Secondary electron imaging of monolayer materials inside a transmission electron microscope
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cretu, Ovidiu, E-mail: cretu.ovidiu@nims.go.jp; Lin, Yung-Chang; Suenaga, Kazutomo
2015-08-10
A scanning transmission electron microscope equipped with a backscattered and secondary electron detector is shown capable to image graphene and hexagonal boron nitride monolayers. Secondary electron contrasts of the two lightest monolayer materials are clearly distinguished from the vacuum level. A signal difference between these two materials is attributed to electronic structure differences, which will influence the escape probabilities of the secondary electrons. Our results show that the secondary electron signal can be used to distinguish between the electronic structures of materials with atomic layer sensitivity, enhancing its applicability as a complementary signal in the analytical microscope.
Hachtel, Jordan A.; Marvinney, Claire; Mouti, Anas; ...
2016-03-02
The nanoscale optical response of surface plasmons in three-dimensional metallic nanostructures plays an important role in many nanotechnology applications, where precise spatial and spectral characteristics of plasmonic elements control device performance. Electron energy loss spectroscopy (EELS) and cathodoluminescence (CL) within a scanning transmission electron microscope have proven to be valuable tools for studying plasmonics at the nanoscale. Each technique has been used separately, producing three-dimensional reconstructions through tomography, often aided by simulations for complete characterization. Here we demonstrate that the complementary nature of the two techniques, namely that EELS probes beam-induced electronic excitations while CL probes radiative decay, allows usmore » to directly obtain a spatially- and spectrally-resolved picture of the plasmonic characteristics of nanostructures in three dimensions. Furthermore, the approach enables nanoparticle-by-nanoparticle plasmonic analysis in three dimensions to aid in the design of diverse nanoplasmonic applications.« less
Measurement and simulation for a complementary imaging with the neutron and X-ray beams
NASA Astrophysics Data System (ADS)
Hara, Kaoru Y.; Sato, Hirotaka; Kamiyama, Takashi; Shinohara, Takenao
2017-09-01
By using a composite source system, we measured radiographs of the thermal neutron and keV X-ray in the 45-MeV electron linear accelerator facility at Hokkaido University. The source system provides the alternative beam of neutron and X-ray by switching the production target onto the electron beam axis. In the measurement to demonstrate a complementary imaging, the detector based on a vacuum-tube type neutron color image intensifier was applied to the both beams for dual-purpose. On the other hand, for reducing background in a neutron transmission spectrum, test measurements using a gadolinium-type neutron grid were performed with a cold neutron source at Hokkaido University. In addition, the simulations of the neutron and X-ray transmissions for various substances were performed using the PHITS code. A data analysis procedure for estimating the substance of sample was investigated through the simulations.
Han, Myung-Geun; Garlow, Joseph A.; Marshall, Matthew S. J.; ...
2017-03-23
The ability to map out electrostatic potentials in materials is critical for the development and the design of nanoscale electronic and spintronic devices in modern industry. Electron holography has been an important tool for revealing electric and magnetic field distributions in microelectronics and magnetic-based memory devices, however, its utility is hindered by several practical constraints, such as charging artifacts and limitations in sensitivity and in field of view. In this article, we report electron-beam-induced-current (EBIC) and secondary-electron voltage-contrast (SE-VC) with an aberration-corrected electron probe in a transmission electron microscope (TEM), as complementary techniques to electron holography, to measure electric fieldsmore » and surface potentials, respectively. These two techniques were applied to ferroelectric thin films, multiferroic nanowires, and single crystals. Electrostatic potential maps obtained by off-axis electron holography were compared with EBIC and SE-VC to show that these techniques can be used as a complementary approach to validate quantitative results obtained from electron holography analysis.« less
Burlaud-Gaillard, Julien; Sellin, Caroline; Georgeault, Sonia; Uzbekov, Rustem; Lebos, Claude; Guillaume, Jean-Marc; Roingeard, Philippe
2014-01-01
The intracellular morphogenesis of flaviviruses has been well described, but flavivirus release from the host cell remains poorly documented. We took advantage of the optimized production of an attenuated chimeric yellow fever/dengue virus for vaccine purposes to study this phenomenon by microscopic approaches. Scanning electron microscopy (SEM) showed the release of numerous viral particles at the cell surface through a short-lived process. For transmission electron microscopy (TEM) studies of the intracellular ultrastructure of the small number of cells releasing viral particles at a given time, we developed a new correlative microscopy method: CSEMTEM (for correlative scanning electron microscopy - transmission electron microscopy). CSEMTEM analysis suggested that chimeric flavivirus particles were released as individual particles, in small exocytosis vesicles, via a regulated secretory pathway. Our morphological findings provide new insight into interactions between flaviviruses and cells and demonstrate that CSEMTEM is a useful new method, complementary to SEM observations of biological events by intracellular TEM investigations.
Burlaud-Gaillard, Julien; Sellin, Caroline; Georgeault, Sonia; Uzbekov, Rustem; Lebos, Claude; Guillaume, Jean-Marc; Roingeard, Philippe
2014-01-01
The intracellular morphogenesis of flaviviruses has been well described, but flavivirus release from the host cell remains poorly documented. We took advantage of the optimized production of an attenuated chimeric yellow fever/dengue virus for vaccine purposes to study this phenomenon by microscopic approaches. Scanning electron microscopy (SEM) showed the release of numerous viral particles at the cell surface through a short-lived process. For transmission electron microscopy (TEM) studies of the intracellular ultrastructure of the small number of cells releasing viral particles at a given time, we developed a new correlative microscopy method: CSEMTEM (for correlative scanning electron microscopy - transmission electron microscopy). CSEMTEM analysis suggested that chimeric flavivirus particles were released as individual particles, in small exocytosis vesicles, via a regulated secretory pathway. Our morphological findings provide new insight into interactions between flaviviruses and cells and demonstrate that CSEMTEM is a useful new method, complementary to SEM observations of biological events by intracellular TEM investigations. PMID:24681578
Electron beam assisted field evaporation of insulating nanowires/tubes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Blanchard, N. P., E-mail: nicholas.blanchard@univ-lyon1.fr; Niguès, A.; Choueib, M.
2015-05-11
We demonstrate field evaporation of insulating materials, specifically BN nanotubes and undoped Si nanowires, assisted by a convergent electron beam. Electron irradiation leads to positive charging at the nano-object's apex and to an important increase of the local electric field thus inducing field evaporation. Experiments performed both in a transmission electron microscope and in a scanning electron microscope are presented. This technique permits the selective evaporation of individual nanowires in complex materials. Electron assisted field evaporation could be an interesting alternative or complementary to laser induced field desorption used in atom probe tomography of insulating materials.
Wu, J.S.; Kim, A. M.; Bleher, R.; Myers, B.D.; Marvin, R. G.; Inada, H.; Nakamura, K.; Zhang, X.F.; Roth, E.; Li, S.Y.; Woodruff, T. K.; O'Halloran, T. V.; Dravid, Vinayak P.
2013-01-01
A dedicated analytical scanning transmission electron microscope (STEM) with dual energy dispersive spectroscopy (EDS) detectors has been designed for complementary high performance imaging as well as high sensitivity elemental analysis and mapping of biological structures. The performance of this new design, based on a Hitachi HD-2300A model, was evaluated using a variety of biological specimens. With three imaging detectors, both the surface and internal structure of cells can be examined simultaneously. The whole-cell elemental mapping, especially of heavier metal species that have low cross-section for electron energy loss spectroscopy (EELS), can be faithfully obtained. Optimization of STEM imaging conditions is applied to thick sections as well as thin sections of biological cells under low-dose conditions at room- and cryogenic temperatures. Such multimodal capabilities applied to soft/biological structures usher a new era for analytical studies in biological systems. PMID:23500508
Guinel, M J-F; Brodusch, N; Verde-Gómez, Y; Escobar-Morales, B; Gauvin, R
2013-10-01
Carbon nanotubes (CNTs) decorated with platinum (Pt) nanoparticles (NPs) have been characterized using a cold field-emission scanning electron microscope (SEM) and a high resolution field-emission transmission electron microscope (TEM). With this particular composite material, the complementary nature of the two instruments was demonstrated. Although the long CNTs were found to be mostly bent and defective in some parts, the nucleation of Pt occurred randomly and uniformly covered the CNTs. The NPs displayed a large variation in size, were sometimes defective with twins and stacking faults, and were found to be faceted with the presence of surface steps. The shape and size of the NPs and the presence of defects may have significant consequences on the activity of the Pt catalyst material. Also, thin layers of platinum oxide were identified on the surface of some NPs. © 2013 The Authors Journal of Microscopy © 2013 Royal Microscopical Society.
Strong electron-hole exchange in coherently coupled quantum dots.
Fält, Stefan; Atatüre, Mete; Türeci, Hakan E; Zhao, Yong; Badolato, Antonio; Imamoglu, Atac
2008-03-14
We have investigated few-body states in vertically stacked quantum dots. Because of a small interdot tunneling rate, the coupling in our system is in a previously unexplored regime where electron-hole exchange plays a prominent role. By tuning the gate bias, we are able to turn this coupling off and study a complementary regime where total electron spin is a good quantum number. The use of differential transmission allows us to obtain unambiguous signatures of the interplay between electron and hole-spin interactions. Small tunnel coupling also enables us to demonstrate all-optical charge sensing, where a conditional exciton energy shift in one dot identifies the charging state of the coupled partner.
Composition, speciation and distribution of iron minerals in Imperata cylindrica.
Amils, Ricardo; de la Fuente, Vicenta; Rodríguez, Nuria; Zuluaga, Javier; Menéndez, Nieves; Tornero, Jesús
2007-05-01
A comparative study of the roots, rhizomes and leaves of an iron hyperaccumulator plant, Imperata cylindrica, isolated from the banks of an extreme acidic environment, using complementary techniques: Mösbauer spectroscopy (MS), X-ray diffraction (XRD), scanning electron microscopy (SEM) coupled to energy-dispersive X-ray microanalysis (EDAX) and transmission electron microscopy (TEM), has shown that two main biominerals, jarosite and ferrihydrate-ferritin, accumulate in the different tissues. Jarosite accumulates mainly in roots and rhizomes, while ferritin has been detected in all the structures. A model of iron management in I. cylindrica is presented.
Wu, J S; Kim, A M; Bleher, R; Myers, B D; Marvin, R G; Inada, H; Nakamura, K; Zhang, X F; Roth, E; Li, S Y; Woodruff, T K; O'Halloran, T V; Dravid, Vinayak P
2013-05-01
A dedicated analytical scanning transmission electron microscope (STEM) with dual energy dispersive spectroscopy (EDS) detectors has been designed for complementary high performance imaging as well as high sensitivity elemental analysis and mapping of biological structures. The performance of this new design, based on a Hitachi HD-2300A model, was evaluated using a variety of biological specimens. With three imaging detectors, both the surface and internal structure of cells can be examined simultaneously. The whole-cell elemental mapping, especially of heavier metal species that have low cross-section for electron energy loss spectroscopy (EELS), can be faithfully obtained. Optimization of STEM imaging conditions is applied to thick sections as well as thin sections of biological cells under low-dose conditions at room and cryogenic temperatures. Such multimodal capabilities applied to soft/biological structures usher a new era for analytical studies in biological systems. Copyright © 2013 Elsevier B.V. All rights reserved.
Resistive switching behavior in oxygen ion irradiated TiO2-x films
NASA Astrophysics Data System (ADS)
Barman, A.; Saini, C. P.; Sarkar, P. K.; Bhattacharjee, G.; Bhattacharya, G.; Srivastava, S.; Satpati, B.; Kanjilal, D.; Ghosh, S. K.; Dhar, S.; Kanjilal, A.
2018-02-01
The room temperature resistive switching behavior in 50 keV O+-ion irradiated TiO2-x layers at an ion fluence of 5 × 1016 ions cm-2 is reported. A clear transformation from columnar to layered polycrystalline films is revealed by transmission electron microscopy with increasing ion fluence, while the complementary electron energy loss spectroscopy suggests an evolution of oxygen vacancy (OV) in TiO2-x matrix. This is further verified by determining electron density with the help of x-ray reflectivity. Both local and device current-voltage measurements illustrate that the ion-beam induced OVs play a key role in bistable resistive switching mechanism.
The study of 'microsurfaces' using thermal desorption spectroscopy
NASA Technical Reports Server (NTRS)
Thomas, M. E.; Poppa, H.; Pound, G. M.
1979-01-01
The use of a newly combined ultrahigh vacuum technique for studying continuous and particulate evaporated thin films using thermal desorption spectroscopy (TDS), transmission electron microscopy (TEM), and transmission electron diffraction (TED) is discussed. It is shown that (1) CO thermal desorption energies of epitaxially deposited (111) Ni and (111) Pd surfaces agree perfectly with previously published data on bulk (111) single crystal, (2) contamination and surface structural differences can be detected using TDS as a surface probe and TEM as a complementary technique, and (3) CO desorption signals from deposited metal coverages of one-thousandth of a monolayer should be detectable. These results indicate that the chemisorption properties of supported 'microsurfaces' of metals can now be investigated with very high sensitivity. The combined use of TDS and TEM-TED experimental methods is a very powerful technique for fundamental studies in basic thin film physics and in catalysis.
Imaging electron motion in graphene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bhandari, Sagar; Westervelt, Robert M.
A cooled scanning probe microscope (SPM) is an ideal tool to image electronic motion in graphene: the SPM tip acts as a scanning gate, which interacts with the electron gas below. We introduce the technique using our group's previous work on imaging electron flow from a quantum point contact in a GaAs 2DEG and tuning an InAs quantum dot in an InAs/InP nanowire. Carriers in graphene have very different characteristics: electrons and holes travel at a constant speed with no bandgap, and they pass through potential barriers via Klein tunneling. In this paper, we review the extension of SPM imagingmore » techniques to graphene. We image the cyclotron orbits passing between two narrow contacts in a single-atomic-layer graphene device in a perpendicular magnetic field. Magnetic focusing produces a peak in transmission between the contacts when the cyclotron diameter is equal to the contact spacing. The charged SPM tip deflects electrons passing from one contact to the other, changing the transmission when it interrupts the flow. By displaying the change in transmission as the tip is raster scanned above the sample, an image of flow is obtained. In addition, we have developed a complementary technique to image electronic charge using a cooled scanning capacitance microscope (SCM) that uses a sensitive charge preamplifier near the SPM tip to achieve a charge noise level 0.13 e Hz -1/2 with high spatial resolution 100 nm. The cooled SPM and SCM can be used to probe the motion of electrons on the nanoscale in graphene devices.« less
Imaging electron motion in graphene
Bhandari, Sagar; Westervelt, Robert M.
2017-01-05
A cooled scanning probe microscope (SPM) is an ideal tool to image electronic motion in graphene: the SPM tip acts as a scanning gate, which interacts with the electron gas below. We introduce the technique using our group's previous work on imaging electron flow from a quantum point contact in a GaAs 2DEG and tuning an InAs quantum dot in an InAs/InP nanowire. Carriers in graphene have very different characteristics: electrons and holes travel at a constant speed with no bandgap, and they pass through potential barriers via Klein tunneling. In this paper, we review the extension of SPM imagingmore » techniques to graphene. We image the cyclotron orbits passing between two narrow contacts in a single-atomic-layer graphene device in a perpendicular magnetic field. Magnetic focusing produces a peak in transmission between the contacts when the cyclotron diameter is equal to the contact spacing. The charged SPM tip deflects electrons passing from one contact to the other, changing the transmission when it interrupts the flow. By displaying the change in transmission as the tip is raster scanned above the sample, an image of flow is obtained. In addition, we have developed a complementary technique to image electronic charge using a cooled scanning capacitance microscope (SCM) that uses a sensitive charge preamplifier near the SPM tip to achieve a charge noise level 0.13 e Hz -1/2 with high spatial resolution 100 nm. The cooled SPM and SCM can be used to probe the motion of electrons on the nanoscale in graphene devices.« less
Electrostatically Driven Nanoballoon Actuator.
Barzegar, Hamid Reza; Yan, Aiming; Coh, Sinisa; Gracia-Espino, Eduardo; Dunn, Gabriel; Wågberg, Thomas; Louie, Steven G; Cohen, Marvin L; Zettl, Alex
2016-11-09
We demonstrate an inflatable nanoballoon actuator based on geometrical transitions between the inflated (cylindrical) and collapsed (flattened) forms of a carbon nanotube. In situ transmission electron microscopy experiments employing a nanoelectromechanical manipulator show that a collapsed carbon nanotube can be reinflated by electrically charging the nanotube, thus realizing an electrostatically driven nanoballoon actuator. We find that the tube actuator can be reliably cycled with only modest control voltages (few volts) with no apparent wear or fatigue. A complementary theoretical analysis identifies critical parameters for nanotube nanoballoon actuation.
Conductivity and local structure in LaNiO3
NASA Astrophysics Data System (ADS)
Fowlie, Jennifer; Gibert, Marta; Tieri, Giulio; Gloter, Alexandre; à+/-Iguez, Jorge; Filippetti, Alessio; Catalano, Sara; Gariglio, Stefano; StéPhan, Odile; Triscone, Jean-Marc
In this study we approach the thickness-dependence of the properties of LaNiO3 films along multiple, complementary avenues: sophisticated ab initio calculations, scanning transmission electron microscopy and electronic transport. Specifically, we find an unexpected maximum in conductivity in films of thickness 6 - 10 unit cells (3 nm) for several series of LaNiO3 films. Ab initio transport based on the detailed crystal structure also reveals a maximum in conductivity at the same thickness. In agreement with the structure obtained from scanning transmission electron microscopy (STEM), our simulated structures reveal that the substrate- and surface-induced distortions lead to three types of local structure (heterointerface, interior-layer, surface). Based on this observation, a 3-element parallel conductor model neatly reproduces the trend of conductivity with thickness. This study addresses the question of how structural distortions at the atomic scale evolve in a thin film under the influence of the substrate and the surface. This topic is key to the understanding of the physics of heterostructures and the design of functional oxides.
Prestat, Eric; Kulzick, Matthew A; Dietrich, Paul J; Smith, Mr Matthew; Tien, Mr Eu-Pin; Burke, M Grace; Haigh, Sarah J; Zaluzec, Nestor J
2017-08-18
We have developed a new experimental platform for in situ scanning transmission electron microscope (STEM) energy dispersive X-ray spectroscopy (EDS) which allows real time, nanoscale, elemental and structural changes to be studied at elevated temperature (up to 1000 °C) and pressure (up to 1 atm). Here we demonstrate the first application of this approach to understand complex structural changes occurring during reduction of a bimetallic catalyst, PdCu supported on TiO 2 , synthesized by wet impregnation. We reveal a heterogeneous evolution of nanoparticle size, distribution, and composition with large differences in reduction behavior for the two metals. We show that the data obtained is complementary to in situ STEM electron energy loss spectroscopy (EELS) and when combined with in situ X-ray absorption spectroscopy (XAS) allows correlation of bulk chemical state with nanoscale changes in elemental distribution during reduction, facilitating new understanding of the catalytic behavior for this important class of materials. © 2017 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.
Electron Waiting Times in Mesoscopic Conductors
NASA Astrophysics Data System (ADS)
Albert, Mathias; Haack, Géraldine; Flindt, Christian; Büttiker, Markus
2012-05-01
Electron transport in mesoscopic conductors has traditionally involved investigations of the mean current and the fluctuations of the current. A complementary view on charge transport is provided by the distribution of waiting times between charge carriers, but a proper theoretical framework for coherent electronic systems has so far been lacking. Here we develop a quantum theory of electron waiting times in mesoscopic conductors expressed by a compact determinant formula. We illustrate our methodology by calculating the waiting time distribution for a quantum point contact and find a crossover from Wigner-Dyson statistics at full transmission to Poisson statistics close to pinch-off. Even when the low-frequency transport is noiseless, the electrons are not equally spaced in time due to their inherent wave nature. We discuss the implications for renewal theory in mesoscopic systems and point out several analogies with level spacing statistics and random matrix theory.
Railean-Plugaru, Viorica; Pomastowski, Pawel; Kowalkowski, Tomasz; Sprynskyy, Myroslav; Buszewski, Boguslaw
2018-04-01
Asymmetric flow field-flow fractionation coupled with use of ultraviolet-visible, multiangle light scattering (MALLS), and dynamic light scattering (DLS) detectors was used for separation and characterization of biologically synthesized silver composites in two liquid compositions. Moreover, to supplement the DLS/MALLS information, various complementary techniques such as transmission electron spectroscopy, Fourier transform infrared spectroscopy, and matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS) were used. The hydrodynamic diameter and the radius of gyration of silver composites were slightly larger than the sizes obtained by transmission electron microscopy (TEM). Moreover, the TEM results revealed the presence of silver clusters and even several morphologies, including multitwinned. Additionally, MALDI-TOF MS examination showed that the particles have an uncommon cluster structure. It can be described as being composed of two or more silver clusters. The organic surface of the nanoparticles can modify their dispersion. We demonstrated that the variation of the silver surface coating directly influenced the migration rate of biologically synthesized silver composites. Moreover, this study proves that the fractionation mechanism of silver biocolloids relies not only on the particle size but also on the type and mass of the surface coatings. Because silver nanoparticles typically have size-dependent cytotoxicity, this behavior is particularly relevant for biomedical applications. Graphical abstract Workflow for asymmetric flow field-flow fractionation of natural biologically synthesized silver nanocomposites.
Detailed Investigation of Core-Shell Precipitates in a Cu-Containing High Entropy Alloy
NASA Astrophysics Data System (ADS)
Alam, T.; Gwalani, B.; Viswanathan, G.; Fraser, H.; Banerjee, R.
2018-05-01
Due to the competing influences of configurational entropy and enthalpy of mixing, in recent years, secondary (including intermetallic) phases have been reported in many high entropy alloy (HEA) systems. These secondary phases offer great potential in terms of strengthening the HEA beyond the solid solution strengthening effects, and as such are of great interest in regards to alloy design for engineering applications. The present research investigates novel nano-scale core-shell precipitates forming within the disordered bcc matrix phase of an Al2CrCuFeNi2 HEA, utilizing complementary high-resolution microscopy techniques of atom probe tomography (APT) and transmission electron microscopy (TEM). The size, morphology, and local chemistry of these core-shell precipitates was measured by APT, and the composition was further corroborated by high-resolution scanning transmission electron microscopy-energy dispersive spectroscopy in an aberration-corrected TEM. Furthermore, high-resolution TEM imaging of the core-shell structure indicates that the Cu-rich core exhibits a bcc crystal structure.
Yang, Wanggui; Chen, Yali; Wong, Man Shing; Lo, Pik Kwan
2012-10-08
One of the most important criteria for the successful DNA-templated polymerization to generate fully synthetic biomimetic polymers is to design the complementary structural monomers, which assemble to the templates strongly and precisely before carrying polymerization. In this study, water-soluble, laterally thymine-substituted donor-acceptor π-conjugated molecules were designed and synthesized to self-assemble with complementary oligoadenines templates, dA(20) and dA(40), into stable and tubular assemblies through noncovalent interactions including π-π stacking, dipole-dipole interactions, and the complementary adenine-thymine (A-T) hydrogen-bonding. UV-vis, fluorescence, circular dichroism (CD), atomic force microscopy (AFM), and transmission electron microscopy (TEM) techniques were used to investigate the formation of highly robust nanofibrous structures. Our results have demonstrated for the first time that the dipole-dipole interactions are stronger and useful to reinforce the assembly of donor-acceptor π-conjugated molecules to DNA templates and the formation of the stable and robust supramolecular nanofibrous complexes together with the complementary hydrogen bonding interactions. This provides an initial step toward DNA-templated polymerization to create fully synthetic DNA-mimetic polymers for biotechnological applications. This study also presents an opportunity to precisely position donor-acceptor type molecules in a controlled manner and tailor-make advanced materials for various biotechnological applications.
Ferroelectric size effects in multiferroic BiFeO3 thin films
NASA Astrophysics Data System (ADS)
Chu, Y. H.; Zhao, T.; Cruz, M. P.; Zhan, Q.; Yang, P. L.; Martin, L. W.; Huijben, M.; Yang, C. H.; Zavaliche, F.; Zheng, H.; Ramesh, R.
2007-06-01
Ferroelectric size effects in multiferroic BiFeO3 have been studied using a host of complementary measurements. The structure of such epitaxial films has been investigated using atomic force microscopy, transmission electron microscopy, and x-ray diffraction. The crystal structure of the films has been identified as a monoclinic phase, which suggests that the polarization direction is close to ⟨111⟩. Such behavior has also been confirmed by piezoforce microscopy measurements. That also reveals that the ferroelectricity is down to at least 2nm.
Behavior of a chemically doped graphene junction
NASA Astrophysics Data System (ADS)
Farmer, Damon B.; Lin, Yu-Ming; Afzali-Ardakani, Ali; Avouris, Phaedon
2009-05-01
Polyethylene imine and diazonium salts are used as complementary molecular dopants to engineer a doping profile in a graphene transistor. Electronic transport in this device reveals the presence of two distinct resistance maxima, alluding to neutrality point separation and subsequent formation of a spatially abrupt junction. Carrier mobility in this device is not significantly affected by molecular doping or junction formation, and carrier transmission is found to scale inversely with the effective channel length of the device. Chemical dilutions are used to modify the dopant concentration and, in effect, alter the properties of the junction.
A metamaterial terahertz modulator based on complementary planar double-split-ring resonator
NASA Astrophysics Data System (ADS)
Wang, Chang-hui; Kuang, Deng-feng; Chang, Sheng-jiang; Lin, Lie
2013-07-01
A metamaterial based on complementary planar double-split-ring resonator (DSRR) structure is presented and demonstrated, which can optically tune the transmission of the terahertz (THz) wave. Unlike the traditional DSRR metamaterials, the DSRR discussed in this paper consists of two split rings connected by two bridges. Numerical simulations with the finite-difference time-domain (FDTD) method reveal that the transmission spectra of the original and the complementary metamaterials are both in good agreement with Babinet's principle. Then by increasing the carrier density of the intrinsic GaAs substrate, the magnetic response of the complementary special DSRR metamaterial can be weakened or even turned off. This metamaterial structure is promised to be a narrow-band THz modulator with response time of several nanoseconds.
Guo, Yinghui; Yan, Lianshan; Pan, Wei; Luo, Bin; Wen, Kunhua; Guo, Zhen; Luo, Xiangang
2012-10-22
We investigate a plasmonic waveguide system based on side-coupled complementary split-ring resonators (CSRR), which exhibits electromagnetically induced transparency (EIT)-like transmission. LC resonance model is utilized to explain the electromagnetic responses of CSRR, which is verified by simulation results of finite difference time domain method. The electromagnetic responses of CSRR can be flexible handled by changing the asymmetry degree of the structure and the width of the metallic baffles. Cascaded CSRRs also have been studied to obtain EIT-like transmission at visible and near-infrared region, simultaneously.
In-Depth View of the Structure and Growth of SnO2 Nanowires and Nanobrushes.
Stuckert, Erin P; Geiss, Roy H; Miller, Christopher J; Fisher, Ellen R
2016-08-31
Strategic application of an array of complementary imaging and diffraction techniques is critical to determine accurate structural information on nanomaterials, especially when also seeking to elucidate structure-property relationships and their effects on gas sensors. In this work, SnO2 nanowires and nanobrushes grown via chemical vapor deposition (CVD) displayed the same tetragonal SnO2 structure as revealed via powder X-ray diffraction bulk crystallinity data. Additional characterization using a range of electron microscopy imaging and diffraction techniques, however, revealed important structure and morphology distinctions between the nanomaterials. Tailoring scanning transmission electron microscopy (STEM) modes combined with transmission electron backscatter diffraction (t-EBSD) techniques afforded a more detailed view of the SnO2 nanostructures. Indeed, upon deeper analysis of individual wires and brushes, we discovered that, despite a similar bulk structure, wires and brushes grew with different crystal faces and lattice spacings. Had we not utilized multiple STEM diffraction modes in conjunction with t-EBSD, differences in orientation related to bristle density would have been overlooked. Thus, it is only through a methodical combination of several structural analysis techniques that precise structural information can be reliably obtained.
Autonomous Filling of Grain-Boundary Cavities during Creep Loading in Fe-Mo Alloys
NASA Astrophysics Data System (ADS)
Zhang, S.; Fang, H.; Gramsma, M. E.; Kwakernaak, C.; Sloof, W. G.; Tichelaar, F. D.; Kuzmina, M.; Herbig, M.; Raabe, D.; Brück, E.; van der Zwaag, S.; van Dijk, N. H.
2016-10-01
We have investigated the autonomous repair of creep damage by site-selective precipitation in a binary Fe-Mo alloy (6.2 wt pct Mo) during constant-stress creep tests at temperatures of 813 K, 823 K, and 838 K (540 °C, 550 °C, and 565 °C). Scanning electron microscopy studies on the morphology of the creep-failed samples reveal irregularly formed deposits that show a close spatial correlation with the creep cavities, indicating the filling of creep cavities at grain boundaries by precipitation of the Fe2Mo Laves phase. Complementary transmission electron microscopy and atom probe tomography have been used to characterize the precipitation mechanism and the segregation at grain boundaries in detail.
Fridman, Sophie; Rana, Krishen J; Bron, James E
2013-10-01
Aspects of ionoregulatory or mitochondria-rich cell (MRC) differentiation and adaptation in Nile tilapia yolk-sac larvae following transfer from freshwater to elevated salinities, that is, 12.5 and 20 ppt are described. Investigations using immunohistochemistry on whole-mount Nile tilapia larvae using anti- Na⁺/K⁺-ATPase as a primary antibody and Fluoronanogold™ (Nanoprobes) as a secondary immunoprobe allowed fluorescent labeling with the high resolution of confocal scanning laser microscopy combined with the detection of immunolabeled target molecules at an ultrastructural level using transmission electron microscopy (TEM). It reports, for the first time, various developmental stages of MRCs within the epithelial layer of the tail of yolk-sac larvae, corresponding to immature, developing, and mature MRCs, identifiable by their own characteristic ultrastructure and form. Following transfer to hyperosmotic salinities the density of immunogold particles and well as the intricacy of the tubular system appeared to increase. In addition, complementary confocal scanning laser microscopy allowed identification of immunopositive ramifying extensions that appeared to emanate from the basolateral portion of the cell that appeared to be correlated with the localization of subsurface tubular areas displaying immunogold labeled Na⁺/K⁺-ATPase. This integrated approach describes a reliable and repeatable prefixation immunogold labeling technique allowing precise visualization of NaK within target cells combined with a 3D imaging that offers valuable insights into MRC dynamics at an ultrastructural level. Copyright © 2013 Wiley Periodicals, Inc.
NASA Astrophysics Data System (ADS)
Choi, Muhan; Kang, Byungsoo; Yi, Yoonsik; Lee, Seung Hoon; Kim, Inbo; Han, Jae-Hyung; Yi, Minwoo; Ahn, Jaewook; Choi, Choon-Gi
2016-05-01
We introduce a flexible multilayered THz metamaterial designed by using the Babinet's principle with the functionality of narrow band-pass filter. The metamaterial gives us systematic way to design frequency selective surfaces working on intended frequencies and bandwidths. It shows highly enhanced transmission of 80% for the normal incident THz waves due to the strong coupling of the two layers of metamaterial complementary to each other.
NASA Astrophysics Data System (ADS)
Bai, Lihua; Li, Meiya; Liu, Xiaolian; Luoshan, Mengdai; Zhang, Feng; Guo, Kaimo; Zhu, Yongdan; Sun, Beilei; Zhao, Xingzhong
2016-10-01
Graphene (G), TiO2 fusiform nanorods (TiO2NRs) adsorbed with Au nanoparticles (AuNPs) are prepared and blended as multifunctional materials into TiO2 nanocrystalline film to form a novel ternary (G-TiO2NRs-Au) composite photoanode in dye-sensitized solar cells (DSSCs). The effects of G-TiO2NRs-Au on the properties of the photoanode and DSSC are investigated. Results show that, by blending G-TiO2NRs-Au, the light absorption and scattering of the photoanode are obviously improved, and the charge transfer resistance R2 and electron recombination are decreased, resulting in a significant enhancement in the short-circuit current density (J sc) and the photoelectric conversion efficiency (PCE) of the DSSCs. The maximum J sc of 17.66 mA cm-2 and PCE of 8.56% are obtained in the optimal G-TiO2NRs-Au-based DSSC, about 33.6% and 35.0% higher than that obtained in the conventional TiO2-based DSSC. This significant improvement in the performance of the DSSC can be attributed to the ternary composite complementary effects of multi-functions from the surface plasmon resonance of AuNPs, light scattering of TiO2NRs, and the improved dye loading and fast electron transmission channel from graphene. This study provides an effective way of ternary composite complementary enhancement of the J sc and PCE of the DSSCs.
Balancing Hole and Electron Conduction in Ambipolar Split-Gate Thin-Film Transistors.
Yoo, Hocheon; Ghittorelli, Matteo; Lee, Dong-Kyu; Smits, Edsger C P; Gelinck, Gerwin H; Ahn, Hyungju; Lee, Han-Koo; Torricelli, Fabrizio; Kim, Jae-Joon
2017-07-10
Complementary organic electronics is a key enabling technology for the development of new applications including smart ubiquitous sensors, wearable electronics, and healthcare devices. High-performance, high-functionality and reliable complementary circuits require n- and p-type thin-film transistors with balanced characteristics. Recent advancements in ambipolar organic transistors in terms of semiconductor and device engineering demonstrate the great potential of this route but, unfortunately, the actual development of ambipolar organic complementary electronics is currently hampered by the uneven electron (n-type) and hole (p-type) conduction in ambipolar organic transistors. Here we show ambipolar organic thin-film transistors with balanced n-type and p-type operation. By manipulating air exposure and vacuum annealing conditions, we show that well-balanced electron and hole transport properties can be easily obtained. The method is used to control hole and electron conductions in split-gate transistors based on a solution-processed donor-acceptor semiconducting polymer. Complementary logic inverters with balanced charging and discharging characteristics are demonstrated. These findings may open up new opportunities for the rational design of complementary electronics based on ambipolar organic transistors.
Characterization of paired helical filaments by scanning transmission electron microscopy.
Ksiezak-Reding, Hanna; Wall, Joseph S
2005-07-01
Paired helical filaments (PHFs) are abnormal twisted filaments composed of hyperphosphorylated tau protein. They are found in Alzheimer's disease and other neurodegenerative disorders designated as tauopathies. They are a major component of intracellular inclusions known as neurofibrillary tangles (NFTs). The objective of this review is to summarize various structural studies of PHFs in which using scanning transmission electron microscopy (STEM) has been particularly informative. STEM provides shape and mass per unit length measurements important for studying ultrastructural aspects of filaments. These include quantitative comparisons between dispersed and aggregated populations of PHFs as well as comparative studies of PHFs in Alzheimer's disease and other neurodegenerative disorders. Other approaches are also discussed if relevant or complementary to studies using STEM, e.g., application of a novel staining reagent, Nanovan. Our understanding of the PHF structure and the development of PHFs into NFTs is presented from a historical perspective. Others goals are to describe the biochemical and ultrastructural complexity of authentic PHFs, to assess similarities between authentic and synthetic PHFs, and to discuss recent advances in PHF modeling.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lomov, A. A., E-mail: lomov@ftian.ru; Myakon’kikh, A. V.; Chesnokov, Yu. M.
The surface layers of Si(001) substrates subjected to plasma-immersion implantation of helium ions with an energy of 2–5 keV and a dose of 5 × 10{sup 17} cm{sup –2} have been investigated using high-resolution X-ray reflectivity, Rutherford backscattering, and transmission electron microscopy. The electron density depth profile in the surface layer formed by helium ions is obtained, and its elemental and phase compositions are determined. This layer is found to have a complex structure and consist of an upper amorphous sublayer and a layer with a porosity of 30–35% beneath. It is shown that the porous layer has the sharpestmore » boundaries at a lower energy of implantable ions.« less
Complementary periodic diffracting metallic nanohole and nanodipole arrays in the mid-infrared range
NASA Astrophysics Data System (ADS)
Ye, Yong-Hong; Zhang, Jia-Yu; Feng Ma, Hui; Yao, Jie; Wang, Xudong
2012-10-01
Metallic nanohole arrays and metallic nanodipole arrays are fabricated and experimentally characterized. A complementary response is observed in both transmission and reflection. For the metallic nanohole arrays, a peak (dip) in transmission (reflection) is observed at resonance whereas the metallic nanodipole arrays display a dip (peak) in transmission (reflection). The resonant frequency of both the metallic nanohole arrays and the nanodipole arrays depends on the dipole arm length, the incident angle, and the period. The resonant position of the nanohole arrays matches that of its complement, which means that Babinet's principle nearly holds for these structures in the mid-infrared region.
Mapping the layer count of few-layer hexagonal boron nitride at high lateral spatial resolutions
NASA Astrophysics Data System (ADS)
Mohsin, Ali; Cross, Nicholas G.; Liu, Lei; Watanabe, Kenji; Taniguchi, Takashi; Duscher, Gerd; Gu, Gong
2018-01-01
Layer count control and uniformity of two dimensional (2D) layered materials are critical to the investigation of their properties and to their electronic device applications, but methods to map 2D material layer count at nanometer-level lateral spatial resolutions have been lacking. Here, we demonstrate a method based on two complementary techniques widely available in transmission electron microscopes (TEMs) to map the layer count of multilayer hexagonal boron nitride (h-BN) films. The mass-thickness contrast in high-angle annular dark-field (HAADF) imaging in the scanning transmission electron microscope (STEM) mode allows for thickness determination in atomically clean regions with high spatial resolution (sub-nanometer), but is limited by surface contamination. To complement, another technique based on the boron K ionization edge in the electron energy loss spectroscopy spectrum (EELS) of h-BN is developed to quantify the layer count so that surface contamination does not cause an overestimate, albeit at a lower spatial resolution (nanometers). The two techniques agree remarkably well in atomically clean regions with discrepancies within ±1 layer. For the first time, the layer count uniformity on the scale of nanometers is quantified for a 2D material. The methodology is applicable to layer count mapping of other 2D layered materials, paving the way toward the synthesis of multilayer 2D materials with homogeneous layer count.
Electron-beam-evaporated thin films of hafnium dioxide for fabricating electronic devices
Xiao, Zhigang; Kisslinger, Kim
2015-06-17
Thin films of hafnium dioxide (HfO 2) are widely used as the gate oxide in fabricating integrated circuits because of their high dielectric constants. In this paper, the authors report the growth of thin films of HfO 2 using e-beam evaporation, and the fabrication of complementary metal-oxide semiconductor (CMOS) integrated circuits using this HfO 2 thin film as the gate oxide. The authors analyzed the thin films using high-resolution transmission electron microscopy and electron diffraction, thereby demonstrating that the e-beam-evaporation-grown HfO 2 film has a polycrystalline structure and forms an excellent interface with silicon. Accordingly, we fabricated 31-stage CMOS ringmore » oscillator to test the quality of the HfO 2 thin film as the gate oxide, and obtained excellent rail-to-rail oscillation waveforms from it, denoting that the HfO 2 thin film functioned very well as the gate oxide.« less
Atomic characterization of Si nanoclusters embedded in SiO2 by atom probe tomography
2011-01-01
Silicon nanoclusters are of prime interest for new generation of optoelectronic and microelectronics components. Physical properties (light emission, carrier storage...) of systems using such nanoclusters are strongly dependent on nanostructural characteristics. These characteristics (size, composition, distribution, and interface nature) are until now obtained using conventional high-resolution analytic methods, such as high-resolution transmission electron microscopy, EFTEM, or EELS. In this article, a complementary technique, the atom probe tomography, was used for studying a multilayer (ML) system containing silicon clusters. Such a technique and its analysis give information on the structure at the atomic level and allow obtaining complementary information with respect to other techniques. A description of the different steps for such analysis: sample preparation, atom probe analysis, and data treatment are detailed. An atomic scale description of the Si nanoclusters/SiO2 ML will be fully described. This system is composed of 3.8-nm-thick SiO layers and 4-nm-thick SiO2 layers annealed 1 h at 900°C. PMID:21711666
Electronic transport property in Weyl semimetal with local Weyl cone tilt
NASA Astrophysics Data System (ADS)
Jiang, Liwei; Feng, Lanting; Yao, Haibo; Zheng, Yisong
2018-03-01
In realistic materials of Weyl semimetal (WSM), the Weyl cone tilt (WCT) is allowed due to the absence of Lorentz invariance in condensed matter physics. In this context, we theoretically study the electronic transport property in WSM with the local WCT as the scattering mechanism. In so doing, we establish an electronic transport structure of WSM with the WCT occurring only in the central region sandwiched between two pieces of semi-infinite WSM without the WCT. By means of two complementary theoretical approaches, i.e. the continuum-model method and the lattice-model method, the electronic transmission probability, the conductivity and the Fano factor as functions of the incident electron energy are calculated respectively. We find that the WCT can give rise to nontrivial intervalley scattering, as a result, the Klein tunneling is notably suppressed. More importantly, the minimal conductivity of a WSM shifts in energy from the Weyl nodal point. The Fano factor of the shot noise deviates obviously from the sub-Poissonian value in a two dimensional WSM with the WCT.
Yang, Soo In; George, Graham N; Lawrence, John R; Kaminskyj, Susan G W; Dynes, James J; Lai, Barry; Pickering, Ingrid J
2016-10-04
Selenium (Se) is an element of growing environmental concern, because low aqueous concentrations can lead to biomagnification through the aquatic food web. Biofilms, naturally occurring microbial consortia, play numerous important roles in the environment, especially in biogeochemical cycling of toxic elements in aquatic systems. The complexity of naturally forming multispecies biofilms presents challenges for characterization because conventional microscopic techniques require chemical and physical modifications of the sample. Here, multispecies biofilms biotransforming selenium oxyanions were characterized using X-ray fluorescence imaging (XFI) and scanning transmission X-ray microscopy (STXM). These complementary synchrotron techniques required minimal sample preparation and were applied correlatively to the same biofilm areas. Sub-micrometer XFI showed distributions of Se and endogenous metals, while Se K-edge X-ray absorption spectroscopy indicated the presence of elemental Se (Se 0 ). Nanoscale carbon K-edge STXM revealed the distributions of microbial cells, extracellular polymeric substances (EPS), and lipids using the protein, saccharide, and lipid signatures, respectively, together with highly localized Se 0 using the Se L III edge. Transmission electron microscopy showed the electron-dense particle diameter to be 50-700 nm, suggesting Se 0 nanoparticles. The intimate association of Se 0 particles with protein and polysaccharide biofilm components has implications for the bioavailability of selenium in the environment.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yang, Soo In; George, Graham N.; Lawrence, John R.
2016-10-04
Selenium (Se) is an element of growing environmental concern, because low aqueous concentrations can lead to biomagnification through the aquatic food web. Biofilms, naturally occurring microbial consortia, play numerous important roles in the environment, especially in biogeochemical cycling of toxic elements in aquatic systems. The complexity of naturally forming multispecies biofilms presents challenges for characterization because conventional microscopic techniques require chemical and physical modifications of the sample. Here, multispecies biofilms biotransforming selenium oxyanions were characterized using X-ray fluorescence imaging (XFI) and scanning transmission X-ray microscopy (STXM). These complementary synchrotron techniques required minimal sample preparation and were applied correlatively to themore » same biofilm areas. Sub-micrometer XFI showed distributions of Se and endogenous metals, while Se K-edge X-ray absorption spectroscopy indicated the presence of elemental Se (Se0). Nanoscale carbon K-edge STXM revealed the distributions of microbial cells, extracellular polymeric substances (EPS), and lipids using the protein, saccharide, and lipid signatures, respectively, together with highly localized Se0 using the Se LIII edge. Transmission electron microscopy showed the electron-dense particle diameter to be 50–700 nm, suggesting Se0 nanoparticles. The intimate association of Se0 particles with protein and polysaccharide biofilm components has implications for the bioavailability of selenium in the environment.« less
NASA Astrophysics Data System (ADS)
Nakata, Yosuke; Urade, Yoshiro; Nakanishi, Toshihiro; Kitano, Masao
2013-11-01
We investigate theoretically electromagnetic plane-wave scattering by self-complementary metasurfaces. By using Babinet's principle extended to metasurfaces with resistive elements, we show that the frequency-independent transmission and reflection are realized for normal incidence of a circularly polarized plane wave onto a self-complementary metasurface, even if there is diffraction. Next, we consider two special classes of self-complementary metasurfaces. We show that self-complementary metasurfaces with rotational symmetry can act as coherent perfect absorbers, and those with translational symmetry compatible with their self-complementarity can split the incident power equally, even for oblique incidences.
Paradigms for pharmacological characterization of C. elegans synaptic transmission mutants.
Locke, Cody; Berry, Kalen; Kautu, Bwarenaba; Lee, Kyle; Caldwell, Kim; Caldwell, Guy
2008-08-18
The nematode, Caenorhabditis elegans, has become an expedient model for studying neurotransmission. C. elegans is unique among animal models, as the anatomy and connectivity of its nervous system has been determined from electron micrographs and refined by pharmacological assays. In this video, we describe how two complementary neural stimulants, an acetylcholinesterase inhibitor, called aldicarb, and a gamma-aminobutyric acid (GABA) receptor antagonist, called pentylenetetrazole (PTZ), may be employed to specifically characterize signaling at C. elegans neuromuscular junctions (NMJs) and facilitate our understanding of antagonistic neural circuits. Of 302 C. elegans neurons, nineteen GABAergic D-type motor neurons innervate body wall muscles (BWMs), while four GABAergic neurons, called RMEs, innervate head muscles. Conversely, thirty-nine motor neurons express the excitatory neurotransmitter, acetylcholine (ACh), and antagonize GABA transmission at BWMs to coordinate locomotion. The antagonistic nature of GABAergic and cholinergic motor neurons at body wall NMJs was initially determined by laser ablation and later buttressed by aldicarb exposure. Acute aldicarb exposure results in a time-course or dose-responsive paralysis in wild-type worms. Yet, loss of excitatory ACh transmission confers resistance to aldicarb, as less ACh accumulates at worm NMJs, leading to less stimulation of BWMs. Resistance to aldicarb may be observed with ACh-specific or general synaptic function mutants. Consistent with antagonistic GABA and ACh transmission, loss of GABA transmission, or a failure to negatively regulate ACh release, confers hypersensitivity to aldicarb. Although aldicarb exposure has led to the isolation of numerous worm homologs of neurotransmission genes, aldicarb exposure alone cannot efficiently determine prevailing roles for genes and pathways in specific C. elegans motor neurons. For this purpose, we have introduced a complementary experimental approach, which uses PTZ. Neurotransmission mutants display clear phenotypes, distinct from aldicarb-induced paralysis, in response to PTZ. Wild-type worms, as well as mutants with specific inabilities to release or receive ACh, do not show apparent sensitivity to PTZ. However, GABA mutants, as well as general synaptic function mutants, display anterior convulsions in a time-course or dose-responsive manner. Mutants that cannot negatively regulate general neurotransmitter release and, thus, secrete excessive amounts of ACh onto BWMs, become paralyzed on PTZ. The PTZ-induced phenotypes of discrete mutant classes indicate that a complementary approach with aldicarb and PTZ exposure paradigms in C. elegans may accelerate our understanding of neurotransmission. Moreover, videos demonstrating how we perform pharmacological assays should establish consistent methods for C. elegans research.
Parish, Chad M.; Miller, Michael K.
2014-12-09
Nanostructured ferritic alloys (NFAs) exhibit complex microstructures consisting of 100-500 nm ferrite grains, grain boundary solute enrichment, and multiple populations of precipitates and nanoclusters (NCs). Understanding these materials' excellent creep and radiation-tolerance properties requires a combination of multiple atomic-scale experimental techniques. Recent advances in scanning transmission electron microscopy (STEM) hardware and data analysis methods have the potential to revolutionize nanometer to micrometer scale materials analysis. The application of these methods is applied to NFAs as a test case and is compared to both conventional STEM methods as well as complementary methods such as scanning electron microscopy and atom probe tomography.more » In this paper, we review past results and present new results illustrating the effectiveness of latest-generation STEM instrumentation and data analysis.« less
TEM-nanoindentation studies of semiconducting structures.
Le Bourhis, E; Patriarche, G
2007-01-01
This paper reviews the application of nanoindentation coupled with transmission electron microscopy (TEM) to investigations of the plastic behaviour of semiconducting structures and its implication for device design. Instrumented nanoindentation has been developed to extract the mechanical behaviour of small volumes scaled to those encountered in semiconductor heterostructures. We illustrate that TEM is a powerful complementary tool for the study of local plasticity induced by nanoindentation. TEM-nanoindentation allows for detailed understanding of the plastic deformation in semiconducting structures and opens practical routes for improvement of devices. Performances of heterostructures are deteriously affected by dislocations that relax the lattice mismatched layers. Different ways to obtain compliant substructures are being developed in order to concentrate the plastic relaxation underneath the heterostructure. Such approaches allow for mechanical design of micro- and opto-electronic devices to be considered throughout the fabrication process.
Singhal, Chaitali; Ingle, Aviraj; Chakraborty, Dhritiman; Pn, Anoop Krishna; Pundir, C S; Narang, Jagriti
2017-05-01
An impedimetric genosensor was fabricated for detection of hepatitis C virus (HCV) genotype 1 in serum, based on hybridization of the probe with complementary target cDNA from sample. To achieve it, probe DNA complementary to HCVgene was immobilized on the surface of methylene blue (MB) doped silica nanoparticles MB@SiNPs) modified fluorine doped tin oxide (FTO) electrode. The synthesized MB@SiNPs was characterized using scanning electron microscopy (SEM), high resolution transmission electron microscopy (HRTEM) and X-ray diffraction (XRD) pattern. This modified electrode (ssDNA/MB@SiNPs/FTO) served both as a signal amplification platform (due to silica nanoparticles (SiNPs) as well as an electrochemical indicator (due to methylene blue (MB)) for the detection of the HCV DNA in patient serum sample. The genosensor was optimized and evaluated. The sensor showed a dynamic linear range 100-10 6 copies/mL, with a detection limit of 90 copies/mL. The sensor was applied for detection of HCV in sera of hepatitis patient and could be renewed. The half life of the sensor was 4 weeks. The MB@SiNPs/FTO electrode could be used for preparation of other gensensors also. Copyright © 2017 Elsevier B.V. All rights reserved.
Mao, Huihui; Luo, Guanghua; Zhan, Yuxia; Zhang, Jun; Yao, Shuang; Yu, Yang
2018-04-30
The base-quenched probe method for detecting single nucleotide polymorphisms (SNPs) relies on real-time PCR and melting-curve analysis, which might require only one pair of primers and one probe. At present, it has been successfully applied to detect SNPs of multiple genes. However, the mechanism of the base-quenched probe method remains unclear. Therefore, we investigated the possible mechanism of fluorescence quenching by DNA bases in aqueous solution using spectroscopic techniques. It showed that the possible mechanism might be photo-induced electron transfer. We next analyzed electron transfer or transmission between DNA bases and fluorophores. The data suggested that in single-stranded DNA, the electrons of the fluorophore are transferred to the orbital of pyrimidine bases (thymine (T) and cytosine (C)), or that the electron orbitals of the fluorophore are occupied by electrons from purine bases (guanine (G) and adenine (A)), which lead to fluorescence quenching. In addition, the electrons of a fluorophore excited by light can be transmitted along double-stranded DNA, which gives rise to stronger fluorescence quenching. Furthermore, we demonstrated that the quenching efficiency of bases is in the order of G > C ≥ A ≥ T and the capability of electron transmission of base-pairs in double-stranded DNA is in the order of CG[combining low line] ≥ GC[combining low line] > TA[combining low line] ≥ AT[combining low line] (letters representing bases on the complementary strand of the probe are bold and underlined), and the most common commercial fluorophores including FAM, HEX, TET, JOE, and TAMRA could be influenced by bases and are in line with this mechanism and regularity.
Polarization-selective transmission in stacked two-dimensional complementary plasmonic crystal slabs
NASA Astrophysics Data System (ADS)
Iwanaga, Masanobu
2010-02-01
It has been experimentally and numerically shown that transmission at near infrared wavelengths is selectively controlled by polarizations in two-dimensional complementary plasmonic crystal slabs (2D c-PlCSs) of stacked unit cell. This feature is naturally derived by taking account of Babinet's principle. Moreover, the slight structural modification of the unit cell has been found to result in a drastic change in linear optical responses of stacked 2D c-PlCSs. These results substantiate the feasibility of 2D c-PlCSs for producing efficient polarizers with subwavelength thickness.
Characterization of complementary electric field coupled resonant surfaces
NASA Astrophysics Data System (ADS)
Hand, Thomas H.; Gollub, Jonah; Sajuyigbe, Soji; Smith, David R.; Cummer, Steven A.
2008-11-01
We present angle-resolved free-space transmission and reflection measurements of a surface composed of complementary electric inductive-capacitive (CELC) resonators. By measuring the reflection and transmission coefficients of a CELC surface with different polarizations and particle orientations, we show that the CELC only responds to in-plane magnetic fields. This confirms the Babinet particle duality between the CELC and its complement, the electric field coupled LC resonator. Characterization of the CELC structure serves to expand the current library of resonant elements metamaterial designers can draw upon to make unique materials and surfaces.
Shariati, Mohsen
2018-05-15
In this paper the field-effect transistor DNA biosensor for detecting hepatitis B virus (HBV) based on indium tin oxide nanowires (ITO NWs) in label free approach has been fabricated. Because of ITO nanowires intensive conductance and functional modified surface, the probe immobilization and target hybridization were increased strongly. The high resolution transmission electron microscopy (HRTEM) measurement showed that ITO nanowires were crystalline and less than 50nm in diameter. The single-stranded hepatitis B virus DNA (SS-DNA) was immobilized as probe on the Au-modified nanowires. The DNA targets were measured in a linear concentration range from 1fM to 10µM. The detection limit of the DNA biosensor was about 1fM. The time of the hybridization process for defined single strand was 90min. The switching ratio of the biosensor between "on" and "off" state was ~ 1.1 × 10 5 . For sensing the specificity of the biosensor, non-complementary, mismatch and complementary DNA oligonucleotide sequences were clearly discriminated. The HBV biosensor confirmed the highly satisfied specificity for differentiating complementary sequences from non-complementary and the mismatch oligonucleotides. The response time of the DNA sensor was 37s with a high reproducibility. The stability and repeatability of the DNA biosensor showed that the peak current of the biosensor retained 98% and 96% of its initial response for measurements after three and five weeks, respectively. Copyright © 2018 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Augustyns, V.; van Stiphout, K.; Joly, V.; Lima, T. A. L.; Lippertz, G.; Trekels, M.; Menéndez, E.; Kremer, F.; Wahl, U.; Costa, A. R. G.; Correia, J. G.; Banerjee, D.; Gunnlaugsson, H. P.; von Bardeleben, J.; Vickridge, I.; Van Bael, M. J.; Hadermann, J.; Araújo, J. P.; Temst, K.; Vantomme, A.; Pereira, L. M. C.
2017-11-01
γ -Fe and related alloys are model systems of the coupling between structure and magnetism in solids. Since different electronic states (with different volumes and magnetic ordering states) are closely spaced in energy, small perturbations can alter which one is the actual ground state. Here, we demonstrate that the ferromagnetic state of γ -Fe nanoparticles is associated with a tetragonal distortion of the fcc structure. Combining a wide range of complementary experimental techniques, including low-temperature Mössbauer spectroscopy, advanced transmission electron microscopy, and synchrotron radiation techniques, we unambiguously identify the tetragonally distorted ferromagnetic ground state, with lattice parameters a =3.76 (2 )Å and c =3.50 (2 )Å , and a magnetic moment of 2.45(5) μB per Fe atom. Our findings indicate that the ferromagnetic order in nanostructured γ -Fe is generally associated with a tetragonal distortion. This observation motivates a theoretical reassessment of the electronic structure of γ -Fe taking tetragonal distortion into account.
NASA Astrophysics Data System (ADS)
Bai, Zhangpeng; Ji, Yuan; Pi, Yiqun; Yang, Kaixiang; Wang, Li; Zhang, Yinqi; Zhai, Yadi; Yan, Zhengguang; Han, Xiaodong
2018-01-01
Investigating the hygroscopic behavior of haze aerosol particles is essential for understanding their physicochemical properties and their impacts on regional weather and visibility. An environmental scanning electron microscope equipped with a home-made transmission-scattering electron imaging setup and an energy dispersive spectrometer was used for in-situ observations of pure water-soluble (WS) salts and Beijing haze particles. This imaging setup showed obvious advantages for improving the resolution and acquiring internal information of mixed particles in hydrated environments. We measured the deliquescence relative humidity of pure NaCl, NH4NO3, and (NH4)2SO4 by deliquescence-crystallization processes with an accuracy of up to 0.3% RH. The mixed haze particles showed hygroscopic activation like water uptake and morphological changes when they included WS components such as nitrates, sulfates, halides, ammoniums, and alkali metal salts. In addition, the hygroscopic behavior provides complementary information for analyzing possible phases in mixed haze particles.
NASA Astrophysics Data System (ADS)
Zhang, Gaohui; Zhao, Guozhong; Zhang, Shengbo
2012-12-01
The terahertz transmission characteristics of bilayer metallic meshes are studied based on the finite difference time domain method. The bilayer well-shaped grid, the array of complementary square metallic pill and the cross wire-hole array were investigated. The results show that the bilayer well-shaped grid achieves a high-pass of filter function, while the bilayer array of complementary square metallic pill achieves a low-pass of filter function, the bilayer cross wire-hole array achieves a band-pass of filter function. Between two metallic microstructures, the medium need to be deposited. Obviously, medium thicknesses have an influence on the terahertz transmission characteristics of metallic microstructures. Simulation results show that with increasing the thicknesses of the medium the cut-off frequency of high-pass filter and low-pass filter move to low frequency. But the bilayer cross wire-hole array possesses two transmission peaks which display competition effect.
Baier, Sina; Damsgaard, Christian D; Klumpp, Michael; Reinhardt, Juliane; Sheppard, Thomas; Balogh, Zoltan; Kasama, Takeshi; Benzi, Federico; Wagner, Jakob B; Schwieger, Wilhelm; Schroer, Christian G; Grunwaldt, Jan-Dierk
2017-06-01
When using bifunctional core@shell catalysts, the stability of both the shell and core-shell interface is crucial for catalytic applications. In the present study, we elucidate the stability of a CuO/ZnO/Al2O3@ZSM-5 core@shell material, used for one-stage synthesis of dimethyl ether from synthesis gas. The catalyst stability was studied in a hierarchical manner by complementary environmental transmission electron microscopy (ETEM), scanning electron microscopy (SEM) and in situ hard X-ray ptychography with a specially designed in situ cell. Both reductive activation and reoxidation were applied. The core-shell interface was found to be stable during reducing and oxidizing treatment at 250°C as observed by ETEM and in situ X-ray ptychography, although strong changes occurred in the core on a 10 nm scale due to the reduction of copper oxide to metallic copper particles. At 350°C, in situ X-ray ptychography indicated the occurrence of structural changes also on the µm scale, i.e. the core material and parts of the shell undergo restructuring. Nevertheless, the crucial core-shell interface required for full bifunctionality appeared to remain stable. This study demonstrates the potential of these correlative in situ microscopy techniques for hierarchically designed catalysts.
HRTEM low dose: the unfold of the morphed graphene, from amorphous carbon to morphed graphenes.
Calderon, H A; Okonkwo, A; Estrada-Guel, I; Hadjiev, V G; Alvarez-Ramírez, F; Robles Hernández, F C
We present experimental evidence under low-dose conditions transmission electron microscopy for the unfolding of the evolving changes in carbon soot during mechanical milling. The milled soot shows evolving changes as a function of the milling severity or time. Those changes are responsible for the transformation from amorphous carbon to graphenes, graphitic carbon, and highly ordered structures such as morphed graphenes, namely Rh6 and Rh6-II. The morphed graphenes are corrugated layers of carbon with cross-linked covalently nature and sp 2 - or sp 3 -type allotropes. Electron microscopy and numerical simulations are excellent complementary tools to identify those phases. Furthermore, the TEAM 05 microscope is an outstanding tool to resolve the microstructure and prevent any damage to the sample. Other characterization techniques such as XRD, Raman, and XPS fade to convey a true identification of those phases because the samples are usually blends or mixes of the mentioned phases.
Production of fullerenes and single-wall carbon nanotubes by high-temperature pulsed arc discharge
NASA Astrophysics Data System (ADS)
Sugai, Toshiki; Omote, Hideki; Bandow, Shunji; Tanaka, Nobuo; Shinohara, Hisanori
2000-04-01
Fullerenes and single-wall carbon nanotubes (SWNTs) have been produced for the first time by the high-temperature pulsed arc-discharge technique, which has developed in this laboratory. Fullerenes are identified quantitatively by high-performance liquid chromatography (HPLC), and scanning electron microscopy (SEM) and transmission electron microscopy (TEM) observations reveal a significant amount of production of bundles of SWNTs in soot. The pulse arc production of fullerenes and SWNTs favors the high-temperature (⩾1000 °C), long pulses (⩾1 ms) and a heavy rare gas such as Ar or Kr as a buffer gas. We have found that fullerenes and SWNTs have complementary relationships in their early stage of production. The details of the pulsed arc discharge have been obtained by observing the transition from the pulsed arc discharge to the steady arc discharge while increasing the pulse width.
Synthesis of quenchable amorphous diamond
Zeng, Zhidan; Yang, Liuxiang; Zeng, Qiaoshi; ...
