophysical properties of cucurbituril-triggered host-guest interactions, the two complementary luminescent colors blue and yellow for white light emission were independently obtained from a single fluorophore dye rather than energy transfer. Further study suggested that the rigid cavity of cucurbiturils efficiently prevented the aggregation of the dye and improved its thermal stability in the solid state by providing a regular nanosized fence for each encapsulated dye molecule. As a result, a novel macrocycle-assisted supramolecular approach for obtaining solid, white light-emitting organic materials with low cost, high efficiency, and easy scale-up was successfully demonstrated.

Strain and lattice orientation distribution in SiN/Ge complementary metal–oxide–semiconductor compatible light emitting microstructures by quick x-ray nano-diffraction microscopy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chahine, G. A.; Schülli, T. U.; Zoellner, M. H.

2015-02-16

This paper presents a study of the spatial distribution of strain and lattice orientation in CMOS-fabricated strained Ge microstripes using high resolution x-ray micro-diffraction. The recently developed model-free characterization tool, based on a quick scanning x-ray diffraction microscopy technique can image strain down to levels of 10{sup −5} (Δa/a) with a spatial resolution of ∼0.5 μm. Strain and lattice tilt are extracted using the strain and orientation calculation software package X-SOCS. The obtained results are compared with the biaxial strain distribution obtained by lattice parameter-sensitive μ-Raman and μ-photoluminescence measurements. The experimental data are interpreted with the help of finite element modelingmore » of the strain relaxation dynamics in the investigated structures.« less

Study of fission fragment de-excitation by gamma-ray spectrometry with the EXILL experiment

NASA Astrophysics Data System (ADS)

Materna, Thomas; a, Michal Rapał; Letourneau, Alain; Marchix, Anthony; Litaize, Olivier; Sérot, Olivier; Urban, Waldemar; Blanc, Aurélien; Jentschel, Michael; Köster, Ulli; Mutti, Paolo; Soldner, Torsten; Simpson, Gary; Ur, Călin A.; France, Gilles de

2017-09-01

A large array of Ge detectors installed at ILL, around a 235U target irradiated with cold neutrons, (EXILL) allowed measurement of prompt gamma-ray cascades occurring in fission fragments with an unambiguous determination of fragments. Here we present preliminary results of a systematic comparison between experimental γ-ray intensities and those obtained from the Monte-Carlo simulation code FIFRELIN, which is dedicated to the de-excitation of fission fragments. Major γ-ray intensities in the 142Ba and 92Kr fission products, extracted from EXILL data, were compared to FIFRELIN, as well as to reported values (when available) obtained with EUROGAM2 in the spontaneous fission of 248Cm. The evolution of γ-ray intensities in 92Kr versus the complementary partner in fission (i.e. versus the total number of evaporated neutrons by the fission pair) was then extracted and compared to FIFRELIN.

Direct chemical profiling of olive (Olea europaea) fruit epicuticular waxes by direct electrospray-ultrahigh resolution mass spectrometry.

PubMed

Vichi, Stefania; Cortés-Francisco, Nuria; Romero, Agustí; Caixach, Josep

2015-03-01

In the present paper, an electrospray ionization (ESI)-Orbitrap method is proposed for the direct chemical profiling of epicuticular wax (EW) from Olea europaea fruit. It constitutes a rapid and efficient tool suitable for a wide-ranging screening of a large number of samples. In a few minutes, the method provides a comprehensive characterization of total EW extracts, based on the molecular formula of their components. Accurate mass measurements are obtained by ultrahigh resolution mass spectrometry, and compositional restrictions are set on the basis of the information available from previous studies of olive EW. By alternating positive and negative ESI modes within the same analysis, complementary results are obtained and a wide range of chemical species is covered. This provides a detailed compositional overview that otherwise would only be available by applying multiple analytical techniques. Copyright © 2015 John Wiley & Sons, Ltd.

Protomagnetar and black hole formation in high-mass stars

NASA Astrophysics Data System (ADS)

Obergaulinger, M.; Aloy, M. Á.

2017-07-01

Using axisymmetric simulations coupling special relativistic magnetohydrodynamics (MHD), an approximate post-Newtonian gravitational potential and two-moment neutrino transport, we show different paths for the formation of either protomagnetars or stellar mass black holes. The fraction of prototypical stellar cores which should result in collapsars depends on a combination of several factors, among which the structure of the progenitor star and the profile of specific angular momentum are probably the foremost. Along with the implosion of the stellar core, we also obtain supernova-like explosions driven by neutrino heating and hydrodynamic instabilities or by magneto-rotational effects in cores of high-mass stars. In the latter case, highly collimated, mildly relativistic outflows are generated. We find that after a rather long post-collapse phase (lasting ≳1 s) black holes may form in cases both of successful and failed supernova-like explosions. A basic trend is that cores with a specific angular momentum smaller than that obtained by standard, one-dimensional stellar evolution calculations form black holes (and eventually collapsars). Complementary, protomagnetars result from stellar cores with the standard distribution of specific angular momentum obtained from prototypical stellar evolution calculations including magnetic torques and moderate to large mass-loss rates.

Use of complementary and alternative medicine in children with autism and other developmental disabilities: associations with ethnicity, child comorbid symptoms, and parental stress.

PubMed

Valicenti-McDermott, Maria; Burrows, Bethany; Bernstein, Leora; Hottinger, Kathryn; Lawson, Katharine; Seijo, Rosa; Schechtman, Merryl; Shulman, Lisa; Shinnar, Shlomo

2014-03-01

The use of complementary and alternative medicine by children with autism and the association of its use with child comorbid symptoms and parental stress was studied in an ethnically diverse population, in a cross-sectional study with structured interviews. The sample included 50 families of children with autism and 50 families of children with other developmental disabilities, matched by age/gender. Interview included the Complementary and Alternative Medicine Questionnaire, Gastrointestinal Questionnaire, Children's Sleep Habits Questionnaire, Aberrant Behavior Checklist, and Parenting Stress Index. In this ethnically diverse sample, the use of complementary and alternative medicine was significantly higher for the autism group. In the autism group, use was significantly related to child's irritability, hyperactivity, food allergies, and parental stress; in the developmental disabilities group, there was no association with child comorbid symptoms or parental stress. The results contribute information to health care providers about families of children with autism who are more likely to use complementary and alternative medicine.

Exposure to benevolent sexism and complementary gender stereotypes: consequences for specific and diffuse forms of system justification.

PubMed

Jost, John T; Kay, Aaron C

2005-03-01

Many have suggested that complementary gender stereotypes of men as agentic (but not communal) and women as communal (but not agentic) serve to increase system justification, but direct experimental support has been lacking. The authors exposed people to specific types of gender-related beliefs and subsequently asked them to complete measures of gender-specific or diffuse system justification. In Studies 1 and 2, activating (a) communal or complementary (communal + agentic) gender stereotypes or (b) benevolent or complementary (benevolent + hostile) sexist items increased support for the status quo among women. In Study 3, activating stereotypes of men as agentic also increased system justification among men and women, but only when women's characteristics were associated with higher status. Results suggest that complementary stereotypes psychologically offset the one-sided advantage of any single group and contribute to an image of society in which everyone benefits through a balanced dispersion of benefits. ((c) 2005 APA, all rights reserved).

Impact of maternal education about complementary feeding and provision of complementary foods on child growth in developing countries

PubMed Central

2011-01-01

Background Childhood undernutrition is prevalent in low and middle income countries. It is an important indirect cause of child mortality in these countries. According to an estimate, stunting (height for age Z score < -2) and wasting (weight for height Z score < -2) along with intrauterine growth restriction are responsible for about 2.1 million deaths worldwide in children < 5 years of age. This comprises 21 % of all deaths in this age group worldwide. The incidence of stunting is the highest in the first two years of life especially after six months of life when exclusive breastfeeding alone cannot fulfill the energy needs of a rapidly growing child. Complementary feeding for an infant refers to timely introduction of safe and nutritional foods in addition to breast-feeding (BF) i.e. clean and nutritionally rich additional foods introduced at about six months of infant age. Complementary feeding strategies encompass a wide variety of interventions designed to improve not only the quality and quantity of these foods but also improve the feeding behaviors. In this review, we evaluated the effectiveness of two most commonly applied strategies of complementary feeding i.e. timely provision of appropriate complementary foods (± nutritional counseling) and education to mothers about practices of complementary feeding on growth. Recommendations have been made for input to the Lives Saved Tool (LiST) model by following standardized guidelines developed by Child Health Epidemiology Reference Group (CHERG). Methods We conducted a systematic review of published randomized and quasi-randomized trials on PubMed, Cochrane Library and WHO regional databases. The included studies were abstracted and graded according to study design, limitations, intervention details and outcome effects. The primary outcomes were change in weight and height during the study period among children 6-24 months of age. We hypothesized that provision of complementary food and education of mother about complementary food would significantly improve the nutritional status of the children in the intervention group compared to control. Meta-analyses were generated for change in weight and height by two methods. In the first instance, we pooled the results to get weighted mean difference (WMD) which helps to pool studies with different units of measurement and that of different duration. A second meta-analysis was conducted to get a pooled estimate in terms of actual increase in weight (kg) and length (cm) in relation to the intervention, for input into the LiST model. Results After screening 3795 titles, we selected 17 studies for inclusion in the review. The included studies evaluated the impact of provision of complementary foods (±nutritional counseling) and of nutritional counseling alone. Both these interventions were found to result in a significant increase in weight [WMD 0.34 SD, 95% CI 0.11 – 0.56 and 0.30 SD, 95 % CI 0.05-0.54 respectively) and linear growth [WMD 0.26 SD, 95 % CI 0.08-0.43 and 0.21 SD, 95 % CI 0.01-0.41 respectively]. Pooled results for actual increase in weight in kilograms and length in centimeters showed that provision of appropriate complementary foods (±nutritional counseling) resulted in an extra gain of 0.25kg (±0.18) in weight and 0.54 cm (±0.38) in height in children aged 6-24 months. The overall quality grades for these estimates were that of ‘moderate’ level. These estimates have been recommended for inclusion in the Lives Saved Tool (LiST) model. Education of mother about complementary feeding led to an extra weight gain of 0.30 kg (±0.26) and a gain of 0.49 cm (±0.50) in height in the intervention group compared to control. These estimates had been recommended for inclusion in the LiST model with an overall quality grade assessment of ‘moderate’ level. Conclusion Provision of appropriate complementary food, with or without nutritional education, and maternal nutritional counseling alone lead to significant increase in weight and height in children 6-24 months of age. These interventions can significantly reduce the risk of stunting in developing countries and are recommended for inclusion in the LiST tool. PMID:21501443

Supramolecular Polymer Network-Mediated Self-Assembly of Semicrystalline Polymers with Excellent Crystalline Performance.

PubMed

Cheng, Chih-Chia; Chuang, Wei-Tsung; Lee, Duu-Jong; Xin, Zhong; Chiu, Chih-Wei

2017-03-01

A novel application of supramolecular interactions within semicrystalline polymers, capable of self-assembling into supramolecular polymer networks via self-complementary multiple hydrogen-bonded complexes, is demonstrated for efficient construction of highly controlled self-organizing hierarchical structures to offer a direct, efficient nucleation pathway resulting in superior crystallization performance. Herein, a novel functionalized poly(ε-caprolactone) containing self-complementary sextuple hydrogen-bonded uracil-diamidopyridine (U-DPy) moieties is successfully developed and demonstrated excellent thermal and viscoelastic properties as well as high dynamic structural stability in the bulk state due to physical cross-linking created by reversible sextuple hydrogen bonding between U-DPy units. Due to the ability to vary the extent of the reversible network by tuning the U-DPy content, this newly developed material can be readily adjusted to obtain the desired crystalline products with specific characteristics. Importantly, incorporating only 0.1% U-DPy resulted in a polymer with a high crystallization rate constant, short crystallization half-time, and much more rapid crystallization kinetics than pristine PCL, indicating a low content of U-DPy moieties provides highly efficient nucleation sites that manipulate the nucleation and growth processes of polymer crystals to promote crystallization and chain alignment in bulk. This new system is suggested as a potential new route to substantially improve the performance of polymer crystallization. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

CHINESE HERBAL DECOCTION AS A COMPLEMENTARY THERAPY FOR ATROPHIC GASTRITIS: A SYSTEMATIC REVIEW AND META-ANALYSIS

PubMed Central

Fang, Wen-jie; Zhang, Xin-ying; Yang, Bo; Sui, Shu-jing; Chen, Min; Pan, Wei-hua; Liao, Wan-qing; Zhong, Ming; Wang, Qing-cai

2017-01-01

Background: Chinese herbal decoction (CHD) has been extensively used in the treatment of atrophic gastritis (AG) in China and other Far Eastern countries. We conducted a systematic review and meta-analysis to estimate the efficacy and safety of CHD in AG. Materials and Methods: Pubmed, Embase, Cochrane central register of controlled trials (central), VIP, China National Knowledge Infrastructure, Sinomed, Wanfang data were searched (up to December 2015). Randomized controlled trials recruiting patients with AG comparing CHD (alone or with western medicine (WM)) with WM were eligible. Dichotomous data were pooled to obtain relative risk (RR), with a 95% confidence interval (CI). Results: Forty-two articles including 3,874 patients were identified. CHD, used alone or with WM, had beneficial effect over WM in the improvement of clinical manifestations (RR=1.28; 95% CI 1.22-1.34) and pathological change (RR=1.42; 95% CI 1.30-1.54) for AG patients. However, the H. pylori eradication effect of CHD was not supported by the existing clinical evidence, because of the significant study heterogeneity (I2>50%) and inconsistency between the primary results and sensitivity analysis. Conclusions: CHD, if prescribed as a complementary therapy to WM, may improve the clinical manifestations and pathological change for AG patients. But its monotherapy for H. pylori eradication is not supported by enough clinical evidence. PMID:28638893

Single-channel, box-shaped, monopole-type antenna for B1+ field manipulation in conjunction with the traveling-wave concept in 9.4 T MRI.

PubMed

Zivkovic, Irena; Scheffler, Klaus

2015-08-01

We have developed a single-channel, box-shaped, monopole-type antenna which, if used in two different configurations, excites complementary B1+ field distributions in the traveling-wave setup. A new monopole-type, single-channel antenna for RF excitation in 9.4 T magnetic resonance imaging is proposed. The antenna is entirely made of copper without lumped elements. Two complementary B1+ field distributions of two different antenna configurations were measured and combined as a root sum of squares. B1+ field inhomogeneity of the combined maps was calculated and compared with published results. By combining B1+ field distributions generated by two antenna configurations, a "no voids" pattern was achieved for the entire upper brain. B1+ inhomogeneity of approximately 20 % was achieved for sagittal and transverse slices; it was <24 % for coronal slices. The results were comparable with those from CP, with "no voids" in slice B1+ inhomogeneity of multichannel loop arrays. The efficiency of the proposed antenna was lower than that of a multichannel array but comparable with that of a patch antenna. The proposed single-channel antenna is a promising candidate for traveling-wave brain imaging. It can be combined with the time-interleaved acquisition of modes (TIAMO) concept if reconfigurability is obtained with a single-antenna element.

The role of complementary and alternative medicine in the treatment of eating disorders: A systematic review.

PubMed

Fogarty, Sarah; Smith, Caroline A; Hay, Phillipa

2016-04-01

This systematic review critically appraises the role of complementary and alternative medicine in the treatment of those with an eating disorder. Sixteen studies were included in the review. The results of this review show that the role of complementary and alternative medicine in the treatment of those with an eating disorder is unclear and further studies should be conducted. A potential role was found for massage and bright light therapy for depression in those with Bulimia Nervosa and a potential role for acupuncture and relaxation therapy, in the treatment of State Anxiety, for those with an eating disorder. The role of these complementary therapies in treating eating disorders should only be provided as an adjunctive treatment only. Copyright © 2016 Elsevier Ltd. All rights reserved.

Ultrasonic characterization of granites obtained from industrial quarries of Extremadura (Spain).

PubMed

del Río, L M; López, F; Esteban, F J; Tejado, J J; Mota, M; González, I; San Emeterio, J L; Ramos, A

2006-12-22

The industry of ornamental rocks, such as granites, represents one of the most important industrial activities in the region of Extremadura, SW Spain. A detailed knowledge of the intrinsic properties of this natural stone and its environmental evolution is a required goal in order to fully characterize its quality. In this work, two independent NDT acoustic techniques have been used to measure the acoustic velocity of longitudinal waves in different prismatic granitic-samples of industrial quarries. A low-frequency transceiver set-up, based on a high-voltage BPV Steinkamp instrument and two 50 kHz probes, has been used to measure pulse travel times by ultrasonic through-transmission testing. In complementary fashion, an Erudite MK3 test equipment with an electromagnetic vibrator and two piezoelectric sensors has also been employed to measure ultrasonic velocity by means of a resonance-based method, using the same types of granite varieties. In addition, a comprehensive set of physical/mechanical properties have also been analyzed, according to Spanish regulations in force, by means of alternative methods including destructive techniques such as strength, porosity, absorption, etc. A large number of samples, representing the most important varieties of granites from quarries of Extremadura, have been analyzed using the above-mentioned procedures. Some results obtained by destructive techniques have been correlated with those found using ultrasonic techniques. Our experimental setting allowed a complementary characterization of granite samples and a thorough validation of the different techniques employed, thus providing the industry of ornamental rocks with a non-destructive tool that will facilitate a more detailed insight on the properties of the rocks under study.

Patterns of cultural consensus and intracultural diversity in Ghanaian complementary feeding practices.

PubMed

Kalra, Nikhila; Pelto, Gretel; Tawiah, Charlotte; Zobrist, Stephanie; Milani, Peiman; Manu, Grace; Laar, Amos; Parker, Megan

2018-01-01

Designing effective interventions to improve infant and young child (IYC) feeding requires knowledge about determinants of current practices, including cultural factors. Current approaches to obtaining and using research on culture tend to assume cultural homogeneity within a population. The purpose of this study was to examine the extent of cultural consensus (homogeneity) in communities where interventions to improve IYC feeding practices are needed to address undernutrition during the period of complementary feeding. A second, related objective was to identify the nature of intracultural variation, if such variation was evident. Selected protocols from the Focused Ethnographic Study for Infant and Young Child Feeding Manual were administered to samples of key informants and caregivers in a peri-urban and a rural area in Brong-Ahafo, Ghana. Cultural domain analysis techniques (free listing, caregiver assessment of culturally significant dimensions, and food ratings on these dimensions), as well as open-ended questions with exploratory probing, were used to obtain data on beliefs and related practices. Results reveal generally high cultural consensus on the 5 dimensions that were assessed (healthiness, appeal, child acceptance, convenience, and modernity) for caregiver decisions and on their ratings of individual foods. However, thematic analysis of caregiver narratives indicates that the meanings and content of the constructs connoted by the dimensions differed widely among individual mothers. These findings suggest that research on cultural factors that affect IYC practices, particularly cultural beliefs, should consider the nature and extent of cultural consensus and intracultural diversity, rather than assuming cultural homogeneity. © 2017 John Wiley & Sons Ltd.

Systematic reviews of complementary therapies – an annotated bibliography. Part 3: Homeopathy

PubMed Central

Linde, Klaus; Hondras, Maria; Vickers, Andrew; Riet, Gerben ter; Melchart, Dieter

2001-01-01

Background Complementary therapies are widespread but controversial. We aim to provide a comprehensive collection and a summary of systematic reviews of clinical trials in three major complementary therapies (acupuncture, herbal medicine, homeopathy). This article is dealing with homeopathy. Potentially relevant reviews were searched through the register of the Cochrane Complementary Medicine Field, the Cochrane Library, Medline, and bibliographies of articles and books. To be included articles had to review prospective clinical trials of homeopathy; had to describe review methods explicitly; had to be published; and had to focus on treatment effects. Information on conditions, interventions, methods, results and conclusions was extracted using a pretested form and summarized descriptively. Results Eighteen out of 22 potentially relevant reviews preselected in the screening process met the inclusion criteria. Six reviews addressed the question whether homeopathy is effective across conditions and interventions. The majority of available trials seem to report positive results but the evidence is not convincing. For isopathic nosodes for allergic conditions, oscillococcinum for influenza-like syndromes and galphimia for pollinosis the evidence is promising while in other areas reviewed the results are equivocal. Interpretation Reviews on homeopathy often address general questions. While the evidence is promising for some topics the findings of the available reviews are unlikely to end the controversy on this therapy. PMID:11527508

Human eye haptics-based multimedia.

PubMed

Velandia, David; Uribe-Quevedo, Alvaro; Perez-Gutierrez, Byron

2014-01-01

Immersive and interactive multimedia applications offer complementary study tools in anatomy as users can explore 3D models while obtaining information about the organ, tissue or part being explored. Haptics increases the sense of interaction with virtual objects improving user experience in a more realistic manner. Common eye studying tools are books, illustrations, assembly models, and more recently these are being complemented with mobile apps whose 3D capabilities, computing power and customers are increasing. The goal of this project is to develop a complementary eye anatomy and pathology study tool using deformable models within a multimedia application, offering the students the opportunity for exploring the eye from up close and within with relevant information. Validation of the tool provided feedback on the potential of the development, along with suggestions on improving haptic feedback and navigation.

The evolution of the quasar continuum

NASA Technical Reports Server (NTRS)

Elvis, M.

1992-01-01

We now have in hand a large data base of Roentgen Satellite (ROSAT), optical, and IR complementary data. We are in the process of obtaining a large amount of the International Ultraviolet Explorer (IUE) data for the same quasar sample. For our complementary sample at high redshifts, where the UV was redshifted into the optical, we have just had approved large amounts of observing time to cover the quasar continuum in the near-IR using the new Near-Infrared Camera and Multi-Object Spectrometer (NICMOS) array spectrographs. Ten micron, optical, and VLA radio, data also have approved time. An ISO US key program was approved to extend this work into the far-IR, and the launch of ASTRO-D (early in 1993) promises to extend it to higher energy X-rays.

Rational Basis for the Use of Bergamot Essential Oil in Complementary Medicine to Treat Chronic Pain.

PubMed

Rombolà, L; Amantea, D; Russo, R; Adornetto, A; Berliocchi, L; Tridico, L; Corasaniti, M T; Sakurada, S; Sakurada, T; Bagetta, G; Morrone, L A

2016-01-01

In complementary medicine, aromatherapy uses essential oils to improve agitation and aggression observed in dementia, mood, depression, anxiety and chronic pain. Preclinical research studies have reported that the essential oil obtained from bergamot (BEO) fruit (Citrus bergamia, Risso) modifies normal and pathological synaptic plasticity implicated, for instance, in nociceptive and neuropathic pain. Interestingly, recent results indicated that BEO modulates sensitive perception of pain in different models of nociceptive, inflammatory and neuropathic pain modulating endogenous systems. Thus, local administration of BEO inhibited the nociceptive behavioral effect induced by intraplantar injection of capsaicin or formalin in mice. Similar effects were observed with linalool and linalyl acetate, major volatile components of the phytocomplex, Pharmacological studies showed that the latter effects are reversed by local or systemic pretreatment with the opioid antagonist naloxone hydrochloride alike with naloxone methiodide, high affinity peripheral μ-opioid receptor antagonist. These results and the synergistic effect observed following systemic or intrathecal injection of an inactive dose of morphine with BEO or linalool indicated an activation of peripheral opioid system. Recently, in neuropathic pain models systemic or local administration of BEO or linalool induced antiallodynic effects. In particular, in partial sciatic nerve ligation (PSNL) model, intraplantar injection of the phytocomplex or linalool in the ipsilateral hindpaw, but not in the contralateral, reduced PSNL-induced extracellularsignal- regulated kinase (ERK) activation and mechanical allodynia. In neuropathic pain high doses of morphine are needed to reduce pain. Interestingly, combination of inactive doses of BEO or linalool with a low dose of morphine induced antiallodynic effects in mice. Peripheral cannabinoid and opioid systems appear to be involved in the antinociception produced by intraplantar injection of β -caryophyllene, present in different essential oils including BEO. The data gathered so far indicate that the essential oil of bergamot is endowed with antinociceptive and antiallodynic effects and contribute to form the rational basis for rigorous testing of its efficacy in complementary medicine.

Activation energies for dissociation of double strand oligonucleotide anions: evidence for watson-crick base pairing in vacuo.

PubMed

Schnier, P D; Klassen, J S; Strittmatter, E F; Williams, E R

1998-09-23

The dissociation kinetics of a series of complementary and noncomplementary DNA duplexes, (TGCA)(2) (3-), (CCGG)(2) (3-), (AATTAAT)(2) (3-), (CCGGCCG)(2) (3-), A(7)*T(7) (3-), A(7)*A(7) (3-), T(7)*T(7) (3-), and A(7)*C(7) (3-) were investigated using blackbody infrared radiative dissociation in a Fourier transform mass spectrometer. From the temperature dependence of the unimolecular dissociation rate constants, Arrhenius activation parameters in the zero-pressure limit are obtained. Activation energies range from 1.2 to 1.7 eV, and preexponential factors range from 10(13) to 10(19) s(-1). Dissociation of the duplexes results in cleavage of the noncovalent bonds and/or cleavage of covalent bonds leading to loss of a neutral nucleobase followed by backbone cleavage producing sequence-specific (a - base) and w ions. Four pieces of evidence are presented which indicate that Watson-Crick (WC) base pairing is preserved in complementary DNA duplexes in the gas phase: i. the activation energy for dissociation of the complementary dimer, A(7)*T(7) (3-), to the single strands is significantly higher than that for the related noncomplementary A(7)*A(7) (3-) and T(7)*T(7) (3-) dimers, indicating a stronger interaction between strands with a specific base sequence, ii. extensive loss of neutral adenine occurs for A(7)*A(7) (3-) and A(7)*C(7) (3-) but not for A(7)*T(7) (3-) consistent with this process being shut down by WC hydrogen bonding, iii. a correlation is observed between the measured activation energy for dissociation to single strands and the dimerization enthalpy (-DeltaH(d)) in solution, and iv. molecular dynamics carried out at 300 and 400 K indicate that WC base pairing is preserved for A(7)*T(7) (3-) duplex, although the helical structure is essentially lost. In combination, these results provide strong evidence that WC base pairing can exist in the complete absence of solvent.

Potential use of tea extract as a complementary mouthwash: comparative evaluation of two commercial samples.

PubMed

Esimone, C O; Adikwu, M U; Nwafor, S V; Okolo, C O

2001-10-01

To evaluate the potential of using tea extracts as complementary mouthwash and to test the comparative efficacy of two commercial samples. A randomized controlled trial with 30 healthy human volunteers was carried out. The subjects were randomly assigned to 5 groups of 6 subjects per group. The ability of Ndu tea (from Cameroon) and Lipton tea (from Nigeria) to reduce colony forming units (CFU) in the liquid expectorated after 60 seconds of gargling from the mouth of the volunteers at 5 and 60 minutes were evaluated. These were compared to the values obtained from bank water and Minty Brett (thymol 0.047%), a standard antiseptic. University of Nigeria, Nsukka, Enugu State, Nigeria. Thirty healthy human volunteers (18 males and 12 females, between 22-30 years of age) who met the eligibility requirement of being nonsmokers and not taking any other antimicrobial agent were selected for the study. Relative to the bank water, the results indicated that the hot water extract of both teas significantly (p < 0.05) reduced CFU per milliliter in the liquid expectorated after gargling at both 5 and 60 minutes. Minty Brett showed higher activity than both tea extracts; however, unlike Minty Brett both extracts still reduced the CFU per milliliter at time 60 minutes (an indication of longer duration of activity). The combination of the tea extracts with sodium lauryl sulfate (1.2% w/v), a surfactant and emulsifier, significantly increased the antimicrobial activity relative to each tea alone. Comparatively, the activity of Ndu tea was found to be slightly higher than that of Lipton tea but this was not significant (p < 0.05). Lipton and Ndu tea extracts potently reduced the CFU per milliliter. This activity was potentiated by sodium lauryl sulfate. Although Minty Brett had more potent antimicrobial activity, both tea extracts have longer duration of activity. The results indicate the potential usefulness of tea extracts as a complementary mouthwash.

Characterization of the Polycaprolactone Melt Crystallization: Complementary Optical Microscopy, DSC, and AFM Studies

PubMed Central

Speranza, V.; Sorrentino, A.; De Santis, F.; Pantani, R.

2014-01-01

The first stages of the crystallization of polycaprolactone (PCL) were studied using several techniques. The crystallization exotherms measured by differential scanning calorimetry (DSC) were analyzed and compared with results obtained by polarized optical microscopy (POM), rheology, and atomic force microscope (AFM). The experimental results suggest a strong influence of the observation scale. In particular, the AFM, even if limited on time scale, appears to be the most sensitive technique to detect the first stages of crystallization. On the contrary, at least in the case analysed in this work, rheology appears to be the least sensitive technique. DSC and POM provide closer results. This suggests that the definition of induction time in the polymer crystallization is a vague concept that, in any case, requires the definition of the technique used for its characterization. PMID:24523644

Characterization of the polycaprolactone melt crystallization: complementary optical microscopy, DSC, and AFM studies.

PubMed

Speranza, V; Sorrentino, A; De Santis, F; Pantani, R

2014-01-01

The first stages of the crystallization of polycaprolactone (PCL) were studied using several techniques. The crystallization exotherms measured by differential scanning calorimetry (DSC) were analyzed and compared with results obtained by polarized optical microscopy (POM), rheology, and atomic force microscope (AFM). The experimental results suggest a strong influence of the observation scale. In particular, the AFM, even if limited on time scale, appears to be the most sensitive technique to detect the first stages of crystallization. On the contrary, at least in the case analysed in this work, rheology appears to be the least sensitive technique. DSC and POM provide closer results. This suggests that the definition of induction time in the polymer crystallization is a vague concept that, in any case, requires the definition of the technique used for its characterization.

Comparing results of X-ray diffraction, µ-Raman spectroscopy and neutron diffraction when identifying chemical phases in seized nuclear material, during a comparative nuclear forensics exercise.

PubMed

Rondahl, Stina Holmgren; Pointurier, Fabien; Ahlinder, Linnea; Ramebäck, Henrik; Marie, Olivier; Ravat, Brice; Delaunay, François; Young, Emma; Blagojevic, Ned; Hester, James R; Thorogood, Gordon; Nelwamondo, Aubrey N; Ntsoane, Tshepo P; Roberts, Sarah K; Holliday, Kiel S

2018-01-01

This work presents the results for identification of chemical phases obtained by several laboratories as a part of an international nuclear forensic round-robin exercise. In this work powder X-ray diffraction (p-XRD) is regarded as the reference technique. Neutron diffraction produced a superior high-angle diffraction pattern relative to p-XRD. Requiring only small amounts of sample, µ-Raman spectroscopy was used for the first time in this context as a potentially complementary technique to p-XRD. The chemical phases were identified as pure UO 2 in two materials, and as a mixture of UO 2 , U 3 O 8 and an intermediate species U 3 O 7 in the third material.

Characterization of Homopolymer and Polymer Blend Films by Phase Sensitive Acoustic Microscopy

NASA Astrophysics Data System (ADS)

Ngwa, Wilfred; Wannemacher, Reinhold; Grill, Wolfgang

2003-03-01

CHARACTERIZATION OF HOMOPOLYMER AND POLYMER BLEND FILMS BY PHASE SENSITIVE ACOUSTIC MICROSCOPY W Ngwa, R Wannemacher, W Grill Institute of Experimental Physics II, University of Leipzig, 04103 Leipzig, Germany Abstract We have used phase sensitive acoustic microscopy (PSAM) to study homopolymer thin films of polystyrene (PS) and poly (methyl methacrylate) (PMMA), as well as PS/PMMA blend films. We show from our results that PSAM can be used as a complementary and highly valuable technique for elucidating the three-dimensional (3D) morphology and micromechanical properties of thin films. Three-dimensional image acquisition with vector contrast provides the basis for: complex V(z) analysis (per image pixel), 3D image processing, height profiling, and subsurface image analysis of the polymer films. Results show good agreement with previous studies. In addition, important new information on the three dimensional structure and properties of polymer films is obtained. Homopolymer film structure analysis reveals (pseudo-) dewetting by retraction of droplets, resulting in a morphology that can serve as a starting point for the analysis of polymer blend thin films. The outcome of confocal laser scanning microscopy studies, performed on the same samples are correlated with the obtained results. Advantages and limitations of PSAM are discussed.

Investigation of the spatially anisotropic component of the laterally averaged molecular Hydrogen/Ag(111) physisorption potential

NASA Astrophysics Data System (ADS)

Whaley, K. B.; Yu, C. F.; Hogg, C. S.; Light, J. C.; Sibener, S. J.

1985-08-01

A detailed investigation of the spatially anisotropic component of the laterally averaged molecular hydrogen/Ag(111) physisorption potential is presented. Experimentally derived rotationally inelastic transition probabilities for H2, D2, and HD, taken as a function of collision energy, are compared with those resulting from close-coupled quantum scattering calculations. These calculations utilize exponential-3 and variable exponent parameterizations of the laterally averaged isotropic potential which reproduce the experimental bound state resonance spectra for p-H2 and o-D2 on Ag(111). Complementary information is obtained by analyzing the magnetic sub-level splittings for physisorbed J = 1 n-H2, using diffractive selective adsorption resonance energies calculated with first order perturbation theory. Theoretical predictions for HD/Ag(111) rotationally mediated selective adsorption resonances are also compared with previously reported experimental results, which show well resolved J-dependent energy shifts resulting in part from the orientational anisotropy of the potential. The results obtained in this study indicate that both the attractive and repulsive parts of the anisotropic potential exhibit only a weak orientation dependence, in agreement with recent theoretical predictions for this system.

Investigation of the spatially anisotropic component of the laterally averaged molecular hydrogen/Ag(111) physisorption potential

NASA Astrophysics Data System (ADS)

Whaley, K. Birgitta; Yu, Chien-fan; Hogg, C. S.; Light, John C.; Sibener, S. J.

1985-10-01

A detailed investigation of the spatially anisotropic component of the laterally averaged molecular hydrogen/Ag(111) physisorption potential is presented. Experimentally derived rotationally inelastic transition probabilities for H2, D2, and HD, taken as a function of collision energy, are compared with those resulting from close-coupled quantum scattering calculations. These calculations utilize exponential-3 and variable exponent parametrizations of the laterally averaged isotropic potential which reproduce the experimental bound state resonance spectra for p-H2 and o-D2 on Ag(111). Complementary information is obtained by analyzing the magnetic sublevel splittings for physisorbed J=1 n-H2, using diffractive selective adsorption resonance energies calculated with first order perturbation theory. Theoretical predictions for HD/Ag(111) rotationally mediated selective adsorption resonances are also compared with previously reported experimental results, which show well resolved J-dependent energy shifts resulting in part from the orientational anisotropy of the potential. The results obtained in this study indicate that both the attractive and repulsive parts of the anisotropic potential exhibit only a weak orientation dependence, in agreement with recent theoretical predictions for this system.

Approximate Analysis for Interlaminar Stresses in Composite Structures with Thickness Discontinuities

NASA Technical Reports Server (NTRS)

Rose, Cheryl A.; Starnes, James H., Jr.

1996-01-01

An efficient, approximate analysis for calculating complete three-dimensional stress fields near regions of geometric discontinuities in laminated composite structures is presented. An approximate three-dimensional local analysis is used to determine the detailed local response due to far-field stresses obtained from a global two-dimensional analysis. The stress results from the global analysis are used as traction boundary conditions for the local analysis. A generalized plane deformation assumption is made in the local analysis to reduce the solution domain to two dimensions. This assumption allows out-of-plane deformation to occur. The local analysis is based on the principle of minimum complementary energy and uses statically admissible stress functions that have an assumed through-the-thickness distribution. Examples are presented to illustrate the accuracy and computational efficiency of the local analysis. Comparisons of the results of the present local analysis with the corresponding results obtained from a finite element analysis and from an elasticity solution are presented. These results indicate that the present local analysis predicts the stress field accurately. Computer execution-times are also presented. The demonstrated accuracy and computational efficiency of the analysis make it well suited for parametric and design studies.

An Overview of Ares-I CFD Ascent Aerodynamic Data Development And Analysis Based on USM3D

NASA Technical Reports Server (NTRS)

Abdol-Hamid, Khaled S.; Ghaffari, Farhad; Parlette, Edward B.

2011-01-01

An overview of the computational results obtained from the NASA Langley developed unstructured grid, Reynolds-averaged Navier-Stokes flow solver USM3D, in support of the Ares-I project within the NASA s Constellation program, are presented. The numerical data are obtained for representative flow conditions pertinent to the ascent phase of the trajectory at both wind tunnel and flight Reynolds number without including any propulsion effects. The USM3D flow solver has been designated to have the primary role within the Ares-I project in developing the computational aerodynamic data for the vehicle while other flow solvers, namely OVERFLOW and FUN3D, have supporting roles to provide complementary results for fewer cases as part of the verification process to ensure code-to-code solution consistency. Similarly, as part of the solution validation efforts, the predicted numerical results are correlated with the aerodynamic wind tunnel data that have been generated within the project in the past few years. Sample aerodynamic results and the processes established for the computational solution/data development for the evolving Ares-I design cycles are presented.

Local-food-based complementary feeding for the nutritional status of children ages 6–36 months in rural areas of Indonesia

PubMed Central

Syahrul; Sulistyorini, Lantin; Rondhianto; Yudisianto, Alfi

2017-01-01

Purpose This study aimed to evaluate a pilot project of the Nursing Feeding Center “Posyandu Plus” (NFCPP) through local food-based complementary feeding (LFCF) program designed to improve the nutritional status of children aged 6–36 months at community health centers in Indonesia. Methods A quasi-experimental design was used to obtain data regarding the nutritional status of 109 children who participated in the project from 6 rural areas. The NFCPP was conducted for 9 weeks, comprising 2 weeks of preintervention, 6 weeks of intervention, and one week of postintervention. The LFCF intervention consisted of 12 sets of recipes to be made by mothers and given to their children 4 times daily over 6 weeks. The weight-for-age z score (WAZ), height-for-age z score (HAZ), weight-for-height z score (WHZ), and body mass index-for-age z score (BAZ) were calculated using World Health Organization Anthro Plus version 1.0.3. Results LFCF intervention significantly increased WHZ, WAZ, and BAZ scores but decreased HAZ scores (P<0.001). Average scores of WHZ (0.96±0.97) and WAZ (0.45±0.72) increased; BAZ increased (1.12±0.93) after 6 weeks of LFCF. WAZ scores postintervention were 50.5% of normal, and WHZ scores were 77.1% of normal. However, the HAZ score decreased by 0.53±0.52, which indicated 57.8% had short stature. Conclusion The NFCPP program with LFCF intervention can improve the nutritional status of children in rural areas. It should be implemented as a sustained program for better provision of complementary feeding during the period of lactation using local food made available at community health centers. PMID:29158766

A Persian-version of the stuttering severity instrument-version four (SSI-4): How the new additions to SSI-4 complement its stuttering severity score?

PubMed

Tahmasebi, Neda; Shafie, Bijan; Karimi, Hamid; Mazaheri, Masood

The fourth version of the Stuttering Severity Instrument (SSI-4) has been available since 2009. It has some modifications and new features which make it more appropriate at least for clinical practice, although further documentation is needed. The objective of the current research was to translate SSI-4 into Persian language and to discuss its relative and absolute reliability as well as its criterion validity for Persian adults who stutter (PWS). We also aimed to study how the new subjective self-reports of the SSI-4 complement the stuttering severity score obtained from the SSI-3 or the SSI-4. The cross-cultural guideline recommended by the International Quality of Life Assessment project was used to translate the SSI-4 into Persian language. Thirty five PWS from ages 17 to 42 were recruited and 10 speech and language pathologists assessed their stuttering severity using either the SSI-4 or stuttering severity ratings (SR) to test validity and reliability of the Persian translated version. A very high inter-judge relative reliability along with a poor absolute inter-judge reliability was found for the SSI-4 scores. The results were more promising for the intra-judge absolute reliability. Test-retest reliability of the complementary questions to the SSI-4 was also found acceptable. However, no strong relationship was found between the SSI-4 scores and its complementary questions. The Persian version of the SSI-4 can be used reliably by trained SLPs for research and clinical purposes, but not to document small changes in stuttering severity. We argue that the response of participants to the complementary self-report questions should also be considered in calculating their stuttering severity score. Copyright © 2018 Elsevier Inc. All rights reserved.

Low-Voltage Complementary Electronics from Ion-Gel-Gated Vertical Van der Waals Heterostructures

DOE Office of Scientific and Technical Information (OSTI.GOV)

Choi, Yongsuk; Kang, Junmo; Jariwala, Deep

2016-03-22

Low-voltage complementary circuits comprising n-type and p-type van der Waals heterojunction vertical field-effect transistors (VFETs) are demonstrated. The resulting VFETs possess high on-state current densities (>3000 A cm-2) and on/off current ratios (>104) in a narrow voltage window (<3 V).

Gain-Scheduled Complementary Filter Design for a MEMS Based Attitude and Heading Reference System

PubMed Central

Yoo, Tae Suk; Hong, Sung Kyung; Yoon, Hyok Min; Park, Sungsu

2011-01-01

This paper describes a robust and simple algorithm for an attitude and heading reference system (AHRS) based on low-cost MEMS inertial and magnetic sensors. The proposed approach relies on a gain-scheduled complementary filter, augmented by an acceleration-based switching architecture to yield robust performance, even when the vehicle is subject to strong accelerations. Experimental results are provided for a road captive test during which the vehicle dynamics are in high-acceleration mode and the performance of the proposed filter is evaluated against the output from a conventional linear complementary filter. PMID:22163824

Vertically stacked multi-heterostructures of layered materials for logic transistors and complementary inverters

PubMed Central

Yu, Woo Jong; Li, Zheng; Zhou, Hailong; Chen, Yu; Wang, Yang; Huang, Yu; Duan, Xiangfeng

2014-01-01

The layered materials such as graphene have attracted considerable interest for future electronics. Here we report the vertical integration of multi-heterostructures of layered materials to enable high current density vertical field-effect transistors (VFETs). An n-channel VFET is created by sandwiching few-layer molybdenum disulfide (MoS2) as the semiconducting channel between a monolayer graphene and a metal thin film. The VFETs exhibit a room temperature on-off ratio >103, while at same time deliver a high current density up to 5,000 A/cm2, sufficient for high performance logic applications. This study offers a general strategy for the vertical integration of various layered materials to obtain both p- and n-channel transistors for complementary logic functions. A complementary inverter with larger than unit voltage gain is demonstrated by vertically stacking the layered materials of graphene, Bi2Sr2Co2O8 (p-channel), graphene, MoS2 (n-channel), and metal thin film in sequence. The ability to simultaneously achieve high on-off ratio, high current density, and logic integration in the vertically stacked multi-heterostructures can open up a new dimension for future electronics to enable three-dimensional integration. PMID:23241535

Power law expansion of the early universe for a V (a) = kan potential

NASA Astrophysics Data System (ADS)

Freitas, Augusto S.

2018-01-01

In a recent paper, He, Gao and Cai [Phys. Rev. D 89, 083510 (2014)], found a rigorous proof, based on analytical solutions of the Wheeler-DeWitt (WDWE) equation, of the spontaneous creation of the universe from nothing. The solutions were obtained from a classical potential V = ka2, where a is the scale factor. In this paper, we present a complementary (to that of He, Gao and Cai) solution to the WDWE equation with V = kan. I have found an exponential expansion of the true vacuum bubble for all scenarios. In all scenarios, we found a power law behavior of the scale factor result which is in agreement with another studies.

Electrets used to measure exhaust cloud effluents from Solid Rocket Motor (SRM) during demonstration model (DM-2) static test firing

NASA Technical Reports Server (NTRS)

Susko, M.

1978-01-01

Electrets were compared with fixed flow samplers during static test firing. The measurement of the rocket exhaust effluents by samplers and electrets indicated that the Solid Rocket Motor had no significant effect on the air quality in the area sampled. The results show that the electrets (a passive device which needs no power) can be used effectively alongside existing measuring devices (which need power). By placing electrets in areas where no power is available, measurements may be obtained. Consequently, it is a valuable complementary instrument in measuring rocket exhaust effluents in areas where other measuring devices may not be able to assess the contaminants.

