Zhang, Hongyan; Lv, Jie; Jia, Zhenhong
2018-01-01
We successfully demonstrate a porous silicon (PS) double Bragg mirror by electrochemical etching at room temperature as a deoxyribonucleic acid (DNA) label-free biosensor for detecting ammonia-oxidizing bacteria (AOB). Compared to various other one-dimension photonic crystal configurations of PS, the double Bragg mirror structure is quite easy to prepare and exhibits interesting optical properties. The width of high reflectivity stop band of the PS double Bragg mirror is about 761 nm with a sharp and deep resonance peak at 1328 nm in the reflectance spectrum, which gives a high sensitivity and distinguishability for sensing performance. The detection sensitivity of such a double Bragg mirror structure is illustrated through the investigation of AOB DNA hybridization in the PS pores. The redshifts of the reflectance spectra show a good linear relationship with both complete complementary and partial complementary DNA. The lowest detection limit for complete complementary DNA is 27.1 nM and the detection limit of the biosensor for partial complementary DNA is 35.0 nM, which provides the feasibility and effectiveness for the detection of AOB in a real environment. The PS double Bragg mirror structure is attractive for widespread biosensing applications and provides great potential for the development of optical applications.
de Bellocq, J Goüy; Leirs, H
2009-09-01
Sequences of the complete open reading frame (ORF) for rodents major histocompatibility complex (MHC) class II genes are rare. Multimammate rat (Mastomys natalensis) complementary DNA (cDNA) encoding the alpha and beta chains of MHC class II DQ gene was cloned from a rapid amplifications of cDNA Emds (RACE) cDNA library. The ORFs consist of 801 and 771 bp encoding 266 and 256 amino acid residues for DQB and DQA, respectively. The genomic structure of Mana-DQ genes is globally analogous to that described for other rodents except for the insertion of a serine residue in the signal peptide of Mana-DQB, which is unique among known rodents.
Complete complementary DNA-derived amino acid sequence of canine cardiac phospholamban.
Fujii, J; Ueno, A; Kitano, K; Tanaka, S; Kadoma, M; Tada, M
1987-01-01
Complementary DNA (cDNA) clones specific for phospholamban of sarcoplasmic reticulum membranes have been isolated from a canine cardiac cDNA library. The amino acid sequence deduced from the cDNA sequence indicates that phospholamban consists of 52 amino acid residues and lacks an amino-terminal signal sequence. The protein has an inferred mol wt 6,080 that is in agreement with its apparent monomeric mol wt 6,000, estimated previously by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Phospholamban contains two distinct domains, a hydrophilic region at the amino terminus (domain I) and a hydrophobic region at the carboxy terminus (domain II). We propose that domain I is localized at the cytoplasmic surface and offers phosphorylatable sites whereas domain II is anchored into the sarcoplasmic reticulum membrane. PMID:3793929
Howland, Shanshan W; Poh, Chek-Meng; Rénia, Laurent
2011-09-01
Directional cloning of complementary DNA (cDNA) primed by oligo(dT) is commonly achieved by appending a restriction site to the primer, whereas the second strand is synthesized through the combined action of RNase H and Escherichia coli DNA polymerase I (PolI). Although random primers provide more uniform and complete coverage, directional cloning with the same strategy is highly inefficient. We report that phosphorothioate linkages protect the tail sequence appended to random primers from the 5'→3' exonuclease activity of PolI. We present a simple strategy for constructing a random-primed cDNA library using the efficient, size-independent, and seamless In-Fusion cloning method instead of restriction enzymes. Copyright © 2011 Elsevier Inc. All rights reserved.
Sin, Jeong-Im
2009-01-01
Interleukin-12 (IL-12) has been shown to enhance cellular immunity in vitro and in vivo. The beneficial roles of IL-12 as a DNA vaccine adjuvant have been commonly observed. Here the impact of IL-12 complementary DNA (cDNA) as an adjuvant for a human papillomavirus (HPV) type 16 E7 DNA vaccine is investigated in a mouse tumour model. Coinjection of E7 DNA vaccine with IL-12 cDNA completely suppressed antigen-specific cytotoxic T-lymphocyte (CTL) responses, leading to a complete loss of antitumour protection from a tumour cell challenge. In addition, antigen-specific antibody and T helper cell proliferative responses were also suppressed by IL-12 cDNA coinjection. This inhibition was observed over different IL-12 cDNA doses. Furthermore, separate leg injections of IL-12 and E7 cDNAs suppressed antigen-specific CTL and tumour protective responses, but not antibody and T helper cell proliferative responses, suggesting different pathways for suppression of these two separate responses. Further knockout animal studies demonstrated that interferon-γ and nitric oxide are not directly associated with suppression of antigen-specific antibody responses by IL-12 cDNA coinjection. However, nitric oxide was found to be involved in suppression of antigen-specific CTL and tumour protective responses by IL-12 cDNA coinjection. These data suggest that coinjection of IL-12 cDNA results in suppression of E7-specific CTL responses through nitric oxide, leading to a loss of antitumour resistance in this DNA vaccine model. This study further shows that the adjuvant effect of IL-12 is dependent on the antigen types tested. PMID:19740332
Sin, Jeong-Im
2009-09-01
Interleukin-12 (IL-12) has been shown to enhance cellular immunity in vitro and in vivo. The beneficial roles of IL-12 as a DNA vaccine adjuvant have been commonly observed. Here the impact of IL-12 complementary DNA (cDNA) as an adjuvant for a human papillomavirus (HPV) type 16 E7 DNA vaccine is investigated in a mouse tumour model. Coinjection of E7 DNA vaccine with IL-12 cDNA completely suppressed antigen-specific cytotoxic T-lymphocyte (CTL) responses, leading to a complete loss of antitumour protection from a tumour cell challenge. In addition, antigen-specific antibody and T helper cell proliferative responses were also suppressed by IL-12 cDNA coinjection. This inhibition was observed over different IL-12 cDNA doses. Furthermore, separate leg injections of IL-12 and E7 cDNAs suppressed antigen-specific CTL and tumour protective responses, but not antibody and T helper cell proliferative responses, suggesting different pathways for suppression of these two separate responses. Further knockout animal studies demonstrated that interferon-gamma and nitric oxide are not directly associated with suppression of antigen-specific antibody responses by IL-12 cDNA coinjection. However, nitric oxide was found to be involved in suppression of antigen-specific CTL and tumour protective responses by IL-12 cDNA coinjection. These data suggest that coinjection of IL-12 cDNA results in suppression of E7-specific CTL responses through nitric oxide, leading to a loss of antitumour resistance in this DNA vaccine model. This study further shows that the adjuvant effect of IL-12 is dependent on the antigen types tested.
Kimura, Tomohiro; Nakano, Toshiki; Yamaguchi, Toshiyasu; Sato, Minoru; Ogawa, Tomohisa; Muramoto, Koji; Yokoyama, Takehiko; Kan-No, Nobuhiro; Nagahisa, Eizou; Janssen, Frank; Grieshaber, Manfred K
2004-01-01
The complete complementary DNA sequences of genes presumably coding for opine dehydrogenases from Arabella iricolor (sandworm), Haliotis discus hannai (abalone), and Patinopecten yessoensis (scallop) were determined, and partial cDNA sequences were derived for Meretrix lusoria (Japanese hard clam) and Spisula sachalinensis (Sakhalin surf clam). The primers ODH-9F and ODH-11R proved useful for amplifying the sequences for opine dehydrogenases from the 4 mollusk species investigated in this study. The sequence of the sandworm was obtained using primers constructed from the amino acid sequence of tauropine dehydrogenase, the main opine dehydrogenase in A. iricolor. The complete cDNA sequence of A. iricolor, H. discus hannai, and P. yessoensis encode 397, 400, and 405 amino acids, respectively. All sequences were aligned and compared with published databank sequences of Loligo opalescens, Loligo vulgaris (squid), Sepia officinalis (cuttlefish), and Pecten maximus (scallop). As expected, a high level of homology was observed for the cDNA from closely related species, such as for cephalopods or scallops, whereas cDNA from the other species showed lower-level homologies. A similar trend was observed when the deduced amino acid sequences were compared. Furthermore, alignment of these sequences revealed some structural motifs that are possibly related to the binding sites of the substrates. The phylogenetic trees derived from the nucleotide and amino acid sequences were consistent with the classification of species resulting from classical taxonomic analyses.
DNA–DNA kissing complexes as a new tool for the assembly of DNA nanostructures
Barth, Anna; Kobbe, Daniela; Focke, Manfred
2016-01-01
Kissing-loop annealing of nucleic acids occurs in nature in several viruses and in prokaryotic replication, among other circumstances. Nucleobases of two nucleic acid strands (loops) interact with each other, although the two strands cannot wrap around each other completely because of the adjacent double-stranded regions (stems). In this study, we exploited DNA kissing-loop interaction for nanotechnological application. We functionalized the vertices of DNA tetrahedrons with DNA stem-loop sequences. The complementary loop sequence design allowed the hybridization of different tetrahedrons via kissing-loop interaction, which might be further exploited for nanotechnology applications like cargo transport and logical elements. Importantly, we were able to manipulate the stability of those kissing-loop complexes based on the choice and concentration of cations, the temperature and the number of complementary loops per tetrahedron either at the same or at different vertices. Moreover, variations in loop sequences allowed the characterization of necessary sequences within the loop as well as additional stability control of the kissing complexes. Therefore, the properties of the presented nanostructures make them an important tool for DNA nanotechnology. PMID:26773051
Complementary DNA libraries: an overview.
Ying, Shao-Yao
2004-07-01
The generation of complete and full-length cDNA libraries for potential functional assays of specific gene sequences is essential for most molecules in biotechnology and biomedical research. The field of cDNA library generation has changed rapidly in the past 10 yr. This review presents an overview of the method available for the basic information of generating cDNA libraries, including the definition of the cDNA library, different kinds of cDNA libraries, difference between methods for cDNA library generation using conventional approaches and a novel strategy, and the quality of cDNA libraries. It is anticipated that the high-quality cDNA libraries so generated would facilitate studies involving genechips and the microarray, differential display, subtractive hybridization, gene cloning, and peptide library generation.
Characterisation of cytoplasmic DNA complementary to non-retroviral RNA viruses in human cells
Shimizu, Akira; Nakatani, Yoko; Nakamura, Takako; Jinno-Oue, Atsushi; Ishikawa, Osamu; Boeke, Jef D.; Takeuchi, Yasuhiro; Hoshino, Hiroo
2014-01-01
The synthesis and subsequent genomic integration of DNA that is complementary to the genomes of non-retroviral RNA viruses are rarely observed. However, upon infection of various human cell lines and primary fibroblasts with the vesicular stomatitis virus (VSV), we detected DNA complementary to the VSV RNA. The VSV DNA was detected in the cytoplasm as single-stranded DNA fully complementary to the viral mRNA from the poly(A) region to the 7-methyl guanosine cap. The formation of this DNA was cell-dependent. Experimentally, we found that the transduction of cells that do not produce VSV DNA with the long interspersed nuclear element 1 and their infection with VSV could lead to the formation of VSV DNA. Viral DNA complementary to other RNA viruses was also detected in the respective infected human cells. Thus, the genetic information of the non-retroviral RNA virus genome can flow into the DNA of mammalian cells expressing LINE-1-like elements. PMID:24875540
RNA-primed complementary-sense DNA synthesis of the geminivirus African cassava mosaic virus.
Saunders, K; Lucy, A; Stanley, J
1992-01-01
The plant DNA virus African cassava mosaic virus (ACMV) is believed to replicate by a rolling circle mechanism. To investigate complementary-sense DNA (lagging strand) synthesis, we have analysed the heterogenous form of complementary-sense DNA (H3 DNA) from infected Nicotiana benthamiana by two-dimensional agarose gel electrophoresis and blot hybridisation. The presence of an RNA moeity is demonstrated by comparison of results for nucleic acids resolved on neutral/alkaline and neutral/formamide gels, suggesting that complementary-sense DNA synthesis on the virus-sense single-stranded DNA template is preceded by the synthesis of an RNA primer. Hybridisation with probes to specific parts of ACMV DNA A genome indicates that synthesis of the putative RNA primer initiates between nucleotides 2581-221, a region that includes intergenic sequences that have been implicated in geminivirus DNA replication and the control of gene expression. Images PMID:1475192
Giehr, Pascal; Walter, Jörn
2018-01-01
The accurate and quantitative detection of 5-methylcytosine is of great importance in the field of epigenetics. The method of choice is usually bisulfite sequencing because of the high resolution and the possibility to combine it with next generation sequencing. Nevertheless, also this method has its limitations. Following the bisulfite treatment DNA strands are no longer complementary such that in a subsequent PCR amplification the DNA methylation patterns information of only one of the two DNA strand is preserved. Several years ago Hairpin Bisulfite sequencing was developed as a method to obtain the pattern information on complementary DNA strands. The method requires fragmentation (usually by enzymatic cleavage) of genomic DNA followed by a covalent linking of both DNA strands through ligation of a short DNA hairpin oligonucleotide to both strands. The ligated covalently linked dsDNA products are then subjected to a conventional bisulfite treatment during which all unmodified cytosines are converted to uracils. During the treatment the DNA is denatured forming noncomplementary ssDNA circles. These circles serve as a template for a locus specific PCR to amplify chromosomal patterns of the region of interest. As a result one ends up with a linearized product, which contains the methylation information of both complementary DNA strands.
NASA Astrophysics Data System (ADS)
Enea, Vincenzo; Ellis, Joan; Zavala, Fidel; Arnot, David E.; Asavanich, Achara; Masuda, Aoi; Quakyi, Isabella; Nussenzweig, Ruth S.
1984-08-01
A clone of complementary DNA encoding the circumsporozoite (CS) protein of the human malaria parasite Plasmodium falciparum has been isolated by screening an Escherichia coli complementary DNA library with a monoclonal antibody to the CS protein. The DNA sequence of the complementary DNA insert encodes a four-amino acid sequence: proline-asparagine-alanine-asparagine, tandemly repeated 23 times. The CS β -lactamase fusion protein specifically binds monoclonal antibodies to the CS protein and inhibits the binding of these antibodies to native Plasmodium falciparum CS protein. These findings provide a basis for the development of a vaccine against Plasmodium falciparum malaria.
Song, Youngjun; Takahashi, Tsukasa; Kim, Sejung; Heaney, Yvonne C; Warner, John; Chen, Shaochen; Heller, Michael J
2017-01-11
We demonstrate a DNA double-write process that uses UV to pattern a uniquely designed DNA write material, which produces two distinct binding identities for hybridizing two different complementary DNA sequences. The process requires no modification to the DNA by chemical reagents and allows programmed DNA self-assembly and further UV patterning in the UV exposed and nonexposed areas. Multilayered DNA patterning with hybridization of fluorescently labeled complementary DNA sequences, biotin probe/fluorescent streptavidin complexes, and DNA patterns with 500 nm line widths were all demonstrated.
Procedure for normalization of cDNA libraries
Bonaldo, Maria DeFatima; Soares, Marcelo Bento
1997-01-01
This invention provides a method to normalize a cDNA library constructed in a vector capable of being converted to single-stranded circles and capable of producing complementary nucleic acid molecules to the single-stranded circles comprising: (a) converting the cDNA library in single-stranded circles; (b) generating complementary nucleic acid molecules to the single-stranded circles; (c) hybridizing the single-stranded circles converted in step (a) with complementary nucleic acid molecules of step (b) to produce partial duplexes to an appropriate Cot; (e) separating the unhybridized single-stranded circles from the hybridized single-stranded circles, thereby generating a normalized cDNA library.
Role of messenger RNA-ribosome complex in complementary DNA display.
Naimuddin, Mohammed; Ohtsuka, Isao; Kitamura, Koichiro; Kudou, Motonori; Kimura, Shinnosuke
2013-07-15
In vitro display technologies such as ribosome display and messenger RNA (mRNA)/complementary DNA (cDNA) display are powerful methods that can generate library diversities on the order of 10(10-14). However, in mRNA and cDNA display methods, the end use diversity is two orders of magnitude lower than initial diversity and is dependent on the downstream processes that act as limiting factors. We found that in our previous cDNA display protocol, the purification of protein fusions by the use of streptavidin matrices from cell-free translation mixtures had poor efficiency (∼10-15%) that seriously affected the diversity of the purified library. Here, we have investigated and optimized the protocols that provided remarkable purification efficiencies. The stalled ribosome in the mRNA-ribosome complex was found to impede this purification efficiency. Among the various conditions tested, destabilization of ribosomes by appropriate concentration of metal chelating agents in combination with an optimal temperature of 30°C were found to be crucial and effective for nearly complete isolation of protein fusions from the cell-free translation system. Thus, this protocol provided 8- to 10-fold increased efficiency of purification over the previous method and results in retaining the diversity of the library by approximately an order of magnitude-important for directed evolution. We also discuss the possible effects in the fabrication of protein chips. Copyright © 2013 Elsevier Inc. All rights reserved.
Procedure for normalization of cDNA libraries
Bonaldo, M.D.; Soares, M.B.
1997-12-30
This invention provides a method to normalize a cDNA library constructed in a vector capable of being converted to single-stranded circles and capable of producing complementary nucleic acid molecules to the single-stranded circles comprising: (a) converting the cDNA library in single-stranded circles; (b) generating complementary nucleic acid molecules to the single-stranded circles; (c) hybridizing the single-stranded circles converted in step (a) with complementary nucleic acid molecules of step (b) to produce partial duplexes to an appropriate Cot; (e) separating the unhybridized single-stranded circles from the hybridized single-stranded circles, thereby generating a normalized cDNA library. 1 fig.
Berns, K. I.; Rose, J. A.
1970-01-01
Single-stranded adenovirus-associated virus type 2 deoxyribonucleic acid (AAV-2 DNA) has been isolated from the virion after enzymatic pretreatment of the particles by heating at 53 C for 1 hr in 0.015 m NaCl plus 0.0015 m sodium citrate in the presence of 1% sodium dodecyl sulfate. Double-stranded AAV-2 DNA present as a marker is not denatured by this treatment. AAV-2 single-stranded DNA is composed of two complementary species which can be separated in neutral CsCl when 5-bromodeoxyuridine has been substituted for thymidine in the DNA. The present report is the first documented instance of the separation of complementary strands of an animal virus DNA. PMID:5429749
Pang, Jie; Zhang, Ziping; Jin, Haizhu
2016-03-15
Electrochemical aptamer-based (E-AB) sensors employing electrode-immobilized, redox-tagged aptamer probes have emerged as a promising platform for the sensitive and quick detection of target analytes ranging from small molecules to proteins. Signal generation in this class of sensor is linked to change in electron transfer efficiency upon binding-induced change in flexibility/conformation of the aptamer probe. Because of this signaling mechanism, signal gains of these sensors can be improved by employing a displacement-based recognition system, which links target binding with a large-scale flexibility/conformation shift from the aptamer-DNA duplex to the single-stranded DNA or the native aptamer. Despite the relatively large number of displacement-based E-AB sensor samples, little attention has been paid to the structure variation of the aptamer-DNA duplex probe. Here we detail the effects of complementary length and position of the aptamer-DNA duplex probe on the performance of a model displacement-based E-AB sensor for ATP. We find that, greater background suppression and signal gain are observed with longer complementary length of the aptamer-DNA duplex probe. However, sensor equilibration time slows monotonically with increasing complementary length; and with too many target binding sites in aptamer sequence being occupied by the complementary DNA, the aptamer-target binding does not occur and no signal gain observed. We also demonstrate that signal gain of the displacement-based E-AB sensor is strongly dependent on the complementary position of the aptamer-DNA duplex probe, with complementary position located at the electrode-attached or redox-tagged end of the duplex probe, larger background suppression and signal increase than that of the middle position are observed. These results highlight the importance of rational structure design of the aptamer-DNA duplex probe and provide new insights into the optimization of displacement-based E-AB sensors. Copyright © 2015 Elsevier B.V. All rights reserved.
Cadmium sulfide nanocluster-based electrochemical stripping detection of DNA hybridization.
Zhu, Ningning; Zhang, Aiping; He, Pingang; Fang, Yuzhi
2003-03-01
A novel, sensitive electrochemical DNA hybridization detection assay, using cadmium sulfide (CdS) nanoclusters as the oligonucleotide labeling tag, is described. The assay relies on the hybridization of the target DNA with the CdS nanocluster oligonucleotide DNA probe, followed by the dissolution of the CdS nanoclusters anchored on the hybrids and the indirect determination of the dissolved cadmium ions by sensitive anodic stripping voltammetry (ASV) at a mercury-coated glassy carbon electrode (GCE). The results showed that only a complementary sequence could form a double-stranded dsDNA-CdS with the DNA probe and give an obvious electrochemical response. A three-base mismatch sequence and non-complementary sequence had negligible response. The combination of the large number of cadmium ions released from each dsDNA hybrid with the remarkable sensitivity of the electrochemical stripping analysis for cadmium at mercury-film GCE allows detection at levels as low as 0.2 pmol L(-1) of the complementary sequence of DNA.
Detection of DNA damage by using hairpin molecular beacon probes and graphene oxide.
Zhou, Jie; Lu, Qian; Tong, Ying; Wei, Wei; Liu, Songqin
2012-09-15
A hairpin molecular beacon tagged with carboxyfluorescein in combination with graphene oxide as a quencher reagent was used to detect the DNA damage by chemical reagents. The fluorescence of molecular beacon was quenched sharply by graphene oxide; while in the presence of its complementary DNA the quenching efficiency decreased because their hybridization prevented the strong adsorbability of molecular beacon on graphene oxide. If the complementary DNA was damaged by a chemical reagent and could not form intact duplex structure with molecular beacon, more molecular beacon would adsorb on graphene oxide increasing the quenching efficiency. Thus, damaged DNA could be detected based on different quenching efficiencies afforded by damaged and intact complementary DNA. The damage effects of chlorpyrifos-methyl and three metabolites of styrene such as mandelieaeids, phenylglyoxylieaeids and epoxystyrene on DNA were studied as models. The method for detection of DNA damage was reliable, rapid and simple compared to the biological methods. Copyright © 2012 Elsevier B.V. All rights reserved.
Bunge, Andreas; Kurz, Anke; Windeck, Anne-Kathrin; Korte, Thomas; Flasche, Wolfgang; Liebscher, Jürgen; Herrmann, Andreas; Huster, Daniel
2007-04-10
For the development of surface functionalized bilayers, we have synthesized lipophilic oligonucleotides to combine the molecular recognition mechanism of nucleic acids and the self-assembly characteristics of lipids in planar membranes. A lipophilic oligonucleotide consisting of 21 thymidine units and two lipophilic nucleotides with an alpha-tocopherol moiety as a lipophilic anchor was synthesized using solid-phase methods with a phosphoramadite strategy. The interaction of the water soluble lipophilic oligonucleotide with vesicular lipid membranes and its capability to bind complementary DNA strands was studied using complementary methods such as NMR, EPR, DSC, fluorescence spectroscopy, and fluorescence microscopy. This oligonucleotide inserted stably into preformed membranes from the aqueous phase. Thereby, no significant perturbation of the lipid bilayer and its stability was observed. However, the non-lipidated end of the oligonucleotide is exposed to the aqueous environment, is relatively mobile, and is free to interact with complementary DNA strands. Binding of the complementary single-stranded DNA molecules is fast and accomplished by the formation of Watson-Crick base pairs, which was confirmed by 1H NMR chemical shift analysis and fluorescence resonance energy transfer. The molecular structure of the membrane bound DNA double helix is very similar to the free double-stranded DNA. Further, the membrane bound DNA double strands also undergo regular melting. Finally, in raft-like membrane mixtures, the lipophilic oligonucleotide was shown to preferentially sequester into liquid-disordered membrane domains.
NASA Astrophysics Data System (ADS)
Jayakumar, Ganesh; Legallais, Maxime; Hellström, Per-Erik; Mouis, Mireille; Stambouli, Valérie; Ternon, Céline; Östling, Mikael
2016-09-01
1D silicon nanowires (SiNW) are attractive for charge based DNA sensing applications due to their small size and large surface to volume ratio. An ideal portable biosensor is expected to have repeatable and reliable sensitivity, selectivity, low production cost and small feature size. Instead of using tools such as e-beam that are capital and time intensive, we propose a low cost CMOS self-aligned-double-patterning I-line lithography process to fabricate 60 nm wide SiNW. DNA probes are grafted on a thin dielectric layer that is deposited on top of the SiNW surface. Here we used HfO2 instead of the usual SiO2. Indeed, compared to SiO2, HfO2 has been reported to have higher amount of OH groups on its surface leading to enhanced signal quality. We also report preliminary biosensor characterizations. After HfO2 functionalization and single-stranded DNA probe grafting onto the SiNWs, the sensors were first put in contact with fluorophore labelled complementary DNA targets in order to test the efficiency of DNA hybridization optically. Then, a sequence of hybridization, de-hybridization and re-hybridization steps was followed by Id-Vg measurements in order to measure the electrical response of the sensors to target DNA as well as recycling capability. After each step, SiNW devices exhibited a threshold voltage shift larger than device-to-device dispersion, showing that both complementary DNA hybridization and de-hybridization can be electrically detected. These results are very encouraging as they open new frontiers for heterogeneous integration of liquid interacting array of nano sensors with CMOS circuits to fabricate a complete lab on chip.
DNA Photo Lithography with Cinnamate-based Photo-Bio-Nano-Glue
NASA Astrophysics Data System (ADS)
Feng, Lang; Li, Minfeng; Romulus, Joy; Sha, Ruojie; Royer, John; Wu, Kun-Ta; Xu, Qin; Seeman, Nadrian; Weck, Marcus; Chaikin, Paul
2013-03-01
We present a technique to make patterned functional surfaces, using a cinnamate photo cross-linker and photolithography. We have designed and modified a complementary set of single DNA strands to incorporate a pair of opposing cinnamate molecules. On exposure to 360nm UV, the cinnamate makes a highly specific covalent bond permanently linking only the complementary strands containing the cinnamates. We have studied this specific and efficient crosslinking with cinnamate-containing DNA in solution and on particles. UV addressability allows us to pattern surfaces functionally. The entire surface is coated with a DNA sequence A incorporating cinnamate. DNA strands A'B with one end containing a complementary cinnamated sequence A' attached to another sequence B, are then hybridized to the surface. UV photolithography is used to bind the A'B strand in a specific pattern. The system is heated and the unbound DNA is washed away. The pattern is then observed by thermo-reversibly hybridizing either fluorescently dyed B' strands complementary to B, or colloids coated with B' strands. Our techniques can be used to reversibly and/or permanently bind, via DNA linkers, an assortment of molecules, proteins and nanostructures. Potential applications range from advanced self-assembly, such as templated self-replication schemes recently reported, to designed physical and chemical patterns, to high-resolution multi-functional DNA surfaces for genetic detection or DNA computing.
Malecka, Kamila; Michalczuk, Lech; Radecka, Hanna; Radecki, Jerzy
2014-10-09
A DNA biosensor for detection of specific oligonucleotides sequences of Plum Pox Virus (PPV) in plant extracts and buffer is proposed. The working principles of a genosensor are based on the ion-channel mechanism. The NH2-ssDNA probe was deposited onto a glassy carbon electrode surface to form an amide bond between the carboxyl group of oxidized electrode surface and amino group from ssDNA probe. The analytical signals generated as a result of hybridization were registered in Osteryoung square wave voltammetry in the presence of [Fe(CN)6]3-/4- as a redox marker. The 22-mer and 42-mer complementary ssDNA sequences derived from PPV and DNA samples from plants infected with PPV were used as targets. Similar detection limits of 2.4 pM (31.0 pg/mL) and 2.3 pM (29.5 pg/mL) in the concentration range 1-8 pM were observed in the presence of the 22-mer ssDNA and 42-mer complementary ssDNA sequences of PPV, respectively. The genosensor was capable of discriminating between samples consisting of extracts from healthy plants and leaf extracts from infected plants in the concentration range 10-50 pg/mL. The detection limit was 12.8 pg/mL. The genosensor displayed good selectivity and sensitivity. The 20-mer partially complementary DNA sequences with four complementary bases and DNA samples from healthy plants used as negative controls generated low signal.
Aptamer-based electrochemical sensors with aptamer-complementary DNA oligonucleotides as probe.
Lu, Ying; Li, Xianchan; Zhang, Limin; Yu, Ping; Su, Lei; Mao, Lanqun
2008-03-15
This study describes a facile and general strategy for the development of aptamer-based electrochemical sensors with a high specificity toward the targets and a ready regeneration feature. Very different from the existing strategies for the development of electrochemical aptasensors with the aptamers as the probes, the strategy proposed here is essentially based on the utilization of the aptamer-complementary DNA (cDNA) oligonucleotides as the probes for electrochemical sensing. In this context, the sequences at both ends of the cDNA are tailor-made to be complementary and both the redox moiety (i.e., ferrocene in this study) and thiol group are labeled onto the cDNA. The labeled cDNA are hybridized with their respective aptamers (i.e., ATP- and thrombin-binding aptamers in this study) to form double-stranded DNA (ds-DNA) and the electrochemical aptasensors are prepared by self-assembling the labeled ds-DNA onto Au electrodes. Upon target binding, the aptamers confined onto electrode surface dissociate from their respective cDNA oligonucleotides into the solution and the single-stranded cDNA could thus tend to form a hairpin structure through the hybridization of the complementary sequences at both its ends. Such a conformational change of the cDNA resulting from the target binding-induced dissociation of the aptamers essentially leads to the change in the voltammetric signal of the redox moiety labeled onto the cDNA and thus constitutes the mechanism for the electrochemical aptasensors for specific target sensing. The aptasensors demonstrated here with the cDNA as the probe are readily regenerated and show good responses toward the targets. This study may offer a new and relatively general approach to electrochemical aptasensors with good analytical properties and potential applications.
Sensitive detection of multiple pathogens using a single DNA probe.
Nordin, Noordiana; Yusof, Nor Azah; Abdullah, Jaafar; Radu, Son; Hushiarian, Roozbeh
2016-12-15
A simple but promising electrochemical DNA nanosensor was designed, constructed and applied to differentiate a few food-borne pathogens. The DNA probe was initially designed to have a complementary region in Vibrio parahaemolyticus (VP) genome and to make different hybridization patterns with other selected pathogens. The sensor was based on a screen printed carbon electrode (SPCE) modified with polylactide-stabilized gold nanoparticles (PLA-AuNPs) and methylene blue (MB) was employed as the redox indicator binding better to single-stranded DNA. The immobilization and hybridization events were assessed using differential pulse voltammetry (DPV). The fabricated biosensor was able to specifically distinguish complementary, non-complementary and mismatched oligonucleotides. DNA was measured in the range of 2.0×10(-9)-2.0×10(-13)M with a detection limit of 5.3×10(-12)M. The relative standard deviation for 6 replications of DPV measurement of 0.2µM complementary DNA was 4.88%. The fabricated DNA biosensor was considered stable and portable as indicated by a recovery of more than 80% after a storage period of 6 months at 4-45°C. Cross-reactivity studies against various food-borne pathogens showed a reliably sensitive detection of VP. Copyright © 2016 Elsevier B.V. All rights reserved.
NASA Technical Reports Server (NTRS)
Egli, M.; Usman, N.; Rich, A.
1993-01-01
We have crystallized three double-helical DNA-RNA chimeric duplexes and determined their structures by X-ray crystallography at resolutions between 2 and 2.25 A. The two self-complementary duplexes [r(G)d(CGTATACGC)]2 and [d(GCGT)r(A)d(TACGC)]2, as well as the Okazaki fragment d(GGGTATACGC).r(GCG)d(TATACCC), were found to adopt A-type conformations. The crystal structures are non-isomorphous, and the crystallographic environments for the three chimeras are different. A number of intramolecular interactions of the ribose 2'-hydroxyl groups contribute to the stabilization of the A-conformation. Hydrogen bonds between 2'-hydroxyls and 5'-oxygens or phosphate oxygens, in addition to the previously observed hydrogen bonds to 1'-oxygens of adjacent riboses and deoxyriboses, are observed in the DNA-RNA chimeric duplexes. The crystalline chimeric duplexes do not show a transition between the DNA A- and B-conformations. CD spectra suggest that the Okazaki fragment assumes an A-conformation in solution as well. In this molecule the three RNA residues may therefore lock the complete decamer in the A-conformation. Crystals of an all-DNA strand with the same sequence as the self-complementary chimeras show a morphology which is different from those of the chimera crystals. Moreover, the oligonucleotide does not match any of the sequence characteristics of DNAs usually adopting the A-conformation in the crystalline state (e.g., octamers with short alternating stretches of purines and pyrimidines). In DNA-RNA chimeric duplexes, it is therefore possible that a single RNA residue can drive the conformational equilibrium toward the A-conformation.
Soares, Marcelo Bento; Bonaldo, Maria de Fatima
1998-01-01
This invention provides a method to normalize a cDNA library comprising: (a) constructing a directionally cloned library containing cDNA inserts wherein the insert is capable of being amplified by polymerase chain reaction; (b) converting a double-stranded cDNA library into single-stranded DNA circles; (c) generating single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) by polymerase chain reaction with appropriate primers; (d) hybridizing the single-stranded DNA circles converted in step (b) with the complementary single-stranded nucleic acid molecules generated in step (c) to produce partial duplexes to an appropriate Cot; and (e) separating the unhybridized single-stranded DNA circles from the hybridized DNA circles, thereby generating a normalized cDNA library. This invention also provides a method to normalize a cDNA library wherein the generating of single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) is by excising cDNA inserts from the double-stranded cDNA library; purifying the cDNA inserts from cloning vectors; and digesting the cDNA inserts with an exonuclease. This invention further provides a method to construct a subtractive cDNA library following the steps described above. This invention further provides normalized and/or subtractive cDNA libraries generated by the above methods.
Soares, M.B.; Fatima Bonaldo, M. de
1998-12-08
This invention provides a method to normalize a cDNA library comprising: (a) constructing a directionally cloned library containing cDNA inserts wherein the insert is capable of being amplified by polymerase chain reaction; (b) converting a double-stranded cDNA library into single-stranded DNA circles; (c) generating single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) by polymerase chain reaction with appropriate primers; (d) hybridizing the single-stranded DNA circles converted in step (b) with the complementary single-stranded nucleic acid molecules generated in step (c) to produce partial duplexes to an appropriate Cot; and (e) separating the unhybridized single-stranded DNA circles from the hybridized DNA circles, thereby generating a normalized cDNA library. This invention also provides a method to normalize a cDNA library wherein the generating of single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) is by excising cDNA inserts from the double-stranded cDNA library; purifying the cDNA inserts from cloning vectors; and digesting the cDNA inserts with an exonuclease. This invention further provides a method to construct a subtractive cDNA library following the steps described above. This invention further provides normalized and/or subtractive cDNA libraries generated by the above methods. 25 figs.
Hardware Acceleration Of Multi-Deme Genetic Algorithm for DNA Codeword Searching
2008-01-01
C and G are complementary to each other. A Watson - Crick complement of a DNA sequence is another DNA sequence which replaces all the A with T or vise...versa and replaces all the T with A or vise versa, and also switches the 5’ and 3’ ends. A DNA sequence binds most stably with its Watson - Crick ...bind with 5 Watson - Crick pairs. The length of the longest complementary sequence between two flexible DNA strands, A and B, is the same as the
Shariati, Mohsen
2018-05-15
In this paper the field-effect transistor DNA biosensor for detecting hepatitis B virus (HBV) based on indium tin oxide nanowires (ITO NWs) in label free approach has been fabricated. Because of ITO nanowires intensive conductance and functional modified surface, the probe immobilization and target hybridization were increased strongly. The high resolution transmission electron microscopy (HRTEM) measurement showed that ITO nanowires were crystalline and less than 50nm in diameter. The single-stranded hepatitis B virus DNA (SS-DNA) was immobilized as probe on the Au-modified nanowires. The DNA targets were measured in a linear concentration range from 1fM to 10µM. The detection limit of the DNA biosensor was about 1fM. The time of the hybridization process for defined single strand was 90min. The switching ratio of the biosensor between "on" and "off" state was ~ 1.1 × 10 5 . For sensing the specificity of the biosensor, non-complementary, mismatch and complementary DNA oligonucleotide sequences were clearly discriminated. The HBV biosensor confirmed the highly satisfied specificity for differentiating complementary sequences from non-complementary and the mismatch oligonucleotides. The response time of the DNA sensor was 37s with a high reproducibility. The stability and repeatability of the DNA biosensor showed that the peak current of the biosensor retained 98% and 96% of its initial response for measurements after three and five weeks, respectively. Copyright © 2018 Elsevier B.V. All rights reserved.
A novel fluorescent DNA sensor for ultrasensitive detection of Helicobacter pylori.
Liu, Ziping; Su, Xingguang
2017-01-15
In this work, a novel fluorescent DNA sensor for ultrasensitive detection of Helicobacter pylori (H. pylori) DNA was developed. This strategy took advantage of DNA hybridization between single-stranded DNA (ssDNA, which had been designed as an aptamer specific for H. pylori DNA) and the complementary target H. pylori DNA, and the feature that ssDNA bound to graphene oxide (GO) with significantly higher affinity than double-stranded DNA (dsDNA). ssDNA were firstly covalent conjugated with CuInS 2 quantum dots (QDs) by reaction between the carboxy group of QDs and amino group modified ssDNA, forming ssDNA-QDs genosensor. In the absence of the complementary target H. pylori DNA, GO could adsorb ssDNA-QDs DNA sensor and efficiently quench the fluorescence of ssDNA-QDs. While the complementary target H. pylori DNA was introduced, the ssDNA-QDs preferentially bound with the H. pylori DNA. The formation of dsDNA would alter the conformation of ssDNA and disturb the interaction between ssDNA and GO. Thus, the dsDNA-QDs/GO system exhibited a stronger fluorescence emission than that of the ssDNA-QDs/GO system. Under the optimized conditions, a linear correlation was established between the fluorescence intensity ratio I/I 0 and the concentration of H. pylori DNA in the range of 1.25-875pmolL -1 with a detection limit of 0.46pmolL -1 . The proposed method was applied to the determination of H. pylori DNA sequence in milk samples with satisfactory results. Copyright © 2016 Elsevier B.V. All rights reserved.
Yang, Wanggui; Chen, Yali; Wong, Man Shing; Lo, Pik Kwan
2012-10-08
One of the most important criteria for the successful DNA-templated polymerization to generate fully synthetic biomimetic polymers is to design the complementary structural monomers, which assemble to the templates strongly and precisely before carrying polymerization. In this study, water-soluble, laterally thymine-substituted donor-acceptor π-conjugated molecules were designed and synthesized to self-assemble with complementary oligoadenines templates, dA(20) and dA(40), into stable and tubular assemblies through noncovalent interactions including π-π stacking, dipole-dipole interactions, and the complementary adenine-thymine (A-T) hydrogen-bonding. UV-vis, fluorescence, circular dichroism (CD), atomic force microscopy (AFM), and transmission electron microscopy (TEM) techniques were used to investigate the formation of highly robust nanofibrous structures. Our results have demonstrated for the first time that the dipole-dipole interactions are stronger and useful to reinforce the assembly of donor-acceptor π-conjugated molecules to DNA templates and the formation of the stable and robust supramolecular nanofibrous complexes together with the complementary hydrogen bonding interactions. This provides an initial step toward DNA-templated polymerization to create fully synthetic DNA-mimetic polymers for biotechnological applications. This study also presents an opportunity to precisely position donor-acceptor type molecules in a controlled manner and tailor-make advanced materials for various biotechnological applications.
A novel self-powered and sensitive label-free DNA biosensor in microbial fuel cell.
Asghary, Maryam; Raoof, Jahan Bakhsh; Rahimnejad, Mostafa; Ojani, Reza
2016-08-15
In this work, a novel self-powered, sensitive, low-cost, and label-free DNA biosensor is reported by applying a two-chambered microbial fuel cell (MFC) as a power supply. A graphite electrode and an Au nanoparticles modified graphite electrode (AuNP/graphite electrode) were used as anode and cathode in the MFC system, respectively. The active biocatalyst in the anodic chamber was a mixed culture of microorganisms. The sensing element of the biosensor was fabricated by the well-known Au-thiol binding the ssDNA probe on the surface of an AuNP/graphite cathode. Electrons produced by microorganisms were transported from the anode to the cathode through an external circuit, which could be detected by the terminal multi-meter detector. The difference between power densities of the ssDNA probe modified cathode in the absence and presence of complementary sequence served as the detection signal of the DNA hybridization with detection limit of 3.1nM. Thereafter, this biosensor was employed for diagnosis and determination of complementary sequence in a human serum sample. The hybridization specificity studies further revealed that the developed DNA biosensor could distinguish fully complementary sequences from one-base mismatched and non-complementary sequences. Copyright © 2016 Elsevier B.V. All rights reserved.
1985-01-01
Previous studies (21) have shown that two mouse kappa light (L) chain variable (V) region polymorphisms, the IB-peptide and Efla markers, reflect expression of a characteristic group of V kappa regions, called V kappa Ser, by some inbred strains and not others. Expression of V kappa Ser is controlled by a locus on chromosome 6, the chromosome that contains the kappa locus. To further characterize this V kappa group and begin to analyze the basis for its strain-specific expression, full- length complementary DNA (cDNA) copies were produced of L chain mRNA from the M75 myeloma that had been induced in the C.C58 strain of mice, and which produces a V kappa Ser L chain. The C.C58 strain is congenic with BALB/cAn, differing in the region of chromosome 6 that controls expression of the V kappa polymorphisms and the Lyt-2 and Lyt-3 T cell alloantigens. The complete nucleotide sequence of this cloned cDNA was determined and compared with the nucleotide sequences the most closely related BALB/c myeloma L chains known. Results indicated significant differences throughout the variable region, but particularly toward the 5' portion of the sequence. A probe corresponding to 200 bp of the 5' end of the cloned V kappa Ser cDNA was used in Southern hybridizations of restriction digests of liver DNA from a number of inbred, recombinant, and recombinant inbred strains. Under stringent hybridization conditions, one strongly-hybridizing fragment was observed in Bam HI, Hind III, and Eco RI digests, and based on the size of the fragments, strains could be organized into two groups. The presence of strongly hybridizing Bam HI, Hind III, and Eco RI fragments of 3.2, 2.8, and 2.1 kb, respectively, was found to correlate completely with expression by the strain of the IB-peptide and Efla markers. All nonexpressor strains yielded hybridizing fragments of 7.8, 8.4, and 2.8 kb, respectively. Possible explanations for strain- specific expression of V kappa Ser-associated phenotypic markers are discussed. PMID:3926938
Loukanov, Alexandre; Filipov, Chavdar; Mladenova, Polina; Toshev, Svetlin; Emin, Saim
2016-04-01
The object of the present report is to provide a method for a visualization of DNA in TEM by complementary labeling of cytosine with guanine derivative, which contains platinum as contrast-enhanced heavy element. The stretched single-chain DNA was obtained by modifying double-stranded DNA. The labeling method comprises the following steps: (i) stretching and adsorption of DNA on the support film of an electron microscope grid (the hydrophobic carbon film holding negative charged DNA); (ii) complementary labeling of the cytosine bases from the stretched single-stranded DNA pieces on the support film with platinum containing guanine derivative to form base-specific hydrogen bond; and (iii) producing a magnified image of the base-specific labeled DNA. Stretched single-stranded DNA on a support film is obtained by a rapid elongation of DNA pieces on the surface between air and aqueous buffer solution. The attached platinum-containing guanine derivative serves as a high-dense marker and it can be discriminated from the surrounding background of support carbon film and visualized by use of conventional TEM observation at 100 kV accelerated voltage. This method allows examination of specific nucleic macromolecules through atom-by-atom analysis and it is promising way toward future DNA-sequencing or molecular diagnostics of nucleic acids by electron microscopic observation. © 2016 Wiley Periodicals, Inc.
2011-01-01
Background Restriction endonucleases are widely applied in recombinant DNA technology. Among them, enzymes of class IIS, which cleave DNA beyond recognition sites, are especially useful. We use BsaI enzyme for the pinpoint introduction of halogen nucleobases into DNA. This has been done for the purpose of anticancer radio- and phototherapy that is our long-term objective. Results An enzymatic method for synthesizing long double-stranded DNA labeled with the halogen derivatives of nucleobases (Hal-NBs) with 1-bp accuracy has been put forward and successfully tested on three different DNA fragments containing the 5-bromouracil (5-BrU) residue. The protocol assumes enzymatic cleavage of two Polymerase-Chain-Reaction (PCR) fragments containing two recognition sequences for the same or different class IIS restriction endonucleases, where each PCR fragment has a partially complementary cleavage site. These sites are introduced using synthetic DNA primers or are naturally present in the sequence used. The cleavage sites are not compatible, and therefore not susceptible to ligation until they are partially filled with a Hal-NB or original nucleobase, resulting in complementary cohesive end formation. Ligation of these fragments ultimately leads to the required Hal-NB-labeled DNA duplex. With this approach, a synthetic, extremely long DNA fragment can be obtained by means of a multiple assembly reaction (n × maximum PCR product length: n × app. 50 kb). Conclusions The long, precisely labeled DNA duplexes obtained behave in very much the same manner as natural DNA and are beyond the range of chemical synthesis. Moreover, the conditions of synthesis closely resemble the natural ones, and all the artifacts accompanying the chemical synthesis of DNA are thus eliminated. The approach proposed seems to be completely general and could be used to label DNA at multiple pre-determined sites and with halogen derivatives of any nucleobase. Access to DNAs labeled with Hal-NBs at specific position is an indispensable condition for the understanding and optimization of DNA photo- and radio-degradation, which are prerequisites for clinical trials of Hal-NBs in anticancer therapy. PMID:21864341
Sobolewski, Ireneusz; Polska, Katarzyna; Zylicz-Stachula, Agnieszka; Jeżewska-Frąckowiak, Joanna; Rak, Janusz; Skowron, Piotr
2011-08-24
Restriction endonucleases are widely applied in recombinant DNA technology. Among them, enzymes of class IIS, which cleave DNA beyond recognition sites, are especially useful. We use BsaI enzyme for the pinpoint introduction of halogen nucleobases into DNA. This has been done for the purpose of anticancer radio- and phototherapy that is our long-term objective. An enzymatic method for synthesizing long double-stranded DNA labeled with the halogen derivatives of nucleobases (Hal-NBs) with 1-bp accuracy has been put forward and successfully tested on three different DNA fragments containing the 5-bromouracil (5-BrU) residue. The protocol assumes enzymatic cleavage of two Polymerase-Chain-Reaction (PCR) fragments containing two recognition sequences for the same or different class IIS restriction endonucleases, where each PCR fragment has a partially complementary cleavage site. These sites are introduced using synthetic DNA primers or are naturally present in the sequence used. The cleavage sites are not compatible, and therefore not susceptible to ligation until they are partially filled with a Hal-NB or original nucleobase, resulting in complementary cohesive end formation. Ligation of these fragments ultimately leads to the required Hal-NB-labeled DNA duplex. With this approach, a synthetic, extremely long DNA fragment can be obtained by means of a multiple assembly reaction (n × maximum PCR product length: n × app. 50 kb). The long, precisely labeled DNA duplexes obtained behave in very much the same manner as natural DNA and are beyond the range of chemical synthesis. Moreover, the conditions of synthesis closely resemble the natural ones, and all the artifacts accompanying the chemical synthesis of DNA are thus eliminated. The approach proposed seems to be completely general and could be used to label DNA at multiple pre-determined sites and with halogen derivatives of any nucleobase. Access to DNAs labeled with Hal-NBs at specific position is an indispensable condition for the understanding and optimization of DNA photo- and radio-degradation, which are prerequisites for clinical trials of Hal-NBs in anticancer therapy.
Moriguchi, Tomohisa; Sakai, Hideaki; Suzuki, Hideo; Shinozuka, Kazuo
2008-09-01
Novel phosphorothioate-modified oligodeoxynucleotides (S-ODNs) containing a deoxyuridine derivative bearing a spermine moiety at the C-5 position were synthesized. The study of the thermal stability and the thermodynamic stability showed that the modified S-ODNs have been able to form the stable duplexes with the complementary DNA. It was also found that the duplex composed of the modified S-ODN and its complementary RNA strand is the substrate for Escherichia coli RNase H, and the cleavage of the RNA strand by the enzyme was almost similar as in the case of the unmodified one.
Nucleotide Sequence Analysis of RNA Synthesized from Rabbit Globin Complementary DNA
Poon, Raymond; Paddock, Gary V.; Heindell, Howard; Whitcome, Philip; Salser, Winston; Kacian, Dan; Bank, Arthur; Gambino, Roberto; Ramirez, Francesco
1974-01-01
Rabbit globin complementary DNA made with RNA-dependent DNA polymerase (reverse transcriptase) was used as template for in vitro synthesis of 32P-labeled RNA. The sequences of the nucleotides in most of the fragments resulting from combined ribonuclease T1 and alkaline phosphatase digestion have been determined. Several fragments were long enough to fit uniquely with the α or β globin amino-acid sequences. These data demonstrate that the cDNA was copied from globin mRNA and contained no detectable contaminants. Images PMID:4139714
Rytelewski, Mateusz; Ferguson, Peter J; Maleki Vareki, Saman; Figueredo, Rene; Vincent, Mark; Koropatnick, James
2013-03-12
A high mutation rate leading to tumor cell heterogeneity is a driver of malignancy in human cancers. Paradoxically, however, genomic instability can also render tumors vulnerable to therapeutic attack. Thus, targeting DNA repair may induce an intolerable level of DNA damage in tumor cells. BRCA2 mediates homologous recombination repair, and BRCA2 polymorphisms increase cancer risk. However, tumors with BRCA2 mutations respond better to chemotherapy and are associated with improved patient prognosis. Thymidylate synthase (TS) is also involved in DNA maintenance and generates cellular thymidylate. We determined that antisense downregulation of BRCA2 synergistically potentiated drugs with mechanisms of action related to BRCA2 function (cisplatin, melphalan), a phenomenon we named "complementary lethality." TS knockdown induced complementary lethality to TS-targeting drugs (5-FUdR and pemetrexed) but not DNA cross-linking agents. Combined targeting of BRCA2 and TS induced complementary lethality to both DNA-damaging and TS-targeting agents, thus creating multidrug sensitive tumors. In addition, we demonstrated for the first time that simultaneous downregulation of both targets induced combined complementary lethality to multiple mechanistically different drugs in the same cell population. In this study, we propose and define the concept of "complementary lethality" and show that actively targeting BRCA2 and TS is of potential therapeutic benefit in multidrug treatment of human tumors. This work has contributed to the development of a BRCA2-targeting antisense oligdeoxynucleotide (ASO) "BR-1" which we will test in vivo in combination with our TS-targeting ASO "SARI 83" and attempt early clinical trials in the future.Molecular Therapy - Nucleic Acids (2013) 2, e78; doi:10.1038/mtna.2013.7 published online 12 March 2013.
Jain, Deepak R; Anandi V, Libi; Lahiri, Mayurika; Ganesh, Krishna N
2014-10-17
Intrinsically cationic and chiral C(γ)-substituted peptide nucleic acid (PNA) analogues have been synthesized in the form of γ(S)-ethyleneamino (eam)- and γ(S)-ethyleneguanidino (egd)-PNA with two carbon spacers from the backbone. The relative stabilization (ΔTm) of duplexes from modified cationic PNAs as compared to 2-aminoethylglycyl (aeg)-PNA is better with complementary DNA (PNA:DNA) than with complementary RNA (PNA:RNA). Inherently, PNA:RNA duplexes have higher stability than PNA:DNA duplexes, and the guanidino PNAs are superior to amino PNAs. The cationic PNAs were found to be specific toward their complementary DNA target as seen from their significantly lower binding with DNA having single base mismatch. The differential binding avidity of cationic PNAs was assessed by the displacement of DNA duplex intercalated ethidium bromide and gel electrophoresis. The live cell imaging of amino/guanidino PNAs demonstrated their ability to penetrate the cell membrane in 3T3 and MCF-7 cells, and cationic PNAs were found to be accumulated in the vicinity of the nuclear membrane in the cytoplasm. Fluorescence-activated cell sorter (FACS) analysis of cell permeability showed the efficiency to be dependent upon the nature of cationic functional group, with guanidino PNAs being better than the amino PNAs in both cell lines. The results are useful to design new biofunctional cationic PNA analogues that not only bind RNA better but also show improved cell permeability.
Werz, Emma; Korneev, Sergei; Montilla-Martinez, Malayko; Wagner, Richard; Hemmler, Roland; Walter, Claudius; Eisfeld, Jörg; Gall, Karsten; Rosemeyer, Helmut
2012-02-01
A novel technique is described which comprises a base-specific DNA duplex formation at a lipid bilayer-H(2) O-phase boundary layer. Two different probes of oligonucleotides both carrying a double-tailed lipid at the 5'-terminus were incorporated into stable artificial lipid bilayers separating two compartments (cis/trans-channel) of an optically transparent microfluidic sample carrier with perfusion capabilities. Both the cis- and trans-channels are filled with saline buffer. Injection of a cyanine-5-labeled target DNA sequence, which is complementary to only one of the oligonucleotide probes, into the cis-channel, followed by a thorough perfusion, leads to an immobilization of the labeled complementary oligonucleotide on the membrane as detected by single-molecule fluorescence spectroscopy and microscopy. In the case of fluorescent but non-complementary DNA sequences, no immobilized fluorescent oligonucleotide duplex could be detected on the membrane. This clearly verifies a specific duplex formation at the membrane interface. Copyright © 2012 Verlag Helvetica Chimica Acta AG, Zürich.
Benvidi, Ali; Tezerjani, Marzieh Dehghan; Jahanbani, Shahriar; Mazloum Ardakani, Mohammad; Moshtaghioun, Seyed Mohammad
2016-01-15
In this research, we have developed lable free DNA biosensors based on modified glassy carbon electrodes (GCE) with reduced graphene oxide (RGO) and carbon nanotubes (MWCNTs) for detection of DNA sequences. This paper compares the detection of BRCA1 5382insC mutation using independent glassy carbon electrodes (GCE) modified with RGO and MWCNTs. A probe (BRCA1 5382insC mutation detection (ssDNA)) was then immobilized on the modified electrodes for a specific time. The immobilization of the probe and its hybridization with the target DNA (Complementary DNA) were performed under optimum conditions using different electrochemical techniques such as cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS). The proposed biosensors were used for determination of complementary DNA sequences. The non-modified DNA biosensor (1-pyrenebutyric acid-N- hydroxysuccinimide ester (PANHS)/GCE), revealed a linear relationship between ∆Rct and logarithm of the complementary target DNA concentration ranging from 1.0×10(-16)molL(-1) to 1.0×10(-10)mol L(-1) with a correlation coefficient of 0.992, for DNA biosensors modified with multi-wall carbon nanotubes (MWCNTs) and reduced graphene oxide (RGO) wider linear range and lower detection limit were obtained. For ssDNA/PANHS/MWCNTs/GCE a linear range 1.0×10(-17)mol L(-1)-1.0×10(-10)mol L(-1) with a correlation coefficient of 0.993 and for ssDNA/PANHS/RGO/GCE a linear range from 1.0×10(-18)mol L(-1) to 1.0×10(-10)mol L(-1) with a correlation coefficient of 0.985 were obtained. In addition, the mentioned biosensors were satisfactorily applied for discriminating of complementary sequences from noncomplementary sequences, so the mentioned biosensors can be used for the detection of BRCA1-associated breast cancer. Copyright © 2015. Published by Elsevier B.V.
Wong, T C; Kang, C Y
1978-01-01
Chicken bone marrow cells transformed by reticuloendotheliosis virus (REV) produce in the cytoplasm a ribonucleoprotein (RNP) complex which has a sedimentation value of approximately 80 to 100S and a density of 1.23 g/cm3. This RNP complex is not derived from the mature virion. An endogenous RNA-directed DNA polymerase activity is associated with the RNP complex. The enzyme activity was completely neutralized by anti-REV DNA polymerase antibody but not by anti-avian myeloblastosis virus DNA polymerase antibody. The DNA product from the endogenous RNA-directed DNA polymerase reaction of the RNP complex hybridized to REV RNA but not to avian leukosis virus RNA. The RNA extracted from the RNP hybridized only to REV-specific complementary DNA synthesized from an endogenous DNA polymerase reaction of purified REV. The size of the RNA in the RNP is 30 to 35S, which represents the subunit size of the genomic RNA. No 60S mature genomic RNA was found within the RNP complex. The significance of finding the endogenous DNA polymerase activity in the viral RNP in infected cells and the maturation process of 60S virion RNA of REV are discussed. PMID:81319
NASA Astrophysics Data System (ADS)
Pontani, Lea-Laetitia; Feng, Lang; Dreyfus, Remi; Seeman, Nadrian; Chaikin, Paul; Brujic, Jasna
2013-03-01
We develop micron-sized emulsions coated with specific DNA sequences and complementary sticky ends. The emulsions are stabilized with phospholipids on which the DNA strands are grafted through biotin-streptavidin interactions, which allows the DNA to diffuse freely on the surface. We produce two complementary emulsions: one is functionalized with S sticky ends and dyed with red streptavidin, the other displays the complementary S' sticky ends and green streptavidin. Mixing those emulsions reveals specific adhesion between them due to the short-range S-S' hybridization. As expected this interaction is thermo-reversible: the red-green adhesive droplets dissociate upon heating and reassemble after cooling. Here the fluid phospholipids layer also leads to diffusive adhesion patches, which allows the bound droplets to rearrange throughout the packing structure. We quantify the adhesion strength between two droplets and build a theoretical framework that captures the observed trends through parameters such as the size of the droplets, the DNA surface density, the various DNA constructs or the temperature. This colloidal-scale, specific, thermo-reversible biomimetic emulsion offers a new versatile and powerful tool for the development of complex self-assembled materials.
Using complementary DNA from MyoD-transduced fibroblasts to sequence large muscle genes.
Waddell, Leigh B; Monnier, Nicole; Cooper, Sandra T; North, Kathryn N; Clarke, Nigel F
2011-08-01
Large muscle genes are often sequenced using complementary DNA (cDNA) made from muscle messenger RNA (mRNA) to reduce the cost and workload associated with sequencing from genomic DNA. Two potential barriers are the availability of a frozen muscle biopsy, and difficulties in detecting nonsense mutations due to nonsense-mediated mRNA decay (NMD). We present patient examples showing that use of MyoD-transduced fibroblasts as a source of muscle-specific mRNA overcomes these potential difficulties in sequencing large muscle-related genes. Copyright © 2011 Wiley Periodicals, Inc.