2017-08-22
Diamond owes its unique mechanical, thermal, optical, electrical, chemical, and biocompatible materials properties to its complete sp 3-carbon network bonding. Crystallinity is another major controlling factor for materials properties. Although other Group-14 elements silicon and germanium have complementary crystalline and amorphous forms consisting of purely sp 3 bonds, purely sp 3-bonded tetrahedral amorphous carbon has not yet been obtained. In this letter, we combine high pressure and in situ laser heating techniques to convert glassy carbon into “quenchable amorphous diamond”, and recover it to ambient conditions. Our X-ray diffraction, high-resolution transmission electron microscopy and electron energy-loss spectroscopy experiments on themore » recovered sample and computer simulations confirm its tetrahedral amorphous structure and complete sp 3 bonding. This transparent quenchable amorphous diamond has, to our knowledge, the highest density among amorphous carbon materials, and shows incompressibility comparable to crystalline diamond.« less
Synthesis of quenchable amorphous diamond
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zeng, Zhidan; Yang, Liuxiang; Zeng, Qiaoshi
Diamond owes its unique mechanical, thermal, optical, electrical, chemical, and biocompatible materials properties to its complete sp 3-carbon network bonding. Crystallinity is another major controlling factor for materials properties. Although other Group-14 elements silicon and germanium have complementary crystalline and amorphous forms consisting of purely sp 3 bonds, purely sp 3-bonded tetrahedral amorphous carbon has not yet been obtained. In this letter, we combine high pressure and in situ laser heating techniques to convert glassy carbon into “quenchable amorphous diamond”, and recover it to ambient conditions. Our X-ray diffraction, high-resolution transmission electron microscopy and electron energy-loss spectroscopy experiments on themore » recovered sample and computer simulations confirm its tetrahedral amorphous structure and complete sp 3 bonding. This transparent quenchable amorphous diamond has, to our knowledge, the highest density among amorphous carbon materials, and shows incompressibility comparable to crystalline diamond.« less
Breen, Andrew J; Xie, Kelvin Y; Moody, Michael P; Gault, Baptiste; Yen, Hung-Wei; Wong, Christopher C; Cairney, Julie M; Ringer, Simon P
2014-08-01
Atom probe is a powerful technique for studying the composition of nano-precipitates, but their morphology within the reconstructed data is distorted due to the so-called local magnification effect. A new technique has been developed to mitigate this limitation by characterizing the distribution of the surrounding matrix atoms, rather than those contained within the nano-precipitates themselves. A comprehensive chemical analysis enables further information on size and chemistry to be obtained. The method enables new insight into the morphology and chemistry of niobium carbonitride nano-precipitates within ferrite for a series of Nb-microalloyed ultra-thin cast strip steels. The results are supported by complementary high-resolution transmission electron microscopy.
Co/Au multisegmented nanowires: a 3D array of magnetostatically coupled nanopillars
NASA Astrophysics Data System (ADS)
Bran, C.; Ivanov, Yu P.; Kosel, J.; Chubykalo-Fesenko, O.; Vazquez, M.
2017-03-01
Arrays of multisegmented Co/Au nanowires with designed segment lengths and diameters have been prepared by electrodeposition into aluminum oxide templates. The high quality of the Co/Au interface and the crystallographic structure of Co segments have determined by high-resolution transmission electron microscopy. Magnetic hysteresis loop measurements show larger coercivity and squareness of multisegmented nanowires as compared to single segment Co nanowires. The complementary micromagnetic simulations are in good agreement with the experimental results, confirming that the magnetic behavior is defined mainly by magnetostatic coupling between different segments. The proposed structure constitutes an innovative route towards a 3D array of synchronized magnetic nano-oscillators with large potential in nanoelectronics.
V-band electronically reconfigurable metamaterial
NASA Astrophysics Data System (ADS)
Radisic, Vesna; Hester, Jimmy G.; Nguyen, Vinh N.; Caira, Nicholas W.; DiMarzio, Donald; Hilgeman, Theodore; Larouche, Stéphane; Kaneshiro, Eric; Gutierrez-Aitken, Augusto
2017-04-01
In this work, we report on a reconfigurable V-band metamaterial fabricated using an InP heterojunction bipolar transistor production process. As designed and fabricated, the implementation uses complementary split ring resonators (cSRRs) and Schottky diodes in both single unit cell and three unit cell monolithic microwave integrated circuits. Each unit cell has two diodes embedded within the gaps of the cSRRs. Reconfigurability is achieved by applying an external bias that turns the diodes on and off, which effectively controls the resonant property of the structure. In order to measure the metamaterial properties, the unit cells are fed and followed by transmission lines. Measured data show good agreement with simulations and demonstrate that the metamaterial structure exhibits resonance at around 65 GHz that can be switched on and off. The three-unit cell transmission line metamaterial shows a deeper resonance and a larger phase change than a single cell, as expected. These are the first reported reconfigurable metamaterials operating at the V-band using the InP high speed device fabrication process.
Transmission Infrastructure | Energy Analysis | NREL
aggregating geothermal with other complementary generating technologies, in renewable energy zones infrastructure planning and expansion to enable large-scale deployment of renewable energy in the future. Large Energy, FERC, NERC, and the regional entities, transmission providers, generating companies, utilities
Ma, Jianfeng; Ji, Zhe; Zhou, Xia; Zhang, Zhiheng; Xu, Feng
2013-02-01
Transmission electron microscopy (TEM), fluorescence microscopy, and confocal Raman microscopy can be used to characterize ultrastructural and compositional heterogeneity of plant cell walls. In this study, TEM observations revealed the ultrastructural characterization of Cornus alba L. fiber, vessel, axial parenchyma, ray parenchyma, and pit membrane between cells, notably with the ray parenchyma consisting of two well-defined layers. Fluorescence microscopy evidenced that cell corner middle lamella was more lignified than adjacent compound middle lamella and secondary wall with variation in lignification level from cell to cell. In situ Raman images showed that the inhomogeneity in cell wall components (cellulose and lignin) among different cells and within morphologically distinct cell wall layers. As the significant precursors of lignin biosynthesis, the pattern of coniferyl alcohol and aldehyde (joint abbreviation Lignin-CAA for both structures) distribution in fiber cell wall was also identified by Raman images, with higher concentration occurring in the fiber secondary wall where there was the highest cellulose concentration. Moreover, noteworthy was the observation that higher concentration of lignin and very minor amounts of cellulose were visualized in the pit membrane areas. These complementary microanalytical methods provide more accurate and complete information with regard to ultrastructural and compositional characterization of plant cell walls.
Reconfigurable Complementary Logic Circuits with Ambipolar Organic Transistors
Yoo, Hocheon; Ghittorelli, Matteo; Smits, Edsger C. P.; Gelinck, Gerwin H.; Lee, Han-Koo; Torricelli, Fabrizio; Kim, Jae-Joon
2016-01-01
Ambipolar organic electronics offer great potential for simple and low-cost fabrication of complementary logic circuits on large-area and mechanically flexible substrates. Ambipolar transistors are ideal candidates for the simple and low-cost development of complementary logic circuits since they can operate as n-type and p-type transistors. Nevertheless, the experimental demonstration of ambipolar organic complementary circuits is limited to inverters. The control of the transistor polarity is crucial for proper circuit operation. Novel gating techniques enable to control the transistor polarity but result in dramatically reduced performances. Here we show high-performance non-planar ambipolar organic transistors with electrical control of the polarity and orders of magnitude higher performances with respect to state-of-art split-gate ambipolar transistors. Electrically reconfigurable complementary logic gates based on ambipolar organic transistors are experimentally demonstrated, thus opening up new opportunities for ambipolar organic complementary electronics. PMID:27762321
Reconfigurable Complementary Logic Circuits with Ambipolar Organic Transistors.
Yoo, Hocheon; Ghittorelli, Matteo; Smits, Edsger C P; Gelinck, Gerwin H; Lee, Han-Koo; Torricelli, Fabrizio; Kim, Jae-Joon
2016-10-20
Ambipolar organic electronics offer great potential for simple and low-cost fabrication of complementary logic circuits on large-area and mechanically flexible substrates. Ambipolar transistors are ideal candidates for the simple and low-cost development of complementary logic circuits since they can operate as n-type and p-type transistors. Nevertheless, the experimental demonstration of ambipolar organic complementary circuits is limited to inverters. The control of the transistor polarity is crucial for proper circuit operation. Novel gating techniques enable to control the transistor polarity but result in dramatically reduced performances. Here we show high-performance non-planar ambipolar organic transistors with electrical control of the polarity and orders of magnitude higher performances with respect to state-of-art split-gate ambipolar transistors. Electrically reconfigurable complementary logic gates based on ambipolar organic transistors are experimentally demonstrated, thus opening up new opportunities for ambipolar organic complementary electronics.
NASA Astrophysics Data System (ADS)
Hwang, Sooyeon; Kim, Se Young; Chung, Kyung Yoon; Stach, Eric A.; Kim, Seung Min; Chang, Wonyoung
2016-09-01
We take advantage of scanning transmission electron microscopy and electron energy loss spectroscopy to investigate the changes in near-surface electronic structure and quantify the degree of local degradation of Ni-based cathode materials with the layered structure (LiNi0.8Mn0.1Co0.1O2 and LiNi0.4Mn0.3Co0.3O2) after 20 cycles of delithiation and lithiation. Reduction of transition metals occurs in the near-surface region of cathode materials: Mn is the major element to be reduced in the case of relatively Mn-rich composition, while reduction of Ni ions is dominant in Ni-rich materials. The valences of Ni and Mn ions are complementary, i.e., when one is reduced, the other is oxidized in order to maintain charge neutrality. The depth of degradation zone is found to be much deeper in Ni-rich materials. This comparative analysis provides important insights needed for the devising of new cathode materials with high capacity as well as long lifetime.
Effect of Cobalt Particle Size on Acetone Steam Reforming
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sun, Junming; Zhang, He; Yu, Ning
2015-06-11
Carbon-supported cobalt nanoparticles with different particle sizes were synthesized and characterized by complementary characterization techniques such as X-ray diffraction, N-2 sorption, acetone temperature-programmed desorption, transmission electron microscopy, and CO chemisorption. Using acetone steam reforming reaction as a probe reaction, we revealed a volcano-shape curve of the intrinsic activity (turnover frequency of acetone) and the CO2 selectivity as a function of the cobalt particle size with the highest activity and selectivity observed at a particle size of approximately 12.8nm. Our results indicate that the overall performance of acetone steam reforming is related to a combination of particle-size-dependent acetone decomposition, water dissociation,more » and the oxidation state of the cobalt nanoparticles.« less
Depth resolved investigations of boron implanted silicon
NASA Astrophysics Data System (ADS)
Sztucki, M.; Metzger, T. H.; Milita, S.; Berberich, F.; Schell, N.; Rouvière, J. L.; Patel, J.
2003-01-01
We have studied the depth distribution and structure of defects in boron implanted silicon (0 0 1). Silicon wafers were implanted with a boron dose of 6×10 15 ions/cm -2 at 32 keV and went through different annealing treatments. Using diffuse X-ray scattering at grazing incidence and exit angles we are able to distinguish between different kinds of defects (point defect clusters and extrinsic stacking faults on {1 1 1} planes) and to determine their depth distribution as a function of the thermal budget. Cross-section transmission electron microscopy was used to gain complementary information. In addition we have determined the strain distribution caused by the boron implantation as a function of depth from rocking curve measurements.
Laser profilometer module based on a low-temperature cofired ceramic substrate
NASA Astrophysics Data System (ADS)
Heikkinen, Veli; Heikkinen, Mikko; Keranen, Kimmo; Mitikka, Risto S.; Putila, Veli-Pekka; Tukkiniemi, Kari
2005-09-01
We realized a laser profilometer module using low temperature cofired ceramics technology. The device consists of a vertical-cavity surface-emitting laser as the light source and a complementary metal oxide semiconductor image sensor as the detector. The laser transmitter produces a thin light stripe on the measurable object, and the receiver calculates the distance profile using triangulation. Because the design of optoelectronic modules, such as the laser profilometer, is usually carried out using specialized software, its electronic compatibility is very important. We developed a data transmission network using commercial optical, electrical, and mechanical design software, which enabled us to electronically transfer data between the designers. The module electronics were realized with multilayer ceramics technology that eases component assembly by providing precision alignment features in the substrate. The housing was manufactured from aluminum using electronic data transfer from the mechanical design software to the five-axis milling workstation. Target distance profiles were obtained from 100 points with an accuracy varying from 0.1 mm at a 5-cm distance to 2 cm at 1.5 m. The module has potential for distance measurement in portable devices where small size, light weight, and low power consumption are important.
Assessing Strategies Against Gambiense Sleeping Sickness Through Mathematical Modeling
Rock, Kat S; Ndeffo-Mbah, Martial L; Castaño, Soledad; Palmer, Cody; Pandey, Abhishek; Atkins, Katherine E; Ndung’u, Joseph M; Hollingsworth, T Déirdre; Galvani, Alison; Bever, Caitlin; Chitnis, Nakul; Keeling, Matt J
2018-01-01
Abstract Background Control of gambiense sleeping sickness relies predominantly on passive and active screening of people, followed by treatment. Methods Mathematical modeling explores the potential of 3 complementary interventions in high- and low-transmission settings. Results Intervention strategies that included vector control are predicted to halt transmission most quickly. Targeted active screening, with better and more focused coverage, and enhanced passive surveillance, with improved access to diagnosis and treatment, are both estimated to avert many new infections but, when used alone, are unlikely to halt transmission before 2030 in high-risk settings. Conclusions There was general model consensus in the ranking of the 3 complementary interventions studied, although with discrepancies between the quantitative predictions due to differing epidemiological assumptions within the models. While these predictions provide generic insights into improving control, the most effective strategy in any situation depends on the specific epidemiology in the region and the associated costs. PMID:29860287
USDA-ARS?s Scientific Manuscript database
The objective of this study was to compare the growth of HIV-exposed children receiving 1 of 2 complementary foods after prevention of mother-to-child HIV transmission through maternal lifelong antiretroviral therapy (ART). In rural Malawi, 280 HIV-infected pregnant women were consecutively identifi...
Non-flickering 100 m RGB visible light communication transmission based on a CMOS image sensor.
Chow, Chi-Wai; Shiu, Ruei-Jie; Liu, Yen-Chun; Liu, Yang; Yeh, Chien-Hung
2018-03-19
We demonstrate a non-flickering 100 m long-distance RGB visible light communication (VLC) transmission based on a complementary-metal-oxide-semiconductor (CMOS) camera. Experimental bit-error rate (BER) measurements under different camera ISO values and different transmission distances are evaluated. Here, we also experimentally reveal that the rolling shutter effect- (RSE) based VLC system cannot work at long distance transmission, and the under-sampled modulation- (USM) based VLC system is a good choice.
Frequency-Independent Response of Self-Complementary Checkerboard Screens
NASA Astrophysics Data System (ADS)
Urade, Yoshiro; Nakata, Yosuke; Nakanishi, Toshihiro; Kitano, Masao
2015-06-01
This research resolves a long-standing problem on the electromagnetic response of self-complementary metallic screens with checkerboardlike geometry. Although Babinet's principle implies that they show a frequency-independent response, this unusual characteristic has not been observed yet due to the singularities of the metallic point contacts in the checkerboard geometry. We overcome this difficulty by replacing the point contacts with resistive sheets. The proposed structure is prepared and characterized by terahertz time-domain spectroscopy. It is experimentally confirmed that the resistive checkerboard structures exhibit a flat transmission spectrum over 0.1-1.1 THz. It is also demonstrated that self-complementarity can eliminate even the frequency-dependent transmission characteristics of resonant metamaterials.
Correlative cryo-fluorescence light microscopy and cryo-electron tomography of Streptomyces.
Koning, Roman I; Celler, Katherine; Willemse, Joost; Bos, Erik; van Wezel, Gilles P; Koster, Abraham J
2014-01-01
Light microscopy and electron microscopy are complementary techniques that in a correlative approach enable identification and targeting of fluorescently labeled structures in situ for three-dimensional imaging at nanometer resolution. Correlative imaging allows electron microscopic images to be positioned in a broader temporal and spatial context. We employed cryo-correlative light and electron microscopy (cryo-CLEM), combining cryo-fluorescence light microscopy and cryo-electron tomography, on vitrified Streptomyces bacteria to study cell division. Streptomycetes are mycelial bacteria that grow as long hyphae and reproduce via sporulation. On solid media, Streptomyces subsequently form distinct aerial mycelia where cell division leads to the formation of unigenomic spores which separate and disperse to form new colonies. In liquid media, only vegetative hyphae are present divided by noncell separating crosswalls. Their multicellular life style makes them exciting model systems for the study of bacterial development and cell division. Complex intracellular structures have been visualized with transmission electron microscopy. Here, we describe the methods for cryo-CLEM that we applied for studying Streptomyces. These methods include cell growth, fluorescent labeling, cryo-fixation by vitrification, cryo-light microscopy using a Linkam cryo-stage, image overlay and relocation, cryo-electron tomography using a Titan Krios, and tomographic reconstruction. Additionally, methods for segmentation, volume rendering, and visualization of the correlative data are described. © 2014 Elsevier Inc. All rights reserved.
Moore, Katie L; Lombi, Enzo; Zhao, Fang-Jie; Grovenor, Chris R M
2012-04-01
The ability to locate and quantify elemental distributions in plants is crucial to understanding plant metabolisms, the mechanisms of uptake and transport of minerals and how plants cope with toxic elements or elemental deficiencies. High-resolution secondary ion mass spectrometry (SIMS) is emerging as an important technique for the analysis of biological material at the subcellular scale. This article reviews recent work using the CAMECA NanoSIMS to determine elemental distributions in plants. The NanoSIMS is able to map elemental distributions at high resolution, down to 50 nm, and can detect very low concentrations (milligrams per kilogram) for some elements. It is also capable of mapping almost all elements in the periodic table (from hydrogen to uranium) and can distinguish between stable isotopes, which allows the design of tracer experiments. In this review, particular focus is placed upon studying the same or similar specimens with both the NanoSIMS and a wide range of complementary techniques, showing how the advantages of each technique can be combined to provide a fuller data set to address complex scientific questions. Techniques covered include optical microscopy, synchrotron techniques, including X-ray fluorescence and X-ray absorption spectroscopy, transmission electron microscopy, electron probe microanalysis, particle-induced X-ray emission and inductively coupled plasma mass spectrometry. Some of the challenges associated with sample preparation of plant material for SIMS analysis, the artefacts and limitations of the technique and future trends are also discussed.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bedewy, Mostafa; Viswanath, B.; Meshot, Eric R.
In order to understand the collective growth of carbon nanotube (CNT) populations tailoring their properties for many applications is key. During the initial stages of CNT growth by chemical vapor deposition, catalyst nanoparticle formation by thin-film dewetting and the subsequent CNT nucleation processes dictate the CNT diameter distribution, areal density, and alignment. We use in situ environmental transmission electron microscopy (E-TEM) to observe the catalyst annealing, growth, and deactivation stages for a population of CNTs grown from a thin-film catalyst. Complementary in situ electron diffraction and TEM imaging show that, during the annealing step in hydrogen, reduction of the ironmore » oxide catalyst is concomitant with changes in the thin-film morphology; complete dewetting and the formation of a population of nanoparticles is only achieved upon the introduction of the carbon source, acetylene. The dewetting kinetics, i.e., the appearance of distinct nanoparticles, exhibits a sigmoidal (autocatalytic) curve with 95% of all nanoparticles appearing within 6 s. After nanoparticles form, they either nucleate CNTs or remain inactive, with incubation times measured to be as small as 3.5 s. Via E-TEM we also directly observe the crowding and self-alignment of CNTs after dewetting and nucleation. Additionally, in situ electron energy loss spectroscopy reveals that the collective rate of carbon accumulation decays exponentially. We conclude that the kinetics of catalyst formation and CNT nucleation must both be addressed in order to achieve uniform and high CNT density, and their transient behavior may be a primary cause of the well-known nonuniform density of CNT forests.« less
Bedewy, Mostafa; Viswanath, B.; Meshot, Eric R.; ...
2016-05-23
In order to understand the collective growth of carbon nanotube (CNT) populations tailoring their properties for many applications is key. During the initial stages of CNT growth by chemical vapor deposition, catalyst nanoparticle formation by thin-film dewetting and the subsequent CNT nucleation processes dictate the CNT diameter distribution, areal density, and alignment. We use in situ environmental transmission electron microscopy (E-TEM) to observe the catalyst annealing, growth, and deactivation stages for a population of CNTs grown from a thin-film catalyst. Complementary in situ electron diffraction and TEM imaging show that, during the annealing step in hydrogen, reduction of the ironmore » oxide catalyst is concomitant with changes in the thin-film morphology; complete dewetting and the formation of a population of nanoparticles is only achieved upon the introduction of the carbon source, acetylene. The dewetting kinetics, i.e., the appearance of distinct nanoparticles, exhibits a sigmoidal (autocatalytic) curve with 95% of all nanoparticles appearing within 6 s. After nanoparticles form, they either nucleate CNTs or remain inactive, with incubation times measured to be as small as 3.5 s. Via E-TEM we also directly observe the crowding and self-alignment of CNTs after dewetting and nucleation. Additionally, in situ electron energy loss spectroscopy reveals that the collective rate of carbon accumulation decays exponentially. We conclude that the kinetics of catalyst formation and CNT nucleation must both be addressed in order to achieve uniform and high CNT density, and their transient behavior may be a primary cause of the well-known nonuniform density of CNT forests.« less
Chiroplasmonic magnetic gold nanocomposites produced by one-step aqueous method using κ-carrageenan.
Lesnichaya, Marina V; Sukhov, Boris G; Aleksandrova, Galina P; Gasilova, Ekaterina R; Vakul'skaya, Tamara I; Khutsishvili, Spartak S; Sapozhnikov, Anatoliy N; Klimenkov, Igor V; Trofimov, Boris A
2017-11-01
Novel water-soluble chiroplasmonic nanobiocomposites with directly varied gold content were synthesized by a one-step redox method in water using a biocompatible polysaccharide κ-carrageenan (industrial product from algae) as both reducing and stabilizing matrix. The influence of the reactants ratio, temperature, and pH on the reaction was studied and the optimal reaction parameters were found. The structure and the properties of composite nanomaterials were examined in solid state and aqueous solutions by using complementary physical-chemical methods X-ray diffraction analysis, transmission electron microscopy, spectroscopy of electron paramagnetic resonance, atomic absorption and optical spectroscopy, polarimetry including optical rotatory dispersion with registration of interphase-crossbred Cotton effect of a chiral polysaccharide matrix on plasmonic chromophore of gold nanoparticles, dynamic and static light scattering. The new perspective multi-purpose nanocomposites demonstrate a complex of chiroplasmonic and magnetic properties, imparted by both nanoparticles and radicals enriched chiral polysaccharide matrix. Copyright © 2017 Elsevier Ltd. All rights reserved.
Almeida, Trevor P.; Kasama, Takeshi; Muxworthy, Adrian R.; Williams, Wyn; Nagy, Lesleis; Hansen, Thomas W.; Brown, Paul D.; Dunin-Borkowski, Rafal E.
2014-01-01
Magnetite (Fe3O4) is an important magnetic mineral to Earth scientists, as it carries the dominant magnetic signature in rocks, and the understanding of its magnetic recording fidelity provides a critical tool in the field of palaeomagnetism. However, reliable interpretation of the recording fidelity of Fe3O4 particles is greatly diminished over time by progressive oxidation to less magnetic iron oxides, such as maghemite (γ-Fe2O3), with consequent alteration of remanent magnetization potentially having important geological significance. Here we use the complementary techniques of environmental transmission electron microscopy and off-axis electron holography to induce and visualize the effects of oxidation on the magnetization of individual nanoscale Fe3O4 particles as they transform towards γ-Fe2O3. Magnetic induction maps demonstrate a change in both strength and direction of remanent magnetization within Fe3O4 particles in the size range dominant in rocks, confirming that oxidation can modify the original stored magnetic information. PMID:25300366
Almeida, Trevor P; Kasama, Takeshi; Muxworthy, Adrian R; Williams, Wyn; Nagy, Lesleis; Hansen, Thomas W; Brown, Paul D; Dunin-Borkowski, Rafal E
2014-10-10
Magnetite (Fe3O4) is an important magnetic mineral to Earth scientists, as it carries the dominant magnetic signature in rocks, and the understanding of its magnetic recording fidelity provides a critical tool in the field of palaeomagnetism. However, reliable interpretation of the recording fidelity of Fe3O4 particles is greatly diminished over time by progressive oxidation to less magnetic iron oxides, such as maghemite (γ-Fe2O3), with consequent alteration of remanent magnetization potentially having important geological significance. Here we use the complementary techniques of environmental transmission electron microscopy and off-axis electron holography to induce and visualize the effects of oxidation on the magnetization of individual nanoscale Fe3O4 particles as they transform towards γ-Fe2O3. Magnetic induction maps demonstrate a change in both strength and direction of remanent magnetization within Fe3O4 particles in the size range dominant in rocks, confirming that oxidation can modify the original stored magnetic information.
Nano-textured high sensitivity ion sensitive field effect transistors
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hajmirzaheydarali, M.; Sadeghipari, M.; Akbari, M.
2016-02-07
Nano-textured gate engineered ion sensitive field effect transistors (ISFETs), suitable for high sensitivity pH sensors, have been realized. Utilizing a mask-less deep reactive ion etching results in ultra-fine poly-Si features on the gate of ISFET devices where spacing of the order of 10 nm and less is achieved. Incorporation of these nano-sized features on the gate is responsible for high sensitivities up to 400 mV/pH in contrast to conventional planar structures. The fabrication process for this transistor is inexpensive, and it is fully compatible with standard complementary metal oxide semiconductor fabrication procedure. A theoretical modeling has also been presented to predict themore » extension of the diffuse layer into the electrolyte solution for highly featured structures and to correlate this extension with the high sensitivity of the device. The observed ultra-fine features by means of scanning electron microscopy and transmission electron microscopy tools corroborate the theoretical prediction.« less
Nanoscale infrared spectroscopy as a non-destructive probe of extraterrestrial samples.
Dominguez, Gerardo; Mcleod, A S; Gainsforth, Zack; Kelly, P; Bechtel, Hans A; Keilmann, Fritz; Westphal, Andrew; Thiemens, Mark; Basov, D N
2014-12-09
Advances in the spatial resolution of modern analytical techniques have tremendously augmented the scientific insight gained from the analysis of natural samples. Yet, while techniques for the elemental and structural characterization of samples have achieved sub-nanometre spatial resolution, infrared spectral mapping of geochemical samples at vibrational 'fingerprint' wavelengths has remained restricted to spatial scales >10 μm. Nevertheless, infrared spectroscopy remains an invaluable contactless probe of chemical structure, details of which offer clues to the formation history of minerals. Here we report on the successful implementation of infrared near-field imaging, spectroscopy and analysis techniques capable of sub-micron scale mineral identification within natural samples, including a chondrule from the Murchison meteorite and a cometary dust grain (Iris) from NASA's Stardust mission. Complementary to scanning electron microscopy, energy-dispersive X-ray spectroscopy and transmission electron microscopy probes, this work evidences a similarity between chondritic and cometary materials, and inaugurates a new era of infrared nano-spectroscopy applied to small and invaluable extraterrestrial samples.
Compact wideband filter element-based on complementary split-ring resonators
NASA Astrophysics Data System (ADS)
Horestani, Ali K.; Shaterian, Zahra; Withayachumnankul, Withawat; Fumeaux, Christophe; Al-Sarawi, Said; Abbott, Derek
2011-12-01
A double resonance defected ground structure is proposed as a filter element. The structure involves a transmission line loaded with complementary split ring resonators embedded in a dumbbell shape defected ground structure. By using a parametric study, it is demonstrated that the two resonance frequencies can be independently tuned. Therefore the structure can be used for different applications such as dual bandstop filters and wide bandstop filters.
pH-Sensitive Interactions between Cellulose Nanocrystals and DOPC Liposomes.
Navon, Yotam; Radavidson, Harisoa; Putaux, Jean-Luc; Jean, Bruno; Heux, Laurent
2017-09-11
The interaction of 1,2 dioleolyl-sn-glycero-3-phosphatidylcholine (DOPC) vesicles with cellulose nanocrystals (CNCs) using several complementary techniques. Dynamic light scattering, zeta-potential, cryo-transmission electron microscopy and isothermal titration calorimetry (ITC) analyses confirmed the formation of pH-dependent CNC-liposome complexes. ITC was used to characterize the thermodynamic properties of this interaction. Positive values of enthalpy were found at pH lower than 5 where the charge sign of the constituents was opposite. The association was more pronounced at lower pH, as indicated by the higher values of association constant. We suggest that the positive enthalpy is derived from the release of counterions from the particle hydration shell during the association and that the charge of the vesicles plays a significant role in this interaction.
NASA Astrophysics Data System (ADS)
Krsjak, Vladimir; Kuriplach, Jan; Vieh, Christiane; Peng, Lei; Dai, Yong
2018-06-01
In the present work, the specific positron trapping rate of small helium bubbles was empirically derived from positron annihilation lifetime spectroscopy (PALS) and transmission electron microscopy (TEM) studies of Fe9Cr martensitic steels. Both techniques are well known to be sensitive to nanometer-sized helium-filled cavities induced during irradiation in a mixed proton-neutron spectrum of spallation target. Complementary TEM and PALS studies show that positrons are being trapped to these defects at a rate of 1.2 ± 0.8 × 10-14 m3s-1. This suggests that helium bubbles in ferritic/martensitic steels are attractive traps for positrons comparable to mono-vacancies and quantitative analysis of the bubbles by PALS technique is plausible.
Morin-like spin canting in the magnetic CaFe5O7 ferrite: A combined neutron and Mössbauer study
NASA Astrophysics Data System (ADS)
Delacotte, C.; Bréard, Y.; Caignaert, V.; Hardy, V.; Greneche, J. M.; Hébert, S.; Suard, E.; Pelloquin, D.
2017-03-01
Magnetic structure of CaFe5O7 ferrite has been studied jointly from neutron powder diffraction data and spectroscopic Mössbauer measurements in the thermal range from 5 to 500 K. This coupled work highlights three distinct magnetic domains around two specific temperatures: TM=125 K and TN=360 K. The latter corroborates the structural monoclinic-orthorhombic transition previously reported by transmission electron microscopy techniques and X-ray thermodiffractometry. Complementary heat capacity measurements have confirmed this first order transition with a sharp peak at 360 K. Interestingly, this large study has revealed a second magnetic transition associated to a spin rotation at 125 K similar to this one reported by Morin in α-Fe2O3 hematite at TM=260 K.
Khakbaz, Faeze; Mahani, Mohamad
2017-04-15
Carbon quantum dots have been proposed as an effective platform for miRNA detection. Carbon dots were synthesized by citric acid. The synthesized dots were characterized by dynamic light scattering, UV-Vis spectrophotometry, spectrofluorimetry, transmission electron microscopy and FT-IR spectrophotometry. The fluorescence quantum yield of the synthesized dots was determined using quinine sulfate as the standard. The FAM-labeled single stranded DNA, as sensing element, was adsorbed on dots by π-π interaction. The quenching of the dots fluorescence due to fluorescence resonance energy transfer (FRET) was used for mir 9-1 detection. In the presence of the complementary miRNA, the FRET did not take place and the fluorescence was recovered. Copyright © 2017 Elsevier Inc. All rights reserved.
Linear Optical and SERS Study on Metallic Membranes with Subwavelength Complementary Patterns
NASA Astrophysics Data System (ADS)
Hao, Qingzhen; Zeng, Yong; Jensen, Lasse; Werner, Douglas; Crespi, Vincent; Huang, Tony Jun; Interdepartmental Collaboration
2011-03-01
An efficient technique is developed to fabricate optically thin metallic films with subwavelength patterns and their complements simultaneously. By comparing the spectra of the complementary films, we show that Babinet's principle nearly holds in the optical domain. A discrete-dipole approximation can qualitatively describe their spectral dependence on the geometry of the constituent particles and the illuminating polarization. Using pyridine as probe molecules, we studied surface-enhanced Raman spectroscopy (SERS) from the complementary structure. Although the complementary structure posses closely related linear spectra, they have quite different near-field behaviors. For hole arrays, their averaged local field gains as well as the SERS enhancements are strongly correlated to their transmission spectra. We therefore can use cos 4 θ to approximately describe the dependence of the Raman intensity on the excitation polarization angle θ , while the complementary particle arrays present maximal local field gains at wavelengths generally much bigger than their localized surface plasmonic resonant wavelengths.
NASA Astrophysics Data System (ADS)
Schofield, Robert; Lefevre, Harlan; Shaffer, Michael
1989-04-01
Energy-loss scanning transmission ion microscopy (ELSTIM or just STIM), PIXE and electron microprobe techniques are used to investigate certain minor element accumulations in a few spiders and scorpions. STIM and PIXE are used to survey the unsectioned specimens, while electron microprobe techniques are used for higher resolution investigations of several sections of the specimens. Concentration values measured using STIM and PIXE are found to be in satisfactory agreement with those measured using electron probe microanalysis. A garden spider Araneus diadematus is found to contain high concentrations of zinc in a thin layer near the surface of its fangs (reaching 23% of dry weight), and manganese in its marginal teeth (about 5% of dry weight). A wolf spider Alopecosa kochi is found to have similar concentrations of zinc in a layer near the surface of it's fang, and concentrations of manganese reaching 1.5% in a layer beneath the zinc containing layer. A scorpion Centruroides sp. is found to contain high concentrations of iron (reaching 8%) and zinc (reaching 24%) in the tips of teeth on the cheliceral fingers, and manganese (about 5%) in the stinger. The hypothesis that these elements simply harden the cuticle does not appear to explain their segregation patterns.
Rational design of Ag/TiO2 nanosystems by a combined RF-sputtering/sol-gel approach.
Armelao, Lidia; Barreca, Davide; Bottaro, Gregorio; Gasparotto, Alberto; Maccato, Chiara; Tondello, Eugenio; Lebedev, Oleg I; Turner, Stuart; Van Tendeloo, Gustaaf; Sada, Cinzia; Stangar, Urska Lavrencic
2009-12-21
The present work is devoted to the preparation of Ag/TiO(2) nanosystems by an original synthetic strategy, based on the radio-frequency (RF) sputtering of silver particles on titania-based xerogels prepared by the sol-gel (SG) route. This approach takes advantage of the synergy between the microporous xerogel structure and the infiltration power characterizing RF-sputtering, whose combination enables the obtainment of a tailored dispersion of Ag-containing particles into the titania matrix. In addition, the system's chemico-physical features can be tuned further through proper ex situ thermal treatments in air at 400 and 600 degrees C. The synthesized composites are extensively characterized by the joint use of complementary techniques, that is, X-ray photoelectron and X-ray excited Auger electron spectroscopies (XPS, XE-AES), secondary ion mass spectrometry (SIMS), glancing incidence X-ray diffraction (GIXRD), field emission scanning electron microscopy (FE-SEM), transmission electron microscopy (TEM), electron diffraction (ED), high-angle annular dark field scanning TEM (HAADF-STEM), energy-filtered TEM (EF-TEM) and optical absorption spectroscopy. Finally, the photocatalytic performances of selected samples in the decomposition of the azo-dye Plasmocorinth B are preliminarily investigated. The obtained results highlight the possibility of tailoring the system characteristics over a broad range, directly influencing their eventual functional properties.
Spectroscopic fingerprints for charge localization in the organic semiconductor (DOEO)4[HgBr4]·TCE
NASA Astrophysics Data System (ADS)
Koplak, Oksana V.; Chernenkaya, Alisa; Medjanik, Katerina; Brambilla, Alberto; Gloskovskii, Andrei; Calloni, Alberto; Elmers, Hans-Joachim; Schönhense, Gerd; Ciccacci, Franco; Morgunov, Roman B.
2015-05-01
Changes of the electronic structure accompanied by charge localization and a transition to an antiferromagnetic ground state were observed in the organic semiconductor (DOEO)4[HgBr4]·TCE. Localization starts in the temperature region of about 150 K and the antiferromagnetic state occurs below 60 K. The magnetic moment of the crystal contains contributions of inclusions (droplets), and individual paramagnetic centers formed by localized holes and free charge carriers at 2 K. Two types of inclusions of 100-400 nm and 2-5 nm sizes were revealed by transmission electron microscopy. Studying the temperature- and angular dependence of electron spin resonance (ESR) spectra revealed fingerprints of antiferromagnetic contributions as well as paramagnetic resonance spectra of individual localized charge carriers. The results point on coexistence of antiferromagnetic long and short range order as evident from a second ESR line. Photoelectron spectroscopy in the VUV, soft and hard X-ray range shows temperature-dependent effects upon crossing the critical temperatures around 60 K and 150 K. The substantially different probing depths of soft and hard X-ray photoelectron spectroscopy yield information on the surface termination. The combined investigation using complementary methods at the same sample reveals the close relation of changes in the transport properties and in the energy distribution of electronic states.
Two-resonance probe for measuring electron density in low-pressure plasmas
NASA Astrophysics Data System (ADS)
Kim, D. W.; You, S. J.; Kim, S. J.; Kim, J. H.; Oh, W. Y.
2017-04-01
A technique for measuring double-checked electron density using two types of microwave resonance is presented. Simultaneous measurement of the resonances (plasma and quarter-wavelength resonator resonances), which were used for the cutoff probe (CP) and hairpin probe (HP), was achieved by the proposed microwave resonance probe. The developed two-resonance probe (TRP) consists of parallel separated coaxial cables exposing the radiation and detection tips. The structure resembles that of the CP, except the gapped coaxial cables operate not only as a microwave feeder for the CP but also as a U- shaped quarter-wavelength resonator for the HP. By virtue of this structure, the microwave resonances that have typically been used for measuring the electron density for the CP and HP were clearly identified on the microwave transmission spectrum of the TRP. The two types of resonances were measured experimentally under various power and pressure conditions for the plasma. A three-dimensional full-wave simulation model for the TRP is also presented and used to investigate and reproduce the resonances. The electron densities inferred from the resonances were compared and showed good agreement. Quantitative differences between the densities were attributed to the effects of the sheath width and spatial density gradient on the resonances. This accessible technique of using the TRP to obtain double-checked electron densities may be useful for comparative study and provides complementary uses for the CP and HP.
NASA Astrophysics Data System (ADS)
Boatman, Elizabeth Marie
The nanoscale structure of compact bone contains several features that are direct indicators of bulk tissue mechanical properties. Fossil bone tissues represent unique opportunities to understand the compact bone structure/property relationships from a deep time perspective, offering a possible array of new insights into bone diseases, biomimicry of composite materials, and basic knowledge of bioapatite composition and nanoscale bone structure. To date, most work with fossil bone has employed microscale techniques and has counter-indicated the survival of bioapatite and other nanoscale structural features. The obvious disconnect between the use of microscale techniques and the discernment of nanoscale structure has prompted this work. The goal of this study was to characterize the nanoscale constituents of fossil compact bone by applying a suite of diffraction, microscopy, and spectrometry techniques, representing the highest levels of spatial and energy resolution available today, and capable of complementary structural and compositional characterization from the micro- to the nanoscale. Fossil dinosaur and crocodile long bone specimens, as well as modern ratite and crocodile femurs, were acquired from the UC Museum of Paleontology. Preserved physiological features of significance were documented with scanning electron microscopy back-scattered imaging. Electron microprobe wavelength-dispersive X-ray spectroscopy (WDS) revealed fossil bone compositions enriched in fluorine with a complementary loss of oxygen. X-ray diffraction analyses demonstrated that all specimens were composed of apatite. Transmission electron microscopy (TEM) imaging revealed preserved nanocrystallinity in the fossil bones and electron diffraction studies further identified these nanocrystallites as apatite. Tomographic analyses of nanoscale elements imaged by TEM and small angle X-ray scattering were performed, with the results of each analysis further indicating that nanoscale structure is highly conserved in these four fossil specimens. Finally, the results of this study indicate that bioapatite can be preserved in even the most ancient vertebrate specimens, further supporting the idea that fossilization is a preservational process. This work also underlines the importance of using appropriately selected characterization and analytical techniques for the study of fossil bone, especially from the perspective of spatial resolution and the scale of the bone structural features in question.
Metal oxide semiconductor thin-film transistors for flexible electronics
NASA Astrophysics Data System (ADS)
Petti, Luisa; Münzenrieder, Niko; Vogt, Christian; Faber, Hendrik; Büthe, Lars; Cantarella, Giuseppe; Bottacchi, Francesca; Anthopoulos, Thomas D.; Tröster, Gerhard
2016-06-01
The field of flexible electronics has rapidly expanded over the last decades, pioneering novel applications, such as wearable and textile integrated devices, seamless and embedded patch-like systems, soft electronic skins, as well as imperceptible and transient implants. The possibility to revolutionize our daily life with such disruptive appliances has fueled the quest for electronic devices which yield good electrical and mechanical performance and are at the same time light-weight, transparent, conformable, stretchable, and even biodegradable. Flexible metal oxide semiconductor thin-film transistors (TFTs) can fulfill all these requirements and are therefore considered the most promising technology for tomorrow's electronics. This review reflects the establishment of flexible metal oxide semiconductor TFTs, from the development of single devices, large-area circuits, up to entirely integrated systems. First, an introduction on metal oxide semiconductor TFTs is given, where the history of the field is revisited, the TFT configurations and operating principles are presented, and the main issues and technological challenges faced in the area are analyzed. Then, the recent advances achieved for flexible n-type metal oxide semiconductor TFTs manufactured by physical vapor deposition methods and solution-processing techniques are summarized. In particular, the ability of flexible metal oxide semiconductor TFTs to combine low temperature fabrication, high carrier mobility, large frequency operation, extreme mechanical bendability, together with transparency, conformability, stretchability, and water dissolubility is shown. Afterward, a detailed analysis of the most promising metal oxide semiconducting materials developed to realize the state-of-the-art flexible p-type TFTs is given. Next, the recent progresses obtained for flexible metal oxide semiconductor-based electronic circuits, realized with both unipolar and complementary technology, are reported. In particular, the realization of large-area digital circuitry like flexible near field communication tags and analog integrated circuits such as bendable operational amplifiers is presented. The last topic of this review is devoted for emerging flexible electronic systems, from foldable displays, power transmission elements to integrated systems for large-area sensing and data storage and transmission. Finally, the conclusions are drawn and an outlook over the field with a prediction for the future is provided.
Metal oxide semiconductor thin-film transistors for flexible electronics
DOE Office of Scientific and Technical Information (OSTI.GOV)
Petti, Luisa; Vogt, Christian; Büthe, Lars
The field of flexible electronics has rapidly expanded over the last decades, pioneering novel applications, such as wearable and textile integrated devices, seamless and embedded patch-like systems, soft electronic skins, as well as imperceptible and transient implants. The possibility to revolutionize our daily life with such disruptive appliances has fueled the quest for electronic devices which yield good electrical and mechanical performance and are at the same time light-weight, transparent, conformable, stretchable, and even biodegradable. Flexible metal oxide semiconductor thin-film transistors (TFTs) can fulfill all these requirements and are therefore considered the most promising technology for tomorrow's electronics. This reviewmore » reflects the establishment of flexible metal oxide semiconductor TFTs, from the development of single devices, large-area circuits, up to entirely integrated systems. First, an introduction on metal oxide semiconductor TFTs is given, where the history of the field is revisited, the TFT configurations and operating principles are presented, and the main issues and technological challenges faced in the area are analyzed. Then, the recent advances achieved for flexible n-type metal oxide semiconductor TFTs manufactured by physical vapor deposition methods and solution-processing techniques are summarized. In particular, the ability of flexible metal oxide semiconductor TFTs to combine low temperature fabrication, high carrier mobility, large frequency operation, extreme mechanical bendability, together with transparency, conformability, stretchability, and water dissolubility is shown. Afterward, a detailed analysis of the most promising metal oxide semiconducting materials developed to realize the state-of-the-art flexible p-type TFTs is given. Next, the recent progresses obtained for flexible metal oxide semiconductor-based electronic circuits, realized with both unipolar and complementary technology, are reported. In particular, the realization of large-area digital circuitry like flexible near field communication tags and analog integrated circuits such as bendable operational amplifiers is presented. The last topic of this review is devoted for emerging flexible electronic systems, from foldable displays, power transmission elements to integrated systems for large-area sensing and data storage and transmission. Finally, the conclusions are drawn and an outlook over the field with a prediction for the future is provided.« less
ERIC Educational Resources Information Center
Höfer, Juliana; Hoffmann, Falk; Bachmann, Christian
2017-01-01
Despite limited evidence, complementary and alternative medicine treatments are popular in autism spectrum disorder. The aim of this review was to summarize the available evidence on complementary and alternative medicine use frequency in autism spectrum disorder. A systematic search of three electronic databases was performed. All research…
Characterization of Mo/Si multilayer growth on stepped topographies
DOE Office of Scientific and Technical Information (OSTI.GOV)
Boogaard, A. J. R. vcan den; Louis, E.; Zoethout, E.
2011-08-31
Mo/Si multilayer mirrors with nanoscale bilayer thicknesses have been deposited on stepped substrate topographies, using various deposition angles. The multilayer morphology at the stepedge region was studied by cross section transmission electron microscopy. A transition from a continuous- to columnar layer morphology is observed near the step-edge, as a function of the local angle of incidence of the deposition flux. Taking into account the corresponding kinetics and anisotropy in layer growth, a continuum model has been developed to give a detailed description of the height profiles of the individual continuous layers. Complementary optical characterization of the multilayer system using amore » microscope operating in the extreme ultraviolet wavelength range, revealed that the influence of the step-edge on the planar multilayer structure is restricted to a region within 300 nm from the step-edge.« less
The role of molecular genetic analysis in the diagnosis of primary ciliary dyskinesia.
Kim, Raymond H; A Hall, David; Cutz, Ernest; Knowles, Michael R; Nelligan, Kathleen A; Nykamp, Keith; Zariwala, Maimoona A; Dell, Sharon D
2014-03-01
Primary ciliary dyskinesia (PCD) is an autosomal recessive genetic disorder of motile cilia. The diagnosis of PCD has previously relied on ciliary analysis with transmission electron microscopy or video microscopy. However, patients with PCD may have normal ultrastructural appearance, and ciliary analysis has limited accessibility. Alternatively, PCD can be diagnosed by demonstrating biallelic mutations in known PCD genes. Genetic testing is emerging as a diagnostic tool to complement ciliary analysis where interpretation and access may delay diagnosis. To determine the diagnostic yield of genetic testing of patients with a confirmed or suspected diagnosis of PCD in a multiethnic urban center. Twenty-eight individuals with confirmed PCD on transmission electron microscopy of ciliary ultrastructure and 24 individuals with a probable diagnosis of PCD based on a classical PCD phenotype and low nasal nitric oxide had molecular analysis of 12 genes associated with PCD. Of 49 subjects who underwent ciliary biopsy, 28 (57%) were diagnosed with PCD through an ultrastructural defect. Of the 52 individuals who underwent molecular genetic analysis, 22 (42%) individuals had two mutations in known PCD genes. Twenty-four previously unreported mutations in known PCD genes were observed. Combining both diagnostic modalities of biopsy and molecular genetics, the diagnostic yield increased to 69% compared with 57% based on biopsy alone. The diagnosis of PCD is challenging and has traditionally relied on ciliary biopsy, which is unreliable as the sole criterion for a definitive diagnosis. Molecular genetic analysis can be used as a complementary test to increase the diagnostic yield.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Aguiar, Jeffery A.; Wozny, Sarah; Alkurd, Nooraldeen R.
Perovskite-based solar cells are one of the emerging candidates for radically lower cost photovoltaics. Herein, we report on the synthesis and crystallization of organic-inorganic formamidinium lead triiodide perovskite films under controlled atmospheric and environmental conditions. Using in situ (scanning) transmission electron microscopy, we make observations of the crystallization process of these materials in nitrogen and oxygen gas with and without the presence of water vapor. Complementary planar samples were also fabricated in the presence of water vapor and characterized by in situ X-ray diffraction. Direct observations of the material structure and final morphology indicate that the exposure to water vapormore » results in a porous film that is metastable, regardless of the presence of argon, nitrogen, or oxygen. However, the optimal crystallization temperature of 175 degrees C is unperturbed across conditions. Rapid modulation about the annealing temperature of 175 degrees C in +/-25 degrees C steps (150-200 degrees C) promotes crystallization and significantly improves the film morphology by overcoming the presence of impregnated water trapped in the material. Following this processing protocol, we demonstrate substantial growth to micron-size grains via observation inside of an environmentally controlled transmission electron microscope. Adapting this insight from our in situ microscopy, we are able to provide an informed materials protocol to control the structure and morphology of these organic-inorganic semiconductors, which is readily applicable to benchtop device growth strategies.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Aguiar, Jeffery A.; Wozny, Sarah; Alkurd, Nooraldeen R.
Perovskite-based solar cells are one of the emerging candidates for radically lower cost photovoltaics. Herein, we report on the synthesis and crystallization of organic-inorganic formamidinium lead triiodide perovskite films under controlled atmospheric and environmental conditions. Using in situ (scanning) transmission electron microscopy, we make observations of the crystallization process of these materials in nitrogen and oxygen gas with and without the presence of water vapor. Complementary planar samples were also fabricated in the presence of water vapor and characterized by in situ X-ray diffraction. Direct observations of the material structure and final morphology indicate that the exposure to water vapormore » results in a porous film that is metastable, regardless of the presence of argon, nitrogen, or oxygen. However, the optimal crystallization temperature of 175 °C is unperturbed across conditions. Rapid modulation about the annealing temperature of 175 °C in ±25 °C steps (150-200 °C) promotes crystallization and significantly improves the film morphology by overcoming the presence of impregnated water trapped in the material. Following this processing protocol, we demonstrate substantial growth to micron-size grains via observation inside of an environmentally controlled transmission electron microscope. Adapting this insight from our in situ microscopy, we are able to provide an informed materials protocol to control the structure and morphology of these organic-inorganic semiconductors, which is readily applicable to benchtop device growth strategies.« less
Mössbauer, TEM/SAED and XRD investigation on waste dumps of the Valea lui Stan gold mines
NASA Astrophysics Data System (ADS)
Constantinescu, Serban Grigore; Udubasa, Sorin S.; Udubasa, Gheorghe; Kuncser, Victor; Popescu-Pogrion, Nicoleta; Mercioniu, Ionel; Feder, Marcel
2012-03-01
The complementary investigation techniques, Mössbauer spectroscopy, transmission electron microscopy with selected area electron diffraction (TEM/SAED), X-ray diffraction (XRD) have been used to investigate the fate of the Valea lui Stan, Romania, gold-ore nanoscale-minerals during the long time of residence in the waste dumps. The preliminary investigations showed such waste dumps to contain significant amount of metals which cannot be identified by conventional methods. An intense research activity started up in order to evaluate the possibilities to recycle Valea lui Stan waste dumps and to recover metals by chemical or phytoextraction procedures. The waste dumps naturally show different mineral constituents with clay minerals as major phases, observed by XRD-technique. Although the waste dumps materials have whitish-yellowish colours, MÖSSBAUER technique evidences the presence of the finely dispersed iron bearing minerals. The authors are focusing to inspect and analyze Fe-compounds in the samples collected from Valea lui Stan's waste dumps in order to identify the magnetic phases by Mössbauer technique.
Quantitative Phase Fraction Detection in Organic Photovoltaic Materials through EELS Imaging
Dyck, Ondrej; Hu, Sheng; Das, Sanjib; ...
2015-11-24
Organic photovoltaic materials have recently seen intense interest from the research community. Improvements in device performance are occurring at an impressive rate; however, visualization of the active layer phase separation still remains a challenge. Our paper outlines the application of two electron energy-loss spectroscopic (EELS) imaging techniques that can complement and enhance current phase detection techniques. Specifically, the bulk plasmon peak position, often used to produce contrast between phases in energy filtered transmission electron microscopy (EFTEM), is quantitatively mapped across a sample cross section. One complementary spectrum image capturing the carbon and sulfur core loss edges is compared with themore » plasmon peak map and found to agree quite well, indicating that carbon and sulfur density differences between the two phases also allows phase discrimination. Additionally, an analytical technique for determining absolute atomic areal density is used to produce an absolute carbon and sulfur areal density map. We also show how these maps may be re-interpreted as a phase ratio map, giving quantitative information about the purity of the phases within the junction.« less
Secondary Electron Emission Materials for Transmission Dynodes in Novel Photomultipliers: A Review
Tao, Shu Xia; Chan, Hong Wah; van der Graaf, Harry
2016-01-01
Secondary electron emission materials are reviewed with the aim of providing guidelines for the future development of novel transmission dynodes. Materials with reflection secondary electron yield higher than three and transmission secondary electron yield higher than one are tabulated for easy reference. Generations of transmission dynodes are listed in the order of the invention time with a special focus on the most recent atomic-layer-deposition synthesized transmission dynodes. Based on the knowledge gained from the survey of secondary election emission materials with high secondary electron yield, an outlook of possible improvements upon the state-of-the-art transmission dynodes is provided. PMID:28774137
Satake, Akiharu; Kobuke, Yoshiaki
2007-06-07
This paper reviews selected types of structurally well defined assemblies of porphyrins and phthalocyanines with strong electronic coupling. Face-to-face, head-to-tail, slipped cofacial, and non-parallel dimeric motifs constructed by covalent and non-covalent bonds are compared in the earlier sections. Their molecular orientation, electronic overlap, and absorption and fluorescence properties are discussed with a view towards the development of artificial photosynthetic systems and molecular electronics. Complementary coordination dimers are fully satisfactory in terms of structural stability, orientation factor, pi-electronic overlap, and zero fluorescence quenching. In later sections, several polymeric and macrocyclic porphyrin assemblies constructed by a combination of covalent bonds and complementary coordination bonds are discussed from the viewpoint of light-harvesting antenna functions.
Luo, P; Morrison, I; Dudkiewicz, A; Tiede, K; Boyes, E; O'Toole, P; Park, S; Boxall, A B
2013-04-01
Imaging and characterization of engineered nanoparticles (ENPs) in water, soils, sediment and food matrices is very important for research into the risks of ENPs to consumers and the environment. However, these analyses pose a significant challenge as most existing techniques require some form of sample manipulation prior to imaging and characterization, which can result in changes in the ENPs in a sample and in the introduction of analytical artefacts. This study therefore explored the application of a newly designed instrument, the atmospheric scanning electron microscope (ASEM), which allows the direct characterization of ENPs in liquid matrices and which therefore overcomes some of the limitations associated with existing imaging methods. ASEM was used to characterize the size distribution of a range of ENPs in a selection of environmental and food matrices, including supernatant of natural sediment, test medium used in ecotoxicology studies, bovine serum albumin and tomato soup under atmospheric conditions. The obtained imaging results were compared to results obtained using conventional imaging by transmission electron microscope (TEM) and SEM as well as to size distribution data derived from nanoparticle tracking analysis (NTA). ASEM analysis was found to be a complementary technique to existing methods that is able to visualize ENPs in complex liquid matrices and to provide ENP size information without extensive sample preparation. ASEM images can detect ENPs in liquids down to 30 nm and to a level of 1 mg L(-1) (9×10(8) particles mL(-1) , 50 nm Au ENPs). The results indicate ASEM is a highly complementary method to existing approaches for analyzing ENPs in complex media and that its use will allow those studying to study ENP behavior in situ, something that is currently extremely challenging to do. © 2013 The Authors Journal of Microscopy © 2013 Royal Microscopical Society.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zieliński, W., E-mail: wiziel@inmat.pw.edu.pl; Płociński, T.; Kurzydłowski, K.J.
2015-06-15
We present a study of the efficiency of the utility of scanning electron microscope (SEM)-based transmission methods for characterizing grain structure in thinned bulk metals. Foils of type 316 stainless steel were prepared by two methods commonly used for transmission electron microscopy — double-jet electropolishing and focused ion beam milling. A customized holder allowed positioning of the foils in a configuration appropriate for both transmission electron forward scatter diffraction, and for transmission imaging by the use of a forescatter detector with two diodes. We found that both crystallographic orientation maps and dark-field transmitted images could be obtained for specimens preparedmore » by either method. However, for both methods, preparation-induced artifacts may affect the quality or accuracy of transmission SEM data, especially those acquired by the use of transmission Kikuchi diffraction. Generally, the quality of orientation data was better for specimens prepared by electropolishing, due to the absence of ion-induced damage. - Highlights: • The transmission imaging and diffraction techniques are emerging in scanning electron microscopy (SEM) as promising new field of materials characterization. • The manuscript titled: “Transmission Kikuchi Diffraction and Transmission Electron Forescatter Imaging of Electropolished and FIB Manufactured TEM Specimens” documents how different specimen thinning procedures can effect efficiency of transmission Kikuchi diffraction and transmission electron forescatter imaging. • The abilities to make precision crystallographic orientation maps and dark-field images in transmission was studied on electropolished versus focus ion beam manufactured TEM specimens. • Depending on the need, electropolished and focused ion beam technique may produce suitable specimens for transmission imaging and diffraction in SEM.« less
Brodusch, N; Demers, H; Gauvin, R
2013-04-01
A charge-coupled device camera of an electron backscattered diffraction system in a scanning electron microscope was positioned below a thin specimen and transmission Kikuchi patterns were collected. Contrary to electron backscattered diffraction, transmission electron forward scatter diffraction provides phase identification and orientation mapping at the nanoscale. The minimum Pd particle size for which a Kikuchi diffraction pattern was detected and indexed reliably was 5.6 nm. An orientation mapping resolution of 5 nm was measured at 30 kV. The resolution obtained with transmission electron forward scatter diffraction was of the same order of magnitude than that reported in electron nanodiffraction in the transmission electron microscope. An energy dispersive spectrometer X-ray map and a transmission electron forward scatter diffraction orientation map were acquired simultaneously. The high-resolution chemical, phase and orientation maps provided at once information on the chemical form, orientation and coherency of precipitates in an aluminium-lithium 2099 alloy. © 2013 The Authors Journal of Microscopy © 2013 Royal Microscopical Society.
Development of an Electrochemical DNA Biosensor to Detect a Foodborne Pathogen.
Nordin, Noordiana; Yusof, Nor Azah; Radu, Son; Hushiarian, Roozbeh
2018-06-03
Vibrio parahaemolyticus (V. parahaemolyticus) is a common foodborne pathogen that contributes to a large proportion of public health problems globally, significantly affecting the rate of human mortality and morbidity. Conventional methods for the detection of V. parahaemolyticus such as culture-based methods, immunological assays, and molecular-based methods require complicated sample handling and are time-consuming, tedious, and costly. Recently, biosensors have proven to be a promising and comprehensive detection method with the advantages of fast detection, cost-effectiveness, and practicality. This research focuses on developing a rapid method of detecting V. parahaemolyticus with high selectivity and sensitivity using the principles of DNA hybridization. In the work, characterization of synthesized polylactic acid-stabilized gold nanoparticles (PLA-AuNPs) was achieved using X-ray Diffraction (XRD), Ultraviolet-visible Spectroscopy (UV-Vis), Transmission Electron Microscopy (TEM), Field-emission Scanning Electron Microscopy (FESEM), and Cyclic Voltammetry (CV). We also carried out further testing of stability, sensitivity, and reproducibility of the PLA-AuNPs. We found that the PLA-AuNPs formed a sound structure of stabilized nanoparticles in aqueous solution. We also observed that the sensitivity improved as a result of the smaller charge transfer resistance (Rct) value and an increase of active surface area (0.41 cm 2 ). The development of our DNA biosensor was based on modification of a screen-printed carbon electrode (SPCE) with PLA-AuNPs and using methylene blue (MB) as the redox indicator. We assessed the immobilization and hybridization events by differential pulse voltammetry (DPV). We found that complementary, non-complementary, and mismatched oligonucleotides were specifically distinguished by the fabricated biosensor. It also showed reliably sensitive detection in cross-reactivity studies against various food-borne pathogens and in the identification of V. parahaemolyticus in fresh cockles.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Johnson, Justin C; Braunecker, Wade A; Hurst, Katherine E
A two-dimensional imine-based covalent organic framework (COF) was designed and synthesized such that phenyl and perfluorophenyl structural units can seamlessly alternate between layers of the framework. X-ray diffraction of the COF powders reveals a striking increase in crystallinity for the COF with self-complementary phenyl/perfluorophenyl interactions (FASt-COF). Whereas measured values of the Brunauer-Emmet-Teller (BET) surface areas for the nonfluorinated Base-COF and the COF employing hydrogen bonding were ~37% and 59%, respectively, of their theoretical Connolly surface areas, the BET value for FASt-COF achieves >90% of its theoretical value (~1700 m2/g). Transmission electron microscopy images also revealed unique micron-sized rodlike features inmore » FASt-COF that were not present in the other materials. The results highlight a promising approach for improving surface areas and long-range order in two-dimensional COFs.« less
NASA Astrophysics Data System (ADS)
Ha, Minh Thien Huu; Hoang Huynh, Sa; Binh Do, Huy; Nguyen, Tuan Anh; Luc, Quang Ho; Lee, Ching Ting; Chang, Edward Yi
2018-05-01
A GaSb epilayer is grown on a GaAs/Si(001) epitaxial substrate via metalorganic chemical vapor deposition. High-resolution transmission electron microscopy micrographs and high-resolution X-ray reciprocal space mapping indicate an entirely relaxed interfacial misfit (IMF) array GaSb epilayer. The valence-band offset and conduction-band offset of the Al2O3/GaSb/GaAs/Si structure are estimated to be 2.39 and 3.65 eV, respectively. The fabricated Al2O3/p-GaSb/GaAs/Si MOS capacitors exhibited good capacitance–voltage characteristics with a small accumulation frequency dispersion of approximately 1.05% per decade. These results imply that the GaSb epilayer grown on the GaAs/Si platform in the IMF mode can be used for future complementary metal–oxide semiconductor applications.
Effects of crystallographic and geometric orientation on ion beam sputtering of gold nanorods
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hinks, J. A.; Hibberd, F.; Hattar, K.
Nanostructures may be exposed to irradiation during their manufacture, their engineering and whilst in-service. The consequences of such bombardment can be vastly different from those seen in the bulk. In this paper, we combine transmission electron microscopy with in situ ion irradiation with complementary computer modelling techniques to explore the physics governing the effects of 1.7 MeV Au ions on gold nanorods. Phenomena surrounding the sputtering and associated morphological changes caused by the ion irradiation have been explored. In both the experiments and the simulations, large variations in the sputter yields from individual nanorods were observed. These sputter yields havemore » been shown to correlate with the strength of channelling directions close to the direction in which the ion beam was incident. Finally, craters decorated by ejecta blankets were found to form due to cluster emission thus explaining the high sputter yields.« less
Ramachandran, Gayathri
2017-01-01
Kinetic studies of tau fibril formation in vitro most commonly employ spectroscopic probes such as thioflavinT fluorescence and laser light scattering or negative stain transmission electron microscopy. Here, I describe the use of Fourier transform infrared (FTIR) spectroscopy, ultraviolet resonance Raman (UVRR) spectroscopy, and atomic force microscopy (AFM) as complementary probes for studies of tau aggregation. The sensitivity of vibrational spectroscopic techniques (FTIR and UVRR) to secondary structure content allows for measurement of conformational changes that occur when the intrinsically disordered protein tau transforms into cross-β-core containing fibrils. AFM imaging serves as a gentle probe of structures populated over the time course of tau fibrillization. Together, these assays help further elucidate the structural and mechanistic complexity inherent in tau fibril formation.
Kinetics of copper nanoparticle precipitation in phosphate glass: an isothermal plasmonic approach.