Quantum Corrections in Nanoplasmonics: Shape, Scale, and Material

NASA Astrophysics Data System (ADS)

Christensen, Thomas; Yan, Wei; Jauho, Antti-Pekka; Soljačić, Marin; Mortensen, N. Asger

2017-04-01

The classical treatment of plasmonics is insufficient at the nanometer-scale due to quantum mechanical surface phenomena. Here, an extension of the classical paradigm is reported which rigorously remedies this deficiency through the incorporation of first-principles surface response functions—the Feibelman d parameters—in general geometries. Several analytical results for the leading-order plasmonic quantum corrections are obtained in a first-principles setting; particularly, a clear separation of the roles of shape, scale, and material is established. The utility of the formalism is illustrated by the derivation of a modified sum rule for complementary structures, a rigorous reformulation of Kreibig's phenomenological damping prescription, and an account of the small-scale resonance shifting of simple and noble metal nanostructures.

Resolving the morphology of niobium carbonitride nano-precipitates in steel using atom probe tomography.

PubMed

Breen, Andrew J; Xie, Kelvin Y; Moody, Michael P; Gault, Baptiste; Yen, Hung-Wei; Wong, Christopher C; Cairney, Julie M; Ringer, Simon P

2014-08-01

Atom probe is a powerful technique for studying the composition of nano-precipitates, but their morphology within the reconstructed data is distorted due to the so-called local magnification effect. A new technique has been developed to mitigate this limitation by characterizing the distribution of the surrounding matrix atoms, rather than those contained within the nano-precipitates themselves. A comprehensive chemical analysis enables further information on size and chemistry to be obtained. The method enables new insight into the morphology and chemistry of niobium carbonitride nano-precipitates within ferrite for a series of Nb-microalloyed ultra-thin cast strip steels. The results are supported by complementary high-resolution transmission electron microscopy.

Design and Simulations of an Energy Harvesting Capable CMOS Pixel for Implantable Retinal Prosthesis

NASA Astrophysics Data System (ADS)

Ansaripour, Iman; Karami, Mohammad Azim

2017-12-01

A new pixel is designed with the capability of imaging and energy harvesting for the retinal prosthesis implant in 0.18 µm standard Complementary Metal Oxide Semiconductor technology. The pixel conversion gain and dynamic range, are 2.05 \\upmu{{V}}/{{e}}^{ - } and 63.2 dB. The power consumption 53.12 pW per pixel while energy harvesting performance is 3.87 nW in 60 klx of illuminance per pixel. These results have been obtained using post layout simulation. In the proposed pixel structure, the high power production capability in energy harvesting mode covers the demanded energy by using all available p-n junction photo generated currents.

Homeostatic signature of anabolic steroids in cattle using 1H-13C HMBC NMR metabonomics.

PubMed

Dumas, Marc-Emmanuel; Canlet, Cécile; Vercauteren, Joseph; André, François; Paris, Alain

2005-01-01

We used metabonomics to discriminate the urinary signature of different anabolic steroid treatments in cattle having different physiological backgrounds (age, sex, and race). (1)H-(13)C heteronuclear multiple bonding connectivity NMR spectroscopy and multivariate statistical methods reveal that metabolites such as trimethylamine-N-oxide, dimethylamine, hippurate, creatine, creatinine, and citrate characterize the biological fingerprint of anabolic treatment. These urinary biomarkers suggest an overall homeostatic adaptation in nitrogen and energy metabolism. From results obtained in this study, it is now possible to consider metabonomics as a complementary method usable to improve doping control strategies to detect fraudulent anabolic treatment in cattle since the oriented global metabolic response provides helpful discrimination.

Temporal BYY encoding, Markovian state spaces, and space dimension determination.

PubMed

Xu, Lei

2004-09-01

As a complementary to those temporal coding approaches of the current major stream, this paper aims at the Markovian state space temporal models from the perspective of the temporal Bayesian Ying-Yang (BYY) learning with both new insights and new results on not only the discrete state featured Hidden Markov model and extensions but also the continuous state featured linear state spaces and extensions, especially with a new learning mechanism that makes selection of the state number or the dimension of state space either automatically during adaptive learning or subsequently after learning via model selection criteria obtained from this mechanism. Experiments are demonstrated to show how the proposed approach works.

Complementary Hand Responses Occur in Both Peri- and Extrapersonal Space.

PubMed

Faber, Tim W; van Elk, Michiel; Jonas, Kai J

2016-01-01

Human beings have a strong tendency to imitate. Evidence from motor priming paradigms suggests that people automatically tend to imitate observed actions such as hand gestures by performing mirror-congruent movements (e.g., lifting one's right finger upon observing a left finger movement; from a mirror perspective). Many observed actions however, do not require mirror-congruent responses but afford complementary (fitting) responses instead (e.g., handing over a cup; shaking hands). Crucially, whereas mirror-congruent responses don't require physical interaction with another person, complementary actions often do. Given that most experiments studying motor priming have used stimuli devoid of contextual information, this space or interaction-dependency of complementary responses has not yet been assessed. To address this issue, we let participants perform a task in which they had to mirror or complement a hand gesture (fist or open hand) performed by an actor depicted either within or outside of reach. In three studies, we observed faster reaction times and less response errors for complementary relative to mirrored hand movements in response to open hand gestures (i.e., 'hand-shaking') irrespective of the perceived interpersonal distance of the actor. This complementary effect could not be accounted for by a low-level spatial cueing effect. These results demonstrate that humans have a strong and automatic tendency to respond by performing complementary actions. In addition, our findings underline the limitations of manipulations of space in modulating effects of motor priming and the perception of affordances.

Women's motivation, perception and experience of complementary and alternative medicine in pregnancy: A meta-synthesis.

PubMed

Bowman, Rebekah L; Davis, Deborah L; Ferguson, Sally; Taylor, Jan

2018-04-01

complementary and Alternative Medicine use during pregnancy is popular in many countries, including Australia. There is currently little evidence to support this practice, which raises the question of women's motivation for use of these therapies and the experiences they encounter. this study aims to explore the perceptions, motivations and experiences of pregnant women with regard to their use of Complementary and Alternative Medicine during pregnancy. a systemic review and meta-synthesis of the available research was conducted. Five databases were explored - CINAHL Plus, Medline, PubMed, AMED and Web of Science using the search terms complementary and alternative medicine; pregnancy; and pregnant. Articles included in this meta-synthesis were screened using the Preferred Reporting Items for Systematic Reviews and Meta-Analyses tool. ten initial themes were drawn from the six studies. These ten themes were summarised by three cluster themes. The results suggest that women are using Complementary and Alternative Medicine in their pregnancy as a means of supporting their sense of self-determination, to pursue a natural and safe childbirth, and because they experience a close affiliation with the philosophical underpinnings of Complementary and Alternative Medicine as an alternative to the biomedical model. these findings are important to practitioners, policy makers, governing bodies and researchers, providing insight into the motivations for Complementary and Alternative Medicine use by women in pregnancy. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

Experimental Comparison Between Mahoney and Complementary Sensor Fusion Algorithm for Attitude Determination by Raw Sensor Data of Xsens Imu on Buoy

NASA Astrophysics Data System (ADS)

Jouybari, A.; Ardalan, A. A.; Rezvani, M.-H.

2017-09-01

The accurate measurement of platform orientation plays a critical role in a range of applications including marine, aerospace, robotics, navigation, human motion analysis, and machine interaction. We used Mahoney filter, Complementary filter and Xsens Kalman filter for achieving Euler angle of a dynamic platform by integration of gyroscope, accelerometer, and magnetometer measurements. The field test has been performed in Kish Island using an IMU sensor (Xsens MTi-G-700) that installed onboard a buoy so as to provide raw data of gyroscopes, accelerometers, magnetometer measurements about 25 minutes. These raw data were used to calculate the Euler angles by Mahoney filter and Complementary filter, while the Euler angles collected by XSense IMU sensor become the reference of the Euler angle estimations. We then compared Euler angles which calculated by Mahoney Filter and Complementary Filter with reference to the Euler angles recorded by the XSense IMU sensor. The standard deviations of the differences between the Mahoney Filter, Complementary Filter Euler angles and XSense IMU sensor Euler angles were about 0.5644, 0.3872, 0.4990 degrees and 0.6349, 0.2621, 2.3778 degrees for roll, pitch, and heading, respectively, so the numerical result assert that Mahoney filter is precise for roll and heading angles determination and Complementary filter is precise only for pitch determination, it should be noted that heading angle determination by Complementary filter has more error than Mahoney filter.

Marketing complementary foods and supplements in Burkina Faso, Madagascar, and Vietnam: lessons learned from the Nutridev program.

PubMed

Bruyeron, Olivier; Denizeau, Mirrdyn; Berger, Jacques; Trèche, Serge

2010-06-01

Sustainable approaches to improving infant and young child feeding are needed. The Nutridev program worked in Vietnam, Madagascar, and Burkina Faso to test different strategies to improve complementary feeding using fortified products sold to families. To review the experiences of programs producing and marketing fortified complementary foods and to report on the feasibility of local production and marketing of fortified complementary foods to increase usage of high-quality foods among children of low-income families in a self-sustaining manner. Project documents, surveys of mothers, and production and sales reports were reviewed. Nutridev experience in Vietnam, Madagascar, and Burkina Faso demonstrates that it is possible to produce affordable, high-quality complementary foods and supplements locally in developing countries. Strategies to make products readily available to the targeted population and to convince this population to consume them yielded mixed results, varying greatly based on the strategy utilized and the context in which it was implemented. In several contexts, the optimal approach appears to be strengthening the existing food distribution network to sell complementary foods and supplements, with the implementation of a temporary promotion and nutrition education network in partnership with local authorities (e.g., health services) to increase awareness among families about the fortified complementary food product and optimal feeding practices. In urban areas, where the density of the population is high, design and implementation of specific networks very close to consumers seems to be a good way to combine economic sustainability and good consumption levels.

Complementary Feeding Practices of Mothers and Their Perceived Impacts on Young Children: Findings from KEEA District of Ghana.

PubMed

Egyir, Bridget K; Ramsay, Samantha A; Bilderback, Barry; Safaii, SeAnne

2016-09-01

Objective Appropriate and timely complementary feeding practices are fundamental to a child's growth, health, and development during the first 2 years of life. This study aimed to understand (1) Ghanaian mother's complementary feeding practices, and (2) their perceived and observed impacts of complementary feeding on their children. Methods Ghanaian mothers with children 4-24 months of age were recruited from four communities in the Komenda Edina Eguafo Abrem district in the Central Region of Ghana (n = 99). A qualitative methodological approach with focus group interview discussions was used. Eleven focus group interviews were conducted, and were audio recorded and transcribed. The audio transcriptions were coded and analyzed into pertinent themes, meta-themes, and theoretical concepts. Results Over 80 % (85) of mothers reported poor knowledge about the effects of complementary feeding on their children and 45 % (45) of the children were undernourished, indicating inappropriate complementary feeding practices. Some mothers held misconceptions about the effect of food on children's health. Four overarching themes were identified: (1) mothers' background knowledge about food, child health and growth outcomes, (2) mothers' motivation in feeding their children, (3) barriers to feeding, (4) foods mothers offered their children. Conclusion for Practice Nutrition education on complementary feeding is needed for Ghanaian mothers. Health facilities and community outreach programs could be a venue to provide education to mothers regarding infant and young child feeding practices in Ghana.

Out-of-Pocket Expenditures on Complementary Health Approaches Associated with Painful Health Conditions in a Nationally Representative Adult Sample

PubMed Central

Nahin, Richard L.; Stussman, Barbara J.; Herman, Patricia M.

2015-01-01

National surveys suggest that millions of adults in the United States use complementary health approaches such as acupuncture, chiropractic manipulation, and herbal medicines to manage painful conditions such as arthritis, back pain and fibromyalgia. Yet, national and per person out-of-pocket (OOP) costs attributable to this condition-specific use are unknown. In the 2007 National Health Interview Survey, use of complementary health approaches, reasons for this use, and associated OOP costs were captured in a nationally representative sample of 5,467 adults. Ordinary least square regression models that controlled for co-morbid conditions were used to estimate aggregate and per person OOP costs associated with 14 painful health conditions. Individuals using complementary approaches spent a total of $14.9 billion (S.E. $0.9 billion) OOP on these approaches to manage these painful conditions. Total OOP expenditures seen in those using complementary approaches for their back pain ($8.7 billion, S.E. $0.8 billion) far outstripped that of any other condition, with the majority of these costs ($4.7 billion, S.E. $0.4 billion) resulting from visits to complementary providers. Annual condition-specific per-person OOP costs varied from a low of $568 (SE $144) for regular headaches, to a high of $895 (SE $163) for fibromyalgia. PMID:26320946

Physical-Chemical Characterization of Fruit Purees and Relationship with Sensory Analysis Carried out by Infants (12 to 24 mo).

PubMed

Inarejos-García, A M; Mancebo-Campos, V; Cañizares, P; Llanos, J

2015-05-01

Fruit purees are one of the foods earliest introduced foods in infants' diet during the complementary period. The rheological characteristics together with the sensory analysis are decisive factors for the acceptance of the food product by the infant. The sensory analysis of three commercial fruit purees (mixed fruits, pear, and plum) was studied by employing a new objective sensory parameter named as SAIR (Sensory Acceptance by Infants Ratio), which is the quotient between the percentage of puree consumed (%) by the time (seconds) throughout the storage time. In parallel, the rheological characteristics of the purees were analyzed in order to obtain a relationship with the SAIR parameter. It was proved that the best acceptance of the product (higher SAIR) was observed for such purees showing a lower apparent viscosity (lower consistency index, "K") and a less pseudoplastic behavior (higher flow behavior index, "n"). These results may help to obtain higher acceptance values based on easy obtainable and objective parameters. © 2015 Institute of Food Technologists®

Characteristics attributed to complementary foods by caregivers in four countries of Latin America and the Caribbean.

PubMed

Dutta, Tanushree; Sywulka, Sara M; Frongillo, Edward A; Lutter, Chessa K

2006-12-01

Attributes that caregivers assign to complementary foods have been primarily described in the context of illness, but attributes assigned to foods in everyday circumstances must be understood to effectively promote good complementary feeding. This study aimed to understand how mothers judge complementary foods to be appropriate by cross-cultural examination of food perceptions in four different Latin American and Caribbean countries. We used semistructured interviews to assess attributes that mothers ascribed to a list of key foods, both home-made and manufactured, and reasons for feeding or not feeding them. We elicited attributes from 79 caregivers with children 6 to 24 months of age from two urban and perirban sites each in Brazil, Jamaica, Mexico, and Panama. Textual analysis based on six home foods common to the four countries and manufactured foods resulted in six attribute categories, five of which could be positive or negative (Nutrient Content, Effects on Child, Child's Response, Availability and Accessibility, and Other Food Attributes); one (Food Quality and Safety) was only negative. Analysis of attributes of home foods (chicken, eggs, beans, carrots, bananas or plantains, and oranges) revealed many beliefs that were common within and across countries, whereas analysis of the attributes of manufactured foods revealed that these foods were less known. The consistency of the attribute categories across countries and across home and manufactured foods suggests their relevance to planning programs to improve complementary feeding in Latin America and the Caribbean and possibly other developing countries. These results can be used programmatically to assess the need for and the focus of food education programs, and to indicate which countries will be more receptive to certain foods as a means of improving complementary feeding.

Use of complementary and alternative medicine by patients with hematological diseases experience at a university hospital in northeast Mexico

PubMed Central

Jaime-Pérez, José Carlos; Chapa-Rodríguez, Adrián; Rodríguez-Martínez, Marisol; Colunga-Pedraza, Perla Rocío; Marfil-Rivera, Luis Javier; Gómez-Almaguer, David

2012-01-01

Background Complementary and alternative medicine includes a diverse group of medical and healthcare systems, practices and products not considered part of conventional medicine. Although there is information on unconventional practices in oncological diseases, specific data regarding the use of complementary and alternative medicine by hematology patients is scarce. Objective The aim of this study is to document the prevalence of this modality of unconventional therapy in patients with malignant and benign hematological diseases, particularly children with acute lymphoblastic leukemia. Methods An observational study of adult patients and guardians of children with malignant or benign hematological diseases was carried out by applying a structured questionnaire detailing the use and results of the most prevalent complementary and alternative medicine practices. Results One hundred and twenty patients were included; 104 had malignant and 16 had benign hematological diseases. The use of complementary and alternative medicine was greater in benign diseases but the difference was not statistically significant (64.7% versus 41.7%; p-value = 0.08). Patients and guardians with high school or college educations used these alternative practices more than patients with less schooling (60.7% versus 54.7%; p-value = 0.032). The use of folk remedies was most prevalent followed by herbal preparations and spiritual healing. Sixty-four percent of patients that used these unconventional practices reported improvement in their symptoms and increased capacity to perform daily activities. Conclusion No significant difference was documented between patients with malignant or benign hematological diseases using these alternative practices. The majority of complementary and alternative medicine users reported improvement of the disease or chemotherapy-related symptoms. PMID:23049401

Adaptive multi-view clustering based on nonnegative matrix factorization and pairwise co-regularization

NASA Astrophysics Data System (ADS)

Zhang, Tianzhen; Wang, Xiumei; Gao, Xinbo

2018-04-01

Nowadays, several datasets are demonstrated by multi-view, which usually include shared and complementary information. Multi-view clustering methods integrate the information of multi-view to obtain better clustering results. Nonnegative matrix factorization has become an essential and popular tool in clustering methods because of its interpretation. However, existing nonnegative matrix factorization based multi-view clustering algorithms do not consider the disagreement between views and neglects the fact that different views will have different contributions to the data distribution. In this paper, we propose a new multi-view clustering method, named adaptive multi-view clustering based on nonnegative matrix factorization and pairwise co-regularization. The proposed algorithm can obtain the parts-based representation of multi-view data by nonnegative matrix factorization. Then, pairwise co-regularization is used to measure the disagreement between views. There is only one parameter to auto learning the weight values according to the contribution of each view to data distribution. Experimental results show that the proposed algorithm outperforms several state-of-the-arts algorithms for multi-view clustering.

Microanalysis (micro-XRF, micro-XANES, and micro-XRD) of a tertiary sediment using microfocused synchrotron radiation.

PubMed

Denecke, Melissa A; Somogyi, Andrea; Janssens, Koen; Simon, Rolf; Dardenne, Kathy; Noseck, Ulrich

2007-06-01

Micro-focused synchrotron radiation techniques to investigate actinide elements in geological samples are becoming an increasingly used tool in nuclear waste disposal research. In this article, results using mu-focus techniques are presented from a bore core section of a U-rich tertiary sediment collected from Ruprechtov, Czech Republic, a natural analog to nuclear waste repository scenarios in deep geological formations. Different methods are applied to obtain various, complementary information. Elemental and element chemical state distributions are obtained from micro-XRF measurements, oxidation states of As determined from micro-XANES, and the crystalline structure of selected regions are studied by means of micro-XRD. We find that preparation of the thin section created an As oxidation state artifact; it apparently changed the As valence in some regions of the sample. Results support our previously proposed hypothesis of the mechanism for U-enrichment in the sediment. AsFeS coating on framboid Fe nodules in the sediment reduced mobile groundwater-dissolved U(VI) to less-soluble U(IV), thereby immobilizing the uranium in the sediment.

Photochemical Degradation of the Anticancer Drug Bortezomib by V-UV/UV (185/254 nm) Investigated by (1)H NMR Fingerprinting: A Way to Follow Aromaticity Evolution.

PubMed

Martignac, Marion; Balayssac, Stéphane; Gilard, Véronique; Benoit-Marquié, Florence

2015-06-18

We have investigated the removal of bortezomib, an anticancer drug prescribed in multiple myeloma, using the photochemical advanced oxidation process of V-UV/UV (185/254 nm). We used two complementary analytical techniques to follow the removal rate of bortezomib. Nuclear magnetic resonance (NMR) is a nonselective method requiring no prior knowledge of the structures of the byproducts and permits us to provide a spectral signature (fingerprinting approach). This untargeted method provides clues to the molecular structure changes and information on the degradation of the parent drug during the irradiation process. This holistic NMR approach could provide information for monitoring aromaticity evolution. We use liquid chromatography, coupled with high-resolution mass spectrometry (LC-MS), to correlate results obtained by (1)H NMR and for accurate identification of the byproducts, in order to understand the mechanistic degradation pathways of bortezomib. The results show that primary byproducts come from photoassisted deboronation of bortezomib at 254 nm. A secondary byproduct of pyrazinecarboxamide was also identified. We obtained a reliable correlation between these two analytical techniques.

Beyond simple small-angle X-ray scattering: developments in online complementary techniques and sample environments.

PubMed

Bras, Wim; Koizumi, Satoshi; Terrill, Nicholas J

2014-11-01

Small- and wide-angle X-ray scattering (SAXS, WAXS) are standard tools in materials research. The simultaneous measurement of SAXS and WAXS data in time-resolved studies has gained popularity due to the complementary information obtained. Furthermore, the combination of these data with non X-ray based techniques, via either simultaneous or independent measurements, has advanced understanding of the driving forces that lead to the structures and morphologies of materials, which in turn give rise to their properties. The simultaneous measurement of different data regimes and types, using either X-rays or neutrons, and the desire to control parameters that initiate and control structural changes have led to greater demands on sample environments. Examples of developments in technique combinations and sample environment design are discussed, together with a brief speculation about promising future developments.

Beyond simple small-angle X-ray scattering: developments in online complementary techniques and sample environments

PubMed Central

Bras, Wim; Koizumi, Satoshi; Terrill, Nicholas J

2014-01-01

Small- and wide-angle X-ray scattering (SAXS, WAXS) are standard tools in materials research. The simultaneous measurement of SAXS and WAXS data in time-resolved studies has gained popularity due to the complementary information obtained. Furthermore, the combination of these data with non X-ray based techniques, via either simultaneous or independent measurements, has advanced understanding of the driving forces that lead to the structures and morphologies of materials, which in turn give rise to their properties. The simultaneous measurement of different data regimes and types, using either X-rays or neutrons, and the desire to control parameters that initiate and control structural changes have led to greater demands on sample environments. Examples of developments in technique combinations and sample environment design are discussed, together with a brief speculation about promising future developments. PMID:25485128

Use of Complementary Medicine in Older Americans: Results from the Health and Retirement Study

ERIC Educational Resources Information Center

Ness, Jose; Cirillo, Dominic J.; Weir, David R.; Nisly, Nicole L.; Wallace, Robert B.

2005-01-01

Purpose: The correlates of complementary and alternative medicine (CAM) utilization among elders have not been fully investigated. This study was designed to identify such correlates in a large sample of older adults, thus generating new data relevant to consumer education, medical training, and health practice and policy. Design and Methods: A…

Attitudes toward and education about complementary and alternative medicine among adult patients with depression in Taiwan.

PubMed

Hsu, Mei-Chi; Moyle, Wendy; Creedy, Debra; Venturato, Lorraine; Ouyang, Wen-Chen; Sun, Gwo-Ching

2010-04-01

To investigate patients' attitudes toward complementary and alternative medicine, the education nurses provided about complementary and alternative medicine for treating depression and to test whether such education mediates the effect of complementary and alternative medicine use and attitudes toward complementary and alternative medicine. Although we know that attitudes influence behaviour, very few studies simultaneously explore the relationship between attitudes, education and complementary and alternative medicine use. Survey. This study was conducted as part of a larger survey, using face-to-face survey interviews with 206 adult patients aged 50 years or over and hospitalised in conventional hospitals in Taiwan for treatment of depression. The attitudes toward complementary and alternative medicine and patient education about complementary and alternative medicine instruments were specially developed for the study. Participants expressed slightly favourable attitudes toward complementary and alternative medicine. Many participants (50%) expressed that they were willing to try any potential treatment for depression. They believed that complementary and alternative medicine helped them to feel better and to live a happier life. However, 66.5% of participants reported that they had inadequate knowledge of complementary and alternative medicine. Participants with a higher monthly income, longer depression duration and religious beliefs hold more positive attitudes toward complementary and alternative medicine. Most participants were not satisfied with the education they received about complementary and alternative medicine. Patient education about complementary and alternative medicine was found to be a mediator for the use of complementary and alternative medicine. Patient education from nurses may predict patients' attitudes toward complementary and alternative medicine. Continuing nursing education is needed to enable nurses to respond knowledgeably to concerns patients may have about complementary and alternative medicine and treatment options. This study highlights the potential role of patient education about complementary and alternative medicine as an effective way of adjusting patients' attitudes toward complementary and alternative medicine and to link both patients' preferences for complementary and alternative medicine and health professionals' concerns about the proper use of complementary and alternative medicine for depression management and adverse drug interactions.

[A cutaneous horn of the free margin of the eyelid: an anatomical and clinical observation].

PubMed

D'Hermies, F; Gerolami-Favreul, I; Meyer, A; Morel, X; Halhal, M; Sam, H; Elmaleh, C; Renard, G; Behar-Cohen, F

2003-05-01

A cutaneous horn was observed close to the free margin of the inferior right eyelid in a 26-year-old-male patient. A minimal resection was primarily performed. Histopathologic study disclosed a precancerous keratosis. As the tumor had not been entirely excised, a complementary resection was performed secondarily to obtain the entire resection of the tumor.

Complementary use of ion beam elastic backscattering and recoil detection analysis for the precise determination of the composition of thin films made of light elements

NASA Astrophysics Data System (ADS)

Climent-Font, A.; Cervera, M.; Hernández, M. J.; Muñoz-Martín, A.; Piqueras, J.

2008-04-01

Rutherford backscattering spectrometry (RBS) is a well known powerful technique to obtain depth profiles of the constituent elements in a thin film deposited on a substrate made of lighter elements. In its standard use the probing beam is typically 2 MeV He. Its capabilities to obtain precise composition profiles are severely diminished when the overlaying film is made of elements lighter than the substrate. In this situation the analysis of the energy of the recoiled element from the sample in the elastic scattering event, the ERDA technique may be advantageous. For the detection of light elements it is also possible to use beams at specific energies producing elastic resonances with these light elements to be analyzed, with a much higher scattering cross sections than the Rutherford values. This technique may be called non-RBS. In this work we report on the complementary use of ERDA with a 30 MeV Cl beam and non-RBS with 1756 keV H ions to characterize thin films made of boron, carbon and nitrogen (BCN) deposited on Si substrates.

Complementary medicine for alcohol dependence in Italian services: a mail questionnaire.

PubMed

Bardazzi, Gabriele; Merluzzi, Jo-Anne; Voller, Fabio; Fontana, Aldo; Abenavoli, Ludovico; Leggio, Lorenzo; Addolorato, Giovanni

2006-08-01

It is well known that Complementary Medicine (CM) is extensively used in western countries for the treatment of many afflictions. CM has been recently promoted in addiction treatment. To evaluate CM use in alcohol dependence we planned a mail questionnaire for Italian alcohol services. We sent out 612 questionnaires. Health services that were unable to respond to the questionnaire within a 20-day limit period were contacted by phone and if we obtained agreement to participate in the study the questionnaire was sent by fax. We obtained 312 (51.82%) completed questionnaires. Only 16.50% of Italian services use CM for alcohol dependence treatment and acupuncture is utilized more frequently than other methods (phytotherapy, homeopathy, etc.). In Italian alcohol services CM is identified as an instrument incorporated into traditional alcohol treatments (self-help groups, drug treatment, etc.) and not an alternative method. In fact, health services that use it as a principal method of treatment were a rare event in our study (1%). CM plays an integrated role with traditional forms of alcohol treatment in Italian alcohol services and this utilization could be useful to reduce drop-outs and improve alcohol treatment compliance.

Durability-enhanced two-dimensional hole gas of C-H diamond surface for complementary power inverter applications

PubMed Central

Kawarada, Hiroshi; Yamada, Tetsuya; Xu, Dechen; Tsuboi, Hidetoshi; Kitabayashi, Yuya; Matsumura, Daisuke; Shibata, Masanobu; Kudo, Takuya; Inaba, Masafumi; Hiraiwa, Atsushi

2017-01-01

Complementary power field effect transistors (FETs) based on wide bandgap materials not only provide high-voltage switching capability with the reduction of on-resistance and switching losses, but also enable a smart inverter system by the dramatic simplification of external circuits. However, p-channel power FETs with equivalent performance to those of n-channel FETs are not obtained in any wide bandgap material other than diamond. Here we show that a breakdown voltage of more than 1600 V has been obtained in a diamond metal-oxide-semiconductor (MOS) FET with a p-channel based on a two-dimensional hole gas (2DHG). Atomic layer deposited (ALD) Al2O3 induces the 2DHG ubiquitously on a hydrogen-terminated (C-H) diamond surface and also acts as both gate insulator and passivation layer. The high voltage performance is equivalent to that of state-of-the-art SiC planar n-channel FETs and AlGaN/GaN FETs. The drain current density in the on-state is also comparable to that of these two FETs with similar device size and VB. PMID:28218234

Durability-enhanced two-dimensional hole gas of C-H diamond surface for complementary power inverter applications.

PubMed

Kawarada, Hiroshi; Yamada, Tetsuya; Xu, Dechen; Tsuboi, Hidetoshi; Kitabayashi, Yuya; Matsumura, Daisuke; Shibata, Masanobu; Kudo, Takuya; Inaba, Masafumi; Hiraiwa, Atsushi

2017-02-20

Complementary power field effect transistors (FETs) based on wide bandgap materials not only provide high-voltage switching capability with the reduction of on-resistance and switching losses, but also enable a smart inverter system by the dramatic simplification of external circuits. However, p-channel power FETs with equivalent performance to those of n-channel FETs are not obtained in any wide bandgap material other than diamond. Here we show that a breakdown voltage of more than 1600 V has been obtained in a diamond metal-oxide-semiconductor (MOS) FET with a p-channel based on a two-dimensional hole gas (2DHG). Atomic layer deposited (ALD) Al 2 O 3 induces the 2DHG ubiquitously on a hydrogen-terminated (C-H) diamond surface and also acts as both gate insulator and passivation layer. The high voltage performance is equivalent to that of state-of-the-art SiC planar n-channel FETs and AlGaN/GaN FETs. The drain current density in the on-state is also comparable to that of these two FETs with similar device size and V B .

RNA-primed complementary-sense DNA synthesis of the geminivirus African cassava mosaic virus.

PubMed Central

Saunders, K; Lucy, A; Stanley, J

1992-01-01

The plant DNA virus African cassava mosaic virus (ACMV) is believed to replicate by a rolling circle mechanism. To investigate complementary-sense DNA (lagging strand) synthesis, we have analysed the heterogenous form of complementary-sense DNA (H3 DNA) from infected Nicotiana benthamiana by two-dimensional agarose gel electrophoresis and blot hybridisation. The presence of an RNA moeity is demonstrated by comparison of results for nucleic acids resolved on neutral/alkaline and neutral/formamide gels, suggesting that complementary-sense DNA synthesis on the virus-sense single-stranded DNA template is preceded by the synthesis of an RNA primer. Hybridisation with probes to specific parts of ACMV DNA A genome indicates that synthesis of the putative RNA primer initiates between nucleotides 2581-221, a region that includes intergenic sequences that have been implicated in geminivirus DNA replication and the control of gene expression. Images PMID:1475192

Complementary and conventional providers in cancer care: experience of communication with patients and steps to improve communication with other providers.

PubMed

Stub, Trine; Quandt, Sara A; Arcury, Thomas A; Sandberg, Joanne C; Kristoffersen, Agnete E

2017-06-08

Effective interdisciplinary communication is important to achieve better quality in health care. The aims of this study were to compare conventional and complementary providers' experience of communication about complementary therapies and conventional medicine with their cancer patients, and to investigate how they experience interdisciplinary communication and cooperation. This study analyzed data from a self-administrated questionnaire. A total of 606 different health care providers, from four counties in Norway, completed the questionnaire. The survey was developed to describe aspects of the communication pattern among oncology doctors, nurses, family physicians and complementary therapists (acupuncturists, massage therapists and reflexologists/zone-therapists). Between-group differences were analyzed using chi-square, ANOVA and Fisher's exact tests. Significance level was defined as p < 0.05 without adjustment for multiple comparisons. Conventional providers and complementary therapists had different patterns of communication with their cancer patients regarding complementary therapies. While complementary therapists advised their patients to apply both complementary and conventional modalities, medical doctors were less supportive of their patients' use of complementary therapies. Of conventional providers, nurses expressed more positive attitudes toward complementary therapies. Opportunities to improve communication between conventional and complementary providers were most strongly supported by complementary providers and nurses; medical doctors were less supportive of such attempts. A number of doctors showed lack of respect for complementary therapists, but asked for more research, guidelines for complementary modalities and training in conventional medicine for complementary therapists. For better quality of care, greater communication about complementary therapy use is needed between cancer patients and their conventional and complementary providers. In addition, more communication between conventional and complementary providers is needed. Nurses may have a crucial role in facilitating communication, as they are positive toward complementary therapies and they have more direct communication with patients about their treatment preferences.

A novel technology for the detection, enrichment, and separation of trace amounts of target DNA based on amino-modified fluorescent magnetic composite nanoparticles.

PubMed

Wang, Guannan; Su, Xingguang

2010-06-01

A novel, highly sensitive technology for the detection, enrichment, and separation of trace amounts of target DNA was developed on the basis of amino-modified fluorescent magnetic composite nanoparticles (AFMN). In this study, the positively charged amino-modified composite nanoparticles conjugate with the negatively charged capture DNA through electrostatic binding. The optimal combination of AFMN and capture DNA was measured by dynamic light scattering (DLS) and UV-vis absorption spectroscopy. The highly sensitive detection of trace amounts of target DNA was achieved through enrichment by means of AFMN. The detection limit for target DNA is 0.4 pM, which could be further improved by using a more powerful magnet. Because of their different melting temperatures, single-base mismatched target DNA could be separated from perfectly complementary target DNA. In addition, the photoluminescence (PL) signals of perfectly complementary target DNA and single-base mismatched DNA as well as the hybridization kinetics of different concentrations of target DNA at different reaction times have also been studied. Most importantly, the detection, enrichment, and separation ability of AFMN was further verified with milk. Simple and satisfactory results were obtained, which show the great potential in the fields of mutation identification and clinical diagnosis.

Fully integrated reflection-mode photoacoustic, two-photon, and second harmonic generation microscopy in vivo

NASA Astrophysics Data System (ADS)

Song, Wei; Xu, Qiang; Zhang, Yang; Zhan, Yang; Zheng, Wei; Song, Liang

2016-08-01

The ability to obtain comprehensive structural and functional information from intact biological tissue in vivo is highly desirable for many important biomedical applications, including cancer and brain studies. Here, we developed a fully integrated multimodal microscopy that can provide photoacoustic (optical absorption), two-photon (fluorescence), and second harmonic generation (SHG) information from tissue in vivo, with intrinsically co-registered images. Moreover, using a delicately designed optical-acoustic coupling configuration, a high-frequency miniature ultrasonic transducer was integrated into a water-immersion optical objective, thus allowing all three imaging modalities to provide a high lateral resolution of ~290 nm with reflection-mode imaging capability, which is essential for studying intricate anatomy, such as that of the brain. Taking advantage of the complementary and comprehensive contrasts of the system, we demonstrated high-resolution imaging of various tissues in living mice, including microvasculature (by photoacoustics), epidermis cells, cortical neurons (by two-photon fluorescence), and extracellular collagen fibers (by SHG). The intrinsic image co-registration of the three modalities conveniently provided improved visualization and understanding of the tissue microarchitecture. The reported results suggest that, by revealing complementary tissue microstructures in vivo, this multimodal microscopy can potentially facilitate a broad range of biomedical studies, such as imaging of the tumor microenvironment and neurovascular coupling.

Molecular analysis of RAPD DNA based markers: their potential use for the detection of genetic variability in jojoba (Simmondsia chinensis L Schneider).

PubMed

Amarger, V; Mercier, L

1995-01-01

We have applied the recently developed technique of random amplified polymorphic DNA (RAPD) for the discrimination between two jojoba clones at the genomic level. Among a set of 30 primers tested, a simple reproducible pattern with three distinct fragments for clone D and two distinct fragments for clone E was obtained with primer OPB08. Since RAPD products are the results of arbitrarily priming events and because a given primer can amplify a number of non-homologous sequences, we wondered whether or not RAPD bands, even those of similar size, were derived from different loci in the two clones. To answer this question, two complementary approaches were used: i) cloning and sequencing of the amplification products from clone E; and ii) complementary Southern analysis of RAPD gels using cloned or amplified fragments (directly recovered from agarose gels) as RFLP probes. The data reported here show that the RAPD reaction generates multiple amplified fragments. Some fragments, although resolved as a single band on agarose gels, contain different DNA species of the same size. Furthermore, it appears that the cloned RAPD products of known sequence that do not target repetitive DNA can be used as hybridization probes in RFLP to detect a polymorphism among individuals.

CHINESE HERBAL DECOCTION AS A COMPLEMENTARY THERAPY FOR ATROPHIC GASTRITIS: A SYSTEMATIC REVIEW AND META-ANALYSIS.

PubMed

Fang, Wen-Jie; Zhang, Xin-Ying; Yang, Bo; Sui, Shu-Jing; Chen, Min; Pan, Wei-Hua; Liao, Wan-Qing; Zhong, Ming; Wang, Qing-Cai

2017-01-01

Chinese herbal decoction (CHD) has been extensively used in the treatment of atrophic gastritis (AG) in China and other Far Eastern countries. We conducted a systematic review and meta-analysis to estimate the efficacy and safety of CHD in AG. Pubmed, Embase, Cochrane central register of controlled trials (central), VIP, China National Knowledge Infrastructure, Sinomed, Wanfang data were searched (up to December 2015). Randomized controlled trials recruiting patients with AG comparing CHD (alone or with western medicine (WM)) with WM were eligible. Dichotomous data were pooled to obtain relative risk (RR), with a 95% confidence interval (CI). Forty-two articles including 3,874 patients were identified. CHD, used alone or with WM, had beneficial effect over WM in the improvement of clinical manifestations (RR=1.28; 95% CI 1.22-1.34) and pathological change (RR=1.42; 95% CI 1.30-1.54) for AG patients. However, the H. pylori eradication effect of CHD was not supported by the existing clinical evidence, because of the significant study heterogeneity (I 2 >50%) and inconsistency between the primary results and sensitivity analysis. CHD, if prescribed as a complementary therapy to WM, may improve the clinical manifestations and pathological change for AG patients. But its monotherapy for H. pylori eradication is not supported by enough clinical evidence.

Complexes of mismatched and complementary DNA with minor groove binders. Structures at nucleotide resolution via an improved hydroxyl radical cleavage methodology

PubMed Central

Bialonska, Dobroslawa; Song, Kenneth; Bolton, Philip H.

2011-01-01

Tumor cell lines can replicate faster than normal cells and many also have defective DNA repair pathways. This has lead to the investigation of the inhibition of DNA repair proteins as a means of therapeutic intervention. An alternative approach is to hide or mask damaged DNA from the repair systems. We have developed a protocol to investigate the structures of the complexes of damaged DNA with drug like molecules. Nucleotide resolution structural information can be obtained using an improved hydroxyl radical cleavage protocol. The use of a dTn tail increases the length of the smallest fragments of interest and allows efficient co-precipitation of the fragments with poly(A). The use of a fluorescent label, on the 5′ end of the dTn tail, in conjunction with modified cleavage reaction conditions, avoids the lifetime and other problems with 32P labeling. The structures of duplex DNAs containing AC and CC mismatches in the presence and absence of minor groove binders have been investigated as have those of the fully complementary DNA. The results indicate that the structural perturbations of the mismatches are localized, are sequence dependent and that the presence of a mismatch can alter the binding of drug like molecules. PMID:21893212

Evaluation of complementary-alternative medicine (CAM) questionnaire development for Indonesian clinical psychologists: A pilot study.

PubMed

Liem, Andrian; Newcombe, Peter A; Pohlman, Annie

2017-08-01

This study aimed to evaluate questionnaire development to measure the knowledge of Complementary-Alternative Medicine (CAM), attitudes towards CAM, CAM experiences, and CAM educational needs of clinical psychologists in Indonesia. A 26-item questionnaire was developed through an extensive literature search. Data was obtained from provisional psychologists from the Master of Professional Clinical Psychology programs at two established public universities in urban areas of Indonesia. To validate the questionnaire, panel reviews by executive members of the Indonesian Clinical Psychology Association (ICPA), experts in health psychology, and experts in public health and CAM provided their professional judgements. The self-reporting questionnaire consisted of four scales including: knowledge of CAM (6 items), attitudes towards CAM (10 items), CAM experiences (4 items), and CAM educational needs (6 items). All scales, except CAM Experiences, were assessed on a 7-point Likert scale. Sixty provisional psychologists were eligible to complete the questionnaire with a response rate of 73% (N=44). The results showed that the CAM questionnaire was reliable (Cronbach's coefficient alpha range=0.62-0.96; item-total correlation range=0.14-0.92) and demonstrated content validity. Following further psychometric evaluation, the CAM questionnaire may provide the evidence-based information to inform the education and practice of Indonesian clinical psychologists. Copyright © 2017 Elsevier Ltd. All rights reserved.

Imaging Modalities Relevant to Intracranial Pressure Assessment in Astronauts: A Case-Based Discussion

NASA Technical Reports Server (NTRS)

Sargsyan, Ashot E.; Kramer, Larry A.; Hamilton, Douglas R.; Hamilton, Douglas R.; Fogarty, Jennifer; Polk, J. D.

2010-01-01

Introduction: Intracranial pressure (ICP) elevation has been inferred or documented in a number of space crewmembers. Recent advances in noninvasive imaging technology offer new possibilities for ICP assessment. Most International Space Station (ISS) partner agencies have adopted a battery of occupational health monitoring tests including magnetic resonance imaging (MRI) pre- and postflight, and high-resolution sonography of the orbital structures in all mission phases including during flight. We hypothesize that joint consideration of data from the two techniques has the potential to improve quality and continuity of crewmember monitoring and care. Methods: Specially designed MRI and sonographic protocols were used to image eyes and optic nerves (ON) including the meningeal sheaths. Specific crewmembers multi-modality imaging data were analyzed to identify points of mutual validation as well as unique features of complementary nature. Results and Conclusion: Magnetic resonance imaging (MRI) and high-resolution sonography are both tomographic methods, however images obtained by the two modalities are based on different physical phenomena and use different acquisition principles. Consideration of the images acquired by these two modalities allows cross-validating findings related to the volume and fluid content of the ON subarachnoid space, shape of the globe, and other anatomical features of the orbit. Each of the imaging modalities also has unique advantages, making them complementary techniques.

Use of Complementary and Alternative Medicine Among Dermatology Outpatients: Results From a National Survey.

PubMed

AlGhamdi, Khalid M; Khurrum, Huma; Al-Natour, Sahar H; Alghamdi, Waleed; Mubki, Thamer; Alzolibani, Abdulatif; Hafez, Dhafer Mohammed Y; AlDraibi, Mohammed

2015-01-01

Little is known about the prevalence and practice of complementary and alternative medicine (CAM) among dermatology patients in the Arab world. The aim of this study was to determine knowledge and attitudes about CAM, prevalence of its use, reasons for its use, and types of CAM used in dermatology patients in Saudi Arabia. This was a national survey of various regions of Saudi Arabia. In this cross-sectional study, dermatology outpatients were interviewed using a questionnaire. Sociodemographic characteristics, acceptability, utilization pattern, and reasons for CAM use were elicited. Dermatology life quality index (DLQI) was obtained. Overall, 1901 patients returned complete questionnaires out of 2500 distributed (76% response rate). Of these, 808 (40%) were CAM users, and the majority were woman (55.1%), with a mean age of 31.6±12 years. Most were literate (71.2%) and just over half were married (51.9%). Patients with acute skin diseases were found to be more likely to use CAM (P=.027). The mean DLQI score was higher (worse quality of life) among CAM users than among nonusers (P=.002). The results showed that 315 of 801 (40%) and 250 of 601 (30%) CAM users agreed that CAM methods are safer and more effective than modern medicine, respectively, and 83% will continue to use CAM in future. The most commonly used CAM modalities were vitamins, prayers, natural products, and herbs. Responses indicated that 379 of 803 (47.2%) CAM users did not consult their doctor before using CAM, and 219 of 743 (30%) did not obtain sufficient answers regarding CAM use from their dermatologists. There is a significant use of CAM among dermatology outpatients in Saudi Arabia. In view of the common belief that CAM has fewer side effects than conventional medicine, dermatologists need to increase their awareness of CAM. © The Author(s) 2015.

Research methods in complementary and alternative medicine: an integrative review.

