Sample records for complementary target dna

  1. Inhibition of BRCA2 and Thymidylate Synthase Creates Multidrug Sensitive Tumor Cells via the Induction of Combined "Complementary Lethality".

    PubMed

    Rytelewski, Mateusz; Ferguson, Peter J; Maleki Vareki, Saman; Figueredo, Rene; Vincent, Mark; Koropatnick, James

    2013-03-12

    A high mutation rate leading to tumor cell heterogeneity is a driver of malignancy in human cancers. Paradoxically, however, genomic instability can also render tumors vulnerable to therapeutic attack. Thus, targeting DNA repair may induce an intolerable level of DNA damage in tumor cells. BRCA2 mediates homologous recombination repair, and BRCA2 polymorphisms increase cancer risk. However, tumors with BRCA2 mutations respond better to chemotherapy and are associated with improved patient prognosis. Thymidylate synthase (TS) is also involved in DNA maintenance and generates cellular thymidylate. We determined that antisense downregulation of BRCA2 synergistically potentiated drugs with mechanisms of action related to BRCA2 function (cisplatin, melphalan), a phenomenon we named "complementary lethality." TS knockdown induced complementary lethality to TS-targeting drugs (5-FUdR and pemetrexed) but not DNA cross-linking agents. Combined targeting of BRCA2 and TS induced complementary lethality to both DNA-damaging and TS-targeting agents, thus creating multidrug sensitive tumors. In addition, we demonstrated for the first time that simultaneous downregulation of both targets induced combined complementary lethality to multiple mechanistically different drugs in the same cell population. In this study, we propose and define the concept of "complementary lethality" and show that actively targeting BRCA2 and TS is of potential therapeutic benefit in multidrug treatment of human tumors. This work has contributed to the development of a BRCA2-targeting antisense oligdeoxynucleotide (ASO) "BR-1" which we will test in vivo in combination with our TS-targeting ASO "SARI 83" and attempt early clinical trials in the future.Molecular Therapy - Nucleic Acids (2013) 2, e78; doi:10.1038/mtna.2013.7 published online 12 March 2013.

  2. Aptamer-based electrochemical sensors with aptamer-complementary DNA oligonucleotides as probe.

    PubMed

    Lu, Ying; Li, Xianchan; Zhang, Limin; Yu, Ping; Su, Lei; Mao, Lanqun

    2008-03-15

    This study describes a facile and general strategy for the development of aptamer-based electrochemical sensors with a high specificity toward the targets and a ready regeneration feature. Very different from the existing strategies for the development of electrochemical aptasensors with the aptamers as the probes, the strategy proposed here is essentially based on the utilization of the aptamer-complementary DNA (cDNA) oligonucleotides as the probes for electrochemical sensing. In this context, the sequences at both ends of the cDNA are tailor-made to be complementary and both the redox moiety (i.e., ferrocene in this study) and thiol group are labeled onto the cDNA. The labeled cDNA are hybridized with their respective aptamers (i.e., ATP- and thrombin-binding aptamers in this study) to form double-stranded DNA (ds-DNA) and the electrochemical aptasensors are prepared by self-assembling the labeled ds-DNA onto Au electrodes. Upon target binding, the aptamers confined onto electrode surface dissociate from their respective cDNA oligonucleotides into the solution and the single-stranded cDNA could thus tend to form a hairpin structure through the hybridization of the complementary sequences at both its ends. Such a conformational change of the cDNA resulting from the target binding-induced dissociation of the aptamers essentially leads to the change in the voltammetric signal of the redox moiety labeled onto the cDNA and thus constitutes the mechanism for the electrochemical aptasensors for specific target sensing. The aptasensors demonstrated here with the cDNA as the probe are readily regenerated and show good responses toward the targets. This study may offer a new and relatively general approach to electrochemical aptasensors with good analytical properties and potential applications.

  3. Effect of structure variation of the aptamer-DNA duplex probe on the performance of displacement-based electrochemical aptamer sensors.

    PubMed

    Pang, Jie; Zhang, Ziping; Jin, Haizhu

    2016-03-15

    Electrochemical aptamer-based (E-AB) sensors employing electrode-immobilized, redox-tagged aptamer probes have emerged as a promising platform for the sensitive and quick detection of target analytes ranging from small molecules to proteins. Signal generation in this class of sensor is linked to change in electron transfer efficiency upon binding-induced change in flexibility/conformation of the aptamer probe. Because of this signaling mechanism, signal gains of these sensors can be improved by employing a displacement-based recognition system, which links target binding with a large-scale flexibility/conformation shift from the aptamer-DNA duplex to the single-stranded DNA or the native aptamer. Despite the relatively large number of displacement-based E-AB sensor samples, little attention has been paid to the structure variation of the aptamer-DNA duplex probe. Here we detail the effects of complementary length and position of the aptamer-DNA duplex probe on the performance of a model displacement-based E-AB sensor for ATP. We find that, greater background suppression and signal gain are observed with longer complementary length of the aptamer-DNA duplex probe. However, sensor equilibration time slows monotonically with increasing complementary length; and with too many target binding sites in aptamer sequence being occupied by the complementary DNA, the aptamer-target binding does not occur and no signal gain observed. We also demonstrate that signal gain of the displacement-based E-AB sensor is strongly dependent on the complementary position of the aptamer-DNA duplex probe, with complementary position located at the electrode-attached or redox-tagged end of the duplex probe, larger background suppression and signal increase than that of the middle position are observed. These results highlight the importance of rational structure design of the aptamer-DNA duplex probe and provide new insights into the optimization of displacement-based E-AB sensors. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. Design of a Sensitive and Selective Electrochemical Aptasensor for the Determination of the Complementary cDNA of miRNA-145 Based on the Intercalation and Electrochemical Reduction of Doxorubicin.

    PubMed

    Mohamadi, Maryam; Mostafavi, Ali; Torkzadeh-Mahani, Masoud

    2017-11-01

    The aim of this research was the determination of a microRNA (miRNA) using a DNA electrochemical aptasensor. In this biosensor, the complementary complementary DNA (cDNA) of miRNA-145 (a sense RNA transcript) was the target strand and the cDNA of miRNA-145 was the probe strand. Both cDNAs can be the product of the reverse transcriptase-polymerase chain reaction of miRNA. The proposed aptasensor's function was based on the hybridization of target strands with probes immobilized on the surface of a working electrode and the subsequent intercalation of doxorubicin (DOX) molecules functioning as the electroactive indicators of any double strands that formed. Electrochemical transduction was performed by measuring the cathodic current resulting from the electrochemical reduction of the intercalated molecules at the electrode surface. In the experiment, because many DOX molecules accumulated on each target strand on the electrode surface, amplification was inherently easy, without a need for enzymatic or complicated amplification strategies. The proposed aptasensor also had the excellent ability to regenerate as a result of the melting of the DNA duplex. Moreover, the use of DNA probe strands obviated the challenges of working with an RNA probe, such as sensitivity to RNase enzyme. In addition to the linear relationship between the electrochemical signal and the concentration of the target strands that ranged from 2.0 to 80.0 nM with an LOD of 0.27 nM, the proposed biosensor was clearly capable of distinguishing between complementary (target strand) and noncomplementary sequences. The presented biosensor was successfully applied for the quantification of DNA strands corresponding to miRNA-145 in human serum samples.

  5. A novel technology for the detection, enrichment, and separation of trace amounts of target DNA based on amino-modified fluorescent magnetic composite nanoparticles.

    PubMed

    Wang, Guannan; Su, Xingguang

    2010-06-01

    A novel, highly sensitive technology for the detection, enrichment, and separation of trace amounts of target DNA was developed on the basis of amino-modified fluorescent magnetic composite nanoparticles (AFMN). In this study, the positively charged amino-modified composite nanoparticles conjugate with the negatively charged capture DNA through electrostatic binding. The optimal combination of AFMN and capture DNA was measured by dynamic light scattering (DLS) and UV-vis absorption spectroscopy. The highly sensitive detection of trace amounts of target DNA was achieved through enrichment by means of AFMN. The detection limit for target DNA is 0.4 pM, which could be further improved by using a more powerful magnet. Because of their different melting temperatures, single-base mismatched target DNA could be separated from perfectly complementary target DNA. In addition, the photoluminescence (PL) signals of perfectly complementary target DNA and single-base mismatched DNA as well as the hybridization kinetics of different concentrations of target DNA at different reaction times have also been studied. Most importantly, the detection, enrichment, and separation ability of AFMN was further verified with milk. Simple and satisfactory results were obtained, which show the great potential in the fields of mutation identification and clinical diagnosis.

  6. Biomimetic nanochannels based biosensor for ultrasensitive and label-free detection of nucleic acids.

    PubMed

    Sun, Zhongyue; Liao, Tangbin; Zhang, Yulin; Shu, Jing; Zhang, Hong; Zhang, Guo-Jun

    2016-12-15

    A very simple sensing device based on biomimetic nanochannels has been developed for label-free, ultrasensitive and highly sequence-specific detection of DNA. Probe DNA was modified on the inner wall of the nanochannel surface by layer-by-layer (LBL) assembly. After probe DNA immobilization, DNA detection was realized by monitoring the rectified ion current when hybridization occurred. Due to three dimensional (3D) nanoscale environment of the nanochannel, this special geometry dramatically increased the surface area of the nanochannel for immobilization of probe molecules on the inner-surface and enlarged contact area between probes and target-molecules. Thus, the unique sensor reached a reliable detection limit of 10 fM for target DNA. In addition, this DNA sensor could discriminate complementary DNA (c-DNA) from non-complementary DNA (nc-DNA), two-base mismatched DNA (2bm-DNA) and one-base mismatched DNA (1bm-DNA) with high specificity. Moreover, the nanochannel-based biosensor was also able to detect target DNA even in an interfering environment and serum samples. This approach will provide a novel biosensing platform for detection and discrimination of disease-related molecular targets and unknown sequence DNA. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. A novel fluorescent DNA sensor for ultrasensitive detection of Helicobacter pylori.

    PubMed

    Liu, Ziping; Su, Xingguang

    2017-01-15

    In this work, a novel fluorescent DNA sensor for ultrasensitive detection of Helicobacter pylori (H. pylori) DNA was developed. This strategy took advantage of DNA hybridization between single-stranded DNA (ssDNA, which had been designed as an aptamer specific for H. pylori DNA) and the complementary target H. pylori DNA, and the feature that ssDNA bound to graphene oxide (GO) with significantly higher affinity than double-stranded DNA (dsDNA). ssDNA were firstly covalent conjugated with CuInS 2 quantum dots (QDs) by reaction between the carboxy group of QDs and amino group modified ssDNA, forming ssDNA-QDs genosensor. In the absence of the complementary target H. pylori DNA, GO could adsorb ssDNA-QDs DNA sensor and efficiently quench the fluorescence of ssDNA-QDs. While the complementary target H. pylori DNA was introduced, the ssDNA-QDs preferentially bound with the H. pylori DNA. The formation of dsDNA would alter the conformation of ssDNA and disturb the interaction between ssDNA and GO. Thus, the dsDNA-QDs/GO system exhibited a stronger fluorescence emission than that of the ssDNA-QDs/GO system. Under the optimized conditions, a linear correlation was established between the fluorescence intensity ratio I/I 0 and the concentration of H. pylori DNA in the range of 1.25-875pmolL -1 with a detection limit of 0.46pmolL -1 . The proposed method was applied to the determination of H. pylori DNA sequence in milk samples with satisfactory results. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. Detection of target-probe oligonucleotide hybridization using synthetic nanopore resistive pulse sensing.

    PubMed

    Booth, Marsilea Adela; Vogel, Robert; Curran, James M; Harbison, SallyAnn; Travas-Sejdic, Jadranka

    2013-07-15

    Despite the plethora of DNA sensor platforms available, a portable, sensitive, selective and economic sensor able to rival current fluorescence-based techniques would find use in many applications. In this research, probe oligonucleotide-grafted particles are used to detect target DNA in solution through a resistive pulse nanopore detection technique. Using carbodiimide chemistry, functionalized probe DNA strands are attached to carboxylated dextran-based magnetic particles. Subsequent incubation with complementary target DNA yields a change in surface properties as the two DNA strands hybridize. Particle-by-particle analysis with resistive pulse sensing is performed to detect these changes. A variable pressure method allows identification of changes in the surface charge of particles. As proof-of-principle, we demonstrate that target hybridization is selectively detected at micromolar concentrations (nanomoles of target) using resistive pulse sensing, confirmed by fluorescence and phase analysis light scattering as complementary techniques. The advantages, feasibility and limitations of using resistive pulse sensing for sample analysis are discussed. Copyright © 2013 Elsevier B.V. All rights reserved.

  9. Ultrasensitive and label-free detection of pathogenic avian influenza DNA by using CMOS impedimetric sensors.

    PubMed

    Lai, Wei-An; Lin, Chih-Heng; Yang, Yuh-Shyong; Lu, Michael S-C

    2012-05-15

    This work presents miniaturized CMOS (complementary metal oxide semiconductor) sensors for non-faradic impedimetric detection of AIV (avian influenza virus) oligonucleotides. The signal-to-noise ratio is significantly improved by monolithic sensor integration to reduce the effect of parasitic capacitances. The use of sub-μm interdigitated microelectrodes is also beneficial for promoting the signal coupling efficiency. Capacitance changes associated with surface modification, functionalization, and DNA hybridization were extracted from the measured frequency responses based on an equivalent-circuit model. Hybridization of the AIV H5 capture and target DNA probes produced a capacitance reduction of -13.2 ± 2.1% for target DNA concentrations from 1 fM to 10 fM, while a capacitance increase was observed when H5 target DNA was replaced with non-complementary H7 target DNA. With the demonstrated superior sensing capabilities, this miniaturized CMOS sensing platform shows great potential for label-free point-of-care biosensing applications. Copyright © 2012 Elsevier B.V. All rights reserved.

  10. The field effect transistor DNA biosensor based on ITO nanowires in label-free hepatitis B virus detecting compatible with CMOS technology.

    PubMed

    Shariati, Mohsen

    2018-05-15

    In this paper the field-effect transistor DNA biosensor for detecting hepatitis B virus (HBV) based on indium tin oxide nanowires (ITO NWs) in label free approach has been fabricated. Because of ITO nanowires intensive conductance and functional modified surface, the probe immobilization and target hybridization were increased strongly. The high resolution transmission electron microscopy (HRTEM) measurement showed that ITO nanowires were crystalline and less than 50nm in diameter. The single-stranded hepatitis B virus DNA (SS-DNA) was immobilized as probe on the Au-modified nanowires. The DNA targets were measured in a linear concentration range from 1fM to 10µM. The detection limit of the DNA biosensor was about 1fM. The time of the hybridization process for defined single strand was 90min. The switching ratio of the biosensor between "on" and "off" state was ~ 1.1 × 10 5 . For sensing the specificity of the biosensor, non-complementary, mismatch and complementary DNA oligonucleotide sequences were clearly discriminated. The HBV biosensor confirmed the highly satisfied specificity for differentiating complementary sequences from non-complementary and the mismatch oligonucleotides. The response time of the DNA sensor was 37s with a high reproducibility. The stability and repeatability of the DNA biosensor showed that the peak current of the biosensor retained 98% and 96% of its initial response for measurements after three and five weeks, respectively. Copyright © 2018 Elsevier B.V. All rights reserved.

  11. Rapid amplification of 5' complementary DNA ends (5' RACE).

    PubMed

    2005-08-01

    This method is used to extend partial cDNA clones by amplifying the 5' sequences of the corresponding mRNAs 1-3. The technique requires knowledge of only a small region of sequence within the partial cDNA clone. During PCR, the thermostable DNA polymerase is directed to the appropriate target RNA by a single primer derived from the region of known sequence; the second primer required for PCR is complementary to a general feature of the target-in the case of 5' RACE, to a homopolymeric tail added (via terminal transferase) to the 3' termini of cDNAs transcribed from a preparation of mRNA. This synthetic tail provides a primer-binding site upstream of the unknown 5' sequence of the target mRNA. The products of the amplification reaction are cloned into a plasmid vector for sequencing and subsequent manipulation.

  12. Development of a photodiode array biochip using a bipolar semiconductor and its application to detection of human papilloma virus.

    PubMed

    Baek, Taek Jin; Park, Pan Yun; Han, Kwi Nam; Kwon, Ho Taik; Seong, Gi Hun

    2008-03-01

    We describe a DNA microarray system using a bipolar integrated circuit photodiode array (PDA) chip as a new platform for DNA analysis. The PDA chip comprises an 8 x 6 array of photodiodes each with a diameter of 600 microm. Each photodiode element acts both as a support for an immobilizing probe DNA and as a two-dimensional photodetector. The usefulness of the PDA microarray platform is demonstrated by the detection of high-risk subtypes of human papilloma virus (HPV). The polymerase chain reaction (PCR)-amplified biotinylated HPV target DNA was hybridized with the immobilized probe DNA on the photodiode surface, and the chip was incubated in an anti-biotin antibody-conjugated gold nanoparticle solution. The silver enhancement by the gold nanoparticles bound to the biotin of the HPV target DNA precipitates silver metal particles at the chip surfaces, which block light irradiated from above. The resulting drop in output voltage depends on the amount of target DNA present in the sample solution, which allows the specific detection and the quantitative analysis of the complementary target DNA. The PDA chip showed high relative signal ratios of HPV probe DNA hybridized with complementary target DNA, indicating an excellent capability in discriminating HPV subtypes. The detection limit for the HPV target DNA analysis improved from 1.2 nM to 30 pM by changing the silver development time from 5 to 10 min. Moreover, the enhanced silver development promoted by the gold nanoparticles could be applied to a broader range of target DNA concentration by controlling the silver development time.

  13. The Size of the Internal Loop in DNA Hairpins Influences Their Targeting with Partially Complementary Strands

    PubMed Central

    2015-01-01

    Targeting of noncanonical DNA structures, such as hairpin loops, may have significant diagnostic and therapeutic potential. Oligonucleotides can be used for binding to mRNA, forming a DNA/RNA hybrid duplex that inhibits translation. This kind of modulation of gene expression is called the antisense approach. In order to determine the best strategy to target a common structural motif in mRNA, we have designed a set of stem-loop DNA molecules with sequence: d(GCGCTnGTAAT5GTTACTnGCGC), where n = 1, 3, or 5, “T5” is an end loop of five thymines. We used a combination of calorimetric and spectroscopy techniques to determine the thermodynamics for the reaction of a set of hairpins containing internal loops with their respective partially complementary strands. Our aim was to determine if internal- and end-loops are promising regions for targeting with their corresponding complementary strands. Indeed, all targeting reactions were accompanied by negative changes in free energy, indicating that reactions proceed spontaneously. Further investigation showed that these negative free energy terms result from a net balance of unfavorable entropy and favorable enthalpy contributions. In particular, unfolding of hairpins and duplexes is accompanied by positive changes in heat capacity, which may be a result of exposure of hydrophobic groups to the solvent. This study provides a new method for the targeting of mRNA in order to control gene expression. PMID:25486129

  14. Development of a Fluorescence Resonance Energy Transfer (FRET)-Based DNA Biosensor for Detection of Synthetic Oligonucleotide of Ganoderma boninense.

    PubMed

    Bakhori, Noremylia Mohd; Yusof, Nor Azah; Abdullah, Abdul Halim; Hussein, Mohd Zobir

    2013-12-12

    An optical DNA biosensor based on fluorescence resonance energy transfer (FRET) utilizing synthesized quantum dot (QD) has been developed for the detection of specific-sequence of DNA for Ganoderma boninense, an oil palm pathogen. Modified QD that contained carboxylic groups was conjugated with a single-stranded DNA probe (ssDNA) via amide-linkage. Hybridization of the target DNA with conjugated QD-ssDNA and reporter probe labeled with Cy5 allows for the detection of related synthetic DNA sequence of Ganoderma boninense gene based on FRET signals. Detection of FRET emission before and after hybridization was confirmed through the capability of the system to produce FRET at 680 nm for hybridized sandwich with complementary target DNA. No FRET emission was observed for non-complementary system. Hybridization time, temperature and effect of different concentration of target DNA were studied in order to optimize the developed system. The developed biosensor has shown high sensitivity with detection limit of 3.55 × 10-9 M. TEM results show that the particle size of QD varies in the range between 5 to 8 nm after ligand modification and conjugation with ssDNA. This approach is capable of providing a simple, rapid and sensitive method for detection of related synthetic DNA sequence of Ganoderma boninense.

  15. Development of a Fluorescence Resonance Energy Transfer (FRET)-Based DNA Biosensor for Detection of Synthetic Oligonucleotide of Ganoderma boninense.

    PubMed

    Mohd Bakhori, Noremylia; Yusof, Nor Azah; Abdullah, Abdul Halim; Hussein, Mohd Zobir

    2013-12-01

    An optical DNA biosensor based on fluorescence resonance energy transfer (FRET) utilizing synthesized quantum dot (QD) has been developed for the detection of specific-sequence of DNA for Ganoderma boninense, an oil palm pathogen. Modified QD that contained carboxylic groups was conjugated with a single-stranded DNA probe (ssDNA) via amide-linkage. Hybridization of the target DNA with conjugated QD-ssDNA and reporter probe labeled with Cy5 allows for the detection of related synthetic DNA sequence of Ganoderma boninense gene based on FRET signals. Detection of FRET emission before and after hybridization was confirmed through the capability of the system to produce FRET at 680 nm for hybridized sandwich with complementary target DNA. No FRET emission was observed for non-complementary system. Hybridization time, temperature and effect of different concentration of target DNA were studied in order to optimize the developed system. The developed biosensor has shown high sensitivity with detection limit of 3.55 × 10(-9) M. TEM results show that the particle size of QD varies in the range between 5 to 8 nm after ligand modification and conjugation with ssDNA. This approach is capable of providing a simple, rapid and sensitive method for detection of related synthetic DNA sequence of Ganoderma boninense.

  16. Cadmium sulfide nanocluster-based electrochemical stripping detection of DNA hybridization.

    PubMed

    Zhu, Ningning; Zhang, Aiping; He, Pingang; Fang, Yuzhi

    2003-03-01

    A novel, sensitive electrochemical DNA hybridization detection assay, using cadmium sulfide (CdS) nanoclusters as the oligonucleotide labeling tag, is described. The assay relies on the hybridization of the target DNA with the CdS nanocluster oligonucleotide DNA probe, followed by the dissolution of the CdS nanoclusters anchored on the hybrids and the indirect determination of the dissolved cadmium ions by sensitive anodic stripping voltammetry (ASV) at a mercury-coated glassy carbon electrode (GCE). The results showed that only a complementary sequence could form a double-stranded dsDNA-CdS with the DNA probe and give an obvious electrochemical response. A three-base mismatch sequence and non-complementary sequence had negligible response. The combination of the large number of cadmium ions released from each dsDNA hybrid with the remarkable sensitivity of the electrochemical stripping analysis for cadmium at mercury-film GCE allows detection at levels as low as 0.2 pmol L(-1) of the complementary sequence of DNA.

  17. Non-Covalent Fluorescent Labeling of Hairpin DNA Probe Coupled with Hybridization Chain Reaction for Sensitive DNA Detection.

    PubMed

    Song, Luna; Zhang, Yonghua; Li, Junling; Gao, Qiang; Qi, Honglan; Zhang, Chengxiao

    2016-04-01

    An enzyme-free signal amplification-based assay for DNA detection was developed using fluorescent hairpin DNA probes coupled with hybridization chain reaction (HCR). The hairpin DNAs were designed to contain abasic sites in the stem moiety. Non-covalent labeling of the hairpin DNAs was achieved when a fluorescent ligand was bound to the abasic sites through hydrogen bonding with the orphan cytosine present on the complementary strand, accompanied by quench of ligand fluorescence. As a result, the resultant probes, the complex formed between the hairpin DNA and ligand, showed almost no fluorescence. Upon hybridization with target DNA, the probe underwent a dehybridization of the stem moiety containing an abasic site. The release of ligand from the abasic site to the solution resulted in an effective fluorescent enhancement, which can be used as a signal. Compared with a sensing system without HCR, a 20-fold increase in the sensitivity was achieved using the sensing system with HCR. The fluorescent intensity of the sensing system increased with the increase in target DNA concentration from 0.5 nM to 100 nM. A single mismatched target ss-DNA could be effectively discriminated from complementary target DNA. Genotyping of a G/C single-nucleotide polymorphism of polymerase chain reaction (PCR) products was successfully demonstrated with the sensing system. Therefore, integrating HCR strategy with non-covalent labeling of fluorescent hairpin DNA probes provides a sensitive and cost-effective DNA assay. © The Author(s) 2016.

  18. Titanium Dioxide Nanoparticle-Based Interdigitated Electrodes: A Novel Current to Voltage DNA Biosensor Recognizes E. coli O157:H7.

    PubMed

    Nadzirah, Sh; Azizah, N; Hashim, Uda; Gopinath, Subash C B; Kashif, Mohd

    2015-01-01

    Nanoparticle-mediated bio-sensing promoted the development of novel sensors in the front of medical diagnosis. In the present study, we have generated and examined the potential of titanium dioxide (TiO2) crystalline nanoparticles with aluminium interdigitated electrode biosensor to specifically detect single-stranded E.coli O157:H7 DNA. The performance of this novel DNA biosensor was measured the electrical current response using a picoammeter. The sensor surface was chemically functionalized with (3-aminopropyl) triethoxysilane (APTES) to provide contact between the organic and inorganic surfaces of a single-stranded DNA probe and TiO2 nanoparticles while maintaining the sensing system's physical characteristics. The complement of the target DNA of E. coli O157:H7 to the carboxylate-probe DNA could be translated into electrical signals and confirmed by the increased conductivity in the current-to-voltage curves. The specificity experiments indicate that the biosensor can discriminate between the complementary sequences from the base-mismatched and the non-complementary sequences. After duplex formation, the complementary target sequence can be quantified over a wide range with a detection limit of 1.0 x 10(-13)M. With target DNA from the lysed E. coli O157:H7, we could attain similar sensitivity. Stability of DNA immobilized surface was calculated with the relative standard deviation (4.6%), displayed the retaining with 99% of its original response current until 6 months. This high-performance interdigitated DNA biosensor with high sensitivity, stability and non-fouling on a novel sensing platform is suitable for a wide range of biomolecular interactive analyses.

  19. Titanium Dioxide Nanoparticle-Based Interdigitated Electrodes: A Novel Current to Voltage DNA Biosensor Recognizes E. coli O157:H7

    PubMed Central

    Nadzirah, Sh.; Azizah, N.; Hashim, Uda; Gopinath, Subash C. B.; Kashif, Mohd

    2015-01-01

    Nanoparticle-mediated bio-sensing promoted the development of novel sensors in the front of medical diagnosis. In the present study, we have generated and examined the potential of titanium dioxide (TiO2) crystalline nanoparticles with aluminium interdigitated electrode biosensor to specifically detect single-stranded E.coli O157:H7 DNA. The performance of this novel DNA biosensor was measured the electrical current response using a picoammeter. The sensor surface was chemically functionalized with (3-aminopropyl) triethoxysilane (APTES) to provide contact between the organic and inorganic surfaces of a single-stranded DNA probe and TiO2 nanoparticles while maintaining the sensing system’s physical characteristics. The complement of the target DNA of E. coli O157:H7 to the carboxylate-probe DNA could be translated into electrical signals and confirmed by the increased conductivity in the current-to-voltage curves. The specificity experiments indicate that the biosensor can discriminate between the complementary sequences from the base-mismatched and the non-complementary sequences. After duplex formation, the complementary target sequence can be quantified over a wide range with a detection limit of 1.0 x 10-13M. With target DNA from the lysed E. coli O157:H7, we could attain similar sensitivity. Stability of DNA immobilized surface was calculated with the relative standard deviation (4.6%), displayed the retaining with 99% of its original response current until 6 months. This high-performance interdigitated DNA biosensor with high sensitivity, stability and non-fouling on a novel sensing platform is suitable for a wide range of biomolecular interactive analyses. PMID:26445455

  20. Flower-like ZnO nanostructure based electrochemical DNA biosensor for bacterial meningitis detection.

    PubMed

    Tak, Manvi; Gupta, Vinay; Tomar, Monika

    2014-09-15

    Zinc oxide (ZnO) nanostructures possessing flower-like morphology have been synthesised onto platinized silicon substrate by simple and economical hydrothermal method. The interaction of physically immobilized single stranded thiolated DNA (ss th-DNA) probe of N. meningitides onto the nanostructured ZnO (ZNF) matrix surface have been investigated using cyclic voltammetry (CV) and electrochemical impeadance spectroscopy (EIS). The electrochemical sensing response behaviour of the DNA bioelectrode (ss th-DNA/ZNF/Pt/Si) has been studied by both differential pulse voltammetric (DPV) as well as impedimetric techniques. The fabricated DNA biosensor can quantify wide range of the complementary target ss th-DNA in the range 5-240 ng μl(-1) with good linearity (R=0.98), high sensitivity (168.64 μA ng(-1) μl cm(-2)) and low detection limit of about 5 ng μl(-1). Results emphasise that the fabricated flower-like ZnO nanostructures offer a useful platform for the immobilization of DNA molecules and could be exploited for efficient detection of complementary target single stranded DNA corresponding to N. meningitides. Copyright © 2014 Elsevier B.V. All rights reserved.

  1. Development of a Fluorescence Resonance Energy Transfer (FRET)-Based DNA Biosensor for Detection of Synthetic Oligonucleotide of Ganoderma boninense

    PubMed Central

    Mohd Bakhori, Noremylia; Yusof, Nor Azah; Abdullah, Abdul Halim; Hussein, Mohd Zobir

    2013-01-01

    An optical DNA biosensor based on fluorescence resonance energy transfer (FRET) utilizing synthesized quantum dot (QD) has been developed for the detection of specific-sequence of DNA for Ganoderma boninense, an oil palm pathogen. Modified QD that contained carboxylic groups was conjugated with a single-stranded DNA probe (ssDNA) via amide-linkage. Hybridization of the target DNA with conjugated QD-ssDNA and reporter probe labeled with Cy5 allows for the detection of related synthetic DNA sequence of Ganoderma boninense gene based on FRET signals. Detection of FRET emission before and after hybridization was confirmed through the capability of the system to produce FRET at 680 nm for hybridized sandwich with complementary target DNA. No FRET emission was observed for non-complementary system. Hybridization time, temperature and effect of different concentration of target DNA were studied in order to optimize the developed system. The developed biosensor has shown high sensitivity with detection limit of 3.55 × 10−9 M. TEM results show that the particle size of QD varies in the range between 5 to 8 nm after ligand modification and conjugation with ssDNA. This approach is capable of providing a simple, rapid and sensitive method for detection of related synthetic DNA sequence of Ganoderma boninense. PMID:25587406

  2. Comparison of impedimetric detection of DNA hybridization on the various biosensors based on modified glassy carbon electrodes with PANHS and nanomaterials of RGO and MWCNTs.

    PubMed

    Benvidi, Ali; Tezerjani, Marzieh Dehghan; Jahanbani, Shahriar; Mazloum Ardakani, Mohammad; Moshtaghioun, Seyed Mohammad

    2016-01-15

    In this research, we have developed lable free DNA biosensors based on modified glassy carbon electrodes (GCE) with reduced graphene oxide (RGO) and carbon nanotubes (MWCNTs) for detection of DNA sequences. This paper compares the detection of BRCA1 5382insC mutation using independent glassy carbon electrodes (GCE) modified with RGO and MWCNTs. A probe (BRCA1 5382insC mutation detection (ssDNA)) was then immobilized on the modified electrodes for a specific time. The immobilization of the probe and its hybridization with the target DNA (Complementary DNA) were performed under optimum conditions using different electrochemical techniques such as cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS). The proposed biosensors were used for determination of complementary DNA sequences. The non-modified DNA biosensor (1-pyrenebutyric acid-N- hydroxysuccinimide ester (PANHS)/GCE), revealed a linear relationship between ∆Rct and logarithm of the complementary target DNA concentration ranging from 1.0×10(-16)molL(-1) to 1.0×10(-10)mol L(-1) with a correlation coefficient of 0.992, for DNA biosensors modified with multi-wall carbon nanotubes (MWCNTs) and reduced graphene oxide (RGO) wider linear range and lower detection limit were obtained. For ssDNA/PANHS/MWCNTs/GCE a linear range 1.0×10(-17)mol L(-1)-1.0×10(-10)mol L(-1) with a correlation coefficient of 0.993 and for ssDNA/PANHS/RGO/GCE a linear range from 1.0×10(-18)mol L(-1) to 1.0×10(-10)mol L(-1) with a correlation coefficient of 0.985 were obtained. In addition, the mentioned biosensors were satisfactorily applied for discriminating of complementary sequences from noncomplementary sequences, so the mentioned biosensors can be used for the detection of BRCA1-associated breast cancer. Copyright © 2015. Published by Elsevier B.V.

  3. Electrochemical detection of sequence-specific DNA based on formation of G-quadruplex-hemin through continuous hybridization chain reaction.

    PubMed

    Sun, Xiaofan; Chen, Haohan; Wang, Shuling; Zhang, Yiping; Tian, Yaping; Zhou, Nandi

    2018-08-27

    A high-sensitive detection of sequence-specific DNA was established based on the formation of G-quadruplex-hemin complex through continuous hybridization chain reaction (HCR). Taking HIV DNA sequence as an example, a capture probe complementary to part of HIV DNA was firstly self-assembled onto the surface of Au electrode. Then a specially designed assistant probe with both terminals complementary to the target DNA and a G-quadruplex-forming sequence in the center was introduced into the detection solution. In the presence of both the target DNA and the assistant probe, the target DNA can be captured on the electrode surface and then a continuous HCR can be conducted due to the mutual recognition of the target DNA and the assistant probe, leading to the formation of a large number of G-quadruplex on the electrode surface. With the help of hemin, a pronounced electrochemical signal can be observed in differential pulse voltammetry (DPV), due to the formation of G-quadruplex-hemin complex. The peak current is linearly related with the logarithm of the concentration of the target DNA in the range from 10 fM to 10 pM. The electrochemical sensor has high selectivity to clearly discriminate single-base mismatched and three-base mismatched sequences from the original HIV DNA sequence. Moreover, the established DNA sensor was challenged by detection of HIV DNA in human serum samples, which showed the low detection limit of 6.3 fM. Thus it has great application prospect in the field of clinical diagnosis and environmental monitoring. Copyright © 2018 Elsevier B.V. All rights reserved.

  4. Investigating the potential of multiwalled carbon nanotubes based zinc nanocomposite as a recognition interface towards plant pathogen detection.

    PubMed

    Tahir, Muhammad Ali; Hameed, Sadaf; Munawar, Anam; Amin, Imran; Mansoor, Shahid; Khan, Waheed S; Bajwa, Sadia Zafar

    2017-11-01

    The emergence of nanotechnology has opened new horizons for constructing efficient recognition interfaces. This is the first report where the potential of a multiwalled carbon nanotube based zinc nanocomposite (MWCNTs-Zn NPs) investigated for the detection of an agricultural pathogen i.e. Chili leaf curl betasatellite (ChLCB). Atomic force microscope analyses revealed the presence of multiwalled carbon nanotubes (MWCNTs) having a diameter of 50-100nm with zinc nanoparticles (Zn-NPs) of 25-500nm. In this system, these bunches of Zn-NPs anchored along the whole lengths of MWCNTs were used for the immobilization of probe DNA strands. The electrochemical performance of DNA biosensor was assessed in the absence and presence of the complementary DNA during cyclic and differential pulse voltammetry scans. Target binding events occurring on the interface surface patterned with single-stranded DNA was quantitatively translated into electrochemical signals due to hybridization process. In the presence of complementary target DNA, as the result of duplex formation, there was a decrease in the peak current from 1.89×10 -04 to 5.84×10 -05 A. The specificity of this electrochemical DNA biosensor was found to be three times as compared to non-complementary DNA. This material structuring technique can be extended to design interfaces for the recognition of the other plant viruses and biomolecules. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Examining a DNA Replication Requirement for Bacteriophage λ Red- and Rac Prophage RecET-Promoted Recombination in Escherichia coli.

    PubMed

    Thomason, Lynn C; Costantino, Nina; Court, Donald L

    2016-09-13

    Recombineering, in vivo genetic engineering with bacteriophage homologous recombination systems, is a powerful technique for making genetic modifications in bacteria. Two systems widely used in Escherichia coli are the Red system from phage λ and RecET from the defective Rac prophage. We investigated the in vivo dependence of recombineering on DNA replication of the recombining substrate using plasmid targets. For λ Red recombination, when DNA replication of a circular target plasmid is prevented, recombination with single-stranded DNA oligonucleotides is greatly reduced compared to that under replicating conditions. For RecET recombination, when DNA replication of the targeted plasmid is prevented, the recombination frequency is also reduced, to a level identical to that seen for the Red system in the absence of replication. The very low level of oligonucleotide recombination observed in the absence of any phage recombination functions is the same in the presence or absence of DNA replication. In contrast, both the Red and RecET systems recombine a nonreplicating linear dimer plasmid with high efficiency to yield a circular monomer. Therefore, the DNA replication requirement is substrate dependent. Our data are consistent with recombination by both the Red and RecET systems occurring predominately by single-strand annealing rather than by strand invasion. Bacteriophage homologous recombination systems are widely used for in vivo genetic engineering in bacteria. Single- or double-stranded linear DNA substrates containing short flanking homologies to chromosome targets are used to generate precise and accurate genetic modifications when introduced into bacteria expressing phage recombinases. Understanding the molecular mechanism of these recombination systems will facilitate improvements in the technology. Here, two phage-specific systems are shown to require exposure of complementary single-strand homologous targets for efficient recombination; these single-strand regions may be created during DNA replication or by single-strand exonuclease digestion of linear duplex DNA. Previously, in vitro studies reported that these recombinases promote the single-strand annealing of two complementary DNAs and also strand invasion of a single DNA strand into duplex DNA to create a three-stranded region. Here, in vivo experiments show that recombinase-mediated annealing of complementary single-stranded DNA is the predominant recombination pathway in E. coli. Copyright © 2016 Thomason et al.

  6. Front-End Processing of Cell Lysates for Enhanced Chip-Based Detection

    DTIC Science & Technology

    2006-07-28

    manipulation used in lab-on-a-chip devices. A small unknown sample is first mixed with the PNA surfactants (“PNAA”) to tag the DNA targets, and then the...unknown sample is first mixed with the PNA surfactants (hereafter referred to as “PNA amphiphiles” or “PNAA”) to tag the DNA targets, and then the...prolate ellipsoid, and mixed PNAA/SDS micelles form spherical micelles. On addition of complementary DNA, the PNAA/DNA duplexes do not participate in

  7. RNA and DNA Targeting by a Reconstituted Thermus thermophilus Type III-A CRISPR-Cas System.

    PubMed

    Liu, Tina Y; Iavarone, Anthony T; Doudna, Jennifer A

    2017-01-01

    CRISPR-Cas (clustered regularly interspaced short palindromic repeats-CRISPR-associated) systems are RNA-guided adaptive immunity pathways used by bacteria and archaea to defend against phages and plasmids. Type III-A systems use a multisubunit interference complex called Csm, containing Cas proteins and a CRISPR RNA (crRNA) to target cognate nucleic acids. The Csm complex is intriguing in that it mediates RNA-guided targeting of both RNA and transcriptionally active DNA, but the mechanism is not well understood. Here, we overexpressed the five components of the Thermus thermophilus (T. thermophilus) Type III-A Csm complex (TthCsm) with a defined crRNA sequence, and purified intact TthCsm complexes from E. coli cells. The complexes were thermophilic, targeting complementary ssRNA more efficiently at 65°C than at 37°C. Sequence-independent, endonucleolytic cleavage of single-stranded DNA (ssDNA) by TthCsm was triggered by recognition of a complementary ssRNA, and required a lack of complementarity between the first 8 nucleotides (5' tag) of the crRNA and the 3' flanking region of the ssRNA. Mutation of the histidine-aspartate (HD) nuclease domain of the TthCsm subunit, Cas10/Csm1, abolished DNA cleavage. Activation of DNA cleavage was dependent on RNA binding but not cleavage. This leads to a model in which binding of an ssRNA target to the Csm complex would stimulate cleavage of exposed ssDNA in the cell, such as could occur when the RNA polymerase unwinds double-stranded DNA (dsDNA) during transcription. Our findings establish an amenable, thermostable system for more in-depth investigation of the targeting mechanism using structural biology methods, such as cryo-electron microscopy and x-ray crystallography.

  8. Electrical DNA biosensor using aluminium interdigitated electrode for E.Coli O157:H7 detection

    NASA Astrophysics Data System (ADS)

    Natasha, N. Z.; Rajapaksha, R. D. A. A.; Uda, M. N. A.; Hashim, U.

    2017-09-01

    Escherichia Coli (E.Coli) O157:H7 is the one of the most dangerous foodborne pathogens based diseases that presence in our daily life that causes illness and death increase every year. Aluminum Interdigitated Electrode (Al IDE) biosensor was introduced to detect E.Coli O157:H7 in earlier stage. In this paper we investigated ssDNA of E.Coli O157:H7 bacteria detection through electrical behavior of Al IDE sensor. The physical properties of Al IDE biosensor has been characterized using Low Power Microscope (LPM), High Power Microscope (HPM), Scanning Electron Microscope (SEM) and 3D Nano Profiler. The bare Al IDE was electrical characterized by using I-V measurement. The surface modification was accomplished by salinization using APTES and immobilization using Carboxylic Probe E.Coli which was the first step in preparing Al IDE biosensor. Geared up prepared biosensor was hybridized with complementary, non-complementary and single based mismatch ssDNA to confirmed specificity detection of E Coli O157:H7 ssDNA target. The Current - Voltage was performed for each step such as bare Al IDE, surface modification, immobilization and hybridization. Sensitivity measurement was accomplished using different concentration of complementary ssDNA target from 1 fM - 10 µM. Selectivity measurements was achieved using same concentration which was 10 µM concentration for complement, non-complement and mismatch E.Coli O157:H7 ssDNA target. It's totally proved that the Al IDE able to detect specific and small current down to Femtomolar concentration.

  9. Method of preparing and applying single stranded DNA probes to double stranded target DNAs in situ

    DOEpatents

    Gray, Joe W.; Pinkel, Daniel

    1991-01-01

    A method is provided for producing single stranded non-self-complementary nucleic acid probes, and for treating target DNA for use therewith. Probe is constructed by treating DNA with a restriction enzyme and an exonuclease to form template/primers for a DNA polymerase. The digested strand is resynthesized in the presence of labeled nucleoside triphosphate precursor. Labeled single stranded fragments are separated from the resynthesized fragments to form the probe. Target DNA is treated with the same restriction enzyme used to construct the probe, and is treated with an exonuclease before application of the probe. The method significantly increases the efficiency and specificity of hybridization mixtures by increasing effective probe concentration by eliminating self-hybridization between both probe and target DNAs, and by reducing the amount of target DNA available for mismatched hybridizations.

  10. Specific DNA duplex formation at an artificial lipid bilayer: towards a new DNA biosensor technology.

    PubMed

    Werz, Emma; Korneev, Sergei; Montilla-Martinez, Malayko; Wagner, Richard; Hemmler, Roland; Walter, Claudius; Eisfeld, Jörg; Gall, Karsten; Rosemeyer, Helmut

    2012-02-01

    A novel technique is described which comprises a base-specific DNA duplex formation at a lipid bilayer-H(2) O-phase boundary layer. Two different probes of oligonucleotides both carrying a double-tailed lipid at the 5'-terminus were incorporated into stable artificial lipid bilayers separating two compartments (cis/trans-channel) of an optically transparent microfluidic sample carrier with perfusion capabilities. Both the cis- and trans-channels are filled with saline buffer. Injection of a cyanine-5-labeled target DNA sequence, which is complementary to only one of the oligonucleotide probes, into the cis-channel, followed by a thorough perfusion, leads to an immobilization of the labeled complementary oligonucleotide on the membrane as detected by single-molecule fluorescence spectroscopy and microscopy. In the case of fluorescent but non-complementary DNA sequences, no immobilized fluorescent oligonucleotide duplex could be detected on the membrane. This clearly verifies a specific duplex formation at the membrane interface. Copyright © 2012 Verlag Helvetica Chimica Acta AG, Zürich.

  11. Recovery Based Nanowire Field-Effect Transistor Detection of Pathogenic Avian Influenza DNA

    NASA Astrophysics Data System (ADS)

    Lin, Chih-Heng; Chu, Chia-Jung; Teng, Kang-Ning; Su, Yi-Jr; Chen, Chii-Dong; Tsai, Li-Chu; Yang, Yuh-Shyong

    2012-02-01

    Fast and accurate diagnosis is critical in infectious disease surveillance and management. We proposed a DNA recovery system that can easily be adapted to DNA chip or DNA biosensor for fast identification and confirmation of target DNA. This method was based on the re-hybridization of DNA target with a recovery DNA to free the DNA probe. Functionalized silicon nanowire field-effect transistor (SiNW FET) was demonstrated to monitor such specific DNA-DNA interaction using high pathogenic strain virus hemagglutinin 1 (H1) DNA of avian influenza (AI) as target. Specific electric changes were observed in real-time for AI virus DNA sensing and device recovery when nanowire surface of SiNW FET was modified with complementary captured DNA probe. The recovery based SiNW FET biosensor can be further developed for fast identification and further confirmation of a variety of influenza virus strains and other infectious diseases.

  12. Ion-channel genosensor for the detection of specific DNA sequences derived from Plum Pox Virus in plant extracts.

    PubMed

    Malecka, Kamila; Michalczuk, Lech; Radecka, Hanna; Radecki, Jerzy

    2014-10-09

    A DNA biosensor for detection of specific oligonucleotides sequences of Plum Pox Virus (PPV) in plant extracts and buffer is proposed. The working principles of a genosensor are based on the ion-channel mechanism. The NH2-ssDNA probe was deposited onto a glassy carbon electrode surface to form an amide bond between the carboxyl group of oxidized electrode surface and amino group from ssDNA probe. The analytical signals generated as a result of hybridization were registered in Osteryoung square wave voltammetry in the presence of [Fe(CN)6]3-/4- as a redox marker. The 22-mer and 42-mer complementary ssDNA sequences derived from PPV and DNA samples from plants infected with PPV were used as targets. Similar detection limits of 2.4 pM (31.0 pg/mL) and 2.3 pM (29.5 pg/mL) in the concentration range 1-8 pM were observed in the presence of the 22-mer ssDNA and 42-mer complementary ssDNA sequences of PPV, respectively. The genosensor was capable of discriminating between samples consisting of extracts from healthy plants and leaf extracts from infected plants in the concentration range 10-50 pg/mL. The detection limit was 12.8 pg/mL. The genosensor displayed good selectivity and sensitivity. The 20-mer partially complementary DNA sequences with four complementary bases and DNA samples from healthy plants used as negative controls generated low signal.

  13. Method of preparing and applying single stranded DNA probes to double stranded target DNAs in situ

    DOEpatents

    Gray, J.W.; Pinkel, D.

    1991-07-02

    A method is provided for producing single stranded non-self-complementary nucleic acid probes, and for treating target DNA for use therewith. The probe is constructed by treating DNA with a restriction enzyme and an exonuclease to form template/primers for a DNA polymerase. The digested strand is resynthesized in the presence of labeled nucleoside triphosphate precursor. Labeled single stranded fragments are separated from the resynthesized fragments to form the probe. Target DNA is treated with the same restriction enzyme used to construct the probe, and is treated with an exonuclease before application of the probe. The method significantly increases the efficiency and specificity of hybridization mixtures by increasing effective probe concentration by eliminating self-hybridization between both probe and target DNAs, and by reducing the amount of target DNA available for mismatched hybridizations. No Drawings

  14. Screening unlabeled DNA targets with randomly ordered fiber-optic gene arrays.

    PubMed

    Steemers, F J; Ferguson, J A; Walt, D R

    2000-01-01

    We have developed a randomly ordered fiber-optic gene array for rapid, parallel detection of unlabeled DNA targets with surface immobilized molecular beacons (MB) that undergo a conformational change accompanied by a fluorescence change in the presence of a complementary DNA target. Microarrays are prepared by randomly distributing MB-functionalized 3-microm diameter microspheres in an array of wells etched in a 500-microm diameter optical imaging fiber. Using several MBs, each designed to recognize a different target, we demonstrate the selective detection of genomic cystic fibrosis related targets. Positional registration and fluorescence response monitoring of the microspheres was performed using an optical encoding scheme and an imaging fluorescence microscope system.

  15. Novel strategy combining SYBR Green I with carbon nanotubes for highly sensitive detection of Salmonella typhimurium DNA.

    PubMed

    Mao, Pingdao; Ning, Yi; Li, Wenkai; Peng, Zhihui; Chen, Yongzhe; Deng, Le

    2014-01-10

    A simple, selective, sensitive and label-free fluorescent method for detecting trpS-harboring Salmonella typhimurium was developed in this study. This assay used the non-covalent interaction of single-stranded DNA (ssDNA) probes with SWNTs, since SWNTs can quench fluorescence. Fluorescence recovery (78% with 1.8 nM target DNA) was detected in the presence of target DNA as ssDNA probes detached from SWNTs hybridized with target DNA, and the resulting double-stranded DNA (dsDNA) intercalated with SYBR Green I (SG) dyes. The increasing fluorescence intensity reached 4.54-fold. In contrast, mismatched oligonucleotides (1- or 3-nt difference to the target DNA) did not contribute to significant fluorescent recovery, which demonstrated the specificity of the assay. The increasing fluorescence intensity increased 3.15-fold when purified PCR products containing complementary sequences of trpS gene were detected. These results confirmed the ability to use this assay for detecting real samples. Copyright © 2013 Elsevier Inc. All rights reserved.

  16. Kits for Characterization of Chromosomal Inversions Using Probes

    NASA Technical Reports Server (NTRS)

    Ray, F. Andrew (Inventor)

    2017-01-01

    A kit for the characterization of chromosomal inversions using single-stranded probes that are either all identical or all complementary to a single-stranded chromatid is described. Reporter species are attached to oligonucleotide strands designed such that they may hybridize to portions of only one of a pair of single-stranded sister chromatids which may be prepared by the CO-FISH procedure. If an inversion has occurred, these marker probes will be detected on the second sister chromatid at the same location as the inversion on the first chromatid. The kit includes non-repetitive probes that are either all identical or all complementary to at least a portion of a target DNA sequence of only one DNA strand of only one chromatid and may in some embodiments include reagents suitable for performing CO-FISH and/or reagents for hybridizing the probes to the target DNA sequence.

  17. Fluorescent quenching-based quantitative detection of specific DNA/RNA using a BODIPY® FL-labeled probe or primer

    PubMed Central

    Kurata, Shinya; Kanagawa, Takahiro; Yamada, Kazutaka; Torimura, Masaki; Yokomaku, Toyokazu; Kamagata, Yoichi; Kurane, Ryuichiro

    2001-01-01

    We have developed a simple method for the quantitative detection of specific DNA or RNA molecules based on the finding that BODIPY® FL fluorescence was quenched by its interaction with a uniquely positioned guanine. This approach makes use of an oligonucleotide probe or primer containing a BODIPY® FL-modified cytosine at its 5′-end. When such a probe was hybridized with a target DNA, its fluorescence was quenched by the guanine in the target, complementary to the modified cytosine, and the quench rate was proportional to the amount of target DNA. This widely applicable technique will be used directly with larger samples or in conjunction with the polymerase chain reaction to quantify small DNA samples. PMID:11239011

  18. Rapid detection of microbial DNA by a novel isothermal genome exponential amplification reaction (GEAR) assay.

    PubMed

    Prithiviraj, Jothikumar; Hill, Vincent; Jothikumar, Narayanan

    2012-04-20

    In this study we report the development of a simple target-specific isothermal nucleic acid amplification technique, termed genome exponential amplification reaction (GEAR). Escherichia coli was selected as the microbial target to demonstrate the GEAR technique as a proof of concept. The GEAR technique uses a set of four primers; in the present study these primers targeted 5 regions on the 16S rRNA gene of E. coli. The outer forward and reverse Tab primer sequences are complementary to each other at their 5' end, whereas their 3' end sequences are complementary to their respective target nucleic acid sequences. The GEAR assay was performed at a constant temperature 60 °C and monitored continuously in a real-time PCR instrument in the presence of an intercalating dye (SYTO 9). The GEAR assay enabled amplification of as few as one colony forming units of E. coli per reaction within 30 min. We also evaluated the GEAR assay for rapid identification of bacterial colonies cultured on agar media directly in the reaction without DNA extraction. Cells from E. coli colonies were picked and added directly to GEAR assay mastermix without prior DNA extraction. DNA in the cells could be amplified, yielding positive results within 15 min. Published by Elsevier Inc.

  19. Gold surface supported spherical liposome-gold nano-particle nano-composite for label free DNA sensing.

    PubMed

    Bhuvana, M; Narayanan, J Shankara; Dharuman, V; Teng, W; Hahn, J H; Jayakumar, K

    2013-03-15

    Immobilization of 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE) liposome-gold nano-particle (DOPE-AuNP) nano-composite covalently on 3-mercaptopropionic acid (MPA) on gold surface is demonstrated for the first time for electrochemical label free DNA sensing. Spherical nature of the DOPE on the MPA monolayer is confirmed by the appearance of sigmoidal voltammetric profile, characteristic behavior of linear diffusion, for the MPA-DOPE in presence of [Fe(CN)(6)](3-/4-) and [Ru(NH(3))(6)](3+) redox probes. The DOPE liposome vesicle fusion is prevented by electroless deposition of AuNP on the hydrophilic amine head groups of the DOPE. Immobilization of single stranded DNA (ssDNA) is made via simple gold-thiol linkage for DNA hybridization sensing in the presence of [Fe(CN)(6)](3-/4-). The sensor discriminates the hybridized (complementary target hybridized), un-hybridized (non-complementary target hybridized) and single base mismatch target hybridized surfaces sensitively and selectively without signal amplification. The lowest target DNA concentration detected is 0.1×10(-12)M. Cyclic voltammetry (CV), electrochemical impedance (EIS), differential pulse voltammetry (DPV) and quartz crystal microbalance (QCM) techniques are used for DNA sensing on DOPE-AuNP nano-composite. Transmission Electron Microscopy (TEM), Fourier Transform Infrared Spectroscopy (FTIR), Atomic Force Microscopy (AFM), Dynamic Light Scattering (DLS) and Ultraviolet-Visible (UV) spectroscopic techniques are used to understand the interactions between the DOPE, AuNP and ssDNA. The results indicate the presence of an intact and well defined spherical DOPE-AuNP nano-composite on the gold surface. The method could be applied for fabrication of the surface based liposome-AuNP-DNA composite for cell transfection studies at reduced reagents and costs. Copyright © 2012 Elsevier B.V. All rights reserved.

  20. Detection of Sub-fM DNA with Target Recycling and Self-Assembly Amplification on Graphene Field-Effect Biosensors

    PubMed Central

    2018-01-01

    All-electronic DNA biosensors based on graphene field-effect transistors (GFETs) offer the prospect of simple and cost-effective diagnostics. For GFET sensors based on complementary probe DNA, the sensitivity is limited by the binding affinity of the target oligonucleotide, in the nM range for 20 mer targets. We report a ∼20 000× improvement in sensitivity through the use of engineered hairpin probe DNA that allows for target recycling and hybridization chain reaction. This enables detection of 21 mer target DNA at sub-fM concentration and provides superior specificity against single-base mismatched oligomers. The work is based on a scalable fabrication process for biosensor arrays that is suitable for multiplexed detection. This approach overcomes the binding-affinity-dependent sensitivity of nucleic acid biosensors and offers a pathway toward multiplexed and label-free nucleic acid testing with high accuracy and selectivity. PMID:29768011

  1. Detection of Sub-fM DNA with Target Recycling and Self-Assembly Amplification on Graphene Field-Effect Biosensors.

    PubMed

    Gao, Zhaoli; Xia, Han; Zauberman, Jonathan; Tomaiuolo, Maurizio; Ping, Jinglei; Zhang, Qicheng; Ducos, Pedro; Ye, Huacheng; Wang, Sheng; Yang, Xinping; Lubna, Fahmida; Luo, Zhengtang; Ren, Li; Johnson, Alan T Charlie

    2018-06-13

    All-electronic DNA biosensors based on graphene field-effect transistors (GFETs) offer the prospect of simple and cost-effective diagnostics. For GFET sensors based on complementary probe DNA, the sensitivity is limited by the binding affinity of the target oligonucleotide, in the nM range for 20 mer targets. We report a ∼20 000× improvement in sensitivity through the use of engineered hairpin probe DNA that allows for target recycling and hybridization chain reaction. This enables detection of 21 mer target DNA at sub-fM concentration and provides superior specificity against single-base mismatched oligomers. The work is based on a scalable fabrication process for biosensor arrays that is suitable for multiplexed detection. This approach overcomes the binding-affinity-dependent sensitivity of nucleic acid biosensors and offers a pathway toward multiplexed and label-free nucleic acid testing with high accuracy and selectivity.

  2. Sensitive fluorescence detection of nucleic acids based on isothermal circular strand-displacement polymerization reaction.

    PubMed

    Guo, Qiuping; Yang, Xiaohai; Wang, Kemin; Tan, Weihong; Li, Wei; Tang, Hongxing; Li, Huimin

    2009-02-01

    Here we have developed a sensitive DNA amplified detection method based on isothermal strand-displacement polymerization reaction. This method takes advantage of both the hybridization property of DNA and the strand-displacement property of polymerase. Importantly, we demonstrate that our method produces a circular polymerization reaction activated by the target, which essentially allows it to self-detect. Functionally, this DNA system consists of a hairpin fluorescence probe, a short primer and polymerase. Upon recognition and hybridization with the target ssDNA, the stem of the hairpin probe is opened, after which the opened probe anneals with the primer and triggers the polymerization reaction. During this process of the polymerization reaction, a complementary DNA is synthesized and the hybridized target is displaced. Finally, the displaced target recognizes and hybridizes with another probe, triggering the next round of polymerization reaction, reaching a target detection limit of 6.4 x 10(-15) M.

  3. A surface-confined DNA assembly amplification strategy on DNA nanostructural scaffold for electrochemiluminescence biosensing.

    PubMed

    Feng, Qiu-Mei; Guo, Yue-Hua; Xu, Jing-Juan; Chen, Hong-Yuan

    2018-02-15

    A critical challenge in surface-based DNA assembly amplification is the reduced accessibility of DNA strands arranged on a heterogeneous surface compared to that in homogeneous solution. Here, a novel in situ surface-confined DNA assembly amplification electrochemiluminescence (ECL) biosensor based on DNA nanostructural scaffold was presented. In this design, a stem-loop structural DNA segment (Hairpin 1) was constructed on the vertex of DNA nanostructural scaffold as recognition probe. In the present of target DNA, the hairpin structure changed to rod-like through complementary hybridization with target DNA, resulting in the formation of Hairpin 1:target DNA. When the obtained Hairpin 1:target DNA met Hairpin 2 labeled with glucose oxidase (GOD), the DNA cyclic amplification was activated, releasing target DNA into homogeneous solution for the next recycling. Thus, the ECL signal of Ru(bpy) 3 2+ -TPrA system was quenched by H 2 O 2 , the product of GOD catalyzing glucose. As a result, this proposed method achieved a linear range response from 50 aM to 10 pM with lower detection limit of 20 aM. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Arrays of nucleic acid probes on biological chips

    DOEpatents

    Chee, Mark; Cronin, Maureen T.; Fodor, Stephen P. A.; Huang, Xiaohua X.; Hubbell, Earl A.; Lipshutz, Robert J.; Lobban, Peter E.; Morris, MacDonald S.; Sheldon, Edward L.

    1998-11-17

    DNA chips containing arrays of oligonucleotide probes can be used to determine whether a target nucleic acid has a nucleotide sequence identical to or different from a specific reference sequence. The array of probes comprises probes exactly complementary to the reference sequence, as well as probes that differ by one or more bases from the exactly complementary probes.

  5. Sandwiching spherical 1,2-dioleoyltrimethylammoniumpropane liposome in gold nanoparticle on solid transducer for electrochemical ultrasensitive DNA detection and transfection.

    PubMed

    Shankara Narayanan, Jeyaraman; Bhuvana, Mohanlal; Dharuman, Venkataraman

    2014-08-15

    Cationic N-[1-(2,3-Dioleoyloxy)propyl]-N,N,N-trimethylammonium propane (DOTAP) liposome is spherically sandwiched in gold nanoparticle (abbreviated as sDOTAP-AuNP) onto a gold electrode surface. The sDOTAP-AuNP is applied for electrochemical label free DNA sensing and Escherichia coli cell transfection for the first time. Complementary target (named as hybridized), non-complementary target (un-hybridized) and single base mismatch target (named as SMM) hybridized surfaces are discriminated sensitively and selectively in presence of [Fe(CN)6](3-/4-). Double strand specific intercalator methylene blue in combination with [Fe(CN)6](3-) is used to enhance target detection limit down to femtomolar concentration. Cyclic voltammetry (CV), electrochemical impedance spectroscopy (EIS), differential pulse voltammetry (DPV) techniques are used for characterizing DNA sensing. High Resolution Transmission Electron Microscopy (HRTEM), Fourier Transform Infrared Spectroscopy (FTIR), Atomic Force Microscopy (AFM) and Dynamic Light Scattering (DLS) techniques are used to confirm the spherical nature of the sDOTAP-AuNP-DNA composite in solution and on the solid surface. DNA on the sDOTAP-ssDNA is transferred by potential stripping method (+0.2V (Ag/AgCl)) into buffer solution containing E. coli cells. The transfection is confirmed by the contrast images for the transfected and non-transfected cell from Confocal Laser Scanning Microscopy (CLSM). The results demonstrate effectiveness of the electrochemical DNA transfection method developed and could be applied for other cells. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. RNA-programmed genome editing in human cells

    PubMed Central

    Jinek, Martin; East, Alexandra; Cheng, Aaron; Lin, Steven; Ma, Enbo; Doudna, Jennifer

    2013-01-01

    Type II CRISPR immune systems in bacteria use a dual RNA-guided DNA endonuclease, Cas9, to cleave foreign DNA at specific sites. We show here that Cas9 assembles with hybrid guide RNAs in human cells and can induce the formation of double-strand DNA breaks (DSBs) at a site complementary to the guide RNA sequence in genomic DNA. This cleavage activity requires both Cas9 and the complementary binding of the guide RNA. Experiments using extracts from transfected cells show that RNA expression and/or assembly into Cas9 is the limiting factor for Cas9-mediated DNA cleavage. In addition, we find that extension of the RNA sequence at the 3′ end enhances DNA targeting activity in vivo. These results show that RNA-programmed genome editing is a facile strategy for introducing site-specific genetic changes in human cells. DOI: http://dx.doi.org/10.7554/eLife.00471.001 PMID:23386978

  7. A Highly Sensitive Oligonucleotide Hybridization Assay for Klebsiella pneumoniae Carbapenemase with the Probes on a Gold Nanoparticles Modified Glassy Carbon Electrode.

    PubMed

    Pan, Hong-zhi; Yu, Hong- Wei; Wang, Na; Zhang, Ze; Wan, Guang-Cai; Liu, Hao; Guan, Xue; Chang, Dong

    2015-01-01

    To develop a new electrochemical DNA biosensor for determination of Klebsiella pneumoniae carbapenemase, a highly sensitive and selective electrochemical biosensor for DNA detection was constructed based on a glassy carbon electrode (GCE) modified with gold nanoparticles (Au-nano). The Au-nano/GCE was characterized by scanning electromicroscopy, cyclic voltammetry, and electrochemical impedance spectroscopy. The hybridization detection was measured by differential pulse voltammetry using methylene blue as the hybridization indicator. The dynamic range of detection of the sensor for the target DNA sequences was from 1 × 10(-11) to 1 × 10(-8) M, with an LOD of 1 × 10(-12) M. The DNA biosensor had excellent specificity for distinguishing complementary DNA sequence in the presence of non-complementary and mismatched DNA sequence. The Au-nano/GCE showed significant improvement in electrochemical characteristics, and this biosensor was successfully applied for determination of K. pneumoniae.

  8. Impedimetric DNA biosensor based on a nanoporous alumina membrane for the detection of the specific oligonucleotide sequence of dengue virus.

    PubMed

    Deng, Jiajia; Toh, Chee-Seng

    2013-06-17

    A novel and integrated membrane sensing platform for DNA detection is developed based on an anodic aluminum oxide (AAO) membrane. Platinum electrodes (~50-100 nm thick) are coated directly on both sides of the alumina membrane to eliminate the solution resistance outside the nanopores. The electrochemical impedance technique is employed to monitor the impedance changes within the nanopores upon DNA binding. Pore resistance (Rp) linearly increases in response towards the increasing concentration of the target DNA in the range of 1 × 10⁻¹² to 1 × 10⁻⁶ M. Moreover, the biosensor selectively differentiates the complementary sequence from single base mismatched (MM-1) strands and non-complementary strands. This study reveals a simple, selective and sensitive method to fabricate a label-free DNA biosensor.

  9. Electrochemical label-free and sensitive nanobiosensing of DNA hybridization by graphene oxide modified pencil graphite electrode.

    PubMed

    Ahour, F; Shamsi, A

    2017-09-01

    Based on the strong interaction between single-stranded DNA (ss-DNA) and graphene material, we have constructed a novel label-free electrochemical biosensor for rapid and facile detection of short sequences ss-DNA molecules related to hepatitis C virus 1a using graphene oxide modified pencil graphite electrode. The sensing mechanism is based on the superior adsorption of single-stranded DNA to GO over double stranded DNA (ds-DNA). The intrinsic guanine oxidation signal measured by differential pulse voltammetry (DPV) has been used for duplex DNA formation detection. The probe ss-DNA adsorbs onto the surface of GO via the π- π* stacking interactions leading to a strong background guanine oxidation signal. In the presence of complementary target, formation of helix which has weak binding ability to GO induced ds-DNA to release from the electrode surface and significant variation in differential pulse voltammetric response of guanine bases. The results indicated that the oxidation peak current was proportional to the concentration of complementary strand in the range of 0.1 nM-0.5 μM with a detection limit of 4.3 × 10 -11  M. The simple fabricated electrochemical biosensor has high sensitivity, good selectivity, and could be applied as a new platform for a range of target molecules in future. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Self-Assembly of Octopus Nanoparticles into Pre-Programmed Finite Clusters

    NASA Astrophysics Data System (ADS)

    Halverson, Jonathan; Tkachenko, Alexei

    2012-02-01

    The precise control of the spatial arrangement of nanoparticles (NP) is often required to take full advantage of their novel optical and electronic properties. NPs have been shown to self-assemble into crystalline structures using either patchy surface regions or complementary DNA strands to direct the assembly. Due to a lack of specificity of the interactions these methods lead to only a limited number of structures. An emerging approach is to bind ssDNA at specific sites on the particle surface making so-called octopus NPs. Using octopus NPs we investigate the inverse problem of the self-assembly of finite clusters. That is, for a given target cluster (e.g., arranging the NPs on the vertices of a dodecahedron) what are the minimum number of complementary DNA strands needed for the robust self-assembly of the cluster from an initially homogeneous NP solution? Based on the results of Brownian dynamics simulations we have compiled a set of design rules for various target clusters including cubes, pyramids, dodecahedrons and truncated icosahedrons. Our approach leads to control over the kinetic pathway and has demonstrated nearly perfect yield of the target.

  11. Influence of pendant chiral C(γ)-(alkylideneamino/guanidino) cationic side-chains of PNA backbone on hybridization with complementary DNA/RNA and cell permeability.

    PubMed

    Jain, Deepak R; Anandi V, Libi; Lahiri, Mayurika; Ganesh, Krishna N

    2014-10-17

    Intrinsically cationic and chiral C(γ)-substituted peptide nucleic acid (PNA) analogues have been synthesized in the form of γ(S)-ethyleneamino (eam)- and γ(S)-ethyleneguanidino (egd)-PNA with two carbon spacers from the backbone. The relative stabilization (ΔTm) of duplexes from modified cationic PNAs as compared to 2-aminoethylglycyl (aeg)-PNA is better with complementary DNA (PNA:DNA) than with complementary RNA (PNA:RNA). Inherently, PNA:RNA duplexes have higher stability than PNA:DNA duplexes, and the guanidino PNAs are superior to amino PNAs. The cationic PNAs were found to be specific toward their complementary DNA target as seen from their significantly lower binding with DNA having single base mismatch. The differential binding avidity of cationic PNAs was assessed by the displacement of DNA duplex intercalated ethidium bromide and gel electrophoresis. The live cell imaging of amino/guanidino PNAs demonstrated their ability to penetrate the cell membrane in 3T3 and MCF-7 cells, and cationic PNAs were found to be accumulated in the vicinity of the nuclear membrane in the cytoplasm. Fluorescence-activated cell sorter (FACS) analysis of cell permeability showed the efficiency to be dependent upon the nature of cationic functional group, with guanidino PNAs being better than the amino PNAs in both cell lines. The results are useful to design new biofunctional cationic PNA analogues that not only bind RNA better but also show improved cell permeability.

  12. CRISPR-Cas9 Structures and Mechanisms.

    PubMed

    Jiang, Fuguo; Doudna, Jennifer A

    2017-05-22

    Many bacterial clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR-associated (Cas) systems employ the dual RNA-guided DNA endonuclease Cas9 to defend against invading phages and conjugative plasmids by introducing site-specific double-stranded breaks in target DNA. Target recognition strictly requires the presence of a short protospacer adjacent motif (PAM) flanking the target site, and subsequent R-loop formation and strand scission are driven by complementary base pairing between the guide RNA and target DNA, Cas9-DNA interactions, and associated conformational changes. The use of CRISPR-Cas9 as an RNA-programmable DNA targeting and editing platform is simplified by a synthetic single-guide RNA (sgRNA) mimicking the natural dual trans-activating CRISPR RNA (tracrRNA)-CRISPR RNA (crRNA) structure. This review aims to provide an in-depth mechanistic and structural understanding of Cas9-mediated RNA-guided DNA targeting and cleavage. Molecular insights from biochemical and structural studies provide a framework for rational engineering aimed at altering catalytic function, guide RNA specificity, and PAM requirements and reducing off-target activity for the development of Cas9-based therapies against genetic diseases.

  13. DNA interrogation by the CRISPR RNA-guided endonuclease Cas9.

    PubMed

    Sternberg, Samuel H; Redding, Sy; Jinek, Martin; Greene, Eric C; Doudna, Jennifer A

    2014-03-06

    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated enzyme Cas9 is an RNA-guided endonuclease that uses RNA-DNA base-pairing to target foreign DNA in bacteria. Cas9-guide RNA complexes are also effective genome engineering agents in animals and plants. Here we use single-molecule and bulk biochemical experiments to determine how Cas9-RNA interrogates DNA to find specific cleavage sites. We show that both binding and cleavage of DNA by Cas9-RNA require recognition of a short trinucleotide protospacer adjacent motif (PAM). Non-target DNA binding affinity scales with PAM density, and sequences fully complementary to the guide RNA but lacking a nearby PAM are ignored by Cas9-RNA. Competition assays provide evidence that DNA strand separation and RNA-DNA heteroduplex formation initiate at the PAM and proceed directionally towards the distal end of the target sequence. Furthermore, PAM interactions trigger Cas9 catalytic activity. These results reveal how Cas9 uses PAM recognition to quickly identify potential target sites while scanning large DNA molecules, and to regulate scission of double-stranded DNA.

  14. DNA interrogation by the CRISPR RNA-guided endonuclease Cas9

    NASA Astrophysics Data System (ADS)

    Sternberg, Samuel H.; Redding, Sy; Jinek, Martin; Greene, Eric C.; Doudna, Jennifer A.

    2014-03-01

    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated enzyme Cas9 is an RNA-guided endonuclease that uses RNA-DNA base-pairing to target foreign DNA in bacteria. Cas9-guide RNA complexes are also effective genome engineering agents in animals and plants. Here we use single-molecule and bulk biochemical experiments to determine how Cas9-RNA interrogates DNA to find specific cleavage sites. We show that both binding and cleavage of DNA by Cas9-RNA require recognition of a short trinucleotide protospacer adjacent motif (PAM). Non-target DNA binding affinity scales with PAM density, and sequences fully complementary to the guide RNA but lacking a nearby PAM are ignored by Cas9-RNA. Competition assays provide evidence that DNA strand separation and RNA-DNA heteroduplex formation initiate at the PAM and proceed directionally towards the distal end of the target sequence. Furthermore, PAM interactions trigger Cas9 catalytic activity. These results reveal how Cas9 uses PAM recognition to quickly identify potential target sites while scanning large DNA molecules, and to regulate scission of double-stranded DNA.

  15. Electrochemical DNA biosensor for bovine papillomavirus detection using polymeric film on screen-printed electrode.

    PubMed

    Nascimento, Gustavo A; Souza, Elaine V M; Campos-Ferreira, Danielly S; Arruda, Mariana S; Castelletti, Carlos H M; Wanderley, Marcela S O; Ekert, Marek H F; Bruneska, Danyelly; Lima-Filho, José L

    2012-01-01

    A new electrochemical DNA biosensor for bovine papillomavirus (BPV) detection that was based on screen-printed electrodes was comprehensively studied by electrochemical methods of cyclic voltammetry (CV) and differential pulse voltammetry (DPV). A BPV probe was immobilised on a working electrode (gold) modified with a polymeric film of poly-L-lysine (PLL) and chitosan. The experimental design was carried out to evaluate the influence of polymers, probe concentration (BPV probe) and immobilisation time on the electrochemical reduction of methylene blue (MB). The polymer poly-L-lysine (PLL), a probe concentration of 1 μM and an immobilisation time of 60 min showed the best result for the BPV probe immobilisation. With the hybridisation of a complementary target sequence (BPV target), the electrochemical signal decreased compared to a BPV probe immobilised on the modified PLL-gold electrode. Viral DNA that was extracted from cattle with papillomatosis also showed a decrease in the MB electrochemical reduction, which suggested that the decreased electrochemical signal corresponded to a bovine papillomavirus infection. The hybridisation specificity experiments further indicated that the biosensor could discriminate the complementary sequence from the non-complementary sequence. Thus, the results showed that the development of analytical devices, such as a biosensor, could assist in the rapid and efficient detection of bovine papillomavirus DNA and help in the prevention and treatment of papillomatosis in cattle. Copyright © 2012 Elsevier B.V. All rights reserved.

  16. Structure-based cleavage mechanism of Thermus thermophilus Argonaute DNA guide strand-mediated DNA target cleavage

    PubMed Central

    Sheng, Gang; Zhao, Hongtu; Wang, Jiuyu; Rao, Yu; Tian, Wenwen; Swarts, Daan C.; van der Oost, John; Patel, Dinshaw J.; Wang, Yanli

    2014-01-01

    We report on crystal structures of ternary Thermus thermophilus Argonaute (TtAgo) complexes with 5′-phosphorylated guide DNA and a series of DNA targets. These ternary complex structures of cleavage-incompatible, cleavage-compatible, and postcleavage states solved at improved resolution up to 2.2 Å have provided molecular insights into the orchestrated positioning of catalytic residues, a pair of Mg2+ cations, and the putative water nucleophile positioned for in-line attack on the cleavable phosphate for TtAgo-mediated target cleavage by a RNase H-type mechanism. In addition, these ternary complex structures have provided insights into protein and DNA conformational changes that facilitate transition between cleavage-incompatible and cleavage-compatible states, including the role of a Glu finger in generating a cleavage-competent catalytic Asp-Glu-Asp-Asp tetrad. Following cleavage, the seed segment forms a stable duplex with the complementary segment of the target strand. PMID:24374628

  17. Sensitive immobilization-free electrochemical DNA sensor based on isothermal circular strand displacement polymerization reaction.

    PubMed

    Xuan, Feng; Luo, Xiaoteng; Hsing, I-Ming

    2012-05-15

    A highly sensitive electrochemical DNA sensor that requires no probe immobilization has been developed based on a target recycling mechanism utilizing a DNA polymerase with a strand displacement activity. The electrochemical detection is realized by taking advantage of the difference in diffusivity between a free ferrocene-labeled peptide nucleic acid (Fc-PNA) and a Fc-PNA hybridized with a complementary DNA, while the DNA polymerase-assisted target recycling leads to signal generation and amplification. The hybridization of the target DNA opens up a stem-loop template DNA with the Fc-PNA hybridized to its extruded 5' end and allows a DNA primer to anneal and be extended by the DNA polymerase, which results in sequential displacement of the target DNA and the Fc-PNA from the template DNA. The displaced target DNA will hybridize with another template DNA, triggering another round of primer extension and strand displacement. The released Fc-PNA, due to its neutral backbone, has much higher diffusivity towards a negatively charged electrode, compared to that when it is hybridized with a negatively charged DNA. Therefore, a significantly enhanced signal of Fc can be observed. The outstanding sensitivity and simplicity make this approach a promising candidate for next-generation electrochemical DNA sensing technologies. Copyright © 2012 Elsevier B.V. All rights reserved.

  18. Problem-Solving Test: Conditional Gene Targeting Using the Cre/loxP Recombination System

    ERIC Educational Resources Information Center

    Szeberényi, József

    2013-01-01

    Terms to be familiar with before you start to solve the test: gene targeting, knock-out mutation, bacteriophage, complementary base-pairing, homologous recombination, deletion, transgenic organisms, promoter, polyadenylation element, transgene, DNA replication, RNA polymerase, Shine-Dalgarno sequence, restriction endonuclease, polymerase chain…

  19. Multi-wall carbon nanotubes (MWCNTs)-doped polypyrrole DNA biosensor for label-free detection of genetically modified organisms by QCM and EIS.

    PubMed

    Truong, Thi Ngoc Lien; Tran, Dai Lam; Vu, Thi Hong An; Tran, Vinh Hoang; Duong, Tuan Quang; Dinh, Quang Khieu; Tsukahara, Toshifumi; Lee, Young Hoon; Kim, Jong Seung

    2010-01-15

    In this paper, we describe DNA electrochemical detection for genetically modified organism (GMO) based on multi-wall carbon nanotubes (MWCNTs)-doped polypyrrole (PPy). DNA hybridization is studied by quartz crystal microbalance (QCM) and electrochemical impedance spectroscopy (EIS). An increase in DNA complementary target concentration results in a decrease in the faradic charge transfer resistance (R(ct)) and signifying "signal-on" behavior of MWCNTs-PPy-DNA system. QCM and EIS data indicated that the electroanalytical MWCNTs-PPy films were highly sensitive (as low as 4pM of target can be detected with QCM technique). In principle, this system can be suitable not only for DNA but also for protein biosensor construction.

  20. Real-time, multiplexed electrochemical DNA detection using an active complementary metal-oxide-semiconductor biosensor array with integrated sensor electronics.

    PubMed

    Levine, Peter M; Gong, Ping; Levicky, Rastislav; Shepard, Kenneth L

    2009-03-15

    Optical biosensing based on fluorescence detection has arguably become the standard technique for quantifying extents of hybridization between surface-immobilized probes and fluorophore-labeled analyte targets in DNA microarrays. However, electrochemical detection techniques are emerging which could eliminate the need for physically bulky optical instrumentation, enabling the design of portable devices for point-of-care applications. Unlike fluorescence detection, which can function well using a passive substrate (one without integrated electronics), multiplexed electrochemical detection requires an electronically active substrate to analyze each array site and benefits from the addition of integrated electronic instrumentation to further reduce platform size and eliminate the electromagnetic interference that can result from bringing non-amplified signals off chip. We report on an active electrochemical biosensor array, constructed with a standard complementary metal-oxide-semiconductor (CMOS) technology, to perform quantitative DNA hybridization detection on chip using targets conjugated with ferrocene redox labels. A 4 x 4 array of gold working electrodes and integrated potentiostat electronics, consisting of control amplifiers and current-input analog-to-digital converters, on a custom-designed 5 mm x 3 mm CMOS chip drive redox reactions using cyclic voltammetry, sense DNA binding, and transmit digital data off chip for analysis. We demonstrate multiplexed and specific detection of DNA targets as well as real-time monitoring of hybridization, a task that is difficult, if not impossible, with traditional fluorescence-based microarrays.

  1. Thiophene antibacterials that allosterically stabilize DNA-cleavage complexes with DNA gyrase.

    PubMed

    Chan, Pan F; Germe, Thomas; Bax, Benjamin D; Huang, Jianzhong; Thalji, Reema K; Bacqué, Eric; Checchia, Anna; Chen, Dongzhao; Cui, Haifeng; Ding, Xiao; Ingraham, Karen; McCloskey, Lynn; Raha, Kaushik; Srikannathasan, Velupillai; Maxwell, Anthony; Stavenger, Robert A

    2017-05-30

    A paucity of novel acting antibacterials is in development to treat the rising threat of antimicrobial resistance, particularly in Gram-negative hospital pathogens, which has led to renewed efforts in antibiotic drug discovery. Fluoroquinolones are broad-spectrum antibacterials that target DNA gyrase by stabilizing DNA-cleavage complexes, but their clinical utility has been compromised by resistance. We have identified a class of antibacterial thiophenes that target DNA gyrase with a unique mechanism of action and have activity against a range of bacterial pathogens, including strains resistant to fluoroquinolones. Although fluoroquinolones stabilize double-stranded DNA breaks, the antibacterial thiophenes stabilize gyrase-mediated DNA-cleavage complexes in either one DNA strand or both DNA strands. X-ray crystallography of DNA gyrase-DNA complexes shows the compounds binding to a protein pocket between the winged helix domain and topoisomerase-primase domain, remote from the DNA. Mutations of conserved residues around this pocket affect activity of the thiophene inhibitors, consistent with allosteric inhibition of DNA gyrase. This druggable pocket provides potentially complementary opportunities for targeting bacterial topoisomerases for antibiotic development.

  2. Surface-enhanced Raman scattering detection of DNA derived from the West Nile virus genome using magnetic capture of Raman-active gold nanoparticles

    USDA-ARS?s Scientific Manuscript database

    A model paramagnetic nanoparticle (MNP) assay is demonstrated for surface-enhanced Raman scattering (SERS) detection of DNA oligonucleotides derived from the West Nile virus (WNV) genome. Detection is based on the capture of WNV target sequences by hybridization with complementary oligonucleotide pr...