Sendova, Mariana; Jiménez, José A; Smith, Robert; Rudawski, Nicholas
2015-01-14
The kinetics of copper nanoparticle (NP) precipitation in melt-quenched barium-phosphate glass has been studied by in situ isothermal optical micro-spectroscopy. A spectroscopically based approximation technique is proposed to obtain information about the activation energies of nucleation and growth in a narrow temperature range (530-570 °C). Pre-plasmonic and plasmonic NP precipitation stages are identified separated in time. The process as a whole is discussed employing classical nucleation/growth theory and the Kolmogorov-Johnson-Mehl-Avrami phase change model. Activation energies of 3.9(7) eV and 2.6(5) eV have been estimated for the pre-plasmonic and plasmonic spectroscopically assessed stages, respectively. High resolution transmission electron microscopy, differential scanning calorimetry, and Raman spectroscopy were used as complementary techniques for studying the nanoparticulate phase and glass host structure. An empirical linear dependence of the diffusion activation energy on the glass transition temperature with broad applicability is suggested.
2017-01-01
We demonstrate the growth of overlapping grain boundaries in continuous, polycrystalline hexagonal boron nitride (h-BN) monolayer films via scalable catalytic chemical vapor deposition. Unlike the commonly reported atomically stitched grain boundaries, these overlapping grain boundaries do not consist of defect lines within the monolayer films but are composed of self-sealing bilayer regions of limited width. We characterize this overlapping h-BN grain boundary structure in detail by complementary (scanning) transmission electron microscopy techniques and propose a catalytic growth mechanism linked to the subsurface/bulk of the process catalyst and its boron and nitrogen solubilities. Our data suggest that the overlapping grain boundaries are comparatively resilient against deleterious pinhole formation associated with grain boundary defect lines and thus may reduce detrimental breakdown effects when polycrystalline h-BN monolayer films are used as ultrathin dielectrics, barrier layers, or separation membranes. PMID:28410557
Bubble evolution in Kr-irradiated UO2 during annealing
NASA Astrophysics Data System (ADS)
He, L.; Bai, X. M.; Pakarinen, J.; Jaques, B. J.; Gan, J.; Nelson, A. T.; El-Azab, A.; Allen, T. R.
2017-12-01
Transmission electron microscopy observation of Kr bubble evolution in polycrystalline UO2 annealed at high temperature was conducted in order to understand the inert gas behavior in oxide nuclear fuel. The average diameter of intragranular bubbles increased gradually from 0.8 nm in as-irradiated sample at room temperature to 2.6 nm at 1600 °C and the bubble size distribution changed from a uniform distribution to a bimodal distribution above 1300 °C. The size of intergranular bubbles increased more rapidly than intragranular ones and bubble denuded zones near grain boundaries formed in all the annealed samples. It was found that high-angle grain boundaries held bigger bubbles than low-angle grain boundaries. Complementary atomistic modeling was conducted to interpret the effects of grain boundary character on the Kr segregation. The area density of strong segregation sites in the high-angle grain boundaries is much higher than that in the low angle grain boundaries.
Enhanced electrical activation in In-implanted Ge by C co-doping
Feng, R.; Kremer, F.; Sprouster, D.; ...
2015-11-22
At high dopant concentrations in Ge, electrically activating all implanted dopants is a major obstacle in the fulfillment of high-performance Ge-channel complementary metal oxide semiconductor devices. In this letter, we demonstrate a significant increase in the electrically-active dopant fraction in In-implanted Ge by co-doping with the isovalent element C. Electrical measurements have been correlated with x-ray absorption spectroscopy and transmission electron microscopy results in addition to density functional theory simulations. With C þ In co-doping, the electrically active fraction was doubled and tripled at In concentrations of 0.2 and 0.7 at. %, respectively. This marked improvement was the result ofmore » C-In pair formation such that In-induced strain in the Ge lattice was reduced while the precipitation of In and the formation of In-V clusters were both suppressed.« less
Effects of crystallographic and geometric orientation on ion beam sputtering of gold nanorods
Hinks, J. A.; Hibberd, F.; Hattar, K.; ...
2018-01-11
Nanostructures may be exposed to irradiation during their manufacture, their engineering and whilst in-service. The consequences of such bombardment can be vastly different from those seen in the bulk. In this paper, we combine transmission electron microscopy with in situ ion irradiation with complementary computer modelling techniques to explore the physics governing the effects of 1.7 MeV Au ions on gold nanorods. Phenomena surrounding the sputtering and associated morphological changes caused by the ion irradiation have been explored. In both the experiments and the simulations, large variations in the sputter yields from individual nanorods were observed. These sputter yields havemore » been shown to correlate with the strength of channelling directions close to the direction in which the ion beam was incident. Finally, craters decorated by ejecta blankets were found to form due to cluster emission thus explaining the high sputter yields.« less
Characterization of Spitsbergen Disks by Transmission Electron Microscopy and Raman Spectroscopy
NASA Technical Reports Server (NTRS)
Thomas-Keprta, K. L.; Clemett, S. J.; Le, L.; Ross, K.; McKay, David S.; Gibson, E. K., Jr.
2010-01-01
'Carbonate disks' found in the fractures and pores spaces of peridotite xenoliths and basalts from the island of Spitsbergen in the Norwegian Svalbard archipelago have been suggested to be "The best (and best documented) terrestrial analogs for the [Martian meteorite] ALH84001 carbonate globules ..." Previous studies have indicated that Spitsbergen carbonates show broadly comparable internal layering and mineral compositions to ALH84001 carbonate-magnetite disks. We report here for the first time, the detailed mineral characterization of Spitsbergen carbonates and their spatial relationship to the host mineral assemblages in the xenolith, using high resolution TEM (as used previously for ALH84001 carbonate disks). These studies were conducted in concert with complementary Raman and SEM analysis of the same samples. Our results indicate that there are significant chemical and physical differences between the disks in Spitsbergen and the carbonates present in ALH84001.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mueller Steffen; Wibbing Sascha; Weigel Robert
2015-07-01
Signal acquisition and data transmission for innovative sensor systems and networks inside the containment of nuclear power plants (NPPs) is still a challenge with respect to safety, performance, reliability, availability, and costs. This especially applies to equipment upgrades for existing plants, special measurements, but also for new builds. This paper presents a novel method for efficient and cost-effective sensor signal acquisition and data transmission via power lines, in order to cope with the disadvantages of common system architectures that often suffer from poor signal integrity due to raw data transmissions via long cables, huge efforts and costs for installation, andmore » low flexibility with respect to maintenance and upgrades. A transmitter-receiver architecture is proposed that allows multiplexing of multiple sensor inputs for unidirectional point-to-point transmission by superimposing information signals on existing AC or DC supply lines, but also on active and inactive sensor wires, or spare cables, using power line communication (PLC) technology. Based on commercial off-the-shelf (COTS) electronic parts, a radiation hard transmitter hardware is designed to operate in harsh environment within the containment during full plant operation. The system's modular approach allows application specific trade-offs between redundancy and throughput regarding data transmission, as well as various sensor input front-ends which are compatible with state of the art systems. PLC technology eliminates the need for costly installation of additional cables and wall penetrations, while providing a complementary and diverse communication technology for upgrades of existing systems. At the receiver side in low dose areas, signals are extracted from the power line, demodulated, and de-multiplexed, in order to regain the original sensor signal information and provide it either in analog or digital output format. Successful laboratory qualification tests, field trails, and a demonstrator setup installation within a NPP verify the overall performance of the proposed system. (authors)« less
8 CFR 217.7 - Electronic data transmission requirement.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 8 Aliens and Nationality 1 2014-01-01 2014-01-01 false Electronic data transmission requirement... VISA WAIVER PROGRAM § 217.7 Electronic data transmission requirement. (a) An alien who applies for... to submit the required electronic arrival or departure manifests specified in paragraph (a) of this...
8 CFR 217.7 - Electronic data transmission requirement.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 8 Aliens and Nationality 1 2011-01-01 2011-01-01 false Electronic data transmission requirement... VISA WAIVER PROGRAM § 217.7 Electronic data transmission requirement. (a) An alien who applies for... to submit the required electronic arrival or departure manifests specified in paragraph (a) of this...
8 CFR 217.7 - Electronic data transmission requirement.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 8 Aliens and Nationality 1 2012-01-01 2012-01-01 false Electronic data transmission requirement... VISA WAIVER PROGRAM § 217.7 Electronic data transmission requirement. (a) An alien who applies for... to submit the required electronic arrival or departure manifests specified in paragraph (a) of this...
8 CFR 217.7 - Electronic data transmission requirement.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 8 Aliens and Nationality 1 2013-01-01 2013-01-01 false Electronic data transmission requirement... VISA WAIVER PROGRAM § 217.7 Electronic data transmission requirement. (a) An alien who applies for... to submit the required electronic arrival or departure manifests specified in paragraph (a) of this...
7 CFR 400.209 - Electronic transmission and receiving system.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 6 2012-01-01 2012-01-01 false Electronic transmission and receiving system. 400.209... Contract-Standards for Approval § 400.209 Electronic transmission and receiving system. Any Contractor...; (b) Maintain an electronic system which must be tested and approved by the Corporation; (c) Maintain...
7 CFR 400.209 - Electronic transmission and receiving system.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 6 2013-01-01 2013-01-01 false Electronic transmission and receiving system. 400.209... Contract-Standards for Approval § 400.209 Electronic transmission and receiving system. Any Contractor...; (b) Maintain an electronic system which must be tested and approved by the Corporation; (c) Maintain...
7 CFR 400.209 - Electronic transmission and receiving system.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 6 2011-01-01 2011-01-01 false Electronic transmission and receiving system. 400.209... Contract-Standards for Approval § 400.209 Electronic transmission and receiving system. Any Contractor...; (b) Maintain an electronic system which must be tested and approved by the Corporation; (c) Maintain...
7 CFR 400.209 - Electronic transmission and receiving system.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 6 2010-01-01 2010-01-01 false Electronic transmission and receiving system. 400.209... Contract-Standards for Approval § 400.209 Electronic transmission and receiving system. Any Contractor...; (b) Maintain an electronic system which must be tested and approved by the Corporation; (c) Maintain...
On the origin of pure optical rotation in twisted-cross metamaterials
Barr, Lauren E.; Díaz-Rubio, Ana; Tremain, Ben; Carbonell, Jorge; Sánchez-Dehesa, José; Hendry, Euan; Hibbins, Alastair P.
2016-01-01
We present an experimental and computational study of the response of twisted-cross metamaterials that provide near dispersionless optical rotation across a broad band of frequencies from 19 GHz to 37 GHz. We compare two distinct geometries: firstly, a bilayer structure comprised of arrays of metallic crosses where the crosses in the second layer are twisted about the layer normal; and secondly where the second layer is replaced by the complementary to the original, i.e. an array of cross-shaped holes. Through numerical modelling we determine the origin of rotatory effects in these two structures. In both, pure optical rotation occurs in a frequency band between two transmission minima, where alignment of electric and magnetic dipole moments occurs. In the cross/cross metamaterial, the transmission minima occur at the symmetric and antisymmetric resonances of the coupled crosses. By contrast, in the cross/complementary-cross structure the transmission minima are associated with the dipole and quadrupole modes of the cross, the frequencies of which appear intrinsic to the cross layer alone. Hence the bandwidth of optical rotation is found to be relatively independent of layer separation. PMID:27457405
Complementary p- and n-type polymer doping for ambient stable graphene inverter.
Yun, Je Moon; Park, Seokhan; Hwang, Young Hwan; Lee, Eui-Sup; Maiti, Uday; Moon, Hanul; Kim, Bo-Hyun; Bae, Byeong-Soo; Kim, Yong-Hyun; Kim, Sang Ouk
2014-01-28
Graphene offers great promise to complement the inherent limitations of silicon electronics. To date, considerable research efforts have been devoted to complementary p- and n-type doping of graphene as a fundamental requirement for graphene-based electronics. Unfortunately, previous efforts suffer from undesired defect formation, poor controllability of doping level, and subtle environmental sensitivity. Here we present that graphene can be complementary p- and n-doped by simple polymer coating with different dipolar characteristics. Significantly, spontaneous vertical ordering of dipolar pyridine side groups of poly(4-vinylpyridine) at graphene surface can stabilize n-type doping at room-temperature ambient condition. The dipole field also enhances and balances the charge mobility by screening the impurity charge effect from the bottom substrate. We successfully demonstrate ambient stable inverters by integrating p- and n-type graphene transistors, which demonstrated clear voltage inversion with a gain of 0.17 at a 3.3 V input voltage. This straightforward polymer doping offers diverse opportunities for graphene-based electronics, including logic circuits, particularly in mechanically flexible form.
Shebanova, A S; Bogdanov, A G; Ismagulova, T T; Feofanov, A V; Semenyuk, P I; Muronets, V I; Erokhina, M V; Onishchenko, G E; Kirpichnikov, M P; Shaitan, K V
2014-01-01
This work represents the results of the study on applicability of the modern methods of analytical transmission electron microscopy for detection, identification and visualization of localization of nanoparticles of titanium and cerium oxides in A549 cell, human lung adenocarcinoma cell line. A comparative analysis of images of the nanoparticles in the cells obtained in the bright field mode of transmission electron microscopy, under dark-field scanning transmission electron microscopy and high-angle annular dark field scanning transmission electron was performed. For identification of nanoparticles in the cells the analytical techniques, energy-dispersive X-ray spectroscopy and electron energy loss spectroscopy, were compared when used in the mode of obtaining energy spectrum from different particles and element mapping. It was shown that the method for electron tomography is applicable to confirm that nanoparticles are localized in the sample but not coated by contamination. The possibilities and fields of utilizing different techniques for analytical transmission electron microscopy for detection, visualization and identification of nanoparticles in the biological samples are discussed.
Wang, Xuezhi; Huang, Xiaotao; Suvorova, Sofia; Moran, Bill
2018-01-01
Golay complementary waveforms can, in theory, yield radar returns of high range resolution with essentially zero sidelobes. In practice, when deployed conventionally, while high signal-to-noise ratios can be achieved for static target detection, significant range sidelobes are generated by target returns of nonzero Doppler causing unreliable detection. We consider signal processing techniques using Golay complementary waveforms to improve radar detection performance in scenarios involving multiple nonzero Doppler targets. A signal processing procedure based on an existing, so called, Binomial Design algorithm that alters the transmission order of Golay complementary waveforms and weights the returns is proposed in an attempt to achieve an enhanced illumination performance. The procedure applies one of three proposed waveform transmission ordering algorithms, followed by a pointwise nonlinear processor combining the outputs of the Binomial Design algorithm and one of the ordering algorithms. The computational complexity of the Binomial Design algorithm and the three ordering algorithms are compared, and a statistical analysis of the performance of the pointwise nonlinear processing is given. Estimation of the areas in the Delay–Doppler map occupied by significant range sidelobes for given targets are also discussed. Numerical simulations for the comparison of the performances of the Binomial Design algorithm and the three ordering algorithms are presented for both fixed and randomized target locations. The simulation results demonstrate that the proposed signal processing procedure has a better detection performance in terms of lower sidelobes and higher Doppler resolution in the presence of multiple nonzero Doppler targets compared to existing methods. PMID:29324708
Gao, Weilu; Shu, Jie; Reichel, Kimberly; Nickel, Daniel V; He, Xiaowei; Shi, Gang; Vajtai, Robert; Ajayan, Pulickel M; Kono, Junichiro; Mittleman, Daniel M; Xu, Qianfan
2014-03-12
Gate-controllable transmission of terahertz (THz) radiation makes graphene a promising material for making high-speed THz wave modulators. However, to date, graphene-based THz modulators have exhibited only small on/off ratios due to small THz absorption in single-layer graphene. Here we demonstrate a ∼50% amplitude modulation of THz waves with gated single-layer graphene by the use of extraordinary transmission through metallic ring apertures placed right above the graphene layer. The extraordinary transmission induced ∼7 times near-filed enhancement of THz absorption in graphene. These results promise complementary metal-oxide-semiconductor compatible THz modulators with tailored operation frequencies, large on/off ratios, and high speeds, ideal for applications in THz communications, imaging, and sensing.
Germanium photodetectors fabricated on 300 mm silicon wafers for near-infrared focal plane arrays
NASA Astrophysics Data System (ADS)
Zeller, John W.; Rouse, Caitlin; Efstathiadis, Harry; Dhar, Nibir K.; Wijewarnasuriya, Priyalal; Sood, Ashok K.
2017-09-01
SiGe p-i-n photodetectors have been fabricated on 300 mm (12") diameter silicon (Si) wafers utilizing high throughput, large-area complementary metal-oxide semiconductor (CMOS) technologies. These Ge photodetectors are designed to operate in room temperature environments without cooling, and thus have potential size and cost advantages over conventional cooled infrared detectors. The two-step fabrication process for the p-i-n photodetector devices, designed to minimize the formation of defects and threading dislocations, involves low temperature epitaxial growth of a thin p+ (boron) Ge seed/buffer layer, followed by higher temperature deposition of a thicker Ge intrinsic layer. Scanning electron microscopy (SEM) and transmission electron microscopy (TEM) demonstrated uniform layer compositions with well defined layer interfaces and reduced dislocation density. Time-of-flight secondary ion mass spectroscopy (TOF-SIMS) was likewise employed to analyze the doping levels of the p+ and n+ layers. Current-voltage (I-V) measurements demonstrated that these SiGe photodetectors, when exposed to incident visible-NIR radiation, exhibited dark currents down below 1 μA and significant enhancement in photocurrent at -1 V. The zero-bias photocurrent was also relatively high, showing a minimal drop compared to that at -1 V bias.
Magnetic and interface properties of the core-shell Fe3O4/Au nanocomposites
NASA Astrophysics Data System (ADS)
Baskakov, A. O.; Solov'eva, A. Yu.; Ioni, Yu. V.; Starchikov, S. S.; Lyubutin, I. S.; Khodos, I. I.; Avilov, A. S.; Gubin, S. P.
2017-11-01
Core-shell Fe3O4/Au nanostructures were obtained with an advanced method of two step synthesis and several complementary methodics were applied for investigation structural and magnetic properties of the samples. Along with X-ray diffraction and transmission electron microscopy, electron diffraction, optical, Raman and Mössbauer spectroscopy were used for nanoparticle characterization. It was established that the physical and structural properties Fe3O4/Au nanocomposites are specific of intrinsic properties of gold and magnetite. Mössbauer and Raman spectroscopy data indicated that magnetite was in a nonstoichiometric state with an excess of trivalent iron both in the initial Fe3O4 nanoparticles and in the Fe3O4/Au nanocomposites. As follows from the Mössbauer data, magnetic properties of iron ions in the internal area (in core) and in the surface layer of magnetite nanoparticles are different due to the rupture of exchange bonds at the particles surface. This leads to decrease in an effective magnetic moment at the surface. Gold atoms at the interface of the composites interact with dangling bonds of magnetite and stabilize the magnetic properties of the surface layers of magnetite.
Role of Crystallization in the Morphology of Polymer: Non-fullerene Acceptor Bulk Heterojunctions
O’Hara, Kathryn A.; Ostrowski, David P.; Koldemir, Unsal; ...
2017-05-22
Many high efficiency organic photovoltaics use fullerene-based acceptors despite their high production cost, weak optical absorption in the visible range, and limited synthetic variability of electronic and optical properties. To circumvent this deficiency, non-fullerene small-molecule acceptors have been developed that have good synthetic flexibility, allowing for precise tuning of optoelectronic properties, leading to enhanced absorption of the solar spectrum and increased open-circuit voltages ( V OC). We examined the detailed morphology of bulk heterojunctions of poly(3-hexylthiophene) and the small-molecule acceptor HPI-BT to reveal structural changes that lead to improvements in the fill factor of solar cells upon thermal annealing. Themore » kinetics of the phase transformation process of HPI-BT during thermal annealing were investigated through in situ grazing incidence wide-angle X-ray scattering studies, atomic force microscopy, and transmission electron microscopy. The HPI-BT acceptor crystallizes during film formation to form micron-sized domains embedded within the film center and a donor rich capping layer at the cathode interface reducing efficient charge extraction. Thermal annealing changes the surface composition and improves charge extraction. In conclusion, this study reveals the need for complementary methods to investigate the morphology of BHJs.« less
Role of Crystallization in the Morphology of Polymer: Non-fullerene Acceptor Bulk Heterojunctions
DOE Office of Scientific and Technical Information (OSTI.GOV)
O’Hara, Kathryn A.; Ostrowski, David P.; Koldemir, Unsal
Many high efficiency organic photovoltaics use fullerene-based acceptors despite their high production cost, weak optical absorption in the visible range, and limited synthetic variability of electronic and optical properties. To circumvent this deficiency, non-fullerene small-molecule acceptors have been developed that have good synthetic flexibility, allowing for precise tuning of optoelectronic properties, leading to enhanced absorption of the solar spectrum and increased open-circuit voltages ( V OC). We examined the detailed morphology of bulk heterojunctions of poly(3-hexylthiophene) and the small-molecule acceptor HPI-BT to reveal structural changes that lead to improvements in the fill factor of solar cells upon thermal annealing. Themore » kinetics of the phase transformation process of HPI-BT during thermal annealing were investigated through in situ grazing incidence wide-angle X-ray scattering studies, atomic force microscopy, and transmission electron microscopy. The HPI-BT acceptor crystallizes during film formation to form micron-sized domains embedded within the film center and a donor rich capping layer at the cathode interface reducing efficient charge extraction. Thermal annealing changes the surface composition and improves charge extraction. In conclusion, this study reveals the need for complementary methods to investigate the morphology of BHJs.« less
Reticulated Organic Photovoltaics
DOE Office of Scientific and Technical Information (OSTI.GOV)
Schiros T.; Yager K.; Mannsfeld S.
2012-03-21
This paper shows how the self-assembled interlocking of two nanostructured materials can lead to increased photovoltaic performance. A detailed picture of the reticulated 6-DBTTC/C{sub 60} organic photovoltaic (OPV) heterojunction, which produces devices approaching the theoretical maximum for these materials, is presented from near edge X-ray absorption spectroscopy (NEXAFS), X-ray photoelectron spectroscopy (XPS), Grazing Incidence X-ray diffraction (GIXD) and transmission electron microscopy (TEM). The complementary suite of techniques shows how self-assembly can be exploited to engineer the interface and morphology between the cables of donor (6-DBTTC) material and a polycrystalline acceptor (C{sub 60}) to create an interpenetrating network of pure phasesmore » expected to be optimal for OPV device design. Moreover, we find that there is also a structural and electronic interaction between the two materials at the molecular interface. The data show how molecular self-assembly can facilitate 3-D nanostructured photovoltaic cells that are made with the simplicity and control of bilayer device fabrication. The significant improvement in photovoltaic performance of the reticulated heterojunction over the flat analog highlights the potential of these strategies to improve the efficiency of organic solar cells.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Steele, Robert; Mata, Angelica; Dunzik-Gougar, Mary Lou
2016-06-01
As part of an overall effort to convert US research reactors to low-enriched uranium (LEU) fuel use, a LEU conversion fuel is being designed for the Transient Reactor Test Facility (TREAT) at the Idaho National Laboratory. TREAT fuel compacts are comprised of UO2 fuel particles in a graphitic matrix material. In order to refine heat transfer modeling, as well as determine other physical and nuclear characteristics of the fuel, the amount and type of graphite and non-graphite phases within the fuel matrix must be known. In this study, we performed a series of complementary analyses, designed to allow detailed characterizationmore » of the graphite and phenolic resin based fuel matrix. Methods included Scanning Electron and Transmission Electron Microscopies, Raman spectroscopy, X-ray Diffraction, and Dual-Beam Focused Ion Beam Tomography. Our results indicate that no single characterization technique will yield all of the desired information; however, through the use of statistical and empirical data analysis, such as curve fitting, partial least squares regression, volume extrapolation and spectra peak ratios, a degree of certainty for the quantity of each phase can be obtained.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hickey, Robert J.; Gillard, Timothy M.; Irwin, Matthew T.
We have established the existence of a line of congruent first-order lamellar-to-disorder (LAM–DIS) transitions when appropriate amounts of poly(cyclohexylethylene) (C) and poly(ethylene) (E) homopolymers are mixed with a corresponding compositionally symmetric CE diblock copolymer. The line of congruent transitions, or the congruent isopleth, terminates at the bicontinuous microemulsion (BμE) channel, and its trajectory appears to be influenced by the critical composition of the C/E binary homopolymer blend. Blends satisfying congruency undergo a direct LAM–DIS transition without passing through a two-phase region. We present complementary optical transmission, small-angle X-ray scattering (SAXS), transmission electron microscopy (TEM), and dynamic mechanical spectroscopy (DMS) resultsmore » that establish the phase behavior at constant copolymer volume fraction and varying C/E homopolymer volume ratios. Adjacent to the congruent composition at constant copolymer volume fraction, the lamellar and disordered phases are separated by two-phase coexistence windows, which converge, along with the line of congruent transitions, at an overall composition in the phase prism coincident with the BμE channel. Hexagonal and cubic (double gyroid) phases occur at higher diblock copolymer concentrations for asymmetric amounts of C and E homopolymers. These results establish a quantitative method for identifying the detailed phase behavior of ternary diblock copolymer–homopolymer blends, especially in the vicinity of the BμE.« less
Hettler, Simon; Dries, Manuel; Hermann, Peter; Obermair, Martin; Gerthsen, Dagmar; Malac, Marek
2017-05-01
We analyze electron-beam induced carbon contamination in a transmission electron microscope. The study is performed on thin films potentially suitable as phase plates for phase-contrast transmission electron microscopy. Electron energy-loss spectroscopy and phase-plate imaging is utilized to analyze the contamination. The deposited contamination layer is identified as a graphitic carbon layer which is not prone to electrostatic charging whereas a non-conductive underlying substrate charges. Several methods that inhibit contamination are evaluated and the impact of carbon contamination on phase-plate imaging is discussed. The findings are in general interesting for scanning transmission electron microscopy applications. Crown Copyright © 2017. Published by Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Almuslem, A. S.; Hanna, A. N.; Yapici, T.; Wehbe, N.; Diallo, E. M.; Kutbee, A. T.; Bahabry, R. R.; Hussain, M. M.
2017-02-01
In the recent past, with the advent of transient electronics for mostly implantable and secured electronic applications, the whole field effect transistor structure has been dissolved in a variety of chemicals. Here, we show simple water soluble nano-scale (sub-10 nm) germanium oxide (GeO2) as the dissolvable component to remove the functional structures of metal oxide semiconductor devices and then reuse the expensive germanium substrate again for functional device fabrication. This way, in addition to transiency, we also show an environmentally friendly manufacturing process for a complementary metal oxide semiconductor (CMOS) technology. Every year, trillions of complementary metal oxide semiconductor (CMOS) electronics are manufactured and billions are disposed, which extend the harmful impact to our environment. Therefore, this is a key study to show a pragmatic approach for water soluble high performance electronics for environmentally friendly manufacturing and bioresorbable electronic applications.
Reconfigurable Complementary Monolayer MoTe2 Field-Effect Transistors for Integrated Circuits.
Larentis, Stefano; Fallahazad, Babak; Movva, Hema C P; Kim, Kyounghwan; Rai, Amritesh; Taniguchi, Takashi; Watanabe, Kenji; Banerjee, Sanjay K; Tutuc, Emanuel
2017-05-23
Transition metal dichalcogenides are of interest for next generation switches, but the lack of low resistance electron and hole contacts in the same material has hindered the development of complementary field-effect transistors and circuits. We demonstrate an air-stable, reconfigurable, complementary monolayer MoTe 2 field-effect transistor encapsulated in hexagonal boron nitride, using electrostatically doped contacts. The introduction of a multigate design with prepatterned bottom contacts allows us to independently achieve low contact resistance and threshold voltage tuning, while also decoupling the Schottky contacts and channel gating. We illustrate a complementary inverter and a p-i-n diode as potential applications.
19 CFR 181.93 - Submission of advance ruling requests.
Code of Federal Regulations, 2013 CFR
2013-04-01
... Court of Appeals for the Federal Circuit, or any court of appeal therefrom, or review by a judicial or... warrant and permit. Requests for special consideration made by telegram or electronic transmission will be... or electronic transmission. A telegram or electronic transmission must be followed up with a signed...
19 CFR 181.93 - Submission of advance ruling requests.
Code of Federal Regulations, 2012 CFR
2012-04-01
... Court of Appeals for the Federal Circuit, or any court of appeal therefrom, or review by a judicial or... warrant and permit. Requests for special consideration made by telegram or electronic transmission will be... or electronic transmission. A telegram or electronic transmission must be followed up with a signed...
The Thermal Emission and Albedo of Super-Earths with Flat Transmission Spectra
NASA Astrophysics Data System (ADS)
Morley, Caroline; Fortney, Jonathan; Marley, Mark
2014-11-01
Vast resources have been dedicated to characterizing the handful of planets with radii between Earth’s and Neptune’s that are accessible to current telescopes. Observations of their transmission spectra have been inconclusive and do not constrain the atmospheric composition. Here, we present a path forward for understanding this class of small planets: by understanding the thermal emission and reflectivity of small planets, we can break these degeneracies and constrain the atmospheric composition. Of the ~four small planets studied to date, all have radii in the near-IR consistent with being constant in wavelength. This suggests either that these planets all have higher mean molecular weight atmospheres than expected for hydrogen-dominated bulk compositions, or that the atmospheres of small planets are consistently enshrouded in thick hazes and clouds. For the particularly well-studied planet GJ 1214b, the measurements made using HST/WFC3 can rule out atmospheres with high mean molecular weights, leaving clouds as the sole explanation for the flat transmission spectrum. We showed in Morley et al. 2013 that these clouds and hazes can be made of salts and sulfides, which condense in the upper atmosphere of a cool H-rich atmosphere like GJ 1214b, or made of photochemical hazes such as soots, which result from methane photodissociation and subsequent carbon chemistry. Here, we explore how clouds thick enough to obscure the transmission spectrum change both thermal emission spectra and albedo spectra. These observations are complementary to transmission spectra measurements. Thermal emission probes deeper layers of the atmosphere, potentially below the high haze layer obscuring the transmission spectra; albedo spectra probe reflected starlight largely from the cloud particles themselves. Crucially, these complementary observations of planets with flat transmission spectra may allow us to break the degeneracies between cloud materials, cloud height and longitude, and bulk composition of the atmosphere. We make predictions for the observability of known planets for current and future telescopes.
The Thermal Emission and Albedo of Super-Earths with Flat Transmission Spectra
NASA Astrophysics Data System (ADS)
Morley, Caroline; Fortney, Jonathan J.; Marley, Mark
2015-01-01
Vast resources have been dedicated to characterizing the handful of planets with radii between Earth's and Neptune's that are accessible to current telescopes. Observations of their transmission spectra have been inconclusive and do not constrain the atmospheric composition. Here, we present a path forward for understanding this class of small planets: by understanding the thermal emission and reflectivity of small planets, we can break these degeneracies and constrain the atmospheric composition.Of the ~five small planets studied to date, four have radii in the near-IR consistent with being constant in wavelength. This suggests either that these planets all have higher mean molecular weight atmospheres than expected for hydrogen-dominated bulk compositions, or that the atmospheres of small planets are consistently enshrouded in thick hazes and clouds. For the particularly well-studied planet GJ 1214b, the measurements made using HST/WFC3 can rule out atmospheres with high mean molecular weights, leaving clouds as the sole explanation for the flat transmission spectrum. We showed in Morley et al. 2013 that these clouds and hazes can be made of salts and sulfides, which condense in the upper atmosphere of a cool H-rich atmosphere like GJ 1214b, or made of photochemical hazes such as soots, which result from methane photodissociation and subsequent carbon chemistry. Here, we explore how clouds thick enough to obscure the transmission spectrum change both thermal emission spectra and albedo spectra. These observations are complementary to transmission spectra measurements. Thermal emission probes deeper layers of the atmosphere, potentially below the high haze layer obscuring the transmission spectra; albedo spectra probe reflected starlight largely from the cloud particles themselves. Crucially, these complementary observations of planets with flat transmission spectra may allow us to break the degeneracies between cloud materials, cloud height and longitude, and bulk composition of the atmosphere. We make predictions for the observability of known planets for current and future telescopes.
Low-Voltage Complementary Electronics from Ion-Gel-Gated Vertical Van der Waals Heterostructures
DOE Office of Scientific and Technical Information (OSTI.GOV)
Choi, Yongsuk; Kang, Junmo; Jariwala, Deep
2016-03-22
Low-voltage complementary circuits comprising n-type and p-type van der Waals heterojunction vertical field-effect transistors (VFETs) are demonstrated. The resulting VFETs possess high on-state current densities (>3000 A cm-2) and on/off current ratios (>104) in a narrow voltage window (<3 V).
Lee, Woongkyu; Yoo, Sijung; Yoon, Kyung Jean; Yeu, In Won; Chang, Hye Jung; Choi, Jung-Hae; Hoffmann-Eifert, Susanne; Waser, Rainer; Hwang, Cheol Seong
2016-01-01
Identification of microstructural evolution of nanoscale conducting phase, such as conducting filament (CF), in many resistance switching (RS) devices is a crucial factor to unambiguously understand the electrical behaviours of the RS-based electronic devices. Among the diverse RS material systems, oxide-based redox system comprises the major category of these intriguing electronic devices, where the local, along both lateral and vertical directions of thin films, changes in oxygen chemistry has been suggested to be the main RS mechanism. However, there are systems which involve distinctive crystallographic phases as CF; the Magnéli phase in TiO2 is one of the very well-known examples. The current research reports the possible presence of distinctive local conducting phase in atomic layer deposited SrTiO3 RS thin film. The conducting phase was identified through extensive transmission electron microscopy studies, which indicated that oxygen-deficient Sr2Ti6O13 or Sr1Ti11O20 phase was presumably present mainly along the grain boundaries of SrTiO3 after the unipolar set switching in Pt/TiN/SrTiO3/Pt structure. A detailed electrical characterization revealed that the samples showed typical bipolar and complementary RS after the memory cell was unipolar reset. PMID:26830978
Kuppan, Saravanan; Shukla, Alpesh Khushalchand; Membreno, Daniel; ...
2017-01-06
Surface properties of cathode particles play important roles in the transport of ions and electrons and they may ultimately dominate cathode's performance and stability in lithium-ion batteries. Through the use of carefully prepared Li 1.2Ni 0.13Mn 0.54Co 0.13O 2 crystal samples with six distinct morphologies, surface transition-metal redox activities and crystal structural transformation are investigated as a function of surface area and surface crystalline orientation. Complementary depth-profiled core-level spectroscopy, namely, X-ray absorption spectroscopy, electron energy loss spectroscopy, and atomic-resolution scanning transmission electron microscopy, are applied in the study, presenting a fine example of combining advanced diagnostic techniques with a well-definedmore » model system of battery materials. Here, we report the following findings: (1) a thin layer of defective spinel with reduced transition metals, similar to what is reported on cycled conventional secondary particles in the literature, is found on pristine oxide surface even before cycling, and (2) surface crystal structure and chemical composition of both pristine and cycled particles are facet dependent. Oxide structural and cycling stabilities improve with maximum expression of surface facets stable against transition-metal reduction. Finally, the intricate relationships among morphology, surface reactivity and structural transformation, electrochemical performance, and stability of the cathode materials are revealed.« less
Transmission electron microscope studies of extraterrestrial materials
NASA Technical Reports Server (NTRS)
Keller, Lindsay P.
1995-01-01
Transmission Electron Microscopy, X-Ray spectrometry and electron-energy-loss spectroscopy are used to analyse carbon in interplanetary dust particles. Optical micrographs are shown depicting cross sections of the dust particles embedded in sulphur. Selected-area electron diffraction patterns are shown. Transmission Electron Microscope specimens of lunar soil were prepared using two methods: ion-milling and ultramicrotomy. A combination of high resolution TEM imaging and electron diffraction is used to characterize the opaque assemblages. The opaque assemblages analyzed in this study are dominated by ilmenite with lesser rutile and spinel exsolutions, and traces of Fe metal.
Qiu, Jiaqi; Ha, Gwanghui; Jing, Chunguang; Baryshev, Sergey V; Reed, Bryan W; Lau, June W; Zhu, Yimei
2016-02-01
A device and a method for producing ultrashort electron pulses with GHz repetition rates via pulsing an input direct current (dc) electron beam are provided. The device and the method are based on an electromagnetic-mechanical pulser (EMMP) that consists of a series of transverse deflecting cavities and magnetic quadrupoles. The EMMP modulates and chops the incoming dc electron beam and converts it into pico- and sub-pico-second electron pulse sequences (pulse trains) at >1GHz repetition rates, as well as controllably manipulates the resulting pulses. Ultimately, it leads to negligible electron pulse phase-space degradation compared to the incoming dc beam parameters. The temporal pulse length and repetition rate for the EMMP can be continuously tunable over wide ranges. Applying the EMMP to a transmission electron microscope (TEM) with any dc electron source (e.g. thermionic, Schottky, or field-emission source), a GHz stroboscopic high-duty-cycle TEM can be realized. Unlike in many recent developments in time-resolved TEM that rely on a sample pumping laser paired with a laser launching electrons from a photocathode to probe the sample, there is no laser in the presented experimental set-up. This is expected to be a significant relief for electron microscopists who are not familiar with laser systems. The EMMP and the sample are externally driven by a radiofrequency (RF) source synchronized through a delay line. With no laser pumping the sample, the problem of the pump laser induced residual heating/damaging the sample is eliminated. As many RF-driven processes can be cycled indefinitely, sampling rates of 1-50GHz become accessible. Such a GHz stroboscopic TEM would open up a new paradigm for in situ and in operando experiments to study samples externally driven electromagnetically. Complementary to the lower (MHz) repetition rates experiments enabled by laser photocathode TEM, new experiments in the multi-GHz regime will be enabled by the proposed RF design. Because TEM is also a platform for various analytical methods, there are infinite application opportunities in energy and electronics to resolve charge (electronic and ionic) transport, and magnetic, plasmonic and excitonic dynamics in advanced functional materials. In addition, because the beam duty-cycle can be as high as ~10(-1) (or 10%), detection can be accomplished by commercially available detectors. In this article, we report an optimal design of the EMMP. The optimal design was found using an analytical generalized matrix approach in the thin lens approximation along with detailed beam dynamics taking actual realistic dc beam parameters in a TEM operating at 200keV. Copyright © 2015 Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bock, David C.; Pelliccione, Christopher J.; Zhang, Wei
Here, the iron oxide magnetite, Fe 3O 4, is a promising conversion type lithium ion battery anode material due to its high natural abundance, low cost and high theoretical capacity. While the close packing of ions in the inverse spinel structure of Fe 3O 4 enables high energy density, it also limits the kinetics of lithium ion diffusion in the material. Nanosizing of Fe 3O 4 to reduce the diffusion path length is an effective strategy for overcoming this issue and results in improved rate capability. However, the impact of nanosizing on the multiple structural transformations that occur during themore » electrochemical (de)lithiation reaction in Fe 3O 4 is poorly understood. In this study, the influence of crystallite size on the lithiation-conversion mechanisms in Fe 3O 4 is investigated using complementary X-ray techniques along with transmission electron microscopy (TEM) and continuum level simulations on electrodes of two different Fe 3O 4 crystallite sizes. In situ X-ray diffraction (XRD) measurements were utilized to track the changes to the crystalline phases during (de)lithiation. X-ray absorption spectroscopy (XAS) measurements at multiple points during the (de)lithiation processes provided local electronic and atomic structural information. Tracking the crystalline and nanocrystalline phases during the first (de)lithiation provides experimental evidence that (1) the lithiation mechanism is non-uniform and dependent on crystallite size, where increased Li + diffusion length in larger crystals results in conversion to Fe 0 metal while insertion of Li + into spinel-Fe 3O 4 is still occurring, and (2) the disorder and size of the Fe metal domains formed when either material is fully lithiated impacts the homogeneity of the FeO phase formed during the subsequent delithiation.« less
Bock, David C.; Pelliccione, Christopher J.; Zhang, Wei; ...
2017-07-17
Here, the iron oxide magnetite, Fe 3O 4, is a promising conversion type lithium ion battery anode material due to its high natural abundance, low cost and high theoretical capacity. While the close packing of ions in the inverse spinel structure of Fe 3O 4 enables high energy density, it also limits the kinetics of lithium ion diffusion in the material. Nanosizing of Fe 3O 4 to reduce the diffusion path length is an effective strategy for overcoming this issue and results in improved rate capability. However, the impact of nanosizing on the multiple structural transformations that occur during themore » electrochemical (de)lithiation reaction in Fe 3O 4 is poorly understood. In this study, the influence of crystallite size on the lithiation-conversion mechanisms in Fe 3O 4 is investigated using complementary X-ray techniques along with transmission electron microscopy (TEM) and continuum level simulations on electrodes of two different Fe 3O 4 crystallite sizes. In situ X-ray diffraction (XRD) measurements were utilized to track the changes to the crystalline phases during (de)lithiation. X-ray absorption spectroscopy (XAS) measurements at multiple points during the (de)lithiation processes provided local electronic and atomic structural information. Tracking the crystalline and nanocrystalline phases during the first (de)lithiation provides experimental evidence that (1) the lithiation mechanism is non-uniform and dependent on crystallite size, where increased Li + diffusion length in larger crystals results in conversion to Fe 0 metal while insertion of Li + into spinel-Fe 3O 4 is still occurring, and (2) the disorder and size of the Fe metal domains formed when either material is fully lithiated impacts the homogeneity of the FeO phase formed during the subsequent delithiation.« less
Viladot, D; Véron, M; Gemmi, M; Peiró, F; Portillo, J; Estradé, S; Mendoza, J; Llorca-Isern, N; Nicolopoulos, S
2013-10-01
A recently developed technique based on the transmission electron microscope, which makes use of electron beam precession together with spot diffraction pattern recognition now offers the possibility to acquire reliable orientation/phase maps with a spatial resolution down to 2 nm on a field emission gun transmission electron microscope. The technique may be described as precession-assisted crystal orientation mapping in the transmission electron microscope, precession-assisted crystal orientation mapping technique-transmission electron microscope, also known by its product name, ASTAR, and consists in scanning the precessed electron beam in nanoprobe mode over the specimen area, thus producing a collection of precession electron diffraction spot patterns, to be thereafter indexed automatically through template matching. We present a review on several application examples relative to the characterization of microstructure/microtexture of nanocrystalline metals, ceramics, nanoparticles, minerals and organics. The strengths and limitations of the technique are also discussed using several application examples. ©2013 The Authors. Journal of Microscopy published by John Wiley & Sons Ltd on behalf of Royal Microscopical Society.
45 CFR Appendix C to Part 1355 - Electronic Data Transmission Format
Code of Federal Regulations, 2013 CFR
2013-10-01
... 45 Public Welfare 4 2013-10-01 2013-10-01 false Electronic Data Transmission Format C Appendix C to Part 1355 Public Welfare Regulations Relating to Public Welfare (Continued) OFFICE OF HUMAN.... 1355, App. C Appendix C to Part 1355—Electronic Data Transmission Format All AFCARS data to be sent...
Kim, Kwan Soo; Kim, Mo Sae; Kim, Joon Mo; Choi, Chul Young
2010-01-01
To evaluate the efficacy of Tracey wavefront aberrometry (Tracey Technologies, Houston, TX) and transmission electron microscopy for the detection of anterior lenticonus in Alport syndrome. Tracey wavefront aberrometry was used to treat a patient with bilateral anterior lenticonus who had a history of Alport syndrome. For transmission electron microscopic examination, anterior lens capsules were obtained during clear lens phacoemulsification and intraocular lens implantation. Spherical aberrations were the predominant higher-order aberrations in the internal optics of both eyes. The Tracey wavefront aberrometer showed that most of the irregular astigmatism originated from the lenticular portion. Transmission electron microscopy of the specimens showed anterior lens capsules with decreased thickness and multiple dehiscences. Tracey wavefront aberrometry and transmission electron microscopy are effective tools for evaluation of anterior lenticonus in Alport syndrome. Copyright 2010, SLACK Incorporated.
Complementary barrier infrared detector (CBIRD)
NASA Technical Reports Server (NTRS)
Ting, David Z. (Inventor); Bandara, Sumith V. (Inventor); Hill, Cory J. (Inventor); Gunapala, Sarath D. (Inventor)
2013-01-01
An infrared detector having a hole barrier region adjacent to one side of an absorber region, an electron barrier region adjacent to the other side of the absorber region, and a semiconductor adjacent to the electron barrier.
Electron transmission through a class of anthracene aldehyde molecules
DOE Office of Scientific and Technical Information (OSTI.GOV)
Petreska, Irina, E-mail: irina.petreska@pmf.ukim.mk; Ohanesjan, Vladimir, E-mail: ohanesjan.vladimir@gmail.com; Pejov, Ljupco, E-mail: ljupcop@pmf.ukim.mk
2016-03-25
Transmission of electrons via metal-molecule-metal junctions, involving rotor-stator anthracene aldehyde molecules is investigated. Two model barriers having input parameters evaluated from accurate ab initio calculations are proposed and the transmission coefficients are obtained by using the quasiclassical approximation. Transmission coefficients further enter in the integral for the net current, utilizing Simmons’ method. Conformational dependence of the tunneling processes is evident and the presence of the side groups enhances the functionality of the future single-molecule based electronic devices.
Flexible Bilingualism through Multimodal Practices: Studying K-12 Community Languages Online
ERIC Educational Resources Information Center
Nordstrom, Janica
2015-01-01
Community language schools are complementary schools set up and run by minority communities in Australia. They aim to assist in intergenerational language and identity transmission, but previous research has indicated that these schools position their students in monolingual ways that contradicts how bilingual speakers use their language in…
Software electron counting for low-dose scanning transmission electron microscopy.
Mittelberger, Andreas; Kramberger, Christian; Meyer, Jannik C
2018-05-01
The performance of the detector is of key importance for low-dose imaging in transmission electron microscopy, and counting every single electron can be considered as the ultimate goal. In scanning transmission electron microscopy, low-dose imaging can be realized by very fast scanning, however, this also introduces artifacts and a loss of resolution in the scan direction. We have developed a software approach to correct for artifacts introduced by fast scans, making use of a scintillator and photomultiplier response that extends over several pixels. The parameters for this correction can be directly extracted from the raw image. Finally, the images can be converted into electron counts. This approach enables low-dose imaging in the scanning transmission electron microscope via high scan speeds while retaining the image quality of artifact-free slower scans. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.
Electronic switching circuit uses complementary non-linear components
NASA Technical Reports Server (NTRS)
Zucker, O. S.
1972-01-01
Inherent switching properties of saturable inductors and storage diodes are combined to perform large variety of electronic functions, such as pulse shaping, gating, and multiplexing. Passive elements replace active switching devices in generation of complex waveforms.
Hirata, Kei; Ishida, Yoichi; Akashi, Tetsuya; Shindo, Daisuke; Tonomura, Akira
2012-01-01
The magnetic domain structure of the writer poles of perpendicular magnetic recording heads was studied using electron holography. Although the domain structure of a 100-nm-thick writer pole could be observed with a 300 kV transmission electron microscope, that of the 250-nm-thick writer pole could not be analyzed due to the limited transmission capability of the instrument. On the other hand, the detailed domain structure of the 250-nm-thick writer pole was successfully analyzed by a 1 MV electron microscope using its high transmission capability. The thickness and material dependency of the domain structure of a writer pole were discussed.
Radiation damage in MOS integrated circuits, Part 1
NASA Technical Reports Server (NTRS)
Danchenko, V.
1971-01-01
Complementary and p-channel MOS integrated circuits made by four commercial manufacturers were investigated for sensitivity to radiation environment. The circuits were irradiated with 1.5 MeV electrons. The results are given for electrons and for the Co-60 gamma radiation equivalent. The data are presented in terms of shifts in the threshold potentials and changes in transconductances and leakages. Gate biases of -10V, +10V and zero volts were applied to individual MOS units during irradiation. It was found that, in most of circuits of complementary MOS technologies, noticable changes due to radiation appear first as increased leakage in n-channel MOSFETs somewhat before a total integrated dose 10 to the 12th power electrons/sg cm is reached. The inability of p-channel MOSFETs to turn on sets in at about 10 to the 13th power electrons/sq cm. Of the circuits tested, an RCA A-series circuit was the most radiation resistant sample.
NASA Astrophysics Data System (ADS)
de Jesús Ruíz-Baltazar, Álvaro; Reyes-López, Simón Yobbany; Larrañaga, Daniel; Estévez, Miriam; Pérez, Ramiro
The exceptional properties of the silver nanoparticles offer several applications in the biomedicine field. The development of antibiotics which are clinically useful against bacteria and drug resistant microorganisms, it is one of the main approaches of silver nanoparticles. However, it is necessary to develop environmentally friendly methods for their synthesis. In this sense, the main objective of this work is focused on to propose a simplified and efficient green synthesis of silver nanoparticles with proven antibacterial properties. The green synthesis route is based on the use of the Melissa officinalis as reducing agent of the silver ions in aqueous solution at room temperature. Complementary, the antibacterial activity of the silver nanoparticles against Staphylococcus aureus and Escherichia coli was confirmed. The silver nanoparticles obtained were characterized by transmission electron microscopy, X-ray diffraction, UV-vis, Raman and FT-IR spectroscopy. The observed results suggested that using Melissa officinalis, it is possible to performed silver nanoparticles with controlled characteristics and with significant inhibitory activity against the Staphylococcus aureus and Escherichia coli.
Nuhiji, Betime; Attard, Darren; Thorogood, Gordon; Hanley, Tracey; Magniez, Kevin; Bungur, Jenny; Fox, Bronwyn
2013-01-01
The role of processing conditions and intercalant chemistry in montmorillonite clays on the dispersion, morphology and mechanical properties of two epoxy/clay nanocomposite systems was investigated in this paper. This work highlights the importance of employing complementary techniques (X-ray diffraction, small angle X-ray scattering, optical microscopy and transmission electron microscopy) to correlate nanomorphology to macroscale properties. Materials were prepared using an out of autoclave manufacturing process equipped to generate rapid heating rates and mechanical vibration. The results suggested that the quaternary ammonium surfactant on C30B clay reacted with the epoxy during cure, while the primary ammonium surfactant (I.30E) catalysed the polymerisation reaction. These effects led to important differences in nanocomposite clay morphologies. The use of mechanical vibration at 4 Hz prior to matrix gelation was found to facilitate clay dispersion and to reduce the area fraction of I.30E clay agglomerates in addition to increasing flexural strength by over 40%. PMID:28811457
Degradation of Au-Ti contacts of SiGe HBTs during electromagnetic field stress
NASA Astrophysics Data System (ADS)
Alaeddine, A.; Genevois, C.; Kadi, M.; Cuvilly, F.; Daoud, K.
2011-02-01
This paper addresses electromagnetic field stress effects on SiGe heterojunction bipolar transistors (HBTs)' reliability issues, focusing on the relationship between the stress-induced current and device structure degradations. The origin of leakage currents and electrical parameter shifts in failed transistors has been studied by complementary failure analysis techniques. Characterization of the structure before and after ageing was performed by transmission electron microscopy (TEM) and energy dispersive spectroscopy (EDS). For the stressed samples, interface deformations of the titanium (Ti) thin film around all gold (Au) contacts have been clearly detected. These degradations include localized interface reaction between Au and Ti layers as well as their lateral atomic migration causing a significant reduction of Ti thickness. EDS analysis of the disordered region which is near the Si3N4 interface has shown significant signals from Au. These observations could be attributed to the coupling between high current densities induced by stress and thermal effects due to local heating effects.
Channel add-drop filter based on dual photonic crystal cavities in push-pull mode.
Poulton, Christopher V; Zeng, Xiaoge; Wade, Mark T; Popović, Miloš A
2015-09-15
We demonstrate an add-drop filter based on a dual photonic crystal nanobeam cavity system that emulates the operation of a traveling wave resonator, and, thus, provides separation of the through and drop port transmission from the input port. The device is on a 3×3 mm chip fabricated in an advanced microelectronics silicon-on-insulator complementary metal-oxide semiconductor (SOI CMOS) process (IBM 45 nm SOI) without any foundry process modifications. The filter shows 1 dB of insertion loss in the drop port with a 3 dB bandwidth of 64 GHz, and 16 dB extinction in the through port. To the best of our knowledge, this is the first implementation of a port-separating, add-drop filter based on standing wave cavities coupled to conventional waveguides, and demonstrates a performance that suggests potential for photonic crystal devices within optical immersion lithography-based advanced CMOS electronics-photonics integration.
Formation Pathways of Carbon Allotropes in Detonation Condensates
NASA Astrophysics Data System (ADS)
Nielsen, Michael; Bagge-Hansen, Michael; Hammons, Josh; Lauderbach, Lisa; Hodgin, Ralph; Bastea, Sorin; Fried, Larry; Lee, Jonathan; van Buuren, Tony; Pagoria, Phil; May, Chadd; Aloni, Shaul; Willey, Trevor
2017-06-01
Time-resolved small-angle scattering (TR-SAXS) data reveal evolution in the size and morphology of nano-carbon particles that form during the first microsecond during the detonation of high explosive (HE) materials, but do not provide chemical or phase information. Herein, we present analysis of complementary post-detonation soots collected with minimal environmental carbon or other contamination: HE samples are detonated whithin clean ice capture layers to yield aqueous dispersions of the carbonaceous soot. We report substantial variation in soots formed through the detonation of HE materials that attain a variety of temperatures and pressures during detonation. Transmission electron microscopy analysis of these recovered soots provides physical and chemical information that we compare directly to TR-SAXS data and SAXS measurements from recovered soots. We observe various structures including graphitic and amorphous carbon, nanodiamond, and spherical carbon onions. These experimental data correlate to models of how products from HE materials traverse the carbon phase diagram during detonation. Prepared by LLNL under Contract DE-AC52-07NA27344.
Timpel, M; Wanderka, N; Vinod Kumar, G S; Banhart, J
2011-05-01
Strontium-modified Al-15 wt%Si casting alloys were investigated after 5 and 60 min of melt holding. The eutectic microstructures were studied using complementary methods at different length scales: focused ion beam-energy selective backscattered tomography, transmission electron microscopy and 3D atom probe. Whereas the samples after 5 min of melt holding show that the structure of eutectic Si changes into a fine fibrous morphology, the increase of prolonged melt holding (60 min) leads to the loss of Sr within the alloy with an evolution of an unmodified eutectic microstructure displaying coarse interconnected Si plates. Strontium was found at the Al/Si eutectic interfaces on the side of the eutectic Al region, measured by 3D atom probe. The new results obtained using 3D atom probe shed light on the location of Sr within the Al-Si eutectic microstructure. Copyright © 2010 Elsevier B.V. All rights reserved.
Manipulating the ABCs of self-assembly via low-χ block polymer design
Chang, Alice B.; Lee, Byeongdu; Garland, Carol M.; Jones, Simon C.; Matsen, Mark W.
2017-01-01
Block polymer self-assembly typically translates molecular chain connectivity into mesoscale structure by exploiting incompatible blocks with large interaction parameters (χij). In this article, we demonstrate that the converse approach, encoding low-χ interactions in ABC bottlebrush triblock terpolymers (χAC ≲ 0), promotes organization into a unique mixed-domain lamellar morphology, which we designate LAMP. Transmission electron microscopy indicates that LAMP exhibits ACBC domain connectivity, in contrast to conventional three-domain lamellae (LAM3) with ABCB periods. Complementary small-angle X-ray scattering experiments reveal a strongly decreasing domain spacing with increasing total molar mass. Self-consistent field theory reinforces these observations and predicts that LAMP is thermodynamically stable below a critical χAC, above which LAM3 emerges. Both experiments and theory expose close analogies to ABA′ triblock copolymer phase behavior, collectively suggesting that low-χ interactions between chemically similar or distinct blocks intimately influence self-assembly. These conclusions provide fresh opportunities for block polymer design with potential consequences spanning all self-assembling soft materials. PMID:28588139
Microyielding of core-shell crystal dendrites in a bulk-metallic-glass matrix composite
Huang, E. -Wen; Qiao, Junwei; Winiarski, Bartlomiej; ...
2014-03-18
In-situ synchrotron x-ray experiments have been used to follow the evolution of the diffraction peaks for crystalline dendrites embedded in a bulk metallic glass matrix subjected to a compressive loading-unloading cycle. We observe irreversible diffraction-peak splitting even though the load does not go beyond half of the bulk yield strength. The chemical analysis coupled with the transmission electron microscopy mapping suggests that the observed peak splitting originates from the chemical heterogeneity between the core (major peak) and the stiffer shell (minor peak) of the dendrites. A molecular dynamics model has been developed to compare the hkl-dependent microyielding of the bulkmore » metallic-glass matrix composite. As a result, the complementary diffraction measurements and the simulation results suggest that the interfaces between the amorphous matrix and the (211) crystalline planes relax under prolonged load that causes a delay in the reload curve which ultimately catches up with the original path.« less
Precipitates and boundaries interaction in ferritic ODS steels
NASA Astrophysics Data System (ADS)
Sallez, Nicolas; Hatzoglou, Constantinos; Delabrouille, Fredéric; Sornin, Denis; Chaffron, Laurent; Blat-Yrieix, Martine; Radiguet, Bertrand; Pareige, Philippe; Donnadieu, Patricia; Bréchet, Yves
2016-04-01
In the course of a recrystallization study of Oxide Dispersion Strengthened (ODS) ferritic steels during extrusion, particular interest was paid to the (GB) Grain Boundaries interaction with precipitates. Complementary and corresponding characterization experiments using Transmission Electron Microscopy (TEM), Energy Dispersive X-ray spectroscopy (EDX) and Atom Probe Tomography (APT) have been carried out on a voluntarily interrupted extrusion or extruded samples. Microscopic observations of Precipitate Free Zones (PFZ) and precipitates alignments suggest precipitate interaction with migrating GB involving dissolution and Oswald ripening of the precipitates. This is consistent with the local chemical information gathered by EDX and APT. This original mechanism for ODS steels is similar to what had been proposed in the late 80s for similar observation made on Ti alloys reinforced by nanosized yttrium oxides: An interaction mechanism between grain boundaries and precipitates involving a diffusion controlled process of precipitates dissolution at grain boundaries. It is believed that this mechanism can be of primary importance to explain the mechanical behaviour of such steels.
NASA Astrophysics Data System (ADS)
Ratnam, Challa; Lakshmana Rao, Vadlamudi; Lachaa Goud, Sivagouni
2006-10-01
In the present paper, and a series of papers to follow, the Fourier analytical properties of multiple annuli coded aperture (MACA) and complementary multiple annuli coded aperture (CMACA) systems are investigated. First, the transmission function for MACA and CMACA is derived using Fourier methods and, based on the Fresnel-Kirchoff diffraction theory, the formulae for the point spread function are formulated. The PSF maxima and minima are calculated for both the MACA and CMACA systems. The dependence of these properties on the number of zones is studied and reported in this paper.
Terahertz Metasurfaces Optimized for Biomolecular Detection
NASA Astrophysics Data System (ADS)
Naranjo, Guillermo A.
In the last decade, there has been an increase in the use of metasurfaces to detect biological compounds at terahertz frequencies. This increased interest has been fueled by the fact that various biomolecules have rotational and vibrational modes at THz frequencies. The metasurface's resonant units can be considered as inductive-capacitive circuits therefore the detection mechanism is the change in dielectric constant in the capacitive region due to the presence of an analyte. In this project we utilized a facing split ring resonator design with three different tip geometries defining the capacitive region; square, triangular and round tips. We also utilized complementary facing split ring resonators, which present a larger capacitive region that their positive counterparts, with the same three tip geometries. In addition, we added micro wells in the capacitive region of the resonators where they serve to infiltrate the analyte into the substrate and increases their interaction with the electric field. The samples were then fabricated using photolithography, electron beam lithography and reactive ion etching to define the micro wells. They were characterized by obtaining the terahertz transmission spectra using terahertz time domain spectroscopy with and without an overlayer of Ara-h-2 or Ara-h-6. Results show that the metasurfaces can detect the presence of the allergens, and present a different response for Ara-h-2 than for Ara-h-6. The results indicate that utilizing complementary metasurfaces and/ or the addition of micro wells in the capacitive region are promising avenues to develop a sensitive terahertz metasurface based biosensor.
Dabos, G; Manolis, A; Papaioannou, S; Tsiokos, D; Markey, L; Weeber, J-C; Dereux, A; Giesecke, A L; Porschatis, C; Chmielak, B; Pleros, N
2018-05-14
We demonstrate wavelength-division-multiplexed (WDM) 200 Gb/s (8 × 25 Gb/s) data transmission over 100 μm long aluminum (Al) surface-plasmon-polariton (SPP) waveguides on a Si 3 N 4 waveguide platform at telecom wavelengths. The Al SPP waveguide was evaluated in terms of signal integrity by performing bit-error-rate (BER) measurements that revealed error-free operation for all eight 25 Gb/s non-return-to-zero (NRZ) modulated data channels with power penalties not exceeding 0.2 dB at 10 -9 . To the best of our knowledge, this is the first demonstration of WDM enabled data transmission over complementary-metal-oxide-semiconductor (CMOS) SPP waveguides fueling future development of CMOS compatible plasmo-photonic devices for on-chip optical interconnections.
Babbar, Shilpa; Williams, Karen B; Maulik, Dev
2016-10-05
The use of complementary and alternative medicine during pregnancy is currently on the rise. A validated survey was conducted at the Central Association of Obstetrician and Gynecologists annual meeting to evaluate the knowledge, attitude, and practice of general obstetricians and gynecologists and maternal-fetal medicine specialists in America. We obtained 128 responses: 73 electronically (57%) and 55 via the paper survey (43%). Forty-five percent reported personally using complementary and alternative medicine and 9% of women respondents used complementary and alternative medicine during pregnancy. Overall, 62% had advised their patients to utilize some form of complementary and alternative medicine in pregnancy. Biofeedback, massage therapy, meditation, and yoga were considered the most effective modalities in pregnancy (median [semi-interquartile range] = 2 [0.5]). Maternal-fetal medicine specialists were significantly more likely to disagree on the use of complementary and alternative medicine for risk reduction of preterm birth compared to obstetricians and gynecologists (P = .03). As the use of complementary and alternative medicine continues to rise in reproductive-age women, obstetricians will play an integral role in incorporating complementary and alternative medicine use with conventional medicine. © The Author(s) 2016.
Babbar, Shilpa; Williams, Karen B.; Maulik, Dev
2016-01-01
The use of complementary and alternative medicine during pregnancy is currently on the rise. A validated survey was conducted at the Central Association of Obstetrician and Gynecologists annual meeting to evaluate the knowledge, attitude, and practice of general obstetricians and gynecologists and maternal-fetal medicine specialists in America. We obtained 128 responses: 73 electronically (57%) and 55 via the paper survey (43%). Forty-five percent reported personally using complementary and alternative medicine and 9% of women respondents used complementary and alternative medicine during pregnancy. Overall, 62% had advised their patients to utilize some form of complementary and alternative medicine in pregnancy. Biofeedback, massage therapy, meditation, and yoga were considered the most effective modalities in pregnancy (median [semi-interquartile range] = 2 [0.5]). Maternal-fetal medicine specialists were significantly more likely to disagree on the use of complementary and alternative medicine for risk reduction of preterm birth compared to obstetricians and gynecologists (P = .03). As the use of complementary and alternative medicine continues to rise in reproductive-age women, obstetricians will play an integral role in incorporating complementary and alternative medicine use with conventional medicine. PMID:27707901
Demonstration of transmission high energy electron microscopy
Merrill, F. E.; Goett, J.; Gibbs, J. W.; ...