PubMed

de Almeida Andrade, Fabiana; Schlechta Portella, Caio Fabio

2018-01-01

The scientific literature presents a modest amount of evidence in the use of complementary and alternative medicine (CAM). On the other hand, in practice, relevant results are common. The debates among CAM practitioners about the quality and execution of scientific research are important. Therefore, the aim of this review is to gather, synthesize and describe the differentiated methodological models that encompass the complexity of therapeutic interventions. The process of bringing evidence-based medicine into clinical practice in CAM is essential for the growth and strengthening of complementary medicines worldwide. Copyright © 2017 Shanghai Changhai Hospital. Published by Elsevier B.V. All rights reserved.

Coupling of carbon and peptide nanotubes.

PubMed

Montenegro, Javier; Vázquez-Vázquez, Carlos; Kalinin, Arseny; Geckeler, Kurt E; Granja, Juan R

2014-02-12

Two of the main types of nanotubular architectures are the single-walled carbon nanotubes (SWCNTs) and the self-assembling cyclic peptide nanotubes (SCPNs). We here report the preparation of the dual composite resulting from the ordered combination of both tubular motifs. In the resulting architecture, the SWCNTs can act as templates for the assembly of SCPNs that engage the carbon nanotubes noncovalently via pyrene "paddles", each member of the resulting hybrid stabilizing the other in aqueous solution. The particular hybrids obtained in the present study formed highly ordered oriented arrays and display complementary properties such as electrical conductivity. Furthermore, a self-sorting of the cyclic peptides toward semiconducting rather than metallic SWCNTs is also observed in the aqueous dispersions. It is envisaged that a broad range of exploitable properties may be achieved and/or controlled by varying the cyclic peptide components of similar SWCNT/SCPN hybrids.

Study on recognition technology of complementary image

NASA Astrophysics Data System (ADS)

Liu, Chengxiang; Hu, Xuejuan; Jian, Yaobo; Zhang, Li

2006-11-01

Complementation image is often used as a guard technology in the trademark and paper currency. The key point of recognizing this kind of images is judging the complementary effect of complementation printing. The perspective images are usually not clear and legible, so it is difficult to recognize them. In this paper, a new method is proposed. Firstly, capture the image by reflex. Secondly, find the same norm to man-made pair printing. Lastly, judge the true and false of paper currency by the complementary effect of complementation printing. This is the purpose of inspecting the false. Theoretic analysis and simulation results reveal that the effect of man-made pair printing is good, the method has advantages such as simplicity, high calculating speed, and good robust to different RMB. The experiment results reveal that the conclusion is reasonable, and demonstrates that this approach is effective.

Evaluation of programs to improve complementary feeding in infants and young children.

PubMed

Frongillo, Edward A

2017-10-01

Evaluation of complementary feeding programs is needed to enhance knowledge on what works, to document responsible use of resources, and for advocacy. Evaluation is done during program conceptualization and design, implementation, and determination of effectiveness. This paper explains the role of evaluation in the advancement of complementary feeding programs, presenting concepts and methods and illustrating them through examples. Planning and investments for evaluations should occur from the beginning of the project life cycle. Essential to evaluation is articulation of a program theory on how change would occur and what program actions are required for change. Analysis of program impact pathways makes explicit the dynamic connections in the program theory and accounts for contextual factors that could influence program effectiveness. Evaluating implementation functioning is done through addressing questions about needs, coverage, provision, and utilization using information obtained from process evaluation, operations research, and monitoring. Evaluating effectiveness is done through assessing impact, efficiency, coverage, process, and causality. Plausibility designs ask whether the program seemed to have an effect above and beyond external influences, often using a nonrandomized control group and baseline and end line measures. Probability designs ask whether there was an effect using a randomized control group. Evaluations may not be able to use randomization, particularly for programs implemented at a large scale. Plausibility designs, innovative designs, or innovative combinations of designs sometimes are best able to provide useful information. Further work is needed to develop practical designs for evaluation of large-scale country programs on complementary feeding. © 2017 John Wiley & Sons Ltd.

Is complementary and alternative medicine effective in job satisfaction among dentists with musculoskeletal disorders? A cross sectional study.

PubMed

Gupta, Devanand; Bhaskar, Dara John; Gupta, Rajendra Kumar; Jain, Ankita; Yadav, Priyanka; Dalai, Deepak Ranjan; Singh, Rajeshwar; Singh, Nisha; Chaudhary, Varunjeet; Singh, Ankit; Yadav, Ankit; Karim, Bushra

2014-01-01

Musculoskeletal disorders have serious impact on the profession of dentistry. There is common occurrence of pain due to incorrect posture in dental professionals. Complementary and alternative medicine (CAM) therapies may cast a new light on preventing and intercepting musculoskeletal disorders (MSD). An epidemiological study was conducted in an effort to contribute to the prevention of musculoskeletal disorders in dentistry. The purpose of this study was to determine the prevalence of MSD at dentists using CAM as a treatment and preventive modality for MSD and to compare job/career satisfaction between dentists who use CAM and conventional therapy (CT). Dentists registered in Uttrakhand state, India, under the Dental Council of India and registered members of the Indian Dental Association, Uttrakhand branch (N = 1496) were surveyed. Statistical analysis was conducted using SPSS 17. A response rate of 84% (N = 1257) was obtained, revealing that 90% (N = 1131) had the problem of MSD. Seventy three percentage (N = 826) of dentists with MSD reported the use of CAM and CT. Complementary and alternative medicine users reported greater overall health (72.7% vs. 51%, p < 0.001), job satisfaction (61.2% vs. 35%, p < 0.001) and work efficiency compared to CT users. Complementary and alternative medicine therapies may improve quality of life, reduce work interruption and enhance job satisfaction for dentists who suffers from MSD. Through the course of their studies, dentists should be equipped with knowledge on ergonomics and CAM therapies, such as yoga and others, to help them prevent musculoskeletal disorders more effectively.

Analysis of Flatness Deviations for Austenitic Stainless Steel Workpieces after Efficient Surface Machining

NASA Astrophysics Data System (ADS)

Nadolny, K.; Kapłonek, W.

2014-08-01

The following work is an analysis of flatness deviations of a workpiece made of X2CrNiMo17-12-2 austenitic stainless steel. The workpiece surface was shaped using efficient machining techniques (milling, grinding, and smoothing). After the machining was completed, all surfaces underwent stylus measurements in order to obtain surface flatness and roughness parameters. For this purpose the stylus profilometer Hommel-Tester T8000 by Hommelwerke with HommelMap software was used. The research results are presented in the form of 2D surface maps, 3D surface topographies with extracted single profiles, Abbott-Firestone curves, and graphical studies of the Sk parameters. The results of these experimental tests proved the possibility of a correlation between flatness and roughness parameters, as well as enabled an analysis of changes in these parameters from shaping and rough grinding to finished machining. The main novelty of this paper is comprehensive analysis of measurement results obtained during a three-step machining process of austenitic stainless steel. Simultaneous analysis of individual machining steps (milling, grinding, and smoothing) enabled a complementary assessment of the process of shaping the workpiece surface macro- and micro-geometry, giving special consideration to minimize the flatness deviations

A study on mastectomy samples to evaluate breast imaging quality and potential clinical relevance of differential phase contrast mammography.

PubMed

Hauser, Nik; Wang, Zhentian; Kubik-Huch, Rahel A; Trippel, Mafalda; Singer, Gad; Hohl, Michael K; Roessl, Ewald; Köhler, Thomas; van Stevendaal, Udo; Wieberneit, Nataly; Stampanoni, Marco

2014-03-01

Differential phase contrast and scattering-based x-ray mammography has the potential to provide additional and complementary clinically relevant information compared with absorption-based mammography. The purpose of our study was to provide a first statistical evaluation of the imaging capabilities of the new technique compared with digital absorption mammography. We investigated non-fixed mastectomy samples of 33 patients with invasive breast cancer, using grating-based differential phase contrast mammography (mammoDPC) with a conventional, low-brilliance x-ray tube. We simultaneously recorded absorption, differential phase contrast, and small-angle scattering signals that were combined into novel high-frequency-enhanced images with a dedicated image fusion algorithm. Six international, expert breast radiologists evaluated clinical digital and experimental mammograms in a 2-part blinded, prospective independent reader study. The results were statistically analyzed in terms of image quality and clinical relevance. The results of the comparison of mammoDPC with clinical digital mammography revealed the general quality of the images to be significantly superior (P < 0.001); sharpness, lesion delineation, as well as the general visibility of calcifications to be significantly more assessable (P < 0.001); and delineation of anatomic components of the specimens (surface structures) to be significantly sharper (P < 0.001). Spiculations were significantly better identified, and the overall clinically relevant information provided by mammoDPC was judged to be superior (P < 0.001). Our results demonstrate that complementary information provided by phase and scattering enhanced mammograms obtained with the mammoDPC approach deliver images of generally superior quality. This technique has the potential to improve radiological breast diagnostics.

PF2fit: Polar Fast Fourier Matched Alignment of Atomistic Structures with 3D Electron Microscopy Maps.

PubMed

Bettadapura, Radhakrishna; Rasheed, Muhibur; Vollrath, Antje; Bajaj, Chandrajit

2015-10-01

There continue to be increasing occurrences of both atomistic structure models in the PDB (possibly reconstructed from X-ray diffraction or NMR data), and 3D reconstructed cryo-electron microscopy (3D EM) maps (albeit at coarser resolution) of the same or homologous molecule or molecular assembly, deposited in the EMDB. To obtain the best possible structural model of the molecule at the best achievable resolution, and without any missing gaps, one typically aligns (match and fits) the atomistic structure model with the 3D EM map. We discuss a new algorithm and generalized framework, named PF(2) fit (Polar Fast Fourier Fitting) for the best possible structural alignment of atomistic structures with 3D EM. While PF(2) fit enables only a rigid, six dimensional (6D) alignment method, it augments prior work on 6D X-ray structure and 3D EM alignment in multiple ways: Scoring. PF(2) fit includes a new scoring scheme that, in addition to rewarding overlaps between the volumes occupied by the atomistic structure and 3D EM map, rewards overlaps between the volumes complementary to them. We quantitatively demonstrate how this new complementary scoring scheme improves upon existing approaches. PF(2) fit also includes two scoring functions, the non-uniform exterior penalty and the skeleton-secondary structure score, and implements the scattering potential score as an alternative to traditional Gaussian blurring. Search. PF(2) fit utilizes a fast polar Fourier search scheme, whose main advantage is the ability to search over uniformly and adaptively sampled subsets of the space of rigid-body motions. PF(2) fit also implements a new reranking search and scoring methodology that considerably improves alignment metrics in results obtained from the initial search.

Electrosynthesis and characterization of nanostructured polyquinone for use in detection and quantification of naturally occurring dsDNA.

PubMed

Hernández, Loreto A; Del Valle, María A; Armijo, Francisco

2016-05-15

The detection of naturally occurring desoxyribonucleic acid (DNA) has become a subject of study by the projections that would generate to be able to sense the genetic material for the detection of future diseases. Bearing this in mind, to provide new measuring strategies, in the current work the preparation of a low-cost electrode, modified with poly(1-amino-9,10-anthraquinone) nanowires using a SiO2 template, is carried out; the assembly is next modified by covalently attaching ssDNA strands. It must be noted that all this is accomplished by using solely electrochemical techniques, according to methodology developed for this purpose. SEM images of the modified surface show high order and homogeneity in the distribution of modified nanowires over the electrode surface. In turn, after the hybridization with its complementary strand, the voltammetric responses enable corroborating the linear relationship between hybridization at different DNA concentrations and normalized current response, obtaining a limit of detection (LOD) 5.7·10(-12)gL(-1) and limit of quantification (LOQ) 1.9·10(-11)gL(-1). The working dynamic range is between 1.4·10(-7) and 8.5·10(-9)gL(-1) with a correlation coefficient 0.9998. The successful obtaining of the modified electrode allows concluding that the high order reached by the nanostructures, guides the subsequent single strand of DNA (ssDNA) covalent attachment, which after hybridization with its complementary strand brings about a considerable current increase. This result allows foreseeing a guaranteed breakthrough with regard to the use of the biosensor in real samples. Copyright © 2015 Elsevier B.V. All rights reserved.

Solution-processed organic thermoelectric materials exhibiting doping-concentration-dependent polarity.

PubMed

Hwang, Sunbin; Potscavage, William J; Yang, Yu Seok; Park, In Seob; Matsushima, Toshinori; Adachi, Chihaya

2016-10-26

Recent progress in conducting polymer-based organic thermoelectric generators (OTEGs) has resulted in high performance due to high Seebeck coefficient, high electrical conductivity (σ), and low thermal conductivity obtained by chemically controlling the materials's redox levels. In addition to improving the properties of individual OTEGs to obtain high performance, the development of solution processes for the fabrication of OTEG modules is necessary to realize large thermoelectric voltage and low-cost mass production. However, the scarcity of good candidates for soluble organic n-type materials limits the use of π-leg module structures consisting of complementary elements of p- and n-type materials because of unbalanced transport coefficients that lead to power losses. In particular, the extremely low σ of n-type materials compared with that of p-type materials is a serious challenge. In this study, poly(pyridinium phenylene) (P(PymPh)) was tested as an n-type semiconductor in solution-processed OTEGs, and the carrier density was controlled by a solution-based chemical doping process using the dopant sodium naphthalenide, a well-known reductant. The electronic structures and doping mechanism of P(PymPh) were explored based on the changes in UV-Vis-IR absorption, ultraviolet photoelectron, and X-ray photoelectron spectra. By controlling the dopant concentration, we demonstrate a maximum n-type power factor of 0.81 μW m -1 K -2 with high σ, and at higher doping concentrations, a switch from n-type to p-type TE operation. This is one of the first cases of a switch in polarity just by increasing the concentration of the reductant and may open a new route for simplified fabrication of complementary organic layers.

PF2 fit: Polar Fast Fourier Matched Alignment of Atomistic Structures with 3D Electron Microscopy Maps

PubMed Central

Bettadapura, Radhakrishna; Rasheed, Muhibur; Vollrath, Antje; Bajaj, Chandrajit

2015-01-01

There continue to be increasing occurrences of both atomistic structure models in the PDB (possibly reconstructed from X-ray diffraction or NMR data), and 3D reconstructed cryo-electron microscopy (3D EM) maps (albeit at coarser resolution) of the same or homologous molecule or molecular assembly, deposited in the EMDB. To obtain the best possible structural model of the molecule at the best achievable resolution, and without any missing gaps, one typically aligns (match and fits) the atomistic structure model with the 3D EM map. We discuss a new algorithm and generalized framework, named PF2 fit (Polar Fast Fourier Fitting) for the best possible structural alignment of atomistic structures with 3D EM. While PF2 fit enables only a rigid, six dimensional (6D) alignment method, it augments prior work on 6D X-ray structure and 3D EM alignment in multiple ways: Scoring. PF2 fit includes a new scoring scheme that, in addition to rewarding overlaps between the volumes occupied by the atomistic structure and 3D EM map, rewards overlaps between the volumes complementary to them. We quantitatively demonstrate how this new complementary scoring scheme improves upon existing approaches. PF2 fit also includes two scoring functions, the non-uniform exterior penalty and the skeleton-secondary structure score, and implements the scattering potential score as an alternative to traditional Gaussian blurring. Search. PF2 fit utilizes a fast polar Fourier search scheme, whose main advantage is the ability to search over uniformly and adaptively sampled subsets of the space of rigid-body motions. PF2 fit also implements a new reranking search and scoring methodology that considerably improves alignment metrics in results obtained from the initial search. PMID:26469938

Image denoising by a direct variational minimization

NASA Astrophysics Data System (ADS)

Janev, Marko; Atanacković, Teodor; Pilipović, Stevan; Obradović, Radovan

2011-12-01

In this article we introduce a novel method for the image de-noising which combines a mathematically well-posdenes of the variational modeling with the efficiency of a patch-based approach in the field of image processing. It based on a direct minimization of an energy functional containing a minimal surface regularizer that uses fractional gradient. The minimization is obtained on every predefined patch of the image, independently. By doing so, we avoid the use of an artificial time PDE model with its inherent problems of finding optimal stopping time, as well as the optimal time step. Moreover, we control the level of image smoothing on each patch (and thus on the whole image) by adapting the Lagrange multiplier using the information on the level of discontinuities on a particular patch, which we obtain by pre-processing. In order to reduce the average number of vectors in the approximation generator and still to obtain the minimal degradation, we combine a Ritz variational method for the actual minimization on a patch, and a complementary fractional variational principle. Thus, the proposed method becomes computationally feasible and applicable for practical purposes. We confirm our claims with experimental results, by comparing the proposed method with a couple of PDE-based methods, where we get significantly better denoising results specially on the oscillatory regions.

Knowledge, Attitude and Practice of General Practitioners toward Complementary and Alternative Medicine: a Cross-Sectional Study.

PubMed

Barikani, Ameneh; Beheshti, Akram; Javadi, Maryam; Yasi, Marzieh

2015-08-01

Orientation of public and physicians to the complementary and alternative medicine (CAM) is one of the most prominent symbols of structural changes in the health service system. The aim of his study was a determination of knowledge, attitude, and practice of general practitioners in complementary and alternative medicine. This cross- sectional study was conducted in Qazvin, Iran in 2013. A self-administered questionnaire was used for collecting data including four information parts: population information, physicians' attitude and knowledge, methods of getting information and their function. A total of 228 physicians in Qazvin comprised the population of study according to the deputy of treatment's report of Qazvin University of Medical Sciences. A total of 150 physicians were selected randomly, and SPSS Statistical program was used to enter questionnaires' data. Results were analyzed as descriptive statistics and statistical analysis. Sixty percent of all responders were male. About sixty (59.4) percent of participating practitioners had worked less than 10 years.96.4 percent had a positive attitude towards complementary and alternative medicine. Knowledge of practitioners about traditional medicine in 11 percent was good, 36.3% and 52.7% had average and little information, respectively. 17.9% of practitioners offered their patients complementary and alternative medicine for treatment. Although there was little knowledge among practitioners about traditional medicine and complementary approaches, a significant percentage of them had attitude higher than the lower limit.

Complementary π-π interactions induce multicomponent coassembly into functional fibrils.

PubMed

Ryan, Derek M; Doran, Todd M; Nilsson, Bradley L

2011-09-06

Noncovalent self-assembled materials inspired by amyloid architectures are useful for biomedical applications ranging from regenerative medicine to drug delivery. The selective coassembly of complementary monomeric units to provide ordered multicomponent fibrils is a possible strategy for enhancing the sophistication of these noncovalent materials. Herein we report that complementary π-π interactions can be exploited to promote the coassembly of phenylalanine (Phe) derivatives that possess complementary aromatic side-chain functionality. Specifically, equimolar mixtures of Fmoc-Phe and Fmoc-F(5)-Phe, which possess side-chain groups with complementary quadrupole electronics, readily coassemble to form two-component fibrils and hydrogels under conditions where Fmoc-Phe alone fails to self-assemble. In addition, it was found that equimolar mixtures of Fmoc-Phe with monohalogenated (F, Cl, and Br) Fmoc-Phe derivatives also coassembled into two-component fibrils. These results collectively indicate that face-to-face quadrupole stacking between benzyl side-chain groups does not account for the molecular recognition between Phe and halogenated Phe derivatives that promote cofibrillization but that coassembly is mediated by more subtle π-π effects arising from the halogenation of the benzyl side chain. The use of complementary π-π interactions to promote the coassembly of two distinct monomeric units into ordered two-component fibrils dramatically expands the repertoire of noncovalent interactions that can be used in the development of sophisticated noncovalent materials. © 2011 American Chemical Society

Numerical modeling of the thermoelectric cooler with a complementary equation for heat circulation in air gaps

NASA Astrophysics Data System (ADS)

Fang, En; Wu, Xiaojie; Yu, Yuesen; Xiu, Junrui

2017-03-01

In this paper, a numerical model is developed by combining thermodynamics with heat transfer theory. Taking inner and external multi-irreversibility into account, it is with a complementary equation for heat circulation in air gaps of a steady cooling system with commercial thermoelectric modules operating in refrigeration mode. With two modes concerned, the equation presents the heat flowing through air gaps which forms heat circulations between both sides of thermoelectric coolers (TECs). In numerical modelling, a TEC is separated as two temperature controlled constant heat flux reservoirs in a thermal resistance network. In order to obtain the parameter values, an experimental apparatus with a commercial thermoelectric cooler was built to characterize the performance of a TEC with heat source and sink assembly. At constant power dissipation, steady temperatures of heat source and both sides of the thermoelectric cooler were compared with those in a standard numerical model. The method displayed that the relationship between Φf and the ratio Φ_{c}'/Φ_{c} was linear as expected. Then, for verifying the accuracy of proposed numerical model, the data in another system were recorded. It is evident that the experimental results are in good agreement with simulation(proposed model) data at different heat transfer rates. The error is small and mainly results from the instabilities of thermal resistances with temperature change and heat flux, heat loss of the device vertical surfaces and measurements.

Terahertz Metasurfaces Optimized for Biomolecular Detection

NASA Astrophysics Data System (ADS)

Naranjo, Guillermo A.

In the last decade, there has been an increase in the use of metasurfaces to detect biological compounds at terahertz frequencies. This increased interest has been fueled by the fact that various biomolecules have rotational and vibrational modes at THz frequencies. The metasurface's resonant units can be considered as inductive-capacitive circuits therefore the detection mechanism is the change in dielectric constant in the capacitive region due to the presence of an analyte. In this project we utilized a facing split ring resonator design with three different tip geometries defining the capacitive region; square, triangular and round tips. We also utilized complementary facing split ring resonators, which present a larger capacitive region that their positive counterparts, with the same three tip geometries. In addition, we added micro wells in the capacitive region of the resonators where they serve to infiltrate the analyte into the substrate and increases their interaction with the electric field. The samples were then fabricated using photolithography, electron beam lithography and reactive ion etching to define the micro wells. They were characterized by obtaining the terahertz transmission spectra using terahertz time domain spectroscopy with and without an overlayer of Ara-h-2 or Ara-h-6. Results show that the metasurfaces can detect the presence of the allergens, and present a different response for Ara-h-2 than for Ara-h-6. The results indicate that utilizing complementary metasurfaces and/ or the addition of micro wells in the capacitive region are promising avenues to develop a sensitive terahertz metasurface based biosensor.

Comparing results of X-ray diffraction, µ-Raman spectroscopy and neutron diffraction when identifying chemical phases in seized nuclear material, during a comparative nuclear forensics exercise

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rondahl, Stina Holmgren; Pointurier, Fabien; Ahlinder, Linnea

This work presents the results for identification of chemical phases obtained by several laboratories as a part of an international nuclear forensic round-robin exercise. In this work powder X-ray diffraction (p-XRD) is regarded as the reference technique. Neutron diffraction produced a superior high-angle diffraction pattern relative to p-XRD. Requiring only small amounts of sample, µ-Raman spectroscopy was used for the first time in this context as a potentially complementary technique to p-XRD. The chemical phases were identified as pure UO 2 in two materials, and as a mixture of UO 2, U 3O 8 and an intermediate species U 3Omore » 7 in the third material.« less

Comparing results of X-ray diffraction, µ-Raman spectroscopy and neutron diffraction when identifying chemical phases in seized nuclear material, during a comparative nuclear forensics exercise

DOE PAGES

Rondahl, Stina Holmgren; Pointurier, Fabien; Ahlinder, Linnea; ...

2018-01-24

This work presents the results for identification of chemical phases obtained by several laboratories as a part of an international nuclear forensic round-robin exercise. In this work powder X-ray diffraction (p-XRD) is regarded as the reference technique. Neutron diffraction produced a superior high-angle diffraction pattern relative to p-XRD. Requiring only small amounts of sample, µ-Raman spectroscopy was used for the first time in this context as a potentially complementary technique to p-XRD. The chemical phases were identified as pure UO 2 in two materials, and as a mixture of UO 2, U 3O 8 and an intermediate species U 3Omore » 7 in the third material.« less

Application of LANDSAT data to delimitation of avalanche hazards in Montane, Colorado

NASA Technical Reports Server (NTRS)

Knepper, D. H. (Principal Investigator); Summer, R.

1976-01-01

The author has identified the following significant results. With rare exceptions, avalanche areas cannot be identified on LANDSAT imagery. Avalanche hazard mapping on a regional scale is best conducted using LANDSAT imagery in conjunction with complementary data sources. Level of detail of such maps will be limited by the amount and completeness of the complementary information used.

Static and transport properties of alkyltrimethylammonium cation-based room-temperature ionic liquids.

PubMed

Seki, Shiro; Tsuzuki, Seiji; Hayamizu, Kikuko; Serizawa, Nobuyuki; Ono, Shimpei; Takei, Katsuhito; Doi, Hiroyuki; Umebayashi, Yasuhiro

2014-05-01

We have measured physicochemical properties of five alkyltrimethylammonium cation-based room-temperature ionic liquids and compared them with those obtained from computational methods. We have found that static properties (density and refractive index) and transport properties (ionic conductivity, self-diffusion coefficient, and viscosity) of these ionic liquids show close relations with the length of the alkyl chain. In particular, static properties obtained by experimental methods exhibit a trend complementary to that by computational methods (refractive index ∝ [polarizability/molar volume]). Moreover, the self-diffusion coefficient obtained by molecular dynamics (MD) simulation was consistent with the data obtained by the pulsed-gradient spin-echo nuclear magnetic resonance technique, which suggests that computational methods can be supplemental tools to predict physicochemical properties of room-temperature ionic liquids.

The effect of traffic lights and regulatory statements on the choice between complementary and conventional medicines in Australia: results from a discrete choice experiment.

PubMed

Spinks, Jean; Mortimer, Duncan

2015-01-01

It has been suggested that complementary medicines are currently 'under-regulated' in some countries due to their potential for harm as a direct result from side-effects or interactions; from delaying more effective care; or from the economic cost of purchasing an ineffective or inappropriate treatment. The requirement of additional labelling on complementary medicine products has been suggested in Australia and may provide additional information to consumers at the point of purchase. This paper details a unique way of testing the potential effects on consumer behaviour of including either a traffic light logo or regulatory statement on labels. Using a discrete choice experiment, data were collected in 2012 in a sample of 521 Australians with either type 2 diabetes or cardiovascular disease. We find that additional labelling can affect consumer behaviour, but in unpredictable ways. The results of this experiment are informative to further the dialogue concerning possible regulatory mechanisms. Copyright © 2014 Elsevier Ltd. All rights reserved.

Uniform and Complementary Social Interaction: Distinct Pathways to Solidarity

PubMed Central

Koudenburg, Namkje; Postmes, Tom; Gordijn, Ernestine H.; van Mourik Broekman, Aafke

2015-01-01

We examine how different forms of co-action give rise to feelings of solidarity. We propose that (a) coordinated action elicits a sense of solidarity, and (b) the process through which such solidarity emerges differs for different forms of co-action. We suggest that whether solidarity within groups emerges from uniform action (e.g. synchronizing, as when people speak in unison) or from more complementary forms of action (e.g. alternating, when speaking in turns) has important consequences for the emergent position of individuals within the group. Uniform action relies on commonality, leaving little scope for individuality. In complementary action each individual makes a distinctive contribution to the group, thereby increasing a sense of personal value to the group, which should contribute to the emergence of solidarity. The predictions receive support from five studies, in which we study groups in laboratory and field settings. Results show that both complementary and uniform co-action increase a sense of solidarity compared to control conditions. However, in the complementary action condition, but not in the uniform action (or synchrony) condition, the effect on feelings of solidarity is mediated by a sense of personal value to the group. PMID:26047131

Complementary health insurance in France. Who pays? Why? Who will suffer from public disengagement?

PubMed

Saliba, Bérengère; Ventelou, Bruno

2007-05-01

The study is based on a rare database with information about health status, socioeconomic characteristics and the complementary health insurance choices of the French population. We intend to characterise a two-stage decision process: first, the decision to purchase complementary health insurance, and then the factors related to choice of policy quality. Our econometric study indicates that (i) income level has a strong and significant effect on the decision to purchase complementary insurance, whilst there is no evidence that health risk considerations affect this decision at all; (ii) the individual decision about quality is associated barely if at all with any rational explanatory variables. The population's concrete behaviour, revealed by the study, is consistent with an allocation of low-risk people to private insurance and high-risk people to public insurance. Complementary insurance is not especially relevant to patients with serious diseases, who depend much more on the public system. If the public insurance system were to disengage significantly from coverage of serious illness, a vacuum would be created that would leave people at high risk without full coverage. These results have broad implications for numerous national systems of social protection seeking a new mix between private and public insurance.

Uniform and Complementary Social Interaction: Distinct Pathways to Solidarity.

PubMed

Koudenburg, Namkje; Postmes, Tom; Gordijn, Ernestine H; van Mourik Broekman, Aafke

2015-01-01

We examine how different forms of co-action give rise to feelings of solidarity. We propose that (a) coordinated action elicits a sense of solidarity, and (b) the process through which such solidarity emerges differs for different forms of co-action. We suggest that whether solidarity within groups emerges from uniform action (e.g. synchronizing, as when people speak in unison) or from more complementary forms of action (e.g. alternating, when speaking in turns) has important consequences for the emergent position of individuals within the group. Uniform action relies on commonality, leaving little scope for individuality. In complementary action each individual makes a distinctive contribution to the group, thereby increasing a sense of personal value to the group, which should contribute to the emergence of solidarity. The predictions receive support from five studies, in which we study groups in laboratory and field settings. Results show that both complementary and uniform co-action increase a sense of solidarity compared to control conditions. However, in the complementary action condition, but not in the uniform action (or synchrony) condition, the effect on feelings of solidarity is mediated by a sense of personal value to the group.

Interseismic coupling and geometry of the Main Himalayan Thrust: A complementary approach

NASA Astrophysics Data System (ADS)

Dal Zilio, L.; Jolivet, R.; van Dinther, Y.

2017-12-01

Estimating the extent of interseismic coupling along megathrusts is essential for quantitative assessments of seismic hazard. However, interseismic deformation is commonly modeled assuming a planar fault in a purely elastic and infinitely long half-space. These assumptions can thus strongly impact inferences of seismogenic coupling. To address this issue, we apply a complementary approach that combines inversion of geodetic data and a newly developed 2D, visco-elasto-plastic seismo-thermo-mechanical (STM) model. By employing a combination of geological and geophysical constraints, we design a high resolution model setup of the present-day Nepal Himalaya and geometry of the Main Himalayan Thrust (MHT) fault. We next invert the resulting synthetic geodetic data for the along-dip pattern of coupling on the MHT. Afterwards, we employ a back-slip model to predict and compare the interseismic strain obtained from the model. Using a Bayesian approach, we finally analyze the 3D pattern of interseismic coupling on the MHT based on a compilation of geodetic data. This allows us to infer the probability of significant fault locking patches as well as of the creeping sections. By considering different geometries of the MHT as end-member cases, our results establish the dependence of interseismic coupling and surface displacement on geometry, temperature and rheology of the MHT. Depending on the position and dip-angle of the well-know mid-crustal ramp, the location and amplitude of interseismic shortening and uplift change according to the back-slip model prediction. These results thus emphasize the necessity of rigorous models that correctly account for complex fault geometries as well as for realistic rheologies in the slip processes. We will discuss how these results can be used to estimate heterogeneity of geodetic coupling, the mechanics governing the observed behavior and the implications for potential large ruptures.

Application of EMA-qPCR as a complementary tool for the detection and monitoring of Legionella in different water systems.

PubMed

Qin, Tian; Tian, Zhengan; Ren, Hongyu; Hu, Guangchun; Zhou, Haijian; Lu, Jinxing; Luo, Chengwang; Liu, Zunyu; Shao, Zhujun

2012-05-01

Legionella are prevalent in human-made water systems and cause legionellosis in humans. Conventional culturing and polymerase chain reaction (PCR) techniques are not sufficiently accurate for the quantitative analysis of live Legionella bacteria in water samples because of the presence of viable but nonculturable cells and dead cells. Here, we report a rapid detection method for viable Legionella that combines ethidium monoazide (EMA) with quantitative real-time PCR (qPCR) and apply this method to detect Legionella in a large number of water samples from different sources. Results yielded that samples treated with 5 μg/ml EMA for 10 min and subsequently exposed to light irradiation for 5 min were optimal for detecting Legionella. EMA treatment before qPCR could block the signal from approximately 4 log(10) of dead cells. When investigating environmental water samples, the percent-positive rate obtained by EMA-qPCR was significantly higher than conventional PCR and culture methods, and slightly lower than qPCR. The bacterial count of Legionella determined by EMA-qPCR were mostly greater than those determined by culture assays and lower than those determined by qPCR. Acceptable correlations were found between the EMA-qPCR and qPCR results for cooling towers, piped water and hot spring water samples (r = 0.849, P < 0.001) and also found between the EMA-qPCR and culture results for hot spring water samples (r = 0.698, P < 0.001). The results indicate that EMA-qPCR could be used as a complementary tool for the detection and monitoring of Legionella in water systems, especially in hot spring water samples.

Magnus expansion method for two-level atom interacting with few-cycle pulse

NASA Astrophysics Data System (ADS)

Begzjav, T.; Ben-Benjamin, J. S.; Eleuch, H.; Nessler, R.; Rostovtsev, Y.; Shchedrin, G.

2018-06-01

Using the Magnus expansion to the fourth order, we obtain analytic expressions for the atomic state of a two-level system driven by a laser pulse of arbitrary shape with small pulse area. We also determine the limitation of our obtained formulas due to limited range of convergence of the Magnus series. We compare our method to the recently developed method of Rostovtsev et al. (PRA 2009, 79, 063833) for several detunings. Our analysis shows that our technique based on the Magnus expansion can be used as a complementary method to the one in PRA 2009.

Timely initiation of complementary feeding and associated factors among children aged 6 to 12 months in Northern Ethiopia: an institution-based cross-sectional study

PubMed Central

2013-01-01

Background Exclusive breastfeeding (EBF) for the first six months of life is critical for the wellbeing of the child. In the mean while, timely initiation and starting nutritionally-adequate, safe, age-appropriate complementary feeding at six months is recommended for the better health and development of infants. According to the Ethiopian Demographic and Health Survey 2011, timely initiation of complementary feeding in Ethiopia at the 6th month was only 51%. The purpose of this study is to determine the magnitude of timely initiation of complementary feeding and associated factors in Mekelle town, Northern Ethiopia. Methods An institutional based cross-sectional study design was conducted among 422 mothers of infants aged from six months to one year selected from six public health facilities. Sample size proportional to the patient flow rate of each institution was allocated and systematic random sampling method was used to get the study participant. An exit interview using structured questionnaire was conducted about their experience on complementary feeding and related experience. The questionnaire was pretested among 21 mothers. Data were entered with EPI info version 3.5.1 and cleaning and analysis was done by using SPSS version 16. Frequencies distribution, binary and multiple logistic regressions were done. OR and 95% confidence interval was computed. Result The prevalence of timely initiation of complementary feeding at sixth month was 62.8% (265/422, 95% C.I: 58.1, 67.31%). Educational level, occupation of mother, parity, having ANC follow up, and birth preparedness were found to be independent predictor of timely initiation of complementary feeding. Conclusions Almost two-third of mothers initiated complementary feeding at six month of child’ age as recommended. This was relatively higher prevalence than most developing countries. However, significant proportion of mothers still did not initiate complementary feeding timely. Mothers who are illiterate and completed only primary school need more attention. All mothers must be encouraged to make antenatal care follow up. PMID:24195592

A 0.1-1.4 GHz inductorless low-noise amplifier with 13 dBm IIP3 and 24 dBm IIP2 in 180 nm CMOS

NASA Astrophysics Data System (ADS)

Guo, Benqing; Chen, Jun; Chen, Hongpeng; Wang, Xuebing

2018-01-01

An inductorless noise-canceling CMOS low-noise amplifier (LNA) with wideband linearization technique is proposed. The complementary configuration by stacked NMOS/PMOS is employed to compensate second-order nonlinearity of the circuit. The third-order distortion of the auxiliary stage is also mitigated by that of the weak inversion transistors in the main path. The bias and scaling size combined by digital control words are further tuned to obtain enhanced linearity over the desired band. Implemented in a 0.18 μm CMOS process, simulated results show that the proposed LNA provides a voltage gain of 16.1 dB and a NF of 2.8-3.4 dB from 0.1 GHz to 1.4 GHz. The IIP3 and IIP2 of 13-18.9 and 24-40 dBm are obtained, respectively. The circuit core consumes 19 mW from a 1.8 V supply.

Monitoring of hardening and hygroscopic induced strains in a calcium phosphate bone cement using FBG sensor.

PubMed

Bimis, A; Karalekas, D; Bouropoulos, N; Mouzakis, D; Zaoutsos, S

2016-07-01

This study initially deals with the investigation of the induced strains during hardening stage of a self-setting calcium phosphate bone cement using fiber-Bragg grating (FBG) optical sensors. A complementary Scanning Electron Microscopy (SEM) investigation was also conducted at different time intervals of the hardening period and its findings were related to the FBG recordings. From the obtained results, it is demonstrated that the FBG response is affected by the microstructural changes taking place when the bone cement is immersed into the hardening liquid media. Subsequently, the FBG sensor was used to monitor the absorption process and hygroscopic response of the hardened and dried biocement when exposed to a liquid/humid environment. From the FBG-based calculated hygric strains as a function of moisture concentration, the coefficient of moisture expansion (CME) of the examined bone cement was obtained, exhibiting two distinct linear regions. Copyright © 2016 Elsevier Ltd. All rights reserved.

Manufacture of radio frequency micromachined switches with annealing.

PubMed

Lin, Cheng-Yang; Dai, Ching-Liang

2014-01-17

The fabrication and characterization of a radio frequency (RF) micromachined switch with annealing were presented. The structure of the RF switch consists of a membrane, coplanar waveguide (CPW) lines, and eight springs. The RF switch is manufactured using the complementary metal oxide semiconductor (CMOS) process. The switch requires a post-process to release the membrane and springs. The post-process uses a wet etching to remove the sacrificial silicon dioxide layer, and to obtain the suspended structures of the switch. In order to improve the residual stress of the switch, an annealing process is applied to the switch, and the membrane obtains an excellent flatness. The finite element method (FEM) software CoventorWare is utilized to simulate the stress and displacement of the RF switch. Experimental results show that the RF switch has an insertion loss of 0.9 dB at 35 GHz and an isolation of 21 dB at 39 GHz. The actuation voltage of the switch is 14 V.

Manufacture of Radio Frequency Micromachined Switches with Annealing

PubMed Central

Lin, Cheng-Yang; Dai, Ching-Liang

2014-01-01

The fabrication and characterization of a radio frequency (RF) micromachined switch with annealing were presented. The structure of the RF switch consists of a membrane, coplanar waveguide (CPW) lines, and eight springs. The RF switch is manufactured using the complementary metal oxide semiconductor (CMOS) process. The switch requires a post-process to release the membrane and springs. The post-process uses a wet etching to remove the sacrificial silicon dioxide layer, and to obtain the suspended structures of the switch. In order to improve the residual stress of the switch, an annealing process is applied to the switch, and the membrane obtains an excellent flatness. The finite element method (FEM) software CoventorWare is utilized to simulate the stress and displacement of the RF switch. Experimental results show that the RF switch has an insertion loss of 0.9 dB at 35 GHz and an isolation of 21 dB at 39 GHz. The actuation voltage of the switch is 14 V. PMID:24445415

[Isolation of Pseudomonas stutzeri from an odontogenic inflammatory cyst: Diagnostic relevance].

PubMed

Molgatini, Susana; Rey, Eduardo; Basilaki, Jorge; Mosca, Christian; Galante, Rafael; Gliosca, Laura

Pseudomonas stutzeri is distributed widely in the environment, and occupies different ecological niches. However, it is found in clinically relevant infections as an opportunistic pathogen. Isolation of P. stutzeri from an odontogenic inflammatory cyst is an uncommon microbiological finding that has not been reported to date. In the case presented here, the bacterium was isolated from surgical material obtained from excision of an inflammatory odontogenic cyst located in the tooth 1.2, and presenting with concomitant pulp necrosis. Complementary techniques such as radiographs, CAT scans, and histopathological and microbiological studies were used to establish definitive diagnosis. The obtained results allowed classifying the process as an inflammatory cyst infected by P. stutzeri. Biotyping and characterization of the susceptibility profile of the isolated strain allowed adjusting the antibiotic therapy more specifically. The microbiological studies allowed establishing the etiology of the infectious process, adjusting the treatment plan, and re-establishing tissue integrity. Copyright © 2016 Asociación Argentina de Microbiología. All rights reserved.

Coffee aroma: Chemometric comparison of the chemical information provided by three different samplings combined with GC-MS to describe the sensory properties in cup.

PubMed

Bressanello, Davide; Liberto, Erica; Cordero, Chiara; Rubiolo, Patrizia; Pellegrino, Gloria; Ruosi, Manuela R; Bicchi, Carlo

2017-01-01

This study is part of a wider project aiming to correlate the chemical composition of the coffee volatile fraction to its sensory properties with the end-goal of developing an instrumental analysis approach complementary to human sensory profiling. The proposed investigation strategy compares the chemical information concerning coffee aroma and flavor obtained with HS-SPME of the ground coffee and in-solution SBSE/SPME sampling combined with GC-MS to evaluate their compatibility with the cupping evaluation for quality control purposes. Roasted coffee samples with specific sensory properties were analyzed. The chemical results obtained by the three samplings were compared through multivariate analysis, and related to the samples' sensory attributes. Despite the differences between the three sampling approaches, data processing showed that the three methods provide the same kind of chemical information useful for sample discrimination, and that they could be used interchangeably to sample the coffee aroma and flavor. Copyright © 2016 Elsevier Ltd. All rights reserved.

Generalized soldering of {+-}2 helicity states in D=2+1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dalmazi, D.; Mendonca, Elias L.

2009-07-15

The direct sum of a couple of Maxwell-Chern-Simons gauge theories of opposite helicities {+-}1 does not lead to a Proca theory in D=2+1, although both theories share the same spectrum. However, it is known that by adding an interference term between both helicities we can join the complementary pieces together and obtain the physically expected result. A generalized soldering procedure can be defined to generate the missing interference term. Here, we show that the same procedure can be applied to join together {+-}2 helicity states in a full off-shell manner. In particular, by using second-order (in derivatives) self-dual models ofmore » helicities {+-}2 (spin-2 analogues of Maxwell-Chern-Simmons models) the Fierz-Pauli theory is obtained after soldering. Remarkably, if we replace the second-order models by third-order self-dual models (linearized topologically massive gravity) of opposite helicities, after soldering, we end up exactly with the new massive gravity theory of Bergshoeff, Hohm, and Townsend in its linearized approximation.« less

Evaluation of Spectral and Prosodic Features of Speech Affected by Orthodontic Appliances Using the Gmm Classifier

NASA Astrophysics Data System (ADS)

Přibil, Jiří; Přibilová, Anna; Ďuračkoá, Daniela

2014-01-01

The paper describes our experiment with using the Gaussian mixture models (GMM) for classification of speech uttered by a person wearing orthodontic appliances. For the GMM classification, the input feature vectors comprise the basic and the complementary spectral properties as well as the supra-segmental parameters. Dependence of classification correctness on the number of the parameters in the input feature vector and on the computation complexity is also evaluated. In addition, an influence of the initial setting of the parameters for GMM training process was analyzed. Obtained recognition results are compared visually in the form of graphs as well as numerically in the form of tables and confusion matrices for tested sentences uttered using three configurations of orthodontic appliances.

Measurement of the microscopic viscosities of microfluids with a dynamic optical tweezers system

NASA Astrophysics Data System (ADS)

Zhang, Yuquan; Wu, Xiaojing; Wang, Yijia; Zhu, Siwei; Gao, Bruce Z.; Yuan, X.-C.

2014-06-01

Viscosity coefficients of microfluids—Newtonian and non-Newtonian—were explored through the rotational motion of a particle trapped by optical tweezers in a microflute. Unlike conventional methods based on viscometers, our microfluidic system employs samples of less than 30 μl to complete a measurement. Viscosity coefficients of ethanol and fetal bovine serum, as typical examples of Newtonian and non-Newtonian fluids, were obtained experimentally, and found to be in excellent agreement with theoretical predictions. Additionally, a practical application to a DNA solution with incremental ethidium bromide content was employed and the results are consistent with clinical data, indicating that our system provides a potentially important complementary tool for use in such biological and medical applications.

Multinuclear solid film state NMR studies of metal oxide catalysts and minerals

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, R.S.; Stec, D.F.; Ellis, P.D.