NASA Astrophysics Data System (ADS)
Pal, Sarika; Verma, Alka; Raikwar, S.; Prajapati, Y. K.; Saini, J. P.
2018-05-01
In this paper, graphene-coated black phosphorus at the metal surface for the detection of DNA hybridization event is numerically demonstrated. The strategy consists of placing the sensing medium on top of black phosphorus-graphene-coated SPR which interfaces with phosphate-buffered saline solution carrying single-stranded DNA. Upon hybridization with its complementary DNA, desorption of the nanostructures takes place and thus enables the sensitive detection of the DNA hybridization event. The proposed sensor exhibits a sensitivity (125 ο/RIU), detection accuracy (0.95) and quality factor (13.62 RIU-1) for complementary DNA. In comparison with other reported papers, our suggested sensor provides much better performance. Thus, this label-free DNA detection platform should spur off new interest towards the use of black phosphorus-graphene-coated SPR interfaces.
Saunders, K; Lucy, A; Stanley, J
1991-01-01
We have analysed DNA from African cassava mosaic virus (ACMV)-infected Nicotiana benthamiana by two-dimensional agarose gel electrophoresis and detected ACMV-specific DNAs by blot-hybridisation. ACMV DNA forms including the previously characterised single-stranded, open-circular, linear and supercoiled DNAs along with five previously uncharacterised heterogeneous DNAs (H1-H5) were resolved. The heterogeneous DNAs were characterised by their chromatographic properties on BND-cellulose and their ability to hybridise to strand-specific and double-stranded probes. The data suggest a rolling circle mechanism of DNA replication, based on the sizes and strand specificity of the heterogeneous single-stranded DNA forms and their electrophoretic properties in relation to genome length single-stranded DNAs. Second-strand synthesis on a single-stranded virus-sense template is evident from the position of heterogeneous subgenomic complementary-sense DNA (H3) associated with genome-length virus-sense template (VT) DNA. The position of heterogeneous virus-sense DNA (H5), ranging in size from one to two genome lengths, is consistent with its association with genome-length complementary-sense template (CT) DNA, reflecting virus-sense strand displacement during replication from a double-stranded intermediate. The absence of subgenomic complementary-sense DNA associated with the displaced virus-sense strand suggests that replication proceeds via an obligate single-stranded intermediate. The other species of heterogeneous DNAs comprised concatemeric single-stranded virus-sense DNA (H4), and double-stranded or partially single-stranded DNA (H1 and H2). Images PMID:2041773
Cryptic splice site in the complementary DNA of glucocerebrosidase causes inefficient expression.
Bukovac, Scott W; Bagshaw, Richard D; Rigat, Brigitte A; Callahan, John W; Clarke, Joe T R; Mahuran, Don J
2008-10-15
The low levels of human lysosomal glucocerebrosidase activity expressed in transiently transfected Chinese hamster ovary (CHO) cells were investigated. Reverse transcription PCR (RT-PCR) demonstrated that a significant portion of the transcribed RNA was misspliced owing to the presence of a cryptic splice site in the complementary DNA (cDNA). Missplicing results in the deletion of 179 bp of coding sequence and a premature stop codon. A repaired cDNA was constructed abolishing the splice site without changing the amino acid sequence. The level of glucocerebrosidase expression was increased sixfold. These data demonstrate that for maximum expression of any cDNA construct, the transcription products should be examined.
Liu, Guo-Hua; Nakamura, Tatsuo; Amemiya, Takashi; Rajendran, Narasimmalu; Itoh, Kiminori
2011-01-01
Two-dimensional gel electrophoresis (2-DGE) mapping of genomic DNA and complementary DNA (cDNA) amplicons was attempted to analyze total and active bacterial populations within soil and activated sludge samples. Distinct differences in the number and species of bacterial populations and those that were metabolically active at the time of sampling were visually observed especially for the soil community. Statistical analyses and sequencing based on the 2-DGE data further revealed the relationships between total and active bacterial populations within each community. This high-resolution technique would be useful for obtaining a better understanding of bacterial population structures in the environment.
Woods, D E; Edge, M D; Colten, H R
1984-01-01
Complementary DNA (cDNA) clones corresponding to the major histocompatibility (MHC) class III antigen, complement protein C2, have been isolated from human liver cDNA libraries with the use of a complex mixture of synthetic oligonucleotides (17 mer) that contains 576 different oligonucleotide sequences. The C2 cDNA were used to identify a DNA restriction enzyme fragment length polymorphism that provides a genetic marker within the MHC that was not detectable at the protein level. An extensive search for genomic polymorphisms using a cDNA clone for another MHC class III gene, factor B, failed to reveal any DNA variants. The genomic variants detected with the C2 cDNA probe provide an additional genetic marker for analysis of MHC-linked diseases. Images PMID:6086718
Mohamadi, Maryam; Mostafavi, Ali; Torkzadeh-Mahani, Masoud
2017-11-01
The aim of this research was the determination of a microRNA (miRNA) using a DNA electrochemical aptasensor. In this biosensor, the complementary complementary DNA (cDNA) of miRNA-145 (a sense RNA transcript) was the target strand and the cDNA of miRNA-145 was the probe strand. Both cDNAs can be the product of the reverse transcriptase-polymerase chain reaction of miRNA. The proposed aptasensor's function was based on the hybridization of target strands with probes immobilized on the surface of a working electrode and the subsequent intercalation of doxorubicin (DOX) molecules functioning as the electroactive indicators of any double strands that formed. Electrochemical transduction was performed by measuring the cathodic current resulting from the electrochemical reduction of the intercalated molecules at the electrode surface. In the experiment, because many DOX molecules accumulated on each target strand on the electrode surface, amplification was inherently easy, without a need for enzymatic or complicated amplification strategies. The proposed aptasensor also had the excellent ability to regenerate as a result of the melting of the DNA duplex. Moreover, the use of DNA probe strands obviated the challenges of working with an RNA probe, such as sensitivity to RNase enzyme. In addition to the linear relationship between the electrochemical signal and the concentration of the target strands that ranged from 2.0 to 80.0 nM with an LOD of 0.27 nM, the proposed biosensor was clearly capable of distinguishing between complementary (target strand) and noncomplementary sequences. The presented biosensor was successfully applied for the quantification of DNA strands corresponding to miRNA-145 in human serum samples.
Torati, Sri Ramulu; Reddy, Venu; Yoon, Seok Soo; Kim, CheolGi
2016-04-15
The template assisted electrochemical deposition technique was used for the synthesis of gold nanotubes array (AuNTsA). The morphological structure of the synthesized AuNTsA was observed by scanning electron microscopy and found that the individual nanotubes are around 1.5 μm in length with a diameter of 200 nm. Nanotubes are vertically aligned to the Au thick film, which is formed during the synthesis process of nanotubes. The electrochemical performance of the AuNTsA was compared with the bare Au electrode and found that AuNTsA has better electron transfer surface than bare Au electrode which is due to the high surface area. Hence, the AuNTsA was used as an electrode for the fabrication of DNA hybridization biosensor for detection of Mycobacterium Tuberculosis DNA. The DNA hybridization biosensor constructed by AuNTsA electrode was characterized by cyclic voltammetry technique with Fe(CN)6(3-/4-) as an electrochemical redox indicator. The selectivity of the fabricated biosensor was illustrated by hybridization with complementary DNA and non-complementary DNA with probe DNA immobilized AuNTsA electrode using methylene blue as a hybridization indicator. The developed electrochemical DNA biosensor shows good linear range of complementary DNA concentration from 0.01 ng/μL to 100 ng/μL with high detection limit. Copyright © 2015 Elsevier B.V. All rights reserved.
Liu, Zhi; Ding, Shuang; Kropachev, Konstantin; Lei, Jia; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E.
2015-01-01
The nucleotide excision repair of certain bulky DNA lesions is abrogated in some specific non-canonical DNA base sequence contexts, while the removal of the same lesions by the nucleotide excision repair mechanism is efficient in duplexes in which all base pairs are complementary. Here we show that the nucleotide excision repair activity in human cell extracts is moderate-to-high in the case of two stereoisomeric DNA lesions derived from the pro-carcinogen benzo[a]pyrene (cis- and trans-B[a]P-N 2-dG adducts) in a normal DNA duplex. By contrast, the nucleotide excision repair activity is completely abrogated when the canonical cytosine base opposite the B[a]P-dG adducts is replaced by an abasic site in duplex DNA. However, base excision repair of the abasic site persists. In order to understand the structural origins of these striking phenomena, we used NMR and molecular spectroscopy techniques to evaluate the conformational features of 11mer DNA duplexes containing these B[a]P-dG lesions opposite abasic sites. Our results show that in these duplexes containing the clustered lesions, both B[a]P-dG adducts adopt base-displaced intercalated conformations, with the B[a]P aromatic rings intercalated into the DNA helix. To explain the persistence of base excision repair in the face of the opposed bulky B[a]P ring system, molecular modeling results suggest how the APE1 base excision repair endonuclease, that excises abasic lesions, can bind productively even with the trans-B[a]P-dG positioned opposite the abasic site. We hypothesize that the nucleotide excision repair resistance is fostered by local B[a]P residue—DNA base stacking interactions at the abasic sites, that are facilitated by the absence of the cytosine partner base in the complementary strand. More broadly, this study sets the stage for elucidating the interplay between base excision and nucleotide excision repair in processing different types of clustered DNA lesions that are substrates of nucleotide excision repair or base excision repair mechanisms. PMID:26340000
Cloning and expression of a cDNA coding for catalase from zebrafish (Danio rerio).
Ken, C F; Lin, C T; Wu, J L; Shaw, J F
2000-06-01
A full-length complementary DNA (cDNA) clone encoding a catalase was amplified by the rapid amplication of cDNA ends-polymerase chain reaction (RACE-PCR) technique from zebrafish (Danio rerio) mRNA. Nucleotide sequence analysis of this cDNA clone revealed that it comprised a complete open reading frame coding for 526 amino acid residues and that it had a molecular mass of 59 654 Da. The deduced amino acid sequence showed high similarity with the sequences of catalase from swine (86.9%), mouse (85.8%), rat (85%), human (83.7%), fruit fly (75.6%), nematode (71.1%), and yeast (58.6%). The amino acid residues for secondary structures are apparently conserved as they are present in other mammal species. Furthermore, the coding region of zebrafish catalase was introduced into an expression vector, pET-20b(+), and transformed into Escherichia coli expression host BL21(DE3)pLysS. A 60-kDa active catalase protein was expressed and detected by Coomassie blue staining as well as activity staining on polyacrylamide gel followed electrophoresis.
Monti, Susanna; Cacelli, Ivo; Ferretti, Alessandro; Prampolini, Giacomo; Barone, Vincenzo
2011-07-21
Molecular dynamics simulations (90 ns) of different DNA complexes attached to a functionalized substrate in solution were performed in order to clarify the behavior of mismatched DNA sequences captured by a tethered DNA probe (biochip). Examination of the trajectories revealed that the substrate influence and a series of cooperative events, including recognition, reorientation and reorganization of the bases, could induce the formation of stable duplexes having non-canonical arrangements. Major adjustment of the structures was observed when the mutated base was located in the end region of the chain close to the surface. This journal is © the Owner Societies 2011
Craig, R K; Hall, L; Parker, D; Campbell, P N
1981-01-01
A complementary DNA (cDNA) plasmid library has been constructed in the plasmid pAT153, using poly(A)-containing RNA isolated from the lactating guinea-pig mammary gland as the starting material. Double stranded cDNA was inserted into the EcoRI site of the plasmid using poly(dA . dT) tails, then transformed into Escherichia coli HB101. From the resulting colonies we have selected and partially characterized plasmids containing cDNA copies of the mRNAs for casein A, casein B, casein C and alpha-lactalbumin. However, the proportion containing casein C cDNA was exceptionally low, and these contained at best 60% of the mRNA sequence. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. PMID:7306038
Template-switching during DNA synthesis by Thermus aquaticus DNA polymerase I.
Odelberg, S J; Weiss, R B; Hata, A; White, R
1995-01-01
Recombinant DNA molecules are often generated during the polymerase chain reaction (PCR) when partially homologous templates are available [e.g., see Pääbo et al. (1990) J. Biol. Chem. 265, 4718-4721]. It has been suggested that these recombinant molecules are a consequence of truncated extension products annealing to partially homologous templates on subsequent PCR cycles. However, we demonstrate here that recombinants can be generated during a single round of primer extension in the absence of subsequent heat denaturation, indicating that template-switching produces some of these recombinant molecules. Two types of template-switches were observed: (i) switches to pre-existing templates and (ii) switches to the complementary nascent strand. Recombination is reduced several fold when the complementary template strands are physically separated by attachment to streptavidin magnetic beads. This result supports the hypothesis that either the polymerase or at least one of the two extending strands switches templates during DNA synthesis and that interaction between the complementary template strands is necessary for efficient template-switching. Images PMID:7596836
Zhang, Zhaoyang; Li, Shihui; Chen, Niancao; Yang, Cheng; Wang, Yong
2013-04-08
Extensive studies have been recently carried out to achieve dynamic control of cell-material interactions primarily through physicochemical stimulation. The purpose of this study was to apply reversible intermolecular hybridization to program cell-hydrogel interactions in physiological conditions based on DNA-antibody chimeras and complementary oligonucleotides. The results showed that DNA oligonucleotides could be captured to and released from the immobilizing DNA-functionalized hydrogels with high specificity via DNA hybridization. Accordingly, DNA-antibody chimeras were captured to the hydrogels, successfully inducing specific cell attachment. The cell attachment to the hydrogels reached the plateau at approximately half an hour after the functionalized hydrogels and the cells were incubated together. The attached cells were rapidly released from the bound hydrogels when triggering complementary oligonucleotides were introduced to the system. However, the capability of the triggering complementary oligonucleotides in releasing cells was affected by the length of intermolecular hybridization. The length needed to be at least more than 20 base pairs in the current experimental setting. Notably, because the procedure of intermolecular hybridization did not involve any harsh condition, the released cells maintained the same viability as that of the cultured cells. The functionalized hydrogels also exhibited the potential to catch and release cells repeatedly. Therefore, this study demonstrates that it is promising to regulate cell-material interactions dynamically through the DNA-programmed display of DNA-protein chimeras.
Reverse transcription of phage RNA and its fragment directed by synthetic heteropolymeric primers
Frolova, L. Yu.; Metelyev, V. G.; Ratmanova, K. I.; Smirnov, V. D.; Shabarova, Z. A.; Prokofyev, M. A.; Berzin, V. M.; Jansone, I. V.; Gren, E. J.; Kisselev, L. L.
1977-01-01
DNA synthesis catalysed by RNA-directed DNA-polymerase (reverse transcriptase) was found to proceed on the RNA template of an MS2 phage in the presence of heteropolymeric synthetic octa- and nonadeoxyribonucleotide primers complementary to the intercistronic region (coat protein binding site) and the region of the coat protein cistron, respectively. The product of synthesis consists of discrete DNA fractions of different length, including transcripts longer than 1,000 nucleotides. The coat protein inhibits DNA synthesis if it is initiated at its binding site, but has no effect on DNA synthesis initiated at the coat protein cistron. It has been suggested that, in this system, the initiation of DNA synthesis by synthetic primers is topographically specific. The MS2 coat protein binding site (an RNA fragment of 59 nucleotides) serves as a template for polydeoxyribonucleotide synthesis in the presence of octanucleotide primer and reverse transcriptase. The product of synthesis is homogenous and its length corresponds to the length of the template. The effective and complete copying of the fragment having a distinct secondary structure proves that the secondary structure does not interfere, in principle, with RNA being a template in the system of reverse transcription. PMID:71713
Highly sensitive self-complementary DNA nanoswitches triggered by polyelectrolytes.
Wu, Jincai; Yu, Feng; Zhang, Zheng; Chen, Yong; Du, Jie; Maruyama, Atsushi
2016-01-07
Dimerization of two homologous strands of genomic DNA/RNA is an essential feature of retroviral replication. Herein we show that a cationic comb-type copolymer (CCC), poly(L-lysine)-graft-dextran, accelerates the dimerization of self-complementary stem-loop DNA, frequently found in functional DNA/RNA molecules, such as aptamers. Furthermore, an anionic polymer poly(sodium vinylsulfonate) (PVS) dissociates CCC from the duplex shortly within a few seconds. Then single stem-loop DNA spontaneously transforms from its dimer. Thus we can easily control the dimer and stem-loop DNA by switching on/off CCC activity. Both polyelectrolytes and DNA concentrations are in the nanomole per liter range. The polyelectrolyte-assisted transconformation and sequences design strategy ensures the reversible state control with rapid response and effective switching under physiologically relevant conditions. A further application of this sensitive assembly is to construct an aptamer-type drug delivery system, bind or release functional molecules responding to its transconformation.
Yeast Pif1 Accelerates Annealing of Complementary DNA Strands
2015-01-01
Pif1 is a helicase involved in the maintenance of nuclear and mitochondrial genomes in eukaryotes. Here we report a new activity of Saccharomyces cerevisiae Pif1, annealing of complementary DNA strands. We identified preferred substrates for annealing as those that generate a duplex product with a single-stranded overhang relative to a blunt end duplex. Importantly, we show that Pif1 can anneal DNA in the presence of ATP and Mg2+. Pif1-mediated annealing also occurs in the presence of single-stranded DNA binding proteins. Additionally, we show that partial duplex substrates with 3′-single-stranded overhangs such as those generated during double-strand break repair can be annealed by Pif1. PMID:25393406
Yeast Pif1 accelerates annealing of complementary DNA strands.
Ramanagoudr-Bhojappa, Ramanagouda; Byrd, Alicia K; Dahl, Christopher; Raney, Kevin D
2014-12-09
Pif1 is a helicase involved in the maintenance of nuclear and mitochondrial genomes in eukaryotes. Here we report a new activity of Saccharomyces cerevisiae Pif1, annealing of complementary DNA strands. We identified preferred substrates for annealing as those that generate a duplex product with a single-stranded overhang relative to a blunt end duplex. Importantly, we show that Pif1 can anneal DNA in the presence of ATP and Mg(2+). Pif1-mediated annealing also occurs in the presence of single-stranded DNA binding proteins. Additionally, we show that partial duplex substrates with 3'-single-stranded overhangs such as those generated during double-strand break repair can be annealed by Pif1.
A direct detection of Escherichia coli genomic DNA using gold nanoprobes
2012-01-01
Background In situation like diagnosis of clinical and forensic samples there exists a need for highly sensitive, rapid and specific DNA detection methods. Though conventional DNA amplification using PCR can provide fast results, it is not widely practised in diagnostic laboratories partially because it requires skilled personnel and expensive equipment. To overcome these limitations nanoparticles have been explored as signalling probes for ultrasensitive DNA detection that can be used in field applications. Among the nanomaterials, gold nanoparticles (AuNPs) have been extensively used mainly because of its optical property and ability to get functionalized with a variety of biomolecules. Results We report a protocol for the use of gold nanoparticles functionalized with single stranded oligonucleotide (AuNP- oligo probe) as visual detection probes for rapid and specific detection of Escherichia coli. The AuNP- oligo probe on hybridization with target DNA containing complementary sequences remains red whereas test samples without complementary DNA sequences to the probe turns purple due to acid induced aggregation of AuNP- oligo probes. The color change of the solution is observed visually by naked eye demonstrating direct and rapid detection of the pathogenic Escherichia coli from its genomic DNA without the need for PCR amplification. The limit of detection was ~54 ng for unamplified genomic DNA. The method requires less than 30 minutes to complete after genomic DNA extraction. However, by using unamplified enzymatic digested genomic DNA, the detection limit of 11.4 ng was attained. Results of UV-Vis spectroscopic measurement and AFM imaging further support the hypothesis of aggregation based visual discrimination. To elucidate its utility in medical diagnostic, the assay was validated on clinical strains of pathogenic Escherichia coli obtained from local hospitals and spiked urine samples. It was found to be 100% sensitive and proves to be highly specific without any cross reaction with non-Escherichia coli strains. Conclusion This work gives entry into a new class of DNA/gold nanoparticles hybrid materials which might have optical property that can be controlled for application in diagnostics. We note that it should be possible to extend this strategy easily for developing new types of DNA biosensor for point of care detection. The salient feature of this approach includes low-cost, robust reagents and simple colorimetric detection of pathogen. PMID:22309695
Sun, Zhongyue; Liao, Tangbin; Zhang, Yulin; Shu, Jing; Zhang, Hong; Zhang, Guo-Jun
2016-12-15
A very simple sensing device based on biomimetic nanochannels has been developed for label-free, ultrasensitive and highly sequence-specific detection of DNA. Probe DNA was modified on the inner wall of the nanochannel surface by layer-by-layer (LBL) assembly. After probe DNA immobilization, DNA detection was realized by monitoring the rectified ion current when hybridization occurred. Due to three dimensional (3D) nanoscale environment of the nanochannel, this special geometry dramatically increased the surface area of the nanochannel for immobilization of probe molecules on the inner-surface and enlarged contact area between probes and target-molecules. Thus, the unique sensor reached a reliable detection limit of 10 fM for target DNA. In addition, this DNA sensor could discriminate complementary DNA (c-DNA) from non-complementary DNA (nc-DNA), two-base mismatched DNA (2bm-DNA) and one-base mismatched DNA (1bm-DNA) with high specificity. Moreover, the nanochannel-based biosensor was also able to detect target DNA even in an interfering environment and serum samples. This approach will provide a novel biosensing platform for detection and discrimination of disease-related molecular targets and unknown sequence DNA. Copyright © 2016 Elsevier B.V. All rights reserved.
Tahir, Muhammad Ali; Hameed, Sadaf; Munawar, Anam; Amin, Imran; Mansoor, Shahid; Khan, Waheed S; Bajwa, Sadia Zafar
2017-11-01
The emergence of nanotechnology has opened new horizons for constructing efficient recognition interfaces. This is the first report where the potential of a multiwalled carbon nanotube based zinc nanocomposite (MWCNTs-Zn NPs) investigated for the detection of an agricultural pathogen i.e. Chili leaf curl betasatellite (ChLCB). Atomic force microscope analyses revealed the presence of multiwalled carbon nanotubes (MWCNTs) having a diameter of 50-100nm with zinc nanoparticles (Zn-NPs) of 25-500nm. In this system, these bunches of Zn-NPs anchored along the whole lengths of MWCNTs were used for the immobilization of probe DNA strands. The electrochemical performance of DNA biosensor was assessed in the absence and presence of the complementary DNA during cyclic and differential pulse voltammetry scans. Target binding events occurring on the interface surface patterned with single-stranded DNA was quantitatively translated into electrochemical signals due to hybridization process. In the presence of complementary target DNA, as the result of duplex formation, there was a decrease in the peak current from 1.89×10 -04 to 5.84×10 -05 A. The specificity of this electrochemical DNA biosensor was found to be three times as compared to non-complementary DNA. This material structuring technique can be extended to design interfaces for the recognition of the other plant viruses and biomolecules. Copyright © 2017 Elsevier B.V. All rights reserved.
Structural Transformation of Wireframe DNA Origami via DNA Polymerase Assisted Gap-Filling.
Agarwal, Nayan P; Matthies, Michael; Joffroy, Bastian; Schmidt, Thorsten L
2018-03-27
The programmability of DNA enables constructing nanostructures with almost any arbitrary shape, which can be decorated with many functional materials. Moreover, dynamic structures can be realized such as molecular motors and walkers. In this work, we have explored the possibility to synthesize the complementary sequences to single-stranded gap regions in the DNA origami scaffold cost effectively by a DNA polymerase rather than by a DNA synthesizer. For this purpose, four different wireframe DNA origami structures were designed to have single-stranded gap regions. This reduced the number of staple strands needed to determine the shape and size of the final structure after gap filling. For this, several DNA polymerases and single-stranded binding (SSB) proteins were tested, with T4 DNA polymerase being the best fit. The structures could be folded in as little as 6 min, and the subsequent optimized gap-filling reaction was completed in less than 3 min. The introduction of flexible gap regions results in fully collapsed or partially bent structures due to entropic spring effects. Finally, we demonstrated structural transformations of such deformed wireframe DNA origami structures with DNA polymerases including the expansion of collapsed structures and the straightening of curved tubes. We anticipate that this approach will become a powerful tool to build DNA wireframe structures more material-efficiently, and to quickly prototype and test new wireframe designs that can be expanded, rigidified, or mechanically switched. Mechanical force generation and structural transitions will enable applications in structural DNA nanotechnology, plasmonics, or single-molecule biophysics.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Halid, Nurul Izni Abdullah; Hasbullah, Siti Aishah; Heng, Lee Yook
2014-09-03
A DNA biosensor detection of oligonucleotides via the interactions of porcine DNA with redox active complex based on the electrochemical transduction is described. A ruthenium(II) complex, [Ru(bpy){sub 2}(PIP)]{sup 2+}, (bpy = 2,2′bipyridine, PIP = 2-phenylimidazo[4,5-f[[1,10-phenanthroline]) as DNA label has been synthesized and characterized by 1H NMR and mass spectra. The study was carried out by covalent bonding immobilization of porcine aminated DNA probes sequences on screen printed electrode (SPE) modified with succinimide-acrylic microspheres and [Ru(bpy){sub 2}(PIP)]{sup 2+} was used as electrochemical redox intercalator label to detect DNA hybridization event. Electrochemical detection was performed by cyclic voltammetry (CV) and differential pulsemore » voltammetry (DPV) over the potential range where the ruthenium (II) complex was active. The results indicate that the interaction of [Ru(bpy){sub 2}(PIP)]{sup 2+} with hybridization complementary DNA has higher response compared to single-stranded and mismatch complementary DNA.« less
RNA-programmed genome editing in human cells
Jinek, Martin; East, Alexandra; Cheng, Aaron; Lin, Steven; Ma, Enbo; Doudna, Jennifer
2013-01-01
Type II CRISPR immune systems in bacteria use a dual RNA-guided DNA endonuclease, Cas9, to cleave foreign DNA at specific sites. We show here that Cas9 assembles with hybrid guide RNAs in human cells and can induce the formation of double-strand DNA breaks (DSBs) at a site complementary to the guide RNA sequence in genomic DNA. This cleavage activity requires both Cas9 and the complementary binding of the guide RNA. Experiments using extracts from transfected cells show that RNA expression and/or assembly into Cas9 is the limiting factor for Cas9-mediated DNA cleavage. In addition, we find that extension of the RNA sequence at the 3′ end enhances DNA targeting activity in vivo. These results show that RNA-programmed genome editing is a facile strategy for introducing site-specific genetic changes in human cells. DOI: http://dx.doi.org/10.7554/eLife.00471.001 PMID:23386978
Properties of an unusual DNA primase from an archaeal plasmid
Beck, Kirsten; Lipps, Georg
2007-01-01
Primases are specialized DNA-dependent RNA polymerases that synthesize a short oligoribonucleotide complementary to single-stranded template DNA. In the context of cellular DNA replication, primases are indispensable since DNA polymerases are not able to start DNA polymerization de novo. The primase activity of the replication protein from the archaeal plasmid pRN1 synthesizes a rather unusual mixed primer consisting of a single ribonucleotide at the 5′ end followed by seven deoxynucleotides. Ribonucleotides and deoxynucleotides are strictly required at the respective positions within the primer. Furthermore, in contrast to other archaeo-eukaryotic primases, the primase activity is highly sequence-specific and requires the trinucleotide motif GTG in the template. Primer synthesis starts outside of the recognition motif, immediately 5′ to the recognition motif. The fidelity of the primase synthesis is high, as non-complementary bases are not incorporated into the primer. PMID:17709343
Pan, Hong-zhi; Yu, Hong- Wei; Wang, Na; Zhang, Ze; Wan, Guang-Cai; Liu, Hao; Guan, Xue; Chang, Dong
2015-01-01
To develop a new electrochemical DNA biosensor for determination of Klebsiella pneumoniae carbapenemase, a highly sensitive and selective electrochemical biosensor for DNA detection was constructed based on a glassy carbon electrode (GCE) modified with gold nanoparticles (Au-nano). The Au-nano/GCE was characterized by scanning electromicroscopy, cyclic voltammetry, and electrochemical impedance spectroscopy. The hybridization detection was measured by differential pulse voltammetry using methylene blue as the hybridization indicator. The dynamic range of detection of the sensor for the target DNA sequences was from 1 × 10(-11) to 1 × 10(-8) M, with an LOD of 1 × 10(-12) M. The DNA biosensor had excellent specificity for distinguishing complementary DNA sequence in the presence of non-complementary and mismatched DNA sequence. The Au-nano/GCE showed significant improvement in electrochemical characteristics, and this biosensor was successfully applied for determination of K. pneumoniae.
Formation of template-switching artifacts by linear amplification.
Chakravarti, Dhrubajyoti; Mailander, Paula C
2008-07-01
Linear amplification is a method of synthesizing single-stranded DNA from either a single-stranded DNA or one strand of a double-stranded DNA. In this protocol, molecules of a single primer DNA are extended by multiple rounds of DNA synthesis at high temperature using thermostable DNA polymerases. Although linear amplification generates the intended full-length single-stranded product, it is more efficient over single-stranded templates than double-stranded templates. We analyzed linear amplification over single- or double-stranded mouse H-ras DNA (exon 1-2 region). The single-stranded H-ras template yielded only the intended product. However, when the double-stranded template was used, additional artifact products were observed. Increasing the concentration of the double-stranded template produced relatively higher amounts of these artifact products. One of the artifact DNA bands could be mapped and analyzed by sequencing. It contained three template-switching products. These DNAs were formed by incomplete DNA strand extension over the template strand, followed by switching to the complementary strand at a specific Ade nucleotide within a putative hairpin sequence, from which DNA synthesis continued over the complementary strand.
Katz, D; Niederberger, C; Slaughter, G R; Cooney, A J
1997-10-01
Nuclear receptors, such as those for androgens, estrogens, and progesterones, control many reproductive processes. Proteins with structures similar to these receptors, but for which ligands have not yet been identified, have been termed orphan nuclear receptors. One of these orphans, germ cell nuclear factor (GCNF), has been shown to be germ cell specific in the adult and, therefore, may also participate in the regulation of reproductive functions. In this paper, we examine more closely the expression patterns of GCNF in germ cells to begin to define spatio-temporal domains of its activity. In situ hybridization showed that GCNF messenger RNA (mRNA) is lacking in the testis of hypogonadal mutant mice, which lack developed spermatids, but is present in the wild-type testis. Thus, GCNF is, indeed, germ cell specific in the adult male. Quantitation of the specific in situ hybridization signal in wild-type testis reveals that GCNF mRNA is most abundant in stage VII round spermatids. Similarly, Northern analysis and specific in situ hybridization show that GCNF expression first occurs in testis of 20-day-old mice, when round spermatids first emerge. Therefore, in the male, GCNF expression occurs postmeiotically and may participate in the morphological changes of the maturing spermatids. In contrast, female expression of GCNF is shown in growing oocytes that have not completed the first meiotic division. Thus, GCNF in the female is expressed before the completion of meiosis. Finally, the nature of the two different mRNAs that hybridize to the GCNF complementary DNA was studied. Although both messages contain the DNA binding domain, only the larger message is recognized by a probe from the extreme 3' untranslated region. In situ hybridization with these differential probes demonstrates that both messages are present in growing oocytes. In addition, the coding region and portions of the 3' untranslated region of the GCNF complementary DNA are conserved in the rat.
[Principles for molecular identification of traditional Chinese materia medica using DNA barcoding].
Chen, Shi-Lin; Yao, Hui; Han, Jian-Ping; Xin, Tian-Yi; Pang, Xiao-Hui; Shi, Lin-Chun; Luo, Kun; Song, Jing-Yuan; Hou, Dian-Yun; Shi, Shang-Mei; Qian, Zhong-Zhi
2013-01-01
Since the research of molecular identification of Chinese Materia Medica (CMM) using DNA barcode is rapidly developing and popularizing, the principle of this method is approved to be listed in the Supplement of the Pharmacopoeia of the People's Republic of China. Based on the study on comprehensive samples, the DNA barcoding systems have been established to identify CMM, i.e. ITS2 as a core barcode and psbA-trnH as a complementary locus for identification of planta medica, and COI as a core barcode and ITS2 as a complementary locus for identification of animal medica. This article introduced the principle of molecular identification of CMM using DNA barcoding and its drafting instructions. Furthermore, its application perspective was discussed.
Deng, Jiajia; Toh, Chee-Seng
2013-06-17
A novel and integrated membrane sensing platform for DNA detection is developed based on an anodic aluminum oxide (AAO) membrane. Platinum electrodes (~50-100 nm thick) are coated directly on both sides of the alumina membrane to eliminate the solution resistance outside the nanopores. The electrochemical impedance technique is employed to monitor the impedance changes within the nanopores upon DNA binding. Pore resistance (Rp) linearly increases in response towards the increasing concentration of the target DNA in the range of 1 × 10⁻¹² to 1 × 10⁻⁶ M. Moreover, the biosensor selectively differentiates the complementary sequence from single base mismatched (MM-1) strands and non-complementary strands. This study reveals a simple, selective and sensitive method to fabricate a label-free DNA biosensor.
Liu, G; Gelboin, H V; Myers, M J
1991-02-01
The role of P450 IA2 in the hydroxylation of acetanilide was examined using an inhibitory monoclonal antibody (MAb) 1-7-1 and vaccinia cDNA expression producing murine P450 IA1 (mIA1), murine P450 IA2 (mIA2), or human P450 IA2 (hIA2). Acetanilide hydroxylase (AcOH) activity was measured using an HPLC method with more than 500-fold greater sensitivity than previously described procedures. This method, which does not require the use of radioactive acetanilide, was achieved by optimizing both the gradient system and the amount of enzyme needed to achieve detection by uv light. MAb 1-7-1 inhibits up to 80% of the AcOH activity in both rat liver microsomes and cDNA expressed mouse and human P450 IA2. MAb 1-7-1, which recognizes both P450 IA1 and P450 IA2, completely inhibits the aryl hydrocarbon hydroxylase (AHH) activity of cDNA expressed in IA1. The inhibition of only 80% of the AHH activity present in MC liver microsomes by MAb 1-7-1 suggests that additional P450 forms are contributing to the overall AHH activity present in methylcholanthrene (MC)-liver microsomes as MAb 1-7-1 almost completely inhibits the AHH activity of expressed mIA1. Maximal inhibition of IA2 by 1-7-1 results in an 80% decrease in acetanilide hydroxylase activity in both liver microsomes and expressed mouse and human IA2. The capacity of MAb 1-7-1 to produce identical levels of inhibition of acetanilide hydroxylase activity in rat MC microsomes (80%) and in expressed mouse (81%) and human P450 IA2 (80%) strongly suggests that P450 IA2 is the major and perhaps the only enzyme responsible for the metabolism of acetanilide. These results demonstrate the complementary utility of monoclonal antibodies and cDNA expression for defining the contribution of specific P450 enzymes to the metabolism of a given substrate. This complementary approach allows for a more precise determination of the inhibitory capacity of MAb with respect to the metabolic capacity of the target P450.
Terminations of DNA synthesis on 'proflavine and light'-treated phi X174 single-stranded DNA.
Piette, J; Calberg-Bacq, C M; Lopez, M; van de Vorst, A
1984-04-05
Bacteriophage phi X174 single-stranded DNA molecules were primed with five different restriction fragments and irradiated with visible light in the presence of proflavine. This photodamaged DNA was used as template for the in vitro complementary chain synthesis by E. coli DNA polymerase I (Klenow fragment). Chain terminations were observed by polyacrylamide gel electrophoresis of the synthesized products and localized by comparison with standard sequencing performed simultaneously on the untreated template. 90% of the chain terminations occurred one nucleotide before a guanine residue in the template strand. More than 80% of the sequenced guanine residues were blocking lesions demonstrating the absence of 'hot-spots' for the photodamaging effect of proflavine. At a defined position, the chain termination frequency increased linearly with the irradiation time and was directly influenced by the proflavine concentration present. An important part of lesions resulted from the action of singlet oxygen produced by excited proflavine as shown by the effect that both NaN3 and 2H2O exerted on the reaction. The induced blocking lesions must be important in vivo since no complete replicative forms could be extracted from cell infected with bacteriophages inactivated by 'proflavine and light' treatment.
Guo, Q; Mintier, G; Ma-Edmonds, M; Storton, D; Wang, X; Xiao, X; Kienzle, B; Zhao, D; Feder, John N
2018-02-01
Using CRISPR/Cas9 delivered as a RNA modality in conjunction with a lipid specifically formulated for large RNA molecules, we demonstrate that homology directed repair (HDR) rates between 20-40% can be achieved in induced pluripotent stem cells (iPSC). Furthermore, low HDR rates (between 1-20%) can be enhanced two- to ten-fold in both iPSCs and HEK293 cells by 'cold shocking' cells at 32 °C for 24-48 hours following transfection. This method can also increases the proportion of loci that have undergone complete sequence conversion across the donor sequence, or 'perfect HDR', as opposed to partial sequence conversion where nucleotides more distal to the CRISPR cut site are less efficiently incorporated ('partial HDR'). We demonstrate that the structure of the single-stranded DNA oligo donor can influence the fidelity of HDR, with oligos symmetric with respect to the CRISPR cleavage site and complementary to the target strand being more efficient at directing 'perfect HDR' compared to asymmetric non-target strand complementary oligos. Our protocol represents an efficient method for making CRISPR-mediated, specific DNA sequence changes within the genome that will facilitate the rapid generation of genetic models of human disease in iPSCs as well as other genome engineered cell lines.
Method for performing site-specific affinity fractionation for use in DNA sequencing
Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Dubley, Svetlana A.
1999-01-01
A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between said cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting said extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to said extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from said array.
Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Dubley, Svetlana A.
2000-01-01
A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between said cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting said extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to said extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from said array.
Method for performing site-specific affinity fractionation for use in DNA sequencing
Mirzabekov, A.D.; Lysov, Y.P.; Dubley, S.A.
1999-05-18
A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between the cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting the extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to the extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from the array. 14 figs.
Tak, Manvi; Gupta, Vinay; Tomar, Monika
2014-09-15
Zinc oxide (ZnO) nanostructures possessing flower-like morphology have been synthesised onto platinized silicon substrate by simple and economical hydrothermal method. The interaction of physically immobilized single stranded thiolated DNA (ss th-DNA) probe of N. meningitides onto the nanostructured ZnO (ZNF) matrix surface have been investigated using cyclic voltammetry (CV) and electrochemical impeadance spectroscopy (EIS). The electrochemical sensing response behaviour of the DNA bioelectrode (ss th-DNA/ZNF/Pt/Si) has been studied by both differential pulse voltammetric (DPV) as well as impedimetric techniques. The fabricated DNA biosensor can quantify wide range of the complementary target ss th-DNA in the range 5-240 ng μl(-1) with good linearity (R=0.98), high sensitivity (168.64 μA ng(-1) μl cm(-2)) and low detection limit of about 5 ng μl(-1). Results emphasise that the fabricated flower-like ZnO nanostructures offer a useful platform for the immobilization of DNA molecules and could be exploited for efficient detection of complementary target single stranded DNA corresponding to N. meningitides. Copyright © 2014 Elsevier B.V. All rights reserved.
A nanophosphor-based method for selective DNA recovery in Synthosomes.
Nallani, Madhavan; Onaca, Ozana; Gera, Nimish; Hildenbrand, Karlheinz; Hoheisel, Werner; Schwaneberg, Ulrich
2006-01-01
A nanocompartment system composed of an ABA triblock copolymer, where A is poly(dimethylsiloxane) and B is poly(2-methyloxazoline), has been developed for selective recovery and detection of DNA. Translocation of TAMRA-labeled complementary primers into the nanocompartment system has been achieved through two deletion mutants (FhuA Delta1-129; FhuA Delta1-160) of the channel protein FhuA. Translocation was monitored by fluorescence resonance energy transfer through hybridization of the TAMRA-labeled primer to the complementary sequence of a nanophosphor-DNA-conjugate, which reduces its half-life (FhuA Delta1-129, 16.0% reduced; FhuA Delta1-160, 39.0% reduced).
Transcriptome analysis by strand-specific sequencing of complementary DNA
Parkhomchuk, Dmitri; Borodina, Tatiana; Amstislavskiy, Vyacheslav; Banaru, Maria; Hallen, Linda; Krobitsch, Sylvia; Lehrach, Hans; Soldatov, Alexey
2009-01-01
High-throughput complementary DNA sequencing (RNA-Seq) is a powerful tool for whole-transcriptome analysis, supplying information about a transcript's expression level and structure. However, it is difficult to determine the polarity of transcripts, and therefore identify which strand is transcribed. Here, we present a simple cDNA sequencing protocol that preserves information about a transcript's direction. Using Saccharomyces cerevisiae and mouse brain transcriptomes as models, we demonstrate that knowing the transcript's orientation allows more accurate determination of the structure and expression of genes. It also helps to identify new genes and enables studying promoter-associated and antisense transcription. The transcriptional landscapes we obtained are available online. PMID:19620212
Transcriptome analysis by strand-specific sequencing of complementary DNA.
Parkhomchuk, Dmitri; Borodina, Tatiana; Amstislavskiy, Vyacheslav; Banaru, Maria; Hallen, Linda; Krobitsch, Sylvia; Lehrach, Hans; Soldatov, Alexey
2009-10-01
High-throughput complementary DNA sequencing (RNA-Seq) is a powerful tool for whole-transcriptome analysis, supplying information about a transcript's expression level and structure. However, it is difficult to determine the polarity of transcripts, and therefore identify which strand is transcribed. Here, we present a simple cDNA sequencing protocol that preserves information about a transcript's direction. Using Saccharomyces cerevisiae and mouse brain transcriptomes as models, we demonstrate that knowing the transcript's orientation allows more accurate determination of the structure and expression of genes. It also helps to identify new genes and enables studying promoter-associated and antisense transcription. The transcriptional landscapes we obtained are available online.
Molecular cloning of a gene encoding translation initiation factor (TIF) from Candida albicans.
Mirbod, F; Nakashima, S; Kitajima, Y; Ghannoum, M A; Cannon, R D; Nozawa, Y
1996-01-01
The differential display technique was applied to compare mRNAs from two clinical isolates of Candida albicans with different virulence; high (potent strain, 16240) and low (weak strain, 18084) extracellular phospholipase activities. Complementary DNA fragments corresponding to several apparently differentially expressed mRNAs were recovered and sequenced. A complementary DNA fragment seen distinctly in the potent phospholipase producing strain was highly homologous to the yeast translation initiation factor (TIF). The selected DNA fragment was then used as a probe to isolate its corresponding complementary DNA clone from a library of C. albicans genomic DNA. The sequence of isolated gene revealed an open reading frame of 1194 nucleotides with the potential to encode a protein of 397 amino acids with a predicted molecular weight of 43 kDa. Over its entire length, the amino acid sequence showed strong homology (78-89%) to Saccharomyces cerevisiae TIF and (63-80%) to mouse eIF-4A proteins. Therefore, our C. albicans gene was identified to be TIF (Ca TIF). Northern blot analysis in the two strains of C. albicans revealed that Ca TIF expression is 1.5-fold higher in the potent phospholipase producing strain. The restriction endonuclease digestion of genomic DNA from this potent strain revealed at least two hybridized bands in Southern blot analysis, suggesting two or more closely related sequences in the C. albicans genome.
Malecka, Kamila; Stachyra, Anna; Góra-Sochacka, Anna; Sirko, Agnieszka; Zagórski-Ostoja, Włodzimierz; Dehaen, Wim; Radecka, Hanna; Radecki, Jerzy
2015-03-15
This paper concerns the development of a redox-active monolayer and its application for the construction of an electrochemical genosensor designed for the detection of specific DNA and RNA oligonucleotide sequences related to the avian influenza virus (AIV) type H5N1. This new redox layer was created on a gold electrode surface step by step. Cyclic Voltammetry, Osteryoung Square-Wave Voltammetry and Differential Pulse Voltammetry were used for its characterization. This new redox-active layer was applied for the construction of the DNA biosensor. The NH2-NC3 probe (20-mer) was covalently attached to the gold electrode surface via a "click" reaction between the amine and an epoxide group. The hybridization process was monitored using the Osteryoung Square-Wave Voltammetry. The 20-mer DNA and ca. 280-mer RNA oligonucleotides were used as the targets. The constructed genosensor was capable to determine complementary oligonucleotide sequences with a detection limit in the pM range. It is able to distinguish the different position of the part RNA complementary to the DNA probe. The genosensor was very selective. The 20-mer DNA as well as the 280-mer RNA oligonucleotides without a complementary sequence generated a weak signal. Copyright © 2014 Elsevier B.V. All rights reserved.
DNA in Uninfected and Virus-Infected Cells Complementary to Avian Tumor Virus RNA
Rosenthal, Peter N.; Robinson, Harriet L.; Robinson, William S.; Hanafusa, Teruko; Hanafusa, Hidesaburo
1971-01-01
The 70S RNA component of several avian tumor viruses was hybridized with DNA extracted from avian tumor virus-infected and uninfected chicken and Japanese quail cells. Tritium-labeled 70S RNAs from Rous sarcoma virus (RSV), Rous associated virus-1 (RAV-1), RAV-60, and Schmidt-Ruppin-RSV (SR-RSV) hybridize from 3 to 10 times more with DNA from uninfected chicken cells than with DNA from Escherichia coli, calfthymus, or baby hamster kidney cells. After infection of chicken cells with RSV(RAV-1), SR-RSV, or RAV-2, the amount of 70S avian tumor virus [3H]RNA hybridized increases by 1.6 times. The specificity of the hybridization reaction was shown by the specific competition of 70S SR-RSV [3H]RNA with 70S RNA from RSV(RAV-1), and not with RNA from Sendai virus or chicken cells. There was no difference in the hybridization of 70S RNA from RSV (RAV-1), RAV-1, or RAV-60 with DNA either from chicken cells that contain RAV-60 in a nonreplicating form or from chicken cells that do not appear to contain RAV-60. These results indicate that both types of uninfected chicken cells contain DNA that is complementary to RNA from several avian tumor viruses and that the amount of complementary DNA increases in such cells after infection with an avian tumor virus. The RNAs of genetically different avian tumor viruses appear to have indistinguishable base sequences by this technique. PMID:4332808
Biorecognition by DNA oligonucleotides after Exposure to Photoresists and Resist Removers
Dean, Stacey L.; Morrow, Thomas J.; Patrick, Sue; Li, Mingwei; Clawson, Gary; Mayer, Theresa S.; Keating, Christine D.
2013-01-01
Combining biological molecules with integrated circuit technology is of considerable interest for next generation sensors and biomedical devices. Current lithographic microfabrication methods, however, were developed for compatibility with silicon technology rather than bioorganic molecules and consequently it cannot be assumed that biomolecules will remain attached and intact during on-chip processing. Here, we evaluate the effects of three common photoresists (Microposit S1800 series, PMGI SF6, and Megaposit SPR 3012) and two photoresist removers (acetone and 1165 remover) on the ability of surface-immobilized DNA oligonucleotides to selectively recognize their reverse-complementary sequence. Two common DNA immobilization methods were compared: adsorption of 5′-thiolated sequences directly to gold nanowires and covalent attachment of 5′-thiolated sequences to surface amines on silica coated nanowires. We found that acetone had deleterious effects on selective hybridization as compared to 1165 remover, presumably due to incomplete resist removal. Use of the PMGI photoresist, which involves a high temperature bake step, was detrimental to the later performance of nanowire-bound DNA in hybridization assays, especially for DNA attached via thiol adsorption. The other three photoresists did not substantially degrade DNA binding capacity or selectivity for complementary DNA sequences. To determine if the lithographic steps caused more subtle damage, we also tested oligonucleotides containing a single base mismatch. Finally, a two-step photolithographic process was developed and used in combination with dielectrophoretic nanowire assembly to produce an array of doubly-contacted, electrically isolated individual nanowire components on a chip. Post-fabrication fluorescence imaging indicated that nanowire-bound DNA was present and able to selectively bind complementary strands. PMID:23952639
Nature and distribution of feline sarcoma virus nucleotide sequences.
Frankel, A E; Gilbert, J H; Porzig, K J; Scolnick, E M; Aaronson, S A
1979-01-01
The genomes of three independent isolates of feline sarcoma virus (FeSV) were compared by molecular hybridization techniques. Using complementary DNAs prepared from two strains, SM- and ST-FeSV, common complementary DNA'S were selected by sequential hybridization to FeSV and feline leukemia virus RNAs. These DNAs were shown to be highly related among the three independent sarcoma virus isolates. FeSV-specific complementary DNAs were prepared by selection for hybridization by the homologous FeSV RNA and against hybridization by fline leukemia virus RNA. Sarcoma virus-specific sequences of SM-FeSV were shown to differ from those of either ST- or GA-FeSV strains, whereas ST-FeSV-specific DNA shared extensive sequence homology with GA-FeSV. By molecular hybridization, each set of FeSV-specific sequences was demonstrated to be present in normal cat cellular DNA in approximately one copy per haploid genome and was conserved throughout Felidae. In contrast, FeSV-common sequences were present in multiple DNA copies and were found only in Mediterranean cats. The present results are consistent with the concept that each FeSV strain has arisen by a mechanism involving recombination between feline leukemia virus and cat cellular DNA sequences, the latter represented within the cat genome in a manner analogous to that of a cellular gene. PMID:225544
Solution structure of a highly stable DNA duplex conjugated to a minor groove binder.
Kumar, S; Reed, M W; Gamper, H B; Gorn, V V; Lukhtanov, E A; Foti, M; West, J; Meyer, R B; Schweitzer, B I
1998-01-01
The tripeptide 1,2-dihydro-(3 H )-pyrrolo[3,2- e ]indole-7-carboxylate (CDPI3) binds to the minor groove of DNA with high affinity. When this minor groove binder is conjugated to the 5'-end of short oligonucleotides the conjugates form unusually stable hybrids with complementary DNA and thus may have useful diagnostic and/or therapeutic applications. In order to gain an understanding of the structural interactions between the CDPI3minor groove binding moiety and the DNA, we have determined and compared the solution structure of a duplex consisting of oligodeoxyribonucleotide 5'-TGATTATCTG-3' conjugated at the 5'-end to CDPI3 and its complementary strand to an unmodified control duplex of the same sequence using nuclear magnetic resonance techniques. Thermal denaturation studies indicated that the hybrid of this conjugate with its complementary strand had a melting temperature that was 30 degrees C higher compared with the unmodified control duplex. Following restrained molecular dynamics and relaxation matrix refinement, the solution structure of the CDPI3-conjugated DNA duplex demonstrated that the overall shape of the duplex was that of a straight B-type helix and that the CDPI3moiety was bound snugly in the minor groove, where it was stabilized by extensive van der Waal's interactions. PMID:9443977
Solution structure of a highly stable DNA duplex conjugated to a minor groove binder.
Kumar, S; Reed, M W; Gamper, H B; Gorn, V V; Lukhtanov, E A; Foti, M; West, J; Meyer, R B; Schweitzer, B I
1998-02-01
The tripeptide 1,2-dihydro-(3 H )-pyrrolo[3,2- e ]indole-7-carboxylate (CDPI3) binds to the minor groove of DNA with high affinity. When this minor groove binder is conjugated to the 5'-end of short oligonucleotides the conjugates form unusually stable hybrids with complementary DNA and thus may have useful diagnostic and/or therapeutic applications. In order to gain an understanding of the structural interactions between the CDPI3minor groove binding moiety and the DNA, we have determined and compared the solution structure of a duplex consisting of oligodeoxyribonucleotide 5'-TGATTATCTG-3' conjugated at the 5'-end to CDPI3 and its complementary strand to an unmodified control duplex of the same sequence using nuclear magnetic resonance techniques. Thermal denaturation studies indicated that the hybrid of this conjugate with its complementary strand had a melting temperature that was 30 degrees C higher compared with the unmodified control duplex. Following restrained molecular dynamics and relaxation matrix refinement, the solution structure of the CDPI3-conjugated DNA duplex demonstrated that the overall shape of the duplex was that of a straight B-type helix and that the CDPI3moiety was bound snugly in the minor groove, where it was stabilized by extensive van der Waal's interactions.
Porcine circovirus: transcription and rolling-circle DNA replication
USDA-ARS?s Scientific Manuscript database
This review summarizes the molecular studies pertaining to porcine circovirus (PCV) transcription and DNA replication. The genome of PCV is circular, single-stranded DNA and contains 1759-1768 nucleotides. Both the genome-strand (packaged in the virus particle) and the complementary-strand (synthesi...
Dialynas, D P; Murre, C; Quertermous, T; Boss, J M; Leiden, J M; Seidman, J G; Strominger, J L
1986-01-01
Complementary DNA (cDNA) encoding a human T-cell gamma chain has been cloned and sequenced. At the junction of the variable and joining regions, there is an apparent deletion of two nucleotides in the human cDNA sequence relative to the murine gamma-chain cDNA sequence, resulting simultaneously in the generation of an in-frame stop codon and in a translational frameshift. For this reason, the sequence presented here encodes an aberrantly rearranged human T-cell gamma chain. There are several surprising differences between the deduced human and murine gamma-chain amino acid sequences. These include poor homology in the variable region, poor homology in a discrete segment of the constant region precisely bounded by the expected junctions of exon CII, and the presence in the human sequence of five potential sites for N-linked glycosylation. Images PMID:3458221
Husain, S M; Shou, Y; Sorrentino, B P; Handgretinger, R
2006-10-01
Human prominin-1 (CD133 or AC133) is an important cell surface marker used to isolate primitive hematopoietic stem cells. The commercially available antibody to human prominin-1 does not recognize rhesus prominin-1. Therefore, we isolated, cloned and characterized the complementary DNA (cDNA) of rhesus prominin-1 gene and determined its coding potential. Following the nomenclature of prominin family of genes, we named this cDNA as rhesus prominin-1.s1. The amino acid sequence data of the putative rhesus prominin-1.s1 could be used in designing antigenic peptides to raise antibodies for use in isolation of pure populations of rhesus prominin-1(+) hematopoietic cells. To the best of our knowledge, there has been no previously published report about the isolation of a prominin-1 cDNA from rhesus monkey (Macaca mulatta).
Nadzirah, Sh; Azizah, N; Hashim, Uda; Gopinath, Subash C B; Kashif, Mohd
2015-01-01
Nanoparticle-mediated bio-sensing promoted the development of novel sensors in the front of medical diagnosis. In the present study, we have generated and examined the potential of titanium dioxide (TiO2) crystalline nanoparticles with aluminium interdigitated electrode biosensor to specifically detect single-stranded E.coli O157:H7 DNA. The performance of this novel DNA biosensor was measured the electrical current response using a picoammeter. The sensor surface was chemically functionalized with (3-aminopropyl) triethoxysilane (APTES) to provide contact between the organic and inorganic surfaces of a single-stranded DNA probe and TiO2 nanoparticles while maintaining the sensing system's physical characteristics. The complement of the target DNA of E. coli O157:H7 to the carboxylate-probe DNA could be translated into electrical signals and confirmed by the increased conductivity in the current-to-voltage curves. The specificity experiments indicate that the biosensor can discriminate between the complementary sequences from the base-mismatched and the non-complementary sequences. After duplex formation, the complementary target sequence can be quantified over a wide range with a detection limit of 1.0 x 10(-13)M. With target DNA from the lysed E. coli O157:H7, we could attain similar sensitivity. Stability of DNA immobilized surface was calculated with the relative standard deviation (4.6%), displayed the retaining with 99% of its original response current until 6 months. This high-performance interdigitated DNA biosensor with high sensitivity, stability and non-fouling on a novel sensing platform is suitable for a wide range of biomolecular interactive analyses.
Nadzirah, Sh.; Azizah, N.; Hashim, Uda; Gopinath, Subash C. B.; Kashif, Mohd
2015-01-01
Nanoparticle-mediated bio-sensing promoted the development of novel sensors in the front of medical diagnosis. In the present study, we have generated and examined the potential of titanium dioxide (TiO2) crystalline nanoparticles with aluminium interdigitated electrode biosensor to specifically detect single-stranded E.coli O157:H7 DNA. The performance of this novel DNA biosensor was measured the electrical current response using a picoammeter. The sensor surface was chemically functionalized with (3-aminopropyl) triethoxysilane (APTES) to provide contact between the organic and inorganic surfaces of a single-stranded DNA probe and TiO2 nanoparticles while maintaining the sensing system’s physical characteristics. The complement of the target DNA of E. coli O157:H7 to the carboxylate-probe DNA could be translated into electrical signals and confirmed by the increased conductivity in the current-to-voltage curves. The specificity experiments indicate that the biosensor can discriminate between the complementary sequences from the base-mismatched and the non-complementary sequences. After duplex formation, the complementary target sequence can be quantified over a wide range with a detection limit of 1.0 x 10-13M. With target DNA from the lysed E. coli O157:H7, we could attain similar sensitivity. Stability of DNA immobilized surface was calculated with the relative standard deviation (4.6%), displayed the retaining with 99% of its original response current until 6 months. This high-performance interdigitated DNA biosensor with high sensitivity, stability and non-fouling on a novel sensing platform is suitable for a wide range of biomolecular interactive analyses. PMID:26445455
Dramatic Increase in the Signal and Sensitivity of Detection via Self-Assembly of Branched DNA
Kim, Kyung-Tae; Chae, Chi-Bom
2011-01-01
In molecular testing using PCR, the target DNA is amplified via PCR and the sequence of interest is investigated via hybridization with short oligonucleotide capture probes that are either in a solution or immobilized on solid supports such as beads or glass slides. In this report, we report the discovery of assembly of DNA complex(es) between a capture probe and multiple strands of the PCR product. The DNA complex most likely has branched structure. The assembly of branched DNA was facilitated by the product of asymmetric PCR. The amount of branched DNA assembled was increased five fold when the asymmetric PCR product was denatured and hybridized with a capture probe all in the same PCR reaction mixture. The major branched DNA species appeared to contain three reverse strands (the strand complementary to the capture probe) and two forward strands. The DNA was sensitive to S1 nuclease suggesting that it had single-stranded gaps. Branched DNA also appeared to be assembled with the capture probes immobilized on the surface of solid support when the product of asymmetric PCR was hybridized. Assembly of the branched DNA was also increased when hybridization was performed in complete PCR reaction mixture suggesting the requirement of DNA synthesis. Integration of asymmetric PCR, heat denaturation and hybridization in the same PCR reaction mixture with the capture probes immobilized on the surface of solid support achieved dramatic increase in the signal and sensitivity of detection of DNA. Such a system should be advantageously applied for development of automated process for detection of DNA. PMID:21870112
NASA Astrophysics Data System (ADS)
Zhou, Hong; Zhang, Zhinan; Chen, Haiyan; Sun, Renhua; Wang, Hui; Guo, Lei; Pan, Haijian
2010-07-01
In this study, we integrated a DNA barcoding project with an ecological survey on intertidal polychaete communities and investigated the utility of CO1 gene sequence as a DNA barcode for the classification of the intertidal polychaetes. Using 16S rDNA as a complementary marker and combining morphological and ecological characterization, some of dominant and common polychaete species from Chinese coasts were assessed for their taxonomic status. We obtained 22 haplotype gene sequences of 13 taxa, including 10 CO1 sequences and 12 16S rDNA sequences. Based on intra- and inter-specific distances, we built phylogenetic trees using the neighbor-joining method. Our study suggested that the mitochondrial CO1 gene was a valid DNA barcoding marker for species identification in polychaetes, but other genes, such as 16S rDNA, could be used as a complementary genetic marker. For more accurate species identification and effective testing of species hypothesis, DNA barcoding should be incorporated with morphological, ecological, biogeographical, and phylogenetic information. The application of DNA barcoding and molecular identification in the ecological survey on the intertidal polychaete communities demonstrated the feasibility of integrating DNA taxonomy and ecology.