2018-04-06
High energy electrons have been used to investigate an extension of transmission electron microscopy. This technique, transmission high energy electron microscopy (THEEM), provides two additional capabilities to electron microscopy. First, high energy electrons are more penetrating than low energy electrons, and thus, they are able to image through thicker samples. Second, the accelerating mode of a radio-frequency linear accelerator provides fast exposures, down to 1 ps, which are ideal for flash radiography, making THEEM well suited to study the evolution of fast material processes under dynamic conditions. Lastly, initial investigations with static objects and during material processing have been performedmore » to investigate the capabilities of this technique.« less
Scanning Transmission Electron Microscopy | Materials Science | NREL
mode by collecting the EDS and EELS signals point-by-point as one scans the electron probe across the . Examples of Scanning Transmission Electron Microscopy Capabilities Z-contrast image microphoto taken by
High Performance Complementary Circuits Based on p-SnO and n-IGZO Thin-Film Transistors.
Zhang, Jiawei; Yang, Jia; Li, Yunpeng; Wilson, Joshua; Ma, Xiaochen; Xin, Qian; Song, Aimin
2017-03-21
Oxide semiconductors are regarded as promising materials for large-area and/or flexible electronics. In this work, a ring oscillator based on n-type indium-gallium-zinc-oxide (IGZO) and p-type tin monoxide (SnO) is presented. The IGZO thin-film transistor (TFT) shows a linear mobility of 11.9 cm²/(V∙s) and a threshold voltage of 12.2 V. The SnO TFT exhibits a mobility of 0.51 cm²/(V∙s) and a threshold voltage of 20.1 V which is suitable for use with IGZO TFTs to form complementary circuits. At a supply voltage of 40 V, the complementary inverter shows a full output voltage swing and a gain of 24 with both TFTs having the same channel length/channel width ratio. The three-stage ring oscillator based on IGZO and SnO is able to operate at 2.63 kHz and the peak-to-peak oscillation amplitude reaches 36.1 V at a supply voltage of 40 V. The oxide-based complementary circuits, after further optimization of the operation voltage, may have wide applications in practical large-area flexible electronics.
High Performance Complementary Circuits Based on p-SnO and n-IGZO Thin-Film Transistors
Zhang, Jiawei; Yang, Jia; Li, Yunpeng; Wilson, Joshua; Ma, Xiaochen; Xin, Qian; Song, Aimin
2017-01-01
Oxide semiconductors are regarded as promising materials for large-area and/or flexible electronics. In this work, a ring oscillator based on n-type indium-gallium-zinc-oxide (IGZO) and p-type tin monoxide (SnO) is presented. The IGZO thin-film transistor (TFT) shows a linear mobility of 11.9 cm2/(V∙s) and a threshold voltage of 12.2 V. The SnO TFT exhibits a mobility of 0.51 cm2/(V∙s) and a threshold voltage of 20.1 V which is suitable for use with IGZO TFTs to form complementary circuits. At a supply voltage of 40 V, the complementary inverter shows a full output voltage swing and a gain of 24 with both TFTs having the same channel length/channel width ratio. The three-stage ring oscillator based on IGZO and SnO is able to operate at 2.63 kHz and the peak-to-peak oscillation amplitude reaches 36.1 V at a supply voltage of 40 V. The oxide-based complementary circuits, after further optimization of the operation voltage, may have wide applications in practical large-area flexible electronics. PMID:28772679
Wang, Lei; Wong, Stanislaus S.; Han, Jinkyu; ...
2015-11-16
As a model system for understanding charge transfer in novel architectural designs for solar cells, double-walled carbon nanotube (DWNT)–CdSe quantum dot (QD) (QDs with average diameters of 2.3, 3.0, and 4.1 nm) heterostructures have been fabricated. The individual nanoscale building blocks were successfully attached and combined using a hole-trapping thiol linker molecule, i.e., 4-mercaptophenol (MTH), through a facile, noncovalent π–π stacking attachment strategy. Transmission electron microscopy confirmed the attachment of QDs onto the external surfaces of the DWNTs. We herein demonstrate a meaningful and unique combination of near-edge X-ray absorption fine structure (NEXAFS) and Raman spectroscopies bolstered by complementary electricalmore » transport measurements in order to elucidate the synergistic interactions between CdSe QDs and DWNTs, which are facilitated by the bridging MTH molecules that can scavenge photoinduced holes and potentially mediate electron redistribution between the conduction bands in CdSe QDs and the C 2p-derived states of the DWNTs. Specifically, we correlated evidence of charge transfer as manifested by (i) changes in the NEXAFS intensities of π* resonance in the C K-edge and Cd M3-edge spectra, (ii) a perceptible outer tube G-band downshift in frequency in Raman spectra, as well as (iii) alterations in the threshold characteristics present in transport data as a function of CdSe QD deposition onto the DWNT surface. Furthermore, the separate effects of (i) varying QD sizes and (ii) QD coverage densities on the electron transfer were independently studied.« less
Deciphering the physics and chemistry of perovskites with transmission electron microscopy.
Polking, Mark J
2016-03-28
Perovskite oxides exhibit rich structural complexity and a broad range of functional properties, including ferroelectricity, ferromagnetism, and superconductivity. The development of aberration correction for the transmission electron microscope and concurrent progress in electron spectroscopy, electron holography, and other techniques has fueled rapid progress in the understanding of the physics and chemistry of these materials. New techniques based on the transmission electron microscope are first surveyed, and the applications of these techniques for the study of the structure, chemistry, electrostatics, and dynamics of perovskite oxides are then explored in detail, with a particular focus on ferroelectric materials.
48 CFR 832.7002-1 - Data transmission.
Code of Federal Regulations, 2013 CFR
2013-10-01
... 48 Federal Acquisition Regulations System 5 2013-10-01 2013-10-01 false Data transmission. 832... CONTRACTING REQUIREMENTS CONTRACT FINANCING Electronic Invoicing Requirements 832.7002-1 Data transmission... conforms to the X12 electronic data interchange (EDI) formats established by the Accredited Standards...
48 CFR 832.7002-1 - Data transmission.
Code of Federal Regulations, 2014 CFR
2014-10-01
... 48 Federal Acquisition Regulations System 5 2014-10-01 2014-10-01 false Data transmission. 832... CONTRACTING REQUIREMENTS CONTRACT FINANCING Electronic Invoicing Requirements 832.7002-1 Data transmission... conforms to the X12 electronic data interchange (EDI) formats established by the Accredited Standards...
Transmission effects in unfolding electronic-vibrational electron-molecule energy-loss spectra
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang Shiyang; Khakoo, Murtadha A.; Johnson, Paul V.
2006-03-15
The results of an investigation concerning the sensitivity of conventional unfolding methods applied to electronic-vibrational electron-energy-loss spectra to the transmission efficiency of electron spectrometers are presented. This investigation was made in an effort to understand differences in the differential cross sections for excitation of low-lying electronic states determined experimentally by various groups using electronic-vibrational energy-loss spectra of N{sub 2}. In these experiments, very similar spectral unfolding methods were used, which relied on similar Franck-Condon factors. However, the overall analyses of the electron scattering spectra (by the individual groups) resulted in large differences among the differential cross sections determined from thesemore » energy-loss spectra. The transmission response of the experimental apparatus to different-energy scattered electrons has often been discussed as a key factor that caused these disagreements. The present investigation shows in contrast that the effect of transmission is smaller than that required to independently explain such differences, implying that other systematic effects are responsible for the existing differences between measurements.« less
Hall, David R.; Pixton, David S.; Briscoe, Michael; Bradford, Kline; Rawle, Michael; Bartholomew, David B.; McPherson, James
2007-03-20
A swivel assembly for a downhole tool string comprises a first and second coaxial housing cooperatively arranged. The first housing comprises a first transmission element in communication with surface equipment. The second housing comprises a second transmission element in communication with the first transmission element. The second housing further comprises a third transmission element adapted for communication with a network integrated into the downhole tool string. The second housing may be rotational and adapted to transmit a signal between the downhole network and the first housing. Electronic circuitry is in communication with at least one of the transmission elements. The electronic circuitry may be externally mounted to the first or second housing. Further, the electronic circuitry may be internally mounted in the second housing. The electronic circuitry may be disposed in a recess in either first or second housing of the swivel.
Höfer, Juliana; Hoffmann, Falk; Bachmann, Christian
2017-05-01
Despite limited evidence, complementary and alternative medicine treatments are popular in autism spectrum disorder. The aim of this review was to summarize the available evidence on complementary and alternative medicine use frequency in autism spectrum disorder. A systematic search of three electronic databases was performed. All research studies in English or German reporting data on the frequency of complementary and alternative medicine use in individuals with autism spectrum disorder were included. Two independent reviewers searched the literature, extracted information on study design and results, and assessed study quality using an established quality assessment tool. Twenty studies with a total of 9540 participants were included. The prevalence of any complementary and alternative medicine use ranged from 28% to 95% (median: 54%). Special diets or dietary supplements (including vitamins) were the most frequent complementary and alternative medicine treatments, ranking first in 75% of studies. There was some evidence for a higher prevalence of complementary and alternative medicine use in autism spectrum disorder compared to other psychiatric disorders and the general population. Approximately half of children and adolescents with autism spectrum disorder use complementary and alternative medicine. Doctors should be aware of this and should discuss complementary and alternative medicine use with patients and their carers, especially as the evidence is mixed and some complementary and alternative medicine treatments are potentially harmful.
Sun, Cheng; Müller, Erich; Meffert, Matthias; Gerthsen, Dagmar
2018-04-01
Transmission electron microscopy (TEM) with low-energy electrons has been recognized as an important addition to the family of electron microscopies as it may avoid knock-on damage and increase the contrast of weakly scattering objects. Scanning electron microscopes (SEMs) are well suited for low-energy electron microscopy with maximum electron energies of 30 keV, but they are mainly used for topography imaging of bulk samples. Implementation of a scanning transmission electron microscopy (STEM) detector and a charge-coupled-device camera for the acquisition of on-axis transmission electron diffraction (TED) patterns, in combination with recent resolution improvements, make SEMs highly interesting for structure analysis of some electron-transparent specimens which are traditionally investigated by TEM. A new aspect is correlative SEM, STEM, and TED imaging from the same specimen region in a SEM which leads to a wealth of information. Simultaneous image acquisition gives information on surface topography, inner structure including crystal defects and qualitative material contrast. Lattice-fringe resolution is obtained in bright-field STEM imaging. The benefits of correlative SEM/STEM/TED imaging in a SEM are exemplified by structure analyses from representative sample classes such as nanoparticulates and bulk materials.
Xu, Tao; Dick, Kimberly A; Plissard, Sébastien; Nguyen, Thanh Hai; Makoudi, Younes; Berthe, Maxime; Nys, Jean-Philippe; Wallart, Xavier; Grandidier, Bruno; Caroff, Philippe
2012-03-09
III-V antimonide nanowires are among the most interesting semiconductors for transport physics, nanoelectronics and long-wavelength optoelectronic devices due to their optimal material properties. In order to investigate their complex crystal structure evolution, faceting and composition, we report a combined scanning electron microscopy (SEM), transmission electron microscopy (TEM), and scanning tunneling microscopy (STM) study of gold-nucleated ternary InAs/InAs(1-x)Sb(x) nanowire heterostructures grown by molecular beam epitaxy. SEM showed the general morphology and faceting, TEM revealed the internal crystal structure and ternary compositions, while STM was successfully applied to characterize the oxide-free nanowire sidewalls, in terms of nanofaceting morphology, atomic structure and surface composition. The complementary use of these techniques allows for correlation of the morphological and structural properties of the nanowires with the amount of Sb incorporated during growth. The addition of even a minute amount of Sb to InAs changes the crystal structure from perfect wurtzite to perfect zinc blende, via intermediate stacking fault and pseudo-periodic twinning regimes. Moreover, the addition of Sb during the axial growth of InAs/InAs(1-x)Sb(x) heterostructure nanowires causes a significant conformal lateral overgrowth on both segments, leading to the spontaneous formation of a core-shell structure, with an Sb-rich shell.
Göncü, Yapıncak; Geçgin, Merve; Bakan, Feray; Ay, Nuran
2017-10-01
In this study, commercial pure titanium samples were coated with nano hydroxyapatite-nano hexagonal boron nitride (nano HA-nano hBN) composite by electrophoretic deposition (EPD). The effect of process parameters (applied voltage, deposition time and solid concentration) on the coating morphology, thickness and the adhesion behavior were studied systematically and crack free nano hBN-nano HA composite coating production was achieved for developing bioactive coatings on titanium substrates for orthopedic applications. For the examination of structural and morphological characteristics of the coating surfaces, various complementary analysis methods were performed. For the structural characterization, XRD and Raman Spectroscopy were used while, Scanning Electron Microscopy (SEM) equipped with an energy dispersive spectrometer (EDS) and Transmission Electron Microscopy (TEM) techniques were carried out for revealing the morphological characterization. The results showed that nano HA-nano hBN were successfully deposited on Ti surface with uniform, crack-free coating by EPD. The amounts of hBN in suspension are considered to have no effect on coating thickness. By adding hBN into HA, the morphology of HA did not change and hBN has no significant effect on porous structure. These nanostructured surfaces are expected to be suitable for proliferation of cells and have high potential for bioactive materials. Copyright © 2017 Elsevier B.V. All rights reserved.
Yumak, Tugrul; Kuralay, Filiz; Muti, Mihrican; Sinag, Ali; Erdem, Arzum; Abaci, Serdar
2011-09-01
In this study, ZnO nanoparticles (ZNP) of approximately 30 nm in size were synthesized by the hydrothermal method and characterized by X-ray diffraction (XRD), Braun-Emmet-Teller (BET) N2 adsorption analysis and transmission electron microscopy (TEM). ZnO nanoparticles enriched with poly(vinylferrocenium) (PVF+) modified single-use graphite electrodes were then developed for the electrochemical monitoring of nucleic acid hybridization related to the Hepatitis B Virus (HBV). Firstly, the surfaces of polymer modified and polymer-ZnO nanoparticle modified single-use pencil graphite electrodes (PGEs) were characterized using scanning electron microscopy (SEM). The electrochemical behavior of these electrodes was also investigated using differential pulse voltammetry (DPV) and electrochemical impedance spectroscopy (EIS). Subsequently, the polymer-ZnO nanoparticle modified PGEs were evaluated for the electrochemical detection of DNA based on the changes at the guanine oxidation signals. Various modifications in DNA oligonucleotides and probe concentrations were examined in order to optimize the electrochemical signals that were generated by means of nucleic acid hybridization. After the optimization studies, the sequence-selective DNA hybridization was investigated in the case of a complementary amino linked probe (target), or noncomplementary (NC) sequences, or target and mismatch (MM) mixture in the ratio of (1:1). Copyright © 2011 Elsevier B.V. All rights reserved.
Doping of two-dimensional MoS2 by high energy ion implantation
NASA Astrophysics Data System (ADS)
Xu, Kang; Zhao, Yuda; Lin, Ziyuan; Long, Yan; Wang, Yi; Chan, Mansun; Chai, Yang
2017-12-01
Two-dimensional (2D) materials have been demonstrated to be promising candidates for next generation electronic circuits. Analogues to conventional Si-based semiconductors, p- and n-doping of 2D materials are essential for building complementary circuits. Controllable and effective doping strategies require large tunability of the doping level and negligible structural damage to ultrathin 2D materials. In this work, we demonstrate a doping method utilizing a conventional high-energy ion-implantation machine. Before the implantation, a Polymethylmethacrylate (PMMA) protective layer is used to decelerate the dopant ions and minimize the structural damage to MoS2, thus aggregating the dopants inside MoS2 flakes. By optimizing the implantation energy and fluence, phosphorus dopants are incorporated into MoS2 flakes. Our Raman and high-resolution transmission electron microscopy (HRTEM) results show that only negligibly structural damage is introduced to the MoS2 lattice during the implantation. P-doping effect by the incorporation of p+ is demonstrated by Photoluminescence (PL) and electrical characterizations. Thin PMMA protection layer leads to large kinetic damage but also a more significant doping effect. Also, MoS2 with large thickness shows less kinetic damage. This doping method makes use of existing infrastructures in the semiconductor industry and can be extended to other 2D materials and dopant species as well.
NASA Astrophysics Data System (ADS)
Grigor'eva, N. A.; Eckerlebe, H.; Eliseev, A. A.; Lukashin, A. V.; Napol'skii, K. S.; Kraje, M.; Grigor'ev, S. V.
2017-03-01
The structural and magnetic properties of the mesoporous systems based on silicon dioxide with a regular hexagonal arrangement of pores several microns in length and several nanometers in diameter, which are filled with iron compound nanofilaments in various chemical states, are studied in detail. The studies are performed using the following mutually complementary methods: transmission electron microscopy, SQUID magnetometry, electron spin resonance, Mössbauer spectroscopy, polarized neutron small-angle diffraction, and synchrotron radiation diffraction. It is shown that the iron nanoparticles in pores are mainly in the γ phase of Fe2O3 with a small addition of the α phase and atomic iron clusters. The effective magnetic field acting on a nanofilament from other nanofilaments is 11 mT and has a dipole nature, the ferromagnetic-paramagnetic transition temperature is in the range 76-94 K depending on the annealing temperature of the samples, and the temperature that corresponds to the change in the magnetic state of the iron oxide nanofilaments is T ≈ 50-60 K at H = 0 and T ≈ 80 K at H = 300 mT. It is also shown that the magnetization reversal of an array of nanofilaments is caused by the magnetostatic interaction between nanofilaments at the fields that are lower than the saturation field.
FIFO Buffer for Asynchronous Data Streams
NASA Technical Reports Server (NTRS)
Bascle, K. P.
1985-01-01
Variable-rate, asynchronous data signals from up to four measuring instruments or other sources combined in first-in/first-out (FIFO) buffer for transmission on single channel. Constructed in complementary metal-oxide-semiconductor (CMOS) logic, buffer consumes low power (only 125 mW at 5V) and conforms to aerospace standards of reliability and maintainability.
ERIC Educational Resources Information Center
Buchs, Celine; Butera, Fabrizio
2009-01-01
Previous studies with university students have shown that resource interdependence during cooperative dyadic work on texts produces two different dynamics in student interaction and learning. Working on complementary information produces positive interactions, but a good quality of information transmission is needed to foster student learning.…
NASA Astrophysics Data System (ADS)
Tanis, J. A.; Keerthisinghe, D.; Wickramarachchi, S. J.; Ikeda, T.; Stolterfoht, N.
2018-05-01
Charge deposition dependences of electron transmission through insulating PET nanocapillaries and a tapered glass microcapillary are reported and differences with HCI transmission are noted. Investigations were conducted for electrons with incident energies 500-1000 eV, corresponding to energies per charge similar to those used for HCI studies, incident on (1) an array of PET nanocapillaries (density ∼5 × 108/cm2) with diameters 100 nm in a foil of thickness 12 μm, and (2) on a tapered glass microcapillary with inlet/outlet diameters of 800/100 μm and a length of ∼35 mm. The transmission was measured for incident electrons at small sample tilt angles ranging from 0° to 5° with respect to the beam direction. For most angles, including those near zero degrees, there was an initial quiet period during which essentially no transmission was observed, followed by large rises in the transmission during relatively short periods of charge deposition before equilibrium of the transmission was reached. The resulting equilibrium was stable, blocked or had frequent oscillations depending on the incident energy and the capillary used. Observations for both capillaries show that a negative charge patch is needed to guide incident electrons through the capillaries similar to the manner in which HCIs are guided through capillaries.
What Hinders Electron Transfer Dissociation (ETD) of DNA Cations?
NASA Astrophysics Data System (ADS)
Hari, Yvonne; Leumann, Christian J.; Schürch, Stefan
2017-12-01
Radical activation methods, such as electron transfer dissociation (ETD), produce structural information complementary to collision-induced dissociation. Herein, electron transfer dissociation of 3-fold protonated DNA hexamers was studied to gain insight into the fragmentation mechanism. The fragmentation patterns of a large set of DNA hexamers confirm cytosine as the primary target of electron transfer. The reported data reveal backbone cleavage by internal electron transfer from the nucleobase to the phosphate linker leading either to a•/ w or d/ z• ion pairs. This reaction pathway contrasts with previous findings on the dissociation processes after electron capture by DNA cations, suggesting multiple, parallel dissociation channels. However, all these channels merely result in partial fragmentation of the precursor ion because the charge-reduced DNA radical cations are quite stable. Two hypotheses are put forward to explain the low dissociation yield of DNA radical cations: it is either attributed to non-covalent interactions between complementary fragments or to the stabilization of the unpaired electron in stacked nucleobases. MS3 experiments suggest that the charge-reduced species is the intact oligonucleotide. Moreover, introducing abasic sites significantly increases the dissociation yield of DNA cations. Consequently, the stabilization of the unpaired electron by π-π-stacking provides an appropriate rationale for the high intensity of DNA radical cations after electron transfer. [Figure not available: see fulltext.
21 CFR 1311.05 - Standards for technologies for electronic transmission of orders.
Code of Federal Regulations, 2011 CFR
2011-04-01
... 21 Food and Drugs 9 2011-04-01 2011-04-01 false Standards for technologies for electronic... JUSTICE REQUIREMENTS FOR ELECTRONIC ORDERS AND PRESCRIPTIONS General § 1311.05 Standards for technologies for electronic transmission of orders. (a) A registrant or a person with power of attorney to sign...
21 CFR 1311.05 - Standards for technologies for electronic transmission of orders.
Code of Federal Regulations, 2010 CFR
2010-04-01
... technologies for electronic transmission of orders. (a) A registrant or a person with power of attorney to sign orders for Schedule I and II controlled substances may use any technology to sign and electronically... 21 Food and Drugs 9 2010-04-01 2010-04-01 false Standards for technologies for electronic...
Angularly-selective transmission imaging in a scanning electron microscope.
Holm, Jason; Keller, Robert R
2016-08-01
This work presents recent advances in transmission scanning electron microscopy (t-SEM) imaging control capabilities. A modular aperture system and a cantilever-style sample holder that enable comprehensive angular selectivity of forward-scattered electrons are described. When combined with a commercially available solid-state transmission detector having only basic bright-field and dark-field imaging capabilities, the advances described here enable numerous transmission imaging modes. Several examples are provided that demonstrate how contrast arising from diffraction to mass-thickness can be obtained. Unanticipated image contrast at some imaging conditions is also observed and addressed. Published by Elsevier B.V.
Sheath energy transmission in a collisional plasma with collisionless sheath
Tang, Xian-Zhu; Guo, Zehua
2015-10-16
Sheath energy transmission governs the plasma energy exhaust onto a material surface. The ion channel is dominated by convection, but the electron channel has a significant thermal conduction component, which is dominated by the Knudsen layer effect in the presence of an absorbing wall. First-principle kinetic simulations also reveal a robustly supersonic sheath entry flow. The ion sheath energy transmission and the sheath potential are accurately predicted by a sheath model of truncated bi-Maxwellian electron distribution. The electron energy transmission is further enhanced by a parallel heat flux of the perpendicular degrees of freedom.
NASA Astrophysics Data System (ADS)
Ye, X.; Tang, Q.; Li, T.; Wang, Y. L.; Zhang, X.; Ye, S. Y.
2017-05-01
The wind, photovoltaic and hydro power bundled transmission system attends to become common in Northwest and Southwest of China. To make better use of the power complementary characteristic of different power sources, the installed capacity proportion of wind, photovoltaic and hydro power, and their capacity distribution for each integration node is a significant issue to be solved in power system planning stage. An optimal capacity proportion and capacity distribution model for wind, photovoltaic and hydro power bundled transmission system is proposed here, which considers the power out characteristic of power resources with different type and in different area based on real operation data. The transmission capacity limit of power grid is also considered in this paper. Simulation cases are tested referring to one real regional system in Southwest China for planning level year 2020. The results verify the effectiveness of the model in this paper.
Quasioptical devices based on extraordinary transmission at THz
NASA Astrophysics Data System (ADS)
Beruete, Miguel
2016-04-01
In this work I will present our latest advances in components developed from extraordinary transmission concepts operating at terahertz (THz) frequencies. First, a structure exhibiting two different extraordinary transmission resonances depending on the polarization of the incident wave will be shown. The peaks of transmission appear at approximately 2 and 2.5 THz for vertical and horizontal polarization, respectively, with a transmittance above 60% in both cases. Later on, a meandering line structure able to tune the extraordinary transmission resonance will be discussed. The operation frequency in this case is between 9 and 17 THz. A self-complementary polarizer will be then presented, with a high polarization purity. The fundamentals of this device based on the Babinet's principle will be discussed in depth. Finally, all these structures will be combined together to produce a dual-band Quarter Wave Plate able to convert a linear polarization at the input in a circular polarization at the output at two different bands, 1 and 2.2. THz. Some final words regarding the potential of extraordinary transmission for sensing applications will close the contribution.
21 CFR 1311.170 - Transmission requirements.
Code of Federal Regulations, 2011 CFR
2011-04-01
... been transmitted only if an intermediary or the designated pharmacy notifies a practitioner that an electronic prescription was not successfully delivered to the designated pharmacy. If this occurs, the... electronically to [name of the specific pharmacy] on [date/time] and that transmission failed. (c) The electronic...
21 CFR 1311.170 - Transmission requirements.
Code of Federal Regulations, 2014 CFR
2014-04-01
... been transmitted only if an intermediary or the designated pharmacy notifies a practitioner that an electronic prescription was not successfully delivered to the designated pharmacy. If this occurs, the... electronically to [name of the specific pharmacy] on [date/time] and that transmission failed. (c) The electronic...
21 CFR 1311.170 - Transmission requirements.
Code of Federal Regulations, 2013 CFR
2013-04-01
... been transmitted only if an intermediary or the designated pharmacy notifies a practitioner that an electronic prescription was not successfully delivered to the designated pharmacy. If this occurs, the... electronically to [name of the specific pharmacy] on [date/time] and that transmission failed. (c) The electronic...
21 CFR 1311.170 - Transmission requirements.
Code of Federal Regulations, 2012 CFR
2012-04-01
... been transmitted only if an intermediary or the designated pharmacy notifies a practitioner that an electronic prescription was not successfully delivered to the designated pharmacy. If this occurs, the... electronically to [name of the specific pharmacy] on [date/time] and that transmission failed. (c) The electronic...
NASA Astrophysics Data System (ADS)
Tu, Hongen; Xu, Yong
2012-07-01
This paper reports a simple flexible electronics technology that is compatible with silicon-on-insulator (SOI) complementary-metal-oxide-semiconductor (CMOS) processes. Compared with existing technologies such as direct fabrication on flexible substrates and transfer printing, the main advantage of this technology is its post-SOI-CMOS compatibility. Consequently, high-performance and high-density CMOS circuits can be first fabricated on SOI wafers using commercial foundry and then be integrated into flexible substrates. The yield is also improved by eliminating the transfer printing step. Furthermore, this technology allows the integration of various sensors and microfluidic devices. To prove the concept of this technology, flexible MOSFETs have been demonstrated.
Measuring Transmission Efficiencies Of Mass Spectrometers
NASA Technical Reports Server (NTRS)
Srivastava, Santosh K.
1989-01-01
Coincidence counts yield absolute efficiencies. System measures mass-dependent transmission efficiencies of mass spectrometers, using coincidence-counting techniques reminiscent of those used for many years in calibration of detectors for subatomic particles. Coincidences between detected ions and electrons producing them counted during operation of mass spectrometer. Under certain assumptions regarding inelastic scattering of electrons, electron/ion-coincidence count is direct measure of transmission efficiency of spectrometer. When fully developed, system compact, portable, and used routinely to calibrate mass spectrometers.
Direct Nanoscale Conversion of Biomolecular Signals into Electronic Information
2008-09-22
the electrode surface. In this experiment, the single free cysteine group featured in the GOx structure was exploited to demonstrate that orientation...first with GOx-ssDNA conjugates featuring a sequence complementary to the address strand, then with a non-complementary conjugate and finally with...fully-functional for an enzyme that features a free thiol group, or that can be engineered to incorporate a thiol onto its outer shell
Transmission/Scanning Transmission Electron Microscopy | Materials Science
imaging such as high resolution TEM. Transmission electron diffraction patterns help to determine the microstructure of a material and its defects. Phase-contrast imaging or high-resolution (HR) TEM imaging gives high scattering angle can be collected to form high-resolution, chemically sensitive, atomic number (Z
NASA Technical Reports Server (NTRS)
Ottens, Brian P.; Connelly, Joseph; Brown, Stephen; Roeder, James; Kauder, Lonny; Cavanaugh, John
2010-01-01
Experiments measuring the effect of electron exposure on 1064nm transmission for optical sapphire were conducted. Detailed before and after inspections did not identify any resulting Litchenburg patterns. Pre- and post-exposure 1064nm transmission measurements are compared.
NASA Technical Reports Server (NTRS)
Ottens, Brian P.; Connelly, Joseph; Brown, Stephen; Roeder, james; Kauder, Lonny; Cavanaugh, John
2008-01-01
Experiments measuring the effect of electron exposure on 1064nm transmission for optical sapphire were conducted. Detailed before and after inspections did not identify any resulting Litchenburg patterns. Pre- and post-exposure 1064nm transmission measurements are compared.
Microwave response of hole and patch arrays
NASA Astrophysics Data System (ADS)
Taylor, Melita C.; Edmunds, James D.; Hendry, Euan; Hibbins, Alastair P.; Sambles, J. Roy
2010-10-01
The electromagnetic response of two-dimensional square arrays of perfectly conducting square patches, and their complementary structures, is modeled utilizing a modal matching technique and employing Babinet’s principle. This method allows for the introduction of progressively higher diffracted orders and waveguide modes to be included in the calculation, hence aiding understanding of the underlying causal mechanism for the observed response. At frequencies close to, but below, the onset of diffraction, a near-complete reflection condition is predicted, even for low filling fractions: conversely, for high filling fractions a near-complete transmission condition results. These resonance phenomena are associated with evanescent diffraction, which is sufficiently strong to reverse the step change in transmission upon establishment of electrical continuity; i.e., the connected structure demonstrates increased transmission with increasing filling fraction.
Solid-state nanopores of controlled geometry fabricated in a transmission electron microscope
NASA Astrophysics Data System (ADS)
Qian, Hui; Egerton, Ray F.
2017-11-01
Energy-filtered transmission electron microscopy and electron tomography were applied to in situ studies of the formation, shape, and diameter of nanopores formed in a silicon nitride membrane in a transmission electron microscope. The nanopore geometry was observed in three dimensions by electron tomography. Drilling conditions, such as probe current, beam convergence angle, and probe position, affect the formation rate and the geometry of the pores. With a beam convergence semi-angle of α = 22 mrad, a conical shaped nanopore is formed but at α = 45 mrad, double-cone (hourglass-shaped) nanopores were produced. Nanopores with an effective diameter between 10 nm and 1.8 nm were fabricated by controlling the drilling time.
Loukanov, Alexandre; Filipov, Chavdar; Mladenova, Polina; Toshev, Svetlin; Emin, Saim
2016-04-01
The object of the present report is to provide a method for a visualization of DNA in TEM by complementary labeling of cytosine with guanine derivative, which contains platinum as contrast-enhanced heavy element. The stretched single-chain DNA was obtained by modifying double-stranded DNA. The labeling method comprises the following steps: (i) stretching and adsorption of DNA on the support film of an electron microscope grid (the hydrophobic carbon film holding negative charged DNA); (ii) complementary labeling of the cytosine bases from the stretched single-stranded DNA pieces on the support film with platinum containing guanine derivative to form base-specific hydrogen bond; and (iii) producing a magnified image of the base-specific labeled DNA. Stretched single-stranded DNA on a support film is obtained by a rapid elongation of DNA pieces on the surface between air and aqueous buffer solution. The attached platinum-containing guanine derivative serves as a high-dense marker and it can be discriminated from the surrounding background of support carbon film and visualized by use of conventional TEM observation at 100 kV accelerated voltage. This method allows examination of specific nucleic macromolecules through atom-by-atom analysis and it is promising way toward future DNA-sequencing or molecular diagnostics of nucleic acids by electron microscopic observation. © 2016 Wiley Periodicals, Inc.
Highly Flexible Hybrid CMOS Inverter Based on Si Nanomembrane and Molybdenum Disulfide.
Das, Tanmoy; Chen, Xiang; Jang, Houk; Oh, Il-Kwon; Kim, Hyungjun; Ahn, Jong-Hyun
2016-11-01
2D semiconductor materials are being considered for next generation electronic device application such as thin-film transistors and complementary metal-oxide-semiconductor (CMOS) circuit due to their unique structural and superior electronics properties. Various approaches have already been taken to fabricate 2D complementary logics circuits. However, those CMOS devices mostly demonstrated based on exfoliated 2D materials show the performance of a single device. In this work, the design and fabrication of a complementary inverter is experimentally reported, based on a chemical vapor deposition MoS 2 n-type transistor and a Si nanomembrane p-type transistor on the same substrate. The advantages offered by such CMOS configuration allow to fabricate large area wafer scale integration of high performance Si technology with transition-metal dichalcogenide materials. The fabricated hetero-CMOS inverters which are composed of two isolated transistors exhibit a novel high performance air-stable voltage transfer characteristic with different supply voltages, with a maximum voltage gain of ≈16, and sub-nano watt power consumption. Moreover, the logic gates have been integrated on a plastic substrate and displayed reliable electrical properties paving a realistic path for the fabrication of flexible/transparent CMOS circuits in 2D electronics. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
NASA Astrophysics Data System (ADS)
He, Jing; Wen, Xuejie; Chen, Ming; Chen, Lin
2015-09-01
In this paper, a Golay complementary training sequence (TS)-based symbol synchronization scheme is proposed and experimentally demonstrated in multiband orthogonal frequency division multiplexing (MB-OFDM) ultra-wideband over fiber (UWBoF) system with a variable rate low-density parity-check (LDPC) code. Meanwhile, the coding gain and spectral efficiency in the variable rate LDPC-coded MB-OFDM UWBoF system are investigated. By utilizing the non-periodic auto-correlation property of the Golay complementary pair, the start point of LDPC-coded MB-OFDM UWB signal can be estimated accurately. After 100 km standard single-mode fiber (SSMF) transmission, at the bit error rate of 1×10-3, the experimental results show that the short block length 64QAM-LDPC coding provides a coding gain of 4.5 dB, 3.8 dB and 2.9 dB for a code rate of 62.5%, 75% and 87.5%, respectively.
The Design and Construction of a Simple Transmission Electron Microscope for Educational Purposes.
ERIC Educational Resources Information Center
Hearsey, Paul K.
This document presents a model for a simple transmission electron microscope for educational purposes. This microscope could demonstrate thermonic emission, particle acceleration, electron deflection, and flourescence. It is designed to be used in high school science courses, particularly physics, taking into account the size, weight, complexity…
29 CFR 1926.1420 - Signals-radio, telephone or other electronic transmission of signals.
Code of Federal Regulations, 2013 CFR
2013-07-01
... 29 Labor 8 2013-07-01 2013-07-01 false Signals-radio, telephone or other electronic transmission of signals. 1926.1420 Section 1926.1420 Labor Regulations Relating to Labor (Continued) OCCUPATIONAL... CONSTRUCTION Cranes and Derricks in Construction § 1926.1420 Signals—radio, telephone or other electronic...
29 CFR 1926.1420 - Signals-radio, telephone or other electronic transmission of signals.
Code of Federal Regulations, 2012 CFR
2012-07-01
... 29 Labor 8 2012-07-01 2012-07-01 false Signals-radio, telephone or other electronic transmission of signals. 1926.1420 Section 1926.1420 Labor Regulations Relating to Labor (Continued) OCCUPATIONAL... CONSTRUCTION Cranes and Derricks in Construction § 1926.1420 Signals—radio, telephone or other electronic...
Pierce, D. T.; Coughlin, D. R.; Williamson, D. L.; ...
2015-05-01
Quenching and partitioning (Q&P) produces steel microstructures with martensite and austenite that exhibit promising property combinations for third generation advanced high strength steels. Understanding the kinetics of reactions that compete for available carbon, such as carbide formation, is critical for alloying and processing design and achieving austenite enrichment and retention during Q&P. Mössbauer effect spectroscopy (MES) was used to characterize Q&P microstructures in a 0.38C-1.54Mn-1.48Si wt.% steel after quenching to 225 °C and partitioning at 400 °C for 10 or 300 s, with an emphasis on transition carbides. The recoilless fraction for η-carbide was calculated and a correction for saturationmore » of the MES absorption spectrum was applied, making quantitative measurements of small amounts of η-carbide, including non-stoichiometric η-carbide, possible in Q&P microstructures. Complementary transmission electron microscopy confirmed the presence of η-carbides, and MES and X-ray diffraction were used to characterize the austenite. The amount of η-carbide formed during Q&P ranged from 1.4 to 2.4 at.%, accounting for a substantial portion (~24% to 41%) of the bulk carbon content of the steel. The amount (5.0 at.%) of η-carbide that formed after quenching and tempering (Q&T) at 400 °C for 300 s was significantly greater than after partitioning at 400 °C for 300 s (2.4 at.%), suggesting that carbon partitioning from martensite to austenite occurs in conjunction with η-carbide formation during Q&P in these specimens.« less
Shankara Narayanan, Jeyaraman; Bhuvana, Mohanlal; Dharuman, Venkataraman
2014-08-15
Cationic N-[1-(2,3-Dioleoyloxy)propyl]-N,N,N-trimethylammonium propane (DOTAP) liposome is spherically sandwiched in gold nanoparticle (abbreviated as sDOTAP-AuNP) onto a gold electrode surface. The sDOTAP-AuNP is applied for electrochemical label free DNA sensing and Escherichia coli cell transfection for the first time. Complementary target (named as hybridized), non-complementary target (un-hybridized) and single base mismatch target (named as SMM) hybridized surfaces are discriminated sensitively and selectively in presence of [Fe(CN)6](3-/4-). Double strand specific intercalator methylene blue in combination with [Fe(CN)6](3-) is used to enhance target detection limit down to femtomolar concentration. Cyclic voltammetry (CV), electrochemical impedance spectroscopy (EIS), differential pulse voltammetry (DPV) techniques are used for characterizing DNA sensing. High Resolution Transmission Electron Microscopy (HRTEM), Fourier Transform Infrared Spectroscopy (FTIR), Atomic Force Microscopy (AFM) and Dynamic Light Scattering (DLS) techniques are used to confirm the spherical nature of the sDOTAP-AuNP-DNA composite in solution and on the solid surface. DNA on the sDOTAP-ssDNA is transferred by potential stripping method (+0.2V (Ag/AgCl)) into buffer solution containing E. coli cells. The transfection is confirmed by the contrast images for the transfected and non-transfected cell from Confocal Laser Scanning Microscopy (CLSM). The results demonstrate effectiveness of the electrochemical DNA transfection method developed and could be applied for other cells. Copyright © 2014 Elsevier B.V. All rights reserved.
A Suggested Basic Course Outline for Industrial Electronics.
ERIC Educational Resources Information Center
Texas A and M Univ., College Station. Vocational Instructional Services.
This course outline for industrial electronics, one of a series for teaching vocational industrial shop subjects in public schools, includes basic skills and technical information for the course. It should be supplemented with other complementary and necessary areas of related instruction. Fifteen major blocks, divided into 2 years of instruction,…
Cross, Dori A; Boukus, Ellyn R; Cohen, Genna R
2011-01-01
Objective A core feature of e-prescribing is the electronic exchange of prescription data between physician practices and pharmacies, which can potentially improve the efficiency of the prescribing process and reduce medication errors. Barriers to implementing this feature exist, but they are not well understood. This study's objectives were to explore recent physician practice and pharmacy experiences with electronic transmission of new prescriptions and renewals, and identify facilitators of and barriers to effective electronic transmission and pharmacy e-prescription processing. Design Qualitative analysis of 114 telephone interviews conducted with representatives from 97 organizations between February and September 2010, including 24 physician practices, 48 community pharmacies, and three mail-order pharmacies actively transmitting or receiving e-prescriptions via Surescripts. Results Practices and pharmacies generally were satisfied with electronic transmission of new prescriptions but reported that the electronic renewal process was used inconsistently, resulting in inefficient workarounds for both parties. Practice communications with mail-order pharmacies were less likely to be electronic than with community pharmacies because of underlying transmission network and computer system limitations. While e-prescribing reduced manual prescription entry, pharmacy staff frequently had to complete or edit certain fields, particularly drug name and patient instructions. Conclusions Electronic transmission of new prescriptions has matured. Changes in technical standards and system design and more targeted physician and pharmacy training may be needed to address barriers to e-renewals, mail-order pharmacy connectivity, and pharmacy processing of e-prescriptions. PMID:22101907
Integration of solid-state nanopores in a 0.5 μm cmos foundry process
Uddin, A; Yemenicioglu, S; Chen, C-H; Corigliano, E; Milaninia, K; Theogarajan, L
2013-01-01
High-bandwidth and low-noise nanopore sensor and detection electronics are crucial in achieving single-DNA base resolution. A potential way to accomplish this goal is to integrate solid-state nanopores within a CMOS platform, in close proximity to the biasing electrodes and custom-designed amplifier electronics. Here we report the integration of solid-state nanopore devices in a commercial complementary metal-oxide semiconductor (CMOS) potentiostat chip implemented in On-Semiconductor’s 0.5 μm technology. Nanopore membranes incorporating electrodes are fabricated by post-CMOS micromachining utilizing the N+ polysilicon/SiO2/N+ polysilicon capacitor structure available in the aforementioned process. Nanopores are created in the CMOS process by drilling in a transmission electron microscope and shrinking by atomic layer deposition. We also describe a batch fabrication method to process a large of number of electrode-embedded nanopores with sub-10 nm diameter across CMOS-compatible wafers by electron beam lithography and atomic layer deposition. The CMOS-compatibility of our fabrication process is verified by testing the electrical functionality of on-chip circuitry. We observe high current leakage with the CMOS nanopore devices due to the ionic diffusion through the SiO2 membrane. To prevent this leakage, we coat the membrane with Al2O3 which acts as an efficient diffusion barrier against alkali ions. The resulting nanopore devices also exhibit higher robustness and lower 1/f noise as compared to SiO2 and SiNx. Furthermore, we propose a theoretical model for our low-capacitance CMOS nanopore devices, showing good agreement with the experimental value. In addition, experiments and theoretical models of translocation studies are presented using 48.5 kbp λ-DNA in order to prove the functionality of on-chip pores coated with Al2O3. PMID:23519330
Lu, Xiaonan; Rasco, Barbara A.; Jabal, Jamie M. F.; Aston, D. Eric; Lin, Mengshi; Konkel, Michael E.
2011-01-01
Fourier transform infrared (FT-IR) spectroscopy and Raman spectroscopy were used to study the cell injury and inactivation of Campylobacter jejuni from exposure to antioxidants from garlic. C. jejuni was treated with various concentrations of garlic concentrate and garlic-derived organosulfur compounds in growth media and saline at 4, 22, and 35°C. The antimicrobial activities of the diallyl sulfides increased with the number of sulfur atoms (diallyl sulfide < diallyl disulfide < diallyl trisulfide). FT-IR spectroscopy confirmed that organosulfur compounds are responsible for the substantial antimicrobial activity of garlic, much greater than those of garlic phenolic compounds, as indicated by changes in the spectral features of proteins, lipids, and polysaccharides in the bacterial cell membranes. Confocal Raman microscopy (532-nm-gold-particle substrate) and Raman mapping of a single bacterium confirmed the intracellular uptake of sulfur and phenolic components. Scanning electron microscopy (SEM) and transmission electron microscopy (TEM) were employed to verify cell damage. Principal-component analysis (PCA), discriminant function analysis (DFA), and soft independent modeling of class analogs (SIMCA) were performed, and results were cross validated to differentiate bacteria based upon the degree of cell injury. Partial least-squares regression (PLSR) was employed to quantify and predict actual numbers of healthy and injured bacterial cells remaining following treatment. PLSR-based loading plots were investigated to further verify the changes in the cell membrane of C. jejuni treated with organosulfur compounds. We demonstrated that bacterial injury and inactivation could be accurately investigated by complementary infrared and Raman spectroscopies using a chemical-based, “whole-organism fingerprint” with the aid of chemometrics and electron microscopy. PMID:21642409
NASA Astrophysics Data System (ADS)
Yuan, Yifei; Amine, Khalil; Lu, Jun; Shahbazian-Yassar, Reza
2017-08-01
An in-depth understanding of material behaviours under complex electrochemical environment is critical for the development of advanced materials for the next-generation rechargeable ion batteries. The dynamic conditions inside a working battery had not been intensively explored until the advent of various in situ characterization techniques. Real-time transmission electron microscopy of electrochemical reactions is one of the most significant breakthroughs poised to enable radical shift in our knowledge on how materials behave in the electrochemical environment. This review, therefore, summarizes the scientific discoveries enabled by in situ transmission electron microscopy, and specifically emphasizes the applicability of this technique to address the critical challenges in the rechargeable ion battery electrodes, electrolyte and their interfaces. New electrochemical systems such as lithium-oxygen, lithium-sulfur and sodium ion batteries are included, considering the rapidly increasing application of in situ transmission electron microscopy in these areas. A systematic comparison between lithium ion-based electrochemistry and sodium ion-based electrochemistry is also given in terms of their thermodynamic and kinetic differences. The effect of the electron beam on the validity of in situ observation is also covered. This review concludes by providing a renewed perspective for the future directions of in situ transmission electron microscopy in rechargeable ion batteries.
Yuan, Yifei; Amine, Khalil; Lu, Jun; Shahbazian-Yassar, Reza
2017-01-01
An in-depth understanding of material behaviours under complex electrochemical environment is critical for the development of advanced materials for the next-generation rechargeable ion batteries. The dynamic conditions inside a working battery had not been intensively explored until the advent of various in situ characterization techniques. Real-time transmission electron microscopy of electrochemical reactions is one of the most significant breakthroughs poised to enable radical shift in our knowledge on how materials behave in the electrochemical environment. This review, therefore, summarizes the scientific discoveries enabled by in situ transmission electron microscopy, and specifically emphasizes the applicability of this technique to address the critical challenges in the rechargeable ion battery electrodes, electrolyte and their interfaces. New electrochemical systems such as lithium–oxygen, lithium–sulfur and sodium ion batteries are included, considering the rapidly increasing application of in situ transmission electron microscopy in these areas. A systematic comparison between lithium ion-based electrochemistry and sodium ion-based electrochemistry is also given in terms of their thermodynamic and kinetic differences. The effect of the electron beam on the validity of in situ observation is also covered. This review concludes by providing a renewed perspective for the future directions of in situ transmission electron microscopy in rechargeable ion batteries.
Future of Electron Scattering and Diffraction
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hall, Ernest; Stemmer, Susanne; Zheng, Haimei
2014-02-25
The ability to correlate the atomic- and nanoscale-structure of condensed matter with physical properties (e.g., mechanical, electrical, catalytic, and optical) and functionality forms the core of many disciplines. Directing and controlling materials at the quantum-, atomic-, and molecular-levels creates enormous challenges and opportunities across a wide spectrum of critical technologies, including those involving the generation and use of energy. The workshop identified next generation electron scattering and diffraction instruments that are uniquely positioned to address these grand challenges. The workshop participants identified four key areas where the next generation of such instrumentation would have major impact: A – Multidimensional Visualizationmore » of Real Materials B – Atomic-scale Molecular Processes C – Photonic Control of Emergence in Quantum Materials D – Evolving Interfaces, Nucleation, and Mass Transport Real materials are comprised of complex three-dimensional arrangements of atoms and defects that directly determine their potential for energy applications. Understanding real materials requires new capabilities for three-dimensional atomic scale tomography and spectroscopy of atomic and electronic structures with unprecedented sensitivity, and with simultaneous spatial and energy resolution. Many molecules are able to selectively and efficiently convert sunlight into other forms of energy, like heat and electric current, or store it in altered chemical bonds. Understanding and controlling such process at the atomic scale require unprecedented time resolution. One of the grand challenges in condensed matter physics is to understand, and ultimately control, emergent phenomena in novel quantum materials that necessitate developing a new generation of instruments that probe the interplay among spin, charge, orbital, and lattice degrees of freedom with intrinsic time- and length-scale resolutions. Molecules and soft matter require imaging and spectroscopy with high spatial resolution without damaging their structure. The strong interaction of electrons with matter allows high-energy electron pulses to gather structural information before a sample is damaged. Electron ScatteringImaging, diffraction, and spectroscopy are the fundamental capabilities of electron-scattering instruments. The DOE BES-funded TEAM (Transmission Electron Aberration-corrected Microscope) project achieved unprecedented sub-atomic spatial resolution in imaging through aberration-corrected transmission electron microscopy. To further advance electron scattering techniques that directly enable groundbreaking science, instrumentation must advance beyond traditional two-dimensional imaging. Advances in temporal resolution, recording the full phase and energy spaces, and improved spatial resolution constitute a new frontier in electron microscopy, and will directly address the BES Grand Challenges, such as to “control the emergent properties that arise from the complex correlations of atomic and electronic constituents” and the “hidden states” “very far away from equilibrium”. Ultrafast methods, such as the pump-probe approach, enable pathways toward understanding, and ultimately controlling, the chemical dynamics of molecular systems and the evolution of complexity in mesoscale and nanoscale systems. Central to understanding how to synthesize and exploit functional materials is having the ability to apply external stimuli (such as heat, light, a reactive flux, and an electrical bias) and to observe the resulting dynamic process in situ and in operando, and under the appropriate environment (e.g., not limited to UHV conditions). To enable revolutionary advances in electron scattering and science, the participants of the workshop recommended three major new instrumental developments: A. Atomic-Resolution Multi-Dimensional Transmission Electron Microscope: This instrument would provide quantitative information over the entire real space, momentum space, and energy space for visualizing dopants, interstitials, and light elements; for imaging localized vibrational modes and the motion of charged particles and vacancies; for correlating lattice, spin, orbital, and charge; and for determining the structure and molecular chemistry of organic and soft matter. The instrument will be uniquely suited to answer fundamental questions in condensed matter physics that require understanding the physical and electronic structure at the atomic scale. Key developments include stable cryogenic capabilities that will allow access to emergent electronic phases, as well as hard/soft interfaces and radiation- sensitive materials. B. Ultrafast Electron Diffraction and Microscopy Instrument: This instrument would be capable of nano-diffraction with 10 fs temporal resolution in stroboscopic mode, and better than 100 fs temporal resolution in single shot mode. The instrument would also achieve single- shot real-space imaging with a spatial/temporal resolution of 10 nm/10 ps, representing a thousand fold improvement over current microscopes. Such a capability would be complementary to x-ray free electron lasers due to the difference in the nature of electron and x-ray scattering, enabling space-time mapping of lattice vibrations and energy transport, facilitating the understanding of molecular dynamics of chemical reactions, the photonic control of emergence in quantum materials, and the dynamics of mesoscopic materials. C. Lab-In-Gap Dynamic Microscope: This instrument would enable quantitative measurements of materials structure, composition, and bonding evolution in technologically relevant environments, including liquids, gases and plasmas, thereby assuring the understanding of structure function relationship at the atomic scale with up to nanosecond temporal resolution. This instrument would employ a versatile, modular sample stage and holder geometry to allow the multi-modal (e.g., optical, thermal, mechanical, electrical, and electrochemical) probing of materials’ functionality in situ and in operando. The electron optics encompasses a pole piece that can accommodate the new stage, differential pumping, detectors, aberration correctors, and other electron optical elements for measurement of materials dynamics. To realize the proposed instruments in a timely fashion, BES should aggressively support research and development of complementary and enabling instruments, including new electron sources, advanced electron optics, new tunable specimen pumps and sample stages, and new detectors. The proposed instruments would have transformative impact on physics, chemistry, materials science, engineering« less
Electron transmission through a steel capillary
NASA Astrophysics Data System (ADS)
Maljković, J. B.; Borka, D.; Ranković, M. Lj.; Marinković, B. P.; Milosavljević, A. R.; Lemell, C.; Tőkési, K.
2018-05-01
The transmission of low-energy electrons through a macroscopic steel capillary has been investigated both experimentally and theoretically. The length of the steel capillary was L = 19.5 mm and the inner diameter was d = 0.9 mm. The kinetic energy distribution of electrons transmitted through the steel capillary was recorded for a tilt angle of ψ = 2.6 ° of the incident electron beam with respect to the capillary axis. Accompanying simulations based on classical transport theory reproduce the experimental data to a high degree of agreement. Transmission for other tilt angles has also been simulated to investigate the influence of the tilt angle on the guiding efficiency.
Morishita, Shigeyuki; Ishikawa, Ryo; Kohno, Yuji; Sawada, Hidetaka; Shibata, Naoya; Ikuhara, Yuichi
2018-02-01
The achievement of a fine electron probe for high-resolution imaging in scanning transmission electron microscopy requires technological developments, especially in electron optics. For this purpose, we developed a microscope with a fifth-order aberration corrector that operates at 300 kV. The contrast flat region in an experimental Ronchigram, which indicates the aberration-free angle, was expanded to 70 mrad. By using a probe with convergence angle of 40 mrad in the scanning transmission electron microscope at 300 kV, we attained the spatial resolution of 40.5 pm, which is the projected interatomic distance between Ga-Ga atomic columns of GaN observed along [212] direction.
Prompt increase of ultrashort laser pulse transmission through thin silver films
NASA Astrophysics Data System (ADS)
Bezhanov, S. G.; Danilov, P. A.; Klekovkin, A. V.; Kudryashov, S. I.; Rudenko, A. A.; Uryupin, S. A.
2018-03-01
We study experimentally and numerically the increase in ultrashort laser pulse transmissivity through thin silver films caused by the heating of electrons. Low to moderate energy femtosecond laser pulse transmission measurements through 40-125 nm thickness silver films were carried out. We compare the experimental data with the values of transmitted fraction of energy obtained by solving the equations for the field together with the two-temperature model. The measured values were fitted with sufficient accuracy by varying the electron-electron collision frequency whose exact values are usually poorly known. Since transmissivity experiences more pronounced changes with the increase in temperature compared to reflectivity, we suggest this technique for studying the properties of nonequilibrium metals.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ali, E. S. M.; McEwen, M. R.; Rogers, D. W. O.
2012-11-15
Purpose: In a recent computational study, an improved physics-based approach was proposed for unfolding linac photon spectra and incident electron energies from transmission data. In this approach, energy differentiation is improved by simultaneously using transmission data for multiple attenuators and detectors, and the unfolding robustness is improved by using a four-parameter functional form to describe the photon spectrum. The purpose of the current study is to validate this approach experimentally, and to demonstrate its application on a typical clinical linac. Methods: The validation makes use of the recent transmission measurements performed on the Vickers research linac of National Research Councilmore » Canada. For this linac, the photon spectra were previously measured using a NaI detector, and the incident electron parameters are independently known. The transmission data are for eight beams in the range 10-30 MV using thick Be, Al and Pb bremsstrahlung targets. To demonstrate the approach on a typical clinical linac, new measurements are performed on an Elekta Precise linac for 6, 10 and 25 MV beams. The different experimental setups are modeled using EGSnrc, with the newly added photonuclear attenuation included. Results: For the validation on the research linac, the 95% confidence bounds of the unfolded spectra fall within the noise of the NaI data. The unfolded spectra agree with the EGSnrc spectra (calculated using independently known electron parameters) with RMS energy fluence deviations of 4.5%. The accuracy of unfolding the incident electron energy is shown to be {approx}3%. A transmission cutoff of only 10% is suitable for accurate unfolding, provided that the other components of the proposed approach are implemented. For the demonstration on a clinical linac, the unfolded incident electron energies and their 68% confidence bounds for the 6, 10 and 25 MV beams are 6.1 {+-} 0.1, 9.3 {+-} 0.1, and 19.3 {+-} 0.2 MeV, respectively. The unfolded spectra for the clinical linac agree with the EGSnrc spectra (calculated using the unfolded electron energies) with RMS energy fluence deviations of 3.7%. The corresponding measured and EGSnrc-calculated transmission data agree within 1.5%, where the typical transmission measurement uncertainty on the clinical linac is 0.4% (not including the uncertainties on the incident electron parameters). Conclusions: The approach proposed in an earlier study for unfolding photon spectra and incident electron energies from transmission data is accurate and practical for clinical use.« less
Zhang, Hai-Bo; Zhang, Xiang-Liang; Wang, Yong; Takaoka, Akio
2007-01-01
The possibility of utilizing high-energy electron tomography to characterize the micron-scale three dimensional (3D) structures of integrated circuits has been demonstrated experimentally. First, electron transmission through a tilted SiO(2) film was measured with an ultrahigh-voltage electron microscope (ultra-HVEM) and analyzed from the point of view of elastic scattering of electrons, showing that linear attenuation of the logarithmic electron transmission still holds valid for effective specimen thicknesses up to 5 microm under 2 MV accelerating voltages. Electron tomography of a micron-order thick integrated circuit specimen including the Cu/via interconnect was then tried with 3 MeV electrons in the ultra-HVEM. Serial projection images of the specimen tilted at different angles over the range of +/-90 degrees were acquired, and 3D reconstruction was performed with the images by means of the IMOD software package. Consequently, the 3D structures of the Cu lines, via and void, were revealed by cross sections and surface rendering.
NASA Astrophysics Data System (ADS)
Daulton, T. L.; Bernatowicz, T. J.; Croat, T. K.
2012-03-01
Micrometer-sized spherules of graphite formed by supernovae contain numerous TiC and Fe-Ni subgrains. These subgrains often have disordered surface rims. The mechanism(s) of rim formation on these subgrains is studied by transmission electron microscopy.
Federal Register 2010, 2011, 2012, 2013, 2014
2012-10-04
... filings must be submitted in accordance with the Commission's electronic tariff filing (eTariff... eTariff Filing Title field and in the Description field in eFiling. DATES: Effective on October 4... electronic tariff filing (eTariff) requirements in Electronic Tariff Filings, Order No. 714, FERC Stats...
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yin, Lan; Harburg, Daniel V.; Rogers, John A., E-mail: jrogers@illinois.edu
Tungsten interconnects in silicon integrated circuits built at the 90 nm node with releasable configurations on silicon on insulator wafers serve as the basis for advanced forms of water-soluble electronics. These physically transient systems have potential uses in applications that range from temporary biomedical implants to zero-waste environmental sensors. Systematic experimental studies and modeling efforts reveal essential aspects of electrical performance in field effect transistors and complementary ring oscillators with as many as 499 stages. Accelerated tests reveal timescales for dissolution of the various constituent materials, including tungsten, silicon, and silicon dioxide. The results demonstrate that silicon complementary metal-oxide-semiconductor circuits formedmore » with tungsten interconnects in foundry-compatible fabrication processes can serve as a path to high performance, mass-produced transient electronic systems.« less
Applications of emerging transmission electron microscopy technology in PCD research and diagnosis.
Shoemark, Amelia
2017-01-01
Primary Ciliary Dyskinesia (PCD) is a heterogeneous genetic condition characterized by dysfunction of motile cilia. Patients suffer from chronic infection and inflammation of the upper and lower respiratory tract. Diagnosis of PCD is confirmed by identification of a hallmark defect of ciliary ultrastructure or by identification of biallelic pathogenic mutations in a known PCD gene. Since the first description of PCD in 1976, assessment of ciliary ultrastructure by transmission electron microscopy (TEM) has been central to diagnosis and research. Electron tomography is a technique whereby a series of transmission electron micrographs are collected at different angles and reconstructed into a single 3D model of a specimen. Electron tomography provides improved spatial information and resolution compared to a single micrograph. Research by electron tomography has revealed new insight into ciliary ultrastructure and consequently ciliary function at a molecular and cellular level. Gene discovery studies in PCD have utilized electron tomography to define the structural consequences of variants in cilia genes. Modern transmission electron microscopes capable of electron tomography are increasingly being installed in clinical laboratories. This presents the possibility for the use of tomography technique in a diagnostic setting. This review describes the electron tomography technique, the contribution tomography has made to the understanding of basic cilia structure and function and finally the potential of the technique for use in PCD diagnosis.
Villa, Francesco
1990-01-01
A high gain, single-pass free electron laser formed of a high brilliance electron injector source, a linear accelerator which imparts high energy to the electron beam, and an undulator capable of extremely high magnetic fields, yet with a very short period. The electron injector source is the first stage (gap) of the linear accelerator or a radial line transformer driven by fast circular switch. The linear accelerator is formed of a plurality of accelerating gaps arranged in series. These gaps are energized in sequence by releasing a single pulse of energy which propagates simultaneously along a plurality of transmission lines, each of which feeds the gaps. The transmission lines are graduated in length so that pulse power is present at each gap as the accelerated electrons pass therethrough. The transmission lines for each gap are open circuited at their ends. The undualtor has a structure similar to the accelerator, except that the transmission lines for each gap are substantially short circuited at their ends, thus converting the electric field into magnetic field. A small amount of resistance is retained in order to generate a small electric field for replenishing the electron bunch with the energy lost as it traverses through the undulator structure.
Lewis, Crystal S.; Moronta, Dominic; Terban, Maxwell W.; ...
2017-12-12
In this report, we have synthesized and structurally characterized nanowire bundles of cobalt-substituted pyroxenes, similar to the crystal structure of aegirine (i.e. Co-substituted XYSi 2O 6 with X and Y referring to metallic elements such as but not limited to Co, Na, and Fe), using a readily scalable hydrothermal technique. We then propose a growth mechanism for these bundles, based on detailed time and temperature dependent studies as well as complementary control experiments, particularly reactions in the absence of either 3-aminopropyltriethoxysilane (APTES) or sodium hydroxide (NaOH), via a transmission electron microscopy visualization study. Moreover, these nanowire bundles were probed formore » their magnetic properties and chemical composition using superconducting quantum interference device (SQUID) measurements, X-ray diffraction, and pair distribution function analysis, respectively. Specifically, SQUID measurement observations highlighted that these bundles evince (i) unique and interesting super-paramagnetic properties at 5 K that are consistent with that of our previously published ~2 nm ultra-small nanoparticles as well as (ii) paramagnetic behavior at 300 K.« less
Manipulating the ABCs of self-assembly via low-χ block polymer design
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chang, Alice B.; Bates, Christopher M.; Lee, Byeongdu
Block polymer self-assembly typically translates molecular chain connectivity into mesoscale structure by exploiting incompatible blocks with large interaction parameters (χ ij). In this report, we demonstrate that the converse approach, encoding low-χ interactions in ABC bottlebrush triblock terpolymers (χ AC ≲ 0), promotes organization into a unique mixed-domain lamellar morphology which we designate LAM P. Transmission electron microscopy indicates that LAMP exhibits ACBC domain connectivity, in contrast to conventional three-domain lamellae (LAM 3) with ABCB periods. Complementary small angle X-ray scattering experiments reveal a strongly decreasing domain spacing with increasing total molar mass. Self-consistent field theory reinforces these observations andmore » predicts that LAM P is thermodynamically stable below a critical χ AC, above which LAM 3 emerges. Both experiments and theory expose close analogies to ABA triblock copolymer phase behavior, collectively suggesting that low-χ interactions between chemically similar or distinct blocks intimately influence self-assembly. Furthermore, these conclusions provide new opportunities in block polymer design with potential consequences spanning all self-assembling soft materials.« less
Manipulating the ABCs of self-assembly via low-χ block polymer design
Chang, Alice B.; Bates, Christopher M.; Lee, Byeongdu; ...