1996-10-01

Several of our investigations of heterogeneous process by novel NMR experiments and analyses are reviewed and the utility and limitations of NMR spectroscopy for these areas discussed. Out studies have included the following: dynamics and arrangements of proton-containing adsorbates, primarily Bronsted acid sites and water, on the surface of zirconia and alumina catalysts; hydrogen dynamics and coordinates in synthetic aluminum oxyhydroxides; phase separation and crystallinity of synthetic minerals. In combination with the complementary results obtained in our laboratory via infrared spectroscopy, thermal analysis (primarily TGA and DSC), and catalytic activity measurements, these NMR data provide unique and valuable information onmore » atomic and molecular dynamics, identities, and structures without requiring pristine, single crystal specimens.« less

MRI as a tool for evaluation of oral controlled release dosage forms.

PubMed

Dorożyński, Przemysław P; Kulinowski, Piotr; Młynarczyk, Anna; Stanisz, Greg J

2012-02-01

The magnetic resonance imaging (MRI) studies of controlled-release (CR) dosage forms can be roughly divided into two groups. The first comprises studies performed in static conditions (small solvent volumes and ambient temperature). Such studies have provided insight into molecular phenomena in hydrating polymeric matrices. The second group covers research performed in dynamic conditions (medium flow or stirring) related to drug dissolution. An important issue is supplementation of the MRI results with data obtained by complementary techniques, such as X-ray microtomography (μCT). As we discuss here, an understanding of the mechanism underlying the release of the drug from the dosage form will lead to the development of detailed, molecularly defined, CR dosage forms. Copyright © 2011 Elsevier Ltd. All rights reserved.

Selling Complementary Patents: Experimental Investigation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bjornstad, David J; Santore, Rudy; McKee, Michael

2010-02-01

Production requiring licensing groups of complementary patents implements a coordination game among patent holders, who can price patents by choosing among combinations of fixed and royalty fees. Summed across patents, these fees become the total producer cost of the package of patents. Royalties, because they function as excise taxes, add to marginal costs, resulting in higher prices and reduced quantities of the downstream product and lower payoffs to the patent holders. Using fixed fees eliminates this inefficiency but yields a more complex coordination game in which there are multiple equilibria, which are very fragile in that small mistakes can leadmore » the downstream firm to not license the technology, resulting in inefficient outcomes. We report on a laboratory market investigation of the efficiency effects of coordinated pricing of patents in a patent pool. We find that pool-like pricing agreements can yield fewer coordination failures in the pricing of complementary patents.« less

Using complementary tools to characterize the effects of radiation in electro-optic polymeric materials

NASA Astrophysics Data System (ADS)

Perez-Moreno, Javier

2015-09-01

Understanding the fundamental mechanisms behind the radiation resistance of polymers and molecules would allow us to tailor new materials with enhanced performance in space and adverse environments. Previous studies of the radiation effects on polymer-based photonic materials indicate that they are very dependent on the choice of polymer-host and guest-chromophores. The best results have been reported from the combination of CLD1 as a guest-chromophore doped in APC as host polymer, where improvement of the performance was observed upon gamma-irradiation at moderate doses. In this paper, we report on the different complementary tools that have been tried to characterize the origin of such enhancement: characterization of the linear and nonlinear response, characterization of chemical properties, and application of an all-optical protocol. We derive some general conclusions by contrasting the results of each characterization, and propose complementary experiments based on microscopy techniques.

Probing plasmons in three dimensions by combining complementary spectroscopies in a scanning transmission electron microscope

DOE PAGES

Hachtel, Jordan A.; Marvinney, Claire; Mouti, Anas; ...

2016-03-02

The nanoscale optical response of surface plasmons in three-dimensional metallic nanostructures plays an important role in many nanotechnology applications, where precise spatial and spectral characteristics of plasmonic elements control device performance. Electron energy loss spectroscopy (EELS) and cathodoluminescence (CL) within a scanning transmission electron microscope have proven to be valuable tools for studying plasmonics at the nanoscale. Each technique has been used separately, producing three-dimensional reconstructions through tomography, often aided by simulations for complete characterization. Here we demonstrate that the complementary nature of the two techniques, namely that EELS probes beam-induced electronic excitations while CL probes radiative decay, allows usmore » to directly obtain a spatially- and spectrally-resolved picture of the plasmonic characteristics of nanostructures in three dimensions. Furthermore, the approach enables nanoparticle-by-nanoparticle plasmonic analysis in three dimensions to aid in the design of diverse nanoplasmonic applications.« less

Women's attitudes towards the use of complementary and alternative medicine products during pregnancy.

PubMed

Frawley, J; Sibbritt, D; Broom, A; Gallois, C; Steel, A; Adams, J

2016-05-01

The aim of this study was to analyse women's attitudes towards the use of complementary and alternative medicine (CAM) products during pregnancy. The study sample was obtained via the Australian Longitudinal Study on Women's Health or ALSWH. A response rate of 79.2% (n = 1,835) was attained. Women who use herbal medicines (34.5%, n = 588) view CAM as a preventative measure, are looking for something holistic and are concerned about evidence of clinical efficacy when considering the use of these products during pregnancy. Women who use aromatherapy (17.4%, n = 319) and homoeopathy (13.3%, n = 244) want more personal control over their body and are concerned more about their own personal experience of the efficacy of CAM than clinical evidence of efficacy. As CAM use in pregnancy appears to be increasingly commonplace, insights into women's attitudes towards CAM are valuable for maternity healthcare providers.

Mesomorphic phase transitions of 3F7HPhF studied by complementary methods

NASA Astrophysics Data System (ADS)

Deptuch, Aleksandra; Jaworska-Gołąb, Teresa; Marzec, Monika; Pociecha, Damian; Fitas, Jakub; Żurowska, Magdalena; Tykarska, Marzena; Hooper, James

2018-02-01

Physical properties and the phase sequence of (S)-4‧-(1-methylheptyloxycarbonyl)biphenyl-4-yl 4-[7-(2,2,3,3,4,4,4-heptafluorobutoxy) heptyl-1-oxy]-2-fluorobenzoate exhibiting the liquid crystalline paraelectric smectic A*, ferroelectric smectic C* and antiferroelectric smectic CA* phases were studied by complementary methods in the temperature range from -125 to 120 °C. Differential scanning calorimetry measurements together with polarizing optical microscopy provided the phase sequence, including the glass transition and a cold crystallization. X-ray diffraction was used to obtain the unit-cell parameters of the crystal phase, as well as the layer thickness and correlation length in the liquid crystalline smectic phases. The tilt angle was found to reach 45°, as determined from the measurements of the layer thickness and molecular modeling. Relaxation processes in the smectic phases and the fragility parameter were studied using frequency-domain dielectric spectroscopy.

Complementary and Alternative Approaches to Pain Relief During Labor

PubMed Central

Theau-Yonneau, Anne

2007-01-01

This review evaluated the effect of complementary and alternative medicine on pain during labor with conventional scientific methods using electronic data bases through 2006 were used. Only randomized controlled trials with outcome measures for labor pain were kept for the conclusions. Many studies did not meet the scientific inclusion criteria. According to the randomized control trials, we conclude that for the decrease of labor pain and/or reduction of the need for conventional analgesic methods: (i) There is an efficacy found for acupressure and sterile water blocks. (ii) Most results favored some efficacy for acupuncture and hydrotherapy. (iii) Studies for other complementary or alternative therapies for labor pain control have not shown their effectiveness. PMID:18227907

Complementary Role of Herbal Medicine and Exercise in Cardiovascular Disease Prevention and Management: A Review of Evidence.

PubMed

Veluswamy, Sundar Kumar; Babu, Abraham Samuel; Sundar, Lakshmi Manickavasagam

2017-01-01

Cardiovascular disease (CVD) is the leading cause of death worldwide. Herbal medicine and exercise interventions have individually been shown to be effective in the prevention and management of CVD. However, the complementary roles of herbal medicine and exercise interventions for CVD prevention and management have not been adequately reported. 1. Identify studies analysing complementary roles of herbal medicine and exercise intervention in CVD prevention and management, 2. Identify herbs and exercise strategies that have been reported to exhibit complementary roles in CVD prevention and management, and 3. Summarize evidence of complementary roles of herbal medicine and exercise interventions for CVD prevention and management. PubMed, CINAHL and Web of Science were searched with a customised search strategy in May 2015. Two reviewers screened the search results for inclusion using pre-specified criteria. Data were extracted from full text of selected abstracts in a predetermined template by two reviewers and verified by the third reviewer when needed. A total of 35 titles were identified for full texts review after screening 827 abstracts. Data were extracted from 23 titles, representing 12 human studies and six animal studies. This review identified effects of 14 different herbs and 10 exercise strategies on over 18 CVD risk factors and markers. Complementary roles of herbal medicine and exercise were reported from five studies. Evidence of complementary role of herbal medicine and exercise is emerging from animal studies. More robust clinical studies on proven risk factors are needed before they can be recommended for clinical practice. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Alternative and complementary reinforcers as mechanisms linking adolescent conduct problems and substance use.

PubMed

Khoddam, Rubin; Leventhal, Adam M

2016-10-01

The present study tested the hypothesis that teens who engage in conduct problems are more likely to use substances because they engage in fewer alternative reinforcing (i.e., pleasurable) substance-free activities and more complementary reinforcing substance-associated activities. In a cross-sectional, correlational design, 9th grade students (N = 3,383; mean age = 14.6 years) in Los Angeles, California, U.S.A. completed surveys in 2013 measuring conduct problems (e.g., stealing, lying, getting in fights); alternative and complementary reinforcement; use of a number of licit, illicit, and prescription drugs; and other cofactors. Conduct problems were positively associated with past 6-month use of any substance (yes/no) among the overall sample and past 30-day use frequency on a composite index that included 6 substances among past 6-month users. These associations were statistically mediated by diminished alternative reinforcement and increased complementary reinforcement when adjusting for relevant covariates. Conduct problems were associated with lower engagement in alternative reinforcers and increased engagement in complementary reinforcers, which, in turn, were associated with greater likelihood and frequency of substance use. Most mediational relations persisted adjusting for demographic, environmental, and intrapersonal cofactors and generalized to alcohol, cigarette, and marijuana use, although, complementary reinforcers did not significantly mediate the relation of conduct problems with alcohol use frequency. These results point to diminished alternative reinforcement and increased complementary reinforcement as mechanisms linking conduct problems and adolescent substance use. Interventions that increase access to and engagement in a diverse set of alternative substance-free activities and deter activities that complement use may prevent substance use in adolescents who engage in conduct problems. (PsycINFO Database Record (c) 2016 APA, all rights reserved).

Alternative and Complementary Reinforcers as Mechanisms Linking Adolescent Conduct Problems and Substance Use

PubMed Central

Khoddam, Rubin; Leventhal, Adam M.

2016-01-01

The present study tested the hypothesis that teens who engage in conduct problems are more likely to use substances because they engage in fewer alternative reinforcing (i.e., pleasurable) substance-free activities and more complementary reinforcing substance-associated activities. In a cross-sectional, correlational design, ninth grade students (N=3,396; mean age=14.6 years) in Los Angeles, California, USA completed surveys in 2013 measuring conduct problems (e.g., stealing, lying, getting in fights), alternative and complementary reinforcement, use of a number of licit, illicit, and prescription drugs, and other co-factors. Conduct problems were positively associated with past six-month use of any substance (yes/no) among the overall sample and past 30-day use frequency on a composite index that included six substances among past six-month users. These associations were statistically mediated by diminished alternative reinforcement and increased complementary reinforcement when adjusting for relevant covariates. Conduct problems were associated with lower engagement in alternative reinforcers and increased engagement in complementary reinforcers, which, in turn, was associated with greater likelihood and frequency of substance use. Most mediational relations persisted adjusting for demographic, environmental, and intrapersonal co-factors and generalized to alcohol, cigarette, and marijuana use; though, complementary reinforcers did not significantly mediate the relation of CPs with alcohol use frequency. These results point to diminished alternative reinforcement and increased complementary reinforcement as mechanisms linking conduct problems and adolescent substance use. Interventions that increase access to and engagement in a diverse set of alternative substance-free activities and deter activities that complement use may prevent substance use in adolescents who engage in conduct problems. PMID:27690501

Educational interventions for improving primary caregiver complementary feeding practices for children aged 24 months and under.

PubMed

Arikpo, Dachi; Edet, Ededet Sewanu; Chibuzor, Moriam T; Odey, Friday; Caldwell, Deborah M

2018-05-18

Although complementary feeding is a universal practice, the methods and manner in which it is practiced vary between cultures, individuals and socioeconomic classes. The period of complementary feeding is a critical time of transition in the life of an infant, and inappropriate complementary feeding practices, with their associated adverse health consequences, remain a significant global public health problem. Educational interventions are widely acknowledged as effective in promoting public health strategy, and those aimed at improving complementary feeding practices provide information about proper complementary feeding practices to caregivers of infants/children. It is therefore important to summarise evidence on the effectiveness of educational interventions to improve the complementary feeding practices of caregivers of infants. To assess the effectiveness of educational interventions for improving the complementary feeding (weaning) practices of primary caregivers of children of complementary feeding age, and related health and growth outcomes in infants. In November 2017, we searched CENTRAL, MEDLINE, Embase, 10 other databases and two trials registers. We also searched the reference lists of relevant studies and reviews to identify any additional studies. We did not limit the searches by date, language or publication status. Randomised controlled trials (RCTs), comparing educational interventions to no intervention, usual practice, or educational interventions provided in conjunction with another intervention, so long as the educational intervention was only available in the experimental group and the adjunctive intervention was available to the control group. Study participants included caregivers of infants aged 4 to 24 months undergoing complementary feeding. Pregnant women who were expected to give birth and commence complementary feeding during the period of the study were also included. Two review authors independently extracted data on participants, settings, interventions, methodology and outcomes using a specifically-developed and piloted data extraction form. We calculated risk ratios (RR) and 95% confidence intervals (CIs) for dichotomous data, and mean differences (MD) and 95% CIs for continuous data. Where data permitted, we conducted a meta-analysis using a random-effects model. We assessed the included studies for risk of bias and also assessed the quality of evidence using the GRADE approach. We included 23 studies (from 35 reports) with a total of 11,170 caregiver-infant pairs who were randomly assigned to receive an educational intervention delivered to the caregiver or usual care. Nineteen of the included studies were community-based studies while four were facility-based studies. In addition, 13 of the included studies were cluster-randomised while the others were individually randomised. Generally, the interventions were focused on the introduction of complementary feeding at the appropriate time, the types and amount of complementary foods to be fed to infants, and hygiene. Using the GRADE criteria, we assessed the quality of the evidence as moderate, mostly due to inadequate allocation concealment and insufficient blinding.Educational interventions led to improvements in complementary feeding practices for age at introduction of complementary foods (average RR 0.88, 95% CI 0.83 to 0.94; 4 studies, 1738 children; moderate-quality evidence) and hygiene practices (average RR 1.38, 95% CI 1.23 to 1.55; 4 studies, 2029 participants; moderate-quality evidence). For duration of exclusive breastfeeding, pooled results were compatible with both a reduction and an increase in the outcome (average RR 1.58, 95% CI 0.77 to 3.22; 3 studies, 1544 children; very low-quality evidence). There was limited (low to very low-quality) evidence of an effect for all growth outcomes.Quality of evidenceThere is moderate to very low-quality evidence that educational interventions can improve complementary feeding practices but insufficient evidence to conclude that it impacts growth outcomes. Overall, we found evidence that education improves complementary feeding practices.

White organic light-emitting diodes with ultra-thin mixed emitting layer

NASA Astrophysics Data System (ADS)

Jeon, T.; Forget, S.; Chenais, S.; Geffroy, B.; Tondelier, D.; Bonnassieux, Y.; Ishow, E.

2012-02-01

White light can be obtained from Organic Light Emitting Diodes by mixing three primary colors, (i.e. red, green and blue) or two complementary colors in the emissive layer. In order to improve the efficiency and stability of the devices, a host-guest system is generally used as an emitting layer. However, the color balance to obtain white light is difficult to control and optimize because the spectrum is very sensitive to doping concentration (especially when a small amount of material is used). We use here an ultra-thin mixed emitting layer (UML) deposited by thermal evaporation to fabricate white organic light emitting diodes (WOLEDs) without co-evaporation. The UML was inserted in the hole-transporting layer consisting of 4, 4'-bis[N-(1-naphtyl)-N-phenylamino]biphenyl (α-NPB) instead of using a conventional doping process. The UML was formed from a single evaporation boat containing a mixture of two dipolar starbust triarylamine molecules (fvin and fcho) presenting very similar structures and thermal properties and emitting in complementary spectral regions (orange and blue respectively) and mixed according to their weight ratio. The composition of the UML specifically allows for fine tuning of the emission color despite its very thin thickness down to 1 nm. Competitive energy transfer processes from fcho and the host interface toward fvin are key parameters to control the relative intensity between red and blue emission. White light with very good CIE 1931 color coordinate (0.34, 0.34) was obtained by simply adjusting the UML film composition.

A Multi-Objective Decision Making Approach for Solving the Image Segmentation Fusion Problem.

PubMed

Khelifi, Lazhar; Mignotte, Max

2017-08-01

Image segmentation fusion is defined as the set of methods which aim at merging several image segmentations, in a manner that takes full advantage of the complementarity of each one. Previous relevant researches in this field have been impeded by the difficulty in identifying an appropriate single segmentation fusion criterion, providing the best possible, i.e., the more informative, result of fusion. In this paper, we propose a new model of image segmentation fusion based on multi-objective optimization which can mitigate this problem, to obtain a final improved result of segmentation. Our fusion framework incorporates the dominance concept in order to efficiently combine and optimize two complementary segmentation criteria, namely, the global consistency error and the F-measure (precision-recall) criterion. To this end, we present a hierarchical and efficient way to optimize the multi-objective consensus energy function related to this fusion model, which exploits a simple and deterministic iterative relaxation strategy combining the different image segments. This step is followed by a decision making task based on the so-called "technique for order performance by similarity to ideal solution". Results obtained on two publicly available databases with manual ground truth segmentations clearly show that our multi-objective energy-based model gives better results than the classical mono-objective one.

Improving the complementary methods to estimate evapotranspiration under diverse climatic and physical conditions

NASA Astrophysics Data System (ADS)

Anayah, F. M.; Kaluarachchi, J. J.

2014-06-01

Reliable estimation of evapotranspiration (ET) is important for the purpose of water resources planning and management. Complementary methods, including complementary relationship areal evapotranspiration (CRAE), advection aridity (AA) and Granger and Gray (GG), have been used to estimate ET because these methods are simple and practical in estimating regional ET using meteorological data only. However, prior studies have found limitations in these methods especially in contrasting climates. This study aims to develop a calibration-free universal method using the complementary relationships to compute regional ET in contrasting climatic and physical conditions with meteorological data only. The proposed methodology consists of a systematic sensitivity analysis using the existing complementary methods. This work used 34 global FLUXNET sites where eddy covariance (EC) fluxes of ET are available for validation. A total of 33 alternative model variations from the original complementary methods were proposed. Further analysis using statistical methods and simplified climatic class definitions produced one distinctly improved GG-model-based alternative. The proposed model produced a single-step ET formulation with results equal to or better than the recent studies using data-intensive, classical methods. Average root mean square error (RMSE), mean absolute bias (BIAS) and R2 (coefficient of determination) across 34 global sites were 20.57 mm month-1, 10.55 mm month-1 and 0.64, respectively. The proposed model showed a step forward toward predicting ET in large river basins with limited data and requiring no calibration.

Focusing light in a bianisotropic slab with negatively refracting materials.

PubMed

Liu, Yan; Guenneau, Sebastien; Gralak, Boris; Ramakrishna, S Anantha

2013-04-03

We investigate the electromagnetic response of a pair of complementary bianisotropic media, which consist of a medium with positive refractive index (+ε, +μ, +ξ) and a medium with negative refractive index(-ε, -μ, -ξ). We show that this idealized system has peculiar imaging properties in that it reproduces images of a source, in principle, with unlimited resolution. We then consider an infinite array of line sources regularly spaced in a 1D photonic crystal (PC) consisting of 2n layers of bianisotropic complementary media. Using coordinate transformations, we map this system into 2D corner chiral lenses of 2n heterogeneous anisotropic complementary media sharing a vertex, within which light circles around closed trajectories. Alternatively, one can consider corner lenses with homogeneous isotropic media and map them into 1D PCs with heterogeneous bianisotropic layers. Interestingly, such complementary media are described by scalar, or matrix valued, sign-shifting parameters, which satisfy a new version of the generalized lens theorem of Pendry and Ramakrishna. This theorem can be derived using Fourier series solutions of the Maxwell-Tellegen equations, or from space-time symmetry arguments. Also of interest are 2D periodic checkerboards consisting of alternating rectangular cells of complementary media which are such that one point source in one cell gives rise to an infinite set of images with an image in every other cell. Such checkerboards can themselves be mapped into a class of 3D corner lenses of complementary bianisotropic media. These theoretical results are illustrated by finite element computations.

A Survey of Medical Students' Knowledge and Attitudes Toward Complementary and Alternative Medicine in Urmia, Iran.

PubMed

Sadeghi, Mahshid; Rabiepoor, Soheila; Forough, Aida Sefidani; Jabbari, Shiva; Shahabi, Shahram

2016-10-01

Personal beliefs of medical students may interfere with their tendency for learning Complementary and Alternative Medicine concepts. This study aimed to investigate the knowledge and attitudes of medical students toward complementary and alternative medicine in Urmia, Iran. A structured questionnaire was used as data collection instrument. One hundred questionnaires were returned. Thirty-one percent of students reported use of alternative medicine for at least once. Iranian Traditional Medicine was the main type of alternative medicine used by medical students (93.5%). Neuromuscular disorders were the main indication of alternative medicine use among students (34.4%). Ninety percent of participants demonstrated competent knowledge about acupuncture while the lowest scores belonged to homeopathy (12%). Study results showed that 49% of medical students had positive attitudes and demonstrated a willingness to receive training on the subject. Thus, there appears a necessity to integrate complementary and alternative medicine into the medical curriculum, by taking expectations and feedbacks of medical students into consideration. © The Author(s) 2015.

Rosacea Patient Perspectives on Homeopathic and Over-the-counter Therapies

PubMed Central

Lan, Lucy; Kuo, Sandy; Huang, Karen E.; Taylor, Sarah L.; Feldman, Steven R.

2015-01-01

Background: Rosacea patients commonly employ nonprescription therapies. The authors’ aim was to understand rosacea patients’ perceptions of over-the-counter products, complementary and alternative medicine, and homeopathic therapies. Method: A public, online discussion forum comprising 3,350 members and 27,051 posts provided a source of 346 posts on patient perceptions on alternative rosacea treatments. Results: Three major themes of nonprescription treatment were identified—motivation for use, patient-provider discussions, and experience with these treatments. Perceived medication failure, barriers to treatment, and distrust of physicians drive patients to seek nonprescription therapies. Still, patients prefer to consult a physician on incorporating nonprescription therapies into treatment. Complementary and alternative medicine natural products (19.4% of posts), complementary and alternative medicine practices (16.5%), and homeopathic medicine (3.8%) were commonly discussed. Conclusion: Physicians have an opportunity to be a trusted source of information on the strengths and weaknesses of skin care products and other complementary treatments for rosacea. PMID:26557217

Polarization-selective transmission in stacked two-dimensional complementary plasmonic crystal slabs

NASA Astrophysics Data System (ADS)

Iwanaga, Masanobu

2010-02-01

It has been experimentally and numerically shown that transmission at near infrared wavelengths is selectively controlled by polarizations in two-dimensional complementary plasmonic crystal slabs (2D c-PlCSs) of stacked unit cell. This feature is naturally derived by taking account of Babinet's principle. Moreover, the slight structural modification of the unit cell has been found to result in a drastic change in linear optical responses of stacked 2D c-PlCSs. These results substantiate the feasibility of 2D c-PlCSs for producing efficient polarizers with subwavelength thickness.

Assessing the Performance of Sensor Fusion Methods: Application to Magnetic-Inertial-Based Human Body Tracking

PubMed Central

Ligorio, Gabriele; Bergamini, Elena; Pasciuto, Ilaria; Vannozzi, Giuseppe; Cappozzo, Aurelio; Sabatini, Angelo Maria

2016-01-01

Information from complementary and redundant sensors are often combined within sensor fusion algorithms to obtain a single accurate observation of the system at hand. However, measurements from each sensor are characterized by uncertainties. When multiple data are fused, it is often unclear how all these uncertainties interact and influence the overall performance of the sensor fusion algorithm. To address this issue, a benchmarking procedure is presented, where simulated and real data are combined in different scenarios in order to quantify how each sensor’s uncertainties influence the accuracy of the final result. The proposed procedure was applied to the estimation of the pelvis orientation using a waist-worn magnetic-inertial measurement unit. Ground-truth data were obtained from a stereophotogrammetric system and used to obtain simulated data. Two Kalman-based sensor fusion algorithms were submitted to the proposed benchmarking procedure. For the considered application, gyroscope uncertainties proved to be the main error source in orientation estimation accuracy for both tested algorithms. Moreover, although different performances were obtained using simulated data, these differences became negligible when real data were considered. The outcome of this evaluation may be useful both to improve the design of new sensor fusion methods and to drive the algorithm tuning process. PMID:26821027

Assessing the Performance of Sensor Fusion Methods: Application to Magnetic-Inertial-Based Human Body Tracking.

PubMed

Ligorio, Gabriele; Bergamini, Elena; Pasciuto, Ilaria; Vannozzi, Giuseppe; Cappozzo, Aurelio; Sabatini, Angelo Maria

2016-01-26

Information from complementary and redundant sensors are often combined within sensor fusion algorithms to obtain a single accurate observation of the system at hand. However, measurements from each sensor are characterized by uncertainties. When multiple data are fused, it is often unclear how all these uncertainties interact and influence the overall performance of the sensor fusion algorithm. To address this issue, a benchmarking procedure is presented, where simulated and real data are combined in different scenarios in order to quantify how each sensor's uncertainties influence the accuracy of the final result. The proposed procedure was applied to the estimation of the pelvis orientation using a waist-worn magnetic-inertial measurement unit. Ground-truth data were obtained from a stereophotogrammetric system and used to obtain simulated data. Two Kalman-based sensor fusion algorithms were submitted to the proposed benchmarking procedure. For the considered application, gyroscope uncertainties proved to be the main error source in orientation estimation accuracy for both tested algorithms. Moreover, although different performances were obtained using simulated data, these differences became negligible when real data were considered. The outcome of this evaluation may be useful both to improve the design of new sensor fusion methods and to drive the algorithm tuning process.

Preliminary evaluation of infrared spectroscopy for the differentiation of Brettanomyces bruxellensis strains isolated from red wines.

PubMed

Oelofse, A; Malherbe, S; Pretorius, I S; Du Toit, M

2010-10-15

The objective of this study was to evaluate different infrared spectroscopy methods in combination with chemometrics for the differentiation between Brettanomyces bruxellensis strains. These methods of discrimination were applied to intact yeast cells of B. bruxellensis strains and on wines spoiled by the same strains. Eleven wine isolates of B. bruxellensis were evaluated for volatile phenol production in red wine and their genetic diversity was determined by Restriction Endonuclease Analysis-Pulsed Field Gel Electrophoresis (REA-PFGE). Fourier transform mid-infrared (FTMIR) spectroscopy was used to obtain spectral fingerprints of the spoiled wines. Attenuated total reflectance (ATR) was used to obtain spectral fingerprints from the intact cells of the 11 B. bruxellensis strains. The groupings from the genetic fingerprints obtained with REA-PFGE were used as reference firstly for comparison with the groupings observed with the FTMIR spectral fingerprint of the wines and secondly for the FTIR-ATR spectral fingerprints from the whole cells. Results indicated that ATR-IR spectra obtained by scanning whole cells of B. bruxellensis could be useful for rapid strain typing in comparison or complementary to molecular techniques and FTMIR spectra from wines provide a useful resource for the discrimination between B. bruxellensis contaminated wines. Copyright © 2010 Elsevier B.V. All rights reserved.

Multicanonical molecular dynamics simulations combined with Metadynamics for the free energy landscape of a biomolecular system with high energy barriers

NASA Astrophysics Data System (ADS)

Yonezawa, Yasushige; Shimoyama, Hiromitsu; Nakamura, Haruki

2011-01-01

Multicanonical molecular-dynamics (McMD) simulation and Metadynamics (MetaD) are useful for obtaining the free-energies, and can be mutually complementary. We combined McMD with MetaD, and applied it to the conformational free energy calculations of a proline dipeptide. First, MetaD was performed along the dihedral angle at the prolyl bond and we obtained a coarse biasing potential. After adding the biasing potential to the dihedral angle potential energy, we conducted McMD with the modified potential energy. Enhanced sampling was achieved for all degrees-of-freedom, and the sampling of the dihedral angle space was facilitated. After reweighting, we obtained an accurate free energy landscape.

Association between use of self-prescribed complementary and alternative medicine and menopause-related symptoms: a cross-sectional study.

PubMed

Peng, Wenbo; Sibbritt, David W; Hickman, Louise; Adams, Jon

2015-10-01

To examine the association between self-prescribed complementary and alternative medicine use and menopause-related symptoms, stratified by menopausal status. Data were obtained from a cross-sectional survey of a nationally representative sample of 10,011 menopausal women from the Australian Longitudinal Study on Women's Health, conducted in 2010. Multivariable logistic regression models were applied to identify if the use of selected self-prescribed complementary and alternative medicine was significantly associated with a range of menopause-related symptoms. Vitamins/minerals were more likely to be used by natural menopausal women experiencing anxiety (adjusted OR=1.20) and/or stiff/painful joints (adjusted OR=1.16). Yoga/meditation was more likely to be used by women with hysterectomy (adjusted OR=1.76) or natural menopausal women (adjusted OR=1.38) experiencing anxiety. Herbal medicines were more likely to be used by natural menopausal women experiencing anxiety (adjusted OR=1.22), tiredness (adjusted OR=1.20), and/or stiff/painful joints (adjusted OR=1.17), and by women with oophorectomy experiencing tiredness (adjusted OR=1.45). Aromatherapy oils were more likely to be used by natural menopausal women experiencing night sweats (adjusted OR=1.25) and by women with hysterectomy experiencing anxiety (adjusted OR=2.02). Chinese medicines were more likely to be used by women with oophorectomy experiencing stiff/painful joints (adjusted OR=4.06) and/or palpitations (adjusted OR=3.06). Our study will help improve the patient-provider communication regarding complementary and alternative medicine use for menopause, and we conclude that menopausal status should be taken into account by providers for menopause care. The women's experience and motivations of such use warrant further research. Copyright © 2015 Elsevier Ltd. All rights reserved.

Activation Energies for Dissociation of Double Strand Oligonucleotide Anions: Evidence for Watson–Crick Base Pairing in Vacuo

PubMed Central

Schnier, Paul D.; Klassen, John S.; Strittmatter, Eric F.; Williams*, Evan R.

2005-01-01

The dissociation kinetics of a series of complementary and noncomplementary DNA duplexes, (TGCA)23−, (CCGG)23−, (AATTAAT)23−, (CCGGCCG)23−, A7·T73−, A7·A73−, T7·T73−, and A7·C73− were investigated using blackbody infrared radiative dissociation in a Fourier transform mass spectrometer. From the temperature dependence of the unimolecular dissociation rate constants, Arrhenius activation parameters in the zero-pressure limit are obtained. Activation energies range from 1.2 to 1.7 eV, and preexponential factors range from 1013 to 1019 s−1. Dissociation of the duplexes results in cleavage of the noncovalent bonds and/or cleavage of covalent bonds leading to loss of a neutral nucleobase followed by backbone cleavage producing sequence-specific (a – base) and w ions. Four pieces of evidence are presented which indicate that Watson–Crick (WC) base pairing is preserved in complementary DNA duplexes in the gas phase: i. the activation energy for dissociation of the complementary dimer, A7·T73−, to the single strands is significantly higher than that for the related noncomplementary A7·A73− and T7·T73− dimers, indicating a stronger interaction between strands with a specific base sequence, ii. extensive loss of neutral adenine occurs for A7·A73− and A7·C73− but not for A7·T73− consistent with this process being shut down by WC hydrogen bonding, iii. a correlation is observed between the measured activation energy for dissociation to single strands and the dimerization enthalpy (−ΔHd) in solution, and iv. molecular dynamics carried out at 300 and 400 K indicate that WC base pairing is preserved for A7·T73− duplex, although the helical structure is essentially lost. In combination, these results provide strong evidence that WC base pairing can exist in the complete absence of solvent. PMID:16498487

The THS Experiment: Simulating Titans Atmospheric Chemistry at Low Temperature (200K)

NASA Technical Reports Server (NTRS)

Sciamma-O'Brien, Ella; Upton, Kathleen; Beauchamp, Jack L.; Salama, Farid; Contreras, Cesar Sanchez; Bejaoui, Salma; Foing, Bernard; Pascale, Ehrenfreund

2015-01-01

In Titan's atmosphere, composed mainly of N2 (95-98%) and CH4 (2-5%), a complex chemistry occurs at low temperature, and leads to the production of heavy organic molecules and subsequently solid aerosols. Here, we used the Titan Haze Simulation (THS) experiment, an experimental setup developed at the NASA Ames COSmIC simulation facility to study Titan's atmospheric chemistry at low temperature. In the THS, the chemistry is simulated by plasma in the stream of a supersonic expansion. With this unique design, the gas is cooled to Titan-like temperature ( approximately 150K) before inducing the chemistry by plasma, and remains at low temperature in the plasma discharge (approximately 200K). Different N2-CH4-based gas mixtures can be injected in the plasma, with or without the addition of heavier precursors present as trace elements on Titan, in order to monitor the evolution of the chemical growth. Both the gas- and solid phase products resulting from the plasma-induced chemistry can be monitored and analyzed using a combination of complementary in situ and ex situ diagnostics. A recent mass spectrometry[1] study of the gas phase has demonstrated that the THS is a unique tool to probe the first and intermediate steps of Titan's atmospheric chemistry at Titan-like temperature. In particular, the mass spectra obtained in a N2-CH4-C2H2-C6H6 mixture are relevant for comparison to Cassini's CAPS-IBS instrument. The results of a complementary study of the solid phase are consistent with the chemical growth evolution observed in the gas phase. Grains and aggregates form in the gas phase and can be jet deposited on various substrates for ex situ analysis. Scanning Electron Microscopy images show that more complex mixtures produce larger aggregates. A mass spectrometry analysis of the solid phase has detected the presence of aminoacetonitrile, a precursor of glycine, in the THS aerosols. X-ray Absorption Near Edge Structure (XANES) measurements also show the presence of imine and nitrile functional groups, showing evidence of nitrogen chemistry. These complementary studies show the high potential of THS to better understand Titan's chemistry and the origin of aerosol formation.

Attitudes towards and personal use of complementary and alternative medicine amongst clinicians working in audiovestibular disciplines.

PubMed

Crundwell, G; Baguley, D M

2016-08-01

Literature indicates that complementary and alternative medicine is used by patients with auditory and vestibular symptoms. This study sought to determine the prevalence of complementary and alternative medicine uptake, and examine attitudes towards complementary and alternative medicine in clinicians working with audiovestibular disorder patients. The Holistic Complementary and Alternative Medicine Questionnaire and a devised questionnaire about recent and lifetime use of complementary and alternative medicine were used. Fifty-four individuals, including audiologists, ENT surgeons, nurses and rehabilitationists, completed the questionnaires (67 per cent response rate). Lifetime prevalence of complementary and alternative medicine uptake was 44 per cent, and 12-month prevalence was 22 per cent. Uptake was more common in females, but there was no significant difference in use when comparing age, seniority or profession. Attitudes towards complementary and alternative medicine were mildly adverse, but sizeable standard deviation indicates wide-ranging attitudes. Clinicians working with patients with audiovestibular disorders have a range of attitudes towards complementary and alternative medicine. Personal uptake of complementary and alternative medicine was lower than that of the general UK population, but remains sizeable.

An Autonomous Circuit for the Measurement of Photovoltaic Devices Parameters.

DTIC Science & Technology

1986-09-01

Comparison Data, Gallium Arsenide ................ 80 A 7 A,. TABLE OF SYMBOLS A Curve Fitting Constant ADC Analog to Digital Converter AMO Air-Mass-Zero...in Radiation Fluence in the Logarithmic Region CMOS Complementary Metal-Oxide Semiconductor DAC Digital to Analog Converter DC Direct Current Dp Hole...characteristics of individual solar cells. A novel circuit is developed that uses a microprocessor controlled Digital to Analog Converter (DAC) to obtain

Thermometric sensing of nitrofurantoin by noncovalently imprinted polymers containing two complementary functional monomers.

PubMed

Athikomrattanakul, Umporn; Gajovic-Eichelmann, Nenad; Scheller, Frieder W

2011-10-15

Molecularly imprinted polymers (MIPs) for nitrofurantoin (NFT) recognition addressing in parallel of two complementary functional groups were created using a noncovalent imprinting approach. Specific tailor-made functional monomers were synthesized: a diaminopyridine derivative as the receptor for the imide residue and three (thio)urea derivatives for the interaction with the nitro group of NFT. A significantly improved binding of NFT to the new MIPs was revealed from the imprinting factor, efficiency of binding, affinity constants and maximum binding number as compared to previously reported MIPs, which addressed either the imide or the nitro residue. Substances possessing only one functionality (either the imide group or nitro group) showed significantly weaker binding to the new imprinted polymers than NFT. However, the compounds lacking both functionalities binds extremely weak to all imprinted polymers. The new imprinted polymers were applied in a flow-through thermistor in organic solvent for the first time. The MIP-thermistor allows the detection of NFT down to a concentration of 5 μM in acetonitrile + 0.2% dimethyl sulfoxide (DMSO). The imprinting factor of 3.91 at 0.1 mM of NFT as obtained by thermistor measurements is well comparable to the value obtained by batch binding experiments. © 2011 American Chemical Society

Evaluation of urban drainage network based geographycal information system (GIS) in Sumenep City

NASA Astrophysics Data System (ADS)

Agrianto, F.; Hadiani, R.; Purwana, Y. M.

2017-02-01

Sumenep City frequently hit by floods. Drainage network conditions greatly affect the performance of her maid, especially those aspects that affect the capacity of the drainage channel. Aspects that affect the capacity of the drainage channel in the form of sedimentation rate and complementary buildings on drainage channels, for example, the presence of street inlet and trash rack. The method used is a drainage channel capacity level approach that level assessment of each segment drainage network conditions by calculating the ratio of the channel cross-sectional area that is filled with sediment to the total cross-sectional area wet and the existence of complementary buildings. Having obtained the condition index value of each segment, the subsequent analysis is spatial analysis using ArcGIS applications to obtain a map of the drainage network information. The analysis showed that the level condition of drainage network in the city of Sumenep in 2016 that of the total 428 drainage network there are 43 sections belonging to the state level “Good”, 198 drainage network belong to the state level “Enough”, 115 drainage network belong to the state “Mild Damaged”, 50 sections belonging to the state “Heavy Damage” and 22 drainage network belong to the state of “Dysfunction”.

Psychosocial Care in Complementary Feeding of Children: A Comparative Study of the Urban and Rural Communities of Osun State, Nigeria

ERIC Educational Resources Information Center

Ogunba, Beatrice Olubukola

2010-01-01

This study investigated psychosocial care in complementary feeding of children under two years of age. The cross-sectional study was carried out in Osun State of Nigeria within Sub-Saharan Africa, and 450 mothers were interviewed of which 337 were from the urban and 113 from the rural communities. Results revealed that 37.4% of the respondents…

Development of a ginkgo biloba fingerprint chromatogram with UV and evaporative light scattering detection and optimization of the evaporative light scattering detector operating conditions.

PubMed

van Nederkassel, A M; Vijverman, V; Massart, D L; Vander Heyden, Y

2005-09-02

A fingerprint chromatogram of a standardized Ginkgo biloba extract is developed on a monolithic silica column using a ternary gradient containing water, iso-propanol and tetrahydrofuran. For the detection, UV and evaporative light scattering (ELS) detectors are used, the latter allowing detection of the poor UV absorbing compounds as ginkgolides (A-C and J) and bilobalide in the extract. The complementary information between the UV and ELS fingerprint is evaluated. The ELS detector used in this study can operate in an impactor 'on' or 'off' mode. For each mode, the operating conditions such as the nebulizing gas flow rate, the drift tube temperature and the gain are optimized by use of three-level screening designs to obtain the best signal-to-noise (S/N) ratio in the final ELS fingerprint chromatogram. In both impactor modes, very similar S/N ratios are obtained for the nominal levels of the design. However, optimization of the operating conditions resulted, for both impactor modes, in a significant increase in S/N ratios compared to the initial evaluated conditions, obtained from the detector software.

Quality of Rapeseed Bio-Fuel Waste: Optical Properties

NASA Astrophysics Data System (ADS)

Sujak, Agnieszka; Muszyñski, Siemowit; Kachel-Jakubowska, Magdalena

2014-04-01

The objective of the presented work was to examine the optical properties of selected bio-fuel waste. Three independent optical methods: UV-Vis spectroscopy, infrared spectroscopy and chromametric measurements were applied to establish the possible quality control test for the obtained substances. The following by-products were tested: distilled glycerine, technical glycerine and matter organic non glycerine fraction from rapeseed oil bio-fuel production. The results show that analysis of UV-Vis spectra can give rapid information about the purity of distilled glycerine, while no direct information can be obtained concerning the concentration and kind of impurities. Transmission mode is more useful as compared to absorption, concerning the detection abilities of average UV-Vis spectrometers. Infrared spectroscopy can be used as a complementary method for determining impurities/admixtures in samples. Measurements of chroma give the quickest data to compare the colour of biofuel by-products obtained by different producers. The condition is, however, that the products are received through the same or similar chemical processes. The other important factor is application of well defined measuring background. All the discussed analyses are quick, cheap and non-destructive, and can help to compare the quality of products.

Use of complementary and alternative medicine by patients with cancer in northern Turkey: analysis of cost and satisfaction.

PubMed

Aydin Avci, Ilknur; Koç, Zeliha; Sağlam, Zeynep

2012-03-01

The aims of this study were to determine (1) the prevalence of complementary and alternative medicine use among patients with cancer, (2) the method of use of the particular therapy, (3) the reasons for using complementary and alternative medicine therapies, (4) the benefits experienced by the use of complementary and alternative medicine, (5) the source of information about complementary and alternative medicine therapies and, (6) the satisfaction and cost of complementary and alternative medicine. Complementary and alternative medicine consists of diverse medical and healthcare systems, practices and products that are not considered at present to be a part of conventional medicine. The majority of patients who use complementary and alternative medicine use more than one method. Complementary and alternative medicine use is more common in cases of advanced disease or poor prognosis. This is a descriptive study of complementary and alternative medicine. This study was conducted in the Chemotherapy Unit at Ondokuz Mayıs University, Faculty of Medicine, Samsun, Turkey, between 18 March 2008-30 June 2008. Two hundred fifty-three patients with cancer, among 281 patients who applied to the chemotherapy clinic between these dates, agreed to take part in the study with whom contact could be made were included. A questionnaire including descriptive characteristics in collecting data, characteristics about diseases and their treatments, complementary and alternative medicine information and implementation situations and a control list about complementary and alternative medicine implementations were given. The collected data were evaluated by computer using descriptive statistics, the chi-square test and Student's t-test. In this study, 94·1% of the patients were content with medical treatment, 58·9% of them used complementary and alternative medicine treatments, 41·1% did not use any complementary and alternative medicine treatments. The satisfaction level of the patients with complementary and alternative medicine methods was slightly above mediocre (2·33 SD 0·64, on a scale of 1-3). The average cost per capita spent by the patients using complementary and alternative medicine for all the different methods was US$288·26. It was determined that although patients did not have enough knowledge about complementary and alternative medicine methods, the prevalence of complementary and alternative medicine and satisfaction levels are high that complementary and alternative medicine users spend substantial sums of money for these methods. To sustain medical treatment and prognosis of cancer, it is important for nurses to consult with their patients regarding the use and potential risks of some complementary and alternative medicine. © 2011 Blackwell Publishing Ltd.

Language of publication restrictions in systematic reviews gave different results depending on whether the intervention was conventional or complementary.