Sex determination based on amelogenin DNA by modified electrode with gold nanoparticle.
Mazloum-Ardakani, Mohammad; Rajabzadeh, Nooshin; Benvidi, Ali; Heidari, Mohammad Mehdi
2013-12-15
We have developed a simple and renewable electrochemical biosensor based on carbon paste electrode (CPE) for the detection of DNA synthesis and hybridization. CPE was modified with gold nanoparticles (AuNPs), which are helpful for immobilization of thiolated bioreceptors. AuNPs were characterized by scanning electron microscopy (SEM). Self-assembled monolayers (SAMs) of thiolated single-stranded DNA (SH-ssDNA) of the amelogenin gene was formed on CPE. The immobilization of the probe and its hybridization with the target DNA was optimized using different experimental conditions. The modified electrode was characterized by electrochemical impedance spectroscopy (EIS) and cyclic voltammetry (CV). The electrochemical response of ssDNA hybridization and DNA synthesis was measured using differential pulse voltammetry (DPV) with methylene blue (MB) as an electroactive indicator. The new biosensor can distinguish between complementary and non-complementary strands of amelogenin ssDNA. Genomic DNA was extracted from blood and was detected based on changes in the MB reduction signal. These results demonstrated that the new biosensor could be used for sex determination. The proposed biosensor in this study could be used for detection and discrimination of polymerase chain reaction (PCR) products of amelogenin DNA. Copyright © 2013 Elsevier Inc. All rights reserved.
DNA microdevice for electrochemical detection of Escherichia coli 0157:H7 molecular markers.
Berganza, J; Olabarria, G; García, R; Verdoy, D; Rebollo, A; Arana, S
2007-04-15
An electrochemical DNA sensor based on the hybridization recognition of a single-stranded DNA (ssDNA) probe immobilized onto a gold electrode to its complementary ssDNA is presented. The DNA probe is bound on gold surface electrode by using self-assembled monolayer (SAM) technology. An optimized mixed SAM with a blocking molecule preventing the nonspecific adsorption on the electrode surface has been prepared. In this paper, a DNA biosensor is designed by means of the immobilization of a single stranded DNA probe on an electrochemical transducer surface to recognize specifically Escherichia coli (E. coli) 0157:H7 complementary target DNA sequence via cyclic voltammetry experiments. The 21 mer DNA probe including a C6 alkanethiol group at the 5' phosphate end has been synthesized to form the SAM onto the gold surface through the gold sulfur bond. The goal of this paper has been to design, characterise and optimise an electrochemical DNA sensor. In order to investigate the oligonucleotide probe immobilization and the hybridization detection, experiments with different concentration of DNA and mismatch sequences have been performed. This microdevice has demonstrated the suitability of oligonucleotide Self-assembled monolayers (SAMs) on gold as immobilization method. The DNA probes deposited on gold surface have been functional and able to detect changes in bases sequence in a 21-mer oligonucleotide.
Toulmin, Anita; Baltierra-Jasso, Laura E; Morten, Michael J; Sabir, Tara; McGlynn, Peter; Schröder, Gunnar F; Smith, Brian O; Magennis, Steven W
2017-09-19
DNA three-way junctions (3WJs) are branched structures that serve as important biological intermediates and as components in DNA nanostructures. We recently derived the global structure of a fully complementary 3WJ and found that it contained unpaired bases at the branchpoint, which is consistent with previous observations of branch flexibility and branchpoint reactivity. By combining high-resolution single-molecule Förster resonance energy transfer, molecular modeling, time-resolved ensemble fluorescence spectroscopy, and the first 19 F nuclear magnetic resonance observations of fully complementary 3WJs, we now show that the 3WJ structure can adopt multiple distinct conformations depending upon the sequence at the branchpoint. A 3WJ with a GC-rich branchpoint adopts an open conformation with unpaired bases at the branch and at least one additional conformation with an increased number of base interactions at the branchpoint. This structural diversity has implications for branch interactions and processing in vivo and for technological applications.
Immunochemical Proof that a Novel Rearranging Gene Encodes the T Cell Receptor δ Subunit
NASA Astrophysics Data System (ADS)
Band, Hamid; Hochstenbach, Frans; McLean, Joanne; Hata, Shingo; Krangel, Michael S.; Brenner, Michael B.
1987-10-01
The T cell receptor (TCR) δ protein is expressed as part of a heterodimer with TCR γ , in association with the CD3 polypeptides on a subset of functional peripheral blood T lymphocytes, thymocytes, and certain leukemic T cell lines. A monoclonal antibody directed against TCR δ was produced that binds specifically to the surface of several TCR γ δ cell lines and immunoprecipitates the TCR γ δ as a heterodimer from Triton X-100 detergent lysates and also immunoprecipitates the TCR δ subunit alone after chain separation. A candidate human TCR δ complementary DNA clone (IDP2 O-240/38), reported in a companion paper, was isolated by the subtractive library approach from a TCR γ δ cell line. This complementary DNA clone was used to direct the synthesis of a polypeptide that is specifically recognized by the monoclonal antibody to TCR δ . This complementary DNA clone thus corresponds to the gene that encodes the TCR δ subunit.
Quantum dot-based microfluidic biosensor for cancer detection
NASA Astrophysics Data System (ADS)
Ghrera, Aditya Sharma; Pandey, Chandra Mouli; Ali, Md. Azahar; Malhotra, Bansi Dhar
2015-05-01
We report results of the studies relating to fabrication of an impedimetric microfluidic-based nucleic acid sensor for quantification of DNA sequences specific to chronic myelogenous leukemia (CML). The sensor chip is prepared by patterning an indium-tin-oxide (ITO) coated glass substrate via wet chemical etching method followed by sealing with polydimethylsiloxane (PDMS) microchannel for fluid control. The fabricated microfluidic chip comprising of a patterned ITO substrate is modified by depositing cadmium selenide quantum dots (QCdSe) via Langmuir-Blodgett technique. Further, the QCdSe surface has been functionalized with specific DNA probe for CML detection. The probe DNA functionalized QCdSe integrated miniaturized system has been used to monitor target complementary DNA concentration by measuring the interfacial charge transfer resistance via hybridization. The presence of complementary DNA in buffer solution significantly results in decreased electro-conductivity of the interface due to presence of a charge barrier for transport of the redox probe ions. The microfluidic DNA biosensor exhibits improved linearity in the concentration range of 10-15 M to 10-11 M.
Lai, Wei-An; Lin, Chih-Heng; Yang, Yuh-Shyong; Lu, Michael S-C
2012-05-15
This work presents miniaturized CMOS (complementary metal oxide semiconductor) sensors for non-faradic impedimetric detection of AIV (avian influenza virus) oligonucleotides. The signal-to-noise ratio is significantly improved by monolithic sensor integration to reduce the effect of parasitic capacitances. The use of sub-μm interdigitated microelectrodes is also beneficial for promoting the signal coupling efficiency. Capacitance changes associated with surface modification, functionalization, and DNA hybridization were extracted from the measured frequency responses based on an equivalent-circuit model. Hybridization of the AIV H5 capture and target DNA probes produced a capacitance reduction of -13.2 ± 2.1% for target DNA concentrations from 1 fM to 10 fM, while a capacitance increase was observed when H5 target DNA was replaced with non-complementary H7 target DNA. With the demonstrated superior sensing capabilities, this miniaturized CMOS sensing platform shows great potential for label-free point-of-care biosensing applications. Copyright © 2012 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Singh, Swati; Kumar, Ashok; Khare, Shashi; Mulchandani, Ashok; Rajesh
2014-11-01
A specific and ultrasensitive, label free single-walled carbon nanotubes (SWNTs) based chemiresistive genosensor was fabricated for the early detection of Streptococcus pyogenes infection in human causing rheumatic heart disease. The mga gene of S. pyogenes specific 24 mer ssDNA probe was covalently immobilized on SWNT through a molecular bilinker, 1-pyrenemethylamine, using carbodiimide coupling reaction. The sensor was characterized by the current-voltage (I-V) characteristic curve and scanning electron microscopy. The sensing performance of the sensor was studied with respect to changes in conductance in SWNT channel based on hybridization of the target S. pyogenes single stranded genomic DNA (ssG-DNA) to its complementary 24 mer ssDNA probe. The sensor shows negligible response to non-complementary Staphylococcus aureus ssG-DNA, confirming the specificity of the sensor only with S. pyogenes. The genosensor exhibited a linear response to S. pyogenes G-DNA from 1 to1000 ng ml-1 with a limit of detection of 0.16 ng ml-1.
Cloning of a Gene Whose Expression is Increased in Scrapie and in Senile Plaques in Human Brain
NASA Astrophysics Data System (ADS)
Wietgrefe, S.; Zupancic, M.; Haase, A.; Chesebro, B.; Race, R.; Frey, W.; Rustan, T.; Friedman, R. L.
1985-12-01
A complementary DNA library was constructed from messenger RNA's extracted from the brains of mice infected with the scrapie agent. The library was differentially screened with the objectives of finding clones that might be used as markers of infection and finding clones of genes whose increased expression might be correlated with the pathological changes common to scrapie and Alzheimer's disease. A gene was identified whose expression is increased in scrapie. The complementary DNA corresponding to this gene hybridized preferentially and focally to cells in the brains of scrapie-infected animals. The cloned DNA also hybridized to the neuritic plaques found with increased frequency in brains of patients with Alzheimer's disease.
Sears, Catherine R; Zhou, Huaxin; Justice, Matthew J; Fisher, Amanda J; Saliba, Jacob; Lamb, Isaac; Wicker, Jessica; Schweitzer, Kelly S; Petrache, Irina
2018-03-01
Cigarette smoke (CS) exposure is a major risk factor for the development of emphysema, a common disease characterized by loss of cells comprising the lung parenchyma. The mechanisms of cell injury leading to emphysema are not completely understood but are thought to involve persistent cytotoxic or mutagenic DNA damage induced by CS. Using complementary cell culture and mouse models of CS exposure, we investigated the role of the DNA repair protein, xeroderma pigmentosum group C (XPC), on CS-induced DNA damage repair and emphysema. Expression of XPC was decreased in mouse lungs after chronic CS exposure and XPC knockdown in cultured human lung epithelial cells decreased their survival after CS exposure due to activation of the intrinsic apoptosis pathway. Similarly, cell autophagy and apoptosis were increased in XPC-deficient mouse lungs and were further increased by CS exposure. XPC deficiency was associated with structural and functional changes characteristic of emphysema, which were worsened by age, similar to levels observed with chronic CS exposure. Taken together, these findings suggest that repair of DNA damage by XPC plays an important and previously unrecognized role in the maintenance of alveolar structures. These findings support that loss of XPC, possibly due to chronic CS exposure, promotes emphysema development and further supports a link between DNA damage, impaired DNA repair, and development of emphysema.
Bakhori, Noremylia Mohd; Yusof, Nor Azah; Abdullah, Abdul Halim; Hussein, Mohd Zobir
2013-12-12
An optical DNA biosensor based on fluorescence resonance energy transfer (FRET) utilizing synthesized quantum dot (QD) has been developed for the detection of specific-sequence of DNA for Ganoderma boninense, an oil palm pathogen. Modified QD that contained carboxylic groups was conjugated with a single-stranded DNA probe (ssDNA) via amide-linkage. Hybridization of the target DNA with conjugated QD-ssDNA and reporter probe labeled with Cy5 allows for the detection of related synthetic DNA sequence of Ganoderma boninense gene based on FRET signals. Detection of FRET emission before and after hybridization was confirmed through the capability of the system to produce FRET at 680 nm for hybridized sandwich with complementary target DNA. No FRET emission was observed for non-complementary system. Hybridization time, temperature and effect of different concentration of target DNA were studied in order to optimize the developed system. The developed biosensor has shown high sensitivity with detection limit of 3.55 × 10-9 M. TEM results show that the particle size of QD varies in the range between 5 to 8 nm after ligand modification and conjugation with ssDNA. This approach is capable of providing a simple, rapid and sensitive method for detection of related synthetic DNA sequence of Ganoderma boninense.
Mohd Bakhori, Noremylia; Yusof, Nor Azah; Abdullah, Abdul Halim; Hussein, Mohd Zobir
2013-12-01
An optical DNA biosensor based on fluorescence resonance energy transfer (FRET) utilizing synthesized quantum dot (QD) has been developed for the detection of specific-sequence of DNA for Ganoderma boninense, an oil palm pathogen. Modified QD that contained carboxylic groups was conjugated with a single-stranded DNA probe (ssDNA) via amide-linkage. Hybridization of the target DNA with conjugated QD-ssDNA and reporter probe labeled with Cy5 allows for the detection of related synthetic DNA sequence of Ganoderma boninense gene based on FRET signals. Detection of FRET emission before and after hybridization was confirmed through the capability of the system to produce FRET at 680 nm for hybridized sandwich with complementary target DNA. No FRET emission was observed for non-complementary system. Hybridization time, temperature and effect of different concentration of target DNA were studied in order to optimize the developed system. The developed biosensor has shown high sensitivity with detection limit of 3.55 × 10(-9) M. TEM results show that the particle size of QD varies in the range between 5 to 8 nm after ligand modification and conjugation with ssDNA. This approach is capable of providing a simple, rapid and sensitive method for detection of related synthetic DNA sequence of Ganoderma boninense.
Dimensions and Global Twist of Single-Layer DNA Origami Measured by Small-Angle X-ray Scattering.
Baker, Matthew A B; Tuckwell, Andrew J; Berengut, Jonathan F; Bath, Jonathan; Benn, Florence; Duff, Anthony P; Whitten, Andrew E; Dunn, Katherine E; Hynson, Robert M; Turberfield, Andrew J; Lee, Lawrence K
2018-06-04
The rational design of complementary DNA sequences can be used to create nanostructures that self-assemble with nanometer precision. DNA nanostructures have been imaged by atomic force microscopy and electron microscopy. Small-angle X-ray scattering (SAXS) provides complementary structural information on the ensemble-averaged state of DNA nanostructures in solution. Here we demonstrate that SAXS can distinguish between different single-layer DNA origami tiles that look identical when immobilized on a mica surface and imaged with atomic force microscopy. We use SAXS to quantify the magnitude of global twist of DNA origami tiles with different crossover periodicities: these measurements highlight the extreme structural sensitivity of single-layer origami to the location of strand crossovers. We also use SAXS to quantify the distance between pairs of gold nanoparticles tethered to specific locations on a DNA origami tile and use this method to measure the overall dimensions and geometry of the DNA nanostructure in solution. Finally, we use indirect Fourier methods, which have long been used for the interpretation of SAXS data from biomolecules, to measure the distance between DNA helix pairs in a DNA origami nanotube. Together, these results provide important methodological advances in the use of SAXS to analyze DNA nanostructures in solution and insights into the structures of single-layer DNA origami.
Loudig, Olivier; Brandwein-Gensler, Margaret; Kim, Ryung S; Lin, Juan; Isayeva, Tatyana; Liu, Christina; Segall, Jeffrey E; Kenny, Paraic A; Prystowsky, Michael B
2011-12-01
High-throughput gene expression profiling from formalin-fixed, paraffin-embedded tissues has become a reality, and several methods are now commercially available. The Illumina whole-genome complementary DNA-mediated annealing, selection, extension and ligation assay (Illumina, Inc) is a full-transcriptome version of the original 512-gene complementary DNA-mediated annealing, selection, extension and ligation assay, allowing high-throughput profiling of 24,526 annotated genes from degraded and formalin-fixed, paraffin-embedded RNA. This assay has the potential to allow identification of novel gene signatures associated with clinical outcome using banked archival pathology specimen resources. We tested the reproducibility of the whole-genome complementary DNA-mediated annealing, selection, extension and ligation assay and its sensitivity for detecting differentially expressed genes in RNA extracted from matched fresh and formalin-fixed, paraffin-embedded cells, after 1 and 13 months of storage, using the human breast cell lines MCF7 and MCF10A. Then, using tumor worst pattern of invasion as a classifier, 1 component of the "risk model," we selected 12 formalin-fixed, paraffin-embedded oral squamous cell carcinomas for whole-genome complementary DNA-mediated annealing, selection, extension and ligation assay analysis. We profiled 5 tumors with nonaggressive, nondispersed pattern of invasion, and 7 tumors with aggressive dispersed pattern of invasion and satellites scattered at least 1 mm apart. To minimize variability, the formalin-fixed, paraffin-embedded specimens were prepared from snap-frozen tissues, and RNA was obtained within 24 hours of fixation. One hundred four down-regulated genes and 72 up-regulated genes in tumors with aggressive dispersed pattern of invasion were identified. We performed quantitative reverse transcriptase polymerase chain reaction validation of 4 genes using Taqman assays and in situ protein detection of 1 gene by immunohistochemistry. Functional cluster analysis of genes up-regulated in tumors with aggressive pattern of invasion suggests presence of genes involved in cellular cytoarchitecture, some of which already associated with tumor invasion. Identification of these genes provides biologic rationale for our histologic classification, with regard to tumor invasion, and demonstrates that the whole-genome complementary DNA-mediated annealing, selection, extension and ligation assay is a powerful assay for profiling degraded RNA from archived specimens when combined with quantitative reverse transcriptase polymerase chain reaction validation. Copyright © 2011 Elsevier Inc. All rights reserved.
Topological Interaction by Entanglement of DNA
NASA Astrophysics Data System (ADS)
Feng, Lang; Sha, Ruojie; Seeman, Nadrian; Chaikin, Paul
2012-02-01
We find and study a new type of interaction between colloids, Topological Interaction by Entanglement of DNA (TIED), due to concatenation of loops formed by palindromic DNA. Consider a particle coated with palindromic DNA of sequence ``P1.'' Below the DNA hybridization temperature (Tm), loops of the self-complementary DNA form on the particle surface. Direct hybridization with similar particle covered with a different sequence P2 do not occur. However when particles are held together at T > Tm, then cooled to T < Tm, some of the loops entangle and link, similar to a Olympic Gel. We quantitatively observe and measure this topological interaction between colloids in a ˜5^o C temperature window, ˜6^o C lower than direct binding of complementary DNA with similar strength and introduce the concept of entanglement binding free energy. To prove our interaction to be topological, we unknot the purely entangled binding sites between colloids by adding Topoisomerase I which unconcatenates our loops. This research suggests novel history dependent ways of binding particles and serves as a new design tool in colloidal self-assembly.
Pan, Hong-zhi; Yu, Hong-wei; Wang, Na; Zhang, Ze; Wan, Guang-cai; Liu, Hao; Guan, Xue; Chang, Dong
2015-11-20
We describe the fabrication of a sensitive electrochemical DNA biosensor for determination of Klebsiella pneumoniae carbapenemase (KPC). The highly sensitive and selective electrochemical biosensor for DNA detection was constructed based on a glassy carbon electrode (GCE) modified with gold nanoparticles (Au-NPs) and graphene (Gr). Then Au-NPs/Gr/GCE was characterized by scanning electro microscope (SEM), cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS). The hybridization detection was measured by diffierential pulse voltammetry (DPV) using methylene blue (MB) as the hybridization indicator. The dynamic range of detection of the sensor for the target DNA sequences was from 1 × 10(-12) to 1 × 10(-7)mol/L, with a detection limit of 2 × 10(-13)mol/L. The DNA biosensor had excellent specificity for distinguishing complementary DNA sequence in the presence of non-complementary and mismatched DNA sequence. The results demonstrated that the Au-NPs/Gr nanocomposite was a promising substrate for the development of high-performance electrocatalysts for determination of KPC. Copyright © 2015 Elsevier B.V. All rights reserved.
Separation of 1-23-kb complementary DNA strands by urea-agarose gel electrophoresis.
Hegedüs, Eva; Kókai, Endre; Kotlyar, Alexander; Dombrádi, Viktor; Szabó, Gábor
2009-09-01
Double-stranded (ds), as well as denatured, single-stranded (ss) DNA samples can be analyzed on urea-agarose gels. Here we report that after denaturation by heat in the presence of 8 M urea, the two strands of the same ds DNA fragment of approximately 1-20-kb size migrate differently in 1 M urea containing agarose gels. The two strands are readily distinguished on Southern blots by ss-specific probes. The different migration of the two strands could be attributed to their different, base composition-dependent conformation impinging on the electrophoretic mobility of the ss molecules. This phenomenon can be exploited for the efficient preparation of strand-specific probes and for the separation of the complementary DNA strands for subsequent analysis, offering a new tool for various cell biological research areas.
Rapid amplification of 5' complementary DNA ends (5' RACE).
2005-08-01
This method is used to extend partial cDNA clones by amplifying the 5' sequences of the corresponding mRNAs 1-3. The technique requires knowledge of only a small region of sequence within the partial cDNA clone. During PCR, the thermostable DNA polymerase is directed to the appropriate target RNA by a single primer derived from the region of known sequence; the second primer required for PCR is complementary to a general feature of the target-in the case of 5' RACE, to a homopolymeric tail added (via terminal transferase) to the 3' termini of cDNAs transcribed from a preparation of mRNA. This synthetic tail provides a primer-binding site upstream of the unknown 5' sequence of the target mRNA. The products of the amplification reaction are cloned into a plasmid vector for sequencing and subsequent manipulation.
Zhang, Yuhuan; Liu, Wei; Zhang, Wentao; Yu, Shaoxuan; Yue, Xiaoyue; Zhu, Wenxin; Zhang, Daohong; Wang, Yanru; Wang, Jianlong
2015-10-15
Herein, the structure of two DNA strands which are complementary except fourteen T-T and C-C mismatches was programmed for the design of the combinatorial logic operation by utilizing the different protective capacities of single chain DNA, part-hybridized DNA and completed-hybridized DNA on unmodified gold nanoparticles. In the presence of either Hg(2+) or Ag(+), the T-Hg(2+)-T or C-Ag(+)-C coordination chemistry could lead to the formation of part-hybridized DNA which keeps gold nanoparticles from clumping after the addition of 40 μL 0.2M NaClO4 solution, but the protection would be screened by 120 μL 0.2M NaClO4 solution. While the coexistence of Hg(2+), Ag(+) caused the formation of completed-hybridized DNA and the protection for gold nanoparticles lost in either 40 μL or 120 μL NaClO4 solutions. Benefiting from sharing of the same inputs of Hg(2+) and Ag(+), OR and AND logic gates were easily integrated into a simple colorimetric combinatorial logic operation in one system, which make it possible to execute logic gates in parallel to mimic arithmetic calculations on a binary digit. Furthermore, two other logic gates including INHIBIT1 and INHIBIT2 were realized to integrated with OR logic gate both for simultaneous qualitative discrimination and quantitative determination of Hg(2+) and Ag(+). Results indicate that the developed logic system based on the different protective capacities of DNA structure on gold nanoparticles provides a new pathway for the design of the combinatorial logic operation in one system and presents a useful strategy for development of advanced sensors, which may have potential applications in multiplex chemical analysis and molecular-scale computer design. Copyright © 2015 Elsevier B.V. All rights reserved.
Nucleic Acid-Based Cross-Linking Assay for Detection and Quantification of Hepatitis B Virus DNA
Lai, Vicky C. H.; Guan, Richard; Wood, Michael L.; Lo, Su Kong; Yuen, Man-Fung; Lai, Ching-Lung
1999-01-01
A nucleic acid photo-cross-linking technology was used to develop a direct assay for the quantification of hepatitis B virus (HBV) DNA levels in serum. Cross-linker-modified DNA probes complementary to the viral genomes of the major HBV subtypes were synthesized and used in an assay that could be completed in less than 6 h. The quantification range of the assay, as determined by testing serial dilutions of Eurohep HBV reference standards and cloned HBV DNA, was 5 × 105 to 3 × 109 molecules of HBV DNA/ml of serum. Within-run and between-run coefficients of variation (CVs) for the assay were 4.3 and 4.0%, respectively. The assay was used to determine HBV DNA levels in 302 serum samples, and the results were compared to those obtained after testing the same samples with the Chiron branched-DNA (bDNA) assay for HBV DNA. Of the samples tested, 218 were positive for HBV DNA by both assays and 72 gave results below the cutoff for both assays. Of the remaining 12 samples, 10 were positive for HBV DNA by the cross-linking assay only; the 2 other samples were positive by the bDNA assay only. Twenty-eight samples had to be retested by the bDNA assay (CV, >20% between the results obtained from the testing of each sample in duplicate), whereas only three samples required retesting by the cross-linking assay. The correlation between the HBV DNA levels, as measured by the two tests, was very high (r = 0.902; P = 0.01). We conclude that the cross-linking assay is a sensitive and reproducible method for the detection and quantification of HBV DNA levels in serum. PMID:9854083
Wang, Guannan; Su, Xingguang
2010-06-01
A novel, highly sensitive technology for the detection, enrichment, and separation of trace amounts of target DNA was developed on the basis of amino-modified fluorescent magnetic composite nanoparticles (AFMN). In this study, the positively charged amino-modified composite nanoparticles conjugate with the negatively charged capture DNA through electrostatic binding. The optimal combination of AFMN and capture DNA was measured by dynamic light scattering (DLS) and UV-vis absorption spectroscopy. The highly sensitive detection of trace amounts of target DNA was achieved through enrichment by means of AFMN. The detection limit for target DNA is 0.4 pM, which could be further improved by using a more powerful magnet. Because of their different melting temperatures, single-base mismatched target DNA could be separated from perfectly complementary target DNA. In addition, the photoluminescence (PL) signals of perfectly complementary target DNA and single-base mismatched DNA as well as the hybridization kinetics of different concentrations of target DNA at different reaction times have also been studied. Most importantly, the detection, enrichment, and separation ability of AFMN was further verified with milk. Simple and satisfactory results were obtained, which show the great potential in the fields of mutation identification and clinical diagnosis.
[DNA structure from A to Z--biological implications of structural diversity of DNA].
Bukowiecka-Matusiak, Małgorzata; Woźniak, Lucyna A
2006-01-01
Deoxyribonucleic acid (DNA) is a biopolymer of nucleotides, usually adopting a double-stranded helical form in cells, with complementary base pairing holding the two strands together. The most stable is B-DNA conformation, although numerous other double helical structures can occur under specific conditions (A-DNA, Z-DNA, P-DNA). The existence of multiple-stranded (triplex, tetraplex) forms in vivo and their biological function in cells are subject of intensive studies.
An Electrochemical DNA Microbiosensor Based on Succinimide-Modified Acrylic Microspheres
Ulianas, Alizar; Heng, Lee Yook; Hanifah, Sharina Abu; Ling, Tan Ling
2012-01-01
An electrochemical microbiosensor for DNA has been fabricated based on new acrylic microspheres modified with reactive N-acryloxysuccinimide (NAS) functional groups. Hydrophobic poly(n-butylacrylate-N-acryloxysuccinimide) microspheres were synthesized in an emulsion form with a simple one-step photopolymerization technique. Aminated DNA probe was attached to the succinimde functional group of the acrylic microspheres via covalent bonding. The hybridization of the immobilized DNA probe with the complementary DNA was studied by differential pulse voltametry using anthraquninone-2-sulfonic acid monohydrate sodium salt (AQMS) as the electroactive hybridization label. The influences of many factors such as duration of DNA probe immobilization and hybridization, pH, type of ions, buffer concentrations, ionic strength, operational temperature and non-complementary DNA on the biosensor performance were evaluated. Under optimized conditions, the DNA microbiosensor demonstrated a linear response range to target DNA over a wide concentration range of 1.0 × 10−16 and 1.0 × 10−8 M with a lower limit of detection (LOD) of 9.46 × 10−17 M (R2 = 0.97). This DNA microbiosensor showed good reproducibility with 2.84% RSD (relative standard deviation) (n = 3). Application of the NAS-modified acrylic microspheres in the construction of DNA microbiosensor had improved the overall analytical performance of the resultant DNA microbiosensor when compared with other reported DNA biosensors using other nano-materials for membranes and microspheres as DNA immobilization matrices. PMID:22778594
Stacked-unstacked equilibrium at the nick site of DNA.
Protozanova, Ekaterina; Yakovchuk, Peter; Frank-Kamenetskii, Maxim D
2004-09-17
Stability of duplex DNA with respect to separation of complementary strands is crucial for DNA executing its major functions in the cell and it also plays a central role in major biotechnology applications of DNA: DNA sequencing, polymerase chain reaction, and DNA microarrays. Two types of interaction are well known to contribute to DNA stability: stacking between adjacent base-pairs and pairing between complementary bases. However, their contribution into the duplex stability is yet to be determined. Now we fill this fundamental gap in our knowledge of the DNA double helix. We have prepared a series of 32, 300 bp-long DNA fragments with solitary nicks in the same position differing only in base-pairs flanking the nick. Electrophoretic mobility of these fragments in the gel has been studied. Assuming the equilibrium between stacked and unstacked conformations at the nick site, all 32 stacking free energy parameters have been obtained. Only ten of them are essential and they govern the stacking interactions between adjacent base-pairs in intact DNA double helix. A full set of DNA stacking parameters has been determined for the first time. From these data and from a well-known dependence of DNA melting temperature on G.C content, the contribution of base-pairing into duplex stability has been estimated. The obtained energy parameters of the DNA double helix are of paramount importance for understanding sequence-dependent DNA flexibility and for numerous biotechnology applications.
Insights into DNA-mediated interparticle interactions from a coarse-grained model
NASA Astrophysics Data System (ADS)
Ding, Yajun; Mittal, Jeetain
2014-11-01
DNA-functionalized particles have great potential for the design of complex self-assembled materials. The major hurdle in realizing crystal structures from DNA-functionalized particles is expected to be kinetic barriers that trap the system in metastable amorphous states. Therefore, it is vital to explore the molecular details of particle assembly processes in order to understand the underlying mechanisms. Molecular simulations based on coarse-grained models can provide a convenient route to explore these details. Most of the currently available coarse-grained models of DNA-functionalized particles ignore key chemical and structural details of DNA behavior. These models therefore are limited in scope for studying experimental phenomena. In this paper, we present a new coarse-grained model of DNA-functionalized particles which incorporates some of the desired features of DNA behavior. The coarse-grained DNA model used here provides explicit DNA representation (at the nucleotide level) and complementary interactions between Watson-Crick base pairs, which lead to the formation of single-stranded hairpin and double-stranded DNA. Aggregation between multiple complementary strands is also prevented in our model. We study interactions between two DNA-functionalized particles as a function of DNA grafting density, lengths of the hybridizing and non-hybridizing parts of DNA, and temperature. The calculated free energies as a function of pair distance between particles qualitatively resemble experimental measurements of DNA-mediated pair interactions.
Fabrication of 3D Reconstituted Organoid Arrays by DNA-programmed Assembly of Cells (DPAC)
Todhunter, Michael E; Weber, Robert J; Farlow, Justin; Jee, Noel Y; Cerchiari, Alec E; Gartner, Zev J
2016-01-01
Tissues are the organizational units of function in metazoan organisms. Tissues comprise an assortment of cellular building blocks, soluble factors, and extracellular matrix (ECM) that are composed into specific three dimensional (3D) structures. The capacity to reconstitute tissues in vitro with the structural complexity observed in vivo is key to understanding processes such as morphogenesis, homeostasis, and disease. In this unit, we describe DNA-programmed Assembly of Cells (DPAC), a method to fabricate viable, functional arrays of organoid-like tissues within 3D ECM gels. In DPAC, dissociated cells are chemically functionalized with degradable oligonucleotide “velcro,” allowing rapid, specific, and reversible cell adhesion to a two-dimensional (2D) template patterned with complementary DNA. An iterative assembly process builds up organoids, layer-by-layer, from this initial 2D template and into the third dimension. Cleavage of the DNA releases the completed array of tissues that are captured and fully embedded in ECM gels for culture and observation. DPAC controls the size, shape, composition, and spatial heterogeneity of organoids, and permits positioning constituent cells with single-cell resolution even within cultures several centimeters long. PMID:27622567
Yeh, Joanne I; Shivachev, Boris; Rapireddy, Srinivas; Crawford, Matthew J; Gil, Roberto R; Du, Shoucheng; Madrid, Marcela; Ly, Danith H
2010-08-11
We have determined the structure of a PNA-DNA duplex to 1.7 A resolution by multiple-wavelength anomalous diffraction phasing method on a zinc derivative. This structure represents the first high-resolution 3D view of a hybrid duplex containing a contiguous chiral PNA strand with complete gamma-backbone modification ("gammaPNA"). Unlike the achiral counterpart, which adopts a random-fold, this particular gammaPNA is already preorganized into a right-handed helix as a single strand. The new structure illustrates the unique characteristics of this modified PNA, possessing conformational flexibility while maintaining sufficient structural integrity to ultimately adopt the preferred P-helical conformation upon hybridization with DNA. The unusual structural adaptability found in the gammaPNA strand is crucial for enabling the accommodation of backbone modifications while constraining conformational states. In conjunction with NMR analysis characterizing the structures and substructures of the individual building blocks, these results provide unprecedented insights into how this new class of chiral gammaPNA is preorganized and stabilized, before and after hybridization with a cDNA strand. Such knowledge is crucial for the future design and development of PNA for applications in biology, biotechnology, and medicine.
Defining functional DNA elements in the human genome
Kellis, Manolis; Wold, Barbara; Snyder, Michael P.; Bernstein, Bradley E.; Kundaje, Anshul; Marinov, Georgi K.; Ward, Lucas D.; Birney, Ewan; Crawford, Gregory E.; Dekker, Job; Dunham, Ian; Elnitski, Laura L.; Farnham, Peggy J.; Feingold, Elise A.; Gerstein, Mark; Giddings, Morgan C.; Gilbert, David M.; Gingeras, Thomas R.; Green, Eric D.; Guigo, Roderic; Hubbard, Tim; Kent, Jim; Lieb, Jason D.; Myers, Richard M.; Pazin, Michael J.; Ren, Bing; Stamatoyannopoulos, John A.; Weng, Zhiping; White, Kevin P.; Hardison, Ross C.
2014-01-01
With the completion of the human genome sequence, attention turned to identifying and annotating its functional DNA elements. As a complement to genetic and comparative genomics approaches, the Encyclopedia of DNA Elements Project was launched to contribute maps of RNA transcripts, transcriptional regulator binding sites, and chromatin states in many cell types. The resulting genome-wide data reveal sites of biochemical activity with high positional resolution and cell type specificity that facilitate studies of gene regulation and interpretation of noncoding variants associated with human disease. However, the biochemically active regions cover a much larger fraction of the genome than do evolutionarily conserved regions, raising the question of whether nonconserved but biochemically active regions are truly functional. Here, we review the strengths and limitations of biochemical, evolutionary, and genetic approaches for defining functional DNA segments, potential sources for the observed differences in estimated genomic coverage, and the biological implications of these discrepancies. We also analyze the relationship between signal intensity, genomic coverage, and evolutionary conservation. Our results reinforce the principle that each approach provides complementary information and that we need to use combinations of all three to elucidate genome function in human biology and disease. PMID:24753594
ERIC Educational Resources Information Center
Militello, Kevin T.
2013-01-01
Epigenetic inheritance is the inheritance of genetic information that is not based on DNA sequence alone. One type of epigenetic information that has come to the forefront in the last few years is modified DNA bases. The most common modified DNA base in nature is 5-methylcytosine. Herein, we describe a laboratory experiment that combines…
Electron transfer of plurimodified DNA SAMs.
Rospigliosi, Alessandro; Ehlich, Rudolf; Hoerber, Heinrich; Middelberg, Anton; Moggridge, Geoff
2007-07-17
An STM-based current-voltage (I/V) investigation of deoxyribonucleic acid (DNA) 18 base pair (bp) oligonucleotide monolayers on gold is presented. Three bases of each of the immobilized and complementary strands were modified with either iodine or phenylethylene moieties. The oligonucleotides were immobilized on template stripped gold (tsg) surfaces and characterized by atomic force microscopy (AFM) and scanning tunneling microscopy (STM). AFM imaging showed that monolayers of the expected height were formed. A comparative study of normal, halogenated, and phenyl-modified DNA was made with the STM in tunneling spectroscopy (TS) mode. I/V spectroscopic measurements in the range +/-250 mV on both single- and double-stranded (ds) DNA monolayers (modified and unmodified) showed that for negative substrate bias (U(sub)) electron transfer is more efficient through a phenyl-modified monolayer than through normal or halogenated DNA. This effect was particularly clear below a threshold bias of -100 mV. For positive U(sub), unmodified ds DNA was found to conduct slightly better than the modified strands. This is presumably caused by greater order in the unmodified versus modified DNA monolayers. Modifications on the immobilized (thiolated) strand seem to improve electron transport through the DNA monolayer more than modifications on the complementary (not surface-bound) strand.
Simulations Meet Experiment to Reveal New Insights into DNA Intrinsic Mechanics
Ben Imeddourene, Akli; Elbahnsi, Ahmad; Guéroult, Marc; Oguey, Christophe; Foloppe, Nicolas; Hartmann, Brigitte
2015-01-01
The accurate prediction of the structure and dynamics of DNA remains a major challenge in computational biology due to the dearth of precise experimental information on DNA free in solution and limitations in the DNA force-fields underpinning the simulations. A new generation of force-fields has been developed to better represent the sequence-dependent B-DNA intrinsic mechanics, in particular with respect to the BI ↔ BII backbone equilibrium, which is essential to understand the B-DNA properties. Here, the performance of MD simulations with the newly updated force-fields Parmbsc0εζOLI and CHARMM36 was tested against a large ensemble of recent NMR data collected on four DNA dodecamers involved in nucleosome positioning. We find impressive progress towards a coherent, realistic representation of B-DNA in solution, despite residual shortcomings. This improved representation allows new and deeper interpretation of the experimental observables, including regarding the behavior of facing phosphate groups in complementary dinucleotides, and their modulation by the sequence. It also provides the opportunity to extensively revisit and refine the coupling between backbone states and inter base pair parameters, which emerges as a common theme across all the complementary dinucleotides. In sum, the global agreement between simulations and experiment reveals new aspects of intrinsic DNA mechanics, a key component of DNA-protein recognition. PMID:26657165
Fujita, Masahiro; Hiramine, Hayato; Pan, Pengju; Hikima, Takaaki; Maeda, Mizuo
2016-02-02
The thermoresponsive structural transition of poly(N-isopropylacrylamide) (PNIPAAm)-b-DNA copolymers was explored. Molecular assembly of the block copolymers was facilitated by adding salt, and this assembly was not nucleated by the association between DNA strands but by the coil-globule transition of PNIPAAm blocks. Below the lower critical solution temperature (LCST) of PNIPAAm, the copolymer solution remained transparent even at high salt concentrations, regardless of whether DNA was hybridized with its complementary partner to form a double-strand (or single-strand) structure. At the LCST, the hybridized copolymer assembled in spherical nanoparticles, surrounded by double-stranded DNA; subsequently, the non-cross-linking aggregation occurred, while the nanoparticles were dispersed if the salt concentration was low or DNA blocks were unhybridized. When the DNA duplex was denatured to a single-stranded state by heating, the aggregated nanoparticles redispersed owing to the recovery of the steric repulsion of the DNA strands. The changes in the steric and electrostatic effects by hybridization and the addition of salt did not result in any specific attraction between DNA strands but merely decreased the repulsive interactions. The van der Waals attraction between the nanoparticles overcame such repulsive interactions so that the non-cross-linking aggregation of the micellar particles was mediated.
Double stranded nucleic acid biochips
Chernov, Boris; Golova, Julia
2006-05-23
This invention describes a new method of constructing double-stranded DNA (dsDNA) microarrays based on the use of pre-synthesized or natural DNA duplexes without a stem-loop structure. The complementary oligonucleotide chains are bonded together by a novel connector that includes a linker for immobilization on a matrix. A non-enzymatic method for synthesizing double-stranded nucleic acids with this novel connector enables the construction of inexpensive and robust dsDNA/dsRNA microarrays. DNA-DNA and DNA-protein interactions are investigated using the microarrays.
Potential of mean force of DNA guided assemblies past Debye-Hückel regime
NASA Astrophysics Data System (ADS)
Girard, Martin; Seo, Soyoung; Li, Yaohua; Mirkin, Chad; Olvera de La Cruz, Monica
Many of the bioinspired systems make use of biopolymers such as polypeptides or DNA. The latter is widely used in self-assembled systems, from colloidal crystals to origami construction. In these systems, salt is commonly required to screen the electrostatic repulsion between the strands. In the classical Debye-Hückel picture, salt ions are point particles and the screening distance is a decreasing monotonic function of salt concentration. This picture breaks down at moderate salt concentrations, where the behavior becomes non-monotonic. In this talk, we will show results for potential of mean force of DNA grafted colloids obtained through multiscale molecular dynamics. In this picture, the highly charged DNA causes non-trivial behavior at moderate salt concentrations (c 0 . 3 - 0 . 7 M), namely increase of repulsion for non-complementary DNA strands while repulsion decreases for complementary strands. We will show spatial cluster distribution as function of size and charge as well as implications for experimental systems.
Booth, Marsilea Adela; Vogel, Robert; Curran, James M; Harbison, SallyAnn; Travas-Sejdic, Jadranka
2013-07-15
Despite the plethora of DNA sensor platforms available, a portable, sensitive, selective and economic sensor able to rival current fluorescence-based techniques would find use in many applications. In this research, probe oligonucleotide-grafted particles are used to detect target DNA in solution through a resistive pulse nanopore detection technique. Using carbodiimide chemistry, functionalized probe DNA strands are attached to carboxylated dextran-based magnetic particles. Subsequent incubation with complementary target DNA yields a change in surface properties as the two DNA strands hybridize. Particle-by-particle analysis with resistive pulse sensing is performed to detect these changes. A variable pressure method allows identification of changes in the surface charge of particles. As proof-of-principle, we demonstrate that target hybridization is selectively detected at micromolar concentrations (nanomoles of target) using resistive pulse sensing, confirmed by fluorescence and phase analysis light scattering as complementary techniques. The advantages, feasibility and limitations of using resistive pulse sensing for sample analysis are discussed. Copyright © 2013 Elsevier B.V. All rights reserved.
Mohd Bakhori, Noremylia; Yusof, Nor Azah; Abdullah, Abdul Halim; Hussein, Mohd Zobir
2013-01-01
An optical DNA biosensor based on fluorescence resonance energy transfer (FRET) utilizing synthesized quantum dot (QD) has been developed for the detection of specific-sequence of DNA for Ganoderma boninense, an oil palm pathogen. Modified QD that contained carboxylic groups was conjugated with a single-stranded DNA probe (ssDNA) via amide-linkage. Hybridization of the target DNA with conjugated QD-ssDNA and reporter probe labeled with Cy5 allows for the detection of related synthetic DNA sequence of Ganoderma boninense gene based on FRET signals. Detection of FRET emission before and after hybridization was confirmed through the capability of the system to produce FRET at 680 nm for hybridized sandwich with complementary target DNA. No FRET emission was observed for non-complementary system. Hybridization time, temperature and effect of different concentration of target DNA were studied in order to optimize the developed system. The developed biosensor has shown high sensitivity with detection limit of 3.55 × 10−9 M. TEM results show that the particle size of QD varies in the range between 5 to 8 nm after ligand modification and conjugation with ssDNA. This approach is capable of providing a simple, rapid and sensitive method for detection of related synthetic DNA sequence of Ganoderma boninense. PMID:25587406
Characterization of rat calcitonin mRNA.
Amara, S G; David, D N; Rosenfeld, M G; Roos, B A; Evans, R M
1980-01-01
A chimeric plasmic containing cDNA complementary to rat calcitonin mRNA has been constructed. Partial sequence analysis shows that the insert contains a nucleotide sequence encoding the complete amino acid sequence of calcitonin. Two basic amino acids precede and three basic amino acids follow the hormone sequence, suggesting that calcitonin is generated by the proteolytic cleavage of a larger precursor in a manner analogous to that of other small polypeptide hormones. The COOH-terminal proline, known to be amidated in the secreted hormone, is followed by a glycine in the precursor. The cloned calcitonin DNA was used to characterize the expression of calcitonin mRNA. Cytoplasmic mRNAs from calcitonin-producing rat medullary thyroid carcinoma lines and from normal rat thyroid glands contain a single species, 1050 nucleotides long, whch hybridizes to the cloned calcitonin cDNA. The concentration of calcitonin mRNA sequences is greater in those tumors that produce larger amounts of immunoreactive calcitonin. RNAs from other endocrine tissues, including anterior and neurointermediate lobes of rat pituitary, contain no detectable calcitonin mRNA. Images PMID:6933496
Three-input majority logic gate and multiple input logic circuit based on DNA strand displacement.
Li, Wei; Yang, Yang; Yan, Hao; Liu, Yan
2013-06-12
In biomolecular programming, the properties of biomolecules such as proteins and nucleic acids are harnessed for computational purposes. The field has gained considerable attention due to the possibility of exploiting the massive parallelism that is inherent in natural systems to solve computational problems. DNA has already been used to build complex molecular circuits, where the basic building blocks are logic gates that produce single outputs from one or more logical inputs. We designed and experimentally realized a three-input majority gate based on DNA strand displacement. One of the key features of a three-input majority gate is that the three inputs have equal priority, and the output will be true if any of the two inputs are true. Our design consists of a central, circular DNA strand with three unique domains between which are identical joint sequences. Before inputs are introduced to the system, each domain and half of each joint is protected by one complementary ssDNA that displays a toehold for subsequent displacement by the corresponding input. With this design the relationship between any two domains is analogous to the relationship between inputs in a majority gate. Displacing two or more of the protection strands will expose at least one complete joint and return a true output; displacing none or only one of the protection strands will not expose a complete joint and will return a false output. Further, we designed and realized a complex five-input logic gate based on the majority gate described here. By controlling two of the five inputs the complex gate can realize every combination of OR and AND gates of the other three inputs.
NASA Astrophysics Data System (ADS)
Kikuchi, Shoshi
2009-02-01
Completion of the high-precision genome sequence analysis of rice led to the collection of about 35,000 full-length cDNA clones and the determination of their complete sequences. Mapping of these full-length cDNA sequences has given us information on (1) the number of genes expressed in the rice genome; (2) the start and end positions and exon-intron structures of rice genes; (3) alternative transcripts; (4) possible encoded proteins; (5) non-protein-coding (np) RNAs; (6) the density of gene localization on the chromosome; (7) setting the parameters of gene prediction programs; and (8) the construction of a microarray system that monitors global gene expression. Manual curation for rice gene annotation by using mapping information on full-length cDNA and EST assemblies has revealed about 32,000 expressed genes in the rice genome. Analysis of major gene families, such as those encoding membrane transport proteins (pumps, ion channels, and secondary transporters), along with the evolution from bacteria to higher animals and plants, reveals how gene numbers have increased through adaptation to circumstances. Family-based gene annotation also gives us a new way of comparing organisms. Massive amounts of data on gene expression under many kinds of physiological conditions are being accumulated in rice oligoarrays (22K and 44K) based on full-length cDNA sequences. Cluster analyses of genes that have the same promoter cis-elements, that have similar expression profiles, or that encode enzymes in the same metabolic pathways or signal transduction cascades give us clues to understanding the networks of gene expression in rice. As a tool for that purpose, we recently developed "RiCES", a tool for searching for cis-elements in the promoter regions of clustered genes.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Singh, Swati; Kumar, Ashok, E-mail: rajesh-csir@yahoo.com, E-mail: ashokigib@rediffmail.com; Academy of Scientific and Innovative Research
A specific and ultrasensitive, label free single-walled carbon nanotubes (SWNTs) based chemiresistive genosensor was fabricated for the early detection of Streptococcus pyogenes infection in human causing rheumatic heart disease. The mga gene of S. pyogenes specific 24 mer ssDNA probe was covalently immobilized on SWNT through a molecular bilinker, 1-pyrenemethylamine, using carbodiimide coupling reaction. The sensor was characterized by the current-voltage (I-V) characteristic curve and scanning electron microscopy. The sensing performance of the sensor was studied with respect to changes in conductance in SWNT channel based on hybridization of the target S. pyogenes single stranded genomic DNA (ssG-DNA) to itsmore » complementary 24 mer ssDNA probe. The sensor shows negligible response to non-complementary Staphylococcus aureus ssG-DNA, confirming the specificity of the sensor only with S. pyogenes. The genosensor exhibited a linear response to S. pyogenes G-DNA from 1 to1000 ng ml{sup −1} with a limit of detection of 0.16 ng ml{sup −1}.« less
Quantum dot-based microfluidic biosensor for cancer detection
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ghrera, Aditya Sharma; School of Engineering and Technology, ITM University, Gurgaon-122017; Pandey, Chandra Mouli
2015-05-11
We report results of the studies relating to fabrication of an impedimetric microfluidic–based nucleic acid sensor for quantification of DNA sequences specific to chronic myelogenous leukemia (CML). The sensor chip is prepared by patterning an indium–tin–oxide (ITO) coated glass substrate via wet chemical etching method followed by sealing with polydimethylsiloxane (PDMS) microchannel for fluid control. The fabricated microfluidic chip comprising of a patterned ITO substrate is modified by depositing cadmium selenide quantum dots (QCdSe) via Langmuir–Blodgett technique. Further, the QCdSe surface has been functionalized with specific DNA probe for CML detection. The probe DNA functionalized QCdSe integrated miniaturized system hasmore » been used to monitor target complementary DNA concentration by measuring the interfacial charge transfer resistance via hybridization. The presence of complementary DNA in buffer solution significantly results in decreased electro-conductivity of the interface due to presence of a charge barrier for transport of the redox probe ions. The microfluidic DNA biosensor exhibits improved linearity in the concentration range of 10{sup −15} M to 10{sup −11} M.« less
Synergetic approach for simple and rapid conjugation of gold nanoparticles with oligonucleotides.
Li, Jiuxing; Zhu, Binqing; Yao, Xiujie; Zhang, Yicong; Zhu, Zhi; Tu, Song; Jia, Shasha; Liu, Rudi; Kang, Huaizhi; Yang, Chaoyong James
2014-10-08
Attaching thiolated DNA on gold nanoparticles (AuNPs) has been extremely important in nanobiotechnology because DNA-AuNPs combine the programmability and molecular recognition properties of the biopolymers with the optical, thermal, and catalytic properties of the inorganic nanomaterials. However, current standard protocols to attach thiolated DNA on AuNPs involve time-consuming, tedious steps and do not perform well for large AuNPs, thereby greatly restricting applications of DNA-AuNPs. Here we demonstrate a rapid and facile strategy to attach thiolated DNA on AuNPs based on the excellent stabilization effect of mPEG-SH on AuNPs. AuNPs are first protected by mPEG-SH in the presence of Tween 20, which results in excellent stability of AuNPs in high ionic strength environments and extreme pHs. A high concentration of NaCl can be applied to the mixture of DNA and AuNP directly, allowing highly efficient DNA attachment to the AuNP surface by minimizing electrostatic repulsion. The entire DNA loading process can be completed in 1.5 h with only a few simple steps. DNA-loaded AuNPs are stable for more than 2 weeks at room temperature, and they can precisely hybridize with the complementary sequence, which was applied to prepare core-satellite nanostructures. Moreover, cytotoxicity assay confirmed that the DNA-AuNPs synthesized by this method exhibit lower cytotoxicity than those prepared by current standard methods. The proposed method provides a new way to stabilize AuNPs for rapid and facile loading thiolated DNA on AuNPs and will find wide applications in many areas requiring DNA-AuNPs, including diagnosis, therapy, and imaging.
Electrical DNA biosensor using aluminium interdigitated electrode for E.Coli O157:H7 detection
NASA Astrophysics Data System (ADS)
Natasha, N. Z.; Rajapaksha, R. D. A. A.; Uda, M. N. A.; Hashim, U.
2017-09-01
Escherichia Coli (E.Coli) O157:H7 is the one of the most dangerous foodborne pathogens based diseases that presence in our daily life that causes illness and death increase every year. Aluminum Interdigitated Electrode (Al IDE) biosensor was introduced to detect E.Coli O157:H7 in earlier stage. In this paper we investigated ssDNA of E.Coli O157:H7 bacteria detection through electrical behavior of Al IDE sensor. The physical properties of Al IDE biosensor has been characterized using Low Power Microscope (LPM), High Power Microscope (HPM), Scanning Electron Microscope (SEM) and 3D Nano Profiler. The bare Al IDE was electrical characterized by using I-V measurement. The surface modification was accomplished by salinization using APTES and immobilization using Carboxylic Probe E.Coli which was the first step in preparing Al IDE biosensor. Geared up prepared biosensor was hybridized with complementary, non-complementary and single based mismatch ssDNA to confirmed specificity detection of E Coli O157:H7 ssDNA target. The Current - Voltage was performed for each step such as bare Al IDE, surface modification, immobilization and hybridization. Sensitivity measurement was accomplished using different concentration of complementary ssDNA target from 1 fM - 10 µM. Selectivity measurements was achieved using same concentration which was 10 µM concentration for complement, non-complement and mismatch E.Coli O157:H7 ssDNA target. It's totally proved that the Al IDE able to detect specific and small current down to Femtomolar concentration.
Controlled assembly of artificial protein-protein complexes via DNA duplex formation.
Płoskoń, Eliza; Wagner, Sara C; Ellington, Andrew D; Jewett, Michael C; O'Reilly, Rachel; Booth, Paula J
2015-03-18
DNA-protein conjugates have found a wide range of applications. This study demonstrates the formation of defined, non-native protein-protein complexes via the site specific labeling of two proteins of interest with complementary strands of single-stranded DNA in vitro. This study demonstrates that the affinity of two DNA-protein conjugates for one another may be tuned by the use of variable lengths of DNA allowing reversible control of complex formation.
Muhire, Brejnev Muhizi; Golden, Michael; Murrell, Ben; Lefeuvre, Pierre; Lett, Jean-Michel; Gray, Alistair; Poon, Art Y F; Ngandu, Nobubelo Kwanele; Semegni, Yves; Tanov, Emil Pavlov; Monjane, Adérito Luis; Harkins, Gordon William; Varsani, Arvind; Shepherd, Dionne Natalie; Martin, Darren Patrick
2014-02-01
Single-stranded DNA (ssDNA) viruses have genomes that are potentially capable of forming complex secondary structures through Watson-Crick base pairing between their constituent nucleotides. A few of the structural elements formed by such base pairings are, in fact, known to have important functions during the replication of many ssDNA viruses. Unknown, however, are (i) whether numerous additional ssDNA virus genomic structural elements predicted to exist by computational DNA folding methods actually exist and (ii) whether those structures that do exist have any biological relevance. We therefore computationally inferred lists of the most evolutionarily conserved structures within a diverse selection of animal- and plant-infecting ssDNA viruses drawn from the families Circoviridae, Anelloviridae, Parvoviridae, Nanoviridae, and Geminiviridae and analyzed these for evidence of natural selection favoring the maintenance of these structures. While we find evidence that is consistent with purifying selection being stronger at nucleotide sites that are predicted to be base paired than at sites predicted to be unpaired, we also find strong associations between sites that are predicted to pair with one another and site pairs that are apparently coevolving in a complementary fashion. Collectively, these results indicate that natural selection actively preserves much of the pervasive secondary structure that is evident within eukaryote-infecting ssDNA virus genomes and, therefore, that much of this structure is biologically functional. Lastly, we provide examples of various highly conserved but completely uncharacterized structural elements that likely have important functions within some of the ssDNA virus genomes analyzed here.