2017-06-06
Block polymer self-assembly typically translates molecular chain connectivity into mesoscale structure by exploiting incompatible blocks with large interaction parameters (χ ij). In this report, we demonstrate that the converse approach, encoding low-χ interactions in ABC bottlebrush triblock terpolymers (χ AC ≲ 0), promotes organization into a unique mixed-domain lamellar morphology which we designate LAM P. Transmission electron microscopy indicates that LAMP exhibits ACBC domain connectivity, in contrast to conventional three-domain lamellae (LAM 3) with ABCB periods. Complementary small angle X-ray scattering experiments reveal a strongly decreasing domain spacing with increasing total molar mass. Self-consistent field theory reinforces these observations andmore » predicts that LAM P is thermodynamically stable below a critical χ AC, above which LAM 3 emerges. Both experiments and theory expose close analogies to ABA triblock copolymer phase behavior, collectively suggesting that low-χ interactions between chemically similar or distinct blocks intimately influence self-assembly. Furthermore, these conclusions provide new opportunities in block polymer design with potential consequences spanning all self-assembling soft materials.« less
InSe monolayer: synthesis, structure and ultra-high second-harmonic generation
NASA Astrophysics Data System (ADS)
Zhou, Jiadong; Shi, Jia; Zeng, Qingsheng; Chen, Yu; Niu, Lin; Liu, Fucai; Yu, Ting; Suenaga, Kazu; Liu, Xinfeng; Lin, Junhao; Liu, Zheng
2018-04-01
III–IV layered materials such as indium selenide have excellent photoelectronic properties. However, synthesis of materials in such group, especially with a controlled thickness down to monolayer, still remains challenging. Herein, we demonstrate the successful synthesis of monolayer InSe by physical vapor deposition (PVD) method. The high quality of the sample was confirmed by complementary characterization techniques such as Raman spectroscopy, atomic force microscopy (AFM) and high resolution annular dark field scanning transmission electron microscopy (ADF-STEM). We found the co-existence of different stacking sequence (β- and γ-InSe) in the same flake with a sharp grain boundary in few-layered InSe. Edge reconstruction is also observed in monolayer InSe, which has a distinct atomic structure from the bulk lattice. Moreover, we discovered that the second-harmonic generation (SHG) signal from monolayer InSe shows large optical second-order susceptibility that is 1–2 orders of magnitude higher than MoS2, and even 3 times of the largest value reported in monolayer GaSe. These results make atom-thin InSe a promising candidate for optoelectronic and photosensitive device applications.
Phase formation and texture of thin nickel germanides on Ge(001) and Ge(111)
DOE Office of Scientific and Technical Information (OSTI.GOV)
De Schutter, B., E-mail: deschutter.bob@ugent.be; Detavernier, C.; Van Stiphout, K.
2016-04-07
We studied the solid-phase reaction between a thin Ni film and a single crystal Ge(001) or Ge(111) substrate during a ramp anneal. The phase formation sequence was determined using in situ X-ray diffraction and in situ Rutherford backscattering spectrometry (RBS), while the nature and the texture of the phases were studied using X-ray pole figures and transmission electron microscopy. The phase sequence is characterized by the formation of a single transient phase before NiGe forms as the final and stable phase. X-ray pole figures were used to unambiguously identify the transient phase as the ϵ-phase, a non-stoichiometric Ni-rich germanide withmore » a hexagonal crystal structure that can exist for Ge concentrations between 34% and 48% and which forms with a different epitaxial texture on both substrate orientations. The complementary information gained from both RBS and X-ray pole figure measurements revealed a simultaneous growth of both the ϵ-phase and NiGe over a small temperature window on both substrate orientations.« less
NASA Astrophysics Data System (ADS)
Chandrashekar, Anand; Chen, Feng; Lin, Jasmine; Humayun, Raashina; Wongsenakhum, Panya; Chang, Sean; Danek, Michal; Itou, Takamasa; Nakayama, Tomoo; Kariya, Atsushi; Kawaguchi, Masazumi; Hizume, Shunichi
2010-09-01
This paper describes electrical testing results of new tungsten chemical vapor deposition (CVD-W) process concepts that were developed to address the W contact and bitline scaling issues on 55 nm node devices. Contact resistance (Rc) measurements in complementary metal oxide semiconductor (CMOS) devices indicate that the new CVD-W process for sub-32 nm and beyond - consisting of an advanced pulsed nucleation layer (PNL) combined with low resistivity tungsten (LRW) initiation - produces a 20-30% drop in Rc for diffused NiSi contacts. From cross-sectional bright field and dark field transmission electron microscopy (TEM) analysis, such Rc improvement can be attributed to improved plugfill and larger in-feature W grain size with the advanced PNL+LRW process. More experiments that measured contact resistance for different feature sizes point to favorable Rc scaling with the advanced PNL+LRW process. Finally, 40% improvement in line resistance was observed with this process as tested on 55 nm embedded dynamic random access memory (DRAM) devices, confirming that the advanced PNL+LRW process can be an effective metallization solution for sub-32 nm devices.
A miniaturized neuroprosthesis suitable for implantation into the brain
NASA Technical Reports Server (NTRS)
Mojarradi, Mohammad; Binkley, David; Blalock, Benjamin; Andersen, Richard; Ulshoefer, Norbert; Johnson, Travis; Del Castillo, Linda
2003-01-01
This paper presents current research on a miniaturized neuroprosthesis suitable for implantation into the brain. The prosthesis is a heterogeneous integration of a 100-element microelectromechanical system (MEMS) electrode array, front-end complementary metal-oxide-semiconductor (CMOS) integrated circuit for neural signal preamplification, filtering, multiplexing and analog-to-digital conversion, and a second CMOS integrated circuit for wireless transmission of neural data and conditioning of wireless power. The prosthesis is intended for applications where neural signals are processed and decoded to permit the control of artificial or paralyzed limbs. This research, if successful, will allow implantation of the electronics into the brain, or subcutaneously on the skull, and eliminate all external signal and power wiring. The neuroprosthetic system design has strict size and power constraints with each of the front-end preamplifier channels fitting within the 400 x 400-microm pitch of the 100-element MEMS electrode array and power dissipation resulting in less than a 1 degree C temperature rise for the surrounding brain tissue. We describe the measured performance of initial micropower low-noise CMOS preamplifiers for the neuroprosthetic.
Understanding Imaging and Metrology with the Helium Ion Microscope
NASA Astrophysics Data System (ADS)
Postek, Michael T.; Vladár, András E.; Ming, Bin
2009-09-01
One barrier to innovation confronting all phases of nanotechnology is the lack of accurate metrology for the characterization of nanomaterials. Ultra-high resolution microscopy is a key technology needed to achieve this goal. But, current microscope technology is being pushed to its limits. The scanning and transmission electron microscopes have incrementally improved in performance and other scanned probe technologies such as atomic force microscopy, scanning tunneling microscopy and focused ion beam microscopes have all been applied to nanotechnology with various levels of success. A relatively new tool for nanotechnology is the scanning helium ion microscope (HIM). The HIM is a new complementary imaging and metrology technology for nanotechnology which may be able to push the current resolution barrier lower. But, successful imaging and metrology with this instrument entails new ion beam/specimen interaction physics which must be fully understood. As a new methodology, HIM is beginning to show promise and the abundance of potentially advantageous applications for nanotechnology have yet to be fully exploited. This presentation will discuss some of the progress made at NIST in understanding the science behind this new technique.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lewis, Crystal S.; Moronta, Dominic; Terban, Maxwell W.
In this report, we have synthesized and structurally characterized nanowire bundles of cobalt-substituted pyroxenes, similar to the crystal structure of aegirine (i.e. Co-substituted XYSi 2O 6 with X and Y referring to metallic elements such as but not limited to Co, Na, and Fe), using a readily scalable hydrothermal technique. We then propose a growth mechanism for these bundles, based on detailed time and temperature dependent studies as well as complementary control experiments, particularly reactions in the absence of either 3-aminopropyltriethoxysilane (APTES) or sodium hydroxide (NaOH), via a transmission electron microscopy visualization study. Moreover, these nanowire bundles were probed formore » their magnetic properties and chemical composition using superconducting quantum interference device (SQUID) measurements, X-ray diffraction, and pair distribution function analysis, respectively. Specifically, SQUID measurement observations highlighted that these bundles evince (i) unique and interesting super-paramagnetic properties at 5 K that are consistent with that of our previously published ~2 nm ultra-small nanoparticles as well as (ii) paramagnetic behavior at 300 K.« less
Ahlinder, Linnea; Ekstrand-Hammarström, Barbro; Geladi, Paul; Österlund, Lars
2013-01-01
It is a challenging task to characterize the biodistribution of nanoparticles in cells and tissue on a subcellular level. Conventional methods to study the interaction of nanoparticles with living cells rely on labeling techniques that either selectively stain the particles or selectively tag them with tracer molecules. In this work, Raman imaging, a label-free technique that requires no extensive sample preparation, was combined with multivariate classification to quantify the spatial distribution of oxide nanoparticles inside living lung epithelial cells (A549). Cells were exposed to TiO2 (titania) and/or α-FeO(OH) (goethite) nanoparticles at various incubation times (4 or 48 h). Using multivariate classification of hyperspectral Raman data with partial least-squares discriminant analysis, we show that a surprisingly large fraction of spectra, classified as belonging to the cell nucleus, show Raman bands associated with nanoparticles. Up to 40% of spectra from the cell nucleus show Raman bands associated with nanoparticles. Complementary transmission electron microscopy data for thin cell sections qualitatively support the conclusions. PMID:23870252
Expansion and melting of Xe nanocrystals in Si
NASA Astrophysics Data System (ADS)
Faraci, Giuseppe; Pennisi, Agata R.; Zontone, Federico; Li, Boquan; Petrov, Ivan
2006-12-01
Xe agglomerates confined in a Si matrix by ion implantation were synthesized with different size depending on the implantation process and/or the thermal treatment. At low temperature Xe nanocrystals are formed, whose expansion and melting were studied in the range 15- 300K . Previous high resolution x-ray diffraction spectra were corroborated with complementary techniques such as two-dimensional imaging plate patterns and transmission electron microscopy. We detected fcc Xe nanocrystals whose properties were size dependent. The experiments showed that in annealed samples epitaxial condensation of small Xe clusters, on the cavities of the Si matrix, gave in fact expanded and oriented Xe, suggesting a possible preferential growth of Xe(311) planes oriented orthogonally to the Si[02-2] direction. On the contrary, small Xe clusters in an amorphous Si matrix have a fcc lattice contracted as a consequence of surface tension. Furthermore, a solid-to-liquid phase transition size dependent was found. Expansion of fcc Xe lattice was accurately determined as a function of the temperature. Overpressurized nanocrystals and/or binary size distributions were disproved.
Diameter Dependence of Planar Defects in InP Nanowires
Wang, Fengyun; Wang, Chao; Wang, Yiqian; Zhang, Minghuan; Han, Zhenlian; Yip, SenPo; Shen, Lifan; Han, Ning; Pun, Edwin Y. B.; Ho, Johnny C.
2016-01-01
In this work, extensive characterization and complementary theoretical analysis have been carried out on Au-catalyzed InP nanowires in order to understand the planar defect formation as a function of nanowire diameter. From the detailed transmission electron microscopic measurements, the density of stacking faults and twin defects are found to monotonically decrease as the nanowire diameter is decreased to 10 nm, and the chemical analysis clearly indicates the drastic impact of In catalytic supersaturation in Au nanoparticles on the minimized planar defect formation in miniaturized nanowires. Specifically, during the chemical vapor deposition of InP nanowires, a significant amount of planar defects is created when the catalyst seed sizes are increased with the lower degree of In supersaturation as dictated by the Gibbs-Thomson effect, and an insufficient In diffusion (or Au-rich enhancement) would lead to a reduced and non-uniform In precipitation at the NW growing interface. The results presented here provide an insight into the fabrication of “bottom-up” InP NWs with minimized defect concentration which are suitable for various device applications. PMID:27616584
Diameter Dependence of Planar Defects in InP Nanowires.
Wang, Fengyun; Wang, Chao; Wang, Yiqian; Zhang, Minghuan; Han, Zhenlian; Yip, SenPo; Shen, Lifan; Han, Ning; Pun, Edwin Y B; Ho, Johnny C
2016-09-12
In this work, extensive characterization and complementary theoretical analysis have been carried out on Au-catalyzed InP nanowires in order to understand the planar defect formation as a function of nanowire diameter. From the detailed transmission electron microscopic measurements, the density of stacking faults and twin defects are found to monotonically decrease as the nanowire diameter is decreased to 10 nm, and the chemical analysis clearly indicates the drastic impact of In catalytic supersaturation in Au nanoparticles on the minimized planar defect formation in miniaturized nanowires. Specifically, during the chemical vapor deposition of InP nanowires, a significant amount of planar defects is created when the catalyst seed sizes are increased with the lower degree of In supersaturation as dictated by the Gibbs-Thomson effect, and an insufficient In diffusion (or Au-rich enhancement) would lead to a reduced and non-uniform In precipitation at the NW growing interface. The results presented here provide an insight into the fabrication of "bottom-up" InP NWs with minimized defect concentration which are suitable for various device applications.
Complementary and Alternative Approaches to Pain Relief During Labor
Theau-Yonneau, Anne
2007-01-01
This review evaluated the effect of complementary and alternative medicine on pain during labor with conventional scientific methods using electronic data bases through 2006 were used. Only randomized controlled trials with outcome measures for labor pain were kept for the conclusions. Many studies did not meet the scientific inclusion criteria. According to the randomized control trials, we conclude that for the decrease of labor pain and/or reduction of the need for conventional analgesic methods: (i) There is an efficacy found for acupressure and sterile water blocks. (ii) Most results favored some efficacy for acupuncture and hydrotherapy. (iii) Studies for other complementary or alternative therapies for labor pain control have not shown their effectiveness. PMID:18227907
Evaluation of a complementary cyber education program for a pathophysiology class.
Yoo, Ji-Soo; Ryue, Sook-Hee; Lee, Jung Eun; Ahn, Jeong-Ah
2009-12-01
The goal of this study was to develop and evaluate a complementary cyber education program for a required pathophysiology class for nursing students. The cyber education program comprised electronic bulletin boards, correspondence material storage, an announcement section, a report submission section, reference sites, and statistics on learning rates. Twelve online lectures complemented five lectures in the classroom. To evaluate the course's educational effectiveness, we performed an online objective questionnaire and an open questionnaire survey anonymously, and compared the complementary cyber education program with traditional classroom education. The complementary cyber education program effected significant improvements in scores for importance with regard to major, clarity of goals and education plans for courses, professor readiness, preciseness and description of lectures, amount and efficiency of assignments, and fairness in appraisal standards compared with the traditional classroom education group. This study indicates that a complementary cyber education program provides nursing students with the flexibility of time and space, the newest information through updated lectures, efficient motivational aids through intimacy between the lecturer and students, and concrete and meaningful tasks. The complementary cyber education course also increased student effort toward studying and student satisfaction with the class.
Shewmon, Nathan; Watkins, Davita; Galindo, Johan; ...
2015-07-20
For organic photovoltaic (OPV) cells based on the bulk heterojunction (BHJ) structure, it remains challenging to rationally control the degree of phase separation and percolation within blends of donors and acceptors to secure optimal charge separation and transport. Reported is a bottom-up, supramolecular approach to BHJ OPVs wherein tailored hydrogen bonding (H-bonding) interactions between π-conjugated electron donor molecules encourage formation of vertically aligned donor π-stacks while simultaneously suppressing lateral aggregation; the programmed arrangement facilitates fine mixing with fullerene acceptors and efficient charge transport. The approach is illustrated using conventional linear or branched quaterthiophene donor chromophores outfitted with terminal functional groupsmore » that are either capable or incapable of self-complementary H-bonding. When applied to OPVs, the H-bond capable donors yield a twofold enhancement in power conversion efficiency relative to the comparator systems, with a maximum external quantum efficiency of 64%. H-bond promoted assembly results in redshifted absorption (in neat films and donor:C 60 blends) and enhanced charge collection efficiency despite disparate donor chromophore structure. Both features positively impact photocurrent and fill factor in OPV devices. Film structural characterization by atomic force microscopy, transmission electron microscopy, and grazing incidence wide angle X-ray scattering reveals a synergistic interplay of lateral H-bonding interactions and vertical π-stacking for directing the favorable morphology of the BHJ.« less
NASA Astrophysics Data System (ADS)
Dell'Erba, Giorgio; Luzio, Alessandro; Natali, Dario; Kim, Juhwan; Khim, Dongyoon; Kim, Dong-Yu; Noh, Yong-Young; Caironi, Mario
2014-04-01
Ambipolar semiconducting polymers, characterized by both high electron (μe) and hole (μh) mobility, offer the advantage of realizing complex complementary electronic circuits with a single semiconducting layer, deposited by simple coating techniques. However, to achieve complementarity, one of the two conduction paths in transistors has to be suppressed, resulting in unipolar devices. Here, we adopt charge injection engineering through a specific interlayer in order to tune injection into frontier energy orbitals of a high mobility donor-acceptor co-polymer. Starting from field-effect transistors with Au contacts, showing a p-type unbalanced behaviour with μh = 0.29 cm2/V s and μe = 0.001 cm2/V s, through the insertion of a caesium salt interlayer with optimized thickness, we obtain an n-type unbalanced transistor with μe = 0.12 cm2/V s and μh = 8 × 10-4 cm2/V s. We applied this result to the development of the basic pass-transistor logic building blocks such as inverters, with high gain and good noise margin, and transmission-gates. In addition, we developed and characterized information storage circuits like D-Latches and D-Flip-Flops consisting of 16 transistors, demonstrating both their static and dynamic performances and thus the suitability of this technology for more complex circuits such as display addressing logic.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, Hongfei; Yang, Zhenhua; Pan, Cheng
Here, we report that the addition of a non-photoactive tertiary polymer phase in the binary bulk heterojunction (BHJ) polymer solar cell leads to a self-assembled columnar nanostructure, enhancing the charge mobilities and photovoltaic efficiency with surprisingly increased optimal active blend thicknesses over 300 nm, 3–4 times larger than that of the binary counterpart. Using the prototypical poly(3-hexylthiophene) (P3HT):fullerene blend as a model BHJ system, we discover that the inert poly(methyl methacrylate) (PMMA) added in the binary BHJ blend self-assembles into vertical columns, which not only template the phase segregation of electron acceptor fullerenes but also induce the out-of-plane rotation ofmore » the edge-on-orientated crystalline P3HT phase. Using complementary interrogation methods including neutron reflectivity, X-ray scattering, atomic force microscopy, transmission electron microscopy, and molecular dynamics simulations, we show that the enhanced charge transport originates from the more randomized molecular stacking of the P3HT phase and the spontaneous segregation of fullerenes at the P3HT/PMMA interface, driven by the high surface tension between the two polymeric components. The results demonstrate a potential method for increasing the thicknesses of high-performance polymer BHJ solar cells with improved photovoltaic efficiency, alleviating the burden of stringently controlling the ultrathin blend thickness during the roll-to-roll-type large-area manufacturing environment.« less
Investigation of titanium dioxide nanoparticles toxicity and uptake by plants
NASA Astrophysics Data System (ADS)
Larue, C.; Khodja, H.; Herlin-Boime, N.; Brisset, F.; Flank, A. M.; Fayard, B.; Chaillou, S.; Carrière, M.
2011-07-01
Nanoparticles (NP) are introduced in a growing number of commercial products and their production may lead to their release in the environment. Plants may be a potential entry point for NP in the food chain. Up to now, results describing NP phytotoxical effects and plant accumulation are scarce and contradictory. To increase knowledge on titanium dioxide NP (TiO2-NPs) accumulation and impact on plants, we designed a study on three plant species, namely wheat (Triticum aestivum), oilseed rape (Brassica napus) and Arabidopsis thaliana. These plants were exposed in hydroponics to a panel of well-characterized TiO2-NPs, with diameters ranging from 12 to 140 nm, either anatase or rutile. Their accumulation in plant tissues is currently being assessed by complementary imaging techniques: scanning electron microscopy (SEM), transmission electron microscopy (TEM), micro-X-ray fluorescence (SR-μ-XRF) imaging and micro-particle induced X-ray emission (μ-PIXE) imaging. Moreover, the impact of TiO2-NP exposure on germination rate, root elongation, dry biomass and evapotranspiration is evaluated. Preliminary results are presented here, with data collected on wheat plants exposed to 12 nm and 25 nm anatase TiO2-NPs. These results show that TiO2-NPs are taken up by plants, and do not significantly alter their germination and root elongation. These results underline the necessity of deeper evaluation of nanoparticle ecotoxicity, and particularly on their interaction with plants.
Quantum-dot-in-perovskite solids.
Ning, Zhijun; Gong, Xiwen; Comin, Riccardo; Walters, Grant; Fan, Fengjia; Voznyy, Oleksandr; Yassitepe, Emre; Buin, Andrei; Hoogland, Sjoerd; Sargent, Edward H
2015-07-16
Heteroepitaxy-atomically aligned growth of a crystalline film atop a different crystalline substrate-is the basis of electrically driven lasers, multijunction solar cells, and blue-light-emitting diodes. Crystalline coherence is preserved even when atomic identity is modulated, a fact that is the critical enabler of quantum wells, wires, and dots. The interfacial quality achieved as a result of heteroepitaxial growth allows new combinations of materials with complementary properties, which enables the design and realization of functionalities that are not available in the single-phase constituents. Here we show that organohalide perovskites and preformed colloidal quantum dots, combined in the solution phase, produce epitaxially aligned 'dots-in-a-matrix' crystals. Using transmission electron microscopy and electron diffraction, we reveal heterocrystals as large as about 60 nanometres and containing at least 20 mutually aligned dots that inherit the crystalline orientation of the perovskite matrix. The heterocrystals exhibit remarkable optoelectronic properties that are traceable to their atom-scale crystalline coherence: photoelectrons and holes generated in the larger-bandgap perovskites are transferred with 80% efficiency to become excitons in the quantum dot nanocrystals, which exploit the excellent photocarrier diffusion of perovskites to produce bright-light emission from infrared-bandgap quantum-tuned materials. By combining the electrical transport properties of the perovskite matrix with the high radiative efficiency of the quantum dots, we engineer a new platform to advance solution-processed infrared optoelectronics.
Curcumin Inhibits Tau Aggregation and Disintegrates Preformed Tau Filaments in vitro.
Rane, Jitendra Subhash; Bhaumik, Prasenjit; Panda, Dulal
2017-01-01
The pathological aggregation of tau is a common feature of most of the neuronal disorders including frontotemporal dementia, Parkinson's disease, and Alzheimer's disease. The inhibition of tau aggregation is considered to be one of the important strategies for treating these neurodegenerative diseases. Curcumin, a natural polyphenolic molecule, has been reported to have neuroprotective ability. In this work, curcumin was found to bind to adult tau and fetal tau with a dissociation constant of 3.3±0.4 and 8±1 μM, respectively. Molecular docking studies indicated a putative binding site of curcumin in the microtubule-binding region of tau. Using several complementary techniques, including dynamic light scattering, thioflavin S fluorescence, 90° light scattering, electron microscopy, and atomic force microscopy, curcumin was found to inhibit the aggregation of tau. The dynamic light scattering analysis and atomic force microscopic images revealed that curcumin inhibits the oligomerization of tau. Curcumin also disintegrated preformed tau oligomers. Using Far-UV circular dichroism, curcumin was found to inhibit the β-sheets formation in tau indicating that curcumin inhibits an initial step of tau aggregation. In addition, curcumin inhibited tau fibril formation. Furthermore, the effect of curcumin on the preformed tau filaments was analyzed by atomic force microscopy, transmission electron microscopy, and 90° light scattering. Curcumin treatment disintegrated preformed tau filaments. The results indicated that curcumin inhibited the oligomerization of tau and could disaggregate tau filaments.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Grigor’eva, N. A., E-mail: natali@lns.pnpi.spb.ru; Eckerlebe, H.; Eliseev, A. A.
2017-03-15
The structural and magnetic properties of the mesoporous systems based on silicon dioxide with a regular hexagonal arrangement of pores several microns in length and several nanometers in diameter, which are filled with iron compound nanofilaments in various chemical states, are studied in detail. The studies are performed using the following mutually complementary methods: transmission electron microscopy, SQUID magnetometry, electron spin resonance, Mössbauer spectroscopy, polarized neutron small-angle diffraction, and synchrotron radiation diffraction. It is shown that the iron nanoparticles in pores are mainly in the γ phase of Fe{sub 2}O{sub 3} with a small addition of the α phase andmore » atomic iron clusters. The effective magnetic field acting on a nanofilament from other nanofilaments is 11 mT and has a dipole nature, the ferromagnetic–paramagnetic transition temperature is in the range 76–94 K depending on the annealing temperature of the samples, and the temperature that corresponds to the change in the magnetic state of the iron oxide nanofilaments is T ≈ 50–60 K at H = 0 and T ≈ 80 K at H = 300 mT. It is also shown that the magnetization reversal of an array of nanofilaments is caused by the magnetostatic interaction between nanofilaments at the fields that are lower than the saturation field.« less
A short-range optical wireless transmission method based on LED
NASA Astrophysics Data System (ADS)
Miao, Meiyuan; Chen, Ailin; Zhu, Mingxing; Li, Ping; Gao, Yingming; Zou, Nianyu
2016-10-01
As to electromagnetic wave interfere and only one to one transmission problem of Bluetooth, a short-range LED optical wireless transmission method is proposed to be complementary technology in this paper. Furthermore achieved image transmission through this method. The system makes C52 to be the mater controller, transmitter got data from terminals by USB and sends modulated signals with LED. Optical signal is detected by PD, through amplified, filtered with shaping wave from, and demodulated on receiver. Then send to terminals like PC and reverted back to original image. Analysis the performance from peak power and average power, power consumption of transmitter, relationship of bit error rate and modulation mode, and influence of ambient light, respectively. The results shows that image can be received accurately which uses this method. The most distant transmission distance can get to 1m with transmitter LED source of 1w, and the transfer rate is 14.4Kbit/s with OOK modulation mode on stabilization system, the ambient light effect little to LED transmission system in normal light environment. The method is a convenient to carry LED wireless short range transmission for mobile transmission equipment as a supplement of Bluetooth short-range transmission for its ISM band interfere, and the analysis method in this paper can be a reference for other similar systems. It also proves the system is feasibility for next study.
NASA Astrophysics Data System (ADS)
Ruiz Ruiz, Juan; Guttenfelder, Walter; Loureiro, Nuno; Ren, Yang; White, Anne; MIT/PPPL Collaboration
2017-10-01
Turbulent fluctuations on the electron gyro-radius length scale are thought to cause anomalous transport of electron energy in spherical tokamaks such as NSTX and MAST in some parametric regimes. In NSTX, electron-scale turbulence is studied through a combination of experimental measurements from a high-k scattering system and gyrokinetic simulations. Until now most comparisons between experiment and simulation of electron scale turbulence have been qualitative, with recent work expanding to more quantitative comparisons via synthetic diagnostic development. In this new work, we propose two alternate, complementary ways to perform a synthetic diagnostic using the gyrokinetic code GYRO. The first approach builds on previous work and is based on the traditional selection of wavenumbers using a wavenumber filter, for which a new wavenumber mapping was implemented for general axisymmetric geometry. A second alternate approach selects wavenumbers in real-space to compute the power spectra. These approaches are complementary, and recent results from both synthetic diagnostic approaches applied to NSTX plasmas will be presented. Work supported by U.S. DOE contracts DE-AC02-09CH11466 and DE-AC02-05CH11231.
NASA Technical Reports Server (NTRS)
Oeftering, Richard C.; Wade, Raymond P.; Izadnegahdar, Alain
2011-01-01
The Component-Level Electronic-Assembly Repair (CLEAR) project at the NASA Glenn Research Center is aimed at developing technologies that will enable space-flight crews to perform in situ component-level repair of electronics on Moon and Mars outposts, where there is no existing infrastructure for logistics spares. These technologies must provide effective repair capabilities yet meet the payload and operational constraints of space facilities. Effective repair depends on a diagnostic capability that is versatile but easy to use by crew members that have limited training in electronics. CLEAR studied two techniques that involve extensive precharacterization of "known good" circuits to produce graphical signatures that provide an easy-to-use comparison method to quickly identify faulty components. Analog Signature Analysis (ASA) allows relatively rapid diagnostics of complex electronics by technicians with limited experience. Because of frequency limits and the growing dependence on broadband technologies, ASA must be augmented with other capabilities. To meet this challenge while preserving ease of use, CLEAR proposed an alternative called Complex Signature Analysis (CSA). Tests of ASA and CSA were used to compare capabilities and to determine if the techniques provided an overlapping or complementary capability. The results showed that the methods are complementary.
2017-02-02
Corresponding Author Abstract Accurate virus quantification is sought, but a perfect method still eludes the scientific community. Electron...unlimited. UNCLASSIFIED 2 provides morphology data and counts all viral particles, including partial or noninfectious particles; however, EM methods ...consistent, reproducible virus quantification method called Scanning Transmission Electron Microscopy – Virus Quantification (STEM-VQ) which simplifies
Crystal structure of stacking faults in InGaAs/InAlAs/InAs heterostructures
DOE Office of Scientific and Technical Information (OSTI.GOV)
Trunkin, I. N.; Presniakov, M. Yu.; Vasiliev, A. L., E-mail: a.vasiliev56@gmail.com
Stacking faults and dislocations in InGaAs/InAlAs/InAs heterostructures have been studied by electron microscopy. The use of different techniques of transmission electron microscopy (primarily, highresolution dark-field scanning transmission electron microscopy) has made it possible to determine the defect structure at the atomic level.
Ionospheric modification at twice the electron cyclotron frequency.
Djuth, F T; Pedersen, T R; Gerken, E A; Bernhardt, P A; Selcher, C A; Bristow, W A; Kosch, M J
2005-04-01
In 2004, a new transmission band was added to the HAARP high-frequency ionospheric modification facility that encompasses the second electron cyclotron harmonic at altitudes between approximately 220 and 330 km. Initial observations indicate that greatly enhanced airglow occurs whenever the transmission frequency approximately matches the second electron cyclotron harmonic at the height of the upper hybrid resonance. This is the reverse of what happens at higher electron cyclotron harmonics. The measured optical emissions confirm the presence of accelerated electrons in the plasma.
NASA Technical Reports Server (NTRS)
Newman, Wyatt S.; Anderson, William J.; Shipitalo, William; Rohn, Douglas
1992-01-01
The design philosophy and measurements performed on a new roller-gear transmission prototype for a robotic manipulator are described. The design incorporates smooth rollers in a planetary configuration integrated with conventional toothed gears. The rollers were designed to handle low torque with low backlash and friction while the complementary gears support higher torques and prevent accumulated creep or slip of the rollers. The introduction of gears with finite numbers of teeth to function in parallel with the rollers imposes severe limits on available designs. Solutions for two-planet row designs are discussed. A two-planet row, four-planet design was conceived, fabricated, and tested. Detailed calculations of cluster geometry, gear stresses, and gear geometry are given. Measurement data reported here include transmission linearity, static and dynamic friction, inertia, backlash, stiffness, and forward and reverse efficiency. Initial test results are reported describing performance of the transmission in a servomechanism with torque feedback.
Shi, Feng; Wei, Zheng; Zhao, Yingying; Xu, Ximing
2016-01-01
Context: Recent studies have demonstrated that baicalin has antihyperglycemic effects by inhibiting lipid peroxidation. Baicalin is low hydrophilic and poorly absorbed after oral administration. Thus, a suitable formulation is highly desired to overcome the disadvantages of baicalin. Objective: The objective of this work was to prepare baicalin-loaded nanostructured lipid carriers (B-NLCs) for enhanced antidiabetic effects. Materials and Methods: B-NLCs were prepared by high-pressure homogenization method using Precirol as the solid lipid and Miglyol as the liquid lipid. The properties of the NLCs, such as particle size, zeta potential (ZP), and drug encapsulation efficiency (EE), were investigated. The morphology of NLCs was observed by transmission electron microscopy. In addition, drug release and antidiabetic activity were also studied. Results: The results revealed that B-NLCs particles were uniformly in the nanosize range and of spherical morphology with a mean size of 92 ± 3.1 nm, a ZP of −31.35 ± 3.08 mV, and an EE of 85.29 ± 3.42%. Baicalin was released from NLCs in a sustained manner. In addition, B-NLCs showed a significantly higher antidiabetic efficacy compared with baicalin. Conclusion: B-NLCs described in this study are well-suited for the delivery of baicalin. SUMMARY Currently, herbal medicines have attracted increasing attention as a complementary approach for type 2 diabetesBaicalin has antihyperglycemic effects by inhibiting lipid peroxidationA suitable formulation is highly desired to overcome the disadvantages (poor solubility and low bioavailability) of baicalinNanostructured lipid carriers could enhance the antidiabetic effects of baicalin. Abbreviations used: B-NLCs: Baicalin-Loaded Nanostructured Lipid Carriers, B-SUS: Baicalin Water Suspension, EE: Encapsulation Efficiency, FBG: Fasting Blood Glucose, HbAlc: Glycosylated Hemoglobin, HPLC: High-performance Liquid Chromatography; NLCs: Nanostructured Lipid Carriers, PI: Polydispersity Index, SD: Sprague-Dawley, SLNs: Solid lipid nanoparticles, STZ: Streptozotocin, TC: Total cholesterol, TEM: Transmission Electron Microscope, TG: Total Triglyceride, ZP: Zeta Potential. PMID:27601850
Shi, Feng; Wei, Zheng; Zhao, Yingying; Xu, Ximing
2016-01-01
Recent studies have demonstrated that baicalin has antihyperglycemic effects by inhibiting lipid peroxidation. Baicalin is low hydrophilic and poorly absorbed after oral administration. Thus, a suitable formulation is highly desired to overcome the disadvantages of baicalin. The objective of this work was to prepare baicalin-loaded nanostructured lipid carriers (B-NLCs) for enhanced antidiabetic effects. B-NLCs were prepared by high-pressure homogenization method using Precirol as the solid lipid and Miglyol as the liquid lipid. The properties of the NLCs, such as particle size, zeta potential (ZP), and drug encapsulation efficiency (EE), were investigated. The morphology of NLCs was observed by transmission electron microscopy. In addition, drug release and antidiabetic activity were also studied. The results revealed that B-NLCs particles were uniformly in the nanosize range and of spherical morphology with a mean size of 92 ± 3.1 nm, a ZP of -31.35 ± 3.08 mV, and an EE of 85.29 ± 3.42%. Baicalin was released from NLCs in a sustained manner. In addition, B-NLCs showed a significantly higher antidiabetic efficacy compared with baicalin. B-NLCs described in this study are well-suited for the delivery of baicalin. Currently, herbal medicines have attracted increasing attention as a complementary approach for type 2 diabetesBaicalin has antihyperglycemic effects by inhibiting lipid peroxidationA suitable formulation is highly desired to overcome the disadvantages (poor solubility and low bioavailability) of baicalinNanostructured lipid carriers could enhance the antidiabetic effects of baicalin. Abbreviations used: B-NLCs: Baicalin-Loaded Nanostructured Lipid Carriers, B-SUS: Baicalin Water Suspension, EE: Encapsulation Efficiency, FBG: Fasting Blood Glucose, HbAlc: Glycosylated Hemoglobin, HPLC: High-performance Liquid Chromatography; NLCs: Nanostructured Lipid Carriers, PI: Polydispersity Index, SD: Sprague-Dawley, SLNs: Solid lipid nanoparticles, STZ: Streptozotocin, TC: Total cholesterol, TEM: Transmission Electron Microscope, TG: Total Triglyceride, ZP: Zeta Potential.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Westraadt, J.E., E-mail: johan.westraadt@nmmu.ac.za; Olivier, E.J.; Neethling, J.H.
2015-11-15
Spinodal decomposition (SD) is an important phenomenon in materials science and engineering. For example, it is considered to be responsible for the 475 °C embrittlement of stainless steels comprising the bcc (ferrite) or bct (martensite) phases. Structural characterization of the evolving minute nano-scale concentration fluctuations during SD in the Fe–Cr system is, however, a notable challenge, and has mainly been considered accessible via atom probe tomography (APT) and small-angle neutron scattering. The standard tool for nanostructure characterization, viz. transmission electron microscopy (TEM), has only been successfully applied to late stages of SD when embrittlement is already severe. However, we heremore » demonstrate that the structural evolution in the early stages of SD in binary Fe–Cr, and alloys based on the binary, are accessible via analytical scanning TEM. An Fe–36 wt% Cr alloy aged at 500 °C for 1, 10 and 100 h is investigated using an aberration-corrected microscope and it is found that highly coherent and interconnected Cr-rich regions develop. The wavelength of decomposition is rather insensitive to the sample thickness and it is quantified to 2, 3 and 6 nm after ageing for 1, 10 and 100 h, which is in reasonable agreement with prior APT analysis. The concentration amplitude is more sensitive to the sample thickness and acquisition parameters but the TEM analysis is in good agreement with APT analysis for the longest ageing time. These findings open up for combinatorial TEM studies where both local crystallography and chemistry is required. - Highlights: • STEM-EELS analysis was successfully applied to resolve early stage SD in Fe–Cr. • Compositional wavelength measured with STEM-EELS compares well to previous ATP studies. • Compositional amplitude measured with STEM-EELS is a function of experimental parameters. • STEM-EELS allows for combinatorial studies of SD using complementary techniques.« less
78 FR 77354 - Procedural Rules To Permit Parties To File and Serve Documents Electronically
Federal Register 2010, 2011, 2012, 2013, 2014
2013-12-23
... by handwriting his or her signature. For documents filed by electronic transmission, a party may sign... transmission. A party or representative of the party shall sign a document by handwriting his signature. (2...
Transmission electron microscopy of amyloid fibrils.
Gras, Sally L; Waddington, Lynne J; Goldie, Kenneth N
2011-01-01
Transmission Electron Microscopy of negatively stained and cryo-prepared specimens allows amyloid fibrils to be visualised at high resolution in a dried or a hydrated state, and is an essential method for characterising the morphology of fibrils and pre-fibrillar species. We outline the key steps involved in the preparation and observation of samples using negative staining and cryo-electron preservation. We also discuss methods to measure fibril characteristics, such as fibril width, from electron micrographs.
2017-06-29
Accurate Virus Quantitation Using a Scanning Transmission Electron Microscopy (STEM) Detector in a Scanning Electron Microscope Candace D Blancett1...L Norris2, Cynthia A Rossi4 , Pamela J Glass3, Mei G Sun1,* 1 Pathology Division, United States Army Medical Research Institute of Infectious...Diseases (USAMRIID), 1425 Porter Street, Fort Detrick, Maryland, 21702 2Biostatistics Division, United States Army Medical Research Institute of
The spatial coherence function in scanning transmission electron microscopy and spectroscopy.
Nguyen, D T; Findlay, S D; Etheridge, J
2014-11-01
We investigate the implications of the form of the spatial coherence function, also referred to as the effective source distribution, for quantitative analysis in scanning transmission electron microscopy, and in particular for interpreting the spatial origin of imaging and spectroscopy signals. These questions are explored using three different source distribution models applied to a GaAs crystal case study. The shape of the effective source distribution was found to have a strong influence not only on the scanning transmission electron microscopy (STEM) image contrast, but also on the distribution of the scattered electron wavefield and hence on the spatial origin of the detected electron intensities. The implications this has for measuring structure, composition and bonding at atomic resolution via annular dark field, X-ray and electron energy loss STEM imaging are discussed. Copyright © 2014 Elsevier B.V. All rights reserved.
Tylko, G; Karasiński, J; Wróblewski, R; Roomans, G M; Kilarski, W M
2000-01-01
Heterogeneity of the elemental content of myogenic C2C12 cultured cells was studied by electron probe X-ray microanalysis (EPXMA) with scanning (SEM EPXMA) and scanning transmission electron microscopy (STEM EPXMA). The best plastic substrate for growing cells was Thermanox. For STEM EPXMA, a Formvar film coated with carbon was found to be suitable substrate. The cells examined by scanning transmission electron microscopy showed great heterogeneity in their elemental content in comparison with the cells examined in the scanning electron microscope despite of an almost identical preparation procedure for EPXMA. Nevertheless the K/Na ratios obtained from both methods of EPXMA were very close (4.1 and 4.3). We conclude that the observed discrepancy in the elemental content obtained by the two methods may be due to differences in instrumentation and this must be taken into account when planning a comparative study.
Phase-space foundations of electron holography
NASA Astrophysics Data System (ADS)
Lubk, A.; Röder, F.
2015-09-01
We present a unified formalism for describing various forms of electron holography in quantum mechanical phase space including their extensions to quantum-state reconstructions. The phase-space perspective allows for taking into account partial coherence as well as the quantum mechanical detection process typically hampering the unique reconstruction of a wave function. We elaborate on the limitations imposed by the electron optical elements of the transmission electron microscope as well as the scattering at the target. The results provide the basis for vastly extending the scope of electron holographic techniques towards analyzing partially coherent signals such as inelastically scattered electrons or electron pulses used in ultrafast transmission electron microscopy.
NASA Astrophysics Data System (ADS)
Hao, Qingzhen
Metal/dielectric nanostructures have the ability to sustain coherent electron oscillations known as surface plasmons. Due to their capability of localizing and guiding light in sub-wavelength metal nanostructures beyond diffraction limits, surface plasmon-based photonics, or “plasmonics” has opened new physical phenomena and lead to novel applications in metamaterials, optoelectronics, surface enhanced spectroscopy and biological sensing. This dissertation centers on design, fabrication, characterization of metallic nanostructures and their applications in surface-enhanced Raman spectroscopy (SERS) and actively tunable plasmonics. Metal-dielectric nanostructures are the building blocks for photonic metamaterials. One valuable design guideline for metamaterials is the Babinet’s principle, which governs the optical properties of complementary nanostructures. However, most complementary metamaterials are designed for the far infrared region or beyond, where the optical absorption of metal is small. We have developed a novel dual fabrication method, capable of simultaneously producing optically thin complementary structures. From experimental measurements and theoretical simulations, we showed that Babinet’s principle qualitatively holds in the visible region for the optically thin complements. The complementary structure is also a good platform to study subtle differences between nanoparticles and nanoholes in SERS (a surface sensitive technique, which can enhance the conventional Raman cross-section by 106˜108 fold, thus very useful for highly sensitive biochemical sensing). Through experimental measurement and theoretical analysis, we showed that the SERS enhancement spectrum (plot of SERS enhancement versus excitation wavelengths), dominated by local near-field, for nanoholes closely follows their far-field optical transmission spectrum. However, the enhancement spectrum for nanoparticles red-shifts significantly from their far-field optical extinction spectrum, due to nontrivial high orders of evanescent scattering modes. This study unveils the different near-field properties between nanoparticle and nanohole arrays and adds important details to the conventional wisdom for SERS substrate design. Besides SERS studies on gold substrates, I further extended my research to transition metals, i.e. platinum. I have carried out a comparative study of SERS performance for gold and platinum substrates. The commonly observed low enhancement from a platinum substrate is explained by the larger Fano interference between its free intra-band electrons and its bound inter-band electrons. A major challenge in applying SERS for biochemical sensing is to fabricate substrates with excellent sensitivity and uniform surface functionality. Graphene, a single sheet of carbon atoms with an ideal two-dimensional honeycomb crystal structure, offers excellent surface chemical properties. We synthesized high quality single-layer graphene sheets by chemical vapor deposition (CVD) on copper foils and transferred them to gold nanostructures, i.e., nanoparticle or nanohole arrays. Our experimental data show that graphene coated metallic substrates could achieve higher sensitivity of SERS detection than bare metallic substrates. The combined graphene-nanostructure substrates show about three-fold or nine-fold enhancement in the Raman signal of methylene blue (MB) compared with the bare nanohole or nanoparticle substrates, respectively. The difference in the enhancement factors between the nanohole and nanoparticle substrates is explained by the different coating morphologies of graphene on the two substrates. SERS enhancement of graphene is further investigated on mechanically exfoliated graphene. We found that SERS enhancement of graphene can be tuned by changing its Fermi level through doping. Both molecular doping and gate doping experiments show that hole-doped graphene yields a larger SERS enhancement in MB than electron-doped graphene, which indicates that the SERS enhancement of graphene involves the chemical mechanism. SERS enhancement from metallic nanostructures, on the other hand, is mainly an electromagnetic effect, relying on the plasmonic properties of the nanostructures. Full-wave electromagnetic simulations indicate that graphene does not alter the plasmonic properties of nanostructures significantly, and consequently there is little influence on the electromagnetic SERS enhancement. However, graphene offers additional chemical enhancement which could be combined with the conventional SERS enhancement of bare gold nanostructures to achieve higher detection sensitivity. Besides SERS, plasmonics offers an opportunity to merge photonics and electronics at the nanoscale, namely optoelectronics, to obtain even larger data capacity and speed of operation. As a necessary component for optoelectronic devices, various optical switches have been developed. First, a thin layer of frequency responsive liquid crystals (LCs) is integrated with a gold nanoparticle or nanohole array. The frequency of the applied voltage controls the configuration of LCs to align parallel or perpendicular to the nanoparticle. The transmission spectra of the system shift back and forth as a result of changing effective LCs dielectric function. We demonstrated that this hybrid system is highly reversible and repeatable. We further extend this concept to use photosensitive LCs to change the absorption bands of a plasmonic absorber. We construct a tunable plasmonic absorber by integrating a photosensitive nematic liquid crystal (PNLC) layer onto an asymmetric gold nanodisk array. A repeatable tuning range of ˜ 25 nm in the dual absorption bands of the plasmonic nanodisk array is demonstrated in the near infrared region.
Schiff, Elad; Ben-Arye, Eran; Attias, Samuel; Sroka, Gideon; Matter, Ibrahim; Keshet, Yael
2012-12-01
This study aims to examine the meaning and practical implications of integration of a complementary medicine-based surgery service in a hospital setting (CISS--Complementary/Integrative Surgery Service) through analysis of consultation reports associated with this service. Thematic analysis was used to evaluate CISS consultation reports in a hospital electronic consultant charting system during the first half year of the service's activity. 304 consultation reports were analyzed. Nurses initiated significantly more consultations than physicians (55% vs 7%). Consultation requests were gradually more focused on specific symptoms, possibly manifesting a better understanding of the scope of complementary medicine in the surgery setting. CISS practitioners responded in more biomedical language over time, albeit offering a more holistic perspective regarding patients' needs as well as clarifications regarding the nature of the treatment they provided. Diverse communication patterns in consultations evolved over time representing dynamics in multiple levels of integration of the CISS. Documented communication through consultations can provide a window to the process of integration of complementary medicine-based services in health systems. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.
Klein tunneling in Weyl semimetals under the influence of magnetic field.
Yesilyurt, Can; Tan, Seng Ghee; Liang, Gengchiau; Jalil, Mansoor B A
2016-12-12
Klein tunneling refers to the absence of normal backscattering of electrons even under the case of high potential barriers. At the barrier interface, the perfect matching of electron and hole wavefunctions enables a unit transmission probability for normally incident electrons. It is theoretically and experimentally well understood in two-dimensional relativistic materials such as graphene. Here we investigate the Klein tunneling effect in Weyl semimetals under the influence of magnetic field induced by ferromagnetic stripes placed at barrier boundaries. Our results show that the resonance of Fermi wave vector at specific barrier lengths gives rise to perfect transmission rings, i.e., three-dimensional analogue of the so-called magic transmission angles in two-dimensional Dirac semimetals. Besides, the transmission profile can be shifted by application of magnetic field in the central region, a property which may be utilized in electro-optic applications. When the applied potential is close to the Fermi level, a particular incident vector can be selected by tuning the magnetic field, thus enabling highly selective transmission of electrons in the bulk of Weyl semimetals. Our analytical and numerical calculations obtained by considering Dirac electrons in three regions and using experimentally feasible parameters can pave the way for relativistic tunneling applications in Weyl semimetals.
Bäcke, Olof; Lindqvist, Camilla; de Zerio Mendaza, Amaia Diaz; Gustafsson, Stefan; Wang, Ergang; Andersson, Mats R; Müller, Christian; Kristiansen, Per Magnus; Olsson, Eva
2017-05-01
We show by in situ microscopy that the effects of electron beam irradiation during transmission electron microscopy can be used to lock microstructural features and enhance the structural thermal stability of a nanostructured polymer:fullerene blend. Polymer:fullerene bulk-heterojunction thin films show great promise for use as active layers in organic solar cells but their low thermal stability is a hindrance. Lack of thermal stability complicates manufacturing and influences the lifetime of devices. To investigate how electron irradiation affects the thermal stability of polymer:fullerene films, a model bulk-heterojunction film based on a thiophene-quinoxaline copolymer and a fullerene derivative was heat-treated in-situ in a transmission electron microscope. In areas of the film that exposed to the electron beam the nanostructure of the film remained stable, while the nanostructure in areas not exposed to the electron beam underwent large phase separation and nucleation of fullerene crystals. UV-vis spectroscopy shows that the polymer:fullerene films are stable for electron doses up to 2000kGy. Copyright © 2016 Elsevier B.V. All rights reserved.
Bäcke, Olof; Lindqvist, Camilla; de Zerio Mendaza, Amaia Diaz; Gustafsson, Stefan; Wang, Ergang; Andersson, Mats R; Müller, Christian; Kristiansen, Per Magnus; Olsson, Eva
2017-02-01
We show by in situ microscopy that the effects of electron beam irradiation during transmission electron microscopy can be used to lock microstructural features and enhance the structural thermal stability of a nanostructured polymer:fullerene blend. Polymer:fullerene bulk-heterojunction thin films show great promise for use as active layers in organic solar cells but their low thermal stability is a hindrance. Lack of thermal stability complicates manufacturing and influences the lifetime of devices. To investigate how electron irradiation affects the thermal stability of polymer:fullerene films, a model bulk-heterojunction film based on a thiophene-quinoxaline copolymer and a fullerene derivative was heat-treated in-situ in a transmission electron microscope. In areas of the film that exposed to the electron beam the nanostructure of the film remained stable, while the nanostructure in areas not exposed to the electron beam underwent large phase separation and nucleation of fullerene crystals. UV-vis spectroscopy shows that the polymer:fullerene films are stable for electron doses up to 2000kGy. Copyright © 2017 Elsevier B.V. All rights reserved.
Spin-dependent electron many-body effects in GaAs
NASA Astrophysics Data System (ADS)
Nemec, P.; Kerachian, Y.; van Driel, H. M.; Smirl, Arthur L.
2005-12-01
Time- and polarization-resolved differential transmission measurements employing same and oppositely circularly polarized 150fs optical pulses are used to investigate spin characteristics of conduction band electrons in bulk GaAs at 295K . Electrons and holes with densities in the 2×1016cm-3-1018cm-3 range are generated and probed with pulses whose center wavelength is between 865 and 775nm . The transmissivity results can be explained in terms of the spin sensitivity of both phase-space filling and many-body effects (band-gap renormalization and screening of the Coulomb enhancement factor). For excitation and probing at 865nm , just above the band-gap edge, the transmissivity changes mainly reflect spin-dependent phase-space filling which is dominated by the electron Fermi factors. However, for 775nm probing, the influence of many-body effects on the induced transmission change are comparable with those from reduced phase space filling, exposing the spin dependence of the many-body effects. If one does not take account of these spin-dependent effects one can misinterpret both the magnitude and time evolution of the electron spin polarization. For suitable measurements we find that the electron spin relaxation time is 130ps .
Sekitani, Tsuyoshi; Takamiya, Makoto; Noguchi, Yoshiaki; Nakano, Shintaro; Kato, Yusaku; Sakurai, Takayasu; Someya, Takao
2007-06-01
The electronics fields face serious problems associated with electric power; these include the development of ecologically friendly power-generation systems and ultralow-power-consuming circuits. Moreover, there is a demand for developing new power-transmission methods in the imminent era of ambient electronics, in which a multitude of electronic devices such as sensor networks will be used in our daily life to enhance security, safety and convenience. We constructed a sheet-type wireless power-transmission system by using state-of-the-art printing technologies using advanced electronic functional inks. This became possible owing to recent progress in organic semiconductor technologies; the diversity of chemical syntheses and processes on organic materials has led to a new class of organic semiconductors, dielectric layers and metals with excellent electronic functionalities. The new system directly drives electronic devices by transmitting power of the order of tens of watts without connectors, thereby providing an easy-to-use and reliable power source. As all of the components are manufactured on plastic films, it is easy to place the wireless power-transmission sheet over desks, floors, walls and any other location imaginable.
Materials and fabrication sequences for water soluble silicon integrated circuits at the 90 nm node
NASA Astrophysics Data System (ADS)
Yin, Lan; Bozler, Carl; Harburg, Daniel V.; Omenetto, Fiorenzo; Rogers, John A.
2015-01-01
Tungsten interconnects in silicon integrated circuits built at the 90 nm node with releasable configurations on silicon on insulator wafers serve as the basis for advanced forms of water-soluble electronics. These physically transient systems have potential uses in applications that range from temporary biomedical implants to zero-waste environmental sensors. Systematic experimental studies and modeling efforts reveal essential aspects of electrical performance in field effect transistors and complementary ring oscillators with as many as 499 stages. Accelerated tests reveal timescales for dissolution of the various constituent materials, including tungsten, silicon, and silicon dioxide. The results demonstrate that silicon complementary metal-oxide-semiconductor circuits formed with tungsten interconnects in foundry-compatible fabrication processes can serve as a path to high performance, mass-produced transient electronic systems.
Transmission Electron Microscopy of Minerals and Rocks
NASA Astrophysics Data System (ADS)
McLaren, Alex C.
1991-04-01
Of the many techniques that have been applied to the study of crystal defects, none has contributed more to our understanding of their nature and influence on the physical and chemical properties of crystalline materials than transmission electron microscopy (TEM). TEM is now used extensively by an increasing number of earth scientists for direct observation of defect microstructures in minerals and rocks. Transmission Electron Microscopy of Rocks and Minerals is an introduction to the principles of the technique and is the only book to date on the subject written specifically for geologists and mineralogists. The first part of the book deals with the essential physics of the transmission electron microscope and presents the basic theoretical background required for the interpretation of images and electron diffraction patterns. The final chapters are concerned with specific applications of TEM in mineralogy and deal with such topics as planar defects, intergrowths, radiation-induced defects, dislocations and deformation-induced microstructures. The examples cover a wide range of rock-forming minerals from crustal rocks to those in the lower mantle, and also take into account the role of defects in important mineralogical and geological processes.
Ikeda, Masato; Nobori, Tadahito; Schmutz, Marc; Lehn, Jean-Marie
2005-01-07
The bow-shaped molecule 1 bearing a self-complementary DAAD-ADDA (D=donor A=acceptor) hydrogen-bonding array generates, in hydrocarbon solvents, highly ordered supramolecular sheet aggregates that subsequently give rise to gels by formation of an entangled network. The process of hierarchical self-assembly of compound 1 was investigated by the concentration and temperature dependence of UV-visible and (1)H NMR spectra, fluorescence spectra, and electron microscopy data. The temperature dependence of the UV-visible spectra indicates a highly cooperative process for the self-assembly of compound 1 in decaline. The electron micrograph of the decaline solution of compound 1 (1.0 mM) revealed supramolecular sheet aggregates forming an entangled network. The selected area electronic diffraction patterns of the supramolecular sheet aggregates were typical for single crystals, indicative of a highly ordered assembly. The results exemplify the generation, by hierarchical self-assembly, of highly organized supramolecular materials presenting novel collective properties at each level of organization.
A simple way to obtain backscattered electron images in a scanning transmission electron microscope.
Tsuruta, Hiroki; Tanaka, Shigeyasu; Tanji, Takayoshi; Morita, Chiaki
2014-08-01
We have fabricated a simple detector for backscattered electrons (BSEs) and incorporated the detector into a scanning transmission electron microscope (STEM) sample holder. Our detector was made from a 4-mm(2) Si chip. The fabrication procedure was easy, and similar to a standard transmission electron microscopy (TEM) sample thinning process based on ion milling. A TEM grid containing particle objects was fixed to the detector with a silver paste. Observations were carried out using samples of Au and latex particles at 75 and 200 kV. Such a detector provides an easy way to obtain BSE images in an STEM. © The Author 2014. Published by Oxford University Press on behalf of The Japanese Society of Microscopy. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
NASA Astrophysics Data System (ADS)
Woo, S. Y.; Hosseini Vajargah, S.; Ghanad-Tavakoli, S.; Kleiman, R. N.; Botton, G. A.
2012-10-01
Unambiguous identification of anti-phase boundaries (APBs) in heteroepitaxial films of GaSb grown on Si has been so far elusive. In this work, we present conventional transmission electron microscopy (TEM) diffraction contrast imaging using superlattice reflections, in conjunction with convergent beam electron diffraction analysis, to determine a change in polarity across APBs in order to confirm the presence of anti-phase disorder. In-depth analysis of anti-phase disorder is further supported with atomic resolution high-angle annular dark-field scanning transmission electron microscopy. The nature of APBs in GaSb is further elucidated by a comparison to previous results for GaAs epilayers grown on Si.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yang, Xiang; Lu, Yang; Lee, Jongho
2016-01-04
Tuning low resistance state is crucial for resistance random access memory (RRAM) that aims to achieve optimal read margin and design flexibility. By back-to-back stacking two nanometallic bipolar RRAMs with different thickness into a complementary structure, we have found that its low resistance can be reliably tuned over several orders of magnitude. Such high tunability originates from the exponential thickness dependence of the high resistance state of nanometallic RRAM, in which electron wave localization in a random network gives rise to the unique scaling behavior. The complementary nanometallic RRAM provides electroforming-free, multi-resistance-state, sub-100 ns switching capability with advantageous characteristics formore » memory arrays.« less
Spin-resolved conductance of Dirac electrons through multibarrier arrays
NASA Astrophysics Data System (ADS)
Dahal, Dipendra; Gumbs, Godfrey; Iurov, Andrii
We use a transfer matrix method to calculate the transmission coefficient of Dirac electrons through an arbitrary number of square potential barrier in gapped monolayer graphene(MLG) and bilayer graphene (BLG). The widths of barriers may not be chosen equal. The shift in the angle of incidence and the width of the barrier required for resonance are investigated numerically for both MLG and BLG. We compare the effects due to energy gap on these two transmission coefficient for each of these two structures (MLG and BLG). We present our results as functions of barrier width, height as well as incoming electron energy as well as band gap and examine the conditions for which perfect reflection or transmission occurs. Our transmission data are further used to calculate conductivity.
An ENG resonator-based microwave sensor for the characterization of aqueous glucose
NASA Astrophysics Data System (ADS)
Kumari, Ratnesh; Patel, Piyush N.; Yadav, Rahul
2018-02-01
This work proposes a microwave filter with a notched frequency of transmission using an epsilon negative (ENG) unit-cell resonator as a sensor device. The device finds important application for the characterization of life-saving samples such as glucose. The ENG structure consists of two complementary geometries in the shape of ring and horn. The structure efficiently inhibits the incoming RF signal and creates a stopband resonance at 2.074 GHz. The printed circuit board of the layout was realized using FR-4 substrate of relative permittivity ɛ r = 4.4, and height of 1.6 mm. It is experimentally seen that in the complementary area of horn and circular ring, the glucose sample perturbs the air-dielectric fringing fields which exist over the complementary area and modifies the frequency of stopband resonance. A change in sensor resonance was recorded and calibrated for different concentrations of glucose sample. The sensor exhibits a linear response for glucose concentration ranging from 20 to 100 mg ml-1 in the sensing area.
Information hiding based on double random-phase encoding and public-key cryptography.
Sheng, Yuan; Xin, Zhou; Alam, Mohammed S; Xi, Lu; Xiao-Feng, Li
2009-03-02
A novel information hiding method based on double random-phase encoding (DRPE) and Rivest-Shamir-Adleman (RSA) public-key cryptosystem is proposed. In the proposed technique, the inherent diffusion property of DRPE is cleverly utilized to make up the diffusion insufficiency of RSA public-key cryptography, while the RSA cryptosystem is utilized for simultaneous transmission of the cipher text and the two phase-masks, which is not possible under the DRPE technique. This technique combines the complementary advantages of the DPRE and RSA encryption techniques and brings security and convenience for efficient information transmission. Extensive numerical simulation results are presented to verify the performance of the proposed technique.
Utsunomiya, Satoshi; Ewing, Rodney C
2003-02-15
A major challenge to the development of a fundamental understanding of transport and retardation mechanisms of trace metal contaminants (<10 ppm) is their identification and characterization at the nanoscale. Atomic-scale techniques, such as conventional transmission electron microscopy, although powerful, are limited by the extremely small amounts of material that are examined. However, recent advances in electron microscopy provide a number of new analytical techniques that expand its application in environmental studies, particularly those concerning heavy metals on airborne particulates or water-borne colloids. High-angle annular dark field scanning transmission electron microscopy (HAADF-STEM), STEM-energy-dispersive X-ray spectrometry (EDX), and energy-filtered TEM (EFTEM) can be effectively used to identify and characterize nanoparticles. The image contrast in HAADF-STEM is strongly correlated to the atomic mass: heavier elements contribute to brighter contrast. Gold nanocrystals in pyrite and uranium nanocrystals in atmospheric aerosols have been identified by HAADF-STEM and STEM-EDX mapping and subsequently characterized by high-resolution TEM (HRTEM). EFTEM was used to identify U and Fe nanocrystals embedded in an aluminosilicate. A rare, As-bearing nanophase, westerveldite (FeAs), was identified by STEM-EDX and HRTEM. The combined use of these techniques greatly expands the effective application of electron microscopy in environmental studies, especially when applied to metals of very low concentrations. This paper describes examples of how these electron microbeam techniques can be used in combination to characterize a low concentration of heavy metals (a few ppm) on nanoscale particles.