PubMed

Pham, Ba'; Klassen, Terry P; Lawson, Margaret L; Moher, David

2005-08-01

To assess whether language of publication restrictions impact the estimates of an intervention's effectiveness, whether such impact is similar for conventional medicine and complementary medicine interventions, and whether the results are influenced by publication bias and statistical heterogeneity. We set out to examine the extent to which including reports of randomized controlled trials (RCTs) in languages other than English (LOE) influences the results of systematic reviews, using a broad dataset of 42 language-inclusive systematic reviews, involving 662 RCTs, including both conventional medicine (CM) and complementary and alternative medicine (CAM) interventions. For CM interventions, language-restricted systematic reviews, compared with language-inclusive ones, did not introduce biased results, in terms of estimates of intervention effectiveness (random effects ration of odds rations ROR=1.02; 95% CI=0.83-1.26). For CAM interventions, however, language-restricted systematic reviews resulted in a 63% smaller protective effect estimate than language-inclusive reviews (random effects ROR=1.63; 95% CI=1.03-2.60). Language restrictions do not change the results of CM systematic reviews but do substantially alter the results of CAM systematic reviews. These findings are robust even after sensitivity analyses, and do not appear to be influenced by statistical heterogeneity and publication bias.

Glycerol, trehalose and glycerol-trehalose mixture effects on thermal stabilization of OCT

NASA Astrophysics Data System (ADS)

Barreca, D.; Laganà, G.; Magazù, S.; Migliardo, F.; Bellocco, E.

2013-10-01

The stabilization effects of trehalose, glycerol and their mixtures on ornithine carbamoyltransferase catalytic activity has been studied as a function of temperature by complementary techniques. The obtained results show that the kinematic viscosities of trehalose (1.0 M) and protein mixture are higher than the one of glycerol plus protein. Changing the trehalose/glycerol ratio, we notice a decrease of the kinematic viscosity values at almost all the analyzed ratio. In particular, the solution composed of 95% trehalose-5% glycerol shows a peculiar behavior. Moreover the trehalose (1.0 M) solution shows the higher OCT thermal stabilization at 343 K, while all the other solutions show minor effects. The smallest stabilizing effect is revealed for the solution that shows the maximum kinematic viscosity. These results support Inelastic Neutron Scattering (INS) and Quasi Elastic Neutron Scattering (QENS) findings, which pointed out a slowing down of the relaxation and diffusive dynamics in some investigated samples.

Guidance and navigation for automatic landing, rollout, and turnoff using MLS and magnetic cable sensors

NASA Technical Reports Server (NTRS)

Pines, S.; Hueschen, R. M.

1978-01-01

This paper describes the navigation and guidance system developed for the TCV B-737, a Langley Field NASA research aircraft, and presents the results of an evaluation during final approach, landing, rollout and turnoff obtained through a nonlinear digital simulation. A Kalman filter (implemented in square root form) and a third order complementary filter were developed and compared for navigation. The Microwave Landing Systems (MLS) is used for all phases of the flight for navigation and guidance. In addition, for rollout and turnoff, a three coil sensor which detects the magnetic field induced by a buried wire in the runway (magnetic leader cable) is used. The outputs of the sensor are processed into measurements of position and heading deviation from the wire. The results show the concept to be both feasible and practical for commercial type aircraft terminal area control.

Measurement of the nonlinear optical response of low-density lipoprotein solutions from patients with periodontitis before and after periodontal treatment: evaluation of cardiovascular risk markers

NASA Astrophysics Data System (ADS)

Monteiro, Andréa M.; Jardini, Maria A. N.; Giampaoli, Viviana; Alves, Sarah; Figueiredo Neto, Antônio M.; Gidlund, Magnus

2012-11-01

The Z-Scan (ZS) technique in the thermal regime has been used to measure the nonlinear optical response of low-density lipoprotein (LDL). The ZS technique is carried out in LDL from 40 patients with chronic periodontitis before and after three, six, and 12 months of periodontal treatment. Clinical parameters such as probing depths, bleeding on probing, total and differential white blood cells counts, lipid profiles, cytokine levels, and antibodies against oxidized LDL are also determined and compared over time. Before the treatment, the ZS experimental results reveal that the LDL particles of these patients are heavily modified. Only after 12 months of the periodontal treatment, the ZS results obtained reveal behavioral characteristics of healthy particles. This conclusion is also supported by complementary laboratorial analysis showing that the periodontal treatment induces systemic changes in several inflammatory markers.

In situ investigation of deformation mechanisms in magnesium-based metal matrix composites

NASA Astrophysics Data System (ADS)

Farkas, Gergely; Choe, Heeman; Máthis, Kristián; Száraz, Zoltán; Noh, Yoonsook; Trojanová, Zuzanka; Minárik, Peter

2015-07-01

We studied the effect of short fibers on the mechanical properties of a magnesium alloy. In particular, deformation mechanisms in a Mg-Al-Sr alloy reinforced with short alumina fibers were studied in situ using neutron diffraction and acoustic emission methods. The fibers' plane orientation with respect to the loading axis was found to be a key parameter, which influences the acting deformation processes, such as twinning or dislocation slip. Furthermore, the twinning activity was much more significant in samples with parallel fiber plane orientation, which was confirmed by both acoustic emission and electron backscattering diffraction results. Neutron diffraction was also used to assist in analyzing the acoustic emission and electron backscattering diffraction results. The simultaneous application of the two in situ methods, neutron diffraction and acoustic emission, was found to be beneficial for obtaining complementary datasets about the twinning and dislocation slip in the magnesium alloys and composites used in this study.

Adhesion of perfume-filled microcapsules to model fabric surfaces.

PubMed

He, Yanping; Bowen, James; Andrews, James W; Liu, Min; Smets, Johan; Zhang, Zhibing

2014-01-01

The retention and adhesion of melamine formaldehyde (MF) microcapsules on a model fabric surface in aqueous solution were investigated using a customised flow chamber technique and atomic force microscopy (AFM). A cellulose film was employed as a model fabric surface. Modification of the cellulose with chitosan was found to increase the retention and adhesion of microcapsules on the model fabric surface. The AFM force-displacement data reveal that bridging forces resulting from the extension of cellulose chains dominate the adhesion between the microcapsule and the unmodified cellulose film, whereas electrostatic attraction helps the microcapsules adhere to the chitosan-modified cellulose film. The correlation between results obtained using these two complementary techniques suggests that the flow chamber device can be potentially used for rapid screening of the effect of chemical modification on the adhesion of microparticles to surfaces, reducing the time required to achieve an optimal formulation.

A power management system for energy harvesting and wireless sensor networks application based on a novel charge pump circuit

NASA Astrophysics Data System (ADS)

Aloulou, R.; De Peslouan, P.-O. Lucas; Mnif, H.; Alicalapa, F.; Luk, J. D. Lan Sun; Loulou, M.

2016-05-01

Energy Harvesting circuits are developed as an alternative solution to supply energy to autonomous sensor nodes in Wireless Sensor Networks. In this context, this paper presents a micro-power management system for multi energy sources based on a novel design of charge pump circuit to allow the total autonomy of self-powered sensors. This work proposes a low-voltage and high performance charge pump (CP) suitable for implementation in standard complementary metal oxide semiconductor (CMOS) technologies. The CP design was implemented using Cadence Virtuoso with AMS 0.35μm CMOS technology parameters. Its active area is 0.112 mm2. Consistent results were obtained between the measured findings of the chip testing and the simulation results. The circuit can operate with an 800 mV supply and generate a boosted output voltage of 2.835 V with 1 MHz as frequency.

Noise and linearity optimization methods for a 1.9GHz low noise amplifier.

PubMed

Guo, Wei; Huang, Da-Quan

2003-01-01

Noise and linearity performances are critical characteristics for radio frequency integrated circuits (RFICs), especially for low noise amplifiers (LNAs). In this paper, a detailed analysis of noise and linearity for the cascode architecture, a widely used circuit structure in LNA designs, is presented. The noise and the linearity improvement techniques for cascode structures are also developed and have been proven by computer simulating experiments. Theoretical analysis and simulation results showed that, for cascode structure LNAs, the first metallic oxide semiconductor field effect transistor (MOSFET) dominates the noise performance of the LNA, while the second MOSFET contributes more to the linearity. A conclusion is thus obtained that the first and second MOSFET of the LNA can be designed to optimize the noise performance and the linearity performance separately, without trade-offs. The 1.9GHz Complementary Metal-Oxide-Semiconductor (CMOS) LNA simulation results are also given as an application of the developed theory.

A compact 5.5 GHz band-rejected UWB antenna using complementary split ring resonators.

PubMed

Islam, M M; Faruque, M R I; Islam, M T

2014-01-01

A band-removal property employing microwave frequencies using complementary split ring resonators (CSRRs) is applied to design a compact UWB antenna wishing for the rejection of some frequency band, which is meanwhile exercised by the existing wireless applications. The reported antenna comprises optimization of a circular radiating patch, in which slotted complementary SRRs are implanted. It is printed on low dielectric FR4 substrate material fed by a partial ground plane and a microstrip line. Validated results exhibit that the reported antenna shows a wide bandwidth covering from 3.45 to more than 12 GHz, with a compact dimension of 22 × 26 mm(2), and VSWR < 2, observing band elimination of 5.5 GHz WLAN band.

Effect of sequencing of complementary feeding in relation to breast-feeding on total intake in infants.

PubMed

Shah, Dheeraj; Singh, Meenakshi; Gupta, Piyush; Faridi, M M A

2014-03-01

The aim of the present study was to evaluate whether the order of complementary feeding in relation to breast-feeding affects breast milk, semisolid, or total energy intake in infants. The present study was designed as a randomized crossover trial. The study was conducted in a tertiary care hospital. The study participants were 25 healthy infants between the ages of 7 and 11 months who were exclusively breast-fed for at least 6 months and were now receiving complementary foods for at least 1 month in addition to breast-feeding. Infants were randomized to follow a sequence of either complementary feeding before breast-feeding (sequence A) or complementary feeding after breast-feeding (sequence B) for the first day (24 hours) of the study period using simple randomization. For the next day, the sequence was reversed for each child. All babies received 3 actively fed complementary food meals per day (morning, afternoon, and evening). A semisolid study diet was prepared in the hospital by cooking rice and pulse with oil using a standard method, ensuring the energy density of at least 0.6 kcal/g. The infants were allowed ad libitum breast-feeding during the observation period. Semisolid intake was directly measured and breast milk intake was quantified by test weighing method. Energy intake from complementary foods was calculated from the product of energy density of the diet served on that day and the total amount consumed. The total energy intake and energy intake from breast milk and complementary foods between the 2 sequences were compared. The mean (standard deviation) energy intake from breast milk during 12 hours of daytime by following sequence A (complementary feeding before breast-feeding) was 132.0 (67.4) kcal in comparison with 135.9 (56.2) kcal in sequence B, which was not statistically different (P = 0.83). The mean (standard deviation) energy consumed from semisolids in sequences A and B was also comparable (88.6 [75.5] kcal vs. 85.5 [89.7] kcal; P = 0.58). The total energy intake during daytime in sequence A was 220.6 (96.2) kcal in comparison with 221.5 (94.0) kcal in sequence B, which was also comparable (P = 0.97). The results related to energy intake through breast milk and total energy intake were not different when insensible losses during feeding were adjusted in both groups. Altering the sequence of complementary feeding in relation to breast-feeding does not affect total energy intake.

Introduction of Complementary Foods to Infants.

PubMed

West, Christina

2017-01-01

While earlier food allergy prevention strategies implemented avoidance of allergenic foods in infancy, the current paradigm is shifting from avoidance to controlled exposure. This review focuses on the outcome of recent randomized controlled trials, which have examined the early introduction of allergenic foods for allergy prevention, and discusses the implementation of results in clinical practice. In infants at high risk of allergic disease, there is now direct evidence that regular early peanut consumption will reduce the prevalence of peanut allergy, compared to avoidance. Many international infant feeding guidelines already recommend complementary foods, including allergenic foods, to be introduced from 4 to 6 months of age irrespective of family history risk. Interim guidelines from 10 International Pediatric Allergy Associations state that healthcare providers should recommend the introduction of peanut-containing products into the diets of infants at high risk of allergic disease in countries where peanut allergy is prevalent. Direct translation of the results obtained from a cohort of high-risk infants to the general population has proved difficult, and issues regarding feasibility, safety, and cost-effectiveness have been raised. Five randomized placebo-controlled trials have assessed the effects of early egg exposure in infancy with varying results. In a recent comprehensive meta-analysis, there was moderate-certainty evidence that early versus late introduction of egg was associated with a reduced egg allergy risk. Although promising, optimal timing, doses, and if the feeding regimen should be stratified according to infant allergy risk remain to be determined. The single study that assessed introduction of multiple foods from 3 months whilst breastfeeding compared with exclusive breastfeeding until 6 months of age showed no reduction in food allergy prevalence. Future research should aim at optimizing infant feeding regimens and support a tolerogenic gastrointestinal microenvironment during the period of food allergen introduction. © 2017 S. Karger AG, Basel.

Evaluation of a modified cleaning procedure in the prevention of carbapenem-resistant Acinetobacter baumannii clonal spread in a burn intensive care unit using a high-sensitivity luminometer.

PubMed

Casini, B; Selvi, C; Cristina, M L; Totaro, M; Costa, A L; Valentini, P; Barnini, S; Baggiani, A; Tagliaferri, E; Privitera, G

2017-01-01

Enhanced environmental cleaning practices are among the most accepted measures for controlling the spread of carbapenem-resistant Acinetobacter baumannii (CR-Ab). To evaluate the impact of heightened cleaning on an ongoing CR-Ab outbreak in a burn intensive care unit (BICU) of an Italian teaching hospital, where chlorhexidine-60% isopropyl alcohol was applied as a complementary disinfectant on high-touch surfaces. Compliance with the microbial limit proposed for the BICU by AFNOR-NF-S90-351 (20 colony-forming units/100cm 2 ) was assessed by plate count, and compared with the results obtained with intracellular adenosine triphosphate (ATP) detection. Genotyping was performed using pulsed-field gel electrophoresis. During the standard cleaning regimen, three out of 23 samples (13%) gave results over the AFNOR limit and five (21.7%) showed unacceptable ATP levels with 100 relative light units/100cm 2 as the benchmark limit (sensibility 86.4%, specificity 92.2%). Following improvement of the cleaning procedure, only two samples out of 50 (4%) did not satisfy the microbiological criteria and seven (14%) exceeded the ATP limit. In a successive phase, eight of 30 samples collected showed unacceptable results (27%). Adding chlorhexidine-60% isopropyl alcohol as complementary disinfectant proved to be effective for reducing environmental microbial contamination, ATP levels and CR-Ab infection/colonization in patients admitted to the BICU. Real-time monitoring by ATP assay was useful for managing the cleaning schedule and reducing hospital infections, although the calculated values must be interpreted as cleanliness indicators rather than risk indicators. Copyright © 2016 The Healthcare Infection Society. Published by Elsevier Ltd. All rights reserved.

A multimodal approach to estimating vigilance using EEG and forehead EOG

NASA Astrophysics Data System (ADS)

Zheng, Wei-Long; Lu, Bao-Liang

2017-04-01

Objective. Covert aspects of ongoing user mental states provide key context information for user-aware human computer interactions. In this paper, we focus on the problem of estimating the vigilance of users using EEG and EOG signals. Approach. The PERCLOS index as vigilance annotation is obtained from eye tracking glasses. To improve the feasibility and wearability of vigilance estimation devices for real-world applications, we adopt a novel electrode placement for forehead EOG and extract various eye movement features, which contain the principal information of traditional EOG. We explore the effects of EEG from different brain areas and combine EEG and forehead EOG to leverage their complementary characteristics for vigilance estimation. Considering that the vigilance of users is a dynamic changing process because the intrinsic mental states of users involve temporal evolution, we introduce continuous conditional neural field and continuous conditional random field models to capture dynamic temporal dependency. Main results. We propose a multimodal approach to estimating vigilance by combining EEG and forehead EOG and incorporating the temporal dependency of vigilance into model training. The experimental results demonstrate that modality fusion can improve the performance compared with a single modality, EOG and EEG contain complementary information for vigilance estimation, and the temporal dependency-based models can enhance the performance of vigilance estimation. From the experimental results, we observe that theta and alpha frequency activities are increased, while gamma frequency activities are decreased in drowsy states in contrast to awake states. Significance. The forehead setup allows for the simultaneous collection of EEG and EOG and achieves comparative performance using only four shared electrodes in comparison with the temporal and posterior sites.

Cancer and Complementary Health Approaches

MedlinePlus

... Cancer Institute's activities in research on complementary health approaches. Toll-free in the U.S.: 1-800-4-CANCER (1-800-422-6237) Web ... complementary health approaches. Information on complementary health approaches in cancer treatment: ...

Complementary and Alternative Medicine for Patients

MedlinePlus

... Ask about Your Treatment Research Complementary and Alternative Medicine for Patients Complementary and alternative medicine (CAM) is ... based on scientific evidence from research studies. Complementary medicine refers to treatments that are used with standard ...

Complementary DNA cloning and molecular evolution of opine dehydrogenases in some marine invertebrates.

PubMed

Kimura, Tomohiro; Nakano, Toshiki; Yamaguchi, Toshiyasu; Sato, Minoru; Ogawa, Tomohisa; Muramoto, Koji; Yokoyama, Takehiko; Kan-No, Nobuhiro; Nagahisa, Eizou; Janssen, Frank; Grieshaber, Manfred K

2004-01-01

The complete complementary DNA sequences of genes presumably coding for opine dehydrogenases from Arabella iricolor (sandworm), Haliotis discus hannai (abalone), and Patinopecten yessoensis (scallop) were determined, and partial cDNA sequences were derived for Meretrix lusoria (Japanese hard clam) and Spisula sachalinensis (Sakhalin surf clam). The primers ODH-9F and ODH-11R proved useful for amplifying the sequences for opine dehydrogenases from the 4 mollusk species investigated in this study. The sequence of the sandworm was obtained using primers constructed from the amino acid sequence of tauropine dehydrogenase, the main opine dehydrogenase in A. iricolor. The complete cDNA sequence of A. iricolor, H. discus hannai, and P. yessoensis encode 397, 400, and 405 amino acids, respectively. All sequences were aligned and compared with published databank sequences of Loligo opalescens, Loligo vulgaris (squid), Sepia officinalis (cuttlefish), and Pecten maximus (scallop). As expected, a high level of homology was observed for the cDNA from closely related species, such as for cephalopods or scallops, whereas cDNA from the other species showed lower-level homologies. A similar trend was observed when the deduced amino acid sequences were compared. Furthermore, alignment of these sequences revealed some structural motifs that are possibly related to the binding sites of the substrates. The phylogenetic trees derived from the nucleotide and amino acid sequences were consistent with the classification of species resulting from classical taxonomic analyses.

Complexes of mismatched and complementary DNA with minor groove binders. Structures at nucleotide resolution via an improved hydroxyl radical cleavage methodology.

PubMed

Bialonska, Dobroslawa; Song, Kenneth; Bolton, Philip H

2011-11-27

Tumor cell lines can replicate faster than normal cells and many also have defective DNA repair pathways. This has lead to the investigation of the inhibition of DNA repair proteins as a means of therapeutic intervention. An alternative approach is to hide or mask damaged DNA from the repair systems. We have developed a protocol to investigate the structures of the complexes of damaged DNA with drug like molecules. Nucleotide resolution structural information can be obtained using an improved hydroxyl radical cleavage protocol. The use of a dT(n) tail increases the length of the smallest fragments of interest and allows efficient co-precipitation of the fragments with poly(A). The use of a fluorescent label, on the 5' end of the dT(n) tail, in conjunction with modified cleavage reaction conditions, avoids the lifetime and other problems with (32)P labeling. The structures of duplex DNAs containing AC and CC mismatches in the presence and absence of minor groove binders have been investigated as have those of the fully complementary DNA. The results indicate that the structural perturbations of the mismatches are localized, are sequence dependent and that the presence of a mismatch can alter the binding of drug like molecules. Copyright © 2011 Elsevier B.V. All rights reserved.

Synthesis and fluorescence studies of multiple labeled oligonucleotides containing dansyl fluorophore covalently attached at 2'-terminus of cytidine via carbamate linkage.

PubMed

Misra, Arvind; Mishra, Satyendra; Misra, Krishna

2004-01-01

Synthesis of modified oligonucleotides in which the specific cytidine nucleoside analogues linked at 2'-OH position via a carbamate bond with an amino ethyl derivative of dansyl fluorophore is reported. For the multiple labeling of oligonucleotides, a strategy involving prelabeling at the monomeric level followed by solid phase assembly of oligonucleotides to obtain regiospecifically labeled probes has been described. The labeled monomer was phosphitylated using 2-cyanoethyl-N,N,N',N'-tetraisopropyl-phosphoramidite (Bis-reagent) and pyridiniumtrifluoro acetate (Py.TFA) as an activator. To ascertain the minimal number of labeled monomers required for a specific length of oligonucleotide for detection and also to assess the effect of carbamate linkage on hybridization, hexamer and 20-mer sequences were selected. Both were labeled with 1, 2, and 3 monomers at the 5'-end and hybridized with normal (unmodified) complementary sequences. As compared to midsequence or 3'-terminal labeling reported earlier, the 5'-terminal labeling has been found to have minimal contact-mediated quenching on duplex formation. This may be due to complementary deoxyguanosine (dG) rich oligonucleotide sequences or CG base pairs at a terminus that is known to yield stronger binding. This is one reason for selecting cytidine for labeling. The results may aid rational design of multiple fluorescent DNA probes for nonradioactive detection of nucleic acids.

Application of process analytical technology for monitoring freeze-drying of an amorphous protein formulation: use of complementary tools for real-time product temperature measurements and endpoint detection.

PubMed

Schneid, Stefan C; Johnson, Robert E; Lewis, Lavinia M; Stärtzel, Peter; Gieseler, Henning

2015-05-01

Process analytical technology (PAT) and quality by design have gained importance in all areas of pharmaceutical development and manufacturing. One important method for monitoring of critical product attributes and process optimization in laboratory scale freeze-drying is manometric temperature measurement (MTM). A drawback of this innovative technology is that problems are encountered when processing high-concentrated amorphous materials, particularly protein formulations. In this study, a model solution of bovine serum albumin and sucrose was lyophilized at both conservative and aggressive primary drying conditions. Different temperature sensors were employed to monitor product temperatures. The residual moisture content at primary drying endpoints as indicated by temperature sensors and batch PAT methods was quantified from extracted sample vials. The data from temperature probes were then used to recalculate critical product parameters, and the results were compared with MTM data. The drying endpoints indicated by the temperature sensors were not suitable for endpoint indication, in contrast to the batch methods endpoints. The accuracy of MTM Pice data was found to be influenced by water reabsorption. Recalculation of Rp and Pice values based on data from temperature sensors and weighed vials was possible. Overall, extensive information about critical product parameters could be obtained using data from complementary PAT tools. © 2015 Wiley Periodicals, Inc. and the American Pharmacists Association.

Metabolomic Fingerprinting in the Comprehensive Study of Liver Changes Associated with Onion Supplementation in Hypercholesterolemic Wistar Rats

PubMed Central

González-Peña, Diana; Dudzik, Danuta; García, Antonia; de Ancos, Begoña; Barbas, Coral; Sánchez-Moreno, Concepción

2017-01-01

The consumption of functional ingredients has been suggested to be a complementary tool for the prevention and management of liver disease. In this light, processed onion can be considered as a source of multiple bioactive compounds with hepatoprotective properties. The liver fingerprint of male Wistar rats (n = 24) fed with three experimental diets (control (C), high-cholesterol (HC), and high-cholesterol enriched with onion (HCO) diets) was obtained through a non-targeted, multiplatform metabolomics approach to produce broad metabolite coverage. LC-MS, CE-MS and GC-MS results were subjected to univariate and multivariate analyses, providing a list of significant metabolites. All data were merged in order to figure out the most relevant metabolites that were modified by the onion ingredient. Several relevant metabolic changes and related metabolic pathways were found to be impacted by both HC and HCO diet. The model highlighted several metabolites (such as hydroxybutyryl carnitine and palmitoyl carnitine) modified by the HCO diet. These findings could suggest potential impairments in the energy−lipid metabolism, perturbations in the tricarboxylic acid cycle (TCA) cycle and β-oxidation modulated by the onion supplementation in the core of hepatic dysfunction. Metabolomics shows to be a valuable tool to evaluate the effects of complementary dietetic approaches directed to hepatic damage amelioration or non-alcoholic fatty liver disease (NAFLD) prevention. PMID:28134852

HUNT: launch of a full-length cDNA database from the Helix Research Institute.

PubMed

Yudate, H T; Suwa, M; Irie, R; Matsui, H; Nishikawa, T; Nakamura, Y; Yamaguchi, D; Peng, Z Z; Yamamoto, T; Nagai, K; Hayashi, K; Otsuki, T; Sugiyama, T; Ota, T; Suzuki, Y; Sugano, S; Isogai, T; Masuho, Y

2001-01-01

The Helix Research Institute (HRI) in Japan is releasing 4356 HUman Novel Transcripts and related information in the newly established HUNT database. The institute is a joint research project principally funded by the Japanese Ministry of International Trade and Industry, and the clones were sequenced in the governmental New Energy and Industrial Technology Development Organization (NEDO) Human cDNA Sequencing Project. The HUNT database contains an extensive amount of annotation from advanced analysis and represents an essential bioinformatics contribution towards understanding of the gene function. The HRI human cDNA clones were obtained from full-length enriched cDNA libraries constructed with the oligo-capping method and have resulted in novel full-length cDNA sequences. A large fraction has little similarity to any proteins of known function and to obtain clues about possible function we have developed original analysis procedures. Any putative function deduced here can be validated or refuted by complementary analysis results. The user can also extract information from specific categories like PROSITE patterns, PFAM domains, PSORT localization, transmembrane helices and clones with GENIUS structure assignments. The HUNT database can be accessed at http://www.hri.co.jp/HUNT.

Controlling charge current through a DNA based molecular transistor

NASA Astrophysics Data System (ADS)

Behnia, S.; Fathizadeh, S.; Ziaei, J.

2017-01-01

Molecular electronics is complementary to silicon-based electronics and may induce electronic functions which are difficult to obtain with conventional technology. We have considered a DNA based molecular transistor and study its transport properties. The appropriate DNA sequence as a central chain in molecular transistor and the functional interval for applied voltages is obtained. I-V characteristic diagram shows the rectifier behavior as well as the negative differential resistance phenomenon of DNA transistor. We have observed the nearly periodic behavior in the current flowing through DNA. It is reported that there is a critical gate voltage for each applied bias which above it, the electrical current is always positive.

Complementary studies of lipid membrane dynamics using iSCAT and super-resolved fluorescence correlation spectroscopy

NASA Astrophysics Data System (ADS)

Reina, Francesco; Galiani, Silvia; Shrestha, Dilip; Sezgin, Erdinc; de Wit, Gabrielle; Cole, Daniel; Lagerholm, B. Christoffer; Kukura, Philipp; Eggeling, Christian

2018-06-01

Observation techniques with high spatial and temporal resolution, such as single-particle tracking based on interferometric scattering (iSCAT) microscopy, and fluorescence correlation spectroscopy applied on a super-resolution STED microscope (STED-FCS), have revealed new insights of the molecular organization of membranes. While delivering complementary information, there are still distinct differences between these techniques, most prominently the use of fluorescent dye tagged probes for STED-FCS and a need for larger scattering gold nanoparticle tags for iSCAT. In this work, we have used lipid analogues tagged with a hybrid fluorescent tag–gold nanoparticle construct, to directly compare the results from STED-FCS and iSCAT measurements of phospholipid diffusion on a homogeneous supported lipid bilayer (SLB). These comparative measurements showed that while the mode of diffusion remained free, at least at the spatial (>40 nm) and temporal (50  ⩽  t  ⩽  100 ms) scales probed, the diffussion coefficient was reduced by 20- to 60-fold when tagging with 20 and 40 nm large gold particles as compared to when using dye tagged lipid analogues. These FCS measurements of hybrid fluorescent tag–gold nanoparticle labeled lipids also revealed that commercially supplied streptavidin-coated gold nanoparticles contain large quantities of free streptavidin. Finally, the values of apparent diffusion coefficients obtained by STED-FCS and iSCAT differed by a factor of 2–3 across the techniques, while relative differences in mobility between different species of lipid analogues considered were identical in both approaches. In conclusion, our experiments reveal that large and potentially cross-linking scattering tags introduce a significant slow-down in diffusion on SLBs but no additional bias, and our labeling approach creates a new way of exploiting complementary information from STED-FCS and iSCAT measurements.

A multimodal approach to estimating vigilance using EEG and forehead EOG.

PubMed

Zheng, Wei-Long; Lu, Bao-Liang

2017-04-01

Covert aspects of ongoing user mental states provide key context information for user-aware human computer interactions. In this paper, we focus on the problem of estimating the vigilance of users using EEG and EOG signals. The PERCLOS index as vigilance annotation is obtained from eye tracking glasses. To improve the feasibility and wearability of vigilance estimation devices for real-world applications, we adopt a novel electrode placement for forehead EOG and extract various eye movement features, which contain the principal information of traditional EOG. We explore the effects of EEG from different brain areas and combine EEG and forehead EOG to leverage their complementary characteristics for vigilance estimation. Considering that the vigilance of users is a dynamic changing process because the intrinsic mental states of users involve temporal evolution, we introduce continuous conditional neural field and continuous conditional random field models to capture dynamic temporal dependency. We propose a multimodal approach to estimating vigilance by combining EEG and forehead EOG and incorporating the temporal dependency of vigilance into model training. The experimental results demonstrate that modality fusion can improve the performance compared with a single modality, EOG and EEG contain complementary information for vigilance estimation, and the temporal dependency-based models can enhance the performance of vigilance estimation. From the experimental results, we observe that theta and alpha frequency activities are increased, while gamma frequency activities are decreased in drowsy states in contrast to awake states. The forehead setup allows for the simultaneous collection of EEG and EOG and achieves comparative performance using only four shared electrodes in comparison with the temporal and posterior sites.

Functional studies of RYR1 mutations in the skeletal muscle ryanodine receptor using human RYR1 complementary DNA.

PubMed

Sato, Keisaku; Pollock, Neil; Stowell, Kathryn M

2010-06-01

Malignant hyperthermia is associated with mutations within the gene encoding the skeletal muscle ryanodine receptor, the calcium channel that releases Ca from sarcoplasmic reticulum stores triggering muscle contraction, and other metabolic activities. More than 200 variants have been identified in the ryanodine receptor, but only some of these have been shown to functionally affect the calcium channel. To implement genetic testing for malignant hyperthermia, variants must be shown to alter the function of the channel. A number of different ex vivo methods can be used to demonstrate functionality, as long as cells from human patients can be obtained and cultured from at least two unrelated families. Because malignant hyperthermia is an uncommon disorder and many variants seem to be private, including the newly identified H4833Y mutation, these approaches are limited. The authors cloned the human skeletal muscle ryanodine receptor complementary DNA and expressed both normal and mutated forms in HEK-293 cells and carried out functional analysis using ryanodine binding assays in the presence of a specific agonist, 4-chloro-m-cresol, and the antagonist Mg. Transiently expressed human ryanodine receptor proteins colocalized with an endoplasmic reticulum marker in HEK-293 cells. Ryanodine binding assays confirmed that mutations causing malignant hyperthermia resulted in a hypersensitive channel, while those causing central core disease resulted in a hyposensitive channel. The functional assays validate recombinant human skeletal muscle ryanodine receptor for analysis of variants and add an additional mutation (H4833Y) to the repertoire of mutations that can be used for the genetic diagnosis of malignant hyperthermia.

Nurses’ Knowledge and Attitudes toward Complementary Therapies for Cancer: A Review of the Literature

PubMed Central

Christina, Juliana; Abigail, Wendy; Cuthbertson, Lesley A.

2016-01-01

Complementary therapies (CTs) are nonconventional supportive therapies, which are used by the patients with cancer. The use of CTs has been known to alleviate symptoms as a result of chemotherapy and to improve quality of life. However, if CTs are inappropriately used, there may be adverse reactions or no effect resulting in poor support of the cancer treatment. Nurses play an important role in supporting patients with cancer who often seek information regarding CTs. Within their scope of practice, it is expected that nurses have sufficient knowledge about the safety and effective use of CTs, and positive attitudes toward supporting patients who wish to use CTs. This review aims to examine existing literature regarding nurses’ knowledge and attitudes toward CTs for patients with cancer. English language articles obtained from recognized nursing and midwifery databases such as CINAHL, Google Scholar, Medline, ProQuest Central, and Scopus for the period between 2002 and 2015 were searched. A total of 96 articles were retrieved using the search terms with only 13 eligible articles meeting the inclusion criteria. Three major themes were identified by the thematic analysis of reviewed studies: nurses’ knowledge about CTs, nurses’ attitudes toward CTs, and sources information about CTs. The majority of studies investigating nurses’ knowledge and attitudes toward the use of CTs for oncology was conducted in developed countries. Overall, it was identified that nurses need to improve their knowledge and skills about CTs so that they were more confident to assist patients in integrating conventional treatment and CTs for cancer management. PMID:27981167

Nurses' Knowledge and Attitudes toward Complementary Therapies for Cancer: A Review of the Literature.

PubMed

Christina, Juliana; Abigail, Wendy; Cuthbertson, Lesley A

2016-01-01

Complementary therapies (CTs) are nonconventional supportive therapies, which are used by the patients with cancer. The use of CTs has been known to alleviate symptoms as a result of chemotherapy and to improve quality of life. However, if CTs are inappropriately used, there may be adverse reactions or no effect resulting in poor support of the cancer treatment. Nurses play an important role in supporting patients with cancer who often seek information regarding CTs. Within their scope of practice, it is expected that nurses have sufficient knowledge about the safety and effective use of CTs, and positive attitudes toward supporting patients who wish to use CTs. This review aims to examine existing literature regarding nurses' knowledge and attitudes toward CTs for patients with cancer. English language articles obtained from recognized nursing and midwifery databases such as CINAHL, Google Scholar, Medline, ProQuest Central, and Scopus for the period between 2002 and 2015 were searched. A total of 96 articles were retrieved using the search terms with only 13 eligible articles meeting the inclusion criteria. Three major themes were identified by the thematic analysis of reviewed studies: nurses' knowledge about CTs, nurses' attitudes toward CTs, and sources information about CTs. The majority of studies investigating nurses' knowledge and attitudes toward the use of CTs for oncology was conducted in developed countries. Overall, it was identified that nurses need to improve their knowledge and skills about CTs so that they were more confident to assist patients in integrating conventional treatment and CTs for cancer management.

Optimizing Telehealth Strategies for Subspecialty Care: Recommendations from Rural Pediatricians

PubMed Central

Demirci, Jill R.; Bogen, Debra L.; Mehrotra, Ateev; Miller, Elizabeth

2015-01-01

Abstract Background: Telehealth offers strategies to improve access to subspecialty care for children in rural communities. Rural pediatrician experiences and preferences regarding the use of these telehealth strategies for children's subspecialty care needs are not known. We elicited rural pediatrician experiences and preferences regarding different pediatric subspecialty telehealth strategies. Materials and Methods: Seventeen semistructured telephone interviews were conducted with rural pediatricians from 17 states within the United States. Interviewees were recruited by e-mails to a pediatric rural health listserv and to rural pediatricians identified through snowball sampling. Themes were identified through thematic analysis of interview transcripts. Institutional Review Board approval was obtained. Results: Rural pediatricians identified several telehealth strategies to improve access to subspecialty care, including physician access hotlines, remote electronic medical record access, electronic messaging systems, live video telemedicine, and telehealth triage systems. Rural pediatricians provided recommendations for optimizing the utility of each of these strategies based on their experiences with different systems. Rural pediatricians preferred specific telehealth strategies for specific clinical contexts, resulting in a proposed framework describing the complementary role of different telehealth strategies for pediatric subspecialty care. Finally, rural pediatricians identified additional benefits associated with the use of telehealth strategies and described a desire for telehealth systems that enhanced (rather than replaced) personal relationships between rural pediatricians and subspecialists. Conclusions: Rural pediatricians described complementary roles for different subspecialty care telehealth strategies. Additionally, rural pediatricians provided recommendations for optimizing individual telehealth strategies. Input from rural pediatricians will be crucial for optimizing specific telehealth strategies and designing effective telehealth systems. PMID:25919585

Nutrition education and introduction of broad bean-based complementary food improves knowledge and dietary practices of caregivers and nutritional status of their young children in Hula, Ethiopia.

PubMed

Negash, Canaan; Belachew, Tefera; Henry, Carol J; Kebebu, Afework; Abegaz, Kebede; Whiting, Susan J

2014-12-01

Nutritious complementary foods are needed in countries where undernutrition and stunting are major problems, but mothers may be reluctant to change from traditional gruels. To test whether a recipe-based complementary feeding education intervention would improve knowledge and practice of mothers with young children in Hula, Ethiopia. A baseline survey of 200 eligible, randomly selected mother-child pairs gathered data on sociodemographic characteristics, food security status, knowledge and practices concerning complementary feeding, food group intakes of children aged 6 to 23 months by 24-hour recalls, and children's anthropometric measurements. Twice a month for 6 months, women in the intervention group received an education session consisting of eight specific messages using Alive and Thrive posters and a demonstration and tasting of a local barley and maize porridge recipe containing 30% broad beans. The control group lived in a different area and had no intervention. At 6 months, knowledge and practice scores regarding complementary feeding were significantly improved (p < .001) in the intervention group but not in the control group. The intervention resulted in improvement of children's dietary diversity, as well as mean intake of energy and selected nutrients, compared with children in the control group. Changes in height and weight did not differ between the two groups. Community-based nutrition education over 6 months that included demonstration of a local porridge recipe with broad beans added improved the complementary feeding practices of caregivers and the nutritional status of their young children.

Use of complementary and alternative medicine by patients with hematological diseases experience at a university hospital in northeast Mexico.

PubMed

Jaime-Pérez, José Carlos; Chapa-Rodríguez, Adrián; Rodríguez-Martínez, Marisol; Colunga-Pedraza, Perla Rocío; Marfil-Rivera, Luis Javier; Gómez-Almaguer, David

2012-01-01

Complementary and alternative medicine includes a diverse group of medical and healthcare systems, practices and products not considered part of conventional medicine. Although there is information on unconventional practices in oncological diseases, specific data regarding the use of complementary and alternative medicine by hematology patients is scarce. The aim of this study is to document the prevalence of this modality of unconventional therapy in patients with malignant and benign hematological diseases, particularly children with acute lymphoblastic leukemia. An observational study of adult patients and guardians of children with malignant or benign hematological diseases was carried out by applying a structured questionnaire detailing the use and results of the most prevalent complementary and alternative medicine practices. One hundred and twenty patients were included; 104 had malignant and 16 had benign hematological diseases. The use of complementary and alternative medicine was greater in benign diseases but the difference was not statistically significant (64.7% versus 41.7%; p-value = 0.08). Patients and guardians with high school or college educations used these alternative practices more than patients with less schooling (60.7% versus 54.7%; p-value = 0.032). The use of folk remedies was most prevalent followed by herbal preparations and spiritual healing. Sixty-four percent of patients that used these unconventional practices reported improvement in their symptoms and increased capacity to perform daily activities. No significant difference was documented between patients with malignant or benign hematological diseases using these alternative practices. The majority of complementary and alternative medicine users reported improvement of the disease or chemotherapy-related symptoms.

Evaluation of employees in public day care centers knowledge about breastfeeding and complementary feeding

PubMed Central

Souza, Joelânia Pires de O.; Prudente, Amanda Moura; Silva, Dyene Aparecida; Pereira, Leandro Alves; Rinaldi, Ana Elisa M.

2013-01-01

OBJECTIVE: To evaluate the knowledge of public day care centers employees about breastfeeding and complementary feeding. METHODS: A cross-sectional study was conducted in 15 public day care centers randomly selected in the city of Uberlandia, Southeast Brazil. A questionnaire applied to school principals, teachers, educators and general services assistants (GSA) included demographic and socioeconomic variables and questions about knowledge on breastfeeding, complementary feeding besides employees' perceptions about these subjects. Kruskal-Wallis with multiple comparison and chi-square tests were used to compare variables by professional category. RESULTS: 304 employees participated in the study. The highest percentages of correct answers were noted for questions about exclusive breastfeeding: definition - 97% (n=296) and duration - 65% (n=199). Regarding complementary feeding, 61% (n=187) correctly answered about the appropriate age to introduce it, with a lower percentage for meat (56%; n=170) and sugar (16%; n=50). Concerning employees' perceptions, 9% (n=29) believed that there is weak breast milk, 79% (n=241) and 51% (n=157) reported the negative influence of bottle feeding and pacifier use on breastfeeding. Among the interviewed subjects, 77% (n=234) answered that they had a positive influence on the quality of the food given to the children. There were no differences in the answers according to professional category, except for the negative influence of pacifiers on breastfeeding. CONCLUSIONS: Employees of public day care centers knew more about breastfeeding than about complementary feeding. Educational activities about breastfeeding and complementary feeding are necessary for day care centers employees. PMID:24473953

Brucella ovis PA mutants for outer membrane proteins Omp10, Omp19, SP41, and BepC are not altered in their virulence and outer membrane properties.

PubMed

Sidhu-Muñoz, Rebeca S; Sancho, Pilar; Vizcaíno, Nieves

2016-04-15

Mutants in several genes have been obtained on the genetic background of virulent rough (lacking O-polysaccharide) Brucella ovis PA. The target genes encode outer membrane proteins previously associated with the virulence of smooth (bearing O-polysaccharide chains in the lipopolysaccharide) Brucella strains. Multiple attempts to delete omp16, coding for a homologue to peptidoglycan-associated lipoproteins, were unsuccessful, which suggests that Omp16 is probably essential for in vitro survival of B. ovis PA. Single deletion of omp10 or omp19-that encode two other outer membrane lipoproteins--was achieved, but the simultaneous removal of both genes failed, suggesting an essential complementary function between both proteins. Two other deletion mutants, defective in the Tol-C-homologue BepC or in the SP41 adhesin, were also obtained. Surprisingly when compared to previous results obtained with smooth Brucella, none of the B. ovis mutants showed attenuation in the virulence, either in the mouse model or in cellular models of professional and non-professional phagocytes. Additionally, and in contrast to the observations reported with smooth Brucella strains, several properties related to the outer membrane remained almost unaltered. These results evidence new distinctive traits between naturally rough B. ovis and smooth brucellae. Copyright © 2016 Elsevier B.V. All rights reserved.

Airborne Infrared and Visible Image Fusion Combined with Region Segmentation

PubMed Central

Zuo, Yujia; Liu, Jinghong; Bai, Guanbing; Wang, Xuan; Sun, Mingchao

2017-01-01

This paper proposes an infrared (IR) and visible image fusion method introducing region segmentation into the dual-tree complex wavelet transform (DTCWT) region. This method should effectively improve both the target indication and scene spectrum features of fusion images, and the target identification and tracking reliability of fusion system, on an airborne photoelectric platform. The method involves segmenting the region in an IR image by significance, and identifying the target region and the background region; then, fusing the low-frequency components in the DTCWT region according to the region segmentation result. For high-frequency components, the region weights need to be assigned by the information richness of region details to conduct fusion based on both weights and adaptive phases, and then introducing a shrinkage function to suppress noise; Finally, the fused low-frequency and high-frequency components are reconstructed to obtain the fusion image. The experimental results show that the proposed method can fully extract complementary information from the source images to obtain a fusion image with good target indication and rich information on scene details. They also give a fusion result superior to existing popular fusion methods, based on eithers subjective or objective evaluation. With good stability and high fusion accuracy, this method can meet the fusion requirements of IR-visible image fusion systems. PMID:28505137

Airborne Infrared and Visible Image Fusion Combined with Region Segmentation.

PubMed

Zuo, Yujia; Liu, Jinghong; Bai, Guanbing; Wang, Xuan; Sun, Mingchao

2017-05-15

This paper proposes an infrared (IR) and visible image fusion method introducing region segmentation into the dual-tree complex wavelet transform (DTCWT) region. This method should effectively improve both the target indication and scene spectrum features of fusion images, and the target identification and tracking reliability of fusion system, on an airborne photoelectric platform. The method involves segmenting the region in an IR image by significance, and identifying the target region and the background region; then, fusing the low-frequency components in the DTCWT region according to the region segmentation result. For high-frequency components, the region weights need to be assigned by the information richness of region details to conduct fusion based on both weights and adaptive phases, and then introducing a shrinkage function to suppress noise; Finally, the fused low-frequency and high-frequency components are reconstructed to obtain the fusion image. The experimental results show that the proposed method can fully extract complementary information from the source images to obtain a fusion image with good target indication and rich information on scene details. They also give a fusion result superior to existing popular fusion methods, based on eithers subjective or objective evaluation. With good stability and high fusion accuracy, this method can meet the fusion requirements of IR-visible image fusion systems.