Muhire, Brejnev Muhizi; Golden, Michael; Murrell, Ben; Lefeuvre, Pierre; Lett, Jean-Michel; Gray, Alistair; Poon, Art Y. F.; Ngandu, Nobubelo Kwanele; Semegni, Yves; Tanov, Emil Pavlov; Monjane, Adérito Luis; Harkins, Gordon William; Varsani, Arvind; Shepherd, Dionne Natalie
2014-01-01
Single-stranded DNA (ssDNA) viruses have genomes that are potentially capable of forming complex secondary structures through Watson-Crick base pairing between their constituent nucleotides. A few of the structural elements formed by such base pairings are, in fact, known to have important functions during the replication of many ssDNA viruses. Unknown, however, are (i) whether numerous additional ssDNA virus genomic structural elements predicted to exist by computational DNA folding methods actually exist and (ii) whether those structures that do exist have any biological relevance. We therefore computationally inferred lists of the most evolutionarily conserved structures within a diverse selection of animal- and plant-infecting ssDNA viruses drawn from the families Circoviridae, Anelloviridae, Parvoviridae, Nanoviridae, and Geminiviridae and analyzed these for evidence of natural selection favoring the maintenance of these structures. While we find evidence that is consistent with purifying selection being stronger at nucleotide sites that are predicted to be base paired than at sites predicted to be unpaired, we also find strong associations between sites that are predicted to pair with one another and site pairs that are apparently coevolving in a complementary fashion. Collectively, these results indicate that natural selection actively preserves much of the pervasive secondary structure that is evident within eukaryote-infecting ssDNA virus genomes and, therefore, that much of this structure is biologically functional. Lastly, we provide examples of various highly conserved but completely uncharacterized structural elements that likely have important functions within some of the ssDNA virus genomes analyzed here. PMID:24284329
Kékedy-Nagy, László; Ferapontova, Elena E; Brand, Izabella
2017-02-23
Unique electronic and ligand recognition properties of the DNA double helix provide basis for DNA applications in biomolecular electronic and biosensor devices. However, the relation between the structure of DNA at electrified interfaces and its electronic properties is still not well understood. Here, potential-driven changes in the submolecular structure of DNA double helices composed of either adenine-thymine (dAdT) 25 or cytosine-guanine (dGdC) 20 base pairs tethered to the gold electrodes are for the first time analyzed by in situ polarization modulation infrared reflection absorption spectroscopy (PM IRRAS) performed under the electrochemical control. It is shown that the conformation of the DNA duplexes tethered to gold electrodes via the C 6 alkanethiol linker strongly depends on the nucleic acid sequence composition. The tilt of purine and pyrimidine rings of the complementary base pairs (dAdT and dGdC) depends on the potential applied to the electrode. By contrast, neither the conformation nor orientation of the ionic in character phosphate-sugar backbone is affected by the electrode potentials. At potentials more positive than the potential of zero charge (pzc), a gradual tilting of the double helix is observed. In this tilted orientation, the planes of the complementary purine and pyrimidine rings lie ideally parallel to each other. These potentials do not affect the integral stability of the DNA double helix at the charged interface. At potentials more negative than the pzc, DNA helices adopt a vertical to the gold surface orientation. Tilt of the purine and pyrimidine rings depends on the composition of the double helix. In monolayers composed of (dAdT) 25 molecules the rings of the complementary base pairs lie parallel to each other. By contrast, the tilt of purine and pyrimidine rings in (dGdC) 20 helices depends on the potential applied to the electrode. Such potential-induced mobility of the complementary base pairs can destabilize the helix structure at a submolecular level. These pioneer results on the potential-driven changes in the submolecular structure of double stranded DNA adsorbed on conductive supports contribute to further understanding of the potential-driven sequence-specific electronic properties of surface-tethered oligonucleotides.
Gao, Zhong Feng; Ling, Yu; Lu, Lu; Chen, Ning Yu; Luo, Hong Qun; Li, Nian Bing
2014-03-04
Although various strategies have been reported for single-nucleotide polymorphisms (SNPs) detection, development of a time-saving, specific, and regenerated electrochemical sensing platform still remains a realistic goal. In this study, an ON-OFF switching of a regenerated biosensor based on a locked nucleic acid (LNA)-integrated and toehold-mediated strand displacement reaction technique is constructed for detection of SNPs. The LNA-integrated and methylene blue-labeled capture probe with an external toehold is designed to switch on the sensing system. The mutant-type DNA probe completes complementary with the capture probe to trigger the strand displacement reaction, which switches off the sensing system. However, when the single-base mismatched wild-type DNA probe is presented, the strand displacement reaction cannot be achieved; therefore, the sensing system still keeps the ON state. This DNA sensor is stable over five reuses. We further testify that the LNA-integrated sequence has better recognition ability for SNPs detection compared to the DNA-integrated sequence. Moreover, this DNA senor exhibits a remarkable discrimination capability of SNPs among abundant wild-type targets and 6000-fold (m/m) excess of genomic DNA. In addition, it is selective enough in complex and contaminant-ridden samples, such as human urine, soil, saliva, and beer. Overall, these results demonstrate that this reliable DNA sensor is easy to be fabricated, simple to operate, and stable enough to be readily regenerated.
Rashid, Jahwarhar Izuan Abdul; Yusof, Nor Azah; Abdullah, Jaafar; Hashim, Uda; Hajian, Reza
2014-12-01
This work describes the incorporation of SiNWs/AuNPs composite as a sensing material for DNA detection on indium tin-oxide (ITO) coated glass slide. The morphology of SiNWs/AuNPs composite as the modifier layer on ITO was studied by scanning electron microscopy (SEM) and energy dispersive X-ray spectroscopy (EDX). The morphological studies clearly showed that SiNWs were successfully decorated with 20 nm-AuNPs using self-assembly monolayer (SAM) technique. The effective surface area for SiNWs/AuNPs-modified ITO enhanced about 10 times compared with bare ITO electrode. SiNWs/AuNPs nanocomposite was further explored as a matrix for DNA probe immobilization in detection of dengue virus as a bio-sensing model to evaluate its performance in electrochemical sensors. The hybridization of complementary DNA was monitored by differential pulse voltammetry (DPV) using methylene blue (MB) as the redox indicator. The fabricated biosensor was able to discriminate significantly complementary, non-complementary and single-base mismatch oligonucleotides. The electrochemical biosensor was sensitive to target DNA related to dengue virus in the range of 9.0-178.0 ng/ml with detection limit of 3.5 ng/ml. In addition, SiNWs/AuNPs-modified ITO, regenerated up to 8 times and its stability was up to 10 weeks at 4°C in silica gel. Copyright © 2014 Elsevier B.V. All rights reserved.
Ahour, F; Shamsi, A
2017-09-01
Based on the strong interaction between single-stranded DNA (ss-DNA) and graphene material, we have constructed a novel label-free electrochemical biosensor for rapid and facile detection of short sequences ss-DNA molecules related to hepatitis C virus 1a using graphene oxide modified pencil graphite electrode. The sensing mechanism is based on the superior adsorption of single-stranded DNA to GO over double stranded DNA (ds-DNA). The intrinsic guanine oxidation signal measured by differential pulse voltammetry (DPV) has been used for duplex DNA formation detection. The probe ss-DNA adsorbs onto the surface of GO via the π- π* stacking interactions leading to a strong background guanine oxidation signal. In the presence of complementary target, formation of helix which has weak binding ability to GO induced ds-DNA to release from the electrode surface and significant variation in differential pulse voltammetric response of guanine bases. The results indicated that the oxidation peak current was proportional to the concentration of complementary strand in the range of 0.1 nM-0.5 μM with a detection limit of 4.3 × 10 -11 M. The simple fabricated electrochemical biosensor has high sensitivity, good selectivity, and could be applied as a new platform for a range of target molecules in future. Copyright © 2017 Elsevier Inc. All rights reserved.
The Viral Evolution Core within the AIDS and Cancer Virus Program will extract viral RNA/DNA from cell-free or cell-associated samples. Complementary (cDNA) will be generated as needed, and cDNA or DNA will be diluted to a single copy prior to nested
What Hinders Electron Transfer Dissociation (ETD) of DNA Cations?
NASA Astrophysics Data System (ADS)
Hari, Yvonne; Leumann, Christian J.; Schürch, Stefan
2017-12-01
Radical activation methods, such as electron transfer dissociation (ETD), produce structural information complementary to collision-induced dissociation. Herein, electron transfer dissociation of 3-fold protonated DNA hexamers was studied to gain insight into the fragmentation mechanism. The fragmentation patterns of a large set of DNA hexamers confirm cytosine as the primary target of electron transfer. The reported data reveal backbone cleavage by internal electron transfer from the nucleobase to the phosphate linker leading either to a•/ w or d/ z• ion pairs. This reaction pathway contrasts with previous findings on the dissociation processes after electron capture by DNA cations, suggesting multiple, parallel dissociation channels. However, all these channels merely result in partial fragmentation of the precursor ion because the charge-reduced DNA radical cations are quite stable. Two hypotheses are put forward to explain the low dissociation yield of DNA radical cations: it is either attributed to non-covalent interactions between complementary fragments or to the stabilization of the unpaired electron in stacked nucleobases. MS3 experiments suggest that the charge-reduced species is the intact oligonucleotide. Moreover, introducing abasic sites significantly increases the dissociation yield of DNA cations. Consequently, the stabilization of the unpaired electron by π-π-stacking provides an appropriate rationale for the high intensity of DNA radical cations after electron transfer. [Figure not available: see fulltext.
DETECTION OF DNA DAMAGE USING A FIBEROPTIC BIOSENSOR
A rapid and sensitive fiber optic biosensor assay for radiation-induced DNA damage is reported. For this assay, a biotin-labeled capture oligonucleotide (38 mer) was immobilized to an avidin-coated quartz fiber. Hybridization of a dye-labeled complementary sequence was observed...
Wang, Shuo; Nanjunda, Rupesh; Aston, Karl; Bashkin, James K.; Wilson, W. David
2012-01-01
In order to better understand the effects of β-alanine (β) substitution and the number of heterocycles on DNA binding affinity and selectivity, the interactions of an eight-ring hairpin polyamide (PA) and two β derivatives as well as a six-heterocycle analog have been investigated with their cognate DNA sequence, 5′-TGGCTT-3′. Binding selectivity and the effects of β have been investigated with the cognate and five mutant DNAs. A set of powerful and complementary methods have been employed for both energetic and structural evaluations: UV-melting, biosensor-surface plasmon resonance, isothermal titration calorimetry, circular dichroism and a DNA ligation ladder global structure assay. The reduced number of heterocycles in the six-ring PA weakens the binding affinity; however, the smaller PA aggregates significantly less than the larger PAs, and allows us to obtain the binding thermodynamics. The PA-DNA binding enthalpy is large and negative with a large negative ΔCp, and is the primary driving component of the Gibbs free energy. The complete SPR binding results clearly show that β substitutions can substantially weaken the binding affinity of hairpin PAs in a position-dependent manner. More importantly, the changes in PA binding to the mutant DNAs further confirm the position-dependent effects on PA-DNA interaction affinity. Comparison of mutant DNA sequences also shows a different effect in recognition of T•A versus A•T base pairs. The effects of DNA mutations on binding of a single PA as well as the effects of the position of β substitution on binding tell a clear and very important story about sequence dependent binding of PAs to DNA. PMID:23167504
Synthesis and binding properties of new selective ligands for the nucleobase opposite the AP site.
Abe, Yukiko; Nakagawa, Osamu; Yamaguchi, Rie; Sasaki, Shigeki
2012-06-01
DNA is continuously damaged by endogenous and exogenous factors such as oxidative stress or DNA alkylating agents. These damaged nucleobases are removed by DNA N-glycosylase and form apurinic/apyrimidinic sites (AP sites) as intermediates in the base excision repair (BER) pathway. AP sites are also representative DNA damages formed by spontaneous hydrolysis. The AP sites block DNA polymerase and a mismatch nucleobase is inserted opposite the AP sites by polymerization to cause acute toxicities and mutations. Thus, AP site specific compounds have attracted much attention for therapeutic and diagnostic purposes. In this study, we have developed nucleobase-polyamine conjugates as the AP site binding ligand by expecting that the nucleobase part would play a role in the specific recognition of the nucleobase opposite the AP site by the Watson-Crick base pair formation and that the polyamine part should contribute to the access of the ligand to the AP site by a non-specific interaction to the DNA phosphate backbone. The nucleobase conjugated with 3,3'-diaminodipropylamine (A-ligand, G-ligand, C-ligand, T-ligand and U-ligand) showed a specific stabilization of the duplex containing the AP site depending on the complementary combination with the nucleobase opposite the AP site; that is A-ligand to T, G-ligand to C, C-ligand to G, T- and U-ligand to A. The thermodynamic binding parameters clearly indicated that the specific stabilization is due to specific binding of the ligands to the complementary AP site. These results have suggested that the complementary base pairs of the Watson-Crick type are formed at the AP site. Copyright © 2012 Elsevier Ltd. All rights reserved.
Wenga, G; Jacques, E; Salaün, A-C; Rogel, R; Pichon, L; Geneste, F
2013-02-15
Currently, detection of DNA hybridization using fluorescence-based detection technique requires expensive optical systems and complex bioinformatics tools. Hence, the development of new low cost devices that enable direct and highly sensitive detection stimulates a lot of research efforts. Particularly, devices based on silicon nanowires are emerging as ultrasensitive electrical sensors for the direct detection of biological species thanks to their high surface to volume ratio. In this study, we propose innovative devices using step-gate polycrystalline silicon nanowire FET (poly-Si NW FETs), achieved with simple and low cost fabrication process, and used as ultrasensitive electronic sensor for DNA hybridization. The poly-SiNWs are synthesized using the sidewall spacer formation technique. The detailed fabrication procedure for a step-gate NWFET sensor is described in this paper. No-complementary and complementary DNA sequences were clearly discriminated and detection limit to 1 fM range is observed. This first result using this nano-device is promising for the development of low cost and ultrasensitive polysilicon nanowires based DNA sensors compatible with the CMOS technology. Copyright © 2012 Elsevier B.V. All rights reserved.
Allison, J; Hall, L; MacIntyre, I; Craig, R K
1981-01-01
(1) Total poly(A)-containing RNA isolated from human thyroid medullary carcinoma tissue was shown to direct the synthesis in the wheat germ cell-free system of a major (Mr 21000) and several minor forms of human calcitonin precursor polyproteins. Evidence for processing of these precursor(s) by the wheat germ cell-free system is also presented. (2) A small complementary DNA (cDNA) plasmid library has been constructed in the PstI site of the plasmid pAT153, using total human thyroid medullary carcinoma poly(A)-containing RNA as the starting material. (3) Plasmids containing abundant cDNA sequences were selected by hybridization in situ, and two of these (ph T-B3 and phT-B6) were characterized by hybridization--translation and restriction analysis. Each was shown to contain human calcitonin precursor polyprotein cDNA sequences. (4) RNA blotting techniques demonstrate that the human calcitonin precursor polyprotein is encoded within a mRNA containing 1000 bases. (5) The results demonstrate that human calcitonin is synthesized as a precursor polyprotein. Images Fig. 1. Fig. 2. Fig. 3. PMID:6896146
Akopiants, Konstantin; Zhou, Rui-Zhe; Mohapatra, Susovan; Valerie, Kristoffer; Lees-Miller, Susan P; Lee, Kyung-Jong; Chen, David J; Revy, Patrick; de Villartay, Jean-Pierre; Povirk, Lawrence F
2009-07-01
XLF/Cernunnos is a core protein of the nonhomologous end-joining pathway of DNA double-strand break repair. To better define the role of Cernunnos in end joining, whole-cell extracts were prepared from Cernunnos-deficient human cells. These extracts effected little joining of DNA ends with cohesive 5' or 3' overhangs, and no joining at all of partially complementary 3' overhangs that required gap filling prior to ligation. Assays in which gap-filled but unligated intermediates were trapped using dideoxynucleotides revealed that there was no gap filling on aligned DSB ends in the Cernunnos-deficient extracts. Recombinant Cernunnos protein restored gap filling and end joining of partially complementary overhangs, and stimulated joining of cohesive ends more than twentyfold. XLF-dependent gap filling was nearly eliminated by immunodepletion of DNA polymerase lambda, but was restored by addition of either polymerase lambda or polymerase mu. Thus, Cernunnos is essential for gap filling by either polymerase during nonhomologous end joining, suggesting that it plays a major role in aligning the two DNA ends in the repair complex.
Proteome-scale human interactomics
Luck, Katja; Sheynkman, Gloria M.; Zhang, Ivy; Vidal, Marc
2017-01-01
Cellular functions are mediated by complex interactome networks of physical, biochemical, and functional interactions between DNA sequences, RNA molecules, proteins, lipids, and small metabolites. A thorough understanding of cellular organization requires accurate and relatively complete models of interactome networks at proteome-scale. The recent publication of four human protein-protein interaction (PPI) maps represents a technological breakthrough and an unprecedented resource for the scientific community, heralding a new era of proteome-scale human interactomics. Our knowledge gained from these and complementary studies provides fresh insights into the opportunities and challenges when analyzing systematically generated interactome data, defines a clear roadmap towards the generation of a first reference interactome, and reveals new perspectives on the organization of cellular life. PMID:28284537
Nascimento, Gustavo A; Souza, Elaine V M; Campos-Ferreira, Danielly S; Arruda, Mariana S; Castelletti, Carlos H M; Wanderley, Marcela S O; Ekert, Marek H F; Bruneska, Danyelly; Lima-Filho, José L
2012-01-01
A new electrochemical DNA biosensor for bovine papillomavirus (BPV) detection that was based on screen-printed electrodes was comprehensively studied by electrochemical methods of cyclic voltammetry (CV) and differential pulse voltammetry (DPV). A BPV probe was immobilised on a working electrode (gold) modified with a polymeric film of poly-L-lysine (PLL) and chitosan. The experimental design was carried out to evaluate the influence of polymers, probe concentration (BPV probe) and immobilisation time on the electrochemical reduction of methylene blue (MB). The polymer poly-L-lysine (PLL), a probe concentration of 1 μM and an immobilisation time of 60 min showed the best result for the BPV probe immobilisation. With the hybridisation of a complementary target sequence (BPV target), the electrochemical signal decreased compared to a BPV probe immobilised on the modified PLL-gold electrode. Viral DNA that was extracted from cattle with papillomatosis also showed a decrease in the MB electrochemical reduction, which suggested that the decreased electrochemical signal corresponded to a bovine papillomavirus infection. The hybridisation specificity experiments further indicated that the biosensor could discriminate the complementary sequence from the non-complementary sequence. Thus, the results showed that the development of analytical devices, such as a biosensor, could assist in the rapid and efficient detection of bovine papillomavirus DNA and help in the prevention and treatment of papillomatosis in cattle. Copyright © 2012 Elsevier B.V. All rights reserved.
McWilliams, D; Callahan, R C; Boime, I
1977-01-01
A complementary DNA (cDNA) strand was transcribed from human placental lactogen (hPL) mRNA. Based on alkaline sucrose gradient centrifugation, the size of the cDNA was about 8 S, which would represent at least 80% of the hPL mRNA. Previously we showed that four to five times more hPL was synthesized in cell-free extracts derived from term as compared to first trimester placentas. Hybridization of the cDNA with RNA derived from placental tissue revealed that there was about four times more hPL mRNA sequences in total RNA from term placenta than in a comparable quantity of total first trimester RNA. Only background hybridization was observed when the cDNA was incubated with RNA prepared from human kidney. To test if this differential accumulation of hPL mRNA was the result of an amplification of hPL genes, we hybridized the labeled cDNA with cellular DNA from first trimester and term placentas and with DNA isolated from human brain. In all cases, the amount of hPL sequences was approximately two copies per haploid genome. Thus, the enhanced synthesis of hPL mRNA appears to result from a transcriptional activation rather than an amplification of the hPL gene. The increase likely reflects placental differentiation in which the proportion of syncytial trophoblast increases at term. Images PMID:66681
HLA genotyping by next-generation sequencing of complementary DNA.
Segawa, Hidenobu; Kukita, Yoji; Kato, Kikuya
2017-11-28
Genotyping of the human leucocyte antigen (HLA) is indispensable for various medical treatments. However, unambiguous genotyping is technically challenging due to high polymorphism of the corresponding genomic region. Next-generation sequencing is changing the landscape of genotyping. In addition to high throughput of data, its additional advantage is that DNA templates are derived from single molecules, which is a strong merit for the phasing problem. Although most currently developed technologies use genomic DNA, use of cDNA could enable genotyping with reduced costs in data production and analysis. We thus developed an HLA genotyping system based on next-generation sequencing of cDNA. Each HLA gene was divided into 3 or 4 target regions subjected to PCR amplification and subsequent sequencing with Ion Torrent PGM. The sequence data were then subjected to an automated analysis. The principle of the analysis was to construct candidate sequences generated from all possible combinations of variable bases and arrange them in decreasing order of the number of reads. Upon collecting candidate sequences from all target regions, 2 haplotypes were usually assigned. Cases not assigned 2 haplotypes were forwarded to 4 additional processes: selection of candidate sequences applying more stringent criteria, removal of artificial haplotypes, selection of candidate sequences with a relaxed threshold for sequence matching, and countermeasure for incomplete sequences in the HLA database. The genotyping system was evaluated using 30 samples; the overall accuracy was 97.0% at the field 3 level and 98.3% at the G group level. With one sample, genotyping of DPB1 was not completed due to short read size. We then developed a method for complete sequencing of individual molecules of the DPB1 gene, using the molecular barcode technology. The performance of the automatic genotyping system was comparable to that of systems developed in previous studies. Thus, next-generation sequencing of cDNA is a viable option for HLA genotyping.
Thomason, Lynn C; Costantino, Nina; Court, Donald L
2016-09-13
Recombineering, in vivo genetic engineering with bacteriophage homologous recombination systems, is a powerful technique for making genetic modifications in bacteria. Two systems widely used in Escherichia coli are the Red system from phage λ and RecET from the defective Rac prophage. We investigated the in vivo dependence of recombineering on DNA replication of the recombining substrate using plasmid targets. For λ Red recombination, when DNA replication of a circular target plasmid is prevented, recombination with single-stranded DNA oligonucleotides is greatly reduced compared to that under replicating conditions. For RecET recombination, when DNA replication of the targeted plasmid is prevented, the recombination frequency is also reduced, to a level identical to that seen for the Red system in the absence of replication. The very low level of oligonucleotide recombination observed in the absence of any phage recombination functions is the same in the presence or absence of DNA replication. In contrast, both the Red and RecET systems recombine a nonreplicating linear dimer plasmid with high efficiency to yield a circular monomer. Therefore, the DNA replication requirement is substrate dependent. Our data are consistent with recombination by both the Red and RecET systems occurring predominately by single-strand annealing rather than by strand invasion. Bacteriophage homologous recombination systems are widely used for in vivo genetic engineering in bacteria. Single- or double-stranded linear DNA substrates containing short flanking homologies to chromosome targets are used to generate precise and accurate genetic modifications when introduced into bacteria expressing phage recombinases. Understanding the molecular mechanism of these recombination systems will facilitate improvements in the technology. Here, two phage-specific systems are shown to require exposure of complementary single-strand homologous targets for efficient recombination; these single-strand regions may be created during DNA replication or by single-strand exonuclease digestion of linear duplex DNA. Previously, in vitro studies reported that these recombinases promote the single-strand annealing of two complementary DNAs and also strand invasion of a single DNA strand into duplex DNA to create a three-stranded region. Here, in vivo experiments show that recombinase-mediated annealing of complementary single-stranded DNA is the predominant recombination pathway in E. coli. Copyright © 2016 Thomason et al.
Probabilistic simple sticker systems
NASA Astrophysics Data System (ADS)
Selvarajoo, Mathuri; Heng, Fong Wan; Sarmin, Nor Haniza; Turaev, Sherzod
2017-04-01
A model for DNA computing using the recombination behavior of DNA molecules, known as a sticker system, was introduced by by L. Kari, G. Paun, G. Rozenberg, A. Salomaa, and S. Yu in the paper entitled DNA computing, sticker systems and universality from the journal of Acta Informatica vol. 35, pp. 401-420 in the year 1998. A sticker system uses the Watson-Crick complementary feature of DNA molecules: starting from the incomplete double stranded sequences, and iteratively using sticking operations until a complete double stranded sequence is obtained. It is known that sticker systems with finite sets of axioms and sticker rules generate only regular languages. Hence, different types of restrictions have been considered to increase the computational power of sticker systems. Recently, a variant of restricted sticker systems, called probabilistic sticker systems, has been introduced [4]. In this variant, the probabilities are initially associated with the axioms, and the probability of a generated string is computed by multiplying the probabilities of all occurrences of the initial strings in the computation of the string. Strings for the language are selected according to some probabilistic requirements. In this paper, we study fundamental properties of probabilistic simple sticker systems. We prove that the probabilistic enhancement increases the computational power of simple sticker systems.
Identification of species adulteration in traded medicinal plant raw drugs using DNA barcoding.
Nithaniyal, Stalin; Vassou, Sophie Lorraine; Poovitha, Sundar; Raju, Balaji; Parani, Madasamy
2017-02-01
Plants are the major source of therapeutic ingredients in complementary and alternative medicine (CAM). However, species adulteration in traded medicinal plant raw drugs threatens the reliability and safety of CAM. Since morphological features of medicinal plants are often not intact in the raw drugs, DNA barcoding was employed for species identification. Adulteration in 112 traded raw drugs was tested after creating a reference DNA barcode library consisting of 1452 rbcL and matK barcodes from 521 medicinal plant species. Species resolution of this library was 74.4%, 90.2%, and 93.0% for rbcL, matK, and rbcL + matK, respectively. DNA barcoding revealed adulteration in about 20% of the raw drugs, and at least 6% of them were derived from plants with completely different medicinal or toxic properties. Raw drugs in the form of dried roots, powders, and whole plants were found to be more prone to adulteration than rhizomes, fruits, and seeds. Morphological resemblance, co-occurrence, mislabeling, confusing vernacular names, and unauthorized or fraudulent substitutions might have contributed to species adulteration in the raw drugs. Therefore, this library can be routinely used to authenticate traded raw drugs for the benefit of all stakeholders: traders, consumers, and regulatory agencies.
Song, Luna; Zhang, Yonghua; Li, Junling; Gao, Qiang; Qi, Honglan; Zhang, Chengxiao
2016-04-01
An enzyme-free signal amplification-based assay for DNA detection was developed using fluorescent hairpin DNA probes coupled with hybridization chain reaction (HCR). The hairpin DNAs were designed to contain abasic sites in the stem moiety. Non-covalent labeling of the hairpin DNAs was achieved when a fluorescent ligand was bound to the abasic sites through hydrogen bonding with the orphan cytosine present on the complementary strand, accompanied by quench of ligand fluorescence. As a result, the resultant probes, the complex formed between the hairpin DNA and ligand, showed almost no fluorescence. Upon hybridization with target DNA, the probe underwent a dehybridization of the stem moiety containing an abasic site. The release of ligand from the abasic site to the solution resulted in an effective fluorescent enhancement, which can be used as a signal. Compared with a sensing system without HCR, a 20-fold increase in the sensitivity was achieved using the sensing system with HCR. The fluorescent intensity of the sensing system increased with the increase in target DNA concentration from 0.5 nM to 100 nM. A single mismatched target ss-DNA could be effectively discriminated from complementary target DNA. Genotyping of a G/C single-nucleotide polymorphism of polymerase chain reaction (PCR) products was successfully demonstrated with the sensing system. Therefore, integrating HCR strategy with non-covalent labeling of fluorescent hairpin DNA probes provides a sensitive and cost-effective DNA assay. © The Author(s) 2016.
Moradi, M; Sattarahmady, N; Rahi, A; Hatam, G R; Sorkhabadi, S M Rezayat; Heli, H
2016-12-01
Detection of leishmaniasis is important in clinical diagnoses. In the present study, identification of Leishmania parasites was performed by a label-free, PCR-free and signal-on ultrasensitive electrochemical DNA biosensor. Gold nanoleaves were firstly electrodeposited by an electrodeposition method using spermidine as a shape directing agent. The biosensor was fabricated by immobilization of a Leishmania major specific DNA probe onto gold nanoleaves, and methylene blue was employed as a marker. Hybridization of the complementary single stranded DNA sequence with the biosensor under the selected conditions was then investigated. The biosensor could detect a synthetic DNA target in a range of 1.0×10 -10 to 1.0×10 -19 molL -1 with a limit of detection of 1.8×10 -20 molL -1 , and genomic DNA in a range of 0.5-20ngμL -1 with a limit of detection of 0.07ngμL -1 . The biosensor could distinguish Leishmania major from a non-complementary-sequence oligonucleotide and the tropica species with a high selectivity. The biosensor was applicable to detect Leishmania major in patient samples. Copyright © 2016 Elsevier B.V. All rights reserved.
Autonomous parvovirus LuIII encapsidates equal amounts of plus and minus DNA strands
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bates, R.C.; Snyder, C.E.; Banerjee, P.T.
1984-02-01
Autonomous parvoviruses are thought to uniquely encapsidate single-stranded DNA of minus polarity. In contrast, the defective adeno-associated viruses separately encapsidate equal amounts of plus and minus DNA strands. The uniqueness of minus strand encapsidation is reexamined for the autonomous parvoviruses. Although it was found that Kilham rat virus and H-1 virus encapsidate varying but small amounts of complementary-strand DNA, it was unexpected to find that LuIII virus encapsidated equal amounts of plus and minus DNA. The extracted LuIII DNA possessed properties of double-stranded replicative-form DNA, including insensitivity to S1 endonuclease, cleavage by restriction enzymes, and conversion to unit-length, single-stranded DNAmore » when electrophoresed under denaturing conditions. However, the inability of this DNA to form single-stranded DNA circles when denatured and then renatured in the presence of formamide and the lack of double-stranded DNA circle formation after treatment with exonuclease III and reannealing shows a lack of sequence homology of the 3' and 5' termini of LuIII DNA, in contrast to adeno-associated virus DNA. Digestion of LuIII double-stranded DNA with EcoRI and HincII and separation of plus and minus DNA strands on composite agarose-acrylamide gels identified a heterogeneity present only in the plus DNA strand. These results suggest that strand specificity of viral DNA encapsidation is not a useful property for differentiation between the autonomous and defective parvoviruses. Furthermore, encapsidation by LuIII of equal amounts of complementary DNA strands in contrast to encapsidation of minus strands by H-1 virus, when propagated in the same host cell type, suggests that selection of strands for encapsidation is a virus-coded rather than host-controlled event.« less
NASA Astrophysics Data System (ADS)
Khadsai, Sudarat; Rutnakornpituk, Boonjira; Vilaivan, Tirayut; Nakkuntod, Maliwan; Rutnakornpituk, Metha
2016-09-01
Magnetite nanoparticles (MNPs) were surface modified with anionic poly( N-acryloyl glycine) (PNAG) and streptavidin for specific interaction with biotin-conjugated pyrrolidinyl peptide nucleic acid (PNA). Hydrodynamic size ( D h) of PNAG-grafted MNPs varied from 334 to 496 nm depending on the loading ratio of the MNP to NAG in the reaction. UV-visible and fluorescence spectrophotometries were used to confirm the successful immobilization of streptavidin and PNA on the MNPs. About 291 pmol of the PNA/mg MNP was immobilized on the particle surface. The PNA-functionalized MNPs were effectively used as solid supports to differentiate between fully complementary and non-complementary/single-base mismatch DNA using the PNA probe. These novel anionic MNPs can be efficiently applicable for use as a magnetically guidable support for DNA base discrimination.
Arrays of nucleic acid probes on biological chips
Chee, Mark; Cronin, Maureen T.; Fodor, Stephen P. A.; Huang, Xiaohua X.; Hubbell, Earl A.; Lipshutz, Robert J.; Lobban, Peter E.; Morris, MacDonald S.; Sheldon, Edward L.
1998-11-17
DNA chips containing arrays of oligonucleotide probes can be used to determine whether a target nucleic acid has a nucleotide sequence identical to or different from a specific reference sequence. The array of probes comprises probes exactly complementary to the reference sequence, as well as probes that differ by one or more bases from the exactly complementary probes.
Naimuddin, Mohammed; Kubo, Tai
2011-12-01
We report an efficient system to produce and display properly folded disulfide-rich proteins facilitated by coupled complementary DNA (cDNA) display and protein disulfide isomerase-assisted folding. The results show that a neurotoxin protein containing four disulfide linkages can be displayed in the folded state. Furthermore, it can be refolded on a solid support that binds efficiently to its natural acetylcholine receptor. Probing the efficiency of the display proteins prepared by these methods provided up to 8-fold higher enrichment by the selective enrichment method compared with cDNA display alone, more than 10-fold higher binding to its receptor by the binding assays, and more than 10-fold higher affinities by affinity measurements. Cotranslational folding was found to have better efficiency than posttranslational refolding between the two investigated methods. We discuss the utilities of efficient display of such proteins in the preparation of superior quality proteins and protein libraries for directed evolution leading to ligand discovery. Copyright © 2011 Elsevier Inc. All rights reserved.
Stranges, P. Benjamin; Palla, Mirkó; Kalachikov, Sergey; Nivala, Jeff; Dorwart, Michael; Trans, Andrew; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Tao, Chuanjuan; Morozova, Irina; Li, Zengmin; Shi, Shundi; Aberra, Aman; Arnold, Cleoma; Yang, Alexander; Aguirre, Anne; Harada, Eric T.; Korenblum, Daniel; Pollard, James; Bhat, Ashwini; Gremyachinskiy, Dmitriy; Bibillo, Arek; Chen, Roger; Davis, Randy; Russo, James J.; Fuller, Carl W.; Roever, Stefan; Ju, Jingyue; Church, George M.
2016-01-01
Scalable, high-throughput DNA sequencing is a prerequisite for precision medicine and biomedical research. Recently, we presented a nanopore-based sequencing-by-synthesis (Nanopore-SBS) approach, which used a set of nucleotides with polymer tags that allow discrimination of the nucleotides in a biological nanopore. Here, we designed and covalently coupled a DNA polymerase to an α-hemolysin (αHL) heptamer using the SpyCatcher/SpyTag conjugation approach. These porin–polymerase conjugates were inserted into lipid bilayers on a complementary metal oxide semiconductor (CMOS)-based electrode array for high-throughput electrical recording of DNA synthesis. The designed nanopore construct successfully detected the capture of tagged nucleotides complementary to a DNA base on a provided template. We measured over 200 tagged-nucleotide signals for each of the four bases and developed a classification method to uniquely distinguish them from each other and background signals. The probability of falsely identifying a background event as a true capture event was less than 1.2%. In the presence of all four tagged nucleotides, we observed sequential additions in real time during polymerase-catalyzed DNA synthesis. Single-polymerase coupling to a nanopore, in combination with the Nanopore-SBS approach, can provide the foundation for a low-cost, single-molecule, electronic DNA-sequencing platform. PMID:27729524
USDA-ARS?s Scientific Manuscript database
Communities of soil nematodes impact ecosystem functions, including plant growth, decomposition, and nutrient cycling, all of which are vital processes in agriculture. We used complementary morphological and DNA metabarcoding analyses to characterize soil nematode communities in three cropping syste...
Schnier, P D; Klassen, J S; Strittmatter, E F; Williams, E R
1998-09-23
The dissociation kinetics of a series of complementary and noncomplementary DNA duplexes, (TGCA)(2) (3-), (CCGG)(2) (3-), (AATTAAT)(2) (3-), (CCGGCCG)(2) (3-), A(7)*T(7) (3-), A(7)*A(7) (3-), T(7)*T(7) (3-), and A(7)*C(7) (3-) were investigated using blackbody infrared radiative dissociation in a Fourier transform mass spectrometer. From the temperature dependence of the unimolecular dissociation rate constants, Arrhenius activation parameters in the zero-pressure limit are obtained. Activation energies range from 1.2 to 1.7 eV, and preexponential factors range from 10(13) to 10(19) s(-1). Dissociation of the duplexes results in cleavage of the noncovalent bonds and/or cleavage of covalent bonds leading to loss of a neutral nucleobase followed by backbone cleavage producing sequence-specific (a - base) and w ions. Four pieces of evidence are presented which indicate that Watson-Crick (WC) base pairing is preserved in complementary DNA duplexes in the gas phase: i. the activation energy for dissociation of the complementary dimer, A(7)*T(7) (3-), to the single strands is significantly higher than that for the related noncomplementary A(7)*A(7) (3-) and T(7)*T(7) (3-) dimers, indicating a stronger interaction between strands with a specific base sequence, ii. extensive loss of neutral adenine occurs for A(7)*A(7) (3-) and A(7)*C(7) (3-) but not for A(7)*T(7) (3-) consistent with this process being shut down by WC hydrogen bonding, iii. a correlation is observed between the measured activation energy for dissociation to single strands and the dimerization enthalpy (-DeltaH(d)) in solution, and iv. molecular dynamics carried out at 300 and 400 K indicate that WC base pairing is preserved for A(7)*T(7) (3-) duplex, although the helical structure is essentially lost. In combination, these results provide strong evidence that WC base pairing can exist in the complete absence of solvent.
Ma, Y; Zuidmeer, L; Bohle, B; Bolhaar, S T H; Gadermaier, G; Gonzalez-Mancebo, E; Fernandez-Rivas, M; Knulst, A C; Himly, M; Asero, R; Ebner, C; van Ree, R; Ferreira, F; Breiteneder, H; Hoffmann-Sommergruber, K
2006-08-01
Profilins are ubiquitous panallergens that have been extensively characterized; yet, their clinical relevance is still unclear. The aim of the present study was to produce recombinant apple profilin (rMal d 4) and to evaluate its allergenic activity and its potency for component-resolved allergy diagnosis. Complementary DNA-derived Mal d 4 was cloned, expressed in Escherichia coli and subsequently purified via poly (l-proline) sepharose. A total of 28 sera from apple-allergic patients were used for IgE-ELISA, immunoblot, RAST and basophil histamine release (BHR) test. In addition, skin prick tests (SPTs) were performed in five patients. Four different complementary DNA coding for apple profilin, Mal d 4, each with an open reading frame of 393 nucleotides, were identified. One isoform Mal d 4.0101 was expressed in Escherichia coli and subsequently purified. Mass spectroscopy revealed the expected mass of 13.826 for rMal d 4.0101, and circular dichroism analysis data were typical for a folded protein and small-angle X-ray scattering measurement identified the protein as a monomer. All the serum samples displayed IgE binding to rMal d 4.0101 in IgE ELISA, immunoblot and RAST. In immunoblotting, IgE binding to natural Mal d 4 was partially/completely inhibited by preincubation with rMal d 4.0101, and RAST values to apple extract were significantly reduced upon serum pretreatment with rMal d 4.0101. SPTs and BHR assays using purified rMal d 4.0101 were positive. Purified rMal d 4.0101 was destroyed within seconds when subjected to pepsin digestion. Apple profilin complementary DNAs were identified. The physicochemical and allergenic properties of purified recombinant Mal d 4.0101 were evaluated showing that the recombinant protein was equal to the natural protein as shown by inhibition assays. Thus, Mal d 4 represents another example suitable for component-resolved diagnosis of food allergy.
Baek, Taek Jin; Park, Pan Yun; Han, Kwi Nam; Kwon, Ho Taik; Seong, Gi Hun
2008-03-01
We describe a DNA microarray system using a bipolar integrated circuit photodiode array (PDA) chip as a new platform for DNA analysis. The PDA chip comprises an 8 x 6 array of photodiodes each with a diameter of 600 microm. Each photodiode element acts both as a support for an immobilizing probe DNA and as a two-dimensional photodetector. The usefulness of the PDA microarray platform is demonstrated by the detection of high-risk subtypes of human papilloma virus (HPV). The polymerase chain reaction (PCR)-amplified biotinylated HPV target DNA was hybridized with the immobilized probe DNA on the photodiode surface, and the chip was incubated in an anti-biotin antibody-conjugated gold nanoparticle solution. The silver enhancement by the gold nanoparticles bound to the biotin of the HPV target DNA precipitates silver metal particles at the chip surfaces, which block light irradiated from above. The resulting drop in output voltage depends on the amount of target DNA present in the sample solution, which allows the specific detection and the quantitative analysis of the complementary target DNA. The PDA chip showed high relative signal ratios of HPV probe DNA hybridized with complementary target DNA, indicating an excellent capability in discriminating HPV subtypes. The detection limit for the HPV target DNA analysis improved from 1.2 nM to 30 pM by changing the silver development time from 5 to 10 min. Moreover, the enhanced silver development promoted by the gold nanoparticles could be applied to a broader range of target DNA concentration by controlling the silver development time.
Formation of rings from segments of HeLa-cell nuclear deoxyribonucleic acid
Hardman, Norman
1974-01-01
Duplex segments of HeLa-cell nuclear DNA were generated by cleavage with DNA restriction endonuclease from Haemophilus influenzae. About 20–25% of the DNA segments produced, when partly degraded with exonuclease III and annealed, were found to form rings visible in the electron microscope. A further 5% of the DNA segments formed structures that were branched in configuration. Similar structures were generated from HeLa-cell DNA, without prior treatment with restriction endonuclease, when the complementary polynucleotide chains were exposed by exonuclease III action at single-chain nicks. After exposure of an average single-chain length of 1400 nucleotides per terminus at nicks in HeLa-cell DNA by exonuclease III, followed by annealing, the physical length of ring closures was estimated and found to be 0.02–0.1μm, or 50–300 base pairs. An almost identical distribution of lengths was recorded for the regions of complementary base sequence responsible for branch formation. It is proposed that most of the rings and branches are formed from classes of reiterated base sequence with an average length of 180 base pairs arranged intermittenly in HeLa-cell DNA. From the rate of formation of branched structures when HeLa-cell DNA segments were heat-denatured and annealed, it is estimated that the reiterated sequences are in families containing approximately 2400–24000 copies. ImagesPLATE 2PLATE 1 PMID:4462738
‘Protected DNA Probes’ capable of strong hybridization without removal of base protecting groups
Ohkubo, Akihiro; Kasuya, Rintaro; Sakamoto, Kazushi; Miyata, Kenichi; Taguchi, Haruhiko; Nagasawa, Hiroshi; Tsukahara, Toshifumi; Watanobe, Takuma; Maki, Yoshiyuki; Seio, Kohji; Sekine, Mitsuo
2008-01-01
We propose a new strategy called the ‘Protected DNA Probes (PDP) method’ in which appropriately protected bases selectively bind to the complementary bases without the removal of their base protecting groups. Previously, we reported that 4-N-acetylcytosine oligonucleotides (ac4C) exhibited a higher hybridization affinity for ssDNA than the unmodified oligonucleotides. For the PDP strategy, we created a modified adenine base and synthesized an N-acylated deoxyadenosine mimic having 6-N-acetyl-8-aza-7-deazaadenine (ac6az8c7A). It was found that PDP containing ac4C and ac6az8c7A exhibited higher affinity for the complementary ssDNA than the corresponding unmodified DNA probes and showed similar base recognition ability. Moreover, it should be noted that this PDP strategy could guarantee highly efficient synthesis of DNA probes on controlled pore glass (CPG) with high purity and thereby could eliminate the time-consuming procedures for isolating DNA probes. This strategy could also avoid undesired base-mediated elimination of DNA probes from CPG under basic conditions such as concentrated ammonia solution prescribed for removal of base protecting groups in the previous standard approach. Here, several successful applications of this strategy to single nucleotide polymorphism detection are also described in detail using PDPs immobilized on glass plates and those prepared on CPG plates, suggesting its potential usefulness. PMID:18272535
A human transcription factor in search mode.
Hauser, Kevin; Essuman, Bernard; He, Yiqing; Coutsias, Evangelos; Garcia-Diaz, Miguel; Simmerling, Carlos
2016-01-08
Transcription factors (TF) can change shape to bind and recognize DNA, shifting the energy landscape from a weak binding, rapid search mode to a higher affinity recognition mode. However, the mechanism(s) driving this conformational change remains unresolved and in most cases high-resolution structures of the non-specific complexes are unavailable. Here, we investigate the conformational switch of the human mitochondrial transcription termination factor MTERF1, which has a modular, superhelical topology complementary to DNA. Our goal was to characterize the details of the non-specific search mode to complement the crystal structure of the specific binding complex, providing a basis for understanding the recognition mechanism. In the specific complex, MTERF1 binds a significantly distorted and unwound DNA structure, exhibiting a protein conformation incompatible with binding to B-form DNA. In contrast, our simulations of apo MTERF1 revealed significant flexibility, sampling structures with superhelical pitch and radius complementary to the major groove of B-DNA. Docking these structures to B-DNA followed by unrestrained MD simulations led to a stable complex in which MTERF1 was observed to undergo spontaneous diffusion on the DNA. Overall, the data support an MTERF1-DNA binding and recognition mechanism driven by intrinsic dynamics of the MTERF1 superhelical topology. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Epitopes of human testis-specific lactate dehydrogenase deduced from a cDNA sequence
DOE Office of Scientific and Technical Information (OSTI.GOV)
Millan, J.L.; Driscoll, C.E.; LeVan, K.M.
The sequence and structure of human testis-specific L-lactate dehydrogenase (LDHC/sub 4/, LDHX; (L)-lactate:NAD/sup +/ oxidoreductase, EC 1.1.1.27) has been derived from analysis of a complementary DNA (cDNA) clone comprising the complete protein coding region of the enzyme. From the deduced amino acid sequence, human LDHC/sub 4/ is as different from rodent LDHC/sub 4/ (73% homology) as it is from human LDHA/sub 4/ (76% homology) and porcine LDHB/sub 4/ (68% homology). Subunit homologies are consistent with the conclusion that the LDHC gene arose by at least two independent duplication events. Furthermore, the lower degree of homology between mouse and human LDHC/submore » 4/ and the appearance of this isozyme late in evolution suggests a higher rate of mutation in the mammalian LDHC genes than in the LDHA and -B genes. Comparison of exposed amino acid residues of discrete anti-genic determinants of mouse and human LDHC/sub 4/ reveals significant differences. Knowledge of the human LDHC/sub 4/ sequence will help design human-specific peptides useful in the development of a contraceptive vaccine.« less
Jaworska, Aleksandra; Jablonska, Anna; Wilanowski, Tomasz; Palys, Barbara; Sek, Slawomir; Kudelski, Andrzej
2018-05-24
Adsorption of molecules of DNA (deoxyribonucleic acid) or modified DNA on gold surfaces is often the first step in construction of many various biosensors, including biosensors for detection of DNA with a particular sequence. In this work we study the influence of amine and thiol modifications at the 3' ends of single stranded DNA (ssDNA) molecules on their adsorption on the surface of gold substrates and on the efficiency of hybridization of immobilized DNA with the complementary single stranded DNA. The characterization of formed layers has been carried out using infrared spectroscopy and atomic force microscopy. As model single stranded DNA we used DNA containing 20 adenine bases, whereas the complementary DNA contained 20 thymine bases. We found that the bands in polarization modulation-infrared reflection-adsorption spectroscopy (PM-IRRAS) spectra of layers formed from thiol-modified DNA are significantly narrower and sharper, indicating their higher regularity in the orientation of DNA on gold surface when using thiol linker. Also, hybridization of the layer of thiol-modified DNA containing 20 adenine bases with the respective DNA containing thymine bases leads to formation of much more organized structures than in the case of unmodified DNA or DNA with the amine linker. We conclude that the thiol-modified ssDNA is more promising for the preparation of biosensors, in comparison with the amine-modified or unmodified ssDNA. We have also found that the above-mentioned modifications at the 3' end of ssDNA significantly influence the IR spectrum (and hence the structure) of polycrystalline films formed from such compounds, even though adsorbed fragments contain less than 5% of the DNA chain. This effect should be taken into account when comparing IR spectra of various polycrystalline films formed from modified and unmodified DNA. Copyright © 2018. Published by Elsevier B.V.
Simulations Using Random-Generated DNA and RNA Sequences
ERIC Educational Resources Information Center
Bryce, C. F. A.
1977-01-01
Using a very simple computer program written in BASIC, a very large number of random-generated DNA or RNA sequences are obtained. Students use these sequences to predict complementary sequences and translational products, evaluate base compositions, determine frequencies of particular triplet codons, and suggest possible secondary structures.…
Although the process of glycolysis is highly conserved in eukaryotes, several glycolytic enzymes have unique structural or functional features in spermatogenic cells. We previously identified and characterized the mouse complementary DNA (cDNA) and a gene for 1 of these enzymes, ...
Comparison of multiple gene assembly methods for metabolic engineering
Chenfeng Lu; Karen Mansoorabadi; Thomas Jeffries
2007-01-01
A universal, rapid DNA assembly method for efficient multigene plasmid construction is important for biological research and for optimizing gene expression in industrial microbes. Three different approaches to achieve this goal were evaluated. These included creating long complementary extensions using a uracil-DNA glycosylase technique, overlap extension polymerase...
Zn2+ blocks annealing of complementary single-stranded DNA in a sequence-selective manner
USDA-ARS?s Scientific Manuscript database
A simple low-temperature EDTA-free agarose gel electrophoresis procedure (LTEAGE) coupled with UV-Vis spectrum and fluorescence quenching analyses was developed and the Zn2+-single-stranded (ss) DNA interaction was investigated under near-physiological conditions. It was found that Zn2+ blocked the...
Kits for Characterization of Chromosomal Inversions Using Probes
NASA Technical Reports Server (NTRS)
Ray, F. Andrew (Inventor)
2017-01-01
A kit for the characterization of chromosomal inversions using single-stranded probes that are either all identical or all complementary to a single-stranded chromatid is described. Reporter species are attached to oligonucleotide strands designed such that they may hybridize to portions of only one of a pair of single-stranded sister chromatids which may be prepared by the CO-FISH procedure. If an inversion has occurred, these marker probes will be detected on the second sister chromatid at the same location as the inversion on the first chromatid. The kit includes non-repetitive probes that are either all identical or all complementary to at least a portion of a target DNA sequence of only one DNA strand of only one chromatid and may in some embodiments include reagents suitable for performing CO-FISH and/or reagents for hybridizing the probes to the target DNA sequence.
Rosa, A M M; Prazeres, D M F; Paulo, P M R
2017-06-28
Fluorescence correlation spectroscopy (FCS) was used to characterize the molecular interactions between the four components of a DNA recognition system. A fluorescent DNA probe was used to assess: (i) the hybridization with a complementary biotin-labeled target, (ii) the complexation of the resulting hybrid and an anti-biotin antibody, and (iii) the binding of the latter complex to a ZZ-CBM fusion protein that combines small synthetic IgG Fc-binding Z domains with a carbohydrate binding module (CBM). These binding interactions were monitored by exposing the fluorescent DNA probe to different amounts and combinations of the other molecules in solution. Through the analysis of FCS autocorrelation curves, an association constant (K a ) of 2.9 × 10 7 M -1 was estimated for DNA·DNA hybridization, and the presence of (non-) complementary target DNA in solution could be discriminated. The specific capture of biotinylated DNA hybrids by anti-biotin IgG was verified, with an apparent K a of 2.5 × 10 6 M -1 . The increment in the diffusion time measured when the DNA·DNA:antibody complexes were in contact with the ZZ-CBM fusion protein suggested that the binding occurs at a stoichiometric ratio of DNA/antibody complex to fusion larger than 1 : 1. The FCS-derived information obtained is useful to gain insight into molecular interactions involved in diagnostic assays.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yeo, Hyun Koo; Lee, Jae Young
2012-04-18
The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.
Yeo, Hyun Koo; Lee, Jae Young
2010-05-01
The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .
Map-based cloning of a gene controlling Omega-3 fatty acid desaturation in Arabidopsis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Arondel, V.; Lemieux, B.; Hwang, I.
1992-11-20
A gene from the flowering plant Arabidopsis thaliana that encodes an omega-3 desaturase was cloned on the basis of the genetic map position of a mutation affecting membrane and storage lipid fatty acid composition. Yeast artificial chromosomes covering the genetic locus were identified and used to probe a seed complementary DNA library. A complementary DNA clone for the desaturase was identified and introduced into roots of both wild-type and mutant plants by Ti plasmid-mediated transformation. Transgenic tissues of both mutant and wild-type plants had significantly increased amounts of the fatty acid produced by this desaturase. 24 refs., 2 figs., 1more » tabs.« less
Wang, Shuo; Aston, Karl; Koeller, Kevin J.; Harris, G. Davis; Rath, Nigam P.
2014-01-01
Hairpin polyamides (PAs) are an important class of sequence-specific DNA minor groove binders, and frequently employ a flexible motif, β-alanine (β), to reduce the molecular rigidity to maintain the DNA recognition register. To better understand the diverse effects β can have on DNA-PA binding affinity, selectivity, and especially kinetics, which have rarely been reported, we have initiated a detailed study for an eight-heterocyclic hairpin PA and its β derivatives with their cognate and mutant sequences. With these derivatives, all internal pyrroles of the parent PA are systematically substituted with single or double βs. A set of complementary experiments have been conducted to evaluate the molecular interactions in detail: UV-melting, biosensor-surface plasmon resonance, circular dichroism and isothermal titration calorimetry. The β substitutions generally weaken the binding affinities of these PAs with cognate DNA, and have large and diverse influences on PA binding kinetics in a position- and number-dependent manner. The DNA base mutations have also shown positional effects on binding of a single PA. Besides the β substitutions, the monocationic Dp group [3-(dimethylamino) propylamine] in parent PA has been modified into a dicationic Ta group (3, 3'-Diamino-N-methyldipropylamine) to minimize the frequently observed PA aggregation with ITC experiments. The results clearly show that the Ta modification not only maintains the DNA binding mode and affinity of PA, but also significantly reduces PA aggregation and allows the complete thermodynamic signature of eight-ring hairpin PA to be determined for the first time. This combined set of results significantly extends our understanding of the energetic basis of specific DNA recognition by PAs. PMID:25141096
2015-01-01
Targeting of noncanonical DNA structures, such as hairpin loops, may have significant diagnostic and therapeutic potential. Oligonucleotides can be used for binding to mRNA, forming a DNA/RNA hybrid duplex that inhibits translation. This kind of modulation of gene expression is called the antisense approach. In order to determine the best strategy to target a common structural motif in mRNA, we have designed a set of stem-loop DNA molecules with sequence: d(GCGCTnGTAAT5GTTACTnGCGC), where n = 1, 3, or 5, “T5” is an end loop of five thymines. We used a combination of calorimetric and spectroscopy techniques to determine the thermodynamics for the reaction of a set of hairpins containing internal loops with their respective partially complementary strands. Our aim was to determine if internal- and end-loops are promising regions for targeting with their corresponding complementary strands. Indeed, all targeting reactions were accompanied by negative changes in free energy, indicating that reactions proceed spontaneously. Further investigation showed that these negative free energy terms result from a net balance of unfavorable entropy and favorable enthalpy contributions. In particular, unfolding of hairpins and duplexes is accompanied by positive changes in heat capacity, which may be a result of exposure of hydrophobic groups to the solvent. This study provides a new method for the targeting of mRNA in order to control gene expression. PMID:25486129
Single Molecule Nano-Metronome
Buranachai, Chittanon; McKinney, Sean A.; Ha, Taekjip
2008-01-01
We constructed a DNA-based nano-mechanical device called the nano-metronome. Our device is made by introducing complementary single stranded overhangs at the two arms of the DNA four-way junction. The ticking rates of this stochastic metronome depend on ion concentrations and can be changed by a set of DNA-based switches to deactivate/reactivate the sticky end. Since the device displays clearly distinguishable responses even with a single basepair difference, it may lead to a single molecule sensor of minute sequence differences of a target DNA. PMID:16522050
Front-End Processing of Cell Lysates for Enhanced Chip-Based Detection
2006-07-28
manipulation used in lab-on-a-chip devices. A small unknown sample is first mixed with the PNA surfactants (“PNAA”) to tag the DNA targets, and then the...unknown sample is first mixed with the PNA surfactants (hereafter referred to as “PNA amphiphiles” or “PNAA”) to tag the DNA targets, and then the...prolate ellipsoid, and mixed PNAA/SDS micelles form spherical micelles. On addition of complementary DNA, the PNAA/DNA duplexes do not participate in
Soares, Marcelo B.; Efstratiadis, Argiris
1997-01-01
This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library.
Soares, M.B.; Efstratiadis, A.
1997-06-10
This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3{prime} noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. 4 figs.
Chang, Shy-Shin; Hsu, Hsung-Ling; Cheng, Ju-Chien; Tseng, Ching-Ping
2011-01-01
Background Bacterial DNA contamination in PCR reagents has been a long standing problem that hampers the adoption of broad-range PCR in clinical and applied microbiology, particularly in detection of low abundance bacteria. Although several DNA decontamination protocols have been reported, they all suffer from compromised PCR efficiency or detection limits. To date, no satisfactory solution has been found. Methodology/Principal Findings We herein describe a method that solves this long standing problem by employing a broad-range primer extension-PCR (PE-PCR) strategy that obviates the need for DNA decontamination. In this method, we first devise a fusion probe having a 3′-end complementary to the template bacterial sequence and a 5′-end non-bacterial tag sequence. We then hybridize the probes to template DNA, carry out primer extension and remove the excess probes using an optimized enzyme mix of Klenow DNA polymerase and exonuclease I. This strategy allows the templates to be distinguished from the PCR reagent contaminants and selectively amplified by PCR. To prove the concept, we spiked the PCR reagents with Staphylococcus aureus genomic DNA and applied PE-PCR to amplify template bacterial DNA. The spiking DNA neither interfered with template DNA amplification nor caused false positive of the reaction. Broad-range PE-PCR amplification of the 16S rRNA gene was also validated and minute quantities of template DNA (10–100 fg) were detectable without false positives. When adapting to real-time and high-resolution melting (HRM) analytical platforms, the unique melting profiles for the PE-PCR product can be used as the molecular fingerprints to further identify individual bacterial species. Conclusions/Significance Broad-range PE-PCR is simple, efficient, and completely obviates the need to decontaminate PCR reagents. When coupling with real-time and HRM analyses, it offers a new avenue for bacterial species identification with a limited source of bacterial DNA, making it suitable for use in clinical and applied microbiology laboratories. PMID:21637859
Bialonska, Dobroslawa; Song, Kenneth; Bolton, Philip H.
2011-01-01
Tumor cell lines can replicate faster than normal cells and many also have defective DNA repair pathways. This has lead to the investigation of the inhibition of DNA repair proteins as a means of therapeutic intervention. An alternative approach is to hide or mask damaged DNA from the repair systems. We have developed a protocol to investigate the structures of the complexes of damaged DNA with drug like molecules. Nucleotide resolution structural information can be obtained using an improved hydroxyl radical cleavage protocol. The use of a dTn tail increases the length of the smallest fragments of interest and allows efficient co-precipitation of the fragments with poly(A). The use of a fluorescent label, on the 5′ end of the dTn tail, in conjunction with modified cleavage reaction conditions, avoids the lifetime and other problems with 32P labeling. The structures of duplex DNAs containing AC and CC mismatches in the presence and absence of minor groove binders have been investigated as have those of the fully complementary DNA. The results indicate that the structural perturbations of the mismatches are localized, are sequence dependent and that the presence of a mismatch can alter the binding of drug like molecules. PMID:21893212
Jayakumar, K; Rajesh, R; Dharuman, V; Venkatasan, R; Hahn, J H; Pandian, S Karutha
2012-01-15
A novel first generation (G1) poly(amidoamine) dendrimer (PAMAM) with graphene core (GG1PAMAM) was synthesized for the first time. Single layer of GG1PAMAM was immobilized covalently on mercaptopropionic acid (MPA) monolayer on Au transducer. This allows cost effective and easy deposition of single layer graphene on the Au transducer surface than the advanced vacuum techniques used in the literature. Au nano particles (17.5 nm) then decorated the GG1PAMAM and used for electrochemical DNA hybridization sensing. The sensor discriminates selectively and sensitively the complementary double stranded DNA (dsDNA, hybridized), non-complementary DNA (ssDNA, un-hybridized) and single nucleotide polymorphism (SNP) surfaces. Interactions of the MPA, GG1PAMAM and the Au nano particles were characterized by Ultra Violet (UV), Fourier Transform Infrared (FTIR), Raman spectroscopy (RS), Thermo gravimetric analysis (TGA), Scanning Electron Microscopy (SEM), Atomic Force Microscopy (AFM), Cyclic Voltmetric (CV), Impedance spectroscopy (IS) and Differntial Pulse Voltammetry (DPV) techniques. The sensor showed linear range 1×10(-6) to 1×10(-12) M with lowest detection limit 1 pM which is 1000 times lower than G1PAMAM without graphene core. Copyright © 2011 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Zhao, Weian; Brook, Michael A.; Li, Yingfu
Periodical assembly of nanospecies is desirable for the construction of nanodevices. We provide a protocol for the preparation of a gold nanoparticle (AuNP)/DNA scaffold on which nanospecies can be assembled in a periodical manner. AuNP/DNA scaffold is prepared by growing long single-stranded DNA (ssDNA) molecules (typically hundreds of nanometers to a few microns in length) on AuNPs via rolling circle amplification (RCA). Since these long ssDNA molecules contain many repetitive sequence units, complementary DNA-attached nanospecies can be assembled through specific hybridization in a controllable and periodical manner.