Börrnert, Felix; Renner, Julian; Kaiser, Ute
2018-05-21
The electron source brightness is an important parameter in an electron microscope. Reliable and easy brightness measurement routes are not easily found. A determination method for the illumination semi-angle distribution in transmission electron microscopy is even less well documented. Herein, we report a simple measurement route for both entities and demonstrate it on a state-of-the-art instrument. The reduced axial brightness of the FEI X-FEG with a monochromator was determined to be larger than 108 A/(m2 sr V).
Electron Diffraction Using Transmission Electron Microscopy
Bendersky, Leonid A.; Gayle, Frank W.
2001-01-01
Electron diffraction via the transmission electron microscope is a powerful method for characterizing the structure of materials, including perfect crystals and defect structures. The advantages of electron diffraction over other methods, e.g., x-ray or neutron, arise from the extremely short wavelength (≈2 pm), the strong atomic scattering, and the ability to examine tiny volumes of matter (≈10 nm3). The NIST Materials Science and Engineering Laboratory has a history of discovery and characterization of new structures through electron diffraction, alone or in combination with other diffraction methods. This paper provides a survey of some of this work enabled through electron microscopy. PMID:27500060
Analysis on electronic control unit of continuously variable transmission
NASA Astrophysics Data System (ADS)
Cao, Shuanggui
Continuously variable transmission system can ensure that the engine work along the line of best fuel economy, improve fuel economy, save fuel and reduce harmful gas emissions. At the same time, continuously variable transmission allows the vehicle speed is more smooth and improves the ride comfort. Although the CVT technology has made great development, but there are many shortcomings in the CVT. The CVT system of ordinary vehicles now is still low efficiency, poor starting performance, low transmission power, and is not ideal controlling, high cost and other issues. Therefore, many scholars began to study some new type of continuously variable transmission. The transmission system with electronic systems control can achieve automatic control of power transmission, give full play to the characteristics of the engine to achieve optimal control of powertrain, so the vehicle is always traveling around the best condition. Electronic control unit is composed of the core processor, input and output circuit module and other auxiliary circuit module. Input module collects and process many signals sent by sensor and , such as throttle angle, brake signals, engine speed signal, speed signal of input and output shaft of transmission, manual shift signals, mode selection signals, gear position signal and the speed ratio signal, so as to provide its corresponding processing for the controller core.
NASA Astrophysics Data System (ADS)
Chang, Chun-Chieh; Huang, Li; Nogan, John; Chen, Hou-Tong
2018-05-01
We experimentally demonstrate high-performance narrowband terahertz (THz) bandpass filters through cascading multiple bilayer metasurface antireflection structures. Each bilayer metasurface, consisting of a square array of silicon pillars with a self-aligned top gold resonator-array and a complementary bottom gold slot-array, enables near-zero reflection and simultaneously close-to-unity single-band transmission at designed operational frequencies in the THz spectral region. The THz bandpass filters based on stacked bilayer metasurfaces allow a fairly narrow, high-transmission passband, and a fast roll-off to an extremely clean background outside the passband, thereby providing superior bandpass performance. The demonstrated scheme of narrowband THz bandpass filtering is of great importance for a variety of applications where spectrally clean, high THz transmission over a narrow bandwidth is desired, such as THz spectroscopy and imaging, molecular detection and monitoring, security screening, and THz wireless communications.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chang, Chun-Chieh; Huang, Li; Nogan, John
We experimentally demonstrate high-performance narrowband terahertz (THz) bandpass filters through cascading multiple bilayer metasurface antireflection structures. Each bilayer metasurface, consisting of a square array of silicon pillars with a self-aligned top gold resonator-array and a complementary bottom gold slot-array, enables near-zero reflection and simultaneously close-to-unity single-band transmission at designed operational frequencies in the THz spectral region. The THz bandpass filters based on stacked bilayer metasurfaces allow a fairly narrow, high-transmission passband, and a fast roll-off to an extremely clean background outside the passband, thereby providing superior bandpass performance. The demonstrated scheme of narrowband THz bandpass filtering is of great importancemore » for a variety of applications where spectrally clean, high THz transmission over a narrow bandwidth is desired, such as THz spectroscopy and imaging, molecular detection and monitoring, security screening, and THz wireless communications.« less
Chang, Chun-Chieh; Huang, Li; Nogan, John; ...
2018-02-01
We experimentally demonstrate high-performance narrowband terahertz (THz) bandpass filters through cascading multiple bilayer metasurface antireflection structures. Each bilayer metasurface, consisting of a square array of silicon pillars with a self-aligned top gold resonator-array and a complementary bottom gold slot-array, enables near-zero reflection and simultaneously close-to-unity single-band transmission at designed operational frequencies in the THz spectral region. The THz bandpass filters based on stacked bilayer metasurfaces allow a fairly narrow, high-transmission passband, and a fast roll-off to an extremely clean background outside the passband, thereby providing superior bandpass performance. The demonstrated scheme of narrowband THz bandpass filtering is of great importancemore » for a variety of applications where spectrally clean, high THz transmission over a narrow bandwidth is desired, such as THz spectroscopy and imaging, molecular detection and monitoring, security screening, and THz wireless communications.« less
Robert, Amélie; Boyer, Lucie; Pineault, Nicolas
2011-03-01
The development of culture processes for hematopoietic progenitors could lead to the development of a complementary source of platelets for therapeutic purposes. However, functional characterization of culture-derived platelets remains limited, which raises some uncertainties about the quality of platelets produced in vitro. The aim of this study was to define the proportion of functional platelets produced in cord blood CD34+ cell cultures. Toward this, the morphological and functional properties of culture-derived platelet-like particles (PLPs) were critically compared to that of blood platelets. Flow cytometry combined with transmission electron microscopy analyses revealed that PLPs formed a more heterogeneous population of platelets at a different stage of maturation than blood platelets. The majority of PLPs harbored the fibrinogen receptor αIIbβ3, but a significant proportion failed to maintain glycoprotein (GP)Ibα surface expression, a component of the vWF receptor essential for platelet functions. Importantly, GPIbα extracellular expression correlated closely with platelet function, as the GPIIb+ GPIbα+ PLP subfraction responded normally to agonist stimulation as evidenced by α-granule release, adhesion, spreading, and aggregation. In contrast, the GPIIb+ GPIbα⁻ subfraction was unresponsive in most functional assays and appeared to be metabolically inactive. The present study confirms that functional platelets can be generated in cord blood CD34+ cell cultures, though these are highly susceptible to ectodomain shedding of receptors associated with loss of function. Optimization of culture conditions to prevent these deleterious effects and to homogenize PLPs is necessary to improve the quality and yields of culture-derived platelets before they can be recognized as a suitable complementary source for therapeutic purposes.
Bhuvana, M; Narayanan, J Shankara; Dharuman, V; Teng, W; Hahn, J H; Jayakumar, K
2013-03-15
Immobilization of 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE) liposome-gold nano-particle (DOPE-AuNP) nano-composite covalently on 3-mercaptopropionic acid (MPA) on gold surface is demonstrated for the first time for electrochemical label free DNA sensing. Spherical nature of the DOPE on the MPA monolayer is confirmed by the appearance of sigmoidal voltammetric profile, characteristic behavior of linear diffusion, for the MPA-DOPE in presence of [Fe(CN)(6)](3-/4-) and [Ru(NH(3))(6)](3+) redox probes. The DOPE liposome vesicle fusion is prevented by electroless deposition of AuNP on the hydrophilic amine head groups of the DOPE. Immobilization of single stranded DNA (ssDNA) is made via simple gold-thiol linkage for DNA hybridization sensing in the presence of [Fe(CN)(6)](3-/4-). The sensor discriminates the hybridized (complementary target hybridized), un-hybridized (non-complementary target hybridized) and single base mismatch target hybridized surfaces sensitively and selectively without signal amplification. The lowest target DNA concentration detected is 0.1×10(-12)M. Cyclic voltammetry (CV), electrochemical impedance (EIS), differential pulse voltammetry (DPV) and quartz crystal microbalance (QCM) techniques are used for DNA sensing on DOPE-AuNP nano-composite. Transmission Electron Microscopy (TEM), Fourier Transform Infrared Spectroscopy (FTIR), Atomic Force Microscopy (AFM), Dynamic Light Scattering (DLS) and Ultraviolet-Visible (UV) spectroscopic techniques are used to understand the interactions between the DOPE, AuNP and ssDNA. The results indicate the presence of an intact and well defined spherical DOPE-AuNP nano-composite on the gold surface. The method could be applied for fabrication of the surface based liposome-AuNP-DNA composite for cell transfection studies at reduced reagents and costs. Copyright © 2012 Elsevier B.V. All rights reserved.
Development of a secondary electron energy analyzer for a transmission electron microscope.
Magara, Hideyuki; Tomita, Takeshi; Kondo, Yukihito; Sato, Takafumi; Akase, Zentaro; Shindo, Daisuke
2018-04-01
A secondary electron (SE) energy analyzer was developed for a transmission electron microscope. The analyzer comprises a microchannel plate (MCP) for detecting electrons, a coil for collecting SEs emitted from the specimen, a tube for reducing the number of backscattered electrons incident on the MCP, and a retarding mesh for selecting the energy of SEs incident on the MCP. The detection of the SEs associated with charging phenomena around a charged specimen was attempted by performing electron holography and SE spectroscopy using the energy analyzer. The results suggest that it is possible to obtain the energy spectra of SEs using the analyzer and the charging states of a specimen by electron holography simultaneously.
Rylene and related diimides for organic electronics.
Zhan, Xiaowei; Facchetti, Antonio; Barlow, Stephen; Marks, Tobin J; Ratner, Mark A; Wasielewski, Michael R; Marder, Seth R
2011-01-11
Organic electron-transporting materials are essential for the fabrication of organic p-n junctions, photovoltaic cells, n-channel field-effect transistors, and complementary logic circuits. Rylene diimides are a robust, versatile class of polycyclic aromatic electron-transport materials with excellent thermal and oxidative stability, high electron affinities, and, in many cases, high electron mobilities; they are, therefore, promising candidates for a variety of organic electronics applications. In this review, recent developments in the area of high-electron-mobility diimides based on rylenes and related aromatic cores, particularly perylene- and naphthalene-diimide-based small molecules and polymers, for application in high-performance organic field-effect transistors and photovoltaic cells are summarized and analyzed.
19 CFR 143.44 - RLF procedure.
Code of Federal Regulations, 2010 CFR
2010-04-01
... transmission of invoice data. For RLF transactions, a customs broker or importer of record must transmit electronically, using EIP, any invoice data required by CBP. (b) Electronic transmission of payment. For RLF...) Automation requirements. Only those entries and entry summaries that CBP processes completely in an...
21 CFR 1311.170 - Transmission requirements.
Code of Federal Regulations, 2010 CFR
2010-04-01
... prescription that has been transmitted only if an intermediary or the designated pharmacy notifies a practitioner that an electronic prescription was not successfully delivered to the designated pharmacy. If this... transmitted electronically to [name of the specific pharmacy] on [date/time] and that transmission failed. (c...
Effect of electronic coupling of Watson-Crick hopping in DNA poly(dA)-poly(dT)
NASA Astrophysics Data System (ADS)
Risqi, A. M.; Yudiarsah, E.
2017-07-01
Charge transport properties of poly(dA)-poly(dT) DNA has been studied by using thigh binding Hamiltonian approach. Molecule DNA that we use consist of 32 base pair of adenine (A) and thymine (T) and backbone is consist of phosphate and sugar. The molecule DNA is contacted electrode at both ends. Charge transport in molecule DNA depend on the environment, we studied the effect of electronic coupling of Watson-Crick hopping in poly(dA)-poly(dT) DNA to transmission probability and characteristic I-V. The electronic coupling constant influence charge transport between adenine-thymine base pairs at the same site. Transmission probability is studied by using transfer matrix and scattering matrix method, and the result of transmission probability is used to calculate the characteristic I-V by using formula Landauer Buttiker. The result shows that when the electronic coupling increase then transmission probability and characteristic I-V increase slightly.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Murayama, Chisato; Okabe, Momoko; Fukuda, Koichiro
We investigated the crystallographic structure of FePS{sub 3} with a layered structure using transmission electron microscopy and powder X-ray diffraction. We found that FePS{sub 3} forms a rotational twin structure with the common axis along the c*-axis. The high-resolution transmission electron microscopy images revealed that the twin boundaries were positioned at the van der Waals gaps between the layers. The narrow bands of dark contrast were observed in the bright-field transmission electron microscopy images below the antiferromagnetic transition temperature, T{sub N} ≈ 120 K. Low-temperature X-ray diffraction showed a lattice distortion; the a- and b-axes shortened and lengthened, respectively, as the temperature decreasedmore » below T{sub N.} We propose that the narrow bands of dark contrast observed in the bright-field transmission electron microscopy images are caused by the directional lattice distortion with respect to each micro-twin variant in the antiferromagnetic phase.« less
Transmission Electron Microscope Measures Lattice Parameters
NASA Technical Reports Server (NTRS)
Pike, William T.
1996-01-01
Convergent-beam microdiffraction (CBM) in thermionic-emission transmission electron microscope (TEM) is technique for measuring lattice parameters of nanometer-sized specimens of crystalline materials. Lattice parameters determined by use of CBM accurate to within few parts in thousand. Technique developed especially for use in quantifying lattice parameters, and thus strains, in epitaxial mismatched-crystal-lattice multilayer structures in multiple-quantum-well and other advanced semiconductor electronic devices. Ability to determine strains in indivdual layers contributes to understanding of novel electronic behaviors of devices.
Ponderomotive phase plate for transmission electron microscopes
Reed, Bryan W [Livermore, CA
2012-07-10
A ponderomotive phase plate system and method for controllably producing highly tunable phase contrast transfer functions in a transmission electron microscope (TEM) for high resolution and biological phase contrast imaging. The system and method includes a laser source and a beam transport system to produce a focused laser crossover as a phase plate, so that a ponderomotive potential of the focused laser crossover produces a scattering-angle-dependent phase shift in the electrons of the post-sample electron beam corresponding to a desired phase contrast transfer function.
Growth and Electronic Structure of Heusler Compounds for Use in Electron Spin Based Devices
2015-06-01
either Co– or MnSi– initiated films on c(4x4) GaAs. Studies using x - ray photoemission spectroscopy (XPS), STM/STS, and transmission electron microscopy...Co– or MnSi– initiated films on c(4x4) GaAs. Studies using x - ray photoemission spectroscopy (XPS), STM/STS, and transmission electron microscopy (TEM...diagram of the Palmstrøm lab in-situ growth and char- acterization setup, with 6 MBE growth chambers, 3 scanning probe microscopes, an x - ray
Baeg, Kang-Jun; Kim, Juhwan; Khim, Dongyoon; Caironi, Mario; Kim, Dong-Yu; You, In-Kyu; Quinn, Jordan R; Facchetti, Antonio; Noh, Yong-Young
2011-08-01
Ambipolar π-conjugated polymers may provide inexpensive large-area manufacturing of complementary integrated circuits (CICs) without requiring micro-patterning of the individual p- and n-channel semiconductors. However, current-generation ambipolar semiconductor-based CICs suffer from higher static power consumption, low operation frequencies, and degraded noise margins compared to complementary logics based on unipolar p- and n-channel organic field-effect transistors (OFETs). Here, we demonstrate a simple methodology to control charge injection and transport in ambipolar OFETs via engineering of the electrical contacts. Solution-processed caesium (Cs) salts, as electron-injection and hole-blocking layers at the interface between semiconductors and charge injection electrodes, significantly decrease the gold (Au) work function (∼4.1 eV) compared to that of a pristine Au electrode (∼4.7 eV). By controlling the electrode surface chemistry, excellent p-channel (hole mobility ∼0.1-0.6 cm(2)/(Vs)) and n-channel (electron mobility ∼0.1-0.3 cm(2)/(Vs)) OFET characteristics with the same semiconductor are demonstrated. Most importantly, in these OFETs the counterpart charge carrier currents are highly suppressed for depletion mode operation (I(off) < 70 nA when I(on) > 0.1-0.2 mA). Thus, high-performance, truly complementary inverters (high gain >50 and high noise margin >75% of ideal value) and ring oscillators (oscillation frequency ∼12 kHz) based on a solution-processed ambipolar polymer are demonstrated.
Development of fast parallel multi-technique scanning X-ray imaging at Synchrotron Soleil
NASA Astrophysics Data System (ADS)
Medjoubi, K.; Leclercq, N.; Langlois, F.; Buteau, A.; Lé, S.; Poirier, S.; Mercère, P.; Kewish, C. M.; Somogyi, A.
2013-10-01
A fast multimodal scanning X-ray imaging scheme is prototyped at Soleil Synchrotron. It permits the simultaneous acquisition of complementary information on the sample structure, composition and chemistry by measuring transmission, differential phase contrast, small-angle scattering, and X-ray fluorescence by dedicated detectors with ms dwell time per pixel. The results of the proof of principle experiments are presented in this paper.
Dao, Toan Thanh; Sakai, Heisuke; Nguyen, Hai Thanh; Ohkubo, Kei; Fukuzumi, Shunichi; Murata, Hideyuki
2016-07-20
We present controllable and reliable complementary organic transistor circuits on a PET substrate using a photoactive dielectric layer of 6-[4'-(N,N-diphenylamino)phenyl]-3-ethoxycarbonylcoumarin (DPA-CM) doped into poly(methyl methacrylate) (PMMA) and an electron-trapping layer of poly(perfluoroalkenyl vinyl ether) (Cytop). Cu was used for a source/drain electrode in both the p-channel and n-channel transistors. The threshold voltage of the transistors and the inverting voltage of the circuits were reversibly controlled over a wide range under a program voltage of less than 10 V and under UV light irradiation. At a program voltage of -2 V, the inverting voltage of the circuits was tuned to be at nearly half of the supply voltage of the circuit. Consequently, an excellent balance between the high and low noise margins (NM) was produced (64% of NMH and 68% of NML), resulting in maximum noise immunity. Furthermore, the programmed circuits showed high stability, such as a retention time of over 10(5) s for the inverter switching voltage. Our findings bring about a flexible, simple way to obtain robust, high-performance organic circuits using a controllable complementary transistor inverter.
Yu, Woo Jong; Li, Zheng; Zhou, Hailong; Chen, Yu; Wang, Yang; Huang, Yu; Duan, Xiangfeng
2014-01-01
The layered materials such as graphene have attracted considerable interest for future electronics. Here we report the vertical integration of multi-heterostructures of layered materials to enable high current density vertical field-effect transistors (VFETs). An n-channel VFET is created by sandwiching few-layer molybdenum disulfide (MoS2) as the semiconducting channel between a monolayer graphene and a metal thin film. The VFETs exhibit a room temperature on-off ratio >103, while at same time deliver a high current density up to 5,000 A/cm2, sufficient for high performance logic applications. This study offers a general strategy for the vertical integration of various layered materials to obtain both p- and n-channel transistors for complementary logic functions. A complementary inverter with larger than unit voltage gain is demonstrated by vertically stacking the layered materials of graphene, Bi2Sr2Co2O8 (p-channel), graphene, MoS2 (n-channel), and metal thin film in sequence. The ability to simultaneously achieve high on-off ratio, high current density, and logic integration in the vertically stacked multi-heterostructures can open up a new dimension for future electronics to enable three-dimensional integration. PMID:23241535
Cryo-scanning transmission electron tomography of vitrified cells.
Wolf, Sharon Grayer; Houben, Lothar; Elbaum, Michael
2014-04-01
Cryo-electron tomography (CET) of fully hydrated, vitrified biological specimens has emerged as a vital tool for biological research. For cellular studies, the conventional imaging modality of transmission electron microscopy places stringent constraints on sample thickness because of its dependence on phase coherence for contrast generation. Here we demonstrate the feasibility of using scanning transmission electron microscopy for cryo-tomography of unstained vitrified specimens (CSTET). We compare CSTET and CET for the imaging of whole bacteria and human tissue culture cells, finding favorable contrast and detail in the CSTET reconstructions. Particularly at high sample tilts, the CSTET signals contain more informative data than energy-filtered CET phase contrast images, resulting in improved depth resolution. Careful control over dose delivery permits relatively high cumulative exposures before the onset of observable beam damage. The increase in acceptable specimen thickness broadens the applicability of electron cryo-tomography.
Hiyoshi, Norihito
2018-05-17
Polyoxometalate nanosheets were synthesized at the gas/liquid interface of an aqueous solution of Keggin-type silicotungstic acid, cesium chloride, and n-octylamine. The structure of the nanosheets was elucidated via aberration-corrected scanning transmission electron microscopy at the atomic and molecular levels.
Conductance of three-terminal molecular bridge based on tight-binding theory
NASA Astrophysics Data System (ADS)
Wang, Li-Guang; Li, Yong; Yu, Ding-Wen; Katsunori, Tagami; Masaru, Tsukada
2005-05-01
The quantum transmission characteristic of three-benzene ring nano-molecular bridge is investigated theoretically by using Green's function approach based on tight-binding theory with only a π orbital per carbon atom at the site. The transmission probabilities that electrons transport through the molecular bridge from one terminal to the other two terminals are obtained. The electronic current distributions inside the molecular bridge are calculated and shown in graphical analogy by the current density method based on Fisher-Lee formula at the energy points E = ±0.42, ±1.06 and ±1.5, respectively, where the transmission spectra appear peaks. We find that the transmission spectra are related to the incident electronic energy and the molecular levels strongly and the current distributions agree well with Kirchhoff quantum current momentum conservation law.
Voltage dependency of transmission probability of aperiodic DNA molecule
NASA Astrophysics Data System (ADS)
Wiliyanti, V.; Yudiarsah, E.
2017-07-01
Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.
Liu, Zhe; Jiang, Liwei; Zheng, Yisong
2015-02-04
By means of an appropriate wave function connection condition, we study the electronic structure of a line defect superlattice of graphene with the Dirac equation method. We obtain the analytical dispersion relation, which can simulate well the tight-binding numerical result about the band structure of the superlattice. Then, we generalize this theoretical method to study the electronic transmission through a potential barrier where multiple line defects are periodically patterned. We find that there exists a critical incident angle which restricts the electronic transmission through multiple line defects within a specific incident angle range. The critical angle depends sensitively on the potential barrier height, which can be modulated by a gate voltage. As a result, non-trivial transmissions of K and K' valley electrons are restricted, respectively, in two distinct ranges of the incident angle. Our theoretical result demonstrates that a gate voltage can act as a feasible measure to tune the valley polarization when electrons tunnel through multiple line defects.
Upgrade of the Surface Spectrometer at NEPOMUC for PAES, XPS and STM Investigations
NASA Astrophysics Data System (ADS)
Zimnik, S.; Lippert, F.; Hugenschmidt, C.
2014-04-01
The characterization of the elemental composition of surfaces is of great importance for the understanding of many surface processes, such as surface segregation or oxidation. Positron-annihilation-induced Auger Electron Spectroscopy (PAES) is a powerful technique for gathering information about the elemental composition of only the topmost atomic layer of a sample. The upgraded surface spectrometer at NEPOMUC (NEtron induced POsitron source MUniCh) enables a comprehensive surface analysis with the complementary techniques STM, XPS and PAES. A new X-ray source for X-ray induced photoelectron spectroscopy (XPS) was installed to gather additional information on oxidation states. A new scanning tunneling microscope (STM) is used as a complementary method to investigate with atomic resolution the surface electron density. The combination of PAES, XPS and STM allows the characterization of both the elemental composition, and the surface topology.
Brodie, Nicholas I; Huguet, Romain; Zhang, Terry; Viner, Rosa; Zabrouskov, Vlad; Pan, Jingxi; Petrotchenko, Evgeniy V; Borchers, Christoph H
2018-03-06
Top-down hydrogen-deuterium exchange (HDX) analysis using electron capture or transfer dissociation Fourier transform mass spectrometry (FTMS) is a powerful method for the analysis of secondary structure of proteins in solution. The resolution of the method is a function of the degree of fragmentation of backbone bonds in the proteins. While fragmentation is usually extensive near the N- and C-termini, electron capture (ECD) or electron transfer dissociation (ETD) fragmentation methods sometimes lack good coverage of certain regions of the protein, most often in the middle of the sequence. Ultraviolet photodissociation (UVPD) is a recently developed fast-fragmentation technique, which provides extensive backbone fragmentation that can be complementary in sequence coverage to the aforementioned electron-based fragmentation techniques. Here, we explore the application of electrospray ionization (ESI)-UVPD FTMS on an Orbitrap Fusion Lumos Tribrid mass spectrometer to top-down HDX analysis of proteins. We have incorporated UVPD-specific fragment-ion types and fragment-ion mixtures into our isotopic envelope fitting software (HDX Match) for the top-down HDX analysis. We have shown that UVPD data is complementary to ETD, thus improving the overall resolution when used as a combined approach.
ERIC Educational Resources Information Center
Ferguson, Douglas K.; And Others
1987-01-01
Describes five research projects that are setting up electronic information delivery systems to serve rural areas in the Pacific Northwest. The technologies being evaluated include simultaneous remote searching, facsimile transmissions, bit map image transmissions, and a combination of optical character recognition equipment and television…
45 CFR Appendix C to Part 1355 - Electronic Data Transmission Format
Code of Federal Regulations, 2014 CFR
2014-10-01
... 45 Public Welfare 4 2014-10-01 2014-10-01 false Electronic Data Transmission Format C Appendix C to Part 1355 Public Welfare Regulations Relating to Public Welfare (Continued) OFFICE OF HUMAN... FAMILIES, FOSTER CARE MAINTENANCE PAYMENTS, ADOPTION ASSISTANCE, AND CHILD AND FAMILY SERVICES GENERAL Pt...
45 CFR Appendix C to Part 1355 - Electronic Data Transmission Format
Code of Federal Regulations, 2012 CFR
2012-10-01
... 45 Public Welfare 4 2012-10-01 2012-10-01 false Electronic Data Transmission Format C Appendix C to Part 1355 Public Welfare Regulations Relating to Public Welfare (Continued) OFFICE OF HUMAN... FAMILIES, FOSTER CARE MAINTENANCE PAYMENTS, ADOPTION ASSISTANCE, AND CHILD AND FAMILY SERVICES GENERAL Pt...
Code of Federal Regulations, 2010 CFR
2010-04-01
... tax must be paid on the basis of a return on the customs form or by authorized electronic transmission... customs form or authorized electronic transmission the following internal revenue tax information. (1) For... rate of tax, and the tax due. (4) For cigars. The importer will show: (i) The number imported under...
Contact dependence of the conductance through C60
NASA Astrophysics Data System (ADS)
Paulsson, Magnus; Stafström, Sven
1998-08-01
The electronic transmission through a C60 molecule is studied with emphasis on the contact geometry. The transmission can not be understood simply by the electronic structure of the C60 molecule itself, interference effects related to the metal/molecule contact are in fact very important for the conductance.
8 CFR 217.7 - Electronic data transmission requirement.
Code of Federal Regulations, 2010 CFR
2010-01-01
... VISA WAIVER PROGRAM § 217.7 Electronic data transmission requirement. (a) An alien who applies for... will not be admitted under the Visa Waiver Program unless an appropriate official of the carrier... departure from the United States by sea or air of an alien admitted under the Visa Waiver Program, an...
Performance of low-voltage STEM/TEM with delta corrector and cold field emission gun.
Sasaki, Takeo; Sawada, Hidetaka; Hosokawa, Fumio; Kohno, Yuji; Tomita, Takeshi; Kaneyama, Toshikatsu; Kondo, Yukihito; Kimoto, Koji; Sato, Yuta; Suenaga, Kazu
2010-08-01
To reduce radiation damage caused by the electron beam and to obtain high-contrast images of specimens, we have developed a highly stabilized transmission electron microscope equipped with a cold field emission gun and spherical aberration correctors for image- and probe-forming systems, which operates at lower acceleration voltages than conventional transmission electron microscopes. A delta-type aberration corrector is designed to simultaneously compensate for third-order spherical aberration and fifth-order 6-fold astigmatism. Both were successfully compensated in both scanning transmission electron microscopy (STEM) and transmission electron microscopy (TEM) modes in the range 30-60 kV. The Fourier transforms of raw high-angle annular dark field (HAADF) images of a Si[110] sample revealed spots corresponding to lattice spacings of 111 and 96 pm at 30 and 60 kV, respectively, and those of raw TEM images of an amorphous Ge film with gold particles showed spots corresponding to spacings of 91 and 79 pm at 30 and 60 kV, respectively. Er@C(82)-doped single-walled carbon nanotubes, which are carbon-based samples, were successfully observed by HAADF-STEM imaging with an atomic-level resolution.
NASA Astrophysics Data System (ADS)
Jiang, N.; Deguchi, M.; Wang, C. L.; Won, J. H.; Jeon, H. M.; Mori, Y.; Hatta, A.; Kitabatake, M.; Ito, T.; Hirao, T.; Sasaki, T.; Hiraki, A.
1997-04-01
A transmission electron microscope (TEM) study of ion-implanted chemical-vapor-deposited (CVD) diamond is presented. CVD diamond used for transmission electron microscope observation was directly deposited onto Mo TEM grids. As-deposited specimens were irradiated by C (100 keV) ions at room temperature with a wide range of implantation doses (10 12-10 17/cm 2). Transmission electron diffraction (TED) patterns indicate that there exists a critical dose ( Dc) for the onset of amorphization of CVD diamond as a result of ion induced damage and the value of critical dose is confirmed to be about 3 × 10 15/cm 2. The ion-induced transformation process is clearly revealed by high resolution electron microscope (HREM) images. For a higher dose implantation (7 × 10 15/cm 2) a large amount of diamond phase is transformed into amorphous carbon and many tiny misoriented diamond blocks are found to be left in the amorphous solid. The average size of these misoriented diamond blocks is only about 1-2 nm. Further bombardment (10 17/cm 2) almost kills all of the diamond phase within the irradiated volume and moreover leads to local formation of micropolycrystalline graphite.
Hall, David R.; Pixton, David S.; Briscoe, Michael; McPherson, James
2007-12-04
A filter for a drill string comprises a perforated receptacle having an open end and a perforated end and first and second mounting surfaces are adjacent the open end. A transmission element is disposed within each of the first and second mounting surfaces. A capacitor may modify electrical characteristics of an LC circuit that comprises the transmission elements. The respective transmission elements are in communication with each other and with a transmission network integrated into the drill string. The transmission elements may be inductive couplers, direct electrical contacts, or optical couplers. In some embodiments of the present invention, the filter comprises an electronic component. The electronic component may be selected from the group consisting of a sensor, a router, a power source, a clock source, a repeater, and an amplifier.
Biosecurity-Based Interventions and Strategies To Reduce Campylobacter spp. on Poultry Farms▿
Newell, D. G.; Elvers, K. T.; Dopfer, D.; Hansson, I.; Jones, P.; James, S.; Gittins, J.; Stern, N. J.; Davies, R.; Connerton, I.; Pearson, D.; Salvat, G.; Allen, V. M.
2011-01-01
The prevention and control of Campylobacter colonization of poultry flocks are important public health strategies for the control of human campylobacteriosis. A critical review of the literature on interventions to control Campylobacter in poultry on farms was undertaken using a systematic approach. Although the focus of the review was on aspects appropriate to the United Kingdom poultry industry, the research reviewed was gathered from worldwide literature. Multiple electronic databases were employed to search the literature, in any language, from 1980 to September 2008. A primary set of 4,316 references was identified and scanned, using specific agreed-upon criteria, to select relevant references related to biosecurity-based interventions. The final library comprised 173 references. Identification of the sources of Campylobacter in poultry flocks was required to inform the development of targeted interventions to disrupt transmission routes. The approach used generally involved risk factor-based surveys related to culture-positive or -negative flocks, usually combined with a structured questionnaire. In addition, some studies, either in combination or independently, undertook intervention trials. Many of these studies were compromised by poor design, sampling, and statistical analysis. The evidence for each potential source and route of transmission on the poultry farm was reviewed critically, and the options for intervention were considered. The review concluded that, in most instances, biosecurity on conventional broiler farms can be enhanced and this should contribute to the reduction of flock colonization. However, complementary, non-biosecurity-based approaches will also be required in the future to maximize the reduction of Campylobacter-positive flocks at the farm level. PMID:21984249
New perspectives in tracing vector-borne interaction networks.
Gómez-Díaz, Elena; Figuerola, Jordi
2010-10-01
Disentangling trophic interaction networks in vector-borne systems has important implications in epidemiological and evolutionary studies. Molecular methods based on bloodmeal typing in vectors have been increasingly used to identify hosts. Although most molecular approaches benefit from good specificity and sensitivity, their temporal resolution is limited by the often rapid digestion of blood, and mixed bloodmeals still remain a challenge for bloodmeal identification in multi-host vector systems. Stable isotope analyses represent a novel complementary tool that can overcome some of these problems. The utility of these methods using examples from different vector-borne systems are discussed and the extents to which they are complementary and versatile are highlighted. There are excellent opportunities for progress in the study of vector-borne transmission networks resulting from the integration of both molecular and stable isotope approaches. Copyright © 2010 Elsevier Ltd. All rights reserved.
Neutron, fluorescence, and optical imaging: An in situ combination of complementary techniques
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wagner, D.; Egelhaaf, S. U.; Hermes, H. E.
2015-09-15
An apparatus which enables the simultaneous combination of three complementary imaging techniques, optical imaging, fluorescence imaging, and neutron radiography, is presented. While each individual technique can provide information on certain aspects of the sample and their time evolution, a combination of the three techniques in one setup provides a more complete and consistent data set. The setup can be used in transmission and reflection modes and thus with optically transparent as well as opaque samples. Its capabilities are illustrated with two examples. A polymer hydrogel represents a transparent sample and the diffusion of fluorescent particles into and through this polymermore » matrix is followed. In reflection mode, the absorption of solvent by a nile red-functionalized mesoporous silica powder and the corresponding change in fluorescent signal are studied.« less
Chang, Hsiao-Yun; Chang, Huai-Lu
2015-06-01
This study reviewed existing literature to investigate how frequently nurses include complementary and alternative forms of medicine in their clinical practice. In so doing, we investigated nurses' knowledge of and attitudes towards complementary and alternative medicine as well as their ability to communicate the risks and benefits of these therapies with patients. Little information is available concerning nurses' knowledge and attitudes towards complementary and alternative medicine or how they incorporate these therapies into their practice. In addition, little is known about the ability of nurses to communicate the risks and benefits of complementary and alternative medicine to their patients. This study used a scoping review method to map and synthesise existing literature. Both electronic and manual searches were used to identify relevant studies published between January 2007 and January 2014. The review was conducted in five stages: (1) identification of research question(s), (2) locate studies, (3) selection of studies, (4) charting of data, and (5) collating, summarising, and reporting of results. Fifteen papers met the inclusion criteria for this review, among which 53·7% referenced how frequently nurses include complementary and alternative medicine in their practice. We found that 66·4% of nurses had positive attitudes towards complementary and alternative medicine; however, 77·4% did not possess a comprehensive understanding of the associated risks and benefits. In addition, nearly half of the respondents (47·3-67·7%) reported feeling uncomfortable discussing complementary and alternative medicine therapies with their patients. The lack of knowledge about complementary and alternative medicine among nurses is a cause for concern, particularly in light of its widespread application. Findings from this study suggest that health care professionals need to promote evidence informed decision-making in complementary and alternative medicine practice and be knowledgeable enough to discuss complementary and alternative medicine therapies. Without involvement of complementary and alternative medicine communication on the part of our profession, we may put our patients at risk of uninformed and without medical guidance. © 2015 John Wiley & Sons Ltd.
2013-01-01
Background In biomedical research, a huge variety of different techniques is currently available for the structural examination of small specimens, including conventional light microscopy (LM), transmission electron microscopy (TEM), confocal laser scanning microscopy (CLSM), microscopic X-ray computed tomography (microCT), and many others. Since every imaging method is physically limited by certain parameters, a correlative use of complementary methods often yields a significant broader range of information. Here we demonstrate the advantages of the correlative use of microCT, light microscopy, and transmission electron microscopy for the analysis of small biological samples. Results We used a small juvenile bivalve mollusc (Mytilus galloprovincialis, approximately 0.8 mm length) to demonstrate the workflow of a correlative examination by microCT, LM serial section analysis, and TEM-re-sectioning. Initially these three datasets were analyzed separately, and subsequently they were fused in one 3D scene. This workflow is very straightforward. The specimen was processed as usual for transmission electron microscopy including post-fixation in osmium tetroxide and embedding in epoxy resin. Subsequently it was imaged with microCT. Post-fixation in osmium tetroxide yielded sufficient X-ray contrast for microCT imaging, since the X-ray absorption of epoxy resin is low. Thereafter, the same specimen was serially sectioned for LM investigation. The serial section images were aligned and specific organ systems were reconstructed based on manual segmentation and surface rendering. According to the region of interest (ROI), specific LM sections were detached from the slides, re-mounted on resin blocks and re-sectioned (ultrathin) for TEM. For analysis, image data from the three different modalities was co-registered into a single 3D scene using the software AMIRA®. We were able to register both the LM section series volume and TEM slices neatly to the microCT dataset, with small geometric deviations occurring only in the peripheral areas of the specimen. Based on co-registered datasets the excretory organs, which were chosen as ROI for this study, could be investigated regarding both their ultrastructure as well as their position in the organism and their spatial relationship to adjacent tissues. We found structures typical for mollusc excretory systems, including ultrafiltration sites at the pericardial wall, and ducts leading from the pericardium towards the kidneys, which exhibit a typical basal infolding system. Conclusions The presented approach allows a comprehensive analysis and presentation of small objects regarding both the overall organization as well as cellular and subcellular details. Although our protocol involves a variety of different equipment and procedures, we maintain that it offers savings in both effort and cost. Co-registration of datasets from different imaging modalities can be accomplished with high-end desktop computers and offers new opportunities for understanding and communicating structural relationships within organisms and tissues. In general, the correlative use of different microscopic imaging techniques will continue to become more widespread in morphological and structural research in zoology. Classical TEM serial section investigations are extremely time consuming, and modern methods for 3D analysis of ultrastructure such as SBF-SEM and FIB-SEM are limited to very small volumes for examination. Thus the re-sectioning of LM sections is suitable for speeding up TEM examination substantially, while microCT could become a key-method for complementing ultrastructural examinations. PMID:23915384
Makhov, Alexander M; Sen, Anindito; Yu, Xiong; Simon, Martha N; Griffith, Jack D; Egelman, Edward H
2009-02-20
Herpes simplex virus type 1 encodes a multifunctional protein, ICP8, which serves both as a single-strand binding protein and as a recombinase, catalyzing reactions involved in replication and recombination of the viral genome. In the presence of divalent ions and at low temperature, previous electron microscopic studies showed that ICP8 will form long left-handed helical filaments. Here, electron microscopic image reconstruction reveals that the filaments are bipolar, with an asymmetric unit containing two subunits of ICP8 that constitute a symmetrical dimer. This organization of the filament has been confirmed using scanning transmission electron microscopy. The pitch of the filaments is approximately 250 A, with approximately 6.2 dimers per turn. Docking of a crystal structure of ICP8 into the reconstructed filament shows that the C-terminal domain of ICP8, attached to the body of the subunit by a flexible linker containing approximately 10 residues, is packed into a pocket in the body of a neighboring subunit in the crystal in a similar manner as in the filament. However, the interactions between the large N-terminal domains are quite different in the filament from that observed in the crystal. A previously proposed model for ICP8 binding single-stranded DNA (ssDNA), based upon the crystal structure, leads to a model for a continuous strand of ssDNA near the filament axis. The bipolar nature of the ICP8 filaments means that a second strand of ssDNA would be running through this filament in the opposite orientation, and this provides a potential mechanism for how ICP8 anneals complementary ssDNA into double-stranded DNA, where each strand runs in opposite directions.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Makhov, A.M.; Simon, M.; Sen, A.
2009-02-20
Herpes simplex virus type 1 encodes a multifunctional protein, ICP8, which serves both as a single-strand binding protein and as a recombinase, catalyzing reactions involved in replication and recombination of the viral genome. In the presence of divalent ions and at low temperature, previous electron microscopic studies showed that ICP8 will form long left-handed helical filaments. Here, electron microscopic image reconstruction reveals that the filaments are bipolar, with an asymmetric unit containing two subunits of ICP8 that constitute a symmetrical dimer. This organization of the filament has been confirmed using scanning transmission electron microscopy. The pitch of the filaments ismore » {approx} 250 {angstrom}, with {approx} 6.2 dimers per turn. Docking of a crystal structure of ICP8 into the reconstructed filament shows that the C-terminal domain of ICP8, attached to the body of the subunit by a flexible linker containing {approx} 10 residues, is packed into a pocket in the body of a neighboring subunit in the crystal in a similar manner as in the filament. However, the interactions between the large N-terminal domains are quite different in the filament from that observed in the crystal. A previously proposed model for ICP8 binding single-stranded DNA (ssDNA), based upon the crystal structure, leads to a model for a continuous strand of ssDNA near the filament axis. The bipolar nature of the ICP8 filaments means that a second strand of ssDNA would be running through this filament in the opposite orientation, and this provides a potential mechanism for how ICP8 anneals complementary ssDNA into double-stranded DNA, where each strand runs in opposite directions.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Celada-Casero, C., E-mail: c.celada@cenim.csic.es
The primary objective of this work is to obtain fundamental insights on phase transformations, with focus on the reaustenitization process (α′→γ transformation), of a cold-rolled (CR) semi-austenitic metastable stainless steel upon different isochronal conditions (0.1, 1, 10 and 100 °C/s). For this purpose, an exhaustive microstructural characterization has been performed by using complementary experimental such as scanning and transmission electron microscopy (SEM and TEM), electron backscattered diffraction (EBSD), electron probe microanalysis (EPMA), micro-hardness Vickers and magnetization measurements. It has been detected that all microstructural changes shift to higher temperatures as the heating rate increases. The reaustenitization occurs in two-steps formore » all heating rates, which is attributed to the chemical banding present in the CR state. The α′→γ transformation is controlled by the migration of substitutional alloying elements across the austenite/martensite (γ/α′) interface, which finally leads to ultrafine-grained reaustenitized microstructures (440–280 nm). The morphology of the martensite phase in the CR state has been found to be the responsible for such a grain refinement, along with the presence of χ-phase and nanometric Ni{sub 3}(Ti,Al) precipitates that pin the austenite grain growth, especially upon slowly heating at 0.1 °C/s. - Highlights: •Ultrafine-grained austenite structures are obtained isochronally at 0.1–100 °C/s •The α′→γ transformation occurs in two steps due to the initial chemical banding •A diffusional mechanism governs the α′→γ transformation for all heating rates •The dislocation-cell-type of martensite promotes a diffusional mechanism •Precipitates located at α′/γ interfaces hinder the austenite growth.« less
Electronic Biometric Transmission Specification. Version 1.2
2006-11-08
Prescribed by ANSI Std Z39-18 Electronic Biometric Transmission Specification DIN: DOD_BTF_TS_EBTS_ Nov06_01.02.00 i Revision History Revision...contains: • the ORI • a Greenwich Mean (a.k.a. Zulu or UTC) date/time stamp • a code for the software used at the point of collection/transmission...long names and would generally include the tribe name. Subfield 1 Item 1 Character Type AS Characters 1 to 50 Special Characters: Any 7-bit non
Purchase of a Transmission Electron Microscope for Xavier University of Louisiana
2015-05-15
imaging facility on the second floor of the Pharmacy Addition at Xavier University that already includes two scanning electron microscopes. The new TEM...is now in use. Xavier University has formally pledged to provide funds for the 1. REPORT DATE (DD-MM-YYYY) 4. TITLE AND SUBTITLE 13. SUPPLEMENTARY...for Public Release; Distribution Unlimited Final Report: Purchase of a Transmission Electron Microscope for Xavier University of Louisiana The views
Achromatic elemental mapping beyond the nanoscale in the transmission electron microscope.
Urban, K W; Mayer, J; Jinschek, J R; Neish, M J; Lugg, N R; Allen, L J
2013-05-03
Newly developed achromatic electron optics allows the use of wide energy windows and makes feasible energy-filtered transmission electron microscopy (EFTEM) at atomic resolution. In this Letter we present EFTEM images formed using electrons that have undergone a silicon L(2,3) core-shell energy loss, exhibiting a resolution in EFTEM of 1.35 Å. This permits elemental mapping beyond the nanoscale provided that quantum mechanical calculations from first principles are done in tandem with the experiment to understand the physical information encoded in the images.
Amorphization induced by focused ion beam milling in metallic and electronic materials.
Huh, Yoon; Hong, Ki Jung; Shin, Kwang Soo
2013-08-01
Focused ion beam (FIB) milling using high-energy gallium ions is widely used in the preparation of specimens for transmission electron microscopy (TEM). However, the energetic ion beam induces amorphization on the edge of specimens during milling, resulting in a mischievous influence on the clearness of high-quality transmission electron micrographs. In this work, the amorphization induced by the FIB milling was investigated by TEM for three kinds of materials, metallic materials in bulk shape, and semiconductive and electronic ceramic materials as a substrate for the deposition of thin films.
Fabrication of ZnS nanoparticle chains on a protein template
Hulleman, J.; Kim, S. M.; Tumkur, T.; Rochet, J.-C.; Stach, E.; Stanciu, L.
2011-01-01
In the present study, we have exploited the properties of a fibrillar protein for the template synthesis of zinc sulfide (ZnS) nanoparticle chains. The diameter of the ZnS nanoparticle chains was tuned in range of ~30 to ~165 nm by varying the process variables. The nanoparticle chains were characterized by field emission scanning electron microscopy, UV–Visible spectroscopy, transmission electron microscopy, electron energy loss spectroscopy, and high-resolution transmission electron microscopy. The effect of incubation temperature on the morphology of the nanoparticle chains was also studied. PMID:21804765
Understanding electron magnetic circular dichroism in a transition potential approach
NASA Astrophysics Data System (ADS)
Barthel, J.; Mayer, J.; Rusz, J.; Ho, P.-L.; Zhong, X. Y.; Lentzen, M.; Dunin-Borkowski, R. E.; Urban, K. W.; Brown, H. G.; Findlay, S. D.; Allen, L. J.
2018-04-01
This paper introduces an approach based on transition potentials for inelastic scattering to understand the underlying physics of electron magnetic circular dichroism (EMCD). The transition potentials are sufficiently localized to permit atomic-scale EMCD. Two-beam and three-beam systematic row cases are discussed in detail in terms of transition potentials for conventional transmission electron microscopy, and the basic symmetries which arise in the three-beam case are confirmed experimentally. Atomic-scale EMCD in scanning transmission electron microscopy (STEM), using both a standard STEM probe and vortex beams, is discussed.
Formation of tetragonal gas bubble superlattice in bulk molybdenum under helium ion implantation
Sun, Cheng; Sprouster, David J.; Hattar, K.; ...
2018-02-09
In this paper, we report the formation of tetragonal gas bubble superlattice in bulk molybdenum under helium ion implantation at 573 K. The transmission electron microscopy study shows that the helium bubble lattice constant measured from the in-plane d-spacing is ~4.5 nm, while it is ~3.9 nm from the out-of-plane measurement. The results of synchrotron-based small-angle x-ray scattering agree well with the transmission electron microscopy results in terms of the measurement of bubble lattice constant and bubble size. The coupling of transmission electron microscopy and synchrotron high-energy X-ray scattering provides an effective approach to study defect superlattices in irradiated materials.
Formation of tetragonal gas bubble superlattice in bulk molybdenum under helium ion implantation
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sun, Cheng; Sprouster, David J.; Hattar, K.
In this paper, we report the formation of tetragonal gas bubble superlattice in bulk molybdenum under helium ion implantation at 573 K. The transmission electron microscopy study shows that the helium bubble lattice constant measured from the in-plane d-spacing is ~4.5 nm, while it is ~3.9 nm from the out-of-plane measurement. The results of synchrotron-based small-angle x-ray scattering agree well with the transmission electron microscopy results in terms of the measurement of bubble lattice constant and bubble size. The coupling of transmission electron microscopy and synchrotron high-energy X-ray scattering provides an effective approach to study defect superlattices in irradiated materials.
Li, Hongfei; Yang, Zhenhua; Pan, Cheng; ...
2017-07-14
Here, we report that the addition of a non-photoactive tertiary polymer phase in the binary bulk heterojunction (BHJ) polymer solar cell leads to a self-assembled columnar nanostructure, enhancing the charge mobilities and photovoltaic efficiency with surprisingly increased optimal active blend thicknesses over 300 nm, 3–4 times larger than that of the binary counterpart. Using the prototypical poly(3-hexylthiophene) (P3HT):fullerene blend as a model BHJ system, we discover that the inert poly(methyl methacrylate) (PMMA) added in the binary BHJ blend self-assembles into vertical columns, which not only template the phase segregation of electron acceptor fullerenes but also induce the out-of-plane rotation ofmore » the edge-on-orientated crystalline P3HT phase. Using complementary interrogation methods including neutron reflectivity, X-ray scattering, atomic force microscopy, transmission electron microscopy, and molecular dynamics simulations, we show that the enhanced charge transport originates from the more randomized molecular stacking of the P3HT phase and the spontaneous segregation of fullerenes at the P3HT/PMMA interface, driven by the high surface tension between the two polymeric components. The results demonstrate a potential method for increasing the thicknesses of high-performance polymer BHJ solar cells with improved photovoltaic efficiency, alleviating the burden of stringently controlling the ultrathin blend thickness during the roll-to-roll-type large-area manufacturing environment.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dell'Erba, Giorgio; Natali, Dario; Dipartimento di Elettronica, Informazione e Bioingegneria, Politecnico di Milano, Piazza L. da Vinci 32, 20133 Milano
Ambipolar semiconducting polymers, characterized by both high electron (μ{sub e}) and hole (μ{sub h}) mobility, offer the advantage of realizing complex complementary electronic circuits with a single semiconducting layer, deposited by simple coating techniques. However, to achieve complementarity, one of the two conduction paths in transistors has to be suppressed, resulting in unipolar devices. Here, we adopt charge injection engineering through a specific interlayer in order to tune injection into frontier energy orbitals of a high mobility donor-acceptor co-polymer. Starting from field-effect transistors with Au contacts, showing a p-type unbalanced behaviour with μ{sub h} = 0.29 cm{sup 2}/V s and μ{sub e} = 0.001more » cm{sup 2}/V s, through the insertion of a caesium salt interlayer with optimized thickness, we obtain an n-type unbalanced transistor with μ{sub e} = 0.12 cm{sup 2}/V s and μ{sub h} = 8 × 10{sup −4} cm{sup 2}/V s. We applied this result to the development of the basic pass-transistor logic building blocks such as inverters, with high gain and good noise margin, and transmission-gates. In addition, we developed and characterized information storage circuits like D-Latches and D-Flip-Flops consisting of 16 transistors, demonstrating both their static and dynamic performances and thus the suitability of this technology for more complex circuits such as display addressing logic.« less
Dose-rate-dependent damage of cerium dioxide in the scanning transmission electron microscope.
Johnston-Peck, Aaron C; DuChene, Joseph S; Roberts, Alan D; Wei, Wei David; Herzing, Andrew A
2016-11-01
Beam damage caused by energetic electrons in the transmission electron microscope is a fundamental constraint limiting the collection of artifact-free information. Through understanding the influence of the electron beam, experimental routines may be adjusted to improve the data collection process. Investigations of CeO 2 indicate that there is not a critical dose required for the accumulation of electron beam damage. Instead, measurements using annular dark field scanning transmission electron microscopy and electron energy loss spectroscopy demonstrate that the onset of measurable damage occurs when a critical dose rate is exceeded. The mechanism behind this phenomenon is that oxygen vacancies created by exposure to a 300keV electron beam are actively annihilated as the sample re-oxidizes in the microscope environment. As a result, only when the rate of vacancy creation exceeds the recovery rate will beam damage begin to accumulate. This observation suggests that dose-intensive experiments can be accomplished without disrupting the native structure of the sample when executed using dose rates below the appropriate threshold. Furthermore, the presence of an encapsulating carbonaceous layer inhibits processes that cause beam damage, markedly increasing the dose rate threshold for the accumulation of damage. Published by Elsevier B.V.
Dose-rate-dependent damage of cerium dioxide in the scanning transmission electron microscope
Johnston-Peck, Aaron C.; DuChene, Joseph S.; Roberts, Alan D.; Wei, Wei David; Herzing, Andrew A.
2016-01-01
Beam damage caused by energetic electrons in the transmission electron microscope is a fundamental constraint limiting the collection of artifact-free information. Through understanding the influence of the electron beam, experimental routines may be adjusted to improve the data collection process. Investigations of CeO2 indicate that there is not a critical dose required for the accumulation of electron beam damage. Instead, measurements using annular dark field scanning transmission electron microscopy and electron energy loss spectroscopy demonstrate that the onset of measurable damage occurs when a critical dose rate is exceeded. The mechanism behind this phenomenon is that oxygen vacancies created by exposure to a 300 keV electron beam are actively annihilated as the sample re-oxidizes in the microscope environment. As a result, only when the rate of vacancy creation exceeds the recovery rate will beam damage begin to accumulate. This observation suggests that dose-intensive experiments can be accomplished without disrupting the native structure of the sample when executed using dose rates below the appropriate threshold. Furthermore, the presence of an encapsulating carbonaceous layer inhibits processes that cause beam damage, markedly increasing the dose rate threshold for the accumulation of damage. PMID:27469265
Transmission of electrons inside the cryogenic pumps of ITER injector.
Veltri, P; Sartori, E
2016-02-01
Large cryogenic pumps are installed in the vessel of large neutral beam injectors (NBIs) used to heat the plasma in nuclear fusion experiments. The operation of such pumps can be compromised by the presence of stray secondary electrons that are generated along the beam path. In this paper, we present a numerical model to analyze the propagation of the electrons inside the pump. The aim of the study is to quantify the power load on the active pump elements, via evaluation of the transmission probabilities across the domain of the pump. These are obtained starting from large datasets of particle trajectories, obtained by numerical means. The transmission probability of the electrons across the domain is calculated for the NBI of the ITER and for its prototype Megavolt ITer Injector and Concept Advancement (MITICA) and the results are discussed.
NASA Astrophysics Data System (ADS)
Meghoufel, F. Z.; Bentata, S.; Terkhi, S.; Bendahma, F.; Cherid, S.
2013-05-01
We study the effect of the nonlinearity on electrons transmission properties in a double barriers structure GaAs/AlxGa1-xAs superlattices. The nonlinearity is introduced as an effective potential in the Schrödinger equation and translates the electronic Colombian repulsion. We have used the transfer matrix formalism and the plane wave functions approximation to solve numerically the equation and calculate the electronic transmission coefficient. We have shown the occurrence of two allowed states within the same well instead of a single, translating the presence of two resonant states at two different energies. The first allowed state intensity strongly decreases with increasing the nonlinear parameter, whereas the second one called the degeneracy state increases. Both the two states evolve towards higher resonances energies.
Walther, Paul; Schmid, Eberhard; Höhn, Katharina
2013-01-01
Using an electron microscope's scanning transmission mode (STEM) for collection of tomographic datasets is advantageous compared to bright field transmission electron microscopic (TEM). For image formation, inelastic scattering does not cause chromatic aberration, since in STEM mode no image forming lenses are used after the beam has passed the sample, in contrast to regular TEM. Therefore, thicker samples can be imaged. It has been experimentally demonstrated that STEM is superior to TEM and energy filtered TEM for tomography of samples as thick as 1 μm. Even when using the best electron microscope, adequate sample preparation is the key for interpretable results. We adapted protocols for high-pressure freezing of cultivated cells from a physiological state. In this chapter, we describe optimized high-pressure freezing and freeze substitution protocols for STEM tomography in order to obtain high membrane contrast.
Transmission environmental scanning electron microscope with scintillation gaseous detection device.
Danilatos, Gerasimos; Kollia, Mary; Dracopoulos, Vassileios
2015-03-01
A transmission environmental scanning electron microscope with use of a scintillation gaseous detection device has been implemented. This corresponds to a transmission scanning electron microscope but with addition of a gaseous environment acting both as environmental and detection medium. A commercial type of low vacuum machine has been employed together with appropriate modifications to the detection configuration. This involves controlled screening of various emitted signals in conjunction with a scintillation gaseous detection device already provided with the machine for regular surface imaging. Dark field and bright field imaging has been obtained along with other detection conditions. With a progressive series of modifications and tests, the theory and practice of a novel type of microscopy is briefly shown now ushering further significant improvements and developments in electron microscopy as a whole. Copyright © 2014 Elsevier B.V. All rights reserved.
Alam, Shah Jamal; Zhang, Xinyu; Romero-Severson, Ethan Obie; Henry, Christopher; Zhong, Lin; Volz, Erik M.; Brenner, Bluma G.; Koopman, James S.
2013-01-01
Episodic high-risk sexual behavior is common and can have a profound effect on HIV transmission. In a model of HIV transmission among men who have sex with men (MSM), changing the frequency, duration and contact rates of high-risk episodes can take endemic prevalence from zero to 50% and more than double transmissions during acute HIV infection (AHI). Undirected test and treat could be inefficient in the presence of strong episodic risk effects. Partner services approaches that use a variety of control options will be likely to have better effects under these conditions, but the question remains: What data will reveal if a population is experiencing episodic risk effects? HIV sequence data from Montreal reveals genetic clusters whose size distribution stabilizes over time and reflects the size distribution of acute infection outbreaks (AIOs). Surveillance provides complementary behavioral data. In order to use both types of data efficiently, it is essential to examine aspects of models that affect both the episodic risk effects and the shape of transmission trees. As a demonstration, we use a deterministic compartmental model of episodic risk to explore the determinants of the fraction of transmissions during acute HIV infection (AHI) at the endemic equilibrium. We use a corresponding individual-based model to observe AIO size distributions and patterns of transmission within AIO. Episodic risk parameters determining whether AHI transmission trees had longer chains, more clustered transmissions from single individuals, or different mixes of these were explored. Encouragingly for parameter estimation, AIO size distributions reflected the frequency of transmissions from acute infection across divergent parameter sets. Our results show that episodic risk dynamics influence both the size and duration of acute infection outbreaks, thus providing a possible link between genetic cluster size distributions and episodic risk dynamics. PMID:23438430
Nanowire growth kinetics in aberration corrected environmental transmission electron microscopy
Chou, Yi -Chia; Panciera, Federico; Reuter, Mark C.; ...
2016-03-15
Here, we visualize atomic level dynamics during Si nanowire growth using aberration corrected environmental transmission electron microscopy, and compare with lower pressure results from ultra-high vacuum microscopy. We discuss the importance of higher pressure observations for understanding growth mechanisms and describe protocols to minimize effects of the higher pressure background gas.
NASA Technical Reports Server (NTRS)
Bekey, I.
1979-01-01
Three examples are used to illustrate what is possible with large space systems: (1) personal communications using wrist telephones, (2) electronic transmission of mail, and (3) wide dissemination of educational TV. Design concepts and costs are explored and compared to alternative ground-based concepts.
Transmission electron microscopy: direct observation of crystal structure in refractory ceramics.
Shaw, T M; Thomas, G
1978-11-10
Using high-resolution multibeam interference techniques in the transmission electron microscope, images have been obtained that make possible a real-space structure analysis of a beryllium-silicon-nitrogen compound. The results illustrate the usefulness of lattice imaging in the analysis of local crystal structure in these technologically promising ceramic materials.
45 CFR Appendix C to Part 1355 - Electronic Data Transmission Format
Code of Federal Regulations, 2010 CFR
2010-10-01
... mainframe-to-mainframe data exchange system using the Sterling Software data transfer package called “SUPERTRACS.” This package will allow data exchange between most computer platforms (both mini and mainframe... 45 Public Welfare 4 2010-10-01 2010-10-01 false Electronic Data Transmission Format C Appendix C...
45 CFR Appendix C to Part 1355 - Electronic Data Transmission Format
Code of Federal Regulations, 2011 CFR
2011-10-01
... mainframe-to-mainframe data exchange system using the Sterling Software data transfer package called “SUPERTRACS.” This package will allow data exchange between most computer platforms (both mini and mainframe... 45 Public Welfare 4 2011-10-01 2011-10-01 false Electronic Data Transmission Format C Appendix C...
Xiao, J; Foray, G; Masenelli-Varlot, K
2018-02-01
Environmental scanning electron microscopy (ESEM) allows the observation of liquids under specific conditions of pressure and temperature. Moreover, when working in the transmission mode, that is in scanning transmission electron microscopy (STEM), nano-objects can be analysed inside a liquid. The contrast in the images is mass-thickness dependent as in STEM-in-TEM (transmission electron microscopy) using closed cells. However, in STEM-in-ESEM, as the liquid-vapour equilibrium is kept dynamically, the thickness of the water droplet remains unknown. In this paper, the contrasts measured in the experimental images are compared with calculations using Monte-Carlo simulations in order to estimate the thickness of water. Two examples are given. On gold nanoparticles, the thickness of a thick film can be estimated thanks to a contrast inversion. On core-shell latex particles, the grey level of the shell compared with those of the core and of the water film gives a relatively precise measurement of the water film thickness. © 2017 The Authors Journal of Microscopy © 2017 Royal Microscopical Society.
Gorelik, Tatiana E; Schmidt, Martin U; Kolb, Ute; Billinge, Simon J L
2015-04-01
This paper shows that pair-distribution function (PDF) analyses can be carried out on organic and organometallic compounds from powder electron diffraction data. Different experimental setups are demonstrated, including selected area electron diffraction and nanodiffraction in transmission electron microscopy or nanodiffraction in scanning transmission electron microscopy modes. The methods were demonstrated on organometallic complexes (chlorinated and unchlorinated copper phthalocyanine) and on purely organic compounds (quinacridone). The PDF curves from powder electron diffraction data, called ePDF, are in good agreement with PDF curves determined from X-ray powder data demonstrating that the problems of obtaining kinematical scattering data and avoiding beam damage of the sample are possible to resolve.
de Jonge, Niels [Oak Ridge, TN
2010-08-17
A confocal scanning transmission electron microscope which includes an electron illumination device providing an incident electron beam propagating in a direction defining a propagation axis, and a precision specimen scanning stage positioned along the propagation axis and movable in at least one direction transverse to the propagation axis. The precision specimen scanning stage is configured for positioning a specimen relative to the incident electron beam. A projector lens receives a transmitted electron beam transmitted through at least part of the specimen and focuses this transmitted beam onto an image plane, where the transmitted beam results from the specimen being illuminated by the incident electron beam. A detection system is placed approximately in the image plane.