Simulations and experiments on vibration damping for zoom-holography and nano-scanning at the GINIX

NASA Astrophysics Data System (ADS)

Osterhoff, Markus; Luley, Peter; Sprung, Michael; Salditt, Tim

2017-09-01

The Göttingen Instrument for Nano-Imaging with X-ray (GINIX) is a holography endstation located at the P10 coherence beamline at PETRA III, designed and operated by the University of Göttingen in close collaboration with DESY Photon science Hamburg [1-2]. GINIX is designed as a waveguide based holography experiment with a Kirkpatrick-Baez nanofocus. Its versatility has stimulated a great manifold of imaging modalities. Today, users choose the GINIX setup not only for its few nm coherent waveguide beams (e.g. for ptychography or holography), but also to carry out scanning SAXS measurements to probe local anisotropies with sub-micron real-space and even higher reciprocal space resolution. In addition, it is possible to combine different detectors for e.g. simultaneous SAXS/WAXS and fluorescence measurements [3]. We summarise our ongoing efforts to reduce vibrations in the setup, and present latest experimental results obtained with GINIX, focusing on the unique capabilities offered by its versatile and flexible design. The overview includes results from different imaging schemes such as waveguide based zoom-tomography and user examples in WAXS geometry. We show how to correlate complementary techniques like holography and scanning SAXS and present first results obtained using a new fast sample scanner for Multilayer Zone Plate imaging..

Patient Use of Complementary and Alternative Medicines in an Outpatient Pediatric Neurology Clinic.

PubMed

Kenney, Daniel; Jenkins, Sarah; Youssef, Paul; Kotagal, Suresh

2016-05-01

This article describes the use of complementary and alternative medicines in an outpatient pediatric neurology clinic, and assesses family attitudes toward the efficacy of complementary and alternative medicines versus prescription medications. Complementary and alternative medicine is an important element of the modern health care landscape. There is limited information about whether, and to what extent, families perceive its utility in childhood neurological disorders. Surveys were distributed to 500 consecutive patients at a child neurology clinic in Rochester, Minnesota. Questions pertained to the child's diagnoses, use of complementary and alternative medicines, and the specific complementary and alternative medicine modalities that were used. Opinions were also gathered on the perceived efficacy of complementary and alternative medicines and prescription medications. Data were compared using χ(2) or Fisher exact tests as indicated. A total of 484 surveys were returned, of which 327 were usable. Only 17.4% admitted to use of complementary and alternative medicine to treat neurological problems. However, in follow-up questioning, actually 41.6% of patients recognized that they were using one or more types of complementary and alternative medicines. Disorders associated with a statistically significant increased prevalence of complementary and alternative medicine use were headache (50.8% with headache used complementary and alternative medicine versus 35.7% without headache; P = 0.008, Fisher exact test), chronic fatigue (63.2% vs 38.8%; P = 0.005, Fisher exact test), and sleep disorders (77.1% vs 37.3%; P < 0.0001, Fisher exact test). A large proportion of pediatric neurology patients in our clinic are also using complementary and alternative medicine. Only 38.5% of these recognize themselves as using complementary and alternative medicine, underlining the need to inquire in-depth about its use. Patients who are less satisfied with their prescription medications are more likely to use complementary and alternative medicine, perhaps reflecting the less tractable nature of their disorders. Copyright © 2016 Elsevier Inc. All rights reserved.

Methods for the Measurement of a Bacterial Enzyme Activity in Cell Lysates and Extracts

PubMed Central

Mendz, George; Hazell, Stuart

1998-01-01

The kinetic characteristics and regulation of aspartate carbamoyltransferase activity were studied in lysates and cell extracts of Helicobacter pylori by three diffirent methods. Nuclear magnetic resonance spectroscopy, radioactive tracer analysis, and spectrophotometry were employed in conjunction to identify the properties of the enzyme activity and to validate the results obtained with each assay. NMR spectroscopy was the most direct method to provide proof of ACTase activity; radioactive tracer analysis was the most sensitive technique and a microtitre-based colorimetric assay was the most cost-and time-efficient for large scale analyses. Freeze-thawing was adopted as the preferred method for cell lysis in studying enzyme activity in situ. This study showed the benefits of employing several different complementary methods to investigate bacterial enzyme activity. PMID:12734591

Effects of Different Buffers on the Construction of Aptamer Sensors

NASA Astrophysics Data System (ADS)

Yu, Quan; Dai, Zhao; Wu, Wenjing; Zhu, Haijia; Ji, Luyu

2017-12-01

In this paper, the effect of different buffers, PBS and TBE, on the construction of an aptamer sensor (apt sensor) for ATP was investigated. The apt sensor was based on fluorescence energy resonance transfer (FRET), when the energy donor was 5'-carboxyfluorescein (5'-FAM) and the energy receptor was Au nanoparticles (AuNPs), respectively. Both the donor and acceptor were conjugated with complementary and single stranded DNA (ssDNA). The fluorescent changes of the sensors were measured to investigate the influence of different buffers during the whole preparation and detection process. The results indicated that when the AuNPs and ssDNA (Au-DNA1) were conjugated in PBS buffer, the corresponding apt sensors would obtain a better detection ability of ATP than in TBE buffer.

Obstacle Detection using Binocular Stereo Vision in Trajectory Planning for Quadcopter Navigation

NASA Astrophysics Data System (ADS)

Bugayong, Albert; Ramos, Manuel, Jr.

2018-02-01

Quadcopters are one of the most versatile unmanned aerial vehicles due to its vertical take-off and landing as well as hovering capabilities. This research uses the Sum of Absolute Differences (SAD) block matching algorithm for stereo vision. A complementary filter was used in sensor fusion to combine obtained quadcopter orientation data from the accelerometer and the gyroscope. PID control was implemented for the motor control and VFH+ algorithm was implemented for trajectory planning. Results show that the quadcopter was able to consistently actuate itself in the roll, yaw and z-axis during obstacle avoidance but was however found to be inconsistent in the pitch axis during forward and backward maneuvers due to the significant noise present in the pitch axis angle outputs compared to the roll and yaw axes.

Experimental evidence of multimaterial jet formation with lasers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nicolaie, Ph.; Stenz, C.; Tikhonchuk, V.

2010-11-15

Laser-produced multimaterial jets have been investigated at the Prague Asterix Laser System laser [K. Jungwirth et al., Phys. Plasmas 8, 2495 (2001)]. The method of jet production is based on the laser-plasma ablation process and proved to be easy to set up and robust. The possibility of multimaterial laboratory jet production is demonstrated and complex hydrodynamic flows in the jet body are obtained. Two complementary diagnostics in the optical ray and x-ray ranges provide detailed information about jet characteristics. The latter are in agreement with estimates and two-dimensional radiation hydrodynamic simulation results. The experiment provides a proof of principle thatmore » a velocity field could be produced and controlled in the jet body. It opens a possibility of astrophysical jet structure modeling in laboratory.« less

Air and blood fluid dynamics: at the interface between engineering and medicine

NASA Astrophysics Data System (ADS)

Pollard, A.; Secretain, F.; Milne, B.

2014-08-01

The flows in the human upper airway and human heart during open heart surgery are considered. Beginning with idealized models of the human upper airway, current methods to extract realistic airway geometries using a novel implementation of optical coherent tomography modality are introduced. Complementary direct numerical simulations are considered that will assist in pre-surgery planning for obstructive sleep apnea. Cardiac air bubbles often arise during open heart surgery. These bubbles are potential emboli that can cause neurological impairment and even death. An experimental programme is outlined that uses acoustic sound to instil bubble surface oscillations that result in bubble breakup. A novel algorithm is introduced that enables a surgical team to obtain real-time in-vivo bubble data to aid cardiac de-airation procedures.

Probing the dark energy with quasar clustering.

PubMed

Calvão, M O; de Mello Neto, J R T; Waga, I

2002-03-04

We show through Monte Carlo simulations that the Alcock-Paczyński test, as applied to quasar clustering, is a powerful tool to probe the cosmological density and equation of state parameters Omega(m0), Omega(x0), and w. By taking into account the effect of peculiar velocities upon the correlation function we obtain for the Two-Degree Field QSO Redshift Survey the predicted confidence contours for the cosmological constant (w = -1) and spatially flat (Omega(m0)+Omega(x0) = 1) cases. For w = -1, the test is especially sensitive to the difference Omega(m0)-Omega(Lambda0), thus being ideal to combine with cosmic microwave background results. For the flat case, it is competitive with future supernova and galaxy number count tests, besides being complementary to them.

SWAT system performance predictions

NASA Astrophysics Data System (ADS)

Parenti, Ronald R.; Sasiela, Richard J.

1993-03-01

In the next phase of Lincoln Laboratory's SWAT (Short-Wavelength Adaptive Techniques) program, the performance of a 241-actuator adaptive-optics system will be measured using a variety of synthetic-beacon geometries. As an aid in this experimental investigation, a detailed set of theoretical predictions has also been assembled. The computational tools that have been applied in this study include a numerical approach in which Monte-Carlo ray-trace simulations of accumulated phase error are developed, and an analytical analysis of the expected system behavior. This report describes the basis of these two computational techniques and compares their estimates of overall system performance. Although their regions of applicability tend to be complementary rather than redundant, good agreement is usually obtained when both sets of results can be derived for the same engagement scenario.

On structure-exploiting trust-region regularized nonlinear least squares algorithms for neural-network learning.

PubMed

Mizutani, Eiji; Demmel, James W

2003-01-01

This paper briefly introduces our numerical linear algebra approaches for solving structured nonlinear least squares problems arising from 'multiple-output' neural-network (NN) models. Our algorithms feature trust-region regularization, and exploit sparsity of either the 'block-angular' residual Jacobian matrix or the 'block-arrow' Gauss-Newton Hessian (or Fisher information matrix in statistical sense) depending on problem scale so as to render a large class of NN-learning algorithms 'efficient' in both memory and operation costs. Using a relatively large real-world nonlinear regression application, we shall explain algorithmic strengths and weaknesses, analyzing simulation results obtained by both direct and iterative trust-region algorithms with two distinct NN models: 'multilayer perceptrons' (MLP) and 'complementary mixtures of MLP-experts' (or neuro-fuzzy modular networks).

Simulation of exposure and alignment for nanoimprint lithography

NASA Astrophysics Data System (ADS)

Deng, Yunfei; Neureuther, Andrew R.

2002-07-01

Rigorous electromagnetic simulation with TEMPEST is used to examine the exposure and alignment processes for nano-imprint lithography with attenuating thin-film molds. Parameters in the design of topographical features of the nano-imprint system and material choices of the components are analyzed. The small feature size limits light transmission through the feature. While little can be done with auxiliary structures to attract light into small holes, the use of an absorbing material with a low real part of the refractive index such as silver helps mitigates the problem. Results on complementary alignment marks shows that the small transmission through the metal layer and the vertical separation of two alignment marks create the leakage equivalent to 1 nm misalignment but satisfactory alignment can be obtained by measuring alignment signals over a +/- 30 nm range.

Complementary health insurance, out- of- pocket expenditures, and health services utilization: A population- based survey.

PubMed

Homaie Rad, Enayatollah; Kavosi, Zahra; Moghadamnia, Mohammad Taghi; Arefnezhad, Masoud; Arefnezhad, Masoumeh; Felezi Nasiri, Banfashe

2017-01-01

Background: Studies have shown that people using complementary health insurances have more access to health services than others. In the present study, we aimed at finding the differences between out- of- pocket payments and health service utilizations in complementary health insurances (CHIs) users and nonusers. Methods: Propensity score matching was used to compare the 2 groups. First, confounder variables were identified, and then propensity score matching was used to compare out- of- pocket expenditures with dental, general physician, hospital inpatient, emergency services, nursing, midwifery, laboratory services, specialists and rehabilitation services utilization. Results: Our results revealed no significant differences between the 2 groups in out- of- pocket health expenditures. Also, the specialist visits, inpatient services at the hospital, and dental services were higher in people who used CHIs compared to nonusers. Conclusion: People did not change their budget share for health care services after using CHIs. The payments were equal for people who were not CHIs users due to the increase in the quantity of the services.

Complementary and alternative treatment in functional dyspepsia

PubMed Central

Chiarioni, Giuseppe; Pesce, Marcella; Fantin, Alberto; Sarnelli, Giovanni

2017-01-01

Introduction and aim The popularity of complementary and alternative medicine (CAM) in treating functional gastrointestinal disorders (FGIDs) has steadily increased in Western countries. We aimed at analyzing available data on CAM effectiveness in functional dyspepsia (FD) patients. Methods A bibliographical search was performed in PubMed using the following keywords: “complementary/alternative medicine,” “hypnosis,” “acupuncture” and/or “functional dyspepsia.” Results In community settings, almost 50% of patients with FGIDs used CAM therapies. Herbal remedies consist of multi-component preparations, whose mechanisms of action have not been systematically clarified. Few studies analyzed the effectiveness of acupuncture in Western countries, yielding conflicting results and possibly reflecting a population bias of this treatment. Hypnosis has been extensively used in irritable bowel syndrome, but few data support its role in treating FD. Conclusions Although some supporting well-designed studies have been recently performed, additional randomized, controlled trials are needed before stating any recommendation on CAM effectiveness in treating FD. PMID:29435308

Length and weight of very low birth weight infants in Germany at 2 years of age: does it matter at what age they start complementary food?

PubMed

Spiegler, J; Eisemann, N; Ehlers, S; Orlikowsky, T; Kannt, O; Herting, E; Göpel, W

2015-06-01

We analysed at what age parents start complementary food in very low birth weight infants, determined risk factors for early introduction of complementary food (post-term age) and analysed whether the age at introduction of complementary food influences height or weight at 2 years of age. Parents of premature infants born in 2009-2011 answered questionnaires regarding introduction of complementary food in the first year of life (N=2262) and were followed up at a post-term age of 2 years (N=981). Length and weight were compared with full-term infants from the KiGGs study. Logistic and linear regression analyses were conducted to study predictors for early introduction of complementary food and the influence of age at introduction of complementary food on later height and weight. Average age at introduction of complementary food was 3.5 months post-term age. The lower the gestational age at birth, the earlier (post-term age) vegetables and meat were introduced. Age at introduction of complementary food was influenced by intrauterine growth restriction, gestational age at birth, maternal education and a developmental delay perceived by the parents. Length and weight at a post-term age of 2 years was not negatively influenced by early introduction of complementary food. VLBW infants are introduced to complementary food on average before a post-term age of 4 months. There was no negative effect of early introduction of complementary food on height and weight at 2 years of age.

Hypnotherapy: fact or fiction: a review in palliative care and opinions of health professionals.

PubMed

Desai, Geetha; Chaturvedi, Santosh K; Ramachandra, Srinivasa

2011-05-01

Complementary medicine like hypnotherapy is often used for pain and palliative care. Health professionals vary in views about hypnotherapy, its utility, value, and attitudes. To understand the opinions of health professionals on hypnotherapy. A semi-qualitative method to survey opinions of the health professionals from various disciplines attending a programme on hypnotherapy was conducted. The survey form consisted of 32 statements about hypnosis and hypnotherapy. Participants were asked to indicate whether they agreed, disagreed, or were not sure about each statement. A qualitative feedback form was used to obtain further views about hypnotherapy. Percentage, frequency distribution. The sample consisted of 21 participants from various disciplines. Two-thirds of the participants gave correct responses to statements on dangerousness of hypnosis (90%), weak mind and hypnosis (86%), and hypnosis as therapy (81%). The participants gave incorrect responses about losing control in hypnosis (57%), hypnosis being in sleep (62%), and becoming dependent on hypnotist (62%). Participants were not sure if one could not hear the hypnotist one is not hypnotized (43%) about the responses on gender and hypnosis (38%), hypnosis leading to revealing secrets (23%). Despite patients using complementary medicine services, often health professionals are unaware of the issues associated with these services. These myths may interfere in using hypnotherapy as therapeutic tool in palliative care. It is important for health professionals to have an appropriate and evidence-based understanding about the complementary therapies including hypnotherapy.

Complementary symbiont contributions to plant decomposition in a fungus-farming termite

PubMed Central

Hu, Haofu; Li, Cai; Chen, Zhensheng; Otani, Saria; Nygaard, Sanne; Nobre, Tania; Klaubauf, Sylvia; Schindler, Philipp M.; Hauser, Frank; Pan, Hailin; Yang, Zhikai; Sonnenberg, Anton S. M.; de Beer, Z. Wilhelm; Zhang, Yong; Wingfield, Michael J.; Grimmelikhuijzen, Cornelis J. P.; de Vries, Ronald P.; Korb, Judith; Aanen, Duur K.; Wang, Jun; Boomsma, Jacobus J.; Zhang, Guojie

2014-01-01

Termites normally rely on gut symbionts to decompose organic matter but the Macrotermitinae domesticated Termitomyces fungi to produce their own food. This transition was accompanied by a shift in the composition of the gut microbiota, but the complementary roles of these bacteria in the symbiosis have remained enigmatic. We obtained high-quality annotated draft genomes of the termite Macrotermes natalensis, its Termitomyces symbiont, and gut metagenomes from workers, soldiers, and a queen. We show that members from 111 of the 128 known glycoside hydrolase families are represented in the symbiosis, that Termitomyces has the genomic capacity to handle complex carbohydrates, and that worker gut microbes primarily contribute enzymes for final digestion of oligosaccharides. This apparent division of labor is consistent with the Macrotermes gut microbes being most important during the second passage of comb material through the termite gut, after a first gut passage where the crude plant substrate is inoculated with Termitomyces asexual spores so that initial fungal growth and polysaccharide decomposition can proceed with high efficiency. Complex conversion of biomass in termite mounds thus appears to be mainly accomplished by complementary cooperation between a domesticated fungal monoculture and a specialized bacterial community. In sharp contrast, the gut microbiota of the queen had highly reduced plant decomposition potential, suggesting that mature reproductives digest fungal material provided by workers rather than plant substrate. PMID:25246537

Special Section: Complementary and Alternative Medicine (CAM):Quiz on Complementary and Alternative Medicine

MedlinePlus

... Special Section CAM Quiz on Complementary and Alternative Medicine Past Issues / Winter 2009 Table of Contents For ... low back pain. True False Complementary and alternative medicine (CAM) includes: Meditation Chiropractic Use of natural products, ...

Tracing back the nascence of a new sex-determination pathway to the ancestor of bees and ants

PubMed Central

Schmieder, Sandra; Colinet, Dominique; Poirié, Marylène

2012-01-01

In several Hymenoptera, sexual fate is determined by the allelic composition at the complementary sex-determiner locus, a sex-determination mechanism that can strongly affect population dynamics. To date, the molecular identification of complementary sex determiner has only been achieved in the honeybee, where the complementary sex-determiner gene was reported to have arisen from duplication of the feminizer gene. Strikingly, the complementary sex-determiner gene was also proposed to be unique to the honeybee lineage. Here we identify feminizer and complementary sex-determiner orthologues in bumble bees and ants. We further demonstrate that the duplication of feminizer that produced complementary sex determiner occurred before the divergence of Aculeata species (~120 Myr ago). Finally, we provide evidence that the two genes evolved concertedly through gene conversion, complementary sex-determiner evolution being additionally shaped by mosaic patterns of selection. Thus, the complementary sex-determiner gene likely represents the molecular basis for single locus-complementary sex determination in the Aculeata infra-order, and possibly, in the entire Hymenoptera order. PMID:22692538

Sensitive, Specific Complementary - Strand Optical Detection of Viral RNA

DTIC Science & Technology

1997-06-01

chemistry and molecular biology, positions us to obtain measurements leaps and bounds ahead of those any other research facility can make -- in...signal-to-noise will be much reduced. Secondly, that, in the ultimate design of our instrument, we can use this effect to generate a differential...sensor before, with avidin as mediator. We chose instead, however, to use goat anti-biotin IgG as a mediator; the anti-biotin offers the following

BOOTES and GTC observations of cosmic gamma-ray bursts and their progenitors

NASA Astrophysics Data System (ADS)

Castro-Tirado, Alberto J.

2016-07-01

We will summarize the follow-up observations of gamma-ray bursts performed worldwide by the BOOTES Network of robotic telescopes (with some of the data being contemporaneous to the prompt emission) leading to the discovery of many afterglows. Complementary data has been also obtained by the 10.4m GTC telescope in La Palma (mainly spectroscopy), with one of them being the highest extinguished afterglow detected to date.

The Generation, Radiation and Prediction of Supersonic Jet Noise. Volume 1

DTIC Science & Technology

1978-10-01

standard, Gaussian correlation function model can yield a good noise spectrum prediction (at 900), but the corresponding axial source distributions do not...forms for the turbulence cross-correlation function. Good agreement was obtained between measured and calculated far- field noise spectra. However, the...complementary error function profile (3.63) was found to provide a good fit to the axial velocity distribution tor a wide range of Mach numbers in the Initial

Magnetic field modification of optical magnetic dipoles.

PubMed

Armelles, Gaspar; Caballero, Blanca; Cebollada, Alfonso; Garcia-Martin, Antonio; Meneses-Rodríguez, David

2015-03-11

Acting on optical magnetic dipoles opens novel routes to govern light-matter interaction. We demonstrate magnetic field modification of the magnetic dipolar moment characteristic of resonant nanoholes in thin magnetoplasmonic films. This is experimentally shown through the demonstration of the magneto-optical analogue of Babinet's principle, where mirror imaged MO spectral dependencies are obtained for two complementary magnetoplasmonic systems: holes in a perforated metallic layer and a layer of disks on a substrate.

Complementary analysis of tissue homogenates composition obtained by Vis and NIR laser excitations and Raman spectroscopy.

PubMed

Staniszewska-Slezak, Emilia; Malek, Kamilla; Baranska, Malgorzata

2015-08-05

Raman spectroscopy and four excitation lines in the visible (Vis: 488, 532, 633 nm) and near infrared (NIR: 785 nm) were used for biochemical analysis of rat tissue homogenates, i.e. myocardium, brain, liver, lung, intestine, and kidney. The Vis Raman spectra are very similar for some organs (brain/intestines and kidney/liver) and dominated by heme signals when tissues of lung and myocardium were investigated (especially with 532 nm excitation). On the other hand, the NIR Raman spectra are specific for each tissue and more informative than the corresponding ones collected with the Vis excitations. The spectra analyzed without any special pre-processing clearly illustrate different chemical composition of each tissue and give information about main components e.g. lipids or proteins, but also about the content of some specific compounds such as amino acid residues, nucleotides and nucleobases. However, in order to obtain the whole spectral information about tissues complex composition the spectra of Vis and NIR excitations should be collected and analyzed together. A good agreement of data gathered from Raman spectra of the homogenates and those obtained previously from Raman imaging of the tissue cross-sections indicates that the presented here approach can be a method of choice for an investigation of biochemical variation in animal tissues. Moreover, the Raman spectral profile of tissue homogenates is specific enough to be used for an investigation of potential pathological changes the organism undergoes, in particular when supported by the complementary FTIR spectroscopy. Copyright © 2015 Elsevier B.V. All rights reserved.

Complementary and alternative medicine use and adherence to asthma medications among Latino and non-Latino white families.

PubMed

McQuaid, Elizabeth L; Fedele, David A; Adams, Sue K; Koinis-Mitchell, Daphne; Mitchell, Jessica; Kopel, Sheryl J; Seifer, Ronald; Jandasek, Barbara; Fritz, Gregory K; Canino, Glorisa

2014-01-01

The current study sought to evaluate patterns of complementary and alternative medicine (CAM) use in a sample of Latino and non-Latino white (NLW) children with asthma to determine whether parental beliefs about conventional medications and barriers to obtaining these medications were related to CAM use and to assess whether CAM use was associated with decreased adherence to controller medications. Participants included 574 families of children with asthma from NLW, Puerto Rican (PR), and Dominican backgrounds from Rhode Island (RI) and from Island PR. All parents completed a brief checklist of barriers to medication use and an assessment of CAM approaches. A subsample of 259 families had controller medication use monitored objectively for approximately 1 month by MDILog (fluticasone propionate), TrackCap (montelukast), or dosage counter (fluticasone/salmeterol combination). Prevalence of CAM use was high among Latino families. Perceived barriers to obtaining medication were related to increased CAM use in PR families from RI. Elevated medication concerns were positively associated with CAM use among NLW and Island PR families. CAM use was positively related to objective adherence within NLW families, and unrelated in other groups. CAM use is common among Latino families with asthma. Among some families, CAM use may be initiated as a way to cope with barriers to obtaining medication or when parents have concerns about conventional medications. Families who report CAM use do not appear to be substituting CAM for conventional asthma medication. Copyright © 2014 Academic Pediatric Association. Published by Elsevier Inc. All rights reserved.

Fatty acid supply with complementary foods and LC-PUFA status in healthy infants: results of a randomised controlled trial.

PubMed

Libuda, Lars; Mesch, Christina M; Stimming, Madlen; Demmelmair, Hans; Koletzko, Berthold; Warschburger, Petra; Blanke, Katharina; Reischl, Eva; Kalhoff, Hermann; Kersting, Mathilde

2016-06-01

Introduction of complementary food usually leads to decreasing intakes of long-chain n-3 polyunsaturated fatty acids (n-3 LC-PUFA), compared to full breastfeeding. In the randomised controlled PINGU intervention trial, we tested the effects of complementary foods with different contents of alpha-linolenic acid (ALA) and docosahexaenoic acid (DHA) on term infant LC-PUFA status. Healthy infants born at term were randomised to receive from the introduction of complementary feeding at the age of 4 to 6 months until age of 10 months ready-made complementary meals either with ALA-rich rapeseed oil (intervention group (IG)-R), with salmon twice weekly to provide preformed DHA (IG-F), or with linoleic acid-rich corn oil (control group, CG). Fatty acid composition was assessed in erythrocyte (RBC) and plasma glycerophospholipids. Complete data of fatty acids in RBC (plasma) were available from 158 (155) infants. After intervention, infants assigned to IG-F showed higher RBC and plasma percentages of eicosapentaenoic acid (EPA), DHA, and total n-3 LC-PUFA than CG (each p < 0.001). In IG-R, levels of ALA and the ratio of ALA to LA in plasma and RBC (all p < 0.0001) as well as RBC-EPA (p < 0.0001) were higher than in CG, while DHA levels did not differ between IG-R and CG. Regular fish consumption during complementary feeding enhances infant EPA and DHA status. The usage of rapeseed oil in small amounts concordant with EU-law for commercial meals enhances endogenic EPA-synthesis, but does not affect DHA status. Provision of oily fish with complementary feeds is advisable to prevent a decline of DHA status. www.clinicaltrials.gov , identifier: NCT01487889, title: Polyunsaturated fatty acids in child nutrition-a German multimodal optimisation study (PINGU).

Navier-Stokes, flight, and wind tunnel flow analysis for the F/A-18 aircraft

NASA Technical Reports Server (NTRS)

Ghaffari, Farhad

1994-01-01

Computational analysis of flow over the F/A-18 aircraft is presented along with complementary data from both flight and wind tunnel experiments. The computational results are based on the three-dimensional thin-layer Navier-Stokes formulation and are obtained from an accurate surface representation of the fuselage, leading-edge extension (LEX), and the wing geometry. However, the constraints imposed by either the flow solver and/or the complexity associated with the flow-field grid generation required certain geometrical approximations to be implemented in the present numerical model. In particular, such constraints inspired the removal of the empennage and the blocking (fairing) of the inlet face. The results are computed for three different free-stream flow conditions and compared with flight test data of surface pressure coefficients, surface tuft flow, and off-surface vortical flow characteristics that included breakdown phenomena. Excellent surface pressure coefficient correlations, both in terms of magnitude and overall trend, are obtained on the forebody throughout the range of flow conditions. Reasonable pressure agreement was obtained over the LEX; the general correlation tends to improve at higher angles of attack. The surface tuft flow and the off-surface vortex flow structures compared qualitatively well with the flight test results. To evaluate the computational results, a wind tunnel investigation was conducted to determine the effects of existing configurational differences between the flight vehicle and the numerical model on aerodynamic characteristics. In most cases, the geometrical approximations made to the numerical model had very little effect on overall aerodynamic characteristics.

Effect of pH and complementary ion concentration on nitrate removal using puroliteA400 Resin impregnated Cu in batch system

NASA Astrophysics Data System (ADS)

Turmuzi, M.; Tarigan, Z. N.; Nadapdap, L.; Batubara, F.

2018-02-01

The total nitrogen content in water bodies should be below 50 mg NO3 -/L (11.3 mgN/l) World Health Organization (WHO) 2006. The content of nitrogen exceeding the quality standard threshold will cause damage to the aquatic ecosystem and be carcinogenic to humans. The Purolite A-400 resin will be modified with Cu metal by batch method to see the adsorption allowance of nitrate in synthetic liquid waste with nitrate concentration of 50 mg/l. This study will evaluate the effect of pH and complementary ions on the adsorption process. From the result of the research, the second order pseudo model is the most suitable adsorption kinetics model. For the adsorption isotherms the most suitable model is the Freundlich adsorption isotherm model. The optimum pH conditions were at the range of 8.5. The addition of complementary ions sulfate and phosphate did not show any significant change, but sulfate is the most effective complementary ion with a content of 20 mg/l.

Geometric phase topology in weak measurement

NASA Astrophysics Data System (ADS)

Samlan, C. T.; Viswanathan, Nirmal K.

2017-12-01

The geometric phase visualization proposed by Bhandari (R Bhandari 1997 Phys. Rep. 281 1-64) in the ellipticity-ellipse orientation basis of the polarization ellipse of light is implemented to understand the geometric aspects of weak measurement. The weak interaction of a pre-selected state, acheived via spin-Hall effect of light (SHEL), results in a spread in the polarization ellipticity (η) or ellipse orientation (χ) depending on the resulting spatial or angular shift, respectively. The post-selection leads to the projection of the η spread in the complementary χ basis results in the appearance of a geometric phase with helical phase topology in the η - χ parameter space. By representing the weak measurement on the Poincaré sphere and using Jones calculus, the complex weak value and the geometric phase topology are obtained. This deeper understanding of the weak measurement process enabled us to explore the techniques’ capabilities maximally, as demonstrated via SHEL in two examples—external reflection at glass-air interface and transmission through a tilted half-wave plate.

Development of chip passivated monolithic complementary MISFET circuits with beam leads

NASA Technical Reports Server (NTRS)

Ragonese, L. J.; Kim, M. J.; Corrie, B. L.; Brouillette, J. W.; Warr, R. E.

1972-01-01

The results are presented of a program to demonstrate the processes for fabricating complementary MISFET beam-leaded circuits, which, potentially, are comparable in quality to available bipolar beam-lead chips that use silicon nitride passivation in conjunction with a platinum-titanium-gold metal system. Materials and techniques, different from the bipolar case, were used in order to be more compatible with the special requirements of fully passivated complementary MISFET devices. Two types of circuits were designed and fabricated, a D-flip-flop and a three-input NOR/NAND gate. Fifty beam-leaded chips of each type were constructed. A quality and reliability assurance program was performed to identify failure mechanisms. Sample tests and inspections (including destructive) were developed to measure the physical characteristics of the circuits.

A Compact 5.5 GHz Band-Rejected UWB Antenna Using Complementary Split Ring Resonators

PubMed Central

Islam, M. M.; Faruque, M. R. I.; Islam, M. T.

2014-01-01

A band-removal property employing microwave frequencies using complementary split ring resonators (CSRRs) is applied to design a compact UWB antenna wishing for the rejection of some frequency band, which is meanwhile exercised by the existing wireless applications. The reported antenna comprises optimization of a circular radiating patch, in which slotted complementary SRRs are implanted. It is printed on low dielectric FR4 substrate material fed by a partial ground plane and a microstrip line. Validated results exhibit that the reported antenna shows a wide bandwidth covering from 3.45 to more than 12 GHz, with a compact dimension of 22 × 26 mm2, and VSWR < 2, observing band elimination of 5.5 GHz WLAN band. PMID:24971379

Complementary roles of interventional radiology and therapeutic endoscopy in gastroenterology

PubMed Central

Ray, David M; Srinivasan, Indu; Tang, Shou-Jiang; Vilmann, Andreas S; Vilmann, Peter; McCowan, Timothy C; Patel, Akash M

2017-01-01

Acute upper and lower gastrointestinal bleeding, enteral feeding, cecostomy tubes and luminal strictures are some of the common reasons for gastroenterology service. While surgery was initially considered the main treatment modality, the advent of both therapeutic endoscopy and interventional radiology have resulted in the paradigm shift in the management of these conditions. In this paper, we discuss the patient’s work up, indications, and complementary roles of endoscopic and angiographic management in the settings of gastrointestinal bleeding, enteral feeding, cecostomy tube placement and luminal strictures. These conditions often require multidisciplinary approaches involving a team of interventional radiologists, gastroenterologists and surgeons. Further, the authors also aim to describe how the fields of interventional radiology and gastrointestinal endoscopy are overlapping and complementary in the management of these complex conditions. PMID:28396724

Systematic reviews of complementary therapies – an annotated bibliography. Part 2: Herbal medicine

PubMed Central

Linde, Klaus; ter Riet, Gerben; Hondras, Maria; Vickers, Andrew; Saller, Reinhard; Melchart, Dieter

2001-01-01

Background Complementary therapies are widespread but controversial. We aim to provide a comprehensive collection and a summary of systematic reviews of clinical trials in three major complementary therapies (acupuncture, herbal medicine, homeopathy). This article is dealing with herbal medicine. Potentially relevant reviews were searched through the register of the Cochrane Complementary Medicine Field, the Cochrane Library, Medline, and bibliographies of articles and books. To be included articles had to review prospective clinical trials of herbal medicines; had to describe review methods explicitly; had to be published; and had to focus on treatment effects. Information on conditions, interventions, methods, results and conclusions was extracted using a pre-tested form and summarized descriptively. Results From a total of 79 potentially relevant reviews pre-selected in the screening process 58 met the inclusion criteria. Thirty of the reports reviewed ginkgo (for dementia, intermittent claudication, tinnitus, and macular degeneration), hypericum (for depression) or garlic preparations (for cardiovascular risk factors and lower limb atherosclerosis). The quality of primary studies was criticized in the majority of the reviews. Most reviews judged the available evidence as promising but definitive conclusions were rarely possible. Conclusions Systematic reviews are available on a broad range of herbal preparations prescribed for defined conditions. There is very little evidence on the effectiveness of herbalism as practised by specialist herbalists who combine herbs and use unconventional diagnosis. PMID:11518548

Factors related to complementary/alternative medicine use among cancer patients in central Anatolia.

PubMed

Er, Ozlem; Mistik, Selcuk; Ozkan, Metin; Ozturk, Ahmet; Altinbas, Mustafa

2008-01-01

We aimed to evaluate the prevalence of and factors related to the use of complementary/alternative medicine among cancer patients undergoing or following conventional treatment at the Erciyes University Oncology Hospital in Central Anatolia. Face-to-face interview and a questionnaire were carried out with cancer patients attending the outpatient clinic of Medical Oncology. Questionnaire items included patients' demographic data, treatment, use of complementary/alternative medicine and possible related factors. Multivariate analysis was performed to compare the factors related to use of complementary/alternative medicine. A total of 268 consecutive cancer patients were enrolled in the study. Overall, 43% of the patients were using or had used complementary/alternative medicine. Totally, 90% of the patients using complementary/alternative medicine utilized herbs, and most of the herbs used were stinging nettle. Nearly half of the patients using complementary/alternative medicine (46.1%) were aiming to fight the disease. Among users, nearly half of them regarded the method used as effective and 54 (50.5%) suggested the use of complementary/alternative medicine to other patients. Only 23.1% of the patients discussed the use of complementary/alternative medicine with their physician. In logistic regression analysis, younger age, higher educational status, advanced stage of the disease, longer duration of the disease and current treatment status were significantly associated with the use of complementary/alternative medicine. In our regression model, the predictivity rate of these variables was 72.2% for use of complementary/alternative medicine according to the backward Wald test. Use of complementary/alternative medicine among cancer patients in our center is modestly high, and the most common method is herbal therapy. Communication between the patient and the physician should be improved on this subject.

Reinforced self-assembly of donor-acceptor π-conjugated molecules to DNA templates by dipole-dipole interactions together with complementary hydrogen bonding interactions for biomimetics.

PubMed

Yang, Wanggui; Chen, Yali; Wong, Man Shing; Lo, Pik Kwan

2012-10-08

One of the most important criteria for the successful DNA-templated polymerization to generate fully synthetic biomimetic polymers is to design the complementary structural monomers, which assemble to the templates strongly and precisely before carrying polymerization. In this study, water-soluble, laterally thymine-substituted donor-acceptor π-conjugated molecules were designed and synthesized to self-assemble with complementary oligoadenines templates, dA(20) and dA(40), into stable and tubular assemblies through noncovalent interactions including π-π stacking, dipole-dipole interactions, and the complementary adenine-thymine (A-T) hydrogen-bonding. UV-vis, fluorescence, circular dichroism (CD), atomic force microscopy (AFM), and transmission electron microscopy (TEM) techniques were used to investigate the formation of highly robust nanofibrous structures. Our results have demonstrated for the first time that the dipole-dipole interactions are stronger and useful to reinforce the assembly of donor-acceptor π-conjugated molecules to DNA templates and the formation of the stable and robust supramolecular nanofibrous complexes together with the complementary hydrogen bonding interactions. This provides an initial step toward DNA-templated polymerization to create fully synthetic DNA-mimetic polymers for biotechnological applications. This study also presents an opportunity to precisely position donor-acceptor type molecules in a controlled manner and tailor-make advanced materials for various biotechnological applications.

Illumina whole-genome complementary DNA-mediated annealing, selection, extension and ligation platform: assessing its performance in formalin-fixed, paraffin-embedded samples and identifying invasion pattern-related genes in oral squamous cell carcinoma.

PubMed

Loudig, Olivier; Brandwein-Gensler, Margaret; Kim, Ryung S; Lin, Juan; Isayeva, Tatyana; Liu, Christina; Segall, Jeffrey E; Kenny, Paraic A; Prystowsky, Michael B

2011-12-01

High-throughput gene expression profiling from formalin-fixed, paraffin-embedded tissues has become a reality, and several methods are now commercially available. The Illumina whole-genome complementary DNA-mediated annealing, selection, extension and ligation assay (Illumina, Inc) is a full-transcriptome version of the original 512-gene complementary DNA-mediated annealing, selection, extension and ligation assay, allowing high-throughput profiling of 24,526 annotated genes from degraded and formalin-fixed, paraffin-embedded RNA. This assay has the potential to allow identification of novel gene signatures associated with clinical outcome using banked archival pathology specimen resources. We tested the reproducibility of the whole-genome complementary DNA-mediated annealing, selection, extension and ligation assay and its sensitivity for detecting differentially expressed genes in RNA extracted from matched fresh and formalin-fixed, paraffin-embedded cells, after 1 and 13 months of storage, using the human breast cell lines MCF7 and MCF10A. Then, using tumor worst pattern of invasion as a classifier, 1 component of the "risk model," we selected 12 formalin-fixed, paraffin-embedded oral squamous cell carcinomas for whole-genome complementary DNA-mediated annealing, selection, extension and ligation assay analysis. We profiled 5 tumors with nonaggressive, nondispersed pattern of invasion, and 7 tumors with aggressive dispersed pattern of invasion and satellites scattered at least 1 mm apart. To minimize variability, the formalin-fixed, paraffin-embedded specimens were prepared from snap-frozen tissues, and RNA was obtained within 24 hours of fixation. One hundred four down-regulated genes and 72 up-regulated genes in tumors with aggressive dispersed pattern of invasion were identified. We performed quantitative reverse transcriptase polymerase chain reaction validation of 4 genes using Taqman assays and in situ protein detection of 1 gene by immunohistochemistry. Functional cluster analysis of genes up-regulated in tumors with aggressive pattern of invasion suggests presence of genes involved in cellular cytoarchitecture, some of which already associated with tumor invasion. Identification of these genes provides biologic rationale for our histologic classification, with regard to tumor invasion, and demonstrates that the whole-genome complementary DNA-mediated annealing, selection, extension and ligation assay is a powerful assay for profiling degraded RNA from archived specimens when combined with quantitative reverse transcriptase polymerase chain reaction validation. Copyright © 2011 Elsevier Inc. All rights reserved.

Use of complementary and alternative medicines during the third trimester.

PubMed

Pallivalapila, Abdul Rouf; Stewart, Derek; Shetty, Ashalatha; Pande, Binita; Singh, Rajvir; McLay, James S

2015-01-01

To estimate the prevalence, indications, and associated factors for complementary and alternative medicine use during the last trimester of pregnancy. A questionnaire survey was conducted of women with a live birth (N=700) admitted to the postnatal unit at the Royal Aberdeen Maternity Hospital, northeast Scotland. Outcome measures included: complementary and alternative medicine used; vitamins and minerals used; reasons for complementary and alternative medicine use; independent associated factors for use; views; and experiences. Descriptive and inferential statistical analysis was performed. The response rate was 79.6% of eligible women. Two thirds of respondents (61.4%) reported using complementary and alternative medicine, excluding vitamins and minerals, during the third trimester. Respondents reported using a total of 30 different complementary and alternative medicine modalities, of which oral herbal products were the most common (38% of respondents, 40 different products). The independent associated factors for complementary and alternative medicine use identified were: complementary and alternative medicine use before pregnancy (odds ratio [OR] 4.36, 95% confidence interval [CI] 2.39-7.95, P<.001); a university education (OR 2.41, 95% CI 1.46-4.0, P=.001), and complementary and alternative medicine use by family or friends (OR 2.36, 95% CI 1.61-3.47, P<.001). There was no association with health care professional recommendations. Users were significantly more likely than nonusers to agree that complementary and alternative medicines were safer than prescribed medicines (P=.006), less likely to be associated with side effects (P≤.001), and could interfere with conventional medicines (P≤.001). Despite the majority of respondents, and notably users, being uncertain about their safety and effectiveness, complementary and alternative medicine modalities and complementary and alternative medicine products are widely used during the third trimester of pregnancy in this study population. Although prior use was the most significant independent associated factor, the role of family and friends, rather than health professionals, in the decision to use complementary and alternative medicine may be of concern. III.

Transformation of [M + 2H](2+) Peptide Cations to [M - H](+), [M + H + O](+), and M(+•) Cations via Ion/Ion Reactions: Reagent Anions Derived from Persulfate.

PubMed

Pilo, Alice L; Bu, Jiexun; McLuckey, Scott A

2015-07-01

The gas-phase oxidation of doubly protonated peptides is demonstrated here using ion/ion reactions with a suite of reagents derived from persulfate. Intact persulfate anion (HS2O8(-)), peroxymonosulfate anion (HSO5(-)), and sulfate radical anion (SO4(-•)) are all either observed directly upon negative nanoelectrospray ionization (nESI) or easily obtained via beam-type collisional activation of persulfate into the mass spectrometer. Ion/ion reactions between each of these reagents and doubly protonated peptides result in the formation of a long-lived complex. Collisional activation of the complex containing a peroxymonosulfate anion results in oxygen transfer from the reagent to the peptide to generate the [M + H + O](+) species. Activation of the complex containing intact persulfate anion either results in oxygen transfer to generate the [M + H + O](+) species or abstraction of two hydrogen atoms and a proton to generate the [M - H](+) species. Activation of the complex containing sulfate radical anion results in abstraction of one hydrogen atom and a proton to form the peptide radical cation, [M](+•). This suite of reagents allows for the facile transformation of the multiply protonated peptides obtained via nESI into a variety of oxidized species capable of providing complementary information about the sequence and structure of the peptide.

Complementary and alternative medicine use in patients presenting to a head and neck oncology clinic.

PubMed

Vyas, Tarren; Hart, Robert D; Trites, Jonathan R; Philips, Timothy J; Archibald, Kathleen E M; Phillips, Judith E; Taylor, S Mark

2010-06-01

The aim of this study was to determine the prevalence of complementary and alternative medicine (CAM) use among patients presenting to a head and neck oncology clinic prior to a diagnosis. The study was conducted by administering questionnaires to 102 patients after being seen in the Head and Neck Oncology clinic for their initial consultation. The questionnaire assessed the extent of CAM use, types of CAMs used, and their reasons for use. A total of 132 CAMs were currently being used among 56 patients. The most common CAMs in use were multivitamins (26/132) and vitamin D (21/132). Meditation and yoga were associated with the greatest perceived benefit. The majority of patients obtained their information from family and friends. Most patients were using CAMs for physical health and well-being. As CAM use among the population is widespread, it is important for clinicians to specifically address their use on initial presentation. (c) 2009 Wiley Periodicals, Inc. Head Neck, 2010.

Rapid, low dose X-ray diffractive imaging of the malaria parasite Plasmodium falciparum.