DNA Nanotechnology for Cancer Therapy
Kumar, Vinit; Palazzolo, Stefano; Bayda, Samer; Corona, Giuseppe; Toffoli, Giuseppe; Rizzolio, Flavio
2016-01-01
DNA nanotechnology is an emerging and exciting field, and represents a forefront frontier for the biomedical field. The specificity of the interactions between complementary base pairs makes DNA an incredible building material for programmable and very versatile two- and three-dimensional nanostructures called DNA origami. Here, we analyze the DNA origami and DNA-based nanostructures as a drug delivery system. Besides their physical-chemical nature, we dissect the critical factors such as stability, loading capability, release and immunocompatibility, which mainly limit in vivo applications. Special attention was dedicated to highlighting the boundaries to be overcome to bring DNA nanostructures closer to the bedside of patients. PMID:27022418
Shamsipur, Mojtaba; Nasirian, Vahid; Barati, Ali; Mansouri, Kamran; Vaisi-Raygani, Asad; Kashanian, Soheila
2017-05-08
In the present study, we developed a sensitive method based on fluorescence resonance energy transfer (FRET) for the determination of the BCR/ABL fusion gene, which is used as a biomarker to confirm the clinical diagnosis of both chronic myelogenous leukemia (CML) and acute lymphocytic leukemia (ALL). For this purpose, CdTe quantum dots (QDs) were conjugated to amino-modified 18-mer oligonucleotide ((N)DNA) to form the QDs-(N)DNA nanosensor. In the presence of methylene blue (MB) as an intercalator, the hybridization of QDs-(N)DNA with the target BCR/ABL fusion gene (complementary DNA), brings the MB (acceptor) at close proximity of the QDs (donor), leading to FRET upon photoexcitation of the QDs. The enhancement in the emission intensity of MB was used to follow up the hybridization, which was linearly proportional to concentration of the target complementary DNA in a range from 1.0 × 10 -9 to 1.25 × 10 -7 M. The detection limit of the proposed method was obtained to be 1.5 × 10 -10 M. Finally, the feasibility and selectivity of the proposed nanosensor was evaluated by the analysis of derived nucleotides from both mismatched sequences and clinical samples of patients with leukemia as real samples. Copyright © 2017 Elsevier B.V. All rights reserved.
CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion.
Santillán, Orlando; Ramírez-Romero, Miguel A; Dávila, Guillermo
2017-06-25
Here, we present chimera assembly by plasmid recovery and restriction enzyme site insertion (CAPRRESI). CAPRRESI benefits from many strengths of the original plasmid recovery method and introduces restriction enzyme digestion to ease DNA ligation reactions (required for chimera assembly). For this protocol, users clone wildtype genes into the same plasmid (pUC18 or pUC19). After the in silico selection of amino acid sequence regions where chimeras should be assembled, users obtain all the synonym DNA sequences that encode them. Ad hoc Perl scripts enable users to determine all synonym DNA sequences. After this step, another Perl script searches for restriction enzyme sites on all synonym DNA sequences. This in silico analysis is also performed using the ampicillin resistance gene (ampR) found on pUC18/19 plasmids. Users design oligonucleotides inside synonym regions to disrupt wildtype and ampR genes by PCR. After obtaining and purifying complementary DNA fragments, restriction enzyme digestion is accomplished. Chimera assembly is achieved by ligating appropriate complementary DNA fragments. pUC18/19 vectors are selected for CAPRRESI because they offer technical advantages, such as small size (2,686 base pairs), high copy number, advantageous sequencing reaction features, and commercial availability. The usage of restriction enzymes for chimera assembly eliminates the need for DNA polymerases yielding blunt-ended products. CAPRRESI is a fast and low-cost method for fusing protein-coding genes.
Proteome-Scale Human Interactomics.
Luck, Katja; Sheynkman, Gloria M; Zhang, Ivy; Vidal, Marc
2017-05-01
Cellular functions are mediated by complex interactome networks of physical, biochemical, and functional interactions between DNA sequences, RNA molecules, proteins, lipids, and small metabolites. A thorough understanding of cellular organization requires accurate and relatively complete models of interactome networks at proteome scale. The recent publication of four human protein-protein interaction (PPI) maps represents a technological breakthrough and an unprecedented resource for the scientific community, heralding a new era of proteome-scale human interactomics. Our knowledge gained from these and complementary studies provides fresh insights into the opportunities and challenges when analyzing systematically generated interactome data, defines a clear roadmap towards the generation of a first reference interactome, and reveals new perspectives on the organization of cellular life. Copyright © 2017 Elsevier Ltd. All rights reserved.
Measurement of the microscopic viscosities of microfluids with a dynamic optical tweezers system
NASA Astrophysics Data System (ADS)
Zhang, Yuquan; Wu, Xiaojing; Wang, Yijia; Zhu, Siwei; Gao, Bruce Z.; Yuan, X.-C.
2014-06-01
Viscosity coefficients of microfluids—Newtonian and non-Newtonian—were explored through the rotational motion of a particle trapped by optical tweezers in a microflute. Unlike conventional methods based on viscometers, our microfluidic system employs samples of less than 30 μl to complete a measurement. Viscosity coefficients of ethanol and fetal bovine serum, as typical examples of Newtonian and non-Newtonian fluids, were obtained experimentally, and found to be in excellent agreement with theoretical predictions. Additionally, a practical application to a DNA solution with incremental ethidium bromide content was employed and the results are consistent with clinical data, indicating that our system provides a potentially important complementary tool for use in such biological and medical applications.
Shi, Xue; Zeng, Haiyang; Xue, Yadong; Luo, Meizhong
2011-10-11
Large-insert BAC and BIBAC libraries are important tools for structural and functional genomics studies of eukaryotic genomes. To facilitate the construction of BAC and BIBAC libraries and the transfer of complete large BAC inserts into BIBAC vectors, which is desired in positional cloning, we developed a pair of new BAC and BIBAC vectors. The new BAC vector pIndigoBAC536-S and the new BIBAC vector BIBAC-S have the following features: 1) both contain two 18-bp non-palindromic I-SceI sites in an inverted orientation at positions that flank an identical DNA fragment containing the lacZ selection marker and the cloning site. Large DNA inserts can be excised from the vectors as single fragments by cutting with I-SceI, allowing the inserts to be easily sized. More importantly, because the two vectors contain different antibiotic resistance genes for transformant selection and produce the same non-complementary 3' protruding ATAA ends by I-SceI that suppress self- and inter-ligations, the exchange of intact large genomic DNA inserts between the BAC and BIBAC vectors is straightforward; 2) both were constructed as high-copy composite vectors. Reliable linearized and dephosphorylated original low-copy pIndigoBAC536-S and BIBAC-S vectors that are ready for library construction can be prepared from the high-copy composite vectors pHZAUBAC1 and pHZAUBIBAC1, respectively, without the need for additional preparation steps or special reagents, thus simplifying the construction of BAC and BIBAC libraries. BIBAC clones constructed with the new BIBAC-S vector are stable in both E. coli and Agrobacterium. The vectors can be accessed through our website http://GResource.hzau.edu.cn. The two new vectors and their respective high-copy composite vectors can largely facilitate the construction and characterization of BAC and BIBAC libraries. The transfer of complete large genomic DNA inserts from one vector to the other is made straightforward.
Sun, Xiaofan; Chen, Haohan; Wang, Shuling; Zhang, Yiping; Tian, Yaping; Zhou, Nandi
2018-08-27
A high-sensitive detection of sequence-specific DNA was established based on the formation of G-quadruplex-hemin complex through continuous hybridization chain reaction (HCR). Taking HIV DNA sequence as an example, a capture probe complementary to part of HIV DNA was firstly self-assembled onto the surface of Au electrode. Then a specially designed assistant probe with both terminals complementary to the target DNA and a G-quadruplex-forming sequence in the center was introduced into the detection solution. In the presence of both the target DNA and the assistant probe, the target DNA can be captured on the electrode surface and then a continuous HCR can be conducted due to the mutual recognition of the target DNA and the assistant probe, leading to the formation of a large number of G-quadruplex on the electrode surface. With the help of hemin, a pronounced electrochemical signal can be observed in differential pulse voltammetry (DPV), due to the formation of G-quadruplex-hemin complex. The peak current is linearly related with the logarithm of the concentration of the target DNA in the range from 10 fM to 10 pM. The electrochemical sensor has high selectivity to clearly discriminate single-base mismatched and three-base mismatched sequences from the original HIV DNA sequence. Moreover, the established DNA sensor was challenged by detection of HIV DNA in human serum samples, which showed the low detection limit of 6.3 fM. Thus it has great application prospect in the field of clinical diagnosis and environmental monitoring. Copyright © 2018 Elsevier B.V. All rights reserved.
Yu, Shunwu; Luo, Lijun
2008-12-01
Pyridoxal kinase is key enzyme for the biosynthesis of pyridoxal 5'-phosphate, the biologically active form of vitamin B6, in the salvage pathway. A pyridoxal kinase gene, BnPKL (GenBank accession No. DQ463962), was isolated from oilseed rape (Brassica napus L.) following water stress through rapid amplification of complementary DNA (cDNA) ends. The results showed that the gene had two splice variants: PKL and PKL2. PKL, the long cDNA, encodes a 334 amino acid protein with a complete ATP-binding site, pyridoxal kinase-binding site and dimer interface site of a pyridoxal kinase, while PKL2, the short cDNA, lacked a partial domain. Southern blot showed that there were two copies in Brassica napus. The expression of BnPKL cDNA could rescue the mutant phenotype of Escherichia coli defective in pyridoxal kinase. Real-time reverse transcription-polymerase chain reaction revealed that the relative abundance of two transcripts are modulated by development and environmental stresses. Abscisic acid and NaCl were inclined to decrease PKL expression, but H2O2 and cold temperatures induced the PKL expression. In addition, the PKL expression could be transiently induced by jasmonate acid at an early stage, abscisic acid, salicylic acid and jasmonate acid enhanced the PKL expression in roots. Our results demonstrated that BnPKL was a pyridoxal kinase involved in responses to biotic and abiotic stresses.
Grossberg, Stephen
2014-01-01
Neural models of perception clarify how visual illusions arise from adaptive neural processes. Illusions also provide important insights into how adaptive neural processes work. This article focuses on two illusions that illustrate a fundamental property of global brain organization; namely, that advanced brains are organized into parallel cortical processing streams with computationally complementary properties. That is, in order to process certain combinations of properties, each cortical stream cannot process complementary properties. Interactions between these streams, across multiple processing stages, overcome their complementary deficiencies to compute effective representations of the world, and to thereby achieve the property of complementary consistency. The two illusions concern how illusory depth can vary with brightness, and how apparent motion of illusory contours can occur. Illusory depth from brightness arises from the complementary properties of boundary and surface processes, notably boundary completion and surface-filling in, within the parvocellular form processing cortical stream. This illusion depends upon how surface contour signals from the V2 thin stripes to the V2 interstripes ensure complementary consistency of a unified boundary/surface percept. Apparent motion of illusory contours arises from the complementary properties of form and motion processes across the parvocellular and magnocellular cortical processing streams. This illusion depends upon how illusory contours help to complete boundary representations for object recognition, how apparent motion signals can help to form continuous trajectories for target tracking and prediction, and how formotion interactions from V2-to-MT enable completed object representations to be continuously tracked even when they move behind intermittently occluding objects through time. PMID:25389399
Controllable g5p-Protein-Directed Aggregation of ssDNA-Gold Nanoparticles
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, S.; Maye, M; Zhang, Y
We assembled single-stranded DNA (ssDNA) conjugated nanoparticles using the phage M13 gene 5 protein (g5p) as the molecular glue to bind two antiparallel noncomplementary ssDNA strands. The entire process was controlled tightly by the concentration of the g5p protein and the presence of double-stranded DNA. The g5p-ssDNA aggregate was disintegrated by hybridization with complementary ssDNA (C-ssDNA) that triggers the dissociation of the complex. Polyhistidine-tagged g5p was bound to nickel nitrilotriacetic acid (Ni2+-NTA) conjugated nanoparticles and subsequently used to coassemble the ssDNA-conjugated nanoparticles into multiparticle-type aggregates. Our approach offers great promise for designing biologically functional, controllable protein/nanoparticle composites.
DNA attachment to support structures
Balhorn, Rodney L.; Barry, Christopher H.
2002-01-01
Microscopic beads or other structures are attached to nucleic acids (DNA) using a terminal transferase. The transferase adds labeled dideoxy nucleotide bases to the ends of linear strands of DNA. The labels, such as the antigens digoxigenin and biotin, bind to the antibody compounds or other appropriate complementary ligands, which are bound to the microscopic beads or other support structures. The method does not require the synthesis of a synthetic oligonucleotide probe. The method can be used to tag or label DNA even when the DNA has an unknown sequence, has blunt ends, or is a very large fragment (e.g., >500 kilobase pairs).
Molecular structure of r/GCG/d/TATACGC/ - A DNA-RNA hybrid helix joined to double helical DNA
NASA Technical Reports Server (NTRS)
Wang, A. H.-J.; Fujii, S.; Rich, A.; Van Boom, J. H.; Van Der Marel, G. A.; Van Boeckel, S. A. A.
1982-01-01
The molecule r(GCG)d(TATACGC) is self-complementary and forms two DNA-RNA hybrid segments surrounding a central region of double helical DNA; its molecular structure has been solved by X-ray analysis. All three parts of the molecule adopt a conformation which is close to that seen in the 11-fold RNA double helix. The conformation of the ribonucleotides is partly determined by water molecules bridging between the ribose O2' hydroxyl group and cytosine O2. The hybrid-DNA duplex junction contains no structural discontinuities. However, the central DNA TATA sequence has some structural irregularities.
Contamine, V; Picard, M
2000-06-01
Instability of the mitochondrial genome (mtDNA) is a general problem from yeasts to humans. However, its genetic control is not well documented except in the yeast Saccharomyces cerevisiae. From the discovery, 50 years ago, of the petite mutants by Ephrussi and his coworkers, it has been shown that more than 100 nuclear genes directly or indirectly influence the fate of the rho(+) mtDNA. It is not surprising that mutations in genes involved in mtDNA metabolism (replication, repair, and recombination) can cause a complete loss of mtDNA (rho(0) petites) and/or lead to truncated forms (rho(-)) of this genome. However, most loss-of-function mutations which increase yeast mtDNA instability act indirectly: they lie in genes controlling functions as diverse as mitochondrial translation, ATP synthase, iron homeostasis, fatty acid metabolism, mitochondrial morphology, and so on. In a few cases it has been shown that gene overexpression increases the levels of petite mutants. Mutations in other genes are lethal in the absence of a functional mtDNA and thus convert this petite-positive yeast into a petite-negative form: petite cells cannot be recovered in these genetic contexts. Most of the data are explained if one assumes that the maintenance of the rho(+) genome depends on a centromere-like structure dispensable for the maintenance of rho(-) mtDNA and/or the function of mitochondrially encoded ATP synthase subunits, especially ATP6. In fact, the real challenge for the next 50 years will be to assemble the pieces of this puzzle by using yeast and to use complementary models, especially in strict aerobes.
Direct Nanoscale Conversion of Biomolecular Signals into Electronic Information
2008-09-22
the electrode surface. In this experiment, the single free cysteine group featured in the GOx structure was exploited to demonstrate that orientation...first with GOx-ssDNA conjugates featuring a sequence complementary to the address strand, then with a non-complementary conjugate and finally with...fully-functional for an enzyme that features a free thiol group, or that can be engineered to incorporate a thiol onto its outer shell
Electrochemical product detection of an asymmetric convective polymerase chain reaction.
Duwensee, Heiko; Mix, Maren; Stubbe, Marco; Gimsa, Jan; Adler, Marcel; Flechsig, Gerd-Uwe
2009-10-15
For the first time, we describe the application of heated microwires for an asymmetric convective polymerase chain reaction (PCR) in a modified PCR tube in a small volume. The partly single-stranded product was labeled with the electrochemically active compound osmium tetroxide bipyridine using a partially complementary protective strand with five mismatches compared to the single-stranded product. The labeled product could be successfully detected at a gold electrode modified with a complementary single-stranded capture probe immobilized via a thiol-linker. Our simple thermo-convective PCR yielded electrochemically detectable products after only 5-10 min. A significant discrimination between complementary and non-complementary target was possible using different immobilized capture probes. The total product yield was approx. half the amount of the classical thermocycler PCR. Numerical simulations describing the thermally driven convective PCR explain the received data. Discrimination between complementary capture probes and non-complementary capture probes was performed using square-wave voltammetry. The coupling of asymmetric thermo-convective PCR with electrochemical detection is very promising for future compact DNA sensor devices.
Method for construction of normalized cDNA libraries
Soares, Marcelo B.; Efstratiadis, Argiris
1996-01-01
This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library.
Method for construction of normalized cDNA libraries
Soares, M.B.; Efstratiadis, A.
1996-01-09
This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form. The method comprises: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3` noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. 4 figs.
Ultrahigh-resolution crystal structures of Z-DNA in complex with Mn(2+) and Zn(2+) ions.
Drozdzal, Pawel; Gilski, Miroslaw; Kierzek, Ryszard; Lomozik, Lechoslaw; Jaskolski, Mariusz
2013-06-01
X-ray crystal structures of the spermine(4+) form of the Z-DNA duplex with the self-complementary d(CG)3 sequence in complexes with Mn(2+) and Zn(2+) cations have been determined at the ultrahigh resolutions of 0.75 and 0.85 Å, respectively. Stereochemical restraints were only used for the sperminium cation (in both structures) and for nucleotides with dual conformation in the Zn(2+) complex. The Mn(2+) and Zn(2+) cations at the major site, designated M(2+)(1), bind at the N7 position of G6 by direct coordination. The coordination geometry of this site was octahedral, with complete hydration shells. An additional Zn(2+)(2) cation was bis-coordinated in a tetrahedral fashion by the N7 atoms of G10 and G12 from a symmetry-related molecule. The coordination distances of Zn(2+)(1) and Zn(2+)(2) to the O6 atom of the guanine residues were 3.613 (6) and 3.258 (5) Å, respectively. Moreover, a chloride ion was also identified in the coordination sphere of Zn(2+)(2). Alternate conformations were observed in the Z-DNA-Zn(2+) structure not only at internucleotide linkages but also at the terminal C3'-OH group of G12. The conformation of the sperminium chain in the Z-DNA-Mn(2+) complex is similar to the spermine(4+) conformation in analogous Z-DNA-Mg(2+) structures. In the Z-DNA-Zn(2+) complex the sperminium cation is disordered and partially invisible in electron-density maps. In the Z-DNA-Zn(2+) complex the sperminium cation only interacts with the phosphate groups of the Z-DNA molecules, while in the Z-DNA-Mn(2+) structure it forms hydrogen bonds to both the phosphate groups and DNA bases.
USDA-ARS?s Scientific Manuscript database
A model paramagnetic nanoparticle (MNP) assay is demonstrated for surface-enhanced Raman scattering (SERS) detection of DNA oligonucleotides derived from the West Nile virus (WNV) genome. Detection is based on the capture of WNV target sequences by hybridization with complementary oligonucleotide pr...
Getting it Right: How DNA Polymerases Select the Right Nucleotide.
Ludmann, Samra; Marx, Andreas
2016-01-01
All living organisms are defined by their genetic code encrypted in their DNA. DNA polymerases are the enzymes that are responsible for all DNA syntheses occurring in nature. For DNA replication, repair and recombination these enzymes have to read the parental DNA and recognize the complementary nucleotide out of a pool of four structurally similar deoxynucleotide triphosphates (dNTPs) for a given template. The selection of the nucleotide is in accordance with the Watson-Crick rule. In this process the accuracy of DNA synthesis is crucial for the maintenance of the genome stability. However, to spur evolution a certain degree of freedom must be allowed. This brief review highlights the mechanistic basis for selecting the right nucleotide by DNA polymerases.
Tuning the Mechanical Properties of a DNA Hydrogel in Three Phases Based on ATP Aptamer.
Liu, Hengyuan; Cao, Tianyang; Xu, Yun; Dong, Yuanchen; Liu, Dongsheng
2018-05-31
By integrating ATP aptamer into the linker DNA, a novel DNA hydrogel was designed, with mechanical properties that could be tuned into three phases. Based on the unique interaction between ATP and its aptamer, the mechanical strength of the hydrogel increased from 204 Pa to 380 Pa after adding ATP. Furthermore, with the addition of the complementary sequence to the ATP aptamer, the mechanical strength could be increased to 570 Pa.
Rapid and label-free electrochemical DNA biosensor for detecting hepatitis A virus.
Manzano, Marisa; Viezzi, Sara; Mazerat, Sandra; Marks, Robert S; Vidic, Jasmina
2018-02-15
Diagnostic systems that can deliver highly specific and sensitive detection of hepatitis A virus (HAV) in food and water are of particular interest in many fields including food safety, biosecurity and control of outbreaks. Our aim was the development of an electrochemical method based on DNA hybridization to detect HAV. A ssDNA probe specific for HAV (capture probe) was designed and tested on DNAs from various viral and bacterial samples using Nested-Reverse Transcription Polymerase Chain Reaction (nRT-PCR). To develop the electrochemical device, a disposable gold electrode was functionalized with the specific capture probe and tested on complementary ssDNA and on HAV cDNA. The DNA hybridization on the electrode was measured through the monitoring of the oxidative peak potential of the indicator tripropylamine by cyclic voltammetry. To prevent non-specific binding the gold surface was treated with 3% BSA before detection. High resolution atomic force microscopy (AFM) confirmed the efficiency of electrode functionalization and on-electrode hybridization. The proposed device showed a limit of detection of 0.65pM for the complementary ssDNA and 6.94fg/µL for viral cDNA. For a comparison, nRT-PCR quantified the target HAV cDNA with a limit of detection of 6.4fg/µL. The DNA-sensor developed can be adapted to a portable format to be adopted as an easy-to- use and low cost method for screening HAV in contaminated food and water. In addition, it can be useful for rapid control of HAV infections as it takes only a few minutes to provide the results. Copyright © 2017. Published by Elsevier B.V.
Liquid biopsy in non-small cell lung cancer: a key role in the future of personalized medicine?
Pi, Can; Zhang, Ming-Feng; Peng, Xiao-Xiao; Zhang, Yi-Chen; Xu, Chong-Rui; Zhou, Qing
2017-12-01
Liquid biopsies, especially the analysis of circulating tumor DNA (ctDNA), as a novel and non-invasive method for the diagnosis and monitoring of non-small cell lung cancer (NSCLC) have already been implemented in clinical settings. The majority of ctDNA is released from apoptotic or necrotic tumor cells, thus reflecting the genetic profile of a tumor. Numerous studies have reported a high concordance in mutation profiles derived from liquid biopsy and tissue biopsy, especially in driver genes. Liquid biopsy could overcome the clonal heterogeneity of tumour biopsy, as it provides a single snapshot of a tumour tissue. Moreover, non-invasiveness is the biggest advantage for liquid biopsy, and the procedure can be repeatedly performed during the treatment for the purpose of monitoring. Therefore, ctDNA could act as a potential complementary method for tissue biopsies in diagnosis, prognostic, treatment response and resistance. Areas covered: This review summarizes the recent advancements in liquid biopsy with a focus on NSCLC, including its applications and technologies associated with assessing ctDNA. The authors conclude the review by discussing the challenges associated with liquid biopsy. Expert commentary: The analysis of ctDNA represents a promising method for liquid biopsy, which will be a novel and potentially complementary method in diagnosis, treatment and prognostic in NSCLC at all stages.
Zagon, Ian S; Sassani, Joseph W; Malefyt, Kristin J; McLaughlin, Patricia J
2006-11-01
To determine whether molecular manipulation of the opioid growth factor receptor (OGFr) alters corneal reepithelialization following central corneal abrasion in rats. The plasmid pcDNA3.1 + OGFr, carrying the rat OGFr complementary DNA in both the sense and antisense orientations, and empty vector (EV), were delivered by gene gun to the rat cornea. After 24 hours, corneas were abraded and reepithelialization was documented by fluorescein photography. Twenty-four hours after wounding, DNA synthesis (with bromodeoxyuridine) was examined. Eyes transfected with sense constructs of OGFr had corneal defects that were 24%, 52%, and 50% larger than the EV group at 16, 24, and 28 hours, respectively. Conversely, corneas transfected with antisense constructs of OGFr had corneal defects that were 56% and 48% smaller than the EV group at 16 and 24 hours, respectively. Bromodeoxyuridine labeling in the basal and suprabasal layers of the antisense group were increased 3.3- and 3.7-fold, respectively, in DNA synthesis from corresponding EV layers; DNA synthesis was comparable in the sense and EV groups. Excess OGFr delays reepithelialization, whereas attenuation of OGFr accelerates repair of the corneal surface. Clinical Relevance Inhibition of opioid growth factor action using gene therapy could be important in the treatment of corneal diseases such as nonhealing and recurrent erosions, diabetic keratopathy, and neurotrophic keratitis.
Bialonska, Dobroslawa; Song, Kenneth; Bolton, Philip H
2011-11-27
Tumor cell lines can replicate faster than normal cells and many also have defective DNA repair pathways. This has lead to the investigation of the inhibition of DNA repair proteins as a means of therapeutic intervention. An alternative approach is to hide or mask damaged DNA from the repair systems. We have developed a protocol to investigate the structures of the complexes of damaged DNA with drug like molecules. Nucleotide resolution structural information can be obtained using an improved hydroxyl radical cleavage protocol. The use of a dT(n) tail increases the length of the smallest fragments of interest and allows efficient co-precipitation of the fragments with poly(A). The use of a fluorescent label, on the 5' end of the dT(n) tail, in conjunction with modified cleavage reaction conditions, avoids the lifetime and other problems with (32)P labeling. The structures of duplex DNAs containing AC and CC mismatches in the presence and absence of minor groove binders have been investigated as have those of the fully complementary DNA. The results indicate that the structural perturbations of the mismatches are localized, are sequence dependent and that the presence of a mismatch can alter the binding of drug like molecules. Copyright © 2011 Elsevier B.V. All rights reserved.
Cui, Yunxi; Kong, Deming; Ghimire, Chiran; Xu, Cuixia; Mao, Hanbin
2016-04-19
G-Quadruplex and i-motif are tetraplex structures that may form in opposite strands at the same location of a duplex DNA. Recent discoveries have indicated that the two tetraplex structures can have conflicting biological activities, which poses a challenge for cells to coordinate. Here, by performing innovative population analysis on mechanical unfolding profiles of tetraplex structures in double-stranded DNA, we found that formations of G-quadruplex and i-motif in the two complementary strands are mutually exclusive in a variety of DNA templates, which include human telomere and promoter fragments of hINS and hTERT genes. To explain this behavior, we placed G-quadruplex- and i-motif-hosting sequences in an offset fashion in the two complementary telomeric DNA strands. We found simultaneous formation of the G-quadruplex and i-motif in opposite strands, suggesting that mutual exclusivity between the two tetraplexes is controlled by steric hindrance. This conclusion was corroborated in the BCL-2 promoter sequence, in which simultaneous formation of two tetraplexes was observed due to possible offset arrangements between G-quadruplex and i-motif in opposite strands. The mutual exclusivity revealed here sets a molecular basis for cells to efficiently coordinate opposite biological activities of G-quadruplex and i-motif at the same dsDNA location.
Zhang, Hongyan; Lv, Jie; Jia, Zhenhong
2017-05-10
A novel assembled biosensor was prepared for detecting 16S rRNA, a small-size persistent specific for Actinobacteria. The mechanism of the porous silicon (PS) photonic crystal biosensor is based on the fluorescence resonance energy transfer (FRET) between quantum dots (QDs) and gold nanoparticles (AuNPs) through DNA hybridization, where QDs act as an emission donor and AuNPs serve as a fluorescence quencher. Results showed that the photoluminescence (PL) intensity of PS photonic crystal was drastically increased when the QDs-conjugated probe DNA was adhered to the PS layer by surface modification using a standard cross-link chemistry method. The PL intensity of QDs was decreased when the addition of AuNPs-conjugated complementary 16S rRNA was dropped onto QDs-conjugated PS. Based on the analysis of different target DNA concentration, it was found that the decrease of the PL intensity showed a good linear relationship with complementary DNA concentration in a range from 0.25 to 10 μM, and the detection limit was 328.7 nM. Such an optical FRET biosensor functions on PS-based photonic crystal for DNA detection that differs from the traditional FRET, which is used only in liquid. This method will benefit the development of a new optical FRET label-free biosensor on Si substrate and has great potential in biochips based on integrated optical devices.
Saleh, Mona; El-Matbouli, Mansour
2015-06-01
Cyprinid herpesvirus-3 (CyHV-3) is a highly infectious pathogen that causes fatal disease in common and koi carp Cyprinus carpio L. CyHV-3 detection is usually based on virus propagation or amplification of the viral DNA using the PCR or LAMP techniques. However, due to the limited susceptibility of cells used for propagation, it is not always possible to successfully isolate CyHV-3 even from tissue samples that have high virus titres. All previously described detection methods including PCR-based assays are time consuming, laborious and require specialized equipment. To overcome these limitations, gold nanoparticles (AuNPs) have been explored for direct and sensitive detection of DNA. In this study, a label-free colorimetric nanodiagnostic method for direct detection of unamplified CyHV-3 DNA using gold nanoparticles is introduced. Under appropriate conditions, DNA probes hybridize with their complementary target sequences in the sample DNA, which results in aggregation of the gold nanoparticles and a concomitant colour change from red to blue, whereas test samples with non complementary DNA sequences remain red. In this study, gold nanoparticles were used to develop and evaluate a specific and sensitive hybridization assay for direct and rapid detection of the highly infectious pathogen termed Cyprinid herpesvirus-3. Copyright © 2015 Elsevier B.V. All rights reserved.
Motif-based analysis of large nucleotide data sets using MEME-ChIP
Ma, Wenxiu; Noble, William S; Bailey, Timothy L
2014-01-01
MEME-ChIP is a web-based tool for analyzing motifs in large DNA or RNA data sets. It can analyze peak regions identified by ChIP-seq, cross-linking sites identified by cLIP-seq and related assays, as well as sets of genomic regions selected using other criteria. MEME-ChIP performs de novo motif discovery, motif enrichment analysis, motif location analysis and motif clustering, providing a comprehensive picture of the DNA or RNA motifs that are enriched in the input sequences. MEME-ChIP performs two complementary types of de novo motif discovery: weight matrix–based discovery for high accuracy; and word-based discovery for high sensitivity. Motif enrichment analysis using DNA or RNA motifs from human, mouse, worm, fly and other model organisms provides even greater sensitivity. MEME-ChIP’s interactive HTML output groups and aligns significant motifs to ease interpretation. this protocol takes less than 3 h, and it provides motif discovery approaches that are distinct and complementary to other online methods. PMID:24853928
Mechanisms of Surface-Mediated DNA Hybridization
2015-01-01
Single-molecule total internal reflection fluorescence microscopy was employed in conjunction with resonance energy transfer (RET) to observe the dynamic behavior of donor-labeled ssDNA at the interface between aqueous solution and a solid surface decorated with complementary acceptor-labeled ssDNA. At least 100 000 molecular trajectories were determined for both complementary strands and negative control ssDNA. RET was used to identify trajectory segments corresponding to the hybridized state. The vast majority of molecules from solution adsorbed nonspecifically to the surface, where a brief two-dimensional search was performed with a 7% chance of hybridization. Successful hybridization events occurred with a characteristic search time of ∼0.1 s, and unsuccessful searches resulted in desorption from the surface, ultimately repeating the adsorption and search process. Hybridization was reversible, and two distinct modes of melting (i.e., dehybridization) were observed, corresponding to long-lived (∼15 s) and short-lived (∼1.4 s) hybridized time intervals. A strand that melted back onto the surface could rehybridize after a brief search or desorb from the interface. These mechanistic observations provide guidance for technologies that involve DNA interactions in the near-surface region, suggesting a need to design surfaces that both enhance the complex multidimensional search process and stabilize the hybridized state. PMID:24708278
Singhal, Chaitali; Ingle, Aviraj; Chakraborty, Dhritiman; Pn, Anoop Krishna; Pundir, C S; Narang, Jagriti
2017-05-01
An impedimetric genosensor was fabricated for detection of hepatitis C virus (HCV) genotype 1 in serum, based on hybridization of the probe with complementary target cDNA from sample. To achieve it, probe DNA complementary to HCVgene was immobilized on the surface of methylene blue (MB) doped silica nanoparticles MB@SiNPs) modified fluorine doped tin oxide (FTO) electrode. The synthesized MB@SiNPs was characterized using scanning electron microscopy (SEM), high resolution transmission electron microscopy (HRTEM) and X-ray diffraction (XRD) pattern. This modified electrode (ssDNA/MB@SiNPs/FTO) served both as a signal amplification platform (due to silica nanoparticles (SiNPs) as well as an electrochemical indicator (due to methylene blue (MB)) for the detection of the HCV DNA in patient serum sample. The genosensor was optimized and evaluated. The sensor showed a dynamic linear range 100-10 6 copies/mL, with a detection limit of 90 copies/mL. The sensor was applied for detection of HCV in sera of hepatitis patient and could be renewed. The half life of the sensor was 4 weeks. The MB@SiNPs/FTO electrode could be used for preparation of other gensensors also. Copyright © 2017 Elsevier B.V. All rights reserved.
del Río, Jonathan Sabaté; Yehia Adly, Nouran; Acero-Sánchez, Josep Lluis; Henry, Olivier Y F; O'Sullivan, Ciara K
2014-04-15
Solid-phase isothermal DNA amplification was performed exploiting the homology protein recombinase A (recA). The system was primarily tested on maleimide activated microtitre plates as a proof-of-concept and later translated to an electrochemical platform. In both cases, forward primer for Francisella tularensis holarctica genomic DNA was surface immobilised via a thiol or an amino moiety and then elongated during the recA mediated amplification, carried out in the presence of specific target sequence and reverse primers. The formation of the subsequent surface tethered amplicons was either colorimetrically or electrochemically monitored using a horseradish peroxidase (HRP)-labelled DNA secondary probe complementary to the elongated strand. The amplification time was optimised to amplify even low amounts of DNA copies in less than an hour at a constant temperature of 37°C, achieving a limit of detection of 1.3×10(-13) M (4×10(6) copies in 50 μL) for the colorimetric assay and 3.3×10(-14) M (2×10(5) copies in 10 μL) for the chronoamperometric assay. The system was demonstrated to be highly specific with negligible cross-reactivity with non-complementary targets or primers. © 2013 Elsevier B.V. All rights reserved.
Single-Molecule Counting of Point Mutations by Transient DNA Binding
NASA Astrophysics Data System (ADS)
Su, Xin; Li, Lidan; Wang, Shanshan; Hao, Dandan; Wang, Lei; Yu, Changyuan
2017-03-01
High-confidence detection of point mutations is important for disease diagnosis and clinical practice. Hybridization probes are extensively used, but are hindered by their poor single-nucleotide selectivity. Shortening the length of DNA hybridization probes weakens the stability of the probe-target duplex, leading to transient binding between complementary sequences. The kinetics of probe-target binding events are highly dependent on the number of complementary base pairs. Here, we present a single-molecule assay for point mutation detection based on transient DNA binding and use of total internal reflection fluorescence microscopy. Statistical analysis of single-molecule kinetics enabled us to effectively discriminate between wild type DNA sequences and single-nucleotide variants at the single-molecule level. A higher single-nucleotide discrimination is achieved than in our previous work by optimizing the assay conditions, which is guided by statistical modeling of kinetics with a gamma distribution. The KRAS c.34 A mutation can be clearly differentiated from the wild type sequence (KRAS c.34 G) at a relative abundance as low as 0.01% mutant to WT. To demonstrate the feasibility of this method for analysis of clinically relevant biological samples, we used this technology to detect mutations in single-stranded DNA generated from asymmetric RT-PCR of mRNA from two cancer cell lines.
Silva, Marina; Alshamali, Farida; Silva, Paula; Carrilho, Carla; Mandlate, Flávio; Jesus Trovoada, Maria; Černý, Viktor; Pereira, Luísa; Soares, Pedro
2015-07-27
Mitochondrial DNA (mtDNA) haplogroup L2 originated in Western Africa but is nowadays spread across the entire continent. L2 movements were previously postulated to be related to the Bantu expansion, but L2 expansions eastwards probably occurred much earlier. By reconstructing the phylogeny of L2 (44 new complete sequences) we provide insights on the complex net of within-African migrations in the last 60 thousand years (ka). Results show that lineages in Southern Africa cluster with Western/Central African lineages at a recent time scale, whereas, eastern lineages seem to be substantially more ancient. Three moments of expansion from a Central African source are associated to L2: (1) one migration at 70-50 ka into Eastern or Southern Africa, (2) postglacial movements (15-10 ka) into Eastern Africa; and (3) the southward Bantu Expansion in the last 5 ka. The complementary population and L0a phylogeography analyses indicate no strong evidence of mtDNA gene flow between eastern and southern populations during the later movement, suggesting low admixture between Eastern African populations and the Bantu migrants. This implies that, at least in the early stages, the Bantu expansion was mainly a demic diffusion with little incorporation of local populations.
Silva, Marina; Alshamali, Farida; Silva, Paula; Carrilho, Carla; Mandlate, Flávio; Jesus Trovoada, Maria; Černý, Viktor; Pereira, Luísa; Soares, Pedro
2015-01-01
Mitochondrial DNA (mtDNA) haplogroup L2 originated in Western Africa but is nowadays spread across the entire continent. L2 movements were previously postulated to be related to the Bantu expansion, but L2 expansions eastwards probably occurred much earlier. By reconstructing the phylogeny of L2 (44 new complete sequences) we provide insights on the complex net of within-African migrations in the last 60 thousand years (ka). Results show that lineages in Southern Africa cluster with Western/Central African lineages at a recent time scale, whereas, eastern lineages seem to be substantially more ancient. Three moments of expansion from a Central African source are associated to L2: (1) one migration at 70–50 ka into Eastern or Southern Africa, (2) postglacial movements (15–10 ka) into Eastern Africa; and (3) the southward Bantu Expansion in the last 5 ka. The complementary population and L0a phylogeography analyses indicate no strong evidence of mtDNA gene flow between eastern and southern populations during the later movement, suggesting low admixture between Eastern African populations and the Bantu migrants. This implies that, at least in the early stages, the Bantu expansion was mainly a demic diffusion with little incorporation of local populations. PMID:26211407
DNA hybridization detection on electrical microarrays using coulostatic pulse technique.
Dharuman, V; Nebling, E; Grunwald, T; Albers, J; Blohm, L; Elsholz, B; Wörl, R; Hintsche, R
2006-12-15
We demonstrated a novel application of transient coulostatic pulse technique for the detection of label free DNA hybridization on nm-sized gold interdigitated ultramicroelectrode arrays (Au-IDA) made in silicon technology. The array consists of eight different positions with an Au-IDA pair at each position arranged on the Si-based Biochip. Immobilization of capture probes onto the Au-IDA was accomplished by self-assembling of thiol-modified oligonucleotides. Target hybridization was indicated by a change in the magnitude of the time dependant potential relaxation curve in presence of electroactive Fe(CN)(6)(3-) in the phosphate buffer solution. While complementary DNA hybridization showed 50% increase in the relaxation potential, the non-complementary DNA showed a negligible change. A constant behaviour was noted for all positions. The dsDNA specific intercalating molecule, methylene blue, was found to be enhancing the discrimination effect. The changes in the relaxation potential curves were further corroborated following the ELISA like experiments using ExtraAvidine alkaline phosphatase labelling and redox recycling of para-aminophenol phosphate at IDAs. The coulostatic pulse technique was shown to be useful for identifying DNA sequences from brain tumour gene CK20, human herpes simplex virus, cytomegalovirus, Epstein-Barr virus and M13 phage. Compared to the hybridization of short chain ONTs (27 mers), the hybridization of long chain M13 phage DNA showed three times higher increase in the relaxation curves. The method is fast enough to monitor hybridization interactions in milli or microsecond time scales and is well suitable for miniaturization and integration compared to the common impedance techniques for developing capacitative DNA sensors.
Highly sensitive self-complementary DNA nanoswitches triggered by polyelectrolytes
NASA Astrophysics Data System (ADS)
Wu, Jincai; Yu, Feng; Zhang, Zheng; Chen, Yong; Du, Jie; Maruyama, Atsushi
2015-12-01
Dimerization of two homologous strands of genomic DNA/RNA is an essential feature of retroviral replication. Herein we show that a cationic comb-type copolymer (CCC), poly(l-lysine)-graft-dextran, accelerates the dimerization of self-complementary stem-loop DNA, frequently found in functional DNA/RNA molecules, such as aptamers. Furthermore, an anionic polymer poly(sodium vinylsulfonate) (PVS) dissociates CCC from the duplex shortly within a few seconds. Then single stem-loop DNA spontaneously transforms from its dimer. Thus we can easily control the dimer and stem-loop DNA by switching on/off CCC activity. Both polyelectrolytes and DNA concentrations are in the nanomole per liter range. The polyelectrolyte-assisted transconformation and sequences design strategy ensures the reversible state control with rapid response and effective switching under physiologically relevant conditions. A further application of this sensitive assembly is to construct an aptamer-type drug delivery system, bind or release functional molecules responding to its transconformation.Dimerization of two homologous strands of genomic DNA/RNA is an essential feature of retroviral replication. Herein we show that a cationic comb-type copolymer (CCC), poly(l-lysine)-graft-dextran, accelerates the dimerization of self-complementary stem-loop DNA, frequently found in functional DNA/RNA molecules, such as aptamers. Furthermore, an anionic polymer poly(sodium vinylsulfonate) (PVS) dissociates CCC from the duplex shortly within a few seconds. Then single stem-loop DNA spontaneously transforms from its dimer. Thus we can easily control the dimer and stem-loop DNA by switching on/off CCC activity. Both polyelectrolytes and DNA concentrations are in the nanomole per liter range. The polyelectrolyte-assisted transconformation and sequences design strategy ensures the reversible state control with rapid response and effective switching under physiologically relevant conditions. A further application of this sensitive assembly is to construct an aptamer-type drug delivery system, bind or release functional molecules responding to its transconformation. Electronic supplementary information (ESI) available: I. Sequences of DIS25, DIS25-2a and DIS25-3a. II. Structural formula of poly(l-lysine)-graft-dextran (PLL-g-Dex). 1H-NMR spectra of PLL-g-Dex in D2O. III. Gel electrophoretic analysis of dimerization of DIS25 with various N/P ratios. IV. The effect of polyelectrolyte on the fluorescence polarity of TAMRA-labeled duplex. V. UV absorption/Tm profiles of DIS25. VI. Arrhenius plots for spontaneous dissociation of the DIS25 dimer and PLL-g-Dex-assisted dimerization of DIS25.VII. Switching between double stem-loop DIS42 and extended multiplex drived by PLL-g-Dex and PVS. See DOI: 10.1039/c5nr05193b
Recovery Based Nanowire Field-Effect Transistor Detection of Pathogenic Avian Influenza DNA
NASA Astrophysics Data System (ADS)
Lin, Chih-Heng; Chu, Chia-Jung; Teng, Kang-Ning; Su, Yi-Jr; Chen, Chii-Dong; Tsai, Li-Chu; Yang, Yuh-Shyong
2012-02-01
Fast and accurate diagnosis is critical in infectious disease surveillance and management. We proposed a DNA recovery system that can easily be adapted to DNA chip or DNA biosensor for fast identification and confirmation of target DNA. This method was based on the re-hybridization of DNA target with a recovery DNA to free the DNA probe. Functionalized silicon nanowire field-effect transistor (SiNW FET) was demonstrated to monitor such specific DNA-DNA interaction using high pathogenic strain virus hemagglutinin 1 (H1) DNA of avian influenza (AI) as target. Specific electric changes were observed in real-time for AI virus DNA sensing and device recovery when nanowire surface of SiNW FET was modified with complementary captured DNA probe. The recovery based SiNW FET biosensor can be further developed for fast identification and further confirmation of a variety of influenza virus strains and other infectious diseases.
Rupture of DNA aptamer: New insights from simulations
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mishra, Rakesh Kumar; Nath, Shesh; Kumar, Sanjay
2015-10-28
Base-pockets (non-complementary base-pairs) in a double-stranded DNA play a crucial role in biological processes. Because of thermal fluctuations, it can lower the stability of DNA, whereas, in case of DNA aptamer, small molecules, e.g., adenosinemonophosphate and adenosinetriphosphate, form additional hydrogen bonds with base-pockets termed as “binding-pockets,” which enhance the stability. Using the Langevin dynamics simulations of coarse grained model of DNA followed by atomistic simulations, we investigated the influence of base-pocket and binding-pocket on the stability of DNA aptamer. Striking differences have been reported here for the separation induced by temperature and force, which require further investigation by single moleculemore » experiments.« less
Enantiospecific recognition of DNA sequences by a proflavine Tröger base.
Bailly, C; Laine, W; Demeunynck, M; Lhomme, J
2000-07-05
The DNA interaction of a chiral Tröger base derived from proflavine was investigated by DNA melting temperature measurements and complementary biochemical assays. DNase I footprinting experiments demonstrate that the binding of the proflavine-based Tröger base is both enantio- and sequence-specific. The (+)-isomer poorly interacts with DNA in a non-sequence-selective fashion. In sharp contrast, the corresponding (-)-isomer recognizes preferentially certain DNA sequences containing both A. T and G. C base pairs, such as the motifs 5'-GTT. AAC and 5'-ATGA. TCAT. This is the first experimental demonstration that acridine-type Tröger bases can be used for enantiospecific recognition of DNA sequences. Copyright 2000 Academic Press.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Niyogi, S.K.; Mitra, S.
Escherichia coli RNA polymerase binds specifically to the single-stranded circular DNA of coliphage M13 in the presence of a saturating concentration of the bacterial DNA binding protein presumably as an essential step in the synthesis of the RNA primer required for synthesizing the complementary DNA strand in parental replicative-form DNA. The RNA polymerase-protected DNA regions were isolated after extensive digestion with pancreatic DNase, S1 endonuclease of Aspergillus oryzae, and exonuclease I of E. coli. The physicochemical properties of the RNA polymerase-protected segments (called PI and PII) were compared with those of the naturally occurring hairpin regions.
Controlling charge current through a DNA based molecular transistor
NASA Astrophysics Data System (ADS)
Behnia, S.; Fathizadeh, S.; Ziaei, J.
2017-01-01
Molecular electronics is complementary to silicon-based electronics and may induce electronic functions which are difficult to obtain with conventional technology. We have considered a DNA based molecular transistor and study its transport properties. The appropriate DNA sequence as a central chain in molecular transistor and the functional interval for applied voltages is obtained. I-V characteristic diagram shows the rectifier behavior as well as the negative differential resistance phenomenon of DNA transistor. We have observed the nearly periodic behavior in the current flowing through DNA. It is reported that there is a critical gate voltage for each applied bias which above it, the electrical current is always positive.
Hiding message into DNA sequence through DNA coding and chaotic maps.
Liu, Guoyan; Liu, Hongjun; Kadir, Abdurahman
2014-09-01
The paper proposes an improved reversible substitution method to hide data into deoxyribonucleic acid (DNA) sequence, and four measures have been taken to enhance the robustness and enlarge the hiding capacity, such as encode the secret message by DNA coding, encrypt it by pseudo-random sequence, generate the relative hiding locations by piecewise linear chaotic map, and embed the encoded and encrypted message into a randomly selected DNA sequence using the complementary rule. The key space and the hiding capacity are analyzed. Experimental results indicate that the proposed method has a better performance compared with the competing methods with respect to robustness and capacity.
Method for construction of normalized cDNA libraries
Soares, Marcelo B.; Efstratiadis, Argiris
1998-01-01
This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to appropriate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. This invention also provides normalized cDNA libraries generated by the above-described method and uses of the generated libraries.
Method for construction of normalized cDNA libraries
Soares, M.B.; Efstratiadis, A.
1998-11-03
This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3` noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to appropriate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. This invention also provides normalized cDNA libraries generated by the above-described method and uses of the generated libraries. 19 figs.
Poltev, V I; Anisimov, V M; Sanchez, C; Deriabina, A; Gonzalez, E; Garcia, D; Rivas, F; Polteva, N A
2016-01-01
It is generally accepted that the important characteristic features of the Watson-Crick duplex originate from the molecular structure of its subunits. However, it still remains to elucidate what properties of each subunit are responsible for the significant characteristic features of the DNA structure. The computations of desoxydinucleoside monophosphates complexes with Na-ions using density functional theory revealed a pivotal role of DNA conformational properties of single-chain minimal fragments in the development of unique features of the Watson-Crick duplex. We found that directionality of the sugar-phosphate backbone and the preferable ranges of its torsion angles, combined with the difference between purines and pyrimidines. in ring bases, define the dependence of three-dimensional structure of the Watson-Crick duplex on nucleotide base sequence. In this work, we extended these density functional theory computations to the minimal' fragments of DNA duplex, complementary desoxydinucleoside monophosphates complexes with Na-ions. Using several computational methods and various functionals, we performed a search for energy minima of BI-conformation for complementary desoxydinucleoside monophosphates complexes with different nucleoside sequences. Two sequences are optimized using ab initio method at the MP2/6-31++G** level of theory. The analysis of torsion angles, sugar ring puckering and mutual base positions of optimized structures demonstrates that the conformational characteristic features of complementary desoxydinucleoside monophosphates complexes with Na-ions remain within BI ranges and become closer to the corresponding characteristic features of the Watson-Crick duplex crystals. Qualitatively, the main characteristic features of each studied complementary desoxydinucleoside monophosphates complex remain invariant when different computational methods are used, although the quantitative values of some conformational parameters could vary lying within the limits typical for the corresponding family. We observe that popular functionals in density functional theory calculations lead to the overestimated distances between base pairs, while MP2 computations and the newer complex functionals produce the structures that have too close atom-atom contacts. A detailed study of some complementary desoxydinucleoside monophosphate complexes with Na-ions highlights the existence of several energy minima corresponding to BI-conformations, in other words, the complexity of the relief pattern of the potential energy surface of complementary desoxydinucleoside monophosphate complexes. This accounts for variability of conformational parameters of duplex fragments with the same base sequence. Popular molecular mechanics force fields AMBER and CHARMM reproduce most of the conformational characteristics of desoxydinucleoside monophosphates and their complementary complexes with Na-ions but fail to reproduce some details of the dependence of the Watson-Crick duplex conformation on the nucleotide sequence.
NASA Technical Reports Server (NTRS)
Kozlov, I. A.; De Bouvere, B.; Van Aerschot, A.; Herdewijn, P.; Orgel, L. E.
1999-01-01
Hexitol nucleic acids (HNAs) are DNA analogues that contain the standard nucleoside bases attached to a phosphorylated 1,5-anhydrohexitol backbone. We find that HNAs support efficient information transfer in nonensymatic template-directed reactions. HNA heterosequences appeared to be superior to the corresponding DNA heterosequences in facilitating synthesis of complementary oligonucleotides from nucleoside-5'-phosphoro-2-methyl imidazolides.
Chiappini, Massimiliano; Eiser, Erika; Sciortino, Francesco
2017-01-01
A new gel-forming colloidal system based on a binary mixture of fd-viruses and gold nanoparticles functionalized with complementary DNA single strands has been recently introduced. Upon quenching below the DNA melt temperature, such a system results in a highly porous gel state, that may be developed in a new functional material of tunable porosity. In order to shed light on the gelation mechanism, we introduce a model closely mimicking the experimental one and we explore via Monte Carlo simulations its equilibrium phase diagram. Specifically, we model the system as a binary mixture of hard rods and hard spheres mutually interacting via a short-range square-well attractive potential. In the experimental conditions, we find evidence of a phase separation occurring either via nucleation-and-growth or via spinodal decomposition. The spinodal decomposition leads to the formation of small clusters of bonded rods and spheres whose further diffusion and aggregation leads to the formation of a percolating network in the system. Our results are consistent with the hypothesis that the mixture of DNA-coated fd-viruses and gold nanoparticles undergoes a non-equilibrium gelation via an arrested spinodal decomposition mechanism.
Payne, G; Ahl, P; Moyer, M; Harper, A; Beck, J; Meins, F; Ryals, J
1990-01-01
Complementary DNA clones encoding two isoforms of the acidic endochitinase (chitinase, EC 3.2.1.14) from tobacco were isolated. Comparison of amino acid sequences deduced from the cDNA clones and the sequence of peptides derived from purified proteins show that these clones encode the pathogenesis-related proteins PR-P and PR-Q. The cDNA inserts were not homologous to either the bacterial form of chitinase or the form from cucumber but shared significant homology to the basic form of chitinase from tobacco and bean. The acidic isoforms of tobacco chitinase did not contain the amino-terminal, cysteine-rich "hevein" domain found in the basic isoforms, indicating that this domain, which binds chitin, is not essential for chitinolytic activity. The accumulation of mRNA for the pathogenesis-related proteins PR-1, PR-R, PR-P, and PR-Q in Xanthi.nc tobacco leaves following infection with tobacco mosaic virus was measured by primer extension. The results indicate that the induction of these proteins during the local necrotic lesion response to the virus is coordinated at the mRNA level. Images PMID:2296608
NASA Astrophysics Data System (ADS)
Srivastava, Pratima; Ghasemi, Mahsa; Ray, Namrata; Sarkar, Amitabha; Kocabova, Jana; Lachmanova, Stepanka; Hromadova, Magdalena; Boujday, Souhir; Cauteruccio, Silvia; Thakare, Pramod; Licandro, Emanuela; Fosse, Céline; Salmain, Michèle
2016-11-01
Amine-reactive surfaces comprising N-hydroxysuccinimide ester groups as well as much more unusual Fischer alkoxymetallocarbene groups were generated on gold-coated surfaces via self-assembled monolayers of carboxy- and azido-terminated thiolates, respectively. These functions were further used to immobilize homothymine peptide nucleic acid (PNA) decamer in a covalent fashion involving the primary amine located at its N-terminus. These stepwise processes were monitored by polarization modulation reflection - absorption infrared spectroscopy (PM-RAIRS) that gave useful information on the molecular composition of the organic layers. PNA grafting and hybridization with complementary DNA strand were successfully transduced by quartz crystal microbalance (QCM) measurements. Unfortunately, attempts to transduce the hybridization optically by IR in a label-free fashion were inconclusive. Therefore we undertook to introduce an IR reporter group, namely a transition metalcarbonyl (TMC) entity at the 5‧ terminus of complementary DNA. Evidence for the formation of PNA-DNA heteroduplex was brought by the presence of ν(Ctbnd O) bands in the 2000 cm-1 region of the IR spectrum of the gold surface owing to the metalcarbonyl label.
Kerschner, Joseph E; Erdos, Geza; Hu, Fen Ze; Burrows, Amy; Cioffi, Joseph; Khampang, Pawjai; Dahlgren, Margaret; Hayes, Jay; Keefe, Randy; Janto, Benjamin; Post, J Christopher; Ehrlich, Garth D
2010-04-01
We sought to construct and partially characterize complementary DNA (cDNA) libraries prepared from the middle ear mucosa (MEM) of chinchillas to better understand pathogenic aspects of infection and inflammation, particularly with respect to leukotriene biogenesis and response. Chinchilla MEM was harvested from controls and after middle ear inoculation with nontypeable Haemophilus influenzae. RNA was extracted to generate cDNA libraries. Randomly selected clones were subjected to sequence analysis to characterize the libraries and to provide DNA sequence for phylogenetic analyses. Reverse transcription-polymerase chain reaction of the RNA pools was used to generate cDNA sequences corresponding to genes associated with leukotriene biosynthesis and metabolism. Sequence analysis of 921 randomly selected clones from the uninfected MEM cDNA library produced approximately 250,000 nucleotides of almost entirely novel sequence data. Searches of the GenBank database with the Basic Local Alignment Search Tool provided for identification of 515 unique genes expressed in the MEM and not previously described in chinchillas. In almost all cases, the chinchilla cDNA sequences displayed much greater homology to human or other primate genes than with rodent species. Genes associated with leukotriene metabolism were present in both normal and infected MEM. Based on both phylogenetic comparisons and gene expression similarities with humans, chinchilla MEM appears to be an excellent model for the study of middle ear inflammation and infection. The higher degree of sequence similarity between chinchillas and humans compared to chinchillas and rodents was unexpected. The cDNA libraries from normal and infected chinchilla MEM will serve as useful molecular tools in the study of otitis media and should yield important information with respect to middle ear pathogenesis.
Kerschner, Joseph E.; Erdos, Geza; Hu, Fen Ze; Burrows, Amy; Cioffi, Joseph; Khampang, Pawjai; Dahlgren, Margaret; Hayes, Jay; Keefe, Randy; Janto, Benjamin; Post, J. Christopher; Ehrlich, Garth D.