  3. Quantum dot-based microfluidic biosensor for cancer detection

    NASA Astrophysics Data System (ADS)

    Ghrera, Aditya Sharma; Pandey, Chandra Mouli; Ali, Md. Azahar; Malhotra, Bansi Dhar

    2015-05-01

    We report results of the studies relating to fabrication of an impedimetric microfluidic-based nucleic acid sensor for quantification of DNA sequences specific to chronic myelogenous leukemia (CML). The sensor chip is prepared by patterning an indium-tin-oxide (ITO) coated glass substrate via wet chemical etching method followed by sealing with polydimethylsiloxane (PDMS) microchannel for fluid control. The fabricated microfluidic chip comprising of a patterned ITO substrate is modified by depositing cadmium selenide quantum dots (QCdSe) via Langmuir-Blodgett technique. Further, the QCdSe surface has been functionalized with specific DNA probe for CML detection. The probe DNA functionalized QCdSe integrated miniaturized system has been used to monitor target complementary DNA concentration by measuring the interfacial charge transfer resistance via hybridization. The presence of complementary DNA in buffer solution significantly results in decreased electro-conductivity of the interface due to presence of a charge barrier for transport of the redox probe ions. The microfluidic DNA biosensor exhibits improved linearity in the concentration range of 10-15 M to 10-11 M.

  4. Single-walled carbon nanotubes based chemiresistive genosensor for label-free detection of human rheumatic heart disease

    NASA Astrophysics Data System (ADS)

    Singh, Swati; Kumar, Ashok; Khare, Shashi; Mulchandani, Ashok; Rajesh

    2014-11-01

    A specific and ultrasensitive, label free single-walled carbon nanotubes (SWNTs) based chemiresistive genosensor was fabricated for the early detection of Streptococcus pyogenes infection in human causing rheumatic heart disease. The mga gene of S. pyogenes specific 24 mer ssDNA probe was covalently immobilized on SWNT through a molecular bilinker, 1-pyrenemethylamine, using carbodiimide coupling reaction. The sensor was characterized by the current-voltage (I-V) characteristic curve and scanning electron microscopy. The sensing performance of the sensor was studied with respect to changes in conductance in SWNT channel based on hybridization of the target S. pyogenes single stranded genomic DNA (ssG-DNA) to its complementary 24 mer ssDNA probe. The sensor shows negligible response to non-complementary Staphylococcus aureus ssG-DNA, confirming the specificity of the sensor only with S. pyogenes. The genosensor exhibited a linear response to S. pyogenes G-DNA from 1 to1000 ng ml-1 with a limit of detection of 0.16 ng ml-1.

  5. Biosensing of BCR/ABL fusion gene using an intensity-interrogation surface plasmon resonance imaging system

    NASA Astrophysics Data System (ADS)

    Wu, Jiangling; Huang, Yu; Bian, Xintong; Li, DanDan; Cheng, Quan; Ding, Shijia

    2016-10-01

    In this work, a custom-made intensity-interrogation surface plasmon resonance imaging (SPRi) system has been developed to directly detect a specific sequence of BCR/ABL fusion gene in chronic myelogenous leukemia (CML). The variation in the reflected light intensity detected from the sensor chip composed of gold islands array is proportional to the change of refractive index due to the selective hybridization of surface-bound DNA probes with target ssDNA. SPRi measurements were performed with different concentrations of synthetic target DNA sequence. The calibration curve of synthetic target sequence shows a good relationship between the concentration of synthetic target and the change of reflected light intensity. The detection limit of this SPRi measurement could approach 10.29 nM. By comparing SPRi images, the target ssDNA and non-complementary DNA sequence are able to be distinguished. This SPRi system has been applied for assay of BCR/ABL fusion gene extracted from real samples. This nucleic acid-based SPRi biosensor therefore offers an alternative high-effective, high-throughput label-free tool for DNA detection in biomedical research and molecular diagnosis.

  6. Mitochondrial targeting of recombinant RNAs modulates the level of a heteroplasmic mutation in human mitochondrial DNA associated with Kearns Sayre Syndrome

    PubMed Central

    Comte, Caroline; Tonin, Yann; Heckel-Mager, Anne-Marie; Boucheham, Abdeldjalil; Smirnov, Alexandre; Auré, Karine; Lombès, Anne; Martin, Robert P.; Entelis, Nina; Tarassov, Ivan

    2013-01-01

    Mitochondrial mutations, an important cause of incurable human neuromuscular diseases, are mostly heteroplasmic: mutated mitochondrial DNA is present in cells simultaneously with wild-type genomes, the pathogenic threshold being generally >70% of mutant mtDNA. We studied whether heteroplasmy level could be decreased by specifically designed oligoribonucleotides, targeted into mitochondria by the pathway delivering RNA molecules in vivo. Using mitochondrially imported RNAs as vectors, we demonstrated that oligoribonucleotides complementary to mutant mtDNA region can specifically reduce the proportion of mtDNA bearing a large deletion associated with the Kearns Sayre Syndrome in cultured transmitochondrial cybrid cells. These findings may be relevant to developing of a new tool for therapy of mtDNA associated diseases. PMID:23087375

  7. Single Molecule Nano-Metronome

    PubMed Central

    Buranachai, Chittanon; McKinney, Sean A.; Ha, Taekjip

    2008-01-01

    We constructed a DNA-based nano-mechanical device called the nano-metronome. Our device is made by introducing complementary single stranded overhangs at the two arms of the DNA four-way junction. The ticking rates of this stochastic metronome depend on ion concentrations and can be changed by a set of DNA-based switches to deactivate/reactivate the sticky end. Since the device displays clearly distinguishable responses even with a single basepair difference, it may lead to a single molecule sensor of minute sequence differences of a target DNA. PMID:16522050

  8. Determination of cDNA encoding BCR/ABL fusion gene in patients with chronic myelogenous leukemia using a novel FRET-based quantum dots-DNA nanosensor.

    PubMed

    Shamsipur, Mojtaba; Nasirian, Vahid; Barati, Ali; Mansouri, Kamran; Vaisi-Raygani, Asad; Kashanian, Soheila

    2017-05-08

    In the present study, we developed a sensitive method based on fluorescence resonance energy transfer (FRET) for the determination of the BCR/ABL fusion gene, which is used as a biomarker to confirm the clinical diagnosis of both chronic myelogenous leukemia (CML) and acute lymphocytic leukemia (ALL). For this purpose, CdTe quantum dots (QDs) were conjugated to amino-modified 18-mer oligonucleotide ((N)DNA) to form the QDs-(N)DNA nanosensor. In the presence of methylene blue (MB) as an intercalator, the hybridization of QDs-(N)DNA with the target BCR/ABL fusion gene (complementary DNA), brings the MB (acceptor) at close proximity of the QDs (donor), leading to FRET upon photoexcitation of the QDs. The enhancement in the emission intensity of MB was used to follow up the hybridization, which was linearly proportional to concentration of the target complementary DNA in a range from 1.0 × 10 -9 to 1.25 × 10 -7  M. The detection limit of the proposed method was obtained to be 1.5 × 10 -10  M. Finally, the feasibility and selectivity of the proposed nanosensor was evaluated by the analysis of derived nucleotides from both mismatched sequences and clinical samples of patients with leukemia as real samples. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Structural Basis for the Altered PAM Recognition by Engineered CRISPR-Cpf1.

    PubMed

    Nishimasu, Hiroshi; Yamano, Takashi; Gao, Linyi; Zhang, Feng; Ishitani, Ryuichiro; Nureki, Osamu

    2017-07-06

    The RNA-guided Cpf1 nuclease cleaves double-stranded DNA targets complementary to the CRISPR RNA (crRNA), and it has been harnessed for genome editing technologies. Recently, Acidaminococcus sp. BV3L6 (AsCpf1) was engineered to recognize altered DNA sequences as the protospacer adjacent motif (PAM), thereby expanding the target range of Cpf1-mediated genome editing. Whereas wild-type AsCpf1 recognizes the TTTV PAM, the RVR (S542R/K548V/N552R) and RR (S542R/K607R) variants can efficiently recognize the TATV and TYCV PAMs, respectively. However, their PAM recognition mechanisms remained unknown. Here we present the 2.0 Å resolution crystal structures of the RVR and RR variants bound to a crRNA and its target DNA. The structures revealed that the RVR and RR variants primarily recognize the PAM-complementary nucleotides via the substituted residues. Our high-resolution structures delineated the altered PAM recognition mechanisms of the AsCpf1 variants, providing a basis for the further engineering of CRISPR-Cpf1. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Fluorescence correlation spectroscopy study of the complexation of DNA hybrids, IgG antibody, and a chimeric protein of IgG-binding ZZ domains fused with a carbohydrate binding module.

    PubMed

    Rosa, A M M; Prazeres, D M F; Paulo, P M R

    2017-06-28

    Fluorescence correlation spectroscopy (FCS) was used to characterize the molecular interactions between the four components of a DNA recognition system. A fluorescent DNA probe was used to assess: (i) the hybridization with a complementary biotin-labeled target, (ii) the complexation of the resulting hybrid and an anti-biotin antibody, and (iii) the binding of the latter complex to a ZZ-CBM fusion protein that combines small synthetic IgG Fc-binding Z domains with a carbohydrate binding module (CBM). These binding interactions were monitored by exposing the fluorescent DNA probe to different amounts and combinations of the other molecules in solution. Through the analysis of FCS autocorrelation curves, an association constant (K a ) of 2.9 × 10 7 M -1 was estimated for DNA·DNA hybridization, and the presence of (non-) complementary target DNA in solution could be discriminated. The specific capture of biotinylated DNA hybrids by anti-biotin IgG was verified, with an apparent K a of 2.5 × 10 6 M -1 . The increment in the diffusion time measured when the DNA·DNA:antibody complexes were in contact with the ZZ-CBM fusion protein suggested that the binding occurs at a stoichiometric ratio of DNA/antibody complex to fusion larger than 1 : 1. The FCS-derived information obtained is useful to gain insight into molecular interactions involved in diagnostic assays.

  11. Biosensors based on DNA-Functionalized Graphene

    NASA Astrophysics Data System (ADS)

    Vishnubhotla, Ramya; Ping, Jinglei; Vrudhula, Amey; Johnson, A. T. Charlie

    Since its discovery, graphene has been used for sensing applications due to its outstanding electrical properties and biocompatibility. Here, we demonstrate the capabilities of field effect transistors (FETs) based on CVD-grown graphene functionalized with commercially obtained DNA oligomers and aptamers for detection of various biomolecular targets (e.g., complementary DNA and small molecule drug targets). Graphene FETs were created with a scalable photolithography process that produces arrays consisting of 50-100 FETs with a layout suitable for multiplexed detection of four molecular targets. FETs were characterized via AFM to confirm the presence of the aptamer. From the measured electrical characteristics, it was determined that binding of molecular targets by the DNA chemical recognition element led to a reproducible, concentration-dependent shift in the Dirac voltage. This biosensor class is potentially suitable for applications in drug detection. This work is funded by NIH through the Center for AIDS Research at the University of Pennsylvania.

  12. A Sensitive DNA Capacitive Biosensor Using Interdigitated Electrodes

    PubMed Central

    Wang, Lei; Veselinovic, Milena; Yang, Lang; Geiss, Brian J.; Dandy, David S.; Chen, Tom

    2017-01-01

    This paper presents a label-free affinity-based capacitive biosensor using interdigitated electrodes. Using an optimized process of DNA probe preparation to minimize the effect of contaminants in commercial thiolated DNA probe, the electrode surface was functionalized with the 24-nucleotide DNA probes based on the West Nile virus sequence (Kunjin strain). The biosensor has the ability to detect complementary DNA fragments with a detection limit down to 20 DNA target molecules (1.5 aM range), making it suitable for a practical point-of-care (POC) platform for low target count clinical applications without the need for amplification. The reproducibility of the biosensor detection was improved with efficient covalent immobilization of purified single-stranded DNA probe oligomers on cleaned gold microelectrodes. In addition to the low detection limit, the biosensor showed a dynamic range of detection from 1 μL−1 to 105 μL−1 target molecules (20 to 2 million targets), making it suitable for sample analysis in a typical clinical application environment. The binding results presented in this paper were validated using fluorescent oligomers. PMID:27619528

  13. A Graphene-Based Biosensing Platform Based on Regulated Release of an Aptameric DNA Biosensor

    PubMed Central

    Mao, Yu; Chen, Yongli; Li, Song; Lin, Shuo; Jiang, Yuyang

    2015-01-01

    A novel biosensing platform was developed by integrating an aptamer-based DNA biosensor with graphene oxide (GO) for rapid and facile detection of adenosine triphosphate (ATP, as a model target). The DNA biosensor, which is locked by GO, is designed to contain two sensing modules that include recognition site for ATP and self-replication track that yields the nicking domain for Nt.BbvCI. By taking advantage of the different binding affinity of single-stranded DNA, double-stranded DNA and aptamer-target complex toward GO, the DNA biosensor could be efficiently released from GO in the presence of target with the help of a complementary DNA strand (CPDNA) that partially hybridizes to the DNA biosensor. Then, the polymerization/nicking enzyme synergetic isothermal amplification could be triggered, leading to the synthesis of massive DNA amplicons, thus achieving an enhanced sensitivity with a wide linear dynamic response range of four orders of magnitude and good selectivity. This biosensing strategy expands the applications of GO-DNA nanobiointerfaces in biological sensing, showing great potential in fundamental research and biomedical diagnosis. PMID:26569239

  14. A Graphene-Based Biosensing Platform Based on Regulated Release of an Aptameric DNA Biosensor.

    PubMed

    Mao, Yu; Chen, Yongli; Li, Song; Lin, Shuo; Jiang, Yuyang

    2015-11-09

    A novel biosensing platform was developed by integrating an aptamer-based DNA biosensor with graphene oxide (GO) for rapid and facile detection of adenosine triphosphate (ATP, as a model target). The DNA biosensor, which is locked by GO, is designed to contain two sensing modules that include recognition site for ATP and self-replication track that yields the nicking domain for Nt.BbvCI. By taking advantage of the different binding affinity of single-stranded DNA, double-stranded DNA and aptamer-target complex toward GO, the DNA biosensor could be efficiently released from GO in the presence of target with the help of a complementary DNA strand (CPDNA) that partially hybridizes to the DNA biosensor. Then, the polymerization/nicking enzyme synergetic isothermal amplification could be triggered, leading to the synthesis of massive DNA amplicons, thus achieving an enhanced sensitivity with a wide linear dynamic response range of four orders of magnitude and good selectivity. This biosensing strategy expands the applications of GO-DNA nanobiointerfaces in biological sensing, showing great potential in fundamental research and biomedical diagnosis.

  15. Cytotoxic chromosomal targeting by CRISPR/Cas systems can reshape bacterial genomes and expel or remodel pathogenicity islands.

    PubMed

    Vercoe, Reuben B; Chang, James T; Dy, Ron L; Taylor, Corinda; Gristwood, Tamzin; Clulow, James S; Richter, Corinna; Przybilski, Rita; Pitman, Andrew R; Fineran, Peter C

    2013-04-01

    In prokaryotes, clustered regularly interspaced short palindromic repeats (CRISPRs) and their associated (Cas) proteins constitute a defence system against bacteriophages and plasmids. CRISPR/Cas systems acquire short spacer sequences from foreign genetic elements and incorporate these into their CRISPR arrays, generating a memory of past invaders. Defence is provided by short non-coding RNAs that guide Cas proteins to cleave complementary nucleic acids. While most spacers are acquired from phages and plasmids, there are examples of spacers that match genes elsewhere in the host bacterial chromosome. In Pectobacterium atrosepticum the type I-F CRISPR/Cas system has acquired a self-complementary spacer that perfectly matches a protospacer target in a horizontally acquired island (HAI2) involved in plant pathogenicity. Given the paucity of experimental data about CRISPR/Cas-mediated chromosomal targeting, we examined this process by developing a tightly controlled system. Chromosomal targeting was highly toxic via targeting of DNA and resulted in growth inhibition and cellular filamentation. The toxic phenotype was avoided by mutations in the cas operon, the CRISPR repeats, the protospacer target, and protospacer-adjacent motif (PAM) beside the target. Indeed, the natural self-targeting spacer was non-toxic due to a single nucleotide mutation adjacent to the target in the PAM sequence. Furthermore, we show that chromosomal targeting can result in large-scale genomic alterations, including the remodelling or deletion of entire pre-existing pathogenicity islands. These features can be engineered for the targeted deletion of large regions of bacterial chromosomes. In conclusion, in DNA-targeting CRISPR/Cas systems, chromosomal interference is deleterious by causing DNA damage and providing a strong selective pressure for genome alterations, which may have consequences for bacterial evolution and pathogenicity.

  16. Structural basis for the recognition of guide RNA and target DNA heteroduplex by Argonaute

    PubMed Central

    Miyoshi, Tomohiro; Ito, Kosuke; Murakami, Ryo; Uchiumi, Toshio

    2016-01-01

    Argonaute proteins are key players in the gene silencing mechanisms mediated by small nucleic acids in all domains of life from bacteria to eukaryotes. However, little is known about the Argonaute protein that recognizes guide RNA/target DNA. Here, we determine the 2 Å crystal structure of Rhodobacter sphaeroides Argonaute (RsAgo) in a complex with 18-nucleotide guide RNA and its complementary target DNA. The heteroduplex maintains Watson–Crick base-pairing even in the 3′-region of the guide RNA between the N-terminal and PIWI domains, suggesting a recognition mode by RsAgo for stable interaction with the target strand. In addition, the MID/PIWI interface of RsAgo has a system that specifically recognizes the 5′ base-U of the guide RNA, and the duplex-recognition loop of the PAZ domain is important for the DNA silencing activity. Furthermore, we show that Argonaute discriminates the nucleic acid type (RNA/DNA) by recognition of the duplex structure of the seed region. PMID:27325485

  17. Structural basis for the recognition of guide RNA and target DNA heteroduplex by Argonaute.

    PubMed

    Miyoshi, Tomohiro; Ito, Kosuke; Murakami, Ryo; Uchiumi, Toshio

    2016-06-21

    Argonaute proteins are key players in the gene silencing mechanisms mediated by small nucleic acids in all domains of life from bacteria to eukaryotes. However, little is known about the Argonaute protein that recognizes guide RNA/target DNA. Here, we determine the 2 Å crystal structure of Rhodobacter sphaeroides Argonaute (RsAgo) in a complex with 18-nucleotide guide RNA and its complementary target DNA. The heteroduplex maintains Watson-Crick base-pairing even in the 3'-region of the guide RNA between the N-terminal and PIWI domains, suggesting a recognition mode by RsAgo for stable interaction with the target strand. In addition, the MID/PIWI interface of RsAgo has a system that specifically recognizes the 5' base-U of the guide RNA, and the duplex-recognition loop of the PAZ domain is important for the DNA silencing activity. Furthermore, we show that Argonaute discriminates the nucleic acid type (RNA/DNA) by recognition of the duplex structure of the seed region.

  18. Mechanism of foreign DNA selection in a bacterial adaptive immune system

    PubMed Central

    Sashital, Dipali G.; Wiedenheft, Blake; Doudna, Jennifer A.

    2012-01-01

    Summary In bacterial and archaeal CRISPR immune pathways, DNA sequences from invading bacteriophage or plasmids are integrated into CRISPR loci within the host genome, conferring immunity against subsequent infections. The ribonucleoprotein complex Cascade utilizes RNAs generated from these loci to target complementary “non-self” DNA sequences for destruction, while avoiding binding to “self” sequences within the CRISPR locus. Here we show that CasA, the largest protein subunit of Cascade, is required for non-self target recognition and binding. Combining a 2.3 Å crystal structure of CasA with cryo-EM structures of Cascade, we have identified a loop that is required for viral defense. This loop contacts a conserved 3-base pair motif that is required for non-self target selection. Our data suggest a model in which the CasA loop scans DNA for this short motif prior to target destabilization and binding, maximizing the efficiency of DNA surveillance by Cascade. PMID:22521690

  19. Electrochemical detection of Francisella tularensis genomic DNA using solid-phase recombinase polymerase amplification.

    PubMed

    del Río, Jonathan Sabaté; Yehia Adly, Nouran; Acero-Sánchez, Josep Lluis; Henry, Olivier Y F; O'Sullivan, Ciara K

    2014-04-15

    Solid-phase isothermal DNA amplification was performed exploiting the homology protein recombinase A (recA). The system was primarily tested on maleimide activated microtitre plates as a proof-of-concept and later translated to an electrochemical platform. In both cases, forward primer for Francisella tularensis holarctica genomic DNA was surface immobilised via a thiol or an amino moiety and then elongated during the recA mediated amplification, carried out in the presence of specific target sequence and reverse primers. The formation of the subsequent surface tethered amplicons was either colorimetrically or electrochemically monitored using a horseradish peroxidase (HRP)-labelled DNA secondary probe complementary to the elongated strand. The amplification time was optimised to amplify even low amounts of DNA copies in less than an hour at a constant temperature of 37°C, achieving a limit of detection of 1.3×10(-13) M (4×10(6) copies in 50 μL) for the colorimetric assay and 3.3×10(-14) M (2×10(5) copies in 10 μL) for the chronoamperometric assay. The system was demonstrated to be highly specific with negligible cross-reactivity with non-complementary targets or primers. © 2013 Elsevier B.V. All rights reserved.

  20. Single-Molecule Counting of Point Mutations by Transient DNA Binding

    NASA Astrophysics Data System (ADS)

    Su, Xin; Li, Lidan; Wang, Shanshan; Hao, Dandan; Wang, Lei; Yu, Changyuan

    2017-03-01

    High-confidence detection of point mutations is important for disease diagnosis and clinical practice. Hybridization probes are extensively used, but are hindered by their poor single-nucleotide selectivity. Shortening the length of DNA hybridization probes weakens the stability of the probe-target duplex, leading to transient binding between complementary sequences. The kinetics of probe-target binding events are highly dependent on the number of complementary base pairs. Here, we present a single-molecule assay for point mutation detection based on transient DNA binding and use of total internal reflection fluorescence microscopy. Statistical analysis of single-molecule kinetics enabled us to effectively discriminate between wild type DNA sequences and single-nucleotide variants at the single-molecule level. A higher single-nucleotide discrimination is achieved than in our previous work by optimizing the assay conditions, which is guided by statistical modeling of kinetics with a gamma distribution. The KRAS c.34 A mutation can be clearly differentiated from the wild type sequence (KRAS c.34 G) at a relative abundance as low as 0.01% mutant to WT. To demonstrate the feasibility of this method for analysis of clinically relevant biological samples, we used this technology to detect mutations in single-stranded DNA generated from asymmetric RT-PCR of mRNA from two cancer cell lines.

  1. RNA-guided transcriptional regulation

    DOEpatents

    Church, George M.; Mali, Prashant G.; Esvelt, Kevin M.

    2016-02-23

    Methods of modulating expression of a target nucleic acid in a cell are provided including introducing into the cell a first foreign nucleic acid encoding one or more RNAs complementary to DNA, wherein the DNA includes the target nucleic acid, introducing into the cell a second foreign nucleic acid encoding a nuclease-null Cas9 protein that binds to the DNA and is guided by the one or more RNAs, introducing into the cell a third foreign nucleic acid encoding a transcriptional regulator protein or domain, wherein the one or more RNAs, the nuclease-null Cas9 protein, and the transcriptional regulator protein or domain are expressed, wherein the one or more RNAs, the nuclease-null Cas9 protein and the transcriptional regulator protein or domain co-localize to the DNA and wherein the transcriptional regulator protein or domain regulates expression of the target nucleic acid.

  2. [Antisense polynucleotides and prospects for their use in fighting viruses].

    PubMed

    Tikhonenko, T I

    1989-01-01

    Natural or synthetic anti-sense (as) polynucleotides complementary to distinct functional regions of mRNA (asRNA or asDNA) are able to inhibit the expression of any target gene. If certain viral mRNAs important for virus replication are targeted the inhibition of viral infection by asRNA or asDNA takes place. Inhibitory effects of complementary polynucleotides on gene activity in eukaryotic cells is due to the disturbance of translation of corresponding mRNAs as well as to the impairment of their splicing or transportation from the nuclei to cytoplasm. In prokaryotic cells, obviously, only the first factor is operating. The recombinant genes programming anti-viral asRNA can confer the resistance to the infection by other virus to the transformed cells. The resistance to viral infection observed in transgenic animals, expressing asRNA genes, may be considered as a new unnatural form of informational immunity.

  3. Sex determination based on amelogenin DNA by modified electrode with gold nanoparticle.

    PubMed

    Mazloum-Ardakani, Mohammad; Rajabzadeh, Nooshin; Benvidi, Ali; Heidari, Mohammad Mehdi

    2013-12-15

    We have developed a simple and renewable electrochemical biosensor based on carbon paste electrode (CPE) for the detection of DNA synthesis and hybridization. CPE was modified with gold nanoparticles (AuNPs), which are helpful for immobilization of thiolated bioreceptors. AuNPs were characterized by scanning electron microscopy (SEM). Self-assembled monolayers (SAMs) of thiolated single-stranded DNA (SH-ssDNA) of the amelogenin gene was formed on CPE. The immobilization of the probe and its hybridization with the target DNA was optimized using different experimental conditions. The modified electrode was characterized by electrochemical impedance spectroscopy (EIS) and cyclic voltammetry (CV). The electrochemical response of ssDNA hybridization and DNA synthesis was measured using differential pulse voltammetry (DPV) with methylene blue (MB) as an electroactive indicator. The new biosensor can distinguish between complementary and non-complementary strands of amelogenin ssDNA. Genomic DNA was extracted from blood and was detected based on changes in the MB reduction signal. These results demonstrated that the new biosensor could be used for sex determination. The proposed biosensor in this study could be used for detection and discrimination of polymerase chain reaction (PCR) products of amelogenin DNA. Copyright © 2013 Elsevier Inc. All rights reserved.

  4. Electrochemical DNA biosensor based on a glassy carbon electrode modified with gold nanoparticles and graphene for sensitive determination of Klebsiella pneumoniae carbapenemase.

    PubMed

    Pan, Hong-zhi; Yu, Hong-wei; Wang, Na; Zhang, Ze; Wan, Guang-cai; Liu, Hao; Guan, Xue; Chang, Dong

    2015-11-20

    We describe the fabrication of a sensitive electrochemical DNA biosensor for determination of Klebsiella pneumoniae carbapenemase (KPC). The highly sensitive and selective electrochemical biosensor for DNA detection was constructed based on a glassy carbon electrode (GCE) modified with gold nanoparticles (Au-NPs) and graphene (Gr). Then Au-NPs/Gr/GCE was characterized by scanning electro microscope (SEM), cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS). The hybridization detection was measured by diffierential pulse voltammetry (DPV) using methylene blue (MB) as the hybridization indicator. The dynamic range of detection of the sensor for the target DNA sequences was from 1 × 10(-12) to 1 × 10(-7)mol/L, with a detection limit of 2 × 10(-13)mol/L. The DNA biosensor had excellent specificity for distinguishing complementary DNA sequence in the presence of non-complementary and mismatched DNA sequence. The results demonstrated that the Au-NPs/Gr nanocomposite was a promising substrate for the development of high-performance electrocatalysts for determination of KPC. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Development of a mass sensitive quartz crystal microbalance (QCM)-based DNA biosensor using a 50 MHz electronic oscillator circuit.

    PubMed

    García-Martinez, Gonzalo; Bustabad, Enrique Alonso; Perrot, Hubert; Gabrielli, Claude; Bucur, Bogdan; Lazerges, Mathieu; Rose, Daniel; Rodriguez-Pardo, Loreto; Fariña, Jose; Compère, Chantal; Vives, Antonio Arnau

    2011-01-01

    This work deals with the design of a high sensitivity DNA sequence detector using a 50 MHz quartz crystal microbalance (QCM) electronic oscillator circuit. The oscillator circuitry is based on Miller topology, which is able to work in damping media. Calibration and experimental study of frequency noise are carried out, finding that the designed sensor has a resolution of 7.1 ng/cm(2) in dynamic conditions (with circulation of liquid). Then the oscillator is proved as DNA biosensor. Results show that the system is able to detect the presence of complementary target DNAs in a solution with high selectivity and sensitivity. DNA target concentrations higher of 50 ng/mL can be detected.

  6. Ordered Self-Assembled Monolayers of Peptide Nucleic Acids with DNA Recognition Capability

    NASA Astrophysics Data System (ADS)

    Briones, C.; Mateo-Marti, E.; Gómez-Navarro, C.; Parro, V.; Román, E.; Martín-Gago, J. A.

    2004-11-01

    We report on the formation of ordered self-assembled monolayers (SAMs) of single-stranded peptide nucleic acids (ssPNA). In spite of their remarkable length (7nm) thiolated PNAs assemble standing up on gold surfaces similarly to the SAMs of short alkanethiols. SAMs of ssPNA recognize complementary nucleic acids, acting as specific biosensors that discriminate even a point mutation in target ssDNA. These results are obtained by surface characterization techniques that avoid labeling of the target molecule: x-ray photoemission, x-ray absorption and atomic force microscopy.

  7. DNA microdevice for electrochemical detection of Escherichia coli 0157:H7 molecular markers.

    PubMed

    Berganza, J; Olabarria, G; García, R; Verdoy, D; Rebollo, A; Arana, S

    2007-04-15

    An electrochemical DNA sensor based on the hybridization recognition of a single-stranded DNA (ssDNA) probe immobilized onto a gold electrode to its complementary ssDNA is presented. The DNA probe is bound on gold surface electrode by using self-assembled monolayer (SAM) technology. An optimized mixed SAM with a blocking molecule preventing the nonspecific adsorption on the electrode surface has been prepared. In this paper, a DNA biosensor is designed by means of the immobilization of a single stranded DNA probe on an electrochemical transducer surface to recognize specifically Escherichia coli (E. coli) 0157:H7 complementary target DNA sequence via cyclic voltammetry experiments. The 21 mer DNA probe including a C6 alkanethiol group at the 5' phosphate end has been synthesized to form the SAM onto the gold surface through the gold sulfur bond. The goal of this paper has been to design, characterise and optimise an electrochemical DNA sensor. In order to investigate the oligonucleotide probe immobilization and the hybridization detection, experiments with different concentration of DNA and mismatch sequences have been performed. This microdevice has demonstrated the suitability of oligonucleotide Self-assembled monolayers (SAMs) on gold as immobilization method. The DNA probes deposited on gold surface have been functional and able to detect changes in bases sequence in a 21-mer oligonucleotide.

  8. New redox-active layer create via epoxy-amine reaction - The base of genosensor for the detection of specific DNA and RNA sequences of avian influenza virus H5N1.

    PubMed

    Malecka, Kamila; Stachyra, Anna; Góra-Sochacka, Anna; Sirko, Agnieszka; Zagórski-Ostoja, Włodzimierz; Dehaen, Wim; Radecka, Hanna; Radecki, Jerzy

    2015-03-15

    This paper concerns the development of a redox-active monolayer and its application for the construction of an electrochemical genosensor designed for the detection of specific DNA and RNA oligonucleotide sequences related to the avian influenza virus (AIV) type H5N1. This new redox layer was created on a gold electrode surface step by step. Cyclic Voltammetry, Osteryoung Square-Wave Voltammetry and Differential Pulse Voltammetry were used for its characterization. This new redox-active layer was applied for the construction of the DNA biosensor. The NH2-NC3 probe (20-mer) was covalently attached to the gold electrode surface via a "click" reaction between the amine and an epoxide group. The hybridization process was monitored using the Osteryoung Square-Wave Voltammetry. The 20-mer DNA and ca. 280-mer RNA oligonucleotides were used as the targets. The constructed genosensor was capable to determine complementary oligonucleotide sequences with a detection limit in the pM range. It is able to distinguish the different position of the part RNA complementary to the DNA probe. The genosensor was very selective. The 20-mer DNA as well as the 280-mer RNA oligonucleotides without a complementary sequence generated a weak signal. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. Hybridization chain reaction-based instantaneous derivatization technology for chemiluminescence detection of specific DNA sequences.

    PubMed

    Wang, Xin; Lau, Choiwan; Kai, Masaaki; Lu, Jianzhong

    2013-05-07

    We propose here a new amplifying strategy that uses hybridization chain reaction (HCR) to detect specific sequences of DNA, where stable DNA monomers assemble on the magnetic beads only upon exposure to a target DNA. Briefly, in the HCR process, two complementary stable species of hairpins coexist in solution until the introduction of initiator reporter strands triggers a cascade of hybridization events that yield nicked double helices analogous to alternating copolymers. Moreover, a "sandwich-type" detection strategy is employed in our design. Magnetic beads, which are functionalized with capture DNA, are reacted with the target, and sandwiched with the above nicked double helices. Then, chemiluminescence (CL) detection proceeds via an instantaneous derivatization reaction between a specific CL reagent, 3,4,5-trimethoxylphenylglyoxal (TMPG), and the guanine nucleotides within the target DNA, reporter strands and DNA monomers for the generation of light. Our results clearly show that the amplification detection of specific sequences of DNA achieves a better performance (e.g. wide linear response range, low detection limit, and high specificity) as compared to the traditional sandwich type (capture/target/reporter) assays. Upon modification, the approach presented could be extended to detect other types of targets. We believe that this simple technique is promising for improving medical diagnosis and treatment.

  10. Mechanistic Insights into Archaeal and Human Argonaute Substrate Binding and Cleavage Properties

    PubMed Central

    Willkomm, Sarah; Zander, Adrian; Grohmann, Dina; Restle, Tobias

    2016-01-01

    Argonaute (Ago) proteins from all three domains of life are key players in processes that specifically regulate cellular nucleic acid levels. Some of these Ago proteins, among them human Argonaute2 (hAgo2) and Ago from the archaeal organism Methanocaldococcus jannaschii (MjAgo), are able to cleave nucleic acid target strands that are recognised via an Ago-associated complementary guide strand. Here we present an in-depth kinetic side-by-side analysis of hAgo2 and MjAgo guide and target substrate binding as well as target strand cleavage, which enabled us to disclose similarities and differences in the mechanistic pathways as a function of the chemical nature of the substrate. Testing all possible guide-target combinations (i.e. RNA/RNA, RNA/DNA, DNA/RNA and DNA/DNA) with both Ago variants we demonstrate that the molecular mechanism of substrate association is highly conserved among archaeal-eukaryotic Argonautes. Furthermore, we show that hAgo2 binds RNA and DNA guide strands in the same fashion. On the other hand, despite striking homology between the two Ago variants, MjAgo cannot orientate guide RNA substrates in a way that allows interaction with the target DNA in a cleavage-compatible orientation. PMID:27741323

  11. Structural Variation of Type I-F CRISPR RNA Guided DNA Surveillance.

    PubMed

    Pausch, Patrick; Müller-Esparza, Hanna; Gleditzsch, Daniel; Altegoer, Florian; Randau, Lennart; Bange, Gert

    2017-08-17

    CRISPR-Cas systems are prokaryotic immune systems against invading nucleic acids. Type I CRISPR-Cas systems employ highly diverse, multi-subunit surveillance Cascade complexes that facilitate duplex formation between crRNA and complementary target DNA for R-loop formation, retention, and DNA degradation by the subsequently recruited nuclease Cas3. Typically, the large subunit recognizes bona fide targets through the PAM (protospacer adjacent motif), and the small subunit guides the non-target DNA strand. Here, we present the Apo- and target-DNA-bound structures of the I-Fv (type I-F variant) Cascade lacking the small and large subunits. Large and small subunits are functionally replaced by the 5' terminal crRNA cap Cas5fv and the backbone protein Cas7fv, respectively. Cas5fv facilitates PAM recognition from the DNA major groove site, in contrast to all other described type I systems. Comparison of the type I-Fv Cascade with an anti-CRISPR protein-bound I-F Cascade reveals that the type I-Fv structure differs substantially at known anti-CRISPR protein target sites and might therefore be resistant to viral Cascade interception. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Single-walled carbon nanotubes based chemiresistive genosensor for label-free detection of human rheumatic heart disease

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Singh, Swati; Kumar, Ashok, E-mail: rajesh-csir@yahoo.com, E-mail: ashokigib@rediffmail.com; Academy of Scientific and Innovative Research

    A specific and ultrasensitive, label free single-walled carbon nanotubes (SWNTs) based chemiresistive genosensor was fabricated for the early detection of Streptococcus pyogenes infection in human causing rheumatic heart disease. The mga gene of S. pyogenes specific 24 mer ssDNA probe was covalently immobilized on SWNT through a molecular bilinker, 1-pyrenemethylamine, using carbodiimide coupling reaction. The sensor was characterized by the current-voltage (I-V) characteristic curve and scanning electron microscopy. The sensing performance of the sensor was studied with respect to changes in conductance in SWNT channel based on hybridization of the target S. pyogenes single stranded genomic DNA (ssG-DNA) to itsmore » complementary 24 mer ssDNA probe. The sensor shows negligible response to non-complementary Staphylococcus aureus ssG-DNA, confirming the specificity of the sensor only with S. pyogenes. The genosensor exhibited a linear response to S. pyogenes G-DNA from 1 to1000 ng ml{sup −1} with a limit of detection of 0.16 ng ml{sup −1}.« less

  13. Quantum dot-based microfluidic biosensor for cancer detection

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ghrera, Aditya Sharma; School of Engineering and Technology, ITM University, Gurgaon-122017; Pandey, Chandra Mouli

    2015-05-11

    We report results of the studies relating to fabrication of an impedimetric microfluidic–based nucleic acid sensor for quantification of DNA sequences specific to chronic myelogenous leukemia (CML). The sensor chip is prepared by patterning an indium–tin–oxide (ITO) coated glass substrate via wet chemical etching method followed by sealing with polydimethylsiloxane (PDMS) microchannel for fluid control. The fabricated microfluidic chip comprising of a patterned ITO substrate is modified by depositing cadmium selenide quantum dots (QCdSe) via Langmuir–Blodgett technique. Further, the QCdSe surface has been functionalized with specific DNA probe for CML detection. The probe DNA functionalized QCdSe integrated miniaturized system hasmore » been used to monitor target complementary DNA concentration by measuring the interfacial charge transfer resistance via hybridization. The presence of complementary DNA in buffer solution significantly results in decreased electro-conductivity of the interface due to presence of a charge barrier for transport of the redox probe ions. The microfluidic DNA biosensor exhibits improved linearity in the concentration range of 10{sup −15} M to 10{sup −11} M.« less

  14. CasA mediates Cas3-catalyzed target degradation during CRISPR RNA-guided interference.

    PubMed

    Hochstrasser, Megan L; Taylor, David W; Bhat, Prashant; Guegler, Chantal K; Sternberg, Samuel H; Nogales, Eva; Doudna, Jennifer A

    2014-05-06

    In bacteria, the clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas) DNA-targeting complex Cascade (CRISPR-associated complex for antiviral defense) uses CRISPR RNA (crRNA) guides to bind complementary DNA targets at sites adjacent to a trinucleotide signature sequence called the protospacer adjacent motif (PAM). The Cascade complex then recruits Cas3, a nuclease-helicase that catalyzes unwinding and cleavage of foreign double-stranded DNA (dsDNA) bearing a sequence matching that of the crRNA. Cascade comprises the CasA-E proteins and one crRNA, forming a structure that binds and unwinds dsDNA to form an R loop in which the target strand of the DNA base pairs with the 32-nt RNA guide sequence. Single-particle electron microscopy reconstructions of dsDNA-bound Cascade with and without Cas3 reveal that Cascade positions the PAM-proximal end of the DNA duplex at the CasA subunit and near the site of Cas3 association. The finding that the DNA target and Cas3 colocalize with CasA implicates this subunit in a key target-validation step during DNA interference. We show biochemically that base pairing of the PAM region is unnecessary for target binding but critical for Cas3-mediated degradation. In addition, the L1 loop of CasA, previously implicated in PAM recognition, is essential for Cas3 activation following target binding by Cascade. Together, these data show that the CasA subunit of Cascade functions as an essential partner of Cas3 by recognizing DNA target sites and positioning Cas3 adjacent to the PAM to ensure cleavage.

  15. Predicting oligonucleotide affinity to nucleic acid targets.

    PubMed Central

    Mathews, D H; Burkard, M E; Freier, S M; Wyatt, J R; Turner, D H

    1999-01-01

    A computer program, OligoWalk, is reported that predicts the equilibrium affinity of complementary DNA or RNA oligonucleotides to an RNA target. This program considers the predicted stability of the oligonucleotide-target helix and the competition with predicted secondary structure of both the target and the oligonucleotide. Both unimolecular and bimolecular oligonucleotide self structure are considered with a user-defined concentration. The application of OligoWalk is illustrated with three comparisons to experimental results drawn from the literature. PMID:10580474

  16. COMplementary Primer ASymmetric PCR (COMPAS-PCR) Applied to the Identification of Salmo salar, Salmo trutta and Their Hybrids

    PubMed Central

    2016-01-01

    Avoiding complementarity between primers when designing a PCR assay constitutes a central rule strongly anchored in the mind of the molecular scientist. 3’-complementarity will extend the primers during PCR elongation using one another as template, consequently disabling further possible involvement in traditional target amplification. However, a 5’-complementarity will leave the primers unchanged during PCR cycles, albeit sequestered to one another, therefore also suppressing target amplification. We show that 5’-complementarity between primers may be exploited in a new PCR method called COMplementary-Primer-Asymmetric (COMPAS)-PCR, using asymmetric primer concentrations to achieve target PCR amplification. Moreover, such a design may paradoxically reduce spurious non-target amplification by actively sequestering the limiting primer. The general principles were demonstrated using 5S rDNA direct repeats as target sequences to design a species-specific assay for identifying Salmo salar and Salmo trutta using almost fully complementary primers overlapping the same target sequence. Specificity was enhanced by using 3’-penultimate point mutations and the assay was further developed to enable identification of S. salar x S. trutta hybrids by High Resolution Melt analysis in a 35 min one-tube assay. This small paradigm shift, using highly complementary primers for PCR, should help develop robust assays that previously would not be considered. PMID:27783658

  17. Fluorescent carbon nanoparticle-based lateral flow biosensor for ultrasensitive detection of DNA.

    PubMed

    Takalkar, Sunitha; Baryeh, Kwaku; Liu, Guodong

    2017-12-15

    We report a fluorescent carbon nanoparticle (FCN)-based lateral flow biosensor for ultrasensitive detection of DNA. Fluorescent carbon nanoparticle with a diameter of around 15nm was used as a tag to label a detection DNA probe, which was complementary with the part of target DNA. A capture DNA probe was immobilized on the test zone of the lateral flow biosensor. Sandwich-type hybridization reactions among the FCN-labeled DNA probe, target DNA and capture DNA probe were performed on the lateral flow biosensor. In the presence of target DNA, FCNs were captured on the test zone of the biosensor and the fluorescent intensity of the captured FCNs was measured with a portable fluorescent reader. After systematic optimizations of experimental parameters (the components of running buffers, the concentration of detection DNA probe used in the preparation of FCN-DNA conjugates, the amount of FCN-DNA dispensed on the conjugate pad and the dispensing cycles of the capture DNA probes on the test-zone), the biosensor could detect a minimum concentration of 0.4 fM DNA. This study provides a rapid and low-cost approach for DNA detection with high sensitivity, showing great promise for clinical application and biomedical diagnosis. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Utilizing Intrinsic Properties of Polyaniline to Detect Nucleic Acid Hybridization through UV-Enhanced Electrostatic Interaction.

    PubMed

    Sengupta, Partha Pratim; Gloria, Jared N; Amato, Dahlia N; Amato, Douglas V; Patton, Derek L; Murali, Beddhu; Flynt, Alex S

    2015-10-12

    Detection of specific RNA or DNA molecules by hybridization to "probe" nucleic acids via complementary base-pairing is a powerful method for analysis of biological systems. Here we describe a strategy for transducing hybridization events through modulating intrinsic properties of the electroconductive polymer polyaniline (PANI). When DNA-based probes electrostatically interact with PANI, its fluorescence properties are increased, a phenomenon that can be enhanced by UV irradiation. Hybridization of target nucleic acids results in dissociation of probes causing PANI fluorescence to return to basal levels. By monitoring restoration of base PANI fluorescence as little as 10(-11) M (10 pM) of target oligonucleotides could be detected within 15 min of hybridization. Detection of complementary oligos was specific, with introduction of a single mismatch failing to form a target-probe duplex that would dissociate from PANI. Furthermore, this approach is robust and is capable of detecting specific RNAs in extracts from animals. This sensor system improves on previously reported strategies by transducing highly specific probe dissociation events through intrinsic properties of a conducting polymer without the need for additional labels.

  19. Inducible Alkylation of DNA by a Quinone Methide-Peptide Nucleic Acid Conjugate†

    PubMed Central

    Liu, Yang; Rokita, Steven E.

    2012-01-01

    The reversibility of alkylation by a quinone methide intermediate (QM) avoids the irreversible consumption that plagues most reagents based on covalent chemistry and allows for site specific reaction that is controlled by the thermodynamics rather than kinetics of target association. This characteristic was originally examined with an oligonucleotide QM conjugate but broad application depends on alternative derivatives that are compatible with a cellular environment. Now, a peptide nucleic acid (PNA) derivative has been constructed and shown to exhibit an equivalent ability to delivery the reactive QM in a controlled manner. This new conjugate demonstrates high selectivity for a complementary sequence of DNA even when challenged with an alternative sequence containing a single T/T mismatch. Alkylation of non-complementary sequences is only possible when a template strand is present to co-localize the conjugate and its target. For efficient alkylation in this example, a single-stranded region of the target is required adjacent to the QM conjugate. Most importantly, the intrastrand self adducts formed between the PNA and its attached QM remained active and reversible over more than eight days in aqueous solution prior to reaction with a chosen target added subsequently. PMID:22243337

  20. Quantification of differential gene expression by multiplexed targeted resequencing of cDNA

    PubMed Central

    Arts, Peer; van der Raadt, Jori; van Gestel, Sebastianus H.C.; Steehouwer, Marloes; Shendure, Jay; Hoischen, Alexander; Albers, Cornelis A.

    2017-01-01

    Whole-transcriptome or RNA sequencing (RNA-Seq) is a powerful and versatile tool for functional analysis of different types of RNA molecules, but sample reagent and sequencing cost can be prohibitive for hypothesis-driven studies where the aim is to quantify differential expression of a limited number of genes. Here we present an approach for quantification of differential mRNA expression by targeted resequencing of complementary DNA using single-molecule molecular inversion probes (cDNA-smMIPs) that enable highly multiplexed resequencing of cDNA target regions of ∼100 nucleotides and counting of individual molecules. We show that accurate estimates of differential expression can be obtained from molecule counts for hundreds of smMIPs per reaction and that smMIPs are also suitable for quantification of relative gene expression and allele-specific expression. Compared with low-coverage RNA-Seq and a hybridization-based targeted RNA-Seq method, cDNA-smMIPs are a cost-effective high-throughput tool for hypothesis-driven expression analysis in large numbers of genes (10 to 500) and samples (hundreds to thousands). PMID:28474677

  1. An Electrochemical DNA Microbiosensor Based on Succinimide-Modified Acrylic Microspheres

    PubMed Central

    Ulianas, Alizar; Heng, Lee Yook; Hanifah, Sharina Abu; Ling, Tan Ling

    2012-01-01

    An electrochemical microbiosensor for DNA has been fabricated based on new acrylic microspheres modified with reactive N-acryloxysuccinimide (NAS) functional groups. Hydrophobic poly(n-butylacrylate-N-acryloxysuccinimide) microspheres were synthesized in an emulsion form with a simple one-step photopolymerization technique. Aminated DNA probe was attached to the succinimde functional group of the acrylic microspheres via covalent bonding. The hybridization of the immobilized DNA probe with the complementary DNA was studied by differential pulse voltametry using anthraquninone-2-sulfonic acid monohydrate sodium salt (AQMS) as the electroactive hybridization label. The influences of many factors such as duration of DNA probe immobilization and hybridization, pH, type of ions, buffer concentrations, ionic strength, operational temperature and non-complementary DNA on the biosensor performance were evaluated. Under optimized conditions, the DNA microbiosensor demonstrated a linear response range to target DNA over a wide concentration range of 1.0 × 10−16 and 1.0 × 10−8 M with a lower limit of detection (LOD) of 9.46 × 10−17 M (R2 = 0.97). This DNA microbiosensor showed good reproducibility with 2.84% RSD (relative standard deviation) (n = 3). Application of the NAS-modified acrylic microspheres in the construction of DNA microbiosensor had improved the overall analytical performance of the resultant DNA microbiosensor when compared with other reported DNA biosensors using other nano-materials for membranes and microspheres as DNA immobilization matrices. PMID:22778594

  2. Magnetic porous carbon nanocomposites derived from metal-organic frameworks as a sensing platform for DNA fluorescent detection.

    PubMed

    Tan, Hongliang; Tang, Gonge; Wang, Zhixiong; Li, Qian; Gao, Jie; Wu, Shimeng

    2016-10-12

    Metal-organic frameworks (MOFs) have emerged as very fascinating functional materials due to their tunable nature and diverse applications. In this work, we prepared a magnetic porous carbon (MPC) nanocomposite by employing iron-containing MOFs (MIL-88A) as precursors through a one-pot thermolysis method. It was found that the MPC can absorb selectively single-stranded DNA (ssDNA) probe to form MPC/ssDNA complex and subsequently quench the labelled fluorescent dye of the ssDNA probe, which is resulted from the synergetic effect of magnetic nanoparticles and carbon matrix. Upon the addition of complementary target DNA, however, the absorbed ssDNA probe could be released from MPC surface by forming double-stranded DNA with target DNA, and accompanied by the recovery of the fluorescence of ssDNA probe. Based on these findings, a sensing platform with low background signal for DNA fluorescent detection was developed. The proposed sensing platform exhibits high sensitivity with detection limit of 1 nM and excellent selectivity to specific target DNA, even single-base mismatched nucleotide can be distinguished. We envision that the presented study would provide a new perspective on the potential applications of MOF-derived nanocomposites in biomedical fields. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. A type III-B CRISPR-Cas effector complex mediating massive target DNA destruction.

    PubMed

    Han, Wenyuan; Li, Yingjun; Deng, Ling; Feng, Mingxia; Peng, Wenfang; Hallstrøm, Søren; Zhang, Jing; Peng, Nan; Liang, Yun Xiang; White, Malcolm F; She, Qunxin

    2017-02-28

    The CRISPR (clustered regularly interspaced short palindromic repeats) system protects archaea and bacteria by eliminating nucleic acid invaders in a crRNA-guided manner. The Sulfolobus islandicus type III-B Cmr-α system targets invading nucleic acid at both RNA and DNA levels and DNA targeting relies on the directional transcription of the protospacer in vivo. To gain further insight into the involved mechanism, we purified a native effector complex of III-B Cmr-α from S. islandicus and characterized it in vitro. Cmr-α cleaved RNAs complementary to crRNA present in the complex and its ssDNA destruction activity was activated by target RNA. The ssDNA cleavage required mismatches between the 5΄-tag of crRNA and the 3΄-flanking region of target RNA. An invader plasmid assay showed that mutation either in the histidine-aspartate acid (HD) domain (a quadruple mutation) or in the GGDD motif of the Cmr-2α protein resulted in attenuation of the DNA interference in vivo. However, double mutation of the HD motif only abolished the DNase activity in vitro. Furthermore, the activated Cmr-α binary complex functioned as a highly active DNase to destroy a large excess DNA substrate, which could provide a powerful means to rapidly degrade replicating viral DNA. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. Colorimetric molecular diagnosis of the HIV gag gene using DNAzyme and a complementary DNA-extended primer.

    PubMed

    Kim, Seong U; Batule, Bhagwan S; Mun, Hyoyoung; Byun, Ju-Young; Shim, Won-Bo; Kim, Min-Gon

    2018-02-07

    We have developed a novel strategy for the colorimetric detection of PCR products by utilizing a target-specific primer modified at the 5'-end with an anti-DNAzyme sequence. A single-stranded DNAzyme sequence folds into a G-quadruplex structure with hemin and shows strong peroxidase activity. When the complementary strand binds to the DNAzyme sequence, it blocks the formation of the G-quadraduplex structure and loses its peroxidase activity. In the presence of the target gene, PCR amplification proceeds, and anti-DNAzyme sequence modified primers present in the reaction mixture form a double strand through primer extension. Therefore, it does not block the DNAzyme sequence. Further, a colorimetric signal is generated by the addition of 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonate) (ABTS) and H 2 O 2 at the end of the reaction. We have successfully detected a single copy of the HIV type 1 gag gene in buffer and 10 copies in human serum. The strategy developed could be used to detect DNA and RNA in complex biological samples by simple primer designing that includes DNAzyme and a DNA extended primer.

  5. A bimetallic nanocomposite modified genosensor for recognition and determination of thalassemia gene.

    PubMed

    Hamidi-Asl, Ezat; Raoof, Jahan Bakhsh; Naghizadeh, Nahid; Akhavan-Niaki, Haleh; Ojani, Reza; Banihashemi, Ali

    2016-10-01

    The main roles of DNA in the cells are to maintain and properly express genetic information. It is important to have analytical methods capable of fast and sensitive detection of DNA damage. DNA hybridization sensors are well suited for diagnostics and other purposes, including determination of bacteria and viruses. Beta thalassemias (βth) are due to mutations in the β-globin gene. In this study, an electrochemical biosensor which detects the sequences related to the β-globin gene issued from real samples amplified by polymerase chain reaction (PCR) is described for the first time. The biosensor relies on the immobilization of 20-mer single stranded oligonucleotide (probe) related to βth sequence on the carbon paste electrode (CPE) modified by 15% silver (Ag) and platinum (Pt) nanoparticles to prepare the bimetallic nanocomposite electrode and hybridization of this oligonucleotide with its complementary sequence (target). The extent of hybridization between the probe and target sequences was shown by using linear sweep voltammetry (LSV) with methylene blue (MB) as hybridization indicator. The selectivity of sensor was investigated using PCR samples containing non-complementary oligonucleotides. The detection limit of biosensor was calculated about 470.0pg/μL. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Construction Strategy for an Internal Amplification Control for Real-Time Diagnostic Assays Using Nucleic Acid Sequence-Based Amplification: Development and Clinical Application

    PubMed Central

    Rodríguez-Lázaro, David; D'Agostino, Martin; Pla, Maria; Cook, Nigel

    2004-01-01

    An important analytical control in molecular amplification-based methods is an internal amplification control (IAC), which should be included in each reaction mixture. An IAC is a nontarget nucleic acid sequence which is coamplified simultaneously with the target sequence. With negative results for the target nucleic acid, the absence of an IAC signal indicates that amplification has failed. A general strategy for the construction of an IAC for inclusion in molecular beacon-based real-time nucleic acid sequence-based amplification (NASBA) assays is presented. Construction proceeds in two phases. In the first phase, a double-stranded DNA molecule that contains nontarget sequences flanked by target sequences complementary to the NASBA primers is produced. At the 5′ end of this DNA molecule is a T7 RNA polymerase binding sequence. In the second phase of construction, RNA transcripts are produced from the DNA by T7 RNA polymerase. This RNA is the IAC; it is amplified by the target NASBA primers and is detected by a molecular beacon probe complementary to the internal nontarget sequences. As a practical example, an IAC for use in an assay for the detection of Mycobacterium avium subsp. paratuberculosis is described, its incorporation and optimization within the assay are detailed, and its application to spiked and natural clinical samples is shown to illustrate the correct interpretation of the diagnostic results. PMID:15583319

  7. Dysregulation of RNA Interference in Breast Cancer

    DTIC Science & Technology

    2007-07-01

    of miRNA complementary elements in 3-UTR of target mRNAs, the concentration in the seed (6–8 bp) of continuous Watson - Crick base pairing in the 5...treated the transfected cells with the anticancer drug topotecan (TPT) that is known to inhibit DNA topoisomerase I and cause DNA damage (Tanizawa et...as DNA damage caused by TPT, can increase the inhibitory effect mediated by R el at iv e C el l G ro w th R el at iv e C el l G ro w th Negative

  8. Characterisation of cytoplasmic DNA complementary to non-retroviral RNA viruses in human cells

    PubMed Central

    Shimizu, Akira; Nakatani, Yoko; Nakamura, Takako; Jinno-Oue, Atsushi; Ishikawa, Osamu; Boeke, Jef D.; Takeuchi, Yasuhiro; Hoshino, Hiroo

    2014-01-01

    The synthesis and subsequent genomic integration of DNA that is complementary to the genomes of non-retroviral RNA viruses are rarely observed. However, upon infection of various human cell lines and primary fibroblasts with the vesicular stomatitis virus (VSV), we detected DNA complementary to the VSV RNA. The VSV DNA was detected in the cytoplasm as single-stranded DNA fully complementary to the viral mRNA from the poly(A) region to the 7-methyl guanosine cap. The formation of this DNA was cell-dependent. Experimentally, we found that the transduction of cells that do not produce VSV DNA with the long interspersed nuclear element 1 and their infection with VSV could lead to the formation of VSV DNA. Viral DNA complementary to other RNA viruses was also detected in the respective infected human cells. Thus, the genetic information of the non-retroviral RNA virus genome can flow into the DNA of mammalian cells expressing LINE-1-like elements. PMID:24875540

  9. What Hinders Electron Transfer Dissociation (ETD) of DNA Cations?

    NASA Astrophysics Data System (ADS)

    Hari, Yvonne; Leumann, Christian J.; Schürch, Stefan

    2017-12-01

    Radical activation methods, such as electron transfer dissociation (ETD), produce structural information complementary to collision-induced dissociation. Herein, electron transfer dissociation of 3-fold protonated DNA hexamers was studied to gain insight into the fragmentation mechanism. The fragmentation patterns of a large set of DNA hexamers confirm cytosine as the primary target of electron transfer. The reported data reveal backbone cleavage by internal electron transfer from the nucleobase to the phosphate linker leading either to a•/ w or d/ z• ion pairs. This reaction pathway contrasts with previous findings on the dissociation processes after electron capture by DNA cations, suggesting multiple, parallel dissociation channels. However, all these channels merely result in partial fragmentation of the precursor ion because the charge-reduced DNA radical cations are quite stable. Two hypotheses are put forward to explain the low dissociation yield of DNA radical cations: it is either attributed to non-covalent interactions between complementary fragments or to the stabilization of the unpaired electron in stacked nucleobases. MS3 experiments suggest that the charge-reduced species is the intact oligonucleotide. Moreover, introducing abasic sites significantly increases the dissociation yield of DNA cations. Consequently, the stabilization of the unpaired electron by π-π-stacking provides an appropriate rationale for the high intensity of DNA radical cations after electron transfer. [Figure not available: see fulltext.

  10. A label-free, PCR-free and signal-on electrochemical DNA biosensor for Leishmania major based on gold nanoleaves.

    PubMed

    Moradi, M; Sattarahmady, N; Rahi, A; Hatam, G R; Sorkhabadi, S M Rezayat; Heli, H

    2016-12-01

    Detection of leishmaniasis is important in clinical diagnoses. In the present study, identification of Leishmania parasites was performed by a label-free, PCR-free and signal-on ultrasensitive electrochemical DNA biosensor. Gold nanoleaves were firstly electrodeposited by an electrodeposition method using spermidine as a shape directing agent. The biosensor was fabricated by immobilization of a Leishmania major specific DNA probe onto gold nanoleaves, and methylene blue was employed as a marker. Hybridization of the complementary single stranded DNA sequence with the biosensor under the selected conditions was then investigated. The biosensor could detect a synthetic DNA target in a range of 1.0×10 -10 to 1.0×10 -19 molL -1 with a limit of detection of 1.8×10 -20 molL -1 , and genomic DNA in a range of 0.5-20ngμL -1 with a limit of detection of 0.07ngμL -1 . The biosensor could distinguish Leishmania major from a non-complementary-sequence oligonucleotide and the tropica species with a high selectivity. The biosensor was applicable to detect Leishmania major in patient samples. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. Fabrication and characterization of high-K dielectric integrated silicon nanowire sensor for DNA sensing application (Conference Presentation)

    NASA Astrophysics Data System (ADS)

    Jayakumar, Ganesh; Legallais, Maxime; Hellström, Per-Erik; Mouis, Mireille; Stambouli, Valérie; Ternon, Céline; Östling, Mikael

    2016-09-01

    1D silicon nanowires (SiNW) are attractive for charge based DNA sensing applications due to their small size and large surface to volume ratio. An ideal portable biosensor is expected to have repeatable and reliable sensitivity, selectivity, low production cost and small feature size. Instead of using tools such as e-beam that are capital and time intensive, we propose a low cost CMOS self-aligned-double-patterning I-line lithography process to fabricate 60 nm wide SiNW. DNA probes are grafted on a thin dielectric layer that is deposited on top of the SiNW surface. Here we used HfO2 instead of the usual SiO2. Indeed, compared to SiO2, HfO2 has been reported to have higher amount of OH groups on its surface leading to enhanced signal quality. We also report preliminary biosensor characterizations. After HfO2 functionalization and single-stranded DNA probe grafting onto the SiNWs, the sensors were first put in contact with fluorophore labelled complementary DNA targets in order to test the efficiency of DNA hybridization optically. Then, a sequence of hybridization, de-hybridization and re-hybridization steps was followed by Id-Vg measurements in order to measure the electrical response of the sensors to target DNA as well as recycling capability. After each step, SiNW devices exhibited a threshold voltage shift larger than device-to-device dispersion, showing that both complementary DNA hybridization and de-hybridization can be electrically detected. These results are very encouraging as they open new frontiers for heterogeneous integration of liquid interacting array of nano sensors with CMOS circuits to fabricate a complete lab on chip.

  12. Fluorescence bio-barcode DNA assay based on gold and magnetic nanoparticles for detection of Exotoxin A gene sequence.

    PubMed

    Amini, Bahram; Kamali, Mehdi; Salouti, Mojtaba; Yaghmaei, Parichehreh

    2017-06-15

    Bio-barcode DNA based on gold nanoparticle (bDNA-GNPs) as a new generation of biosensor based detection tools, holds promise for biological science studies. They are of enormous importance in the emergence of rapid and sensitive procedures for detecting toxins of microorganisms. Exotoxin A (ETA) is the most toxic virulence factor of Pseudomonas aeruginosa. ETA has ADP-ribosylation activity and decisively affects the protein synthesis of the host cells. In the present study, we developed a fluorescence bio-barcode technology to trace P. aeruginosa ETA. The GNPs were coated with the first target-specific DNA probe 1 (1pDNA) and bio-barcode DNA, which acted as a signal reporter. The magnetic nanoparticles (MNPs) were coated with the second target-specific DNA probe 2 (2pDNA) that was able to recognize the other end of the target DNA. After binding the nanoparticles with the target DNA, the following sandwich structure was formed: MNP 2pDNA/tDNA/1pDNA-GNP-bDNA. After isolating the sandwiches by a magnetic field, the DNAs of the probes which have been hybridized to their complementary DNA, GNPs and MNPs, via the hydrogen, electrostatic and covalently bonds, were released from the sandwiches after dissolving in dithiothreitol solution (DTT 0.8M). This bio-barcode DNA with known DNA sequence was then detected by fluorescence spectrophotometry. The findings showed that the new method has the advantages of fast, high sensitivity (the detection limit was 1.2ng/ml), good selectivity, and wide linear range of 5-200ng/ml. The regression analysis also showed that there was a good linear relationship (∆F=0.57 [target DNA]+21.31, R 2 =0.9984) between the fluorescent intensity and the target DNA concentration in the samples. Copyright © 2016. Published by Elsevier B.V.

  13. Toward a General Approach for RNA-Templated Hierarchical Assembly of Split-Proteins

    PubMed Central

    Furman, Jennifer L.; Badran, Ahmed H.; Ajulo, Oluyomi; Porter, Jason R.; Stains, Cliff I.; Segal, David J.; Ghosh, Indraneel

    2010-01-01

    The ability to conditionally turn on a signal or induce a function in the presence of a user-defined RNA target has potential applications in medicine and synthetic biology. Although sequence-specific pumilio repeat proteins can target a limited set of ssRNA sequences, there are no general methods for targeting ssRNA with designed proteins. As a first step toward RNA recognition, we utilized the RNA binding domain of argonaute, implicated in RNA interference, for specifically targeting generic 2-nucleotide, 3' overhangs of any dsRNA. We tested the reassembly of a split-luciferase enzyme guided by argonaute-mediated recognition of newly generated nucleotide overhangs when ssRNA is targeted by a designed complementary guide sequence. This approach was successful when argonaute was utilized in conjunction with a pumilio repeat and expanded the scope of potential ssRNA targets. However, targeting any desired ssRNA remained elusive as two argonaute domains provided minimal reassembled split-luciferase. We next designed and tested a second hierarchical assembly, wherein ssDNA guides are appended to DNA hairpins that serve as a scaffold for high affinity zinc fingers attached to split-luciferase. In the presence of a ssRNA target containing adjacent sequences complementary to the guides, the hairpins are brought into proximity, allowing for zinc finger binding and concomitant reassembly of the fragmented luciferase. The scope of this new approach was validated by specifically targeting RNA encoding VEGF, hDM2, and HER2. These approaches provide potentially general design paradigms for the conditional reassembly of fragmented proteins in the presence of any desired ssRNA target. PMID:20681585

  14. Secondary structure prediction and structure-specific sequence analysis of single-stranded DNA.

    PubMed

    Dong, F; Allawi, H T; Anderson, T; Neri, B P; Lyamichev, V I

    2001-08-01

    DNA sequence analysis by oligonucleotide binding is often affected by interference with the secondary structure of the target DNA. Here we describe an approach that improves DNA secondary structure prediction by combining enzymatic probing of DNA by structure-specific 5'-nucleases with an energy minimization algorithm that utilizes the 5'-nuclease cleavage sites as constraints. The method can identify structural differences between two DNA molecules caused by minor sequence variations such as a single nucleotide mutation. It also demonstrates the existence of long-range interactions between DNA regions separated by >300 nt and the formation of multiple alternative structures by a 244 nt DNA molecule. The differences in the secondary structure of DNA molecules revealed by 5'-nuclease probing were used to design structure-specific probes for mutation discrimination that target the regions of structural, rather than sequence, differences. We also demonstrate the performance of structure-specific 'bridge' probes complementary to non-contiguous regions of the target molecule. The structure-specific probes do not require the high stringency binding conditions necessary for methods based on mismatch formation and permit mutation detection at temperatures from 4 to 37 degrees C. Structure-specific sequence analysis is applied for mutation detection in the Mycobacterium tuberculosis katG gene and for genotyping of the hepatitis C virus.

  15. Recent Advances in Aptamers Targeting Immune System.

    PubMed

    Hu, Piao-Ping

    2017-02-01

    The immune system plays important role in protecting the organism by recognizing non-self molecules from pathogen such as bacteria, parasitic worms, and viruses. When the balance of the host defense system is disturbed, immunodeficiency, autoimmunity, and inflammation occur. Nucleic acid aptamers are short single-stranded DNA (ssDNA) or RNA ligands that interact with complementary molecules with high specificity and affinity. Aptamers that target the molecules involved in immune system to modulate their function have great potential to be explored as new diagnostic and therapeutic agents for immune disorders. This review summarizes recent advances in the development of aptamers targeting immune system. The selection of aptamers with superior chemical and biological characteristics will facilitate their application in the diagnosis and treatment of immune disorders.

  16. The utilization of SiNWs/AuNPs-modified indium tin oxide (ITO) in fabrication of electrochemical DNA sensor.

    PubMed

    Rashid, Jahwarhar Izuan Abdul; Yusof, Nor Azah; Abdullah, Jaafar; Hashim, Uda; Hajian, Reza

    2014-12-01

    This work describes the incorporation of SiNWs/AuNPs composite as a sensing material for DNA detection on indium tin-oxide (ITO) coated glass slide. The morphology of SiNWs/AuNPs composite as the modifier layer on ITO was studied by scanning electron microscopy (SEM) and energy dispersive X-ray spectroscopy (EDX). The morphological studies clearly showed that SiNWs were successfully decorated with 20 nm-AuNPs using self-assembly monolayer (SAM) technique. The effective surface area for SiNWs/AuNPs-modified ITO enhanced about 10 times compared with bare ITO electrode. SiNWs/AuNPs nanocomposite was further explored as a matrix for DNA probe immobilization in detection of dengue virus as a bio-sensing model to evaluate its performance in electrochemical sensors. The hybridization of complementary DNA was monitored by differential pulse voltammetry (DPV) using methylene blue (MB) as the redox indicator. The fabricated biosensor was able to discriminate significantly complementary, non-complementary and single-base mismatch oligonucleotides. The electrochemical biosensor was sensitive to target DNA related to dengue virus in the range of 9.0-178.0 ng/ml with detection limit of 3.5 ng/ml. In addition, SiNWs/AuNPs-modified ITO, regenerated up to 8 times and its stability was up to 10 weeks at 4°C in silica gel. Copyright © 2014 Elsevier B.V. All rights reserved.

  17. Detection of DNA hybridization by ABEI electrochemiluminescence in DNA-chip compatible assembly.

    PubMed

    Calvo-Muñoz, M-L; Dupont-Filliard, A; Billon, M; Guillerez, S; Bidan, G; Marquette, C; Blum, L

    2005-04-01

    The electrochemiluminescence (ECL) of a luminol derivate (ABEI) generated both by a carbon electrode and a polypyrrole-coated carbon electrode was examined. It was found that the polypyrrole film (ppy) did not inhibit the ECL. After that, ABEI anchored on a single stranded DNA target (ODNt) has been used for the ECL detection of the hybridization between a complementary single stranded DNA probe (ODNp) covalently linked to a polypyrrole support and the ODNt. The ECL detection has been performed using a DNA sensor having a low surface concentration of ODNp probes, constituted of a polypyrrole copolymer electrosynthesized from a pyrrole-ODNp/pyrrole monomer ratio of 1/20,000.

  18. Capture-SELEX: Selection of DNA Aptamers for Aminoglycoside Antibiotics

    PubMed Central

    2012-01-01

    Small organic molecules are challenging targets for an aptamer selection using the SELEX technology (SELEX—Systematic Evolution of Ligans by EXponential enrichment). Often they are not suitable for immobilization on solid surfaces, which is a common procedure in known aptamer selection methods. The Capture-SELEX procedure allows the selection of DNA aptamers for solute targets. A special SELEX library was constructed with the aim to immobilize this library on magnetic beads or other surfaces. For this purpose a docking sequence was incorporated into the random region of the library enabling hybridization to a complementary oligo fixed on magnetic beads. Oligonucleotides of the library which exhibit high affinity to the target and a secondary structure fitting to the target are released from the beads for binding to the target during the aptamer selection process. The oligonucleotides of these binding complexes were amplified, purified, and immobilized via the docking sequence to the magnetic beads as the starting point of the following selection round. Based on this Capture-SELEX procedure, the successful DNA aptamer selection for the aminoglycoside antibiotic kanamycin A as a small molecule target is described. PMID:23326761

  19. Electrochemical product detection of an asymmetric convective polymerase chain reaction.

    PubMed

    Duwensee, Heiko; Mix, Maren; Stubbe, Marco; Gimsa, Jan; Adler, Marcel; Flechsig, Gerd-Uwe

    2009-10-15

    For the first time, we describe the application of heated microwires for an asymmetric convective polymerase chain reaction (PCR) in a modified PCR tube in a small volume. The partly single-stranded product was labeled with the electrochemically active compound osmium tetroxide bipyridine using a partially complementary protective strand with five mismatches compared to the single-stranded product. The labeled product could be successfully detected at a gold electrode modified with a complementary single-stranded capture probe immobilized via a thiol-linker. Our simple thermo-convective PCR yielded electrochemically detectable products after only 5-10 min. A significant discrimination between complementary and non-complementary target was possible using different immobilized capture probes. The total product yield was approx. half the amount of the classical thermocycler PCR. Numerical simulations describing the thermally driven convective PCR explain the received data. Discrimination between complementary capture probes and non-complementary capture probes was performed using square-wave voltammetry. The coupling of asymmetric thermo-convective PCR with electrochemical detection is very promising for future compact DNA sensor devices.

  20. Streptavidin-coated magnetic beads for DNA strand separation implicate a multitude of problems during cell-SELEX.

    PubMed

    Paul, Angela; Avci-Adali, Meltem; Ziemer, Gerhard; Wendel, Hans P

    2009-09-01

    Using whole living cells as a target for SELEX (systematic evolution of ligands by exponential enrichment) experiments represents a promising method to generate cell receptor-specific aptamers. These aptamers have a huge potential in diagnostics, therapeutics, imaging, regenerative medicine, and target validation. During the SELEX for selecting DNA aptamers, one important step is the separation of 2 DNA strands to yield one of the 2 strands as single-stranded DNA aptamer. This is being done routinely by biotin labeling of the complementary DNA strand to the desired aptamer and then separating the DNA strand by using streptavidin-coated magnetic beads. After immobilization of the double-stranded DNA on these magnetic beads and alkaline denaturation, the non-biotinylated strand is being eluted and the biotinylated strand is retarded. Using Western blot analysis, we demonstrated the detachment of covalent-bonded streptavidin from the bead surface after alkaline treatment. The eluates were also contaminated with undesired biotinylated strands. Furthermore, a streptavidin-induced aggregation of target cells was demonstrated by flow cytometry and microscopic methods. Cell-specific enrichment of aptamers was not possible due to clustering and patching effects triggered by streptavidin. Therefore, the use of streptavidin-coated magnetic beads for DNA strand separation should be examined thoroughly, especially for cell-SELEX applications.

  1. Individual sequences in large sets of gene sequences may be distinguished efficiently by combinations of shared sub-sequences

    PubMed Central

    Gibbs, Mark J; Armstrong, John S; Gibbs, Adrian J

    2005-01-01

    Background Most current DNA diagnostic tests for identifying organisms use specific oligonucleotide probes that are complementary in sequence to, and hence only hybridise with the DNA of one target species. By contrast, in traditional taxonomy, specimens are usually identified by 'dichotomous keys' that use combinations of characters shared by different members of the target set. Using one specific character for each target is the least efficient strategy for identification. Using combinations of shared bisectionally-distributed characters is much more efficient, and this strategy is most efficient when they separate the targets in a progressively binary way. Results We have developed a practical method for finding minimal sets of sub-sequences that identify individual sequences, and could be targeted by combinations of probes, so that the efficient strategy of traditional taxonomic identification could be used in DNA diagnosis. The sizes of minimal sub-sequence sets depended mostly on sequence diversity and sub-sequence length and interactions between these parameters. We found that 201 distinct cytochrome oxidase subunit-1 (CO1) genes from moths (Lepidoptera) were distinguished using only 15 sub-sequences 20 nucleotides long, whereas only 8–10 sub-sequences 6–10 nucleotides long were required to distinguish the CO1 genes of 92 species from the 9 largest orders of insects. Conclusion The presence/absence of sub-sequences in a set of gene sequences can be used like the questions in a traditional dichotomous taxonomic key; hybridisation probes complementary to such sub-sequences should provide a very efficient means for identifying individual species, subtypes or genotypes. Sequence diversity and sub-sequence length are the major factors that determine the numbers of distinguishing sub-sequences in any set of sequences. PMID:15817134

  2. DNA recognition by an RNA-guided bacterial Argonaute

    PubMed Central

    Doudna, Jennifer A.

    2017-01-01

    Argonaute (Ago) proteins are widespread in prokaryotes and eukaryotes and share a four-domain architecture capable of RNA- or DNA-guided nucleic acid recognition. Previous studies identified a prokaryotic Argonaute protein from the eubacterium Marinitoga piezophila (MpAgo), which binds preferentially to 5′-hydroxylated guide RNAs and cleaves single-stranded RNA (ssRNA) and DNA (ssDNA) targets. Here we present a 3.2 Å resolution crystal structure of MpAgo bound to a 21-nucleotide RNA guide and a complementary 21-nucleotide ssDNA substrate. Comparison of this ternary complex to other target-bound Argonaute structures reveals a unique orientation of the N-terminal domain, resulting in a straight helical axis of the entire RNA-DNA heteroduplex through the central cleft of the protein. Additionally, mismatches introduced into the heteroduplex reduce MpAgo cleavage efficiency with a symmetric profile centered around the middle of the helix. This pattern differs from the canonical mismatch tolerance of other Argonautes, which display decreased cleavage efficiency for substrates bearing sequence mismatches to the 5′ region of the guide strand. This structural analysis of MpAgo bound to a hybrid helix advances our understanding of the diversity of target recognition mechanisms by Argonaute proteins. PMID:28520746

  3. Cytotoxic Chromosomal Targeting by CRISPR/Cas Systems Can Reshape Bacterial Genomes and Expel or Remodel Pathogenicity Islands

    PubMed Central

    Vercoe, Reuben B.; Chang, James T.; Dy, Ron L.; Taylor, Corinda; Gristwood, Tamzin; Clulow, James S.; Richter, Corinna; Przybilski, Rita; Pitman, Andrew R.; Fineran, Peter C.

    2013-01-01

    In prokaryotes, clustered regularly interspaced short palindromic repeats (CRISPRs) and their associated (Cas) proteins constitute a defence system against bacteriophages and plasmids. CRISPR/Cas systems acquire short spacer sequences from foreign genetic elements and incorporate these into their CRISPR arrays, generating a memory of past invaders. Defence is provided by short non-coding RNAs that guide Cas proteins to cleave complementary nucleic acids. While most spacers are acquired from phages and plasmids, there are examples of spacers that match genes elsewhere in the host bacterial chromosome. In Pectobacterium atrosepticum the type I-F CRISPR/Cas system has acquired a self-complementary spacer that perfectly matches a protospacer target in a horizontally acquired island (HAI2) involved in plant pathogenicity. Given the paucity of experimental data about CRISPR/Cas–mediated chromosomal targeting, we examined this process by developing a tightly controlled system. Chromosomal targeting was highly toxic via targeting of DNA and resulted in growth inhibition and cellular filamentation. The toxic phenotype was avoided by mutations in the cas operon, the CRISPR repeats, the protospacer target, and protospacer-adjacent motif (PAM) beside the target. Indeed, the natural self-targeting spacer was non-toxic due to a single nucleotide mutation adjacent to the target in the PAM sequence. Furthermore, we show that chromosomal targeting can result in large-scale genomic alterations, including the remodelling or deletion of entire pre-existing pathogenicity islands. These features can be engineered for the targeted deletion of large regions of bacterial chromosomes. In conclusion, in DNA–targeting CRISPR/Cas systems, chromosomal interference is deleterious by causing DNA damage and providing a strong selective pressure for genome alterations, which may have consequences for bacterial evolution and pathogenicity. PMID:23637624

  4. The role of differing probe and target strand lengths in DNA microarrays investigated via Monte Carlo molecular simulation

    NASA Astrophysics Data System (ADS)

    Rivard, Brea R.; Cooper, Sarah J.; Stubbs, John M.

    2018-02-01

    DNA duplexes consisting of a 25mer together with shorter complementary sequences were studied over a range of temperature and surface binding motifs using a coarse-grained two-site nucleotide model. Results were analyzed in terms of hydrogen bonding interactions and structural characteristics and indicate that hybridization is most stable when furthest from the surface binding site. Strand elongation and straightening near the bound end are found to be correlated to duplex destabilization.

  5. RNA-primed complementary-sense DNA synthesis of the geminivirus African cassava mosaic virus.

    PubMed Central

    Saunders, K; Lucy, A; Stanley, J

    1992-01-01

    The plant DNA virus African cassava mosaic virus (ACMV) is believed to replicate by a rolling circle mechanism. To investigate complementary-sense DNA (lagging strand) synthesis, we have analysed the heterogenous form of complementary-sense DNA (H3 DNA) from infected Nicotiana benthamiana by two-dimensional agarose gel electrophoresis and blot hybridisation. The presence of an RNA moeity is demonstrated by comparison of results for nucleic acids resolved on neutral/alkaline and neutral/formamide gels, suggesting that complementary-sense DNA synthesis on the virus-sense single-stranded DNA template is preceded by the synthesis of an RNA primer. Hybridisation with probes to specific parts of ACMV DNA A genome indicates that synthesis of the putative RNA primer initiates between nucleotides 2581-221, a region that includes intergenic sequences that have been implicated in geminivirus DNA replication and the control of gene expression. Images PMID:1475192

  6. Structure and Engineering of Francisella novicida Cas9

    PubMed Central

    Hirano, Hisato; Gootenberg, Jonathan S.; Horii, Takuro; Abudayyeh, Omar O.; Kimura, Mika; Hsu, Patrick D.; Nakane, Takanori; Ishitani, Ryuichiro; Hatada, Izuho; Zhang, Feng; Nishimasu, Hiroshi; Nureki, Osamu

    2016-01-01

    Summary The RNA-guided endonuclease Cas9 cleaves double-stranded DNA targets complementary to the guide RNA, and has been applied to programmable genome editing. Cas9-mediated cleavage requires a protospacer adjacent motif (PAM) juxtaposed with the DNA target sequence, thus constricting the range of targetable sites. Here, we report the 1.7 Å resolution crystal structures of Cas9 from Francisella novicida (FnCas9), one of the largest Cas9 orthologs, in complex with a guide RNA and its PAM-containing DNA targets. A structural comparison of FnCas9 with other Cas9 orthologs revealed striking conserved and divergent features among distantly related CRISPR-Cas9 systems. We found that FnCas9 recognizes the 5′-NGG-3′ PAM, and used the structural information to create a variant that can recognize the more relaxed 5′-YG-3′ PAM. Furthermore, we demonstrated that pre-assembled FnCas9 ribonucleoprotein complexes can be microinjected into mouse zygotes to edit endogenous sites with the 5′-YG-3′ PAMs, thus expanding the target space of the CRISPR-Cas9 toolbox. PMID:26875867

  7. Programmable RNA Cleavage and Recognition by a Natural CRISPR-Cas9 System from Neisseria meningitidis.

    PubMed

    Rousseau, Beth A; Hou, Zhonggang; Gramelspacher, Max J; Zhang, Yan

    2018-03-01

    The microbial CRISPR systems enable adaptive defense against mobile elements and also provide formidable tools for genome engineering. The Cas9 proteins are type II CRISPR-associated, RNA-guided DNA endonucleases that identify double-stranded DNA targets by sequence complementarity and protospacer adjacent motif (PAM) recognition. Here we report that the type II-C CRISPR-Cas9 from Neisseria meningitidis (Nme) is capable of programmable, RNA-guided, site-specific cleavage and recognition of single-stranded RNA targets and that this ribonuclease activity is independent of the PAM sequence. We define the mechanistic feature and specificity constraint for RNA cleavage by NmeCas9 and also show that nuclease null dNmeCas9 binds to RNA target complementary to CRISPR RNA. Finally, we demonstrate that NmeCas9-catalyzed RNA cleavage can be blocked by three families of type II-C anti-CRISPR proteins. These results fundamentally expand the targeting capacities of CRISPR-Cas9 and highlight the potential utility of NmeCas9 as a single platform to target both RNA and DNA. Copyright © 2018 Elsevier Inc. All rights reserved.