Dahlhaus, Anne; Siebenhofer, Andrea; Guethlin, Corina
2015-01-01
The aim of this study was to investigate how general practitioners react when their cancer patients show interest in complementary medicine, and how their reaction is related to their knowledge in the field. We conducted semi-structured interviews with 10 German general practitioners. Interviewees came from 5 different federal states and varied in terms of urban/rural setting, single/joint practice, additional certifications, gender and length of professional experience. Interviews were electronically recorded, transcribed and then analysed using qualitative content analysis according to Mayring. General practitioners feel largely responsible for providing information on complementary medicine to their cancer patients. However, uncertainty and a lack of knowledge concerning CAM lead mainly to reactive responses to patients' needs, and the general practitioners base their recommendations on personal experiences and attitudes. They wish to support their cancer patients and thus, in order to keep their patients' hopes up and maintain a trusting relationship, sometimes support complementary medicine, regardless of their own convictions. Although general practitioners see themselves as an important source of information on complementary medicine for their cancer patients, they also speak of their uncertainties and lack of knowledge. General practitioners would profit from training in complementary medicine enabling them to discuss this topic with their cancer patients in a proactive, open and honest manner. © 2015 S. Karger GmbH, Freiburg
Complementary π-π interactions induce multicomponent coassembly into functional fibrils.
Ryan, Derek M; Doran, Todd M; Nilsson, Bradley L
2011-09-06
Noncovalent self-assembled materials inspired by amyloid architectures are useful for biomedical applications ranging from regenerative medicine to drug delivery. The selective coassembly of complementary monomeric units to provide ordered multicomponent fibrils is a possible strategy for enhancing the sophistication of these noncovalent materials. Herein we report that complementary π-π interactions can be exploited to promote the coassembly of phenylalanine (Phe) derivatives that possess complementary aromatic side-chain functionality. Specifically, equimolar mixtures of Fmoc-Phe and Fmoc-F(5)-Phe, which possess side-chain groups with complementary quadrupole electronics, readily coassemble to form two-component fibrils and hydrogels under conditions where Fmoc-Phe alone fails to self-assemble. In addition, it was found that equimolar mixtures of Fmoc-Phe with monohalogenated (F, Cl, and Br) Fmoc-Phe derivatives also coassembled into two-component fibrils. These results collectively indicate that face-to-face quadrupole stacking between benzyl side-chain groups does not account for the molecular recognition between Phe and halogenated Phe derivatives that promote cofibrillization but that coassembly is mediated by more subtle π-π effects arising from the halogenation of the benzyl side chain. The use of complementary π-π interactions to promote the coassembly of two distinct monomeric units into ordered two-component fibrils dramatically expands the repertoire of noncovalent interactions that can be used in the development of sophisticated noncovalent materials. © 2011 American Chemical Society
Advanced CMOS Radiation Effects Testing and Analysis
NASA Technical Reports Server (NTRS)
Pellish, J. A.; Marshall, P. W.; Rodbell, K. P.; Gordon, M. S.; LaBel, K. A.; Schwank, J. R.; Dodds, N. A.; Castaneda, C. M.; Berg, M. D.; Kim, H. S.;
2014-01-01
Presentation at the annual NASA Electronic Parts and Packaging (NEPP) Program Electronic Technology Workshop (ETW). The material includes an update of progress in this NEPP task area over the past year, which includes testing, evaluation, and analysis of radiation effects data on the IBM 32 nm silicon-on-insulator (SOI) complementary metal oxide semiconductor (CMOS) process. The testing was conducted using test vehicles supplied by directly by IBM.
New developments in electron microscopy for serial image acquisition of neuronal profiles.
Kubota, Yoshiyuki
2015-02-01
Recent developments in electron microscopy largely automate the continuous acquisition of serial electron micrographs (EMGs), previously achieved by laborious manual serial ultrathin sectioning using an ultramicrotome and ultrastructural image capture process with transmission electron microscopy. The new systems cut thin sections and capture serial EMGs automatically, allowing for acquisition of large data sets in a reasonably short time. The new methods are focused ion beam/scanning electron microscopy, ultramicrotome/serial block-face scanning electron microscopy, automated tape-collection ultramicrotome/scanning electron microscopy and transmission electron microscope camera array. In this review, their positive and negative aspects are discussed. © The Author 2015. Published by Oxford University Press on behalf of The Japanese Society of Microscopy. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Hlaing, Htay; Kim, Chang-Hyun; Carta, Fabio; Nam, Chang-Yong; Barton, Rob A; Petrone, Nicholas; Hone, James; Kymissis, Ioannis
2015-01-14
The vertical integration of graphene with inorganic semiconductors, oxide semiconductors, and newly emerging layered materials has recently been demonstrated as a promising route toward novel electronic and optoelectronic devices. Here, we report organic thin film transistors based on vertical heterojunctions of graphene and organic semiconductors. In these thin heterostructure devices, current modulation is accomplished by tuning of the injection barriers at the semiconductor/graphene interface with the application of a gate voltage. N-channel devices fabricated with a thin layer of C60 show a room temperature on/off ratio >10(4) and current density of up to 44 mAcm(-2). Because of the ultrashort channel intrinsic to the vertical structure, the device is fully operational at a driving voltage of 200 mV. A complementary p-channel device is also investigated, and a logic inverter based on two complementary transistors is demonstrated. The vertical integration of graphene with organic semiconductors via simple, scalable, and low-temperature fabrication processes opens up new opportunities to realize flexible, transparent organic electronic, and optoelectronic devices.
Kundu, Souvik; Maurya, Deepam; Clavel, Michael; Zhou, Yuan; Halder, Nripendra N.; Hudait, Mantu K.; Banerji, Pallab; Priya, Shashank
2015-01-01
We introduce a novel lead-free ferroelectric thin film (1-x)BaTiO3-xBa(Cu1/3Nb2/3)O3 (x = 0.025) (BT-BCN) integrated on to HfO2 buffered Si for non-volatile memory (NVM) applications. Piezoelectric force microscopy (PFM), x-ray diffraction, and high resolution transmission electron microscopy were employed to establish the ferroelectricity in BT-BCN thin films. PFM study reveals that the domains reversal occurs with 180° phase change by applying external voltage, demonstrating its effectiveness for NVM device applications. X-ray photoelectron microscopy was used to investigate the band alignments between atomic layer deposited HfO2 and pulsed laser deposited BT-BCN films. Programming and erasing operations were explained on the basis of band-alignments. The structure offers large memory window, low leakage current, and high and low capacitance values that were easily distinguishable even after ~106 s, indicating strong charge storage potential. This study explains a new approach towards the realization of ferroelectric based memory devices integrated on Si platform and also opens up a new possibility to embed the system within current complementary metal-oxide-semiconductor processing technology. PMID:25683062
Quantitative assessment of carbon allocation anomalies in low temperature bainite
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rementeria, Rosalia
Low temperature bainite is a mixture of ferrite and austenite with a high dislocation density and nanoscale precipitates produced by isothermal transformation of the austenite in high-carbon high-silicon steels. The mass balance for carbon is systematically unsuitable when considering only ferrite and austenite forming the structure, but no attempt has been made to evaluate the amount of carbon located at linear defects and precipitates. Additionally, bainitic ferrite has been recently shown to have a tetragonal crystal structure, allowing greater amounts of carbon in solid solution than those expected by the paraequilibrium phase boundaries. In order to quantify the contribution ofmore » all the carbon sinks, we have followed the evolution of carbon in ferrite and austenite, along with the precipitation of cementite and η–carbide, during the isothermal bainitic transformation at 220 and 250 °C by means of in-situ synchrotron high energy X-ray diffraction and complementary transmission electron microscopy (TEM) and atom probe tomography (APT) analyses. Furthermore, this is the first time that the mass balance for carbon is successfully achieved by considering all the transformation products together with an estimation of the carbon segregated to linear defects.« less
Heterogeneous Two-Phase Pillars in Epitaxial NiFe 2 O 4 -LaFeO 3 Nanocomposites
DOE Office of Scientific and Technical Information (OSTI.GOV)
Comes, Ryan B.; Perea, Daniel E.; Spurgeon, Steven R.
2017-07-10
Self-assembled epitaxial oxide nanocomposites have been explored for a wide range of applications, including multiferroic and magnetoelectric properties, plasmonics, and catalysis. These so-called “vertically aligned nanocomposites” form spontaneously during the deposition process when segregation into two phases is energetically favorable as compared to a solid solution. However, there has been surprisingly little work understanding the driving forces that govern the synthesis of these materials, which can include point defect energetics, surface diffusion, and interfacial energies. To explore these factors, La-Ni-Fe-O films have been synthesized by molecular beam epitaxy and it is shown that these phase segregate into spinel-perovskite nanocomposites. Usingmore » complementary scanning transmission electron microscopy and atom-probe tomography, the elemental composition of each phase is examined and found that Ni ions are exclusively found in the spinel phase. From correlative analysis, a model for the relative favorability of the Ni2+ and Ni3+ valences under the growth conditions is developed. It is shown that multidimensional characterization techniques provide previously unobserved insight into the growth process and complex driving forces for phase segregation.« less
Quantitative assessment of carbon allocation anomalies in low temperature bainite
Rementeria, Rosalia
2017-05-24
Low temperature bainite is a mixture of ferrite and austenite with a high dislocation density and nanoscale precipitates produced by isothermal transformation of the austenite in high-carbon high-silicon steels. The mass balance for carbon is systematically unsuitable when considering only ferrite and austenite forming the structure, but no attempt has been made to evaluate the amount of carbon located at linear defects and precipitates. Additionally, bainitic ferrite has been recently shown to have a tetragonal crystal structure, allowing greater amounts of carbon in solid solution than those expected by the paraequilibrium phase boundaries. In order to quantify the contribution ofmore » all the carbon sinks, we have followed the evolution of carbon in ferrite and austenite, along with the precipitation of cementite and η–carbide, during the isothermal bainitic transformation at 220 and 250 °C by means of in-situ synchrotron high energy X-ray diffraction and complementary transmission electron microscopy (TEM) and atom probe tomography (APT) analyses. Furthermore, this is the first time that the mass balance for carbon is successfully achieved by considering all the transformation products together with an estimation of the carbon segregated to linear defects.« less
Measuring Mass-Based Hygroscopicity of Atmospheric Particles through in situ Imaging
DOE Office of Scientific and Technical Information (OSTI.GOV)
Piens, Dominique` Y.; Kelly, Stephen T.; Harder, Tristan
Quantifying how atmospheric particles interact with water vapor is critical for understanding the effects of aerosols on climate. We present a novel method to measure the mass-based hygroscopicity of particles while characterizing their elemental and carbon functional group compositions. Since mass-based hygroscopicity is insensitive to particle geometry, it is advantageous for probing the hygroscopic behavior of atmospheric particles, which can have irregular morphologies. Combining scanning electron microscopy with energy dispersive X-ray analysis (SEM/EDX), scanning transmission X-ray microscopy (STXM) analysis, and in situ STXM humidification experiments, this method was validated using laboratory-generated, atmospherically relevant particles. Then, the hygroscopicity and elemental compositionmore » of 15 complex atmospheric particles were analyzed by leveraging quantification of C, N, and O from STXM, and complementary elemental quantification from SEM/EDX. We found three types of hygroscopic responses, and correlated high hygroscopicity with Na and Cl content. The mixing state determined for 158 particles broadly agreed with those of the humidified particles, indicating the potential to infer the atmospheric hygroscopic behavior from a selected subset of particles. These methods offer unique quantitative capabilities to characterize and correlate the hygroscopicity and chemistry of individual submicron atmospheric particles.« less
Observation of thermally etched grain boundaries with the FIB/TEM technique
DOE Office of Scientific and Technical Information (OSTI.GOV)
Palizdar, Y., E-mail: y.palizdar@merc.ac.ir; San Martin, D.; Ward, M.
2013-10-15
Thermal etching is a method which is able to reveal and characterize grain boundaries, twins or dislocation structures and determine parameters such as grain boundary energies, surface diffusivities or study phase transformations in steels, intermetallics or ceramic materials. This method relies on the preferential transfer of matter away from grain boundaries on a polished sample during heating at high temperatures in an inert/vacuum atmosphere. The evaporation/diffusion of atoms at high temperatures results in the formation of grooves at the intersections of the planes of grain/twin boundaries with the polished surface. This work describes how the combined use of Focussed Ionmore » Beam and Transmission Electron Microscopy can be used to characterize not only the grooves and their profile with the surface, but also the grain boundary line below the groove, this method being complementary to the commonly used scanning probe techniques. - Highlights: • Thermally etched low-carbon steel samples have been characterized by FIB/TEM • Grain boundary (GB) lines below the groove have been characterized in this way • Absence of ghost traces and large θ angle suggests that GB are not stationary but mobile • Observations correlate well with previous works and Mullins' investigations [22].« less
Time-resolved soft-x-ray studies of energy transport in layered and planar laser-driven targets
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stradling, G.L.
New low-energy x-ray diagnostic techniques are used to explore energy-transport processes in laser heated plasmas. Streak cameras are used to provide 15-psec time-resolution measurements of subkeV x-ray emission. A very thin (50 ..mu..g/cm/sup 2/) carbon substrate provides a low-energy x-ray transparent window to the transmission photocathode of this soft x-ray streak camera. Active differential vacuum pumping of the instrument is required. The use of high-sensitivity, low secondary-electron energy-spread CsI photocathodes in x-ray streak cameras is also described. Significant increases in sensitivity with only a small and intermittant decrease in dynamic range were observed. These coherent, complementary advances in subkeV, time-resolvedmore » x-ray diagnostic capability are applied to energy-transport investigations of 1.06-..mu..m laser plasmas. Both solid disk targets of a variety of Z's as well as Be-on-Al layered-disk targets were irradiated with 700-psec laser pulses of selected intensity between 3 x 10/sup 14/ W/cm/sup 2/ and 1 x 10/sup 15/ W/cm/sup 2/.« less
NASA Astrophysics Data System (ADS)
Tsuda, Kenji; Tanaka, Michiyoshi
2015-08-01
Rhombohedral nanostructures previously found in the orthorhombic phase of KNbO3, by convergent-beam electron diffraction [Tsuda et al., Appl. Phys. Lett. 102, 051913 (2013)], have been investigated by the combined use of scanning transmission electron microscopy and convergent-beam electron diffraction. Two-dimensional distributions of the rhombohedral nanostructures, or nanometer-scale spatial fluctuations of polarization clusters, have been successfully visualized. The correlation length of the observed spatial fluctuations of local polarizations is related to the cpc/apc ratio and the transition entropy.
Atmospheric pressure scanning transmission electron microscopy.
de Jonge, Niels; Bigelow, Wilbur C; Veith, Gabriel M
2010-03-10
Scanning transmission electron microscope (STEM) images of gold nanoparticles at atmospheric pressure have been recorded through a 0.36 mm thick mixture of CO, O2, and He. This was accomplished using a reaction cell consisting of two electron-transparent silicon nitride membranes. Gold nanoparticles of a full width at half-maximum diameter of 1.0 nm were visible above the background noise, and the achieved edge resolution was 0.4 nm in accordance with calculations of the beam broadening.
Nano Electronics on Atomically Controlled van der Waals Quantum Heterostructures
2015-03-30
for the structural of the atomically sharp interface between hBN and Bi2Te3. Finally, we have developed unprecedentedly clean graphene supercoductor...crystals by MBE method. We also use transmission electron microscopy (TEM) analysis for the structural of the atomically sharp interface between hBN and...by MBE method. We also use transmission electron microscopy (TEM) analysis for the structural of the atomically sharp interface between hBN and Bi2Te3
Exploring transmission Kikuchi diffraction using a Timepix detector
NASA Astrophysics Data System (ADS)
Vespucci, S.; Winkelmann, A.; Mingard, K.; Maneuski, D.; O'Shea, V.; Trager-Cowan, C.
2017-02-01
Electron backscatter diffraction (EBSD) is a well-established scanning electron microscope (SEM)-based technique [1]. It allows the non-destructive mapping of the crystal structure, texture, crystal phase and strain with a spatial resolution of tens of nanometers. Conventionally this is performed by placing an electron sensitive screen, typically consisting of a phosphor screen combined with a charge coupled device (CCD) camera, in front of a specimen, usually tilted 70° to the normal of the exciting electron beam. Recently, a number of authors have shown that a significant increase in spatial resolution is achievable when Kikuchi diffraction patterns are acquired in transmission geometry; that is when diffraction patterns are generated by electrons transmitted through an electron-transparent, usually thinned, specimen. The resolution of this technique, called transmission Kikuchi diffraction (TKD), has been demonstrated to be better than 10 nm [2,3]. We have recently demonstrated the advantages of a direct electron detector, Timepix [4,5], for the acquisition of standard EBSD patterns [5]. In this article we will discuss the advantages of Timepix to perform TKD and for acquiring spot diffraction patterns and more generally for acquiring scanning transmission electron microscopy micrographs in the SEM. Particularly relevant for TKD, is its very compact size, which allows much more flexibility in the positioning of the detector in the SEM chamber. We will furthermore show recent results using Timepix as a virtual forward scatter detector, and will illustrate the information derivable on producing images through processing of data acquired from different areas of the detector. We will show results from samples ranging from gold nanoparticles to nitride semiconductor nanorods.
Krause, F F; Rosenauer, A; Barthel, J; Mayer, J; Urban, K; Dunin-Borkowski, R E; Brown, H G; Forbes, B D; Allen, L J
2017-10-01
This paper addresses a novel approach to atomic resolution elemental mapping, demonstrating a method that produces elemental maps with a similar resolution to the established method of electron energy-loss spectroscopy in scanning transmission electron microscopy. Dubbed energy-filtered imaging scanning transmission electron microscopy (EFISTEM) this mode of imaging is, by the quantum mechanical principle of reciprocity, equivalent to tilting the probe in energy-filtered transmission electron microscopy (EFTEM) through a cone and incoherently averaging the results. In this paper we present a proof-of-principle EFISTEM experimental study on strontium titanate. The present approach, made possible by chromatic aberration correction, has the advantage that it provides elemental maps which are immune to spatial incoherence in the electron source, coherent aberrations in the probe-forming lens and probe jitter. The veracity of the experiment is supported by quantum mechanical image simulations, which provide an insight into the image-forming process. Elemental maps obtained in EFTEM suffer from the effect known as preservation of elastic contrast, which, for example, can lead to a given atomic species appearing to be in atomic columns where it is not to be found. EFISTEM very substantially reduces the preservation of elastic contrast and yields images which show stability of contrast with changing thickness. The experimental application is demonstrated in a proof-of-principle study on strontium titanate. Copyright © 2017 Elsevier B.V. All rights reserved.
The HALO / HALO-2 Supernova Neutrino Detectors
NASA Astrophysics Data System (ADS)
Yen, Stanley; HALO Collaboration; HALO-2 Collaboration
2016-09-01
The Helium and Lead Observatory (HALO) is a dedicated supernova neutrino detector in SNOLAB, which is built from 79 tons of surplus lead and the helium-3 neutron detectors from the SNO experiment. It is sensitive primarily to electron neutrinos, and is thus complementary to water Cerenkov and organic scintillation detectors which are primarily sensitive to electron anti-neutrinos. A comparison of the rates in these complementary detectors will enable a flavor decomposition of the neutrino flux from the next galactic core-collapse supernova. We have tentative ideas to build a 1000-ton HALO-2 detector in the Gran Sasso laboratory by using the lead from the decommissioned OPERA detector. We are exploring several neutron detector technologies to supplement the existing helium-3 detectors. We welcome new collaborators to join us. This research is supported by the NRC and NSERC (Canada), the US DOE and NSF, and the German RISE program.
Ophus, Colin; Ciston, Jim; Pierce, Jordan; ...
2016-02-29
The ability to image light elements in soft matter at atomic resolution enables unprecedented insight into the structure and properties of molecular heterostructures and beam-sensitive nanomaterials. In this study, we introduce a scanning transmission electron microscopy technique combining a pre-specimen phase plate designed to produce a probe with structured phase with a high-speed direct electron detector to generate nearly linear contrast images with high efficiency. We demonstrate this method by using both experiment and simulation to simultaneously image the atomic-scale structure of weakly scattering amorphous carbon and strongly scattering gold nanoparticles. Our method demonstrates strong contrast for both materials, makingmore » it a promising candidate for structural determination of heterogeneous soft/hard matter samples even at low electron doses comparable to traditional phase-contrast transmission electron microscopy. Ultimately, simulated images demonstrate the extension of this technique to the challenging problem of structural determination of biological material at the surface of inorganic crystals.« less
Ophus, Colin; Ciston, Jim; Pierce, Jordan; Harvey, Tyler R; Chess, Jordan; McMorran, Benjamin J; Czarnik, Cory; Rose, Harald H; Ercius, Peter
2016-02-29
The ability to image light elements in soft matter at atomic resolution enables unprecedented insight into the structure and properties of molecular heterostructures and beam-sensitive nanomaterials. In this study, we introduce a scanning transmission electron microscopy technique combining a pre-specimen phase plate designed to produce a probe with structured phase with a high-speed direct electron detector to generate nearly linear contrast images with high efficiency. We demonstrate this method by using both experiment and simulation to simultaneously image the atomic-scale structure of weakly scattering amorphous carbon and strongly scattering gold nanoparticles. Our method demonstrates strong contrast for both materials, making it a promising candidate for structural determination of heterogeneous soft/hard matter samples even at low electron doses comparable to traditional phase-contrast transmission electron microscopy. Simulated images demonstrate the extension of this technique to the challenging problem of structural determination of biological material at the surface of inorganic crystals.
Ophus, Colin; Ciston, Jim; Pierce, Jordan; Harvey, Tyler R.; Chess, Jordan; McMorran, Benjamin J.; Czarnik, Cory; Rose, Harald H.; Ercius, Peter
2016-01-01
The ability to image light elements in soft matter at atomic resolution enables unprecedented insight into the structure and properties of molecular heterostructures and beam-sensitive nanomaterials. In this study, we introduce a scanning transmission electron microscopy technique combining a pre-specimen phase plate designed to produce a probe with structured phase with a high-speed direct electron detector to generate nearly linear contrast images with high efficiency. We demonstrate this method by using both experiment and simulation to simultaneously image the atomic-scale structure of weakly scattering amorphous carbon and strongly scattering gold nanoparticles. Our method demonstrates strong contrast for both materials, making it a promising candidate for structural determination of heterogeneous soft/hard matter samples even at low electron doses comparable to traditional phase-contrast transmission electron microscopy. Simulated images demonstrate the extension of this technique to the challenging problem of structural determination of biological material at the surface of inorganic crystals. PMID:26923483
Interaction of electrons with light metal hydrides in the transmission electron microscope.
Wang, Yongming; Wakasugi, Takenobu; Isobe, Shigehito; Hashimoto, Naoyuki; Ohnuki, Somei
2014-12-01
Transmission electron microscope (TEM) observation of light metal hydrides is complicated by the instability of these materials under electron irradiation. In this study, the electron kinetic energy dependences of the interactions of incident electrons with lithium, sodium and magnesium hydrides, as well as the constituting element effect on the interactions, were theoretically discussed, and electron irradiation damage to these hydrides was examined using in situ TEM. The results indicate that high incident electron kinetic energy helps alleviate the irradiation damage resulting from inelastic or elastic scattering of the incident electrons in the TEM. Therefore, observations and characterizations of these materials would benefit from increased, instead decreased, TEM operating voltage. © The Author 2014. Published by Oxford University Press on behalf of The Japanese Society of Microscopy. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Hata, S; Miyazaki, S; Gondo, T; Kawamoto, K; Horii, N; Sato, K; Furukawa, H; Kudo, H; Miyazaki, H; Murayama, M
2017-04-01
This paper reports the preliminary results of a new in-situ three-dimensional (3D) imaging system for observing plastic deformation behavior in a transmission electron microscope (TEM) as a directly relevant development of the recently reported straining-and-tomography holder [Sato K et al. (2015) Development of a novel straining holder for transmission electron microscopy compatible with single tilt-axis electron tomography. Microsc. 64: 369-375]. We designed an integrated system using the holder and newly developed straining and image-acquisition software and then developed an experimental procedure for in-situ straining and time-resolved electron tomography (ET) data acquisition. The software for image acquisition and 3D visualization was developed based on the commercially available ET software TEMographyTM. We achieved time-resolved 3D visualization of nanometer-scale plastic deformation behavior in a Pb-Sn alloy sample, thus demonstrating the capability of this system for potential applications in materials science. © The Author 2016. Published by Oxford University Press on behalf of The Japanese Society of Microscopy. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Mittelberger, Andreas; Kramberger, Christian; Meyer, Jannik C
2018-03-19
Atomically resolved images of monolayer organic crystals have only been obtained with scanning probe methods so far. On the one hand, they are usually prepared on surfaces of bulk materials, which are not accessible by (scanning) transmission electron microscopy. On the other hand, the critical electron dose of a monolayer organic crystal is orders of magnitudes lower than the one for bulk crystals, making (scanning) transmission electron microscopy characterization very challenging. In this work we present an atomically resolved study on the dynamics of a monolayer CuPcCl 16 crystal under the electron beam as well as an image of the undamaged molecules obtained by low-dose electron microscopy. The results show the dynamics and the radiation damage mechanisms in the 2D layer of this material, complementing what has been found for bulk crystals in earlier studies. Furthermore, being able to image the undamaged molecular crystal allows the characterization of new composites consisting of 2D materials and organic molecules.
Note: An improved 3D imaging system for electron-electron coincidence measurements
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lin, Yun Fei; Lee, Suk Kyoung; Adhikari, Pradip
We demonstrate an improved imaging system that can achieve highly efficient 3D detection of two electrons in coincidence. The imaging system is based on a fast frame complementary metal-oxide semiconductor camera and a high-speed waveform digitizer. We have shown previously that this detection system is capable of 3D detection of ions and electrons with good temporal and spatial resolution. Here, we show that with a new timing analysis algorithm, this system can achieve an unprecedented dead-time (<0.7 ns) and dead-space (<1 mm) when detecting two electrons. A true zero dead-time detection is also demonstrated.
Note: An improved 3D imaging system for electron-electron coincidence measurements
NASA Astrophysics Data System (ADS)
Lin, Yun Fei; Lee, Suk Kyoung; Adhikari, Pradip; Herath, Thushani; Lingenfelter, Steven; Winney, Alexander H.; Li, Wen
2015-09-01
We demonstrate an improved imaging system that can achieve highly efficient 3D detection of two electrons in coincidence. The imaging system is based on a fast frame complementary metal-oxide semiconductor camera and a high-speed waveform digitizer. We have shown previously that this detection system is capable of 3D detection of ions and electrons with good temporal and spatial resolution. Here, we show that with a new timing analysis algorithm, this system can achieve an unprecedented dead-time (<0.7 ns) and dead-space (<1 mm) when detecting two electrons. A true zero dead-time detection is also demonstrated.
Communication: Time- and space-sliced velocity map electron imaging
NASA Astrophysics Data System (ADS)
Lee, Suk Kyoung; Lin, Yun Fei; Lingenfelter, Steven; Fan, Lin; Winney, Alexander H.; Li, Wen
2014-12-01
We develop a new method to achieve slice electron imaging using a conventional velocity map imaging apparatus with two additional components: a fast frame complementary metal-oxide semiconductor camera and a high-speed digitizer. The setup was previously shown to be capable of 3D detection and coincidence measurements of ions. Here, we show that when this method is applied to electron imaging, a time slice of 32 ps and a spatial slice of less than 1 mm thick can be achieved. Each slice directly extracts 3D velocity distributions of electrons and provides electron velocity distributions that are impossible or difficult to obtain with a standard 2D imaging electron detector.
Yoshida, Kenta; Shimodaira, Masaki; Toyama, Takeshi; Shimizu, Yasuo; Inoue, Koji; Yoshiie, Toshimasa; Milan, Konstantinovic J; Gerard, Robert; Nagai, Yasuyoshi
2017-04-01
To evaluate dislocations induced by neutron irradiation, we developed a weak-beam scanning transmission electron microscopy (WB-STEM) system by installing a novel beam selector, an annular detector, a high-speed CCD camera and an imaging filter in the camera chamber of a spherical aberration-corrected transmission electron microscope. The capabilities of the WB-STEM with respect to wide-view imaging, real-time diffraction monitoring and multi-contrast imaging are demonstrated using typical reactor pressure vessel steel that had been used in an European nuclear reactor for 30 years as a surveillance test piece with a fluence of 1.09 × 1020 neutrons cm-2. The quantitatively measured size distribution (average loop size = 3.6 ± 2.1 nm), number density of the dislocation loops (3.6 × 1022 m-3) and dislocation density (7.8 × 1013 m m-3) were carefully compared with the values obtained via conventional weak-beam transmission electron microscopy studies. In addition, cluster analysis using atom probe tomography (APT) further demonstrated the potential of the WB-STEM for correlative electron tomography/APT experiments. © The Author 2017. Published by Oxford University Press on behalf of The Japanese Society of Microscopy. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Castejon, O J; Castejon, H V; Diaz, M; Castellano, A
2001-10-01
Cortical biopsies of 11 patients with traumatic brain oedema were consecutively studied by light microscopy (LM) using thick plastic sections, scanning-transmission electron microscopy ((S)TEM) using semithin plastic sections and transmission electron microscopy (TEM) using ultrathin sections. Samples were glutaraldehyde-osmium fixed and embedded in Araldite or Epon. Thick sections were stained with toluidine-blue for light microscopy. Semithin sections were examined unstained and uncoated for (S)TEM. Ultrathin sections were stained with uranyl and lead. Perivascular haemorrhages and perivascular extravasation of proteinaceous oedema fluid were observed in both moderate and severe oedema. Ischaemic pyramidal and non-pyramidal nerve cells appeared shrunken, electron dense and with enlargement of intracytoplasmic membrane compartment. Notably swollen astrocytes were observed in all samples examined. Glycogen-rich and glycogen-depleted astrocytes were identified in anoxic-ischaemic regions. Dark and hydropic satellite, interfascicular and perivascular oligodendrocytes were also found. The status spongiosus of severely oedematous brain parenchyma observed by LM and (S)TEM was correlated with the enlarged extracellular space and disrupted neuropil observed by TEM. The (S)TEM is recommended as a suitable technique for studying pathological processes in the central nervous system and as an informative adjunct to LM and TEM.
Angle-Resolved Photoemission of Solvated Electrons in Sodium-Doped Clusters.
West, Adam H C; Yoder, Bruce L; Luckhaus, David; Saak, Clara-Magdalena; Doppelbauer, Maximilian; Signorell, Ruth
2015-04-16
Angle-resolved photoelectron spectroscopy of the unpaired electron in sodium-doped water, methanol, ammonia, and dimethyl ether clusters is presented. The experimental observations and the complementary calculations are consistent with surface electrons for the cluster size range studied. Evidence against internally solvated electrons is provided by the photoelectron angular distribution. The trends in the ionization energies seem to be mainly determined by the degree of hydrogen bonding in the solvent and the solvation of the ion core. The onset ionization energies of water and methanol clusters do not level off at small cluster sizes but decrease slightly with increasing cluster size.
Gupta, Sanju; Evans, Brendan; Henson, Alex; Carrizosa, Sara B.
2017-01-01
Nanodiamond particles form agglomerates in the dry powder state and this poses limitation to the accessibility of their diamond-like core thus dramatically impacting their technological advancement. In this work, we report de-agglomeration of nanodiamond (ND) by using a facile technique namely, salt-assisted ultrasonic de-agglomeration (SAUD). Utilizing ultrasound energy and ionic salts (sodium chloride and sodium acetate), SAUD is expected to break apart thermally treated nanodiamond aggregates (~50–100 nm) and produce an aqueous slurry of de-aggregated stable colloidal nanodiamond dispersions by virtue of ionic interactions and electrostatic stabilization. Moreover, the SAUD technique neither has toxic chemicals nor is it difficult to remove impurities and therefore the isolated nanodiamonds produced are exceptionally suited for engineered nanocarbon for mechanical (composites, lubricants) and biomedical (bio-labeling, biosensing, bioimaging, theranostic) applications. We characterized the microscopic structure using complementary techniques including transmission electron microscopy combined with selected-area electron diffraction, optical and vibrational spectroscopy. We immobilized SAUD produced NDs on boron-doped diamond electrodes to investigate fundamental electrochemical properties. They included surface potential (or Fermi energy level), carrier density and mapping electrochemical (re)activity using advanced scanning electrochemical microscopy in the presence of a redox-active probe, with the aim of understanding the surface redox chemistry and the interfacial process of isolated nanodiamond particles as opposed to aggregated and untreated nanoparticles. The experimental findings are discussed in terms of stable colloids, quantum confinement and predominantly surface effects, defect sites (sp2–bonded C and unsaturated bonds), inner core (sp3–bonded C)/outer shell (sp2–bonded C) structure, and surface functionality. Moreover, the surface electronic states give rise to midgap states which serve as electron donors (or acceptors) depending upon the bonding (or antibonding). These are important as electroanalytical platforms for various electrocatalytic processes. PMID:29125547
Integration of solid-state nanopores in a 0.5 μm CMOS foundry process.
Uddin, A; Yemenicioglu, S; Chen, C-H; Corigliano, E; Milaninia, K; Theogarajan, L
2013-04-19
High-bandwidth and low-noise nanopore sensor and detection electronics are crucial in achieving single-DNA-base resolution. A potential way to accomplish this goal is to integrate solid-state nanopores within a CMOS platform, in close proximity to the biasing electrodes and custom-designed amplifier electronics. Here we report the integration of solid-state nanopore devices in a commercial complementary metal-oxide-semiconductor (CMOS) potentiostat chip implemented in On-Semiconductor's 0.5 μm technology. Nanopore membranes incorporating electrodes are fabricated by post-CMOS micromachining utilizing the n+ polysilicon/SiO2/n+ polysilicon capacitor structure available in the aforementioned process. Nanopores are created in the CMOS process by drilling in a transmission electron microscope and shrinking by atomic layer deposition. We also describe a batch fabrication method to process a large of number of electrode-embedded nanopores with sub-10 nm diameter across CMOS-compatible wafers by electron beam lithography and atomic layer deposition. The CMOS-compatibility of our fabrication process is verified by testing the electrical functionality of on-chip circuitry. We observe high current leakage with the CMOS nanopore devices due to the ionic diffusion through the SiO2 membrane. To prevent this leakage, we coat the membrane with Al2O3, which acts as an efficient diffusion barrier against alkali ions. The resulting nanopore devices also exhibit higher robustness and lower 1/f noise as compared to SiO2 and SiNx. Furthermore, we propose a theoretical model for our low-capacitance CMOS nanopore devices, showing good agreement with the experimental value. In addition, experiments and theoretical models of translocation studies are presented using 48.5 kbp λ-DNA in order to prove the functionality of on-chip pores coated with Al2O3.
Transmission of electrons inside the cryogenic pumps of ITER injector
DOE Office of Scientific and Technical Information (OSTI.GOV)
Veltri, P., E-mail: pierluigi.veltri@igi.cnr.it; Sartori, E.
2016-02-15
Large cryogenic pumps are installed in the vessel of large neutral beam injectors (NBIs) used to heat the plasma in nuclear fusion experiments. The operation of such pumps can be compromised by the presence of stray secondary electrons that are generated along the beam path. In this paper, we present a numerical model to analyze the propagation of the electrons inside the pump. The aim of the study is to quantify the power load on the active pump elements, via evaluation of the transmission probabilities across the domain of the pump. These are obtained starting from large datasets of particlemore » trajectories, obtained by numerical means. The transmission probability of the electrons across the domain is calculated for the NBI of the ITER and for its prototype Megavolt ITer Injector and Concept Advancement (MITICA) and the results are discussed.« less
Isotope analysis in the transmission electron microscope.
Susi, Toma; Hofer, Christoph; Argentero, Giacomo; Leuthner, Gregor T; Pennycook, Timothy J; Mangler, Clemens; Meyer, Jannik C; Kotakoski, Jani
2016-10-10
The Ångström-sized probe of the scanning transmission electron microscope can visualize and collect spectra from single atoms. This can unambiguously resolve the chemical structure of materials, but not their isotopic composition. Here we differentiate between two isotopes of the same element by quantifying how likely the energetic imaging electrons are to eject atoms. First, we measure the displacement probability in graphene grown from either 12 C or 13 C and describe the process using a quantum mechanical model of lattice vibrations coupled with density functional theory simulations. We then test our spatial resolution in a mixed sample by ejecting individual atoms from nanoscale areas spanning an interface region that is far from atomically sharp, mapping the isotope concentration with a precision better than 20%. Although we use a scanning instrument, our method may be applicable to any atomic resolution transmission electron microscope and to other low-dimensional materials.
Levine, Peter M; Gong, Ping; Levicky, Rastislav; Shepard, Kenneth L
2009-03-15
Optical biosensing based on fluorescence detection has arguably become the standard technique for quantifying extents of hybridization between surface-immobilized probes and fluorophore-labeled analyte targets in DNA microarrays. However, electrochemical detection techniques are emerging which could eliminate the need for physically bulky optical instrumentation, enabling the design of portable devices for point-of-care applications. Unlike fluorescence detection, which can function well using a passive substrate (one without integrated electronics), multiplexed electrochemical detection requires an electronically active substrate to analyze each array site and benefits from the addition of integrated electronic instrumentation to further reduce platform size and eliminate the electromagnetic interference that can result from bringing non-amplified signals off chip. We report on an active electrochemical biosensor array, constructed with a standard complementary metal-oxide-semiconductor (CMOS) technology, to perform quantitative DNA hybridization detection on chip using targets conjugated with ferrocene redox labels. A 4 x 4 array of gold working electrodes and integrated potentiostat electronics, consisting of control amplifiers and current-input analog-to-digital converters, on a custom-designed 5 mm x 3 mm CMOS chip drive redox reactions using cyclic voltammetry, sense DNA binding, and transmit digital data off chip for analysis. We demonstrate multiplexed and specific detection of DNA targets as well as real-time monitoring of hybridization, a task that is difficult, if not impossible, with traditional fluorescence-based microarrays.
46 CFR 531.8 - Amendment, correction, cancellation, and electronic transmission errors.
Code of Federal Regulations, 2014 CFR
2014-10-01
..., cancellation, and electronic transmission errors. (a) Amendment. (1) NSAs may be amended by mutual agreement of... § 531.5 and Appendix A to this part. (i) Where feasible, NSAs should be amended by amending only the affected specific term(s) or subterms. (ii) Each time any part of an NSA is amended, the filer shall assign...
46 CFR 531.8 - Amendment, correction, cancellation, and electronic transmission errors.
Code of Federal Regulations, 2012 CFR
2012-10-01
..., cancellation, and electronic transmission errors. (a) Amendment. (1) NSAs may be amended by mutual agreement of... § 531.5 and Appendix A to this part. (i) Where feasible, NSAs should be amended by amending only the affected specific term(s) or subterms. (ii) Each time any part of an NSA is amended, the filer shall assign...
46 CFR 531.8 - Amendment, correction, cancellation, and electronic transmission errors.
Code of Federal Regulations, 2011 CFR
2011-10-01
..., cancellation, and electronic transmission errors. (a) Amendment. (1) NSAs may be amended by mutual agreement of... § 531.5 and Appendix A to this part. (i) Where feasible, NSAs should be amended by amending only the affected specific term(s) or subterms. (ii) Each time any part of an NSA is amended, the filer shall assign...
46 CFR 531.8 - Amendment, correction, cancellation, and electronic transmission errors.
Code of Federal Regulations, 2013 CFR
2013-10-01
..., cancellation, and electronic transmission errors. (a) Amendment. (1) NSAs may be amended by mutual agreement of... § 531.5 and Appendix A to this part. (i) Where feasible, NSAs should be amended by amending only the affected specific term(s) or subterms. (ii) Each time any part of an NSA is amended, the filer shall assign...
46 CFR 531.8 - Amendment, correction, cancellation, and electronic transmission errors.
Code of Federal Regulations, 2010 CFR
2010-10-01
..., cancellation, and electronic transmission errors. (a) Amendment. (1) NSAs may be amended by mutual agreement of... § 531.5 and Appendix A to this part. (i) Where feasible, NSAs should be amended by amending only the affected specific term(s) or subterms. (ii) Each time any part of an NSA is amended, the filer shall assign...
Triggered plasma opening switch
Mendel, Clifford W.
1988-01-01
A triggerable opening switch for a very high voltage and current pulse includes a transmission line extending from a source to a load and having an intermediate switch section including a plasma for conducting electrons between transmission line conductors and a magnetic field for breaking the plasma conduction path and magnetically insulating the electrons when it is desired to open the switch.
Hammouda, Hédi; Alvarado, Camille; Bouchet, Brigitte; Kalthoum-Chérif, Jamila; Trabelsi-Ayadi, Malika; Guyot, Sylvain
2014-07-16
A histological approach including light microscopy and transmission electron microscopy (TEM) was used to provide accurate information on the localization of condensed tannins in the edible tissues and in the stone of date fruits (Phoenix dactylifera L.). Light microscopy was carried out on fresh tissues after staining by 4-dimethylaminocinnamaldehyde (DMACA) for a specific detection of condensed tannins. Thus, whether under light microscopy or transmission electron microscopy (TEM), results showed that tannins are not located in the epidermis but more deeply in the mesocarp in the vacuole of very large cells. Regarding the stones, tannins are found in a specific cell layer located at 50 μm from the sclereid cells of the testa.
Early, James W.
1990-01-01
A light-driven phase shifter is provided for modulating a transmission light beam. A gaseous medium such as argon is provided with electron energy states excited to populate a metastable state. A tunable dye laser is selected with a wavelength effective to deplete the metastable electron state and may be intensity modulated. The dye laser is directed through the gaseous medium to define a first optical path having an index of refraction determined by the gaseous medium having a depleted metastable electron state. A transmission laser beam is also directed through the gaseous medium to define a second optical path at least partially coincident with the first optical path. The intensity of the dye laser beam may then be varied to phase modulate the transmission laser beam.
Zhang, Lina; Zhang, Haoxu; Zhou, Ruifeng; Chen, Zhuo; Li, Qunqing; Fan, Shoushan; Ge, Guanglu; Liu, Renxiao; Jiang, Kaili
2011-09-23
A novel grid for use in transmission electron microscopy is developed. The supporting film of the grid is composed of thin graphene oxide films overlying a super-aligned carbon nanotube network. The composite film combines the advantages of graphene oxide and carbon nanotube networks and has the following properties: it is ultra-thin, it has a large flat and smooth effective supporting area with a homogeneous amorphous appearance, high stability, and good conductivity. The graphene oxide-carbon nanotube grid has a distinct advantage when characterizing the fine structure of a mass of nanomaterials over conventional amorphous carbon grids. Clear high-resolution transmission electron microscopy images of various nanomaterials are obtained easily using the new grids.
A fast image simulation algorithm for scanning transmission electron microscopy.
Ophus, Colin
2017-01-01
Image simulation for scanning transmission electron microscopy at atomic resolution for samples with realistic dimensions can require very large computation times using existing simulation algorithms. We present a new algorithm named PRISM that combines features of the two most commonly used algorithms, namely the Bloch wave and multislice methods. PRISM uses a Fourier interpolation factor f that has typical values of 4-20 for atomic resolution simulations. We show that in many cases PRISM can provide a speedup that scales with f 4 compared to multislice simulations, with a negligible loss of accuracy. We demonstrate the usefulness of this method with large-scale scanning transmission electron microscopy image simulations of a crystalline nanoparticle on an amorphous carbon substrate.
Controlling resonant tunneling in graphene via Fermi velocity engineering
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lima, Jonas R. F., E-mail: jonas.lima@ufrpe.br; Pereira, Luiz Felipe C.; Bezerra, C. G.
We investigate the resonant tunneling in a single layer graphene superlattice with modulated energy gap and Fermi velocity via an effective Dirac-like Hamiltonian. We calculate the transmission coefficient with the transfer matrix method and analyze the effect of a Fermi velocity modulation on the electronic transmission, in the case of normal and oblique incidence. We find it is possible to manipulate the electronic transmission in graphene by Fermi velocity engineering, and show that it is possible to tune the transmitivity from 0 to 1. We also analyze how a Fermi velocity modulation influences the total conductance and the Fano factor.more » Our results are relevant for the development of novel graphene-based electronic devices.« less
A fast image simulation algorithm for scanning transmission electron microscopy
Ophus, Colin
2017-05-10
Image simulation for scanning transmission electron microscopy at atomic resolution for samples with realistic dimensions can require very large computation times using existing simulation algorithms. Here, we present a new algorithm named PRISM that combines features of the two most commonly used algorithms, namely the Bloch wave and multislice methods. PRISM uses a Fourier interpolation factor f that has typical values of 4-20 for atomic resolution simulations. We show that in many cases PRISM can provide a speedup that scales with f 4 compared to multislice simulations, with a negligible loss of accuracy. We demonstrate the usefulness of this methodmore » with large-scale scanning transmission electron microscopy image simulations of a crystalline nanoparticle on an amorphous carbon substrate.« less
Rauh, R. David; Goldner, Ronald B.
1989-01-01
In a device for transmitting light, means for controlling the transmissivity of the device, including a ceramic, reversibly electrochromic, crystalline element having a highly reflective state when injected with electrons and charge compensating ions and a highly transmissive state when the electrons and ions are removed, the crystalline element being characterized as having a reflectivity of at least 50% in the reflective state and not greater than 10% in the transmissive state, and means for modulating the crystalline element between the reflective and transmissive states by injecting ions into the crystalline element in response to an applied electrical current of a first polarity and removing the ions in response to an applied electrical current of a second polarity.
Rauh, R.D.; Goldner, R.B.
1989-12-26
In a device for transmitting light, means for controlling the transmissivity of the device, including a ceramic, reversibly electrochromic, crystalline element having a highly reflective state when injected with electrons and charge compensating ions and a highly transmissive state when the electrons and ions are removed, the crystalline element being characterized as having a reflectivity of at least 50% in the reflective state and not greater than 10% in the transmissive state, and means for modulating the crystalline element between the reflective and transmissive states by injecting ions into the crystalline element in response to an applied electrical current of a first polarity and removing the ions in response to an applied electrical current of a second polarity are disclosed. 1 fig.
High-resolution low-dose scanning transmission electron microscopy.
Buban, James P; Ramasse, Quentin; Gipson, Bryant; Browning, Nigel D; Stahlberg, Henning
2010-01-01
During the past two decades instrumentation in scanning transmission electron microscopy (STEM) has pushed toward higher intensity electron probes to increase the signal-to-noise ratio of recorded images. While this is suitable for robust specimens, biological specimens require a much reduced electron dose for high-resolution imaging. We describe here protocols for low-dose STEM image recording with a conventional field-emission gun STEM, while maintaining the high-resolution capability of the instrument. Our findings show that a combination of reduced pixel dwell time and reduced gun current can achieve radiation doses comparable to low-dose TEM.
Foucault imaging by using non-dedicated transmission electron microscope
DOE Office of Scientific and Technical Information (OSTI.GOV)
Taniguchi, Yoshifumi; Matsumoto, Hiroaki; Harada, Ken
2012-08-27
An electron optical system for observing Foucault images was constructed using a conventional transmission electron microscope without any special equipment for Lorentz microscopy. The objective lens was switched off and an electron beam was converged by a condenser optical system to the crossover on the selected area aperture plane. The selected area aperture was used as an objective aperture to select the deflected beam for Foucault mode, and the successive image-forming lenses were controlled for observation of the specimen images. The irradiation area on the specimen was controlled by selecting the appropriate diameter of the condenser aperture.
Concurrent in situ ion irradiation transmission electron microscope
Hattar, K.; Bufford, D. C.; Buller, D. L.
2014-08-29
An in situ ion irradiation transmission electron microscope has been developed and is operational at Sandia National Laboratories. This facility permits high spatial resolution, real time observation of electron transparent samples under ion irradiation, implantation, mechanical loading, corrosive environments, and combinations thereof. This includes the simultaneous implantation of low-energy gas ions (0.8–30 keV) during high-energy heavy ion irradiation (0.8–48 MeV). In addition, initial results in polycrystalline gold foils are provided to demonstrate the range of capabilities.
Mayoral, Alvaro; Magen, Cesar; Jose-Yacaman, Miguel
2011-01-01
Long multi-branched gold nanoparticles have been synthesized in a very high yield through a facile synthesis combining two different capping agents. The stability of these materials with the time has been tested and their characterization have been performed by diverse advanced electron microscopy techniques, paying special attention to aberration corrected transmission electron microscopy in order to unambiguously analyze the surface structure of the branches and provide insights for the formation of stellated gold nanoparticles. PMID:22125420
Houdellier, F; Caruso, G M; Weber, S; Kociak, M; Arbouet, A
2018-03-01
We report on the development of an ultrafast Transmission Electron Microscope based on a cold field emission source which can operate in either DC or ultrafast mode. Electron emission from a tungsten nanotip is triggered by femtosecond laser pulses which are tightly focused by optical components integrated inside a cold field emission source close to the cathode. The properties of the electron probe (brightness, angular current density, stability) are quantitatively determined. The measured brightness is the largest reported so far for UTEMs. Examples of imaging, diffraction and spectroscopy using ultrashort electron pulses are given. Finally, the potential of this instrument is illustrated by performing electron holography in the off-axis configuration using ultrashort electron pulses. Copyright © 2017 Elsevier B.V. All rights reserved.
Gorelik, Tatiana E.; Billinge, Simon J. L.; Schmidt, Martin U.; ...
2015-04-01
This paper shows for the first time that pair-distribution function analyses can be carried out on organic and organo-metallic compounds from powder electron diffraction data. Different experimental setups are demonstrated, including selected area electron diffraction (SAED) and nanodiffraction in transmission electron microscopy (TEM) or nanodiffraction in scanning transmission electron microscopy (STEM) modes. The methods were demonstrated on organo-metallic complexes (chlorinated and unchlorinated copper-phthalocyanine) and on purely organic compounds (quinacridone). The PDF curves from powder electron diffraction data, called ePDF, are in good agreement with PDF curves determined from X-ray powder data demonstrating that the problems of obtaining kinematical scattering datamore » and avoiding beam-damage of the sample are possible to resolve.« less
Pearce, J; Taylor, M A; Langley-Evans, S C
2013-10-01
The World Health Organisation recommends exclusive breastfeeding until 6 months of age and continued breastfeeding until 2 years of age or beyond. Appropriate complementary foods should be introduced in a timely fashion, beginning when the infant is 6 months old. In developing countries, early or inappropriate complementary feeding may lead to malnutrition and poor growth, but in countries such as the United Kingdom and United States of America, where obesity is a greater public health concern than malnutrition, the relationship to growth is unclear. We conducted a systematic review of the literature that investigated the relationship between the timing of the introduction of complementary feeding and overweight or obesity during childhood. Electronic databases were searched from inception until 30 September 2012 using specified keywords. Following the application of strict inclusion/exclusion criteria, 23 studies were identified and reviewed by two independent reviewers. Data were extracted and aspects of quality were assessed using an adapted Newcastle-Ottawa scale. Twenty-one of the studies considered the relationship between the time at which complementary foods were introduced and childhood body mass index (BMI), of which five found that introducing complementary foods at <3 months (two studies), 4 months (2 studies) or 20 weeks (one study) was associated with a higher BMI in childhood. Seven of the studies considered the association between complementary feeding and body composition but only one study reported an increase in the percentage of body fat among children given complementary foods before 15 weeks of age. We conclude that there is no clear association between the timing of the introduction of complementary foods and childhood overweight or obesity, but some evidence suggests that very early introduction (at or before 4 months), rather than at 4-6 months or >6 months, may increase the risk of childhood overweight.
Yang, Xin; Zhang, Chi; Wan, Mingjie; Chen, Zhuo; Wang, Zhenlin
2016-07-01
We theoretically and experimentally investigated the optical second-harmonic (SH) diffraction from metasurfaces based on gold complementary split-ring resonators (CSRRs). We have demonstrated that the generated SH currents are mostly parallel to the incident polarization and are asymmetric with respect to the base of a CSRR, thus allowing us to impose the phase change of π on the SH radiation by reversing the CSRR's orientation. We verified this concept of geometry-induced nonlinear phase by designing and fabricating a nonlinear metasurface consisting of supercells of CSRRs with opposite orientations that can function as a SH beam splitter. The ability to control the phase of the local nonlinearity coupled with the high transmittance at both fundamental and SHG wavelengths makes the CSRRs good candidates for the construction of highly efficient three-dimensional nonlinear metamaterials and suitable for applications in nonlinear beam shaping.
NASA Technical Reports Server (NTRS)
Ting, David Z.-Y; Soibel, Alexander; Khoshakhlagh, Arezou; Keo, Sam A.; Nguyen, Jean; Hoglund, Linda; Mumolo, Jason M.; Liu, John K.; Rafol, Sir B.; Hill, Cory J.;
2012-01-01
The InAs/GaSb type-II superlattice based complementary barrier infrared detector (CBIRD) has already demonstrated very good performance in long-wavelength infrared (LWIR) detection. In this work, we describe results on a modified CBIRD device that incorporates a double tunnel junction contact designed for robust device and focal plane array processing. The new device also exhibited reduced turn-on voltage. We also report results on the quantum dot barrier infrared detector (QD-BIRD). By incorporating self-assembled InSb quantum dots into the InAsSb absorber of the standard nBn detector structure, the QD-BIRD extend the detector cutoff wavelength from approximately 4.2 micrometers to 6 micrometers, allowing the coverage of the mid-wavelength infrared (MWIR) transmission window. The device has been observed to show infrared response at 225 K.
Towards a Chemiresistive Sensor-Integrated Electronic Nose: A Review
Chiu, Shih-Wen; Tang, Kea-Tiong
2013-01-01
Electronic noses have potential applications in daily life, but are restricted by their bulky size and high price. This review focuses on the use of chemiresistive gas sensors, metal-oxide semiconductor gas sensors and conductive polymer gas sensors in an electronic nose for system integration to reduce size and cost. The review covers the system design considerations and the complementary metal-oxide-semiconductor integrated technology for a chemiresistive gas sensor electronic nose, including the integrated sensor array, its readout interface, and pattern recognition hardware. In addition, the state-of-the-art technology integrated in the electronic nose is also presented, such as the sensing front-end chip, electronic nose signal processing chip, and the electronic nose system-on-chip. PMID:24152879
Kékedy-Nagy, László; Ferapontova, Elena E; Brand, Izabella
2017-02-23
Unique electronic and ligand recognition properties of the DNA double helix provide basis for DNA applications in biomolecular electronic and biosensor devices. However, the relation between the structure of DNA at electrified interfaces and its electronic properties is still not well understood. Here, potential-driven changes in the submolecular structure of DNA double helices composed of either adenine-thymine (dAdT) 25 or cytosine-guanine (dGdC) 20 base pairs tethered to the gold electrodes are for the first time analyzed by in situ polarization modulation infrared reflection absorption spectroscopy (PM IRRAS) performed under the electrochemical control. It is shown that the conformation of the DNA duplexes tethered to gold electrodes via the C 6 alkanethiol linker strongly depends on the nucleic acid sequence composition. The tilt of purine and pyrimidine rings of the complementary base pairs (dAdT and dGdC) depends on the potential applied to the electrode. By contrast, neither the conformation nor orientation of the ionic in character phosphate-sugar backbone is affected by the electrode potentials. At potentials more positive than the potential of zero charge (pzc), a gradual tilting of the double helix is observed. In this tilted orientation, the planes of the complementary purine and pyrimidine rings lie ideally parallel to each other. These potentials do not affect the integral stability of the DNA double helix at the charged interface. At potentials more negative than the pzc, DNA helices adopt a vertical to the gold surface orientation. Tilt of the purine and pyrimidine rings depends on the composition of the double helix. In monolayers composed of (dAdT) 25 molecules the rings of the complementary base pairs lie parallel to each other. By contrast, the tilt of purine and pyrimidine rings in (dGdC) 20 helices depends on the potential applied to the electrode. Such potential-induced mobility of the complementary base pairs can destabilize the helix structure at a submolecular level. These pioneer results on the potential-driven changes in the submolecular structure of double stranded DNA adsorbed on conductive supports contribute to further understanding of the potential-driven sequence-specific electronic properties of surface-tethered oligonucleotides.
Hybrid electronic/optical synchronized chaos communication system.
Toomey, J P; Kane, D M; Davidović, A; Huntington, E H
2009-04-27
A hybrid electronic/optical system for synchronizing a chaotic receiver to a chaotic transmitter has been demonstrated. The chaotic signal is generated electronically and injected, in addition to a constant bias current, to a semiconductor laser to produce an optical carrier for transmission. The optical chaotic carrier is photodetected to regenerate an electronic signal for synchronization in a matched electronic receiver The system has been successfully used for the transmission and recovery of a chaos masked message that is added to the chaotic optical carrier. Past demonstrations of synchronized chaos based, secure communication systems have used either an electronic chaotic carrier or an optical chaotic carrier (such as the chaotic output of various nonlinear laser systems). This is the first electronic/optical hybrid system to be demonstrated. We call this generation of a chaotic optical carrier by electronic injection.
eV-TEM: Transmission electron microscopy in a low energy cathode lens instrument.
Geelen, Daniël; Thete, Aniket; Schaff, Oliver; Kaiser, Alexander; van der Molen, Sense Jan; Tromp, Rudolf
2015-12-01
We are developing a transmission electron microscope that operates at extremely low electron energies, 0-40 eV. We call this technique eV-TEM. Its feasibility is based on the fact that at very low electron energies the number of energy loss pathways decreases. Hence, the electron inelastic mean free path increases dramatically. eV-TEM will enable us to study elastic and inelastic interactions of electrons with thin samples. With the recent development of aberration correction in cathode lens instruments, a spatial resolution of a few nm appears within range, even for these very low electron energies. Such resolution will be highly relevant to study biological samples such as proteins and cell membranes. The low electron energies minimize adverse effects due to radiation damage. Copyright © 2015. Published by Elsevier B.V.
Charpentier, Elena; Garnaud, Cécile; Wintenberger, Claire; Bailly, Sébastien; Murat, Jean-Benjamin; Rendu, John; Pavese, Patricia; Drouet, Thibault; Augier, Caroline; Malvezzi, Paolo; Thiébaut-Bertrand, Anne; Mallaret, Marie-Reine; Epaulard, Olivier; Cornet, Muriel; Larrat, Sylvie; Maubon, Danièle
2017-08-01
Pneumocystis jirovecii is a major threat for immunocompromised patients, and clusters of pneumocystis pneumonia (PCP) have been increasingly described in transplant units during the past decade. Exploring an outbreak transmission network requires complementary spatiotemporal and strain-typing approaches. We analyzed a PCP outbreak and demonstrated the added value of next-generation sequencing (NGS) for the multilocus sequence typing (MLST) study of P. jirovecii strains. Thirty-two PCP patients were included. Among the 12 solid organ transplant patients, 5 shared a major and unique genotype that was also found as a minor strain in a sixth patient. A transmission map analysis strengthened the suspicion of nosocomial acquisition of this strain for the 6 patients. NGS-MLST enables accurate determination of subpopulation, which allowed excluding other patients from the transmission network. NGS-MLST genotyping approach was essential to deciphering this outbreak. This innovative approach brings new insights for future epidemiologic studies on this uncultivable opportunistic fungus.
Charpentier, Elena; Garnaud, Cécile; Wintenberger, Claire; Bailly, Sébastien; Murat, Jean-Benjamin; Rendu, John; Pavese, Patricia; Drouet, Thibault; Augier, Caroline; Malvezzi, Paolo; Thiébaut-Bertrand, Anne; Mallaret, Marie-Reine; Epaulard, Olivier; Cornet, Muriel; Larrat, Sylvie
2017-01-01
Pneumocystis jirovecii is a major threat for immunocompromised patients, and clusters of pneumocystis pneumonia (PCP) have been increasingly described in transplant units during the past decade. Exploring an outbreak transmission network requires complementary spatiotemporal and strain-typing approaches. We analyzed a PCP outbreak and demonstrated the added value of next-generation sequencing (NGS) for the multilocus sequence typing (MLST) study of P. jirovecii strains. Thirty-two PCP patients were included. Among the 12 solid organ transplant patients, 5 shared a major and unique genotype that was also found as a minor strain in a sixth patient. A transmission map analysis strengthened the suspicion of nosocomial acquisition of this strain for the 6 patients. NGS-MLST enables accurate determination of subpopulation, which allowed excluding other patients from the transmission network. NGS-MLST genotyping approach was essential to deciphering this outbreak. This innovative approach brings new insights for future epidemiologic studies on this uncultivable opportunistic fungus. PMID:28726611
47 CFR 54.5 - Terms and definitions.
Code of Federal Regulations, 2013 CFR
2013-10-01
..., or making available information via telecommunications, and includes electronic publishing, but does... transmission of information as common carriage; (2) The transmission of information as part of a gateway to an... information, but may include data transmission, address translation, protocol conversion, billing management...
47 CFR 54.5 - Terms and definitions.
Code of Federal Regulations, 2014 CFR
2014-10-01
..., or making available information via telecommunications, and includes electronic publishing, but does... transmission of information as common carriage; and (2) The transmission of information as part of a gateway to... content of information, but may include data transmission, address translation, protocol conversion...
47 CFR 54.5 - Terms and definitions.
Code of Federal Regulations, 2012 CFR
2012-10-01
..., or making available information via telecommunications, and includes electronic publishing, but does... transmission of information as common carriage; (2) The transmission of information as part of a gateway to an... information, but may include data transmission, address translation, protocol conversion, billing management...
NASA Astrophysics Data System (ADS)
Peng, Wanli; Zhang, Yanchao; Yang, Zhimin; Chen, Jincan
2018-02-01
Three-terminal energy selective electron (ESE) devices consisting of three electronic reservoirs connected by two energy filters and an electronic conductor with negligible resistance may work as ESE refrigerators and amplifiers. They have three possible connective ways for the electronic conductor and six electronic transmission forms. The configuration of energy filters may be described by the different transmission functions such as the rectangular and Lorentz transmission functions. The ESE devices with three connective ways can be, respectively, regarded as three equivalent hybrid systems composed of an ESE heat engine and an ESE refrigerator/heat pump. With the help of the theory of the ESE devices operated between two electronic reservoirs, the coefficients of performance and cooling rates (heat-pumping rates) of hybrid systems are directly derived. The general performance characteristics of hybrid systems are revealed. The optimal regions of these devices are determined. The performances of the devices with three connective ways of the electronic conductor and two configurations of energy filters are compared in detail. The advantages and disadvantages of each of three-terminal ESE devices are expounded. The results obtained here may provide some guidance for the optimal design and operation of three-terminal ESE devices.