PubMed

Jones, Michael W M; Dearnley, Megan K; van Riessen, Grant A; Abbey, Brian; Putkunz, Corey T; Junker, Mark D; Vine, David J; McNulty, Ian; Nugent, Keith A; Peele, Andrew G; Tilley, Leann

2014-08-01

Phase-diverse X-ray coherent diffractive imaging (CDI) provides a route to high sensitivity and spatial resolution with moderate radiation dose. It also provides a robust solution to the well-known phase-problem, making on-line image reconstruction feasible. Here we apply phase-diverse CDI to a cellular sample, obtaining images of an erythrocyte infected by the sexual stage of the malaria parasite, Plasmodium falciparum, with a radiation dose significantly lower than the lowest dose previously reported for cellular imaging using CDI. The high sensitivity and resolution allow key biological features to be identified within intact cells, providing complementary information to optical and electron microscopy. This high throughput method could be used for fast tomographic imaging, or to generate multiple replicates in two-dimensions of hydrated biological systems without freezing or fixing. This work demonstrates that phase-diverse CDI is a valuable complementary imaging method for the biological sciences and ready for immediate application. © 2013 Elsevier B.V. All rights reserved.

Tools for Visualizing HIV in Cure Research.

PubMed

Niessl, Julia; Baxter, Amy E; Kaufmann, Daniel E

2018-02-01

The long-lived HIV reservoir remains a major obstacle for an HIV cure. Current techniques to analyze this reservoir are generally population-based. We highlight recent developments in methods visualizing HIV, which offer a different, complementary view, and provide indispensable information for cure strategy development. Recent advances in fluorescence in situ hybridization techniques enabled key developments in reservoir visualization. Flow cytometric detection of HIV mRNAs, concurrently with proteins, provides a high-throughput approach to study the reservoir on a single-cell level. On a tissue level, key spatial information can be obtained detecting viral RNA and DNA in situ by fluorescence microscopy. At total-body level, advancements in non-invasive immuno-positron emission tomography (PET) detection of HIV proteins may allow an encompassing view of HIV reservoir sites. HIV imaging approaches provide important, complementary information regarding the size, phenotype, and localization of the HIV reservoir. Visualizing the reservoir may contribute to the design, assessment, and monitoring of HIV cure strategies in vitro and in vivo.

Complementary home mechanical ventilation techniques. SEPAR Year 2014.

PubMed

Chiner, Eusebi; Sancho-Chust, José N; Landete, Pedro; Senent, Cristina; Gómez-Merino, Elia

2014-12-01

This is a review of the different complementary techniques that are useful for optimizing home mechanical ventilation (HMV). Airway clearance is very important in patients with HMV and many patients, particularly those with reduced peak cough flow, require airway clearance (manual or assisted) or assisted cough techniques (manual or mechanical) and suctioning procedures, in addition to ventilation. In the case of invasive HMV, good tracheostomy cannula management is essential for success. HMV patients may have sleep disturbances that must be taken into account. Sleep studies including complete polysomnography or respiratory polygraphy are helpful for identifying patient-ventilator asynchrony. Other techniques, such as bronchoscopy or nutritional support, may be required in patients on HMV, particularly if percutaneous gastrostomy is required. Information on treatment efficacy can be obtained from HMV monitoring, using methods such as pulse oximetry, capnography or the internal programs of the ventilators themselves. Finally, the importance of the patient's subjective perception is reviewed, as this may potentially affect the success of the HMV. Copyright © 2014 SEPAR. Published by Elsevier Espana. All rights reserved.

The Diamond Beamline Controls and Data Acquisition Software Architecture

NASA Astrophysics Data System (ADS)

Rees, N.

2010-06-01

The software for the Diamond Light Source beamlines[1] is based on two complementary software frameworks: low level control is provided by the Experimental Physics and Industrial Control System (EPICS) framework[2][3] and the high level user interface is provided by the Java based Generic Data Acquisition or GDA[4][5]. EPICS provides a widely used, robust, generic interface across a wide range of hardware where the user interfaces are focused on serving the needs of engineers and beamline scientists to obtain detailed low level views of all aspects of the beamline control systems. The GDA system provides a high-level system that combines an understanding of scientific concepts, such as reciprocal lattice coordinates, a flexible python syntax scripting interface for the scientific user to control their data acquisition, and graphical user interfaces where necessary. This paper describes the beamline software architecture in more detail, highlighting how these complementary frameworks provide a flexible system that can accommodate a wide range of requirements.

Long-Term Homeostatic Properties Complementary to Hebbian Rules in CuPc-Based Multifunctional Memristor

NASA Astrophysics Data System (ADS)

Wang, Laiyuan; Wang, Zhiyong; Lin, Jinyi; Yang, Jie; Xie, Linghai; Yi, Mingdong; Li, Wen; Ling, Haifeng; Ou, Changjin; Huang, Wei

2016-10-01

Most simulations of neuroplasticity in memristors, which are potentially used to develop artificial synapses, are confined to the basic biological Hebbian rules. However, the simplex rules potentially can induce excessive excitation/inhibition, even collapse of neural activities, because they neglect the properties of long-term homeostasis involved in the frameworks of realistic neural networks. Here, we develop organic CuPc-based memristors of which excitatory and inhibitory conductivities can implement both Hebbian rules and homeostatic plasticity, complementary to Hebbian patterns and conductive to the long-term homeostasis. In another adaptive situation for homeostasis, in thicker samples, the overall excitement under periodic moderate stimuli tends to decrease and be recovered under intense inputs. Interestingly, the prototypes can be equipped with bio-inspired habituation and sensitization functions outperforming the conventional simplified algorithms. They mutually regulate each other to obtain the homeostasis. Therefore, we develop a novel versatile memristor with advanced synaptic homeostasis for comprehensive neural functions.

Age of Complementary Foods Introduction and Risk of Anemia in Children Aged 4-6 years: A Prospective Birth Cohort in China.

PubMed

Wang, Fenglei; Liu, Huijuan; Wan, Yi; Li, Jing; Chen, Yu; Zheng, Jusheng; Huang, Tao; Li, Duo

2017-03-23

Age of complementary foods introduction is associated with childhood anemia, but the ideal age for the introduction of complementary foods to infants is a continuing topic of debate. We examined the longitudinal association between complementary foods introduction age and risk of anemia in 18,446 children from the Jiaxing Birth Cohort, who had detailed complementary feeding records at 3 and 6 months of age and had hemoglobin concentrations measured at 4-6 years. Early introduction of complementary foods at 3-6 months of age was significantly associated with a higher risk of anemia (odds ratio = 1.14; 95% confidence interval: 1.01-1.28) and a lower hemoglobin concentration of -0.84 g/L (95% confidence interval: -1.33 to -0.35) in children aged 4-6 years, compared with those fed complementary foods starting at 6 months of age. When it comes to the specific type of complementary foods, early introduction of all plant-based foods was associated with increased anemia risks and lower hemoglobin concentrations, while early introduction of most animal-based foods was not. These findings may be informative regarding the appropriate time to introduce complementary foods in infants.

76 FR 59707 - National Center for Complementary & Alternative Medicine; Notice of Closed Meetings

Federal Register 2010, 2011, 2012, 2013, 2014

2011-09-27

... Complementary & Alternative Medicine; Notice of Closed Meetings Pursuant to section 10(d) of the Federal... for Complementary and Alternative Medicine Special Emphasis Panel, Training and Education. Date... Complementary and Alternative Medicine Special Emphasis Panel, Clinical Studies of CAM Therapies. Date: November...

Enzymatic synthesis of long double-stranded DNA labeled with haloderivatives of nucleobases in a precisely pre-determined sequence

PubMed Central

2011-01-01

Background Restriction endonucleases are widely applied in recombinant DNA technology. Among them, enzymes of class IIS, which cleave DNA beyond recognition sites, are especially useful. We use BsaI enzyme for the pinpoint introduction of halogen nucleobases into DNA. This has been done for the purpose of anticancer radio- and phototherapy that is our long-term objective. Results An enzymatic method for synthesizing long double-stranded DNA labeled with the halogen derivatives of nucleobases (Hal-NBs) with 1-bp accuracy has been put forward and successfully tested on three different DNA fragments containing the 5-bromouracil (5-BrU) residue. The protocol assumes enzymatic cleavage of two Polymerase-Chain-Reaction (PCR) fragments containing two recognition sequences for the same or different class IIS restriction endonucleases, where each PCR fragment has a partially complementary cleavage site. These sites are introduced using synthetic DNA primers or are naturally present in the sequence used. The cleavage sites are not compatible, and therefore not susceptible to ligation until they are partially filled with a Hal-NB or original nucleobase, resulting in complementary cohesive end formation. Ligation of these fragments ultimately leads to the required Hal-NB-labeled DNA duplex. With this approach, a synthetic, extremely long DNA fragment can be obtained by means of a multiple assembly reaction (n × maximum PCR product length: n × app. 50 kb). Conclusions The long, precisely labeled DNA duplexes obtained behave in very much the same manner as natural DNA and are beyond the range of chemical synthesis. Moreover, the conditions of synthesis closely resemble the natural ones, and all the artifacts accompanying the chemical synthesis of DNA are thus eliminated. The approach proposed seems to be completely general and could be used to label DNA at multiple pre-determined sites and with halogen derivatives of any nucleobase. Access to DNAs labeled with Hal-NBs at specific position is an indispensable condition for the understanding and optimization of DNA photo- and radio-degradation, which are prerequisites for clinical trials of Hal-NBs in anticancer therapy. PMID:21864341

Home-made and commercial complementary meals in German infants: results of the DONALD study.

PubMed

Hilbig, A; Foterek, K; Kersting, M; Alexy, U

2015-12-01

Infant complementary food can be home-made or bought as ready-to-eat commercial products. The nutrient composition of commercial products is regularised in a European Commission guideline, whereas the preparation of home-made complementary meals is the responsibility of caregivers. In the present study, the composition of commercial and home-made complementary meals as eaten by healthy German infants was compared. Of 8226 complementary meals (74% commercial and 26% home-made) recorded in 1083, 3-day weighed dietary records from 396 participants (6-12 months old) of the German DONALD (DOrtmund Nutritional and Anthropometric Longitudinally Designed) study were analysed. Median energy density (kcal 100 g(-1)) was highest in commercial and home-made cereal-milk meals (89 kcal 100 g(-1)). In home-made savoury and cereal-fruit meals, the energy density was significantly higher compared to their commercial counterparts. Median protein contents were highest in savoury and cereal-milk meals (>2.5 g 100 g(-1)) and dairy-fruit meals (2-4 g 100 g(-1)). Added sugars were found in less than a quarter of meals. Highest median sodium contents were found not only in commercial savoury meals (median 38 mg 100 g(-1)) and vegetable meals (32 mg 100 g(-1)), but also in home-made cereal-milk meals (36 mg 100 g(-1)). Both median fat and iron contents were higher in home-made meals compared to commercial savoury and cereal-fruit meals. With the exception of the higher sodium content in commercial savoury meals for older infants, the lower fat content in commercial savoury and cereal-fruit meals, and the added sugar content in some commercial dairy-fruit meals, a comparison of commercial and home-made complementary meals did not reveal any serious inadequacy. © 2015 The British Dietetic Association Ltd.

The role of the Therapeutic Goods Administration and the Medicine and Medical Devices Safety Authority in evaluating complementary and alternative medicines in Australia and New Zealand.

PubMed

Ghosh, Dilip; Skinner, Margot; Ferguson, Lynnette R

2006-04-03

Currently, the regulation of complementary and alternative medicines and related health claims in Australia and New Zealand is managed in a number of ways. Complementary medicines, including herbal, minerals, nutritional/dietary supplements, aromatherapy oils and homeopathic medicines are regulated under therapeutic goods/products legislation. The Therapeutic Goods Administration (TGA), a division of the Commonwealth Department of Health and Ageing is responsible for administering the provisions of the legislation in Australia. The New Zealand Medicines and Medical Devices Safety Authority (Medsafe) administers the provision of legislation in New Zealand. In December 2003 the Australian and New Zealand governments signed a Treaty to establish a single, bi-national agency to regulate therapeutic products, including medical devices prescription, over-the-counter and complementary medicines. A single agency will replace the Australian TGA and the New Zealand Medsafe. The role of the new agency will be to safeguard public health through regulation of the quality, safety and efficacy or performance of therapeutic products in both Australia and New Zealand. The major activities of the new joint Australia New Zealand therapeutic products agency are in product licensing, specifying labelling standards and setting the advertising scheme, together with determining the risk classes of medicines and creating an expanded list of ingredients permitted in Class I medicines. A new, expanded definition of complementary medicines is proposed and this definition is currently under consultation. Related Australian and New Zealand legislation is being developed to implement the joint scheme. Once this legislation is passed, the Treaty will come into force and the new joint regulatory scheme will begin. The agency is expected to commence operation no later than 1 July 2006 and will result in a single agency to regulate complementary and alternative medicines.

Self-complementary circular codes in coding theory.

PubMed

Fimmel, Elena; Michel, Christian J; Starman, Martin; Strüngmann, Lutz

2018-04-01

Self-complementary circular codes are involved in pairing genetic processes. A maximal [Formula: see text] self-complementary circular code X of trinucleotides was identified in genes of bacteria, archaea, eukaryotes, plasmids and viruses (Michel in Life 7(20):1-16 2017, J Theor Biol 380:156-177, 2015; Arquès and Michel in J Theor Biol 182:45-58 1996). In this paper, self-complementary circular codes are investigated using the graph theory approach recently formulated in Fimmel et al. (Philos Trans R Soc A 374:20150058, 2016). A directed graph [Formula: see text] associated with any code X mirrors the properties of the code. In the present paper, we demonstrate a necessary condition for the self-complementarity of an arbitrary code X in terms of the graph theory. The same condition has been proven to be sufficient for codes which are circular and of large size [Formula: see text] trinucleotides, in particular for maximal circular codes ([Formula: see text] trinucleotides). For codes of small-size [Formula: see text] trinucleotides, some very rare counterexamples have been constructed. Furthermore, the length and the structure of the longest paths in the graphs associated with the self-complementary circular codes are investigated. It has been proven that the longest paths in such graphs determine the reading frame for the self-complementary circular codes. By applying this result, the reading frame in any arbitrary sequence of trinucleotides is retrieved after at most 15 nucleotides, i.e., 5 consecutive trinucleotides, from the circular code X identified in genes. Thus, an X motif of a length of at least 15 nucleotides in an arbitrary sequence of trinucleotides (not necessarily all of them belonging to X) uniquely defines the reading (correct) frame, an important criterion for analyzing the X motifs in genes in the future.

Using Flow-Ecology Relationships to Evaluate Ecosystem Service Trade-Offs and Complementarities in the Nation's Largest River Swamp.

PubMed

Kozak, Justin P; Bennett, Micah G; Hayden-Lesmeister, Anne; Fritz, Kelley A; Nickolotsky, Aaron

2015-06-01

Large river systems are inextricably linked with social systems; consequently, management decisions must be made within a given ecological, social, and political framework that often defies objective, technical resolution. Understanding flow-ecology relationships in rivers is necessary to assess potential impacts of management decisions, but translating complex flow-ecology relationships into stakeholder-relevant information remains a struggle. The concept of ecosystem services provides a bridge between flow-ecology relationships and stakeholder-relevant data. Flow-ecology relationships were used to explore complementary and trade-off relationships among 12 ecosystem services and related variables in the Atchafalaya River Basin, Louisiana. Results from Indicators of Hydrologic Alteration were reduced to four management-relevant hydrologic variables using principal components analysis. Multiple regression was used to determine flow-ecology relationships and Pearson correlation coefficients, along with regression results, were used to determine complementary and trade-off relationships among ecosystem services and related variables that were induced by flow. Seven ecosystem service variables had significant flow-ecology relationships for at least one hydrologic variable (R (2) = 0.19-0.64). River transportation and blue crab (Callinectes sapidus) landings exhibited a complementary relationship mediated by flow; whereas transportation and crawfish landings, crawfish landings and crappie (Pomoxis spp.) abundance, and blue crab landings and blue catfish (Ictalurus furcatus) abundance exhibited trade-off relationships. Other trade-off and complementary relationships among ecosystem services and related variables, however, were not related to flow. These results give insight into potential conflicts among stakeholders, can reduce the dimensions of management decisions, and provide initial hypotheses for experimental flow modifications.

Using Flow-Ecology Relationships to Evaluate Ecosystem Service Trade-Offs and Complementarities in the Nation's Largest River Swamp

NASA Astrophysics Data System (ADS)

Kozak, Justin P.; Bennett, Micah G.; Hayden-Lesmeister, Anne; Fritz, Kelley A.; Nickolotsky, Aaron

2015-06-01

Large river systems are inextricably linked with social systems; consequently, management decisions must be made within a given ecological, social, and political framework that often defies objective, technical resolution. Understanding flow-ecology relationships in rivers is necessary to assess potential impacts of management decisions, but translating complex flow-ecology relationships into stakeholder-relevant information remains a struggle. The concept of ecosystem services provides a bridge between flow-ecology relationships and stakeholder-relevant data. Flow-ecology relationships were used to explore complementary and trade-off relationships among 12 ecosystem services and related variables in the Atchafalaya River Basin, Louisiana. Results from Indicators of Hydrologic Alteration were reduced to four management-relevant hydrologic variables using principal components analysis. Multiple regression was used to determine flow-ecology relationships and Pearson correlation coefficients, along with regression results, were used to determine complementary and trade-off relationships among ecosystem services and related variables that were induced by flow. Seven ecosystem service variables had significant flow-ecology relationships for at least one hydrologic variable ( R 2 = 0.19-0.64). River transportation and blue crab ( Callinectes sapidus) landings exhibited a complementary relationship mediated by flow; whereas transportation and crawfish landings, crawfish landings and crappie ( Pomoxis spp.) abundance, and blue crab landings and blue catfish ( Ictalurus furcatus) abundance exhibited trade-off relationships. Other trade-off and complementary relationships among ecosystem services and related variables, however, were not related to flow. These results give insight into potential conflicts among stakeholders, can reduce the dimensions of management decisions, and provide initial hypotheses for experimental flow modifications.

Ethical responsibilities of pharmacists when selling complementary medicines: a systematic review.

PubMed

Salman Popattia, Amber; Winch, Sarah; La Caze, Adam

2018-04-01

The widespread sale of complementary medicines in community pharmacy raises important questions regarding the responsibilities of pharmacists when selling complementary medicines. This study reviews the academic literature that explores a pharmacist's responsibilities when selling complementary medicines. International Pharmaceutical Abstracts, Embase, PubMed, Cinahl, PsycINFO and Philosopher's index databases were searched for articles written in English and published between 1995 and 2017. Empirical studies discussing pharmacists' practices or perceptions, consumers' expectations and normative studies discussing ethical perspectives or proposing ethical frameworks related to pharmacists' responsibilities in selling complementary medicines were included in the review. Fifty-eight studies met the inclusion criteria. The majority of the studies discussing the responsibilities of pharmacists selling complementary medicines had an empirical focus. Pharmacists and consumers identified counselling and ensuring safe use of complementary medicines as the primary responsibilities of pharmacists. No formal ethical framework is explicitly employed to describe the responsibilities of pharmacists selling complementary medicines. To the degree any ethical framework is employed, a number of papers implicitly rely on principlism. The studies discussing the ethical perspectives of selling complementary medicines mainly describe the ethical conflict between a pharmacist's business and health professional role. No attempt is made to provide guidance on appropriate ways to resolve the conflict. There is a lack of explicit normative advice in the existing literature regarding the responsibilities of pharmacists selling complementary medicines. This review identifies the need to develop a detailed practice-specific ethical framework to guide pharmacists regarding their responsibilities when selling complementary medicines. © 2018 Royal Pharmaceutical Society.

Expectations and responsibilities regarding the sale of complementary medicines in pharmacies: perspectives of consumers and pharmacy support staff.

PubMed

Iyer, Priya; McFarland, Reanna; La Caze, Adam

2017-08-01

Most sales of complementary medicines within pharmacies are conducted by pharmacy support staff. The absence of rigorous evidence for the effectiveness of many complementary medicines raises a number of ethical questions regarding the sale of complementary medicines in pharmacies. Explore (1) what consumers expect from pharmacists/pharmacies with regard to the sale of complementary medicines, and (2) how pharmacy support staff perceive their responsibilities when selling complementary medicines. One-on-one semi-structured interviews were conducted with a convenience sample of pharmacy support staff and consumers in pharmacies in Brisbane. Consumers were asked to describe their expectations when purchasing complementary medicines. Pharmacy support staff were asked to describe their responsibilities when selling complementary medicines. Interviews were conducted and analysed using the techniques developed within Grounded Theory. Thirty-three consumers were recruited from three pharmacies. Consumers described complementary medicine use as a personal health choice. Consumer expectations on the pharmacist included: select the right product for the right person, expert product knowledge and maintaining a wide range of good quality stock. Twenty pharmacy support staff were recruited from four pharmacies. Pharmacy support staff employed processes to ensure consumers receive the right product for the right person. Pharmacy support staff expressed a commitment to aiding consumers, but few evaluated the reliability of effectiveness claims regarding complementary medicines. Pharmacists need to respect the personal health choices of consumers while also putting procedures in place to ensure safe and appropriate use of complementary medicines. This includes providing appropriate support to pharmacy support staff. © 2016 Royal Pharmaceutical Society.

Bio-photonic detection method for morphological analysis of anthracnose disease and physiological disorders of Diospyros kaki

NASA Astrophysics Data System (ADS)

Wijesinghe, Ruchire Eranga; Lee, Seung-Yeol; Ravichandran, Naresh Kumar; Shirazi, Muhammad Faizan; Moon, Byungin; Jung, Hee-Young; Jeon, Mansik; Kim, Jeehyun

2017-04-01

The pathological and physiological defects in various types of fruits lead to large amounts of economical waste. It is well recognized that internal fruit defects due to pathological infections and physiological disorders can be effectively visualized at an initial stage of the disease using a well-known bio-photonic detection method called optical coherence tomography (OCT). This work investigates the use of OCT for identifying the morphological variations of anthracnose (bitter rot) disease infected and physiologically disordered Diospyros kaki (Asian Persimmon) fruits. An experiment was conducted using fruit samples that were carefully selected from persimmon orchards. Depth-resolved images with a high axial resolution were acquired using 850-nm-based spectral-domain OCT (SD-OCT) system. The obtained exemplary high-resolution two-dimensional and volumetric three-dimensional images revealed complementary morphological differences between healthy and defected samples. Moreover, the obtained depth-profile analysis results confirmed the disappearance of the healthy cell layers among the healthy-infected boundary regions. Thus, the proposed method has the potential to increase the diagnostic accuracy of the OCT technique used in agricultural plantations.

Electromagnetic fluctuations for anisotropic media and the generalized Kirchhoff's law

NASA Technical Reports Server (NTRS)

Yueh, Simon H.; Kwok, R.

1993-01-01

In this paper the polarimetric emission parameters for anisotropic media are derived using the generalized Kirchhoff's law for media with a uniform temperature and the fluctuation-dissipation theory for media with a temperature profile. Both finite-size objects and half-space media are considered. When the object has a uniform temperature across its body, the Kirchhoff's law, based on the condition of energy conservation in thermal equilibrium is generalized to obtain the emission parameters of an anisotropic medium, which can be interpreted as the absorptivity or the absorption cross section of the complementary object with a permittivity that is the transpose of the original object. When the medium has a nonuniform temperature distribution, the fluctuation-dissipation theory is applied for deriving the covariances between vector components of the thermal currents and, consequently, the covariances of the polarizations of electric fields radiated by the thermal currents. To verify the formulas derived from the fluctuation-dissipation theory, we let the temperature of the object be a constant and show that the results reduce to those obtained from the generalized Kirchhoff's law.

Complementary Characterization of Cu(In,Ga)Se₂ Thin-Film Photovoltaic Cells Using Secondary Ion Mass Spectrometry, Auger Electron Spectroscopy, and Atom Probe Tomography.

PubMed

Jang, Yun Jung; Lee, Jihye; Jeong, Jeung-Hyun; Lee, Kang-Bong; Kim, Donghwan; Lee, Yeonhee

2018-05-01

To enhance the conversion performance of solar cells, a quantitative and depth-resolved elemental analysis of photovoltaic thin films is required. In this study, we determined the average concentration of the major elements (Cu, In, Ga, and Se) in fabricated Cu(In,Ga)Se2 (CIGS) thin films, using inductively coupled plasma atomic emission spectroscopy, X-ray fluorescence, and wavelengthdispersive electron probe microanalysis. Depth profiling results for CIGS thin films with different cell efficiencies were obtained using secondary ion mass spectrometry and Auger electron spectroscopy to compare the atomic concentrations. Atom probe tomography, a characterization technique with sub-nanometer resolution, was used to obtain three-dimensional elemental mapping and the compositional distribution at the grain boundaries (GBs). GBs are identified by Na increment accompanied by Cu depletion and In enrichment. Segregation of Na atoms along the GB had a beneficial effect on cell performance. Comparative analyses of different CIGS absorber layers using various analytical techniques provide us with understanding of the compositional distributions and structures of high efficiency CIGS thin films in solar cells.

Structure and transport mechanism of the sodium/proton antiporter MjNhaP1

PubMed Central

Paulino, Cristina; Wöhlert, David; Kapotova, Ekaterina; Yildiz, Özkan; Kühlbrandt, Werner

2014-01-01

Sodium/proton antiporters are essential for sodium and pH homeostasis and play a major role in human health and disease. We determined the structures of the archaeal sodium/proton antiporter MjNhaP1 in two complementary states. The inward-open state was obtained by x-ray crystallography in the presence of sodium at pH 8, where the transporter is highly active. The outward-open state was obtained by electron crystallography without sodium at pH 4, where MjNhaP1 is inactive. Comparison of both structures reveals a 7° tilt of the 6 helix bundle. 22Na+ uptake measurements indicate non-cooperative transport with an activity maximum at pH 7.5. We conclude that binding of a Na+ ion from the outside induces helix movements that close the extracellular cavity, open the cytoplasmic funnel, and result in a ∼5 Å vertical relocation of the ion binding site to release the substrate ion into the cytoplasm. DOI: http://dx.doi.org/10.7554/eLife.03583.001 PMID:25426803

Cd hyperfine interactions in DNA bases and DNA of mouse strains infected with Trypanosoma cruzi investigated by perturbed angular correlation spectroscopy and ab initio calculations.

PubMed

Petersen, Philippe A D; Silva, Andreia S; Gonçalves, Marcos B; Lapolli, André L; Ferreira, Ana Maria C; Carbonari, Artur W; Petrilli, Helena M

2014-06-03

In this work, perturbed angular correlation (PAC) spectroscopy is used to study differences in the nuclear quadrupole interactions of Cd probes in DNA molecules of mice infected with the Y-strain of Trypanosoma cruzi. The possibility of investigating the local genetic alterations in DNA, which occur along generations of mice infected with T. cruzi, using hyperfine interactions obtained from PAC measurements and density functional theory (DFT) calculations in DNA bases is discussed. A comparison of DFT calculations with PAC measurements could determine the type of Cd coordination in the studied molecules. To the best of our knowledge, this is the first attempt to use DFT calculations and PAC measurements to investigate the local environment of Cd ions bound to DNA bases in mice infected with Chagas disease. The obtained results also allowed the detection of local changes occurring in the DNA molecules of different generations of mice infected with T. cruzi, opening the possibility of using this technique as a complementary tool in the characterization of complicated biological systems.

Impact of processing conditions on the kinetic of vitamin C degradation and 2-furoylmethyl amino acid formation in dried strawberries.

PubMed

Gamboa-Santos, Juliana; Megías-Pérez, Roberto; Soria, A Cristina; Olano, Agustín; Montilla, Antonia; Villamiel, Mar

2014-06-15

In this paper, a study on the usefulness of the determination of vitamin C together with indicators of the initial steps of Maillard reaction (2-furoylmethyl amino acids, 2-FM-AA) during the convective drying of strawberries has been carried out for the first time, paying special attention to the kinetics of degradation and formation, respectively, of both parameters. Formation of 2-FM-AA of Lys, Arg and GABA and vitamin C loss increased with time and temperature following, respectively, a zero and first-order kinetics. As supported by its lower activation energy, 2-FM-GABA (55.9 kJ/mol) and 2-FM-Lys+2-FM-Arg (58.2 kJ/mol) were shown to be slightly more sensitive indicators than vitamin C (82.1 kJ/mol). The obtained results, together with a complementary study on the rehydration ability and sensorial attributes of samples, pointed out the suitability of the convective drying system to obtain dried strawberries of high nutritive quality and bioactivity and good consumer acceptance. Copyright © 2013 Elsevier Ltd. All rights reserved.

75 FR 11186 - National Center for Complementary and Alternative Medicine Announcement of Workshop on Natural...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-03-10

... Complementary and Alternative Medicine Announcement of Workshop on Natural Products ACTION: Notice. SUMMARY: As part of its strategic planning process, the National Center for Complementary and Alternative Medicine... attend. Seating is limited. Background: The National Center for Complementary and Alternative Medicine...

75 FR 19979 - National Center for Complementary and Alternative Medicine Announcement of Workshop on the...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-04-16

... Complementary and Alternative Medicine Announcement of Workshop on the Deconstruction of Back Pain ACTION: Notice. SUMMARY: The National Center for Complementary and Alternative Medicine (NCCAM) invites the... Alternative Medicine (NCCAM) was established in 1999 with the mission of exploring complementary and...

75 FR 30039 - National Center for Complementary and Alternative Medicine; Notice of Closed Meetings

Federal Register 2010, 2011, 2012, 2013, 2014

2010-05-28

... Complementary and Alternative Medicine; Notice of Closed Meetings Pursuant to section 10(d) of the Federal... Complementary and Alternative Medicine Special Emphasis Panel; Education Panel. Date: June 24-25, 2010. Time: 5... of Committee: National Center for Complementary and Alternative Medicine Special Emphasis Panel; RFA...

75 FR 57970 - National Center for Complementary & Alternative Medicine; Notice of Closed Meeting

Federal Register 2010, 2011, 2012, 2013, 2014

2010-09-23

... Complementary & Alternative Medicine; Notice of Closed Meeting Pursuant to section 10(d) of the Federal Advisory... Complementary and Alternative Medicine Special Emphasis Panel, Centers of Excellence for Research on CAM (CERC... Complementary, & Alternative Medicine, NIH, 6707 Democracy Blvd., Suite 401, Bethesda, MD 20892, 301-594-3456...

77 FR 73036 - National Center for Complementary & Alternative Medicine; Notice of Meeting

Federal Register 2010, 2011, 2012, 2013, 2014

2012-12-07

... Complementary & Alternative Medicine; Notice of Meeting Pursuant to section 10(d) of the Federal Advisory... Council for Complementary and Alternative Medicine. The meeting will be open to the public as indicated... privacy. Name of Committee: National Advisory Council for Complementary and Alternative Medicine. Date...

77 FR 52750 - National Center for Complementary & Alternative Medicine; Notice of Meeting

Federal Register 2010, 2011, 2012, 2013, 2014

2012-08-30

... Complementary & Alternative Medicine; Notice of Meeting Pursuant to section 10(d) of the Federal Advisory... Council for Complementary and Alternative Medicine. The meeting will be open to the public as indicated... privacy. Name of Committee: National Advisory Council for Complementary and Alternative Medicine. Date...

78 FR 76635 - National Center for Complementary and Alternative Medicine; Notice of Meeting

Federal Register 2010, 2011, 2012, 2013, 2014

2013-12-18

... Complementary and Alternative Medicine; Notice of Meeting Pursuant to section 10(d) of the Federal Advisory... Council for Complementary and Alternative Medicine. The meeting will be open to the public as indicated... privacy. Name of Committee: National Advisory Council for Complementary and Alternative Medicine; NCCAM...

75 FR 43994 - National Center for Complementary and Alternative Medicine; Notice of Meeting

Federal Register 2010, 2011, 2012, 2013, 2014

2010-07-27

... Complementary and Alternative Medicine; Notice of Meeting Pursuant to section 10(d) of the Federal Advisory... Complementary and Alternative Medicine (NACCAM) meeting. The meeting will be open to the public as indicated... privacy. Name of Committee: National Advisory Council for Complementary and Alternative Medicine. Date...

77 FR 25185 - National Center for Complementary and Alternative Medicine; Notice of Meeting

Federal Register 2010, 2011, 2012, 2013, 2014

2012-04-27

... Complementary and Alternative Medicine; Notice of Meeting Pursuant to section 10(d) of the Federal Advisory... Council for Complementary and Alternative Medicine. The meeting will be open to the public as indicated... privacy. Name of Committee: National Advisory Council for Complementary and Alternative Medicine. Date...

[In-depth interviews and the Kano model to determine user requirements in a burns unit].

PubMed

González-Revaldería, J; Holguín-Holgado, P; Lumbreras-Marín, E; Núñez-López, G

To determine the healthcare requirements of patients in a Burns Unit, using qualitative techniques, such us in-depth personal interviews and Kano's methodology. Qualitative methodology using in-depth personal interviews (12 patients), Kano's conceptual model, and the SERVQHOS questionnaire (24 patients). All patients had been hospitalised in the last 12 months in the Burns Unit. Using Kano's methodology, service attributes were grouped by affinity diagrams, and classified as follows: must-be, attractive (unexpected, great satisfaction), and one-dimensional (linked to the degree of functionality of the service). The outcomes were compared with those obtained with SERVQHOS questionnaire. From the analysis of in-depth interviews, 11 requirements were obtained, referring to hotel aspects, information, need for closer staff relationship, and organisational aspects. The attributes classified as must-be were free television and automatic TV disconnection at midnight. Those classified as attractive were: individual room for more privacy, information about dressing change times in order to avoid anxiety, and additional staff for in-patients. The results were complementary to those obtained with the SERVQHOS questionnaire. In-depth personal interviews provide extra knowledge about patient requirements, complementing the information obtained with questionnaires. With this methodology, a more active patient participation is achieved and the companion's opinion is also taken into account. Copyright © 2016 SECA. Publicado por Elsevier España, S.L.U. All rights reserved.

Substrate-Controlled Diastereoselectivity Reversal in NHC-Catalyzed Cross-Benzoin Reactions Using N-Boc-N-Bn-Protected α-Amino Aldehydes.

PubMed

Haghshenas, Pouyan; Quail, J Wilson; Gravel, Michel

2016-12-16

The effectiveness of utilizing N-Bn-N-Boc-α-amino aldehydes in cross-benzoin reactions with heteroaromatic aldehydes is demonstrated. The reaction is both chemoselective and syn-selective, making it complementary to the anti-selective cross-benzoin reaction of NHBoc-α-amino aldehydes. Good diastereoselectivity is obtained for a variety of amino aldehydes, including nonhindered ones. A Felkin-Anh model can be used to rationalize the observed diastereoselectivity.

Complementary DNA cloning of the pear 1-aminocyclopropane-1-carboxylic acid oxidase gene and agrobacterium-mediated anti-sense genetic transformation.

PubMed

Qi, Jing; Dong, Zhen; Zhang, Yu-Xing

2015-12-01

The aim of the present study was to genetically modify plantlets of the Chinese yali pear to reduce their expression of ripening-associated 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) and therefore increase the shelf-life of the fruit. Primers were designed with selectivity for the conserved regions of published ACO gene sequences, and yali complementary DNA (cDNA) cloning was performed by reverse transcription quantitative polymerase chain reaction (PCR). The obtained cDNA fragment contained 831 base pairs, encoding 276 amino acid residues, and shared no less than 94% nucleotide sequence identity with other published ACO genes. The cDNA fragment was inversely inserted into a pBI121 expression vector, between the cauliflower mosaic virus 35S promoter and the nopaline synthase terminator, in order to construct the anti‑sense expression vector of the ACO gene; it was transfected into cultured yali plants using Agrobacterium LBA4404. Four independent transgenic lines of pear plantlets were obtained and validated by PCR analysis. A Southern blot assay revealed that there were three transgenic lines containing a single copy of exogenous gene and one line with double copies. The present study provided germplasm resources for the cultivation of novel storage varieties of pears, therefore providing a reference for further applications of anti‑sense RNA technology in the genetic improvement of pears and other fruit.

CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion.

PubMed

Santillán, Orlando; Ramírez-Romero, Miguel A; Dávila, Guillermo

2017-06-25

Here, we present chimera assembly by plasmid recovery and restriction enzyme site insertion (CAPRRESI). CAPRRESI benefits from many strengths of the original plasmid recovery method and introduces restriction enzyme digestion to ease DNA ligation reactions (required for chimera assembly). For this protocol, users clone wildtype genes into the same plasmid (pUC18 or pUC19). After the in silico selection of amino acid sequence regions where chimeras should be assembled, users obtain all the synonym DNA sequences that encode them. Ad hoc Perl scripts enable users to determine all synonym DNA sequences. After this step, another Perl script searches for restriction enzyme sites on all synonym DNA sequences. This in silico analysis is also performed using the ampicillin resistance gene (ampR) found on pUC18/19 plasmids. Users design oligonucleotides inside synonym regions to disrupt wildtype and ampR genes by PCR. After obtaining and purifying complementary DNA fragments, restriction enzyme digestion is accomplished. Chimera assembly is achieved by ligating appropriate complementary DNA fragments. pUC18/19 vectors are selected for CAPRRESI because they offer technical advantages, such as small size (2,686 base pairs), high copy number, advantageous sequencing reaction features, and commercial availability. The usage of restriction enzymes for chimera assembly eliminates the need for DNA polymerases yielding blunt-ended products. CAPRRESI is a fast and low-cost method for fusing protein-coding genes.

Stacked-unstacked equilibrium at the nick site of DNA.

PubMed

Protozanova, Ekaterina; Yakovchuk, Peter; Frank-Kamenetskii, Maxim D

2004-09-17

Stability of duplex DNA with respect to separation of complementary strands is crucial for DNA executing its major functions in the cell and it also plays a central role in major biotechnology applications of DNA: DNA sequencing, polymerase chain reaction, and DNA microarrays. Two types of interaction are well known to contribute to DNA stability: stacking between adjacent base-pairs and pairing between complementary bases. However, their contribution into the duplex stability is yet to be determined. Now we fill this fundamental gap in our knowledge of the DNA double helix. We have prepared a series of 32, 300 bp-long DNA fragments with solitary nicks in the same position differing only in base-pairs flanking the nick. Electrophoretic mobility of these fragments in the gel has been studied. Assuming the equilibrium between stacked and unstacked conformations at the nick site, all 32 stacking free energy parameters have been obtained. Only ten of them are essential and they govern the stacking interactions between adjacent base-pairs in intact DNA double helix. A full set of DNA stacking parameters has been determined for the first time. From these data and from a well-known dependence of DNA melting temperature on G.C content, the contribution of base-pairing into duplex stability has been estimated. The obtained energy parameters of the DNA double helix are of paramount importance for understanding sequence-dependent DNA flexibility and for numerous biotechnology applications.

Discovering complementary colors from the perspective of steam education

NASA Astrophysics Data System (ADS)

Karabey, Burak; Yigit Koyunkaya, Melike; Enginoglu, Turan; Yurumezoglu, Kemal

2018-05-01

This study explored the theory and applications of complementary colors using a technology-based activity designed from the perspective of STEAM education. Complementary colors and their areas of use were examined from the perspective of physics, mathematics and art, respectively. The study, which benefits from technology, makes the theory of complementary colors accessible to all through practical applications and provides a multidisciplinary, integrated and innovative technique of teaching the subject of colors, which could be used to teach complementary colors.

Scientific Results of Yoga for Health and Well-Being

MedlinePlus Videos and Cool Tools

... What Is Complementary, Alternative or Integrative Health? Safety Information Know the Science For Health Care Professionals Clinical Practice Guidelines Literature Reviews All Health Information Research Research Results Results by Date Sponsored by ...

Complementarity and Correlations

NASA Astrophysics Data System (ADS)

Maccone, Lorenzo; Bruß, Dagmar; Macchiavello, Chiara

2015-04-01

We provide an interpretation of entanglement based on classical correlations between measurement outcomes of complementary properties: States that have correlations beyond a certain threshold are entangled. The reverse is not true, however. We also show that, surprisingly, all separable nonclassical states exhibit smaller correlations for complementary observables than some strictly classical states. We use mutual information as a measure of classical correlations, but we conjecture that the first result holds also for other measures (e.g., the Pearson correlation coefficient or the sum of conditional probabilities).

Synergy optimization and operation management on syndicate complementary knowledge cooperation

NASA Astrophysics Data System (ADS)

Tu, Kai-Jan

2014-10-01

The number of multi enterprises knowledge cooperation has grown steadily, as a result of global innovation competitions. I have conducted research based on optimization and operation studies in this article, and gained the conclusion that synergy management is effective means to break through various management barriers and solve cooperation's chaotic systems. Enterprises must communicate system vision and access complementary knowledge. These are crucial considerations for enterprises to exert their optimization and operation knowledge cooperation synergy to meet global marketing challenges.

High-performance hybrid complementary logic inverter through monolithic integration of a MEMS switch and an oxide TFT.

PubMed

Song, Yong-Ha; Ahn, Sang-Joon Kenny; Kim, Min-Wu; Lee, Jeong-Oen; Hwang, Chi-Sun; Pi, Jae-Eun; Ko, Seung-Deok; Choi, Kwang-Wook; Park, Sang-Hee Ko; Yoon, Jun-Bo

2015-03-25

A hybrid complementary logic inverter consisting of a microelectromechanical system switch as a promising alternative for the p-type oxide thin film transistor (TFT) and an n-type oxide TFT is presented for ultralow power integrated circuits. These heterogeneous microdevices are monolithically integrated. The resulting logic device shows a distinctive voltage transfer characteristic curve, very low static leakage, zero-short circuit current, and exceedingly high voltage gain. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Homeopathy Use by US Adults: Results of a National Survey

PubMed Central

Davis, Roger B.; Kaptchuk, Ted J.; Yeh, Gloria Y.

2016-01-01

We used the 2012 National Health Interview Survey to compare homeopathy users with supplement users and those using other forms of complementary and integrative medicine. Among US adults, 2.1% used homeopathy within the past 12 months. Respiratory and otorhinolaryngology complaints were most commonly treated (18.5%). Homeopathy users were more likely to use multiple complementary and integrative medicine therapies and to perceive the therapy as helpful than were supplement users. US homeopathy use remains uncommon; however, users perceive it as helpful. PMID:26890179

Homeopathy Use by US Adults: Results of a National Survey.

PubMed

Dossett, Michelle L; Davis, Roger B; Kaptchuk, Ted J; Yeh, Gloria Y

2016-04-01

We used the 2012 National Health Interview Survey to compare homeopathy users with supplement users and those using other forms of complementary and integrative medicine. Among US adults, 2.1% used homeopathy within the past 12 months. Respiratory and otorhinolaryngology complaints were most commonly treated (18.5%). Homeopathy users were more likely to use multiple complementary and integrative medicine therapies and to perceive the therapy as helpful than were supplement users. US homeopathy use remains uncommon; however, users perceive it as helpful.

Fully Associative, Nonisothermal, Potential-Based Unified Viscoplastic Model for Titanium-Based Matrices

NASA Technical Reports Server (NTRS)

2005-01-01

A number of titanium matrix composite (TMC) systems are currently being investigated for high-temperature air frame and propulsion system applications. As a result, numerous computational methodologies for predicting both deformation and life for this class of materials are under development. An integral part of these methodologies is an accurate and computationally efficient constitutive model for the metallic matrix constituent. Furthermore, because these systems are designed to operate at elevated temperatures, the required constitutive models must account for both time-dependent and time-independent deformations. To accomplish this, the NASA Lewis Research Center is employing a recently developed, complete, potential-based framework. This framework, which utilizes internal state variables, was put forth for the derivation of reversible and irreversible constitutive equations. The framework, and consequently the resulting constitutive model, is termed complete because the existence of the total (integrated) form of the Gibbs complementary free energy and complementary dissipation potentials are assumed a priori. The specific forms selected here for both the Gibbs and complementary dissipation potentials result in a fully associative, multiaxial, nonisothermal, unified viscoplastic model with nonlinear kinematic hardening. This model constitutes one of many models in the Generalized Viscoplasticity with Potential Structure (GVIPS) class of inelastic constitutive equations.