  8. Structure and Engineering of Francisella novicida Cas9.

    PubMed

    Hirano, Hisato; Gootenberg, Jonathan S; Horii, Takuro; Abudayyeh, Omar O; Kimura, Mika; Hsu, Patrick D; Nakane, Takanori; Ishitani, Ryuichiro; Hatada, Izuho; Zhang, Feng; Nishimasu, Hiroshi; Nureki, Osamu

    2016-02-25

    The RNA-guided endonuclease Cas9 cleaves double-stranded DNA targets complementary to the guide RNA and has been applied to programmable genome editing. Cas9-mediated cleavage requires a protospacer adjacent motif (PAM) juxtaposed with the DNA target sequence, thus constricting the range of targetable sites. Here, we report the 1.7 Å resolution crystal structures of Cas9 from Francisella novicida (FnCas9), one of the largest Cas9 orthologs, in complex with a guide RNA and its PAM-containing DNA targets. A structural comparison of FnCas9 with other Cas9 orthologs revealed striking conserved and divergent features among distantly related CRISPR-Cas9 systems. We found that FnCas9 recognizes the 5'-NGG-3' PAM, and used the structural information to create a variant that can recognize the more relaxed 5'-YG-3' PAM. Furthermore, we demonstrated that the FnCas9-ribonucleoprotein complex can be microinjected into mouse zygotes to edit endogenous sites with the 5'-YG-3' PAM, thus expanding the target space of the CRISPR-Cas9 toolbox. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. Microfluidic Arrayed Lab-On-A-Chip for Electrochemical Capacitive Detection of DNA Hybridization Events.

    PubMed

    Ben-Yoav, Hadar; Dykstra, Peter H; Bentley, William E; Ghodssi, Reza

    2017-01-01

    A microfluidic electrochemical lab-on-a-chip (LOC) device for DNA hybridization detection has been developed. The device comprises a 3 × 3 array of microelectrodes integrated with a dual layer microfluidic valved manipulation system that provides controlled and automated capabilities for high throughput analysis of microliter volume samples. The surface of the microelectrodes is functionalized with single-stranded DNA (ssDNA) probes which enable specific detection of complementary ssDNA targets. These targets are detected by a capacitive technique which measures dielectric variation at the microelectrode-electrolyte interface due to DNA hybridization events. A quantitative analysis of the hybridization events is carried out based on a sensing modeling that includes detailed analysis of energy storage and dissipation components. By calculating these components during hybridization events the device is able to demonstrate specific and dose response sensing characteristics. The developed microfluidic LOC for DNA hybridization detection offers a technology for real-time and label-free assessment of genetic markers outside of laboratory settings, such as at the point-of-care or in-field environmental monitoring.

  10. The CRISPR RNA-guided surveillance complex in Escherichia coli accommodates extended RNA spacers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Luo, Michelle L.; Jackson, Ryan N.; Denny, Steven R.

    Bacteria and archaea acquire resistance to foreign genetic elements by integrating fragments of foreign DNA into CRISPR (clustered regularly interspaced short palindromic repeats) loci. In Escherichia coli, CRISPR-derived RNAs (crRNAs) assemble with Cas proteins into a multi-subunit surveillance complex called Cascade (CRISPR-associated complex for antiviral defense). Cascade recognizes DNA targets via protein-mediated recognition of a protospacer adjacent motif and complementary base pairing between the crRNA spacer and the DNA target. Previously determined structures of Cascade showed that the crRNA is stretched along an oligomeric protein assembly, leading us to ask how crRNA length impacts the assembly and function of thismore » complex. We found that extending the spacer portion of the crRNA resulted in larger Cascade complexes with altered stoichiometry and preserved in vitro binding affinity for target DNA. Longer spacers also preserved the in vivo ability of Cascade to repress target gene expression and to recruit the Cas3 endonuclease for target degradation. Lastly, longer spacers exhibited enhanced silencing at particular target locations and were sensitive to mismatches within the extended region. These findings demonstrate the flexibility of the Type I-E CRISPR machinery and suggest that spacer length can be modified to fine-tune Cascade activity.« less

  11. The CRISPR RNA-guided surveillance complex in Escherichia coli accommodates extended RNA spacers

    DOE PAGES

    Luo, Michelle L.; Jackson, Ryan N.; Denny, Steven R.; ...

    2016-05-12

    Bacteria and archaea acquire resistance to foreign genetic elements by integrating fragments of foreign DNA into CRISPR (clustered regularly interspaced short palindromic repeats) loci. In Escherichia coli, CRISPR-derived RNAs (crRNAs) assemble with Cas proteins into a multi-subunit surveillance complex called Cascade (CRISPR-associated complex for antiviral defense). Cascade recognizes DNA targets via protein-mediated recognition of a protospacer adjacent motif and complementary base pairing between the crRNA spacer and the DNA target. Previously determined structures of Cascade showed that the crRNA is stretched along an oligomeric protein assembly, leading us to ask how crRNA length impacts the assembly and function of thismore » complex. We found that extending the spacer portion of the crRNA resulted in larger Cascade complexes with altered stoichiometry and preserved in vitro binding affinity for target DNA. Longer spacers also preserved the in vivo ability of Cascade to repress target gene expression and to recruit the Cas3 endonuclease for target degradation. Lastly, longer spacers exhibited enhanced silencing at particular target locations and were sensitive to mismatches within the extended region. These findings demonstrate the flexibility of the Type I-E CRISPR machinery and suggest that spacer length can be modified to fine-tune Cascade activity.« less

  12. Real-space and real-time dynamics of CRISPR-Cas9 visualized by high-speed atomic force microscopy.

    PubMed

    Shibata, Mikihiro; Nishimasu, Hiroshi; Kodera, Noriyuki; Hirano, Seiichi; Ando, Toshio; Uchihashi, Takayuki; Nureki, Osamu

    2017-11-10

    The CRISPR-associated endonuclease Cas9 binds to a guide RNA and cleaves double-stranded DNA with a sequence complementary to the RNA guide. The Cas9-RNA system has been harnessed for numerous applications, such as genome editing. Here we use high-speed atomic force microscopy (HS-AFM) to visualize the real-space and real-time dynamics of CRISPR-Cas9 in action. HS-AFM movies indicate that, whereas apo-Cas9 adopts unexpected flexible conformations, Cas9-RNA forms a stable bilobed structure and interrogates target sites on the DNA by three-dimensional diffusion. These movies also provide real-time visualization of the Cas9-mediated DNA cleavage process. Notably, the Cas9 HNH nuclease domain fluctuates upon DNA binding, and subsequently adopts an active conformation, where the HNH active site is docked at the cleavage site in the target DNA. Collectively, our HS-AFM data extend our understanding of the action mechanism of CRISPR-Cas9.

  13. Drugging the Cancers Addicted to DNA Repair.

    PubMed

    Nickoloff, Jac A; Jones, Dennie; Lee, Suk-Hee; Williamson, Elizabeth A; Hromas, Robert

    2017-11-01

    Defects in DNA repair can result in oncogenic genomic instability. Cancers occurring from DNA repair defects were once thought to be limited to rare inherited mutations (such as BRCA1 or 2). It now appears that a clinically significant fraction of cancers have acquired DNA repair defects. DNA repair pathways operate in related networks, and cancers arising from loss of one DNA repair component typically become addicted to other repair pathways to survive and proliferate. Drug inhibition of the rescue repair pathway prevents the repair-deficient cancer cell from replicating, causing apoptosis (termed synthetic lethality). However, the selective pressure of inhibiting the rescue repair pathway can generate further mutations that confer resistance to the synthetic lethal drugs. Many such drugs currently in clinical use inhibit PARP1, a repair component to which cancers arising from inherited BRCA1 or 2 mutations become addicted. It is now clear that drugs inducing synthetic lethality may also be therapeutic in cancers with acquired DNA repair defects, which would markedly broaden their applicability beyond treatment of cancers with inherited DNA repair defects. Here we review how each DNA repair pathway can be attacked therapeutically and evaluate DNA repair components as potential drug targets to induce synthetic lethality. Clinical use of drugs targeting DNA repair will markedly increase when functional and genetic loss of repair components are consistently identified. In addition, future therapies will exploit artificial synthetic lethality, where complementary DNA repair pathways are targeted simultaneously in cancers without DNA repair defects. © The Author 2017. Published by Oxford University Press.

  14. Enzyme Functionalized AuNPs and Glucometer-based Protein Detection

    NASA Astrophysics Data System (ADS)

    Dai, Tao; Fang, Jie; Yu, Wen; Xie, Guoming

    2017-12-01

    We here developed a novel method for protein detection by using protein aptamer-functionalized magnetic beads for protein recognition and invertase-functionalized AuNPs catalyze sucrose generate glucose that can be detected by a glucometer. First, the invertase and DNA probe P2 are immobilized onto the gold nanoparticles (I.P2@AuNPs). Next protein aptamer P1 are immobilized onto the streptavidin-coated Magnetic beads (P1@MB). P1 and P2 can complementary to form double-stranded DNA. When target protein presence, P1 combine with target and release I/P2@AuNPs. Then magnetic separation, take supernatant fluid and add sucrose after a period of reaction, detection of glucose concentration by glucometer, thus achieve the sensitive and selective detection of the target protein.

  15. High sensitivity DNA detection using gold nanoparticle functionalised polyaniline nanofibres.

    PubMed

    Spain, Elaine; Kojima, Robert; Kaner, Richard B; Wallace, Gordan G; O'Grady, Justin; Lacey, Katrina; Barry, Thomas; Keyes, Tia E; Forster, Robert J

    2011-01-15

    Polyaniline (PANI) nanofibres (PANI-NF) have been modified with chemically grown gold nanoparticles to give a nanocomposite material (PANI-NF-AuNP) and deposited on gold electrodes. Single stranded capture DNA was then bound to the gold nanoparticles and the underlying gold electrode and allowed to hybridise with a complementary target strand that is uniquely associated with the pathogen, Staphylococcus aureus (S. aureus), that causes mastitis. Significantly, cyclic voltammetry demonstrates that deposition of the gold nanoparticles increases the area available for DNA immobilisation by a factor of approximately 4. EPR reveals that the addition of the Au nanoparticles efficiently decreases the interactions between adjacent PANI chains and/or motional broadening. Finally, a second horseradish peroxidase (HRP) labelled DNA strand hybridises with the target allowing the concentration of the target DNA to be detected by monitoring the reduction of a hydroquinone mediator in solution. The sensors have a wide dynamic range, excellent ability to discriminate DNA mismatches and a high sensitivity. Semi-log plots of the pathogen DNA concentration vs. faradaic current were linear from 150×10(-12) to 1×10(-6) mol L(-1) and pM concentrations could be detected without the need for molecular, e.g., PCR or NASBA, amplification. Copyright © 2010 Elsevier B.V. All rights reserved.

  16. Label-free DNA hybridization detection and single base-mismatch discrimination using CE-ICP-MS assay.

    PubMed

    Li, Yan; Sun, Shao-kai; Yang, Jia-lin; Jiang, Yan

    2011-12-07

    Detecting a specific DNA sequence and discriminating single base-mismatch is critical to clinical diagnosis, paternity testing, forensic sciences, food and drug industry, pathology, genetics, environmental monitoring, and anti-bioterrorism. To this end, capillary electrophoresis (CE) coupled with the inductively coupled plasma mass spectrometry (ICP-MS) method is developed using the displacing interaction between the target ssDNA and the competitor Hg(2+) for the first time. The thymine-rich capture ssDNA 1 is interacted with the competitor Hg(2+), forming an assembled complex in a hairpin-structure between the thymine bases arrangement at both sides of the capture ssDNA 1. In the presence of a target ssDNA with stronger affinity than that of the competitor Hg(2+), the energetically favorable hybridization between capture ssDNA 1 and the target ssDNA destroys the hairpin-structure and releases the competitor as free Hg(2+), which was then read out and accurately quantified by CE-ICP-MS assay. Under the optimal CE separation conditions, free Hg(2+) ions and its capture ssDNA 1 adduct were baseline separated and detected on-line by ICP-MS; the increased peak intensity of free Hg(2+) against the concentration of perfectly complementary target ssDNA was linear over the concentration range of 30-600 nmol L(-1) with a limit of detection of 8 nmol L(-1) (3s, n = 11) in the pre-incubated mixture containing 1 μmol L(-1) Hg(2+) and 0.2 μmol L(-1) capture ssDNA 1. This new assay method is simple in design since any target ssDNA binding can in principle result in free Hg(2+) release by 6-fold Hg(2+) signal amplification, avoiding oligonucleotide labeling or assistance by excess signal transducer and signal reporter to read out the target. Due to element-specific detection of ICP-MS in our assay procedure, the interference from the autofluorescence of substrata was eliminated.

  17. High-sensitive electrochemical detection of point mutation based on polymerization-induced enzymatic amplification.

    PubMed

    Feng, Kejun; Zhao, Jingjin; Wu, Zai-Sheng; Jiang, Jianhui; Shen, Guoli; Yu, Ruqin

    2011-03-15

    Here a highly sensitive electrochemical method is described for the detection of point mutation in DNA. Polymerization extension reaction is applied to specifically initiate enzymatic electrochemical amplification to improve the sensitivity and enhance the performance of point mutation detection. In this work, 5'-thiolated DNA probe sequences complementary to the wild target DNA are assembled on the gold electrode. In the presence of wild target DNA, the probe is extended by DNA polymerase over the free segment of target as the template. After washing with NaOH solution, the target DNA is removed while the elongated probe sequence remains on the sensing surface. Via hybridizing to the designed biotin-labeled detection probe, the extended sequence is capable of capturing detection probe. After introducing streptavidin-conjugated alkaline phosphatase (SA-ALP), the specific binding between streptavidin and biotin mediates a catalytic reaction of ascorbic acid 2-phosphate (AA-P) substrate to produce a reducing agent ascorbic acid (AA). Then the silver ions in solution are reduced by AA, leading to the deposition of silver metal onto the electrode surface. The amount of deposited silver which is determined by the amount of wild target can be quantified by the linear sweep voltammetry (LSV). The present approach proved to be capable of detecting the wild target DNA down to a detection limit of 1.0×10(-14) M in a wide target concentration range and identifying -28 site (A to G) of the β-thalassemia gene, demonstrating that this scheme offers a highly sensitive and specific approach for point mutation detection. Copyright © 2010 Elsevier B.V. All rights reserved.

  18. Transformable DNA Nanocarriers for Plasma Membrane Targeted Delivery of Cytokine

    PubMed Central

    Sun, Wujin; Ji, Wenyan; Hu, Quanyin; Yu, Jicheng; Wang, Chao; Qian, Chenggen; Hochu, Gabrielle; Gu, Zhen

    2016-01-01

    Direct delivery of cytokines using nanocarriers holds great promise for cancer therapy. However, the nanometric scale of the vehicles made them susceptible to size-dependent endocytosis, reducing the plasma membrane-associated apoptosis signalling. Herein, we report a tumor microenvironment-responsive and transformable nanocarrier for cell membrane targeted delivery of cytokine. This formulation is comprised of a phospholipase A2 (PLA2) degradable liposome as a shell, and complementary DNA nanostructures (designated as nanoclews) decorated with cytokines as the cores. Utilizing the tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) as a model cytokine, we demonstrate that the TRAIL loaded DNA nanoclews are capable of transforming into nanofibers after PLA2 activation. The nanofibers with micro-scaled lengths efficiently present the loaded TRAIL to death receptors on the cancer cell membrane and amplified the apoptotic signalling with reduced TRAIL internalization. PMID:27131597

  19. Preparation of genosensor for detection of specific DNA sequence of the hepatitis B virus

    NASA Astrophysics Data System (ADS)

    Honorato Castro, Ana C.; França, Erick G.; de Paula, Lucas F.; Soares, Marcia M. C. N.; Goulart, Luiz R.; Madurro, João M.; Brito-Madurro, Ana G.

    2014-09-01

    An electrochemical genosensor was constructed for detection of specific DNA sequence of the hepatitis B virus, based on graphite electrodes modified with poly(4-aminophenol) and incorporating a specific oligonucleotide probe. The modified electrode containing the probe was evaluated by differential pulse voltammetry, before and after incubation with the complementary oligonucleotide target. Detection was performed by monitoring oxidizable DNA bases (direct detection) or using ethidium bromide as indicator of the hybridization process (indirect detection). The device showed a detection limit for the oligonucleotide target of 2.61 nmol L-1. Indirect detection using ethidium bromide was promising in discriminating mismatches, which is a very desirable attribute for detection of disease-related point mutations. In addition, it was possible to observe differences between hybridized and non-hybridized surfaces by atomic force microscopy.

  20. Label-Free Detection of Live Cancer Cells and DNA Hybridization using 3D Multilayered Plasmonic Biosensor.

    PubMed

    Zhu, Shuyan; Li, Hualin; Yang, Mengsu; Pang, Stella W

    2018-05-31

    Three-dimensional (3D) multilayered plasmonic structures consisting of Au submicrometric squares on top of SU-8 submicrometric pillars, Au asymmetrical submicrometric structures in the middle, and Au asymmetrical submicrometric holes at the bottom were fabricated through reversal nanoimprint technology. Compared with two-dimensional and quasi-3D plasmonic structures, the 3D multilayered plasmonic structures showed higher electromagnetic field intensity, longer plasmon decay length and larger plasmon sensing area, which are desirable for highly sensitive localized surface plasmonic resonance biosensors. The sensitivity and resonance peak wavelength of the 3D multilayered plasmonic structures could be adjusted by varying the offset between the top and bottom SU-8 submicrometric pillars from 31% to 56%, and the highest sensitivity of 382 and 442 nm/refractive index unit were observed for resonance peaks at 581 and 805 nm, respectively. Live lung cancer A549 cells with a low concentration of 5×103 cells/ml and a low sample volume of 2 µl could be detected by the 3D multilayered plasmonic structures integrated in a microfluidic system. The 3D plasmonic biosensors also had the advantages of detecting DNA hybridization by capturing the complementary target DNA in the low concentration range of 10-14 to 10-7 M, and providing a large peak shift of 82 nm for capturing 10-7 M complementary target DNA without additional signal amplification. Creative Commons Attribution license.

  1. Ultrasensitive detection of nucleic acids and proteins using quartz crystal microbalance and surface plasmon resonance sensors based on target-triggering multiple signal amplification strategy.

    PubMed

    Sun, Wenbo; Song, Weiling; Guo, Xiaoyan; Wang, Zonghua

    2017-07-25

    In this study, quartz crystal microbalance (QCM) and surface plasmon resonance (SPR) sensors were combined with template enhanced hybridization processes (TEHP), rolling circle amplification (RCA) and biocatalytic precipitation (BCP) for ultrasensitive detection of DNA and protein. The DNA complementary to the aptamer was released by the specific binding of the aptamer to the target protein and then hybridized with the capture probe and the assistant DNA to form a ternary "Y" junction structure. The initiation chain was generated by the template-enhanced hybridization process which leaded to the rolling circle amplification reaction, and a large number of repeating unit sequences were formed. Hybridized with the enzyme-labeled probes, the biocatalytic precipitation reaction was further carried out, resulting in a large amount of insoluble precipitates and amplifying the detection signal. Under the optimum conditions, detection limits as low as 43 aM for target DNA and 53 aM for lysozyme were achieved. In addition, this method also showed good selectivity and sensitivity in human serum. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Nuclease-mediated genome editing: At the front-line of functional genomics technology.

    PubMed

    Sakuma, Tetsushi; Woltjen, Knut

    2014-01-01

    Genome editing with engineered endonucleases is rapidly becoming a staple method in developmental biology studies. Engineered nucleases permit random or designed genomic modification at precise loci through the stimulation of endogenous double-strand break repair. Homology-directed repair following targeted DNA damage is mediated by co-introduction of a custom repair template, allowing the derivation of knock-out and knock-in alleles in animal models previously refractory to classic gene targeting procedures. Currently there are three main types of customizable site-specific nucleases delineated by the source mechanism of DNA binding that guides nuclease activity to a genomic target: zinc-finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and clustered regularly interspaced short palindromic repeats (CRISPR). Among these genome engineering tools, characteristics such as the ease of design and construction, mechanism of inducing DNA damage, and DNA sequence specificity all differ, making their application complementary. By understanding the advantages and disadvantages of each method, one may make the best choice for their particular purpose. © 2014 The Authors Development, Growth & Differentiation © 2014 Japanese Society of Developmental Biologists.

  3. Autonomous generation and loading of DNA guides by bacterial Argonaute

    PubMed Central

    Chandradoss, Stanley D.; Zhu, Yifan; Timmers, Elizabeth M.; Zhang, Yong; Zhao, Hongtu; Lou, Jizhong; Wang, Yanli; Joo, Chirlmin; van der Oost, John

    2018-01-01

    Summary Several prokaryotic Argonaute proteins (pAgos) utilize small DNA guides to mediate host defense by targeting invading DNA complementary to the DNA guide. It is unknown how these DNA guides are being generated and loaded onto pAgo. Here we demonstrate that guide-free Argonaute from Thermus thermophilus (TtAgo) can degrade dsDNA, thereby generating small dsDNA fragments that subsequently are loaded onto TtAgo. Combining single-molecule fluorescence, molecular dynamic simulations and structural studies, we show that TtAgo loads dsDNA molecules with a preference towards a deoxyguanosine on the passenger strand at the position opposite to the 5’-end of the guide strand. This explains why in vivo TtAgo is preferentially loaded with guides with a 5’-end deoxycytidine. Our data demonstrate that TtAgo can independently generate and selectively load functional DNA guides. PMID:28262506

  4. Two methods for construction of internal amplification controls for the detection of Escherichia coli O157 by polymerase chain reaction.

    PubMed

    Abdulmawjood, A; Roth, S; Bülte, M

    2002-10-01

    For the detection of food born bacteria by polymerase chain reaction (PCR) in food products, an internal amplification control (IAC) is required in order to prevent false negative results that might be caused by PCR inhibitors. In the present study, two IACs were constructed using two different methods. These IACs were designed in a way that the same primer pair can be used to amplify the target DNA and coamplify the IAC. The first IAC with a size of approximately 200 bp was constructed by deleting a part of the amplicon of the original target DNA (500 bp) between the two primer sites to produce an IAC smaller than the target DNA. The second IAC with a size of approximately 600 bp was synthesized in a one step PCR reaction. The primers used in this reaction possessed 5' over-hanging ends, which were identical to the primers used in the diagnostic reaction, whereas their 3' ends were complementary to the (pUC19) predetermined DNA sequence of defined length and sequence. The concentration of IACs appeared to be critical. Too much IAC DNA template would out-compete the target DNA template, thus giving a false negative result. However the use of an optimal IAC concentration increased the reliability of the PCR assays and appeared to be useful for food diagnostics.

  5. Ultrasensitive and selective signal-on electrochemical DNA detection via exonuclease III catalysis and hybridization chain reaction amplification.

    PubMed

    Ren, Wang; Gao, Zhong Feng; Li, Nian Bing; Luo, Hong Qun

    2015-01-15

    This work reported a novel, ultrasensitive, and selective platform for electrochemical detection of DNA, employing an integration of exonuclease III (Exo-III) assisted target recycling and hybridization chain reaction (HCR) for the dual signal amplification strategy. The hairpin capture probe DNA (C-DNA) with an Exo-III 3' overhang end was self-assembled on a gold electrode. In the presence of target DNA (T-DNA), C-DNA hybridized with the T-DNA to form a duplex region, exposing its 5' complementary sequence (initiator). Exo-III was applied to selectively digest duplex region from its 3-hydroxyl termini until the duplex was fully consumed, leaving the remnant initiator. The intact T-DNA spontaneously dissociated from the structure and then initiated the next hybridization process as a result of catalysis of the Exo-III. HCR event was triggered by the initiator and two hairpin helper signal probes labeled with methylene blue, facilitating the polymerization of oligonucleotides into a long nicked dsDNA molecule. The numerous exposed remnant initiators can trigger more HCR events. Because of integration of dual signal amplification and the specific HCR process reaction, the resultant sensor showed a high sensitivity for the detection of the target DNA in a linear range from 1.0 fM to 1.0 nM, and a detection limit as low as 0.2 fM. The proposed dual signal amplification strategy provides a powerful tool for detecting different sequences of target DNA by changing the sequence of capture probe and signal probes, holding a great potential for early diagnosis in gene-related diseases. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. DNA biosensors implemented on PNA-functionalized microstructured optical fibers Bragg gratings

    NASA Astrophysics Data System (ADS)

    Candiani, A.; Giannetti, S.; Cucinotta, A.; Bertucci, A.; Manicardi, A.; Konstantaki, M.; Margulis, W.; Pissadakis, S.; Corradini, R.; Selleri, S.

    2013-05-01

    A novel DNA sensing platform based on a Peptide Nucleic Acid - functionalized Microstructured Optical Fibers gratings has been demonstrated. The inner surface of different MOFs has been functionalized using PNA probes, OligoNucleotides mimic that are well suited for specific DNA target sequences detection. The hybrid sensing systems were tested for optical DNA detection of targets of relevance in biomedical application, using the cystic fibrosis gene mutation, and food-analysis, using the genomic DNA from genetic modified organism soy flour. After the solutions of DNA molecules has been infiltrated inside the fibers capillaries and hybridization has occurred, oligonucleotidefunctionalized gold nanoparticles were infiltrated and used to form a sandwich-like system to achieve signal amplification. Spectral measurements of the reflected signal reveal a clear wavelength shift of the reflected modes when the infiltrated complementary DNA matches with the PNA probes placed on the inner fiber surface. Measurements have also been made using the mismatched DNA solution for the c, containing a single nucleotide polymorphism, showing no significant changes in the reflected spectrum. Several experiments have been carried out demonstrating the reproducibility of the results and the high selectivity of the sensors, showing the simplicity and the potential of this approach.

  7. Terahertz spectroscopy for the isothermal detection of bacterial DNA by magnetic bead-based rolling circle amplification.

    PubMed

    Yang, Xiang; Yang, Ke; Zhao, Xiang; Lin, Zhongquan; Liu, Zhiyong; Luo, Sha; Zhang, Yang; Wang, Yunxia; Fu, Weiling

    2017-12-04

    The demand for rapid and sensitive bacterial detection is continuously increasing due to the significant requirements of various applications. In this study, a terahertz (THz) biosensor based on rolling circle amplification (RCA) was developed for the isothermal detection of bacterial DNA. The synthetic bacterium-specific sequence of 16S rDNA hybridized with a padlock probe (PLP) that contains a sequence fully complementary to the target sequence at the 5' and 3' ends. The linear PLP was circularized by ligation to form a circular PLP upon recognition of the target sequence; then the capture probe (CP) immobilized on magnetic beads (MBs) acted as a primer to initialize RCA. As DNA molecules are much less absorptive than water molecules in the THz range, the RCA products on the surface of the MBs cause a significant decrease in THz absorption, which can be sensitively probed by THz spectroscopy. Our results showed that 0.12 fmol of synthetic bacterial DNA and 0.05 ng μL -1 of genomic DNA could be effectively detected using this assay. In addition, the specificity of this strategy was demonstrated by its low signal response to interfering bacteria. The proposed strategy not only represents a new method for the isothermal detection of the target bacterial DNA but also provides a general methodology for sensitive and specific DNA biosensing using THz spectroscopy.

  8. Mimicking an Enzyme-Based Colorimetric Aptasensor for Antibiotic Residue Detection in Milk Combining Magnetic Loop-DNA Probes and CHA-Assisted Target Recycling Amplification.

    PubMed

    Luan, Qian; Gan, Ning; Cao, Yuting; Li, Tianhua

    2017-07-19

    A mimicking-enzyme-based colorimetric aptasensor was developed for the detection of kanamycin (KANA) in milk using magnetic loop-DNA-NMOF-Pt (m-L-DNA) probes and catalytic hairpin assembly (CHA)-assisted target recycling for signal amplification. The m-L-DNA probes were constructed via hybridization of hairpin DNA H1 (containing aptamer sequence) immobilized magnetic beads (m-H1) and signal DNA (sDNA, partial hybridization with H1) labeled nano Fe-MIL-88NH 2 -Pt (NMOF-Pt-sDNA). In the presence of KANA and complementary hairpin DNA H2, the m-L-DNA probes decomposed and formed an m-H1/KANA intermediate, which triggered the CHA reaction to form a stable duplex strand (m-H1-H2) while releasing KANA again for recycling. Consequently, numerous NMOF-Pt-sDNA as mimicking enzymes can synergistically catalyze 3,3',5,5'-tetramethylbenzidine (TMB) for color development. The aptasensor exhibited high selectivity and sensitivity for KANA in milk with a detection limit of 0.2 pg mL -1 within 30 min. The assay can be conveniently extended for on-site screening of other antibiotics in foods by simply changing the base sequence of the probes.

  9. Circulating Tumor Cells Versus Circulating Tumor DNA in Colorectal Cancer: Pros and Cons

    PubMed Central

    Tan, Carlyn Rose C.; Zhou, Lanlan

    2016-01-01

    Circulating tumor cells (CTCs) and circulating tumor DNA (ctDNA) are emerging noninvasive multifunctional biomarkers in liquid biopsy allowing for early diagnosis, accurate prognosis, therapeutic target selection, spatiotemporal monitoring of metastasis, as well as monitoring response and resistance to treatment. CTCs and ctDNA are released from different tumor types at different stages and contribute complementary information for clinical decision. Although big strides have been taken in technology development for detection, isolation and characterization of CTCs and sensitive and specific detection of ctDNA, CTC-, and ctDNA-based liquid biopsies may not be widely adopted for routine cancer patient care until the suitability, accuracy, and reliability of these tests are validated and more standardized protocols are corroborated in large, independent, prospectively designed trials. This review covers CTC- and ctDNA-related technologies and their application in colorectal cancer. The promise of CTC-and ctDNA-based liquid biopsies is envisioned. PMID:27516729

  10. Circulating Tumor Cells Versus Circulating Tumor DNA in Colorectal Cancer: Pros and Cons.

    PubMed

    Tan, Carlyn Rose C; Zhou, Lanlan; El-Deiry, Wafik S

    2016-06-01

    Circulating tumor cells (CTCs) and circulating tumor DNA (ctDNA) are emerging noninvasive multifunctional biomarkers in liquid biopsy allowing for early diagnosis, accurate prognosis, therapeutic target selection, spatiotemporal monitoring of metastasis, as well as monitoring response and resistance to treatment. CTCs and ctDNA are released from different tumor types at different stages and contribute complementary information for clinical decision. Although big strides have been taken in technology development for detection, isolation and characterization of CTCs and sensitive and specific detection of ctDNA, CTC-, and ctDNA-based liquid biopsies may not be widely adopted for routine cancer patient care until the suitability, accuracy, and reliability of these tests are validated and more standardized protocols are corroborated in large, independent, prospectively designed trials. This review covers CTC- and ctDNA-related technologies and their application in colorectal cancer. The promise of CTC-and ctDNA-based liquid biopsies is envisioned.

  11. Ultrasensitive sensing platform for platelet-derived growth factor BB detection based on layered molybdenum selenide-graphene composites and Exonuclease III assisted signal amplification.

    PubMed

    Huang, Ke-Jing; Shuai, Hong-Lei; Zhang, Ji-Zong

    2016-03-15

    A highly sensitive and ultrasensitive electrochemical aptasensor for platelet-derived growth factor BB (PDGF-BB) detection is fabricated based on layered molybdenum selenide-graphene (MoSe2-Gr) composites and Exonuclease III (Exo III)-aided signal amplification. MoSe2-Gr is prepared by a simple hydrothermal method and used as a promising sensing platform. Exo III has a specifical exo-deoxyribonuclease activity for duplex DNAs in the direction from 3' to 5' terminus, however its activity is limited on the duplex DNAs with more than 4 mismatched terminal bases at 3' ends. Herein, aptamer and complementary DNA (cDNA) sequences are designed with four thymine bases on 3' ends. In the presence of target protein, the aptamer associates with it and facilitates the formation of duplex DNA between cDNA and signal DNA. The duplex DNA then is digested by Exo III and releases cDNA, which hybridizes with signal DNA to perform a new cleavage process. Nevertheless, in the absence of target protein, the aptamer hybridizes with cDNA will inhibit the Exo III-assisted nucleotides cleavage. The signal DNA then hybridizes with capture DNA on the electrode. Subsequently, horse radish peroxidase is fixed on electrode by avidin-biotin reaction and then catalyzes hydrogen peroxide and hydroquinone to produce electrochemical response. Therefore, a bridge can be established between the concentration of target protein and the degree of the attenuation of the obtained signal, providing a quantitative measure of target protein with a broad detection range of 0.0001-1 nM and a detection limit of 20 fM. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. Impedimetric genosensor for detection of hepatitis C virus (HCV1) DNA using viral probe on methylene blue doped silica nanoparticles.

    PubMed

    Singhal, Chaitali; Ingle, Aviraj; Chakraborty, Dhritiman; Pn, Anoop Krishna; Pundir, C S; Narang, Jagriti

    2017-05-01

    An impedimetric genosensor was fabricated for detection of hepatitis C virus (HCV) genotype 1 in serum, based on hybridization of the probe with complementary target cDNA from sample. To achieve it, probe DNA complementary to HCVgene was immobilized on the surface of methylene blue (MB) doped silica nanoparticles MB@SiNPs) modified fluorine doped tin oxide (FTO) electrode. The synthesized MB@SiNPs was characterized using scanning electron microscopy (SEM), high resolution transmission electron microscopy (HRTEM) and X-ray diffraction (XRD) pattern. This modified electrode (ssDNA/MB@SiNPs/FTO) served both as a signal amplification platform (due to silica nanoparticles (SiNPs) as well as an electrochemical indicator (due to methylene blue (MB)) for the detection of the HCV DNA in patient serum sample. The genosensor was optimized and evaluated. The sensor showed a dynamic linear range 100-10 6 copies/mL, with a detection limit of 90 copies/mL. The sensor was applied for detection of HCV in sera of hepatitis patient and could be renewed. The half life of the sensor was 4 weeks. The MB@SiNPs/FTO electrode could be used for preparation of other gensensors also. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Validation of microinjection methods for generating knockout mice by CRISPR/Cas-mediated genome engineering.

    PubMed

    Horii, Takuro; Arai, Yuji; Yamazaki, Miho; Morita, Sumiyo; Kimura, Mika; Itoh, Masahiro; Abe, Yumiko; Hatada, Izuho

    2014-03-28

    The CRISPR/Cas system, in which the Cas9 endonuclease and a guide RNA complementary to the target are sufficient for RNA-guided cleavage of the target DNA, is a powerful new approach recently developed for targeted gene disruption in various animal models. However, there is little verification of microinjection methods for generating knockout mice using this approach. Here, we report the verification of microinjection methods of the CRISPR/Cas system. We compared three methods for injection: (1) injection of DNA into the pronucleus, (2) injection of RNA into the pronucleus, and (3) injection of RNA into the cytoplasm. We found that injection of RNA into the cytoplasm was the most efficient method in terms of the numbers of viable blastocyst stage embryos and full-term pups generated. This method also showed the best overall knockout efficiency.

  14. DNA Nanostructures as Smart Drug-Delivery Vehicles and Molecular Devices.

    PubMed

    Linko, Veikko; Ora, Ari; Kostiainen, Mauri A

    2015-10-01

    DNA molecules can be assembled into custom predesigned shapes via hybridization of sequence-complementary domains. The folded structures have high spatial addressability and a tremendous potential to serve as platforms and active components in a plethora of bionanotechnological applications. DNA is a truly programmable material, and its nanoscale engineering thus opens up numerous attractive possibilities to develop novel methods for therapeutics. The tailored molecular devices could be used in targeting cells and triggering the cellular actions in the biological environment. In this review we focus on the DNA-based assemblies - primarily DNA origami nanostructures - that could perform complex tasks in cells and serve as smart drug-delivery vehicles in, for example, cancer therapy, prodrug medication, and enzyme replacement therapy. Copyright © 2015 Elsevier Ltd. All rights reserved.

  15. DNA nanostructure-based drug delivery nanosystems in cancer therapy.

    PubMed

    Wu, Dandan; Wang, Lei; Li, Wei; Xu, Xiaowen; Jiang, Wei

    2017-11-25

    DNA as a novel biomaterial can be used to fabricate different kinds of DNA nanostructures based on its principle of GC/AT complementary base pairing. Studies have shown that DNA nanostructure is a nice drug carrier to overcome big obstacles existing in cancer therapy such as systemic toxicity and unsatisfied drug efficacy. Thus, different types of DNA nanostructure-based drug delivery nanosystems have been designed in cancer therapy. To improve treating efficacy, they are also developed into more functional drug delivery nanosystems. In recent years, some important progresses have been made. The objective of this review is to make a retrospect and summary about these different kinds of DNA nanostructure-based drug delivery nanosystems and their latest progresses: (1) active targeting; (2) mutidrug co-delivery; (3) construction of stimuli-responsive/intelligent nanosystems. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Mutations altering the cleavage specificity of a homing endonuclease

    PubMed Central

    Seligman, Lenny M.; Chisholm, Karen M.; Chevalier, Brett S.; Chadsey, Meggen S.; Edwards, Samuel T.; Savage, Jeremiah H.; Veillet, Adeline L.

    2002-01-01

    The homing endonuclease I-CreI recognizes and cleaves a particular 22 bp DNA sequence. The crystal structure of I-CreI bound to homing site DNA has previously been determined, leading to a number of predictions about specific protein–DNA contacts. We test these predictions by analyzing a set of endonuclease mutants and a complementary set of homing site mutants. We find evidence that all structurally predicted I-CreI/DNA contacts contribute to DNA recognition and show that these contacts differ greatly in terms of their relative importance. We also describe the isolation of a collection of altered specificity I-CreI derivatives. The in vitro DNA-binding and cleavage properties of two such endonucleases demonstrate that our genetic approach is effective in identifying homing endonucleases that recognize and cleave novel target sequences. PMID:12202772

  17. Toehold-mediated DNA displacement-based surface-enhanced Raman scattering DNA sensor utilizing an Au-Ag bimetallic nanodendrite substrate.

    PubMed

    Kim, Saetbyeol; Tran Ngoc, Huan; Kim, Joohoon; Yoo, So Young; Chung, Hoeil

    2015-07-23

    A simple and sensitive surface enhanced Raman scattering (SERS)-based DNA sensor that utilizes the toehold-mediated DNA displacement reaction as a target-capturing scheme has been demonstrated. For a SERS substrate, Au-Ag bimetallic nanodendrites were electrochemically synthesized and used as a sensor platform. The incorporation of both Ag and Au was employed to simultaneously secure high sensitivity and stability of the substrate. An optimal composition of Ag and Au that satisfied these needs was determined. A double-strand composed of 'a probe DNA (pDNA)' complementary to 'a target DNA (tDNA)' and 'an indicator DNA tagged with a Raman reporter (iDNA)' was conjugated on the substrate. The conjugation made the reporter molecule close to the surface and induced generation of the Raman signal. The tDNA released the pre-hybridized iDNA from the pDNA via toehold-mediated displacement, and the displacement of the iDNA resulted in the decrease of Raman intensity. The variation of percent intensity change was sensitive and linear in the concentration range from 200fM to 20nM, and the achieved limit of detection (LOD) was 96.3fM, superior to those reported in previous studies that adopted different signal taggings based on such as fluorescence and electrochemistry. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. Efficient Fluorescence Resonance Energy Transfer between Quantum Dots and Gold Nanoparticles Based on Porous Silicon Photonic Crystal for DNA Detection.

    PubMed

    Zhang, Hongyan; Lv, Jie; Jia, Zhenhong

    2017-05-10

    A novel assembled biosensor was prepared for detecting 16S rRNA, a small-size persistent specific for Actinobacteria. The mechanism of the porous silicon (PS) photonic crystal biosensor is based on the fluorescence resonance energy transfer (FRET) between quantum dots (QDs) and gold nanoparticles (AuNPs) through DNA hybridization, where QDs act as an emission donor and AuNPs serve as a fluorescence quencher. Results showed that the photoluminescence (PL) intensity of PS photonic crystal was drastically increased when the QDs-conjugated probe DNA was adhered to the PS layer by surface modification using a standard cross-link chemistry method. The PL intensity of QDs was decreased when the addition of AuNPs-conjugated complementary 16S rRNA was dropped onto QDs-conjugated PS. Based on the analysis of different target DNA concentration, it was found that the decrease of the PL intensity showed a good linear relationship with complementary DNA concentration in a range from 0.25 to 10 μM, and the detection limit was 328.7 nM. Such an optical FRET biosensor functions on PS-based photonic crystal for DNA detection that differs from the traditional FRET, which is used only in liquid. This method will benefit the development of a new optical FRET label-free biosensor on Si substrate and has great potential in biochips based on integrated optical devices.

  19. Rapid detection of Cyprinid herpesvirus-3 (CyHV-3) using a gold nanoparticle-based hybridization assay.

    PubMed

    Saleh, Mona; El-Matbouli, Mansour

    2015-06-01

    Cyprinid herpesvirus-3 (CyHV-3) is a highly infectious pathogen that causes fatal disease in common and koi carp Cyprinus carpio L. CyHV-3 detection is usually based on virus propagation or amplification of the viral DNA using the PCR or LAMP techniques. However, due to the limited susceptibility of cells used for propagation, it is not always possible to successfully isolate CyHV-3 even from tissue samples that have high virus titres. All previously described detection methods including PCR-based assays are time consuming, laborious and require specialized equipment. To overcome these limitations, gold nanoparticles (AuNPs) have been explored for direct and sensitive detection of DNA. In this study, a label-free colorimetric nanodiagnostic method for direct detection of unamplified CyHV-3 DNA using gold nanoparticles is introduced. Under appropriate conditions, DNA probes hybridize with their complementary target sequences in the sample DNA, which results in aggregation of the gold nanoparticles and a concomitant colour change from red to blue, whereas test samples with non complementary DNA sequences remain red. In this study, gold nanoparticles were used to develop and evaluate a specific and sensitive hybridization assay for direct and rapid detection of the highly infectious pathogen termed Cyprinid herpesvirus-3. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Accelerated Photobleaching of a Cyanine Dye in the Presence of a Ternary Target DNA, PNA Probe, Dye Catalytic Complex: A Molecular Diagnostic

    PubMed Central

    Wang, M.; Holmes-Davis, R.; Rafinski, Z.; Jedrzejewska, B.; Choi, K. Y.; Zwick, M.; Bupp, C.; Izmailov, A.; Paczkowski, J.; Warner, B.; Koshinsky, H.

    2009-01-01

    In many settings, molecular testing is needed but unavailable due to complexity and cost. Simple, rapid, and specific DNA detection technologies would provide important alternatives to existing detection methods. Here we report a novel, rapid nucleic acid detection method based on the accelerated photobleaching of the light-sensitive cyanine dye, 3,3′-diethylthiacarbocyanine iodide (DiSC2(3) I−), in the presence of a target genomic DNA and a complementary peptide nucleic acid (PNA) probe. On the basis of the UV–vis, circular dichroism, and fluorescence spectra of DiSC2(3) with PNA–DNA oligomer duplexes and on characterization of a product of photolysis of DiSC2(3) I−, a possible reaction mechanism is proposed. We propose that (1) a novel complex forms between dye, PNA, and DNA, (2) this complex functions as a photosensitizer producing 1O2, and (3) the 1O2 produced promotes photobleaching of dye molecules in the mixture. Similar cyanine dyes (DiSC3(3), DiSC4(3), DiSC5(3), and DiSCpy(3)) interact with preformed PNA–DNA oligomer duplexes but do not demonstrate an equivalent accelerated photobleaching effect in the presence of PNA and target genomic DNA. The feasibility of developing molecular diagnostic assays based on the accelerated photobleaching (the smartDNA assay) that results from the novel complex formed between DiSC2(3) and PNA–DNA is under way. PMID:19231844

  1. Mapping of transcription factor binding regions in mammalian cells by ChIP: Comparison of array- and sequencing-based technologies

    PubMed Central

    Euskirchen, Ghia M.; Rozowsky, Joel S.; Wei, Chia-Lin; Lee, Wah Heng; Zhang, Zhengdong D.; Hartman, Stephen; Emanuelsson, Olof; Stolc, Viktor; Weissman, Sherman; Gerstein, Mark B.; Ruan, Yijun; Snyder, Michael

    2007-01-01

    Recent progress in mapping transcription factor (TF) binding regions can largely be credited to chromatin immunoprecipitation (ChIP) technologies. We compared strategies for mapping TF binding regions in mammalian cells using two different ChIP schemes: ChIP with DNA microarray analysis (ChIP-chip) and ChIP with DNA sequencing (ChIP-PET). We first investigated parameters central to obtaining robust ChIP-chip data sets by analyzing STAT1 targets in the ENCODE regions of the human genome, and then compared ChIP-chip to ChIP-PET. We devised methods for scoring and comparing results among various tiling arrays and examined parameters such as DNA microarray format, oligonucleotide length, hybridization conditions, and the use of competitor Cot-1 DNA. The best performance was achieved with high-density oligonucleotide arrays, oligonucleotides ≥50 bases (b), the presence of competitor Cot-1 DNA and hybridizations conducted in microfluidics stations. When target identification was evaluated as a function of array number, 80%–86% of targets were identified with three or more arrays. Comparison of ChIP-chip with ChIP-PET revealed strong agreement for the highest ranked targets with less overlap for the low ranked targets. With advantages and disadvantages unique to each approach, we found that ChIP-chip and ChIP-PET are frequently complementary in their relative abilities to detect STAT1 targets for the lower ranked targets; each method detected validated targets that were missed by the other method. The most comprehensive list of STAT1 binding regions is obtained by merging results from ChIP-chip and ChIP-sequencing. Overall, this study provides information for robust identification, scoring, and validation of TF targets using ChIP-based technologies. PMID:17568005

  2. Single nucleotide polymorphism discrimination with and without an ethidium bromide intercalator.

    PubMed

    Fenati, Renzo A; Connolly, Ashley R; Ellis, Amanda V

    2017-02-15

    Single nucleotide polymorphism (SNP) genotyping is an important aspect in understanding genetic variations. Here, we discriminate SNPs using toe-hold mediated displacement reactions. The biological target is an 80 nucleotide long double-stranded-DNA from the mtDNA HV1 region, associated with maternal ancestry. This target has been specially designed with a pendant toehold and a cationic fluorophore, ATTO 647N, as a reporter, produced in a polymerase chain reaction. Rates of reaction for the toehold-polymerase chain reaction products (TPPs) with their corresponding complementary displacing sequences, labelled with a Black Hole Quencher 1, followed the order TPP-Cytosine > TPP-Thymine > TPP-Adenine ≥ TPP-Guanine. Non-complementary rates were the slowest with mismatches involving cytosine. These reactions, operating in a static/or contact mode, gave averaged readouts between SNPs within 15 min (with 80-90% quenching), compared to 25-30 min in previous studies involving fluorescence resonance energy transfer. Addition of an intercalating agent, ethidium bromide, retarded the rate of reaction in which cytosine was involved, presumably through stabilization of the base pairing, which resulted in markedly improved discrimination of cytosine containing SNPs. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. The illusion of specific capture: surface and solution studies of suboptimal oligonucleotide hybridization

    PubMed Central

    2013-01-01

    Background Hybridization based assays and capture systems depend on the specificity of hybridization between a probe and its intended target. A common guideline in the construction of DNA microarrays, for instance, is that avoiding complementary stretches of more than 15 nucleic acids in a 50 or 60-mer probe will eliminate sequence specific cross-hybridization reactions. Here we present a study of the behavior of partially matched oligonucleotide pairs with complementary stretches starting well below this threshold complementarity length – in silico, in solution, and at the microarray surface. The modeled behavior of pairs of oligonucleotide probes and their targets suggests that even a complementary stretch of sequence 12 nt in length would give rise to specific cross-hybridization. We designed a set of binding partners to a 50-mer oligonucleotide containing complementary stretches from 6 nt to 21 nt in length. Results Solution melting experiments demonstrate that stable partial duplexes can form when only 12 bp of complementary sequence are present; surface hybridization experiments confirm that a signal close in magnitude to full-strength signal can be obtained from hybridization of a 12 bp duplex within a 50mer oligonucleotide. Conclusions Microarray and other molecular capture strategies that rely on a 15 nt lower complementarity bound for eliminating specific cross-hybridization may not be sufficiently conservative. PMID:23445545

  4. DNA origami as an in vivo drug delivery vehicle for cancer therapy.

    PubMed

    Zhang, Qian; Jiang, Qiao; Li, Na; Dai, Luru; Liu, Qing; Song, Linlin; Wang, Jinye; Li, Yaqian; Tian, Jie; Ding, Baoquan; Du, Yang

    2014-07-22

    Many chemotherapeutics used for cancer treatments encounter issues during delivery to tumors in vivo and may have high levels of systemic toxicity due to their nonspecific distribution. Various materials have been explored to fabricate nanoparticles as drug carriers to improve delivery efficiency. However, most of these materials suffer from multiple drawbacks, such as limited biocompatibility and inability to engineer spatially addressable surfaces that can be utilized for multifunctional activity. Here, we demonstrate that DNA origami possessed enhanced tumor passive targeting and long-lasting properties at the tumor region. Particularly, the triangle-shaped DNA origami exhibits optimal tumor passive targeting accumulation. The delivery of the known anticancer drug doxorubicin into tumors by self-assembled DNA origami nanostructures was performed, and this approach showed prominent therapeutic efficacy in vivo. The DNA origami carriers were prepared through the self-assembly of M13mp18 phage DNA and hundreds of complementary DNA helper strands; the doxorubicin was subsequently noncovalently intercalated into these nanostructures. After conducting fluorescence imaging and safety evaluation, the doxorubicin-containing DNA origami exhibited remarkable antitumor efficacy without observable systemic toxicity in nude mice bearing orthotopic breast tumors labeled with green fluorescent protein. Our results demonstrated the potential of DNA origami nanostructures as innovative platforms for the efficient and safe drug delivery of cancer therapeutics in vivo.

  5. A universal colorimetry for nucleic acids and aptamer-specific ligands detection based on DNA hybridization amplification.

    PubMed

    Li, Shuang; Shang, Xinxin; Liu, Jia; Wang, Yujie; Guo, Yingshu; You, Jinmao

    2017-07-01

    We present a universal amplified-colorimetric for detecting nucleic acid targets or aptamer-specific ligand targets based on gold nanoparticle-DNA (GNP-DNA) hybridization chain reaction (HCR). The universal arrays consisted of capture probe and hairpin DNA-GNP. First, capture probe recognized target specificity and released the initiator sequence. Then dispersed hairpin DNA modified GNPs were cross-linked to form aggregates through HCR events triggered by initiator sequence. As the aggregates accumulate, a significant red-to purple color change can be easily visualized by the naked eye. We used miRNA target sequence (miRNA-203) and aptamer-specific ligand (ATP) as target molecules for this proof-of-concept experiment. Initiator sequence (DNA2) was released from the capture probe (MNP/DNA1/2 conjugates) under the strong competitiveness of miRNA-203. Hairpin DNA (H1 and H2) can be complementary with the help of initiator DNA2 to form GNP-H1/GNP-H2 aggregates. The absorption ratio (A 620 /A 520 ) values of solutions were a sensitive function of miRNA-203 concentration covering from 1.0 × 10 -11  M to 9.0 × 10 -10  M, and as low as 1.0 × 10 -11  M could be detected. At the same time, the color changed from light wine red to purple and then to light blue have occurred in the solution. For ATP, initiator sequence (5'-end of DNA3) was released from the capture probe (DNA3) under the strong combination of aptamer-ATP. The present colorimetric for specific detection of ATP exhibited good sensitivity and 1.0 × 10 -8  M ATP could be detected. The proposed strategy also showed good performances for qualitative analysis and quantitative analysis of intracellular nucleic acids and aptamer-specific ligands. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Robust and specific ratiometric biosensing using a copper-free clicked quantum dot-DNA aptamer sensor

    NASA Astrophysics Data System (ADS)

    Zhang, Haiyan; Feng, Guoqiang; Guo, Yuan; Zhou, Dejian

    2013-10-01

    We report herein the successful preparation of a compact and functional CdSe-ZnS core-shell quantum dot (QD)-DNA conjugate via highly efficient copper-free ``click chemistry'' (CFCC) between a dihydro-lipoic acid-polyethylene glycol-azide (DHLA-PEG-N3) capped QD and a cyclooctyne modified DNA. This represents an excellent balance between the requirements of high sensitivity, robustness and specificity for the QD-FRET (Förster resonance energy transfer) based sensor as confirmed by a detailed FRET analysis on the QD-DNA conjugate, yielding a relatively short donor-acceptor distance of ~5.8 nm. We show that this CFCC clicked QD-DNA conjugate is not only able to retain the native fluorescence quantum yield (QY) of the parent DHLA-PEG-N3 capped QD, but also well-suited for robust and specific biosensing; it can directly quantitate, at the pM level, both labelled and unlabelled complementary DNA probes with a good SNP (single-nucleotide polymorphism) discrimination ability in complex media, e.g. 10% human serum via target-binding induced FRET changes between the QD donor and the dye acceptor. Furthermore, this sensor has also been successfully exploited for the detection, at the pM level, of a specific protein target (thrombin) via the encoded anti-thrombin aptamer sequence in the QD-DNA conjugate.We report herein the successful preparation of a compact and functional CdSe-ZnS core-shell quantum dot (QD)-DNA conjugate via highly efficient copper-free ``click chemistry'' (CFCC) between a dihydro-lipoic acid-polyethylene glycol-azide (DHLA-PEG-N3) capped QD and a cyclooctyne modified DNA. This represents an excellent balance between the requirements of high sensitivity, robustness and specificity for the QD-FRET (Förster resonance energy transfer) based sensor as confirmed by a detailed FRET analysis on the QD-DNA conjugate, yielding a relatively short donor-acceptor distance of ~5.8 nm. We show that this CFCC clicked QD-DNA conjugate is not only able to retain the native fluorescence quantum yield (QY) of the parent DHLA-PEG-N3 capped QD, but also well-suited for robust and specific biosensing; it can directly quantitate, at the pM level, both labelled and unlabelled complementary DNA probes with a good SNP (single-nucleotide polymorphism) discrimination ability in complex media, e.g. 10% human serum via target-binding induced FRET changes between the QD donor and the dye acceptor. Furthermore, this sensor has also been successfully exploited for the detection, at the pM level, of a specific protein target (thrombin) via the encoded anti-thrombin aptamer sequence in the QD-DNA conjugate. Electronic supplementary information (ESI) available: Details on the synthesis, purification and characterisation of the DHLA-PEG600-N3, cyclooctyne-DNA, and QD-TBA20 conjugates as well as all supporting figures and tables. See DOI: 10.1039/c3nr02897f

  7. Surface-Enhanced Raman Scattering Based Nonfluorescent Probe for Multiplex DNA Detection

    PubMed Central

    Sun, Lan; Yu, Chenxu; Irudayaraj, Joseph

    2008-01-01

    To provide rapid and accurate detection of DNA markers in a straightforward, inexpensive and multiplex format, an alternative surface enhanced Raman scattering (SERS) based probe was designed and fabricated to covalently attach both DNA probing sequence and non-fluorescent Raman tags to the surface of gold nanoparticles (DNA-AuP-RTag). The intensity of Raman signal of the probes could be controlled through the surface coverage of the non-fluorescent Raman tags (RTags). Detection sensitivity of these probes could be optimized by fine-tuning the amount of DNA molecules and RTags on the probes. Long-term stability of the DNA-AuP-RTag probes was found to be good (over 3 months). Excellent multiplexing capability of the DNA-AuP-RTag scheme was demonstrated by simultaneous identification of up to eight probes in a mixture. Detection of hybridization of single-stranded DNA (ssDNA) to its complementary targets was successfully accomplished with a long-term goal to use non-fluorescent RTags in a Raman-based DNA microarray platform. PMID:17465531

  8. Hairpin Bisulfite Sequencing: Synchronous Methylation Analysis on Complementary DNA Strands of Individual Chromosomes.

    PubMed

    Giehr, Pascal; Walter, Jörn

    2018-01-01

    The accurate and quantitative detection of 5-methylcytosine is of great importance in the field of epigenetics. The method of choice is usually bisulfite sequencing because of the high resolution and the possibility to combine it with next generation sequencing. Nevertheless, also this method has its limitations. Following the bisulfite treatment DNA strands are no longer complementary such that in a subsequent PCR amplification the DNA methylation patterns information of only one of the two DNA strand is preserved. Several years ago Hairpin Bisulfite sequencing was developed as a method to obtain the pattern information on complementary DNA strands. The method requires fragmentation (usually by enzymatic cleavage) of genomic DNA followed by a covalent linking of both DNA strands through ligation of a short DNA hairpin oligonucleotide to both strands. The ligated covalently linked dsDNA products are then subjected to a conventional bisulfite treatment during which all unmodified cytosines are converted to uracils. During the treatment the DNA is denatured forming noncomplementary ssDNA circles. These circles serve as a template for a locus specific PCR to amplify chromosomal patterns of the region of interest. As a result one ends up with a linearized product, which contains the methylation information of both complementary DNA strands.

  9. DNA Cloning of Plasmodium falciparum Circumsporozoite Gene: Amino Acid Sequence of Repetitive Epitope

    NASA Astrophysics Data System (ADS)

    Enea, Vincenzo; Ellis, Joan; Zavala, Fidel; Arnot, David E.; Asavanich, Achara; Masuda, Aoi; Quakyi, Isabella; Nussenzweig, Ruth S.

    1984-08-01

    A clone of complementary DNA encoding the circumsporozoite (CS) protein of the human malaria parasite Plasmodium falciparum has been isolated by screening an Escherichia coli complementary DNA library with a monoclonal antibody to the CS protein. The DNA sequence of the complementary DNA insert encodes a four-amino acid sequence: proline-asparagine-alanine-asparagine, tandemly repeated 23 times. The CS β -lactamase fusion protein specifically binds monoclonal antibodies to the CS protein and inhibits the binding of these antibodies to native Plasmodium falciparum CS protein. These findings provide a basis for the development of a vaccine against Plasmodium falciparum malaria.

  10. Ultrasensitive signal-on DNA biosensor based on nicking endonuclease assisted electrochemistry signal amplification.

    PubMed

    Liu, Zhongyuan; Zhang, Wei; Zhu, Shuyun; Zhang, Ling; Hu, Lianzhe; Parveen, Saima; Xu, Guobao

    2011-11-15

    Combining the advantages of signal-on strategy and nicking endonuclease assisted electrochemistry signal amplification (NEAESA), a new sensitive and signal-on electrochemical DNA biosensor for the sequence specific DNA detection based on NEAESA has been developed for the first time. A Hairpin-shape probe (HP), containing the target DNA recognition sequence, is thiol-modified at 5' end and immobilized on gold electrode via Au-S bonding. Subsequently, the HP modified electrode is hybridized with target DNA to form a duplex. Then the nicking endonuclease is added and nicks the HP strand in the duplex. After nicking, 3'-ferrocene (Fc)-labeled part complementary probe (Fc-PCP) is introduced on the electrode surface by hybridizing with the thiol-modified HP fragment, which results in the generation of electrochemical signal. Hence, the DNA biosensor is constructed successfully. The present DNA biosensor shows a wide linear range of 5.0×10(-13)-5.0×10(-8)M for detecting target DNA, with a low detection limit of 0.167pM. The proposed strategy does not require any amplifying labels (enzymes, DNAzymes, nanoparticles, etc.) for biorecognition events, which avoids false-positive results to occur frequently. Moreover, the strategy has the benefits of simple preparation, convenient operation, good selectivity, and high sensitivity. With the advantages mentioned above, this simple and sensitive strategy has the potential to be integrated in portable, low cost and simplified devices for diagnostic applications. Copyright © 2011 Elsevier B.V. All rights reserved.

  11. Relative stabilities of triple helices composed of combinations of DNA, RNA and 2'-O-methyl-RNA backbones: chimeric circular oligonucleotides as probes.

    PubMed

    Wang, S; Kool, E T

    1995-04-11

    Described is a systematic study of the effects of varied backbone structure on the stabilities of pyr.pur.pyr triple helices. The effects were measured using six circular 34 base oligonucleotides containing DNA (D), RNA (R) and/or 2'-O-methyl-RNA (M) residues designed to bind a complementary single-stranded purine target strand by triple helix formation. Eighteen different backbone combinations were studied at pH 5.5 and 7.0 by optical melting experiments and the results compared with the stabilities of the corresponding Watson-Crick duplexes. When the target purine strand is DNA, all circles form pH-dependent triple helical complexes which are considerably stronger than the duplexes alone. When RNA is the target, five of the nine complexes studied are of the pH-dependent triplex type and the other four complexes are not significantly stronger than the corresponding duplexes. The results are useful in the design of the highest affinity ligands for single- and double-stranded DNAs and RNAs and also point out novel ways to engender DNA- or RNA-selective binding.

  12. Single-Molecule Methods for Nucleotide Excision Repair: Building a System to Watch Repair in Real Time.

    PubMed

    Kong, Muwen; Beckwitt, Emily C; Springall, Luke; Kad, Neil M; Van Houten, Bennett

    2017-01-01

    Single-molecule approaches to solving biophysical problems are powerful tools that allow static and dynamic real-time observations of specific molecular interactions of interest in the absence of ensemble-averaging effects. Here, we provide detailed protocols for building an experimental system that employs atomic force microscopy and a single-molecule DNA tightrope assay based on oblique angle illumination fluorescence microscopy. Together with approaches for engineering site-specific lesions into DNA substrates, these complementary biophysical techniques are well suited for investigating protein-DNA interactions that involve target-specific DNA-binding proteins, such as those engaged in a variety of DNA repair pathways. In this chapter, we demonstrate the utility of the platform by applying these techniques in the studies of proteins participating in nucleotide excision repair. © 2017 Elsevier Inc. All rights reserved.

  13. DNA biosensing with 3D printing technology.

    PubMed

    Loo, Adeline Huiling; Chua, Chun Kiang; Pumera, Martin

    2017-01-16

    3D printing, an upcoming technology, has vast potential to transform conventional fabrication processes due to the numerous improvements it can offer to the current methods. To date, the employment of 3D printing technology has been examined for applications in the fields of engineering, manufacturing and biological sciences. In this study, we examined the potential of adopting 3D printing technology for a novel application, electrochemical DNA biosensing. Metal 3D printing was utilized to construct helical-shaped stainless steel electrodes which functioned as a transducing platform for the detection of DNA hybridization. The ability of electroactive methylene blue to intercalate into the double helix structure of double-stranded DNA was then exploited to monitor the DNA hybridization process, with its inherent reduction peak serving as an analytical signal. The designed biosensing approach was found to demonstrate superior selectivity against a non-complementary DNA target, with a detection range of 1-1000 nM.

  14. Surface-enhanced Raman scattering based nonfluorescent probe for multiplex DNA detection.

    PubMed

    Sun, Lan; Yu, Chenxu; Irudayaraj, Joseph

    2007-06-01

    To provide rapid and accurate detection of DNA markers in a straightforward, inexpensive, and multiplex format, an alternative surface-enhanced Raman scattering based probe was designed and fabricated to covalently attach both DNA probing sequence and nonfluorescent Raman tags to the surface of gold nanoparticles (DNA-AuP-RTag). The intensity of Raman signal of the probes could be controlled through the surface coverage of the nonfluorescent Raman tags (RTags). Detection sensitivity of these probes could be optimized by fine-tuning the amount of DNA molecules and RTags on the probes. Long-term stability of the DNA-AuP-RTag probes was found to be good (over 3 months). Excellent multiplexing capability of the DNA-AuP-RTag scheme was demonstrated by simultaneous identification of up to eight probes in a mixture. Detection of hybridization of single-stranded DNA to its complementary targets was successfully accomplished with a long-term goal to use nonfluorescent RTags in a Raman-based DNA microarray platform.

  15. An electrochemiluminescent DNA sensor based on nano-gold enhancement and ferrocene quenching.

    PubMed

    Yao, Wu; Wang, Lun; Wang, Haiyan; Zhang, Xiaolei; Li, Ling; Zhang, Na; Pan, Le; Xing, Nannan

    2013-02-15

    An electrochemiluminescent DNA (ECL-DNA) sensor based on nano-gold signal enhancement (i.e. gold nanoparticles, GNP) and ferrocene signal quenching was investigated. The Au electrode was first modified with GNPs through electrodeposition method, followed by subsequent immobilization of single-stranded probe DNA labeled with ruthenium complex. The resulting sensor produced a higher ECL signal due to its higher density of self-assembled probe DNAs on the surface. Upon the hybridization of probe DNA with complementary target DNA labeled with ferrocene, ECL intensity decreased significantly due to spatial separation of ECL label from the electrode surface. As a result, the ECL signal was simultaneously quenched by ferrocene. The effects of both nano-gold electrodeposition time and ferrocene on the performance of ECL-DNA sensor were studied in detail and possible reasons for these effects were suggested as well. The reported ECL-DNA sensor showed great sensitivity and may provide an alternative approach for DNA detection in diagnostics and gene analysis. Copyright © 2012 Elsevier B.V. All rights reserved.

  16. Newer Gene Editing Technologies toward HIV Gene Therapy

    PubMed Central

    Manjunath, N.; Yi, Guohua; Dang, Ying; Shankar, Premlata

    2013-01-01

    Despite the great success of highly active antiretroviral therapy (HAART) in ameliorating the course of HIV infection, alternative therapeutic approaches are being pursued because of practical problems associated with life-long therapy. The eradication of HIV in the so-called “Berlin patient” who received a bone marrow transplant from a CCR5-negative donor has rekindled interest in genome engineering strategies to achieve the same effect. Precise gene editing within the cells is now a realistic possibility with recent advances in understanding the DNA repair mechanisms, DNA interaction with transcription factors and bacterial defense mechanisms. Within the past few years, four novel technologies have emerged that can be engineered for recognition of specific DNA target sequences to enable site-specific gene editing: Homing Endonuclease, ZFN, TALEN, and CRISPR/Cas9 system. The most recent CRISPR/Cas9 system uses a short stretch of complementary RNA bound to Cas9 nuclease to recognize and cleave target DNA, as opposed to the previous technologies that use DNA binding motifs of either zinc finger proteins or transcription activator-like effector molecules fused to an endonuclease to mediate sequence-specific DNA cleavage. Unlike RNA interference, which requires the continued presence of effector moieties to maintain gene silencing, the newer technologies allow permanent disruption of the targeted gene after a single treatment. Here, we review the applications, limitations and future prospects of novel gene-editing strategies for use as HIV therapy. PMID:24284874

  17. DNA hybridization detection on electrical microarrays using coulostatic pulse technique.

    PubMed

    Dharuman, V; Nebling, E; Grunwald, T; Albers, J; Blohm, L; Elsholz, B; Wörl, R; Hintsche, R

    2006-12-15

    We demonstrated a novel application of transient coulostatic pulse technique for the detection of label free DNA hybridization on nm-sized gold interdigitated ultramicroelectrode arrays (Au-IDA) made in silicon technology. The array consists of eight different positions with an Au-IDA pair at each position arranged on the Si-based Biochip. Immobilization of capture probes onto the Au-IDA was accomplished by self-assembling of thiol-modified oligonucleotides. Target hybridization was indicated by a change in the magnitude of the time dependant potential relaxation curve in presence of electroactive Fe(CN)(6)(3-) in the phosphate buffer solution. While complementary DNA hybridization showed 50% increase in the relaxation potential, the non-complementary DNA showed a negligible change. A constant behaviour was noted for all positions. The dsDNA specific intercalating molecule, methylene blue, was found to be enhancing the discrimination effect. The changes in the relaxation potential curves were further corroborated following the ELISA like experiments using ExtraAvidine alkaline phosphatase labelling and redox recycling of para-aminophenol phosphate at IDAs. The coulostatic pulse technique was shown to be useful for identifying DNA sequences from brain tumour gene CK20, human herpes simplex virus, cytomegalovirus, Epstein-Barr virus and M13 phage. Compared to the hybridization of short chain ONTs (27 mers), the hybridization of long chain M13 phage DNA showed three times higher increase in the relaxation curves. The method is fast enough to monitor hybridization interactions in milli or microsecond time scales and is well suitable for miniaturization and integration compared to the common impedance techniques for developing capacitative DNA sensors.

  18. The Ties That Bind: Mapping the Dynamic Enhancer-Promoter Interactome

    DOE PAGES

    Spurrell, Cailyn H.; Dickel, Diane E.; Visel, Axel

    2016-11-17

    Coupling chromosome conformation capture to molecular enrichment for promoter-containing DNA fragments enables the systematic mapping of interactions between individual distal regulatory sequences and their target genes. Here in this Minireview, we describe recent progress in the application of this technique and related complementary approaches to gain insight into the lineage- and cell-type-specific dynamics of interactions between regulators and gene promoters.

  19. A Programmable DNA Double-Write Material: Synergy of Photolithography and Self-Assembly Nanofabrication.

    PubMed

    Song, Youngjun; Takahashi, Tsukasa; Kim, Sejung; Heaney, Yvonne C; Warner, John; Chen, Shaochen; Heller, Michael J

    2017-01-11

    We demonstrate a DNA double-write process that uses UV to pattern a uniquely designed DNA write material, which produces two distinct binding identities for hybridizing two different complementary DNA sequences. The process requires no modification to the DNA by chemical reagents and allows programmed DNA self-assembly and further UV patterning in the UV exposed and nonexposed areas. Multilayered DNA patterning with hybridization of fluorescently labeled complementary DNA sequences, biotin probe/fluorescent streptavidin complexes, and DNA patterns with 500 nm line widths were all demonstrated.

  20. Rapid and label-free electrochemical DNA biosensor for detecting hepatitis A virus.

    PubMed

    Manzano, Marisa; Viezzi, Sara; Mazerat, Sandra; Marks, Robert S; Vidic, Jasmina

    2018-02-15

    Diagnostic systems that can deliver highly specific and sensitive detection of hepatitis A virus (HAV) in food and water are of particular interest in many fields including food safety, biosecurity and control of outbreaks. Our aim was the development of an electrochemical method based on DNA hybridization to detect HAV. A ssDNA probe specific for HAV (capture probe) was designed and tested on DNAs from various viral and bacterial samples using Nested-Reverse Transcription Polymerase Chain Reaction (nRT-PCR). To develop the electrochemical device, a disposable gold electrode was functionalized with the specific capture probe and tested on complementary ssDNA and on HAV cDNA. The DNA hybridization on the electrode was measured through the monitoring of the oxidative peak potential of the indicator tripropylamine by cyclic voltammetry. To prevent non-specific binding the gold surface was treated with 3% BSA before detection. High resolution atomic force microscopy (AFM) confirmed the efficiency of electrode functionalization and on-electrode hybridization. The proposed device showed a limit of detection of 0.65pM for the complementary ssDNA and 6.94fg/µL for viral cDNA. For a comparison, nRT-PCR quantified the target HAV cDNA with a limit of detection of 6.4fg/µL. The DNA-sensor developed can be adapted to a portable format to be adopted as an easy-to- use and low cost method for screening HAV in contaminated food and water. In addition, it can be useful for rapid control of HAV infections as it takes only a few minutes to provide the results. Copyright © 2017. Published by Elsevier B.V.

  1. Alterations in the GyrA subunit of DNA gyrase and the ParC subunit of topoisomerase IV in quinolone-resistant clinical isolates of Klebsiella pneumoniae.

    PubMed

    Deguchi, T; Fukuoka, A; Yasuda, M; Nakano, M; Ozeki, S; Kanematsu, E; Nishino, Y; Ishihara, S; Ban, Y; Kawada, Y

    1997-03-01

    We determined a partial sequence of the Klebsiella pneumoniae parC gene, including the region analogous to the quinolone resistance-determining region of the Escherichia coli gyrA gene, and examined 26 clinical strains of K. pneumoniae for an association of alterations in GyrA and ParC with susceptibilities to quinolones. The study suggests that in K. pneumoniae DNA gyrase is a primary target of quinolones and that ParC alterations play a complementary role in the development of higher-level fluoroquinolone resistance.

  2. Procedure for normalization of cDNA libraries

    DOEpatents

    Bonaldo, Maria DeFatima; Soares, Marcelo Bento

    1997-01-01

    This invention provides a method to normalize a cDNA library constructed in a vector capable of being converted to single-stranded circles and capable of producing complementary nucleic acid molecules to the single-stranded circles comprising: (a) converting the cDNA library in single-stranded circles; (b) generating complementary nucleic acid molecules to the single-stranded circles; (c) hybridizing the single-stranded circles converted in step (a) with complementary nucleic acid molecules of step (b) to produce partial duplexes to an appropriate Cot; (e) separating the unhybridized single-stranded circles from the hybridized single-stranded circles, thereby generating a normalized cDNA library.

  3. Crystal Structure of the Minimal Cas9 from Campylobacter jejuni Reveals the Molecular Diversity in the CRISPR-Cas9 Systems.

    PubMed

    Yamada, Mari; Watanabe, Yuto; Gootenberg, Jonathan S; Hirano, Hisato; Ran, F Ann; Nakane, Takanori; Ishitani, Ryuichiro; Zhang, Feng; Nishimasu, Hiroshi; Nureki, Osamu

    2017-03-16

    The RNA-guided endonuclease Cas9 generates a double-strand break at DNA target sites complementary to the guide RNA and has been harnessed for the development of a variety of new technologies, such as genome editing. Here, we report the crystal structures of Campylobacter jejuni Cas9 (CjCas9), one of the smallest Cas9 orthologs, in complex with an sgRNA and its target DNA. The structures provided insights into a minimal Cas9 scaffold and revealed the remarkable mechanistic diversity of the CRISPR-Cas9 systems. The CjCas9 guide RNA contains a triple-helix structure, which is distinct from known RNA triple helices, thereby expanding the natural repertoire of RNA triple helices. Furthermore, unlike the other Cas9 orthologs, CjCas9 contacts the nucleotide sequences in both the target and non-target DNA strands and recognizes the 5'-NNNVRYM-3' as the protospacer-adjacent motif. Collectively, these findings improve our mechanistic understanding of the CRISPR-Cas9 systems and may facilitate Cas9 engineering. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. Molecular analysis of RAPD DNA based markers: their potential use for the detection of genetic variability in jojoba (Simmondsia chinensis L Schneider).

    PubMed

    Amarger, V; Mercier, L

    1995-01-01

    We have applied the recently developed technique of random amplified polymorphic DNA (RAPD) for the discrimination between two jojoba clones at the genomic level. Among a set of 30 primers tested, a simple reproducible pattern with three distinct fragments for clone D and two distinct fragments for clone E was obtained with primer OPB08. Since RAPD products are the results of arbitrarily priming events and because a given primer can amplify a number of non-homologous sequences, we wondered whether or not RAPD bands, even those of similar size, were derived from different loci in the two clones. To answer this question, two complementary approaches were used: i) cloning and sequencing of the amplification products from clone E; and ii) complementary Southern analysis of RAPD gels using cloned or amplified fragments (directly recovered from agarose gels) as RFLP probes. The data reported here show that the RAPD reaction generates multiple amplified fragments. Some fragments, although resolved as a single band on agarose gels, contain different DNA species of the same size. Furthermore, it appears that the cloned RAPD products of known sequence that do not target repetitive DNA can be used as hybridization probes in RFLP to detect a polymorphism among individuals.

  5. Homogeneous and label-free electrochemiluminescence aptasensor based on the difference of electrostatic interaction and exonuclease-assisted target recycling amplification.

    PubMed

    Ni, Jiancong; Yang, Weiqiang; Wang, Qingxiang; Luo, Fang; Guo, Longhua; Qiu, Bin; Lin, Zhenyu; Yang, Huanghao

    2018-05-15

    The difference of electrostatic interaction between free Ru(phen) 3 2+ and Ru(phen) 3 2+ embedded in double strand DNA (dsDNA) to the negatively charged indium tin oxide (ITO) electrode has been applied to develop a homogeneous and label-free electrochemiluminescence (ECL) aptasensor for the first time. Ochratoxin A (OTA) has been chosen as the model target. The OTA aptamer is first hybridized with its complementary single strand DNA (ssDNA) to form dsDNA and then interacted with Ru(phen) 3 2+ via the grooves binding mode to form dsDNA-Ru(phen) 3 2+ complex, which remains negatively charged feature as well as low diffusion capacity to the negatively charged ITO electrode surface owing to the electrostatic repulsion. Meanwhile, the intercalated Ru(phen) 3 2+ in the grooves of dsDNA works as an ECL signal reporter instead of the labor-intensive labeling steps and can generate much more ECL signal than that from the labeling probe. In the presence of target, the aptamer prefers to form an aptamer-target complex in lieu of dsDNA, which induces the releasing of Ru(phen) 3 2+ from the dsDNA-Ru(phen) 3 2+ complex into the solution. With the assistance of RecJ f exonuclease (a ssDNA specific exonuclease), the released ssDNA and the aptamer in the target-complex were digested into mononucleotides. In the meantime, the target can be also liberated from OTA-aptamer complex and induce target cycling and large amount of free Ru(phen) 3 2+ present in the solution. Since Ru(phen) 3 2+ contains positive charges, which can diffuses easily to the ITO electrode surface because of electrostatic attraction, causing an obviously enhanced ECL signal detected. Under the optimal conditions, the enhanced ECL of the system has a linear relationship with the OTA concentration in the range of 0.01-1.0 ng/mL with a detection limit of 2 pg/mL. This innovative system not only expands the immobilization-free sensors in the electrochemiluminescent fields, but also can be developed for the detection of different targets easily with the same strategy by changing the aptamer used. Copyright © 2018 Elsevier B.V. All rights reserved.

  6. Efficient Fluorescence Resonance Energy Transfer between Quantum Dots and Gold Nanoparticles Based on Porous Silicon Photonic Crystal for DNA Detection

    PubMed Central

    Zhang, Hongyan; Lv, Jie; Jia, Zhenhong

    2017-01-01

    A novel assembled biosensor was prepared for detecting 16S rRNA, a small-size persistent specific for Actinobacteria. The mechanism of the porous silicon (PS) photonic crystal biosensor is based on the fluorescence resonance energy transfer (FRET) between quantum dots (QDs) and gold nanoparticles (AuNPs) through DNA hybridization, where QDs act as an emission donor and AuNPs serve as a fluorescence quencher. Results showed that the photoluminescence (PL) intensity of PS photonic crystal was drastically increased when the QDs-conjugated probe DNA was adhered to the PS layer by surface modification using a standard cross-link chemistry method. The PL intensity of QDs was decreased when the addition of AuNPs-conjugated complementary 16S rRNA was dropped onto QDs-conjugated PS. Based on the analysis of different target DNA concentration, it was found that the decrease of the PL intensity showed a good linear relationship with complementary DNA concentration in a range from 0.25 to 10 μM, and the detection limit was 328.7 nM. Such an optical FRET biosensor functions on PS-based photonic crystal for DNA detection that differs from the traditional FRET, which is used only in liquid. This method will benefit the development of a new optical FRET label-free biosensor on Si substrate and has great potential in biochips based on integrated optical devices. PMID:28489033

  7. Synthesis and application of a triazene-ferrocene modifier for immobilization and characterization of oligonucleotides at electrodes.

    PubMed

    Hansen, Majken N; Farjami, Elaheh; Kristiansen, Martin; Clima, Lilia; Pedersen, Steen Uttrup; Daasbjerg, Kim; Ferapontova, Elena E; Gothelf, Kurt V

    2010-04-16

    A new DNA modifier containing triazene, ferrocene, and activated ester functionalities was synthesized and applied for electrochemical grafting and characterization of DNA at glassy carbon (GC) and gold electrodes. The modifier was synthesized from ferrocenecarboxylic acid by attaching a phenyltriazene derivative to one of the ferrocene Cp rings, while the other Cp ring containing the carboxylic acid was converted to an activated ester. The modifier was conjugated to an amine-modified DNA sequence. For immobilization of the conjugate at Au or GC electrodes, the triazene was activated by dimethyl sulfate for release of the diazonium salt. The salt was reductively converted to the aryl radical which was readily immobilized at the surface. DNA grafted onto electrodes exhibited remarkable hybridization properties, as detected through a reversible shift in the redox potential of the Fc redox label upon repeated hybridization/denaturation procedures with a complementary target DNA sequence. By using a methylene blue (MB) labeled target DNA sequence the hybridization could also be followed through the MB redox potential. Electrochemical studies demonstrated that grafting through the triazene modifier can successfully compete with existing protocols for DNA immobilization through the commonly used alkanethiol linkers and diazonium salts. Furthermore, the triazene modifier provides a practical one-step immobilization procedure.

  8. Detection of bacterial 16S rRNA using a molecular beacon-based X sensor

    PubMed Central

    Gerasimova, Yulia V.; Kolpashchikov, Dmitry M.

    2012-01-01

    We demonstrate how a long structurally constrained RNA can be analyzed in homogeneous solution at ambient temperatures with high specificity using a sophisticated biosensor. The sensor consists of a molecular beacon probe as a signal reporter and two DNA adaptor strands, which have fragments complementary to the reporter and to the analyzed RNA. One adaptor strand uses its long RNA-binding arm to unwind the RNA secondary structure. Second adaptor strand with a short RNA-binding arm hybridizes only to a fully complementary site, thus providing high recognition specificity. Overall the three-component sensor and the target RNA form a four-stranded DNA crossover (X) structure. Using this sensor, E.coli 16S rRNA was detected in real time with the detection limit of ~ 0.17 nM. The high specificity of the analysis was proven by differentiating B.subtilus from E.coli 16S rRNA sequences. The sensor responds to the presence of the analyte within seconds. PMID:23021850

  9. Rapid and sensitive detection of foodborne pathogenic bacteria (Staphylococcus aureus) using an electrochemical DNA genomic biosensor and its application in fresh beef.

    PubMed

    Abdalhai, Mandour H; Fernandes, António Maximiano; Bashari, Mohand; Ji, Jian; He, Qian; Sun, Xiulan

    2014-12-31

    Rapid early detection of food contamination is the main key in food safety and quality control. Biosensors are emerging as a vibrant area of research, and the use of DNA biosensor recognition detectors is relatively new. In this study a genomic DNA biosensor system with a fixing and capture probe was modified by a sulfhydryl and amino group, respectively, as complementary with target DNA. After immobilization and hybridization, the following sandwich structure fixing DNA-target DNA-capture DNA-PbS NPs was formed to detect pathogenic bacteria (Staphylococuus aureus EF529607.1) by using GCE modified with (multiwalled carbon nanotubes-chitosan-bismuth) to increase the sensitivity of the electrode. The modification procedure was characterized by cyclic voltammetry and electrochemical impedance spectroscopy. The sandwich structure was dissolved in 1 M nitric acid to become accessible to the electrode, and the PbS NPs was measured in solution by differential pulse voltammetry (DPV). The results showed that the detection limit of the DNA sensor was 3.17 × 10(-14) M S. aureus using PbS NPs, whereas the result for beef samples was 1.23 ng/mL. Thus, according to the experimental results presented, the DNA biosensor exhibited high sensitivity and rapid response, and it will be useful for the food matrix.