2010-01-01
Objectives We sought to construct and partially characterize complementary DNA (cDNA) libraries prepared from the middle ear mucosa (MEM) of chinchillas to better understand pathogenic aspects of infection and inflammation, particularly with respect to leukotriene biogenesis and response. Methods Chinchilla MEM was harvested from controls and after middle ear inoculation with nontypeable Haemophilus influenzae. RNA was extracted to generate cDNA libraries. Randomly selected clones were subjected to sequence analysis to characterize the libraries and to provide DNA sequence for phylogenetic analyses. Reverse transcription–polymerase chain reaction of the RNA pools was used to generate cDNA sequences corresponding to genes associated with leukotriene biosynthesis and metabolism. Results Sequence analysis of 921 randomly selected clones from the uninfected MEM cDNA library produced approximately 250,000 nucleotides of almost entirely novel sequence data. Searches of the GenBank database with the Basic Local Alignment Search Tool provided for identification of 515 unique genes expressed in the MEM and not previously described in chinchillas. In almost all cases, the chinchilla cDNA sequences displayed much greater homology to human or other primate genes than with rodent species. Genes associated with leukotriene metabolism were present in both normal and infected MEM. Conclusions Based on both phylogenetic comparisons and gene expression similarities with humans, chinchilla MEM appears to be an excellent model for the study of middle ear inflammation and infection. The higher degree of sequence similarity between chinchillas and humans compared to chinchillas and rodents was unexpected. The cDNA libraries from normal and infected chinchilla MEM will serve as useful molecular tools in the study of otitis media and should yield important information with respect to middle ear pathogenesis. PMID:20433028
RNA and DNA Targeting by a Reconstituted Thermus thermophilus Type III-A CRISPR-Cas System.
Liu, Tina Y; Iavarone, Anthony T; Doudna, Jennifer A
2017-01-01
CRISPR-Cas (clustered regularly interspaced short palindromic repeats-CRISPR-associated) systems are RNA-guided adaptive immunity pathways used by bacteria and archaea to defend against phages and plasmids. Type III-A systems use a multisubunit interference complex called Csm, containing Cas proteins and a CRISPR RNA (crRNA) to target cognate nucleic acids. The Csm complex is intriguing in that it mediates RNA-guided targeting of both RNA and transcriptionally active DNA, but the mechanism is not well understood. Here, we overexpressed the five components of the Thermus thermophilus (T. thermophilus) Type III-A Csm complex (TthCsm) with a defined crRNA sequence, and purified intact TthCsm complexes from E. coli cells. The complexes were thermophilic, targeting complementary ssRNA more efficiently at 65°C than at 37°C. Sequence-independent, endonucleolytic cleavage of single-stranded DNA (ssDNA) by TthCsm was triggered by recognition of a complementary ssRNA, and required a lack of complementarity between the first 8 nucleotides (5' tag) of the crRNA and the 3' flanking region of the ssRNA. Mutation of the histidine-aspartate (HD) nuclease domain of the TthCsm subunit, Cas10/Csm1, abolished DNA cleavage. Activation of DNA cleavage was dependent on RNA binding but not cleavage. This leads to a model in which binding of an ssRNA target to the Csm complex would stimulate cleavage of exposed ssDNA in the cell, such as could occur when the RNA polymerase unwinds double-stranded DNA (dsDNA) during transcription. Our findings establish an amenable, thermostable system for more in-depth investigation of the targeting mechanism using structural biology methods, such as cryo-electron microscopy and x-ray crystallography.
Bhuvana, M; Narayanan, J Shankara; Dharuman, V; Teng, W; Hahn, J H; Jayakumar, K
2013-03-15
Immobilization of 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE) liposome-gold nano-particle (DOPE-AuNP) nano-composite covalently on 3-mercaptopropionic acid (MPA) on gold surface is demonstrated for the first time for electrochemical label free DNA sensing. Spherical nature of the DOPE on the MPA monolayer is confirmed by the appearance of sigmoidal voltammetric profile, characteristic behavior of linear diffusion, for the MPA-DOPE in presence of [Fe(CN)(6)](3-/4-) and [Ru(NH(3))(6)](3+) redox probes. The DOPE liposome vesicle fusion is prevented by electroless deposition of AuNP on the hydrophilic amine head groups of the DOPE. Immobilization of single stranded DNA (ssDNA) is made via simple gold-thiol linkage for DNA hybridization sensing in the presence of [Fe(CN)(6)](3-/4-). The sensor discriminates the hybridized (complementary target hybridized), un-hybridized (non-complementary target hybridized) and single base mismatch target hybridized surfaces sensitively and selectively without signal amplification. The lowest target DNA concentration detected is 0.1×10(-12)M. Cyclic voltammetry (CV), electrochemical impedance (EIS), differential pulse voltammetry (DPV) and quartz crystal microbalance (QCM) techniques are used for DNA sensing on DOPE-AuNP nano-composite. Transmission Electron Microscopy (TEM), Fourier Transform Infrared Spectroscopy (FTIR), Atomic Force Microscopy (AFM), Dynamic Light Scattering (DLS) and Ultraviolet-Visible (UV) spectroscopic techniques are used to understand the interactions between the DOPE, AuNP and ssDNA. The results indicate the presence of an intact and well defined spherical DOPE-AuNP nano-composite on the gold surface. The method could be applied for fabrication of the surface based liposome-AuNP-DNA composite for cell transfection studies at reduced reagents and costs. Copyright © 2012 Elsevier B.V. All rights reserved.
Cilleros, Kévin; Valentini, Alice; Allard, Luc; Dejean, Tony; Etienne, Roselyne; Grenouillet, Gaël; Iribar, Amaia; Taberlet, Pierre; Vigouroux, Régis; Brosse, Sébastien
2018-05-16
Determining the species compositions of local assemblages is a prerequisite to understanding how anthropogenic disturbances affect biodiversity. However, biodiversity measurements often remain incomplete due to the limited efficiency of sampling methods. This is particularly true in freshwater tropical environments that host rich fish assemblages, for which assessments are uncertain and often rely on destructive methods. Developing an efficient and non-destructive method to assess biodiversity in tropical freshwaters is highly important. In this study, we tested the efficiency of environmental DNA (eDNA) metabarcoding to assess the fish diversity of 39 Guianese sites. We compared the diversity and composition of assemblages obtained using traditional and metabarcoding methods. More than 7,000 individual fish belonging to 203 Guianese fish species were collected by traditional sampling methods, and ~17 million reads were produced by metabarcoding, among which ~8 million reads were assigned to 148 fish taxonomic units, including 132 fish species. The two methods detected a similar number of species at each site, but the species identities partially matched. The assemblage compositions from the different drainage basins were better discriminated using metabarcoding, revealing that while traditional methods provide a more complete but spatially limited inventory of fish assemblages, metabarcoding provides a more partial but spatially extensive inventory. eDNA metabarcoding can therefore be used for rapid and large-scale biodiversity assessments, while at a local scale, the two approaches are complementary and enable an understanding of realistic fish biodiversity. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Zhou, Feng; Noor, M Omair; Krull, Ulrich J
2014-03-04
A bioassay based on DNA hybridization on cellulose paper is a promising format for gene fragment detection that may be suited for in-field and rapid diagnostic applications. We demonstrate for the first time that luminescence resonance energy transfer (LRET) associated with upconverting phosphors (UCPs) can be used to develop a paper-based DNA hybridization assay with high sensitivity, selectivity and fast response. UCPs with strong green emission were synthesized and subsequently functionalized with streptavidin (UCP-strep). UCP-strep particles were immobilized on cellulose paper, and then biotinylated single-stranded oligonucleotide probes were conjugated onto the UCPs via streptavidin-biotin linkage. The UCPs served as donors that were LRET-paired with Cy3-labeled target DNA. Selective DNA hybridization enabled the proximity required for LRET-sensitized emission from Cy3, which was used as the detection signal. Hybridization was complete within 2 min, and the limit of detection of the method was 34 fmol, which is a significant improvement in comparison to an analogous fluorescence resonance energy transfer (FRET) assay based on quantum dots. The assay exhibited excellent resistance to nonspecific adsorption of noncomplementary short/long DNA and protein. The selectivity of the assay was further evaluated by one base pair mismatched (1BPM) DNA detection, where a maximum signal ratio of 3.1:1 was achieved between fully complementary and 1BPM samples. This work represents a preliminary but significant step for the development of paper-based UCP-LRET nucleic acid hybridization assays, which offer potential for lowering the limit of detection of luminescent hybridization assays due to the negligible background signal associated with optical excitation by near-infrared (NIR) light.
Bahreyni, Amirhossein; Yazdian-Robati, Rezvan; Ramezani, Mohammad; Abnous, Khalil; Taghdisi, Seyed Mohammad
2018-04-29
A fluorometric aptamer-based assay was developed for ultrasensitive and selective determination of the neonicotinoid insecticide acetamiprid. The method is based on the use of an aptamer against acetamiprid, multiple complementary strands (CSs), and gold nanoparticles (AuNPs). It is found that by using different CSs, the sensitivity and selectivity of the method is enhanced. On addition of acetamiprid to the aptamer, they will bind to each other and CS1-fluorescein (FAM)-labeled CS2 (as a dsDNA) will be formed. The FAM-labeled dsDNA does not bind to the AuNPs (as a strong quencher) and remains free in the environment, resulting in a strong fluorescence intensity. Without the introduction of acetamiprid, FAM-labeled CS2 binds to AuNPs directly and indirectly through hybridization with CS3 immobilized on the surface of the AuNPs. So, the fluorescence intensity of FAM-labeled CS2 is significantly quenched by AuNPs. The method can detect acetamiprid in the 5 to 50 nM concentration range with a 2.8 nM detection limit. The assay was applied to the determination of acetamiprid in spiked tap water where is gave recoveries that ranged between 95.4% and 94.4%. Graphical abstract (a) In the presence of acetamiprid, aptamer interacts with acetamiprid. The formation of aptamer/acetamiprid causes pairing of complementary strand 1 with FAM-labeled complementary strand, leading to a strong fluorescence intensity. (b) In the absence of acetamiprid, aptamer is hybridized with complementary strand 1. Thus, a very weak fluorescence signal is detected.
Schnier, Paul D.; Klassen, John S.; Strittmatter, Eric F.; Williams*, Evan R.
2005-01-01
The dissociation kinetics of a series of complementary and noncomplementary DNA duplexes, (TGCA)23−, (CCGG)23−, (AATTAAT)23−, (CCGGCCG)23−, A7·T73−, A7·A73−, T7·T73−, and A7·C73− were investigated using blackbody infrared radiative dissociation in a Fourier transform mass spectrometer. From the temperature dependence of the unimolecular dissociation rate constants, Arrhenius activation parameters in the zero-pressure limit are obtained. Activation energies range from 1.2 to 1.7 eV, and preexponential factors range from 1013 to 1019 s−1. Dissociation of the duplexes results in cleavage of the noncovalent bonds and/or cleavage of covalent bonds leading to loss of a neutral nucleobase followed by backbone cleavage producing sequence-specific (a – base) and w ions. Four pieces of evidence are presented which indicate that Watson–Crick (WC) base pairing is preserved in complementary DNA duplexes in the gas phase: i. the activation energy for dissociation of the complementary dimer, A7·T73−, to the single strands is significantly higher than that for the related noncomplementary A7·A73− and T7·T73− dimers, indicating a stronger interaction between strands with a specific base sequence, ii. extensive loss of neutral adenine occurs for A7·A73− and A7·C73− but not for A7·T73− consistent with this process being shut down by WC hydrogen bonding, iii. a correlation is observed between the measured activation energy for dissociation to single strands and the dimerization enthalpy (−ΔHd) in solution, and iv. molecular dynamics carried out at 300 and 400 K indicate that WC base pairing is preserved for A7·T73− duplex, although the helical structure is essentially lost. In combination, these results provide strong evidence that WC base pairing can exist in the complete absence of solvent. PMID:16498487
Aptamer based SERS detection of Salmonella typhimurium using DNA-assembled gold nanodimers.
Xu, Xumin; Ma, Xiaoyuan; Wang, Haitao; Wang, Zhouping
2018-06-12
The authors describe a surface-enhanced Raman scattering (SERS) based aptasensor for Salmonella typhimurium (S. typhimurium). Gold nanoparticles (AuNPs; 35 nm i.d.) were functionalized with the aptamer (ssDNA 1) and used as the capture probe, while smaller (15 nm) AuNPs were modified with a Cy3-labeled complementary sequence (ssDNA 2) and used as the signalling probe. The asymmetric gold nanodimers (AuNDs) were assemblied with the Raman signal probe and the capture probe via hybridization of the complementary ssDNAs. The gap between two nanoparticles is a "hot spot" in which the Raman reporter Cy3 is localized. It experiences a strong enhancement of the electromagnetic field around the particle. After addition of S. typhimurium, it will be bound by the aptamer which therefore is partially dehybridized from its complementary sequence. Hence, Raman intensity drops. Under the optimal experimental conditions, the SERS signal at 1203 cm -1 increases linearly with the logarithm of the number of colonies in the 10 2 to 10 7 cfu·mL -1 concentration range, and the limit of detection is 35 cfu·mL -1 . The method can be performed within 1 h and was successfully applied to the analysis of spiked milk samples and performed very well and with high specificity. Graphical abstract DNA-assembled asymmetric gold nanodimers (AuNDs) were synthesized and appllied in a SERS-based aptasensor for S. typhimurium. Capture probe was preferentially combined with S. typhimurium and the structure of the AuNDs was destroyed. The "hot spot" vanished partly, this resulting in the decreased Raman intensity of Cy3.
Bosch, Linda J W; Oort, Frank A; Neerincx, Maarten; Khalid-de Bakker, Carolina A J; Terhaar sive Droste, Jochim S; Melotte, Veerle; Jonkers, Daisy M A E; Masclee, Ad A M; Mongera, Sandra; Grooteclaes, Madeleine; Louwagie, Joost; van Criekinge, Wim; Coupé, Veerle M H; Mulder, Chris J; van Engeland, Manon; Carvalho, Beatriz; Meijer, Gerrit A
2012-03-01
Using a bioinformatics-based strategy, we set out to identify hypermethylated genes that could serve as biomarkers for early detection of colorectal cancer (CRC) in stool. In addition, the complementary value to a Fecal Immunochemical Test (FIT) was evaluated. Candidate genes were selected by applying cluster alignment and computational analysis of promoter regions to microarray-expression data of colorectal adenomas and carcinomas. DNA methylation was measured by quantitative methylation-specific PCR on 34 normal colon mucosa, 71 advanced adenoma, and 64 CRC tissues. The performance as biomarker was tested in whole stool samples from in total 193 subjects, including 19 with advanced adenoma and 66 with CRC. For a large proportion of these series, methylation data for GATA4 and OSMR were available for comparison. The complementary value to FIT was measured in stool subsamples from 92 subjects including 44 with advanced adenoma or CRC. Phosphatase and Actin Regulator 3 (PHACTR3) was identified as a novel hypermethylated gene showing more than 70-fold increased DNA methylation levels in advanced neoplasia compared with normal colon mucosa. In a stool training set, PHACTR3 methylation showed a sensitivity of 55% (95% CI: 33-75) for CRC and a specificity of 95% (95% CI: 87-98). In a stool validation set, sensitivity reached 66% (95% CI: 50-79) for CRC and 32% (95% CI: 14-57) for advanced adenomas at a specificity of 100% (95% CI: 86-100). Adding PHACTR3 methylation to FIT increased sensitivity for CRC up to 15%. PHACTR3 is a new hypermethylated gene in CRC with a good performance in stool DNA testing and has complementary value to FIT.
Artificial Informational Polymers and Nanomaterials from Ring-Opening Metathesis Polymerization
NASA Astrophysics Data System (ADS)
James, Carrie Rae
Inspired by naturally occurring polymers (DNA, polypeptides, polysaccharides, etc.) that can self-assemble on the nanoscale into complex, information-rich architectures, we have synthesized nucleic acid based polymers using ROMP. These polymers were synthesized using a graft-through strategy, whereby nucleic acids bearing a strained cyclic olefin were directly polymerized. This is the first example of the graft-through polymerization of nucleic acids. Our approach takes advantage of non-charged peptide nucleic acids (PNAs) as elements to incorporate into ROMP polymer backbones. PNA is a synthetic nucleic acid analogue known for its increased affinity and specificity for complementary DNA or RNA. To accomplish the graft-through polymerization of PNA, we conjugated PNA to strained cyclic olefins using solid phase peptide conjugation chemistry. These PNA monomers were then directly polymerized into homo and block copolymers forming brushes, or comb-like arrangements, of information. Block copolymer amphiphiles of these materials, where the PNA brush served as the hydrophilic portion, were capable of self-assembly into spherical nanoparticles (PNA NPs). These PNA NPs were then studied with respect to their ability to hybridize complementary DNA sequences, as well as their ability to undergo cellular internalization. PNA NPs consisting of densely packed brushes of nucleic acids possessed increased thermal stability when mixed with their complementary DNA sequence, indicating a greater DNA binding affinity over their unpolymerized PNA counterparts. In addition, by arranging the PNA into dense brushes at the surface of the nanoparticle, Cy5.5 labeled PNA NPs were able to undergo cellular internalization into HeLa cells without the need for an additional cellular delivery device. Importantly, cellular internalization of PNA has remained a significant challenge in the literature due to the neutrally charged amino-ethyl glycine backbone of PNA. Therefore, this represents a novel way of facilitating cellular uptake of PNA. This materials strategy represents the first direct polymerization of nucleic acids, and presents a novel method for arranging biological information on the nanoscale at high density in order to confer novel attributes.
Phylogenetics of modern birds in the era of genomics
Edwards, Scott V; Bryan Jennings, W; Shedlock, Andrew M
2005-01-01
In the 14 years since the first higher-level bird phylogenies based on DNA sequence data, avian phylogenetics has witnessed the advent and maturation of the genomics era, the completion of the chicken genome and a suite of technologies that promise to add considerably to the agenda of avian phylogenetics. In this review, we summarize current approaches and data characteristics of recent higher-level bird studies and suggest a number of as yet untested molecular and analytical approaches for the unfolding tree of life for birds. A variety of comparative genomics strategies, including adoption of objective quality scores for sequence data, analysis of contiguous DNA sequences provided by large-insert genomic libraries, and the systematic use of retroposon insertions and other rare genomic changes all promise an integrated phylogenetics that is solidly grounded in genome evolution. The avian genome is an excellent testing ground for such approaches because of the more balanced representation of single-copy and repetitive DNA regions than in mammals. Although comparative genomics has a number of obvious uses in avian phylogenetics, its application to large numbers of taxa poses a number of methodological and infrastructural challenges, and can be greatly facilitated by a ‘community genomics’ approach in which the modest sequencing throughputs of single PI laboratories are pooled to produce larger, complementary datasets. Although the polymerase chain reaction era of avian phylogenetics is far from complete, the comparative genomics era—with its ability to vastly increase the number and type of molecular characters and to provide a genomic context for these characters—will usher in a host of new perspectives and opportunities for integrating genome evolution and avian phylogenetics. PMID:16024355
Zhang, Hongyan; Lv, Jie; Jia, Zhenhong
2017-01-01
A novel assembled biosensor was prepared for detecting 16S rRNA, a small-size persistent specific for Actinobacteria. The mechanism of the porous silicon (PS) photonic crystal biosensor is based on the fluorescence resonance energy transfer (FRET) between quantum dots (QDs) and gold nanoparticles (AuNPs) through DNA hybridization, where QDs act as an emission donor and AuNPs serve as a fluorescence quencher. Results showed that the photoluminescence (PL) intensity of PS photonic crystal was drastically increased when the QDs-conjugated probe DNA was adhered to the PS layer by surface modification using a standard cross-link chemistry method. The PL intensity of QDs was decreased when the addition of AuNPs-conjugated complementary 16S rRNA was dropped onto QDs-conjugated PS. Based on the analysis of different target DNA concentration, it was found that the decrease of the PL intensity showed a good linear relationship with complementary DNA concentration in a range from 0.25 to 10 μM, and the detection limit was 328.7 nM. Such an optical FRET biosensor functions on PS-based photonic crystal for DNA detection that differs from the traditional FRET, which is used only in liquid. This method will benefit the development of a new optical FRET label-free biosensor on Si substrate and has great potential in biochips based on integrated optical devices. PMID:28489033
Takamitsu, Emi; Fukunaga, Kazuki; Iio, Yusuke; Moriya, Koko; Utsumi, Toshihiko
2014-11-01
To establish a non-radioactive, cell-free detection system for protein N-myristoylation, metabolic labeling in a cell-free protein synthesis system using bioorthogonal myristic acid analogues was performed. After Cu(I)-catalyzed azide-alkyne cycloaddition (CuAAC) with a biotin tag, the tagged proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and blotted on a polyvinylidene fluoride (PVDF) membrane, and then protein N-myristoylation was detected by enhanced chemiluminescence (ECL) using horseradish peroxidase (HRP)-conjugated streptavidin. The results showed that metabolic labeling in an insect cell-free protein synthesis system using an azide analogue of myristic acid followed by CuAAC with alkynyl biotin was the most effective strategy for cell-free detection of protein N-myristoylation. To determine whether the newly developed detection method can be applied for the detection of novel N-myristoylated proteins from complementary DNA (cDNA) resources, four candidate cDNA clones were selected from a human cDNA resource and their susceptibility to protein N-myristoylation was evaluated using the newly developed strategy. As a result, the products of three cDNA clones were found to be novel N-myristoylated protein, and myristoylation-dependent specific intracellular localization was observed for two novel N-myristoylated proteins. Thus, the metabolic labeling in an insect cell-free protein synthesis system using bioorthogonal azide analogue of myristic acid was an effective strategy to identify novel N-myristoylated proteins from cDNA resources. Copyright © 2014 Elsevier Inc. All rights reserved.
Shankara Narayanan, Jeyaraman; Bhuvana, Mohanlal; Dharuman, Venkataraman
2014-08-15
Cationic N-[1-(2,3-Dioleoyloxy)propyl]-N,N,N-trimethylammonium propane (DOTAP) liposome is spherically sandwiched in gold nanoparticle (abbreviated as sDOTAP-AuNP) onto a gold electrode surface. The sDOTAP-AuNP is applied for electrochemical label free DNA sensing and Escherichia coli cell transfection for the first time. Complementary target (named as hybridized), non-complementary target (un-hybridized) and single base mismatch target (named as SMM) hybridized surfaces are discriminated sensitively and selectively in presence of [Fe(CN)6](3-/4-). Double strand specific intercalator methylene blue in combination with [Fe(CN)6](3-) is used to enhance target detection limit down to femtomolar concentration. Cyclic voltammetry (CV), electrochemical impedance spectroscopy (EIS), differential pulse voltammetry (DPV) techniques are used for characterizing DNA sensing. High Resolution Transmission Electron Microscopy (HRTEM), Fourier Transform Infrared Spectroscopy (FTIR), Atomic Force Microscopy (AFM) and Dynamic Light Scattering (DLS) techniques are used to confirm the spherical nature of the sDOTAP-AuNP-DNA composite in solution and on the solid surface. DNA on the sDOTAP-ssDNA is transferred by potential stripping method (+0.2V (Ag/AgCl)) into buffer solution containing E. coli cells. The transfection is confirmed by the contrast images for the transfected and non-transfected cell from Confocal Laser Scanning Microscopy (CLSM). The results demonstrate effectiveness of the electrochemical DNA transfection method developed and could be applied for other cells. Copyright © 2014 Elsevier B.V. All rights reserved.
Bish, Lawrence T.; Sleeper, Meg M.; Brainard, Benjamin; Cole, Stephen; Russell, Nicholas; Withnall, Elanor; Arndt, Jason; Reynolds, Caryn; Davison, Ellen; Sanmiguel, Julio; Wu, Di; Gao, Guangping; Wilson, James M.; Sweeney, H. Lee
2011-01-01
Achieving efficient cardiac gene transfer in a large animal model has proven to be technically challenging. Prior strategies have employed cardio-pulmonary bypass or dual catheterization with the aid of vasodilators to deliver vectors, such as adenovirus, adeno-associated virus or plasmid DNA. While single stranded adeno-associated virus vectors have shown the greatest promise, they suffer from delayed expression, which might be circumvented by using self-complementary vectors. We sought to optimize cardiac gene transfer using a percutaneous transendocardial injection catheter to deliver adeno-associated virus vectors to the canine myocardium. Four vectors were evaluated—single stranded adeno-associated virus 9, self-complementary adeno-associated virus 9, self-complementary adeno-associated virus 8, self-complementary adeno-associated virus 6—so that comparison could be made between single stranded and self complementary vectors as well as among serotypes 9, 8, and 6. We demonstrate that self-complementary adeno-associated virus is superior to single stranded adeno-associated virus and that adeno-associated virus 6 is superior to other serotypes evaluated. Biodistribution studies revealed that vector genome copies were 15 to 4000 times more abundant in the heart than in any other organ for self-complementary adeno-associated virus 6. Percutaneous transendocardial injection of self-complementary adeno-associated virus 6 is a safe, effective method for achieving efficient cardiac gene transfer. PMID:18813281
Truong, Thi Ngoc Lien; Tran, Dai Lam; Vu, Thi Hong An; Tran, Vinh Hoang; Duong, Tuan Quang; Dinh, Quang Khieu; Tsukahara, Toshifumi; Lee, Young Hoon; Kim, Jong Seung
2010-01-15
In this paper, we describe DNA electrochemical detection for genetically modified organism (GMO) based on multi-wall carbon nanotubes (MWCNTs)-doped polypyrrole (PPy). DNA hybridization is studied by quartz crystal microbalance (QCM) and electrochemical impedance spectroscopy (EIS). An increase in DNA complementary target concentration results in a decrease in the faradic charge transfer resistance (R(ct)) and signifying "signal-on" behavior of MWCNTs-PPy-DNA system. QCM and EIS data indicated that the electroanalytical MWCNTs-PPy films were highly sensitive (as low as 4pM of target can be detected with QCM technique). In principle, this system can be suitable not only for DNA but also for protein biosensor construction.
3G vector-primer plasmid for constructing full-length-enriched cDNA libraries.
Zheng, Dong; Zhou, Yanna; Zhang, Zidong; Li, Zaiyu; Liu, Xuedong
2008-09-01
We designed a 3G vector-primer plasmid for the generation of full-length-enriched complementary DNA (cDNA) libraries. By employing the terminal transferase activity of reverse transcriptase and the modified strand replacement method, this plasmid (assembled with a polydT end and a deoxyguanosine [dG] end) combines priming full-length cDNA strand synthesis and directional cDNA cloning. As a result, the number of steps involved in cDNA library preparation is decreased while simplifying downstream gene manipulation, sequencing, and subcloning. The 3G vector-primer plasmid method yields fully represented plasmid primed libraries that are equivalent to those made by the SMART (switching mechanism at 5' end of RNA transcript) approach.
Toehold-Mediated Displacement of an Adenosine-Binding Aptamer from a DNA Duplex by its Ligand.
Monserud, Jon H; Macri, Katherine M; Schwartz, Daniel K
2016-10-24
DNA is increasingly used to engineer dynamic nanoscale circuits, structures, and motors, many of which rely on DNA strand-displacement reactions. The use of functional DNA sequences (e.g., aptamers, which bind to a wide range of ligands) in these reactions would potentially confer responsiveness on such devices, and integrate DNA computation with highly varied molecular stimuli. By using high-throughput single-molecule FRET methods, we compared the kinetics of a putative aptamer-ligand and aptamer-complement strand-displacement reaction. We found that the ligands actively disrupted the DNA duplex in the presence of a DNA toehold in a similar manner to complementary DNA, with kinetic details specific to the aptamer structure, thus suggesting that the DNA strand-displacement concept can be extended to functional DNA-ligand systems. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Creating complex molecular topologies by configuring DNA four-way junctions
NASA Astrophysics Data System (ADS)
Liu, Di; Chen, Gang; Akhter, Usman; Cronin, Timothy M.; Weizmann, Yossi
2016-10-01
The realization of complex topologies at the molecular level represents a grand challenge in chemistry. This necessitates the manipulation of molecular interactions with high precision. Here we show that single-stranded DNA (ssDNA) knots and links can be created by utilizing the inherent topological properties that pertain to the DNA four-way junction, at which the two helical strands form a node and can be configured conveniently and connected for complex topological construction. Using this strategy, we produced series of ssDNA topoisomers with the same sequences. By finely designing the curvature and torsion, double-stranded DNA knots were accessed by hybridizing and ligating the complementary strands with the knotted ssDNA templates. Furthermore, we demonstrate the use of a constructed ssDNA knot both to probe the topological conversion catalysed by DNA topoisomerase and to study the DNA replication under topological constraint.
NASA Astrophysics Data System (ADS)
Xiong, Yanxiang; Wei, Min; Wei, Wei; Yin, Lihong; Pu, Yuepu; Liu, Songqin
2014-01-01
DNA hairpin structure probes are usually designed by forming intra-molecular duplex based on Watson-Crick hydrogen bonds. In this paper, a molecular beacon based on silver ions-mediated cytosine-Ag+-cytosine base pairs was used to detect DNA. The inherent characteristic of the metal ligation facilitated the design of functional probe and the adjustment of its binding strength compared to traditional DNA hairpin structure probes, which make it be used to detect DNA in a simple, rapid and easy way with the help of DNA strands displacement reaction. The method was sensitive and also possesses the good specificity to differentiate the single base mismatched DNA from the complementary DNA. It was also successfully applied to study the damage effect of classic genotoxicity chemicals such as styrene oxide and sodium arsenite on DNA, which was significant in food science, environmental science and pharmaceutical science.
Haas, Christian S; Creighton, Chad J; Pi, Xiujun; Maine, Ira; Koch, Alisa E; Haines, G Kenneth; Ling, Song; Chinnaiyan, Arul M; Holoshitz, Joseph
2006-07-01
To identify disease-specific gene expression profiles in patients with rheumatoid arthritis (RA), using complementary DNA (cDNA) microarray analyses on lymphoblastoid B cell lines (LCLs) derived from RA-discordant monozygotic (MZ) twins. The cDNA was prepared from LCLs derived from the peripheral blood of 11 pairs of RA-discordant MZ twins. The RA twin cDNA was labeled with cy5 fluorescent dye, and the cDNA of the healthy co-twin was labeled with cy3. To determine relative expression profiles, cDNA from each twin pair was combined and hybridized on 20,000-element microarray chips. Immunohistochemistry and real-time polymerase chain reaction were used to detect the expression of selected gene products in synovial tissue from patients with RA compared with patients with osteoarthritis and normal healthy controls. In RA twin LCLs compared with healthy co-twin LCLs, 1,163 transcripts were significantly differentially expressed. Of these, 747 were overexpressed and 416 were underexpressed. Gene ontology analysis revealed many genes known to play a role in apoptosis, angiogenesis, proteolysis, and signaling. The 3 most significantly overexpressed genes were laeverin (a novel enzyme with sequence homology to CD13), 11beta-hydroxysteroid dehydrogenase type 2 (a steroid pathway enzyme), and cysteine-rich, angiogenic inducer 61 (a known angiogenic factor). The products of these genes, heretofore uncharacterized in RA, were all abundantly expressed in RA synovial tissues. Microarray cDNA analysis of peripheral blood-derived LCLs from well-controlled patient populations is a useful tool to detect RA-relevant genes and could help in identifying novel therapeutic targets.
Qi, Jing; Dong, Zhen; Zhang, Yu-Xing
2015-12-01
The aim of the present study was to genetically modify plantlets of the Chinese yali pear to reduce their expression of ripening-associated 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) and therefore increase the shelf-life of the fruit. Primers were designed with selectivity for the conserved regions of published ACO gene sequences, and yali complementary DNA (cDNA) cloning was performed by reverse transcription quantitative polymerase chain reaction (PCR). The obtained cDNA fragment contained 831 base pairs, encoding 276 amino acid residues, and shared no less than 94% nucleotide sequence identity with other published ACO genes. The cDNA fragment was inversely inserted into a pBI121 expression vector, between the cauliflower mosaic virus 35S promoter and the nopaline synthase terminator, in order to construct the anti‑sense expression vector of the ACO gene; it was transfected into cultured yali plants using Agrobacterium LBA4404. Four independent transgenic lines of pear plantlets were obtained and validated by PCR analysis. A Southern blot assay revealed that there were three transgenic lines containing a single copy of exogenous gene and one line with double copies. The present study provided germplasm resources for the cultivation of novel storage varieties of pears, therefore providing a reference for further applications of anti‑sense RNA technology in the genetic improvement of pears and other fruit.
Seto, P; Hirayu, H; Magnusson, R P; Gestautas, J; Portmann, L; DeGroot, L J; Rapoport, B
1987-01-01
The thyroid microsomal antigen (MSA) in autoimmune thyroid disease is a protein of approximately 107 kD. We screened a human thyroid cDNA library constructed in the expression vector lambda gt11 with anti-107-kD monoclonal antibodies. Of five clones obtained, the recombinant beta-galactosidase fusion protein from one clone (PM-5) was confirmed to react with the monoclonal antiserum. The complementary DNA (cDNA) insert from PM-5 (0.8 kb) was used as a probe on Northern blot analysis to estimate the size of the mRNA coding for the MSA. The 2.9-kb messenger RNA (mRNA) species observed was the same size as that coding for human thyroid peroxidase (TPO). The probe did not bind to human liver mRNA, indicating the thyroid-specific nature of the PM-5-related mRNA. The nucleotide sequence of PM-5 (842 bp) was determined and consisted of a single open reading frame. Comparison of the nucleotide sequence of PM-5 with that presently available for pig TPO indicates 84% homology. In conclusion, a cDNA clone representing part of the microsomal antigen has been isolated. Sequence homology with porcine TPO, as well as identity in the size of the mRNA species for both the microsomal antigen and TPO, indicate that the microsomal antigen is, at least in part, TPO. Images PMID:3654979
Ogunremi, Oladele; Benjamin, Jane; MacDonald, Lily; Schimpf, Robert
2008-12-01
Newly developed serological tests for diagnosing parelaphostrongylosis in cervids, using the excretory-secretory products (ES) of the infective larvae of Parelaphostrongylus tenuis in enzyme-linked immunosorbent assays (ELISAs), have demonstrable superiority over the traditional method of larval recovery and microscopic identification. To generate a source of ELISA antigen by genetic engineering, we created a complementary DNA (cDNA) expression library by the reverse transcription of mRNA of P. tenuis adult worms, and ligation with the vector lambda-ZAP II. The library was screened using antisera produced in mice by immunization with a somatic antigen preparation of adult worms. Seventeen clones were isolated, sequenced, and checked for similarity to other DNA sequences in GenBank. A previously identified parasite gene encoding an aspartyl protease inhibitor (API) was isolated from the cDNA library, subcloned and expressed using the pET expression vector to produce a glutathione S transferase (GST)-His-S.Tag-P. tenuis API fusion protein (molecular weight = 63 kDa). An enzyme-linked immunosorbent assay utilizing the API fusion protein as the coating antigen was used to serologically diagnose all white-tailed deer (WTD, 10 out of 10) that had been inoculated with 6 - 150 L3 P. tenuis, indicating that the antigen may be a useful serodiagnostic antigen for P. tenuis infection in this cervid species.
Levine, Peter M; Gong, Ping; Levicky, Rastislav; Shepard, Kenneth L
2009-03-15
Optical biosensing based on fluorescence detection has arguably become the standard technique for quantifying extents of hybridization between surface-immobilized probes and fluorophore-labeled analyte targets in DNA microarrays. However, electrochemical detection techniques are emerging which could eliminate the need for physically bulky optical instrumentation, enabling the design of portable devices for point-of-care applications. Unlike fluorescence detection, which can function well using a passive substrate (one without integrated electronics), multiplexed electrochemical detection requires an electronically active substrate to analyze each array site and benefits from the addition of integrated electronic instrumentation to further reduce platform size and eliminate the electromagnetic interference that can result from bringing non-amplified signals off chip. We report on an active electrochemical biosensor array, constructed with a standard complementary metal-oxide-semiconductor (CMOS) technology, to perform quantitative DNA hybridization detection on chip using targets conjugated with ferrocene redox labels. A 4 x 4 array of gold working electrodes and integrated potentiostat electronics, consisting of control amplifiers and current-input analog-to-digital converters, on a custom-designed 5 mm x 3 mm CMOS chip drive redox reactions using cyclic voltammetry, sense DNA binding, and transmit digital data off chip for analysis. We demonstrate multiplexed and specific detection of DNA targets as well as real-time monitoring of hybridization, a task that is difficult, if not impossible, with traditional fluorescence-based microarrays.
Detection of DNA hybridization by ABEI electrochemiluminescence in DNA-chip compatible assembly.
Calvo-Muñoz, M-L; Dupont-Filliard, A; Billon, M; Guillerez, S; Bidan, G; Marquette, C; Blum, L
2005-04-01
The electrochemiluminescence (ECL) of a luminol derivate (ABEI) generated both by a carbon electrode and a polypyrrole-coated carbon electrode was examined. It was found that the polypyrrole film (ppy) did not inhibit the ECL. After that, ABEI anchored on a single stranded DNA target (ODNt) has been used for the ECL detection of the hybridization between a complementary single stranded DNA probe (ODNp) covalently linked to a polypyrrole support and the ODNt. The ECL detection has been performed using a DNA sensor having a low surface concentration of ODNp probes, constituted of a polypyrrole copolymer electrosynthesized from a pyrrole-ODNp/pyrrole monomer ratio of 1/20,000.
Teixeira, M M; Campaner, M; Camargo, E P
1994-01-01
To improve the diagnosis of Phytomonas infections in plants, we developed a polymerase chain reaction (PCR) assay using synthetic oligonucleotides complementary to conserved sequences of the 18S small subunit ribosomal (SSU) gene. From 10 ng upward of DNA of cultures of Phytomonas isolated from plants, fruits, and insects, PCR amplified an 800-bp DNA band that, after restriction analysis and probe hybridization, proved to be of 18S rDNA Phytomonas origin. PCR was also done with sap samples of tomatoes experimentally infected with Phytomonas, yielding amplified 800-bp ribosomal DNA bands before any flagellate could be detected by microscopic examination of the fruit sap.
Chang, Soyoung; Kilic, Tugba; Lee, Chang Kee; Avci, Huseyin; Bae, Hojae; Oskui, Shirin Mesbah; Jung, Sung Mi; Shin, Su Ryon; Kim, Seon Jeong
2018-04-08
The unique biological features of supramolecular DNA have led to an increasing interest in biomedical applications such as biosensors. We have developed an i-motif and G-rich DNA conjugated single-walled carbon nanotube hybrid materials, which shows reversible conformational switching upon external stimuli such as pH (5 and 8) and presence of ions (Li⁺ and K⁺). We observed reversible electrochemical redox activity upon external stimuli in a quick and robust manner. Given the ease and the robustness of this method, we believe that pH- and ion-driven reversible DNA structure transformations will be utilized for future applications for developing novel biosensors.
The origin of in situ hybridization - A personal history.
Gall, Joseph G
2016-04-01
In situ hybridization is the technique by which specific RNA or DNA molecules are detected in cytological preparations. Basically it involves formation of a hybrid molecule between an endogenous single-stranded RNA or DNA in the cell and a complementary single-stranded RNA or DNA probe. In its original form the probe was labeled with (3)H and the hybrid was detected by autoradiography. The first successful experiments in 1968 involved detection of the highly amplified ribosomal DNA in oocytes of the frog Xenopus, followed soon after by the reiterated "satellite DNA" in mouse and Drosophila chromosomes. Fluorescent probes were developed about ten years later. Copyright © 2015 Elsevier Inc. All rights reserved.
C-5 Propynyl Modifications Enhance the Mechanical Stability of DNA.
Aschenbrenner, Daniela; Baumann, Fabian; Milles, Lukas F; Pippig, Diana A; Gaub, Hermann E
2015-07-20
Increased thermal or mechanical stability of DNA duplexes is desired for many applications in nanotechnology or -medicine where DNA is used as a programmable building block. Modifications of pyrimidine bases are known to enhance thermal stability and have the advantage of standard base-pairing and easy integration during chemical DNA synthesis. Through single-molecule force spectroscopy experiments with atomic force microscopy and the molecular force assay we investigated the effect of pyrimidines harboring C-5 propynyl modifications on the mechanical stability of double-stranded DNA. Utilizing these complementary techniques, we show that propynyl bases significantly increase the mechanical stability if the DNA is annealed at high temperature. In contrast, modified DNA complexes formed at room temperature and short incubation times display the same stability as non-modified DNA duplexes. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
A fiber optic biosensor for fluorimetric detection of triple-helical DNA.
Uddin, A H; Piunno, P A; Hudson, R H; Damha, M J; Krull, U J
1997-10-15
A fiber optic biosensor was used for the fluorimetric detection of T/AT triple-helical DNA formation. The surfaces of two sets of fused silica optical fibers were functionalized with hexaethylene oxide linkers from which decaadenylic acid oligonucleotides were grown in the 3'to 5'and 5'to 3'direction, respectively, using a DNA synthesizer. Fluorescence studies of hybridization showed unequivocal hybridization between oligomers immobilized on the fibers and complementary oligonucleotides from the solution phase, as detected by fluorescence from intercalated ethidium bromide. The complementary oligonucleotide, dT10, which was expected to Watson-Crick hybridize upon cooling the system below the duplex melting temperature ( T m), provided a fluorescence intensity with a negative temperature coefficient. Upon further cooling, to the point where the pyrimidine motif T*AT triple-helix formation occurred, a fluorescence intensity change with a positive temperature coefficient was observed. The reverse-Hoogsteen T.AT triplex, which is known to form with branched nucleic acids, provided a corresponding decrease in fluorescence intensity with decreasing temperature. Full analytical signal evolution was attainable in minutes.
Self-Assembly of Octopus Nanoparticles into Pre-Programmed Finite Clusters
NASA Astrophysics Data System (ADS)
Halverson, Jonathan; Tkachenko, Alexei
2012-02-01
The precise control of the spatial arrangement of nanoparticles (NP) is often required to take full advantage of their novel optical and electronic properties. NPs have been shown to self-assemble into crystalline structures using either patchy surface regions or complementary DNA strands to direct the assembly. Due to a lack of specificity of the interactions these methods lead to only a limited number of structures. An emerging approach is to bind ssDNA at specific sites on the particle surface making so-called octopus NPs. Using octopus NPs we investigate the inverse problem of the self-assembly of finite clusters. That is, for a given target cluster (e.g., arranging the NPs on the vertices of a dodecahedron) what are the minimum number of complementary DNA strands needed for the robust self-assembly of the cluster from an initially homogeneous NP solution? Based on the results of Brownian dynamics simulations we have compiled a set of design rules for various target clusters including cubes, pyramids, dodecahedrons and truncated icosahedrons. Our approach leads to control over the kinetic pathway and has demonstrated nearly perfect yield of the target.
Dysregulation of RNA Interference in Breast Cancer
2007-07-01
of miRNA complementary elements in 3-UTR of target mRNAs, the concentration in the seed (6–8 bp) of continuous Watson - Crick base pairing in the 5...treated the transfected cells with the anticancer drug topotecan (TPT) that is known to inhibit DNA topoisomerase I and cause DNA damage (Tanizawa et...as DNA damage caused by TPT, can increase the inhibitory effect mediated by R el at iv e C el l G ro w th R el at iv e C el l G ro w th Negative
Korch, C
1987-01-01
A cross index is presented for using the improved selectivity offered by the Hung and Wensink (Nucl. Acids Res. 12, 1863-1874, 1984) method of partially filling in 5'-extensions produced by type II restriction endonucleases. After this treatment, DNA fragments which normally cannot be ligated to one another, can be joined providing that complementary cohesive ends have been generated. The uses of this technique, which include the prevention of DNA fragments (both vector and insert) auto-annealing, are discussed. PMID:3033600
The generative power of weighted one-sided and regular sticker systems
NASA Astrophysics Data System (ADS)
Siang, Gan Yee; Heng, Fong Wan; Sarmin, Nor Haniza; Turaev, Sherzod
2014-06-01
Sticker systems were introduced in 1998 as one of the DNA computing models by using the recombination behavior of DNA molecules. The Watson-Crick complementary principle of DNA molecules is abstractly used in the sticker systems to perform the computation of sticker systems. In this paper, the generative power of weighted one-sided sticker systems and weighted regular sticker systems are investigated. Moreover, the relationship of the families of languages generated by these two variants of sticker systems to the Chomsky hierarchy is also presented.
Autonomous generation and loading of DNA guides by bacterial Argonaute
Chandradoss, Stanley D.; Zhu, Yifan; Timmers, Elizabeth M.; Zhang, Yong; Zhao, Hongtu; Lou, Jizhong; Wang, Yanli; Joo, Chirlmin; van der Oost, John
2018-01-01
Summary Several prokaryotic Argonaute proteins (pAgos) utilize small DNA guides to mediate host defense by targeting invading DNA complementary to the DNA guide. It is unknown how these DNA guides are being generated and loaded onto pAgo. Here we demonstrate that guide-free Argonaute from Thermus thermophilus (TtAgo) can degrade dsDNA, thereby generating small dsDNA fragments that subsequently are loaded onto TtAgo. Combining single-molecule fluorescence, molecular dynamic simulations and structural studies, we show that TtAgo loads dsDNA molecules with a preference towards a deoxyguanosine on the passenger strand at the position opposite to the 5’-end of the guide strand. This explains why in vivo TtAgo is preferentially loaded with guides with a 5’-end deoxycytidine. Our data demonstrate that TtAgo can independently generate and selectively load functional DNA guides. PMID:28262506
NASA Technical Reports Server (NTRS)
Kozlov, I. A.; Politis, P. K.; Van Aerschot, A.; Busson, R.; Herdewijn, P.; Orgel, L. E.; Bada, J. L. (Principal Investigator); Dolan, M. (Principal Investigator)
1999-01-01
Hexitol nucleic acid (HNA) is an analogue of DNA containing the standard nucleoside bases, but with a phosphorylated 1,5-anhydrohexitol backbone. HNA oligomers form duplexes having the nucleic acid A structure with complementary DNA or RNA oligomers. The HNA decacytidylate oligomer is an efficient template for the oligomerization of the 5'-phosphoroimidazolides of guanosine or deoxyguanosine. Comparison of the oligomerization efficiencies on HNA, RNA, and DNA decacytidylate templates under various conditions suggests strongly that only nucleic acid double helices with the A structure support efficient template-directed synthesis when 5'-phosphoroimidazolides of nucleosides are used as substrates.
Kinetic Self-Assembly of DNA Tiles and Bricks
2016-08-26
research, and educa- tion. This is achieved by freeze drying cell-free systems into paper and other porous substrates to create materials with the...different toehold switches on paper . Experiments were performed by freeze drying the recombinant PT7 expression system onto paper discs, along with linear...DNA encoding specific switch RNAs. The paper discs were rehy- drated with or without the complementary RNA trigger 24 hr after drying and then
Bilbao, Nerea; Destoop, Iris; De Feyter, Steven; González-Rodríguez, David
2016-01-11
We present an approach that makes use of DNA base pairing to produce hydrogen-bonded macrocycles whose supramolecular structure can be transferred from solution to a solid substrate. A hierarchical assembly process ultimately leads to two-dimensional nanostructured porous networks that are able to host size-complementary guests. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Prithiviraj, Jothikumar; Hill, Vincent; Jothikumar, Narayanan
2012-04-20
In this study we report the development of a simple target-specific isothermal nucleic acid amplification technique, termed genome exponential amplification reaction (GEAR). Escherichia coli was selected as the microbial target to demonstrate the GEAR technique as a proof of concept. The GEAR technique uses a set of four primers; in the present study these primers targeted 5 regions on the 16S rRNA gene of E. coli. The outer forward and reverse Tab primer sequences are complementary to each other at their 5' end, whereas their 3' end sequences are complementary to their respective target nucleic acid sequences. The GEAR assay was performed at a constant temperature 60 °C and monitored continuously in a real-time PCR instrument in the presence of an intercalating dye (SYTO 9). The GEAR assay enabled amplification of as few as one colony forming units of E. coli per reaction within 30 min. We also evaluated the GEAR assay for rapid identification of bacterial colonies cultured on agar media directly in the reaction without DNA extraction. Cells from E. coli colonies were picked and added directly to GEAR assay mastermix without prior DNA extraction. DNA in the cells could be amplified, yielding positive results within 15 min. Published by Elsevier Inc.
Amarger, V; Mercier, L
1995-01-01
We have applied the recently developed technique of random amplified polymorphic DNA (RAPD) for the discrimination between two jojoba clones at the genomic level. Among a set of 30 primers tested, a simple reproducible pattern with three distinct fragments for clone D and two distinct fragments for clone E was obtained with primer OPB08. Since RAPD products are the results of arbitrarily priming events and because a given primer can amplify a number of non-homologous sequences, we wondered whether or not RAPD bands, even those of similar size, were derived from different loci in the two clones. To answer this question, two complementary approaches were used: i) cloning and sequencing of the amplification products from clone E; and ii) complementary Southern analysis of RAPD gels using cloned or amplified fragments (directly recovered from agarose gels) as RFLP probes. The data reported here show that the RAPD reaction generates multiple amplified fragments. Some fragments, although resolved as a single band on agarose gels, contain different DNA species of the same size. Furthermore, it appears that the cloned RAPD products of known sequence that do not target repetitive DNA can be used as hybridization probes in RFLP to detect a polymorphism among individuals.
Adenovirus type 2 DNA replication. I. Evidence for discontinuous DNA synthesis.
Winnacker, E L
1975-01-01
Isolated nuclei from adenovirus type 2-infected HeLa cells catalyze the incorporation of all four deoxyribonucleoside triphosphates into viral DNA. The observed DNA synthesis occurs via a transient formation of DNA fragments with a sedimentation coefficient of 10S. The fragments are precursors to unit-length viral DNA, they are self-complementary to an extent of at least 70%, and they are distributed along most of the viral chromosome. In addition, accumulation of 10S DNA fragments is observed either in intact, virus-infected HeLa cells under conditions where viral DNA synthesis is inhibited by hydroxyurea or in isolated nuclei from virus-infected HeLa cells at low concentrations of deoxyribonucleotides. Under these suboptimal conditions for DNA synthesis in isolated nuclei, ribonucleoside triphosphates determine the size distribution of DNA intermediates. The evidence presented suggests that a ribonucleoside-dependent initiation step as well at two DNA polymerase catalyzed reactions are involved in the discontinuous replication of adenovirus type 2 DNA. PMID:1117487
Maruyama, Sandra Regina; Castro-Jorge, Luiza Antunes; Ribeiro, José Marcos Chaves; Gardinassi, Luiz Gustavo; Garcia, Gustavo Rocha; Brandão, Lucinda Giampietro; Rodrigues, Aline Rezende; Okada, Marcos Ituo; Abrão, Emiliana Pereira; Ferreira, Beatriz Rossetti; da Fonseca, Benedito Antonio Lopes; de Miranda-Santos, Isabel Kinney Ferreira
2013-01-01
Transcripts similar to those that encode the nonstructural (NS) proteins NS3 and NS5 from flaviviruses were found in a salivary gland (SG) complementary DNA (cDNA) library from the cattle tick Rhipicephalus microplus. Tick extracts were cultured with cells to enable the isolation of viruses capable of replicating in cultured invertebrate and vertebrate cells. Deep sequencing of the viral RNA isolated from culture supernatants provided the complete coding sequences for the NS3 and NS5 proteins and their molecular characterisation confirmed similarity with the NS3 and NS5 sequences from other flaviviruses. Despite this similarity, phylogenetic analyses revealed that this potentially novel virus may be a highly divergent member of the genus Flavivirus. Interestingly, we detected the divergent NS3 and NS5 sequences in ticks collected from several dairy farms widely distributed throughout three regions of Brazil. This is the first report of flavivirus-like transcripts in R. microplus ticks. This novel virus is a potential arbovirus because it replicated in arthropod and mammalian cells; furthermore, it was detected in a cDNA library from tick SGs and therefore may be present in tick saliva. It is important to determine whether and by what means this potential virus is transmissible and to monitor the virus as a potential emerging tick-borne zoonotic pathogen. PMID:24626302
Wang, Haibo; Ao, Pingxing; Yang, Shuanglong; Zou, Zhurong; Wang, Shasha; Gong, Ming
2015-03-01
Proline dehydrogenase (ProDH) (EC 1.5.99.8) is a key enzyme in the catabolism of proline. The enzyme JcProDH and its complementary DNA (cDNA) were isolated from Jatropha curcas L., an important woody oil plant used as a raw material for biodiesels. It has been classified as a member of the Pro_dh superfamily based on multiple sequence alignment, phylogenetic characterization, and its role in proline catabolism. Its cDNA is 1674 bp in length with a complete open reading frame of 1485 bp, which encodes a polypeptide chain of 494 amino acids with a predicted molecular mass of 54 kD and a pI of 8.27. Phylogenetic analysis indicated that JcProDH showed high similarity with ProDH from other plants. Reverse transcription PCR (RT-PCR) analysis revealed that JcProDH was especially abundant in the seeds and flowers but scarcely present in the stems, roots, and leaves. In addition, the expression of JcProDH increased in leaves experiencing environmental stress such as cold (5 °C), heat (42 °C), salt (300 mM), and drought (30 % PEG6000). The JcProDH protein was successfully expressed in the yeast strain INVSc1 and showed high enzyme activity in proline catabolism. This result confirmed that the JcProDH gene negatively participated in the stress response.
Complementary-encoding holographic associative memory using a photorefractive crystal
NASA Astrophysics Data System (ADS)
Yuan, ShiFu; Wu, Minxian; Yan, Yingbai; Jin, Guofan
1996-06-01
We present a holographic implementation of accurate associative memory with only one holographic memory system. In the implementation, the stored and test images are coded by using complementary-encoding method. The recalled complete image is also a coded image that can be decoded with a decoding mask to get an original image or its complement image. The experiment shows that the complementary encoding can efficiently increase the addressing accuracy in a simple way. Instead of the above complementary-encoding method, a scheme that uses complementary area-encoding method is also proposed for the holographic implementation of gray-level image associative memory with accurate addressing.
Comte, Caroline; Tonin, Yann; Heckel-Mager, Anne-Marie; Boucheham, Abdeldjalil; Smirnov, Alexandre; Auré, Karine; Lombès, Anne; Martin, Robert P.; Entelis, Nina; Tarassov, Ivan
2013-01-01
Mitochondrial mutations, an important cause of incurable human neuromuscular diseases, are mostly heteroplasmic: mutated mitochondrial DNA is present in cells simultaneously with wild-type genomes, the pathogenic threshold being generally >70% of mutant mtDNA. We studied whether heteroplasmy level could be decreased by specifically designed oligoribonucleotides, targeted into mitochondria by the pathway delivering RNA molecules in vivo. Using mitochondrially imported RNAs as vectors, we demonstrated that oligoribonucleotides complementary to mutant mtDNA region can specifically reduce the proportion of mtDNA bearing a large deletion associated with the Kearns Sayre Syndrome in cultured transmitochondrial cybrid cells. These findings may be relevant to developing of a new tool for therapy of mtDNA associated diseases. PMID:23087375
NASA Astrophysics Data System (ADS)
Reiß, Edda; Hölzel, Ralph; von Nickisch-Rosenegk, Markus; Bier, Frank F.
2006-09-01
In this article the usefulness of the enzyme phi29 DNA polymerase and the principle of rolling circle amplification (RCA) for creating single-stranded DNA (ssDNA) nanostructures is described. Currently we are working on the spatial orientation of a growing ssDNA molecule during its RCA-based synthesis by the application of a hydrodynamic force. Starting at an immobilized primer at single molecule level, the aim is to construct a nanostructure of known location and orientation, providing multiple repeating binding sites that can be addressed via complementary base-pairing. Proof-of-principle experiments demonstrate the potential of the enzymatic reaction. ssDNA molecules of more than 20 μm length were created at an immobilized primer and detected by means of fluorescence microscopy.
A new approach for cloning hLIF cDNA from genomic DNA isolated from the oral mucous membrane.
Cui, Y H; Zhu, G Q; Chen, Q J; Wang, Y F; Yang, M M; Song, Y X; Wang, J G; Cao, B Y
2011-11-25
Complementary DNA (cDNA) is valuable for investigating protein structure and function in the study of life science, but it is difficult to obtain by traditional reverse transcription. We employed a novel strategy to clone human leukemia inhibitory factor (hLIF) gene cDNA from genomic DNA, which was directly isolated from the mucous membrane of mouth. The hLIF sequence, which is 609 bp long and is composed of three exons, can be acquired within a few hours by amplifying each exon and splicing all of them using overlap-PCR. This new approach developed is simple, time- and cost-effective, without RNA preparation or cDNA synthesis, and is not limited to the specific tissues for a particular gene and the expression level of the gene.
DNA Origami: Folded DNA-Nanodevices That Can Direct and Interpret Cell Behavior
Kearney, Cathal J.; Lucas, Christopher R.; O'Brien, Fergal J.; Castro, Carlos E.
2016-01-01
DNA origami is a DNA-based nanotechnology that utilizes programmed combinations of short complementary oligonucleotides to fold a large single strand of DNA into precise 2-D and 3-D shapes. The exquisite nanoscale shape control of this inherently biocompatible material is combined with the potential to spatially address the origami structures with diverse cargos including drugs, antibodies, nucleic acid sequences, small molecules and inorganic particles. This programmable flexibility enables the fabrication of precise nanoscale devices that have already shown great potential for biomedical applications such as: drug delivery, biosensing and synthetic nanopore formation. In this Progress Report, we will review the advances in the DNA origami field since its inception several years ago and then focus on how these DNA-nanodevices can be designed to interact with cells to direct or probe their behavior. PMID:26840503
Crespo-Hernandez, Carlos E; Close, David M; Gorb, Leonid; Leszczynski, Jerzy
2007-05-17
Redox potentials for the DNA nucleobases and nucleosides, various relevant nucleoside analogues, Watson-Crick base pairs, and seven organic dyes are presented based on DFT/B3LYP/6-31++G(d,p) and B3YLP/6-311+G(2df,p)//B3LYP/6-31+G* levels of calculations. The values are determined from an experimentally calibrated set of equations that correlate the vertical ionization (electron affinity) energy of 20 organic molecules with their experimental reversible oxidation (reduction) potential. Our results are in good agreement with those estimated experimentally for the DNA nucleosides in acetonitrile solutions (Seidel et al. J. Phys. Chem. 1996, 100, 5541). We have found that nucleosides with anti conformation exhibit lower oxidation potentials than the corresponding syn conformers. The lowering in the oxidation potential is due to the formation of an intramolecular hydrogen bonding interaction between the 5'-OH group of the sugar and the N3 of the purine bases or C2=O of the pyrimidine bases in the syn conformation. Pairing of adenine or guanine with its complementary pyrimidine base decreases its oxidation potential by 0.15 or 0.28 V, respectively. The calculated energy difference between the oxidation potential for the G.C base pair and that of the guanine base is in good agreement with the experimental value estimated recently (0.34 V: Caruso, T.; et al. J. Am. Chem. Soc. 2005, 127, 15040). The complete and consistent set of reversible redox values determined in this work for the DNA constituents is expected to be of considerable value to those studying charge and electronic energy transfer in DNA.