Surface Acoustic Wave (SAW) Resonators for Monitoring Conditioning Film Formation

PubMed Central

Hohmann, Siegfried; Kögel, Svea; Brunner, Yvonne; Schmieg, Barbara; Ewald, Christina; Kirschhöfer, Frank; Brenner-Weiß, Gerald; Länge, Kerstin

2015-01-01

We propose surface acoustic wave (SAW) resonators as a complementary tool for conditioning film monitoring. Conditioning films are formed by adsorption of inorganic and organic substances on a substrate the moment this substrate comes into contact with a liquid phase. In the case of implant insertion, for instance, initial protein adsorption is required to start wound healing, but it will also trigger immune reactions leading to inflammatory responses. The control of the initial protein adsorption would allow to promote the healing process and to suppress adverse immune reactions. Methods to investigate these adsorption processes are available, but it remains difficult to translate measurement results into actual protein binding events. Biosensor transducers allow user-friendly investigation of protein adsorption on different surfaces. The combination of several transduction principles leads to complementary results, allowing a more comprehensive characterization of the adsorbing layer. We introduce SAW resonators as a novel complementary tool for time-resolved conditioning film monitoring. SAW resonators were coated with polymers. The adsorption of the plasma proteins human serum albumin (HSA) and fibrinogen onto the polymer-coated surfaces were monitored. Frequency results were compared with quartz crystal microbalance (QCM) sensor measurements, which confirmed the suitability of the SAW resonators for this application. PMID:26007735

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pritam Chakraborty; Michael R. Tonks; Giovanni Pastore

Grain boundary (GB) separation as a mechanism for fission gas release (FGR), complementary to gas bubble interlinkage, has been experimentally observed in irradiated light water reactor fuel. However there has been limited effort to develop physics-based models incorporating this mechanism for the analysis of FGR. In this work, a computational study is carried out to investigate GB separation in UO2 fuel under the effect of gas bubble pressure and hydrostatic stress. A non-dimensional stress intensity factor formula is obtained through 2D axisymmetric analyses considering lenticular bubbles and Mode-I crack growth. The obtained functional form can be used in higher length-scalemore » models to estimate the contribution of GB separation to FGR.« less

Complementary and alternative medicine in women's health. Developing a research agenda.

PubMed

Murphy, P A; Kronenberg, F; Wade, C

1999-01-01

Complementary and alternative medicine is becoming an established intervention modality within the contemporary health care system. Various forms of complementary and alternative medicine are used by patients and practitioners alike, including chiropractic, massage, botanical medicine, homeopathy, and energy therapies. The National Center for Complementary and Alternative Medicine was established within the National Institutes of Health to facilitate evaluation of these alternative therapies, establish an information clearinghouse, and promote research in the field. This article discusses several aspects of complementary and alternative medicine, relates them to women's health, and describes the need for a research agenda to evaluate the impact of the complementary and alternative medicine modalities used for important conditions affecting women.

Testing large aspheric surfaces with complementary annular subaperture interferometric method

NASA Astrophysics Data System (ADS)

Hou, Xi; Wu, Fan; Lei, Baiping; Fan, Bin; Chen, Qiang

2008-07-01

Annular subaperture interferometric method has provided an alternative solution to testing rotationally symmetric aspheric surfaces with low cost and flexibility. However, some new challenges, particularly in the motion and algorithm components, appear when applied to large aspheric surfaces with large departure in the practical engineering. Based on our previously reported annular subaperture reconstruction algorithm with Zernike annular polynomials and matrix method, and the experimental results for an approximate 130-mm diameter and f/2 parabolic mirror, an experimental investigation by testing an approximate 302-mm diameter and f/1.7 parabolic mirror with the complementary annular subaperture interferometric method is presented. We have focused on full-aperture reconstruction accuracy, and discuss some error effects and limitations of testing larger aspheric surfaces with the annular subaperture method. Some considerations about testing sector segment with complementary sector subapertures are provided.

75 FR 76019 - National Center for Complementary & Alternative Medicine; Notice of Meeting

Federal Register 2010, 2011, 2012, 2013, 2014

2010-12-07

... Complementary & Alternative Medicine; Notice of Meeting Pursuant to section 10(d) of the Federal Advisory... Complementary and Alternative Medicine (NACCAM) meeting. The meeting will be open to the public as indicated... for Complementary and Alternative Medicine. Date: February 4, 2011. Closed: February 4, 2011, 8:30 a.m...

Predictors of College Students' Use of Complementary and Alternative Medicine

ERIC Educational Resources Information Center

Chng, Chwee Lye; Neill, Kweethai; Fogle, Peggy

2003-01-01

This study assessed the use of complementary and alternative medicine among college students (N=913), the relationships between health locus of control with use of complementary and alternative medicine, and health local of control with attitudes toward complementary and alternative medicine and what predicts their use. A majority (66%, n-913) of…

78 FR 21381 - National Center for Complementary & Alternative Medicine; Notice of Closed Meeting

Federal Register 2010, 2011, 2012, 2013, 2014

2013-04-10

... Complementary & Alternative Medicine; Notice of Closed Meeting Pursuant to section 10(d) of the Federal Advisory... Complementary and Alternative Medicine Special Emphasis Education Panel. Date: June 21, 2013. Time: 8:00 a.m. to... Complementary and Alternative Medicine, National Institutes of Health, HHS) Dated: April 4, 2013. Michelle Trout...

76 FR 19379 - National Center for Complementary & Alternative Medicine; Notice of Meeting

Federal Register 2010, 2011, 2012, 2013, 2014

2011-04-07

... Complementary & Alternative Medicine; Notice of Meeting Pursuant to section 10(d) of the Federal Advisory... Complementary and Alternative Medicine (NACCAM) meeting. The meeting will be open to the public as indicated... for Complementary and Alternative Medicine. Date: June 3, 2011. Closed: June 3, 2011, 8:30 a.m. to 10...

The Prevalence of Complementary and Alternative Medicine Use Among Dermatology Outpatients in Shiraz, Iran

PubMed Central

Dastgheib, Ladan; Farahangiz, Saman; Adelpour, Zeinab; Salehi, Alireza

2017-01-01

The objective of this study was to assess complementary and alternative medicine use and its related factors among Iranian dermatology outpatients. In this cross-sectional study, a self-structured questionnaire was administered to 600 dermatology outpatients. Mann-Whitney U test, chi-square test, and binary logistic regression test were used. A total of 188 (31.3%) patients had used one of complementary and alternative medicine methods. The most frequent method used was herbal medicine (89.9%). The mean years of duration of the skin condition were significantly higher in complementary and alternative medicine users compared with nonusers (P = .037). Patients with acne and alopecia significantly used more complementary and alternative medicine (odds ratio: 2.48 and 3.19, respectively). There was a significant relationship between education and using complementary and alternative medicine (P < .001). Complementary and alternative medicine use is prevalent among our patients and we should think of ways of educating general population about complementary and alternative medicine methods and their potential risks and benefits and encourage our health care workers to communicate these materials with their patients. PMID:28446027

Knowledge, Attitude, and Practice of Complementary and Alternative Medicine Among Residents of Wayu Town, Western Ethiopia.

PubMed

Belachew, Negash; Tadesse, Tarekegne; Gube, Addisu Alemayehu

2017-10-01

Complementary and alternative medicine covers a wide variety of therapies and practices, which vary from country to country and region to region. The study was conducted to assess the knowledge, attitude, and practice of complementary and alternative medicine among the residents of Wayu town, Western Ethiopia. A descriptive cross-sectional study was carried out on 302 residents. A systematic sampling was used to select households. Data were entered in SPSS (version 20; IBM Corp) and descriptive statistics was carried out. Of 302 participants, 51.65% have a good knowledge, 78.6% were aware of complementary and alternative medicine, and 74.22% used it in the past 2 years. A total of 23.83% believe that complementary and alternative medicine is more effective than modern medicine and 28.8% preferred complementary and alternative medicine to modern medicine. This study revealed that in Wayu town, there is relatively high public interest in complementary and alternative medicine practices and a significant number has a good knowledge but generally the attitude toward complementary and alternative medicine is relatively low.

Knowledge, Attitude, and Practice of Complementary and Alternative Medicine Among Residents of Wayu Town, Western Ethiopia

PubMed Central

Belachew, Negash; Tadesse, Tarekegne

2017-01-01

Complementary and alternative medicine covers a wide variety of therapies and practices, which vary from country to country and region to region. The study was conducted to assess the knowledge, attitude, and practice of complementary and alternative medicine among the residents of Wayu town, Western Ethiopia. A descriptive cross-sectional study was carried out on 302 residents. A systematic sampling was used to select households. Data were entered in SPSS (version 20; IBM Corp) and descriptive statistics was carried out. Of 302 participants, 51.65% have a good knowledge, 78.6% were aware of complementary and alternative medicine, and 74.22% used it in the past 2 years. A total of 23.83% believe that complementary and alternative medicine is more effective than modern medicine and 28.8% preferred complementary and alternative medicine to modern medicine. This study revealed that in Wayu town, there is relatively high public interest in complementary and alternative medicine practices and a significant number has a good knowledge but generally the attitude toward complementary and alternative medicine is relatively low. PMID:29250965

The Prevalence of Complementary and Alternative Medicine Use Among Dermatology Outpatients in Shiraz, Iran.

PubMed

Dastgheib, Ladan; Farahangiz, Saman; Adelpour, Zeinab; Salehi, Alireza

2017-10-01

The objective of this study was to assess complementary and alternative medicine use and its related factors among Iranian dermatology outpatients. In this cross-sectional study, a self-structured questionnaire was administered to 600 dermatology outpatients. Mann-Whitney U test, chi-square test, and binary logistic regression test were used. A total of 188 (31.3%) patients had used one of complementary and alternative medicine methods. The most frequent method used was herbal medicine (89.9%). The mean years of duration of the skin condition were significantly higher in complementary and alternative medicine users compared with nonusers ( P = .037). Patients with acne and alopecia significantly used more complementary and alternative medicine (odds ratio: 2.48 and 3.19, respectively). There was a significant relationship between education and using complementary and alternative medicine ( P < .001). Complementary and alternative medicine use is prevalent among our patients and we should think of ways of educating general population about complementary and alternative medicine methods and their potential risks and benefits and encourage our health care workers to communicate these materials with their patients.

Use of Complementary Health Practices in a Church-Based African American Cohort.

PubMed

Escoto, Kamisha Hamilton; Milbury, Kathrin; Nguyen, Nga; Cho, Dalnim; Roberson, Crystal; Wetter, David; McNeill, Lorna H

2018-06-08

Few studies have examined the use of complementary health practices (e.g., mind/body practices and dietary supplements) among African Americans, particularly those who identify as being spiritual and/or religious. Furthermore, research on the health and health behavior profiles of such complementary health users is scant. The purpose of this study was to explore the use of complementary health practices and their lifestyle and health indicator correlates in a large, church-based African American population. Cross-sectional analysis of 1467 African American adults drawn from a church-based cohort study. Participants reported use of complementary health practices, lifestyle behaviors (e.g., diet and smoking status), and health indicators (e.g., physical health and medical problems). Multiple logistic regressions were conducted to examine associations between lifestyle variables, health indicators, and use of complementary health practices. Outcomes included prevalence of mind/body practices (e.g., meditation and Reiki) and dietary supplements (multivitamins) along with health indicator and lifestyle correlates of use. Use of complementary health practices was high; 40% reported using any mind/body practice and 50% reported using dietary supplements. Poorer physical health was associated with use of mind/body practices, while likelihood of meeting fruit and vegetable recommendations was significantly associated with dietary supplement use. Complementary health practices were used heavily in a church-based sample of African American adults. Poorer physical health was associated with use of complementary health practices, yet users also displayed health conscious behaviors. Given the high engagement in complementary health practices, it may be prudent to consider adapting complementary health approaches for use in wellness interventions targeting African Americans in faith-based settings.

Perception of risk and communication among conventional and complementary health care providers involving cancer patients' use of complementary therapies: a literature review.

PubMed

Stub, Trine; Quandt, Sara A; Arcury, Thomas A; Sandberg, Joanne C; Kristoffersen, Agnete E; Musial, Frauke; Salamonsen, Anita

2016-09-08

Communication between different health care providers (conventional and complementary) and cancer patients about their use of complementary therapies affects the health and safety of the patients. The aim of this study was to examine the qualitative research literature on the perception of and communication about the risk of complementary therapies between different health care providers and cancer patients. Systematic searches in six medical databases covering literature from 2000 to 2015 were performed. The studies were accessed according to the level of evidence and summarized into different risk situations. Qualitative content analysis was used to analyze the text data, and the codes were defined before and during the data analysis. Twenty-nine papers were included in the primary analysis and five main themes were identified and discussed. The main risk situations identified were 1. Differences in treatment concepts and philosophical values among complementary and conventional health care providers. 2. Adverse effects from complementary products and herbs due to their contamination/toxicity and interactions with conventional cancer treatment. 3. Health care physicians and oncologists find it difficult to recommend many complementary modalities due to the lack of scientific evidence for their effect. 4. Lack of knowledge and information about complementary and conventional cancer treatments among different health care providers. The risk of consuming herbs and products containing high level of toxins is a considerable threat to patient safety (direct risk). At the same time, the lack of scientific evidence of effect for many complementary therapies and differences in treatment philosophy among complementary and conventional health care providers potentially hinder effective communication about these threats with mutual patients (indirect risk). As such, indirect risk may pose an additional risk to patients who want to combine complementary therapies with conventional treatment in cancer care. Health care providers who care for cancer patients should be aware of these risks.

Complementary Feeding Interventions Have a Small but Significant Impact on Linear and Ponderal Growth of Children in Low- and Middle-Income Countries: A Systematic Review and Meta-Analysis.

PubMed

Panjwani, Anita; Heidkamp, Rebecca

2017-11-01

Background: World Health Assembly member states have committed to ambitious global targets for reductions in stunting and wasting by 2025. Improving complementary diets of children aged 6-23 mo is a recommended approach for reducing stunting in children <5 y old. Less is known about the potential of these interventions to prevent wasting. Objective: The aim of this article was to review and synthesize the current literature for the impact of complementary feeding interventions on linear [length-for-age z score (LAZ)] and ponderal [weight-for-length z score (WLZ)] growth of children aged 6-23 mo, with the specific goal of updating intervention-outcome linkages in the Lives Saved Tool (LiST). Methods: We started our review with studies included in the previous LiST review and searched for articles published since January 2012. We identified longitudinal trials that compared children aged 6-23 mo who received 1 of 2 types of complementary feeding interventions (nutrition education or counseling alone or complementary food supplementation with or without nutrition education or counseling) with a no-intervention control. We assessed study quality and generated pooled estimates of LAZ and WLZ change, as well as length and weight gain, for each category of intervention. Results: Interventions that provided nutrition education or counseling had a small but significant impact on linear growth in food-secure populations [LAZ standardized mean difference (SMD): 0.11; 95% CI: 0.01, 0.22] but not on ponderal growth. Complementary food supplementation interventions with or without nutrition education also had a small, significant effect in food-insecure settings on both LAZ (SMD: 0.08; 95% CI: 0.04, 0.13) and WLZ (SMD: 0.05; 95% CI: 0.01, 0.08). Conclusions: Nutrition education and complementary feeding interventions both had a small but significant impact on linear growth, and complementary feeding interventions also had an impact on ponderal growth of children aged 6-23 mo in low- and middle-income countries. The updated LiST model will support nutrition program planning and evaluation efforts by allowing users to model changes in intervention coverage on both stunting and wasting. © 2017 American Society for Nutrition.

X-ray micro-CT and neutron CT as complementary imaging tools for non-destructive 3D imaging of rare silicified fossil plants

NASA Astrophysics Data System (ADS)

Karch, J.; Dudák, J.; Žemlička, J.; Vavřík, D.; Kumpová, I.; Kvaček, J.; Heřmanová, Z.; Šoltés, J.; Viererbl, L.; Morgano, M.; Kaestner, A.; Trtík, P.

2017-12-01

Computed tomography provides 3D information of inner structures of investigated objects. The obtained information is, however, strongly dependent on the used radiation type. It is known that as X-rays interact with electron cloud and neutrons with atomic nucleus, the obtained data often provide different contrast of sample structures. In this work we present a set of comparative radiographic and CT measurements of rare fossil plant samples using X-rays and thermal neutrons. The X-ray measurements were performed using large area photon counting detectors Timepix at IEAP CTU in Prague and Perkin Elmer flat-panel detector at Center of Excellence Telč. The neutron CT measurement was carried out at Paul Scherrer Institute using BOA beam-line. Furthermore, neutron radiography of fossil samples, provided by National Museum, were performed using a large-area Timepix detector with a neutron-sensitive converting 6LiF layer at Research Centre Rez, Czech Republic. The obtained results show different capabilities of both imaging approaches. While X-ray micro-CT provides very high resolution and enables visualization of fine cracks or small cavities in the samples neutron imaging provides high contrast of morphological structures of fossil plant samples, where X-ray imaging provides insufficient contrast.

Multispectral radiation envelope characteristics of aerial infrared targets

NASA Astrophysics Data System (ADS)

Kou, Tian; Zhou, Zhongliang; Liu, Hongqiang; Yang, Yuanzhi; Lu, Chunguang

2018-07-01

Multispectral detection signals are relatively stable and complementary to single spectral detection signals with deficiencies of severe scintillation and poor anti-interference. To take advantage of multispectral radiation characteristics in the application of infrared target detection, the concept of a multispectral radiation envelope is proposed. To build the multispectral radiation envelope model, the temperature distribution of an aerial infrared target is calculated first. By considering the coupling heat transfer process, the heat balance equation is built by using the node network, and the convective heat transfer laws as a function of target speed are uncovered. Then, the tail flame temperature distribution model is built and the temperature distributions at different horizontal distances are calculated. Second, to obtain the optimal detection angles, envelope models of reflected background multispectral radiation and target multispectral radiation are built. Finally, the envelope characteristics of the aerial target multispectral radiation are analyzed in different wavebands in detail. The results we obtained reflect Wien's displacement law and prove the effectiveness and reasonableness of the envelope model, and also indicate that the major difference between multispectral wavebands is greatly influenced by the target speed. Moreover, optimal detection angles are obtained by numerical simulation, and these are very important for accurate and fast target detection, attack decision-making and developing multispectral detection platforms.

Rediscovering ancient glass technologies through the examination of opacifier crystals

NASA Astrophysics Data System (ADS)

Lahlil, S.; Biron, I.; Galoisy, L.; Morin, G.

2008-07-01

The aim of the study is to understand how antimonate opacifying crystals were obtained throughout history. Two archaeological glass productions opacified with calcium and lead antimonates are studied in this paper, in order to rediscover ancient opaque glass technologies: Roman mosaic tesserae (1st cent. B.C. 4th cent. A.D.) and Nevers lampworking glass (18th cent. A.D.). The fine examination of crystalline phases and of the vitreous matrix is undertaken using various and complementary techniques. Results are compared with a modern reference production, for which the technological process is well known. We demonstrate that Ca-antimonate opacifiers in Roman mosaic tesserae, as well as in Nevers lampworking glass, were obtained by in situ crystallization. Nevertheless, Roman and Nevers glass would have undergone different firing processes. We propose that the addition of previously synthesized crystals or the use of “anime” could be the process used to obtain Pb-antimonate opacified glass, for both productions studied. We demonstrate that CaO, PbO and Sb2O3 concentrations in the bulk compositions and in the matrices, and their evolution with the crystallinity ratio, offer robust criteria for the distinction of the opacification process used. Also, the different crystalline structures help to provide information on the experimental conditions.

Search in 8 TeV proton-proton collisions with the MoEDAL monopole-trapping test array

NASA Astrophysics Data System (ADS)

Pinfold, J.; Soluk, R.; Lacarrère, D.; Katre, A.; Mermod, P.; Bendtz, K.; Milstead, D.

2014-06-01

The magnetic monopole appears in theories of spontaneous gauge symmetry breaking and its existence would explain the quantisation of electric charge. MoEDAL is the latest approved LHC experiment, designed to search directly for monopoles produced in high-energy collisions. It has now taken data for the first time. The MoEDAL detectors are based on two complementary techniques: nuclear-track detectors are sensitive to the high-ionisation signature expected from a monopole, and the magnetic monopole trapper (MMT) relies on the stopping and trapping of monopoles inside an aluminium array which is then analysed with a superconducting magnetometer. The first results obtained with the MoEDAL MMT test array deployed in 2012 are presented. This experiment probes monopoles carrying a multiple of the fundamental unit magnetic charge for the first time at the LHC.

Approaches to chemical synthetic biology.

PubMed

Chiarabelli, Cristiano; Stano, Pasquale; Anella, Fabrizio; Carrara, Paolo; Luisi, Pier Luigi

2012-07-16

Synthetic biology is first represented in terms of two complementary aspects, the bio-engineering one, based on the genetic manipulation of extant microbial forms in order to obtain forms of life which do not exist in nature; and the chemical synthetic biology, an approach mostly based on chemical manipulation for the laboratory synthesis of biological structures that do not exist in nature. The paper is mostly devoted to shortly review chemical synthetic biology projects currently carried out in our laboratory. In particular, we describe: the minimal cell project, then the "Never Born Proteins" and lastly the Never Born RNAs. We describe and critically analyze the main results, emphasizing the possible relevance of chemical synthetic biology for the progress in basic science and biotechnology. Copyright © 2012 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

Application of infrared spectroscopy and pyrolysis gas chromatography for characterisation of adhesive tapes

NASA Astrophysics Data System (ADS)

Zięba-Palus, Janina; Nowińska, Sabina; Kowalski, Rafał

2016-12-01

Infrared spectroscopy and pyrolysis GC/MS were applied in the comparative analysis of adhesive tapes. By providing information about the polymer composition, it was possible to classify both backings and adhesives of tapes into defined chemical classes. It was found that samples of the same type (of backings and adhesives) and similar infrared spectra can in most cases be effectively differentiated using Py-GC/MS, sometimes based only on the presence of peaks of very low intensity originating from minor components. The results obtained enabled us to draw the conclusion that Py-GC/MS appears to be a valuable analytical technique for examining tapes, which is complementary to infrared spectroscopy. Identification of pyrolysis products enables discrimination of samples. Both methods also provide crucial information that is useful for identification of adhesive tapes found at the crime scene.

DNA and RNA polymerase activity in a Moniliophthora perniciosa mitochondrial plasmid and self-defense against oxidative stress.

PubMed

Andrade, B S; Villela-Dias, C; Gomes, D S; Micheli, F; Góes-Neto, A

2013-06-13

Moniliophthora perniciosa (Stahel) Aime and Phillips-Mora is a hemibiotrophic basidiomycete (Agaricales, Tricholomataceae) that causes witches' broom disease in cocoa (Theobroma cacao L.). This pathogen carries a stable integrated invertron-type linear plasmid in its mitochondrial genome that encodes viral-like DNA and RNA polymerases related to fungal senescence and longevity. After culturing the fungus and obtaining its various stages of development in triplicate, we carried out total RNA extraction and subsequent complementary DNA synthesis. To analyze DNA and RNA polymerase expression levels, we performed real-time reverse transcriptase polymerase chain reaction for various fungal phases of development. Our results showed that DNA and RNA polymerase gene expression in the primordium phase of M. perniciosa is related to a potential defense mechanism against T. cacao oxidative attack.

Decomposition of Proteins into Dynamic Units from Atomic Cross-Correlation Functions.

PubMed

Calligari, Paolo; Gerolin, Marco; Abergel, Daniel; Polimeno, Antonino

2017-01-10

In this article, we present a clustering method of atoms in proteins based on the analysis of the correlation times of interatomic distance correlation functions computed from MD simulations. The goal is to provide a coarse-grained description of the protein in terms of fewer elements that can be treated as dynamically independent subunits. Importantly, this domain decomposition method does not take into account structural properties of the protein. Instead, the clustering of protein residues in terms of networks of dynamically correlated domains is defined on the basis of the effective correlation times of the pair distance correlation functions. For these properties, our method stands as a complementary analysis to the customary protein decomposition in terms of quasi-rigid, structure-based domains. Results obtained for a prototypal protein structure illustrate the approach proposed.

Reinforced Superhydrophobic Coating on Silicone Rubber for Longstanding Anti-Icing Performance in Severe Conditions.

PubMed

Emelyanenko, Alexandre M; Boinovich, Ludmila B; Bezdomnikov, Alexey A; Chulkova, Elizaveta V; Emelyanenko, Kirill A

2017-07-19

We present a simple method for fabricating the superhydrophobic coatings on composite silicone rubber used for electrical outdoor applications. The coating is characterized by contact angles as high as 170° and is mechanically durable in contact with the aqueous phase. We discuss the impact of mechanical durability of the surface texture on the anti-icing performance of the coating on the basis of the experimental data on freezing delay of sessile aqueous droplets. A set of complementary data obtained in laboratory and outdoor experiments on freezing delay time, variation of wettability and practical work of adhesion for supercooled aqueous sessile droplets, impacting behavior of droplets at low negative temperatures, as well as the results of snow and ice accumulation in outdoor experiments indicate the very prospective icephobic properties of the developed coating.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Conn, Charlotte E.; Darmanin, Connie; Sagnella, Sharon M.

The dopamine D2 long (D2L) receptor and bacteriorhodopsin (bR), which are integral membraneproteins, have been incorporated within bicontinuous cubic mesophases formed by the lipids anandamide and H-farnesoyl monoethanolamide, which have been specifically investigated by us for use as in mesocrystallization media. We show that the incorporated membraneprotein affects the structure of the cubic phases with the particular effect observed dependent on the geometry of the underlying cubic phase. The results are complementary to those obtained in Part 1 of this series, where we demonstrated that the structural effects observed depend on the structure of the membraneprotein. Importantly protein concentrations commonlymore » used for crystallization can destroy the cubic phase matrix, particularly where there is a large discrepancy between the hydrophilic and the hydrophobic spans of the membraneprotein, and the hydrophilic and hydrophobic domain sizes of the cubic phase.« less

[Malaria in the Republic of Djibouti. Strategy for control using a biological antilarval campaign: indigenous larvivorous fishes (Aphanius dispar) and bacterial toxins].

PubMed

Louis, J P; Albert, J P

1988-01-01

The authors take stock of the present situation of malaria in the Republic of Djibouti which, after several decades of silence, seems to have been reintroduced at the beginning of the seventies. Actually it is hypo-endemic malaria with Plasmodium falciparum of which the only vector seems to be Anopheles arabiensis, gambiae complex. The specificity of the larvae nests allows a control strategy based on the only treatment of larvae sites by biological control: larvivorous fishes (Aphanius Dispar) and in addition the pin-point use of bacterial toxins as a complementary measure. The first results obtained in the rural zones around the capital are encouraging and permit to envisage the extensions of such a strategy to the whole of the territory of the Republic.

A rapid procedure for measurement of the free testosterone fraction in human plasma using the centria radioimmunoassay centrifugal analyzer.

PubMed

Schwarz, S; Boyd, J

1981-01-01

Following the incubation of plasma with a tracer amount of tritiated testosterone, the reaction mixture is separated into a sex hormone-binding globulin bound and an unbound fraction of radioligand using DEAE-cellulose columns placed in the incubator-separator module of the Centria radioimmunoassay centrifugal analyzer. Neural Tris-buffer elutes unbound steroid from the matrix, while acidic Tris-buffer can remove the protein-bound fraction in a subsequent step. Complementary and thus qualitatively equal results are obtained when counting either eluate. Comparison of this technique with an ammonium sulfate precipitation method showed high correlation. Free testosterone indices as determined by the Centria modification in a number of prepuberal children, normal men and women, as well as pregnant and hirsute women similar to those previously reported.

Inelastic Neutron Scattering and Magnetisation Investigation of an Exchange-Coupled Dy2 SMM

NASA Astrophysics Data System (ADS)

Baker, Michael L.; Zhang, Qing; Sarachik, Myriam P.; Kent, Andrew D.; Chen, Yizhang; Butch, Nicholas; Pineda, Eufemio M.; McInnes, Eric

The strong spin orbit coupling and weak crystal field energies of simple exchange-coupled rare earth SMMs makes the precise evaluation of their magnetic properties nontrivial. Here we report a detailed investigation of the single molecule magnet hqH2Dy2(hq)4(NO3)3MeOH. Inelastic neutron scattering is used to obtain direct access to several low energy crystal field excitations. The INS results display several features that are not found in earlier FIR absorption experiments, while other features found in the latter are absent. Based on the effective point charge model, numerical calculations are currently underway to resolve these apparent discrepancies using complementary magnetisation measurements to resolve the exchange between Dy ions. Work supported by ARO W911NF-13-1-1025 (CCNY) and NSF-DMR-1309202 (NYU).

Capillary electrophoresis, a method for the determination of nucleic acid ligands covalently attached to quantum dots representing a donor of Förster resonance energy transfer.

PubMed

Datinská, Vladimíra; Klepárník, Karel; Belšánová, Barbora; Minárik, Marek; Foret, František

2018-05-09

The synthesis and determination of the structure of a Förster resonance energy transfer probe intended for the detection of specific nucleic acid sequences are described here. The probe is based on the hybridization of oligonucleotide modified quantum dots with a fluorescently labeled nucleic acid sample resulting in changes of the fluorescence emission due to the energy transfer effect. The stoichiometry distribution of oligonucleotides conjugated to quantum dots was determined by capillary electrophoresis separation. The results indicate that one to four molecules of oligonucleotide are conjugated to the surface of a single nanoparticle. This conclusion is confirmed by the course of the dependence of Förster resonance energy transfer efficiency on the concentration of fluorescently labeled complementary single-stranded nucleic acid, showing saturation. While the energy transfer efficiency of the probe hybridized with complementary nucleic acid strands was 30%, negligible efficiency was observed with a non-complementary strands. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Theoretical and Kinetic Tools for Selecting Effective Antioxidants: Application to the Protection of Omega-3 Oils with Natural and Synthetic Phenols

PubMed Central

Guitard, Romain; Nardello-Rataj, Véronique; Aubry, Jean-Marie

2016-01-01

Radical-scavenging antioxidants play crucial roles in the protection of unsaturated oils against autoxidation and, especially, edible oils rich in omega-3 because of their high sensitivity to oxygen. Two complementary tools are employed to select, among a large set of natural and synthetic phenols, the most promising antioxidants. On the one hand, density functional theory (DFT) calculations provide bond dissociation enthalpies (BDEs) of 70 natural (i.e., tocopherols, hydroxybenzoic and cinnamic acids, flavonoids, stilbenes, lignans, and coumarins) and synthetic (i.e., 2,6-di-tert-butyl-4-methylphenol (BHT), 3-tert-butyl-4-hydroxyanisol (BHA), and tert-butylhydroquinone (TBHQ)) phenols. These BDEs are discussed on the basis of structure–activity relationships with regard to their potential antioxidant activities. On the other hand, the kinetic rate constants and number of hydrogen atoms released per phenol molecule are measured by monitoring the reaction of phenols with 2,2-diphenyl-1-picrylhydrazyl (DPPH•) radical. The comparison of the results obtained with these two complementary methods allows highlighting the most promising antioxidants. Finally, the antioxidant effectiveness of the best candidates is assessed by following the absorption of oxygen by methyl esters of linseed oil containing 0.5 mmol L−1 of antioxidant and warmed at 90 °C under oxygen atmosphere. Under these conditions, some natural phenols namely epigallocatechin gallate, myricetin, rosmarinic and carnosic acids were found to be more effective antioxidants than α-tocopherol. PMID:27483242

Fluorescence correlation spectroscopy study of the complexation of DNA hybrids, IgG antibody, and a chimeric protein of IgG-binding ZZ domains fused with a carbohydrate binding module.

PubMed

Rosa, A M M; Prazeres, D M F; Paulo, P M R

2017-06-28

Fluorescence correlation spectroscopy (FCS) was used to characterize the molecular interactions between the four components of a DNA recognition system. A fluorescent DNA probe was used to assess: (i) the hybridization with a complementary biotin-labeled target, (ii) the complexation of the resulting hybrid and an anti-biotin antibody, and (iii) the binding of the latter complex to a ZZ-CBM fusion protein that combines small synthetic IgG Fc-binding Z domains with a carbohydrate binding module (CBM). These binding interactions were monitored by exposing the fluorescent DNA probe to different amounts and combinations of the other molecules in solution. Through the analysis of FCS autocorrelation curves, an association constant (K a ) of 2.9 × 10 7 M -1 was estimated for DNA·DNA hybridization, and the presence of (non-) complementary target DNA in solution could be discriminated. The specific capture of biotinylated DNA hybrids by anti-biotin IgG was verified, with an apparent K a of 2.5 × 10 6 M -1 . The increment in the diffusion time measured when the DNA·DNA:antibody complexes were in contact with the ZZ-CBM fusion protein suggested that the binding occurs at a stoichiometric ratio of DNA/antibody complex to fusion larger than 1 : 1. The FCS-derived information obtained is useful to gain insight into molecular interactions involved in diagnostic assays.

An Integrated Phosphoproteomics Work Flow Reveals Extensive Network Regulation in Early Lysophosphatidic Acid Signaling*

PubMed Central

Schreiber, Thiemo B.; Mäusbacher, Nina; Kéri, György; Cox, Jürgen; Daub, Henrik

2010-01-01

Lysophosphatidic acid (LPA) induces a variety of cellular signaling pathways through the activation of its cognate G protein-coupled receptors. To investigate early LPA responses and assess the contribution of epidermal growth factor (EGF) receptor transactivation in LPA signaling, we performed phosphoproteomics analyses of both total cell lysate and protein kinase-enriched fractions as complementary strategies to monitor phosphorylation changes in A498 kidney carcinoma cells. Our integrated work flow enabled the identification and quantification of more than 5,300 phosphorylation sites of which 224 were consistently regulated by LPA. In addition to induced phosphorylation events, we also obtained evidence for early dephosphorylation reactions due to rapid phosphatase regulation upon LPA treatment. Phosphorylation changes induced by direct heparin-binding EGF-like growth factor-mediated EGF receptor activation were typically weaker and only detected on a subset of LPA-regulated sites, indicating signal integration among EGF receptor transactivation and other LPA-triggered pathways. Our results reveal rapid phosphoregulation of many proteins not yet implicated in G protein-coupled receptor signaling and point to various additional mechanisms by which LPA might regulate cell survival and migration as well as gene transcription on the molecular level. Moreover, our phosphoproteomics analysis of both total lysate and kinase-enriched fractions provided highly complementary parts of the LPA-regulated signaling network and thus represents a useful and generic strategy toward comprehensive signaling studies on a system-wide level. PMID:20071362

Use of Complementary and Alternative Medicine for Epileptic Children in Tehran: A Cross-Sectional Study (2009-2011)

PubMed Central

TONEKABONI, Seyed Hassan; JAFARI NAEINI, Sepideh; KHAJEH, Ali; YAGHINI, Omid; GHAZAVI, Ahad; ABDOLLAH GORJI, Fatemeh

2014-01-01

Objective Although the use of Complementary and Alternative Medicine (CAM) has been evaluated globally, there are few studies in our country on this subject. The purpose of this study was to determine the prevalence, pattern of use, parental sources of information, and benefits of CAM in epileptic children in Tehran. Materials & Methods One hundred thirty-three parents or relatives of epileptic children who were referred to outpatient clinics or admitted in neurologic ward of four major hospitals in Tehran, were interviewed by our researcher based on a structured questionnaire; from 2009 to 2010. The information obtained comprised the demographic data of patients and their parents, frequency and morphology of convulsions, the type and sources of CAM and finally, the benefits and adverse effects of this practice. Results Forty-four percent of the respondents had used CAM methods either alone or in combination with other methods. The most frequently used CAM was written prayers followed by oral herbs and special diets. CAM was mainly introduced to them by relatives. Only 16.7% of these parents had discussed this matter with their children’s physicians. No efficacy to control seizure was observed for most of these methods. Conclusion This study showed that use of CAM in our study group is relatively common and may have a potentially hazardous role in the treatment process. So, it is necessary for physicians to have enough information about CAM practice in their patients. PMID:24665324

Safety and Toxicity of Saw palmetto in the Complementary and Alternative Medicine for Urological Symptoms (CAMUS) Trial

PubMed Central

Avins, Andrew L.; Lee, Jeannette Y.; Meyers, Catherine M.; Barry, Michael J.

2013-01-01

Purpose Extracts of the saw palmetto berry are used by many men in the U.S. as self-treatment for lower urinary tract symptoms due to benign prostatic hyperplasia. While the most recent data from double-blind clinical trials do not support efficacy superior to that of placebo, there are few data on the toxicity of saw palmetto. Materials and Methods 369 patients were randomized in the Complementary and Alternative Medicine for Urological Symptoms (CAMUS) trial; 357 participants are included in this modified intention-to-treat analysis. Participants were randomized to 320mg, 640mg, and 960mg daily of an ethanolic saw palmetto extract or an identical-appearing placebo, in an escalating manner at 6-month intervals, for a total of 18 months follow-up. Adverse-event assessments, vital signs, and blood and urine laboratory tests were obtained at regular intervals. Results There were no statistically significant differences between groups in rates of serious or non-serious adverse events, changes in vital signs, digital prostate exam findings, or study withdrawal rates. Overall, there were no significant inter-group differences in the occurrence of laboratory-test abnormalities; differences in individual laboratory tests were uncommon and small in magnitude. No evidence of significant dose-response phenomena were identified. Conclusions The saw palmetto extract used in the CAMUS trial showed no evidence of toxicity at doses up to three times the usual clinical dose over a period of 18 months. PMID:23063633

Theoretical and Kinetic Tools for Selecting Effective Antioxidants: Application to the Protection of Omega-3 Oils with Natural and Synthetic Phenols.

PubMed

Guitard, Romain; Nardello-Rataj, Véronique; Aubry, Jean-Marie

2016-07-29

Radical-scavenging antioxidants play crucial roles in the protection of unsaturated oils against autoxidation and, especially, edible oils rich in omega-3 because of their high sensitivity to oxygen. Two complementary tools are employed to select, among a large set of natural and synthetic phenols, the most promising antioxidants. On the one hand, density functional theory (DFT) calculations provide bond dissociation enthalpies (BDEs) of 70 natural (i.e., tocopherols, hydroxybenzoic and cinnamic acids, flavonoids, stilbenes, lignans, and coumarins) and synthetic (i.e., 2,6-di-tert-butyl-4-methylphenol (BHT), 3-tert-butyl-4-hydroxyanisol (BHA), and tert-butylhydroquinone (TBHQ)) phenols. These BDEs are discussed on the basis of structure-activity relationships with regard to their potential antioxidant activities. On the other hand, the kinetic rate constants and number of hydrogen atoms released per phenol molecule are measured by monitoring the reaction of phenols with 2,2-diphenyl-1-picrylhydrazyl (DPPH(•)) radical. The comparison of the results obtained with these two complementary methods allows highlighting the most promising antioxidants. Finally, the antioxidant effectiveness of the best candidates is assessed by following the absorption of oxygen by methyl esters of linseed oil containing 0.5 mmol L(-1) of antioxidant and warmed at 90 °C under oxygen atmosphere. Under these conditions, some natural phenols namely epigallocatechin gallate, myricetin, rosmarinic and carnosic acids were found to be more effective antioxidants than α-tocopherol.

[Changes in the demand for paediatric neurology care in a spanish tertiary care hospital over a 20-year period].

PubMed

Monge Galindo, L; López-Pisón, J; Samper Villagrasa, P; Peña Segura, J L

2014-01-01

The purpose of this study is to determine the profile of the demand for paediatric neurology care in a Spanish tertiary hospital over the past 20 years. We studied epidemiological data, reasons for consultation, diagnoses and complementary tests from all patients examined by our Paediatric Neurology Unit in its 20 years of service (from May 1990 to March 2010). We also reviewed data from patients whose first visit took place within the last five years (2005-2010) and compared them to data obtained from a prior study carried out in this Unit from 1990 to 1995. To compare the first 5 years (group 1) with the last 5 years (group 2), we calculated confidence intervals, P<.05, for the frequency distribution (%) in each category. Main reasons for consultation and principal diagnoses for the 12726 patients evaluated in the 20-year period, as well as results from group 1 (2046 patients) and group 2 (4488 patients) corresponding to first and the last 5 years of activity respectively, are presented with their confidence intervals in a series of tables. Variations in the reasons for consultation, diagnoses and complementary tests over time reflect changes determined by medical, scientific and social progress, and organisational changes specific to each hospital. This explains the difficulty of comparing different patient series studied consecutively, which are even more pronounced between different hospitals. Copyright © 2012 Sociedad Española de Neurología. Published by Elsevier Espana. All rights reserved.

Relationship between the caregiver's report on the patient's spontaneous-speech and the Brief Aphasia Evaluation.

PubMed

Vigliecca, Nora Silvana

2017-11-09

To study the relationship between the caregiver's perception about the patient's impairment in spontaneous speech, according to an item of four questions administered by semi-structured interview, and the patient's performance in the Brief Aphasia Evaluation (BAE). 102 right-handed patients with focal brain lesions of different types and location were examined. BAE is a valid and reliable instrument to assess aphasia. The caregiver's perception was correlated with the item of spontaneous speech, the total score and the three main factors of the BAE: Expression, Comprehension and Complementary factors. The precision (sensitivity/ specificity) about the caregiver's perception of the patient's spontaneous speech was analyzed with reference to the presence or absence of disorder, according to the professional, on the BAE item of spontaneous speech. The studied correlation was satisfactory, being greater (higher than 80%) for the following indicators: the item of spontaneous speech, the Expression factor and the total score of the scale; the correlation was a little smaller (higher than 70%) for the Comprehension and Complementary factors. Comparing two cut-off points that evaluated the precision of the caregiver's perception, satisfactory results were observed in terms of sensitivity and specificity (>70%) with likelihood ratios higher than three. By using the median as the cut-off point, more satisfactory diagnostic discriminations were obtained. Interviewing the caregiver specifically on the patient's spontaneous speech, in an abbreviated form, provides relevant information for the aphasia diagnosis.

geneCommittee: a web-based tool for extensively testing the discriminatory power of biologically relevant gene sets in microarray data classification.

PubMed

Reboiro-Jato, Miguel; Arrais, Joel P; Oliveira, José Luis; Fdez-Riverola, Florentino

2014-01-30

The diagnosis and prognosis of several diseases can be shortened through the use of different large-scale genome experiments. In this context, microarrays can generate expression data for a huge set of genes. However, to obtain solid statistical evidence from the resulting data, it is necessary to train and to validate many classification techniques in order to find the best discriminative method. This is a time-consuming process that normally depends on intricate statistical tools. geneCommittee is a web-based interactive tool for routinely evaluating the discriminative classification power of custom hypothesis in the form of biologically relevant gene sets. While the user can work with different gene set collections and several microarray data files to configure specific classification experiments, the tool is able to run several tests in parallel. Provided with a straightforward and intuitive interface, geneCommittee is able to render valuable information for diagnostic analyses and clinical management decisions based on systematically evaluating custom hypothesis over different data sets using complementary classifiers, a key aspect in clinical research. geneCommittee allows the enrichment of microarrays raw data with gene functional annotations, producing integrated datasets that simplify the construction of better discriminative hypothesis, and allows the creation of a set of complementary classifiers. The trained committees can then be used for clinical research and diagnosis. Full documentation including common use cases and guided analysis workflows is freely available at http://sing.ei.uvigo.es/GC/.

Physicochemical study of natural fractionated biocolloid by asymmetric flow field-flow fractionation in tandem with various complementary techniques using biologically synthesized silver nanocomposites.

PubMed

Railean-Plugaru, Viorica; Pomastowski, Pawel; Kowalkowski, Tomasz; Sprynskyy, Myroslav; Buszewski, Boguslaw

2018-04-01

Asymmetric flow field-flow fractionation coupled with use of ultraviolet-visible, multiangle light scattering (MALLS), and dynamic light scattering (DLS) detectors was used for separation and characterization of biologically synthesized silver composites in two liquid compositions. Moreover, to supplement the DLS/MALLS information, various complementary techniques such as transmission electron spectroscopy, Fourier transform infrared spectroscopy, and matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS) were used. The hydrodynamic diameter and the radius of gyration of silver composites were slightly larger than the sizes obtained by transmission electron microscopy (TEM). Moreover, the TEM results revealed the presence of silver clusters and even several morphologies, including multitwinned. Additionally, MALDI-TOF MS examination showed that the particles have an uncommon cluster structure. It can be described as being composed of two or more silver clusters. The organic surface of the nanoparticles can modify their dispersion. We demonstrated that the variation of the silver surface coating directly influenced the migration rate of biologically synthesized silver composites. Moreover, this study proves that the fractionation mechanism of silver biocolloids relies not only on the particle size but also on the type and mass of the surface coatings. Because silver nanoparticles typically have size-dependent cytotoxicity, this behavior is particularly relevant for biomedical applications. Graphical abstract Workflow for asymmetric flow field-flow fractionation of natural biologically synthesized silver nanocomposites.