  10. A mass spectrometry-based multiplex SNP genotyping by utilizing allele-specific ligation and strand displacement amplification.

    PubMed

    Park, Jung Hun; Jang, Hyowon; Jung, Yun Kyung; Jung, Ye Lim; Shin, Inkyung; Cho, Dae-Yeon; Park, Hyun Gyu

    2017-05-15

    We herein describe a new mass spectrometry-based method for multiplex SNP genotyping by utilizing allele-specific ligation and strand displacement amplification (SDA) reaction. In this method, allele-specific ligation is first performed to discriminate base sequence variations at the SNP site within the PCR-amplified target DNA. The primary ligation probe is extended by a universal primer annealing site while the secondary ligation probe has base sequences as an overhang with a nicking enzyme recognition site and complementary mass marker sequence. The ligation probe pairs are ligated by DNA ligase only at specific allele in the target DNA and the resulting ligated product serves as a template to promote the SDA reaction using a universal primer. This process isothermally amplifies short DNA fragments, called mass markers, to be analyzed by mass spectrometry. By varying the sizes of the mass markers, we successfully demonstrated the multiplex SNP genotyping capability of this method by reliably identifying several BRCA mutations in a multiplex manner with mass spectrometry. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. A fluorescent aptasensor based on a DNA pyramid nanostructure for ultrasensitive detection of ochratoxin A.

    PubMed

    Nameghi, Morteza Alinezhad; Danesh, Noor Mohammad; Ramezani, Mohammad; Hassani, Faezeh Vahdati; Abnous, Khalil; Taghdisi, Seyed Mohammad

    2016-08-01

    Analytical techniques for detection of ochratoxin A (OTA) in food products and blood serum are of great significance. In this study, a fluorescent aptasensor was developed for sensitive and specific detection of OTA, based on a DNA pyramid nanostructure (DPN) and PicoGreen (PG) dye. The designed aptasensor inherits characteristics of DPN, such as high stability and capacity for PG loading. PG, as a fluorescent dye, could bind to double-stranded DNA (dsDNA). In the absence of OTA, the pyramid structure of DPN remains intact, leading to a very strong fluorescence emission. Because of higher affinity of aptamer for its target relative to its complementary strand, upon addition of target, the pyramid structure of DPN is disassembled, leading to a weak fluorescence emission. The presented aptasensor showed high specificity toward OTA with a limit of detection (LOD) as low as 0.135 nM. Besides, the designed sensing strategy was successfully utilized to recognize OTA in serum and grape juice with LODs of 0.184 and 0.149 nM, respectively.

  12. A sensitive colorimetric aptasensor based on trivalent peroxidase-mimic DNAzyme and magnetic nanoparticles.

    PubMed

    Liu, Shuwen; Xu, Naihan; Tan, Chunyan; Fang, Wei; Tan, Ying; Jiang, Yuyang

    2018-08-14

    In this study, a novel colorimetric aptasensor was prepared by coupling trivalent peroxidase-mimic DNAzyme and magnetic nanoparticles for highly sensitive and selective detection of target proteins. A three G-quadruplex (G4) DNA-hemin complex was employed as the trivalent peroxidase-mimic DNAzyme, in which hemin assisted the G4-DNA to fold into a catalytic conformation and act as an enzyme. The design of the aptasensor includes magnetic nanoparticles (MNPs), complementary DNA (cDNA) modified with biotin, and a label-free single strand DNA (ssDNA) including the aptamer and trivalent peroxidase-mimic DNAzyme. The trivalent DNAzyme, which has the highest catalytic activity among multivalent DNAzymes, catalyzed the H 2 O 2 -mediated oxidation of ABTS. The colorless ABTS was oxidized to produce a blue-green product that can be clearly distinguished by the naked eye. The aptamer and trivalent peroxidase-mimic DNAzyme promote the specificity and sensitivity of this detection method, which can be generalized for other targets by simply replacing the corresponding aptamers. To demonstrate the feasible use of the aptasensor for target detection, a well-known tumor biomarker MUC1 was evaluated as the model target. The limits of detection were determined to be 5.08 and 5.60 nM in a linear range of 50-1000 nM in a buffer solution and 10% serum system, respectively. This colorimetric and label-free aptasensor with excellent sensitivity and strong anti-interference ability has potential application in disease diagnoses, prognosis tracking, and therapeutic evaluation. Copyright © 2018 Elsevier B.V. All rights reserved.

  13. Procedure for normalization of cDNA libraries

    DOEpatents

    Bonaldo, M.D.; Soares, M.B.

    1997-12-30

    This invention provides a method to normalize a cDNA library constructed in a vector capable of being converted to single-stranded circles and capable of producing complementary nucleic acid molecules to the single-stranded circles comprising: (a) converting the cDNA library in single-stranded circles; (b) generating complementary nucleic acid molecules to the single-stranded circles; (c) hybridizing the single-stranded circles converted in step (a) with complementary nucleic acid molecules of step (b) to produce partial duplexes to an appropriate Cot; (e) separating the unhybridized single-stranded circles from the hybridized single-stranded circles, thereby generating a normalized cDNA library. 1 fig.

  14. Evidence for a Single-Stranded Adenovirus-Associated Virus Genome: Isolation and Separation of Complementary Single Strands

    PubMed Central

    Berns, K. I.; Rose, J. A.

    1970-01-01

    Single-stranded adenovirus-associated virus type 2 deoxyribonucleic acid (AAV-2 DNA) has been isolated from the virion after enzymatic pretreatment of the particles by heating at 53 C for 1 hr in 0.015 m NaCl plus 0.0015 m sodium citrate in the presence of 1% sodium dodecyl sulfate. Double-stranded AAV-2 DNA present as a marker is not denatured by this treatment. AAV-2 single-stranded DNA is composed of two complementary species which can be separated in neutral CsCl when 5-bromodeoxyuridine has been substituted for thymidine in the DNA. The present report is the first documented instance of the separation of complementary strands of an animal virus DNA. PMID:5429749

  15. 'Cold shock' increases the frequency of homology directed repair gene editing in induced pluripotent stem cells.

    PubMed

    Guo, Q; Mintier, G; Ma-Edmonds, M; Storton, D; Wang, X; Xiao, X; Kienzle, B; Zhao, D; Feder, John N

    2018-02-01

    Using CRISPR/Cas9 delivered as a RNA modality in conjunction with a lipid specifically formulated for large RNA molecules, we demonstrate that homology directed repair (HDR) rates between 20-40% can be achieved in induced pluripotent stem cells (iPSC). Furthermore, low HDR rates (between 1-20%) can be enhanced two- to ten-fold in both iPSCs and HEK293 cells by 'cold shocking' cells at 32 °C for 24-48 hours following transfection. This method can also increases the proportion of loci that have undergone complete sequence conversion across the donor sequence, or 'perfect HDR', as opposed to partial sequence conversion where nucleotides more distal to the CRISPR cut site are less efficiently incorporated ('partial HDR'). We demonstrate that the structure of the single-stranded DNA oligo donor can influence the fidelity of HDR, with oligos symmetric with respect to the CRISPR cleavage site and complementary to the target strand being more efficient at directing 'perfect HDR' compared to asymmetric non-target strand complementary oligos. Our protocol represents an efficient method for making CRISPR-mediated, specific DNA sequence changes within the genome that will facilitate the rapid generation of genetic models of human disease in iPSCs as well as other genome engineered cell lines.

  16. Guanine oxidation signal enhancement in DNA via a polyacrylonitrile nanofiber-coated and cyclic voltammetry-treated pencil graphite electrode

    NASA Astrophysics Data System (ADS)

    Aladag Tanik, Nilay; Demirkan, Elif; Aykut, Yakup

    2018-07-01

    This study investigated the electrochemical detection of specific nucleic acid hybridization sequences using a nanofiber-coated pencil graphite biosensor. The biosensor was developed to detect Val66Met single point mutations in the brain-derived neurotrophic factor gene, which is frequently observed in neurodegenerative diseases such as Alzheimer's disease, Parkinson's disease, and bipolar disorder. The oxidation signal of the most electroactive and stable DNA base, i.e., guanine, was used at approximately +1.0 V. Pencil graphite electrode (PGE) surfaces were coated with polyacrylonitrile nanofibers by electrospinning. Cyclic voltammetry was applied to the nanofiber-coated PGE to pretreat its surfaces. The application of cyclic voltammetry to the nanofiber-coated PGE surfaces before attaching the probe yielded a four fold increase in the oxidation signal for guanine compared with that using the untreated and uncoated PGE surface. The signal reductions were 70% for hybridization, 10% for non-complementary binding, and 14% for a single mismatch compared with the probe. The differences in full match, non-complementary, and mismatch binding indicated that the biosensor selectively detected the target, and that it was possible to determine hybridization in about 65 min. The detection limit was 0.19 μg/ml at a target concentration of 10 ppm.

  17. Electroactive chitosan nanoparticles for the detection of single-nucleotide polymorphisms using peptide nucleic acids.

    PubMed

    Kerman, Kagan; Saito, Masato; Tamiya, Eiichi

    2008-08-01

    Here we report an electrochemical biosensor that would allow for simple and rapid analysis of nucleic acids in combination with nuclease activity on nucleic acids and electroactive bionanoparticles. The detection of single-nucleotide polymorphisms (SNPs) using PNA probes takes advantage of the significant structural and physicochemical differences between the full hybrids and SNPs in PNA/DNA and DNA/DNA duplexes. Ferrocene-conjugated chitosan nanoparticles (Chi-Fc) were used as the electroactive indicator of hybridization. Chi-Fc had no affinity towards the neutral PNA probe immobilized on a gold electrode (AuE) surface. When the PNA probe on the electrode surface hybridized with a full-complementary target DNA, Chi-Fc electrostatically attached to the negatively-charged phosphate backbone of DNA on the surface and gave rise to a high electrochemical oxidation signal from ferrocene at approximately 0.30 V. Exposing the surface to a single-stranded DNA specific nuclease, Nuclease S1, was found to be very effective for removing the nonspecifically adsorbed SNP DNA. An SNP in the target DNA to PNA made it susceptible to the enzymatic digestion. After the enzymatic digestion and subsequent exposure to Chi-Fc, the presence of SNPs was determined by monitoring the changes in the electrical current response of Chi-Fc. The method provided a detection limit of 1 fM (S/N = 3) for the target DNA oligonucleotide. Additionally, asymmetric PCR was employed to detect the presence of genetically modified organism (GMO) in standard Roundup Ready soybean samples. PNA-mediated PCR amplification of real DNA samples was performed to detect SNPs related to alcohol dehydrogenase (ALDH). Chitosan nanoparticles are promising biomaterials for various analytical and pharmaceutical applications.

  18. New concepts of fluorescent probes for specific detection of DNA sequences: bis-modified oligonucleotides in excimer and exciplex detection.

    PubMed

    Gbaj, A; Bichenkova, Ev; Walsh, L; Savage, He; Sardarian, Ar; Etchells, Ll; Gulati, A; Hawisa, S; Douglas, Kt

    2009-12-01

    The detection of single base mismatches in DNA is important for diagnostics, treatment of genetic diseases, and identification of single nucleotide polymorphisms. Highly sensitive, specific assays are needed to investigate genetic samples from patients. The use of a simple fluorescent nucleoside analogue in detection of DNA sequence and point mutations by hybridisation in solution is described in this study. The 5'-bispyrene and 3'-naphthalene oligonucleotide probes form an exciplex on hybridisation to target in water and the 5'-bispyrene oligonucleotide alone is an adequate probe to determine concentration of target present. It was also indicated that this system has a potential to identify mismatches and insertions. The aim of this work was to investigate experimental structures and conditions that permit strong exciplex emission for nucleic acid detectors, and show how such exciplexes can register the presence of mismatches as required in SNP analysis. This study revealed that the hybridisation of 5'-bispyrenyl fluorophore to a DNA target results in formation of a fluorescent probe with high signal intensity change and specificity for detecting a complementary target in a homogeneous system. Detection of SNP mutations using this split-probe system is a highly specific, simple, and accessible method to meet the rigorous requirements of pharmacogenomic studies. Thus, it is possible for the system to act as SNP detectors and it shows promise for future applications in genetic testing.

  19. Fluorescent aptasensor for detection of four tetracycline veterinary drugs in milk based on catalytic hairpin assembly reaction and displacement of G-quadruplex.

    PubMed

    Zhou, Chen; Zou, Haimin; Sun, Chengjun; Ren, Dongxia; Xiong, Wei; Li, Yongxin

    2018-05-01

    Based on a novel signal amplification strategy by catalytic hairpin assembly and displacement of G-quadruplex DNA, an enzyme-free, non-label fluorescent aptasensing approach was established for sensitive detection of four tetracycline veterinary drugs in milk. The network consisted of a pair of partially complementary DNA hairpins (HP1 and HP2). The DNA aptamer of four tetracycline veterinary drugs was located at the sticky end of the HP1. The ring region of HP1 rich in G and C could form a stable G-quadruplex structure, which could emit specific fluorescence signal after binding with the fluorescent dye and N-methylmesoporphyrin IX (NMM). When presented in the system, the target analytes would be repeatedly used to trigger a recycling procedure between the hairpins, generating numerous HP1-HP2 duplex complexes and displacing G-quadruplex DNA. Thus, the sensitive detection of target analytes was achieved in a wide linear range (0-1000 μg/L) with the detection limit of 4.6 μg/L. Moreover, this proposed method showed high discrimination efficiency towards target analytes against other common mismatched veterinary drugs, and could be successfully applied to the analysis of milk samples. Graphical abstract Schematic of target analyte detection based on catalytic hairpin assembly reaction and displacement of G-quadruplex.

  20. Hybridization chain reaction-based colorimetric aptasensor of adenosine 5'-triphosphate on unmodified gold nanoparticles and two label-free hairpin probes.

    PubMed

    Gao, Zhuangqiang; Qiu, Zhenli; Lu, Minghua; Shu, Jian; Tang, Dianping

    2017-03-15

    This work designs a new label-free aptasensor for the colorimetric determination of small molecules (adenosine 5'-triphosphate, ATP) by using visible gold nanoparticles as the signal-generation tags, based on target-triggered hybridization chain reaction (HCR) between two hairpin DNA probes. The assay is carried out referring to the change in the color/absorbance by salt-induced aggregation of gold nanoparticles after the interaction with hairpins, gold nanoparticles and ATP. To construct such an assay system, two hairpin DNA probes with a short single-stranded DNA at the sticky end are utilized for interaction with gold nanoparticles. In the absence of target ATP, the hairpin DNA probes can prevent gold nanoparticles from the salt-induced aggregation through the interaction of the single-stranded DNA at the sticky end with gold nanoparticles. Upon target ATP introduction, the aptamer-based hairpin probe is opened to expose a new sticky end for the strand-displacement reaction with another complementary hairpin, thus resulting in the decreasing single-stranded DNA because of the consumption of hairpins. In this case, gold nanoparticles are uncovered owing to the formation of double-stranded DNA, which causes their aggregation upon addition of the salt, thereby leading to the change in the red-to-blue color. Under the optimal conditions, the HCR-based colorimetric assay presents good visible color or absorbance responses for the determination of target ATP at a concentration as low as 1.0nM. Importantly, the methodology can be further extended to quantitatively or qualitatively monitor other small molecules or biotoxins by changing the sequence of the corresponding aptamer. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Molecular inversion probe assay for allelic quantitation

    PubMed Central

    Ji, Hanlee; Welch, Katrina

    2010-01-01

    Molecular inversion probe (MIP) technology has been demonstrated to be a robust platform for large-scale dual genotyping and copy number analysis. Applications in human genomic and genetic studies include the possibility of running dual germline genotyping and combined copy number variation ascertainment. MIPs analyze large numbers of specific genetic target sequences in parallel, relying on interrogation of a barcode tag, rather than direct hybridization of genomic DNA to an array. The MIP approach does not replace, but is complementary to many of the copy number technologies being performed today. Some specific advantages of MIP technology include: Less DNA required (37 ng vs. 250 ng), DNA quality less important, more dynamic range (amplifications detected up to copy number 60), allele specific information “cleaner” (less SNP crosstalk/contamination), and quality of markers better (fewer individual MIPs versus SNPs needed to identify copy number changes). MIPs can be considered a candidate gene (targeted whole genome) approach and can find specific areas of interest that otherwise may be missed with other methods. PMID:19488872

  2. Metal Nanoparticles/Porous Silicon Microcavity Enhanced Surface Plasmon Resonance Fluorescence for the Detection of DNA.

    PubMed

    Wang, Jiajia; Jia, Zhenhong

    2018-02-23

    A porous silicon microcavity (PSiMC) with resonant peak wavelength of 635 nm was fabricated by electrochemical etching. Metal nanoparticles (NPs)/PSiMC enhanced fluorescence substrates were prepared by the electrostatic adherence of Au NPs that were distributed in PSiMC. The Au NPs/PSiMC device was used to characterize the target DNA immobilization and hybridization with its complementary DNA sequences marked with Rhodamine red (RRA). Fluorescence enhancement was observed on the Au NPs/PSiMC device substrate; and the minimum detection concentration of DNA ran up to 10 pM. The surface plasmon resonance (SPR) of the MC substrate; which is so well-positioned to improve fluorescence enhancement rather the fluorescence enhancement of the high reflection band of the Bragg reflector; would welcome such a highly sensitive in biosensor.

  3. Structural and Functional Characterization of an Archaeal Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)-associated Complex for Antiviral Defense (CASCADE)*

    PubMed Central

    Lintner, Nathanael G.; Kerou, Melina; Brumfield, Susan K.; Graham, Shirley; Liu, Huanting; Naismith, James H.; Sdano, Matthew; Peng, Nan; She, Qunxin; Copié, Valérie; Young, Mark J.; White, Malcolm F.; Lawrence, C. Martin

    2011-01-01

    In response to viral infection, many prokaryotes incorporate fragments of virus-derived DNA into loci called clustered regularly interspaced short palindromic repeats (CRISPRs). The loci are then transcribed, and the processed CRISPR transcripts are used to target invading viral DNA and RNA. The Escherichia coli “CRISPR-associated complex for antiviral defense” (CASCADE) is central in targeting invading DNA. Here we report the structural and functional characterization of an archaeal CASCADE (aCASCADE) from Sulfolobus solfataricus. Tagged Csa2 (Cas7) expressed in S. solfataricus co-purifies with Cas5a-, Cas6-, Csa5-, and Cas6-processed CRISPR-RNA (crRNA). Csa2, the dominant protein in aCASCADE, forms a stable complex with Cas5a. Transmission electron microscopy reveals a helical complex of variable length, perhaps due to substoichiometric amounts of other CASCADE components. A recombinant Csa2-Cas5a complex is sufficient to bind crRNA and complementary ssDNA. The structure of Csa2 reveals a crescent-shaped structure unexpectedly composed of a modified RNA-recognition motif and two additional domains present as insertions in the RNA-recognition motif. Conserved residues indicate potential crRNA- and target DNA-binding sites, and the H160A variant shows significantly reduced affinity for crRNA. We propose a general subunit architecture for CASCADE in other bacteria and Archaea. PMID:21507944

  4. Structural and functional characterization of an archaeal clustered regularly interspaced short palindromic repeat (CRISPR)-associated complex for antiviral defense (CASCADE).

    PubMed

    Lintner, Nathanael G; Kerou, Melina; Brumfield, Susan K; Graham, Shirley; Liu, Huanting; Naismith, James H; Sdano, Matthew; Peng, Nan; She, Qunxin; Copié, Valérie; Young, Mark J; White, Malcolm F; Lawrence, C Martin

    2011-06-17

    In response to viral infection, many prokaryotes incorporate fragments of virus-derived DNA into loci called clustered regularly interspaced short palindromic repeats (CRISPRs). The loci are then transcribed, and the processed CRISPR transcripts are used to target invading viral DNA and RNA. The Escherichia coli "CRISPR-associated complex for antiviral defense" (CASCADE) is central in targeting invading DNA. Here we report the structural and functional characterization of an archaeal CASCADE (aCASCADE) from Sulfolobus solfataricus. Tagged Csa2 (Cas7) expressed in S. solfataricus co-purifies with Cas5a-, Cas6-, Csa5-, and Cas6-processed CRISPR-RNA (crRNA). Csa2, the dominant protein in aCASCADE, forms a stable complex with Cas5a. Transmission electron microscopy reveals a helical complex of variable length, perhaps due to substoichiometric amounts of other CASCADE components. A recombinant Csa2-Cas5a complex is sufficient to bind crRNA and complementary ssDNA. The structure of Csa2 reveals a crescent-shaped structure unexpectedly composed of a modified RNA-recognition motif and two additional domains present as insertions in the RNA-recognition motif. Conserved residues indicate potential crRNA- and target DNA-binding sites, and the H160A variant shows significantly reduced affinity for crRNA. We propose a general subunit architecture for CASCADE in other bacteria and Archaea.

  5. A label-free, fluorescence based assay for microarray

    NASA Astrophysics Data System (ADS)

    Niu, Sanjun

    DNA chip technology has drawn tremendous attention since it emerged in the mid 90's as a method that expedites gene sequencing by over 100-fold. DNA chip, also called DNA microarray, is a combinatorial technology in which different single-stranded DNA (ssDNA) molecules of known sequences are immobilized at specific spots. The immobilized ssDNA strands are called probes. In application, the chip is exposed to a solution containing ssDNA of unknown sequence, called targets, which are labeled with fluorescent dyes. Due to specific molecular recognition among the base pairs in the DNA, the binding or hybridization occurs only when the probe and target sequences are complementary. The nucleotide sequence of the target is determined by imaging the fluorescence from the spots. The uncertainty of background in signal detection and statistical error in data analysis, primarily due to the error in the DNA amplification process and statistical distribution of the tags in the target DNA, have become the fundamental barriers in bringing the technology into application for clinical diagnostics. Furthermore, the dye and tagging process are expensive, making the cost of DNA chips inhibitive for clinical testing. These limitations and challenges make it difficult to implement DNA chip methods as a diagnostic tool in a pathology laboratory. The objective of this dissertation research is to provide an alternative approach that will address the above challenges. In this research, a label-free assay is designed and studied. Polystyrene (PS), a commonly used polymeric material, serves as the fluorescence agent. Probe ssDNA is covalently immobilized on polystyrene thin film that is supported by a reflecting substrate. When this chip is exposed to excitation light, fluorescence light intensity from PS is detected as the signal. Since the optical constants and conformations of ssDNA and dsDNA (double stranded DNA) are different, the measured fluorescence from PS changes for the same intensity of excitation light. The fluorescence contrast is used to quantify the amount of probe-target hybridization. A mathematical model that considers multiple reflections and scattering is developed to explain the mechanism of the fluorescence contrast which depends on the thickness of the PS film. Scattering is the dominant factor that contributes to the contrast. The potential of this assay to detect single nucleotide polymorphism is also tested.

  6. Identification of genes modulated in rheumatoid arthritis using complementary DNA microarray analysis of lymphoblastoid B cell lines from disease-discordant monozygotic twins.

    PubMed

    Haas, Christian S; Creighton, Chad J; Pi, Xiujun; Maine, Ira; Koch, Alisa E; Haines, G Kenneth; Ling, Song; Chinnaiyan, Arul M; Holoshitz, Joseph

    2006-07-01

    To identify disease-specific gene expression profiles in patients with rheumatoid arthritis (RA), using complementary DNA (cDNA) microarray analyses on lymphoblastoid B cell lines (LCLs) derived from RA-discordant monozygotic (MZ) twins. The cDNA was prepared from LCLs derived from the peripheral blood of 11 pairs of RA-discordant MZ twins. The RA twin cDNA was labeled with cy5 fluorescent dye, and the cDNA of the healthy co-twin was labeled with cy3. To determine relative expression profiles, cDNA from each twin pair was combined and hybridized on 20,000-element microarray chips. Immunohistochemistry and real-time polymerase chain reaction were used to detect the expression of selected gene products in synovial tissue from patients with RA compared with patients with osteoarthritis and normal healthy controls. In RA twin LCLs compared with healthy co-twin LCLs, 1,163 transcripts were significantly differentially expressed. Of these, 747 were overexpressed and 416 were underexpressed. Gene ontology analysis revealed many genes known to play a role in apoptosis, angiogenesis, proteolysis, and signaling. The 3 most significantly overexpressed genes were laeverin (a novel enzyme with sequence homology to CD13), 11beta-hydroxysteroid dehydrogenase type 2 (a steroid pathway enzyme), and cysteine-rich, angiogenic inducer 61 (a known angiogenic factor). The products of these genes, heretofore uncharacterized in RA, were all abundantly expressed in RA synovial tissues. Microarray cDNA analysis of peripheral blood-derived LCLs from well-controlled patient populations is a useful tool to detect RA-relevant genes and could help in identifying novel therapeutic targets.

  7. A Single Electrochemical Probe Used for Analysis of Multiple Nucleic Acid Sequences

    PubMed Central

    Mills, Dawn M.; Calvo-Marzal, Percy; Pinzon, Jeffer M.; Armas, Stephanie; Kolpashchikov, Dmitry M.; Chumbimuni-Torres, Karin Y.

    2017-01-01

    Electrochemical hybridization sensors have been explored extensively for analysis of specific nucleic acids. However, commercialization of the platform is hindered by the need for attachment of separate oligonucleotide probes complementary to a RNA or DNA target to an electrode’s surface. Here we demonstrate that a single probe can be used to analyze several nucleic acid targets with high selectivity and low cost. The universal electrochemical four-way junction (4J)-forming (UE4J) sensor consists of a universal DNA stem-loop (USL) probe attached to the electrode’s surface and two adaptor strands (m and f) which hybridize to the USL probe and the analyte to form a 4J associate. The m adaptor strand was conjugated with a methylene blue redox marker for signal ON sensing and monitored using square wave voltammetry. We demonstrated that a single sensor can be used for detection of several different DNA/RNA sequences and can be regenerated in 30 seconds by a simple water rinse. The UE4J sensor enables a high selectivity by recognition of a single base substitution, even at room temperature. The UE4J sensor opens a venue for a re-useable universal platform that can be adopted at low cost for the analysis of DNA or RNA targets. PMID:29371782

  8. Evaluation of digital PCR for absolute RNA quantification.

    PubMed

    Sanders, Rebecca; Mason, Deborah J; Foy, Carole A; Huggett, Jim F

    2013-01-01

    Gene expression measurements detailing mRNA quantities are widely employed in molecular biology and are increasingly important in diagnostic fields. Reverse transcription (RT), necessary for generating complementary DNA, can be both inefficient and imprecise, but remains a quintessential RNA analysis tool using qPCR. This study developed a Transcriptomic Calibration Material and assessed the RT reaction using digital (d)PCR for RNA measurement. While many studies characterise dPCR capabilities for DNA quantification, less work has been performed investigating similar parameters using RT-dPCR for RNA analysis. RT-dPCR measurement using three, one-step RT-qPCR kits was evaluated using single and multiplex formats when measuring endogenous and synthetic RNAs. The best performing kit was compared to UV quantification and sensitivity and technical reproducibility investigated. Our results demonstrate assay and kit dependent RT-dPCR measurements differed significantly compared to UV quantification. Different values were reported by different kits for each target, despite evaluation of identical samples using the same instrument. RT-dPCR did not display the strong inter-assay agreement previously described when analysing DNA. This study demonstrates that, as with DNA measurement, RT-dPCR is capable of accurate quantification of low copy RNA targets, but the results are both kit and target dependent supporting the need for calibration controls.

  9. Homogenous assay for protein detection based on proximity DNA hybridization and isothermal circular strand displacement amplification reaction.

    PubMed

    Zhang, Manjun; Li, Ruimin; Ling, Liansheng

    2017-06-01

    This work proposed a homogenous fluorescence assay for proteins, based on the target-triggered proximity DNA hybridization in combination with strand displacement amplification (SDA). It benefited from target-triggered proximity DNA hybridization to specifically recognize the target and SDA making recycling signal amplification. The system included a molecular beacon (MB), an extended probe (EP), and an assistant probe (AP), which were not self-assembly in the absence of target proteins, due to the short length of the designed complementary sequence among MB, EP, and AP. Upon addition of the target proteins, EP and AP are bound to the target proteins, which induced the occurrence of proximity hybridization between MB, EP, and AP and followed by strand displacement amplification. Through the primer extension, a tripartite complex of probes and target was displaced and recycled to hybridize with another MB, and the more opened MB enabled the detection signal to amplify. Under optimum conditions, it was used for the detection of streptavidin and thrombin. Fluorescence intensity was proportional to the concentration of streptavidin and thrombin in the range of 0.2-30 and 0.2-35 nmol/L, respectively. Furthermore, this fluorescent method has a good selectivity, in which the fluorescence intensity of thrombin was ~37-fold or even larger than that of the other proteins at the same concentration. It is a new and simple method for SDA-involved target protein detection and possesses a great potential for other protein detection in the future. Graphical abstract A homogenous assay for protein detection is based on proximity DNA hybridization and strand displacement amplification reaction.

  10. Detection of DNA damage by using hairpin molecular beacon probes and graphene oxide.

    PubMed

    Zhou, Jie; Lu, Qian; Tong, Ying; Wei, Wei; Liu, Songqin

    2012-09-15

    A hairpin molecular beacon tagged with carboxyfluorescein in combination with graphene oxide as a quencher reagent was used to detect the DNA damage by chemical reagents. The fluorescence of molecular beacon was quenched sharply by graphene oxide; while in the presence of its complementary DNA the quenching efficiency decreased because their hybridization prevented the strong adsorbability of molecular beacon on graphene oxide. If the complementary DNA was damaged by a chemical reagent and could not form intact duplex structure with molecular beacon, more molecular beacon would adsorb on graphene oxide increasing the quenching efficiency. Thus, damaged DNA could be detected based on different quenching efficiencies afforded by damaged and intact complementary DNA. The damage effects of chlorpyrifos-methyl and three metabolites of styrene such as mandelieaeids, phenylglyoxylieaeids and epoxystyrene on DNA were studied as models. The method for detection of DNA damage was reliable, rapid and simple compared to the biological methods. Copyright © 2012 Elsevier B.V. All rights reserved.

  11. Vesicle Fusion Observed by Content Transfer across a Tethered Lipid Bilayer

    PubMed Central

    Rawle, Robert J.; van Lengerich, Bettina; Chung, Minsub; Bendix, Poul Martin; Boxer, Steven G.

    2011-01-01

    Synaptic transmission is achieved by exocytosis of small, synaptic vesicles containing neurotransmitters across the plasma membrane. Here, we use a DNA-tethered freestanding bilayer as a target architecture that allows observation of content transfer of individual vesicles across the tethered planar bilayer. Tethering and fusion are mediated by hybridization of complementary DNA-lipid conjugates inserted into the two membranes, and content transfer is monitored by the dequenching of an aqueous content dye. By analyzing the diffusion profile of the aqueous dye after vesicle fusion, we are able to distinguish content transfer across the tethered bilayer patch from vesicle leakage above the patch. PMID:22004762

  12. Lipophilic oligonucleotides spontaneously insert into lipid membranes, bind complementary DNA strands, and sequester into lipid-disordered domains.

    PubMed

    Bunge, Andreas; Kurz, Anke; Windeck, Anne-Kathrin; Korte, Thomas; Flasche, Wolfgang; Liebscher, Jürgen; Herrmann, Andreas; Huster, Daniel

    2007-04-10

    For the development of surface functionalized bilayers, we have synthesized lipophilic oligonucleotides to combine the molecular recognition mechanism of nucleic acids and the self-assembly characteristics of lipids in planar membranes. A lipophilic oligonucleotide consisting of 21 thymidine units and two lipophilic nucleotides with an alpha-tocopherol moiety as a lipophilic anchor was synthesized using solid-phase methods with a phosphoramadite strategy. The interaction of the water soluble lipophilic oligonucleotide with vesicular lipid membranes and its capability to bind complementary DNA strands was studied using complementary methods such as NMR, EPR, DSC, fluorescence spectroscopy, and fluorescence microscopy. This oligonucleotide inserted stably into preformed membranes from the aqueous phase. Thereby, no significant perturbation of the lipid bilayer and its stability was observed. However, the non-lipidated end of the oligonucleotide is exposed to the aqueous environment, is relatively mobile, and is free to interact with complementary DNA strands. Binding of the complementary single-stranded DNA molecules is fast and accomplished by the formation of Watson-Crick base pairs, which was confirmed by 1H NMR chemical shift analysis and fluorescence resonance energy transfer. The molecular structure of the membrane bound DNA double helix is very similar to the free double-stranded DNA. Further, the membrane bound DNA double strands also undergo regular melting. Finally, in raft-like membrane mixtures, the lipophilic oligonucleotide was shown to preferentially sequester into liquid-disordered membrane domains.

  13. DNA Photo Lithography with Cinnamate-based Photo-Bio-Nano-Glue

    NASA Astrophysics Data System (ADS)

    Feng, Lang; Li, Minfeng; Romulus, Joy; Sha, Ruojie; Royer, John; Wu, Kun-Ta; Xu, Qin; Seeman, Nadrian; Weck, Marcus; Chaikin, Paul

    2013-03-01

    We present a technique to make patterned functional surfaces, using a cinnamate photo cross-linker and photolithography. We have designed and modified a complementary set of single DNA strands to incorporate a pair of opposing cinnamate molecules. On exposure to 360nm UV, the cinnamate makes a highly specific covalent bond permanently linking only the complementary strands containing the cinnamates. We have studied this specific and efficient crosslinking with cinnamate-containing DNA in solution and on particles. UV addressability allows us to pattern surfaces functionally. The entire surface is coated with a DNA sequence A incorporating cinnamate. DNA strands A'B with one end containing a complementary cinnamated sequence A' attached to another sequence B, are then hybridized to the surface. UV photolithography is used to bind the A'B strand in a specific pattern. The system is heated and the unbound DNA is washed away. The pattern is then observed by thermo-reversibly hybridizing either fluorescently dyed B' strands complementary to B, or colloids coated with B' strands. Our techniques can be used to reversibly and/or permanently bind, via DNA linkers, an assortment of molecules, proteins and nanostructures. Potential applications range from advanced self-assembly, such as templated self-replication schemes recently reported, to designed physical and chemical patterns, to high-resolution multi-functional DNA surfaces for genetic detection or DNA computing.

  14. A self-assembled deoxyribonucleic acid concatemer for sensitive detection of single nucleotide polymorphism.

    PubMed

    Wu, Wei; Chen, Junhua; Fang, Zhiyuan; Ge, Chenchen; Xiang, Zhicheng; Ouyang, Chuanyan; Lie, Puchang; Xiao, Zhuo; Yu, Luxin; Wang, Lin; Zeng, Lingwen

    2013-12-04

    Polymerase-free and label-free strategies for DNA detection have shown excellent sensitivity and specificity in various biological samples. Herein, we propose a method for single nucleotide polymorphism (SNP) detection by using self-assembled DNA concatemers. Capture probes, bound to magnetic beads, can joint mediator probes by T4 DNA ligase in the presence of target DNA that is complementary to the capture probe and mediator probe. The mediator probes trigger self-assembly of two auxiliary probes on magnetic beads to form DNA concatemers. Separated by a magnetic rack, the double-stranded concatemers on beads can recruit a great amount of SYBR Green I and eventually result in amplified fluorescent signals. In comparison with reported methods for SNP detection, the concatemer-based approach has significant advantages of low background, simplicity, and ultrasensitivity, making it as a convenient platform for clinical applications. As a proof of concept, BRAF(T1799A) oncogene mutation, a SNP involved in diverse human cancers, was used as a model target. The developed approach using a fluorescent intercalator can detect as low as 0.1 fM target BRAF(T1799A) DNA, which is better than those previously published methods for SNP detection. This method is robust and can be used directly to measure the BRAF(T1799A) DNA in complex human serum with excellent recovery (94-103%). It is expected that this assay principle can be directed toward other SNP genes by simply changing the mediator probe and auxiliary probes. Copyright © 2013 Elsevier B.V. All rights reserved.

  15. Rapid and sensitive PCR-dipstick DNA chromatography for multiplex analysis of the oral microbiota.

    PubMed

    Tian, Lingyang; Sato, Takuichi; Niwa, Kousuke; Kawase, Mitsuo; Tanner, Anne C R; Takahashi, Nobuhiro

    2014-01-01

    A complex of species has been associated with dental caries under the ecological hypothesis. This study aimed to develop a rapid, sensitive PCR-dipstick DNA chromatography assay that could be read by eye for multiplex and semiquantitative analysis of plaque bacteria. Parallel oligonucleotides were immobilized on a dipstick strip for multiplex analysis of target DNA sequences of the caries-associated bacteria, Streptococcus mutans, Streptococcus sobrinus, Scardovia wiggsiae, Actinomyces species, and Veillonella parvula. Streptavidin-coated blue-colored latex microspheres were to generate signal. Target DNA amplicons with an oligonucleotide-tagged terminus and a biotinylated terminus were coupled with latex beads through a streptavidin-biotin interaction and then hybridized with complementary oligonucleotides on the strip. The accumulation of captured latex beads on the test and control lines produced blue bands, enabling visual detection with the naked eye. The PCR-dipstick DNA chromatography detected quantities as low as 100 pg of DNA amplicons and demonstrated 10- to 1000-fold higher sensitivity than PCR-agarose gel electrophoresis, depending on the target bacterial species. Semiquantification of bacteria was performed by obtaining a series of chromatograms using serial 10-fold dilution of PCR-amplified DNA extracted from dental plaque samples. The assay time was less than 3 h. The semiquantification procedure revealed the relative amounts of each test species in dental plaque samples, indicating that this disposable device has great potential in analysis of microbial composition in the oral cavity and intestinal tract, as well as in point-of-care diagnosis of microbiota-associated diseases.

  16. Rapid and Sensitive PCR-Dipstick DNA Chromatography for Multiplex Analysis of the Oral Microbiota

    PubMed Central

    Niwa, Kousuke; Kawase, Mitsuo; Tanner, Anne C. R.; Takahashi, Nobuhiro

    2014-01-01

    A complex of species has been associated with dental caries under the ecological hypothesis. This study aimed to develop a rapid, sensitive PCR-dipstick DNA chromatography assay that could be read by eye for multiplex and semiquantitative analysis of plaque bacteria. Parallel oligonucleotides were immobilized on a dipstick strip for multiplex analysis of target DNA sequences of the caries-associated bacteria, Streptococcus mutans, Streptococcus sobrinus, Scardovia wiggsiae, Actinomyces species, and Veillonella parvula. Streptavidin-coated blue-colored latex microspheres were to generate signal. Target DNA amplicons with an oligonucleotide-tagged terminus and a biotinylated terminus were coupled with latex beads through a streptavidin-biotin interaction and then hybridized with complementary oligonucleotides on the strip. The accumulation of captured latex beads on the test and control lines produced blue bands, enabling visual detection with the naked eye. The PCR-dipstick DNA chromatography detected quantities as low as 100 pg of DNA amplicons and demonstrated 10- to 1000-fold higher sensitivity than PCR-agarose gel electrophoresis, depending on the target bacterial species. Semiquantification of bacteria was performed by obtaining a series of chromatograms using serial 10-fold dilution of PCR-amplified DNA extracted from dental plaque samples. The assay time was less than 3 h. The semiquantification procedure revealed the relative amounts of each test species in dental plaque samples, indicating that this disposable device has great potential in analysis of microbial composition in the oral cavity and intestinal tract, as well as in point-of-care diagnosis of microbiota-associated diseases. PMID:25485279

  17. The Ties That Bind: Mapping the Dynamic Enhancer-Promoter Interactome.

    PubMed

    Spurrell, Cailyn H; Dickel, Diane E; Visel, Axel

    2016-11-17

    Coupling chromosome conformation capture to molecular enrichment for promoter-containing DNA fragments enables the systematic mapping of interactions between individual distal regulatory sequences and their target genes. In this Minireview, we describe recent progress in the application of this technique and related complementary approaches to gain insight into the lineage- and cell-type-specific dynamics of interactions between regulators and gene promoters. Copyright © 2016 Elsevier Inc. All rights reserved.

  18. Growth of equilibrium structures built from a large number of distinct component types.

    PubMed

    Hedges, Lester O; Mannige, Ranjan V; Whitelam, Stephen

    2014-09-14

    We use simple analytic arguments and lattice-based computer simulations to study the growth of structures made from a large number of distinct component types. Components possess 'designed' interactions, chosen to stabilize an equilibrium target structure in which each component type has a defined spatial position, as well as 'undesigned' interactions that allow components to bind in a compositionally-disordered way. We find that high-fidelity growth of the equilibrium target structure can happen in the presence of substantial attractive undesigned interactions, as long as the energy scale of the set of designed interactions is chosen appropriately. This observation may help explain why equilibrium DNA 'brick' structures self-assemble even if undesigned interactions are not suppressed [Ke et al. Science, 338, 1177, (2012)]. We also find that high-fidelity growth of the target structure is most probable when designed interactions are drawn from a distribution that is as narrow as possible. We use this result to suggest how to choose complementary DNA sequences in order to maximize the fidelity of multicomponent self-assembly mediated by DNA. We also comment on the prospect of growing macroscopic structures in this manner.

  19. Label-free electrochemical genosensor based on mesoporous silica thin film.

    PubMed

    Saadaoui, Maroua; Fernández, Iñigo; Luna, Gema; Díez, Paula; Campuzano, Susana; Raouafi, Noureddine; Sánchez, Alfredo; Pingarrón, José M; Villalonga, Reynaldo

    2016-10-01

    A novel label-free electrochemical strategy for nucleic acid detection was developed by using gold electrodes coated with mesoporous silica thin films as sensing interface. The biosensing approach relies on the covalent attachment of a capture DNA probe on the surface of the silica nanopores and further hybridization with its complementary target oligonucleotide sequence, causing a diffusion hindering of an Fe(CN)6 (3-/4-) electrochemical probe through the nanochannels of the mesoporous film. This DNA-mesoporous silica thin film-modified electrodes allowed sensitive (91.7 A/M) and rapid (45 min) detection of low nanomolar levels of synthetic target DNA (25 fmol) and were successfully employed to quantify the endogenous content of Escherichia coli 16S ribosomal RNA (rRNA) directly in raw bacterial lysate samples without isolation or purification steps. Moreover, the 1-month stability demonstrated by these biosensing devices enables their advanced preparation and storage, as desired for practical real-life applications. Graphical abstract Mesoporous silica thin films as scaffolds for the development of novel label-free electrochemical genosensors to perform selective, sensitive and rapid detection of target oligonucleotide sequences. Application towards E. coli determination.

  20. Sensitive detection of multiple pathogens using a single DNA probe.

    PubMed

    Nordin, Noordiana; Yusof, Nor Azah; Abdullah, Jaafar; Radu, Son; Hushiarian, Roozbeh

    2016-12-15

    A simple but promising electrochemical DNA nanosensor was designed, constructed and applied to differentiate a few food-borne pathogens. The DNA probe was initially designed to have a complementary region in Vibrio parahaemolyticus (VP) genome and to make different hybridization patterns with other selected pathogens. The sensor was based on a screen printed carbon electrode (SPCE) modified with polylactide-stabilized gold nanoparticles (PLA-AuNPs) and methylene blue (MB) was employed as the redox indicator binding better to single-stranded DNA. The immobilization and hybridization events were assessed using differential pulse voltammetry (DPV). The fabricated biosensor was able to specifically distinguish complementary, non-complementary and mismatched oligonucleotides. DNA was measured in the range of 2.0×10(-9)-2.0×10(-13)M with a detection limit of 5.3×10(-12)M. The relative standard deviation for 6 replications of DPV measurement of 0.2µM complementary DNA was 4.88%. The fabricated DNA biosensor was considered stable and portable as indicated by a recovery of more than 80% after a storage period of 6 months at 4-45°C. Cross-reactivity studies against various food-borne pathogens showed a reliably sensitive detection of VP. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Unfolding and Targeting Thermodynamics of a DNA Intramolecular Complex with Joined Triplex-Duplex Domains.

    PubMed

    Johnson, Sarah E; Reiling-Steffensmeier, Calliste; Lee, Hui-Ting; Marky, Luis A

    2018-01-25

    Our laboratory is interested in developing methods that can be used for the control of gene expression. In this work, we are investigating the reaction of an intramolecular complex containing a triplex-duplex junction with partially complementary strands. We used a combination of isothermal titration calorimetry (ITC), differential scanning calorimetry (DSC), and spectroscopy techniques to determine standard thermodynamic profiles for these targeting reactions. Specifically, we have designed single strands to target one loop (CTTTC) or two loops (CTTTC and GCAA) of this complex. Both reactions yielded exothermic enthalpies of -66.3 and -82.8 kcal/mol by ITC, in excellent agreement with the reaction enthalpies of -72.7 and -88.7 kcal/mol, respectively, obtained from DSC Hess cycles. The favorable heat contributions result from the formation of base-pair stacks involving mainly the unpaired bases of the loops. This shows that each complementary strand is able to invade and disrupt the secondary structure. The simultaneous targeting of two loops yielded a more favorable reaction free energy, by approximately -8 kcal/mol, which corresponds to the formation of roughly four base-pair stacks involving the unpaired bases of the 5'-GCAA loop. The main conclusion is that the targeting of loops with a large number of unpaired bases results in a more favorable reaction free energy.

  2. Strand-invading linear probe combined with unmodified PNA.

    PubMed

    Asanuma, Hiroyuki; Niwa, Rie; Akahane, Mariko; Murayama, Keiji; Kashida, Hiromu; Kamiya, Yukiko

    2016-09-15

    Efficient strand invasion by a linear probe to fluorescently label double-stranded DNA has been implemented by employing a probe and unmodified PNA. As a fluorophore, we utilized ethynylperylene. Multiple ethynylperylene residues were incorporated into the DNA probe via a d-threoninol scaffold. The ethynylperylene did not significantly disrupt hybridization with complementary DNA. The linear probe self-quenched in the absence of target DNA and did not hybridize with PNA. A gel-shift assay revealed that linear probe and PNA combination invaded the central region of double-stranded DNA upon heat-shock treatment to form a double duplex. To further suppress the background emission and increase the stability of the probe/DNA duplex, a probe containing anthraquinones as well as ethynylperylene was synthesized. This probe and PNA invader pair detected an internal sequence in a double-stranded DNA with high sensitivity when heat shock treatment was used. The probe and PNA pair was able to invade at the terminus of a long double-stranded DNA at 40°C at 100mM NaCl concentration. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. In vivo, cardiac-specific knockdown of target protein, Malic Enzyme-1, in rat via adenoviral delivery of DNA for non-native miRNA

    PubMed Central

    O'Donnell, J. Michael; Kalichira, Asha; Bi, Jian; Lewandowski, E. Douglas

    2013-01-01

    This study examines the feasibility of using the adenoviral delivery of DNA for a non-native microRNA to suppress expression of a target protein (cytosolic NADP+-dependent malic-enzyme 1, ME1) in whole heart in vivo, via an isolated-heart coronary perfusion approach. Complementary DNA constructs for ME1 microRNA were inserted into adenoviral vectors. Viral gene transfer to neonatal rat cardiomyocytes yielded 65% suppression of ME1 protein. This viral package was delivered to rat hearts in vivo (Adv.miR_ME1, 1013 vp/ml PBS) via coronary perfusion, using a cardiac-specific isolation technique. ME1 mRNA was reduced by 73% at 2-6 days post-surgery in heart receiving the Adv.miR_ME1. Importantly, ME1 protein was reduced by 66% (p<0.0002) at 5-6 days relative to sham-operated control hearts. Non-target protein expression for GAPDH, calsequestrin, and mitochondrial malic enzyme, ME3, were all unchanged. The non-target isoform, ME2, was unchanged at 2-5 days and reduced at day 6. This new approach demonstrates for the first time significant and acute silencing of target RNA translation and protein content in whole heart, in vivo, via non-native microRNA expression. PMID:22974418

  4. Hit-Validation Methodologies for Ligands Isolated from DNA-Encoded Chemical Libraries.

    PubMed

    Zimmermann, Gunther; Li, Yizhou; Rieder, Ulrike; Mattarella, Martin; Neri, Dario; Scheuermann, Jörg

    2017-05-04

    DNA-encoded chemical libraries (DECLs) are large collections of compounds linked to DNA fragments, serving as amplifiable barcodes, which can be screened on target proteins of interest. In typical DECL selections, preferential binders are identified by high-throughput DNA sequencing, by comparing their frequency before and after the affinity capture step. Hits identified in this procedure need to be confirmed, by resynthesis and by performing affinity measurements. In this article we present new methods based on hybridization of oligonucleotide conjugates with fluorescently labeled complementary oligonucleotides; these facilitate the determination of affinity constants and kinetic dissociation constants. The experimental procedures were demonstrated with acetazolamide, a binder to carbonic anhydrase IX with a dissociation constant in the nanomolar range. The detection of binding events was compatible not only with fluorescence polarization methodologies, but also with Alphascreen technology and with microscale thermophoresis. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Efficient and simpler method to construct normalized cDNA libraries with improved representations of full-length cDNAs

    DOEpatents

    Soares, Marcelo Bento; Bonaldo, Maria de Fatima

    1998-01-01

    This invention provides a method to normalize a cDNA library comprising: (a) constructing a directionally cloned library containing cDNA inserts wherein the insert is capable of being amplified by polymerase chain reaction; (b) converting a double-stranded cDNA library into single-stranded DNA circles; (c) generating single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) by polymerase chain reaction with appropriate primers; (d) hybridizing the single-stranded DNA circles converted in step (b) with the complementary single-stranded nucleic acid molecules generated in step (c) to produce partial duplexes to an appropriate Cot; and (e) separating the unhybridized single-stranded DNA circles from the hybridized DNA circles, thereby generating a normalized cDNA library. This invention also provides a method to normalize a cDNA library wherein the generating of single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) is by excising cDNA inserts from the double-stranded cDNA library; purifying the cDNA inserts from cloning vectors; and digesting the cDNA inserts with an exonuclease. This invention further provides a method to construct a subtractive cDNA library following the steps described above. This invention further provides normalized and/or subtractive cDNA libraries generated by the above methods.

  6. Efficient and simpler method to construct normalized cDNA libraries with improved representations of full-length cDNAs

    DOEpatents

    Soares, M.B.; Fatima Bonaldo, M. de

    1998-12-08

    This invention provides a method to normalize a cDNA library comprising: (a) constructing a directionally cloned library containing cDNA inserts wherein the insert is capable of being amplified by polymerase chain reaction; (b) converting a double-stranded cDNA library into single-stranded DNA circles; (c) generating single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) by polymerase chain reaction with appropriate primers; (d) hybridizing the single-stranded DNA circles converted in step (b) with the complementary single-stranded nucleic acid molecules generated in step (c) to produce partial duplexes to an appropriate Cot; and (e) separating the unhybridized single-stranded DNA circles from the hybridized DNA circles, thereby generating a normalized cDNA library. This invention also provides a method to normalize a cDNA library wherein the generating of single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) is by excising cDNA inserts from the double-stranded cDNA library; purifying the cDNA inserts from cloning vectors; and digesting the cDNA inserts with an exonuclease. This invention further provides a method to construct a subtractive cDNA library following the steps described above. This invention further provides normalized and/or subtractive cDNA libraries generated by the above methods. 25 figs.

  7. Hardware Acceleration Of Multi-Deme Genetic Algorithm for DNA Codeword Searching

    DTIC Science & Technology

    2008-01-01

    C and G are complementary to each other. A Watson - Crick complement of a DNA sequence is another DNA sequence which replaces all the A with T or vise...versa and replaces all the T with A or vise versa, and also switches the 5’ and 3’ ends. A DNA sequence binds most stably with its Watson - Crick ...bind with 5 Watson - Crick pairs. The length of the longest complementary sequence between two flexible DNA strands, A and B, is the same as the

  8. A Sequence-Dependent DNA Condensation Induced by Prion Protein

    PubMed Central

    2018-01-01

    Different studies indicated that the prion protein induces hybridization of complementary DNA strands. Cell culture studies showed that the scrapie isoform of prion protein remained bound with the chromosome. In present work, we used an oxazole dye, YOYO, as a reporter to quantitative characterization of the DNA condensation by prion protein. We observe that the prion protein induces greater fluorescence quenching of YOYO intercalated in DNA containing only GC bases compared to the DNA containing four bases whereas the effect of dye bound to DNA containing only AT bases is marginal. DNA-condensing biological polyamines are less effective than prion protein in quenching of DNA-bound YOYO fluorescence. The prion protein induces marginal quenching of fluorescence of the dye bound to oligonucleotides, which are resistant to condensation. The ultrastructural studies with electron microscope also validate the biophysical data. The GC bases of the target DNA are probably responsible for increased condensation in the presence of prion protein. To our knowledge, this is the first report of a human cellular protein inducing a sequence-dependent DNA condensation. The increased condensation of GC-rich DNA by prion protein may suggest a biological function of the prion protein and a role in its pathogenesis. PMID:29657864

  9. A Sequence-Dependent DNA Condensation Induced by Prion Protein.

    PubMed

    Bera, Alakesh; Biring, Sajal

    2018-01-01

    Different studies indicated that the prion protein induces hybridization of complementary DNA strands. Cell culture studies showed that the scrapie isoform of prion protein remained bound with the chromosome. In present work, we used an oxazole dye, YOYO, as a reporter to quantitative characterization of the DNA condensation by prion protein. We observe that the prion protein induces greater fluorescence quenching of YOYO intercalated in DNA containing only GC bases compared to the DNA containing four bases whereas the effect of dye bound to DNA containing only AT bases is marginal. DNA-condensing biological polyamines are less effective than prion protein in quenching of DNA-bound YOYO fluorescence. The prion protein induces marginal quenching of fluorescence of the dye bound to oligonucleotides, which are resistant to condensation. The ultrastructural studies with electron microscope also validate the biophysical data. The GC bases of the target DNA are probably responsible for increased condensation in the presence of prion protein. To our knowledge, this is the first report of a human cellular protein inducing a sequence-dependent DNA condensation. The increased condensation of GC-rich DNA by prion protein may suggest a biological function of the prion protein and a role in its pathogenesis.

  10. Two-color, 30 second microwave-accelerated Metal-Enhanced Fluorescence DNA assays: a new Rapid Catch and Signal (RCS) technology.

    PubMed

    Dragan, Anatoliy I; Golberg, Karina; Elbaz, Amit; Marks, Robert; Zhang, Yongxia; Geddes, Chris D

    2011-03-07

    For analyses of DNA fragment sequences in solution we introduce a 2-color DNA assay, utilizing a combination of the Metal-Enhanced Fluorescence (MEF) effect and microwave-accelerated DNA hybridization. The assay is based on a new "Catch and Signal" technology, i.e. the simultaneous specific recognition of two target DNA sequences in one well by complementary anchor-ssDNAs, attached to silver island films (SiFs). It is shown that fluorescent labels (Alexa 488 and Alexa 594), covalently attached to ssDNA fragments, play the role of biosensor recognition probes, demonstrating strong response upon DNA hybridization, locating fluorophores in close proximity to silver NPs, which is ideal for MEF. Subsequently the emission dramatically increases, while the excited state lifetime decreases. It is also shown that 30s microwave irradiation of wells, containing DNA molecules, considerably (~1000-fold) speeds up the highly selective hybridization of DNA fragments at ambient temperature. The 2-color "Catch and Signal" DNA assay platform can radically expedite quantitative analysis of genome DNA sequences, creating a simple and fast bio-medical platform for nucleic acid analysis. Copyright © 2010 Elsevier B.V. All rights reserved.

  11. New Concepts of Fluorescent Probes for Specific Detection of DNA Sequences: Bis-Modified Oligonucleotides in Excimer and Exciplex Detection

    PubMed Central

    Gbaj, A; Bichenkova, EV; Walsh, L; Savage, HE; Sardarian, AR; Etchells, LL; Gulati, A; Hawisa, S; Douglas, KT

    2009-01-01

    The detection of single base mismatches in DNA is important for diagnostics, treatment of genetic diseases, and identification of single nucleotide polymorphisms. Highly sensitive, specific assays are needed to investigate genetic samples from patients. The use of a simple fluorescent nucleoside analogue in detection of DNA sequence and point mutations by hybridisation in solution is described in this study. The 5′-bispyrene and 3′-naphthalene oligonucleotide probes form an exciplex on hybridisation to target in water and the 5′-bispyrene oligonucleotide alone is an adequate probe to determine concentration of target present. It was also indicated that this system has a potential to identify mismatches and insertions. The aim of this work was to investigate experimental structures and conditions that permit strong exciplex emission for nucleic acid detectors, and show how such exciplexes can register the presence of mismatches as required in SNP analysis. This study revealed that the hybridisation of 5′-bispyrenyl fluorophore to a DNA target results in formation of a fluorescent probe with high signal intensity change and specificity for detecting a complementary target in a homogeneous system. Detection of SNP mutations using this split-probe system is a highly specific, simple, and accessible method to meet the rigorous requirements of pharmacogenomic studies. Thus, it is possible for the system to act as SNP detectors and it shows promise for future applications in genetic testing. PMID:21483539

  12. Label-Free Nanopore Biosensor for Rapid and Highly Sensitive Cocaine Detection in Complex Biological Fluids.

    PubMed

    Rauf, Sana; Zhang, Ling; Ali, Asghar; Liu, Yang; Li, Jinghong

    2017-02-24

    Detection of very low amounts of illicit drugs such as cocaine in clinical fluids like serum continues to be important for many areas in the fight against drug trafficking. Herein, we constructed a label-free nanopore biosensor for rapid and highly sensitive detection of cocaine in human serum and saliva samples based on target-induced strand release strategy. In this bioassay, an aptamer for cocaine was prehybridized with a short complementary DNA. Owing to cocaine specific binding with aptamer, the short DNA strand was displaced from aptamer and translocation of this output DNA through α-hemolysin nanopore generated distinct spike-like current blockages. When plotted in double-logarithmic scale, a linear relationship between target cocaine concentration and output DNA event frequency was obtained in a wide concentration range from 50 nM to 100 μM of cocaine, with the limit of detection down to 50 nM. In addition, this aptamer-based sensor method was successfully applied for cocaine detection in complex biological fluids like human saliva and serum samples with great selectivity. Simple preparation, low cost, rapid, label-free, and real sample detection are the motivating factors for practical application of the proposed biosensor.

  13. Amplified biosensing using the horseradish peroxidase-mimicking DNAzyme as an electrocatalyst.

    PubMed

    Pelossof, Gilad; Tel-Vered, Ran; Elbaz, Johann; Willner, Itamar

    2010-06-01

    The hemin/G-quadruplex horseradish peroxidase-mimicking DNAzyme is assembled on Au electrodes. It reveals bioelectrocatalytic properties and electrocatalyzes the reduction of H(2)O(2). The bioelectrocatalytic functions of the hemin/G-quadruplex DNAzyme are used to develop electrochemical sensors that follow the activity of glucose oxidase and biosensors for the detection of DNA or low-molecular-weight substrates (adenosine monophosphate, AMP). Hairpin nucleic structures that include the G-quadruplex sequence in a caged configuration and the nucleic acid sequence complementary to the analyte DNA, or the aptamer sequence for AMP, are immobilized on Au-electrode surfaces. In the presence of the DNA analyte, or AMP, the hairpin structures are opened, and the hemin/G-quadruplex horseradish peroxidase-mimicking DNAzyme structures are generated on the electrode surfaces. The bioelectrocatalytic cathodic currents generated by the functionalized electrodes, upon the electrochemical reduction of H(2)O(2), provide a quantitative measure for the detection of the target analytes. The DNA target was analyzed with a detection limit of 1 x 10(-12) M, while the detection limit for analyzing AMP was 1 x 10(-6) M. Methods to regenerate the sensing surfaces are presented.

  14. Crystallization and preliminary X-ray diffraction analysis of the CRISPR-Cas RNA-silencing Cmr complex.

    PubMed

    Osawa, Takuo; Inanaga, Hideko; Numata, Tomoyuki

    2015-06-01

    Clustered regularly interspaced short palindromic repeat (CRISPR)-derived RNA (crRNA) and CRISPR-associated (Cas) proteins constitute a prokaryotic adaptive immune system (CRISPR-Cas system) that targets and degrades invading genetic elements. The type III-B CRISPR-Cas Cmr complex, composed of the six Cas proteins (Cmr1-Cmr6) and a crRNA, captures and cleaves RNA complementary to the crRNA guide sequence. Here, a Cmr1-deficient functional Cmr (CmrΔ1) complex composed of Pyrococcus furiosus Cmr2-Cmr3, Archaeoglobus fulgidus Cmr4-Cmr5-Cmr6 and the 39-mer P. furiosus 7.01-crRNA was prepared. The CmrΔ1 complex was cocrystallized with single-stranded DNA (ssDNA) complementary to the crRNA guide by the vapour-diffusion method. The crystals diffracted to 2.1 Å resolution using synchrotron radiation at the Photon Factory. The crystals belonged to the triclinic space group P1, with unit-cell parameters a = 75.5, b = 76.2, c = 139.2 Å, α = 90.3, β = 104.8, γ = 118.6°. The asymmetric unit of the crystals is expected to contain one CmrΔ1-ssDNA complex, with a Matthews coefficient of 2.03 Å(3) Da(-1) and a solvent content of 39.5%.

  15. Different strategies for the detection of bioagents using electrochemical and photoelectrochemical genosensors

    NASA Astrophysics Data System (ADS)

    Voccia, Diego; Bettazi, Francesca; Palchetti, Ilaria

    2015-10-01

    In recent years various kinds of biosensors for the detection of pathogens have been developed. A genosensor consists in the immobilization, onto the surface of a chosen transducer, of an oligonucleotide with a specific base sequence called capture probe. The complementary sequence (the analytical target, i.e. a specific sequence of the DNA/RNA of the pathogen) present in the sample is recognized and captured by the probe through the hybridization reaction. The evaluation of the extent of the hybridization allows one to confirm whether the sample contains the complementary sequence of the probe or not. Electrochemical transducers have received considerable attention in connection with the detection of DNA hybridization. Moreover, recently, with the emergence of novel photoelectrochemically active species and new detection schemes, photoelectrochemistry has resulted in substantial progress in its analytical performance for biosensing applications. In this paper, some examples of electrochemical genosensors for multiplexed pathogen detection are shown. Moreover, the preliminary experiments towards the development of a photoelectrochemical genosensor using a TiO2 - nanocrystal-modified ITO electrode are discussed.

  16. Gold nanoparticles modified electrode via simple electrografting of in situ generated mercaptophenyl diazonium cations for development of DNA electrochemical biosensor.

    PubMed

    Li, Feng; Feng, Yan; Dong, Pingjun; Yang, Limin; Tang, Bo

    2011-01-15

    A novel protocol for development of DNA electrochemical biosensor based on gold nanoparticles (AuNPs) modified glassy carbon electrode (GCE) was proposed, which was carried out by the self-assembly of AuNPs on the mercaptophenyl film (MPF) via simple electrografting of in situ generated mercaptophenyl diazonium cations. The resulting MPF was covalently immobilized on GCE surface via C-C bond with high stability, which was desirable in fabrication of excellent performance biosensors. Probe DNA was self-assembled on AuNPs through the well-known Au-thiol binding. The recognition of fabricated DNA electrochemical biosensor toward complementary single-stranded DNA was determined by differential pulse voltammetry with the use of Co(phen)(3)(3+) as the electrochemical indicator. Taking advantage of amplification effects of AuNPs and stability of MPF, the developed biosensor could detect target DNA with the detection limit of 7.2×10(-11) M, which also exhibits good selectivity, stability and regeneration ability for DNA detection. Copyright © 2010 Elsevier B.V. All rights reserved.

  17. Highly sensitive DNA sensors based on cerium oxide nanorods

    NASA Astrophysics Data System (ADS)

    Nguyet, Nguyen Thi; Hai Yen, Le Thi; Van Thu, Vu; lan, Hoang; Trung, Tran; Vuong, Pham Hung; Tam, Phuong Dinh

    2018-04-01

    In this work, a CeO2 nanorod (NR)-based electrochemical DNA sensor was developed to identify Salmonella that causes food-borne infections. CeO2 NRs were synthesized without templates via a simple and unexpensive hydrothermal approach at 170 °C for 12 h by using CeO(NO3)3·6H2O as a Ce source. The DNA probe was immobilized onto the CeO2 NR-modified electrode through covalent attachment. The characteristics of the hybridized DNA were analyzed through electrochemical impedance spectroscopy (EIS) with [Fe(CN)6]3-/4- as a redox probe. Experimental results showed that electron transfer resistance (Ret) increased after the DNA probe was attached to the electrode surface and increased further after the DNA probe hybridized with its complementary sequence. A linear response of Ret to the target DNA concentration was found from 0.01 μM to 2 μM. The detection limit and sensitivity of the DNA sensor were 0.01 μM and 3362.1 Ω μM-1 cm-2, respectively. Various parameters, such as pH value, ionic strength, DNA probe concentration, and hybridization time, influencing DNA sensor responses were also investigated.

  18. A G-quadruplex-based Label-free Fluorometric Aptasensor for Adenosine Triphosphate Detection.

    PubMed

    Li, Li Juan; Tian, Xue; Kong, Xiang Juan; Chu, Xia

    2015-01-01

    A G-quadruplex-based, label-free fluorescence assay was demonstrated for the detection of adenosine triphosphate (ATP). A double-stranded DNA (dsDNA), hybridized by ATP-aptamer and its complementary sequence, was employed as a substrate for ATP binding. SYBR Green I (SG I) was a fluorescent probe and exonuclease III (Exo III) was a nuclease to digest the dsDNA. Consequently, in the absence of ATP, the dsDNA was inset with SG I and was digested by Exo III, resulting in a low background signal. In the presence of ATP, the aptamer in dsDNA folded into a G-quadruplex structure that resisted the digestion of Exo III. SG I was inserted into the structure, showing high fluorescence. Owing to a decrease of the background noise, a high signal-to-noise ratio could be obtained. This sensor can detect ATP with a concentration ranging from 50 μM to 5 mM, and possesses a capacity for the sensitive determination of other targets.

  19. Vesicle fusion observed by content transfer across a tethered lipid bilayer.

    PubMed

    Rawle, Robert J; van Lengerich, Bettina; Chung, Minsub; Bendix, Poul Martin; Boxer, Steven G

    2011-10-19

    Synaptic transmission is achieved by exocytosis of small, synaptic vesicles containing neurotransmitters across the plasma membrane. Here, we use a DNA-tethered freestanding bilayer as a target architecture that allows observation of content transfer of individual vesicles across the tethered planar bilayer. Tethering and fusion are mediated by hybridization of complementary DNA-lipid conjugates inserted into the two membranes, and content transfer is monitored by the dequenching of an aqueous content dye. By analyzing the diffusion profile of the aqueous dye after vesicle fusion, we are able to distinguish content transfer across the tethered bilayer patch from vesicle leakage above the patch. Copyright © 2011 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  20. Reinforced self-assembly of donor-acceptor π-conjugated molecules to DNA templates by dipole-dipole interactions together with complementary hydrogen bonding interactions for biomimetics.

    PubMed

    Yang, Wanggui; Chen, Yali; Wong, Man Shing; Lo, Pik Kwan

    2012-10-08

    One of the most important criteria for the successful DNA-templated polymerization to generate fully synthetic biomimetic polymers is to design the complementary structural monomers, which assemble to the templates strongly and precisely before carrying polymerization. In this study, water-soluble, laterally thymine-substituted donor-acceptor π-conjugated molecules were designed and synthesized to self-assemble with complementary oligoadenines templates, dA(20) and dA(40), into stable and tubular assemblies through noncovalent interactions including π-π stacking, dipole-dipole interactions, and the complementary adenine-thymine (A-T) hydrogen-bonding. UV-vis, fluorescence, circular dichroism (CD), atomic force microscopy (AFM), and transmission electron microscopy (TEM) techniques were used to investigate the formation of highly robust nanofibrous structures. Our results have demonstrated for the first time that the dipole-dipole interactions are stronger and useful to reinforce the assembly of donor-acceptor π-conjugated molecules to DNA templates and the formation of the stable and robust supramolecular nanofibrous complexes together with the complementary hydrogen bonding interactions. This provides an initial step toward DNA-templated polymerization to create fully synthetic DNA-mimetic polymers for biotechnological applications. This study also presents an opportunity to precisely position donor-acceptor type molecules in a controlled manner and tailor-make advanced materials for various biotechnological applications.

  1. DNA barcoding amphibians and reptiles.

    PubMed

    Vences, Miguel; Nagy, Zoltán T; Sonet, Gontran; Verheyen, Erik

    2012-01-01

    Only a few major research programs are currently targeting COI barcoding of amphibians and reptiles (including chelonians and crocodiles), two major groups of tetrapods. Amphibian and reptile species are typically old, strongly divergent, and contain deep conspecific lineages which might lead to problems in species assignment with incomplete reference databases. As far as known, there is no single pair of COI primers that will guarantee a sufficient rate of success across all amphibian and reptile taxa, or within major subclades of amphibians and reptiles, which means that the PCR amplification strategy needs to be adjusted depending on the specific research question. In general, many more amphibian and reptile taxa have been sequenced for 16S rDNA, which for some purposes may be a suitable complementary marker, at least until a more comprehensive COI reference database becomes available. DNA barcoding has successfully been used to identify amphibian larval stages (tadpoles) in species-rich tropical assemblages. Tissue sampling, DNA extraction, and amplification of COI is straightforward in amphibians and reptiles. Single primer pairs are likely to have a failure rate between 5 and 50% if taxa of a wide taxonomic range are targeted; in such cases the use of primer cocktails or subsequent hierarchical usage of different primer pairs is necessary. If the target group is taxonomically limited, many studies have followed a strategy of designing specific primers which then allow an easy and reliable amplification of all samples.

  2. Assembly of Francisella novicida Cpf1 endonuclease in complex with guide RNA and target DNA

    PubMed Central

    Montoya, Guillermo; Stella, Stefano

    2017-01-01

    Bacteria and archaea use the CRISPR–Cas system as an adaptive response against infection by foreign nucleic acids. Owing to its remarkable flexibility, this mechanism has been harnessed and adopted as a powerful tool for genome editing. The CRISPR–Cas system includes two classes that are subdivided into six types and 19 subtypes according to conservation of the cas gene and loci organization. Recently, a new protein with endonuclease activity belonging to class 2 type V has been identified. This endonuclease, termed Cpf1, in complex with a single CRISPR RNA (crRNA) is able to recognize and cleave a target DNA preceded by a 5′-TTN-3′ protospacer-adjacent motif (PAM) complementary to the RNA guide. To obtain structural insight into the inner workings of Cpf1, the crystallization of an active complex containing the full extent of the crRNA and a 31-nucleotide dsDNA target was attempted. The gene encoding Cpf1 from Francisella novicida was cloned, overexpressed and purified. The crRNA was transcribed and purified in vitro. Finally, the ternary FnCpf1–crRNA–DNA complex was assembled and purified by preparative electrophoresis before crystallization. Crystals belonging to space group C2221, with unit-cell parameters a = 85.2, b = 137.6, c = 320.5 Å, were obtained and subjected to preliminary diffraction experiments. PMID:28695850

  3. A novel self-powered and sensitive label-free DNA biosensor in microbial fuel cell.

    PubMed

    Asghary, Maryam; Raoof, Jahan Bakhsh; Rahimnejad, Mostafa; Ojani, Reza

    2016-08-15

    In this work, a novel self-powered, sensitive, low-cost, and label-free DNA biosensor is reported by applying a two-chambered microbial fuel cell (MFC) as a power supply. A graphite electrode and an Au nanoparticles modified graphite electrode (AuNP/graphite electrode) were used as anode and cathode in the MFC system, respectively. The active biocatalyst in the anodic chamber was a mixed culture of microorganisms. The sensing element of the biosensor was fabricated by the well-known Au-thiol binding the ssDNA probe on the surface of an AuNP/graphite cathode. Electrons produced by microorganisms were transported from the anode to the cathode through an external circuit, which could be detected by the terminal multi-meter detector. The difference between power densities of the ssDNA probe modified cathode in the absence and presence of complementary sequence served as the detection signal of the DNA hybridization with detection limit of 3.1nM. Thereafter, this biosensor was employed for diagnosis and determination of complementary sequence in a human serum sample. The hybridization specificity studies further revealed that the developed DNA biosensor could distinguish fully complementary sequences from one-base mismatched and non-complementary sequences. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Visible light-sensitive APTES-bound ZnO nanowire toward a potent nanoinjector sensing biomolecules in a living cell

    NASA Astrophysics Data System (ADS)

    Lee, Jooran; Choi, Sunyoung; Bae, Seon Joo; Yoon, Seok Min; Choi, Joon Sig; Yoon, Minjoong

    2013-10-01

    Nanoscale cell injection techniques combined with nanoscopic photoluminescence (PL) spectroscopy have been important issues in high-resolution optical biosensing, gene and drug delivery and single-cell endoscopy for medical diagnostics and therapeutics. However, the current nanoinjectors remain limited for optical biosensing and communication at the subwavelength level, requiring an optical probe such as semiconductor quantum dots, separately. Here, we show that waveguided red emission is observed at the tip of a single visible light-sensitive APTES-modified ZnO nanowire (APTES-ZnO NW) and it exhibits great enhancement upon interaction with a complementary sequence-based double stranded (ds) DNA, whereas it is not significantly affected by non-complementary ds DNA. Further, the tip of a single APTES-ZnO NW can be inserted into the subcellular region of living HEK 293 cells without significant toxicity, and it can also detect the enhancement of the tip emission from subcellular regions with high spatial resolution. These results indicate that the single APTES-ZnO NW would be useful as a potent nanoinjector which can guide visible light into intracellular compartments of mammalian cells, and can also detect nanoscopic optical signal changes induced by interaction with the subcellular specific target biomolecules without separate optical probes.Nanoscale cell injection techniques combined with nanoscopic photoluminescence (PL) spectroscopy have been important issues in high-resolution optical biosensing, gene and drug delivery and single-cell endoscopy for medical diagnostics and therapeutics. However, the current nanoinjectors remain limited for optical biosensing and communication at the subwavelength level, requiring an optical probe such as semiconductor quantum dots, separately. Here, we show that waveguided red emission is observed at the tip of a single visible light-sensitive APTES-modified ZnO nanowire (APTES-ZnO NW) and it exhibits great enhancement upon interaction with a complementary sequence-based double stranded (ds) DNA, whereas it is not significantly affected by non-complementary ds DNA. Further, the tip of a single APTES-ZnO NW can be inserted into the subcellular region of living HEK 293 cells without significant toxicity, and it can also detect the enhancement of the tip emission from subcellular regions with high spatial resolution. These results indicate that the single APTES-ZnO NW would be useful as a potent nanoinjector which can guide visible light into intracellular compartments of mammalian cells, and can also detect nanoscopic optical signal changes induced by interaction with the subcellular specific target biomolecules without separate optical probes. Electronic supplementary information (ESI) available: Synthesis of APTES-modified ZnO nanowires, DNA functionalization and spectroscopic measurements with additional fluorescence image ad fluorescence decay times, cell culture, injection of a single nanowire into living cells, subcellular imaging and determination of cytotoxicity. See DOI: 10.1039/c3nr03042c

  5. An enhanced sensing platform for ultrasensitive impedimetric detection of target genes based on ordered FePt nanoparticles decorated carbon nanotubes.

    PubMed

    Zhang, Wei; Zong, Peisong; Zheng, Xiuwen; Wang, Libin

    2013-04-15

    We demonstrate a novel high-performance DNA hybridization biosensor with a carbon nanotubes (CNTs)-based nanocomposite membrane as the enhanced sensing platform. The platform was constructed by homogenously distributing ordered FePt nanoparticles (NPs) onto the CNTs matrix. The surface structure and electrochemical performance of the FePt/CNTs nanocomposite membrane were systematically investigated. Such a nanostructured composite membrane platform could combine with the advantages of FePt NPs and CNTs, greatly facilitate the electron-transfer process and the sensing behavior for DNA detection, leading to excellent sensitivity and selectivity. The complementary target genes from acute promyelocytic leukemia could be quantified in a wide range of 1.0×10⁻¹² mol/L to 1.0×10⁻⁶ mol/L using electrochemical impedance spectroscopy, and the detection limit was 2.1×10⁻¹³ mol/L under the optimal conditions. In addition, the DNA electrochemical biosensor was highly selective to discriminate single-base or double-base mismatched sequences. Copyright © 2012 Elsevier B.V. All rights reserved.

  6. Striking Plasticity of CRISPR-Cas9 and Key Role of Non-target DNA, as Revealed by Molecular Simulations.

    PubMed

    Palermo, Giulia; Miao, Yinglong; Walker, Ross C; Jinek, Martin; McCammon, J Andrew

    2016-10-26

    The CRISPR (clustered regularly interspaced short palindromic repeats)-Cas9 system recently emerged as a transformative genome-editing technology that is innovating basic bioscience and applied medicine and biotechnology. The endonuclease Cas9 associates with a guide RNA to match and cleave complementary sequences in double stranded DNA, forming an RNA:DNA hybrid and a displaced non-target DNA strand. Although extensive structural studies are ongoing, the conformational dynamics of Cas9 and its interplay with the nucleic acids during association and DNA cleavage are largely unclear. Here, by employing multi-microsecond time scale molecular dynamics, we reveal the conformational plasticity of Cas9 and identify key determinants that allow its large-scale conformational changes during nucleic acid binding and processing. We show how the "closure" of the protein, which accompanies nucleic acid binding, fundamentally relies on highly coupled and specific motions of the protein domains, collectively initiating the prominent conformational changes needed for nucleic acid association. We further reveal a key role of the non-target DNA during the process of activation of the nuclease HNH domain, showing how the nontarget DNA positioning triggers local conformational changes that favor the formation of a catalytically competent Cas9. Finally, a remarkable conformational plasticity is identified as an intrinsic property of the HNH domain, constituting a necessary element that allows for the HNH repositioning. These novel findings constitute a reference for future experimental studies aimed at a full characterization of the dynamic features of the CRISPR-Cas9 system, and-more importantly-call for novel structure engineering efforts that are of fundamental importance for the rational design of new genome-engineering applications.

  7. Multiplexed evaluation of capture agent binding kinetics using arrays of silicon photonic microring resonators.

    PubMed

    Byeon, Ji-Yeon; Bailey, Ryan C

    2011-09-07

    High affinity capture agents recognizing biomolecular targets are essential in the performance of many proteomic detection methods. Herein, we report the application of a label-free silicon photonic biomolecular analysis platform for simultaneously determining kinetic association and dissociation constants for two representative protein capture agents: a thrombin-binding DNA aptamer and an anti-thrombin monoclonal antibody. The scalability and inherent multiplexing capability of the technology make it an attractive platform for simultaneously evaluating the binding characteristics of multiple capture agents recognizing the same target antigen, and thus a tool complementary to emerging high-throughput capture agent generation strategies.

  8. Electron microscopic visualization of complementary labeled DNA with platinum-containing guanine derivative.

    PubMed

    Loukanov, Alexandre; Filipov, Chavdar; Mladenova, Polina; Toshev, Svetlin; Emin, Saim

    2016-04-01

    The object of the present report is to provide a method for a visualization of DNA in TEM by complementary labeling of cytosine with guanine derivative, which contains platinum as contrast-enhanced heavy element. The stretched single-chain DNA was obtained by modifying double-stranded DNA. The labeling method comprises the following steps: (i) stretching and adsorption of DNA on the support film of an electron microscope grid (the hydrophobic carbon film holding negative charged DNA); (ii) complementary labeling of the cytosine bases from the stretched single-stranded DNA pieces on the support film with platinum containing guanine derivative to form base-specific hydrogen bond; and (iii) producing a magnified image of the base-specific labeled DNA. Stretched single-stranded DNA on a support film is obtained by a rapid elongation of DNA pieces on the surface between air and aqueous buffer solution. The attached platinum-containing guanine derivative serves as a high-dense marker and it can be discriminated from the surrounding background of support carbon film and visualized by use of conventional TEM observation at 100 kV accelerated voltage. This method allows examination of specific nucleic macromolecules through atom-by-atom analysis and it is promising way toward future DNA-sequencing or molecular diagnostics of nucleic acids by electron microscopic observation. © 2016 Wiley Periodicals, Inc.

  9. Enhancing the response rate of strand displacement-based electrochemical aptamer sensors using bivalent binding aptamer-cDNA probes.

    PubMed

    Zhang, Ziping; Tao, Cancan; Yin, Jungang; Wang, Yunhui; Li, Yanshen

    2018-04-30

    Electrochemical aptamer (EA) sensors based on aptamer-cDNA duplex probes (cDNA: complementary DNA) and target induced strand displacement (TISD) recognition are sensitive, selective and capable of detecting a wide variety of target analytes. While substantial research efforts have focused on engineering of new signaling mechanisms for the improvement of sensor sensitivity, little attention was paid to the enhancement of sensor response rate. Typically, the previous TISD based EA sensors exhibited relatively long response times larger than 30min, which mainly resulted from the suboptimal aptamer-cDNA probe structure in which most of aptamer bases were paired to the cDNA bases. In an effort to improve the response rate of this type of sensors, we report here the rational engineering of a quickly responsive and sensitive aptamer-cDNA probe by employing the conception of bivalent interaction in supramolecular chemistry. We design a bivalent cDNA strand through linking two short monovalent cDNA sequences, and it is simultaneously hybridized to two electrode-immobilized aptamer probes to form a bivalent binding (BB) aptamer-cDNA probe. This class of BB probe possesses the advantages of less aptamer bases paired to the cDNA bases for quick response rate and good structural stability for high sensor sensitivity. By use of the rationally designed BB aptamer-cDNA probe, a TISD based EA sensor against ATP with significantly enhanced response rate (with a displacement equilibrium time of 4min) and high sensitivity was successfully constructed. We believe that our BB probe conception will help guide future designs and applications of TISD based EA sensors. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Probing the structural dynamics of the CRISPR-Cas9 RNA-guided DNA-cleavage system by coarse-grained modeling.