Loo, Jacky F C; Lau, P M; Ho, H P; Kong, S K
2013-10-15
Based on a recently reported ultra-sensitive bio-barcode (BBC) assay, we have developed an aptamer-based bio-barcode (ABC) alternative to detect a cell death marker cytochrome-c (Cyto-c) and its subsequent application to screen anti-cancer drugs. Aptamer is a short single-stranded DNA selected from a synthetic DNA library by virtue of its high binding affinity and specificity to its target based on its unique 3D structure from the nucleotide sequence after folding. In the BBC assay, an antigen (Ag) in analytes is captured by a micro-magnetic particle (MMP) coated with capturing antibodies (Abs). Gold nanoparticles (NPs) with another recognition Ab against the same target and hundreds of identical DNA molecules of known sequence are subsequently added to allow the formation of sandwich structures ([MMP-Ab1]-Ag-[Ab2-NP-DNA]). After isolating the sandwiches by a magnetic field, the DNAs hybridized to their complementary DNAs covalently bound on the NPs are released from the sandwiches after heating. Acting as an Ag identification tag, these bio-barcode DNAs with known DNA sequence are then amplified by polymerase chain reaction (PCR) and detected by fluorescence. In our ABC assay, we employed a Cyto-c-specific aptamer to substitute both the recognition Ab and barcode DNAs on the NPs in the BBC assay; and a novel isothermal recombinase polymerase amplification for the time-consuming PCR. The detection limit of our ABC assay for the Cyto-c was found to be 10 ng/mL and this new assay can be completed within 3h. Several potential anti-cancer drugs have been tested in vitro for their efficacy to kill liver cancer with or without multi-drug resistance. © 2013 Elsevier B.V. All rights reserved.
Röder, Christoph; König, Helmut; Fröhlich, Jürgen
2007-09-01
Sequencing of the complete 26S rRNA genes of all Dekkera/Brettanomyces species colonizing different beverages revealed the potential for a specific primer and probe design to support diagnostic PCR approaches and FISH. By analysis of the complete 26S rRNA genes of all five currently known Dekkera/Brettanomyces species (Dekkera bruxellensis, D. anomala, Brettanomyces custersianus, B. nanus and B. naardenensis), several regions with high nucleotide sequence variability yet distinct from the D1/D2 domains were identified. FISH species-specific probes targeting the 26S rRNA gene's most variable regions were designed. Accessibility of probe targets for hybridization was facilitated by the construction of partially complementary 'side'-labeled probes, based on secondary structure models of the rRNA sequences. The specificity and routine applicability of the FISH-based method for yeast identification were tested by analyzing different wine isolates. Investigation of the prevalence of Dekkera/Brettanomyces yeasts in the German viticultural regions Wonnegau, Nierstein and Bingen (Rhinehesse, Rhineland-Palatinate) resulted in the isolation of 37 D. bruxellensis strains from 291 wine samples.
Pooled-matrix protein interaction screens using Barcode Fusion Genetics.
Yachie, Nozomu; Petsalaki, Evangelia; Mellor, Joseph C; Weile, Jochen; Jacob, Yves; Verby, Marta; Ozturk, Sedide B; Li, Siyang; Cote, Atina G; Mosca, Roberto; Knapp, Jennifer J; Ko, Minjeong; Yu, Analyn; Gebbia, Marinella; Sahni, Nidhi; Yi, Song; Tyagi, Tanya; Sheykhkarimli, Dayag; Roth, Jonathan F; Wong, Cassandra; Musa, Louai; Snider, Jamie; Liu, Yi-Chun; Yu, Haiyuan; Braun, Pascal; Stagljar, Igor; Hao, Tong; Calderwood, Michael A; Pelletier, Laurence; Aloy, Patrick; Hill, David E; Vidal, Marc; Roth, Frederick P
2016-04-22
High-throughput binary protein interaction mapping is continuing to extend our understanding of cellular function and disease mechanisms. However, we remain one or two orders of magnitude away from a complete interaction map for humans and other major model organisms. Completion will require screening at substantially larger scales with many complementary assays, requiring further efficiency gains in proteome-scale interaction mapping. Here, we report Barcode Fusion Genetics-Yeast Two-Hybrid (BFG-Y2H), by which a full matrix of protein pairs can be screened in a single multiplexed strain pool. BFG-Y2H uses Cre recombination to fuse DNA barcodes from distinct plasmids, generating chimeric protein-pair barcodes that can be quantified via next-generation sequencing. We applied BFG-Y2H to four different matrices ranging in scale from ~25 K to 2.5 M protein pairs. The results show that BFG-Y2H increases the efficiency of protein matrix screening, with quality that is on par with state-of-the-art Y2H methods. © 2016 The Authors. Published under the terms of the CC BY 4.0 license.
Wallen, Rachel; Gokarn, Nirmal; Bercea, Priscila; Grzincic, Elissa; Bandyopadhyay, Krisanu
2015-12-01
Vertically aligned single-walled carbon nanotube (VASWCNT) assemblies are generated on cysteamine and 2-mercaptoethanol (2-ME)-functionalized gold surfaces through amide bond formation between carboxylic groups generated at the end of acid-shortened single-walled carbon nanotubes (SWCNTs) and amine groups present on the gold surfaces. Atomic force microscopy (AFM) imaging confirms the vertical alignment mode of SWCNT attachment through significant changes in surface roughness compared to bare gold surfaces and the lack of any horizontally aligned SWCNTs present. These SWCNT assemblies are further modified with an amine-terminated single-stranded probe-DNA. Subsequent hybridization of the surface-bound probe-DNA in the presence of complementary strands in solution is followed using impedance measurements in the presence of Fe(CN)6 (3-/4-) as the redox probe in solution, which show changes in the interfacial electrochemical properties, specifically the charge-transfer resistance, due to hybridization. In addition, hybridization of the probe-DNA is also compared when it is attached directly to the gold surfaces without any intermediary SWCNTs. Contrary to our expectations, impedance measurements show a decrease in charge-transfer resistance with time due to hybridization with 300 nM complementary DNA in solution with the probe-DNA attached to SWCNTs. In contrast, an increase in charge-transfer resistance is observed with time during hybridization when the probe-DNA is attached directly to the gold surfaces. The decrease in charge-transfer resistance during hybridization in the presence of VASWCNTs indicates an enhancement in the electron transfer process of the redox probe at the VASWCNT-modified electrode. The results suggest that VASWCNTs are acting as mediators of electron transfer, which facilitate the charge transfer of the redox probe at the electrode-solution interface.
NASA Astrophysics Data System (ADS)
Wallen, Rachel; Gokarn, Nirmal; Bercea, Priscila; Grzincic, Elissa; Bandyopadhyay, Krisanu
2015-06-01
Vertically aligned single-walled carbon nanotube (VASWCNT) assemblies are generated on cysteamine and 2-mercaptoethanol (2-ME)-functionalized gold surfaces through amide bond formation between carboxylic groups generated at the end of acid-shortened single-walled carbon nanotubes (SWCNTs) and amine groups present on the gold surfaces. Atomic force microscopy (AFM) imaging confirms the vertical alignment mode of SWCNT attachment through significant changes in surface roughness compared to bare gold surfaces and the lack of any horizontally aligned SWCNTs present. These SWCNT assemblies are further modified with an amine-terminated single-stranded probe-DNA. Subsequent hybridization of the surface-bound probe-DNA in the presence of complementary strands in solution is followed using impedance measurements in the presence of Fe(CN)6 3-/4- as the redox probe in solution, which show changes in the interfacial electrochemical properties, specifically the charge-transfer resistance, due to hybridization. In addition, hybridization of the probe-DNA is also compared when it is attached directly to the gold surfaces without any intermediary SWCNTs. Contrary to our expectations, impedance measurements show a decrease in charge-transfer resistance with time due to hybridization with 300 nM complementary DNA in solution with the probe-DNA attached to SWCNTs. In contrast, an increase in charge-transfer resistance is observed with time during hybridization when the probe-DNA is attached directly to the gold surfaces. The decrease in charge-transfer resistance during hybridization in the presence of VASWCNTs indicates an enhancement in the electron transfer process of the redox probe at the VASWCNT-modified electrode. The results suggest that VASWCNTs are acting as mediators of electron transfer, which facilitate the charge transfer of the redox probe at the electrode-solution interface.
Circulating Tumor Cells Versus Circulating Tumor DNA in Colorectal Cancer: Pros and Cons
Tan, Carlyn Rose C.; Zhou, Lanlan
2016-01-01
Circulating tumor cells (CTCs) and circulating tumor DNA (ctDNA) are emerging noninvasive multifunctional biomarkers in liquid biopsy allowing for early diagnosis, accurate prognosis, therapeutic target selection, spatiotemporal monitoring of metastasis, as well as monitoring response and resistance to treatment. CTCs and ctDNA are released from different tumor types at different stages and contribute complementary information for clinical decision. Although big strides have been taken in technology development for detection, isolation and characterization of CTCs and sensitive and specific detection of ctDNA, CTC-, and ctDNA-based liquid biopsies may not be widely adopted for routine cancer patient care until the suitability, accuracy, and reliability of these tests are validated and more standardized protocols are corroborated in large, independent, prospectively designed trials. This review covers CTC- and ctDNA-related technologies and their application in colorectal cancer. The promise of CTC-and ctDNA-based liquid biopsies is envisioned. PMID:27516729
DNA methylation dynamics during in vivo differentiation of blood and skin stem cells
Bock, Christoph; Beerman, Isabel; Lien, Wen-Hui; Smith, Zachary D.; Gu, Hongcang; Boyle, Patrick; Gnirke, Andreas; Fuchs, Elaine; Rossi, Derrick J.; Meissner, Alexander
2012-01-01
DNA methylation is a mechanism of epigenetic regulation that is common to all vertebrates. Functional studies underscore its relevance for tissue homeostasis, but the global dynamics of DNA methylation during in vivo differentiation remain underexplored. Here we report high-resolution DNA methylation maps of adult stem cell differentiation in mouse, focusing on 19 purified cell populations of the blood and skin lineages. DNA methylation changes were locus-specific and relatively modest in magnitude. They frequently overlapped with lineage-associated transcription factors and their binding sites, suggesting that DNA methylation may protect cells from aberrant transcription factor activation. DNA methylation and gene expression provided complementary information, and combining the two enabled us to infer the cellular differentiation hierarchy of the blood lineage directly from genomic data. In summary, these results demonstrate that in vivo differentiation of adult stem cells is associated with small but informative changes in the genomic distribution of DNA methylation. PMID:22841485
Multisegment nanowire sensors for the detection of DNA molecules.
Wang, Xu; Ozkan, Cengiz S
2008-02-01
We describe a novel application for detecting specific single strand DNA sequences using multisegment nanowires via a straightforward surface functionalization method. Nanowires comprising CdTe-Au-CdTe segments are fabricated using electrochemical deposition, and electrical characterization indicates a p-type behavior for the multisegment nanostructures, in a back-to-back Schottky diode configuration. Such nanostructures modified with thiol-terminated probe DNA fragments could function as high fidelity sensors for biomolecules at very low concentration. The gold segment is utilized for functionalization and binding of single strand DNA (ssDNA) fragments while the CdTe segments at both ends serve to modulate the equilibrium Fermi level of the heterojunction device upon hybridization of the complementary DNA fragments (cDNA) to the ssDNA over the Au segment. Employing such multisegment nanowires could lead to the fabrication more sophisticated and high multispecificity biosensors via selective functionalization of individual segments for biowarfare sensing and medical diagnostics applications.
Circulating Tumor Cells Versus Circulating Tumor DNA in Colorectal Cancer: Pros and Cons.
Tan, Carlyn Rose C; Zhou, Lanlan; El-Deiry, Wafik S
2016-06-01
Circulating tumor cells (CTCs) and circulating tumor DNA (ctDNA) are emerging noninvasive multifunctional biomarkers in liquid biopsy allowing for early diagnosis, accurate prognosis, therapeutic target selection, spatiotemporal monitoring of metastasis, as well as monitoring response and resistance to treatment. CTCs and ctDNA are released from different tumor types at different stages and contribute complementary information for clinical decision. Although big strides have been taken in technology development for detection, isolation and characterization of CTCs and sensitive and specific detection of ctDNA, CTC-, and ctDNA-based liquid biopsies may not be widely adopted for routine cancer patient care until the suitability, accuracy, and reliability of these tests are validated and more standardized protocols are corroborated in large, independent, prospectively designed trials. This review covers CTC- and ctDNA-related technologies and their application in colorectal cancer. The promise of CTC-and ctDNA-based liquid biopsies is envisioned.
Istrate, Alena; Katolik, Adam; Istrate, Andrei; Leumann, Christian J
2017-08-01
We describe the synthesis, thermal stability, structural and RNase H activation properties of 2'β-fluoro-tricyclo nucleic acids (2'F-tc-ANA). Three 2'F-tc-ANA nucleosides (T, 5Me C and A) were synthesized starting from a previously described fluorinated tricyclo sugar intermediate. NMR analysis and quantum mechanical calculations indicate that 2'F-tc-ANA nucleosides prefer sugar conformations in the East and South regions of the pseudorotational cycle. UV-melting experiments revealed that non-consecutive insertions of 2'F-tc-ANA units in DNA reduce the affinity to DNA and RNA complements. However, an oligonucleotide with five contiguous 2'F-tc-ANA-T insertions exhibits increased affinity to complementary RNA. Moreover, a fully modified 10-mer 2'F-tc-ANA oligonucleotide paired to both DNA (+1.6 °C/mod) and RNA (+2.5 °C/mod) with significantly higher affinity compared to corresponding unmodified DNA, and similar affinity compared to corresponding tc-DNA. In addition, CD spectroscopy and molecular dynamics simulations indicate that the conformation of the 2'F-tc-ANA/RNA duplex is similar to that of a DNA/RNA duplex. Moreover, in some sequence contexts, 2'F-tc-ANA promotes RNase H-mediated cleavage of a complementary RNA strand. Taken together, 2'F-tc-ANA represents a nucleic acid analogue that offers the advantage of high RNA affinity while maintaining the ability to activate RNase H, and can be considered a prospective candidate for gene silencing applications. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Dedkov, V S
2009-01-01
The specificity of DNA-methyltransferase M.Bsc4I was defined in cellular lysate of Bacillus schlegelii 4. For this purpose, we used methylation sensitivity of restriction endonucleases, and also modeling of methylation. The modeling consisted in editing sequences of DNA using replacements of methylated bases and their complementary bases. The substratum DNA processed by M.Bsc4I also were used for studying sensitivity of some restriction endonucleases to methylation. Thus, it was shown that M.Bsc4I methylated 5'-Cm4CNNNNNNNGG-3' and the overlapped dcm-methylation blocked its activity. The offered approach can appear universal enough and simple for definition of specificity of DNA-methyltransferases.
Kurata, Shinya; Kanagawa, Takahiro; Yamada, Kazutaka; Torimura, Masaki; Yokomaku, Toyokazu; Kamagata, Yoichi; Kurane, Ryuichiro
2001-01-01
We have developed a simple method for the quantitative detection of specific DNA or RNA molecules based on the finding that BODIPY® FL fluorescence was quenched by its interaction with a uniquely positioned guanine. This approach makes use of an oligonucleotide probe or primer containing a BODIPY® FL-modified cytosine at its 5′-end. When such a probe was hybridized with a target DNA, its fluorescence was quenched by the guanine in the target, complementary to the modified cytosine, and the quench rate was proportional to the amount of target DNA. This widely applicable technique will be used directly with larger samples or in conjunction with the polymerase chain reaction to quantify small DNA samples. PMID:11239011
Dynamic Properties of DNA-Programmable Nanoparticle Crystallization.
Yu, Qiuyan; Zhang, Xuena; Hu, Yi; Zhang, Zhihao; Wang, Rong
2016-08-23
The dynamics of DNA hybridization is very important in DNA-programmable nanoparticle crystallization. Here, coarse-grained molecular dynamics is utilized to explore the structural and dynamic properties of DNA hybridizations for a self-complementary DNA-directed nanoparticle self-assembly system. The hexagonal close-packed (HCP) and close-packed face-centered cubic (FCC) ordered structures are identified for the systems of different grafted DNA chains per nanoparticle, which are in good agreement with the experimental results. Most importantly, the dynamic crystallization processes of DNA hybridizations are elucidated by virtue of the mean square displacement, the percentage of hybridizations, and the lifetime of DNA bonds. The lifetime can be modeled by the DNA dehybridization, which has an exponential form. The lifetime of DNA bonds closely depends on the temperature. A suitable temperature for the DNA-nanoparticle crystallization is obtained in the work. Moreover, a too large volume fraction hinders the self-assembly process due to steric effects. This work provides some essential information for future design of nanomaterials.
DOE Office of Scientific and Technical Information (OSTI.GOV)
White, D.A.; Zilinskas, B.A.
1991-08-01
The authors now report the nucleotide sequence of the cytosolic Cu/Zn SOD cloned from a {lambda}gt11 cDNA library constructed from mRNA extracted from leaves of 7- to 10-d pea seedlings (Pisum sativum L.). The clone was isolated using a 22-base synthetic oligonucleotide complementary to the amino acid sequence CGIIGLQG. This sequence, found at the protein's carboxy terminus, is highly conserved among plant cytosolic Cu/Zn SODs but not chloroplastic Cu/Zn SODs. The 738-base pair sequence contains an open reading frame specifying 152 codons and a predicted M{sub r} of 18,024 D. The deduced amino acid sequence is highly homologous (79-82% identity)more » with the sequences of other known plant cytosolic Cu/Zn SODs but less highly conserved (63-65%) when compared with several chloroplastic Cu/Zn SODs including pea (10).« less
Miroshnichenko, O I; Ponomareva, T I; Tikchonenko, T I
1989-12-07
To study the effect of antisense E1a RNA (asRNA) on adenovirus development, two types of adenovirus 5 E1a antisense constructs have been engineered. One was complementary to the viral DNA region [nucleotide (nt) positions 500-720] regulated by the metallothionein-I promoter, and the other was complementary to the DNA regions (nt positions 630-1570) under control of the long terminal repeat Moloney mouse leukosis virus promoter. Both asRNA constructs were cloned into a plasmid containing the simian virus 40 origin of replication, the gene controlling geneticin (G418) resistance (G418R), and other regulatory elements. The COS-1 cells, which contained up to 100 copies of the engineered plasmids, synthesized antiviral asRNAs, which provided 71 to over 95% inhibition of adenoviral replication, in comparison to the control cells not synthesizing asRNAs.
[Antisense polynucleotides and prospects for their use in fighting viruses].
Tikhonenko, T I
1989-01-01
Natural or synthetic anti-sense (as) polynucleotides complementary to distinct functional regions of mRNA (asRNA or asDNA) are able to inhibit the expression of any target gene. If certain viral mRNAs important for virus replication are targeted the inhibition of viral infection by asRNA or asDNA takes place. Inhibitory effects of complementary polynucleotides on gene activity in eukaryotic cells is due to the disturbance of translation of corresponding mRNAs as well as to the impairment of their splicing or transportation from the nuclei to cytoplasm. In prokaryotic cells, obviously, only the first factor is operating. The recombinant genes programming anti-viral asRNA can confer the resistance to the infection by other virus to the transformed cells. The resistance to viral infection observed in transgenic animals, expressing asRNA genes, may be considered as a new unnatural form of informational immunity.
DeWitt, D L; Smith, W L
1988-01-01
Prostaglandin G/H synthase (8,11,14-icosatrienoate, hydrogen-donor:oxygen oxidoreductase, EC 1.14.99.1) catalyzes the first step in the formation of prostaglandins and thromboxanes, the conversion of arachidonic acid to prostaglandin endoperoxides G and H. This enzyme is the site of action of nonsteroidal anti-inflammatory drugs. We have isolated a 2.7-kilobase complementary DNA (cDNA) encompassing the entire coding region of prostaglandin G/H synthase from sheep vesicular glands. This cDNA, cloned from a lambda gt 10 library prepared from poly(A)+ RNA of vesicular glands, hybridizes with a single 2.75-kilobase mRNA species. The cDNA clone was selected using oligonucleotide probes modeled from amino acid sequences of tryptic peptides prepared from the purified enzyme. The full-length cDNA encodes a protein of 600 amino acids, including a signal sequence of 24 amino acids. Identification of the cDNA as coding for prostaglandin G/H synthase is based on comparison of amino acid sequences of seven peptides comprising 103 amino acids with the amino acid sequence deduced from the nucleotide sequence of the cDNA. The molecular weight of the unglycosylated enzyme lacking the signal peptide is 65,621. The synthase is a glycoprotein, and there are three potential sites for N-glycosylation, two of them in the amino-terminal half of the molecule. The serine reported to be acetylated by aspirin is at position 530, near the carboxyl terminus. There is no significant similarity between the sequence of the synthase and that of any other protein in amino acid or nucleotide sequence libraries, and a heme binding site(s) is not apparent from the amino acid sequence. The availability of a full-length cDNA clone coding for prostaglandin G/H synthase should facilitate studies of the regulation of expression of this enzyme and the structural features important for catalysis and for interaction with anti-inflammatory drugs. Images PMID:3125548
Hirai, A; Uchida, D; Yoshida, S
1992-12-01
Vasopressin is thought to play an important role, not only in the metabolism of water and electrolytes, but also in the regulation of renal hemodynamics. This year, great progress has been achieved in molecular biology of vasopressin receptors. First, the cloning of a complementary DNA, encoding the rat liver V1a arginine vasopressin receptor, was reported. The liver cDNA encodes a protein with seven putative transmembrane domains, which binds arginine vasopressin and related compounds with affinities similar to the native rat V1a receptor. The messenger RNA, corresponding to the cDNA, is distributed in rat tissues, known to contain V1a receptors. Second, the cloning of a complementary DNA encoding the rat kidney V2 arginine vasopressin receptor was also successful. The kidney cDNA encodes a protein with a transmembrane topography characteristic of G protein-coupled receptors. The receptor messenger RNA is detected only in the kidney. Last year, an orally active and specific vasopressin V1 receptor antagonist, OPC-21268 was first reported. The i.v. or p.o. administration of OPC-21268 dose-dependently inhibited vasopressin-induced vasoconstriction, while that induced by angiotensin II was not affected. OPC-21268 may have clinical potentials in certain hypertensive cardiovascular disorders. In addition, an orally active and specific vasopressin V2 receptor antagonist, OPC-31260 was also reported. Oral administration of OPC-31260 inhibited antidiuretic action of arginine vasopressin. OPC-31260 is thought to be useful in the treatment of certain disorders, such as the syndrome of inappropriate secretion of ADH (SIADH).
Geranyl diphosphate synthase from mint
Croteau, Rodney Bruce; Wildung, Mark Raymond; Burke, Charles Cullen; Gershenzon, Jonathan
1999-01-01
A cDNA encoding geranyl diphosphate synthase from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID No:1) is provided which codes for the expression of geranyl diphosphate synthase (SEQ ID No:2) from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase or for a base sequence sufficiently complementary to at least a portion of the geranyl diphosphate synthase DNA or RNA to enable hybridization therewith (e.g., antisense geranyl diphosphate synthase RNA or fragments of complementary geranyl diphosphate synthase DNA which are useful as polymerase chain reaction primers or as probes for geranyl diphosphate synthase or related genes). In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase that may be used to facilitate the production, isolation and purification of significant quantities of recombinant geranyl diphosphate synthase for subsequent use, to obtain expression or enhanced expression of geranyl diphosphate synthase in plants in order to enhance the production of monoterpenoids, to produce geranyl diphosphate in cancerous cells as a precursor to monoterpenoids having anti-cancer properties or may be otherwise employed for the regulation or expression of geranyl diphosphate synthase or the production of geranyl diphosphate.
Geranyl diphosphate synthase from mint
Croteau, R.B.; Wildung, M.R.; Burke, C.C.; Gershenzon, J.
1999-03-02
A cDNA encoding geranyl diphosphate synthase from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID No:1) is provided which codes for the expression of geranyl diphosphate synthase (SEQ ID No:2) from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase or for a base sequence sufficiently complementary to at least a portion of the geranyl diphosphate synthase DNA or RNA to enable hybridization therewith (e.g., antisense geranyl diphosphate synthase RNA or fragments of complementary geranyl diphosphate synthase DNA which are useful as polymerase chain reaction primers or as probes for geranyl diphosphate synthase or related genes). In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase that may be used to facilitate the production, isolation and purification of significant quantities of recombinant geranyl diphosphate synthase for subsequent use, to obtain expression or enhanced expression of geranyl diphosphate synthase in plants in order to enhance the production of monoterpenoids, to produce geranyl diphosphate in cancerous cells as a precursor to monoterpenoids having anti-cancer properties or may be otherwise employed for the regulation or expression of geranyl diphosphate synthase or the production of geranyl diphosphate. 5 figs.
Two-dimensional self-assembly of DNA-functionalized gold nanoparticles
NASA Astrophysics Data System (ADS)
Wang, Wenjie; Zhang, Honghu; Hagen, Noah; Kuzmenko, Ivan; Akinc, Mufit; Travesset, Alex; Mallapragada, Surya; Vaknin, David
2D superlattices of nanoparticles (NPs) are promising candidates for nano-devices. It is still challenging to develop a simple yet efficient protocol to assemble NPs in a controlled manner. Here, we report on formation of 2D Gibbs monolayers of single-stranded DNA-coated gold nanoparticles (ssDNA-AuNPs) at the air-water interface by manipulation of salts contents. MgCl2 and CaCl2 in solutions facilitate the accumulation of the non-complementary ssDNA-AuNPs on aqueous surfaces. Grazing-incidence small-angle X-ray scattering (GISAXS) and X-ray reflectivity show that the surface AuNPs assembly forms a mono-particle layer and undergoes a transformation from short-range to long-range (hexagonal) order above a threshold of [MgCl2] or [CaCl2]. For solutions that include two kinds of ssDNA-AuNPs with complementary base-pairing, the surface AuNPs form a thicker film and only in-plane short-range order is observed. By using other salts (NaCl or LaCl3) at concentrations of similar ionic strength to those of MgCl2 or CaCl2, we find that surface adsorbed NPs lack any orders. X-ray fluorescence measurements provide direct evidence of surface enrichment of AuNPs and divalent ions (Ca2 +) . The work was supported by the Office of Basic Energy Sciences, USDOE under Contract No. DE-AC02-07CH11358 and DE-AC02-06CH11357.
Orlando, Ludovic; Eisenmann, Véra; Reynier, Frédéric; Sondaar, Paul; Hänni, Catherine
2003-01-01
Unusual equids named hippidions inhabited South America for more than 2 MY (million years). Like many other animals they succumbed to the worldwide climatic change that occurred 10 KY (thousand years) ago and completely disappeared during the great late Pleistocene megafaunal extinction. According to fossil records and numerous dental, cranial, and postcranial characters, Hippidion and Equus lineages are known to have diverged prior to 10 MY. Some equid bones from Rio Verde and Ultima Esperanza (Patagonia, Chile) dating back to the late Pleistocene period (8-13 KY) have been identified as Hippidion saldiasi, while a few teeth have been assigned to Equus. Six samples of those remains have been obtained from the Zoological Museum of Amsterdam for ancient DNA analysis to try to place Hippidion in the evolutive tree of Perissodactyla. Two samples of Hippidion and one sample of Equus yielded 241-394 bp of the mtDNA control region and 172-296 bp of the cytochrome b gene. Unexpectedly, all the sequences clustered deep inside the Equus genus, casting doubt on the initial identification of the bones. For paleontologists, one of the striking and classical diagnostic characters of Hippidion is their extremely short and massive metapodials, a probable locomotory adaptation to the Andine steep slopes. However, our DNA analysis reveals that a very Hippidion-like metapod might also have been possessed by another South American equid, i.e., Equus (Amerhippus), an interpretation supported by complementary anatomical observations. This adaptive convergence between members of the two South American equid genera may lead paleontologists to limb bone misidentification.
Oliveira-Cunha, Melissa; Byers, Richard J; Siriwardena, Ajith K
2010-03-01
There is a need to develop methods of early diagnosis for pancreatic cancer. Pancreatic juice is easily collected by endoscopic retrograde cholangiopancreatography and may facilitate diagnosis using molecular markers. The aim of this work was to explore the feasibility of measurement of gene expression in RNA isolated from ductal juice. Intraoperative sampling of pancreatic juice was undertaken in 27 patients undergoing pancreaticoduodenectomy for suspected tumor. Total RNA was extracted and used as template for poly(adenylic acid) (poly[A]) polymerase chain reaction (PCR) to generate a globally amplified complementary DNA pool representative of all expressed messenger RNAs. Real-time PCR was performed for trefoil factor 2 (TFF2), carboxypeptidase B1 (CPB1), and kallikrein-related peptidase 3 (KLK3) in a subset of samples; all samples were normalized for 3 reference genes (glyceraldehyde-3-phosphate dehydrogenase [GAPDH], PSMB6, and beta-2-microglobulin [B2M]). The median volume of the pancreatic juice obtained was 1245 microL (range, 50-5000 microL). The RNA integrity number ranged from 1.9 to 10. Reverse transcriptase PCR was positive for pancreas-specific genes (TFF2 and CPB1) and negative for prostatic-specific antigen in all samples. These results demonstrate that RNA analysis of pancreatic juice is feasible using a combination of poly(A) PCR and real-time PCR. In addition, the poly(A) complementary DNA generated can be probed for multiple genes and is indefinitely renewable, thereby representing a molecular block of importance for future research.
Xiong, Yanxiang; Wei, Min; Wei, Wei; Yin, Lihong; Pu, Yuepu; Liu, Songqin
2014-01-24
DNA hairpin structure probes are usually designed by forming intra-molecular duplex based on Watson-Crick hydrogen bonds. In this paper, a molecular beacon based on silver ions-mediated cytosine-Ag(+)-cytosine base pairs was used to detect DNA. The inherent characteristic of the metal ligation facilitated the design of functional probe and the adjustment of its binding strength compared to traditional DNA hairpin structure probes, which make it be used to detect DNA in a simple, rapid and easy way with the help of DNA strands displacement reaction. The method was sensitive and also possesses the good specificity to differentiate the single base mismatched DNA from the complementary DNA. It was also successfully applied to study the damage effect of classic genotoxicity chemicals such as styrene oxide and sodium arsenite on DNA, which was significant in food science, environmental science and pharmaceutical science. Copyright © 2013 Elsevier B.V. All rights reserved.
Effect of C(60) fullerene on the duplex formation of i-motif DNA with complementary DNA in solution.
Jin, Kyeong Sik; Shin, Su Ryon; Ahn, Byungcheol; Jin, Sangwoo; Rho, Yecheol; Kim, Heesoo; Kim, Seon Jeong; Ree, Moonhor
2010-04-15
The structural effects of fullerene on i-motif DNA were investigated by characterizing the structures of fullerene-free and fullerene-bound i-motif DNA, in the presence of cDNA and in solutions of varying pH, using circular dichroism and synchrotron small-angle X-ray scattering. To facilitate a direct structural comparison between the i-motif and duplex structures in response to pH stimulus, we developed atomic scale structural models for the duplex and i-motif DNA structures, and for the C(60)/i-motif DNA hybrid associated with the cDNA strand, assuming that the DNA strands are present in an ideal right-handed helical conformation. We found that fullerene shifted the pH-induced conformational transition between the i-motif and the duplex structure, possibly due to the hydrophobic interactions between the terminal fullerenes and between the terminal fullerenes and an internal TAA loop in the DNA strand. The hybrid structure showed a dramatic reduction in cyclic hysteresis.
Surface-Enhanced Raman Scattering Based Nonfluorescent Probe for Multiplex DNA Detection
Sun, Lan; Yu, Chenxu; Irudayaraj, Joseph
2008-01-01
To provide rapid and accurate detection of DNA markers in a straightforward, inexpensive and multiplex format, an alternative surface enhanced Raman scattering (SERS) based probe was designed and fabricated to covalently attach both DNA probing sequence and non-fluorescent Raman tags to the surface of gold nanoparticles (DNA-AuP-RTag). The intensity of Raman signal of the probes could be controlled through the surface coverage of the non-fluorescent Raman tags (RTags). Detection sensitivity of these probes could be optimized by fine-tuning the amount of DNA molecules and RTags on the probes. Long-term stability of the DNA-AuP-RTag probes was found to be good (over 3 months). Excellent multiplexing capability of the DNA-AuP-RTag scheme was demonstrated by simultaneous identification of up to eight probes in a mixture. Detection of hybridization of single-stranded DNA (ssDNA) to its complementary targets was successfully accomplished with a long-term goal to use non-fluorescent RTags in a Raman-based DNA microarray platform. PMID:17465531
Mao, Pingdao; Ning, Yi; Li, Wenkai; Peng, Zhihui; Chen, Yongzhe; Deng, Le
2014-01-10
A simple, selective, sensitive and label-free fluorescent method for detecting trpS-harboring Salmonella typhimurium was developed in this study. This assay used the non-covalent interaction of single-stranded DNA (ssDNA) probes with SWNTs, since SWNTs can quench fluorescence. Fluorescence recovery (78% with 1.8 nM target DNA) was detected in the presence of target DNA as ssDNA probes detached from SWNTs hybridized with target DNA, and the resulting double-stranded DNA (dsDNA) intercalated with SYBR Green I (SG) dyes. The increasing fluorescence intensity reached 4.54-fold. In contrast, mismatched oligonucleotides (1- or 3-nt difference to the target DNA) did not contribute to significant fluorescent recovery, which demonstrated the specificity of the assay. The increasing fluorescence intensity increased 3.15-fold when purified PCR products containing complementary sequences of trpS gene were detected. These results confirmed the ability to use this assay for detecting real samples. Copyright © 2013 Elsevier Inc. All rights reserved.
Falk, L; Lindahl, T; Bjursell, G; Klein, G
1979-07-15
Herpesvirus papio (HVP) is an indigenous B-lymphotropic virus of baboons (Papio sp.) present in latent form in baboon lymphoblastoid cell lines. It shares cross-reacting viral capsid and early antigens with the Epstein-Barr virus (EBV), and HVP DNA and EBV DNA show partial sequence homology. EBV-specific complementary RNA was employed here as a probe to investigate the physical state of the HVP DNA component in baboon lymphoblastoid cells after fractionation of cellular DNA by density gradient centrifugation. Five virus-producing cultures contained both free and integrated HVP DNA sequences while one non-producing cell line had two or three viral genome equivalents per cell in an apparently integrated form. Further analysis of one virus-producing line showed that the free HVP DNA fraction was composed of both linear and circular viral DNA. Contour length measurements of HVP circular DNA molecules by electron microscopy revealed that they were similar in length to the EBV circular DNA present in human lymphoblastoid cells.
Crundwell, G; Baguley, D M
2016-08-01
Literature indicates that complementary and alternative medicine is used by patients with auditory and vestibular symptoms. This study sought to determine the prevalence of complementary and alternative medicine uptake, and examine attitudes towards complementary and alternative medicine in clinicians working with audiovestibular disorder patients. The Holistic Complementary and Alternative Medicine Questionnaire and a devised questionnaire about recent and lifetime use of complementary and alternative medicine were used. Fifty-four individuals, including audiologists, ENT surgeons, nurses and rehabilitationists, completed the questionnaires (67 per cent response rate). Lifetime prevalence of complementary and alternative medicine uptake was 44 per cent, and 12-month prevalence was 22 per cent. Uptake was more common in females, but there was no significant difference in use when comparing age, seniority or profession. Attitudes towards complementary and alternative medicine were mildly adverse, but sizeable standard deviation indicates wide-ranging attitudes. Clinicians working with patients with audiovestibular disorders have a range of attitudes towards complementary and alternative medicine. Personal uptake of complementary and alternative medicine was lower than that of the general UK population, but remains sizeable.
Triple helix purification and sequencing
Wang, Renfeng; Smith, Lloyd M.; Tong, Xinchun E.
1995-01-01
Disclosed herein are methods, kits, and equipment for purifying single stranded circular DNA and then using the DNA for DNA sequencing purposes. Templates are provided with an insert having a hybridization region. An elongated oligonucleotide has two regions that are complementary to the insert and the oligo is bound to a magnetic anchor. The oligo hybridizes to the insert on two sides to form a stable triple helix complex. The anchor can then be used to drag the template out of solution using a magnet. The system can purify sequencing templates, and if desired the triple helix complex can be opened up to a double helix so that the oligonucleotide will act as a primer for further DNA synthesis.
Triazole-linked DNA as a primer surrogate in the synthesis of first-strand cDNA.
Fujino, Tomoko; Yasumoto, Ken-ichi; Yamazaki, Naomi; Hasome, Ai; Sogawa, Kazuhiro; Isobe, Hiroyuki
2011-11-04
A phosphate-eliminated nonnatural oligonucleotide serves as a primer surrogate in reverse transcription reaction of mRNA. Despite of the nonnatural triazole linkages in the surrogate, the reverse transcriptase effectively elongated cDNA sequences on the 3'-downstream of the primer by transcription of the complementary sequence of mRNA. A structure-activity comparison with the reference natural oligonucleotides shows the superior priming activity of the surrogate containing triazole-linkages. The nonnatural linkages also protect the transcribed cDNA from digestion reactions with 5'-exonuclease and enable us to remove noise transcripts of unknown origins. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Triple helix purification and sequencing
Wang, R.; Smith, L.M.; Tong, X.E.
1995-03-28
Disclosed herein are methods, kits, and equipment for purifying single stranded circular DNA and then using the DNA for DNA sequencing purposes. Templates are provided with an insert having a hybridization region. An elongated oligonucleotide has two regions that are complementary to the insert and the oligo is bound to a magnetic anchor. The oligo hybridizes to the insert on two sides to form a stable triple helix complex. The anchor can then be used to drag the template out of solution using a magnet. The system can purify sequencing templates, and if desired the triple helix complex can be opened up to a double helix so that the oligonucleotide will act as a primer for further DNA synthesis. 4 figures.
Jung, Seungwon; Cha, Misun; Park, Jiyong; Jeong, Namjo; Kim, Gunn; Park, Changwon; Ihm, Jisoon; Lee, Junghoon
2010-08-18
It has been known that single-strand DNA wraps around a single-walled carbon nanotube (SWNT) by pi-stacking. In this paper it is demonstrated that such DNA is dissociated from the SWNT by Watson-Crick base-pairing with a complementary sequence. Measurement of field effect transistor characteristics indicates a shift of the electrical properties as a result of this "unwrapping" event. We further confirm the suggested process through Raman spectroscopy and gel electrophoresis. Experimental results are verified in view of atomistic mechanisms with molecular dynamics simulations and binding energy analyses.
Research on Image Encryption Based on DNA Sequence and Chaos Theory
NASA Astrophysics Data System (ADS)
Tian Zhang, Tian; Yan, Shan Jun; Gu, Cheng Yan; Ren, Ran; Liao, Kai Xin
2018-04-01
Nowadays encryption is a common technique to protect image data from unauthorized access. In recent years, many scientists have proposed various encryption algorithms based on DNA sequence to provide a new idea for the design of image encryption algorithm. Therefore, a new method of image encryption based on DNA computing technology is proposed in this paper, whose original image is encrypted by DNA coding and 1-D logistic chaotic mapping. First, the algorithm uses two modules as the encryption key. The first module uses the real DNA sequence, and the second module is made by one-dimensional logistic chaos mapping. Secondly, the algorithm uses DNA complementary rules to encode original image, and uses the key and DNA computing technology to compute each pixel value of the original image, so as to realize the encryption of the whole image. Simulation results show that the algorithm has good encryption effect and security.
Label-free DNA biosensor based on resistance change of platinum nanoparticles assemblies.
Skotadis, Evangelos; Voutyras, Konstantinos; Chatzipetrou, Marianneza; Tsekenis, Georgios; Patsiouras, Lampros; Madianos, Leonidas; Chatzandroulis, Stavros; Zergioti, Ioanna; Tsoukalas, Dimitris
2016-07-15
A novel nanoparticle based biosensor for the fast and simple detection of DNA hybridization events is presented. The sensor utilizes hybridized DNA's charge transport properties, combining them with metallic nanoparticle networks that act as nano-gapped electrodes. The DNA hybridization events can be detected by a significant reduction in the sensor's resistance due to the conductive bridging offered by hybridized DNA. By modifying the nanoparticle surface coverage, which can be controlled experimentally being a function of deposition time, and the structural properties of the electrodes, an optimized biosensor for the in situ detection of DNA hybridization events is ultimately fabricated. The fabricated biosensor exhibits a wide response range, covering four orders of magnitude, a limit of detection of 1nM and can detect a single base pair mismatch between probe and complementary DNA. Copyright © 2016 Elsevier B.V. All rights reserved.
Diverse Applications of Environmental DNA Methods in Parasitology.
Bass, David; Stentiford, Grant D; Littlewood, D T J; Hartikainen, Hanna
2015-10-01
Nucleic acid extraction and sequencing of genes from organisms within environmental samples encompasses a variety of techniques collectively referred to as environmental DNA or 'eDNA'. The key advantages of eDNA analysis include the detection of cryptic or otherwise elusive organisms, large-scale sampling with fewer biases than specimen-based methods, and generation of data for molecular systematics. These are particularly relevant for parasitology because parasites can be difficult to locate and are morphologically intractable and genetically divergent. However, parasites have rarely been the focus of eDNA studies. Focusing on eukaryote parasites, we review the increasing diversity of the 'eDNA toolbox'. Combining eDNA methods with complementary tools offers much potential to understand parasite communities, disease risk, and parasite roles in broader ecosystem processes such as food web structuring and community assembly. Crown Copyright © 2015. Published by Elsevier Ltd. All rights reserved.
Method of preparing and applying single stranded DNA probes to double stranded target DNAs in situ
Gray, Joe W.; Pinkel, Daniel
1991-01-01
A method is provided for producing single stranded non-self-complementary nucleic acid probes, and for treating target DNA for use therewith. Probe is constructed by treating DNA with a restriction enzyme and an exonuclease to form template/primers for a DNA polymerase. The digested strand is resynthesized in the presence of labeled nucleoside triphosphate precursor. Labeled single stranded fragments are separated from the resynthesized fragments to form the probe. Target DNA is treated with the same restriction enzyme used to construct the probe, and is treated with an exonuclease before application of the probe. The method significantly increases the efficiency and specificity of hybridization mixtures by increasing effective probe concentration by eliminating self-hybridization between both probe and target DNAs, and by reducing the amount of target DNA available for mismatched hybridizations.
DNA nanostructure-based drug delivery nanosystems in cancer therapy.
Wu, Dandan; Wang, Lei; Li, Wei; Xu, Xiaowen; Jiang, Wei
2017-11-25
DNA as a novel biomaterial can be used to fabricate different kinds of DNA nanostructures based on its principle of GC/AT complementary base pairing. Studies have shown that DNA nanostructure is a nice drug carrier to overcome big obstacles existing in cancer therapy such as systemic toxicity and unsatisfied drug efficacy. Thus, different types of DNA nanostructure-based drug delivery nanosystems have been designed in cancer therapy. To improve treating efficacy, they are also developed into more functional drug delivery nanosystems. In recent years, some important progresses have been made. The objective of this review is to make a retrospect and summary about these different kinds of DNA nanostructure-based drug delivery nanosystems and their latest progresses: (1) active targeting; (2) mutidrug co-delivery; (3) construction of stimuli-responsive/intelligent nanosystems. Copyright © 2017 Elsevier B.V. All rights reserved.
Mutations altering the cleavage specificity of a homing endonuclease
Seligman, Lenny M.; Chisholm, Karen M.; Chevalier, Brett S.; Chadsey, Meggen S.; Edwards, Samuel T.; Savage, Jeremiah H.; Veillet, Adeline L.
2002-01-01
The homing endonuclease I-CreI recognizes and cleaves a particular 22 bp DNA sequence. The crystal structure of I-CreI bound to homing site DNA has previously been determined, leading to a number of predictions about specific protein–DNA contacts. We test these predictions by analyzing a set of endonuclease mutants and a complementary set of homing site mutants. We find evidence that all structurally predicted I-CreI/DNA contacts contribute to DNA recognition and show that these contacts differ greatly in terms of their relative importance. We also describe the isolation of a collection of altered specificity I-CreI derivatives. The in vitro DNA-binding and cleavage properties of two such endonucleases demonstrate that our genetic approach is effective in identifying homing endonucleases that recognize and cleave novel target sequences. PMID:12202772
Thiophene antibacterials that allosterically stabilize DNA-cleavage complexes with DNA gyrase.
Chan, Pan F; Germe, Thomas; Bax, Benjamin D; Huang, Jianzhong; Thalji, Reema K; Bacqué, Eric; Checchia, Anna; Chen, Dongzhao; Cui, Haifeng; Ding, Xiao; Ingraham, Karen; McCloskey, Lynn; Raha, Kaushik; Srikannathasan, Velupillai; Maxwell, Anthony; Stavenger, Robert A
2017-05-30
A paucity of novel acting antibacterials is in development to treat the rising threat of antimicrobial resistance, particularly in Gram-negative hospital pathogens, which has led to renewed efforts in antibiotic drug discovery. Fluoroquinolones are broad-spectrum antibacterials that target DNA gyrase by stabilizing DNA-cleavage complexes, but their clinical utility has been compromised by resistance. We have identified a class of antibacterial thiophenes that target DNA gyrase with a unique mechanism of action and have activity against a range of bacterial pathogens, including strains resistant to fluoroquinolones. Although fluoroquinolones stabilize double-stranded DNA breaks, the antibacterial thiophenes stabilize gyrase-mediated DNA-cleavage complexes in either one DNA strand or both DNA strands. X-ray crystallography of DNA gyrase-DNA complexes shows the compounds binding to a protein pocket between the winged helix domain and topoisomerase-primase domain, remote from the DNA. Mutations of conserved residues around this pocket affect activity of the thiophene inhibitors, consistent with allosteric inhibition of DNA gyrase. This druggable pocket provides potentially complementary opportunities for targeting bacterial topoisomerases for antibiotic development.
Structural Basis for the Altered PAM Recognition by Engineered CRISPR-Cpf1.
Nishimasu, Hiroshi; Yamano, Takashi; Gao, Linyi; Zhang, Feng; Ishitani, Ryuichiro; Nureki, Osamu
2017-07-06
The RNA-guided Cpf1 nuclease cleaves double-stranded DNA targets complementary to the CRISPR RNA (crRNA), and it has been harnessed for genome editing technologies. Recently, Acidaminococcus sp. BV3L6 (AsCpf1) was engineered to recognize altered DNA sequences as the protospacer adjacent motif (PAM), thereby expanding the target range of Cpf1-mediated genome editing. Whereas wild-type AsCpf1 recognizes the TTTV PAM, the RVR (S542R/K548V/N552R) and RR (S542R/K607R) variants can efficiently recognize the TATV and TYCV PAMs, respectively. However, their PAM recognition mechanisms remained unknown. Here we present the 2.0 Å resolution crystal structures of the RVR and RR variants bound to a crRNA and its target DNA. The structures revealed that the RVR and RR variants primarily recognize the PAM-complementary nucleotides via the substituted residues. Our high-resolution structures delineated the altered PAM recognition mechanisms of the AsCpf1 variants, providing a basis for the further engineering of CRISPR-Cpf1. Copyright © 2017 Elsevier Inc. All rights reserved.
Kim, Seong U; Batule, Bhagwan S; Mun, Hyoyoung; Byun, Ju-Young; Shim, Won-Bo; Kim, Min-Gon
2018-02-07
We have developed a novel strategy for the colorimetric detection of PCR products by utilizing a target-specific primer modified at the 5'-end with an anti-DNAzyme sequence. A single-stranded DNAzyme sequence folds into a G-quadruplex structure with hemin and shows strong peroxidase activity. When the complementary strand binds to the DNAzyme sequence, it blocks the formation of the G-quadraduplex structure and loses its peroxidase activity. In the presence of the target gene, PCR amplification proceeds, and anti-DNAzyme sequence modified primers present in the reaction mixture form a double strand through primer extension. Therefore, it does not block the DNAzyme sequence. Further, a colorimetric signal is generated by the addition of 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonate) (ABTS) and H 2 O 2 at the end of the reaction. We have successfully detected a single copy of the HIV type 1 gag gene in buffer and 10 copies in human serum. The strategy developed could be used to detect DNA and RNA in complex biological samples by simple primer designing that includes DNAzyme and a DNA extended primer.
Hamidi-Asl, Ezat; Raoof, Jahan Bakhsh; Naghizadeh, Nahid; Akhavan-Niaki, Haleh; Ojani, Reza; Banihashemi, Ali
2016-10-01
The main roles of DNA in the cells are to maintain and properly express genetic information. It is important to have analytical methods capable of fast and sensitive detection of DNA damage. DNA hybridization sensors are well suited for diagnostics and other purposes, including determination of bacteria and viruses. Beta thalassemias (βth) are due to mutations in the β-globin gene. In this study, an electrochemical biosensor which detects the sequences related to the β-globin gene issued from real samples amplified by polymerase chain reaction (PCR) is described for the first time. The biosensor relies on the immobilization of 20-mer single stranded oligonucleotide (probe) related to βth sequence on the carbon paste electrode (CPE) modified by 15% silver (Ag) and platinum (Pt) nanoparticles to prepare the bimetallic nanocomposite electrode and hybridization of this oligonucleotide with its complementary sequence (target). The extent of hybridization between the probe and target sequences was shown by using linear sweep voltammetry (LSV) with methylene blue (MB) as hybridization indicator. The selectivity of sensor was investigated using PCR samples containing non-complementary oligonucleotides. The detection limit of biosensor was calculated about 470.0pg/μL. Copyright © 2016 Elsevier B.V. All rights reserved.
Surface-enhanced Raman scattering based nonfluorescent probe for multiplex DNA detection.
Sun, Lan; Yu, Chenxu; Irudayaraj, Joseph
2007-06-01
To provide rapid and accurate detection of DNA markers in a straightforward, inexpensive, and multiplex format, an alternative surface-enhanced Raman scattering based probe was designed and fabricated to covalently attach both DNA probing sequence and nonfluorescent Raman tags to the surface of gold nanoparticles (DNA-AuP-RTag). The intensity of Raman signal of the probes could be controlled through the surface coverage of the nonfluorescent Raman tags (RTags). Detection sensitivity of these probes could be optimized by fine-tuning the amount of DNA molecules and RTags on the probes. Long-term stability of the DNA-AuP-RTag probes was found to be good (over 3 months). Excellent multiplexing capability of the DNA-AuP-RTag scheme was demonstrated by simultaneous identification of up to eight probes in a mixture. Detection of hybridization of single-stranded DNA to its complementary targets was successfully accomplished with a long-term goal to use nonfluorescent RTags in a Raman-based DNA microarray platform.
An electrochemiluminescent DNA sensor based on nano-gold enhancement and ferrocene quenching.
Yao, Wu; Wang, Lun; Wang, Haiyan; Zhang, Xiaolei; Li, Ling; Zhang, Na; Pan, Le; Xing, Nannan
2013-02-15
An electrochemiluminescent DNA (ECL-DNA) sensor based on nano-gold signal enhancement (i.e. gold nanoparticles, GNP) and ferrocene signal quenching was investigated. The Au electrode was first modified with GNPs through electrodeposition method, followed by subsequent immobilization of single-stranded probe DNA labeled with ruthenium complex. The resulting sensor produced a higher ECL signal due to its higher density of self-assembled probe DNAs on the surface. Upon the hybridization of probe DNA with complementary target DNA labeled with ferrocene, ECL intensity decreased significantly due to spatial separation of ECL label from the electrode surface. As a result, the ECL signal was simultaneously quenched by ferrocene. The effects of both nano-gold electrodeposition time and ferrocene on the performance of ECL-DNA sensor were studied in detail and possible reasons for these effects were suggested as well. The reported ECL-DNA sensor showed great sensitivity and may provide an alternative approach for DNA detection in diagnostics and gene analysis. Copyright © 2012 Elsevier B.V. All rights reserved.
Cook, Anthony L; Snow, Elizabeth T; Binns, Henrica; Cook, Peta S
2015-01-01
Inquiry-based learning (IBL) activities are complementary to the processes of laboratory discovery, as both are focused on producing new findings through research and inquiry. Here, we describe the results of student surveys taken pre- and postpractical to an IBL undergraduate practical on PCR. Our analysis focuses primarily student perceptions of knowledge acquisition and their ability to troubleshoot problems. The survey results demonstrate significant self-reported gains in knowledge related to DNA structure and PCR, and an increase in confidence with "troubleshooting problems during scientific experiments." We conclude that the IBL-based approach that combines PCR primer design with wet laboratory experimentation using student-designed primers, provides students a sense of confidence by imparting workplace and research skills that are integral to diverse forms and applications of laboratory practices. © 2015 The International Union of Biochemistry and Molecular Biology.
A Single Molecular Beacon Probe Is Sufficient for the Analysis of Multiple Nucleic Acid Sequences
Gerasimova, Yulia V.; Hayson, Aaron; Ballantyne, Jack; Kolpashchikov, Dmitry M.
2010-01-01
Molecular beacon (MB) probes are dual-labeled hairpin-shaped oligodeoxyribonucleotides that are extensively used for real-time detection of specific RNA/DNA analytes. In the MB probe, the loop fragment is complementary to the analyte: therefore, a unique probe is required for the analysis of each new analyte sequence. The conjugation of an oligonucleotide with two dyes and subsequent purification procedures add to the cost of MB probes, thus reducing their application in multiplex formats. Here we demonstrate how one MB probe can be used for the analysis of an arbitrary nucleic acid. The approach takes advantage of two oligonucleotide adaptor strands, each of which contains a fragment complementary to the analyte and a fragment complementary to an MB probe. The presence of the analyte leads to association of MB probe and the two DNA strands in quadripartite complex. The MB probe fluorescently reports the formation of this complex. In this design, the MB does not bind the analyte directly; therefore, the MB sequence is independent of the analyte. In this study one universal MB probe was used to genotype three human polymorphic sites. This approach promises to reduce the cost of multiplex real-time assays and improve the accuracy of single-nucleotide polymorphism genotyping. PMID:20665615
DNA Nanostructures as Smart Drug-Delivery Vehicles and Molecular Devices.
Linko, Veikko; Ora, Ari; Kostiainen, Mauri A
2015-10-01
DNA molecules can be assembled into custom predesigned shapes via hybridization of sequence-complementary domains. The folded structures have high spatial addressability and a tremendous potential to serve as platforms and active components in a plethora of bionanotechnological applications. DNA is a truly programmable material, and its nanoscale engineering thus opens up numerous attractive possibilities to develop novel methods for therapeutics. The tailored molecular devices could be used in targeting cells and triggering the cellular actions in the biological environment. In this review we focus on the DNA-based assemblies - primarily DNA origami nanostructures - that could perform complex tasks in cells and serve as smart drug-delivery vehicles in, for example, cancer therapy, prodrug medication, and enzyme replacement therapy. Copyright © 2015 Elsevier Ltd. All rights reserved.
Free Energy Gap and Statistical Thermodynamic Fidelity of DNA Codes
2007-10-01
reverse-complement unless otherwise stated. For strand x, let Nx denote its complement. A (perfect) Watson - Crick duplex is the joining of complement...is possible for complementary sequences to form a non-perfectly aligned duplex, we will call any x W Nx duplex a Watson - Crick (WC) duplex. Two...DATES COVERED (From - To) 4. TITLE AND SUBTITLE FREE ENERGY GAP AND STATISTICAL THERMODYNAMIC FIDELITY OF DNA CODES 5a. CONTRACT NUMBER FA8750-07
Free Energy Gap and Statistical Thermodynamic Fidelity of DNA Codes (Postprint)
2007-01-01
reverse-complement unless otherwise stated. For strand x, let Nx denote its complement. A (perfect) Watson - Crick duplex is the joining of complement...is possible for complementary sequences to form a non-perfectly aligned duplex, we will call any x W Nx duplex a Watson - Crick (WC) duplex. Two...DATES COVERED (From - To) 4. TITLE AND SUBTITLE FREE ENERGY GAP AND STATISTICAL THERMODYNAMIC FIDELITY OF DNA CODES 5a. CONTRACT NUMBER FA8750-07
Kurtz, David T.; Feigelson, Philip
1977-01-01
A procedure is presented for the preparation of a 3H-labeled complementary DNA (cDNA) specific for the mRNA coding for α2u-globulin, a male rat liver protein under multihormonal control that represents approximately 1% of hepatic protein synthesis. Rat liver polysomes are incubated with monospecific rabbit antiserum to α2u-globulin, which binds to the nascent α2u-globulin chains on the polysomes. These antibody-polysome complexes are then adsorbed to goat antiserum to rabbit IgG that is covalently linked to p-aminobenzylcellulose. mRNA preparations are thus obtained that contain 30-40% α2u-globulin mRNA. A labeled cDNA is made to this α2u-globulin-enriched mRNA preparation by using RNA-dependent DNA polymerase (reverse transcriptase). To remove the non-α2u-globulin sequences, this cDNA preparation is hybridized to an RNA concentration × incubation time (R0t) of 1000 mol of ribonucleotide per liter × sec with female rat liver mRNA, which, though it shares the vast majority of mRNA sequences with male liver, contains no α2u-globulin mRNA sequences. The cDNA remaining single-stranded is isolated by hydroxylapatite chromatography and is shown to be specific for α2u-globulin mRNA by several criteria. Good correlation was found in all endocrine states studied between the hepatic level of α2u-globulin, the level of functional α2u-globulin mRNA as assayed in a wheat germ cell-free translational system, and the level of α2u-globulin mRNA sequences as measured by hybridization to the α2u-globulin cDNA. Thus, the hormonal control of hepatic α2u-globulin synthesis by sex steroids and thyroid hormone occurs through modulation of the cellular level of α2u-globulin mRNA sequences, presumably by hormonal control of transcriptive synthesis. PMID:73184
Langie, Sabine A S; Knaapen, Ad M; Brauers, Karen J J; van Berlo, Damien; van Schooten, Frederik-Jan; Godschalk, Roger W L
2006-03-01
There is an increasing need for simple and reliable approaches to phenotypically assess DNA repair capacities. Therefore, a modification of the alkaline comet assay was developed to determine the ability of human lymphocyte extracts to perform the initial steps of the nucleotide excision repair (NER) process, i.e. damage recognition and incision. Gel-embedded nucleoids from A549 cells, pre-exposed to 1 microM benzo[a]pyrene-diol-epoxide, were incubated with cell extracts from frozen or freshly isolated lymphocytes. The rate at which incisions are introduced and the subsequent increase in tail moment is indicative for the repair capacity of the extracts. Freshly prepared extracts from lymphocytes of human volunteers (n = 8) showed significant inter-individual variations in their DNA repair capacity, which correlated with the removal of bulky DNA lesions over a period of 48 h determined by (32)P-post-labelling (R(2) = 0.76, P = 0.005). Repeated measurements revealed a low inter-assay variation (11%). Storage of cell extracts for more than 3 weeks significantly reduced (up to 80%) the capacity to incise the damaged DNA as compared to freshly isolated extracts. This reduction was completely restored by addition of ATP to the extracts before use, as it is required for the incision step of NER. In contrast, extracts freshly prepared from frozen lymphocyte pellets can be used without loss of repair activity. DNA repair deficient XPA-/- and XPC-/- fibroblasts were used to further validate the assay. Although some residual capacity to incise the DNA was observed in these cells, the repair activity was restored to normal wild-type levels when a complementary mixture of both extracts (thereby restoring XPA and XPC deficiency) was used. These results demonstrate that this repair assay can be applied in molecular epidemiological studies to assess inter-individual differences in NER.