Nga Ng, Tse; Schwartz, David E.; Mei, Ping; Krusor, Brent; Kor, Sivkheng; Veres, Janos; Bröms, Per; Eriksson, Torbjörn; Wang, Yong; Hagel, Olle; Karlsson, Christer
2015-01-01
We have demonstrated a printed electronic tag that monitors time-integrated sensor signals and writes to nonvolatile memories for later readout. The tag is additively fabricated on flexible plastic foil and comprises a thermistor divider, complementary organic circuits, and two nonvolatile memory cells. With a supply voltage below 30 V, the threshold temperatures can be tuned between 0 °C and 80 °C. The time-temperature dose measurement is calibrated for minute-scale integration. The two memory bits are sequentially written in a thermometer code to provide an accumulated dose record. PMID:26307438
NASA Astrophysics Data System (ADS)
Tsai, Jung-Hui
2014-01-01
DC performance of InP/InGaAs metamorphic co-integrated complementary doping-channel field-effect transistors (DCFETs) grown on a low-cost GaAs substrate is first demonstrated. In the complementary DCFETs, the n-channel device was fabricated on the InxGa1-xP metamorphic linearly graded buffer layer and the p-channel field-effect transistor was stacked on the top of the n-channel device. Particularly, the saturation voltage of the n-channel device is substantially reduced to decrease the VOL and VIH values attributed that two-dimensional electron gas is formed and could be modulated in the n-InGaAs channel. Experimentally, a maximum extrinsic transconductance of 215 (17) mS/mm and a maximum saturation current density of 43 (-27) mA/mm are obtained in the n-channel (p-channel) device. Furthermore, the noise margins NMH and NML are up to 0.842 and 0.330 V at a supply voltage of 1.5 V in the complementary logic inverter application.
Towards quantitative PET/MRI: a review of MR-based attenuation correction techniques.
Hofmann, Matthias; Pichler, Bernd; Schölkopf, Bernhard; Beyer, Thomas
2009-03-01
Positron emission tomography (PET) is a fully quantitative technology for imaging metabolic pathways and dynamic processes in vivo. Attenuation correction of raw PET data is a prerequisite for quantification and is typically based on separate transmission measurements. In PET/CT attenuation correction, however, is performed routinely based on the available CT transmission data. Recently, combined PET/magnetic resonance (MR) has been proposed as a viable alternative to PET/CT. Current concepts of PET/MRI do not include CT-like transmission sources and, therefore, alternative methods of PET attenuation correction must be found. This article reviews existing approaches to MR-based attenuation correction (MR-AC). Most groups have proposed MR-AC algorithms for brain PET studies and more recently also for torso PET/MR imaging. Most MR-AC strategies require the use of complementary MR and transmission images, or morphology templates generated from transmission images. We review and discuss these algorithms and point out challenges for using MR-AC in clinical routine. MR-AC is work-in-progress with potentially promising results from a template-based approach applicable to both brain and torso imaging. While efforts are ongoing in making clinically viable MR-AC fully automatic, further studies are required to realize the potential benefits of MR-based motion compensation and partial volume correction of the PET data.
Simulation of exposure and alignment for nanoimprint lithography
NASA Astrophysics Data System (ADS)
Deng, Yunfei; Neureuther, Andrew R.
2002-07-01
Rigorous electromagnetic simulation with TEMPEST is used to examine the exposure and alignment processes for nano-imprint lithography with attenuating thin-film molds. Parameters in the design of topographical features of the nano-imprint system and material choices of the components are analyzed. The small feature size limits light transmission through the feature. While little can be done with auxiliary structures to attract light into small holes, the use of an absorbing material with a low real part of the refractive index such as silver helps mitigates the problem. Results on complementary alignment marks shows that the small transmission through the metal layer and the vertical separation of two alignment marks create the leakage equivalent to 1 nm misalignment but satisfactory alignment can be obtained by measuring alignment signals over a +/- 30 nm range.
USDA-ARS?s Scientific Manuscript database
The objective of this study was to investigate the morphological changes that occurred in Listeria monocytogenes serotype 1/2a cells as visualized by transmission electron microscopy (TEM) after exposure to sublethal heat stress at 48°C for 60 min and in combination with lethal concentration of carv...
Federal Register 2010, 2011, 2012, 2013, 2014
2011-01-13
... Commission encourages electronic filing of comments and has expert eFiling staff available to assist you at... Documents and Filings. An eComment is an easy method for interested persons to submit brief, text-only comments on a project; (2) You may file your comments electronically by using the eFiling feature, which is...
NASA Technical Reports Server (NTRS)
Brearley, Adrian J.
2002-01-01
Energy filtered TEM (Transmission Electron Microscopy) has been used to study the location of carbonaceous material in situ in Murchison matrix. Carbon occurs frequently as narrow rims around sulfide grains, but is rare in regions of matrix that are dominated by phyllosilicates. Additional information is contained in the original extended abstract.
NASA Technical Reports Server (NTRS)
Brearley, A. J.; Abreu, N. M.
2001-01-01
Energy filtered transmission electron microscopy shows that organic matter can be detected in situ in the matrices of carbonaceous chondrites at a spatial resolution of at least 1 nm. In CM chondrites, carbon is often associated with sulfide particles. Additional information is contained in the original extended abstract.
Data and clock transmission interface for the WCDA in LHAASO
NASA Astrophysics Data System (ADS)
Chu, S. P.; Zhao, L.; Jiang, Z. Y.; Ma, C.; Gao, X. S.; Yang, Y. F.; Liu, S. B.; An, Q.
2016-12-01
The Water Cherenkov Detector Array (WCDA) is one of the major components of the Large High Altitude Air Shower Observatory (LHAASO). In the WCDA, 3600 Photomultiplier Tubes (PMTs) and the Front End Electronics (FEEs) are scattered over a 90000 m2 area, while high precision time measurements (0.5 ns RMS) are required in the readout electronics. To meet this requirement, the clock has to be distributed to the FEEs with high precision. Due to the ``triggerless'' architecture, high speed data transfer is required based on the TCP/IP protocol. To simplify the readout electronics architecture and be consistent with the whole LHAASO readout electronics, the White Rabbit (WR) switches are used to transfer clock, data, and commands via a single fiber of about 400 meters. In this paper, a prototype of data and clock transmission interface for LHAASO WCDA is developed. The performance tests are conducted and the results indicate that the clock synchronization precision of the data and clock transmission is better than 50 ps. The data transmission throughput can reach 400 Mbps for one FEE board and 180 Mbps for 4 FEE boards sharing one up link port in WR switch, which is better than the requirement of the LHAASO WCDA.
Effect of a gap opening on the conductance of graphene with magnetic barrier structures
NASA Astrophysics Data System (ADS)
Esmailpour, Mohammad
2018-04-01
In the present study Klein tunneling in a single-layer gapped graphene was investigated by transfer matrix method under normal magnetic field for one and two magnetic barriers. Calculations show that electron transmission through a magnetic barrier is deflected to positive angles and reduces as the magnitude of magnetic field and especially the energy gap increases. This reduction is even more significant in larger fields so that after reaching a specific value of energy gap, an effective confinement for fermions and suppression of Klein tunneling is reached particularly in normal incidence and the conductance becomes zero. Unlike one barrier, the process of tunneling through two magnetic barriers induces symmetric transmission probability versus the incident angle; even, for lower energy gaps, electron transmission probability increases which in turn reduces total conductance via proper changes in the value of the magnetic field and energy gap. In general, it is concluded that confining electrons in asymmetric transmission through one barrier is conducted better than two barriers.
Moretti, Elena; Sutera, Gaetano; Collodel, Giulia
2016-06-01
This review is aimed at discussing the role of ultrastructural studies on human spermatozoa and evaluating transmission electron microscopy as a diagnostic tool that can complete andrology protocols. It is clear that morphological sperm defects may explain decreased fertilizing potential and acquire particular value in the field of male infertility. Electron microscopy is the best method to identify systematic or monomorphic and non-systematic or polymorphic sperm defects. The systematic defects are characterized by a particular anomaly that affects the vast majority of spermatozoa in a semen sample, whereas a heterogeneous combination of head and tail defects found in variable percentages are typically non-systematic or polymorphic sperm defects. A correct diagnosis of these specific sperm alterations is important for choosing the male infertility's therapy and for deciding to turn to assisted reproduction techniques. Transmission electron microscopy (TEM) also represents a valuable method to explore the in vitro effects of different compounds (for example drugs with potential spermicidal activity) on the morphology of human spermatozoa. Finally, TEM used in combination with immunohistochemical techniques, integrates structural and functional aspects that provide a wide horizon in the understanding of sperm physiology and pathology. transmission electron microscopy: TEM; World Health Organization: WHO; light microscopy: LM; motile sperm organelle morphology examination: MSOME; intracytoplasmic morphologically selected sperm injection: IMSI; intracytoplasmic sperm injection: ICSI; dysplasia of fibrous sheath: DFS; primary ciliary dyskinesia: PCD; outer dense fibers: ODF; assisted reproduction technologies: ART; scanning electron microscopy: SEM; polyvinylpirrolidone: PVP; tert-butylhydroperoxide: TBHP.
de Winter, D A Matthijs; Mesman, Rob J; Hayles, Michael F; Schneijdenberg, Chris T W M; Mathisen, Cliff; Post, Jan A
2013-07-01
Recently a number of new approaches have been presented with the intention to produce electron beam transparent cryo-sections (lamellas in FIB-SEM terminology) from hydrated vitreously frozen cryo samples with a Focused Ion Beam (FIB) system, suitable for cryo-Transmission Electron Microscopy (cryo-TEM). As the workflow is still challenging and time consuming, it is important to be able to determine the integrity and suitability (cells vs. no cells; vitreous vs. crystalline) of the lamellas. Here we present an in situ method that tests both conditions by using the cryo-Scanning Electron Microscope (cryo-SEM) in transmission mode (TSEM; Transmission Scanning Electron Microscope) once the FIB-made lamella is ready. Cryo-TSEM imaging of unstained cells yields strong contrast, enabling direct imaging of material present in the lamellas. In addition, orientation contrast is shown to be suitable for distinguishing crystalline lamellas from vitreous lamellas. Tilting the stage a few degrees results in changes of contrast between ice grains as a function of the tilt angle, whereas the contrast of areas with vitreous ice remains unchanged as a function of the tilt angle. This orientation contrast has subsequently been validated by cryo-Electron BackScattered Diffraction (EBSD) in transmission mode. Integration of the presented method is discussed and the role it can play in future developments for a new and innovative all-in-one cryo-FIB-SEM life sciences instrument. Copyright © 2013 Elsevier Inc. All rights reserved.
Introduction of new food textures during complementary feeding: Observations in France.
Marduel Boulanger, A; Vernet, M
2018-01-01
Complementary feeding plays a crucial role in the development of infants and toddlers and studies suggest benefits specific to the introduction of food textures. Evaluate the recommendations given to parents, their practices, and their attitudes towards the introduction of food textures during complementary feeding in France. This was a cross-sectional pilot study conducted in 2013. One hundred and eighty-one parents with at least one child aged 6-36 months living in France completed an ad hoc questionnaire. Eighty-eight percent of the parents surveyed received oral information on complementary feeding, but only 46% received such information on the introduction of food textures. Pediatricians were the most frequently listed source of oral information on complementary feeding. More than half the parents also looked for additional information in books and on the internet. While oral recommendations matched parents' practices, they seemed to occur at a later age compared to infants' physiological ability to handle new textures. The quality of information on food texture advice available in paper and electronic formats evaluated using a 4-point scale was found to be limited. Introducing new food texture was spontaneously reported as the most common difficulty in complementary feeding (16%). Fear of choking when first introducing food pieces was reported by 54% of the parents. The parents' lack of information on the introduction of food textures, as well as their fear that their child may choke, should encourage providing new recommendations in France. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
NASA Astrophysics Data System (ADS)
Corricelli, M.; Depalo, N.; di Carlo, E.; Fanizza, E.; Laquintana, V.; Denora, N.; Agostiano, A.; Striccoli, M.; Curri, M. L.
2014-06-01
Nanoparticles (NPs) emitting in the second biological near infrared (NIR) window of the electromagnetic spectrum have been successfully synthesized by growing a silica shell on the hydrophobic surface of OLEA/TOP PbS nanocrystals (NCs), by means of a reverse microemulsion approach, and subsequently decorated with biotin molecules. The fabrication of very uniform and monodisperse NPs, formed of SiO2 shell coated single core PbS NCs, has been demonstrated by means of a set of complementary optical and structural techniques (Vis-NIR absorption and photoluminescence spectroscopy, transmission electron microscopy) that have highlighted how experimental parameters, such as PbS NC and silica precursor concentration, are crucial to direct the morphology and optical properties of silica coated PbS NPs. Subsequently, the silica surface of the core-shell NPs has been grafted with amino groups, in order to achieve covalent binding of biotin to NIR emitting silica coated NPs. Finally the successful reaction with a green-fluorescent labelled streptavidin has verified the molecular recognition response of the biotin molecules decorating the PbS@SiO2 NP surface. Dynamic light scattering (DLS) and ζ-potential techniques have been used to monitor the hydrodynamic diameter and colloidal stability of both PbS@SiO2 and biotin decorated NPs, showing their high colloidal stability in physiological media, as needed for biomedical applications. Remarkably the obtained biotinylated PbS@SiO2 NPs have been found to retain emission properties in the `second optical window' of the NIR region of the electromagnetic spectrum, thus representing attractive receptor-targeted NIR fluorescent probes for in vivo tumour imaging.Nanoparticles (NPs) emitting in the second biological near infrared (NIR) window of the electromagnetic spectrum have been successfully synthesized by growing a silica shell on the hydrophobic surface of OLEA/TOP PbS nanocrystals (NCs), by means of a reverse microemulsion approach, and subsequently decorated with biotin molecules. The fabrication of very uniform and monodisperse NPs, formed of SiO2 shell coated single core PbS NCs, has been demonstrated by means of a set of complementary optical and structural techniques (Vis-NIR absorption and photoluminescence spectroscopy, transmission electron microscopy) that have highlighted how experimental parameters, such as PbS NC and silica precursor concentration, are crucial to direct the morphology and optical properties of silica coated PbS NPs. Subsequently, the silica surface of the core-shell NPs has been grafted with amino groups, in order to achieve covalent binding of biotin to NIR emitting silica coated NPs. Finally the successful reaction with a green-fluorescent labelled streptavidin has verified the molecular recognition response of the biotin molecules decorating the PbS@SiO2 NP surface. Dynamic light scattering (DLS) and ζ-potential techniques have been used to monitor the hydrodynamic diameter and colloidal stability of both PbS@SiO2 and biotin decorated NPs, showing their high colloidal stability in physiological media, as needed for biomedical applications. Remarkably the obtained biotinylated PbS@SiO2 NPs have been found to retain emission properties in the `second optical window' of the NIR region of the electromagnetic spectrum, thus representing attractive receptor-targeted NIR fluorescent probes for in vivo tumour imaging. Electronic supplementary information (ESI) available: Size statistical analysis of silanized PbS NPs, TLC plate showing the ninhydrin test results and a table summarizing the DH and ζ-potential values for the investigated samples. See DOI: 10.1039/c4nr01025f
Effect of contact area on electron transport through graphene-metal interface.
Liu, Hongmei; Kondo, Hisashi; Ohno, Takahisa
2013-08-21
We perform first-principles investigations of electron transport in armchair graphene nanoribbons adsorbed on Cu(111) and Ni(111) surfaces with various contact areas. We find that the contact area between metals and graphene has different influences on the conductance. The Cu-graphene system shows an increase in differential conductance for more contact area at a low bias voltage, primarily originating from the shift of transmission peaks relative to the Fermi energy. As the bias increases, there is an irregular change of conductance, including a weak negative differential conductance for more contact area. In contrast, the conductance of the Ni-graphene junction is monotonically enhanced with increasing overlap area. The minority spin which shows a broad transmission is responsible for the conductance increase of Ni-graphene. These behaviors can be attributed to different mechanisms of the interfacial electron transport: Charge transfer between graphene and Cu largely dominates the transmission enhancement of Cu-graphene, whereas hybridization between graphene and Ni states plays a more important role in the transmission enhancement of Ni-graphene. The different behaviors of transmission increase correlate with not only the strength of the graphene-metal interaction but also the location of metal d states.
Writing silica structures in liquid with scanning transmission electron microscopy.
van de Put, Marcel W P; Carcouët, Camille C M C; Bomans, Paul H H; Friedrich, Heiner; de Jonge, Niels; Sommerdijk, Nico A J M
2015-02-04
Silica nanoparticles are imaged in solution with scanning transmission electron microscopy (STEM) using a liquid cell with silicon nitride (SiN) membrane windows. The STEM images reveal that silica structures are deposited in well-defined patches on the upper SiN membranes upon electron beam irradiation. The thickness of the deposits is linear with the applied electron dose. Scanning electron microscopy (SEM) and atomic force microscopy (AFM) demonstrate that the deposited patches are a result of the merging of the original 20 nm-diameter nanoparticles, and that the related surface roughness depends on the electron dose rate used. Using this approach, sub-micrometer scale structures are written on the SiN in liquid by controlling the electron exposure as function of the lateral position. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Wang, Qing; Kitaura, Ryo; Suzuki, Shoji; Miyauchi, Yuhei; Matsuda, Kazunari; Yamamoto, Yuta; Arai, Shigeo; Shinohara, Hisanori
2016-01-26
Edge-dependent electronic properties of graphene nanoribbons (GNRs) have attracted intense interests. To fully understand the electronic properties of GNRs, the combination of precise structural characterization and electronic property measurement is essential. For this purpose, two experimental techniques using free-standing GNR devices have been developed, which leads to the simultaneous characterization of electronic properties and structures of GNRs. Free-standing graphene has been sculpted by a focused electron beam in transmission electron microscope (TEM) and then purified and narrowed by Joule heating down to several nanometer width. Structure-dependent electronic properties are observed in TEM, and significant increase in sheet resistance and semiconducting behavior become more salient as the width of GNR decreases. The narrowest GNR width we obtained with the present method is about 1.6 nm with a large transport gap of 400 meV.
Note on in situ (scanning) transmission electron microscopy study of liquid samples.
Jiang, Nan
2017-08-01
Liquid cell (scanning) transmission electron microscopy has been developed rapidly, using amorphous SiN x membranes as electron transparent windows. The current interpretations of electron beam effects are mainly based on radiolytic processes. In this note, additional effects of the electric field due to electron-beam irradiation are discussed. The electric field can be produced by the charge accumulation due to the emission of secondary and Auger electrons. Besides various beam-induced phenomena, such as nanoparticle precipitation and gas bubble formation and motion, two other effects need to be considered; one is the change of Gibbs free energy of nucleation and the other is the violation of Brownian motion due to ion drifting driven by the electric field. Copyright © 2017 Elsevier B.V. All rights reserved.
Scholl, A; Marcus, M A; Doran, A; Nasiatka, J R; Young, A T; MacDowell, A A; Streubel, R; Kent, N; Feng, J; Wan, W; Padmore, H A
2018-05-01
Aberration correction by an electron mirror dramatically improves the spatial resolution and transmission of photoemission electron microscopes. We will review the performance of the recently installed aberration corrector of the X-ray Photoemission Electron Microscope PEEM-3 and show a large improvement in the efficiency of the electron optics. Hartmann testing is introduced as a quantitative method to measure the geometrical aberrations of a cathode lens electron microscope. We find that aberration correction leads to an order of magnitude reduction of the spherical aberrations, suggesting that a spatial resolution of below 100 nm is possible at 100% transmission of the optics when using x-rays. We demonstrate this improved performance by imaging test patterns employing element and magnetic contrast. Published by Elsevier B.V.
Complementary aspects of spatial resolution and signal-to-noise ratio in computational imaging
NASA Astrophysics Data System (ADS)
Gureyev, T. E.; Paganin, D. M.; Kozlov, A.; Nesterets, Ya. I.; Quiney, H. M.
2018-05-01
A generic computational imaging setup is considered which assumes sequential illumination of a semitransparent object by an arbitrary set of structured coherent illumination patterns. For each incident illumination pattern, all transmitted light is collected by a photon-counting bucket (single-pixel) detector. The transmission coefficients measured in this way are then used to reconstruct the spatial distribution of the object's projected transmission. It is demonstrated that the square of the spatial resolution of such a setup is usually equal to the ratio of the image area to the number of linearly independent illumination patterns. If the noise in the measured transmission coefficients is dominated by photon shot noise, then the ratio of the square of the mean signal to the noise variance is proportional to the ratio of the mean number of registered photons to the number of illumination patterns. The signal-to-noise ratio in a reconstructed transmission distribution is always lower if the illumination patterns are nonorthogonal, because of spatial correlations in the measured data. Examples of imaging methods relevant to the presented analysis include conventional imaging with a pixelated detector, computational ghost imaging, compressive sensing, super-resolution imaging, and computed tomography.
Room temperature chemical synthesis of lead selenide thin films with preferred orientation
NASA Astrophysics Data System (ADS)
Kale, R. B.; Sartale, S. D.; Ganesan, V.; Lokhande, C. D.; Lin, Yi-Feng; Lu, Shih-Yuan
2006-11-01
Room temperature chemical synthesis of PbSe thin films was carried out from aqueous ammoniacal solution using Pb(CH3COO)2 as Pb2+ and Na2SeSO3 as Se2- ion sources. The films were characterized by a various techniques including, X-ray diffraction (XRD), energy dispersive X-ray analysis (EDAX), scanning electron microscopy (SEM), transmission electron microscopy (TEM), high resolution transmission electron microscopy (HR-TEM), selected area electron diffraction (SAED), Fast Fourier transform (FFT) and UV-vis-NIR techniques. The study revealed that the PbSe thin film consists of preferentially oriented nanocubes with energy band gap of 0.5 eV.
Shiojiri, M; Saijo, H
2006-09-01
The first part of this paper is devoted to physics, to explain high-angle annular dark-field scanning transmission electron microscopy (HAADF-STEM) imaging and to interpret why HAADF-STEM imaging is incoherent, instructing a strict definition of interference and coherence of electron waves. Next, we present our recent investigations of InGaN/GaN multiple quantum wells and AlGaN/GaN strained-layer superlattice claddings in GaN-based violet laser diodes, which have been performed by HAADF-STEM and high-resolution field-emission gun scanning electron microscopy.
Quantitative Cryo-Scanning Transmission Electron Microscopy of Biological Materials.
Elbaum, Michael
2018-05-11
Electron tomography provides a detailed view into the 3D structure of biological cells and tissues. Physical fixation by vitrification of the aqueous medium provides the most faithful preservation of biological specimens in the native, fully hydrated state. Cryo-microscopy is challenging, however, because of the sensitivity to electron irradiation and due to the weak electron scattering of organic material. Tomography is even more challenging because of the dependence on multiple exposures of the same area. Tomographic imaging is typically performed in wide-field transmission electron microscopy (TEM) mode with phase contrast generated by defocus. Scanning transmission electron microscopy (STEM) is an alternative mode based on detection of scattering from a focused probe beam, without imaging optics following the specimen. While careful configuration of the illumination and detectors is required to generate useful contrast, STEM circumvents the major restrictions of phase contrast TEM to very thin specimens and provides a signal that is more simply interpreted in terms of local composition and density. STEM has gained popularity in recent years for materials science. The extension of STEM to cryomicroscopy and tomography of cells and macromolecules is summarized herein. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Peckys, Diana B; de Jonge, Niels
2014-04-01
Scanning transmission electron microscopy (STEM) of specimens in liquid, so-called Liquid STEM, is capable of imaging the individual subunits of macromolecular complexes in whole eukaryotic cells in liquid. This paper discusses this new microscopy modality within the context of state-of-the-art microscopy of cells. The principle of operation and equations for the resolution are described. The obtained images are different from those acquired with standard transmission electron microscopy showing the cellular ultrastructure. Instead, contrast is obtained on specific labels. Images can be recorded in two ways, either via STEM at 200 keV electron beam energy using a microfluidic chamber enclosing the cells, or via environmental scanning electron microscopy at 30 keV of cells in a wet environment. The first series of experiments involved the epidermal growth factor receptor labeled with gold nanoparticles. The labels were imaged in whole fixed cells with nanometer resolution. Since the cells can be kept alive in the microfluidic chamber, it is also feasible to detect the labels in unfixed, live cells. The rapid sample preparation and imaging allows studies of multiple whole cells.
Dukes, Madeline J; Peckys, Diana B; de Jonge, Niels
2010-07-27
Correlative fluorescence microscopy and transmission electron microscopy (TEM) is a state-of-the-art microscopy methodology to study cellular function, combining the functionality of light microscopy with the high resolution of electron microscopy. However, this technique involves complex sample preparation procedures due to its need for either thin sections or frozen samples for TEM imaging. Here, we introduce a novel correlative approach capable of imaging whole eukaryotic cells in liquid with fluorescence microscopy and with scanning transmission electron microscopy (STEM); there is no additional sample preparation necessary for the electron microscopy. Quantum dots (QDs) were bound to epidermal growth factor (EGF) receptors of COS7 fibroblast cells. Fixed whole cells in saline water were imaged with fluorescence microscopy and subsequently with STEM. The STEM images were correlated with fluorescence images of the same cellular regions. QDs of dimensions 7x12 nm were visible in a 5 microm thick layer of saline water, consistent with calculations. A spatial resolution of 3 nm was achieved on the QDs.
Dukes, Madeline J.; Peckys, Diana B.; de Jonge, Niels
2010-01-01
Correlative fluorescence microscopy and transmission electron microscopy (TEM) is a state-of-the-art microscopy methodology to study cellular function, combining the functionality of light microscopy with the high resolution of electron microscopy. However, this technique involves complex sample preparation procedures due to its need for either thin sections or frozen samples for TEM imaging. Here, we introduce a novel correlative approach capable of imaging whole eukaryotic cells in liquid with fluorescence microscopy and with scanning transmission electron microscopy (STEM); there is no additional sample preparation necessary for the electron microscopy. Quantum dots (QDs) were bound to epidermal growth factor (EGF) receptors of COS7 fibroblast cells. Fixed whole cells in saline water were imaged with fluorescence microscopy and subsequently with STEM. The STEM images were correlated with fluorescence images of the same cellular regions. QDs of dimensions 7 × 12 nm were visible in a 5 μm thick layer of saline water, consistent with calculations. A spatial resolution of 3 nm was achieved on the QDs. PMID:20550177
Arkill, Kenton P.; Mantell, Judith M.; Plant, Simon R.; Verkade, Paul; Palmer, Richard E.
2015-01-01
A three-dimensional reconstruction of a nano-scale aqueous object can be achieved by taking a series of transmission electron micrographs tilted at different angles in vitreous ice: cryo-Transmission Electron Tomography. Presented here is a novel method of fine alignment for the tilt series. Size-selected gold clusters of ~2.7 nm (Au561 ± 14), ~3.2 nm (Au923 ± 22), and ~4.3 nm (Au2057 ± 45) in diameter were deposited onto separate graphene oxide films overlaying holes on amorphous carbon grids. After plunge freezing and subsequent transfer to cryo-Transmission Electron Tomography, the resulting tomograms have excellent (de-)focus and alignment properties during automatic acquisition. Fine alignment is accurate when the evenly distributed 3.2 nm gold particles are used as fiducial markers, demonstrated with a reconstruction of a tobacco mosaic virus. Using a graphene oxide film means the fiducial markers are not interfering with the ice bound sample and that automated collection is consistent. The use of pre-deposited size-selected clusters means there is no aggregation and a user defined concentration. The size-selected clusters are mono-dispersed and can be produced in a wide size range including 2–5 nm in diameter. The use of size-selected clusters on a graphene oxide films represents a significant technical advance for 3D cryo-electron microscopy. PMID:25783049
Miyai, K; Abraham, J L; Linthicum, D S; Wagner, R M
1976-10-01
Several methods of tissue preparation and different modes of operation of the scanning electron microscope were used to study the ultrastructure of rat liver. Rat livers were perfusion fixed with buffered 2 per cent paraformaldehyde or a mixture of 1.5 per cent paraformaldehyde and 1 per cent glutaraldehyde and processed as follows. Tissue blocks were postfixed in buffered 2 per cent osmium tetroxide followed sequentially by the ligand-mediated osmium binding technique, dehydration and cryofracture in ethanol, and critical point drying. They were then examined without metal coating in the scanning electron microscope operating in the secondary electron and backscattered electron modes. Fifty-micrometer sections were cut with a tissue sectioner, stained with lead citrate, postfixed with osmium, dehydrated, critical point dried, and examined in the secondary electron and back-scattered electron modes. Frozen sections (0.25 to 0.75 mum. thick) were cut by the method of Tokuyasu (Toluyasu KT: J Cell Biol 57:551, 1973) and their scanning transmission electron microscope images were examined either with a scanning transmission electron microscope detector or with a conversion stub using the secondary electron detector. Secondary electron images of the liver prepared by ligand-mediated osmium binding and subsequent cryofracture revealed such intracellular structures as cisternae of the endoplasmic reticulum, lysosomes, mitochondria, lipid droplets, nucleolus and nuclear chromatin, as well as the usual surface morphology, Lipocytes in the perisinusoidal space were readily identified. Backscattered electron images. Unembedded frozen sections had little drying artifact and were virtually free of freezing damage. The scanning transmission electron microscope image revealed those organelles visualized by the secondary electron mode in the ligand-mediated osmium binding-treated tissue.
Structural, morphological and optical properties of chromium oxide nanoparticles
DOE Office of Scientific and Technical Information (OSTI.GOV)
Babukutty, Blessy; Parakkal, Fasalurahman; Nair, Swapna S., E-mail: swapna.s.nair@gmail.com
2015-06-24
Chromium oxide nanoparticles are synthesized by reduction route from chloride precursors with surfactant, trioctylphosphine oxide (TOPO). Structural and morphological characterization are analyzed using X-ray Diffraction (XRD) and Transmission Electron Microscopy (TEM). Transmission Electron micrographs show that the average grain size lies in the range 5nm to 10nm. Optical characterization has been done by UV-VIS spectrophotometer. Distinct optical absorptions of Cr{sup 3+} ions show hinting towards the presence of Cr{sub 2}O{sub 3}. Presence of oxygen is also confirmed from Electron Energy Loss Spectroscopy (EELS) studies.
Scanning transmission electron microscopy: Albert Crewe's vision and beyond.
Krivanek, Ondrej L; Chisholm, Matthew F; Murfitt, Matthew F; Dellby, Niklas
2012-12-01
Some four decades were needed to catch up with the vision that Albert Crewe and his group had for the scanning transmission electron microscope (STEM) in the nineteen sixties and seventies: attaining 0.5Å resolution, and identifying single atoms spectroscopically. With these goals now attained, STEM developments are turning toward new directions, such as rapid atomic resolution imaging and exploring atomic bonding and electronic properties of samples at atomic resolution. The accomplishments and the future challenges are reviewed and illustrated with practical examples. Copyright © 2012 Elsevier B.V. All rights reserved.
Porto Ferreira, Cassio; Oliveira de Almeida, Ana Cristina; Corte-Real, Suzana
2015-01-01
Transmission electron microscopy can yield useful information in a range of scientific fields; it is capable of imaging at a significantly higher resolution than light microscopes and has been a very useful tool in the identification of morphological changes of the dermis as well as assessment of changes in the extracellular matrix. Our aim is to characterize by electron microscopy the cellular profile of lesions caused by Sporothrix schenckii from the sporotrichosis epidemic in its zoonotic form that occurs in Rio de Janeiro, Brazil. PMID:25653392
NASA Technical Reports Server (NTRS)
Heinemann, K.
1987-01-01
The detection and size analysis of small metal particles supported on amorphous substrates becomes increasingly difficult when the particle size approaches that of the phase contrast background structures of the support. An approach of digital image analysis, involving Fourier transformation of the original image, filtering, and image reconstruction was studied with respect to the likelihood of unambiguously detecting particles of less than 1 nm diameter on amorphous substrates from a single electron micrograph.
Krausko, Ján; Runštuk, Jiří; Neděla, Vilém; Klán, Petr; Heger, Dominik
2014-05-20
Observation of a uranyl-salt brine layer on an ice surface using backscattered electron detection and ice surface morphology using secondary-electron detection under equilibrium conditions was facilitated using an environmental scanning electron microscope (ESEM) at temperatures above 250 K and pressures of hundreds of Pa. The micrographs of a brine layer over ice grains prepared by either slow or shock freezing provided a complementary picture of the contaminated ice grain boundaries. Fluorescence spectroscopy of the uranyl ions in the brine layer confirmed that the species exists predominately in the solvated state under experimental conditions of ESEM.
Application of He ion microscopy for material analysis
NASA Astrophysics Data System (ADS)
Altmann, F.; Simon, M.; Klengel, R.
2009-05-01
Helium ion beam microscopy (HIM) is a new high resolution imaging technique. The use of Helium ions instead of electrons enables none destructive imaging combined with contrasts quite similar to that from Gallium ion beam imaging. The use of very low probe currents and the comfortable charge compensation using low energy electrons offer imaging of none conductive samples without conductive coating. An ongoing microelectronic sample with Gold/Aluminum interconnects and polymer electronic devices were chosen to evaluate HIM in comparison to scanning electron microscopy (SEM). The aim was to look for key applications of HIM in material analysis. Main focus was on complementary contrast mechanisms and imaging of none conductive samples.
Molecular characterization of organic electronic films.
DeLongchamp, Dean M; Kline, R Joseph; Fischer, Daniel A; Richter, Lee J; Toney, Michael F
2011-01-18
Organic electronics have emerged as a viable competitor to amorphous silicon for the active layer in low-cost electronics. The critical performance of organic electronic materials is closely related to their morphology and molecular packing. Unlike their inorganic counterparts, polymers combine complex repeat unit structure and crystalline disorder. This combination prevents any single technique from being able to uniquely solve the packing arrangement of the molecules. Here, a general methodology for combining multiple, complementary techniques that provide accurate unit cell dimensions and molecular orientation is described. The combination of measurements results in a nearly complete picture of the organic film morphology. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Weiner, Rebecca G.; Chen, Dennis P.; Unocic, Raymond R.; ...
2016-04-01
In situ liquid cell scanning transmission electron microscopy probes seeded growth in real time. The growth of Pd on Au nanocubes is monitored as a model system to compare growth within a liquid cell and traditional colloidal synthesis. Furthermore, different growth patterns are observed due to seed immobilization and the highly reducing environment within the liquid cell.
Highlighting material structure with transmission electron diffraction correlation coefficient maps.
Kiss, Ákos K; Rauch, Edgar F; Lábár, János L
2016-04-01
Correlation coefficient maps are constructed by computing the differences between neighboring diffraction patterns collected in a transmission electron microscope in scanning mode. The maps are shown to highlight material structural features like grain boundaries, second phase particles or dislocations. The inclination of the inner crystal interfaces are directly deduced from the resulting contrast. Copyright © 2016 Elsevier B.V. All rights reserved.
Electron-Beam Produced Air Plasma: Optical Measurement of Beam Current
NASA Astrophysics Data System (ADS)
Vidmar, Robert; Stalder, Kenneth; Seeley, Megan
2006-10-01
Experiments to quantify the electron beam current and distribution of beam current in air plasma are discussed. The air plasma is produced by a 100-keV 10-mA electron beam source that traverses a transmission window into a chamber with air as a target gas. Air pressure is between 1 mTorr and 760 Torr. Strong optical emissions due to electron impact ionization are observed for the N2 2^nd positive line at 337.1 nm and the N2^+ 1^st negative line at 391.4 nm. Calibration of optical emissions using signals from the isolated transmission window and a Faraday plate are discussed. The calibrated optical system is then used to quantify the electron distribution in the air plasma.
Scanning electron microscope observation of dislocations in semiconductor and metal materials.
Kuwano, Noriyuki; Itakura, Masaru; Nagatomo, Yoshiyuki; Tachibana, Shigeaki
2010-08-01
Scanning electron microscope (SEM) image contrasts have been investigated for dislocations in semiconductor and metal materials. It is revealed that single dislocations can be observed in a high contrast in SEM images formed by backscattered electrons (BSE) under the condition of a normal configuration of SEM. The BSE images of dislocations were compared with those of the transmission electron microscope and scanning transmission electron microscope (STEM) and the dependence of BSE image contrast on the tilting of specimen was examined to discuss the origin of image contrast. From the experimental results, it is concluded that the BSE images of single dislocations are attributed to the diffraction effect and related with high-angle dark-field images of STEM.
GC/HRSIR as a Complementary Technique to GC/ECNIMS
Gas chromatography/electron capture negative ion mass spectrometry (GC/ECNIMS) is a highly selective and sensitive technique for the analysis of appropriate analytes in complex matrices. Its major drawback is often the lack of fragmentation indicative of structure that can be use...
Electron transfer of plurimodified DNA SAMs.
Rospigliosi, Alessandro; Ehlich, Rudolf; Hoerber, Heinrich; Middelberg, Anton; Moggridge, Geoff
2007-07-17
An STM-based current-voltage (I/V) investigation of deoxyribonucleic acid (DNA) 18 base pair (bp) oligonucleotide monolayers on gold is presented. Three bases of each of the immobilized and complementary strands were modified with either iodine or phenylethylene moieties. The oligonucleotides were immobilized on template stripped gold (tsg) surfaces and characterized by atomic force microscopy (AFM) and scanning tunneling microscopy (STM). AFM imaging showed that monolayers of the expected height were formed. A comparative study of normal, halogenated, and phenyl-modified DNA was made with the STM in tunneling spectroscopy (TS) mode. I/V spectroscopic measurements in the range +/-250 mV on both single- and double-stranded (ds) DNA monolayers (modified and unmodified) showed that for negative substrate bias (U(sub)) electron transfer is more efficient through a phenyl-modified monolayer than through normal or halogenated DNA. This effect was particularly clear below a threshold bias of -100 mV. For positive U(sub), unmodified ds DNA was found to conduct slightly better than the modified strands. This is presumably caused by greater order in the unmodified versus modified DNA monolayers. Modifications on the immobilized (thiolated) strand seem to improve electron transport through the DNA monolayer more than modifications on the complementary (not surface-bound) strand.
Pryor, Alan; Ophus, Colin; Miao, Jianwei
2017-10-25
Simulation of atomic-resolution image formation in scanning transmission electron microscopy can require significant computation times using traditional methods. A recently developed method, termed plane-wave reciprocal-space interpolated scattering matrix (PRISM), demonstrates potential for significant acceleration of such simulations with negligible loss of accuracy. In this paper, we present a software package called Prismatic for parallelized simulation of image formation in scanning transmission electron microscopy (STEM) using both the PRISM and multislice methods. By distributing the workload between multiple CUDA-enabled GPUs and multicore processors, accelerations as high as 1000 × for PRISM and 15 × for multislice are achieved relative to traditionalmore » multislice implementations using a single 4-GPU machine. We demonstrate a potentially important application of Prismatic, using it to compute images for atomic electron tomography at sufficient speeds to include in the reconstruction pipeline. Prismatic is freely available both as an open-source CUDA/C++ package with a graphical user interface and as a Python package, PyPrismatic.« less
Room Temperature Ferromagnetism of Fe Doped Indium Tin Oxide Based on Dispersed Fe3O4 Nanoparticles
NASA Astrophysics Data System (ADS)
Okada, Koichi; Kohiki, Shigemi; Nishi, Sachio; Shimooka, Hirokazu; Deguchi, Hiroyuki; Mitome, Masanori; Bando, Yoshio; Shishido, Toetsu
2007-09-01
Transmission electron microscopy revealed that Fe3O4 nanoparticles with diameter of ≈200 nm dispersed in Fe doped indium tin oxide (Fe@ITO) powders exhibiting co-occurrence of room temperature ferromagnetism and superparamagnetism. Although we observed no X-ray diffraction peak from Fe related compounds for Fe0.19@ITO (ITO: In1.9Sn0.1O3) powders, the powders showed both hysteresis loop in field dependent magnetization at 300 K and divergence of zero-field-cooled magnetization from field-cooled magnetization. Scanning transmission electron microscopy with energy dispersive X-ray spectroscopy demonstrated that the nanoparticle with diameter of ≈200 nm consists of Fe and oxygen. Transmission electron diffraction revealed that crystal structure of the nanoparticle is inverse spinel type Fe3O4. The Fe3O4 crystalline phase by electron diffraction is consistent with the saturation magnetization of 1.3 μB/Fe and magnetic anomaly at ≈110 K observed for the powders.
Jikiken /EXOS-B/ observation of Siple transmissions
NASA Technical Reports Server (NTRS)
Kimura, I.; Matsumoto, H.; Hashimoto, K.; Mukai, T.; Helliwell, R. A.; Bell, T. F.; Inan, U. S.; Katsufrakis, J. P.
1981-01-01
Preliminary results of observations by the Japanese magnetospheric satellite Jikiken (EXOS-B) of Siple transmissions and VLF emissions triggered by the Siple signals are reviewed. The experiments discussed were carried out in July, August, and September of 1979 and in December 1979 and January 1980. Only four events concentrated within the period from August 14 to 18 were found in which triggered emissions were associated with Siple transmissions. The electron distributions observed on the equatorial crossing passes, when Siple triggered emissions were detected, suggest that the cyclotron resonance condition is satisfied for Siple signals and electrons of energy around 1 keV or less, provided the interaction region is inside the plasmapause. It is noted that if these emissions were generated outside the plasmapause, electron energies much higher than 10 keV would be necessary for the cyclotron interaction, which were above the range of the measurements. For the high latitude passes of August 14 and 17, the electron fluxes were found to be very small.
Pryor, Alan; Ophus, Colin; Miao, Jianwei
2017-01-01
Simulation of atomic-resolution image formation in scanning transmission electron microscopy can require significant computation times using traditional methods. A recently developed method, termed plane-wave reciprocal-space interpolated scattering matrix (PRISM), demonstrates potential for significant acceleration of such simulations with negligible loss of accuracy. Here, we present a software package called Prismatic for parallelized simulation of image formation in scanning transmission electron microscopy (STEM) using both the PRISM and multislice methods. By distributing the workload between multiple CUDA-enabled GPUs and multicore processors, accelerations as high as 1000 × for PRISM and 15 × for multislice are achieved relative to traditional multislice implementations using a single 4-GPU machine. We demonstrate a potentially important application of Prismatic , using it to compute images for atomic electron tomography at sufficient speeds to include in the reconstruction pipeline. Prismatic is freely available both as an open-source CUDA/C++ package with a graphical user interface and as a Python package, PyPrismatic .
Chu, Ming-Wen; Chen, Cheng Hsuan
2013-06-25
With innovative modern material-growth methods, a broad spectrum of fascinating materials with reduced dimensions-ranging from single-atom catalysts, nanoplasmonic and nanophotonic materials to two-dimensional heterostructural interfaces-is continually emerging and extending the new frontiers of materials research. A persistent central challenge in this grand scientific context has been the detailed characterization of the individual objects in these materials with the highest spatial resolution, a problem prompting the need for experimental techniques that integrate both microscopic and spectroscopic capabilities. To date, several representative microscopy-spectroscopy combinations have become available, such as scanning tunneling microscopy, tip-enhanced scanning optical microscopy, atom probe tomography, scanning transmission X-ray microscopy, and scanning transmission electron microscopy (STEM). Among these tools, STEM boasts unique chemical and electronic sensitivity at unparalleled resolution. In this Perspective, we elucidate the advances in STEM and chemical mapping applications at the atomic scale by energy-dispersive X-ray spectroscopy and electron energy loss spectroscopy with a focus on the ultimate challenge of chemical quantification with atomic accuracy.
Zimmermann, Katrin; Jordan, Anna; Gay, Frédéric; Watanabe, Kenji; Taniguchi, Takashi; Han, Zheng; Bouchiat, Vincent; Sellier, Hermann; Sacépé, Benjamin
2017-04-13
Charge carriers in the quantum Hall regime propagate via one-dimensional conducting channels that form along the edges of a two-dimensional electron gas. Controlling their transmission through a gate-tunable constriction, also called quantum point contact, is fundamental for many coherent transport experiments. However, in graphene, tailoring a constriction with electrostatic gates remains challenging due to the formation of p-n junctions below gate electrodes along which electron and hole edge channels co-propagate and mix, short circuiting the constriction. Here we show that this electron-hole mixing is drastically reduced in high-mobility graphene van der Waals heterostructures thanks to the full degeneracy lifting of the Landau levels, enabling quantum point contact operation with full channel pinch-off. We demonstrate gate-tunable selective transmission of integer and fractional quantum Hall edge channels through the quantum point contact. This gate control of edge channels opens the door to quantum Hall interferometry and electron quantum optics experiments in the integer and fractional quantum Hall regimes of graphene.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pryor, Alan; Ophus, Colin; Miao, Jianwei
Simulation of atomic-resolution image formation in scanning transmission electron microscopy can require significant computation times using traditional methods. A recently developed method, termed plane-wave reciprocal-space interpolated scattering matrix (PRISM), demonstrates potential for significant acceleration of such simulations with negligible loss of accuracy. In this paper, we present a software package called Prismatic for parallelized simulation of image formation in scanning transmission electron microscopy (STEM) using both the PRISM and multislice methods. By distributing the workload between multiple CUDA-enabled GPUs and multicore processors, accelerations as high as 1000 × for PRISM and 15 × for multislice are achieved relative to traditionalmore » multislice implementations using a single 4-GPU machine. We demonstrate a potentially important application of Prismatic, using it to compute images for atomic electron tomography at sufficient speeds to include in the reconstruction pipeline. Prismatic is freely available both as an open-source CUDA/C++ package with a graphical user interface and as a Python package, PyPrismatic.« less
Structural Fingerprinting of Nanocrystals in the Transmission Electron Microscope
NASA Astrophysics Data System (ADS)
Rouvimov, Sergei; Plachinda, Pavel; Moeck, Peter
2010-03-01
Three novel strategies for the structurally identification of nanocrystals in a transmission electron microscope are presented. Either a single high-resolution transmission electron microscopy image [1] or a single precession electron diffractogram (PED) [2] may be employed. PEDs from fine-grained crystal powders may also be utilized. Automation of the former two strategies is in progress and shall lead to statistically significant results on ensembles of nanocrystals. Open-access databases such as the Crystallography Open Database which provides more than 81,500 crystal structure data sets [3] or its mainly inorganic and educational subsets [4] may be utilized. [1] http://www.scientificjournals.org/journals 2007/j/of/dissertation.htm [2] P. Moeck and S. Rouvimov, in: {Drugs and the Pharmaceutical Sciences}, Vol. 191, 2009, 270-313 [3] http://cod.ibt.lt, http://www.crystallography.net, http://cod.ensicaen.fr, http://nanocrystallography.org, http://nanocrystallography.net, http://journals.iucr.org/j/issues/2009/04/00/kk5039/kk5039.pdf [4] http://nanocrystallography.research.pdx.edu/CIF-searchable
Three-dimensional imaging of adherent cells using FIB/SEM and STEM.
Villinger, Clarissa; Schauflinger, Martin; Gregorius, Heiko; Kranz, Christine; Höhn, Katharina; Nafeey, Soufi; Walther, Paul
2014-01-01
In this chapter we describe three different approaches for three-dimensional imaging of electron microscopic samples: serial sectioning transmission electron microscopy (TEM), scanning transmission electron microscopy (STEM) tomography, and focused ion beam/scanning electron microscopy (FIB/SEM) tomography. With these methods, relatively large volumes of resin-embedded biological structures can be analyzed at resolutions of a few nm within a reasonable expenditure of time. The traditional method is serial sectioning and imaging the same area in all sections. Another method is TEM tomography that involves tilting a section in the electron beam and then reconstruction of the volume by back projection of the images. When the scanning transmission (STEM) mode is used, thicker sections (up to 1 μm) can be analyzed. The third approach presented here is focused ion beam/scanning electron microscopy (FIB/SEM) tomography, in which a sample is repeatedly milled with a focused ion beam (FIB) and each newly produced block face is imaged with the scanning electron microscope (SEM). This process can be repeated ad libitum in arbitrary small increments allowing 3D analysis of relatively large volumes such as eukaryotic cells. We show that resolution of this approach is considerably improved when the secondary electron signal is used. However, the most important prerequisite for three-dimensional imaging is good specimen preparation. For all three imaging methods, cryo-fixed (high-pressure frozen) and freeze-substituted samples have been used.
Morphological studies of the developing human esophageal epithelium.
Ménard, D
1995-06-15
This article focusses on the structural development of human esophageal ciliated epithelium. A combination of transmission electron microscopic (TEM), scanning electron microscopic (SEM), radioautographic, and light microscopic (LM) analyses were carried out using intact fetal tissues between 8 and 20 weeks of gestation as well as cultured esophageal explants. Up to the age of 10 weeks, the stratified esophageal epithelium consisted of two longitudinal primary folds. The surface cells were undifferentiated and contained large glycogen aggregates. Between 11 and 16 weeks, the primary folds (now up to four) had developed secondary folds. The thickness of the epithelium drastically increased (123%) in concomittance with a differentiation of surface columnar ciliated cells. These highly specialized surface cells exhibited junctional complexes and well-developed organelles with numerous microvilli interspersed among the cilia. Transverse sections revealed the internal structure of the cilia with a consistent pattern of nine doublet microtubules surrounding a central pair of single microtubules. Freeze-fracture studies illustrated the presence of a ciliary necklace composed of 6 ring-like rows of intramembranous particles. They also revealed the structure of ciliary cell tight junctions consisting of up to nine anastomosing strands (P-face) or complementary grooves (E-face). Ultrastructural studies (LM, TEM, SEM) of the esophageal squamous epithelium obtained after 15 days of culture showed that the newly formed epithelium was similar to adult human epithelium. Finally LM and SEM observations established that the esophagogastric junction was not yet well delineated, consisting of a transitional area composed of a mixture of esophageal ciliated cells and gastric columnar mucous cells.
NASA Astrophysics Data System (ADS)
Shevlyagin, A. V.; Goroshko, D. L.; Chusovitin, E. A.; Balagan, S. A.; Dotsenko, S. A.; Galkin, K. N.; Galkin, N. G.; Shamirzaev, T. S.; Gutakovskii, A. K.; Latyshev, A. V.; Iinuma, M.; Terai, Y.
2017-03-01
This article describes the development of an Si-based light-emitting diode with β-FeSi2 nanocrystals embedded in the active layer. Favorable epitaxial conditions allow us to obtain a direct band gap type-I band alignment Si/β-FeSi2 nanocrystals/Si heterostructure with optical transition at a wavelength range of 1500-1550 nm at room temperature. Transmission electron microscopy data reveal strained, defect-free β-FeSi2 nanocrystals of diameter 6 and 25 nm embedded in the Si matrix. Intense electroluminescence was observed at a pumping current density as low as 0.7 A/cm2. The device reached an optical emission power of up to 25 μW at 9 A/cm2 with an external quantum efficiency of 0.009%. Watt-Ampere characteristic linearity suggests that the optical power margin of the light-emitting diode has not been exhausted. Band structure calculations explain the luminescence as being mainly due to radiative recombination in the large β-FeSi2 nanocrystals resulting from the realization of an indirect-to-direct band gap electronic configuration transformation arising from a favorable deformation of nanocrystals. The direct band gap structure and the measured short decay time of the luminescence of several tens of ns give rise to a fast operation speed for the device. Thus a method for developing a silicon-based photonic integrated circuit, combining complementary metal-oxide-semiconductor technology functionality and near-infrared light emission, is reported here.
NASA Astrophysics Data System (ADS)
Guo, Hong-Yan; Xia, Min; Wu, Zheng-Tao; Chan, Lap-Chung; Dai, Yong; Wang, Kun; Yan, Qing-Zhi; He, Man-Chao; Ge, Chang-Chun; Lu, Jian
2016-11-01
A nanostructured surface layer was fabricated on commercial pure tungsten using the method of surface mechanical attrition treatment (SMAT). The microstructure evolution of the surface layer was characterized by using scanning electron microscopy (SEM) and transmission electron microscopy (TEM) and its formation mechanism was discussed as well. Both refinement and elongation of the brittle W grains were confirmed. The elongated SMATed W was heavily strained, the maximum value of the strain at the grain boundaries reaches as high as 3-5%. Dislocation density in the SMATed W nanograins was found to be 5 × 1012 cm-2. The formation of the nanograins in the top surface layer of the W was ascribed to the extremely high strain and strain rate, as well as the multidirectional repetitive loading. Bending strength of commercial W could be improved from 825 MPa to 1850 MPa by SMAT process. Microhardness results indicated the strain range in SMATed W can reach up to 220 μm beneath the top surface. The notched Charpy testing results demonstrated that SMATed W possess higher ductility than that of commercial W. The top surface of the W plates with and without SMATe processing possesses residual compressive stress of about -881 MPa and -234 MPa in y direction, and -872 MPa and -879 MPa in x direction respectively. The improvement of toughness (DBTT shift) of SMATed W may be the synergistic effect of residual compressive stress, dislocation density improvement and microstructure refinement induced by SMAT processing. SMAT processing could be a complementary method to further decrease the DBTT value of tungsten based materials.
Federal Register 2010, 2011, 2012, 2013, 2014
2011-03-23
...: Heating, ventilating, air-conditioning systems (HVAC), amplifiers, mainboards, gas control modules, hybrid airmeter electronics, hybrid ignition electronics, pressure sensors, transmission control modules, crash...
Mega-electron-volt ultrafast electron diffraction at SLAC National Accelerator Laboratory
DOE Office of Scientific and Technical Information (OSTI.GOV)
Weathersby, S. P.; Brown, G.; Chase, T. F.
Ultrafast electron probes are powerful tools, complementary to x-ray free-electron lasers, used to study structural dynamics in material, chemical, and biological sciences. High brightness, relativistic electron beams with femtosecond pulse duration can resolve details of the dynamic processes on atomic time and length scales. SLAC National Accelerator Laboratory recently launched the Ultrafast Electron Diffraction (UED) and microscopy Initiative aiming at developing the next generation ultrafast electron scattering instruments. As the first stage of the Initiative, a mega-electron-volt (MeV) UED system has been constructed and commissioned to serve ultrafast science experiments and instrumentation development. The system operates at 120-Hz repetition ratemore » with outstanding performance. In this paper, we report on the SLAC MeV UED system and its performance, including the reciprocal space resolution, temporal resolution, and machine stability.« less
Mega-electron-volt ultrafast electron diffraction at SLAC National Accelerator Laboratory.
Weathersby, S P; Brown, G; Centurion, M; Chase, T F; Coffee, R; Corbett, J; Eichner, J P; Frisch, J C; Fry, A R; Gühr, M; Hartmann, N; Hast, C; Hettel, R; Jobe, R K; Jongewaard, E N; Lewandowski, J R; Li, R K; Lindenberg, A M; Makasyuk, I; May, J E; McCormick, D; Nguyen, M N; Reid, A H; Shen, X; Sokolowski-Tinten, K; Vecchione, T; Vetter, S L; Wu, J; Yang, J; Dürr, H A; Wang, X J
2015-07-01
Ultrafast electron probes are powerful tools, complementary to x-ray free-electron lasers, used to study structural dynamics in material, chemical, and biological sciences. High brightness, relativistic electron beams with femtosecond pulse duration can resolve details of the dynamic processes on atomic time and length scales. SLAC National Accelerator Laboratory recently launched the Ultrafast Electron Diffraction (UED) and microscopy Initiative aiming at developing the next generation ultrafast electron scattering instruments. As the first stage of the Initiative, a mega-electron-volt (MeV) UED system has been constructed and commissioned to serve ultrafast science experiments and instrumentation development. The system operates at 120-Hz repetition rate with outstanding performance. In this paper, we report on the SLAC MeV UED system and its performance, including the reciprocal space resolution, temporal resolution, and machine stability.
47 CFR 54.5 - Terms and definitions.
Code of Federal Regulations, 2011 CFR
2011-10-01
... electronic publishing, but does not include any use of any such capability for the management, control, or... transmission of information as part of a gateway to an information service, when that transmission does not involve the generation or alteration of the content of information, but may include data transmission...
Specimen-thickness effects on transmission Kikuchi patterns in the scanning electron microscope.
Rice, K P; Keller, R R; Stoykovich, M P
2014-06-01
We report the effects of varying specimen thickness on the generation of transmission Kikuchi patterns in the scanning electron microscope. Diffraction patterns sufficient for automated indexing were observed from films spanning nearly three orders of magnitude in thickness in several materials, from 5 nm of hafnium dioxide to 3 μm of aluminum, corresponding to a mass-thickness range of ~5 to 810 μg cm(-2) . The scattering events that are most likely to be detected in transmission are shown to be very near the exit surface of the films. The energies, spatial distribution and trajectories of the electrons that are transmitted through the film and are collected by the detector are predicted using Monte Carlo simulations. Published 2014. This article is a U.S. Government work and is in the public domain in the USA.
Torati, Sri Ramulu; Reddy, Venu; Yoon, Seok Soo; Kim, CheolGi
2016-04-15
The template assisted electrochemical deposition technique was used for the synthesis of gold nanotubes array (AuNTsA). The morphological structure of the synthesized AuNTsA was observed by scanning electron microscopy and found that the individual nanotubes are around 1.5 μm in length with a diameter of 200 nm. Nanotubes are vertically aligned to the Au thick film, which is formed during the synthesis process of nanotubes. The electrochemical performance of the AuNTsA was compared with the bare Au electrode and found that AuNTsA has better electron transfer surface than bare Au electrode which is due to the high surface area. Hence, the AuNTsA was used as an electrode for the fabrication of DNA hybridization biosensor for detection of Mycobacterium Tuberculosis DNA. The DNA hybridization biosensor constructed by AuNTsA electrode was characterized by cyclic voltammetry technique with Fe(CN)6(3-/4-) as an electrochemical redox indicator. The selectivity of the fabricated biosensor was illustrated by hybridization with complementary DNA and non-complementary DNA with probe DNA immobilized AuNTsA electrode using methylene blue as a hybridization indicator. The developed electrochemical DNA biosensor shows good linear range of complementary DNA concentration from 0.01 ng/μL to 100 ng/μL with high detection limit. Copyright © 2015 Elsevier B.V. All rights reserved.
Song, Dongsheng; Tavabi, Amir H.; Li, Zi-An; Kovács, András; Rusz, Ján; Huang, Wenting; Richter, Gunther; Dunin-Borkowski, Rafal E.; Zhu, Jing
2017-01-01
Electron energy-loss magnetic chiral dichroism is a powerful technique that allows the local magnetic properties of materials to be measured quantitatively with close-to-atomic spatial resolution and element specificity in the transmission electron microscope. Until now, the technique has been restricted to measurements of the magnetic circular dichroism signal in the electron beam direction. However, the intrinsic magnetization directions of thin samples are often oriented in the specimen plane, especially when they are examined in magnetic-field-free conditions in the transmission electron microscope. Here, we introduce an approach that allows in-plane magnetic signals to be measured using electron magnetic chiral dichroism by selecting a specific diffraction geometry. We compare experimental results recorded from a cobalt nanoplate with simulations to demonstrate that an electron magnetic chiral dichroism signal originating from in-plane magnetization can be detected successfully. PMID:28504267
Development of an environmental high-voltage electron microscope for reaction science.
Tanaka, Nobuo; Usukura, Jiro; Kusunoki, Michiko; Saito, Yahachi; Sasaki, Katuhiro; Tanji, Takayoshi; Muto, Shunsuke; Arai, Shigeo
2013-02-01
Environmental transmission electron microscopy and ultra-high resolution electron microscopic observation using aberration correctors have recently emerged as topics of great interest. The former method is an extension of the so-called in situ electron microscopy that has been performed since the 1970s. Current research in this area has been focusing on dynamic observation with atomic resolution under gaseous atmospheres and in liquids. Since 2007, Nagoya University has been developing a new 1-MV high voltage (scanning) transmission electron microscope that can be used to observe nanomaterials under conditions that include the presence of gases, liquids and illuminating lights, and it can be also used to perform mechanical operations to nanometre-sized areas as well as electron tomography and elemental analysis by electron energy loss spectroscopy. The new instrument has been used to image and analyse various types of samples including biological ones.
49 CFR 229.20 - Electronic recordkeeping.
Code of Federal Regulations, 2014 CFR
2014-10-01
... 49 Transportation 4 2014-10-01 2014-10-01 false Electronic recordkeeping. 229.20 Section 229.20..., DEPARTMENT OF TRANSPORTATION RAILROAD LOCOMOTIVE SAFETY STANDARDS General § 229.20 Electronic recordkeeping... part through electronic transmission, storage, and retrieval provided that all of the requirements...
49 CFR 229.20 - Electronic recordkeeping.
Code of Federal Regulations, 2013 CFR
2013-10-01
... 49 Transportation 4 2013-10-01 2013-10-01 false Electronic recordkeeping. 229.20 Section 229.20..., DEPARTMENT OF TRANSPORTATION RAILROAD LOCOMOTIVE SAFETY STANDARDS General § 229.20 Electronic recordkeeping... part through electronic transmission, storage, and retrieval provided that all of the requirements...
Landier, Wendy; Tse, Alice M.
2016-01-01
This integrative review aims to identify evidence in four electronic databases (MEDLINE, CINAHL, PsyINFO, and COCHRANE) regarding the effectiveness of complementary and alternative medical interventions, either alone or as an adjunct to pharmacological therapy, in alleviating procedure-related pain, anxiety, and distress in children and adolescents with cancer. A total of 32 articles met inclusion criteria. Results suggest that mind–body interventions, including hypnosis, distraction, and imagery, may be effective, alone or as adjuncts to pharmacological interventions, in managing procedure-related pain, anxiety, and distress in pediatric oncology. PMID:21035021
NASA Astrophysics Data System (ADS)
Geng, Ying; Li, Shenping; Li, Ming-Jun; Sutton, Clifford G.; McCollum, Robert L.; McClure, Randy L.; Koklyushkin, Alexander V.; Matthews, Karen I.; Luther, James P.; Butler, Douglas L.
2015-03-01
A complete single mode dual-core fiber system for short-reach optical interconnects is fabricated and tested for high-speed data transmission. It includes dual-core fibers capable of bi-directional data transmission, dual-core simplex LC connectors, and fan-outs. The transmission system offers simplified bi-directional traffic engineering with integrated bidirectional transceivers and compact system design, utilizing simplex dual-core LC connectors that use half the space while increasing the bandwidth density by a factor of two. The fiber has two cores that are compatible with single mode fiber and conforms to the industry standard outer diameter of 125 μm. This reduces operational complexity by reducing the size and number of fibers, cables and connectors. Measured OTDR loss for both cores was 0.34 dB/km at 1310 nm and 0.19 dB/km at 1550 nm. Crosstalk for a piece of 5.8 km long dual-core fiber was measured to be below -75 dB at 1310 nm, and below -40 dB at 1550 nm. Both free-space optics fan-outs and tapered-fiber-coupler based MCF fan-outs were evaluated for the transmission system. Error-free and penalty-free 25 Gb/s bi-directional transmission performance was demonstrated for three different fiber lengths, 200 m, 2 km and 10 km, using the complete all-fiber-based system including connectors and fan-outs. This single mode, dual-core fiber transmission system adds complementary value to systems where additional increases in bandwidth density can come from wavelength division multiplexing and multiple bits per symbol.