    PubMed

    Zheng, Wenjun

    2017-02-01

    In the adaptive immune systems of many bacteria and archaea, the Cas9 endonuclease forms a complex with specific guide/scaffold RNA to identify and cleave complementary target sequences in foreign DNA. This DNA targeting machinery has been exploited in numerous applications of genome editing and transcription control. However, the molecular mechanism of the Cas9 system is still obscure. Recently, high-resolution structures have been solved for Cas9 in different structural forms (e.g., unbound forms, RNA-bound binary complexes, and RNA-DNA-bound tertiary complexes, corresponding to an inactive state, a pre-target-bound state, and a cleavage-competent or product state), which offered key structural insights to the Cas9 mechanism. To further probe the structural dynamics of Cas9 interacting with RNA and DNA at the amino-acid level of details, we have performed systematic coarse-grained modeling using an elastic network model and related analyses. Our normal mode analysis predicted a few key modes of collective motions that capture the observed conformational changes featuring large domain motions triggered by binding of RNA and DNA. Our flexibility analysis identified specific regions with high or low flexibility that coincide with key functional sites (such as DNA/RNA-binding sites, nuclease cleavage sites, and key hinges). We also identified a small set of hotspot residues that control the energetics of functional motions, which overlap with known functional sites and offer promising targets for future mutagenesis efforts to improve the specificity of Cas9. Finally, we modeled the conformational transitions of Cas9 from the unbound form to the binary complex and then the tertiary complex, and predicted a distinct sequence of domain motions. In sum, our findings have offered rich structural and dynamic details relevant to the Cas9 machinery, and will guide future investigation and engineering of the Cas9 systems. Proteins 2017; 85:342-353. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  11. Fabrication of an electrochemical DNA-based biosensor for Bacillus cereus detection in milk and infant formula.

    PubMed

    Izadi, Zahra; Sheikh-Zeinoddin, Mahmoud; Ensafi, Ali A; Soleimanian-Zad, Sabihe

    2016-06-15

    This paper describes fabrication of a DNA-based Au-nanoparticle modified pencil graphite electrode (PGE) biosensor for detection of Bacillus cereus, causative agent of two types of food-borne disease, i.e., emetic and diarrheal syndrome. The sensing element of the biosensor was comprised of gold nanoparticles (GNPs) self-assembled with single-stranded DNA (ssDNA) of nheA gene immobilized with thiol linker on the GNPs modified PGE. The size, shape and dispersion of the GNPs were characterized by field emission scanning electron microscope (FESEM). Detection of B. cereus was carried out based on an increase in the charge transfer resistance (Rct) of the biosensor due to hybridization of the ss-DNA with target DNA. An Atomic force microscope (AFM) was used to confirm the hybridization. The biosensor sensitivity in pure cultures of B. cereus was found to be 10(0) colony forming units per milliliter (CFU/mL) with a detection limit of 9.4 × 10(-12) mol L(-1). The biosensor could distinguish complementary from mismatch DNA sequence. The proposed biosensor exhibited a rapid detection, low cost, high sensitivity to bacterial contamination and could exclusively and specifically detect the target DNA sequence of B. cereus from other bacteria that can be found in dairy products. Moreover, the DNA biosensor exhibited high reproducibility and stability, thus it may be used as a suitable biosensor to detect B. cereus and to become a portable system for food quality control. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Isoelectric Bovine Serum Albumin: Robust Blocking Agent for Enhanced Performance in Optical-Fiber Based DNA Sensing.

    PubMed

    Wang, Ruoyu; Zhou, Xiaohong; Zhu, Xiyu; Yang, Chao; Liu, Lanhua; Shi, Hanchang

    2017-02-24

    Surface blocking is a well-known process for reducing unwanted nonspecific adsorption in sensor fabrication, especially important in the emerging field where DNA/RNA applied. Bovine serum albumin (BSA) is one of the most popular blocking agents with an isoelectric point at pH 4.6. Although it is widely recognized that the adsorption of a blocking agent is strongly affected by its net charge and the maximum adsorption is often observed under its isoelectric form, BSA has long been perfunctorily used for blocking merely in neutral solution, showing poor blocking performances in the optical-fiber evanescent wave (OFEW) based sensing toward DNA target. To meet this challenge, we first put forward the view that isoelectric BSA (iep-BSA) has the best blocking performance and use an OFEW sensor platform to demonstrate this concept. An optical-fiber was covalently modified with amino-DNA, and further coupled with the optical system to detect fluorophore labeled complementary DNA within the evanescent field. A dramatic improvement in the reusability of this DNA modified sensing surface was achieved with 120 stable detection cycles, which ensured accurate quantitative bioassay. As expected, the iep-BSA blocked OFEW system showed enhanced sensing performance toward target DNA with a detection limit of 125 pM. To the best of our knowledge, this is the highest number of regeneration cycles ever reported for a DNA immobilized optical-fiber surface. This study can also serve as a good reference and provide important implications for developing similar DNA-directed surface biosensors.

  13. Spermine moiety attached to the C-5 position of deoxyuridine enhances the duplex stability of the phosphorothioate DNA/complementary DNA and shows the susceptibility of the substrate to RNase H.

    PubMed

    Moriguchi, Tomohisa; Sakai, Hideaki; Suzuki, Hideo; Shinozuka, Kazuo

    2008-09-01

    Novel phosphorothioate-modified oligodeoxynucleotides (S-ODNs) containing a deoxyuridine derivative bearing a spermine moiety at the C-5 position were synthesized. The study of the thermal stability and the thermodynamic stability showed that the modified S-ODNs have been able to form the stable duplexes with the complementary DNA. It was also found that the duplex composed of the modified S-ODN and its complementary RNA strand is the substrate for Escherichia coli RNase H, and the cleavage of the RNA strand by the enzyme was almost similar as in the case of the unmodified one.

  14. [Electrochemical detection of toxin gene in Listeria monocytogenes].

    PubMed

    Wu, Ling-Wei; Liu, Quan-Jun; Wu, Zhong-Wei; Lu, Zu-Hong

    2010-05-01

    Listeria monocytogenes (LM) is a food-borne pathogen inducing listeriosis, an illness characterized by encephalitis, septicaemia, and meningitis. Listeriolysin O (LLO) is absolutely required for virulence by L. monocytogenes, and is found only in virulent strains of the species. One of the best ways to detect and confirm the pathogen is detection of one of the virulence factors, LLO, produced by the microorganism. This paper focused on the electrical method used to detect the LLO toxin gene in food products and organism without labeling the target DNA. The electrochemical sensor was obtained by immobilizing single-stranded oligonucleotides onto the gold electrode with the mercaptan activated by N-hydroxysulfosuccinimide (NHS) and N-(3-dimethylamion)propyl-N'-ethyl carbodiimidehydrochloride (EDC). The hy-bridization reaction that occurred on the electrode surface was evidenced by Cyclic Voltammetry (CV) analysis using [Co(phen)3](ClO4)3 as an indicator. The covalently immobilized single-stranded DNA could selectively hybridize to its complementary DNA in solution to form double-stranded DNA on the gold surface. A significant increase of the peak cur-rent of Cyclic Voltammetry (CV) upon hybridization of immobilized ssDNA with PCR amplification products in the solu-tion was observed. This peak current change was used to monitor the amount of PCR amplification products. Factors deter-mining the sensitivity of the electrochemical assay, such as DNA target concentration and hybridization conditions, were investigated. The coupling of DNA to the electrochemical sensors has the potential of the quantitative evaluation of gene.

  15. Nucleotide Sequence Analysis of RNA Synthesized from Rabbit Globin Complementary DNA

    PubMed Central

    Poon, Raymond; Paddock, Gary V.; Heindell, Howard; Whitcome, Philip; Salser, Winston; Kacian, Dan; Bank, Arthur; Gambino, Roberto; Ramirez, Francesco

    1974-01-01

    Rabbit globin complementary DNA made with RNA-dependent DNA polymerase (reverse transcriptase) was used as template for in vitro synthesis of 32P-labeled RNA. The sequences of the nucleotides in most of the fragments resulting from combined ribonuclease T1 and alkaline phosphatase digestion have been determined. Several fragments were long enough to fit uniquely with the α or β globin amino-acid sequences. These data demonstrate that the cDNA was copied from globin mRNA and contained no detectable contaminants. Images PMID:4139714

  16. Promotion of double-duplex invasion of peptide nucleic acids through conjugation with nuclear localization signal peptide.

    PubMed

    Aiba, Yuichiro; Honda, Yuta; Komiyama, Makoto

    2015-03-02

    Pseudo-complementary peptide nucleic acid (pcPNA), as one of the most widely used synthetic DNA analogues, invades double-stranded DNA according to Watson-Crick rules to form invasion complexes. This unique mode of DNA recognition induces structural changes at the invasion site and can be used for a range of applications. In this paper, pcPNA is conjugated with a nuclear localization signal (NLS) peptide, and its invading activity is notably promoted both thermodynamically and kinetically. Thus, the double-duplex invasion complex is formed promptly at low pcPNA concentrations under high salt conditions, where the invasion otherwise never occurs. Furthermore, NLS-modified pcPNA is successfully employed for site-selective DNA scission, and the targeted DNA is selectively cleaved under conditions that are not conducive for DNA cutters using unmodified pcPNAs. This strategy of pcPNA modification is expected to be advantageous and promising for a range of in vitro and in vivo applications. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Label-Free Potentiometry for Detecting DNA Hybridization Using Peptide Nucleic Acid and DNA Probes

    PubMed Central

    Goda, Tatsuro; Singi, Ankit Balram; Maeda, Yasuhiro; Matsumoto, Akira; Torimura, Masaki; Aoki, Hiroshi; Miyahara, Yuji

    2013-01-01

    Peptide nucleic acid (PNA) has outstanding affinity over DNA for complementary nucleic acid sequences by forming a PNA-DNA heterodimer upon hybridization via Watson-Crick base-pairing. To verify whether PNA probes on an electrode surface enhance sensitivity for potentiometric DNA detection or not, we conducted a comparative study on the hybridization of PNA and DNA probes on the surface of a 10-channel gold electrodes microarray. Changes in the charge density as a result of hybridization at the solution/electrode interface on the self-assembled monolayer (SAM)-formed microelectrodes were directly transformed into potentiometric signals using a high input impedance electrometer. The charge readout allows label-free, reagent-less, and multi-parallel detection of target oligonucleotides without any optical assistance. The differences in the probe lengths between 15- to 22-mer dramatically influenced on the sensitivity of the PNA and DNA sensors. Molecular type of the capturing probe did not affect the degree of potential shift. Theoretical model for charged rod-like duplex using the Gouy-Chapman equation indicates the dominant effect of electrostatic attractive forces between anionic DNA and underlying electrode at the electrolyte/electrode interface in the potentiometry. PMID:23435052

  18. [Single-molecule detection and characterization of DNA replication based on DNA origami].

    PubMed

    Wang, Qi; Fan, Youjie; Li, Bin

    2014-08-01

    To investigate single-molecule detection and characterization of DNA replication. Single-stranded DNA (ssDNA) as the template of DNA replication was attached to DNA origami by a hybridization reaction based on the complementary base-pairing principle. DNA replication catalyzed by E.coli DNA polymerase I Klenow Fragment (KF) was detected using atomic force microscopy (AFM). The height variations between the ssDNA and the double-stranded DNA (dsDNA), the distribution of KF during DNA replication and biotin-streptavidin (BA) complexes on the DNA strand after replication were detected. Agarose gel electrophoresis was employed to analyze the changes in the DNA after replication. The designed ssDNA could be anchored on the target positions of over 50% of the DNA origami. The KF was capable of binding to the ssDNA fixed on DNA origami and performing its catalytic activities, and was finally dissociated from the DNA after replication. The height of DNA strand increased by about 0.7 nm after replication. The addition of streptavidin also resulted in an DNA height increase to about 4.9 nm due to the formation of BA complexes on the biotinylated dsDNA. The resulting dsDNA and BA complex were subsequently confirmed by agarose gel electrophoresis. The combination of AFM and DNA origami allows detection and characterization of DNA replication at the single molecule level, and this approach provides better insights into the mechanism of DNA polymerase and the factors affecting DNA replication.

  19. A new age in functional genomics using CRISPR/Cas9 in arrayed library screening.

    PubMed

    Agrotis, Alexander; Ketteler, Robin

    2015-01-01

    CRISPR technology has rapidly changed the face of biological research, such that precise genome editing has now become routine for many labs within several years of its initial development. What makes CRISPR/Cas9 so revolutionary is the ability to target a protein (Cas9) to an exact genomic locus, through designing a specific short complementary nucleotide sequence, that together with a common scaffold sequence, constitute the guide RNA bridging the protein and the DNA. Wild-type Cas9 cleaves both DNA strands at its target sequence, but this protein can also be modified to exert many other functions. For instance, by attaching an activation domain to catalytically inactive Cas9 and targeting a promoter region, it is possible to stimulate the expression of a specific endogenous gene. In principle, any genomic region can be targeted, and recent efforts have successfully generated pooled guide RNA libraries for coding and regulatory regions of human, mouse and Drosophila genomes with high coverage, thus facilitating functional phenotypic screening. In this review, we will highlight recent developments in the area of CRISPR-based functional genomics and discuss potential future directions, with a special focus on mammalian cell systems and arrayed library screening.

  20. Fluorescent "on-off-on" switching sensor based on CdTe quantum dots coupled with multiwalled carbon nanotubes@graphene oxide nanoribbons for simultaneous monitoring of dual foreign DNAs in transgenic soybean.

    PubMed

    Li, Yaqi; Sun, Li; Qian, Jing; Long, Lingliang; Li, Henan; Liu, Qian; Cai, Jianrong; Wang, Kun

    2017-06-15

    With the increasing concern of potential health and environmental risk, it is essential to develop reliable methods for transgenic soybean detection. Herein, a simple, sensitive and selective assay was constructed based on homogeneous fluorescence resonance energy transfer (FRET) between CdTe quantum dots (QDs) and multiwalled carbon nanotubes@graphene oxide nanoribbons (MWCNTs@GONRs) to form the fluorescent "on-off-on" switching for simultaneous monitoring dual target DNAs of promoter cauliflower mosaic virus 35s (P35s) and terminator nopaline synthase (TNOS) from transgenic soybean. The capture DNAs were immobilized with corresponding QDs to obtain strong fluorescent signals (turning on). The strong π-π stacking interaction between single-stranded DNA (ssDNA) probes and MWCNTs@GONRs led to minimal background fluorescence due to the FRET process (turning off). The targets of P35s and TNOS were recognized by dual fluorescent probes to form double-stranded DNA (dsDNA) through the specific hybridization between target DNAs and ssDNA probes. And the dsDNA were released from the surface of MWCNTs@GONRs, which leaded the dual fluorescent probes to generate the strong fluorescent emissions (turning on). Therefore, this proposed homogeneous assay can be achieved to detect P35s and TNOS simultaneously by monitoring the relevant fluorescent emissions. Moreover, this assay can distinguish complementary and mismatched nucleic acid sequences with high sensitivity. The constructed approach has the potential to be a tool for daily detection of genetically modified organism with the merits of feasibility and reliability. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Using surface-enhanced Raman spectroscopy and electrochemically driven melting to discriminate Yersinia pestis from Y. pseudotuberculosis based on single nucleotide polymorphisms within unpurified polymerase chain reaction amplicons.

    PubMed

    Papadopoulou, Evanthia; Goodchild, Sarah A; Cleary, David W; Weller, Simon A; Gale, Nittaya; Stubberfield, Michael R; Brown, Tom; Bartlett, Philip N

    2015-02-03

    The development of sensors for the detection of pathogen-specific DNA, including relevant species/strain level discrimination, is critical in molecular diagnostics with major impacts in areas such as bioterrorism and food safety. Herein, we use electrochemically driven denaturation assays monitored by surface-enhanced Raman spectroscopy (SERS) to target single nucleotide polymorphisms (SNPs) that distinguish DNA amplicons generated from Yersinia pestis, the causative agent of plague, from the closely related species Y. pseudotuberculosis. Two assays targeting SNPs within the groEL and metH genes of these two species have been successfully designed. Polymerase chain reaction (PCR) was used to produce Texas Red labeled single-stranded DNA (ssDNA) amplicons of 262 and 251 bases for the groEL and metH targets, respectively. These amplicons were used in an unpurified form to hybridize to immobilized probes then subjected to electrochemically driven melting. In all cases electrochemically driven melting was able to discriminate between fully homologous DNA and that containing SNPs. The metH assay was particularly challenging due to the presence of only a single base mismatch in the middle of the 251 base long PCR amplicon. However, manipulation of assay conditions (conducting the electrochemical experiments at 10 °C) resulted in greater discrimination between the complementary and mismatched DNA. Replicate data were collected and analyzed for each duplex on different days, using different batches of PCR product and different sphere segment void (SSV) substrates. Despite the variability introduced by these differences, the assays are shown to be reliable and robust providing a new platform for strain discrimination using unpurified PCR samples.

  2. Detection of Ammonia-Oxidizing Bacteria (AOB) Using a Porous Silicon Optical Biosensor Based on a Multilayered Double Bragg Mirror Structure.

    PubMed

    Zhang, Hongyan; Lv, Jie; Jia, Zhenhong

    2018-01-01

    We successfully demonstrate a porous silicon (PS) double Bragg mirror by electrochemical etching at room temperature as a deoxyribonucleic acid (DNA) label-free biosensor for detecting ammonia-oxidizing bacteria (AOB). Compared to various other one-dimension photonic crystal configurations of PS, the double Bragg mirror structure is quite easy to prepare and exhibits interesting optical properties. The width of high reflectivity stop band of the PS double Bragg mirror is about 761 nm with a sharp and deep resonance peak at 1328 nm in the reflectance spectrum, which gives a high sensitivity and distinguishability for sensing performance. The detection sensitivity of such a double Bragg mirror structure is illustrated through the investigation of AOB DNA hybridization in the PS pores. The redshifts of the reflectance spectra show a good linear relationship with both complete complementary and partial complementary DNA. The lowest detection limit for complete complementary DNA is 27.1 nM and the detection limit of the biosensor for partial complementary DNA is 35.0 nM, which provides the feasibility and effectiveness for the detection of AOB in a real environment. The PS double Bragg mirror structure is attractive for widespread biosensing applications and provides great potential for the development of optical applications.

  3. Biomimetic DNA emulsions: specific, thermo-reversible and adjustable binding from a liquid-like DNA layer

    NASA Astrophysics Data System (ADS)

    Pontani, Lea-Laetitia; Feng, Lang; Dreyfus, Remi; Seeman, Nadrian; Chaikin, Paul; Brujic, Jasna

    2013-03-01

    We develop micron-sized emulsions coated with specific DNA sequences and complementary sticky ends. The emulsions are stabilized with phospholipids on which the DNA strands are grafted through biotin-streptavidin interactions, which allows the DNA to diffuse freely on the surface. We produce two complementary emulsions: one is functionalized with S sticky ends and dyed with red streptavidin, the other displays the complementary S' sticky ends and green streptavidin. Mixing those emulsions reveals specific adhesion between them due to the short-range S-S' hybridization. As expected this interaction is thermo-reversible: the red-green adhesive droplets dissociate upon heating and reassemble after cooling. Here the fluid phospholipids layer also leads to diffusive adhesion patches, which allows the bound droplets to rearrange throughout the packing structure. We quantify the adhesion strength between two droplets and build a theoretical framework that captures the observed trends through parameters such as the size of the droplets, the DNA surface density, the various DNA constructs or the temperature. This colloidal-scale, specific, thermo-reversible biomimetic emulsion offers a new versatile and powerful tool for the development of complex self-assembled materials.

  4. Reverse transcription strand invasion based amplification (RT-SIBA): a method for rapid detection of influenza A and B.

    PubMed

    Eboigbodin, Kevin; Filén, Sanna; Ojalehto, Tuomas; Brummer, Mirko; Elf, Sonja; Pousi, Kirsi; Hoser, Mark

    2016-06-01

    Rapid and accurate diagnosis of influenza viruses plays an important role in infection control, as well as in preventing the misuse of antibiotics. Isothermal nucleic acid amplification methods offer significant advantages over the polymerase chain reaction (PCR), since they are more rapid and do not require the sophisticated instruments needed for thermal cycling. We previously described a novel isothermal nucleic acid amplification method, 'Strand Invasion Based Amplification' (SIBA®), with high analytical sensitivity and specificity, for the detection of DNA. In this study, we describe the development of a variant of the SIBA method, namely, reverse transcription SIBA (RT-SIBA), for the rapid detection of viral RNA targets. The RT-SIBA method includes a reverse transcriptase enzyme that allows one-step reverse transcription of RNA to complementary DNA (cDNA) and simultaneous amplification and detection of the cDNA by SIBA under isothermal reaction conditions. The RT-SIBA method was found to be more sensitive than PCR for the detection of influenza A and B and could detect 100 copies of influenza RNA within 15 min. The development of RT-SIBA will enable rapid and accurate diagnosis of viral RNA targets within point-of-care or central laboratory settings.

  5. DNA Sequence Analysis of a Complementary DNA for Cold-Regulated Arabidopsis Gene cor15 and Characterization of the COR 15 Polypeptide 1

    PubMed Central

    Lin, Chentao; Thomashow, Michael F.

    1992-01-01

    Previous studies have indicated that changes in gene expression occur in Arabidopsis thaliana L. (Heyn) during cold acclimation and that certain of the cor (cold-regulated) genes encode polypeptides that share the unusual property of remaining soluble upon boiling in aqueous solution. Here, we identify a cDNA clone for a cold-regulated gene encoding one of the “boiling-stable” polypeptides, COR15. DNA sequence analysis indicated that the gene, designated cor15, encodes a 14.7-kilodalton hydrophilic polypeptide having an N-terminal amino acid sequence that closely resembles transit peptides that target proteins to the stromal compartment of chloroplasts. Immunological studies indicated that COR15 is processed in vivo and that the mature polypeptide, COR 15m, is present in the soluble fraction of chloroplasts. Possible functions of COR 15m are discussed. ImagesFigure 1Figure 4Figure 5Figure 6Figure 7 PMID:16668917

  6. DNA/RNA heteroduplex oligonucleotide for highly efficient gene silencing

    PubMed Central

    Nishina, Kazutaka; Piao, Wenying; Yoshida-Tanaka, Kie; Sujino, Yumiko; Nishina, Tomoko; Yamamoto, Tsuyoshi; Nitta, Keiko; Yoshioka, Kotaro; Kuwahara, Hiroya; Yasuhara, Hidenori; Baba, Takeshi; Ono, Fumiko; Miyata, Kanjiro; Miyake, Koichi; Seth, Punit P.; Low, Audrey; Yoshida, Masayuki; Bennett, C. Frank; Kataoka, Kazunori; Mizusawa, Hidehiro; Obika, Satoshi; Yokota, Takanori

    2015-01-01

    Antisense oligonucleotides (ASOs) are recognized therapeutic agents for the modulation of specific genes at the post-transcriptional level. Similar to any medical drugs, there are opportunities to improve their efficacy and safety. Here we develop a short DNA/RNA heteroduplex oligonucleotide (HDO) with a structure different from double-stranded RNA used for short interfering RNA and single-stranded DNA used for ASO. A DNA/locked nucleotide acid gapmer duplex with an α-tocopherol-conjugated complementary RNA (Toc-HDO) is significantly more potent at reducing the expression of the targeted mRNA in liver compared with the parent single-stranded gapmer ASO. Toc-HDO also improves the phenotype in disease models more effectively. In addition, the high potency of Toc-HDO results in a reduction of liver dysfunction observed in the parent ASO at a similar silencing effect. HDO technology offers a novel concept of therapeutic oligonucleotides, and the development of this molecular design opens a new therapeutic field. PMID:26258894

  7. Theory and modeling of particles with DNA-mediated interactions

    NASA Astrophysics Data System (ADS)

    Licata, Nicholas A.

    2008-05-01

    In recent years significant attention has been attracted to proposals which utilize DNA for nanotechnological applications. Potential applications of these ideas range from the programmable self-assembly of colloidal crystals, to biosensors and nanoparticle based drug delivery platforms. In Chapter I we introduce the system, which generically consists of colloidal particles functionalized with specially designed DNA markers. The sequence of bases on the DNA markers determines the particle type. Due to the hybridization between complementary single-stranded DNA, specific, type-dependent interactions can be introduced between particles by choosing the appropriate DNA marker sequences. In Chapter II we develop a statistical mechanical description of the aggregation and melting behavior of particles with DNA-mediated interactions. In Chapter III a model is proposed to describe the dynamical departure and diffusion of particles which form reversible key-lock connections. In Chapter IV we propose a method to self-assemble nanoparticle clusters using DNA scaffolds. A natural extension is discussed in Chapter V, the programmable self-assembly of nanoparticle clusters where the desired cluster geometry is encoded using DNA-mediated interactions. In Chapter VI we consider a nanoparticle based drug delivery platform for targeted, cell specific chemotherapy. In Chapter VII we present prospects for future research: the connection between DNA-mediated colloidal crystallization and jamming, and the inverse problem in self-assembly.

  8. Using complementary DNA from MyoD-transduced fibroblasts to sequence large muscle genes.

    PubMed

    Waddell, Leigh B; Monnier, Nicole; Cooper, Sandra T; North, Kathryn N; Clarke, Nigel F

    2011-08-01

    Large muscle genes are often sequenced using complementary DNA (cDNA) made from muscle messenger RNA (mRNA) to reduce the cost and workload associated with sequencing from genomic DNA. Two potential barriers are the availability of a frozen muscle biopsy, and difficulties in detecting nonsense mutations due to nonsense-mediated mRNA decay (NMD). We present patient examples showing that use of MyoD-transduced fibroblasts as a source of muscle-specific mRNA overcomes these potential difficulties in sequencing large muscle-related genes. Copyright © 2011 Wiley Periodicals, Inc.

  9. A Novel Method for Rapid Hybridization of DNA to a Solid Support

    PubMed Central

    Pettersson, Erik; Ahmadian, Afshin; Ståhl, Patrik L.

    2013-01-01

    Here we present a novel approach entitled Magnetic Forced Hybridization (MFH) that provides the means for efficient and direct hybridization of target nucleic acids to complementary probes immobilized on a glass surface in less than 15 seconds at ambient temperature. In addition, detection is carried out instantly since the beads become visible on the surface. The concept of MFH was tested for quality control of array manufacturing, and was combined with a multiplex competitive hybridization (MUCH) approach for typing of Human Papilloma Virus (HPV). Magnetic Forced Hybridization of bead-DNA constructs to a surface achieves a significant reduction in diagnostic testing time. In addition, readout of results by visual inspection of the unassisted eye eliminates the need for additional expensive instrumentation. The method uses the same set of beads throughout the whole process of manipulating and washing DNA constructs prior to detection, as in the actual detection step itself. PMID:23950946

  10. Detection of DNA hybridization using graphene-coated black phosphorus surface plasmon resonance sensor

    NASA Astrophysics Data System (ADS)

    Pal, Sarika; Verma, Alka; Raikwar, S.; Prajapati, Y. K.; Saini, J. P.

    2018-05-01

    In this paper, graphene-coated black phosphorus at the metal surface for the detection of DNA hybridization event is numerically demonstrated. The strategy consists of placing the sensing medium on top of black phosphorus-graphene-coated SPR which interfaces with phosphate-buffered saline solution carrying single-stranded DNA. Upon hybridization with its complementary DNA, desorption of the nanostructures takes place and thus enables the sensitive detection of the DNA hybridization event. The proposed sensor exhibits a sensitivity (125 ο/RIU), detection accuracy (0.95) and quality factor (13.62 RIU-1) for complementary DNA. In comparison with other reported papers, our suggested sensor provides much better performance. Thus, this label-free DNA detection platform should spur off new interest towards the use of black phosphorus-graphene-coated SPR interfaces.

  11. Unravelling the structural and mechanistic basis of CRISPR-Cas systems.

    PubMed

    van der Oost, John; Westra, Edze R; Jackson, Ryan N; Wiedenheft, Blake

    2014-07-01

    Bacteria and archaea have evolved sophisticated adaptive immune systems, known as CRISPR-Cas (clustered regularly interspaced short palindromic repeats-CRISPR-associated proteins) systems, which target and inactivate invading viruses and plasmids. Immunity is acquired by integrating short fragments of foreign DNA into CRISPR loci, and following transcription and processing of these loci, the CRISPR RNAs (crRNAs) guide the Cas proteins to complementary invading nucleic acid, which results in target interference. In this Review, we summarize the recent structural and biochemical insights that have been gained for the three major types of CRISPR-Cas systems, which together provide a detailed molecular understanding of the unique and conserved mechanisms of RNA-guided adaptive immunity in bacteria and archaea.

  12. DNA forms of the geminivirus African cassava mosaic virus consistent with a rolling circle mechanism of replication.

    PubMed Central

    Saunders, K; Lucy, A; Stanley, J

    1991-01-01

    We have analysed DNA from African cassava mosaic virus (ACMV)-infected Nicotiana benthamiana by two-dimensional agarose gel electrophoresis and detected ACMV-specific DNAs by blot-hybridisation. ACMV DNA forms including the previously characterised single-stranded, open-circular, linear and supercoiled DNAs along with five previously uncharacterised heterogeneous DNAs (H1-H5) were resolved. The heterogeneous DNAs were characterised by their chromatographic properties on BND-cellulose and their ability to hybridise to strand-specific and double-stranded probes. The data suggest a rolling circle mechanism of DNA replication, based on the sizes and strand specificity of the heterogeneous single-stranded DNA forms and their electrophoretic properties in relation to genome length single-stranded DNAs. Second-strand synthesis on a single-stranded virus-sense template is evident from the position of heterogeneous subgenomic complementary-sense DNA (H3) associated with genome-length virus-sense template (VT) DNA. The position of heterogeneous virus-sense DNA (H5), ranging in size from one to two genome lengths, is consistent with its association with genome-length complementary-sense template (CT) DNA, reflecting virus-sense strand displacement during replication from a double-stranded intermediate. The absence of subgenomic complementary-sense DNA associated with the displaced virus-sense strand suggests that replication proceeds via an obligate single-stranded intermediate. The other species of heterogeneous DNAs comprised concatemeric single-stranded virus-sense DNA (H4), and double-stranded or partially single-stranded DNA (H1 and H2). Images PMID:2041773

  13. Cryptic splice site in the complementary DNA of glucocerebrosidase causes inefficient expression.

    PubMed

    Bukovac, Scott W; Bagshaw, Richard D; Rigat, Brigitte A; Callahan, John W; Clarke, Joe T R; Mahuran, Don J

    2008-10-15

    The low levels of human lysosomal glucocerebrosidase activity expressed in transiently transfected Chinese hamster ovary (CHO) cells were investigated. Reverse transcription PCR (RT-PCR) demonstrated that a significant portion of the transcribed RNA was misspliced owing to the presence of a cryptic splice site in the complementary DNA (cDNA). Missplicing results in the deletion of 179 bp of coding sequence and a premature stop codon. A repaired cDNA was constructed abolishing the splice site without changing the amino acid sequence. The level of glucocerebrosidase expression was increased sixfold. These data demonstrate that for maximum expression of any cDNA construct, the transcription products should be examined.

  14. Analysis of bacterial populations in the environment using two-dimensional gel electrophoresis of genomic DNA and complementary DNA.

    PubMed

    Liu, Guo-Hua; Nakamura, Tatsuo; Amemiya, Takashi; Rajendran, Narasimmalu; Itoh, Kiminori

    2011-01-01

    Two-dimensional gel electrophoresis (2-DGE) mapping of genomic DNA and complementary DNA (cDNA) amplicons was attempted to analyze total and active bacterial populations within soil and activated sludge samples. Distinct differences in the number and species of bacterial populations and those that were metabolically active at the time of sampling were visually observed especially for the soil community. Statistical analyses and sequencing based on the 2-DGE data further revealed the relationships between total and active bacterial populations within each community. This high-resolution technique would be useful for obtaining a better understanding of bacterial population structures in the environment.

  15. Isolation of a complementary DNA clone for the human complement protein C2 and its use in the identification of a restriction fragment length polymorphism.

    PubMed Central

    Woods, D E; Edge, M D; Colten, H R

    1984-01-01

    Complementary DNA (cDNA) clones corresponding to the major histocompatibility (MHC) class III antigen, complement protein C2, have been isolated from human liver cDNA libraries with the use of a complex mixture of synthetic oligonucleotides (17 mer) that contains 576 different oligonucleotide sequences. The C2 cDNA were used to identify a DNA restriction enzyme fragment length polymorphism that provides a genetic marker within the MHC that was not detectable at the protein level. An extensive search for genomic polymorphisms using a cDNA clone for another MHC class III gene, factor B, failed to reveal any DNA variants. The genomic variants detected with the C2 cDNA probe provide an additional genetic marker for analysis of MHC-linked diseases. Images PMID:6086718

  16. Using long ssDNA polynucleotides to amplify STRs loci in degraded DNA samples

    PubMed Central

    Pérez Santángelo, Agustín; Corti Bielsa, Rodrigo M.; Sala, Andrea; Ginart, Santiago; Corach, Daniel

    2017-01-01

    Obtaining informative short tandem repeat (STR) profiles from degraded DNA samples is a challenging task usually undermined by locus or allele dropouts and peak-high imbalances observed in capillary electrophoresis (CE) electropherograms, especially for those markers with large amplicon sizes. We hereby show that the current STR assays may be greatly improved for the detection of genetic markers in degraded DNA samples by using long single stranded DNA polynucleotides (ssDNA polynucleotides) as surrogates for PCR primers. These long primers allow a closer annealing to the repeat sequences, thereby reducing the length of the template required for the amplification in fragmented DNA samples, while at the same time rendering amplicons of larger sizes suitable for multiplex assays. We also demonstrate that the annealing of long ssDNA polynucleotides does not need to be fully complementary in the 5’ region of the primers, thus allowing for the design of practically any long primer sequence for developing new multiplex assays. Furthermore, genotyping of intact DNA samples could also benefit from utilizing long primers since their close annealing to the target STR sequences may overcome wrong profiling generated by insertions/deletions present between the STR region and the annealing site of the primers. Additionally, long ssDNA polynucleotides might be utilized in multiplex PCR assays for other types of degraded or fragmented DNA, e.g. circulating, cell-free DNA (ccfDNA). PMID:29099837

  17. Interaction Analysis through Proteomic Phage Display

    PubMed Central

    2014-01-01

    Phage display is a powerful technique for profiling specificities of peptide binding domains. The method is suited for the identification of high-affinity ligands with inhibitor potential when using highly diverse combinatorial peptide phage libraries. Such experiments further provide consensus motifs for genome-wide scanning of ligands of potential biological relevance. A complementary but considerably less explored approach is to display expression products of genomic DNA, cDNA, open reading frames (ORFs), or oligonucleotide libraries designed to encode defined regions of a target proteome on phage particles. One of the main applications of such proteomic libraries has been the elucidation of antibody epitopes. This review is focused on the use of proteomic phage display to uncover protein-protein interactions of potential relevance for cellular function. The method is particularly suited for the discovery of interactions between peptide binding domains and their targets. We discuss the largely unexplored potential of this method in the discovery of domain-motif interactions of potential biological relevance. PMID:25295249

  18. DNA Three-Way Junction for Differentiation of Single-Nucleotide Polymorphisms with Fluorescent Copper Nanoparticles.

    PubMed

    Sun, Feifei; You, Ying; Liu, Jie; Song, Quanwei; Shen, Xiaotong; Na, Na; Ouyang, Jin

    2017-05-23

    A label- and enzyme-free fluorescent sensor for the detection of single-nucleotide polymorphisms (SNPs) at room temperature is proposed, using new copper nanoparticles (CuNPs) as fluorescent reporters. The CuNPs were constructed by using a DNA three-way junction (3WJ) template. In this assay, two complementary adenine/thymine-rich probes can hybridize with the wild-type target simultaneously to construct a 3WJ structure, serving as an efficient scaffold for the generation of CuNPs. However, the CuNPs produce weak fluorescence when the probes bind with a mutant-type target. SNPs can be identified by the difference in fluorescence intensity of the CuNPs. This SNPs detection strategy is straightforward, cost-effective, and avoids the complicated procedures of labeling or enzymatic reactions. The fluorescent sensor is versatile and can be applied to all types of mutation because the probes are programmable. Moreover, the sensor exhibits good detection performance in biological samples. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. The Impact of DNA Topology and Guide Length on Target Selection by a Cytosine-Specific Cas9.

    PubMed

    Tsui, Tsz Kin Martin; Hand, Travis H; Duboy, Emily C; Li, Hong

    2017-06-16

    Cas9 is an RNA-guided DNA cleavage enzyme being actively developed for genome editing and gene regulation. To be cleaved by Cas9, a double stranded DNA, or the protospacer, must be complementary to the guide region, typically 20-nucleotides in length, of the Cas9-bound guide RNA, and adjacent to a short Cas9-specific element called Protospacer Adjacent Motif (PAM). Understanding the correct juxtaposition of the protospacer- and PAM-interaction with Cas9 will enable development of versatile and safe Cas9-based technology. We report identification and biochemical characterization of Cas9 from Acidothermus cellulolyticus (AceCas9). AceCas9 depends on a 5'-NNNCC-3' PAM and is more efficient in cleaving negative supercoils than relaxed DNA. Kinetic as well as in vivo activity assays reveal that AceCas9 achieves optimal activity when combined with a guide RNA containing a 24-nucleotide complementarity region. The cytosine-specific, DNA topology-sensitive, and extended guide-dependent properties of AceCas9 may be explored for specific genome editing applications.

  20. DNA Detection by Flow Cytometry using PNA-Modified Metal-Organic Framework Particles.

    PubMed

    Mejia-Ariza, Raquel; Rosselli, Jessica; Breukers, Christian; Manicardi, Alex; Terstappen, Leon W M M; Corradini, Roberto; Huskens, Jurriaan

    2017-03-23

    A DNA-sensing platform is developed by exploiting the easy surface functionalization of metal-organic framework (MOF) particles and their highly parallelized fluorescence detection by flow cytometry. Two strategies were employed to functionalize the surface of MIL-88A, using either covalent or non-covalent interactions, resulting in alkyne-modified and biotin-modified MIL-88A, respectively. Covalent surface coupling of an azide-dye and the alkyne-MIL-88A was achieved by means of a click reaction. Non-covalent streptavidin-biotin interactions were employed to link biotin-PNA to biotin-MIL-88A particles mediated by streptavidin. Characterization by confocal imaging and flow cytometry demonstrated that DNA can be bound selectively to the MOF surface. Flow cytometry provided quantitative data of the interaction with DNA. Making use of the large numbers of particles that can be simultaneously processed by flow cytometry, this MOF platform was able to discriminate between fully complementary, single-base mismatched, and randomized DNA targets. © 2017 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.

  1. Electrochemical biosensor for Mycobacterium tuberculosis DNA detection based on gold nanotubes array electrode platform.

    PubMed

    Torati, Sri Ramulu; Reddy, Venu; Yoon, Seok Soo; Kim, CheolGi

    2016-04-15

    The template assisted electrochemical deposition technique was used for the synthesis of gold nanotubes array (AuNTsA). The morphological structure of the synthesized AuNTsA was observed by scanning electron microscopy and found that the individual nanotubes are around 1.5 μm in length with a diameter of 200 nm. Nanotubes are vertically aligned to the Au thick film, which is formed during the synthesis process of nanotubes. The electrochemical performance of the AuNTsA was compared with the bare Au electrode and found that AuNTsA has better electron transfer surface than bare Au electrode which is due to the high surface area. Hence, the AuNTsA was used as an electrode for the fabrication of DNA hybridization biosensor for detection of Mycobacterium Tuberculosis DNA. The DNA hybridization biosensor constructed by AuNTsA electrode was characterized by cyclic voltammetry technique with Fe(CN)6(3-/4-) as an electrochemical redox indicator. The selectivity of the fabricated biosensor was illustrated by hybridization with complementary DNA and non-complementary DNA with probe DNA immobilized AuNTsA electrode using methylene blue as a hybridization indicator. The developed electrochemical DNA biosensor shows good linear range of complementary DNA concentration from 0.01 ng/μL to 100 ng/μL with high detection limit. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Sensitive detection of point mutation by electrochemiluminescence and DNA ligase-based assay

    NASA Astrophysics Data System (ADS)

    Zhou, Huijuan; Wu, Baoyan

    2008-12-01

    The technology of single-base mutation detection plays an increasingly important role in diagnosis and prognosis of genetic-based diseases. Here we reported a new method for the analysis of point mutations in genomic DNA through the integration of allele-specific oligonucleotide ligation assay (OLA) with magnetic beads-based electrochemiluminescence (ECL) detection scheme. In this assay the tris(bipyridine) ruthenium (TBR) labeled probe and the biotinylated probe are designed to perfectly complementary to the mutant target, thus a ligation can be generated between those two probes by Taq DNA Ligase in the presence of mutant target. If there is an allele mismatch, the ligation does not take place. The ligation products are then captured onto streptavidin-coated paramagnetic beads, and detected by measuring the ECL signal of the TBR label. Results showed that the new method held a low detection limit down to 10 fmol and was successfully applied in the identification of point mutations from ASTC-α-1, PANC-1 and normal cell lines in codon 273 of TP53 oncogene. In summary, this method provides a sensitive, cost-effective and easy operation approach for point mutation detection.

  3. Complementary and partially complementary DNA duplexes tethered to a functionalized substrate: a molecular dynamics approach to biosensing.

    PubMed

    Monti, Susanna; Cacelli, Ivo; Ferretti, Alessandro; Prampolini, Giacomo; Barone, Vincenzo

    2011-07-21

    Molecular dynamics simulations (90 ns) of different DNA complexes attached to a functionalized substrate in solution were performed in order to clarify the behavior of mismatched DNA sequences captured by a tethered DNA probe (biochip). Examination of the trajectories revealed that the substrate influence and a series of cooperative events, including recognition, reorientation and reorganization of the bases, could induce the formation of stable duplexes having non-canonical arrangements. Major adjustment of the structures was observed when the mutated base was located in the end region of the chain close to the surface. This journal is © the Owner Societies 2011

  4. The construction, identification and partial characterization of plasmids containing guinea-pig milk protein complementary DNA sequences.

    PubMed Central

    Craig, R K; Hall, L; Parker, D; Campbell, P N

    1981-01-01

    A complementary DNA (cDNA) plasmid library has been constructed in the plasmid pAT153, using poly(A)-containing RNA isolated from the lactating guinea-pig mammary gland as the starting material. Double stranded cDNA was inserted into the EcoRI site of the plasmid using poly(dA . dT) tails, then transformed into Escherichia coli HB101. From the resulting colonies we have selected and partially characterized plasmids containing cDNA copies of the mRNAs for casein A, casein B, casein C and alpha-lactalbumin. However, the proportion containing casein C cDNA was exceptionally low, and these contained at best 60% of the mRNA sequence. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. PMID:7306038

  5. Solid phase sequencing of biopolymers

    DOEpatents

    Cantor, Charles; Koster, Hubert

    2010-09-28

    This invention relates to methods for detecting and sequencing target nucleic acid sequences, to mass modified nucleic acid probes and arrays of probes useful in these methods, and to kits and systems which contain these probes. Useful methods involve hybridizing the nucleic acids or nucleic acids which represent complementary or homologous sequences of the target to an array of nucleic acid probes. These probes comprise a single-stranded portion, an optional double-stranded portion and a variable sequence within the single-stranded portion. The molecular weights of the hybridized nucleic acids of the set can be determined by mass spectroscopy, and the sequence of the target determined from the molecular weights of the fragments. Nucleic acids whose sequences can be determined include DNA or RNA in biological samples such as patient biopsies and environmental samples. Probes may be fixed to a solid support such as a hybridization chip to facilitate automated molecular weight analysis and identification of the target sequence.

  6. Sensitive Leptospira DNA detection using tapered optical fiber sensor.

    PubMed

    Zainuddin, Nurul H; Chee, Hui Y; Ahmad, Muhammad Z; Mahdi, Mohd A; Abu Bakar, Muhammad H; Yaacob, Mohd H

    2018-03-23

    This paper presents the development of tapered optical fiber sensor to detect a specific Leptospira bacteria DNA. The bacteria causes Leptospirosis, a deadly disease but with common early flu-like symptoms. Optical single mode fiber (SMF) of 125 μm diameter is tapered to produce 12 μm waist diameter and 15 cm length. The novel DNA-based optical fiber sensor is functionalized by incubating the tapered region with sodium hydroxide (NaOH), (3-Aminopropyl) triethoxysilane and glutaraldehyde. Probe DNA is immobilized onto the tapered region and subsequently hybridized by its complementary DNA (cDNA). The transmission spectra of the DNA-based optical fiber sensor are measured in the 1500 to 1600 nm wavelength range. It is discovered that the shift of the wavelength in the SMF sensor is linearly proportional with the increase in the cDNA concentrations from 0.1 to 1.0 nM. The sensitivity of the sensor toward DNA is measured to be 1.2862 nm/nM and able to detect as low as 0.1 fM. The sensor indicates high specificity when only minimal shift is detected for non-cDNA testing. The developed sensor is able to distinguish between actual DNA of Leptospira serovars (Canicola and Copenhageni) against Clostridium difficile (control sample) at very low (femtomolar) target concentrations. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. An internalin a probe-based genosensor for Listeria monocytogenes detection and differentiation.

    PubMed

    Bifulco, Laura; Ingianni, Angela; Pompei, Raffaello

    2013-01-01

    Internalin A (InlA), a protein required for Listeria monocytogenes virulence, is encoded by the inlA gene, which is only found in pathogenic strains of this genus. One of the best ways to detect and confirm the pathogenicity of the strain is the detection of one of the virulence factors produced by the microorganism. This paper focuses on the design of an electrochemical genosensor used to detect the inlA gene in Listeria strains without labelling the target DNA. The electrochemical sensor was obtained by immobilising an inlA gene probe (single-stranded oligonucleotide) on the surfaces of screen-printed gold electrodes (Au-SPEs) by means of a mercaptan-activated self-assembled monolayer (SAM). The hybridisation reaction occurring on the electrode surface was electrochemically transduced by differential pulse voltammetry (DPV) using methylene blue (MB) as an indicator. The covalently immobilised single-stranded DNA was able to selectively hybridise to its complementary DNA sequences in solution to form double-stranded DNA on the gold surface. A significant decrease of the peak current of the voltammogram (DPV) upon hybridisation of immobilised ssDNA was recorded. Whole DNA samples of L. monocytogenes strains could be discriminated from other nonpathogenic Listeria species DNA with the inlA gene DNA probe genosensor.

  8. Complementary DNA sequences encoding the multimammate rat MHC class II DQ alpha and beta chains and cross-species sequence comparison in rodents.

    PubMed

    de Bellocq, J Goüy; Leirs, H

    2009-09-01

    Sequences of the complete open reading frame (ORF) for rodents major histocompatibility complex (MHC) class II genes are rare. Multimammate rat (Mastomys natalensis) complementary DNA (cDNA) encoding the alpha and beta chains of MHC class II DQ gene was cloned from a rapid amplifications of cDNA Emds (RACE) cDNA library. The ORFs consist of 801 and 771 bp encoding 266 and 256 amino acid residues for DQB and DQA, respectively. The genomic structure of Mana-DQ genes is globally analogous to that described for other rodents except for the insertion of a serine residue in the signal peptide of Mana-DQB, which is unique among known rodents.

  9. Visualization of nucleic acids with synthetic exciton-controlled fluorescent oligonucleotide probes.

    PubMed

    Wang, Dan Ohtan; Okamoto, Akimitsu

    2015-01-01

    Engineered probes to adapt new photochemical properties upon recognition of target nucleic acids offer powerful tools to DNA and RNA visualization technologies. Herein, we describe a rapid and effective visualization method of nucleic acids in both fixed and living cells with hybridization-sensitive fluorescent oligonucleotide probes. These probes are efficiently quenched in an aqueous environment due to the homodimeric, excitonic interactions between fluorophores but become highly fluorescent upon hybridization to DNA or RNA with complementary sequences. The fast hybridization kinetics and quick fluorescence activation of the new probes allow applications to simplify the conventional fluorescent in situ hybridization protocols and reduce the amount of time to process the samples. Furthermore, hybridization-sensitive fluorescence emission of the probes allows monitoring dynamic behaviors of RNA in living cells.

  10. Template-switching during DNA synthesis by Thermus aquaticus DNA polymerase I.

    PubMed Central

    Odelberg, S J; Weiss, R B; Hata, A; White, R

    1995-01-01

    Recombinant DNA molecules are often generated during the polymerase chain reaction (PCR) when partially homologous templates are available [e.g., see Pääbo et al. (1990) J. Biol. Chem. 265, 4718-4721]. It has been suggested that these recombinant molecules are a consequence of truncated extension products annealing to partially homologous templates on subsequent PCR cycles. However, we demonstrate here that recombinants can be generated during a single round of primer extension in the absence of subsequent heat denaturation, indicating that template-switching produces some of these recombinant molecules. Two types of template-switches were observed: (i) switches to pre-existing templates and (ii) switches to the complementary nascent strand. Recombination is reduced several fold when the complementary template strands are physically separated by attachment to streptavidin magnetic beads. This result supports the hypothesis that either the polymerase or at least one of the two extending strands switches templates during DNA synthesis and that interaction between the complementary template strands is necessary for efficient template-switching. Images PMID:7596836

  11. Programmable display of DNA-protein chimeras for controlling cell-hydrogel interactions via reversible intermolecular hybridization.

    PubMed

    Zhang, Zhaoyang; Li, Shihui; Chen, Niancao; Yang, Cheng; Wang, Yong

    2013-04-08

    Extensive studies have been recently carried out to achieve dynamic control of cell-material interactions primarily through physicochemical stimulation. The purpose of this study was to apply reversible intermolecular hybridization to program cell-hydrogel interactions in physiological conditions based on DNA-antibody chimeras and complementary oligonucleotides. The results showed that DNA oligonucleotides could be captured to and released from the immobilizing DNA-functionalized hydrogels with high specificity via DNA hybridization. Accordingly, DNA-antibody chimeras were captured to the hydrogels, successfully inducing specific cell attachment. The cell attachment to the hydrogels reached the plateau at approximately half an hour after the functionalized hydrogels and the cells were incubated together. The attached cells were rapidly released from the bound hydrogels when triggering complementary oligonucleotides were introduced to the system. However, the capability of the triggering complementary oligonucleotides in releasing cells was affected by the length of intermolecular hybridization. The length needed to be at least more than 20 base pairs in the current experimental setting. Notably, because the procedure of intermolecular hybridization did not involve any harsh condition, the released cells maintained the same viability as that of the cultured cells. The functionalized hydrogels also exhibited the potential to catch and release cells repeatedly. Therefore, this study demonstrates that it is promising to regulate cell-material interactions dynamically through the DNA-programmed display of DNA-protein chimeras.

  12. A direct detection of Escherichia coli genomic DNA using gold nanoprobes

    PubMed Central

    2012-01-01

    Background In situation like diagnosis of clinical and forensic samples there exists a need for highly sensitive, rapid and specific DNA detection methods. Though conventional DNA amplification using PCR can provide fast results, it is not widely practised in diagnostic laboratories partially because it requires skilled personnel and expensive equipment. To overcome these limitations nanoparticles have been explored as signalling probes for ultrasensitive DNA detection that can be used in field applications. Among the nanomaterials, gold nanoparticles (AuNPs) have been extensively used mainly because of its optical property and ability to get functionalized with a variety of biomolecules. Results We report a protocol for the use of gold nanoparticles functionalized with single stranded oligonucleotide (AuNP- oligo probe) as visual detection probes for rapid and specific detection of Escherichia coli. The AuNP- oligo probe on hybridization with target DNA containing complementary sequences remains red whereas test samples without complementary DNA sequences to the probe turns purple due to acid induced aggregation of AuNP- oligo probes. The color change of the solution is observed visually by naked eye demonstrating direct and rapid detection of the pathogenic Escherichia coli from its genomic DNA without the need for PCR amplification. The limit of detection was ~54 ng for unamplified genomic DNA. The method requires less than 30 minutes to complete after genomic DNA extraction. However, by using unamplified enzymatic digested genomic DNA, the detection limit of 11.4 ng was attained. Results of UV-Vis spectroscopic measurement and AFM imaging further support the hypothesis of aggregation based visual discrimination. To elucidate its utility in medical diagnostic, the assay was validated on clinical strains of pathogenic Escherichia coli obtained from local hospitals and spiked urine samples. It was found to be 100% sensitive and proves to be highly specific without any cross reaction with non-Escherichia coli strains. Conclusion This work gives entry into a new class of DNA/gold nanoparticles hybrid materials which might have optical property that can be controlled for application in diagnostics. We note that it should be possible to extend this strategy easily for developing new types of DNA biosensor for point of care detection. The salient feature of this approach includes low-cost, robust reagents and simple colorimetric detection of pathogen. PMID:22309695

  13. Highly sensitive self-complementary DNA nanoswitches triggered by polyelectrolytes.

    PubMed

    Wu, Jincai; Yu, Feng; Zhang, Zheng; Chen, Yong; Du, Jie; Maruyama, Atsushi

    2016-01-07

    Dimerization of two homologous strands of genomic DNA/RNA is an essential feature of retroviral replication. Herein we show that a cationic comb-type copolymer (CCC), poly(L-lysine)-graft-dextran, accelerates the dimerization of self-complementary stem-loop DNA, frequently found in functional DNA/RNA molecules, such as aptamers. Furthermore, an anionic polymer poly(sodium vinylsulfonate) (PVS) dissociates CCC from the duplex shortly within a few seconds. Then single stem-loop DNA spontaneously transforms from its dimer. Thus we can easily control the dimer and stem-loop DNA by switching on/off CCC activity. Both polyelectrolytes and DNA concentrations are in the nanomole per liter range. The polyelectrolyte-assisted transconformation and sequences design strategy ensures the reversible state control with rapid response and effective switching under physiologically relevant conditions. A further application of this sensitive assembly is to construct an aptamer-type drug delivery system, bind or release functional molecules responding to its transconformation.

  14. Chapter 17. Extension of endogenous primers as a tool to detect micro-RNA targets.

    PubMed

    Vatolin, Sergei; Weil, Robert J

    2008-01-01

    Mammalian cells express a large number of small, noncoding RNAs, including micro-RNAs (miRNAs), that can regulate both the level of a target mRNA and the protein produced by the target mRNA. Recognition of miRNA targets is a complicated process, as a single target mRNA may be regulated by several miRNAs. The potential for combinatorial miRNA-mediated regulation of miRNA targets complicates diagnostic and therapeutic applications of miRNAs. Despite significant progress in understanding the biology of miRNAs and advances in computational predictions of miRNA targets, methods that permit direct physical identification of miRNA-mRNA complexes in eukaryotic cells are still required. Several groups have utilized coimmunoprecipitation of RNA associated with a protein(s) that is part of the RNA silencing macromolecular complex. This chapter describes a detailed but straightforward strategy that identifies miRNA targets based on the assumption that small RNAs base paired with a complementary target mRNA can be used as a primer to synthesize cDNA that may be used for cloning, identification, and functional analysis.

  15. Construction of a directed hammerhead ribozyme library: towards the identification of optimal target sites for antisense-mediated gene inhibition.

    PubMed Central

    Pierce, M L; Ruffner, D E

    1998-01-01

    Antisense-mediated gene inhibition uses short complementary DNA or RNA oligonucleotides to block expression of any mRNA of interest. A key parameter in the success or failure of an antisense therapy is the identification of a suitable target site on the chosen mRNA. Ultimately, the accessibility of the target to the antisense agent determines target suitability. Since accessibility is a function of many complex factors, it is currently beyond our ability to predict. Consequently, identification of the most effective target(s) requires examination of every site. Towards this goal, we describe a method to construct directed ribozyme libraries against any chosen mRNA. The library contains nearly equal amounts of ribozymes targeting every site on the chosen transcript and the library only contains ribozymes capable of binding to that transcript. Expression of the ribozyme library in cultured cells should allow identification of optimal target sites under natural conditions, subject to the complexities of a fully functional cell. Optimal target sites identified in this manner should be the most effective sites for therapeutic intervention. PMID:9801305

  16. A Label-Free Photoluminescence Genosensor Using Nanostructured Magnesium Oxide for Cholera Detection

    NASA Astrophysics Data System (ADS)

    Patel, Manoj Kumar; Ali, Md. Azahar; Krishnan, Sadagopan; Agrawal, Ved Varun; Al Kheraif, Abdulaziz A.; Fouad, H.; Ansari, Z. A.; Ansari, S. G.; Malhotra, Bansi D.

    2015-11-01

    Nanomaterial-based photoluminescence (PL) diagnostic devices offer fast and highly sensitive detection of pesticides, DNA, and toxic agents. Here we report a label-free PL genosensor for sensitive detection of Vibrio cholerae that is based on a DNA hybridization strategy utilizing nanostructured magnesium oxide (nMgO; size >30 nm) particles. The morphology and size of the synthesized nMgO were determined by transmission electron microscopic (TEM) studies. The probe DNA (pDNA) was conjugated with nMgO and characterized by X-ray photoelectron and Fourier transform infrared spectroscopic techniques. The target complementary genomic DNA (cDNA) isolated from clinical samples of V. cholerae was subjected to DNA hybridization studies using the pDNA-nMgO complex and detection of the cDNA was accomplished by measuring changes in PL intensity. The PL peak intensity measured at 700 nm (red emission) increases with the increase in cDNA concentration. A linear range of response in the developed PL genosensor was observed from 100 to 500 ng/μL with a sensitivity of 1.306 emi/ng, detection limit of 3.133 ng/μL and a regression coefficient (R2) of 0.987. These results show that this ultrasensitive PL genosensor has the potential for applications in the clinical diagnosis of cholera.

  17. Repairing the sickle cell mutation. I. Specific covalent binding of a photoreactive third strand to the mutated base pair.

    PubMed

    Broitman, S; Amosova, O; Dolinnaya, N G; Fresco, J R

    1999-07-30

    A DNA third strand with a 3'-psoralen substituent was designed to form a triplex with the sequence downstream of the T.A mutant base pair of the human sickle cell beta-globin gene. Triplex-mediated psoralen modification of the mutant T residue was sought as an approach to gene repair. The 24-nucleotide purine-rich target sequence switches from one strand to the other and has four pyrimidine interruptions. Therefore, a third strand sequence favorable to two triplex motifs was used, one parallel and the other antiparallel to it. To cope with the pyrimidine interruptions, which weaken third strand binding, 5-methylcytosine and 5-propynyluracil were used in the third strand. Further, a six residue "hook" complementary to an overhang of a linear duplex target was added to the 5'-end of the third strand via a T(4) linker. In binding to the overhang by Watson-Crick pairing, the hook facilitates triplex formation. This third strand also binds specifically to the target within a supercoiled plasmid. The psoralen moiety at the 3'-end of the third strand forms photoadducts to the targeted T with high efficiency. Such monoadducts are known to preferentially trigger reversion of the mutation by DNA repair enzymes.

  18. A label-free and high-efficient GO-based aptasensor for cancer cells based on cyclic enzymatic signal amplification.

    PubMed

    Xiao, Kunyi; Liu, Juan; Chen, Hui; Zhang, Song; Kong, Jilie

    2017-05-15

    A label-free and high-efficient graphene oxide (GO)-based aptasensor was developed for the detection of low quantity cancer cells based on cell-triggered cyclic enzymatic signal amplification (CTCESA). In the absence of target cells, hairpin aptamer probes (HAPs) and dye-labeled linker DNAs stably coexisted in solution, and the fluorescence was quenched by the GO-based FÖrster resonance energy transfer (FRET) process. In the presence of target cells, the specific binding of HAPs with the target cells triggered a conformational alternation, which resulted in linker DNA complementary pairing and cleavage by nicking endonuclease-strand scission cycles. Consequently, more cleaved fragments of linker DNAs with more the terminal labeled dyes could show the enhanced fluorescence because these cleaved DNA fragments hardly combine with GOs and prevent the FRET process. Fluorescence analysis demonstrated that this GO-based aptasensor exhibited selective and sensitive response to the presence of target CCRF-CEM cells in the concentration range from 50 to 10 5 cells. The detection limit of this method was 25 cells, which was approximately 20 times lower than the detection limit of normal fluorescence aptasensors without amplification. With high sensitivity and specificity, it provided a simple and cost-effective approach for early cancer diagnosis. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. The effect of hybridization-induced secondary structure alterations on RNA detection using backscattering interferometry

    PubMed Central

    Adams, Nicholas M.; Olmsted, Ian R.; Haselton, Frederick R.; Bornhop, Darryl J.; Wright, David W.

    2013-01-01

    Backscattering interferometry (BSI) has been used to successfully monitor molecular interactions without labeling and with high sensitivity. These properties suggest that this approach might be useful for detecting biomarkers of infection. In this report, we identify interactions and characteristics of nucleic acid probes that maximize BSI signal upon binding the respiratory syncytial virus nucleocapsid gene RNA biomarker. The number of base pairs formed upon the addition of oligonucleotide probes to a solution containing the viral RNA target correlated with the BSI signal magnitude. Using RNA folding software mfold, we found that the predicted number of unpaired nucleotides in the targeted regions of the RNA sequence generally correlated with BSI sensitivity. We also demonstrated that locked nucleic acid (LNA) probes improved sensitivity approximately 4-fold compared to DNA probes of the same sequence. We attribute this enhancement in BSI performance to the increased A-form character of the LNA:RNA hybrid. A limit of detection of 624 pM, corresponding to ∼105 target molecules, was achieved using nine distinct ∼23-mer DNA probes complementary to regions distributed along the RNA target. Our results indicate that BSI has promise as an effective tool for sensitive RNA detection and provides a road map for further improving detection limits. PMID:23519610

  20. Unravelling the structural and mechanistic basis of CRISPR–Cas systems

    PubMed Central

    van der Oost, John; Westra, Edze R.; Jackson, Ryan N.; Wiedenheft, Blake

    2014-01-01

    Bacteria and archaea have evolved sophisticated adaptive immune systems, known as CRISPR–Cas (clustered regularly interspaced short palindromic repeats–CRISPR-associated proteins) systems, which target and inactivate invading viruses and plasmids. Immunity is acquired by integrating short fragments of foreign DNA into CRISPR loci, and following transcription and processing of these loci, the CRISPR RNAs (crRNAs) guide the Cas proteins to complementary invading nucleic acid, which results in target interference. In this Review, we summarize the recent structural and biochemical insights that have been gained for the three major types of CRISPR–Cas systems, which together provide a detailed molecular understanding of the unique and conserved mechanisms of RNA-guided adaptive immunity in bacteria and archaea. PMID:24909109

  1. Deep sequencing methods for protein engineering and design.

    PubMed

    Wrenbeck, Emily E; Faber, Matthew S; Whitehead, Timothy A

    2017-08-01

    The advent of next-generation sequencing (NGS) has revolutionized protein science, and the development of complementary methods enabling NGS-driven protein engineering have followed. In general, these experiments address the functional consequences of thousands of protein variants in a massively parallel manner using genotype-phenotype linked high-throughput functional screens followed by DNA counting via deep sequencing. We highlight the use of information rich datasets to engineer protein molecular recognition. Examples include the creation of multiple dual-affinity Fabs targeting structurally dissimilar epitopes and engineering of a broad germline-targeted anti-HIV-1 immunogen. Additionally, we highlight the generation of enzyme fitness landscapes for conducting fundamental studies of protein behavior and evolution. We conclude with discussion of technological advances. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. DNA Duplex-Based Photodynamic Molecular Beacon for Targeted Killing of Retinoblastoma Cell.

    PubMed

    Wei, Yanchun; Lu, Cuixia; Chen, Qun; Xing, Da

    2016-11-01

    Retinoblastoma (RB) is the most common primary intraocular malignancy of infancy. An alternative RB treatment protocol is proposed and tested. It is based on a photodynamic therapy (PDT) with a designed molecular beacon that specifically targets the murine double minute x (MDMX) high-expressed RB cells. A MDMX mRNA triggered photodynamic molecular beacon is designed by binding a photosensitizer molecule (pyropheophorbide-a, or PPa) and a black hole quencher-3 (BHQ3) through a complementary oligonucleotide sequence. Cells with and without MDMX high-expression are incubated with the beacon and then irradiated with a laser. The fluorescence and reactive oxygen species are detected in solution to verify the specific activation of PPa by the perfectly matched DNA targets. The cell viabilities are evaluated with CCK-8 and flow cytometry assay. The fluorescence and photo-cytoxicity of PPa is recovered and significantly higher in the MDMX high-expressed Y79 and WERI-Rb1 cells, compared to that with the MDMX low-expressed cells. The synthesized beacon exhibits high PDT efficiency toward MDMX high-expressed RB cells. The data suggest that the designed beacon may provide a potential alternative for RB therapy and secures the ground for future investigation.

  3. Quantum dot-DNA aptamer conjugates coupled with capillary electrophoresis: A universal strategy for ratiometric detection of organophosphorus pesticides.

    PubMed

    Tang, Tingting; Deng, Jingjing; Zhang, Min; Shi, Guoyue; Zhou, Tianshu

    2016-01-01

    Based on the highly sensitivity and stable-fluorescence of water-soluble CdTe/CdS core-shell quantum dots (QDs) with broad-specificity DNA aptamers, a novel ratiometric detection strategy was proposed for the sensitive detection of organophosphorus pesticides by capillary electrophoresis with laser-induced fluorescence (CE-LIF). The as-prepared QDs were first conjugated with the amino-modified oligonucleotide (AMO) by amidation reaction, which is partial complementary to the DNA aptamer of organophosphorus pesticides. Then QD-labeled AMO (QD-AMO) was incubated with the DNA aptamer to form QD-AMO-aptamer duplex. When the target organophosphorus pesticides were added, they could specifically bind the DNA aptamer, leading to the cleavage of QD-AMO-aptamer duplex, accompany with the release of QD-AMO. As a result, the ratio of peak height between QD-AMO and QD-AMO-aptamer duplex changed in the detection process of CE-LIF. This strategy was subsequently applied for the detection of phorate, profenofos, isocarbophos, and omethoate with the detection limits of 0.20, 0.10, 0.17, and 0.23μM, respectively. This is the first report about using QDs as the signal indicators for organophosphorus pesticides detection based on broad-specificity DNA aptamers by CE-LIF, thus contributing to extend the scope of application of QDs in different fields. The proposed method has great potential to be a universal strategy for rapid detection of aptamer-specific small molecule targets by simply changing the types of aptamer sequences. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. Simply amplified electrochemical aptasensor of ochratoxin A based on exonuclease-catalyzed target recycling.

    PubMed

    Tong, Ping; Zhang, Lan; Xu, Jing-Juan; Chen, Hong-Yuan

    2011-11-15

    A new "signal-on" aptasensor for ultrasensitive detection of Ochratoxin A (OTA) in wheat starch was developed based on exonuclease-catalyzed target recycling. To construct the aptasensor, a ferrocene (Fc) labeled probe DNA (S1) was immobilized on a gold electrode (GE) via Au-S bonding for the following hybridization with the complementary OTA aptamer, with the labeled Fc on S1 far from the GE surface. In the presence of analyte OTA, the formation of aptamer-OTA complex would result in not only the dissociation of aptamer from the double-strand DNA but also the transformation of the probe DNA into a hairpin structure. Subsequently, the OTA could be liberated from the aptamer-OTA complex for analyte recycling due to the employment of exonuclease, which is a single-stranded DNA specific exonuclease to selectively digest the appointed DNA (aptamer). Owing to the labeled Fc in close proximity to the electrode surface caused by the formation of the hairpin DNA and to the analyte recycling, differential pulse voltammetry (DPV) signal could be produced with enhanced signal amplification. Based on this strategy, an ultrasensitive aptasensor for the detection of OTA could be exhibited with a wide linear range of 0.005-10.0ngmL(-1) with a low detection limit (LOD) of 1.0pgmL(-1) OTA (at 3σ). The fabricated biosensor was then applied for the measurement of OTA in real wheat starch sample and validated by ELISA method. Copyright © 2011 Elsevier B.V. All rights reserved.

  5. Yeast Pif1 Accelerates Annealing of Complementary DNA Strands

    PubMed Central

    2015-01-01

    Pif1 is a helicase involved in the maintenance of nuclear and mitochondrial genomes in eukaryotes. Here we report a new activity of Saccharomyces cerevisiae Pif1, annealing of complementary DNA strands. We identified preferred substrates for annealing as those that generate a duplex product with a single-stranded overhang relative to a blunt end duplex. Importantly, we show that Pif1 can anneal DNA in the presence of ATP and Mg2+. Pif1-mediated annealing also occurs in the presence of single-stranded DNA binding proteins. Additionally, we show that partial duplex substrates with 3′-single-stranded overhangs such as those generated during double-strand break repair can be annealed by Pif1. PMID:25393406

  6. Yeast Pif1 accelerates annealing of complementary DNA strands.

    PubMed

    Ramanagoudr-Bhojappa, Ramanagouda; Byrd, Alicia K; Dahl, Christopher; Raney, Kevin D

    2014-12-09

    Pif1 is a helicase involved in the maintenance of nuclear and mitochondrial genomes in eukaryotes. Here we report a new activity of Saccharomyces cerevisiae Pif1, annealing of complementary DNA strands. We identified preferred substrates for annealing as those that generate a duplex product with a single-stranded overhang relative to a blunt end duplex. Importantly, we show that Pif1 can anneal DNA in the presence of ATP and Mg(2+). Pif1-mediated annealing also occurs in the presence of single-stranded DNA binding proteins. Additionally, we show that partial duplex substrates with 3'-single-stranded overhangs such as those generated during double-strand break repair can be annealed by Pif1.

  7. Fiber-optic microsphere-based arrays for multiplexed biological warfare agent detection.

    PubMed

    Song, Linan; Ahn, Soohyoun; Walt, David R

    2006-02-15

    We report a multiplexed high-density DNA array capable of rapid, sensitive, and reliable identification of potential biological warfare agents. An optical fiber bundle containing 6000 individual 3.1-mum-diameter fibers was chemically etched to yield microwells and used as the substrate for the array. Eighteen different 50-mer single-stranded DNA probes were covalently attached to 3.1-mum microspheres. Probe sequences were designed for Bacillus anthracis, Yersinia pestis, Francisella tularensis, Brucella melitensis, Clostridium botulinum, Vaccinia virus, and one biological warfare agent (BWA) simulant, Bacillus thuringiensis kurstaki. The microspheres were distributed into the microwells to form a randomized multiplexed high-density DNA array. A detection limit of 10 fM in a 50-microL sample volume was achieved within 30 min of hybridization for B. anthracis, Y. pestis, Vaccinia virus, and B. thuringiensis kurstaki. We used both specific responses of probes upon hybridization to complementary targets as well as response patterns of the multiplexed array to identify BWAs with high accuracy. We demonstrated the application of this multiplexed high-density DNA array for parallel identification of target BWAs in spiked sewage samples after PCR amplification. The array's miniaturized feature size, fabrication flexibility, reusability, and high reproducibility may enable this array platform to be integrated into a highly sensitive, specific, and reliable portable instrument for in situ BWA detection.

  8. A Rapid, High-Quality, Cost-Effective, Comprehensive and Expandable Targeted Next-Generation Sequencing Assay for Inherited Heart Diseases.

    PubMed

    Wilson, Kitchener D; Shen, Peidong; Fung, Eula; Karakikes, Ioannis; Zhang, Angela; InanlooRahatloo, Kolsoum; Odegaard, Justin; Sallam, Karim; Davis, Ronald W; Lui, George K; Ashley, Euan A; Scharfe, Curt; Wu, Joseph C

    2015-09-11

    Thousands of mutations across >50 genes have been implicated in inherited cardiomyopathies. However, options for sequencing this rapidly evolving gene set are limited because many sequencing services and off-the-shelf kits suffer from slow turnaround, inefficient capture of genomic DNA, and high cost. Furthermore, customization of these assays to cover emerging targets that suit individual needs is often expensive and time consuming. We sought to develop a custom high throughput, clinical-grade next-generation sequencing assay for detecting cardiac disease gene mutations with improved accuracy, flexibility, turnaround, and cost. We used double-stranded probes (complementary long padlock probes), an inexpensive and customizable capture technology, to efficiently capture and amplify the entire coding region and flanking intronic and regulatory sequences of 88 genes and 40 microRNAs associated with inherited cardiomyopathies, congenital heart disease, and cardiac development. Multiplexing 11 samples per sequencing run resulted in a mean base pair coverage of 420, of which 97% had >20× coverage and >99% were concordant with known heterozygous single nucleotide polymorphisms. The assay correctly detected germline variants in 24 individuals and revealed several polymorphic regions in miR-499. Total run time was 3 days at an approximate cost of $100 per sample. Accurate, high-throughput detection of mutations across numerous cardiac genes is achievable with complementary long padlock probe technology. Moreover, this format allows facile insertion of additional probes as more cardiomyopathy and congenital heart disease genes are discovered, giving researchers a powerful new tool for DNA mutation detection and discovery. © 2015 American Heart Association, Inc.

  9. Colorimetric DNA detection of transgenic plants using gold nanoparticles functionalized with L-shaped DNA probes

    NASA Astrophysics Data System (ADS)

    Nourisaeid, Elham; Mousavi, Amir; Arpanaei, Ayyoob

    2016-01-01

    In this study, a DNA colorimetric detection system based on gold nanoparticles functionalized with L-shaped DNA probes was prepared and evaluated. We investigated the hybridization efficiency of the L-shaped probes and studied the effect of nanoparticle size and the L-shaped DNA probe length on the performance of the as-prepared system. Probes were attached to the surface of gold nanoparticles using an adenine sequence. An optimal sequence of 35S rRNA gene promoter from the cauliflower mosaic virus, which is frequently used in the development of transgenic plants, and the two complementary ends of this gene were employed as model target strands and probe molecules, respectively. The spectrophotometric properties of the as-prepared systems indicated that the large NPs show better changes in the absorption spectrum and consequently present a better performance. The results of this study revealed that the probe/Au-NPs prepared using a vertical spacer containing 5 thymine oligonucleotides exhibited a stronger spectrophotometric response in comparison to that of larger probes. These results in general indicate the suitable performance of the L-shaped DNA probe-functionalized Au-NPs, and in particular emphasize the important role of the gold nanoparticle size and length of the DNA probes in enhancing the performance of such a system.

  10. Spacer-length DNA intermediates are associated with Cas1 in cells undergoing primed CRISPR adaptation.

    PubMed

    Musharova, Olga; Klimuk, Evgeny; Datsenko, Kirill A; Metlitskaya, Anastasia; Logacheva, Maria; Semenova, Ekaterina; Severinov, Konstantin; Savitskaya, Ekaterina

    2017-04-07

    During primed CRISPR adaptation spacers are preferentially selected from DNA recognized by CRISPR interference machinery, which in the case of Type I CRISPR-Cas systems consists of CRISPR RNA (crRNA) bound effector Cascade complex that locates complementary targets, and Cas3 executor nuclease/helicase. A complex of Cas1 and Cas2 proteins is capable of inserting new spacers in the CRISPR array. Here, we show that in Escherichia coli cells undergoing primed adaptation, spacer-sized fragments of foreign DNA are associated with Cas1. Based on sensitivity to digestion with nucleases, the associated DNA is not in a standard double-stranded state. Spacer-sized fragments are cut from one strand of foreign DNA in Cas1- and Cas3-dependent manner. These fragments are generated from much longer S1-nuclease sensitive fragments of foreign DNA that require Cas3 for their production. We propose that in the course of CRISPR interference Cas3 generates fragments of foreign DNA that are recognized by the Cas1-Cas2 adaptation complex, which excises spacer-sized fragments and channels them for insertion into CRISPR array. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  11. Complete complementary DNA-derived amino acid sequence of canine cardiac phospholamban.

    PubMed Central

    Fujii, J; Ueno, A; Kitano, K; Tanaka, S; Kadoma, M; Tada, M

    1987-01-01

    Complementary DNA (cDNA) clones specific for phospholamban of sarcoplasmic reticulum membranes have been isolated from a canine cardiac cDNA library. The amino acid sequence deduced from the cDNA sequence indicates that phospholamban consists of 52 amino acid residues and lacks an amino-terminal signal sequence. The protein has an inferred mol wt 6,080 that is in agreement with its apparent monomeric mol wt 6,000, estimated previously by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Phospholamban contains two distinct domains, a hydrophilic region at the amino terminus (domain I) and a hydrophobic region at the carboxy terminus (domain II). We propose that domain I is localized at the cytoplasmic surface and offers phosphorylatable sites whereas domain II is anchored into the sarcoplasmic reticulum membrane. PMID:3793929

  12. Directional, seamless, and restriction enzyme-free construction of random-primed complementary DNA libraries using phosphorothioate-modified primers.

    PubMed

    Howland, Shanshan W; Poh, Chek-Meng; Rénia, Laurent

    2011-09-01

    Directional cloning of complementary DNA (cDNA) primed by oligo(dT) is commonly achieved by appending a restriction site to the primer, whereas the second strand is synthesized through the combined action of RNase H and Escherichia coli DNA polymerase I (PolI). Although random primers provide more uniform and complete coverage, directional cloning with the same strategy is highly inefficient. We report that phosphorothioate linkages protect the tail sequence appended to random primers from the 5'→3' exonuclease activity of PolI. We present a simple strategy for constructing a random-primed cDNA library using the efficient, size-independent, and seamless In-Fusion cloning method instead of restriction enzymes. Copyright © 2011 Elsevier Inc. All rights reserved.

  13. High-density fiber optic biosensor arrays

    NASA Astrophysics Data System (ADS)

    Epstein, Jason R.; Walt, David R.

    2002-02-01

    Novel approaches are required to coordinate the immense amounts of information derived from diverse genomes. This concept has influenced the expanded role of high-throughput DNA detection and analysis in the biological sciences. A high-density fiber optic DNA biosensor was developed consisting of oligonucleotide-functionalized, 3.1 mm diameter microspheres deposited into the etched wells on the distal face of a 500 micrometers imaging fiber bundle. Imaging fiber bundles containing thousands of optical fibers, each associated with a unique oligonucleotide probe sequence, were the foundation for an optically connected, individually addressable DNA detection platform. Different oligonucleotide-functionalized microspheres were combined in a stock solution, and randomly dispersed into the etched wells. Microsphere positions were registered from optical dyes incorporated onto the microspheres. The distribution process provided an inherent redundancy that increases the signal-to-noise ratio as the square root of the number of sensors examined. The representative amount of each probe-type in the array was dependent on their initial stock solution concentration, and as other sequences of interest arise, new microsphere elements can be added to arrays without altering the existing detection capabilities. The oligonucleotide probe sequences hybridize to fluorescently-labeled, complementary DNA target solutions. Fiber optic DNA microarray research has included DNA-protein interaction profiles, microbial strain differentiation, non-labeled target interrogation with molecular beacons, and single cell-based assays. This biosensor array is proficient in DNA detection linked to specific disease states, single nucleotide polymorphism (SNP's) discrimination, and gene expression analysis. This array platform permits multiple detection formats, provides smaller feature sizes, and enables sensor design flexibility. High-density fiber optic microarray biosensors provide a fast, reversible format with the detection limit of a few hundred molecules.

  14. Fiber optofluidic biosensor for the label-free detection of DNA hybridization and methylation based on an in-line tunable mode coupler.

    PubMed

    Gao, Ran; Lu, Dan-Feng; Cheng, Jin; Jiang, Yi; Jiang, Lan; Xu, Jian-Dong; Qi, Zhi-Mei

    2016-12-15

    An optical fiber optofluidic biosensor for the detection of DNA hybridization and methylation has been proposed and experimentally demonstrated. An in-line fiber Michelson interferometer was formed in the photonic crystal fiber. A micrhole in the collapsed region, which combined the tunable mode coupler and optofluidic channel, was fabricated by using femtosecond laser micromachining. The mode field diameter of the guided light is changed with the refractive index in the optofluidic channel, which results in the tunable coupling ratio. Label-free detections of the DNA hybridization and methylation have been experimentally demonstrated. The probe single stranded DNA (ssDNA) was bound with the surface of the optofluidic channel through the Poly-l-lysine layer, and the hybridization between a short 22-mer probe ssDNA and a complementary target ssDNA was carried out and detected by interrogating the fringe visibility of the reflection spectrum. Then, the DNA methylation was also detected through the binding between the methylated DNA and the 5-methylcytosine (5-mC) monoclonal antibody. The experiments results demonstrate that the limit of detection of 5nM is achieved, establishing the tunable mode coupler as a sensitive and versatile biosensor. The sensitive optical fiber optofluidic biosensor possesses high specificity and low temperature cross-sensitivity. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. Noncoding transcripts in sense and antisense orientation regulate the epigenetic state of ribosomal RNA genes.

    PubMed

    Bierhoff, H; Schmitz, K; Maass, F; Ye, J; Grummt, I

    2010-01-01

    Alternative transcription of the same gene in sense and antisense orientation regulates expression of protein-coding genes. Here we show that noncoding RNA (ncRNA) in sense and antisense orientation also controls transcription of rRNA genes (rDNA). rDNA exists in two types of chromatin--a euchromatic conformation that is permissive to transcription and a heterochromatic conformation that is transcriptionally silent. Silencing of rDNA is mediated by NoRC, a chromatin-remodeling complex that triggers heterochromatin formation. NoRC function requires RNA that is complementary to the rDNA promoter (pRNA). pRNA forms a DNA:RNA triplex with a regulatory element in the rDNA promoter, and this triplex structure is recognized by DNMT3b. The results imply that triplex-mediated targeting of DNMT3b to specific sequences may be a common pathway in epigenetic regulation. We also show that rDNA is transcribed in antisense orientation. The level of antisense RNA (asRNA) is down-regulated in cancer cells and up-regulated in senescent cells. Ectopic asRNA triggers trimethylation of histone H4 at lysine 20 (H4K20me3), suggesting that antisense transcripts guide the histone methyltransferase Suv4-20 to rDNA. The results reveal that noncoding RNAs in sense and antisense orientation are important determinants of the epigenetic state of rDNA.

  16. Quartz crystal microbalance (QCM) affinity biosensor for genetically modified organisms (GMOs) detection.

    PubMed

    Mannelli, Ilaria; Minunni, Maria; Tombelli, Sara; Mascini, Marco

    2003-03-01

    A DNA piezoelectric sensor has been developed for the detection of genetically modified organisms (GMOs). Single stranded DNA (ssDNA) probes were immobilised on the sensor surface of a quartz crystal microbalance (QCM) device and the hybridisation between the immobilised probe and the target complementary sequence in solution was monitored. The probe sequences were internal to the sequence of the 35S promoter (P) and Nos terminator (T), which are inserted sequences in the genome of GMOs regulating the transgene expression. Two different probe immobilisation procedures were applied: (a) a thiol-dextran procedure and (b) a thiol-derivatised probe and blocking thiol procedure. The system has been optimised using synthetic oligonucleotides, which were then applied to samples of plasmidic and genomic DNA isolated from the pBI121 plasmid, certified reference materials (CRM), and real samples amplified by the polymerase chain reaction (PCR). The analytical parameters of the sensor have been investigated (sensitivity, reproducibility, lifetime etc.). The results obtained showed that both immobilisation procedures enabled sensitive and specific detection of GMOs, providing a useful tool for screening analysis in food samples.

  17. Strand-Specific Analysis of DNA Synthesis and Proteins Association with DNA Replication Forks in Budding Yeast.

    PubMed

    Yu, Chuanhe; Gan, Haiyun; Zhang, Zhiguo

    2018-01-01

    DNA replication initiates at DNA replication origins after unwinding of double-strand DNA(dsDNA) by replicative helicase to generate single-stranded DNA (ssDNA) templates for the continuous synthesis of leading-strand and the discontinuous synthesis of lagging-strand. Therefore, methods capable of detecting strand-specific information will likely yield insight into the association of proteins at leading and lagging strand of DNA replication forks and the regulation of leading and lagging strand synthesis during DNA replication. The enrichment and Sequencing of Protein-Associated Nascent DNA (eSPAN), which measure the relative amounts of proteins at nascent leading and lagging strands of DNA replication forks, is a step-wise procedure involving the chromatin immunoprecipitation (ChIP) of a protein of interest followed by the enrichment of protein-associated nascent DNA through BrdU immunoprecipitation. The isolated ssDNA is then subjected to strand-specific sequencing. This method can detect whether a protein is enriched at leading or lagging strand of DNA replication forks. In addition to eSPAN, two other strand-specific methods, (ChIP-ssSeq), which detects potential protein-ssDNA binding and BrdU-IP-ssSeq, which can measure synthesis of both leading and lagging strand, were developed along the way. These methods can provide strand-specific and complementary information about the association of the target protein with DNA replication forks as well as synthesis of leading and lagging strands genome wide. Below, we describe the detailed eSPAN, ChIP-ssSeq, and BrdU-IP-ssSeq protocols.

  18. Electrochemical DNA biosensor for detection of porcine oligonucleotides using ruthenium(II) complex as intercalator label redox

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Halid, Nurul Izni Abdullah; Hasbullah, Siti Aishah; Heng, Lee Yook

    2014-09-03

    A DNA biosensor detection of oligonucleotides via the interactions of porcine DNA with redox active complex based on the electrochemical transduction is described. A ruthenium(II) complex, [Ru(bpy){sub 2}(PIP)]{sup 2+}, (bpy = 2,2′bipyridine, PIP = 2-phenylimidazo[4,5-f[[1,10-phenanthroline]) as DNA label has been synthesized and characterized by 1H NMR and mass spectra. The study was carried out by covalent bonding immobilization of porcine aminated DNA probes sequences on screen printed electrode (SPE) modified with succinimide-acrylic microspheres and [Ru(bpy){sub 2}(PIP)]{sup 2+} was used as electrochemical redox intercalator label to detect DNA hybridization event. Electrochemical detection was performed by cyclic voltammetry (CV) and differential pulsemore » voltammetry (DPV) over the potential range where the ruthenium (II) complex was active. The results indicate that the interaction of [Ru(bpy){sub 2}(PIP)]{sup 2+} with hybridization complementary DNA has higher response compared to single-stranded and mismatch complementary DNA.« less

  19. A Portable and Autonomous Magnetic Detection Platform for Biosensing

    PubMed Central

    Germano, José; Martins, Verónica C.; Cardoso, Filipe A.; Almeida, Teresa M.; Sousa, Leonel; Freitas, Paulo P.; Piedade, Moisés S.

    2009-01-01

    This paper presents a prototype of a platform for biomolecular recognition detection. The system is based on a magnetoresistive biochip that performs biorecognition assays by detecting magnetically tagged targets. All the electronic circuitry for addressing, driving and reading out signals from spin-valve or magnetic tunnel junctions sensors is implemented using off-the-shelf components. Taking advantage of digital signal processing techniques, the acquired signals are processed in real time and transmitted to a digital analyzer that enables the user to control and follow the experiment through a graphical user interface. The developed platform is portable and capable of operating autonomously for nearly eight hours. Experimental results show that the noise level of the described platform is one order of magnitude lower than the one presented by the previously used measurement set-up. Experimental results also show that this device is able to detect magnetic nanoparticles with a diameter of 250 nm at a concentration of about 40 fM. Finally, the biomolecular recognition detection capabilities of the platform are demonstrated by performing a hybridization assay using complementary and non-complementary probes and a magnetically tagged 20mer single stranded DNA target. PMID:22408516

  20. Properties of an unusual DNA primase from an archaeal plasmid

    PubMed Central

    Beck, Kirsten; Lipps, Georg

    2007-01-01

    Primases are specialized DNA-dependent RNA polymerases that synthesize a short oligoribonucleotide complementary to single-stranded template DNA. In the context of cellular DNA replication, primases are indispensable since DNA polymerases are not able to start DNA polymerization de novo. The primase activity of the replication protein from the archaeal plasmid pRN1 synthesizes a rather unusual mixed primer consisting of a single ribonucleotide at the 5′ end followed by seven deoxynucleotides. Ribonucleotides and deoxynucleotides are strictly required at the respective positions within the primer. Furthermore, in contrast to other archaeo-eukaryotic primases, the primase activity is highly sequence-specific and requires the trinucleotide motif GTG in the template. Primer synthesis starts outside of the recognition motif, immediately 5′ to the recognition motif. The fidelity of the primase synthesis is high, as non-complementary bases are not incorporated into the primer. PMID:17709343

  1. Human Immunodeficiency Virus Integration Protein Expressed in Escherichia Coli Possesses Selective DNA Cleaving Activity

    NASA Astrophysics Data System (ADS)

    Sherman, Paula A.; Fyfe, James A.

    1990-07-01

    The human immunodeficiency virus (HIV) integration protein, a potential target for selective antiviral therapy, was expressed in Escherichia coli. The purified protein, free of detectable contaminating endonucleases, selectively cleaved double-stranded DNA oligonucleotides that mimic the U3 and the U5 termini of linear HIV DNA. Two nucleotides were removed from the 3' ends of both the U5 plus strand and the U3 minus strand; in both cases, cleavage was adjacent to a conserved CA dinucleotide. The reaction was metal-ion dependent, with a preference for Mn2+ over Mg2+. Reaction selectivity was further demonstrated by the lack of cleavage of an HIV U5 substrate on the complementary (minus) strand, an analogous substrate that mimics the U3 terminus of an avian retrovirus, and an HIV U5 substrate in which the conserved CA dinucleotide was replaced with a TA dinucleotide. Such an integration protein-mediated cleavage reaction is expected to occur as part of the integration event in the retroviral life cycle, in which a double-stranded DNA copy of the viral RNA genome is inserted into the host cell DNA.

  2. RNA-templated single-base mutation detection based on T4 DNA ligase and reverse molecular beacon.

    PubMed

    Tang, Hongxing; Yang, Xiaohai; Wang, Kemin; Tan, Weihong; Li, Huimin; He, Lifang; Liu, Bin

    2008-06-15

    A novel RNA-templated single-base mutation detection method based on T4 DNA ligase and reverse molecular beacon (rMB) has been developed and successfully applied to identification of single-base mutation in codon 273 of the p53 gene. The discrimination was carried out using allele-specific primers, which flanked the variable position in the target RNA and was ligated using T4 DNA ligase only when the primers perfectly matched the RNA template. The allele-specific primers also carried complementary stem structures with end-labels (fluorophore TAMRA, quencher DABCYL), which formed a molecular beacon after RNase H digestion. One-base mismatch can be discriminated by analyzing the change of fluorescence intensity before and after RNase H digestion. This method has several advantages for practical applications, such as direct discrimination of single-base mismatch of the RNA extracted from cell; no requirement of PCR amplification; performance of homogeneous detection; and easily design of detection probes.

  3. Gene chips and arrays revealed: a primer on their power and their uses.

    PubMed

    Watson, S J; Akil, H

    1999-03-01

    This article provides an overview and general explanation of the rapidly developing area of gene chips and expression array technology. These are methods targeted at allowing the simultaneous study of thousands of genes or messenger RNAs under various physiological and pathological states. Their technical basis grows from the Human Genome Project. Both methods place DNA strands on glass computer chips (or microscope slides). Expression arrays start with complementary DNA (cDNA) clones derived from the EST data base, whereas Gene Chips synthesize oligonucleotides directly on the chip itself. Both are analyzed using image analysis systems, are capable of reading values from two different individuals at any one site, and can yield quantitative data for thousands of genes or mRNAs per slide. These methods promise to revolutionize molecular biology, cell biology, neuroscience and psychiatry. It is likely that this technology will radically open up our ability to study the actions and structure of the multiple genes involved in the complex genetics of brain disorders.

  4. Formation of template-switching artifacts by linear amplification.

    PubMed

    Chakravarti, Dhrubajyoti; Mailander, Paula C

    2008-07-01

    Linear amplification is a method of synthesizing single-stranded DNA from either a single-stranded DNA or one strand of a double-stranded DNA. In this protocol, molecules of a single primer DNA are extended by multiple rounds of DNA synthesis at high temperature using thermostable DNA polymerases. Although linear amplification generates the intended full-length single-stranded product, it is more efficient over single-stranded templates than double-stranded templates. We analyzed linear amplification over single- or double-stranded mouse H-ras DNA (exon 1-2 region). The single-stranded H-ras template yielded only the intended product. However, when the double-stranded template was used, additional artifact products were observed. Increasing the concentration of the double-stranded template produced relatively higher amounts of these artifact products. One of the artifact DNA bands could be mapped and analyzed by sequencing. It contained three template-switching products. These DNAs were formed by incomplete DNA strand extension over the template strand, followed by switching to the complementary strand at a specific Ade nucleotide within a putative hairpin sequence, from which DNA synthesis continued over the complementary strand.

  5. Multiplex quantification of 16S rDNA of predominant bacteria group within human fecal samples by polymerase chain reaction--ligase detection reaction (PCR-LDR).

    PubMed

    Li, Kai; Chen, Bei; Zhou, Yuxun; Huang, Rui; Liang, Yinming; Wang, Qinxi; Xiao, Zhenxian; Xiao, Junhua

    2009-03-01

    A new method, based on ligase detection reaction (LDR), was developed for quantitative detection of multiplex PCR amplicons of 16S rRNA genes present in complex mixtures (specifically feces). LDR has been widely used in single nucleotide polymorphism (SNP) assay but never applied for quantification of multiplex PCR products. This method employs one pair of DNA probes, one of which is labeled with fluorescence for signal capture, complementary to the target sequence. For multiple target sequence analysis, probes were modified with different lengths of polyT at the 5' end and 3' end. Using a DNA sequencer, these ligated probes were separated and identified by size and dye color. Then, relative abundance of target DNA were normalized and quantified based on the fluorescence intensities and exterior size standards. 16S rRNA gene of three preponderant bacteria groups in human feces: Clostridium coccoides, Bacteroides and related genera, and Clostridium leptum group, were amplified and cloned into plasmid DNA so as to make standard curves. After PCR-LDR analysis, a strong linear relationship was found between the florescence intensity and the diluted plasmid DNA concentrations. Furthermore, based on this method, 100 human fecal samples were quantified for the relative abundance of the three bacterial groups. Relative abundance of C. coccoides was significantly higher in elderly people in comparison with young adults, without gender differences. Relative abundance of Bacteroides and related genera and C. leptum group were significantly higher in young and middle aged than in the elderly. Regarding the whole set of sample, C. coccoides showed the highest relative abundance, followed by decreasing groups Bacteroides and related genera, and C. leptum. These results imply that PCR-LDR can be feasible and flexible applied to large scale epidemiological studies.

  6. Programmable Removal of Bacterial Strains by Use of Genome-Targeting CRISPR-Cas Systems

    PubMed Central

    Gomaa, Ahmed A.; Klumpe, Heidi E.; Luo, Michelle L.; Selle, Kurt; Barrangou, Rodolphe; Beisel, Chase L.

    2014-01-01

    ABSTRACT CRISPR (clustered regularly interspaced short palindromic repeats)-Cas (CRISPR-associated) systems in bacteria and archaea employ CRISPR RNAs to specifically recognize the complementary DNA of foreign invaders, leading to sequence-specific cleavage or degradation of the target DNA. Recent work has shown that the accidental or intentional targeting of the bacterial genome is cytotoxic and can lead to cell death. Here, we have demonstrated that genome targeting with CRISPR-Cas systems can be employed for the sequence-specific and titratable removal of individual bacterial strains and species. Using the type I-E CRISPR-Cas system in Escherichia coli as a model, we found that this effect could be elicited using native or imported systems and was similarly potent regardless of the genomic location, strand, or transcriptional activity of the target sequence. Furthermore, the specificity of targeting with CRISPR RNAs could readily distinguish between even highly similar strains in pure or mixed cultures. Finally, varying the collection of delivered CRISPR RNAs could quantitatively control the relative number of individual strains within a mixed culture. Critically, the observed selectivity and programmability of bacterial removal would be virtually impossible with traditional antibiotics, bacteriophages, selectable markers, or tailored growth conditions. Once delivery challenges are addressed, we envision that this approach could offer a novel means to quantitatively control the composition of environmental and industrial microbial consortia and may open new avenues for the development of “smart” antibiotics that circumvent multidrug resistance and differentiate between pathogenic and beneficial microorganisms. PMID:24473129

  7. [Principles for molecular identification of traditional Chinese materia medica using DNA barcoding].

    PubMed

    Chen, Shi-Lin; Yao, Hui; Han, Jian-Ping; Xin, Tian-Yi; Pang, Xiao-Hui; Shi, Lin-Chun; Luo, Kun; Song, Jing-Yuan; Hou, Dian-Yun; Shi, Shang-Mei; Qian, Zhong-Zhi

    2013-01-01

    Since the research of molecular identification of Chinese Materia Medica (CMM) using DNA barcode is rapidly developing and popularizing, the principle of this method is approved to be listed in the Supplement of the Pharmacopoeia of the People's Republic of China. Based on the study on comprehensive samples, the DNA barcoding systems have been established to identify CMM, i.e. ITS2 as a core barcode and psbA-trnH as a complementary locus for identification of planta medica, and COI as a core barcode and ITS2 as a complementary locus for identification of animal medica. This article introduced the principle of molecular identification of CMM using DNA barcoding and its drafting instructions. Furthermore, its application perspective was discussed.

  8. Preparation and characterization of zinc oxide nanoparticles and their sensor applications for electrochemical monitoring of nucleic acid hybridization.

    PubMed

    Yumak, Tugrul; Kuralay, Filiz; Muti, Mihrican; Sinag, Ali; Erdem, Arzum; Abaci, Serdar

    2011-09-01

    In this study, ZnO nanoparticles (ZNP) of approximately 30 nm in size were synthesized by the hydrothermal method and characterized by X-ray diffraction (XRD), Braun-Emmet-Teller (BET) N2 adsorption analysis and transmission electron microscopy (TEM). ZnO nanoparticles enriched with poly(vinylferrocenium) (PVF+) modified single-use graphite electrodes were then developed for the electrochemical monitoring of nucleic acid hybridization related to the Hepatitis B Virus (HBV). Firstly, the surfaces of polymer modified and polymer-ZnO nanoparticle modified single-use pencil graphite electrodes (PGEs) were characterized using scanning electron microscopy (SEM). The electrochemical behavior of these electrodes was also investigated using differential pulse voltammetry (DPV) and electrochemical impedance spectroscopy (EIS). Subsequently, the polymer-ZnO nanoparticle modified PGEs were evaluated for the electrochemical detection of DNA based on the changes at the guanine oxidation signals. Various modifications in DNA oligonucleotides and probe concentrations were examined in order to optimize the electrochemical signals that were generated by means of nucleic acid hybridization. After the optimization studies, the sequence-selective DNA hybridization was investigated in the case of a complementary amino linked probe (target), or noncomplementary (NC) sequences, or target and mismatch (MM) mixture in the ratio of (1:1). Copyright © 2011 Elsevier B.V. All rights reserved.

  9. A novel sensitive pathogen detection system based on Microbead Quantum Dot System.

    PubMed

    Wu, Tzong-Yuan; Su, Yi-Yu; Shu, Wei-Hsien; Mercado, Augustus T; Wang, Shi-Kwun; Hsu, Ling-Yi; Tsai, Yow-Fu; Chen, Chung-Yung

    2016-04-15

    A fast and accurate detection system for pathogens can provide immediate measurements for the identification of infectious agents. Therefore, the Microbead Quantum-dots Detection System (MQDS) was developed to identify and measure target DNAs of pathogenic microorganisms and eliminated the need of PCR amplifications. This nanomaterial-based technique can detect different microorganisms by flow cytometry measurements. In MQDS, pathogen specific DNA probes were designed to form a hairpin structure and conjugated on microbeads. In the presence of the complementary target DNA sequence, the probes will compete for binding with the reporter probes but will not interfere with the binding between the probe and internal control DNA. To monitor the binding process by flow cytometry, both the reporter probes and internal control probes were conjugated with Quantum dots that fluoresce at different emission wavelengths using the click reaction. When MQDS was used to detect the pathogens in environmental samples, a high correlation coefficient (R=0.994) for Legionella spp., with a detection limit of 0.1 ng of the extracted DNAs and 10 CFU/test, can be achieved. Thus, this newly developed technique can also be applied to detect other pathogens, particularly viruses and other genetic diseases. Copyright © 2015 Elsevier B.V. All rights reserved.

  10. Visual detection of multidrug resistance gene in living cell using the molecular beacon imaging

    NASA Astrophysics Data System (ADS)

    Zhou, Qiumei; Ma, Yi; Gu, Yueqing

    2014-09-01

    A major problem in cancer treatment is the development of resistance to chemotherapeutic agents in tumor cells. Detection of effective prognostic biomarkers and targets are of crucial importance to the management of individualized therapies. However, quantitative analysis of the drug resistance gene had been difficult because of technical limitations. In this study, we designed and used a special hairpin deoxyribonucleic acid (DNA), which served as a beacon for detecting human drug resistance indicater. Upon hybridizing with the target mRNA, the hairpin DNA modified gold nanoparticle beacons (hDAuNP beacons) release the fluorophores attached at 5'end of the oligonucleotide sequence. The fluorescence properties of the beacon before and after the hybridization with the complementary DNA were confirmed in vitro. The hDAuNP beacons could be taken up by living cells with low inherent cytotoxicity and higher stability. hDAuNP beacon imaged by confocal laser scanning microscopy to detect the resistance gene expression. The detected fluorescence in MCF7and MCF7/ADR cells correlates with the specific drug resistance gene expression, which is consistent with the result from Q-PCR. Thus, this approach overcame many of the challenges of previous techniques by creating highly sensitive and effective intracellular probes for monitoring gene expression.

  11. Engraftment of gene-modified umbilical cord blood cells in neonates with adenosine deaminase deficiency

    PubMed Central

    Kohn, Donald B.; Weinberg, Kenneth I.; Nolta, Jan A.; Heiss, Linda N.; Lenarsky, Carl; Crooks, Gay M.; Hanley, Mary E.; Annett, Geralyn; Brooks, Judith S.; El-Khoureiy, Anthony; Lawrence, Kim; Wells, Susie; Moen, Robert C.; Bastian, John; Williams-Herman, Debora E.; Elder, Melissa; Wara, Diane; Bowen, Thomas; Hershfield, Michael S.; Mullen, Craig A.; Blaese, R. Michael; Parkman, Robertson

    2010-01-01

    Haematopoietic stem cells in umbilical cord blood are an attractive target for gene therapy of inborn errors of metabolism. Three neonates with severe combined immunodeficiency were treated by retroviral-mediated transduction of the CD34+ cells from their umbilical cord blood with a normal human adenosine deaminase complementary DNA followed by autologous transplantation. The continued presence and expression of the introduced gene in leukocytes from bone marrow and peripheral blood for 18 months demonstrates that umbilical cord blood cells may be genetically modified with retroviral vectors and engrafted in neonates for gene therapy. PMID:7489356

  12. Post-injection hybridization of complementary DNA strands on capillary electrophoresis platforms: a novel solution for dsDNA artifacts.

    PubMed

    McLaren, Robert S; Ensenberger, Martin G; Budowle, Bruce; Rabbach, Dawn; Fulmer, Patricia M; Sprecher, Cindy J; Bessetti, Joseph; Sundquist, Terri M; Storts, Douglas R

    2008-09-01

    Several laboratories have reported the occurrence of a split or n-1 peak at the vWA locus in PowerPlex 16 and PowerPlex ES amplification products separated on 4- and 16-capillary electrophoresis instruments. The root cause of this artifact is post-PCR reannealing of the unlabeled, unincorporated vWA primer to the 3'-end of the tetramethylrhodamine (TMR)-labeled strand of the vWA amplicon. This reannealing occurs in the capillary post-electrokinetic injection. The split peak is eliminated by incorporation into the loading cocktail of a sacrificial hybridization sequence (SHS) oligonucleotide that is complementary to the vWA primer. The SHS preferentially anneals to the primer instead of the TMR-labeled strand of the vWA amplicon. In addition, the n-10/n-18 artifact that may be seen at the vWA locus was determined to be due to double-stranded amplicon formed post-electrokinetic injection into the capillary. This was also eliminated by adding in two Complementary Oligo Targets (COT1 and COT2) in addition to the SHS oligonucleotide into the loading cocktail. These three oligonucleotides are complementary to the 33 bases at the 5'-end of the unlabeled vWA amplicon strand and the 60 bases at its 3'-end and therefore compete for hybridization to the TMR-labeled amplicon strand. Incorporation of these three oligonucleotides in the Internal Lane Standard 600 (ILS600) eliminate both the split peak and n-10/n-18 artifact in PowerPlex 16 and PowerPlex ES amplification products without affecting sizing of alleles at the vWA locus or any locus in the PowerPlex 16, PowerPlex Y, PowerPlex ES, AmpFlSTR Profiler Plus ID, AmpFlSTR Cofiler, and AmpFlSTR SGM Plus kits.

  13. Reducing the background fluorescence in mice receiving fluorophore/inhibitor DNA duplexes.

    PubMed

    Liang, Minmin; Liu, Xinrong; Liu, Guozheng; Dou, Shuping; Cheng, Dengfeng; Liu, Yuxia; Rusckowski, Mary; Hnatowich, Donald J

    2011-02-07

    In principle, a DNA duplex consisting of an antisense fluorophore-conjugated major strand hybridized to a shorter complementary inhibitor-conjugated minor strand should provide fluorescence only in the tumor after intravenous administration if designed to remain intact except in the presence in tumor of its mRNA target. While we have obtained impressive tumor images in mice using this approach, there remains some background fluorescence. In this study, tissue homogenates of selected mouse organs were incubated with a test duplex and the kinetics of duplex dissociation in normal tissues were measured. In this manner we were able to identify the liver as the likely major source responsible for the duplex dissociation providing this fluorescence background. Thereafter liver homogenates were used to screen a series of duplex candidates with variable-length minor strands, and dissociation was measured by gel electrophoresis. The selected fluorophore/inhibitor duplex with improved stability displayed an insignificant (P > 0.05) background fluorescence after administration to SKH-1 normal mice and apparently without affecting target mRNA binding in vitro in cell culture or in vivo in tumor bearing mice.

  14. Labeling TiO2 nanoparticles with dyes for optical fluorescence microscopy and determination of TiO2-DNA nanoconjugate stability.

    PubMed

    Thurn, Kenneth T; Paunesku, Tatjana; Wu, Aiguo; Brown, Eric M B; Lai, Barry; Vogt, Stefan; Maser, Jörg; Aslam, Mohammed; Dravid, Vinayak; Bergan, Raymond; Woloschak, Gayle E

    2009-06-01

    Visualization of nanoparticles without intrinsic optical fluorescence properties is a significant problem when performing intracellular studies. Such is the case with titanium dioxide (TiO2) nanoparticles. These nanoparticles, when electronically linked to single-stranded DNA oligonucleotides, have been proposed to be used both as gene knockout devices and as possible tumor imaging agents. By interacting with complementary target sequences in living cells, these photoinducible TiO2-DNA nanoconjugates have the potential to cleave intracellular genomic DNA in a sequence specific and inducible manner. The nanoconjugates also become detectable by magnetic resonance imaging with the addition of gadolinium Gd(III) contrast agents. Herein two approaches for labeling TiO2 nanoparticles and TiO2-DNA nanoconjugates with optically fluorescent agents are described. This permits direct quantification of fluorescently labeled TiO2 nanoparticle uptake in a large population of living cells (>10(4) cells). X-ray fluorescence microscopy (XFM) is combined with fluorescent microscopy to determine the relative intracellular stability of the nanoconjugates and used to quantify intracellular nanoparticles. Imaging the DNA component of the TiO2-DNA nanoconjugate by fluorescent confocal microscopy within the same cell shows an overlap with the titanium signal as mapped by XFM. This strongly implies the intracellular integrity of the TiO2-DNA nanoconjugates in malignant cells.

  15. Targeting PML-RARα and Oncogenic Signaling Pathways by Chinese Herbal Mixture Tien-Hsien Liquid in Acute Promyelocytic Leukemia NB4 Cells

    PubMed Central

    Yao, Chih-Jung; Yang, Chia-Ming; Chuang, Shuang-En; Yan, Jiann-Long; Liu, Chun-Yen; Chen, Suz-Wen; Yan, Kun-Huang; Lai, Tung-Yuan; Lai, Gi-Ming

    2011-01-01

    Tien-Hsien Liquid (THL) is a Chinese herbal mixture that has been used worldwide as complementary treatment for cancer patients in the past decade. Recently, THL has been shown to induce apoptosis in various types of solid tumor cells in vitro. However, the underlying molecular mechanisms have not yet been well elucidated. In this study, we explored the effects of THL on acute promyelocytic leukemia (APL) NB4 cells, which could be effectively treated by some traditional Chinese remedies containing arsenic trioxide. The results showed THL could induce G2/M arrest and apoptosis in NB4 cells. Accordingly, the decrease of cyclin A and B1 were observed in THL-treated cells. The THL-induced apoptosis was accompanied with caspase-3 activation and decrease of PML-RARα fusion protein. Moreover, DNA methyltransferase 1 and oncogenic signaling pathways such as Akt/mTOR, Stat3 and ERK were also down-regulated by THL. By using ethyl acetate extraction and silica gel chromatography, an active fraction of THL named as EAS5 was isolated. At about 0.5–1% of the dose of THL, EAS5 appeared to have most of THL-induced multiple molecular targeting effects in NB4 cells. Based on the findings of these multi-targeting effects, THL might be regarding as a complementary and alternative therapeutic agent for refractory APL. PMID:19897545

  16. Label-Free Electrochemical Detection of the Specific Oligonucleotide Sequence of Dengue Virus Type 1 on Pencil Graphite Electrodes

    PubMed Central

    Souza, Elaine; Nascimento, Gustavo; Santana, Nataly; Ferreira, Danielly; Lima, Manoel; Natividade, Edna; Martins, Danyelly; Lima-Filho, José

    2011-01-01

    A biosensor that relies on the adsorption immobilization of the 18-mer single-stranded nucleic acid related to dengue virus gene 1 on activated pencil graphite was developed. Hybridization between the probe and its complementary oligonucleotides (the target) was investigated by monitoring guanine oxidation by differential pulse voltammetry (DPV). The pencil graphite electrode was made of ordinary pencil lead (type 4B). The polished surface of the working electrode was activated by applying a potential of 1.8 V for 5 min. Afterward, the dengue oligonucleotides probe was immobilized on the activated electrode by applying 0.5 V to the electrode in 0.5 M acetate buffer (pH 5.0) for 5 min. The hybridization process was carried out by incubating at the annealing temperature of the oligonucleotides. A time of five minutes and concentration of 1 μM were found to be the optimal conditions for probe immobilization. The electrochemical detection of annealing between the DNA probe (TS-1P) immobilized on the modified electrode, and the target (TS-1T) was achieved. The target could be quantified in a range from 1 to 40 nM with good linearity and a detection limit of 0.92 nM. The specificity of the electrochemical biosensor was tested using non-complementary sequences of dengue virus 2 and 3. PMID:22163916

  17. Method for performing site-specific affinity fractionation for use in DNA sequencing

    DOEpatents

    Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Dubley, Svetlana A.

    1999-01-01

    A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between said cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting said extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to said extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from said array.

  18. Miniaturized reaction vessel system, method for performing site-specific biochemical reactions and affinity fractionation for use in DNA sequencing

    DOEpatents

    Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Dubley, Svetlana A.

    2000-01-01

    A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between said cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting said extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to said extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from said array.

  19. Method for performing site-specific affinity fractionation for use in DNA sequencing

    DOEpatents

    Mirzabekov, A.D.; Lysov, Y.P.; Dubley, S.A.

    1999-05-18

    A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between the cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting the extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to the extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from the array. 14 figs.

  20. Capture and release of cells using a temperature-responsive surface that immobilizes an antibody through DNA duplex formation.

    PubMed

    Kimura, Tsuyoshi; Nakamura, Naoko; Umeda, Kanji; Hashimoto, Yoshihide; Kishida, Akio

    We synthesized a temperature-responsive surface that immobilized an antibody via DNA duplex formation for selective capture and release of target cells. Polyethylene films were modified by grafting poly(N-isopropylacrylamide-co-acrylic acid) (P(NIPAAm-co-AAc)), which were prepared at various ratios of NIPAAm/AAc. The increased hydrophilicity of P(NIPAAm-co-PAA) film with decreased temperature was confirmed by water contact angle measurement. Single strand DNA (20mer) was chemically immobilized on the surface and then antibody (anti-mouse CD45, mCD45) modified with the complementary single strand DNA was immobilized on the surface through DNA duplex formation. The mCD45 antibody immobilization was confirmed by immunostaining. HeLa cells (mCD45 negative) and mouse bone marrow (BM) cells (mCD45 positive) were adhered on the surfaces at 37 °C. Although HeLa cells were detached by 4 °C incubation, BM cells were still adhered on the surface and then the adhered cells were released by DNase treatment. From these results, it was suggested that cells could be selectively captured and collected by using a film having surface that immobilizes an antibody via DNA duplex formation.

  1. Detection of anthrax lef with DNA-based photonic crystal sensors

    NASA Astrophysics Data System (ADS)

    Zhang, Bailin; Dallo, Shatha; Peterson, Ralph; Hussain, Syed; Weitao, Tao; Ye, Jing Yong

    2011-12-01

    Bacillus anthracis has posed a threat of becoming biological weapons of mass destruction due to its virulence factors encoded by the plasmid-borne genes, such as lef for lethal factor. We report the development of a fast and sensitive anthrax DNA biosensor based on a photonic crystal structure used in a total-internal-reflection configuration. For the detection of the lef gene, a single-stranded DNA lef probe was biotinylated and immobilized onto the sensor via biotin-streptavidin interactions. A positive control, lef-com, was the complementary strand of the probe, while a negative control was an unrelated single-stranded DNA fragment from the 16S rRNA gene of Acinetobacter baumannii. After addition of the biotinylated lef probe onto the sensor, significant changes in the resonance wavelength of the sensor were observed, resulting from binding of the probe to streptavidin on the sensor. The addition of lef-com led to another significant increase as a result of hybridization between the two DNA strands. The detection sensitivity for the target DNA reached as low as 0.1 nM. In contrast, adding the unrelated DNAs did not cause an obvious shift in the resonant wavelength. These results demonstrate that detection of the anthrax lef by the photonic crystal structure in a total-internal-reflection sensor is highly specific and sensitive.

  2. A nanophosphor-based method for selective DNA recovery in Synthosomes.

    PubMed

    Nallani, Madhavan; Onaca, Ozana; Gera, Nimish; Hildenbrand, Karlheinz; Hoheisel, Werner; Schwaneberg, Ulrich

    2006-01-01

    A nanocompartment system composed of an ABA triblock copolymer, where A is poly(dimethylsiloxane) and B is poly(2-methyloxazoline), has been developed for selective recovery and detection of DNA. Translocation of TAMRA-labeled complementary primers into the nanocompartment system has been achieved through two deletion mutants (FhuA Delta1-129; FhuA Delta1-160) of the channel protein FhuA. Translocation was monitored by fluorescence resonance energy transfer through hybridization of the TAMRA-labeled primer to the complementary sequence of a nanophosphor-DNA-conjugate, which reduces its half-life (FhuA Delta1-129, 16.0% reduced; FhuA Delta1-160, 39.0% reduced).

  3. Transcriptome analysis by strand-specific sequencing of complementary DNA

    PubMed Central

    Parkhomchuk, Dmitri; Borodina, Tatiana; Amstislavskiy, Vyacheslav; Banaru, Maria; Hallen, Linda; Krobitsch, Sylvia; Lehrach, Hans; Soldatov, Alexey

    2009-01-01

    High-throughput complementary DNA sequencing (RNA-Seq) is a powerful tool for whole-transcriptome analysis, supplying information about a transcript's expression level and structure. However, it is difficult to determine the polarity of transcripts, and therefore identify which strand is transcribed. Here, we present a simple cDNA sequencing protocol that preserves information about a transcript's direction. Using Saccharomyces cerevisiae and mouse brain transcriptomes as models, we demonstrate that knowing the transcript's orientation allows more accurate determination of the structure and expression of genes. It also helps to identify new genes and enables studying promoter-associated and antisense transcription. The transcriptional landscapes we obtained are available online. PMID:19620212

  4. Transcriptome analysis by strand-specific sequencing of complementary DNA.

    PubMed

    Parkhomchuk, Dmitri; Borodina, Tatiana; Amstislavskiy, Vyacheslav; Banaru, Maria; Hallen, Linda; Krobitsch, Sylvia; Lehrach, Hans; Soldatov, Alexey

    2009-10-01

    High-throughput complementary DNA sequencing (RNA-Seq) is a powerful tool for whole-transcriptome analysis, supplying information about a transcript's expression level and structure. However, it is difficult to determine the polarity of transcripts, and therefore identify which strand is transcribed. Here, we present a simple cDNA sequencing protocol that preserves information about a transcript's direction. Using Saccharomyces cerevisiae and mouse brain transcriptomes as models, we demonstrate that knowing the transcript's orientation allows more accurate determination of the structure and expression of genes. It also helps to identify new genes and enables studying promoter-associated and antisense transcription. The transcriptional landscapes we obtained are available online.

  5. Whole genome analysis of CRISPR Cas9 sgRNA off-target homologies via an efficient computational algorithm.

    PubMed

    Zhou, Hong; Zhou, Michael; Li, Daisy; Manthey, Joseph; Lioutikova, Ekaterina; Wang, Hong; Zeng, Xiao

    2017-11-17

    The beauty and power of the genome editing mechanism, CRISPR Cas9 endonuclease system, lies in the fact that it is RNA-programmable such that Cas9 can be guided to any genomic loci complementary to a 20-nt RNA, single guide RNA (sgRNA), to cleave double stranded DNA, allowing the introduction of wanted mutations. Unfortunately, it has been reported repeatedly that the sgRNA can also guide Cas9 to off-target sites where the DNA sequence is homologous to sgRNA. Using human genome and Streptococcus pyogenes Cas9 (SpCas9) as an example, this article mathematically analyzed the probabilities of off-target homologies of sgRNAs and discovered that for large genome size such as human genome, potential off-target homologies are inevitable for sgRNA selection. A highly efficient computationl algorithm was developed for whole genome sgRNA design and off-target homology searches. By means of a dynamically constructed sequence-indexed database and a simplified sequence alignment method, this algorithm achieves very high efficiency while guaranteeing the identification of all existing potential off-target homologies. Via this algorithm, 1,876,775 sgRNAs were designed for the 19,153 human mRNA genes and only two sgRNAs were found to be free of off-target homology. By means of the novel and efficient sgRNA homology search algorithm introduced in this article, genome wide sgRNA design and off-target analysis were conducted and the results confirmed the mathematical analysis that for a sgRNA sequence, it is almost impossible to escape potential off-target homologies. Future innovations on the CRISPR Cas9 gene editing technology need to focus on how to eliminate the Cas9 off-target activity.

  6. High-density, microsphere-based fiber optic DNA microarrays.

    PubMed

    Epstein, Jason R; Leung, Amy P K; Lee, Kyong Hoon; Walt, David R

    2003-05-01

    A high-density fiber optic DNA microarray has been developed consisting of oligonucleotide-functionalized, 3.1-microm-diameter microspheres randomly distributed on the etched face of an imaging fiber bundle. The fiber bundles are comprised of 6000-50000 fused optical fibers and each fiber terminates with an etched well. The microwell array is capable of housing complementary-sized microspheres, each containing thousands of copies of a unique oligonucleotide probe sequence. The array fabrication process results in random microsphere placement. Determining the position of microspheres in the random array requires an optical encoding scheme. This array platform provides many advantages over other array formats. The microsphere-stock suspension concentration added to the etched fiber can be controlled to provide inherent sensor redundancy. Examining identical microspheres has a beneficial effect on the signal-to-noise ratio. As other sequences of interest are discovered, new microsphere sensing elements can be added to existing microsphere pools and new arrays can be fabricated incorporating the new sequences without altering the existing detection capabilities. These microarrays contain the smallest feature sizes (3 microm) of any DNA array, allowing interrogation of extremely small sample volumes. Reducing the feature size results in higher local target molecule concentrations, creating rapid and highly sensitive assays. The microsphere array platform is also flexible in its applications; research has included DNA-protein interaction profiles, microbial strain differentiation, and non-labeled target interrogation with molecular beacons. Fiber optic microsphere-based DNA microarrays have a simple fabrication protocol enabling their expansion into other applications, such as single cell-based assays.

  7. Molecular cloning of a gene encoding translation initiation factor (TIF) from Candida albicans.

    PubMed

    Mirbod, F; Nakashima, S; Kitajima, Y; Ghannoum, M A; Cannon, R D; Nozawa, Y

    1996-01-01

    The differential display technique was applied to compare mRNAs from two clinical isolates of Candida albicans with different virulence; high (potent strain, 16240) and low (weak strain, 18084) extracellular phospholipase activities. Complementary DNA fragments corresponding to several apparently differentially expressed mRNAs were recovered and sequenced. A complementary DNA fragment seen distinctly in the potent phospholipase producing strain was highly homologous to the yeast translation initiation factor (TIF). The selected DNA fragment was then used as a probe to isolate its corresponding complementary DNA clone from a library of C. albicans genomic DNA. The sequence of isolated gene revealed an open reading frame of 1194 nucleotides with the potential to encode a protein of 397 amino acids with a predicted molecular weight of 43 kDa. Over its entire length, the amino acid sequence showed strong homology (78-89%) to Saccharomyces cerevisiae TIF and (63-80%) to mouse eIF-4A proteins. Therefore, our C. albicans gene was identified to be TIF (Ca TIF). Northern blot analysis in the two strains of C. albicans revealed that Ca TIF expression is 1.5-fold higher in the potent phospholipase producing strain. The restriction endonuclease digestion of genomic DNA from this potent strain revealed at least two hybridized bands in Southern blot analysis, suggesting two or more closely related sequences in the C. albicans genome.

  8. DNA in Uninfected and Virus-Infected Cells Complementary to Avian Tumor Virus RNA

    PubMed Central

    Rosenthal, Peter N.; Robinson, Harriet L.; Robinson, William S.; Hanafusa, Teruko; Hanafusa, Hidesaburo

    1971-01-01

    The 70S RNA component of several avian tumor viruses was hybridized with DNA extracted from avian tumor virus-infected and uninfected chicken and Japanese quail cells. Tritium-labeled 70S RNAs from Rous sarcoma virus (RSV), Rous associated virus-1 (RAV-1), RAV-60, and Schmidt-Ruppin-RSV (SR-RSV) hybridize from 3 to 10 times more with DNA from uninfected chicken cells than with DNA from Escherichia coli, calfthymus, or baby hamster kidney cells. After infection of chicken cells with RSV(RAV-1), SR-RSV, or RAV-2, the amount of 70S avian tumor virus [3H]RNA hybridized increases by 1.6 times. The specificity of the hybridization reaction was shown by the specific competition of 70S SR-RSV [3H]RNA with 70S RNA from RSV(RAV-1), and not with RNA from Sendai virus or chicken cells. There was no difference in the hybridization of 70S RNA from RSV (RAV-1), RAV-1, or RAV-60 with DNA either from chicken cells that contain RAV-60 in a nonreplicating form or from chicken cells that do not appear to contain RAV-60. These results indicate that both types of uninfected chicken cells contain DNA that is complementary to RNA from several avian tumor viruses and that the amount of complementary DNA increases in such cells after infection with an avian tumor virus. The RNAs of genetically different avian tumor viruses appear to have indistinguishable base sequences by this technique. PMID:4332808

  9. Dramatic Increase in the Signal and Sensitivity of Detection via Self-Assembly of Branched DNA

    PubMed Central

    Kim, Kyung-Tae; Chae, Chi-Bom

    2011-01-01

    In molecular testing using PCR, the target DNA is amplified via PCR and the sequence of interest is investigated via hybridization with short oligonucleotide capture probes that are either in a solution or immobilized on solid supports such as beads or glass slides. In this report, we report the discovery of assembly of DNA complex(es) between a capture probe and multiple strands of the PCR product. The DNA complex most likely has branched structure. The assembly of branched DNA was facilitated by the product of asymmetric PCR. The amount of branched DNA assembled was increased five fold when the asymmetric PCR product was denatured and hybridized with a capture probe all in the same PCR reaction mixture. The major branched DNA species appeared to contain three reverse strands (the strand complementary to the capture probe) and two forward strands. The DNA was sensitive to S1 nuclease suggesting that it had single-stranded gaps. Branched DNA also appeared to be assembled with the capture probes immobilized on the surface of solid support when the product of asymmetric PCR was hybridized. Assembly of the branched DNA was also increased when hybridization was performed in complete PCR reaction mixture suggesting the requirement of DNA synthesis. Integration of asymmetric PCR, heat denaturation and hybridization in the same PCR reaction mixture with the capture probes immobilized on the surface of solid support achieved dramatic increase in the signal and sensitivity of detection of DNA. Such a system should be advantageously applied for development of automated process for detection of DNA. PMID:21870112

  10. Biorecognition by DNA oligonucleotides after Exposure to Photoresists and Resist Removers

    PubMed Central

    Dean, Stacey L.; Morrow, Thomas J.; Patrick, Sue; Li, Mingwei; Clawson, Gary; Mayer, Theresa S.; Keating, Christine D.

    2013-01-01

    Combining biological molecules with integrated circuit technology is of considerable interest for next generation sensors and biomedical devices. Current lithographic microfabrication methods, however, were developed for compatibility with silicon technology rather than bioorganic molecules and consequently it cannot be assumed that biomolecules will remain attached and intact during on-chip processing. Here, we evaluate the effects of three common photoresists (Microposit S1800 series, PMGI SF6, and Megaposit SPR 3012) and two photoresist removers (acetone and 1165 remover) on the ability of surface-immobilized DNA oligonucleotides to selectively recognize their reverse-complementary sequence. Two common DNA immobilization methods were compared: adsorption of 5′-thiolated sequences directly to gold nanowires and covalent attachment of 5′-thiolated sequences to surface amines on silica coated nanowires. We found that acetone had deleterious effects on selective hybridization as compared to 1165 remover, presumably due to incomplete resist removal. Use of the PMGI photoresist, which involves a high temperature bake step, was detrimental to the later performance of nanowire-bound DNA in hybridization assays, especially for DNA attached via thiol adsorption. The other three photoresists did not substantially degrade DNA binding capacity or selectivity for complementary DNA sequences. To determine if the lithographic steps caused more subtle damage, we also tested oligonucleotides containing a single base mismatch. Finally, a two-step photolithographic process was developed and used in combination with dielectrophoretic nanowire assembly to produce an array of doubly-contacted, electrically isolated individual nanowire components on a chip. Post-fabrication fluorescence imaging indicated that nanowire-bound DNA was present and able to selectively bind complementary strands. PMID:23952639

  11. Nature and distribution of feline sarcoma virus nucleotide sequences.

    PubMed Central

    Frankel, A E; Gilbert, J H; Porzig, K J; Scolnick, E M; Aaronson, S A

    1979-01-01

    The genomes of three independent isolates of feline sarcoma virus (FeSV) were compared by molecular hybridization techniques. Using complementary DNAs prepared from two strains, SM- and ST-FeSV, common complementary DNA'S were selected by sequential hybridization to FeSV and feline leukemia virus RNAs. These DNAs were shown to be highly related among the three independent sarcoma virus isolates. FeSV-specific complementary DNAs were prepared by selection for hybridization by the homologous FeSV RNA and against hybridization by fline leukemia virus RNA. Sarcoma virus-specific sequences of SM-FeSV were shown to differ from those of either ST- or GA-FeSV strains, whereas ST-FeSV-specific DNA shared extensive sequence homology with GA-FeSV. By molecular hybridization, each set of FeSV-specific sequences was demonstrated to be present in normal cat cellular DNA in approximately one copy per haploid genome and was conserved throughout Felidae. In contrast, FeSV-common sequences were present in multiple DNA copies and were found only in Mediterranean cats. The present results are consistent with the concept that each FeSV strain has arisen by a mechanism involving recombination between feline leukemia virus and cat cellular DNA sequences, the latter represented within the cat genome in a manner analogous to that of a cellular gene. PMID:225544

  12. Solution structure of a highly stable DNA duplex conjugated to a minor groove binder.

    PubMed Central

    Kumar, S; Reed, M W; Gamper, H B; Gorn, V V; Lukhtanov, E A; Foti, M; West, J; Meyer, R B; Schweitzer, B I

    1998-01-01

    The tripeptide 1,2-dihydro-(3 H )-pyrrolo[3,2- e ]indole-7-carboxylate (CDPI3) binds to the minor groove of DNA with high affinity. When this minor groove binder is conjugated to the 5'-end of short oligonucleotides the conjugates form unusually stable hybrids with complementary DNA and thus may have useful diagnostic and/or therapeutic applications. In order to gain an understanding of the structural interactions between the CDPI3minor groove binding moiety and the DNA, we have determined and compared the solution structure of a duplex consisting of oligodeoxyribonucleotide 5'-TGATTATCTG-3' conjugated at the 5'-end to CDPI3 and its complementary strand to an unmodified control duplex of the same sequence using nuclear magnetic resonance techniques. Thermal denaturation studies indicated that the hybrid of this conjugate with its complementary strand had a melting temperature that was 30 degrees C higher compared with the unmodified control duplex. Following restrained molecular dynamics and relaxation matrix refinement, the solution structure of the CDPI3-conjugated DNA duplex demonstrated that the overall shape of the duplex was that of a straight B-type helix and that the CDPI3moiety was bound snugly in the minor groove, where it was stabilized by extensive van der Waal's interactions. PMID:9443977

  13. Solution structure of a highly stable DNA duplex conjugated to a minor groove binder.

    PubMed

    Kumar, S; Reed, M W; Gamper, H B; Gorn, V V; Lukhtanov, E A; Foti, M; West, J; Meyer, R B; Schweitzer, B I

    1998-02-01

    The tripeptide 1,2-dihydro-(3 H )-pyrrolo[3,2- e ]indole-7-carboxylate (CDPI3) binds to the minor groove of DNA with high affinity. When this minor groove binder is conjugated to the 5'-end of short oligonucleotides the conjugates form unusually stable hybrids with complementary DNA and thus may have useful diagnostic and/or therapeutic applications. In order to gain an understanding of the structural interactions between the CDPI3minor groove binding moiety and the DNA, we have determined and compared the solution structure of a duplex consisting of oligodeoxyribonucleotide 5'-TGATTATCTG-3' conjugated at the 5'-end to CDPI3 and its complementary strand to an unmodified control duplex of the same sequence using nuclear magnetic resonance techniques. Thermal denaturation studies indicated that the hybrid of this conjugate with its complementary strand had a melting temperature that was 30 degrees C higher compared with the unmodified control duplex. Following restrained molecular dynamics and relaxation matrix refinement, the solution structure of the CDPI3-conjugated DNA duplex demonstrated that the overall shape of the duplex was that of a straight B-type helix and that the CDPI3moiety was bound snugly in the minor groove, where it was stabilized by extensive van der Waal's interactions.

  14. Label-free detection of DNA using a light-addressable potentiometric sensor modified with a positively charged polyelectrolyte layer

    NASA Astrophysics Data System (ADS)

    Wu, Chunsheng; Bronder, Thomas; Poghossian, Arshak; Werner, Carl Frederik; Schöning, Michael J.

    2015-03-01

    A multi-spot (16 spots) light-addressable potentiometric sensor (MLAPS) consisting of an Al-p-Si-SiO2 structure modified with a weak polyelectrolyte layer of PAH (poly(allylamine hydrochloride)) was applied for the label-free electrical detection of DNA (deoxyribonucleic acid) immobilization and hybridization by the intrinsic molecular charge for the first time. To achieve a preferentially flat orientation of DNA strands and thus, to reduce the distance between the DNA charge and MLAPS surface, the negatively charged probe single-stranded DNAs (ssDNA) were electrostatically adsorbed onto the positively charged PAH layer using a simple layer-by-layer (LbL) technique. In this way, more DNA charge can be positioned within the Debye length, yielding a higher sensor signal. The surface potential changes in each spot induced due to the surface modification steps (PAH adsorption, probe ssDNA immobilization, hybridization with complementary target DNA (cDNA), non-specific adsorption of mismatched ssDNA) were determined from the shifts of photocurrent-voltage curves along the voltage axis. A high sensor signal of 83 mV was registered after immobilization of probe ssDNA onto the PAH layer. The hybridization signal increases from 5 mV to 32 mV with increasing the concentration of cDNA from 0.1 nM to 5 μM. In contrast, a small signal of 5 mV was recorded in the case of non-specific adsorption of fully mismatched ssDNA (5 μM). The obtained results demonstrate the potential of the MLAPS in combination with the simple and rapid LbL immobilization technique as a promising platform for the future development of multi-spot light-addressable label-free DNA chips with direct electrical readout.A multi-spot (16 spots) light-addressable potentiometric sensor (MLAPS) consisting of an Al-p-Si-SiO2 structure modified with a weak polyelectrolyte layer of PAH (poly(allylamine hydrochloride)) was applied for the label-free electrical detection of DNA (deoxyribonucleic acid) immobilization and hybridization by the intrinsic molecular charge for the first time. To achieve a preferentially flat orientation of DNA strands and thus, to reduce the distance between the DNA charge and MLAPS surface, the negatively charged probe single-stranded DNAs (ssDNA) were electrostatically adsorbed onto the positively charged PAH layer using a simple layer-by-layer (LbL) technique. In this way, more DNA charge can be positioned within the Debye length, yielding a higher sensor signal. The surface potential changes in each spot induced due to the surface modification steps (PAH adsorption, probe ssDNA immobilization, hybridization with complementary target DNA (cDNA), non-specific adsorption of mismatched ssDNA) were determined from the shifts of photocurrent-voltage curves along the voltage axis. A high sensor signal of 83 mV was registered after immobilization of probe ssDNA onto the PAH layer. The hybridization signal increases from 5 mV to 32 mV with increasing the concentration of cDNA from 0.1 nM to 5 μM. In contrast, a small signal of 5 mV was recorded in the case of non-specific adsorption of fully mismatched ssDNA (5 μM). The obtained results demonstrate the potential of the MLAPS in combination with the simple and rapid LbL immobilization technique as a promising platform for the future development of multi-spot light-addressable label-free DNA chips with direct electrical readout. Electronic supplementary information (ESI) available. See DOI: 10.1039/c4nr07225a

  15. Palindromic Molecule Beacon-Based Cascade Amplification for Colorimetric Detection of Cancer Genes.

    PubMed

    Shen, Zhi-Fa; Li, Feng; Jiang, Yi-Fan; Chen, Chang; Xu, Huo; Li, Cong-Cong; Yang, Zhe; Wu, Zai-Sheng

    2018-03-06

    A highly sensitive and selective colorimetric assay based on a multifunctional molecular beacon with palindromic tail (PMB) was proposed for the detection of target p53 gene. The PMB probe can serve as recognition element, primer, and polymerization template and contains a nicking site and a C-rich region complementary to a DNAzyme. In the presence of target DNA, the hairpin of PMB is opened, and the released palindromic tails intermolecularly hybridize with each other, triggering the autonomous polymerization/nicking/displacement cycles. Although only one type of probe is involved, the system can execute triple and continuous polymerization strand displacement amplifications, generating large amounts of G-quadruplex fragments. These G-rich fragments can bind to hemin and form the DNAzymes that possess the catalytic activity similar to horseradish peroxidase, catalyzing the oxidation of ABTS by H 2 O 2 and producing the colorimetric signal. Utilizing the newly proposed sensing system, target DNA can be detected down to 10 pM with a linear response range from 10 pM to 200 nM, and mutant target DNAs are able to be distinguished even by the naked eye. The desirable detection sensitivity, high specificity, and operation convenience without any separation step and chemical modification demonstrate that the palindromic molecular beacon holds the potential for detecting and monitoring a variety of nucleic acid-related biomarkers.

  16. Porcine circovirus: transcription and rolling-circle DNA replication

    USDA-ARS?s Scientific Manuscript database

    This review summarizes the molecular studies pertaining to porcine circovirus (PCV) transcription and DNA replication. The genome of PCV is circular, single-stranded DNA and contains 1759-1768 nucleotides. Both the genome-strand (packaged in the virus particle) and the complementary-strand (synthesi...

  17. Cloning and sequence analysis of complementary DNA encoding an aberrantly rearranged human T-cell gamma chain.

    PubMed Central

    Dialynas, D P; Murre, C; Quertermous, T; Boss, J M; Leiden, J M; Seidman, J G; Strominger, J L

    1986-01-01

    Complementary DNA (cDNA) encoding a human T-cell gamma chain has been cloned and sequenced. At the junction of the variable and joining regions, there is an apparent deletion of two nucleotides in the human cDNA sequence relative to the murine gamma-chain cDNA sequence, resulting simultaneously in the generation of an in-frame stop codon and in a translational frameshift. For this reason, the sequence presented here encodes an aberrantly rearranged human T-cell gamma chain. There are several surprising differences between the deduced human and murine gamma-chain amino acid sequences. These include poor homology in the variable region, poor homology in a discrete segment of the constant region precisely bounded by the expected junctions of exon CII, and the presence in the human sequence of five potential sites for N-linked glycosylation. Images PMID:3458221

  18. Isolation, molecular cloning and in vitro expression of rhesus monkey (Macaca mulatta) prominin-1.s1 complementary DNA encoding a potential hematopoietic stem cell antigen.

    PubMed

    Husain, S M; Shou, Y; Sorrentino, B P; Handgretinger, R

    2006-10-01

    Human prominin-1 (CD133 or AC133) is an important cell surface marker used to isolate primitive hematopoietic stem cells. The commercially available antibody to human prominin-1 does not recognize rhesus prominin-1. Therefore, we isolated, cloned and characterized the complementary DNA (cDNA) of rhesus prominin-1 gene and determined its coding potential. Following the nomenclature of prominin family of genes, we named this cDNA as rhesus prominin-1.s1. The amino acid sequence data of the putative rhesus prominin-1.s1 could be used in designing antigenic peptides to raise antibodies for use in isolation of pure populations of rhesus prominin-1(+) hematopoietic cells. To the best of our knowledge, there has been no previously published report about the isolation of a prominin-1 cDNA from rhesus monkey (Macaca mulatta).

  19. BEMER Electromagnetic Field Therapy Reduces Cancer Cell Radioresistance by Enhanced ROS Formation and Induced DNA Damage.

    PubMed

    Storch, Katja; Dickreuter, Ellen; Artati, Anna; Adamski, Jerzy; Cordes, Nils

    2016-01-01

    Each year more than 450,000 Germans are expected to be diagnosed with cancer subsequently receiving standard multimodal therapies including surgery, chemotherapy and radiotherapy. On top, molecular-targeted agents are increasingly administered. Owing to intrinsic and acquired resistance to these therapeutic approaches, both the better molecular understanding of tumor biology and the consideration of alternative and complementary therapeutic support are warranted and open up broader and novel possibilities for therapy personalization. Particularly the latter is underpinned by the increasing utilization of non-invasive complementary and alternative medicine by the population. One investigated approach is the application of low-dose electromagnetic fields (EMF) to modulate cellular processes. A particular system is the BEMER therapy as a Physical Vascular Therapy for which a normalization of the microcirculation has been demonstrated by a low-frequency, pulsed EMF pattern. Open remains whether this EMF pattern impacts on cancer cell survival upon treatment with radiotherapy, chemotherapy and the molecular-targeted agent Cetuximab inhibiting the epidermal growth factor receptor. Using more physiological, three-dimensional, matrix-based cell culture models and cancer cell lines originating from lung, head and neck, colorectal and pancreas, we show significant changes in distinct intermediates of the glycolysis and tricarboxylic acid cycle pathways and enhanced cancer cell radiosensitization associated with increased DNA double strand break numbers and higher levels of reactive oxygen species upon BEMER treatment relative to controls. Intriguingly, exposure of cells to the BEMER EMF pattern failed to result in sensitization to chemotherapy and Cetuximab. Further studies are necessary to better understand the mechanisms underlying the cellular alterations induced by the BEMER EMF pattern and to clarify the application areas for human disease.

  20. BEMER Electromagnetic Field Therapy Reduces Cancer Cell Radioresistance by Enhanced ROS Formation and Induced DNA Damage

    PubMed Central

    Artati, Anna; Adamski, Jerzy

    2016-01-01

    Each year more than 450,000 Germans are expected to be diagnosed with cancer subsequently receiving standard multimodal therapies including surgery, chemotherapy and radiotherapy. On top, molecular-targeted agents are increasingly administered. Owing to intrinsic and acquired resistance to these therapeutic approaches, both the better molecular understanding of tumor biology and the consideration of alternative and complementary therapeutic support are warranted and open up broader and novel possibilities for therapy personalization. Particularly the latter is underpinned by the increasing utilization of non-invasive complementary and alternative medicine by the population. One investigated approach is the application of low-dose electromagnetic fields (EMF) to modulate cellular processes. A particular system is the BEMER therapy as a Physical Vascular Therapy for which a normalization of the microcirculation has been demonstrated by a low-frequency, pulsed EMF pattern. Open remains whether this EMF pattern impacts on cancer cell survival upon treatment with radiotherapy, chemotherapy and the molecular-targeted agent Cetuximab inhibiting the epidermal growth factor receptor. Using more physiological, three-dimensional, matrix-based cell culture models and cancer cell lines originating from lung, head and neck, colorectal and pancreas, we show significant changes in distinct intermediates of the glycolysis and tricarboxylic acid cycle pathways and enhanced cancer cell radiosensitization associated with increased DNA double strand break numbers and higher levels of reactive oxygen species upon BEMER treatment relative to controls. Intriguingly, exposure of cells to the BEMER EMF pattern failed to result in sensitization to chemotherapy and Cetuximab. Further studies are necessary to better understand the mechanisms underlying the cellular alterations induced by the BEMER EMF pattern and to clarify the application areas for human disease. PMID:27959944

  1. A DNA origami nanorobot controlled by nucleic acid hybridization.

    PubMed

    Torelli, Emanuela; Marini, Monica; Palmano, Sabrina; Piantanida, Luca; Polano, Cesare; Scarpellini, Alice; Lazzarino, Marco; Firrao, Giuseppe

    2014-07-23

    A prototype for a DNA origami nanorobot is designed, produced, and tested. The cylindrical nanorobot (diameter of 14 nm and length of 48 nm) with a switchable flap, is able to respond to an external stimulus and reacts by a physical switch from a disarmed to an armed configuration able to deliver a cellular compatible message. In the tested design the robot weapon is a nucleic acid fully contained in the inner of the tube and linked to a single point of the internal face of the flap. Upon actuation the nanorobot moves the flap extracting the nucleic acid that assembles into a hemin/G-quadruplex horseradish peroxidase mimicking DNAzyme catalyzing a colorimetric reaction or chemiluminescence generation. The actuation switch is triggered by an external nucleic acid (target) that interacts with a complementary nucleic acid that is beard externally by the nanorobot (probe). Hybridization of probe and target produces a localized structural change that results in flap opening. The flap movement is studied on a two-dimensional prototype origami using Förster resonance energy transfer and is shown to be triggered by a variety of targets, including natural RNAs. The nanorobot has potential for in vivo biosensing and intelligent delivery of biological activators. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Integrating a DNA barcoding project with an ecological survey: a case study on temperate intertidal polychaete communities in Qingdao, China

    NASA Astrophysics Data System (ADS)

    Zhou, Hong; Zhang, Zhinan; Chen, Haiyan; Sun, Renhua; Wang, Hui; Guo, Lei; Pan, Haijian

    2010-07-01

    In this study, we integrated a DNA barcoding project with an ecological survey on intertidal polychaete communities and investigated the utility of CO1 gene sequence as a DNA barcode for the classification of the intertidal polychaetes. Using 16S rDNA as a complementary marker and combining morphological and ecological characterization, some of dominant and common polychaete species from Chinese coasts were assessed for their taxonomic status. We obtained 22 haplotype gene sequences of 13 taxa, including 10 CO1 sequences and 12 16S rDNA sequences. Based on intra- and inter-specific distances, we built phylogenetic trees using the neighbor-joining method. Our study suggested that the mitochondrial CO1 gene was a valid DNA barcoding marker for species identification in polychaetes, but other genes, such as 16S rDNA, could be used as a complementary genetic marker. For more accurate species identification and effective testing of species hypothesis, DNA barcoding should be incorporated with morphological, ecological, biogeographical, and phylogenetic information. The application of DNA barcoding and molecular identification in the ecological survey on the intertidal polychaete communities demonstrated the feasibility of integrating DNA taxonomy and ecology.

  3. DNA Immobilization and Hybridization Detection by the Intrinsic Molecular Charge Using Capacitive Field-Effect Sensors Modified with a Charged Weak Polyelectrolyte Layer.

    PubMed

    Bronder, Thomas S; Poghossian, Arshak; Scheja, Sabrina; Wu, Chunsheng; Keusgen, Michael; Mewes, Dieter; Schöning, Michael J

    2015-09-16

    Miniaturized setup, compatibility with advanced micro- and nanotechnologies, and ability to detect biomolecules by their intrinsic molecular charge favor the semiconductor field-effect platform as one of the most attractive approaches for the development of label-free DNA chips. In this work, a capacitive field-effect EIS (electrolyte-insulator-semiconductor) sensor covered with a layer-by-layer prepared, positively charged weak polyelectrolyte layer of PAH (poly(allylamine hydrochloride)) was used for the label-free electrical detection of DNA (deoxyribonucleic acid) immobilization and hybridization. The negatively charged probe single-stranded DNA (ssDNA) molecules were electrostatically adsorbed onto the positively charged PAH layer, resulting in a preferentially flat orientation of the ssDNA molecules within the Debye length, thus yielding a reduced charge-screening effect and a higher sensor signal. Each sensor-surface modification step (PAH adsorption, probe ssDNA immobilization, hybridization with complementary target DNA (cDNA), reducing an unspecific adsorption by a blocking agent, incubation with noncomplementary DNA (ncDNA) solution) was monitored by means of capacitance-voltage and constant-capacitance measurements. In addition, the surface morphology of the PAH layer was studied by atomic force microscopy and contact-angle measurements. High hybridization signals of 34 and 43 mV were recorded in low-ionic strength solutions of 10 and 1 mM, respectively. In contrast, a small signal of 4 mV was recorded in the case of unspecific adsorption of fully mismatched ncDNA. The density of probe ssDNA and dsDNA molecules as well as the hybridization efficiency was estimated using the experimentally measured DNA immobilization and hybridization signals and a simplified double-layer capacitor model. The results of field-effect experiments were supported by fluorescence measurements, verifying the DNA-immobilization and hybridization event.

  4. The Design of New HIV-IN Tethered Bifunctional Inhibitors using Multiple Microdomain Targeted Docking.

    PubMed

    Ciubotaru, Mihai; Musat, Mihaela Georgiana; Surleac, Marius; Ionita, Elena; Petrescu, Andrei Jose; Abele, Edgars; Abele, Ramona

    2018-04-05

    Currently used antiretroviral HIV therapy drugs exclusively target critical groups in the enzymes essential for the viral life cycle. Increased mutagenesis of their genes, changes these viral enzymes which once mutated can evade therapeutic targeting, effects which confer drug resistance. To circumvent this, our review addresses a strategy to design and derive HIV-Integrase (HIV-IN) inhibitors which simultaneously target two IN functional domains, rendering it inactive even if the enzyme accumulates many mutations. First we review the enzymatic role of IN to insert the copied viral DNA into a chromosome of the host T lymphocyte, highlighting its main functional and structural features to be subjected to inhibitory action. From a functional and structural perspective we present all classes of HIV-IN inhibitors with their most representative candidates. For each chosen compound we also explain its mechanism of IN inhibition. We use the recently resolved cryo EM IN tetramer intasome DNA complex [1] onto which we dock various reference IN inhibitory chemical scaffolds such as to target adjacent functional IN domains. Pairing compounds with complementary activity, which dock in the vicinity of a IN structural microdomain, we design bifunctional new drugs which may not only be more resilient to IN mutations but also may be more potent inhibitors than their original counterparts. In the end of our review we propose synthesis pathways to link such paired compounds with enhanced synergistic IN inhibitory effects. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  5. Conformational Heterogeneity in a Fully Complementary DNA Three-Way Junction with a GC-Rich Branchpoint.

    PubMed

    Toulmin, Anita; Baltierra-Jasso, Laura E; Morten, Michael J; Sabir, Tara; McGlynn, Peter; Schröder, Gunnar F; Smith, Brian O; Magennis, Steven W

    2017-09-19

    DNA three-way junctions (3WJs) are branched structures that serve as important biological intermediates and as components in DNA nanostructures. We recently derived the global structure of a fully complementary 3WJ and found that it contained unpaired bases at the branchpoint, which is consistent with previous observations of branch flexibility and branchpoint reactivity. By combining high-resolution single-molecule Förster resonance energy transfer, molecular modeling, time-resolved ensemble fluorescence spectroscopy, and the first 19 F nuclear magnetic resonance observations of fully complementary 3WJs, we now show that the 3WJ structure can adopt multiple distinct conformations depending upon the sequence at the branchpoint. A 3WJ with a GC-rich branchpoint adopts an open conformation with unpaired bases at the branch and at least one additional conformation with an increased number of base interactions at the branchpoint. This structural diversity has implications for branch interactions and processing in vivo and for technological applications.

  6. Immunochemical Proof that a Novel Rearranging Gene Encodes the T Cell Receptor δ Subunit

    NASA Astrophysics Data System (ADS)

    Band, Hamid; Hochstenbach, Frans; McLean, Joanne; Hata, Shingo; Krangel, Michael S.; Brenner, Michael B.

    1987-10-01

    The T cell receptor (TCR) δ protein is expressed as part of a heterodimer with TCR γ , in association with the CD3 polypeptides on a subset of functional peripheral blood T lymphocytes, thymocytes, and certain leukemic T cell lines. A monoclonal antibody directed against TCR δ was produced that binds specifically to the surface of several TCR γ δ cell lines and immunoprecipitates the TCR γ δ as a heterodimer from Triton X-100 detergent lysates and also immunoprecipitates the TCR δ subunit alone after chain separation. A candidate human TCR δ complementary DNA clone (IDP2 O-240/38), reported in a companion paper, was isolated by the subtractive library approach from a TCR γ δ cell line. This complementary DNA clone was used to direct the synthesis of a polypeptide that is specifically recognized by the monoclonal antibody to TCR δ . This complementary DNA clone thus corresponds to the gene that encodes the TCR δ subunit.

  7. Gallium plasmonic nanoparticles for label-free DNA and single nucleotide polymorphism sensing

    NASA Astrophysics Data System (ADS)

    Marín, Antonio García; García-Mendiola, Tania; Bernabeu, Cristina Navio; Hernández, María Jesús; Piqueras, Juan; Pau, Jose Luis; Pariente, Félix; Lorenzo, Encarnación

    2016-05-01

    A label-free DNA and single nucleotide polymorphism (SNP) sensing method is described. It is based on the use of the pseudodielectric function of gallium plasmonic nanoparticles (GaNPs) deposited on Si (100) substrates under reversal of the polarization handedness condition. Under this condition, the pseudodielectric function is extremely sensitive to changes in the surrounding medium of the nanoparticle surface providing an excellent sensing platform competitive to conventional surface plasmon resonance. DNA sensing has been carried out by immobilizing a thiolated capture probe sequence from Helicobacter pylori onto GaNP/Si substrates; complementary target sequences of Helicobacter pylori can be quantified over the range of 10 pM to 3.0 nM with a detection limit of 6.0 pM and a linear correlation coefficient of R2 = 0.990. The selectivity of the device allows the detection of a single nucleotide polymorphism (SNP) in a specific sequence of Helicobacter pylori, without the need for a hybridization suppressor in solution such as formamide. Furthermore, it also allows the detection of this sequence in the presence of other pathogens, such as Escherichia coli in the sample. The broad applicability of the system was demonstrated by the detection of a specific gene mutation directly associated with cystic fibrosis in large genomic DNA isolated from blood cells.A label-free DNA and single nucleotide polymorphism (SNP) sensing method is described. It is based on the use of the pseudodielectric function of gallium plasmonic nanoparticles (GaNPs) deposited on Si (100) substrates under reversal of the polarization handedness condition. Under this condition, the pseudodielectric function is extremely sensitive to changes in the surrounding medium of the nanoparticle surface providing an excellent sensing platform competitive to conventional surface plasmon resonance. DNA sensing has been carried out by immobilizing a thiolated capture probe sequence from Helicobacter pylori onto GaNP/Si substrates; complementary target sequences of Helicobacter pylori can be quantified over the range of 10 pM to 3.0 nM with a detection limit of 6.0 pM and a linear correlation coefficient of R2 = 0.990. The selectivity of the device allows the detection of a single nucleotide polymorphism (SNP) in a specific sequence of Helicobacter pylori, without the need for a hybridization suppressor in solution such as formamide. Furthermore, it also allows the detection of this sequence in the presence of other pathogens, such as Escherichia coli in the sample. The broad applicability of the system was demonstrated by the detection of a specific gene mutation directly associated with cystic fibrosis in large genomic DNA isolated from blood cells. Electronic supplementary information (ESI) available. See DOI: 10.1039/c6nr00926c

  8. Osmylated DNA, a novel concept for sequencing DNA using nanopores

    NASA Astrophysics Data System (ADS)

    Kanavarioti, Anastassia

    2015-03-01

    Saenger sequencing has led the advances in molecular biology, while faster and cheaper next generation technologies are urgently needed. A newer approach exploits nanopores, natural or solid-state, set in an electrical field, and obtains base sequence information from current variations due to the passage of a ssDNA molecule through the pore. A hurdle in this approach is the fact that the four bases are chemically comparable to each other which leads to small differences in current obstruction. ‘Base calling’ becomes even more challenging because most nanopores sense a short sequence and not individual bases. Perhaps sequencing DNA via nanopores would be more manageable, if only the bases were two, and chemically very different from each other; a sequence of 1s and 0s comes to mind. Osmylated DNA comes close to such a sequence of 1s and 0s. Osmylation is the addition of osmium tetroxide bipyridine across the C5-C6 double bond of the pyrimidines. Osmylation adds almost 400% mass to the reactive base, creates a sterically and electronically notably different molecule, labeled 1, compared to the unreactive purines, labeled 0. If osmylated DNA were successfully sequenced, the result would be a sequence of osmylated pyrimidines (1), and purines (0), and not of the actual nucleobases. To solve this problem we studied the osmylation reaction with short oligos and with M13mp18, a long ssDNA, developed a UV-vis assay to measure extent of osmylation, and designed two protocols. Protocol A uses mild conditions and yields osmylated thymidines (1), while leaving the other three bases (0) practically intact. Protocol B uses harsher conditions and effectively osmylates both pyrimidines, but not the purines. Applying these two protocols also to the complementary of the target polynucleotide yields a total of four osmylated strands that collectively could define the actual base sequence of the target DNA.

  9. Detection of miRNA using a double-strand displacement biosensor with a self-complementary fluorescent reporter.

    PubMed

    Larkey, Nicholas E; Almlie, C Kyle; Tran, Victoria; Egan, Marianne; Burrows, Sean M

    2014-02-04

    Design of rapid, selective, and sensitive DNA and ribonucleic acid (RNA) biosensors capable of minimizing false positives from nuclease degradation is crucial for translational research and clinical diagnostics. We present proof-of-principle studies of an innovative micro-ribonucleic acid (miRNA) reporter-probe biosensor that displaces a self-complementary reporter, while target miRNA binds to the probe. The freed reporter folds into a hairpin structure to induce a decrease in the fluorescent signal. The self-complementarity of the reporter facilitates the reduction of false positives from nuclease degradation. Nanomolar limits of detection and quantitation were capable with this proof-of-principle design. Detection of miRNA occurs within 10 min and does not require any additional hybridization, labeling, or rinsing steps. The potential for medical applications of the reporter-probe biosensor is demonstrated by selective detection of a cancer regulating microRNA, Lethal-7 (Let-7a). Mechanisms for transporting the biosensor across the cell membrane will be the focus of future work.

  10. Cloning of a Gene Whose Expression is Increased in Scrapie and in Senile Plaques in Human Brain

    NASA Astrophysics Data System (ADS)

    Wietgrefe, S.; Zupancic, M.; Haase, A.; Chesebro, B.; Race, R.; Frey, W.; Rustan, T.; Friedman, R. L.

    1985-12-01

    A complementary DNA library was constructed from messenger RNA's extracted from the brains of mice infected with the scrapie agent. The library was differentially screened with the objectives of finding clones that might be used as markers of infection and finding clones of genes whose increased expression might be correlated with the pathological changes common to scrapie and Alzheimer's disease. A gene was identified whose expression is increased in scrapie. The complementary DNA corresponding to this gene hybridized preferentially and focally to cells in the brains of scrapie-infected animals. The cloned DNA also hybridized to the neuritic plaques found with increased frequency in brains of patients with Alzheimer's disease.

  11. Development of dansyl-modified oligonucleotide probes responding to structural changes in a duplex.

    PubMed

    Suzuki, Yoshio; Kowata, Keiko; Komatsu, Yasuo

    2013-11-15

    We have synthesized a nonnucleoside amidite block of dansyl fluorophore to prepare dansyl-modified oligonucleotides (ONTs). The fluorescence intensities of dansyl-ONT specifically increased by the presence of adjacent guanosine residues but, significantly reduced in a dansyl-flipping duplex. These changes were caused by solvatochromism effect due to the number of guanine which is hydrophobic functional group and the external environment of dansyl group. The fluorescence intensities could be plotted as a function of the ONTs concentrations and the increase in the fluorescence was observed to equimolar concentrations of target DNA. This duplex exhibited higher melting temperature relative to the corresponding duplexes containing other base pairs. Similar changes in fluorescence could be detected upon hybridization with complementary RNAs. Thus, the dansyl-modified ONTs provide sequence specific fluorescent probe of DNA and RNA. Copyright © 2013 Elsevier Ltd. All rights reserved.

  12. CRISPR-Cas systems: prokaryotes upgrade to adaptive immunity

    PubMed Central

    Barrangou, Rodolphe; Marraffini, Luciano A.

    2014-01-01

    Summary Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR), and associated proteins (Cas) comprise the CRISPR-Cas system, which confers adaptive immunity against exogenic elements in many bacteria and most archaea. CRISPR-mediated immunization occurs through the uptake of DNA from invasive genetic elements such as plasmids and viruses, followed by its integration into CRISPR loci. These loci are subsequently transcribed and processed into small interfering RNAs that guide nucleases for specific cleavage of complementary sequences. Conceptually, CRISPR-Cas shares functional features with the mammalian adaptive immune system, while also exhibiting characteristics of Lamarckian evolution. Because immune markers spliced from exogenous agents are integrated iteratively in CRISPR loci, they constitute a genetic record of vaccination events and reflect environmental conditions and changes over time. Cas endonucleases, which can be reprogrammed by small guide RNAs have shown unprecedented potential and flexibility for genome editing, and can be repurposed for numerous DNA targeting applications including transcriptional control. PMID:24766887

  13. Development of purely structure-based pharmacophores for the topoisomerase I-DNA-ligand binding pocket

    NASA Astrophysics Data System (ADS)

    Drwal, Malgorzata N.; Agama, Keli; Pommier, Yves; Griffith, Renate

    2013-12-01

    Purely structure-based pharmacophores (SBPs) are an alternative method to ligand-based approaches and have the advantage of describing the entire interaction capability of a binding pocket. Here, we present the development of SBPs for topoisomerase I, an anticancer target with an unusual ligand binding pocket consisting of protein and DNA atoms. Different approaches to cluster and select pharmacophore features are investigated, including hierarchical clustering and energy calculations. In addition, the performance of SBPs is evaluated retrospectively and compared to the performance of ligand- and complex-based pharmacophores. SBPs emerge as a valid method in virtual screening and a complementary approach to ligand-focussed methods. The study further reveals that the choice of pharmacophore feature clustering and selection methods has a large impact on the virtual screening hit lists. A prospective application of the SBPs in virtual screening reveals that they can be used successfully to identify novel topoisomerase inhibitors.

  14. Dimensions and Global Twist of Single-Layer DNA Origami Measured by Small-Angle X-ray Scattering.

    PubMed

    Baker, Matthew A B; Tuckwell, Andrew J; Berengut, Jonathan F; Bath, Jonathan; Benn, Florence; Duff, Anthony P; Whitten, Andrew E; Dunn, Katherine E; Hynson, Robert M; Turberfield, Andrew J; Lee, Lawrence K

    2018-06-04

    The rational design of complementary DNA sequences can be used to create nanostructures that self-assemble with nanometer precision. DNA nanostructures have been imaged by atomic force microscopy and electron microscopy. Small-angle X-ray scattering (SAXS) provides complementary structural information on the ensemble-averaged state of DNA nanostructures in solution. Here we demonstrate that SAXS can distinguish between different single-layer DNA origami tiles that look identical when immobilized on a mica surface and imaged with atomic force microscopy. We use SAXS to quantify the magnitude of global twist of DNA origami tiles with different crossover periodicities: these measurements highlight the extreme structural sensitivity of single-layer origami to the location of strand crossovers. We also use SAXS to quantify the distance between pairs of gold nanoparticles tethered to specific locations on a DNA origami tile and use this method to measure the overall dimensions and geometry of the DNA nanostructure in solution. Finally, we use indirect Fourier methods, which have long been used for the interpretation of SAXS data from biomolecules, to measure the distance between DNA helix pairs in a DNA origami nanotube. Together, these results provide important methodological advances in the use of SAXS to analyze DNA nanostructures in solution and insights into the structures of single-layer DNA origami.

  15. Illumina whole-genome complementary DNA-mediated annealing, selection, extension and ligation platform: assessing its performance in formalin-fixed, paraffin-embedded samples and identifying invasion pattern-related genes in oral squamous cell carcinoma.

    PubMed

    Loudig, Olivier; Brandwein-Gensler, Margaret; Kim, Ryung S; Lin, Juan; Isayeva, Tatyana; Liu, Christina; Segall, Jeffrey E; Kenny, Paraic A; Prystowsky, Michael B

    2011-12-01

    High-throughput gene expression profiling from formalin-fixed, paraffin-embedded tissues has become a reality, and several methods are now commercially available. The Illumina whole-genome complementary DNA-mediated annealing, selection, extension and ligation assay (Illumina, Inc) is a full-transcriptome version of the original 512-gene complementary DNA-mediated annealing, selection, extension and ligation assay, allowing high-throughput profiling of 24,526 annotated genes from degraded and formalin-fixed, paraffin-embedded RNA. This assay has the potential to allow identification of novel gene signatures associated with clinical outcome using banked archival pathology specimen resources. We tested the reproducibility of the whole-genome complementary DNA-mediated annealing, selection, extension and ligation assay and its sensitivity for detecting differentially expressed genes in RNA extracted from matched fresh and formalin-fixed, paraffin-embedded cells, after 1 and 13 months of storage, using the human breast cell lines MCF7 and MCF10A. Then, using tumor worst pattern of invasion as a classifier, 1 component of the "risk model," we selected 12 formalin-fixed, paraffin-embedded oral squamous cell carcinomas for whole-genome complementary DNA-mediated annealing, selection, extension and ligation assay analysis. We profiled 5 tumors with nonaggressive, nondispersed pattern of invasion, and 7 tumors with aggressive dispersed pattern of invasion and satellites scattered at least 1 mm apart. To minimize variability, the formalin-fixed, paraffin-embedded specimens were prepared from snap-frozen tissues, and RNA was obtained within 24 hours of fixation. One hundred four down-regulated genes and 72 up-regulated genes in tumors with aggressive dispersed pattern of invasion were identified. We performed quantitative reverse transcriptase polymerase chain reaction validation of 4 genes using Taqman assays and in situ protein detection of 1 gene by immunohistochemistry. Functional cluster analysis of genes up-regulated in tumors with aggressive pattern of invasion suggests presence of genes involved in cellular cytoarchitecture, some of which already associated with tumor invasion. Identification of these genes provides biologic rationale for our histologic classification, with regard to tumor invasion, and demonstrates that the whole-genome complementary DNA-mediated annealing, selection, extension and ligation assay is a powerful assay for profiling degraded RNA from archived specimens when combined with quantitative reverse transcriptase polymerase chain reaction validation. Copyright © 2011 Elsevier Inc. All rights reserved.

  16. Genome-wide target profiling of piggyBac and Tol2 in HEK 293: pros and cons for gene discovery and gene therapy

    PubMed Central

    2011-01-01

    Background DNA transposons have emerged as indispensible tools for manipulating vertebrate genomes with applications ranging from insertional mutagenesis and transgenesis to gene therapy. To fully explore the potential of two highly active DNA transposons, piggyBac and Tol2, as mammalian genetic tools, we have conducted a side-by-side comparison of the two transposon systems in the same setting to evaluate their advantages and disadvantages for use in gene therapy and gene discovery. Results We have observed that (1) the Tol2 transposase (but not piggyBac) is highly sensitive to molecular engineering; (2) the piggyBac donor with only the 40 bp 3'-and 67 bp 5'-terminal repeat domain is sufficient for effective transposition; and (3) a small amount of piggyBac transposases results in robust transposition suggesting the piggyBac transpospase is highly active. Performing genome-wide target profiling on data sets obtained by retrieving chromosomal targeting sequences from individual clones, we have identified several piggyBac and Tol2 hotspots and observed that (4) piggyBac and Tol2 display a clear difference in targeting preferences in the human genome. Finally, we have observed that (5) only sites with a particular sequence context can be targeted by either piggyBac or Tol2. Conclusions The non-overlapping targeting preference of piggyBac and Tol2 makes them complementary research tools for manipulating mammalian genomes. PiggyBac is the most promising transposon-based vector system for achieving site-specific targeting of therapeutic genes due to the flexibility of its transposase for being molecularly engineered. Insights from this study will provide a basis for engineering piggyBac transposases to achieve site-specific therapeutic gene targeting. PMID:21447194

  17. 27nt-RNAs guide histone variant deposition via 'RNA-induced DNA replication interference' and thus transmit parental genome partitioning in Stylonychia.

    PubMed

    Postberg, Jan; Jönsson, Franziska; Weil, Patrick Philipp; Bulic, Aneta; Juranek, Stefan Andreas; Lipps, Hans-Joachim

    2018-06-12

    During sexual reproduction in the unicellular ciliate Stylonychia somatic macronuclei differentiate from germline micronuclei. Thereby, programmed sequence reduction takes place, leading to the elimination of > 95% of germline sequences, which priorly adopt heterochromatin structure via H3K27me3. Simultaneously, 27nt-ncRNAs become synthesized from parental transcripts and are bound by the Argonaute protein PIWI1. These 27nt-ncRNAs cover sequences destined to the developing macronucleus and are thought to protect them from degradation. We provide evidence and propose that RNA/DNA base-pairing guides PIWI1/27nt-RNA complexes to complementary macronucleus-destined DNA target sequences, hence transiently causing locally stalled replication during polytene chromosome formation. This spatiotemporal delay enables the selective deposition of temporarily available histone H3.4K27me3 nucleosomes at all other sequences being continuously replicated, thus dictating their prospective heterochromatin structure before becoming developmentally eliminated. Concomitantly, 27nt-RNA-covered sites remain protected. We introduce the concept of 'RNA-induced DNA replication interference' and explain how the parental functional genome partition could become transmitted to the progeny.

  18. Topological Interaction by Entanglement of DNA

    NASA Astrophysics Data System (ADS)

    Feng, Lang; Sha, Ruojie; Seeman, Nadrian; Chaikin, Paul

    2012-02-01

    We find and study a new type of interaction between colloids, Topological Interaction by Entanglement of DNA (TIED), due to concatenation of loops formed by palindromic DNA. Consider a particle coated with palindromic DNA of sequence ``P1.'' Below the DNA hybridization temperature (Tm), loops of the self-complementary DNA form on the particle surface. Direct hybridization with similar particle covered with a different sequence P2 do not occur. However when particles are held together at T > Tm, then cooled to T < Tm, some of the loops entangle and link, similar to a Olympic Gel. We quantitatively observe and measure this topological interaction between colloids in a ˜5^o C temperature window, ˜6^o C lower than direct binding of complementary DNA with similar strength and introduce the concept of entanglement binding free energy. To prove our interaction to be topological, we unknot the purely entangled binding sites between colloids by adding Topoisomerase I which unconcatenates our loops. This research suggests novel history dependent ways of binding particles and serves as a new design tool in colloidal self-assembly.

  19. Modeling Hybridization Kinetics of Gene Probes in a DNA Biochip Using FEMLAB

    PubMed Central

    Munir, Ahsan; Waseem, Hassan; Williams, Maggie R.; Stedtfeld, Robert D.; Gulari, Erdogan; Tiedje, James M.; Hashsham, Syed A.

    2017-01-01

    Microfluidic DNA biochips capable of detecting specific DNA sequences are useful in medical diagnostics, drug discovery, food safety monitoring and agriculture. They are used as miniaturized platforms for analysis of nucleic acids-based biomarkers. Binding kinetics between immobilized single stranded DNA on the surface and its complementary strand present in the sample are of interest. To achieve optimal sensitivity with minimum sample size and rapid hybridization, ability to predict the kinetics of hybridization based on the thermodynamic characteristics of the probe is crucial. In this study, a computer aided numerical model for the design and optimization of a flow-through biochip was developed using a finite element technique packaged software tool (FEMLAB; package included in COMSOL Multiphysics) to simulate the transport of DNA through a microfluidic chamber to the reaction surface. The model accounts for fluid flow, convection and diffusion in the channel and on the reaction surface. Concentration, association rate constant, dissociation rate constant, recirculation flow rate, and temperature were key parameters affecting the rate of hybridization. The model predicted the kinetic profile and signal intensities of eighteen 20-mer probes targeting vancomycin resistance genes (VRGs). Predicted signal intensities and hybridization kinetics strongly correlated with experimental data in the biochip (R2 = 0.8131). PMID:28555058

  20. Modeling Hybridization Kinetics of Gene Probes in a DNA Biochip Using FEMLAB.

    PubMed

    Munir, Ahsan; Waseem, Hassan; Williams, Maggie R; Stedtfeld, Robert D; Gulari, Erdogan; Tiedje, James M; Hashsham, Syed A

    2017-05-29

    Microfluidic DNA biochips capable of detecting specific DNA sequences are useful in medical diagnostics, drug discovery, food safety monitoring and agriculture. They are used as miniaturized platforms for analysis of nucleic acids-based biomarkers. Binding kinetics between immobilized single stranded DNA on the surface and its complementary strand present in the sample are of interest. To achieve optimal sensitivity with minimum sample size and rapid hybridization, ability to predict the kinetics of hybridization based on the thermodynamic characteristics of the probe is crucial. In this study, a computer aided numerical model for the design and optimization of a flow-through biochip was developed using a finite element technique packaged software tool (FEMLAB; package included in COMSOL Multiphysics) to simulate the transport of DNA through a microfluidic chamber to the reaction surface. The model accounts for fluid flow, convection and diffusion in the channel and on the reaction surface. Concentration, association rate constant, dissociation rate constant, recirculation flow rate, and temperature were key parameters affecting the rate of hybridization. The model predicted the kinetic profile and signal intensities of eighteen 20-mer probes targeting vancomycin resistance genes (VRGs). Predicted signal intensities and hybridization kinetics strongly correlated with experimental data in the biochip (R² = 0.8131).

  1. DNA nanomechanics allows direct digital detection of complementary DNA and microRNA targets.

    PubMed

    Husale, Sudhir; Persson, Henrik H J; Sahin, Ozgur

    2009-12-24

    Techniques to detect and quantify DNA and RNA molecules in biological samples have had a central role in genomics research. Over the past decade, several techniques have been developed to improve detection performance and reduce the cost of genetic analysis. In particular, significant advances in label-free methods have been reported. Yet detection of DNA molecules at concentrations below the femtomolar level requires amplified detection schemes. Here we report a unique nanomechanical response of hybridized DNA and RNA molecules that serves as an intrinsic molecular label. Nanomechanical measurements on a microarray surface have sufficient background signal rejection to allow direct detection and counting of hybridized molecules. The digital response of the sensor provides a large dynamic range that is critical for gene expression profiling. We have measured differential expressions of microRNAs in tumour samples; such measurements have been shown to help discriminate between the tissue origins of metastatic tumours. Two hundred picograms of total RNA is found to be sufficient for this analysis. In addition, the limit of detection in pure samples is found to be one attomolar. These results suggest that nanomechanical read-out of microarrays promises attomolar-level sensitivity and large dynamic range for the analysis of gene expression, while eliminating biochemical manipulations, amplification and labelling.

  2. Separation of 1-23-kb complementary DNA strands by urea-agarose gel electrophoresis.

    PubMed

    Hegedüs, Eva; Kókai, Endre; Kotlyar, Alexander; Dombrádi, Viktor; Szabó, Gábor

    2009-09-01

    Double-stranded (ds), as well as denatured, single-stranded (ss) DNA samples can be analyzed on urea-agarose gels. Here we report that after denaturation by heat in the presence of 8 M urea, the two strands of the same ds DNA fragment of approximately 1-20-kb size migrate differently in 1 M urea containing agarose gels. The two strands are readily distinguished on Southern blots by ss-specific probes. The different migration of the two strands could be attributed to their different, base composition-dependent conformation impinging on the electrophoretic mobility of the ss molecules. This phenomenon can be exploited for the efficient preparation of strand-specific probes and for the separation of the complementary DNA strands for subsequent analysis, offering a new tool for various cell biological research areas.

  3. Discriminating DNA mismatches by electrochemical and gravimetric techniques.

    PubMed

    Mazouz, Zouhour; Fourati, Najla; Zerrouki, Chouki; Ommezine, Asma; Rebhi, Lamia; Yaakoubi, Nourdin; Kalfat, Rafik; Othmane, Ali

    2013-10-15

    A silicon nitride functionalized electrode and a 104 MHz lithium tantalate (LiTaO₃) surface acoustic wave (SAW) sensor have been used to investigate target-probe recognition processes. Electrochemical and gravimetric measurements have been considered to monitor hybridization of single base mismatch (SBM) in synthetic oligonucleotides and single-nucleotide polymorphisms ApoE in real clinical genotypes. Obvious discrimination of SBM in nucleotides has been shown by both gravimetric and electrochemical techniques, without labeling nor amplification. Investigations on mismatches nature and position have also been considered. For guanine-adenine (GA), guanine-thymine (GT) and guanine-guanine (GG) mismatches, the sensors responses present a dependence upon positions. Considering the capacitance variations and hybridization rates, results showed that gravimetric transduction is more sensitive than electrochemical one. Moreover, the highest value of GT hybridization rate (in the middle position) was found in accordance with the nearest-neighbor model, where the considered configuration appears as the most thermodynamically stable. For the real samples, where the electrochemical transduction, by combining capacitance and flat-band potential measurements, were found more sensitive, the results show that the realized sensor permits an unambiguous discrimination of recognition between fully complementary, non-complementary and single base mismatched targets, and even between the combination of differently matched strands. Copyright © 2013 Elsevier B.V. All rights reserved.

  4. Identification of novel peptides for horse meat speciation in highly processed foodstuffs.

    PubMed

    Claydon, Amy J; Grundy, Helen H; Charlton, Adrian J; Romero, M Rosario

    2015-01-01

    There is a need for robust analytical methods to support enforcement of food labelling legislation. Proteomics is emerging as a complementary methodology to existing tools such as DNA and antibody-based techniques. Here we describe the development of a proteomics strategy for the determination of meat species in highly processed foods. A database of specific peptides for nine relevant animal species was used to enable semi-targeted species determination. This principle was tested for horse meat speciation, and a range of horse-specific peptides were identified as heat stable marker peptides for the detection of low levels of horse meat in mixtures with other species.

  5. 2'-O-[2-[2-(N,N-Dimethylamino)ethoxy]ethyl] Modified Antisense Oligonucleotides: Symbiosis of Charge Interaction Factors and Stereoelectronic Effects

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Prhavc, M.; Prakash, T.P.; Minasov, G.

    Oligonucleotides with a novel, 2'-O-[2-[2-(N,N-dimethylamino)ethoxy]ethyl] (2'-O-DMAEOE) modification have been synthesized. This modification, a cationic analogue of the 2'-O-(2-methoxyethyl) (2'-O-MOE) modification, exhibits high binding affinity to target RNA (but not to DNA) and exceptional resistance to nuclease degradation. Analysis of the crystal structure of a self-complementary oligonucleotide containing a single 2'-O-DMAEOE modification explains the importance of charge factors and gauche effects on the observed antisense properties. 2'-O-DMAEOE modified oligonucleotides are ideal candidates for antisense drugs.

  6. G-quadruplexes as novel cis-elements controlling transcription during embryonic development.

    PubMed

    David, Aldana P; Margarit, Ezequiel; Domizi, Pablo; Banchio, Claudia; Armas, Pablo; Calcaterra, Nora B

    2016-05-19

    G-quadruplexes are dynamic structures folded in G-rich single-stranded DNA regions. These structures have been recognized as a potential nucleic acid based mechanism for regulating multiple cellular processes such as replication, transcription and genomic maintenance. So far, their transcriptional role in vivo during vertebrate embryonic development has not yet been addressed. Here, we performed an in silico search to find conserved putative G-quadruplex sequences (PQSs) within proximal promoter regions of human, mouse and zebrafish developmental genes. Among the PQSs able to fold in vitro as G-quadruplex, those present in nog3, col2a1 and fzd5 promoters were selected for further studies. In cellulo studies revealed that the selected G-quadruplexes affected the transcription of luciferase controlled by the SV40 nonrelated promoter. G-quadruplex disruption in vivo by microinjection in zebrafish embryos of either small ligands or DNA oligonucleotides complementary to the selected PQSs resulted in lower transcription of the targeted genes. Moreover, zebrafish embryos and larvae phenotypes caused by the presence of complementary oligonucleotides fully resembled those ones reported for nog3, col2a1 and fzd5 morphants. To our knowledge, this is the first work revealing in vivo the role of conserved G-quadruplexes in the embryonic development, one of the most regulated processes of the vertebrates biology. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. G-quadruplexes as novel cis-elements controlling transcription during embryonic development

    PubMed Central

    David, Aldana P.; Margarit, Ezequiel; Domizi, Pablo; Banchio, Claudia; Armas, Pablo; Calcaterra, Nora B.

    2016-01-01

    G-quadruplexes are dynamic structures folded in G-rich single-stranded DNA regions. These structures have been recognized as a potential nucleic acid based mechanism for regulating multiple cellular processes such as replication, transcription and genomic maintenance. So far, their transcriptional role in vivo during vertebrate embryonic development has not yet been addressed. Here, we performed an in silico search to find conserved putative G-quadruplex sequences (PQSs) within proximal promoter regions of human, mouse and zebrafish developmental genes. Among the PQSs able to fold in vitro as G-quadruplex, those present in nog3, col2a1 and fzd5 promoters were selected for further studies. In cellulo studies revealed that the selected G-quadruplexes affected the transcription of luciferase controlled by the SV40 nonrelated promoter. G-quadruplex disruption in vivo by microinjection in zebrafish embryos of either small ligands or DNA oligonucleotides complementary to the selected PQSs resulted in lower transcription of the targeted genes. Moreover, zebrafish embryos and larvae phenotypes caused by the presence of complementary oligonucleotides fully resembled those ones reported for nog3, col2a1 and fzd5 morphants. To our knowledge, this is the first work revealing in vivo the role of conserved G-quadruplexes in the embryonic development, one of the most regulated processes of the vertebrates biology. PMID:26773060

  8. [DNA structure from A to Z--biological implications of structural diversity of DNA].

    PubMed

    Bukowiecka-Matusiak, Małgorzata; Woźniak, Lucyna A

    2006-01-01

    Deoxyribonucleic acid (DNA) is a biopolymer of nucleotides, usually adopting a double-stranded helical form in cells, with complementary base pairing holding the two strands together. The most stable is B-DNA conformation, although numerous other double helical structures can occur under specific conditions (A-DNA, Z-DNA, P-DNA). The existence of multiple-stranded (triplex, tetraplex) forms in vivo and their biological function in cells are subject of intensive studies.

  9. Stacked-unstacked equilibrium at the nick site of DNA.

    PubMed

    Protozanova, Ekaterina; Yakovchuk, Peter; Frank-Kamenetskii, Maxim D

    2004-09-17

    Stability of duplex DNA with respect to separation of complementary strands is crucial for DNA executing its major functions in the cell and it also plays a central role in major biotechnology applications of DNA: DNA sequencing, polymerase chain reaction, and DNA microarrays. Two types of interaction are well known to contribute to DNA stability: stacking between adjacent base-pairs and pairing between complementary bases. However, their contribution into the duplex stability is yet to be determined. Now we fill this fundamental gap in our knowledge of the DNA double helix. We have prepared a series of 32, 300 bp-long DNA fragments with solitary nicks in the same position differing only in base-pairs flanking the nick. Electrophoretic mobility of these fragments in the gel has been studied. Assuming the equilibrium between stacked and unstacked conformations at the nick site, all 32 stacking free energy parameters have been obtained. Only ten of them are essential and they govern the stacking interactions between adjacent base-pairs in intact DNA double helix. A full set of DNA stacking parameters has been determined for the first time. From these data and from a well-known dependence of DNA melting temperature on G.C content, the contribution of base-pairing into duplex stability has been estimated. The obtained energy parameters of the DNA double helix are of paramount importance for understanding sequence-dependent DNA flexibility and for numerous biotechnology applications.

  10. Insights into DNA-mediated interparticle interactions from a coarse-grained model

    NASA Astrophysics Data System (ADS)

    Ding, Yajun; Mittal, Jeetain

    2014-11-01

    DNA-functionalized particles have great potential for the design of complex self-assembled materials. The major hurdle in realizing crystal structures from DNA-functionalized particles is expected to be kinetic barriers that trap the system in metastable amorphous states. Therefore, it is vital to explore the molecular details of particle assembly processes in order to understand the underlying mechanisms. Molecular simulations based on coarse-grained models can provide a convenient route to explore these details. Most of the currently available coarse-grained models of DNA-functionalized particles ignore key chemical and structural details of DNA behavior. These models therefore are limited in scope for studying experimental phenomena. In this paper, we present a new coarse-grained model of DNA-functionalized particles which incorporates some of the desired features of DNA behavior. The coarse-grained DNA model used here provides explicit DNA representation (at the nucleotide level) and complementary interactions between Watson-Crick base pairs, which lead to the formation of single-stranded hairpin and double-stranded DNA. Aggregation between multiple complementary strands is also prevented in our model. We study interactions between two DNA-functionalized particles as a function of DNA grafting density, lengths of the hybridizing and non-hybridizing parts of DNA, and temperature. The calculated free energies as a function of pair distance between particles qualitatively resemble experimental measurements of DNA-mediated pair interactions.

  11. Investigating actinomycin D binding to G-quadruplex, i-motif and double-stranded DNA in 27-nt segment of c-MYC gene promoter.

    PubMed

    Niknezhad, Zhila; Hassani, Leila; Norouzi, Davood

    2016-01-01

    c-MYC DNA is an attractive target for drug design, especially for cancer chemotherapy. Around 90% of c-MYC transcription is controlled by NHE III1, whose 27-nt purine-rich strand has the ability to form G-quadruplex structure. In this investigation, interaction of ActD with 27-nt G-rich strand (G/c-MYC) and its equimolar mixture with the complementary sequence, (GC/c-MYC) as well as related C-rich oligonucleotide (C/c-MYC) was evaluated. Molecular dynamic simulations showed that phenoxazine and lactone rings of ActD come close to the outer G-tetrad nucleotides indicating that ActD binds through end-stacking to the quadruplex DNA. RMSD and RMSF revealed that fluctuation of the quadruplex DNA increases upon interaction with the drug. The results of spectrophotometry and spectrofluorometry indicated that ActD most probably binds to the c-MYC quadruplex and duplex DNA via end-stacking and intercalation, respectively and polarity of ActD environment decreases due to the interaction. It was also found that binding of ActD to the GC-rich DNA is stronger than the two other forms of DNA. Circular dichroism results showed that the type of the three forms of DNA structures doesn't change, but their compactness alters due to their interaction with ActD. Finally, it can be concluded that ActD binds differently to double stranded DNA, quadruplex DNA and i-motif. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. Structural Insights into the Quadruplex-Duplex 3' Interface Formed from a Telomeric Repeat: A Potential Molecular Target.

    PubMed

    Russo Krauss, Irene; Ramaswamy, Sneha; Neidle, Stephen; Haider, Shozeb; Parkinson, Gary N

    2016-02-03

    We report here on an X-ray crystallographic and molecular modeling investigation into the complex 3' interface formed between putative parallel stranded G-quadruplexes and a duplex DNA sequence constructed from the human telomeric repeat sequence TTAGGG. Our crystallographic approach provides a detailed snapshot of a telomeric 3' quadruplex-duplex junction: a junction that appears to have the potential to form a unique molecular target for small molecule binding and interference with telomere-related functions. This unique target is particularly relevant as current high-affinity compounds that bind putative G-quadruplex forming sequences only rarely have a high degree of selectivity for a particular quadruplex. Here DNA junctions were assembled using different putative quadruplex-forming scaffolds linked at the 3' end to a telomeric duplex sequence and annealed to a complementary strand. We successfully generated a series of G-quadruplex-duplex containing crystals, both alone and in the presence of ligands. The structures demonstrate the formation of a parallel folded G-quadruplex and a B-form duplex DNA stacked coaxially. Most strikingly, structural data reveals the consistent formation of a TAT triad platform between the two motifs. This triad allows for a continuous stack of bases to link the quadruplex motif with the duplex region. For these crystal structures formed in the absence of ligands, the TAT triad interface occludes ligand binding at the 3' quadruplex-duplex interface, in agreement with in silico docking predictions. However, with the rearrangement of a single nucleotide, a stable pocket can be produced, thus providing an opportunity for the binding of selective molecules at the interface.

  13. A SERS-active sensor based on heterogeneous gold nanostar core-silver nanoparticle satellite assemblies for ultrasensitive detection of aflatoxinB1

    NASA Astrophysics Data System (ADS)

    Li, Aike; Tang, Lijuan; Song, Dan; Song, Shanshan; Ma, Wei; Xu, Liguang; Kuang, Hua; Wu, Xiaoling; Liu, Liqiang; Chen, Xin; Xu, Chuanlai

    2016-01-01

    A surface-enhanced Raman scattering (SERS) sensor based on gold nanostar (Au NS) core-silver nanoparticle (Ag NP) satellites was fabricated for the first time to detect aflatoxinB1 (AFB1). We constructed the SERS sensor using AFB1 aptamer (DNA1)-modified Ag satellites and a complementary sequence (DNA2)-modified Au NS core. The Raman label (ATP) was modified on the surface of Ag satellites. The SERS signal was enhanced when the satellite NP was attached to the Au core NS. The AFB1 aptamer on the surface of Ag satellites would bind to the targets when AFB1 was present in the system, Ag satellites were then removed and the SERS signal decreased. This SERS sensor showed superior specificity for AFB1 and the linear detection range was from 1 to 1000 pg mL-1 with the limit of detection (LOD) of 0.48 pg mL-1. The excellent recovery experiment using peanut milk demonstrated that the sensor could be applied in food and environmental detection.A surface-enhanced Raman scattering (SERS) sensor based on gold nanostar (Au NS) core-silver nanoparticle (Ag NP) satellites was fabricated for the first time to detect aflatoxinB1 (AFB1). We constructed the SERS sensor using AFB1 aptamer (DNA1)-modified Ag satellites and a complementary sequence (DNA2)-modified Au NS core. The Raman label (ATP) was modified on the surface of Ag satellites. The SERS signal was enhanced when the satellite NP was attached to the Au core NS. The AFB1 aptamer on the surface of Ag satellites would bind to the targets when AFB1 was present in the system, Ag satellites were then removed and the SERS signal decreased. This SERS sensor showed superior specificity for AFB1 and the linear detection range was from 1 to 1000 pg mL-1 with the limit of detection (LOD) of 0.48 pg mL-1. The excellent recovery experiment using peanut milk demonstrated that the sensor could be applied in food and environmental detection. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr08372a

  14. Enumeration and targeted analysis of KRAS, BRAF and PIK3CA mutations in CTCs captured by a label-free platform: Comparison to ctDNA and tissue in metastatic colorectal cancer.

    PubMed

    Kidess-Sigal, Evelyn; Liu, Haiyan E; Triboulet, Melanie M; Che, James; Ramani, Vishnu C; Visser, Brendan C; Poultsides, George A; Longacre, Teri A; Marziali, Andre; Vysotskaia, Valentina; Wiggin, Matthew; Heirich, Kyra; Hanft, Violet; Keilholz, Ulrich; Tinhofer, Ingeborg; Norton, Jeffrey A; Lee, Mark; Sollier-Christen, Elodie; Jeffrey, Stefanie S

    2016-12-20

    Treatment of advanced colorectal cancer (CRC) requires multimodal therapeutic approaches and need for monitoring tumor plasticity. Liquid biopsy biomarkers, including CTCs and ctDNA, hold promise for evaluating treatment response in real-time and guiding therapeutic modifications. From 15 patients with advanced CRC undergoing liver metastasectomy with curative intent, we collected 41 blood samples at different time points before and after surgery for CTC isolation and quantification using label-free Vortex technology. For mutational profiling, KRAS, BRAF, and PIK3CA hotspot mutations were analyzed in CTCs and ctDNA from 23 samples, nine matched liver metastases and three primary tumor samples. Mutational patterns were compared. 80% of patient blood samples were positive for CTCs, using a healthy baseline value as threshold (0.4 CTCs/mL), and 81.4% of captured cells were EpCAM+ CTCs. At least one mutation was detected in 78% of our blood samples. Among 23 matched CTC and ctDNA samples, we found a concordance of 78.2% for KRAS, 73.9% for BRAF and 91.3% for PIK3CA mutations. In several cases, CTCs exhibited a mutation that was not detected in ctDNA, and vice versa. Complementary assessment of both CTCs and ctDNA appears advantageous to assess dynamic tumor profiles.

  15. A fluorometric lateral flow assay for visual detection of nucleic acids using a digital camera readout.

    PubMed

    Magiati, Maria; Sevastou, Areti; Kalogianni, Despina P

    2018-06-04

    A fluorometric lateral flow assay has been developed for the detection of nucleic acids. The fluorophores phycoerythrin (PE) and fluorescein isothiocyanate (FITC) were used as labels, while a common digital camera and a colored vinyl-sheet, acting as a cut-off optical filter, are used for fluorescence imaging. After DNA amplification by polymerase chain reaction (PCR), the biotinylated PCR product is hybridized to its complementary probe that carries a poly(dA) tail at 3΄ edge and then applied to the lateral flow strip. The hybrids are captured to the test zone of the strip by immobilized poly(dT) sequences and detected by streptavidin-fluorescein and streptavidin-phycoerythrin conjugates, through streptavidin-biotin interaction. The assay is widely applicable, simple, cost-effective, and offers a large multiplexing potential. Its performance is comparable to assays based on the use of streptavidin-gold nanoparticles conjugates. As low as 7.8 fmol of a ssDNA and 12.5 fmol of an amplified dsDNA target were detectable. Graphical abstract Schematic presentation of a fluorometric lateral flow assay based on fluorescein and phycoerythrin fluorescent labels for the detection of single-stranded (ssDNA) and double-stranded DNA (dsDNA) sequences and using a digital camera readout. SA: streptavidin, BSA: Bovine Serum Albumin, B: biotin, FITC: fluorescein isothiocyanate, PE: phycoerythrin, TZ: test zone, CZ: control zone.

  16. Synthesis of cis- and trans-α-l-[4.3.0]bicyclo-DNA monomers for antisense technology: methods for the diastereoselective formation of bicyclic nucleosides.

    PubMed

    Hanessian, Stephen; Schroeder, Benjamin R; Merner, Bradley L; Chen, Bin; Swayze, Eric E; Seth, Punit P

    2013-09-20

    Two α-L-ribo-configured bicyclic nucleic acid modifications, represented by analogues 12 and 13, which are epimeric at C3' and C5' have been synthesized using a carbohydrate-based approach to build the bicyclic core structure. An intramolecular L-proline-mediated aldol reaction was employed to generate the cis-configured ring junction of analogue 12 and represents a rare application of this venerable organocatalytic reaction to a carbohydrate system. In the case of analogue 13, where a trans-ring junction was desired, an intermolecular diastereoselective Grignard reaction followed by ring-closing metathesis was used. In order to set the desired stereochemistry at the C5' positions of both nucleoside targets, a study of diastereoselective Lewis acid mediated allylation reactions on a common bicyclic aldehyde precursor was carried out. Analogue 12 was incorporated in oligonucleotide sequences, and thermal denaturation experiments indicate that it is destabilizing when paired with complementary DNA and RNA. However, this construct shows a significant improvement in nuclease stability relative to a DNA oligonucleotide.

  17. Electrophoretic fabrication of chitosan-zirconium-oxide nanobiocomposite platform for nucleic acid detection.

    PubMed

    Das, Maumita; Dhand, Chetna; Sumana, Gajjala; Srivastava, A K; Nagarajan, R; Nain, Lata; Iwamoto, M; Manaka, Takaaki; Malhotra, B D

    2011-03-14

    The present work describes electrophoretic fabrication of nanostructured chitosan-zirconium-oxide composite (CHIT-NanoZrO(2)) film (180 nm) onto indium-tin-oxide (ITO)-coated glass plate. This nanobiocomposite film has been explored as immobilization platform for probe DNA specific to M. Tuberculosis as model biomolecule to investigate its sensing characteristics. It is revealed that pH-responsive behavior of CHIT and its cationic skeleton is responsible for the movement of CHIT-NanoZrO(2) colloids toward cathode during electrophoretic deposition. The FT-IR, SEM, TEM, and EDX techniques have been employed for the structural, morphological, and composition analysis of the fabricated electrodes. The morphological studies clearly reveal uniform inter-linking and dispersion of hexagonal nanograins of ZrO(2) (30-50 nm) into the chitosan matrix, resulting in homogeneous nanobiocomposite formation. Electrochemical response measurements of DNA/CHIT-NanoZrO(2)/ITO bioelectrode, carried out using cyclic voltammetry and differential pulse voltammetry, reveal that this bioelectrode can specifically detect complementary target DNA up to 0.00078 μM with sensitivity of 6.38 × 10(-6) AμM(-1).

  18. Dissecting the hybridization of oligonucleotides to structured complementary sequences.

    PubMed

    Peracchi, Alessio

    2016-06-01

    When oligonucleotides hybridize to long target molecules, the process is slowed by the secondary structure in the targets. The phenomenon has been analyzed in several previous studies, but many details remain poorly understood. I used a spectrofluorometric strategy, focusing on the formation/breaking of individual base pairs, to study the kinetics of association between a DNA hairpin and >20 complementary oligonucleotides ('antisenses'). Hybridization rates differed by over three orders of magnitude. Association was toehold-mediated, both for antisenses binding to the target's ends and for those designed to interact with the loop. Binding of these latter, besides being consistently slower, was affected to variable, non-uniform extents by the asymmetric loop structure. Divalent metal ions accelerated hybridization, more pronouncedly when nucleation occurred at the loop. Incorporation of locked nucleic acid (LNA) residues in the antisenses substantially improved the kinetics only when LNAs participated to the earliest hybridization steps. The effects of individual LNAs placed along the antisense indicated that the reaction transition state occurred after invading at least the first base pair of the stem. The experimental approach helps dissect hybridization reactions involving structured nucleic acids. Toehold-dependent, nucleation-invasion models appear fully appropriate for describing such reactions. Estimating the stability of nucleation complexes formed at internal toeholds is the major hurdle for the quantitative prediction of hybridization rates. While analyzing the mechanisms of a fundamental biochemical process (hybridization), this work also provides suggestions for the improvement of technologies that rely on such process. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Diastereoselective DNA Cleavage Recognition by Ni(II)•Gly-Gly-His Derived Metallopeptides

    PubMed Central

    Fang, Ya-Yin; Claussen, Craig A.; Lipkowitz, Kenny B.; Long, Eric C.

    2008-01-01

    Site-selective DNA cleavage by diastereoisomers of Ni(II)•Gly-Gly-His-derived metallopeptides was investigated through high-resolution gel analyses and molecular dynamics simulations. Ni(II)•L-Arg-Gly-His and Ni(II)•D-Arg-Gly-His (and their respective Lys analogues) targeted A/T-rich regions; however, the L-isomers consistently modified a sub-set of available nucleotides within a given minor groove site while the D-isomers differed in both their sites of preference and ability to target individual nucleotides within some sites. In comparison, Ni(II)•L-Pro-Gly-His and Ni(II)•D-Pro-Gly-His were unable to exhibit a similar diastereoselectivity. Simulations of the above systems, along with Ni(II)•Gly-Gly-His, indicated that the stereochemistry of the amino-terminal amino acid produces either an isohelical metallopeptide that associates stably at individual DNA sites (L-Arg or L-Lys) or, with D-Arg and D-Lys, a non-complementary metallopeptide structure that cannot fully employ its side chain nor amino-terminal amine as a positional stabilizing moiety. In contrast, amino-terminal Pro-containing metallopeptides of either stereochemistry, lacking an extended side chain directed toward the minor groove, did not exhibit a similar diastereoselectivity. While the identity and stereochemistry of amino acids located in the amino-terminal peptide position influenced DNA cleavage, metallopeptide diastereoisomers containing L- and D-Arg (or Lys) within the second peptide position did not exhibit diastereoselective DNA cleavage patterns; simulations indicated that a positively-charged amino acid in this location alters the interaction of the metallopeptide equatorial plane and the minor groove leading to an interaction similar to Ni(II)•Gly-Gly-His. PMID:16522100

  20. TP53 regulates miRNA association with AGO2 to remodel the miRNA-mRNA interaction network.

    PubMed

    Krell, Jonathan; Stebbing, Justin; Carissimi, Claudia; Dabrowska, Aleksandra F; de Giorgio, Alexander; Frampton, Adam E; Harding, Victoria; Fulci, Valerio; Macino, Giuseppe; Colombo, Teresa; Castellano, Leandro

    2016-03-01

    DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis. © 2016 Krell et al.; Published by Cold Spring Harbor Laboratory Press.

  1. An aptamer-based bio-barcode assay with isothermal recombinase polymerase amplification for cytochrome-c detection and anti-cancer drug screening.

    PubMed

    Loo, Jacky F C; Lau, P M; Ho, H P; Kong, S K

    2013-10-15

    Based on a recently reported ultra-sensitive bio-barcode (BBC) assay, we have developed an aptamer-based bio-barcode (ABC) alternative to detect a cell death marker cytochrome-c (Cyto-c) and its subsequent application to screen anti-cancer drugs. Aptamer is a short single-stranded DNA selected from a synthetic DNA library by virtue of its high binding affinity and specificity to its target based on its unique 3D structure from the nucleotide sequence after folding. In the BBC assay, an antigen (Ag) in analytes is captured by a micro-magnetic particle (MMP) coated with capturing antibodies (Abs). Gold nanoparticles (NPs) with another recognition Ab against the same target and hundreds of identical DNA molecules of known sequence are subsequently added to allow the formation of sandwich structures ([MMP-Ab1]-Ag-[Ab2-NP-DNA]). After isolating the sandwiches by a magnetic field, the DNAs hybridized to their complementary DNAs covalently bound on the NPs are released from the sandwiches after heating. Acting as an Ag identification tag, these bio-barcode DNAs with known DNA sequence are then amplified by polymerase chain reaction (PCR) and detected by fluorescence. In our ABC assay, we employed a Cyto-c-specific aptamer to substitute both the recognition Ab and barcode DNAs on the NPs in the BBC assay; and a novel isothermal recombinase polymerase amplification for the time-consuming PCR. The detection limit of our ABC assay for the Cyto-c was found to be 10 ng/mL and this new assay can be completed within 3h. Several potential anti-cancer drugs have been tested in vitro for their efficacy to kill liver cancer with or without multi-drug resistance. © 2013 Elsevier B.V. All rights reserved.

  2. Studying Epigenetic DNA Modifications in Undergraduate Laboratories Using Complementary Bioinformatic and Molecular Approaches

    ERIC Educational Resources Information Center

    Militello, Kevin T.

    2013-01-01

    Epigenetic inheritance is the inheritance of genetic information that is not based on DNA sequence alone. One type of epigenetic information that has come to the forefront in the last few years is modified DNA bases. The most common modified DNA base in nature is 5-methylcytosine. Herein, we describe a laboratory experiment that combines…

  3. Electron transfer of plurimodified DNA SAMs.

    PubMed

    Rospigliosi, Alessandro; Ehlich, Rudolf; Hoerber, Heinrich; Middelberg, Anton; Moggridge, Geoff

    2007-07-17

    An STM-based current-voltage (I/V) investigation of deoxyribonucleic acid (DNA) 18 base pair (bp) oligonucleotide monolayers on gold is presented. Three bases of each of the immobilized and complementary strands were modified with either iodine or phenylethylene moieties. The oligonucleotides were immobilized on template stripped gold (tsg) surfaces and characterized by atomic force microscopy (AFM) and scanning tunneling microscopy (STM). AFM imaging showed that monolayers of the expected height were formed. A comparative study of normal, halogenated, and phenyl-modified DNA was made with the STM in tunneling spectroscopy (TS) mode. I/V spectroscopic measurements in the range +/-250 mV on both single- and double-stranded (ds) DNA monolayers (modified and unmodified) showed that for negative substrate bias (U(sub)) electron transfer is more efficient through a phenyl-modified monolayer than through normal or halogenated DNA. This effect was particularly clear below a threshold bias of -100 mV. For positive U(sub), unmodified ds DNA was found to conduct slightly better than the modified strands. This is presumably caused by greater order in the unmodified versus modified DNA monolayers. Modifications on the immobilized (thiolated) strand seem to improve electron transport through the DNA monolayer more than modifications on the complementary (not surface-bound) strand.

  4. Simulations Meet Experiment to Reveal New Insights into DNA Intrinsic Mechanics

    PubMed Central

    Ben Imeddourene, Akli; Elbahnsi, Ahmad; Guéroult, Marc; Oguey, Christophe; Foloppe, Nicolas; Hartmann, Brigitte

    2015-01-01

    The accurate prediction of the structure and dynamics of DNA remains a major challenge in computational biology due to the dearth of precise experimental information on DNA free in solution and limitations in the DNA force-fields underpinning the simulations. A new generation of force-fields has been developed to better represent the sequence-dependent B-DNA intrinsic mechanics, in particular with respect to the BI ↔ BII backbone equilibrium, which is essential to understand the B-DNA properties. Here, the performance of MD simulations with the newly updated force-fields Parmbsc0εζOLI and CHARMM36 was tested against a large ensemble of recent NMR data collected on four DNA dodecamers involved in nucleosome positioning. We find impressive progress towards a coherent, realistic representation of B-DNA in solution, despite residual shortcomings. This improved representation allows new and deeper interpretation of the experimental observables, including regarding the behavior of facing phosphate groups in complementary dinucleotides, and their modulation by the sequence. It also provides the opportunity to extensively revisit and refine the coupling between backbone states and inter base pair parameters, which emerges as a common theme across all the complementary dinucleotides. In sum, the global agreement between simulations and experiment reveals new aspects of intrinsic DNA mechanics, a key component of DNA-protein recognition. PMID:26657165

  5. Effects of Complementary DNA and Salt on the Thermoresponsiveness of Poly(N-isopropylacrylamide)-b-DNA.

    PubMed

    Fujita, Masahiro; Hiramine, Hayato; Pan, Pengju; Hikima, Takaaki; Maeda, Mizuo

    2016-02-02

    The thermoresponsive structural transition of poly(N-isopropylacrylamide) (PNIPAAm)-b-DNA copolymers was explored. Molecular assembly of the block copolymers was facilitated by adding salt, and this assembly was not nucleated by the association between DNA strands but by the coil-globule transition of PNIPAAm blocks. Below the lower critical solution temperature (LCST) of PNIPAAm, the copolymer solution remained transparent even at high salt concentrations, regardless of whether DNA was hybridized with its complementary partner to form a double-strand (or single-strand) structure. At the LCST, the hybridized copolymer assembled in spherical nanoparticles, surrounded by double-stranded DNA; subsequently, the non-cross-linking aggregation occurred, while the nanoparticles were dispersed if the salt concentration was low or DNA blocks were unhybridized. When the DNA duplex was denatured to a single-stranded state by heating, the aggregated nanoparticles redispersed owing to the recovery of the steric repulsion of the DNA strands. The changes in the steric and electrostatic effects by hybridization and the addition of salt did not result in any specific attraction between DNA strands but merely decreased the repulsive interactions. The van der Waals attraction between the nanoparticles overcame such repulsive interactions so that the non-cross-linking aggregation of the micellar particles was mediated.

  6. Detection of Non-Nucleic Acid Targets with an Unmodified Aptamer and a Fluorogenic Competitor

    PubMed Central

    Li, Na

    2010-01-01

    Aptamers are oligonucleotides that can bind to various non-nucleic acid targets, ranging from proteins to small molecules, with a specificity and affinity comparable to that of antibodies. Most aptamer-based detection strategies require modification on the aptamer, which could lead to a significant loss in its affinity and specificity to the target. Here we reported a generic strategy to design aptamer-based optical probes. An unmodified aptamer specific to the target and a fluorogenic competitor complementary to the aptamer are utilized for target recognition and signal generation, respectively. The competitor is a hairpin oligonucleotide with a fluorophore attached on one end and a quencher attached on the other. When no target is present, the competitor binds to the aptamer. However, when the target is introduced, the competitor will be displaced from the aptamer by the target, thus resulting in a target-specific decrease in fluorescence signal. Successful application of this strategy to different types of targets (small molecules and proteins) as well as different types of aptamers (DNA and RNA) has been demonstrated. Furthermore, a thermodynamics-based prediction model was established to further rationalize the optimization process. Due to its rapidness and simplicity, this aptamer-based detection strategy holds great promise in high throughput applications. PMID:20563298

  7. Double stranded nucleic acid biochips

    DOEpatents

    Chernov, Boris; Golova, Julia

    2006-05-23

    This invention describes a new method of constructing double-stranded DNA (dsDNA) microarrays based on the use of pre-synthesized or natural DNA duplexes without a stem-loop structure. The complementary oligonucleotide chains are bonded together by a novel connector that includes a linker for immobilization on a matrix. A non-enzymatic method for synthesizing double-stranded nucleic acids with this novel connector enables the construction of inexpensive and robust dsDNA/dsRNA microarrays. DNA-DNA and DNA-protein interactions are investigated using the microarrays.

  8. Mass effect of redox reactions: A novel mode for surface plasmon resonance-based bioanalysis.

    PubMed

    Yuan, Pei-Xin; Deng, Sheng-Yuan; Xin, Peng; Ji, Xu-Bo; Shan, Dan; Cosnier, Serge

    2015-12-15

    The pursuit of more specific and sensitive response is a perpetual goal for modern bioassays. This work proposed a novel label-free strategy about redox-related mass effect based on the surface plasmon resonance (SPR) technique for ultrasensitive determination of DNA. The protocol starts with the modification of SPR gilded disk with the capture DNA (cDNA). After the conjugation of immobilized cDNA with the target DNA (tDNA), the hybridization chain reaction was triggered by the introduction of mutual partial complementary primers to elongate the terminal into a nanoscale duplex. As it is reported that porphyrin could intercalate into the grooves of the double-stranded DNA (dsDNA) scaffold, multiple positive-charged Fe(III)meso-tetra(N-methyl-4-pyridyl) porphine (FeTMPyP) with symmetric structure were uptaken for in situ formation of porphyrin-dsDNA complex. Given FeTMPyP a highly efficient catalysis for the peroxide reduction, its presence as a biomimetic cofactor was validated via circular dichroism and UV-vis spectroscopy, demonstrating a tight binding as well as high catalytic activity and stability. Using 4-chloro-1-naphthol as a proton donor, the catalytic reduction of H2O2 would oxidize it into insoluble benzo-4-chloro-hexadienone, which simultaneously deposited on the heterogeneous interface, leading to a significant amplification in both SPR response and topological height profile. The signal increment was proportional to the concentration of tDNA, thus an ultrasensitive SPR-based DNA assay was developed with a linear range over four orders of magnitudes and a sub-femtomolar detection limit of 0.73 fM. The developed methodology exemplifies a different way of thinking about mass-sensing modes, extending conventional SPR-based DNA analysis to relevant biomedical applications. Copyright © 2015 Elsevier B.V. All rights reserved.

  9. Potential of mean force of DNA guided assemblies past Debye-Hückel regime

    NASA Astrophysics Data System (ADS)

    Girard, Martin; Seo, Soyoung; Li, Yaohua; Mirkin, Chad; Olvera de La Cruz, Monica

    Many of the bioinspired systems make use of biopolymers such as polypeptides or DNA. The latter is widely used in self-assembled systems, from colloidal crystals to origami construction. In these systems, salt is commonly required to screen the electrostatic repulsion between the strands. In the classical Debye-Hückel picture, salt ions are point particles and the screening distance is a decreasing monotonic function of salt concentration. This picture breaks down at moderate salt concentrations, where the behavior becomes non-monotonic. In this talk, we will show results for potential of mean force of DNA grafted colloids obtained through multiscale molecular dynamics. In this picture, the highly charged DNA causes non-trivial behavior at moderate salt concentrations (c 0 . 3 - 0 . 7 M), namely increase of repulsion for non-complementary DNA strands while repulsion decreases for complementary strands. We will show spatial cluster distribution as function of size and charge as well as implications for experimental systems.

  10. DNA–DNA kissing complexes as a new tool for the assembly of DNA nanostructures

    PubMed Central

    Barth, Anna; Kobbe, Daniela; Focke, Manfred

    2016-01-01

    Kissing-loop annealing of nucleic acids occurs in nature in several viruses and in prokaryotic replication, among other circumstances. Nucleobases of two nucleic acid strands (loops) interact with each other, although the two strands cannot wrap around each other completely because of the adjacent double-stranded regions (stems). In this study, we exploited DNA kissing-loop interaction for nanotechnological application. We functionalized the vertices of DNA tetrahedrons with DNA stem-loop sequences. The complementary loop sequence design allowed the hybridization of different tetrahedrons via kissing-loop interaction, which might be further exploited for nanotechnology applications like cargo transport and logical elements. Importantly, we were able to manipulate the stability of those kissing-loop complexes based on the choice and concentration of cations, the temperature and the number of complementary loops per tetrahedron either at the same or at different vertices. Moreover, variations in loop sequences allowed the characterization of necessary sequences within the loop as well as additional stability control of the kissing complexes. Therefore, the properties of the presented nanostructures make them an important tool for DNA nanotechnology. PMID:26773051

  11. An Integrated Analysis of miRNA and mRNA Expressions in Non-Small Cell Lung Cancers

    PubMed Central

    Ma, Lina; Huang, Yanyan; Zhu, Wangyu; Zhou, Shiquan; Zhou, Jihang; Zeng, Fang; Liu, Xiaoguang; Zhang, Yongkui; Yu, Jun

    2011-01-01

    Using DNA microarrays, we generated both mRNA and miRNA expression data from 6 non-small cell lung cancer (NSCLC) tissues and their matching normal control from adjacent tissues to identify potential miRNA markers for diagnostics. We demonstrated that hsa-miR-96 is significantly and consistently up-regulated in all 6 NSCLCs. We validated this result in an independent set of 35 paired tumors and their adjacent normal tissues, as well as their sera that are collected before surgical resection or chemotherapy, and the results suggested that hsa-miR-96 may play an important role in NSCLC development and has great potential to be used as a noninvasive marker for diagnosing NSCLC. We predicted potential miRNA target mRNAs based on different methods (TargetScan and miRanda). Further classification of miRNA regulated genes based on their relationship with miRNAs revealed that hsa-miR-96 and certain other miRNAs tend to down-regulate their target mRNAs in NSCLC development, which have expression levels permissive to direct interaction between miRNAs and their target mRNAs. In addition, we identified a significant correlation of miRNA regulation with genes coincide with high density of CpG islands, which suggests that miRNA may represent a primary regulatory mechanism governing basic cellular functions and cell differentiations, and such mechanism may be complementary to DNA methylation in repressing or activating gene expression. PMID:22046296

  12. Single-Step Incubation Determination of miRNAs in Cancer Cells Using an Amperometric Biosensor Based on Competitive Hybridization onto Magnetic Beads.

    PubMed

    Vargas, Eva; Povedano, Eloy; Montiel, Víctor Ruiz-Valdepeñas; Torrente-Rodríguez, Rebeca M; Zouari, Mohamed; Montoya, Juan José; Raouafi, Noureddine; Campuzano, Susana; Pingarrón, José M

    2018-03-15

    This work reports an amperometric biosensor for the determination of miRNA-21, a relevant oncogene. The methodology involves a competitive DNA-target miRNA hybridization assay performed on the surface of magnetic microbeads (MBs) and amperometric transduction at screen-printed carbon electrodes (SPCEs). The target miRNA competes with a synthetic fluorescein isothiocyanate (FITC)-modified miRNA with an identical sequence for hybridization with a biotinylated and complementary DNA probe (b-Cp) immobilized on the surface of streptavidin-modified MBs (b-Cp-MBs). Upon labeling, the FITC-modified miRNA attached to the MBs with horseradish peroxidase (HRP)-conjugated anti-FITC Fab fragments and magnetic capturing of the MBs onto the working electrode surface of SPCEs. The cathodic current measured at -0.20 V (versus the Ag pseudo-reference electrode) was demonstrated to be inversely proportional to the concentration of the target miRNA. This convenient biosensing method provided a linear range between 0.7 and 10.0 nM and a limit of detection (LOD) of 0.2 nM (5 fmol in 25 μL of sample) for the synthetic target miRNA without any amplification step. An acceptable selectivity towards single-base mismatched oligonucleotides, a high storage stability of the b-Cp-MBs, and usefulness for the accurate determination of miRNA-21 in raw total RNA (RNA t ) extracted from breast cancer cells (MCF-7) were demonstrated.

  13. Detection of single-nucleotide polymorphisms using an ON-OFF switching of regenerated biosensor based on a locked nucleic acid-integrated and toehold-mediated strand displacement reaction.

    PubMed

    Gao, Zhong Feng; Ling, Yu; Lu, Lu; Chen, Ning Yu; Luo, Hong Qun; Li, Nian Bing

    2014-03-04

    Although various strategies have been reported for single-nucleotide polymorphisms (SNPs) detection, development of a time-saving, specific, and regenerated electrochemical sensing platform still remains a realistic goal. In this study, an ON-OFF switching of a regenerated biosensor based on a locked nucleic acid (LNA)-integrated and toehold-mediated strand displacement reaction technique is constructed for detection of SNPs. The LNA-integrated and methylene blue-labeled capture probe with an external toehold is designed to switch on the sensing system. The mutant-type DNA probe completes complementary with the capture probe to trigger the strand displacement reaction, which switches off the sensing system. However, when the single-base mismatched wild-type DNA probe is presented, the strand displacement reaction cannot be achieved; therefore, the sensing system still keeps the ON state. This DNA sensor is stable over five reuses. We further testify that the LNA-integrated sequence has better recognition ability for SNPs detection compared to the DNA-integrated sequence. Moreover, this DNA senor exhibits a remarkable discrimination capability of SNPs among abundant wild-type targets and 6000-fold (m/m) excess of genomic DNA. In addition, it is selective enough in complex and contaminant-ridden samples, such as human urine, soil, saliva, and beer. Overall, these results demonstrate that this reliable DNA sensor is easy to be fabricated, simple to operate, and stable enough to be readily regenerated.

  14. A silicon carbide nanowire field effect transistor for DNA detection

    NASA Astrophysics Data System (ADS)

    Fradetal, L.; Bano, E.; Attolini, G.; Rossi, F.; Stambouli, V.

    2016-06-01

    This work reports on the label-free electrical detection of DNA molecules for the first time, using silicon carbide (SiC) as a novel material for the realization of nanowire field effect transistors (NWFETs). SiC is a promising semiconductor for this application due to its specific characteristics such as chemical inertness and biocompatibility. Non-intentionally n-doped SiC NWs are first grown using a bottom-up vapor-liquid-solid (VLS) mechanism, leading to the NWs exhibiting needle-shaped morphology, with a length of approximately 2 μm and a diameter ranging from 25 to 60 nm. Then, the SiC NWFETs are fabricated and functionalized with DNA molecule probes via covalent coupling using an amino-terminated organosilane. The drain current versus drain voltage (I d-V d) characteristics obtained after the DNA grafting and hybridization are reported from the comparative and simultaneous measurements carried out on the SiC NWFETs, used either as sensors or references. As a representative result, the current of the sensor is lowered by 22% after probe DNA grafting and by 7% after target DNA hybridization, while the current of the reference does not vary by more than ±0.6%. The current decrease confirms the field effect induced by the negative charges of the DNA molecules. Moreover, the selectivity, reproducibility, reversibility and stability of the studied devices are emphasized by de-hybridization, non-complementary hybridization and re-hybridization experiments. This first proof of concept opens the way for future developments using SiC-NW-based sensors.

  15. DNA-mediated nanoparticle crystallization into Wulff polyhedra

    NASA Astrophysics Data System (ADS)

    Auyeung, Evelyn; Li, Ting I. N. G.; Senesi, Andrew J.; Schmucker, Abrin L.; Pals, Bridget C.; de La Cruz, Monica Olvera; Mirkin, Chad A.

    2014-01-01

    Crystallization is a fundamental and ubiquitous process much studied over the centuries. But although the crystallization of atoms is fairly well understood, it remains challenging to predict reliably the outcome of molecular crystallization processes that are complicated by various molecular interactions and solvent involvement. This difficulty also applies to nanoparticles: high-quality three-dimensional crystals are mostly produced using drying and sedimentation techniques that are often impossible to rationalize and control to give a desired crystal symmetry, lattice spacing and habit (crystal shape). In principle, DNA-mediated assembly of nanoparticles offers an ideal opportunity for studying nanoparticle crystallization: a well-defined set of rules have been developed to target desired lattice symmetries and lattice constants, and the occurrence of features such as grain boundaries and twinning in DNA superlattices and traditional crystals comprised of molecular or atomic building blocks suggests that similar principles govern their crystallization. But the presence of charged biomolecules, interparticle spacings of tens of nanometres, and the realization so far of only polycrystalline DNA-interconnected nanoparticle superlattices, all suggest that DNA-guided crystallization may differ from traditional crystal growth. Here we show that very slow cooling, over several days, of solutions of complementary-DNA-modified nanoparticles through the melting temperature of the system gives the thermodynamic product with a specific and uniform crystal habit. We find that our nanoparticle assemblies have the Wulff equilibrium crystal structure that is predicted from theoretical considerations and molecular dynamics simulations, thus establishing that DNA hybridization can direct nanoparticle assembly along a pathway that mimics atomic crystallization.

  16. On-chip transduction of nucleic acid hybridization using spatial profiles of immobilized quantum dots and fluorescence resonance energy transfer.

    PubMed

    Tavares, Anthony J; Noor, M Omair; Vannoy, Charles H; Algar, W Russ; Krull, Ulrich J

    2012-01-03

    The glass surface of a glass-polydimethylsiloxane (PDMS) microfluidic channel was modified to develop a solid-phase assay for quantitative determination of nucleic acids. Electroosmotic flow (EOF) within channels was used to deliver and immobilize semiconductor quantum dots (QDs), and electrophoresis was used to decorate the QDs with oligonucleotide probe sequences. These processes took only minutes to complete. The QDs served as energy donors in fluorescence resonance energy transfer (FRET) for transduction of nucleic acid hybridization. Electrokinetic injection of fluorescent dye (Cy3) labeled oligonucleotide target into a microfluidic channel and subsequent hybridization (within minutes) provided the proximity for FRET, with emission from Cy3 being the analytical signal. The quantification of target concentration was achieved by measurement of the spatial length of coverage by target along a channel. Detection of femtomole quantities of target was possible with a dynamic range spanning an order of magnitude. The assay provided excellent resistance to nonspecific interactions of DNA. Further selectivity of the assay was achieved using 20% formamide, which allowed discrimination between a fully complementary target and a 3 base pair mismatch target at a contrast ratio of 4:1. © 2011 American Chemical Society

  17. Controlled assembly of artificial protein-protein complexes via DNA duplex formation.

    PubMed

    Płoskoń, Eliza; Wagner, Sara C; Ellington, Andrew D; Jewett, Michael C; O'Reilly, Rachel; Booth, Paula J

    2015-03-18

    DNA-protein conjugates have found a wide range of applications. This study demonstrates the formation of defined, non-native protein-protein complexes via the site specific labeling of two proteins of interest with complementary strands of single-stranded DNA in vitro. This study demonstrates that the affinity of two DNA-protein conjugates for one another may be tuned by the use of variable lengths of DNA allowing reversible control of complex formation.

  18. Submolecular Structure and Orientation of Oligonucleotide Duplexes Tethered to Gold Electrodes Probed by Infrared Reflection Absorption Spectroscopy: Effect of the Electrode Potentials.

    PubMed

    Kékedy-Nagy, László; Ferapontova, Elena E; Brand, Izabella

    2017-02-23

    Unique electronic and ligand recognition properties of the DNA double helix provide basis for DNA applications in biomolecular electronic and biosensor devices. However, the relation between the structure of DNA at electrified interfaces and its electronic properties is still not well understood. Here, potential-driven changes in the submolecular structure of DNA double helices composed of either adenine-thymine (dAdT) 25 or cytosine-guanine (dGdC) 20 base pairs tethered to the gold electrodes are for the first time analyzed by in situ polarization modulation infrared reflection absorption spectroscopy (PM IRRAS) performed under the electrochemical control. It is shown that the conformation of the DNA duplexes tethered to gold electrodes via the C 6 alkanethiol linker strongly depends on the nucleic acid sequence composition. The tilt of purine and pyrimidine rings of the complementary base pairs (dAdT and dGdC) depends on the potential applied to the electrode. By contrast, neither the conformation nor orientation of the ionic in character phosphate-sugar backbone is affected by the electrode potentials. At potentials more positive than the potential of zero charge (pzc), a gradual tilting of the double helix is observed. In this tilted orientation, the planes of the complementary purine and pyrimidine rings lie ideally parallel to each other. These potentials do not affect the integral stability of the DNA double helix at the charged interface. At potentials more negative than the pzc, DNA helices adopt a vertical to the gold surface orientation. Tilt of the purine and pyrimidine rings depends on the composition of the double helix. In monolayers composed of (dAdT) 25 molecules the rings of the complementary base pairs lie parallel to each other. By contrast, the tilt of purine and pyrimidine rings in (dGdC) 20 helices depends on the potential applied to the electrode. Such potential-induced mobility of the complementary base pairs can destabilize the helix structure at a submolecular level. These pioneer results on the potential-driven changes in the submolecular structure of double stranded DNA adsorbed on conductive supports contribute to further understanding of the potential-driven sequence-specific electronic properties of surface-tethered oligonucleotides.

  19. In vitro evaluation of phosphorothioate oligonucleotides targeted to the E2 mRNA of papillomavirus: potential treatment for genital warts.

    PubMed Central

    Cowsert, L M; Fox, M C; Zon, G; Mirabelli, C K

    1993-01-01

    Papillomaviruses induce benign proliferative lesions, such as genital warts, in humans. The E2 gene product is thought to play a major role in the regulation of viral transcription and DNA replication and may represent a rational target for an antisense oligonucleotide drug action. Phosphorothioate oligonucleotides complementary to E2 mRNAs were synthesized and tested in a series of in vitro bovine papillomavirus (BPV) and human papillomavirus (HPV) models for the ability to inhibit E2 transactivation and virus-induced focus formation. The most active BPV-specific compounds were complementary to the mRNA cap region (ISIS 1751), the translation initiation region for the full-length E2 transactivator (ISIS 1753), and the translation initiation region for the E2 transrepressor mRNA (ISIS 1755). ISIS 1751 and ISIS 1753 were found to reduce E2-dependent transactivation and viral focus formation in a sequence-specific and concentration-dependent manner. ISIS 1755 increased E2 transactivation in a dose-dependent manner but had no effect on focus formation. Oligonucleotides with a chain length of 20 residues had optimal activity in the E2 transactivation assay. On the basis of the above observations, ISIS 2105, a 20-residue phosphorothioate oligonucleotide targeted to the translation initiation of both HPV type 6 (HPV-6) and HPV-11 E2 mRNA, was designed and shown to inhibit E2-dependent transactivation by HPV-11 E2 expressed from a surrogate promoter. These observations support the rationale of E2 as a target for antiviral therapy against papillomavirus infections and specifically identify ISIS 2105 as a candidate antisense oligonucleotide for the treatment of genital warts induced by HPV-6 and HPV-11. Images PMID:8383937

  20. Identification of Human N-Myristoylated Proteins from Human Complementary DNA Resources by Cell-Free and Cellular Metabolic Labeling Analyses.

    PubMed

    Takamitsu, Emi; Otsuka, Motoaki; Haebara, Tatsuki; Yano, Manami; Matsuzaki, Kanako; Kobuchi, Hirotsugu; Moriya, Koko; Utsumi, Toshihiko

    2015-01-01

    To identify physiologically important human N-myristoylated proteins, 90 cDNA clones predicted to encode human N-myristoylated proteins were selected from a human cDNA resource (4,369 Kazusa ORFeome project human cDNA clones) by two bioinformatic N-myristoylation prediction systems, NMT-The MYR Predictor and Myristoylator. After database searches to exclude known human N-myristoylated proteins, 37 cDNA clones were selected as potential human N-myristoylated proteins. The susceptibility of these cDNA clones to protein N-myristoylation was first evaluated using fusion proteins in which the N-terminal ten amino acid residues were fused to an epitope-tagged model protein. Then, protein N-myristoylation of the gene products of full-length cDNAs was evaluated by metabolic labeling experiments both in an insect cell-free protein synthesis system and in transfected human cells. As a result, the products of 13 cDNA clones (FBXL7, PPM1B, SAMM50, PLEKHN, AIFM3, C22orf42, STK32A, FAM131C, DRICH1, MCC1, HID1, P2RX5, STK32B) were found to be human N-myristoylated proteins. Analysis of the role of protein N-myristoylation on the intracellular localization of SAMM50, a mitochondrial outer membrane protein, revealed that protein N-myristoylation was required for proper targeting of SAMM50 to mitochondria. Thus, the strategy used in this study is useful for the identification of physiologically important human N-myristoylated proteins from human cDNA resources.

  1. Identification of Human N-Myristoylated Proteins from Human Complementary DNA Resources by Cell-Free and Cellular Metabolic Labeling Analyses

    PubMed Central

    Takamitsu, Emi; Otsuka, Motoaki; Haebara, Tatsuki; Yano, Manami; Matsuzaki, Kanako; Kobuchi, Hirotsugu; Moriya, Koko; Utsumi, Toshihiko

    2015-01-01

    To identify physiologically important human N-myristoylated proteins, 90 cDNA clones predicted to encode human N-myristoylated proteins were selected from a human cDNA resource (4,369 Kazusa ORFeome project human cDNA clones) by two bioinformatic N-myristoylation prediction systems, NMT-The MYR Predictor and Myristoylator. After database searches to exclude known human N-myristoylated proteins, 37 cDNA clones were selected as potential human N-myristoylated proteins. The susceptibility of these cDNA clones to protein N-myristoylation was first evaluated using fusion proteins in which the N-terminal ten amino acid residues were fused to an epitope-tagged model protein. Then, protein N-myristoylation of the gene products of full-length cDNAs was evaluated by metabolic labeling experiments both in an insect cell-free protein synthesis system and in transfected human cells. As a result, the products of 13 cDNA clones (FBXL7, PPM1B, SAMM50, PLEKHN, AIFM3, C22orf42, STK32A, FAM131C, DRICH1, MCC1, HID1, P2RX5, STK32B) were found to be human N-myristoylated proteins. Analysis of the role of protein N-myristoylation on the intracellular localization of SAMM50, a mitochondrial outer membrane protein, revealed that protein N-myristoylation was required for proper targeting of SAMM50 to mitochondria. Thus, the strategy used in this study is useful for the identification of physiologically important human N-myristoylated proteins from human cDNA resources. PMID:26308446

  2. Development of a molecular diagnostic system to discriminate Dreissena polymorpha (zebra mussel) and Dreissena bugensis (quagga mussel)

    USGS Publications Warehouse

    Hoy, M.S.; Kelly, K.; Rodriguez, R.J.

    2010-01-01

    A 3-primer PCR system was developed to discriminate invasive zebra (Dreissena polymorpha) and quagga (Dreissena bugensis) mussel. The system is based on: 1) universal primers that amplifies a region of the nuclear 28s rDNA gene from both species and 2) a species-specific primer complementary to either zebra or quagga mussel. The species-specific primers bind to sequences between the binding sites for the universal primers resulting in the amplification of two products from the target species and one product from the nontarget species. Therefore, nontarget products are positive amplification controls. The 3-primer system accurately discriminated zebra and quagga mussels from seven geographically distinct populations.

  3. Large scale DNA microsequencing device

    DOEpatents

    Foote, Robert S.

    1997-01-01

    A microminiature sequencing apparatus and method provide means for simultaneously obtaining sequences of plural polynucleotide strands. The apparatus comprises a microchip into which plural channels have been etched using standard lithographic procedures and chemical wet etching. The channels include a reaction well and a separating section. Enclosing the channels is accomplished by bonding a transparent cover plate over the apparatus. A first oligonucleotide strand is chemically affixed to the apparatus through an alkyl chain. Subsequent nucleotides are selected by complementary base pair bonding. A target nucleotide strand is used to produce a family of labelled sequencing strands in each channel which are separated in the separating section. During or following separation the sequences are determined using appropriate detection means.

  4. Large scale DNA microsequencing device

    DOEpatents

    Foote, Robert S.

    1999-01-01

    A microminiature sequencing apparatus and method provide means for simultaneously obtaining sequences of plural polynucleotide strands. The apparatus comprises a microchip into which plural channels have been etched using standard lithographic procedures and chemical wet etching. The channels include a reaction well and a separating section. Enclosing the channels is accomplished by bonding a transparent cover plate over the apparatus. A first oligonucleotide strand is chemically affixed to the apparatus through an alkyl chain. Subsequent nucleotides are selected by complementary base pair bonding. A target nucleotide strand is used to produce a family of labelled sequencing strands in each channel which are separated in the separating section. During or following separation the sequences are determined using appropriate detection means.

  5. Large scale DNA microsequencing device

    DOEpatents

    Foote, R.S.

    1999-08-31

    A microminiature sequencing apparatus and method provide means for simultaneously obtaining sequences of plural polynucleotide strands. The apparatus comprises a microchip into which plural channels have been etched using standard lithographic procedures and chemical wet etching. The channels include a reaction well and a separating section. Enclosing the channels is accomplished by bonding a transparent cover plate over the apparatus. A first oligonucleotide strand is chemically affixed to the apparatus through an alkyl chain. Subsequent nucleotides are selected by complementary base pair bonding. A target nucleotide strand is used to produce a family of labelled sequencing strands in each channel which are separated in the separating section. During or following separation the sequences are determined using appropriate detection means. 11 figs.

  6. ACVP-05: Virus Genetic Analysis from Cell-Free Plasma, Virally Infected Cells or Tissues and Cultured Supernatant Via Single Genome Amplification and Direct Sequencing | Frederick National Laboratory for Cancer Research

    Cancer.gov

    The Viral Evolution Core within the AIDS and Cancer Virus Program will extract viral RNA/DNA from cell-free or cell-associated samples. Complementary (cDNA) will be generated as needed, and cDNA or DNA will be diluted to a single copy prior to nested

  7. What's in the box? Authentication of Echinacea herbal products using DNA metabarcoding and HPTLC.

    PubMed

    Raclariu, Ancuta Cristina; Ţebrencu, Carmen Elena; Ichim, Mihael Cristin; Ciupercǎ, Oana Teodora; Brysting, Anne Krag; de Boer, Hugo

    2018-05-15

    Differences in regulatory policies between countries as well as a lack of appropriate standardized methods for the authentication and quality control of herbal products directly impact their quality and safety. Echinacea products are among the top-selling herbal products in Europe and the United States with indications for a broad range of ailments. The increased use of Echinacea species has led to concerns about adulterated products resulting from challenges in morphology-based identification, due to overlapping morphological variation, frequent hybridization between species, and deliberate adulteration. This study addressed the need for a novel analytical strategy in the authentication of herbal products. A combination of high performance thin layer chromatography (HPTLC) and DNA metabarcoding was employed. Fifty-three Echinacea herbal products marketed across Europe were tested to evaluate the accuracy of these methods in plant identification and their potential for detecting substitutes, adulterants and other unreported plant constituents. HPTLC provides high resolution in the detection of Echinacea phytochemical target compounds, but does not offer information on the other species within the product. Alternatively, we showed that the limitation of HPTLC in detecting non-targeted species can be overcome by the complementary use of DNA metabarcoding. Using DNA metabarcoding, Echinacea species were detected in 34 out of the 38 retained products (89%), but with a lack of discriminatory resolution at the species level due to the low level of molecular divergence within the Echinacea genus. All of the tested herbal products showed considerable discrepancies between ingredients listed on the label and the ones detected using DNA metabarcoding, registering an overall ingredient fidelity of only 43%. The results confirm that DNA metabarcoding can be used to test for the presence of Echinacea species and simultaneously to detect other species present in even highly processed and multi-ingredient herbal products. Copyright © 2018 Elsevier GmbH. All rights reserved.

  8. HLA genotyping by next-generation sequencing of complementary DNA.

    PubMed

    Segawa, Hidenobu; Kukita, Yoji; Kato, Kikuya

    2017-11-28

    Genotyping of the human leucocyte antigen (HLA) is indispensable for various medical treatments. However, unambiguous genotyping is technically challenging due to high polymorphism of the corresponding genomic region. Next-generation sequencing is changing the landscape of genotyping. In addition to high throughput of data, its additional advantage is that DNA templates are derived from single molecules, which is a strong merit for the phasing problem. Although most currently developed technologies use genomic DNA, use of cDNA could enable genotyping with reduced costs in data production and analysis. We thus developed an HLA genotyping system based on next-generation sequencing of cDNA. Each HLA gene was divided into 3 or 4 target regions subjected to PCR amplification and subsequent sequencing with Ion Torrent PGM. The sequence data were then subjected to an automated analysis. The principle of the analysis was to construct candidate sequences generated from all possible combinations of variable bases and arrange them in decreasing order of the number of reads. Upon collecting candidate sequences from all target regions, 2 haplotypes were usually assigned. Cases not assigned 2 haplotypes were forwarded to 4 additional processes: selection of candidate sequences applying more stringent criteria, removal of artificial haplotypes, selection of candidate sequences with a relaxed threshold for sequence matching, and countermeasure for incomplete sequences in the HLA database. The genotyping system was evaluated using 30 samples; the overall accuracy was 97.0% at the field 3 level and 98.3% at the G group level. With one sample, genotyping of DPB1 was not completed due to short read size. We then developed a method for complete sequencing of individual molecules of the DPB1 gene, using the molecular barcode technology. The performance of the automatic genotyping system was comparable to that of systems developed in previous studies. Thus, next-generation sequencing of cDNA is a viable option for HLA genotyping.

  9. Functional DNA-containing nanomaterials: cellular applications in biosensing, imaging, and targeted therapy.

    PubMed

    Liang, Hao; Zhang, Xiao-Bing; Lv, Yifan; Gong, Liang; Wang, Ruowen; Zhu, Xiaoyan; Yang, Ronghua; Tan, Weihong

    2014-06-17

    CONSPECTUS: DNA performs a vital function as a carrier of genetic code, but in the field of nanotechnology, DNA molecules can catalyze chemical reactions in the cell, that is, DNAzymes, or bind with target-specific ligands, that is, aptamers. These functional DNAs with different modifications have been developed for sensing, imaging, and therapeutic systems. Thus, functional DNAs hold great promise for future applications in nanotechnology and bioanalysis. However, these functional DNAs face challenges, especially in the field of biomedicine. For example, functional DNAs typically require the use of cationic transfection reagents to realize cellular uptake. Such reagents enter the cells, increasing the difficulty of performing bioassays in vivo and potentially damaging the cell's nucleus. To address this obstacle, nanomaterials, such as metallic, carbon, silica, or magnetic materials, have been utilized as DNA carriers or assistants. In this Account, we describe selected examples of functional DNA-containing nanomaterials and their applications from our recent research and those of others. As models, we have chosen to highlight DNA/nanomaterial complexes consisting of gold nanoparticles, graphene oxides, and aptamer-micelles, and we illustrate the potential of such complexes in biosensing, imaging, and medical diagnostics. Under proper conditions, multiple ligand-receptor interactions, decreased steric hindrance, and increased surface roughness can be achieved from a high density of DNA that is bound to the surface of nanomaterials, resulting in a higher affinity for complementary DNA and other targets. In addition, this high density of DNA causes a high local salt concentration and negative charge density, which can prevent DNA degradation. For example, DNAzymes assembled on gold nanoparticles can effectively catalyze chemical reactions even in living cells. And it has been confirmed that DNA-nanomaterial complexes can enter cells more easily than free single-stranded DNA. Nanomaterials can be designed and synthesized in needed sizes and shapes, and they possess unique chemical and physical properties, which make them useful as DNA carriers or assistants, excellent signal reporters, transducers, and amplifiers. When nanomaterials are combined with functional DNAs to create novel assay platforms, highly sensitive biosensing and high-resolution imaging result. For example, gold nanoparticles and graphene oxides can quench fluorescence efficiently to achieve low background and effectively increase the signal-to-background ratio. Meanwhile, gold nanoparticles themselves can be colorimetric reporters because of their different optical absorptions between monodispersion and aggregation. DNA self-assembled nanomaterials contain several properties of both DNA and nanomaterials. Compared with DNA-nanomaterial complexes, DNA self-assembled nanomaterials more closely resemble living beings, and therefore they have lower cytotoxicity at high concentrations. Functional DNA self-assemblies also have high density of DNA for multivalent reaction and three-dimensional nanostructures for cell uptake. Now and in the future, we envision the use of DNA bases in making designer molecules for many challenging applications confronting chemists. With the further development of artificial DNA bases using smart organic synthesis, DNA macromolecules based on elegant molecular assembly approaches are expected to achieve great diversity, additional versatility, and advanced functions.

  10. Sensitive detection of porcine DNA in processed animal proteins using a TaqMan real-time PCR assay.

    PubMed

    Pegels, N; González, I; Fernández, S; García, T; Martín, R

    2012-01-01

    A TaqMan real-time PCR method was developed for specific detection of porcine-prohibited material in industrial feeds. The assay combines the use of a porcine-specific primer pair, which amplifies a 79 bp fragment of the mitochondrial (mt) 12 S rRNA gene, and a locked nucleic acid (LNA) TaqMan probe complementary to a target sequence lying between the porcine-specific primers. The nuclear 18 S rRNA gene system, yielding a 77 bp amplicon, was employed as a positive amplification control to monitor the total content of amplifiable DNA in the samples. The specificity of the porcine primers-probe system was verified against different animal and plant species, including mammals, birds and fish. The applicability of the real-time PCR protocol to detect the presence of porcine mt DNA in feeds was determined through the analysis of 190 industrial feeds (19 known reference and 171 blind samples) subjected to stringent processing treatments. The performance of the method allows qualitative and highly sensitive detection of short fragments from porcine DNA in all the industrial feeds declared to contain porcine material. Although the method has quantitative potential, the real quantitative capability of the assay is limited by the existing variability in terms of composition and processing conditions of the feeds, which affect the amount and quality of amplifiable DNA.

  11. Silicon Nanowires with High-k Hafnium Oxide Dielectrics for Sensitive Detection of Small Nucleic Acid Oligomers

    PubMed Central

    Dorvel, Brian R.; Reddy, Bobby; Go, Jonghyun; Guevara, Carlos Duarte; Salm, Eric; Alam, Muhammad Ashraful; Bashir, Rashid

    2012-01-01

    Nanobiosensors based on silicon nanowire field effect transistors offer advantages of low cost, label-free detection, and potential for massive parallelization. As a result, these sensors have often been suggested as an attractive option for applications in Point-of-care (POC) medical diagnostics. Unfortunately, a number of performance issues such as gate leakage and current instability due to fluid contact, have prevented widespread adoption of the technology for routine use. High-k dielectrics, such as hafnium oxide (HfO2), have the known ability to address these challenges by passivating the exposed surfaces against destabilizing concerns of ion transport. With these fundamental stability issues addressed, a promising target for POC diagnostics and SiNWFET’s has been small oligonucleotides, more specifically microRNA (miRNA). MicroRNA’s are small RNA oligonucleotides which bind to messenger RNA’s, causing translational repression of proteins, gene silencing, and expressions are typically altered in several forms of cancer. In this paper, we describe a process for fabricating stable HfO2 dielectric based silicon nanowires for biosensing applications. Here we demonstrate sensing of single stranded DNA analogues to their microRNA cousins using miR-10b and miR-21 as templates, both known to be upregulated in breast cancer. We characterize the effect of surface functionalization on device performance using the miR-10b DNA analogue as the target sequence and different molecular weight poly-l-lysine as the functionalization layer. By optimizing the surface functionalization and fabrication protocol, we were able to achieve <100fM detection levels of miR-10b DNA analogue, with a theoretical limit of detection of 1fM. Moreover, the non-complementary DNA target strand, based on miR-21, showed very little response, indicating a highly sensitive and highly selective biosensing platform. PMID:22695179

  12. F14512, a potent antitumor agent targeting topoisomerase II vectored into cancer cells via the polyamine transport system.

    PubMed

    Barret, Jean-Marc; Kruczynski, Anna; Vispé, Stéphane; Annereau, Jean-Philippe; Brel, Viviane; Guminski, Yves; Delcros, Jean-Guy; Lansiaux, Amélie; Guilbaud, Nicolas; Imbert, Thierry; Bailly, Christian

    2008-12-01

    The polyamine transport system (PTS) is an energy-dependent machinery frequently overactivated in cancer cells with a high demand for polyamines. We have exploited the PTS to selectively deliver a polyamine-containing drug to cancer cells. F14512 combines an epipodophyllotoxin core-targeting topoisomerase II with a spermine moiety introduced as a cell delivery vector. The polyamine tail supports three complementary functions: (a) facilitate formulation of a water-soluble compound, (b) increase DNA binding to reinforce topoisomerase II inhibition, and (c) facilitate selective uptake by tumor cells via the PTS. F14512 is 73-fold more cytotoxic to Chinese hamster ovary cells compared with CHO-MG cells with a reduced PTS activity. A decreased sensitivity of L1210 leukemia cells to F14512 was observed in the presence of putrescine, spermidine, and spermine. In parallel, the spermine moiety considerably enhances the drug-DNA interaction, leading to a reinforced inhibition of topoisomerase II. The spermine tail of F14512 serves as a cell delivery vehicle as well as a DNA anchor, and this property translates at the cellular level into a distinct pharmacologic profile. Twenty-nine human solid or hematologic cell lines were used to characterize the high cytotoxic potential of F14512 (median IC50 of 0.18 micromol/L). Finally, the potent antitumor activity of F14512 in vivo was evidenced with a MX1 human breast tumor xenograft model, with partial and complete tumor regressions. This work supports the clinical development of F14512 as a novel targeted cytotoxic drug and sheds light on the concept of selective delivery of drugs to tumor cells expressing the PTS.

  13. Kit for detecting nucleic acid sequences using competitive hybridization probes

    DOEpatents

    Lucas, Joe N.; Straume, Tore; Bogen, Kenneth T.

    2001-01-01

    A kit is provided for detecting a target nucleic acid sequence in a sample, the kit comprising: a first hybridization probe which includes a nucleic acid sequence that is sufficiently complementary to selectively hybridize to a first portion of the target sequence, the first hybridization probe including a first complexing agent for forming a binding pair with a second complexing agent; and a second hybridization probe which includes a nucleic acid sequence that is sufficiently complementary to selectively hybridize to a second portion of the target sequence to which the first hybridization probe does not selectively hybridize, the second hybridization probe including a detectable marker; a third hybridization probe which includes a nucleic acid sequence that is sufficiently complementary to selectively hybridize to a first portion of the target sequence, the third hybridization probe including the same detectable marker as the second hybridization probe; and a fourth hybridization probe which includes a nucleic acid sequence that is sufficiently complementary to selectively hybridize to a second portion of the target sequence to which the third hybridization probe does not selectively hybridize, the fourth hybridization probe including the first complexing agent for forming a binding pair with the second complexing agent; wherein the first and second hybridization probes are capable of simultaneously hybridizing to the target sequence and the third and fourth hybridization probes are capable of simultaneously hybridizing to the target sequence, the detectable marker is not present on the first or fourth hybridization probes and the first, second, third, and fourth hybridization probes each include a competitive nucleic acid sequence which is sufficiently complementary to a third portion of the target sequence that the competitive sequences of the first, second, third, and fourth hybridization probes compete with each other to hybridize to the third portion of the target sequence.

  14. DETECTION OF DNA DAMAGE USING A FIBEROPTIC BIOSENSOR

    EPA Science Inventory

    A rapid and sensitive fiber optic biosensor assay for radiation-induced DNA damage is reported. For this assay, a biotin-labeled capture oligonucleotide (38 mer) was immobilized to an avidin-coated quartz fiber. Hybridization of a dye-labeled complementary sequence was observed...

  15. Real-time and label-free ring-resonator monitoring of solid-phase recombinase polymerase amplification.

    PubMed

    Sabaté Del Río, Jonathan; Steylaerts, Tim; Henry, Olivier Y F; Bienstman, Peter; Stakenborg, Tim; Van Roy, Wim; O'Sullivan, Ciara K

    2015-11-15

    In this work we present the use of a silicon-on-insulator (SOI) chip featuring an array of 64 optical ring resonators used as refractive index sensors for real-time and label-free DNA detection. Single ring functionalisation was achieved using a click reaction after precise nanolitre spotting of specific hexynyl-terminated DNA capture probes to link to an azido-silanised chip surface. To demonstrate detectability using the ring resonators and to optimise conditions for solid-phase amplification, hybridisation between short 25-mer single stranded DNA (ssDNA) fragments and a complementary capture probe immobilised on the surface of the ring resonators was carried out and detected through the shift in the resonant wavelength. Using the optimised conditions demonstrated via the solid-phase hybridisation, a 144-bp double stranded DNA (dsDNA) was then detected directly using recombinase and polymerase proteins through on-chip target amplification and solid-phase elongation of immobilised forward primers on specific rings, at a constant temperature of 37°C and in less than 60min, achieving a limit of detection of 7.8·10(-13)M (6·10(5) copies in 50µL). The use of an automatic liquid handler injection instrument connected to an integrated resealable chip interface (RCI) allowed programmable multiple injection protocols. Air plugs between different solutions were introduced to prevent intermixing and a proportional-integral-derivative (PID) temperature controller minimised temperature based drifts. Published by Elsevier B.V.

  16. Synthesis and binding properties of new selective ligands for the nucleobase opposite the AP site.

    PubMed

    Abe, Yukiko; Nakagawa, Osamu; Yamaguchi, Rie; Sasaki, Shigeki

    2012-06-01

    DNA is continuously damaged by endogenous and exogenous factors such as oxidative stress or DNA alkylating agents. These damaged nucleobases are removed by DNA N-glycosylase and form apurinic/apyrimidinic sites (AP sites) as intermediates in the base excision repair (BER) pathway. AP sites are also representative DNA damages formed by spontaneous hydrolysis. The AP sites block DNA polymerase and a mismatch nucleobase is inserted opposite the AP sites by polymerization to cause acute toxicities and mutations. Thus, AP site specific compounds have attracted much attention for therapeutic and diagnostic purposes. In this study, we have developed nucleobase-polyamine conjugates as the AP site binding ligand by expecting that the nucleobase part would play a role in the specific recognition of the nucleobase opposite the AP site by the Watson-Crick base pair formation and that the polyamine part should contribute to the access of the ligand to the AP site by a non-specific interaction to the DNA phosphate backbone. The nucleobase conjugated with 3,3'-diaminodipropylamine (A-ligand, G-ligand, C-ligand, T-ligand and U-ligand) showed a specific stabilization of the duplex containing the AP site depending on the complementary combination with the nucleobase opposite the AP site; that is A-ligand to T, G-ligand to C, C-ligand to G, T- and U-ligand to A. The thermodynamic binding parameters clearly indicated that the specific stabilization is due to specific binding of the ligands to the complementary AP site. These results have suggested that the complementary base pairs of the Watson-Crick type are formed at the AP site. Copyright © 2012 Elsevier Ltd. All rights reserved.

  17. Step-gate polysilicon nanowires field effect transistor compatible with CMOS technology for label-free DNA biosensor.

    PubMed

    Wenga, G; Jacques, E; Salaün, A-C; Rogel, R; Pichon, L; Geneste, F

    2013-02-15

    Currently, detection of DNA hybridization using fluorescence-based detection technique requires expensive optical systems and complex bioinformatics tools. Hence, the development of new low cost devices that enable direct and highly sensitive detection stimulates a lot of research efforts. Particularly, devices based on silicon nanowires are emerging as ultrasensitive electrical sensors for the direct detection of biological species thanks to their high surface to volume ratio. In this study, we propose innovative devices using step-gate polycrystalline silicon nanowire FET (poly-Si NW FETs), achieved with simple and low cost fabrication process, and used as ultrasensitive electronic sensor for DNA hybridization. The poly-SiNWs are synthesized using the sidewall spacer formation technique. The detailed fabrication procedure for a step-gate NWFET sensor is described in this paper. No-complementary and complementary DNA sequences were clearly discriminated and detection limit to 1 fM range is observed. This first result using this nano-device is promising for the development of low cost and ultrasensitive polysilicon nanowires based DNA sensors compatible with the CMOS technology. Copyright © 2012 Elsevier B.V. All rights reserved.

  18. The construction and partial characterization of plasmids containing complementary DNA sequences to human calcitonin precursor polyprotein.

    PubMed Central

    Allison, J; Hall, L; MacIntyre, I; Craig, R K

    1981-01-01

    (1) Total poly(A)-containing RNA isolated from human thyroid medullary carcinoma tissue was shown to direct the synthesis in the wheat germ cell-free system of a major (Mr 21000) and several minor forms of human calcitonin precursor polyproteins. Evidence for processing of these precursor(s) by the wheat germ cell-free system is also presented. (2) A small complementary DNA (cDNA) plasmid library has been constructed in the PstI site of the plasmid pAT153, using total human thyroid medullary carcinoma poly(A)-containing RNA as the starting material. (3) Plasmids containing abundant cDNA sequences were selected by hybridization in situ, and two of these (ph T-B3 and phT-B6) were characterized by hybridization--translation and restriction analysis. Each was shown to contain human calcitonin precursor polyprotein cDNA sequences. (4) RNA blotting techniques demonstrate that the human calcitonin precursor polyprotein is encoded within a mRNA containing 1000 bases. (5) The results demonstrate that human calcitonin is synthesized as a precursor polyprotein. Images Fig. 1. Fig. 2. Fig. 3. PMID:6896146

  19. Requirement for XLF/Cernunnos in alignment-based gap filling by DNA polymerases lambda and mu for nonhomologous end joining in human whole-cell extracts.

    PubMed

    Akopiants, Konstantin; Zhou, Rui-Zhe; Mohapatra, Susovan; Valerie, Kristoffer; Lees-Miller, Susan P; Lee, Kyung-Jong; Chen, David J; Revy, Patrick; de Villartay, Jean-Pierre; Povirk, Lawrence F

    2009-07-01

    XLF/Cernunnos is a core protein of the nonhomologous end-joining pathway of DNA double-strand break repair. To better define the role of Cernunnos in end joining, whole-cell extracts were prepared from Cernunnos-deficient human cells. These extracts effected little joining of DNA ends with cohesive 5' or 3' overhangs, and no joining at all of partially complementary 3' overhangs that required gap filling prior to ligation. Assays in which gap-filled but unligated intermediates were trapped using dideoxynucleotides revealed that there was no gap filling on aligned DSB ends in the Cernunnos-deficient extracts. Recombinant Cernunnos protein restored gap filling and end joining of partially complementary overhangs, and stimulated joining of cohesive ends more than twentyfold. XLF-dependent gap filling was nearly eliminated by immunodepletion of DNA polymerase lambda, but was restored by addition of either polymerase lambda or polymerase mu. Thus, Cernunnos is essential for gap filling by either polymerase during nonhomologous end joining, suggesting that it plays a major role in aligning the two DNA ends in the repair complex.

  20. CRISPR-Cas systems: Prokaryotes upgrade to adaptive immunity.

    PubMed

    Barrangou, Rodolphe; Marraffini, Luciano A

    2014-04-24

    Clustered regularly interspaced short palindromic repeats (CRISPR), and associated proteins (Cas) comprise the CRISPR-Cas system, which confers adaptive immunity against exogenic elements in many bacteria and most archaea. CRISPR-mediated immunization occurs through the uptake of DNA from invasive genetic elements such as plasmids and viruses, followed by its integration into CRISPR loci. These loci are subsequently transcribed and processed into small interfering RNAs that guide nucleases for specific cleavage of complementary sequences. Conceptually, CRISPR-Cas shares functional features with the mammalian adaptive immune system, while also exhibiting characteristics of Lamarckian evolution. Because immune markers spliced from exogenous agents are integrated iteratively in CRISPR loci, they constitute a genetic record of vaccination events and reflect environmental conditions and changes over time. Cas endonucleases, which can be reprogrammed by small guide RNAs have shown unprecedented potential and flexibility for genome editing and can be repurposed for numerous DNA targeting applications including transcriptional control. Copyright © 2014 Elsevier Inc. All rights reserved.

  1. Trypanosomatidae: a spliced-leader-derived probe specific for the genus Phytomonas.

    PubMed

    Teixeira, M M; Serrano, M G; Nunes, L R; Campaner, M; Buck, G A; Camargo, E P

    1996-12-01

    We probed DNA from all trypanosomatid genera by slot blot hybridization with an oligonucleotide (SL3') complementary to a sequence of the Phytomonas spliced-leader or mini-exon RNA. The 19-nucleotide probe target site was previously shown to be highly conserved among a limited number of Phytomonas isolates, but diverges in other kinetoplastid genera. Our examination of 84 isolates of various genera of trypanosomatids showed hybridization of this probe exclusively with isolates from plants or insects which could, by morphological, biochemical, and molecular criteria, be considered to belong to the genus Phytomonas. In contrast, no hybridization was observed with flagellates of the genera Blastocrithidia, Crithidia, Endotrypanum, Herpetomonas, Leptomonas, Leishmania, and Trypanosoma. The method detected DNA quantities as low as 50 ng using either radioactive or nonradioactive probes, and was effective with as few as 10(4) intact flagellates. Together, these results suggest that this probe will serve as a convenient marker for taxonomic and epidemiological studies requiring reliable identification of Phytomonas spp. in plants or in putative insect vectors.

  2. Human placental lactogen mRNA and its structural genes during pregnancy: quantitation with a complementary DNA.

    PubMed Central

    McWilliams, D; Callahan, R C; Boime, I

    1977-01-01

    A complementary DNA (cDNA) strand was transcribed from human placental lactogen (hPL) mRNA. Based on alkaline sucrose gradient centrifugation, the size of the cDNA was about 8 S, which would represent at least 80% of the hPL mRNA. Previously we showed that four to five times more hPL was synthesized in cell-free extracts derived from term as compared to first trimester placentas. Hybridization of the cDNA with RNA derived from placental tissue revealed that there was about four times more hPL mRNA sequences in total RNA from term placenta than in a comparable quantity of total first trimester RNA. Only background hybridization was observed when the cDNA was incubated with RNA prepared from human kidney. To test if this differential accumulation of hPL mRNA was the result of an amplification of hPL genes, we hybridized the labeled cDNA with cellular DNA from first trimester and term placentas and with DNA isolated from human brain. In all cases, the amount of hPL sequences was approximately two copies per haploid genome. Thus, the enhanced synthesis of hPL mRNA appears to result from a transcriptional activation rather than an amplification of the hPL gene. The increase likely reflects placental differentiation in which the proportion of syncytial trophoblast increases at term. Images PMID:66681

  3. Functional DNA-Containing Nanomaterials: Cellular Applications in Biosensing, Imaging, and Targeted Therapy

    PubMed Central

    2015-01-01

    Conspectus DNA performs a vital function as a carrier of genetic code, but in the field of nanotechnology, DNA molecules can catalyze chemical reactions in the cell, that is, DNAzymes, or bind with target-specific ligands, that is, aptamers. These functional DNAs with different modifications have been developed for sensing, imaging, and therapeutic systems. Thus, functional DNAs hold great promise for future applications in nanotechnology and bioanalysis. However, these functional DNAs face challenges, especially in the field of biomedicine. For example, functional DNAs typically require the use of cationic transfection reagents to realize cellular uptake. Such reagents enter the cells, increasing the difficulty of performing bioassays in vivo and potentially damaging the cell’s nucleus. To address this obstacle, nanomaterials, such as metallic, carbon, silica, or magnetic materials, have been utilized as DNA carriers or assistants. In this Account, we describe selected examples of functional DNA-containing nanomaterials and their applications from our recent research and those of others. As models, we have chosen to highlight DNA/nanomaterial complexes consisting of gold nanoparticles, graphene oxides, and aptamer–micelles, and we illustrate the potential of such complexes in biosensing, imaging, and medical diagnostics. Under proper conditions, multiple ligand–receptor interactions, decreased steric hindrance, and increased surface roughness can be achieved from a high density of DNA that is bound to the surface of nanomaterials, resulting in a higher affinity for complementary DNA and other targets. In addition, this high density of DNA causes a high local salt concentration and negative charge density, which can prevent DNA degradation. For example, DNAzymes assembled on gold nanoparticles can effectively catalyze chemical reactions even in living cells. And it has been confirmed that DNA–nanomaterial complexes can enter cells more easily than free single-stranded DNA. Nanomaterials can be designed and synthesized in needed sizes and shapes, and they possess unique chemical and physical properties, which make them useful as DNA carriers or assistants, excellent signal reporters, transducers, and amplifiers. When nanomaterials are combined with functional DNAs to create novel assay platforms, highly sensitive biosensing and high-resolution imaging result. For example, gold nanoparticles and graphene oxides can quench fluorescence efficiently to achieve low background and effectively increase the signal-to-background ratio. Meanwhile, gold nanoparticles themselves can be colorimetric reporters because of their different optical absorptions between monodispersion and aggregation. DNA self-assembled nanomaterials contain several properties of both DNA and nanomaterials. Compared with DNA–nanomaterial complexes, DNA self-assembled nanomaterials more closely resemble living beings, and therefore they have lower cytotoxicity at high concentrations. Functional DNA self-assemblies also have high density of DNA for multivalent reaction and three-dimensional nanostructures for cell uptake. Now and in the future, we envision the use of DNA bases in making designer molecules for many challenging applications confronting chemists. With the further development of artificial DNA bases using smart organic synthesis, DNA macromolecules based on elegant molecular assembly approaches are expected to achieve great diversity, additional versatility, and advanced functions. PMID:24780000

  4. A PDDA/poly(2,6-pyridinedicarboxylic acid)-CNTs composite film DNA electrochemical sensor and its application for the detection of specific sequences related to PAT gene and NOS gene.

    PubMed

    Yang, Tao; Zhang, Wei; Du, Meng; Jiao, Kui

    2008-05-30

    2,6-Pyridinedicarboxylic acid (PDC) was electropolymerized on the glassy carbon electrode (GCE) surface combined with carboxylic group-functionalized single-walled carbon nanotubes (SWNTs) by cyclic voltammetry (CV) to form PDC-SWNTs composite film, which was rich in negatively charged carboxylic group. Then, poly(diallyldimethyl ammonium chloride) (PDDA), a linear cationic polyelectrolyte, was electrostatically adsorbed on the PDC-SWNTs/GCE surface. DNA probes with negatively charged phosphate group at the 5' end were immobilized on the PDDA/PDC-SWNTs/GCE due to the strong electrostatic attraction between PDDA and phosphate group of DNA. It has been found that modification of the electrode with PDC-SWNTs film has enhanced the effective electrode surface area and electron-transfer ability, in addition to providing negatively charged groups for the electrostatic assembly of cationic polyelectrolyte. PDDA plays a key role in the attachment of DNA probes to the PDC-SWNTs composite film and acts as a bridge to connect DNA with PDC-SWNTs film. The cathodic peak current of methylene blue (MB), an electroactive label, decreased obviously after the hybridization of DNA probe (ssDNA) with the complementary DNA (cDNA). This peak current change was used to monitor the recognition of the specific sequences related to PAT gene in the transgenic corn and the polymerase chain reaction (PCR) amplification of NOS gene from the sample of transgenic soybean with satisfactory results. Under optimal conditions, the dynamic detection range of the sensor to PAT gene target sequence was from 1.0x10(-11) to 1.0x10(-6) mol/L with the detection limit of 2.6x10(-12) mol/L.

  5. Autonomous parvovirus LuIII encapsidates equal amounts of plus and minus DNA strands

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bates, R.C.; Snyder, C.E.; Banerjee, P.T.

    1984-02-01

    Autonomous parvoviruses are thought to uniquely encapsidate single-stranded DNA of minus polarity. In contrast, the defective adeno-associated viruses separately encapsidate equal amounts of plus and minus DNA strands. The uniqueness of minus strand encapsidation is reexamined for the autonomous parvoviruses. Although it was found that Kilham rat virus and H-1 virus encapsidate varying but small amounts of complementary-strand DNA, it was unexpected to find that LuIII virus encapsidated equal amounts of plus and minus DNA. The extracted LuIII DNA possessed properties of double-stranded replicative-form DNA, including insensitivity to S1 endonuclease, cleavage by restriction enzymes, and conversion to unit-length, single-stranded DNAmore » when electrophoresed under denaturing conditions. However, the inability of this DNA to form single-stranded DNA circles when denatured and then renatured in the presence of formamide and the lack of double-stranded DNA circle formation after treatment with exonuclease III and reannealing shows a lack of sequence homology of the 3' and 5' termini of LuIII DNA, in contrast to adeno-associated virus DNA. Digestion of LuIII double-stranded DNA with EcoRI and HincII and separation of plus and minus DNA strands on composite agarose-acrylamide gels identified a heterogeneity present only in the plus DNA strand. These results suggest that strand specificity of viral DNA encapsidation is not a useful property for differentiation between the autonomous and defective parvoviruses. Furthermore, encapsidation by LuIII of equal amounts of complementary DNA strands in contrast to encapsidation of minus strands by H-1 virus, when propagated in the same host cell type, suggests that selection of strands for encapsidation is a virus-coded rather than host-controlled event.« less

  6. Anionic magnetite nanoparticle conjugated with pyrrolidinyl peptide nucleic acid for DNA base discrimination

    NASA Astrophysics Data System (ADS)

    Khadsai, Sudarat; Rutnakornpituk, Boonjira; Vilaivan, Tirayut; Nakkuntod, Maliwan; Rutnakornpituk, Metha

    2016-09-01

    Magnetite nanoparticles (MNPs) were surface modified with anionic poly( N-acryloyl glycine) (PNAG) and streptavidin for specific interaction with biotin-conjugated pyrrolidinyl peptide nucleic acid (PNA). Hydrodynamic size ( D h) of PNAG-grafted MNPs varied from 334 to 496 nm depending on the loading ratio of the MNP to NAG in the reaction. UV-visible and fluorescence spectrophotometries were used to confirm the successful immobilization of streptavidin and PNA on the MNPs. About 291 pmol of the PNA/mg MNP was immobilized on the particle surface. The PNA-functionalized MNPs were effectively used as solid supports to differentiate between fully complementary and non-complementary/single-base mismatch DNA using the PNA probe. These novel anionic MNPs can be efficiently applicable for use as a magnetically guidable support for DNA base discrimination.

  7. Display of disulfide-rich proteins by complementary DNA display and disulfide shuffling assisted by protein disulfide isomerase.

    PubMed

    Naimuddin, Mohammed; Kubo, Tai

    2011-12-01

    We report an efficient system to produce and display properly folded disulfide-rich proteins facilitated by coupled complementary DNA (cDNA) display and protein disulfide isomerase-assisted folding. The results show that a neurotoxin protein containing four disulfide linkages can be displayed in the folded state. Furthermore, it can be refolded on a solid support that binds efficiently to its natural acetylcholine receptor. Probing the efficiency of the display proteins prepared by these methods provided up to 8-fold higher enrichment by the selective enrichment method compared with cDNA display alone, more than 10-fold higher binding to its receptor by the binding assays, and more than 10-fold higher affinities by affinity measurements. Cotranslational folding was found to have better efficiency than posttranslational refolding between the two investigated methods. We discuss the utilities of efficient display of such proteins in the preparation of superior quality proteins and protein libraries for directed evolution leading to ligand discovery. Copyright © 2011 Elsevier Inc. All rights reserved.

  8. Reassembly of a bioluminescent protein Renilla luciferase directed through DNA hybridization.

    PubMed

    Cissell, Kyle A; Rahimi, Yasmeen; Shrestha, Suresh; Deo, Sapna K

    2009-01-01

    Reassembly of split reporter proteins, also referred to as protein complementation, is utilized in the detection of protein-protein or protein-nucleic acid interactions. In this strategy, a reporter protein is fragmented into two inactive polypeptides to which interacting/binding partners are fused. The interaction between fused partners leads to the formation of a reassembled, active reporter. In this Communication, we have presented a proof-of-concept for the detection of a target nucleic acid sequence based on the reassembly of the bioluminescent reporter Renilla luciferase (Rluc), which is driven by DNA hybridization. Although, reassembly of Rluc though protein interactions has been demonstrated by others, the Rluc reassembly through DNA hybridization has not been shown yet, which is the novelty of this work. It is well established that bioluminescence detection offers significant advantages due to the absence of any background signal. In our study, two rationally designed fragments of Rluc were conjugated to complementary oligonucleotide probes. Hybridization of the two probes with fused Rluc fragments resulted in the reassembly of the fragments, generating active Rluc, measurable by the intensity of light given off upon addition of coelenterazine. Our study also shows that the reassembly of Rluc can be inhibited by an oligonucleotide probe that competes to bind to the hybridized probe-Rluc fragment complex, indicating a potential strategy for the quantitative detection of target nucleic acid. We were able to achieve the reassembly of Rluc fused to oligonucleotide probes using femtomole amounts of the probe-fragment protein conjugate. This concentration is approximately 4 orders of magnitude less than that reported using green fluorescent protein (GFP) as the reporter. A DNA-driven Rluc reassembly study performed in a cellular matrix did not show any interference from the matrix.

  9. Design and characterization of a nanopore-coupled polymerase for single-molecule DNA sequencing by synthesis on an electrode array

    PubMed Central

    Stranges, P. Benjamin; Palla, Mirkó; Kalachikov, Sergey; Nivala, Jeff; Dorwart, Michael; Trans, Andrew; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Tao, Chuanjuan; Morozova, Irina; Li, Zengmin; Shi, Shundi; Aberra, Aman; Arnold, Cleoma; Yang, Alexander; Aguirre, Anne; Harada, Eric T.; Korenblum, Daniel; Pollard, James; Bhat, Ashwini; Gremyachinskiy, Dmitriy; Bibillo, Arek; Chen, Roger; Davis, Randy; Russo, James J.; Fuller, Carl W.; Roever, Stefan; Ju, Jingyue; Church, George M.

    2016-01-01

    Scalable, high-throughput DNA sequencing is a prerequisite for precision medicine and biomedical research. Recently, we presented a nanopore-based sequencing-by-synthesis (Nanopore-SBS) approach, which used a set of nucleotides with polymer tags that allow discrimination of the nucleotides in a biological nanopore. Here, we designed and covalently coupled a DNA polymerase to an α-hemolysin (αHL) heptamer using the SpyCatcher/SpyTag conjugation approach. These porin–polymerase conjugates were inserted into lipid bilayers on a complementary metal oxide semiconductor (CMOS)-based electrode array for high-throughput electrical recording of DNA synthesis. The designed nanopore construct successfully detected the capture of tagged nucleotides complementary to a DNA base on a provided template. We measured over 200 tagged-nucleotide signals for each of the four bases and developed a classification method to uniquely distinguish them from each other and background signals. The probability of falsely identifying a background event as a true capture event was less than 1.2%. In the presence of all four tagged nucleotides, we observed sequential additions in real time during polymerase-catalyzed DNA synthesis. Single-polymerase coupling to a nanopore, in combination with the Nanopore-SBS approach, can provide the foundation for a low-cost, single-molecule, electronic DNA-sequencing platform. PMID:27729524

  10. A high-throughput assay for the comprehensive profiling of DNA ligase fidelity

    PubMed Central

    Lohman, Gregory J. S.; Bauer, Robert J.; Nichols, Nicole M.; Mazzola, Laurie; Bybee, Joanna; Rivizzigno, Danielle; Cantin, Elizabeth; Evans, Thomas C.

    2016-01-01

    DNA ligases have broad application in molecular biology, from traditional cloning methods to modern synthetic biology and molecular diagnostics protocols. Ligation-based detection of polynucleotide sequences can be achieved by the ligation of probe oligonucleotides when annealed to a complementary target sequence. In order to achieve a high sensitivity and low background, the ligase must efficiently join correctly base-paired substrates, while discriminating against the ligation of substrates containing even one mismatched base pair. In the current study, we report the use of capillary electrophoresis to rapidly generate mismatch fidelity profiles that interrogate all 256 possible base-pair combinations at a ligation junction in a single experiment. Rapid screening of ligase fidelity in a 96-well plate format has allowed the study of ligase fidelity in unprecedented depth. As an example of this new method, herein we report the ligation fidelity of Thermus thermophilus DNA ligase at a range of temperatures, buffer pH and monovalent cation strength. This screen allows the selection of reaction conditions that maximize fidelity without sacrificing activity, while generating a profile of specific mismatches that ligate detectably under each set of conditions. PMID:26365241

  11. A high-throughput assay for the comprehensive profiling of DNA ligase fidelity.

    PubMed

    Lohman, Gregory J S; Bauer, Robert J; Nichols, Nicole M; Mazzola, Laurie; Bybee, Joanna; Rivizzigno, Danielle; Cantin, Elizabeth; Evans, Thomas C

    2016-01-29

    DNA ligases have broad application in molecular biology, from traditional cloning methods to modern synthetic biology and molecular diagnostics protocols. Ligation-based detection of polynucleotide sequences can be achieved by the ligation of probe oligonucleotides when annealed to a complementary target sequence. In order to achieve a high sensitivity and low background, the ligase must efficiently join correctly base-paired substrates, while discriminating against the ligation of substrates containing even one mismatched base pair. In the current study, we report the use of capillary electrophoresis to rapidly generate mismatch fidelity profiles that interrogate all 256 possible base-pair combinations at a ligation junction in a single experiment. Rapid screening of ligase fidelity in a 96-well plate format has allowed the study of ligase fidelity in unprecedented depth. As an example of this new method, herein we report the ligation fidelity of Thermus thermophilus DNA ligase at a range of temperatures, buffer pH and monovalent cation strength. This screen allows the selection of reaction conditions that maximize fidelity without sacrificing activity, while generating a profile of specific mismatches that ligate detectably under each set of conditions. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. Molecular characterization and functional analysis of serine/threonine protein phosphatase of Toxocara canis.

    PubMed

    Ma, Guang Xu; Zhou, Rong Qiong; Hu, Shi Jun; Huang, Han Cheng; Zhu, Tao; Xia, Qing You

    2014-06-01

    Toxocara canis (T. canis) is a widely prevalent zoonotic parasite that infects a wide range of mammalian hosts, including humans. We generated the full-length complementary DNA (cDNA) of the serine/threonine phosphatase gene of T. canis (Tc stp) using 5' rapid amplification of the cDNA ends. The 1192-bp sequence contained a continuous 942-nucleotide open reading frame, encoding a 313-amino-acid polypeptide. The Tc STP polypeptide shares a high level of amino-acid sequence identity with the predicted STPs of Loa loa (89%), Brugia malayi (86%), Oesophagostomum columbianum (76%), and Oesophagostomumdentatum (76%). The Tc STP contains GDXHG, GDXVDRG, GNHE motifs, which are characteristic of members of the phosphoprotein phosphatase family. Our quantitative real-time polymerase chain reaction analysis showed that the Tc STP was expressed in six different tissues in the adult male, with high-level expression in the spermary, vas deferens, and musculature, but was not expressed in the adult female, suggesting that Tc STP might be involved in spermatogenesis and mating behavior. Thus, STP might represent a potential molecular target for controlling T. canis reproduction. Copyright © 2014 Elsevier Inc. All rights reserved.

  13. Electrical detection of DNA hybridization: three extraction techniques based on interdigitated Al/Al2O3 capacitors.

    PubMed

    Moreno-Hagelsieb, L; Foultier, B; Laurent, G; Pampin, R; Remacle, J; Raskin, J-P; Flandre, D

    2007-04-15

    Based on interdigitated aluminum electrodes covered with Al(2)O(3) and silver precipitation via biotin-antibody coupled gold nano-labels as signal enhancement, three complementary electrical methods were used and compared to detect the hybridization of target DNA for concentrations down to the 50 pM of a PCR product from cytochrome P450 2b2 gene. Human hepatic cytochrome P450 (CYP) enzymes participate in detoxification metabolism of xenobiotics. Therefore, determination of mutational status of P450 gene in a patient could have a significant impact on the choice of a medical treatment. Our three electrical extraction procedures are performed on the same interdigitated capacitive sensor lying on a passivated silicon substrate and consist in the measurement of respectively the low-frequency inter-electrodes capacitance, the high-frequency self-resonance frequency, and the equivalent MOS capacitance between the short-circuited electrodes and the backside metallization of the silicon substrate. This study is the first of its kind as it opens the way for correlation studies and noise reduction techniques based on multiple electrical measurements of the same DNA hybridization event with a single sensor.

  14. Engineered external guide sequences are highly effective in inhibiting gene expression and replication of hepatitis B virus in cultured cells.

    PubMed

    Zhang, Zhigang; Vu, Gia-Phong; Gong, Hao; Xia, Chuan; Chen, Yuan-Chuan; Liu, Fenyong; Wu, Jianguo; Lu, Sangwei

    2013-01-01

    External guide sequences (EGSs) are RNA molecules that consist of a sequence complementary to a target mRNA and recruit intracellular ribonuclease P (RNase P), a tRNA processing enzyme, for specific degradation of the target mRNA. We have previously used an in vitro selection procedure to generate EGS variants that efficiently induce human RNase P to cleave a target mRNA in vitro. In this study, we constructed EGSs from a variant to target the overlapping region of the S mRNA, pre-S/L mRNA, and pregenomic RNA (pgRNA) of hepatitis B virus (HBV), which are essential for viral replication and infection. The EGS variant was about 50-fold more efficient in inducing human RNase P to cleave the mRNA in vitro than the EGS derived from a natural tRNA. Following Salmonella-mediated gene delivery, the EGSs were expressed in cultured HBV-carrying cells. A reduction of about 97% and 75% in the level of HBV RNAs and proteins and an inhibition of about 6,000- and 130-fold in the levels of capsid-associated HBV DNA were observed in cells treated with Salmonella vectors carrying the expression cassette for the variant and the tRNA-derived EGS, respectively. Our study provides direct evidence that the EGS variant is more effective in blocking HBV gene expression and DNA replication than the tRNA-derived EGS. Furthermore, these results demonstrate the feasibility of developing Salmonella-mediated gene delivery of highly active EGS RNA variants as a novel approach for gene-targeting applications such as anti-HBV therapy.

  15. Diversity Measures in Environmental Sequences Are Highly Dependent on Alignment Quality—Data from ITS and New LSU Primers Targeting Basidiomycetes

    PubMed Central

    Fischer, Christiane; Daniel, Rolf; Wubet, Tesfaye

    2012-01-01

    The ribosomal DNA comprised of the ITS1-5.8S-ITS2 regions is widely used as a fungal marker in molecular ecology and systematics but cannot be aligned with confidence across genetically distant taxa. In order to study the diversity of Agaricomycotina in forest soils, we designed primers targeting the more alignable 28S (LSU) gene, which should be more useful for phylogenetic analyses of the detected taxa. This paper compares the performance of the established ITS1F/4B primer pair, which targets basidiomycetes, to that of two new pairs. Key factors in the comparison were the diversity covered, off-target amplification, rarefaction at different Operational Taxonomic Unit (OTU) cutoff levels, sensitivity of the method used to process the alignment to missing data and insecure positional homology, and the congruence of monophyletic clades with OTU assignments and BLAST-derived OTU names. The ITS primer pair yielded no off-target amplification but also exhibited the least fidelity to the expected phylogenetic groups. The LSU primers give complementary pictures of diversity, but were more sensitive to modifications of the alignment such as the removal of difficult-to align stretches. The LSU primers also yielded greater numbers of singletons but also had a greater tendency to produce OTUs containing sequences from a wider variety of species as judged by BLAST similarity. We introduced some new parameters to describe alignment heterogeneity based on Shannon entropy and the extent and contents of the OTUs in a phylogenetic tree space. Our results suggest that ITS should not be used when calculating phylogenetic trees from genetically distant sequences obtained from environmental DNA extractions and that it is inadvisable to define OTUs on the basis of very heterogeneous alignments. PMID:22363808

  16. Fluorescence based Aptasensors for the determination of hepatitis B virus e antigen.

    PubMed

    Huang, Rongrong; Xi, Zhijiang; Deng, Yan; He, Nongyue

    2016-08-08

    This research is aimed at selecting specific aptamer of hepatitis B e antigen by SELEX and its applications. Hepatitis B e antigen (HBeAg) seroconversion is used as an indicator of virological response when treating patients suffering from chronic hepatitis B. HBeAg also indicates a high viremia and high infectivity in untreated patients. With HBeAg modified magnetic beads as targets, three groups of aptamers are successfully selected. These are the first reported DNA aptamers that can specifically bind to HBeAg. Based on the property that the conformation changes upon binding to its target, aptamer has emerged as ideal candidate in a variety of sensing applications. In this study, we present a simple strategy for aptamer-based fluorescence biosensors for the quantitative detection of HBeAg, in which a fluorescence labeled HBeAg aptamer serves as the molecular recognition element and a short DNA molecule that is complementary to the aptamer serves as the competitor. The LOD for HBeAg is 609 ng/mL. Later, the fluorescence system is deployed in HBeAg positive and negative blood serum (p < 0.05). The total detection assay could be completed in 2 min. These newly isolated aptamers could assist the diagnosis of chronic hepatitis B.

  17. Fluorescence based Aptasensors for the determination of hepatitis B virus e antigen

    PubMed Central

    Huang, Rongrong; Xi, Zhijiang; Deng, Yan; He, Nongyue

    2016-01-01

    This research is aimed at selecting specific aptamer of hepatitis B e antigen by SELEX and its applications. Hepatitis B e antigen (HBeAg) seroconversion is used as an indicator of virological response when treating patients suffering from chronic hepatitis B. HBeAg also indicates a high viremia and high infectivity in untreated patients. With HBeAg modified magnetic beads as targets, three groups of aptamers are successfully selected. These are the first reported DNA aptamers that can specifically bind to HBeAg. Based on the property that the conformation changes upon binding to its target, aptamer has emerged as ideal candidate in a variety of sensing applications. In this study, we present a simple strategy for aptamer-based fluorescence biosensors for the quantitative detection of HBeAg, in which a fluorescence labeled HBeAg aptamer serves as the molecular recognition element and a short DNA molecule that is complementary to the aptamer serves as the competitor. The LOD for HBeAg is 609 ng/mL. Later, the fluorescence system is deployed in HBeAg positive and negative blood serum (p < 0.05). The total detection assay could be completed in 2 min. These newly isolated aptamers could assist the diagnosis of chronic hepatitis B. PMID:27499342

  18. A fluorescent 3,7-bis-(naphthalen-1-ylethynylated)-2'-deoxyadenosine analogue reports thymidine in complementary DNA by a large emission Stokes shift.

    PubMed

    Yanagi, Masaki; Suzuki, Azusa; Hudson, Robert H E; Saito, Yoshio

    2018-02-28

    The new environmentally responsive fluorescent nucleosides, 3,7-bis-(naphthalen-1-ylethynyl)-8-aza-3,7-dideaza-2'-deoxyadenosine (3n7nzA, 1) and 7-(naphthalen-1-ylethynyl)-8-aza-3,7-dideaza-2'-deoxyadenosine (37nzA, 2), have been synthesized. Both 3n7nzA (1) and 37nzA (2) possess large π-conjugated systems which extend into both the minor and major grooves or the major groove alone, respectively. The nucleosides exhibited large solvatochromic shifts (3n7nzA: Δλ = 45 nm, 37nzA: Δλ = 78 nm) and were examined for their ability to fluorimetrically report hybridization events. When incorporated into ODN probes, the bis-substituted 3n7nzA (1) selectively recognized thymidine on target strands which was reported by a distinct change in its emission wavelength in the long wavelength region, whereas 37nzA (2) showed a preference for pairing to cytidine and a smaller wavelength shift. Thus, 3n7nzA (1) has the potential for use as a fluorescent probe for structural studies of DNAs/RNAs including the detection of single-base alterations in target DNA sequences.

  19. Characterization of soil nematode communities in three cropping systems through morphological and DNA metabarcoding approaches

    USDA-ARS?s Scientific Manuscript database

    Communities of soil nematodes impact ecosystem functions, including plant growth, decomposition, and nutrient cycling, all of which are vital processes in agriculture. We used complementary morphological and DNA metabarcoding analyses to characterize soil nematode communities in three cropping syste...

  20. Formation of rings from segments of HeLa-cell nuclear deoxyribonucleic acid

    PubMed Central

    Hardman, Norman

    1974-01-01

    Duplex segments of HeLa-cell nuclear DNA were generated by cleavage with DNA restriction endonuclease from Haemophilus influenzae. About 20–25% of the DNA segments produced, when partly degraded with exonuclease III and annealed, were found to form rings visible in the electron microscope. A further 5% of the DNA segments formed structures that were branched in configuration. Similar structures were generated from HeLa-cell DNA, without prior treatment with restriction endonuclease, when the complementary polynucleotide chains were exposed by exonuclease III action at single-chain nicks. After exposure of an average single-chain length of 1400 nucleotides per terminus at nicks in HeLa-cell DNA by exonuclease III, followed by annealing, the physical length of ring closures was estimated and found to be 0.02–0.1μm, or 50–300 base pairs. An almost identical distribution of lengths was recorded for the regions of complementary base sequence responsible for branch formation. It is proposed that most of the rings and branches are formed from classes of reiterated base sequence with an average length of 180 base pairs arranged intermittenly in HeLa-cell DNA. From the rate of formation of branched structures when HeLa-cell DNA segments were heat-denatured and annealed, it is estimated that the reiterated sequences are in families containing approximately 2400–24000 copies. ImagesPLATE 2PLATE 1 PMID:4462738

  1. ‘Protected DNA Probes’ capable of strong hybridization without removal of base protecting groups

    PubMed Central

    Ohkubo, Akihiro; Kasuya, Rintaro; Sakamoto, Kazushi; Miyata, Kenichi; Taguchi, Haruhiko; Nagasawa, Hiroshi; Tsukahara, Toshifumi; Watanobe, Takuma; Maki, Yoshiyuki; Seio, Kohji; Sekine, Mitsuo

    2008-01-01

    We propose a new strategy called the ‘Protected DNA Probes (PDP) method’ in which appropriately protected bases selectively bind to the complementary bases without the removal of their base protecting groups. Previously, we reported that 4-N-acetylcytosine oligonucleotides (ac4C) exhibited a higher hybridization affinity for ssDNA than the unmodified oligonucleotides. For the PDP strategy, we created a modified adenine base and synthesized an N-acylated deoxyadenosine mimic having 6-N-acetyl-8-aza-7-deazaadenine (ac6az8c7A). It was found that PDP containing ac4C and ac6az8c7A exhibited higher affinity for the complementary ssDNA than the corresponding unmodified DNA probes and showed similar base recognition ability. Moreover, it should be noted that this PDP strategy could guarantee highly efficient synthesis of DNA probes on controlled pore glass (CPG) with high purity and thereby could eliminate the time-consuming procedures for isolating DNA probes. This strategy could also avoid undesired base-mediated elimination of DNA probes from CPG under basic conditions such as concentrated ammonia solution prescribed for removal of base protecting groups in the previous standard approach. Here, several successful applications of this strategy to single nucleotide polymorphism detection are also described in detail using PDPs immobilized on glass plates and those prepared on CPG plates, suggesting its potential usefulness. PMID:18272535

  2. A human transcription factor in search mode.

    PubMed

    Hauser, Kevin; Essuman, Bernard; He, Yiqing; Coutsias, Evangelos; Garcia-Diaz, Miguel; Simmerling, Carlos

    2016-01-08

    Transcription factors (TF) can change shape to bind and recognize DNA, shifting the energy landscape from a weak binding, rapid search mode to a higher affinity recognition mode. However, the mechanism(s) driving this conformational change remains unresolved and in most cases high-resolution structures of the non-specific complexes are unavailable. Here, we investigate the conformational switch of the human mitochondrial transcription termination factor MTERF1, which has a modular, superhelical topology complementary to DNA. Our goal was to characterize the details of the non-specific search mode to complement the crystal structure of the specific binding complex, providing a basis for understanding the recognition mechanism. In the specific complex, MTERF1 binds a significantly distorted and unwound DNA structure, exhibiting a protein conformation incompatible with binding to B-form DNA. In contrast, our simulations of apo MTERF1 revealed significant flexibility, sampling structures with superhelical pitch and radius complementary to the major groove of B-DNA. Docking these structures to B-DNA followed by unrestrained MD simulations led to a stable complex in which MTERF1 was observed to undergo spontaneous diffusion on the DNA. Overall, the data support an MTERF1-DNA binding and recognition mechanism driven by intrinsic dynamics of the MTERF1 superhelical topology. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. Suppression of antitumour protective cytotoxic T lymphocyte responses to a human papillomavirus 16 E7 DNA vaccine by coinjection of interleukin-12 complementary DNA: involvement of nitric oxide in immune suppression

    PubMed Central

    Sin, Jeong-Im

    2009-01-01

    Interleukin-12 (IL-12) has been shown to enhance cellular immunity in vitro and in vivo. The beneficial roles of IL-12 as a DNA vaccine adjuvant have been commonly observed. Here the impact of IL-12 complementary DNA (cDNA) as an adjuvant for a human papillomavirus (HPV) type 16 E7 DNA vaccine is investigated in a mouse tumour model. Coinjection of E7 DNA vaccine with IL-12 cDNA completely suppressed antigen-specific cytotoxic T-lymphocyte (CTL) responses, leading to a complete loss of antitumour protection from a tumour cell challenge. In addition, antigen-specific antibody and T helper cell proliferative responses were also suppressed by IL-12 cDNA coinjection. This inhibition was observed over different IL-12 cDNA doses. Furthermore, separate leg injections of IL-12 and E7 cDNAs suppressed antigen-specific CTL and tumour protective responses, but not antibody and T helper cell proliferative responses, suggesting different pathways for suppression of these two separate responses. Further knockout animal studies demonstrated that interferon-γ and nitric oxide are not directly associated with suppression of antigen-specific antibody responses by IL-12 cDNA coinjection. However, nitric oxide was found to be involved in suppression of antigen-specific CTL and tumour protective responses by IL-12 cDNA coinjection. These data suggest that coinjection of IL-12 cDNA results in suppression of E7-specific CTL responses through nitric oxide, leading to a loss of antitumour resistance in this DNA vaccine model. This study further shows that the adjuvant effect of IL-12 is dependent on the antigen types tested. PMID:19740332

  4. Suppression of antitumour protective cytotoxic T lymphocyte responses to a human papillomavirus 16 E7 DNA vaccine by coinjection of interleukin-12 complementary DNA: involvement of nitric oxide in immune suppression.

    PubMed

    Sin, Jeong-Im

    2009-09-01

    Interleukin-12 (IL-12) has been shown to enhance cellular immunity in vitro and in vivo. The beneficial roles of IL-12 as a DNA vaccine adjuvant have been commonly observed. Here the impact of IL-12 complementary DNA (cDNA) as an adjuvant for a human papillomavirus (HPV) type 16 E7 DNA vaccine is investigated in a mouse tumour model. Coinjection of E7 DNA vaccine with IL-12 cDNA completely suppressed antigen-specific cytotoxic T-lymphocyte (CTL) responses, leading to a complete loss of antitumour protection from a tumour cell challenge. In addition, antigen-specific antibody and T helper cell proliferative responses were also suppressed by IL-12 cDNA coinjection. This inhibition was observed over different IL-12 cDNA doses. Furthermore, separate leg injections of IL-12 and E7 cDNAs suppressed antigen-specific CTL and tumour protective responses, but not antibody and T helper cell proliferative responses, suggesting different pathways for suppression of these two separate responses. Further knockout animal studies demonstrated that interferon-gamma and nitric oxide are not directly associated with suppression of antigen-specific antibody responses by IL-12 cDNA coinjection. However, nitric oxide was found to be involved in suppression of antigen-specific CTL and tumour protective responses by IL-12 cDNA coinjection. These data suggest that coinjection of IL-12 cDNA results in suppression of E7-specific CTL responses through nitric oxide, leading to a loss of antitumour resistance in this DNA vaccine model. This study further shows that the adjuvant effect of IL-12 is dependent on the antigen types tested.

  5. Influence of amine and thiol modifications at the 3' ends of single stranded DNA molecules on their adsorption on gold surface and the efficiency of their hybridization.

    PubMed

    Jaworska, Aleksandra; Jablonska, Anna; Wilanowski, Tomasz; Palys, Barbara; Sek, Slawomir; Kudelski, Andrzej

    2018-05-24

    Adsorption of molecules of DNA (deoxyribonucleic acid) or modified DNA on gold surfaces is often the first step in construction of many various biosensors, including biosensors for detection of DNA with a particular sequence. In this work we study the influence of amine and thiol modifications at the 3' ends of single stranded DNA (ssDNA) molecules on their adsorption on the surface of gold substrates and on the efficiency of hybridization of immobilized DNA with the complementary single stranded DNA. The characterization of formed layers has been carried out using infrared spectroscopy and atomic force microscopy. As model single stranded DNA we used DNA containing 20 adenine bases, whereas the complementary DNA contained 20 thymine bases. We found that the bands in polarization modulation-infrared reflection-adsorption spectroscopy (PM-IRRAS) spectra of layers formed from thiol-modified DNA are significantly narrower and sharper, indicating their higher regularity in the orientation of DNA on gold surface when using thiol linker. Also, hybridization of the layer of thiol-modified DNA containing 20 adenine bases with the respective DNA containing thymine bases leads to formation of much more organized structures than in the case of unmodified DNA or DNA with the amine linker. We conclude that the thiol-modified ssDNA is more promising for the preparation of biosensors, in comparison with the amine-modified or unmodified ssDNA. We have also found that the above-mentioned modifications at the 3' end of ssDNA significantly influence the IR spectrum (and hence the structure) of polycrystalline films formed from such compounds, even though adsorbed fragments contain less than 5% of the DNA chain. This effect should be taken into account when comparing IR spectra of various polycrystalline films formed from modified and unmodified DNA. Copyright © 2018. Published by Elsevier B.V.

  6. Simulations Using Random-Generated DNA and RNA Sequences

    ERIC Educational Resources Information Center

    Bryce, C. F. A.

    1977-01-01

    Using a very simple computer program written in BASIC, a very large number of random-generated DNA or RNA sequences are obtained. Students use these sequences to predict complementary sequences and translational products, evaluate base compositions, determine frequencies of particular triplet codons, and suggest possible secondary structures.…

  7. HUMAN GLYCERALDEHYDE 3-PHOSPHATE DEHYDROGENASE-2 (GAPD2) GENE IS EXPRESSED SPECIFICALLY IN SPERMATOGENIC CELLS

    EPA Science Inventory

    Although the process of glycolysis is highly conserved in eukaryotes, several glycolytic enzymes have unique structural or functional features in spermatogenic cells. We previously identified and characterized the mouse complementary DNA (cDNA) and a gene for 1 of these enzymes, ...

  8. Comparison of multiple gene assembly methods for metabolic engineering

    Treesearch

    Chenfeng Lu; Karen Mansoorabadi; Thomas Jeffries

    2007-01-01

    A universal, rapid DNA assembly method for efficient multigene plasmid construction is important for biological research and for optimizing gene expression in industrial microbes. Three different approaches to achieve this goal were evaluated. These included creating long complementary extensions using a uracil-DNA glycosylase technique, overlap extension polymerase...

  9. Zn2+ blocks annealing of complementary single-stranded DNA in a sequence-selective manner

    USDA-ARS?s Scientific Manuscript database

    A simple low-temperature EDTA-free agarose gel electrophoresis procedure (LTEAGE) coupled with UV-Vis spectrum and fluorescence quenching analyses was developed and the Zn2+-single-stranded (ss) DNA interaction was investigated under near-physiological conditions. It was found that Zn2+ blocked the...

  10. Species-specific identification of Dekkera/Brettanomyces yeasts by fluorescently labeled DNA probes targeting the 26S rRNA.

    PubMed

    Röder, Christoph; König, Helmut; Fröhlich, Jürgen

    2007-09-01

    Sequencing of the complete 26S rRNA genes of all Dekkera/Brettanomyces species colonizing different beverages revealed the potential for a specific primer and probe design to support diagnostic PCR approaches and FISH. By analysis of the complete 26S rRNA genes of all five currently known Dekkera/Brettanomyces species (Dekkera bruxellensis, D. anomala, Brettanomyces custersianus, B. nanus and B. naardenensis), several regions with high nucleotide sequence variability yet distinct from the D1/D2 domains were identified. FISH species-specific probes targeting the 26S rRNA gene's most variable regions were designed. Accessibility of probe targets for hybridization was facilitated by the construction of partially complementary 'side'-labeled probes, based on secondary structure models of the rRNA sequences. The specificity and routine applicability of the FISH-based method for yeast identification were tested by analyzing different wine isolates. Investigation of the prevalence of Dekkera/Brettanomyces yeasts in the German viticultural regions Wonnegau, Nierstein and Bingen (Rhinehesse, Rhineland-Palatinate) resulted in the isolation of 37 D. bruxellensis strains from 291 wine samples.

  11. Oligonucleotide-Gold Nanoparticle Networks for Detection of Cryptosporidium parvum Heat Shock Protein 70 mRNA ▿

    PubMed Central

    Javier, David J.; Castellanos-Gonzalez, Alejandro; Weigum, Shannon E.; White, A. Clinton; Richards-Kortum, Rebecca

    2009-01-01

    We report on a novel strategy for the detection of mRNA targets derived from Cryptosporidium parvum oocysts by the use of oligonucleotide-gold nanoparticles. Gold nanoparticles are functionalized with oligonucleotides which are complementary to unique sequences present on the heat shock protein 70 (HSP70) DNA/RNA target. The results indicate that the presence of HPS70 targets of increasing complexity causes the formation of oligonucleotide-gold nanoparticle networks which can be visually monitored via a simple colorimetric readout measured by a total internal reflection imaging setup. Furthermore, the induced expression of HSP70 mRNA in Cryptosporidium parvum oocysts via a simple heat shock process provides nonenzymatic amplification such that the HSP70 mRNA derived from as few as 5 × 103 purified C. parvum oocysts was successfully detected. Taken together, these results support the use of oligonucleotide-gold nanoparticles for the molecular diagnosis of cryptosporidiosis, offering new opportunities for the further development of point-of-care diagnostic assays with low-cost, robust reagents and simple colorimetric detection. PMID:19828740

  12. Site-directed nucleases: a paradigm shift in predictable, knowledge-based plant breeding.

    PubMed

    Podevin, Nancy; Davies, Howard V; Hartung, Frank; Nogué, Fabien; Casacuberta, Josep M

    2013-06-01

    Conventional plant breeding exploits existing genetic variability and introduces new variability by mutagenesis. This has proven highly successful in securing food supplies for an ever-growing human population. The use of genetically modified plants is a complementary approach but all plant breeding techniques have limitations. Here, we discuss how the recent evolution of targeted mutagenesis and DNA insertion techniques based on tailor-made site-directed nucleases (SDNs) provides opportunities to overcome such limitations. Plant breeding companies are exploiting SDNs to develop a new generation of crops with new and improved traits. Nevertheless, some technical limitations as well as significant uncertainties on the regulatory status of SDNs may challenge their use for commercial plant breeding. Copyright © 2013 Elsevier Ltd. All rights reserved.

  13. Large scale DNA microsequencing device

    DOEpatents

    Foote, R.S.

    1997-08-26

    A microminiature sequencing apparatus and method provide a means for simultaneously obtaining sequences of plural polynucleotide strands. The apparatus cosists of a microchip into which plural channels have been etched using standard lithographic procedures and chemical wet etching. The channels include a reaction well and a separating section. Enclosing the channels is accomplished by bonding a transparent cover plate over the apparatus. A first oligonucleotide strand is chemically affixed to the apparatus through an alkyl chain. Subsequent nucleotides are selected by complementary base pair bonding. A target nucleotide strand is used to produce a family of labelled sequencing strands in each channel which are separated in the separating section. During or following separation the sequences are determined using appropriate detection means. 17 figs.

  14. Printing Proteins as Microarrays for High-Throughput Function Determination

    NASA Astrophysics Data System (ADS)

    MacBeath, Gavin; Schreiber, Stuart L.

    2000-09-01

    Systematic efforts are currently under way to construct defined sets of cloned genes for high-throughput expression and purification of recombinant proteins. To facilitate subsequent studies of protein function, we have developed miniaturized assays that accommodate extremely low sample volumes and enable the rapid, simultaneous processing of thousands of proteins. A high-precision robot designed to manufacture complementary DNA microarrays was used to spot proteins onto chemically derivatized glass slides at extremely high spatial densities. The proteins attached covalently to the slide surface yet retained their ability to interact specifically with other proteins, or with small molecules, in solution. Three applications for protein microarrays were demonstrated: screening for protein-protein interactions, identifying the substrates of protein kinases, and identifying the protein targets of small molecules.

  15. Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3;-terminus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yeo, Hyun Koo; Lee, Jae Young

    2012-04-18

    The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.

  16. Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus.

    PubMed

    Yeo, Hyun Koo; Lee, Jae Young

    2010-05-01

    The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .

  17. Map-based cloning of a gene controlling Omega-3 fatty acid desaturation in Arabidopsis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Arondel, V.; Lemieux, B.; Hwang, I.

    1992-11-20

    A gene from the flowering plant Arabidopsis thaliana that encodes an omega-3 desaturase was cloned on the basis of the genetic map position of a mutation affecting membrane and storage lipid fatty acid composition. Yeast artificial chromosomes covering the genetic locus were identified and used to probe a seed complementary DNA library. A complementary DNA clone for the desaturase was identified and introduced into roots of both wild-type and mutant plants by Ti plasmid-mediated transformation. Transgenic tissues of both mutant and wild-type plants had significantly increased amounts of the fatty acid produced by this desaturase. 24 refs., 2 figs., 1more » tabs.« less

  18. Normalized cDNA libraries

    DOEpatents

    Soares, Marcelo B.; Efstratiadis, Argiris

    1997-01-01

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library.

  19. Normalized cDNA libraries

    DOEpatents

    Soares, M.B.; Efstratiadis, A.

    1997-06-10

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3{prime} noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. 4 figs.

  20. A Method for Selecting Structure-switching Aptamers Applied to a Colorimetric Gold Nanoparticle Assay

    PubMed Central

    Martin, Jennifer A.; Smith, Joshua E.; Warren, Mercedes; Chávez, Jorge L.; Hagen, Joshua A.; Kelley-Loughnane, Nancy

    2015-01-01

    Small molecules provide rich targets for biosensing applications due to their physiological implications as biomarkers of various aspects of human health and performance. Nucleic acid aptamers have been increasingly applied as recognition elements on biosensor platforms, but selecting aptamers toward small molecule targets requires special design considerations. This work describes modification and critical steps of a method designed to select structure-switching aptamers to small molecule targets. Binding sequences from a DNA library hybridized to complementary DNA capture probes on magnetic beads are separated from nonbinders via a target-induced change in conformation. This method is advantageous because sequences binding the support matrix (beads) will not be further amplified, and it does not require immobilization of the target molecule. However, the melting temperature of the capture probe and library is kept at or slightly above RT, such that sequences that dehybridize based on thermodynamics will also be present in the supernatant solution. This effectively limits the partitioning efficiency (ability to separate target binding sequences from nonbinders), and therefore many selection rounds will be required to remove background sequences. The reported method differs from previous structure-switching aptamer selections due to implementation of negative selection steps, simplified enrichment monitoring, and extension of the length of the capture probe following selection enrichment to provide enhanced stringency. The selected structure-switching aptamers are advantageous in a gold nanoparticle assay platform that reports the presence of a target molecule by the conformational change of the aptamer. The gold nanoparticle assay was applied because it provides a simple, rapid colorimetric readout that is beneficial in a clinical or deployed environment. Design and optimization considerations are presented for the assay as proof-of-principle work in buffer to provide a foundation for further extension of the work toward small molecule biosensing in physiological fluids. PMID:25870978

  1. Water-Soluble Conjugated Polymers: Self-Assembly and Biosensor Applications

    NASA Astrophysics Data System (ADS)

    Bazan, Guillermo

    2005-03-01

    Homogeneous assays can be designed which take advantage of the optical amplification of conjugated polymers and the self-assembly characteristic of aqueous polyelectrolytes. For example, a ssDNA sequence sensor comprises an aqueous solution containing a cationic water soluble conjugated polymer such as poly(9,9-bis(trimethylammonium)-hexyl)-fluorene phenylene) with a peptide nucleic acid (PNA) labeled with a dye (PNA-C*). Signal transduction is controlled by hybridization of the neutral PNA-C* probe and the negative ssDNA target, resulting in favorable electrostatic interactions between the hybrid complex and the cationic polymer. Distance requirements for Förster energy transfer are thus met only when ssDNA of complementary sequence to the PNA-C* probe is present. Signal amplification by the conjugated polymer provides fluorescein emission >25 times higher than that of the directly excited dye. Transduction by electrostatic interactions followed by energy transfer is a general strategy. Examples involving other biomolecular recognition events, such as DNA/DNA, RNA/protein and RNA/RNA, will also be provided. The mechanism of biosensing will be discussed, with special attention to the varying contributions of hydrophobic and electrostatic forces, polymer conformation, charge density, local concentration of C*s and tailored defect sites for aggregation-induced optical changes. Finally, the water solubility of these conjugated polymers opens possibilities for spin casting onto organic materials, without dissolving the underlying layers. This property is useful for fabricating multilayer organic optoelectronic devices by simple solution techniques.

  2. Complexes of mismatched and complementary DNA with minor groove binders. Structures at nucleotide resolution via an improved hydroxyl radical cleavage methodology

    PubMed Central

    Bialonska, Dobroslawa; Song, Kenneth; Bolton, Philip H.

    2011-01-01

    Tumor cell lines can replicate faster than normal cells and many also have defective DNA repair pathways. This has lead to the investigation of the inhibition of DNA repair proteins as a means of therapeutic intervention. An alternative approach is to hide or mask damaged DNA from the repair systems. We have developed a protocol to investigate the structures of the complexes of damaged DNA with drug like molecules. Nucleotide resolution structural information can be obtained using an improved hydroxyl radical cleavage protocol. The use of a dTn tail increases the length of the smallest fragments of interest and allows efficient co-precipitation of the fragments with poly(A). The use of a fluorescent label, on the 5′ end of the dTn tail, in conjunction with modified cleavage reaction conditions, avoids the lifetime and other problems with 32P labeling. The structures of duplex DNAs containing AC and CC mismatches in the presence and absence of minor groove binders have been investigated as have those of the fully complementary DNA. The results indicate that the structural perturbations of the mismatches are localized, are sequence dependent and that the presence of a mismatch can alter the binding of drug like molecules. PMID:21893212

  3. Gold nano particle decorated graphene core first generation PAMAM dendrimer for label free electrochemical DNA hybridization sensing.

    PubMed

    Jayakumar, K; Rajesh, R; Dharuman, V; Venkatasan, R; Hahn, J H; Pandian, S Karutha

    2012-01-15

    A novel first generation (G1) poly(amidoamine) dendrimer (PAMAM) with graphene core (GG1PAMAM) was synthesized for the first time. Single layer of GG1PAMAM was immobilized covalently on mercaptopropionic acid (MPA) monolayer on Au transducer. This allows cost effective and easy deposition of single layer graphene on the Au transducer surface than the advanced vacuum techniques used in the literature. Au nano particles (17.5 nm) then decorated the GG1PAMAM and used for electrochemical DNA hybridization sensing. The sensor discriminates selectively and sensitively the complementary double stranded DNA (dsDNA, hybridized), non-complementary DNA (ssDNA, un-hybridized) and single nucleotide polymorphism (SNP) surfaces. Interactions of the MPA, GG1PAMAM and the Au nano particles were characterized by Ultra Violet (UV), Fourier Transform Infrared (FTIR), Raman spectroscopy (RS), Thermo gravimetric analysis (TGA), Scanning Electron Microscopy (SEM), Atomic Force Microscopy (AFM), Cyclic Voltmetric (CV), Impedance spectroscopy (IS) and Differntial Pulse Voltammetry (DPV) techniques. The sensor showed linear range 1×10(-6) to 1×10(-12) M with lowest detection limit 1 pM which is 1000 times lower than G1PAMAM without graphene core. Copyright © 2011 Elsevier B.V. All rights reserved.

  4. Periodic Assembly of Nanospecies on Repetitive DNA Sequences Generated on Gold Nanoparticles by Rolling Circle Amplification

    NASA Astrophysics Data System (ADS)

    Zhao, Weian; Brook, Michael A.; Li, Yingfu

    Periodical assembly of nanospecies is desirable for the construction of nanodevices. We provide a protocol for the preparation of a gold nanoparticle (AuNP)/DNA scaffold on which nanospecies can be assembled in a periodical manner. AuNP/DNA scaffold is prepared by growing long single-stranded DNA (ssDNA) molecules (typically hundreds of nanometers to a few microns in length) on AuNPs via rolling circle amplification (RCA). Since these long ssDNA molecules contain many repetitive sequence units, complementary DNA-attached nanospecies can be assembled through specific hybridization in a controllable and periodical manner.

  5. DNA Nanotechnology for Cancer Therapy

    PubMed Central

    Kumar, Vinit; Palazzolo, Stefano; Bayda, Samer; Corona, Giuseppe; Toffoli, Giuseppe; Rizzolio, Flavio

    2016-01-01

    DNA nanotechnology is an emerging and exciting field, and represents a forefront frontier for the biomedical field. The specificity of the interactions between complementary base pairs makes DNA an incredible building material for programmable and very versatile two- and three-dimensional nanostructures called DNA origami. Here, we analyze the DNA origami and DNA-based nanostructures as a drug delivery system. Besides their physical-chemical nature, we dissect the critical factors such as stability, loading capability, release and immunocompatibility, which mainly limit in vivo applications. Special attention was dedicated to highlighting the boundaries to be overcome to bring DNA nanostructures closer to the bedside of patients. PMID:27022418

  6. Detection of Trypanosoma cruzi infection in naturally-infected dogs and cats using serological, parasitological and molecular methods

    PubMed Central

    Enriquez, G.F.; Cardinal, M.V.; Orozco, M.M.; Schijman, A.G.; Gürtler, R.E.

    2013-01-01

    Domestic dogs and cats are major domestic reservoir hosts of Trypanosoma cruzi and a risk factor for parasite transmission. In this study we assessed the relative performance of a polymerase chain reaction assay targeted to minicircle DNA (kDNA-PCR) in reference to conventional serological tests, a rapid dipstick test and xenodiagnosis to detect T. cruzi infection in dogs and cats from an endemic rural area in northeastern Argentina. A total of 43 dogs and 13 cats seropositive for T. cruzi by an immunosorbent assay (ELISA) and an indirect hemagglutination assay (IHA), which had been examined by xenodiagnosis, were also tested by kDNA-PCR. kDNA-PCR was nearly as sensitive as xenodiagnosis for detecting T. cruzi- infectious dogs and cats. kDNA-PCR was slightly more sensitive than xenodiagnosis in seropositive dogs (91% versus 86%, respectively) and cats (77% against 54%, respectively), but failed to detect all of the seropositive individuals. ELISA and IHA detected all xenodiagnosis-positive dogs and both outcomes largely agreed (kappa coefficient, κ = 0.92), whereas both assays failed to detect all of the xenodiagnosis-positive cats and their agreement was moderate (κ = 0.68). In dogs, the sensitivity of the dipstick test was 95% and agreed closely with the outcome of conventional serological tests (κ = 0.82). The high sensitivity of kDNA-PCR to detect T. cruzi infections in naturally-infected dogs and cats supports its application as a diagnostic tool complementary to serology and may replace the use of xenodiagnosis or hemoculture. PMID:23499860

  7. Community Composition and Transcriptional Activity of Ammonia-Oxidizing Prokaryotes of Seagrass Thalassia hemprichii in Coral Reef Ecosystems.

    PubMed

    Ling, Juan; Lin, Xiancheng; Zhang, Yanying; Zhou, Weiguo; Yang, Qingsong; Lin, Liyun; Zeng, Siquan; Zhang, Ying; Wang, Cong; Ahmad, Manzoor; Long, Lijuan; Dong, Junde

    2018-01-01

    Seagrasses in coral reef ecosystems play important ecological roles by enhancing coral reef resilience under ocean acidification. However, seagrass primary productivity is typically constrained by limited nitrogen availability. Ammonia oxidation is an important process conducted by ammonia-oxidizing archaea (AOA) and bacteria (AOB), yet little information is available concerning the community structure and potential activity of seagrass AOA and AOB. Therefore, this study investigated the variations in the abundance, diversity and transcriptional activity of AOA and AOB at the DNA and transcript level from four sample types: the leaf, root, rhizosphere sediment and bulk sediment of seagrass Thalassia hemprichii in three coral reef ecosystems. DNA and complementary DNA (cDNA) were used to prepare clone libraries and DNA and cDNA quantitative PCR ( q PCR) assays, targeting the ammonia monooxygenase-subunit ( amo A) genes as biomarkers. Our results indicated that the closest relatives of the obtained archaeal and bacterial amo A gene sequences recovered from DNA and cDNA libraries mainly originated from the marine environment. Moreover, all the obtained AOB sequences belong to the Nitrosomonadales cluster. Nearly all the AOA communities exhibited higher diversity than the AOB communities at the DNA level, but the q PCR data demonstrated that the abundances of AOB communities were higher than that of AOA communities based on both DNA and RNA transcripts. Collectively, most of the samples shared greater community composition similarity with samples from the same location rather than sample type. Furthermore, the abundance of archaeal amo A gene in rhizosphere sediments showed significant relationships with the ammonium concentration of sediments and the nitrogen content of plant tissue (leaf and root) at the DNA level ( P < 0.05). Conversely, no such relationships were found for the AOB communities. This work provides new insight into the nitrogen cycle, particularly nitrification of seagrass meadows in coral reef ecosystems.

  8. The recognition and modification sites for the bacterial type I restriction systems KpnAI, StySEAI, StySENI and StySGI

    PubMed Central

    Kasarjian, Julie K. A.; Hidaka, Masumi; Horiuchi, Takashi; Iida, Masatake; Ryu, Junichi

    2004-01-01

    Using an in vivo plasmid transformation method, we have determined the DNA sequences recognized by the KpnAI, StySEAI, StySENI and StySGI R-M systems from Klebsiella oxytoca strain M5a1, Salmonella eastbourne, Salmonella enteritidis and Salmonella gelsenkirchen, respectively. These type I restriction-modification systems were originally identified using traditional phage assay, and described here is the plasmid transformation test and computer program used to determine their DNA recognition sequences. For this test, we constructed two sets of plasmids, pL and pE, that contain phage lambda and Escherichia coli K-12 chromosomal DNA fragments, respectively. Further, using the methylation sensitivities of various known type II restriction enzymes, we identified the target adenines for methylation (listed in bold italics below as A or T in case of the complementary strand). The recognition sequence and methylation sites are GAA(6N)TGCC (KpnAI), ACA(6N)TYCA (StySEAI), CGA(6N)TACC (StySENI) and TAAC(7N)RTCG (StySGI). These DNA recognition sequences all have a typical type I bipartite pattern and represent three novel specificities and one isoschizomer (StySENI). For confirmation, oligonucleotides containing each of the predicted sequences were synthesized, cloned into plasmid pMECA and transformed into each strain, resulting in a large reduction in efficiency of transformation (EOT). PMID:15199175

  9. Precise and selective sensing of DNA-DNA hybridization by graphene/Si-nanowires diode-type biosensors.

    PubMed

    Kim, Jungkil; Park, Shin-Young; Kim, Sung; Lee, Dae Hun; Kim, Ju Hwan; Kim, Jong Min; Kang, Hee; Han, Joong-Soo; Park, Jun Woo; Lee, Hosun; Choi, Suk-Ho

    2016-08-18

    Single-Si-nanowire (NW)-based DNA sensors have been recently developed, but their sensitivity is very limited because of high noise signals, originating from small source-drain current of the single Si NW. Here, we demonstrate that chemical-vapor-deposition-grown large-scale graphene/surface-modified vertical-Si-NW-arrays junctions can be utilized as diode-type biosensors for highly-sensitive and -selective detection of specific oligonucleotides. For this, a twenty-seven-base-long synthetic oligonucleotide, which is a fragment of human DENND2D promoter sequence, is first decorated as a probe on the surface of vertical Si-NW arrays, and then the complementary oligonucleotide is hybridized to the probe. This hybridization gives rise to a doping effect on the surface of Si NWs, resulting in the increase of the current in the biosensor. The current of the biosensor increases from 19 to 120% as the concentration of the target DNA varies from 0.1 to 500 nM. In contrast, such biosensing does not come into play by the use of the oligonucleotide with incompatible or mismatched sequences. Similar results are observed from photoluminescence microscopic images and spectra. The biosensors show very-uniform current changes with standard deviations ranging ~1 to ~10% by ten-times endurance tests. These results are very promising for their applications in accurate, selective, and stable biosensing.

  10. CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion.

    PubMed

    Santillán, Orlando; Ramírez-Romero, Miguel A; Dávila, Guillermo

    2017-06-25

    Here, we present chimera assembly by plasmid recovery and restriction enzyme site insertion (CAPRRESI). CAPRRESI benefits from many strengths of the original plasmid recovery method and introduces restriction enzyme digestion to ease DNA ligation reactions (required for chimera assembly). For this protocol, users clone wildtype genes into the same plasmid (pUC18 or pUC19). After the in silico selection of amino acid sequence regions where chimeras should be assembled, users obtain all the synonym DNA sequences that encode them. Ad hoc Perl scripts enable users to determine all synonym DNA sequences. After this step, another Perl script searches for restriction enzyme sites on all synonym DNA sequences. This in silico analysis is also performed using the ampicillin resistance gene (ampR) found on pUC18/19 plasmids. Users design oligonucleotides inside synonym regions to disrupt wildtype and ampR genes by PCR. After obtaining and purifying complementary DNA fragments, restriction enzyme digestion is accomplished. Chimera assembly is achieved by ligating appropriate complementary DNA fragments. pUC18/19 vectors are selected for CAPRRESI because they offer technical advantages, such as small size (2,686 base pairs), high copy number, advantageous sequencing reaction features, and commercial availability. The usage of restriction enzymes for chimera assembly eliminates the need for DNA polymerases yielding blunt-ended products. CAPRRESI is a fast and low-cost method for fusing protein-coding genes.

  11. Cinnamate:CoA ligase initiates the biosynthesis of a benzoate-derived xanthone phytoalexin in Hypericum calycinum cell cultures.

    PubMed

    Gaid, Mariam M; Sircar, Debabrata; Müller, Andreas; Beuerle, Till; Liu, Benye; Ernst, Ludger; Hänsch, Robert; Beerhues, Ludger

    2012-11-01

    Although a number of plant natural products are derived from benzoic acid, the biosynthesis of this structurally simple precursor is poorly understood. Hypericum calycinum cell cultures accumulate a benzoic acid-derived xanthone phytoalexin, hyperxanthone E, in response to elicitor treatment. Using a subtracted complementary DNA (cDNA) library and sequence information about conserved coenzyme A (CoA) ligase motifs, a cDNA encoding cinnamate:CoA ligase (CNL) was isolated. This enzyme channels metabolic flux from the general phenylpropanoid pathway into benzenoid metabolism. HcCNL preferred cinnamic acid as a substrate but failed to activate benzoic acid. Enzyme activity was strictly dependent on the presence of Mg²⁺ and K⁺ at optimum concentrations of 2.5 and 100 mM, respectively. Coordinated increases in the Phe ammonia-lyase and HcCNL transcript levels preceded the accumulation of hyperxanthone E in cell cultures of H. calycinum after the addition of the elicitor. HcCNL contained a carboxyl-terminal type 1 peroxisomal targeting signal made up by the tripeptide Ser-Arg-Leu, which directed an amino-terminal reporter fusion to the peroxisomes. Masking the targeting signal by carboxyl-terminal reporter fusion led to cytoplasmic localization. A phylogenetic tree consisted of two evolutionarily distinct clusters. One cluster was formed by CoA ligases related to benzenoid metabolism, including HcCNL. The other cluster comprised 4-coumarate:CoA ligases from spermatophytes, ferns, and mosses, indicating divergence of the two clades prior to the divergence of the higher plant lineages.

  12. Construction of photoelectrochemical thrombin aptasensor via assembling multilayer of graphene-CdS nanocomposites.

    PubMed

    Shangguan, Li; Zhu, Wei; Xue, Yanchun; Liu, Songqin

    2015-02-15

    A photoelectrochemical (PEC) aptasensor for highly sensitive and specific detection of thrombin was developed by using graphene–CdS nanocomposites multilayer as photoactive species and electroactive mediator hexaammineruthenium(III) chloride (Ru(NH(3))(6)(3+)) as signal enhancer. Graphene–CdS nanocomposites (G–CdS) were synthesized by one-pot reduction of oxide graphene and CdCl2 with thioacetamide. The photoactive multilayer was prepared by alternative assembly of the negatively charged 3-mercaptopropionic acid modified graphene–CdS nanocomposites (MPA-G–CdS) and the positively charged polyethylenimine (PEI) on ITO electrode. This layer-by-layer assembly method enhanced the stability and homogeneity of the photocurrent readout of G–CdS. Thrombin aptamer was covalently bound to the multilayer by using glutaraldehyde as cross-linking. Electroactive mediator (Ru(NH(3))(6)(3+)) could interact with the DNA phosphate backbone and thus facilitated the electron transfer between G–CdS multilayer and electrode and enhanced the photocurrent. Hybridizing of a long complementary DNA with thrombin aptamer could increase the adsorption amount of (Ru(NH(3))(6)(3+)), which in turn boosted the signal readout. In the presence of target thrombin, the affinity interaction between thrombin and its aptamer resulted in the long complementary DNA releasing from the G–CdS multilayer and decreasing of photocurrent signal. On the basis of G–CdS multilayer as the photoactive species, (Ru (NH(3))(6)(3+)) as an electroactive mediator, and aptamer as a recognition module, a high sensitive PEC aptasensor for thrombin detection was proposed. The thrombin aptasensor displayed a linear range from 2.0 pM to 600.0 pM and a detection limit of 1.0 pM. The present strategy provided a promising ideology for the future development of PEC biosensor. Copyright © 2014 Elsevier B.V. All rights reserved.

  13. A novel "dual-potential" electrochemiluminescence aptasensor array using CdS quantum dots and luminol-gold nanoparticles as labels for simultaneous detection of malachite green and chloramphenicol.

    PubMed

    Feng, Xiaobin; Gan, Ning; Zhang, Huairong; Yan, Qing; Li, Tianhua; Cao, Yuting; Hu, Futao; Yu, Hongwei; Jiang, Qianli

    2015-12-15

    A novel type of "dual-potential" electrochemiluminescence (ECL) aptasensor array was fabricated on a homemade screen-printed carbon electrode (SPCE) for simultaneous detection of malachite green (MG) and chloramphenicol (CAP) in one single assay. The SPCE substrate consisted of a common Ag/AgCl reference electrode, carbon counter electrode and two carbon working electrodes (WE1 and WE2). In the system, CdS quantum dots (QDs) were modified on WE1 as cathode ECL emitters and luminol-gold nanoparticles (L-Au NPs) were modified on WE2 as anode ECL emitters. Then the MG aptamer complementary strand (MG cDNA) and CAP aptamer complementary strand (CAP cDNA) were attached on CdS QDs and L-Au NPs, respectively. The cDNA would hybridize with corresponding aptamer that was respectively tagged with cyanine dye (Cy5) (as quenchers of CdS QDs) and chlorogenic acid (CA) (as quenchers of l-Au NPs) using poly(ethylenimine) (PEI) as a bridging agent. PEI could lead to a large number of quenchers on the aptamer, which increased the quenching efficiency. Upon MG and CAP adding, the targets could induce strand release due to the highly affinity of analytes toward aptamers. Meanwhile, it could release the Cy5 and CA, which recovered cathode ECL of CdS QDs and anode ECL of L-Au NPs simultaneously. This "dual-potential" ECL strategy could be used to detect MG and CAP with the linear ranges of 0.1-100 nM and 0.2-150 nM, with detection limits of 0.03 nM and 0.07 nM (at 3sB), respectively. More importantly, this designed method was successfully applied to determine MG and CAP in real fish samples and held great potential in the food analysis. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. Role of cytochrome P450 IA2 in acetanilide 4-hydroxylation as determined with cDNA expression and monoclonal antibodies.

    PubMed

    Liu, G; Gelboin, H V; Myers, M J

    1991-02-01

    The role of P450 IA2 in the hydroxylation of acetanilide was examined using an inhibitory monoclonal antibody (MAb) 1-7-1 and vaccinia cDNA expression producing murine P450 IA1 (mIA1), murine P450 IA2 (mIA2), or human P450 IA2 (hIA2). Acetanilide hydroxylase (AcOH) activity was measured using an HPLC method with more than 500-fold greater sensitivity than previously described procedures. This method, which does not require the use of radioactive acetanilide, was achieved by optimizing both the gradient system and the amount of enzyme needed to achieve detection by uv light. MAb 1-7-1 inhibits up to 80% of the AcOH activity in both rat liver microsomes and cDNA expressed mouse and human P450 IA2. MAb 1-7-1, which recognizes both P450 IA1 and P450 IA2, completely inhibits the aryl hydrocarbon hydroxylase (AHH) activity of cDNA expressed in IA1. The inhibition of only 80% of the AHH activity present in MC liver microsomes by MAb 1-7-1 suggests that additional P450 forms are contributing to the overall AHH activity present in methylcholanthrene (MC)-liver microsomes as MAb 1-7-1 almost completely inhibits the AHH activity of expressed mIA1. Maximal inhibition of IA2 by 1-7-1 results in an 80% decrease in acetanilide hydroxylase activity in both liver microsomes and expressed mouse and human IA2. The capacity of MAb 1-7-1 to produce identical levels of inhibition of acetanilide hydroxylase activity in rat MC microsomes (80%) and in expressed mouse (81%) and human P450 IA2 (80%) strongly suggests that P450 IA2 is the major and perhaps the only enzyme responsible for the metabolism of acetanilide. These results demonstrate the complementary utility of monoclonal antibodies and cDNA expression for defining the contribution of specific P450 enzymes to the metabolism of a given substrate. This complementary approach allows for a more precise determination of the inhibitory capacity of MAb with respect to the metabolic capacity of the target P450.

  15. Development of a real-time PCR assay for the detection and identification of Staphylococcus capitis, Staphylococcus haemolyticus and Staphylococcus warneri.

    PubMed

    Iwase, Tadayuki; Seki, Keiko; Shinji, Hitomi; Mizunoe, Yoshimitsu; Masuda, Shogo

    2007-10-01

    Staphylococcus capitis, Staphylococcus haemolyticus and Staphylococcus warneri are coagulase-negative staphylococci. Each species has different characteristics, and a difference in pathology is also seen in compromised hosts. Therefore, the development of a species-specific simple detection method for the identification of these staphylococci is important. Here, a species-specific real-time PCR assay is reported that targets the superoxide dismutase A-encoding gene of these bacteria. Primers were designed with a base that was non-complementary with regard to the other bacteria. This base was at the 3' end of the primer (3' mismatch primer) and conferred high specificity. These primers were then evaluated using real-time PCR. They reacted only with the target bacterium. In addition, stable quantitative reactions were observed when experiments were performed using genomic DNA extracted from varying numbers of staphylococci cells (10(1)-10(7) cells). These results indicate that this method is useful for the identification and quantitative analysis of S. capitis, S. haemolyticus and S. warneri.

  16. Targeted and genome-scale methylomics reveals gene body signatures in human cell lines

    PubMed Central

    Ball, Madeleine Price; Li, Jin Billy; Gao, Yuan; Lee, Je-Hyuk; LeProust, Emily; Park, In-Hyun; Xie, Bin; Daley, George Q.; Church, George M.

    2012-01-01

    Cytosine methylation, an epigenetic modification of DNA, is a target of growing interest for developing high throughput profiling technologies. Here we introduce two new, complementary techniques for cytosine methylation profiling utilizing next generation sequencing technology: bisulfite padlock probes (BSPPs) and methyl sensitive cut counting (MSCC). In the first method, we designed a set of ~10,000 BSPPs distributed over the ENCODE pilot project regions to take advantage of existing expression and chromatin immunoprecipitation data. We observed a pattern of low promoter methylation coupled with high gene body methylation in highly expressed genes. Using the second method, MSCC, we gathered genome-scale data for 1.4 million HpaII sites and confirmed that gene body methylation in highly expressed genes is a consistent phenomenon over the entire genome. Our observations highlight the usefulness of techniques which are not inherently or intentionally biased in favor of only profiling particular subsets like CpG islands or promoter regions. PMID:19329998

  17. A homogeneous nucleic acid hybridization assay based on strand displacement.

    PubMed Central

    Vary, C P

    1987-01-01

    A homogeneous nucleic acid hybridization assay which is conducted in solution and requires no separation steps is described. The assay is based on the concept of strand displacement. In the strand displacement assay, an RNA "signal strand" is hybridized within a larger DNA strand termed the "probe strand", which is, in turn, complementary to the target nucleic acid of interest. Hybridization of the target nucleic acid with the probe strand ultimately results in displacement of the RNA signal strand. Strand displacement, therefore, causes conversion of the RNA from double to single-stranded form. The single-strand specificity of polynucleotide phosphorylase (EC 2.7.7.8) allows discrimination between double-helical and single-stranded forms of the RNA signal strand. As displacement proceeds, free RNA signal strands are preferentially phosphorolyzed to component nucleoside diphosphates, including adenosine diphosphate. The latter nucleotide is converted to ATP by pyruvate kinase(EC 2.7.1.40). Luciferase catalyzed bioluminescence is employed to measure the ATP generated as a result of strand displacement. Images PMID:3309890

  18. Argonaute Proteins and Mechanisms of RNA Interference in Eukaryotes and Prokaryotes.

    PubMed

    Olina, A V; Kulbachinskiy, A V; Aravin, A A; Esyunina, D M

    2018-05-01

    Noncoding RNAs play essential roles in genetic regulation in all organisms. In eukaryotic cells, many small noncoding RNAs act in complex with Argonaute proteins and regulate gene expression by recognizing complementary RNA targets. The complexes of Argonaute proteins with small RNAs also play a key role in silencing of mobile genetic elements and, in some cases, viruses. These processes are collectively called RNA interference. RNA interference is a powerful tool for specific gene silencing in both basic research and therapeutic applications. Argonaute proteins are also found in prokaryotic organisms. Recent studies have shown that prokaryotic Argonautes can also cleave their target nucleic acids, in particular DNA. This activity of prokaryotic Argonautes might potentially be used to edit eukaryotic genomes. However, the molecular mechanisms of small nucleic acid biogenesis and the functions of Argonaute proteins, in particular in bacteria and archaea, remain largely unknown. Here we briefly review available data on the RNA interference processes and Argonaute proteins in eukaryotes and prokaryotes.

  19. Complementary DNA libraries: an overview.

    PubMed

    Ying, Shao-Yao

    2004-07-01

    The generation of complete and full-length cDNA libraries for potential functional assays of specific gene sequences is essential for most molecules in biotechnology and biomedical research. The field of cDNA library generation has changed rapidly in the past 10 yr. This review presents an overview of the method available for the basic information of generating cDNA libraries, including the definition of the cDNA library, different kinds of cDNA libraries, difference between methods for cDNA library generation using conventional approaches and a novel strategy, and the quality of cDNA libraries. It is anticipated that the high-quality cDNA libraries so generated would facilitate studies involving genechips and the microarray, differential display, subtractive hybridization, gene cloning, and peptide library generation.

  20. Controllable g5p-Protein-Directed Aggregation of ssDNA-Gold Nanoparticles

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, S.; Maye, M; Zhang, Y

    We assembled single-stranded DNA (ssDNA) conjugated nanoparticles using the phage M13 gene 5 protein (g5p) as the molecular glue to bind two antiparallel noncomplementary ssDNA strands. The entire process was controlled tightly by the concentration of the g5p protein and the presence of double-stranded DNA. The g5p-ssDNA aggregate was disintegrated by hybridization with complementary ssDNA (C-ssDNA) that triggers the dissociation of the complex. Polyhistidine-tagged g5p was bound to nickel nitrilotriacetic acid (Ni2+-NTA) conjugated nanoparticles and subsequently used to coassemble the ssDNA-conjugated nanoparticles into multiparticle-type aggregates. Our approach offers great promise for designing biologically functional, controllable protein/nanoparticle composites.

Top