Hernández, Loreto A; Del Valle, María A; Armijo, Francisco
2016-05-15
The detection of naturally occurring desoxyribonucleic acid (DNA) has become a subject of study by the projections that would generate to be able to sense the genetic material for the detection of future diseases. Bearing this in mind, to provide new measuring strategies, in the current work the preparation of a low-cost electrode, modified with poly(1-amino-9,10-anthraquinone) nanowires using a SiO2 template, is carried out; the assembly is next modified by covalently attaching ssDNA strands. It must be noted that all this is accomplished by using solely electrochemical techniques, according to methodology developed for this purpose. SEM images of the modified surface show high order and homogeneity in the distribution of modified nanowires over the electrode surface. In turn, after the hybridization with its complementary strand, the voltammetric responses enable corroborating the linear relationship between hybridization at different DNA concentrations and normalized current response, obtaining a limit of detection (LOD) 5.7·10(-12)gL(-1) and limit of quantification (LOQ) 1.9·10(-11)gL(-1). The working dynamic range is between 1.4·10(-7) and 8.5·10(-9)gL(-1) with a correlation coefficient 0.9998. The successful obtaining of the modified electrode allows concluding that the high order reached by the nanostructures, guides the subsequent single strand of DNA (ssDNA) covalent attachment, which after hybridization with its complementary strand brings about a considerable current increase. This result allows foreseeing a guaranteed breakthrough with regard to the use of the biosensor in real samples. Copyright © 2015 Elsevier B.V. All rights reserved.
Suard, Y M; Tosi, M; Kraehenbuhl, J P
1982-01-01
Total cytoplasmic polyadenylated RNA from lactating rabbit mammary glands was analysed on methylmercury hydroxide-agarose gels. The size of the most abundant mRNA species ranged between 0.5 and 5.0 kb (kilobases), with major bands at 0.55, 0.84, 0.92, 1.18 and 2.4 kb and discrete minor bands of 1.5, 1.7, 3.0 and 3.9 kb. Translation in vitro of total mRNA with [3H]leucine or [35S]methionine as precursor yielded four major bands with apparent Mr values of 16 000, 25 000, 26 000 and 29 000. The four protein bands were identified by immunoprecipitation by using specific antisera as alpha-lactalbumin and x-, kappa- and alpha-caseins, respectively. Labelling with (35S]cysteine followed by immunoprecipitation with anti-transferrin or anti-alpha-lactalbumin sera allowed the identification of two whey proteins. Translated transferrin was resolved as an 80 000-dalton band and alpha-lactalbumin appeared as a 16 000-dalton protein. A library of recombinant plasmids containing cDNA (complementary DNA) sequences representing cytoplasmic polyadenylated RNA was used to isolate clones for the major rabbit caseins and alpha-lactalbumin. A preliminary characterization of these cDNA clones was achieved by colony hybridization with enriched RNA fractions as probes. Positive clones were identified by use of hybrid-promoted translation in vitro and immunoprecipitation of the translation products. The corresponding mRNA species were further identified by hybridizing RNA blots with radioactively labelled cDNA clones. We present the restriction map of alpha-casein and kappa-casein cDNA clones. Images Fig. 1. Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 6. PMID:6123313
NASA Astrophysics Data System (ADS)
Chen, Quansheng; Yang, Mingxiu; Yang, Xiaojing; Li, Huanhuan; Guo, Zhiming; Rahma, M. H.
2018-01-01
With growing concern on oil safety problems, developing a simple and sensitive method to detect Aflatoxin B1 (AFB1), a common mycotoxin in peanut oil, is very necessary. In this study, Surface-enhanced Raman Scattering (SERS) aptasensor was developed for ultrasensitive AFB1 detection using the amino-terminal AFB1 aptamer (NH2-DNA1); and thiol-terminal AFB1 complementary aptamer (SH-DNA2) conjugated magnetic-beads (CS-Fe3O4) as enrichment nanoprobe and AuNR@DNTB@Ag nanorods (ADANRs) as reporter nanoprobe respectively. 5,5‧-Dithiobis(2-nitrobenzoicacid) (DNTB) with large Raman scattering cross-section and no fluorescence interference was embedded in Au and Ag core/shell nanorods as Raman reporter molecules. CS-Fe3O4 possessed excellent biocompatibility and superparamagnetism for rapid signal enrichment. Therefore, NH2-DNA1-CS-Fe3O4 and SH-DNA2-ADANRs were fabricated via the hybrid reaction between aptamers and complementary aptamers. When there is AFB1, AFB1 would competitively combine with the NH2-DNA1-CS-Fe3O4 inducing the dissociation of SH-DNA2-ADANRs from CS-Fe3O4 and further decreasing the SERS signal. Based on this developed SERS aptasensor, a low limit of 0.0036 ng/mL and an effective linear detection range from 0.01 to 100 ng/mL with the correlation coefficient up to 0.986 for AFB1 detection were obtained. Moreover, the specificity of this SERS aptasensor was demonstrated by detecting other two mycotoxins and its accuracy for AFB1 detection in real peanut oil was further confirmed by standard addition recovery test.
Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.
2012-01-01
DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820
DNA cytoskeleton for stabilizing artificial cells.
Kurokawa, Chikako; Fujiwara, Kei; Morita, Masamune; Kawamata, Ibuki; Kawagishi, Yui; Sakai, Atsushi; Murayama, Yoshihiro; Nomura, Shin-Ichiro M; Murata, Satoshi; Takinoue, Masahiro; Yanagisawa, Miho
2017-07-11
Cell-sized liposomes and droplets coated with lipid layers have been used as platforms for understanding live cells, constructing artificial cells, and implementing functional biomedical tools such as biosensing platforms and drug delivery systems. However, these systems are very fragile, which results from the absence of cytoskeletons in these systems. Here, we construct an artificial cytoskeleton using DNA nanostructures. The designed DNA oligomers form a Y-shaped nanostructure and connect to each other with their complementary sticky ends to form networks. To undercoat lipid membranes with this DNA network, we used cationic lipids that attract negatively charged DNA. By encapsulating the DNA into the droplets, we successfully created a DNA shell underneath the membrane. The DNA shells increased interfacial tension, elastic modulus, and shear modulus of the droplet surface, consequently stabilizing the lipid droplets. Such drastic changes in stability were detected only when the DNA shell was in the gel phase. Furthermore, we demonstrate that liposomes with the DNA gel shell are substantially tolerant against outer osmotic shock. These results clearly show the DNA gel shell is a stabilizer of the lipid membrane akin to the cytoskeleton in live cells.
Detection of Z DNA binding proteins in tissue culture cells.
Leith, I R; Hay, R T; Russell, W C
1988-01-01
A gel electrophoresis DNA binding assay to detect Z DNA binding proteins has been developed utilising [32P] labelled poly [d(G-C)] which was converted to the Z form by incubation in 100 microM Co(NH3)6Cl3. The parameters of the assay were established using a Z DNA antibody as a model system and then applied to extracts of Hela and BHK21 cells. Using an anti-Z DNA antibody conditions were established which allowed resolution of antibody-DNA complexes and free DNA in the presence of 100 microM Co(NH3)6Cl3. The inclusion of unlabelled complementary homopolymers eliminated non-specific binding to the labelled Z-DNA probe. Competition experiments demonstrated that the assay was highly specific for double stranded non-B DNA. Application of the technique to extracts of mammalian cells demonstrated that human and hamster cells contain Z-DNA binding proteins; further characterisation by a blotting technique indicated that a 56,000 molecular weight cell protein preferentially binds Z-DNA. Images PMID:3419919
A simple procedure for parallel sequence analysis of both strands of 5'-labeled DNA.
Razvi, F; Gargiulo, G; Worcel, A
1983-08-01
Ligation of a 5'-labeled DNA restriction fragment results in a circular DNA molecule carrying the two 32Ps at the reformed restriction site. Double digestions of the circular DNA with the original enzyme and a second restriction enzyme cleavage near the labeled site allows direct chemical sequencing of one 5'-labeled DNA strand. Similar double digestions, using an isoschizomer that cleaves differently at the 32P-labeled site, allows direct sequencing of the now 3'-labeled complementary DNA strand. It is possible to directly sequence both strands of cloned DNA inserts by using the above protocol and a multiple cloning site vector that provides the necessary restriction sites. The simultaneous and parallel visualization of both DNA strands eliminates sequence ambiguities. In addition, the labeled circular molecules are particularly useful for single-hit DNA cleavage studies and DNA footprint analysis. As an example, we show here an analysis of the micrococcal nuclease-induced breaks on the two strands of the somatic 5S RNA gene of Xenopus borealis, which suggests that the enzyme may recognize and cleave small AT-containing palindromes along the DNA helix.
Phylogenetic Analysis of Marine Picoplankton Using Tau RNA Sequences.
1991-02-01
Pacific Ocean (Aloha Station). DNA prepared from both populations was analyzed by hybridization using kingdom -specific probes complementary to 16S rRNA...euba:-teria. Few eukaryotes, no archaebacteria detected (at low resolution). "* Fluorescendly labeled phylogenetir group-specific oligon ucleotfides
Vapnek, Daniel; Spingler, Elizabeth
1974-01-01
Deoxyribonucleic acid-ribonucleic acid (DNA-RNA) hybridization studies have been performed with R-plasmid DNA (R538-1drd) and in vivo-synthesized RNA. R-plasmid DNA was isolated from Escherichia coli K-12, and the complementary strands were separated in cesium chloride-polyuridylic acid-polyguanylic acid gradients. DNA-RNA hybridization was performed with the separated DNA strands and RNA purified from R-plasmid-carrying cells. The results demonstrated that an asymmetric transcription of the R-plasmid DNA occurs in vivo. Hybridization was only detected with the H strand (denser strand in cesium chloride-polyuridylic acid-polyguanylic acid). By determining the density of the RNA-DNA hybrid in CsCl gradients, it was estimated that greater than 60% of the nucleotide sequences in the R-plasmid DNA are transcribed in logarithmically growing E. coli cells. No R-plasmid-specific RNA was detected in E. coli cells that did not carry the plasmid. PMID:4612013
DNA biosensing with 3D printing technology.
Loo, Adeline Huiling; Chua, Chun Kiang; Pumera, Martin
2017-01-16
3D printing, an upcoming technology, has vast potential to transform conventional fabrication processes due to the numerous improvements it can offer to the current methods. To date, the employment of 3D printing technology has been examined for applications in the fields of engineering, manufacturing and biological sciences. In this study, we examined the potential of adopting 3D printing technology for a novel application, electrochemical DNA biosensing. Metal 3D printing was utilized to construct helical-shaped stainless steel electrodes which functioned as a transducing platform for the detection of DNA hybridization. The ability of electroactive methylene blue to intercalate into the double helix structure of double-stranded DNA was then exploited to monitor the DNA hybridization process, with its inherent reduction peak serving as an analytical signal. The designed biosensing approach was found to demonstrate superior selectivity against a non-complementary DNA target, with a detection range of 1-1000 nM.
Instructing cells with programmable peptide DNA hybrids
DOE Office of Scientific and Technical Information (OSTI.GOV)
Freeman, Ronit; Stephanopoulos, Nicholas; Alvarez, Zaida
The native extracellular matrix is a space in which signals can be displayed dynamically and reversibly, positioned with nanoscale precision, and combined synergistically to control cell function. Here we describe a molecular system that can be programmed to control these three characteristics. In this approach we immobilize peptide-DNA (P-DNA) molecules on a surface through complementary DNA tethers directing cells to adhere and spread reversibly over multiple cycles. The DNA can also serve as a molecular ruler to control the distance-dependent synergy between two peptides. Finally, we use two orthogonal DNA handles to regulate two different bioactive signals, with the abilitymore » to independently up- or downregulate each over time. This enabled us to discover that neural stem cells, derived from the murine spinal cord and organized as neurospheres, can be triggered to migrate out in response to an exogenous signal but then regroup into a neurosphere as the signal is removed.« less
Mechanism for accurate, protein-assisted DNA annealing by Deinococcus radiodurans DdrB
Sugiman-Marangos, Seiji N.; Weiss, Yoni M.; Junop, Murray S.
2016-01-01
Accurate pairing of DNA strands is essential for repair of DNA double-strand breaks (DSBs). How cells achieve accurate annealing when large regions of single-strand DNA are unpaired has remained unclear despite many efforts focused on understanding proteins, which mediate this process. Here we report the crystal structure of a single-strand annealing protein [DdrB (DNA damage response B)] in complex with a partially annealed DNA intermediate to 2.2 Å. This structure and supporting biochemical data reveal a mechanism for accurate annealing involving DdrB-mediated proofreading of strand complementarity. DdrB promotes high-fidelity annealing by constraining specific bases from unauthorized association and only releases annealed duplex when bound strands are fully complementary. To our knowledge, this mechanism provides the first understanding for how cells achieve accurate, protein-assisted strand annealing under biological conditions that would otherwise favor misannealing. PMID:27044084
Dynamic DNA nanotechnology using strand-displacement reactions
NASA Astrophysics Data System (ADS)
Zhang, David Yu; Seelig, Georg
2011-02-01
The specificity and predictability of Watson-Crick base pairing make DNA a powerful and versatile material for engineering at the nanoscale. This has enabled the construction of a diverse and rapidly growing set of DNA nanostructures and nanodevices through the programmed hybridization of complementary strands. Although it had initially focused on the self-assembly of static structures, DNA nanotechnology is now also becoming increasingly attractive for engineering systems with interesting dynamic properties. Various devices, including circuits, catalytic amplifiers, autonomous molecular motors and reconfigurable nanostructures, have recently been rationally designed to use DNA strand-displacement reactions, in which two strands with partial or full complementarity hybridize, displacing in the process one or more pre-hybridized strands. This mechanism allows for the kinetic control of reaction pathways. Here, we review DNA strand-displacement-based devices, and look at how this relatively simple mechanism can lead to a surprising diversity of dynamic behaviour.
Method of preparing and applying single stranded DNA probes to double stranded target DNAs in situ
Gray, J.W.; Pinkel, D.
1991-07-02
A method is provided for producing single stranded non-self-complementary nucleic acid probes, and for treating target DNA for use therewith. The probe is constructed by treating DNA with a restriction enzyme and an exonuclease to form template/primers for a DNA polymerase. The digested strand is resynthesized in the presence of labeled nucleoside triphosphate precursor. Labeled single stranded fragments are separated from the resynthesized fragments to form the probe. Target DNA is treated with the same restriction enzyme used to construct the probe, and is treated with an exonuclease before application of the probe. The method significantly increases the efficiency and specificity of hybridization mixtures by increasing effective probe concentration by eliminating self-hybridization between both probe and target DNAs, and by reducing the amount of target DNA available for mismatched hybridizations. No Drawings
Rizzi, Giovanni; Lee, Jung-Rok; Dahl, Christina; Guldberg, Per; Dufva, Martin; Wang, Shan X; Hansen, Mikkel F
2017-09-26
Epigenetic modifications, in particular DNA methylation, are gaining increasing interest as complementary information to DNA mutations for cancer diagnostics and prognostics. We introduce a method to simultaneously profile DNA mutation and methylation events for an array of sites with single site specificity. Genomic (mutation) or bisulphite-treated (methylation) DNA is amplified using nondiscriminatory primers, and the amplicons are then hybridized to a giant magnetoresistive (GMR) biosensor array followed by melting curve measurements. The GMR biosensor platform offers scalable multiplexed detection of DNA hybridization, which is insensitive to temperature variation. The melting curve approach further enhances the assay specificity and tolerance to variations in probe length. We demonstrate the utility of this method by simultaneously profiling five mutation and four methylation sites in human melanoma cell lines. The method correctly identified all mutation and methylation events and further provided quantitative assessment of methylation density validated by bisulphite pyrosequencing.
Instructing cells with programmable peptide DNA hybrids
Freeman, Ronit; Stephanopoulos, Nicholas; Alvarez, Zaida; ...
2017-07-10
The native extracellular matrix is a space in which signals can be displayed dynamically and reversibly, positioned with nanoscale precision, and combined synergistically to control cell function. Here we describe a molecular system that can be programmed to control these three characteristics. In this approach we immobilize peptide-DNA (P-DNA) molecules on a surface through complementary DNA tethers directing cells to adhere and spread reversibly over multiple cycles. The DNA can also serve as a molecular ruler to control the distance-dependent synergy between two peptides. Finally, we use two orthogonal DNA handles to regulate two different bioactive signals, with the abilitymore » to independently up- or downregulate each over time. This enabled us to discover that neural stem cells, derived from the murine spinal cord and organized as neurospheres, can be triggered to migrate out in response to an exogenous signal but then regroup into a neurosphere as the signal is removed.« less
Brégeon, Damien; Doetsch, Paul W
2004-11-01
Cells of all living organisms are continuously exposed to physical and chemical agents that damage DNA and alter the integrity of their genomes. Despite the relatively high efficiency of the different repair pathways, some lesions remain in DNA when it is replicated or transcribed. Lesion bypass by DNA and RNA polymerases has been the subject of numerous investigations. However, knowledge of the in vivo mechanism of transcription lesion bypass is very limited because no robust methodology is available. Here we describe a protocol based on the synthesis of a complementary strand of a circular, single-stranded DNA molecule, which allows for the production of large amounts of double-stranded DNA containing a lesion at a specific position in a transcribed sequence. Such constructs can subsequently be used for lesion bypass studies in vivo by RNA polymerase and to ascertain how these events can be affected by the genetic background of the cells.
Instructing cells with programmable peptide DNA hybrids
NASA Astrophysics Data System (ADS)
Freeman, Ronit; Stephanopoulos, Nicholas; Álvarez, Zaida; Lewis, Jacob A.; Sur, Shantanu; Serrano, Chris M.; Boekhoven, Job; Lee, Sungsoo S.; Stupp, Samuel I.
2017-07-01
The native extracellular matrix is a space in which signals can be displayed dynamically and reversibly, positioned with nanoscale precision, and combined synergistically to control cell function. Here we describe a molecular system that can be programmed to control these three characteristics. In this approach we immobilize peptide-DNA (P-DNA) molecules on a surface through complementary DNA tethers directing cells to adhere and spread reversibly over multiple cycles. The DNA can also serve as a molecular ruler to control the distance-dependent synergy between two peptides. Finally, we use two orthogonal DNA handles to regulate two different bioactive signals, with the ability to independently up- or downregulate each over time. This enabled us to discover that neural stem cells, derived from the murine spinal cord and organized as neurospheres, can be triggered to migrate out in response to an exogenous signal but then regroup into a neurosphere as the signal is removed.
García-Martinez, Gonzalo; Bustabad, Enrique Alonso; Perrot, Hubert; Gabrielli, Claude; Bucur, Bogdan; Lazerges, Mathieu; Rose, Daniel; Rodriguez-Pardo, Loreto; Fariña, Jose; Compère, Chantal; Vives, Antonio Arnau
2011-01-01
This work deals with the design of a high sensitivity DNA sequence detector using a 50 MHz quartz crystal microbalance (QCM) electronic oscillator circuit. The oscillator circuitry is based on Miller topology, which is able to work in damping media. Calibration and experimental study of frequency noise are carried out, finding that the designed sensor has a resolution of 7.1 ng/cm(2) in dynamic conditions (with circulation of liquid). Then the oscillator is proved as DNA biosensor. Results show that the system is able to detect the presence of complementary target DNAs in a solution with high selectivity and sensitivity. DNA target concentrations higher of 50 ng/mL can be detected.
“Ultra-high resolution optical trap with single fluorophore sensitivity”
Comstock, Matthew J; Ha, Taekjip; Chemla, Yann R
2013-01-01
We present a single-molecule instrument that combines a timeshared ultra-high resolution dual optical trap interlaced with a confocal fluorescence microscope. In a demonstration experiment, individual single-fluorophore labeled DNA oligonucleotides were observed to bind and unbind to complementary DNA suspended between two trapped beads. Simultaneous with the single-fluorophore detection, coincident angstrom-scale changes in tether extension could be clearly observed. Fluorescence readout allowed us to determine the duplex melting rate as a function of force. The new instrument will enable the simultaneous measurement of angstrom-scale mechanical motion of individual DNA-binding proteins (e.g., single base pair stepping of DNA translocases) along with the detection of fluorescently labeled protein properties (e.g., internal configuration). PMID:21336286
Lee, Sangwoo; Kim, Cheolmin; Kim, Jungkon; Kim, Woo-Keun; Shin, Hyun Suk; Lim, Eun-Suk; Lee, Jin Wuk; Kim, Sunmi; Kim, Ki-Tae; Lee, Sung-Kyu; Choi, Cheol Young; Choi, Kyungho
2015-07-01
Zacco platypus, pale chub, is an indigenous freshwater fish of East Asia including Korea and has many useful characteristics as indicator species for water pollution. While utility of Z. platypus as an experimental species has been recognized, genetic-level information is very limited and warrants extensive research. Metallothionein (MT) is widely used and well-known biomarker for heavy metal exposure in many experimental species. In the present study, we cloned MT in Z. platypus and evaluated its utility as a biomarker for metal exposure. For this purpose, we sequenced complete complementary DNA (cDNA) of MT in Z. platypus and carried out phylogenetic analysis with its sequences. The transcription-level responses of MT gene following the exposure to CdCl2 were also assessed to validate the utility of this gene as an exposure biomarker. Analysis of cDNA sequence of MT gene demonstrated high conformity with those of other fish. MT messenger RNA (mRNA) expression and enzymatic MT content significantly increased following CdCl2 exposure in a concentration-dependent manner. The level of CdCl2 that resulted in significant MT changes in Z. platypus was within the range that was reported from other fish. The MT gene of Z. platypus sequenced in the present study can be used as a useful biomarker for heavy metal exposure in the aquatic environment of Korea and other countries where this freshwater fish species represents the ecosystem.
NASA Astrophysics Data System (ADS)
Rivard, Brea R.; Cooper, Sarah J.; Stubbs, John M.
2018-02-01
DNA duplexes consisting of a 25mer together with shorter complementary sequences were studied over a range of temperature and surface binding motifs using a coarse-grained two-site nucleotide model. Results were analyzed in terms of hydrogen bonding interactions and structural characteristics and indicate that hybridization is most stable when furthest from the surface binding site. Strand elongation and straightening near the bound end are found to be correlated to duplex destabilization.
Genome-wide epigenetic perturbation jump-starts patterns of heritable variation found in nature.
Roux, Fabrice; Colomé-Tatché, Maria; Edelist, Cécile; Wardenaar, René; Guerche, Philippe; Hospital, Frédéric; Colot, Vincent; Jansen, Ritsert C; Johannes, Frank
2011-08-01
We extensively phenotyped 6000 Arabidopsis plants with experimentally perturbed DNA methylomes as well as a diverse panel of natural accessions in a common garden. We found that alterations in DNA methylation not only caused heritable phenotypic diversity but also produced heritability patterns closely resembling those of the natural accessions. Our findings indicate that epigenetically induced and naturally occurring variation in complex traits share part of their polygenic architecture and may offer complementary adaptation routes in ecological settings.
Feng, Qiu-Mei; Guo, Yue-Hua; Xu, Jing-Juan; Chen, Hong-Yuan
2018-02-15
A critical challenge in surface-based DNA assembly amplification is the reduced accessibility of DNA strands arranged on a heterogeneous surface compared to that in homogeneous solution. Here, a novel in situ surface-confined DNA assembly amplification electrochemiluminescence (ECL) biosensor based on DNA nanostructural scaffold was presented. In this design, a stem-loop structural DNA segment (Hairpin 1) was constructed on the vertex of DNA nanostructural scaffold as recognition probe. In the present of target DNA, the hairpin structure changed to rod-like through complementary hybridization with target DNA, resulting in the formation of Hairpin 1:target DNA. When the obtained Hairpin 1:target DNA met Hairpin 2 labeled with glucose oxidase (GOD), the DNA cyclic amplification was activated, releasing target DNA into homogeneous solution for the next recycling. Thus, the ECL signal of Ru(bpy) 3 2+ -TPrA system was quenched by H 2 O 2 , the product of GOD catalyzing glucose. As a result, this proposed method achieved a linear range response from 50 aM to 10 pM with lower detection limit of 20 aM. Copyright © 2017 Elsevier B.V. All rights reserved.
Interactions of the EcoRV restriction endonuclease with fluorescent oligodeoxynucleotides.
Erskine, S G; Halford, S E
1995-05-19
A self-complementary dodecadeoxyribonucleotide that contains the recognition sequence for the R.EcoRV ENase was synthesised with a primary amino group at its 5' terminus. The 5' amino function was labeled with the fluorescent dye 5-[dimethylamino] napthalene-1-sulfonyl chloride. The labeled oligodeoxyribonucleotide in its duplex form was shown to be a suitable substrate for kinetic studies on the ENase and that no significant dye-DNA or dye-protein interactions occurred. Finally, the binding of R.EcoRV to the labeled DNA was followed by detecting the fluorescence resonance energy transfer between the tryptophans of the protein and the fluorescent labels of the DNA.
Miles, Robin R [Danville, CA; Belgrader, Phillip [Severna Park, MD; Fuller, Christopher D [Oakland, CA
2007-01-02
Impedance measurements are used to detect the end-point for PCR DNA amplification. A pair of spaced electrodes are located on a surface of a microfluidic channel and an AC or DC voltage is applied across the electrodes to produce an electric field. An ionically labeled probe will attach to a complementary DNA segment, and a polymerase enzyme will release the ionic label. This causes the conductivity of the solution in the area of the electrode to change. This change in conductivity is measured as a change in the impedance been the two electrodes.
DNA interrogation by the CRISPR RNA-guided endonuclease Cas9.
Sternberg, Samuel H; Redding, Sy; Jinek, Martin; Greene, Eric C; Doudna, Jennifer A
2014-03-06
The clustered regularly interspaced short palindromic repeats (CRISPR)-associated enzyme Cas9 is an RNA-guided endonuclease that uses RNA-DNA base-pairing to target foreign DNA in bacteria. Cas9-guide RNA complexes are also effective genome engineering agents in animals and plants. Here we use single-molecule and bulk biochemical experiments to determine how Cas9-RNA interrogates DNA to find specific cleavage sites. We show that both binding and cleavage of DNA by Cas9-RNA require recognition of a short trinucleotide protospacer adjacent motif (PAM). Non-target DNA binding affinity scales with PAM density, and sequences fully complementary to the guide RNA but lacking a nearby PAM are ignored by Cas9-RNA. Competition assays provide evidence that DNA strand separation and RNA-DNA heteroduplex formation initiate at the PAM and proceed directionally towards the distal end of the target sequence. Furthermore, PAM interactions trigger Cas9 catalytic activity. These results reveal how Cas9 uses PAM recognition to quickly identify potential target sites while scanning large DNA molecules, and to regulate scission of double-stranded DNA.
UVA irradiation of BrU-substituted DNA in the presence of Hoechst 33258.
Saha, Abhijit; Kizaki, Seiichiro; Han, Ji Hoon; Yu, Zutao; Sugiyama, Hiroshi
2018-01-01
Given that our knowledge of DNA repair is limited because of the complexity of the DNA system, a technique called UVA micro-irradiation has been developed that can be used to visualize the recruitment of DNA repair proteins at double-strand break (DSB) sites. Interestingly, Hoechst 33258 was used under micro-irradiation to sensitize 5-bromouracil ( Br U)-labelled DNA, causing efficient DSBs. However, the molecular basis of DSB formation under UVA micro-irradiation remains unknown. Herein, we investigated the mechanism of DSB formation under UVA micro-irradiation conditions. Our results suggest that the generation of a uracil-5-yl radical through electron transfer from Hoechst 33258 to Br U caused DNA cleavage preferentially at self-complementary 5'-AA Br U Br U-3' sequences to induce DSB. We also investigated the DNA cleavage in the context of the nucleosome to gain a better understanding of UVA micro-irradiation in a cell-like model. We found that DNA cleavage occurred in both core and linker DNA regions although its efficiency reduced in core DNA. Copyright © 2017 Elsevier Ltd. All rights reserved.
DNA interrogation by the CRISPR RNA-guided endonuclease Cas9
NASA Astrophysics Data System (ADS)
Sternberg, Samuel H.; Redding, Sy; Jinek, Martin; Greene, Eric C.; Doudna, Jennifer A.
2014-03-01
The clustered regularly interspaced short palindromic repeats (CRISPR)-associated enzyme Cas9 is an RNA-guided endonuclease that uses RNA-DNA base-pairing to target foreign DNA in bacteria. Cas9-guide RNA complexes are also effective genome engineering agents in animals and plants. Here we use single-molecule and bulk biochemical experiments to determine how Cas9-RNA interrogates DNA to find specific cleavage sites. We show that both binding and cleavage of DNA by Cas9-RNA require recognition of a short trinucleotide protospacer adjacent motif (PAM). Non-target DNA binding affinity scales with PAM density, and sequences fully complementary to the guide RNA but lacking a nearby PAM are ignored by Cas9-RNA. Competition assays provide evidence that DNA strand separation and RNA-DNA heteroduplex formation initiate at the PAM and proceed directionally towards the distal end of the target sequence. Furthermore, PAM interactions trigger Cas9 catalytic activity. These results reveal how Cas9 uses PAM recognition to quickly identify potential target sites while scanning large DNA molecules, and to regulate scission of double-stranded DNA.
A Graphene-Based Biosensing Platform Based on Regulated Release of an Aptameric DNA Biosensor
Mao, Yu; Chen, Yongli; Li, Song; Lin, Shuo; Jiang, Yuyang
2015-01-01
A novel biosensing platform was developed by integrating an aptamer-based DNA biosensor with graphene oxide (GO) for rapid and facile detection of adenosine triphosphate (ATP, as a model target). The DNA biosensor, which is locked by GO, is designed to contain two sensing modules that include recognition site for ATP and self-replication track that yields the nicking domain for Nt.BbvCI. By taking advantage of the different binding affinity of single-stranded DNA, double-stranded DNA and aptamer-target complex toward GO, the DNA biosensor could be efficiently released from GO in the presence of target with the help of a complementary DNA strand (CPDNA) that partially hybridizes to the DNA biosensor. Then, the polymerization/nicking enzyme synergetic isothermal amplification could be triggered, leading to the synthesis of massive DNA amplicons, thus achieving an enhanced sensitivity with a wide linear dynamic response range of four orders of magnitude and good selectivity. This biosensing strategy expands the applications of GO-DNA nanobiointerfaces in biological sensing, showing great potential in fundamental research and biomedical diagnosis. PMID:26569239
A Graphene-Based Biosensing Platform Based on Regulated Release of an Aptameric DNA Biosensor.
Mao, Yu; Chen, Yongli; Li, Song; Lin, Shuo; Jiang, Yuyang
2015-11-09
A novel biosensing platform was developed by integrating an aptamer-based DNA biosensor with graphene oxide (GO) for rapid and facile detection of adenosine triphosphate (ATP, as a model target). The DNA biosensor, which is locked by GO, is designed to contain two sensing modules that include recognition site for ATP and self-replication track that yields the nicking domain for Nt.BbvCI. By taking advantage of the different binding affinity of single-stranded DNA, double-stranded DNA and aptamer-target complex toward GO, the DNA biosensor could be efficiently released from GO in the presence of target with the help of a complementary DNA strand (CPDNA) that partially hybridizes to the DNA biosensor. Then, the polymerization/nicking enzyme synergetic isothermal amplification could be triggered, leading to the synthesis of massive DNA amplicons, thus achieving an enhanced sensitivity with a wide linear dynamic response range of four orders of magnitude and good selectivity. This biosensing strategy expands the applications of GO-DNA nanobiointerfaces in biological sensing, showing great potential in fundamental research and biomedical diagnosis.
Andrade, B S; Villela-Dias, C; Gomes, D S; Micheli, F; Góes-Neto, A
2013-06-13
Moniliophthora perniciosa (Stahel) Aime and Phillips-Mora is a hemibiotrophic basidiomycete (Agaricales, Tricholomataceae) that causes witches' broom disease in cocoa (Theobroma cacao L.). This pathogen carries a stable integrated invertron-type linear plasmid in its mitochondrial genome that encodes viral-like DNA and RNA polymerases related to fungal senescence and longevity. After culturing the fungus and obtaining its various stages of development in triplicate, we carried out total RNA extraction and subsequent complementary DNA synthesis. To analyze DNA and RNA polymerase expression levels, we performed real-time reverse transcriptase polymerase chain reaction for various fungal phases of development. Our results showed that DNA and RNA polymerase gene expression in the primordium phase of M. perniciosa is related to a potential defense mechanism against T. cacao oxidative attack.
A novel input-parasitic compensation technique for a nanopore-based CMOS DNA detection sensor
NASA Astrophysics Data System (ADS)
Kim, Jungsuk
2016-12-01
This paper presents a novel input-parasitic compensation (IPC) technique for a nanopore-based complementary metal-oxide-semiconductor (CMOS) DNA detection sensor. A resistive-feedback transimpedance amplifier is typically adopted as the headstage of a DNA detection sensor to amplify the minute ionic currents generated from a nanopore and convert them to a readable voltage range for digitization. But, parasitic capacitances arising from the headstage input and the nanopore often cause headstage saturation during nanopore sensing, thereby resulting in significant DNA data loss. To compensate for the unwanted saturation, in this work, we propose an area-efficient and automated IPC technique, customized for a low-noise DNA detection sensor, fabricated using a 0.35- μm CMOS process; we demonstrated this prototype in a benchtop test using an α-hemolysin ( α-HL) protein nanopore.
Kong, Muwen; Beckwitt, Emily C; Springall, Luke; Kad, Neil M; Van Houten, Bennett
2017-01-01
Single-molecule approaches to solving biophysical problems are powerful tools that allow static and dynamic real-time observations of specific molecular interactions of interest in the absence of ensemble-averaging effects. Here, we provide detailed protocols for building an experimental system that employs atomic force microscopy and a single-molecule DNA tightrope assay based on oblique angle illumination fluorescence microscopy. Together with approaches for engineering site-specific lesions into DNA substrates, these complementary biophysical techniques are well suited for investigating protein-DNA interactions that involve target-specific DNA-binding proteins, such as those engaged in a variety of DNA repair pathways. In this chapter, we demonstrate the utility of the platform by applying these techniques in the studies of proteins participating in nucleotide excision repair. © 2017 Elsevier Inc. All rights reserved.
Detection of bacterial 16S rRNA using a molecular beacon-based X sensor
Gerasimova, Yulia V.; Kolpashchikov, Dmitry M.
2012-01-01
We demonstrate how a long structurally constrained RNA can be analyzed in homogeneous solution at ambient temperatures with high specificity using a sophisticated biosensor. The sensor consists of a molecular beacon probe as a signal reporter and two DNA adaptor strands, which have fragments complementary to the reporter and to the analyzed RNA. One adaptor strand uses its long RNA-binding arm to unwind the RNA secondary structure. Second adaptor strand with a short RNA-binding arm hybridizes only to a fully complementary site, thus providing high recognition specificity. Overall the three-component sensor and the target RNA form a four-stranded DNA crossover (X) structure. Using this sensor, E.coli 16S rRNA was detected in real time with the detection limit of ~ 0.17 nM. The high specificity of the analysis was proven by differentiating B.subtilus from E.coli 16S rRNA sequences. The sensor responds to the presence of the analyte within seconds. PMID:23021850
Induction of UO-44 gene expression by tamoxifen in the rat uterus and ovary.
Huynh, H; Ng, C Y; Lim, K B; Ong, C K; Ong, C S; Tran, E; Tuyen Nguyen, T T; Chan, T W
2001-07-01
A complementary DNA, uterine-ovarian-specific gene 44 (UO-44), has been isolated from tamoxifen-induced rat uterine complementary DNA library using differential display techniques. UO-44 transcripts are found to be abundant in the uterus and ovary. UO-44 gene expression in the uterus is strictly regulated by estrogens, tamoxifen, and GH, whereas the pure antiestrogen ICI 182780 is inhibitory. Treatment of ovariectomized rats and hypophysectomized rats with tamoxifen and GH, respectively, resulted in up-regulation of UO-44 expression in a dose-dependent manner. In situ hybridization revealed that UO-44 gene expression was restricted to the luminal and glandular epithelial cells of the uterus and to granulosa cells of medium-size ovarian follicles. Transfection studies showed that UO-44 was a membrane-associated protein. Because estrogens, tamoxifen, and GH are stimulators of uterine luminal epithelial cell growth in vivo, UO-44 protein may serve as a mediator of the effect of these compounds in inducing epithelial proliferation and differentiation in these tissues.
An Evidence-Based Course in Complementary Medicines
Hughes, Jeff
2012-01-01
Objective. To evaluate the impact of an evidence-based course in complementary medicines on the attitudes, knowledge, and professional practice behavior of undergraduate pharmacy students. Design. A required 12-week evidence-based complementary medicine course was designed and introduced into the third-year undergraduate pharmacy curriculum. The course included a combination of traditional lectures, interactive tutorial sessions, and a range of formal assessments. Assessment. Pre- and post-course survey instruments were administered to assess changes in students’ attitudes, perceptions, knowledge, and the likelihood they would recommend the use of complementary medicines in a pharmacy practice environment. Conclusion. Completion of a required evidence-based complementary medicines course resulted in a positive change in pharmacy students’ perceptions of the value of various complementary medicines as well as in their willingness to recommend them, and provided students with the required knowledge to make patient-centered recommendations for use of complementary medicines in a professional pharmacy practice setting. These findings support the need for greater evidence-based complementary medicine education within pharmacy curricula to meet consumer demand and to align with pharmacists’ professional responsibilities. PMID:23275665
Bilia, Anna Rita
2014-12-02
The European Pharmacopoeia (Ph. Eur.) is a standard reference for both European and non-European countries and defines requirements for the qualitative and quantitative composition of medicines. Herbal drug (HD) monographs state which aspects have to be considered for quality assurance through the relevant chapters "Definition", "Characters", "Identification", "Tests", and "Assay". Identification of botanical material is achieved by macroscopic and microscopic morphology, generally examined by a trained expert. Content or assay is the most difficult area of quality control to perform, since in most herbal drugs the active constituents are unknown and markers should be used which cannot be really related to the quality. The other critical points are represented by the purity tests, in particular some tests such as heavy metals, aflatoxins and pesticides are laborious and time intensive, requiring a significant investment in equipment, materials, and maintenance. A literature survey concerning alternative and/or complementary tools for quality control of botanicals has been performed by searching the scientific databases Pubmed, SciFinder, Scopus and Web of Science. Diverse analytical methods including DNA fingerprinting, Nuclear Magnetic Resonance (NMR), Near Infra Red (NIR) and (bio)sensors have been reported in the literature to evaluate the quality of botanical products. Identification of plants at the species level can be successfully based on genome-based methods, using DNA barcodes, the nucleotide sequence of a short DNA fragment. NMR can provide direct NMR fingerprint determination (complete assignment of the signals by 1D and 2D experiments), quantitative NMR and chemometric analysis (the metabolite fingerprint is based on the distribution of intensity in the NMR spectrum to provide sample classification). NIR spectroscopy is a fast qualitative and quantitative analytical method, getting knowledge about plant species and/or its geographic origin. Finally, the development of chemical and biological sensors is currently one of the most active areas of analytical research. Immobilization of specific enzymes led to recognize definite class of compounds such as cysteine sulfoxides, glucosinolates, cyanogenic glycosides, and polyphenols. Other recognition elements are nucleic acids to evaluate the ability of different molecules to bind DNA. Sensors have also been developed for the detection of heavy metals in botanicals. Moreover, the analysis of mycotoxins and pesticides, could represent another field of possible application. These alternative/complementary analytical methods represent tools which appear to be an analyst's dream: they are able to give rapid analysis responses; to operate directly on complex matrices, in many cases; to be selective and sensitive enough for the required application; to be portable and sometimes also disposable; and to have fast analysis times. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Yu, Xiang-Qin; Drew, Bryan T; Yang, Jun-Bo; Gao, Lian-Ming; Li, De-Zhu
2017-01-01
Schima is an ecologically and economically important woody genus in tea family (Theaceae). Unresolved species delimitations and phylogenetic relationships within Schima limit our understanding of the genus and hinder utilization of the genus for economic purposes. In the present study, we conducted comparative analysis among the complete chloroplast (cp) genomes of 11 Schima species. Our results indicate that Schima cp genomes possess a typical quadripartite structure, with conserved genomic structure and gene order. The size of the Schima cp genome is about 157 kilo base pairs (kb). They consistently encode 114 unique genes, including 80 protein-coding genes, 30 tRNAs, and 4 rRNAs, with 17 duplicated in the inverted repeat (IR). These cp genomes are highly conserved and do not show obvious expansion or contraction of the IR region. The percent variability of the 68 coding and 93 noncoding (>150 bp) fragments is consistently less than 3%. The seven most widely touted DNA barcode regions as well as one promising barcode candidate showed low sequence divergence. Eight mutational hotspots were identified from the 11 cp genomes. These hotspots may potentially be useful as specific DNA barcodes for species identification of Schima. The 58 cpSSR loci reported here are complementary to the microsatellite markers identified from the nuclear genome, and will be leveraged for further population-level studies. Phylogenetic relationships among the 11 Schima species were resolved with strong support based on the cp genome data set, which corresponds well with the species distribution pattern. The data presented here will serve as a foundation to facilitate species identification, DNA barcoding and phylogenetic reconstructions for future exploration of Schima.
Electronic Activation of a DNA Nanodevice Using a Multilayer Nanofilm.
Jeong, Hyejoong; Ranallo, Simona; Rossetti, Marianna; Heo, Jiwoong; Shin, Jooseok; Park, Kwangyong; Ricci, Francesco; Hong, Jinkee
2016-10-01
A method to control activation of a DNA nanodevice by supplying a complementary DNA (cDNA) strand from an electro-responsive nanoplatform is reported. To develop functional nanoplatform, hexalayer nanofilm is precisely designed by layer-by-layer assembly technique based on electrostatic interaction with four kinds of materials: Hydrolyzed poly(β-amino ester) can help cDNA release from the film. A cDNA is used as a key building block to activate DNA nanodevice. Reduced graphene oxides (rGOs) and the conductive polymer provide conductivity. In particular, rGOs efficiently incorporate a cDNA in the film via several interactions and act as a barrier. Depending on the types of applied electronic stimuli (reductive and oxidative potentials), a cDNA released from the electrode can quantitatively control the activation of DNA nanodevice. From this report, a new system is successfully demonstrated to precisely control DNA release on demand. By applying more advanced form of DNA-based nanodevices into multilayer system, the electro-responsive nanoplatform will expand the availability of DNA nanotechnology allowing its improved application in areas such as diagnosis, biosensing, bioimaging, and drug delivery. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
MutSα's Multi-Domain Allosteric Response to Three DNA Damage Types Revealed by Machine Learning
NASA Astrophysics Data System (ADS)
Melvin, Ryan L.; Thompson, William G.; Godwin, Ryan C.; Gmeiner, William H.; Salsbury, Freddie R.
2017-03-01
MutSalpha is a key component in the mismatch repair (MMR) pathway. This protein is responsible for initiating the signaling pathways for DNA repair or cell death. Herein we investigate this heterodimer’s post-recognition, post-binding response to three types of DNA damage involving cytotoxic, anti-cancer agents - carboplatin, cisplatin, and FdU. Through a combination of supervised and unsupervised machine learning techniques along with more traditional structural and kinetic analysis applied to all-atom molecular dynamics (MD) calculations, we predict that MutSalpha has a distinct response to each of the three damage types. Via a binary classification tree (a supervised machine learning technique), we identify key hydrogen bond motifs unique to each type of damage and suggest residues for experimental mutation studies. Through a combination of a recently developed clustering (unsupervised learning) algorithm, RMSF calculations, PCA, and correlated motions we predict that each type of damage causes MutS↵to explore a specific region of conformation space. Detailed analysis suggests a short range effect for carboplatin - primarily altering the structures and kinetics of residues within 10 angstroms of the damaged DNA - and distinct longer-range effects for cisplatin and FdU. In our simulations, we also observe that a key phenylalanine residue - known to stack with a mismatched or unmatched bases in MMR - stacks with the base complementary to the damaged base in 88.61% of MD frames containing carboplatinated DNA. Similarly, this Phe71 stacks with the base complementary to damage in 91.73% of frames with cisplatinated DNA. This residue, however, stacks with the damaged base itself in 62.18% of trajectory frames with FdU-substituted DNA and has no stacking interaction at all in 30.72% of these frames. Each drug investigated here induces a unique perturbation in the MutS↵complex, indicating the possibility of a distinct signaling event and specific repair or death pathway (or set of pathways) for a given type of damage.
Computational Approaches to Nucleic Acid Origami.
Jabbari, Hosna; Aminpour, Maral; Montemagno, Carlo
2015-10-12
Recent advances in experimental DNA origami have dramatically expanded the horizon of DNA nanotechnology. Complex 3D suprastructures have been designed and developed using DNA origami with applications in biomaterial science, nanomedicine, nanorobotics, and molecular computation. Ribonucleic acid (RNA) origami has recently been realized as a new approach. Similar to DNA, RNA molecules can be designed to form complex 3D structures through complementary base pairings. RNA origami structures are, however, more compact and more thermodynamically stable due to RNA's non-canonical base pairing and tertiary interactions. With all these advantages, the development of RNA origami lags behind DNA origami by a large gap. Furthermore, although computational methods have proven to be effective in designing DNA and RNA origami structures and in their evaluation, advances in computational nucleic acid origami is even more limited. In this paper, we review major milestones in experimental and computational DNA and RNA origami and present current challenges in these fields. We believe collaboration between experimental nanotechnologists and computer scientists are critical for advancing these new research paradigms.
Fluorescence based Aptasensors for the determination of hepatitis B virus e antigen.
Huang, Rongrong; Xi, Zhijiang; Deng, Yan; He, Nongyue
2016-08-08
This research is aimed at selecting specific aptamer of hepatitis B e antigen by SELEX and its applications. Hepatitis B e antigen (HBeAg) seroconversion is used as an indicator of virological response when treating patients suffering from chronic hepatitis B. HBeAg also indicates a high viremia and high infectivity in untreated patients. With HBeAg modified magnetic beads as targets, three groups of aptamers are successfully selected. These are the first reported DNA aptamers that can specifically bind to HBeAg. Based on the property that the conformation changes upon binding to its target, aptamer has emerged as ideal candidate in a variety of sensing applications. In this study, we present a simple strategy for aptamer-based fluorescence biosensors for the quantitative detection of HBeAg, in which a fluorescence labeled HBeAg aptamer serves as the molecular recognition element and a short DNA molecule that is complementary to the aptamer serves as the competitor. The LOD for HBeAg is 609 ng/mL. Later, the fluorescence system is deployed in HBeAg positive and negative blood serum (p < 0.05). The total detection assay could be completed in 2 min. These newly isolated aptamers could assist the diagnosis of chronic hepatitis B.
Fluorescence based Aptasensors for the determination of hepatitis B virus e antigen
Huang, Rongrong; Xi, Zhijiang; Deng, Yan; He, Nongyue
2016-01-01
This research is aimed at selecting specific aptamer of hepatitis B e antigen by SELEX and its applications. Hepatitis B e antigen (HBeAg) seroconversion is used as an indicator of virological response when treating patients suffering from chronic hepatitis B. HBeAg also indicates a high viremia and high infectivity in untreated patients. With HBeAg modified magnetic beads as targets, three groups of aptamers are successfully selected. These are the first reported DNA aptamers that can specifically bind to HBeAg. Based on the property that the conformation changes upon binding to its target, aptamer has emerged as ideal candidate in a variety of sensing applications. In this study, we present a simple strategy for aptamer-based fluorescence biosensors for the quantitative detection of HBeAg, in which a fluorescence labeled HBeAg aptamer serves as the molecular recognition element and a short DNA molecule that is complementary to the aptamer serves as the competitor. The LOD for HBeAg is 609 ng/mL. Later, the fluorescence system is deployed in HBeAg positive and negative blood serum (p < 0.05). The total detection assay could be completed in 2 min. These newly isolated aptamers could assist the diagnosis of chronic hepatitis B. PMID:27499342
The energetic basis of the DNA double helix: a combined microcalorimetric approach
Vaitiekunas, Paulius; Crane-Robinson, Colyn; Privalov, Peter L.
2015-01-01
Microcalorimetric studies of DNA duplexes and their component single strands showed that association enthalpies of unfolded complementary strands into completely folded duplexes increase linearly with temperature and do not depend on salt concentration, i.e. duplex formation results in a constant heat capacity decrement, identical for CG and AT pairs. Although duplex thermostability increases with CG content, the enthalpic and entropic contributions of an AT pair to duplex formation exceed that of a CG pair when compared at the same temperature. The reduced contribution of AT pairs to duplex stabilization comes not from their lower enthalpy, as previously supposed, but from their larger entropy contribution. This larger enthalpy and particularly the greater entropy results from water fixed by the AT pair in the minor groove. As the increased entropy of an AT pair exceeds that of melting ice, the water molecule fixed by this pair must affect those of its neighbors. Water in the minor groove is, thus, orchestrated by the arrangement of AT groups, i.e. is context dependent. In contrast, water hydrating exposed nonpolar surfaces of bases is responsible for the heat capacity increment on dissociation and, therefore, for the temperature dependence of all thermodynamic characteristics of the double helix. PMID:26304541
Laino, Aldana; Lopez-Zavala, Alonso A.; Garcia-Orozco, Karina D.; ...
2017-09-11
Energy buffering systems are key for homeostasis during variations in energy supply. Spiders are the most important predators for insects and therefore key in terrestrial ecosystems. From biomedical interest, spiders are important for their venoms and as a source of potent allergens, such as arginine kinase (AK, EC 2.7.3.3). AK is an enzyme crucial for energy metabolism, keeping the pool of phosphagens in invertebrates, and also an allergen for humans. In this work, we studied AK from the Argentininan spider Polybetes pythagoricus ( PpAK), from its complementary DNA to the crystal structure. The PpAK cDNA from muscle was cloned, andmore » it is comprised of 1068 nucleotides that encode a 384-amino acids protein, similar to other invertebrate AKs. The apparent Michaelis-Menten kinetic constant ( K m) was 1.7 mM with a k cat of 75 s –1. Two crystal structures are presented, the apo PvAK and PpAK bound to arginine, both in the open conformation with the active site lid (residues 310–320) completely disordered. The guanidino group binding site in the apo structure appears to be organized to accept the arginine substrate. Lastly, these results contribute to knowledge of mechanistic details of the function of arginine kinase.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Laino, Aldana; Lopez-Zavala, Alonso A.; Garcia-Orozco, Karina D.
Energy buffering systems are key for homeostasis during variations in energy supply. Spiders are the most important predators for insects and therefore key in terrestrial ecosystems. From biomedical interest, spiders are important for their venoms and as a source of potent allergens, such as arginine kinase (AK, EC 2.7.3.3). AK is an enzyme crucial for energy metabolism, keeping the pool of phosphagens in invertebrates, and also an allergen for humans. In this work, we studied AK from the Argentininan spider Polybetes pythagoricus ( PpAK), from its complementary DNA to the crystal structure. The PpAK cDNA from muscle was cloned, andmore » it is comprised of 1068 nucleotides that encode a 384-amino acids protein, similar to other invertebrate AKs. The apparent Michaelis-Menten kinetic constant ( K m) was 1.7 mM with a k cat of 75 s –1. Two crystal structures are presented, the apo PvAK and PpAK bound to arginine, both in the open conformation with the active site lid (residues 310–320) completely disordered. The guanidino group binding site in the apo structure appears to be organized to accept the arginine substrate. Lastly, these results contribute to knowledge of mechanistic details of the function of arginine kinase.« less
DNA assisted self-assembly of PAMAM dendrimers.
Mandal, Taraknath; Kumar, Mattaparthi Venkata Satish; Maiti, Prabal K
2014-10-09
We report DNA assisted self-assembly of polyamidoamine (PAMAM) dendrimers using all atom Molecular Dynamics (MD) simulations and present a molecular level picture of a DNA-linked PAMAM dendrimer nanocluster, which was first experimentally reported by Choi et al. (Nano Lett., 2004, 4, 391-397). We have used single stranded DNA (ssDNA) to direct the self-assembly process. To explore the effect of pH on this mechanism, we have used both the protonated (low pH) and nonprotonated (high pH) dendrimers. In all cases studied here, we observe that the DNA strand on one dendrimer unit drives self-assembly as it binds to the complementary DNA strand present on the other dendrimer unit, leading to the formation of a DNA-linked dendrimer dimeric complex. However, this binding process strongly depends on the charge of the dendrimer and length of the ssDNA. We observe that the complex with a nonprotonated dendrimer can maintain a DNA length dependent inter-dendrimer distance. In contrast, for complexes with a protonated dendrimer, the inter-dendrimer distance is independent of the DNA length. We attribute this observation to the electrostatic complexation of a negatively charged DNA strand with the positively charged protonated dendrimer.
The substrate binding interface of alkylpurine DNA glycosylase AlkD.
Mullins, Elwood A; Rubinson, Emily H; Eichman, Brandt F
2014-01-01
Tandem helical repeats have emerged as an important DNA binding architecture. DNA glycosylase AlkD, which excises N3- and N7-alkylated nucleobases, uses repeating helical motifs to bind duplex DNA and to selectively pause at non-Watson-Crick base pairs. Remodeling of the DNA backbone promotes nucleotide flipping of the lesion and the complementary base into the solvent and toward the protein surface, respectively. The important features of this new DNA binding architecture that allow AlkD to distinguish between damaged and normal DNA without contacting the lesion are poorly understood. Here, we show through extensive mutational analysis that DNA binding and N3-methyladenine (3mA) and N7-methylguanine (7mG) excision are dependent upon each residue lining the DNA binding interface. Disrupting electrostatic or hydrophobic interactions with the DNA backbone substantially reduced binding affinity and catalytic activity. These results demonstrate that residues seemingly only involved in general DNA binding are important for catalytic activity and imply that base excision is driven by binding energy provided by the entire substrate interface of this novel DNA binding architecture. Copyright © 2013 Elsevier B.V. All rights reserved.
Site-directed DNA crosslinking of large multisubunit protein-DNA complexes.
Persinger, Jim; Bartholomew, Blaine
2009-01-01
Several methods have been developed to site-specifically incorporate photoreactive nucleotide analogs into DNA for the purpose of identifying the proteins and their domains that are in contact with particular regions of DNA. The synthesis of several deoxynucleotide analogs that have a photoreactive group tethered to the nucleotide base and the incorporation of these analogs into DNA are described. In a second approach, oligonucleotide with a photoreactive group attached to the phosphate backbone is chemically synthesized. The photoreactive oligonucleotide is then enzymatically incorporated into DNA by annealing it to a complementary DNA template and extending with DNA polymerase. Both approaches have been effectively used to map protein-DNA interactions in large multisubunit complexes such as the eukaryotic transcription or ATP-dependent chromatin remodeling complexes. Not only do these techniques map the binding sites of the various subunits in these complexes, but when coupled with peptide mapping also determine the protein domain that is in close proximity to the different DNA sites. The strength of these techniques is the ability to scan a large number of potential sites by making combinations of different DNA probes and is facilitated by using an immobilized DNA template for synthesis.
Time-Resolved Small-Angle X-ray Scattering Reveals Millisecond Transitions of a DNA Origami Switch.
Bruetzel, Linda K; Walker, Philipp U; Gerling, Thomas; Dietz, Hendrik; Lipfert, Jan
2018-04-11
Self-assembled DNA structures enable creation of specific shapes at the nanometer-micrometer scale with molecular resolution. The construction of functional DNA assemblies will likely require dynamic structures that can undergo controllable conformational changes. DNA devices based on shape complementary stacking interactions have been demonstrated to undergo reversible conformational changes triggered by changes in ionic environment or temperature. An experimentally unexplored aspect is how quickly conformational transitions of large synthetic DNA origami structures can actually occur. Here, we use time-resolved small-angle X-ray scattering to monitor large-scale conformational transitions of a two-state DNA origami switch in free solution. We show that the DNA device switches from its open to its closed conformation upon addition of MgCl 2 in milliseconds, which is close to the theoretical diffusive speed limit. In contrast, measurements of the dimerization of DNA origami bricks reveal much slower and concentration-dependent assembly kinetics. DNA brick dimerization occurs on a time scale of minutes to hours suggesting that the kinetics depend on local concentration and molecular alignment.
On-chip isothermal, chemical cycling polymerase chain reaction (ccPCR)
NASA Astrophysics Data System (ADS)
Persat, Alexandre; Santiago, Juan
2008-11-01
We demonstrate a novel ccPCR technique for microfluidic DNA amplification where temperature is held constant in space and time. The polymerase chain reaction is a platform of choice for biological assays and typically based on a three-step thermal cycling: DNA denaturation, primers annealing and extension by an enzyme. We here demonstrate a novel technique where high concentration chemical denaturants (solvents) denature DNA. We leverage the high electrophoretic mobility of DNA and the electrical neutrality of denaturants to achieve chemical cycling. We focus DNA with isotachophoresis (ITP); a robust electrophoretic preconcentration technique which generates strong electric field gradients and protects the sample from dispersion. We apply a pressure-driven flow to balance electromigration velocity and keep the DNA sample stationary in a microchannel. We drive the DNA through a series of high denaturant concentration zones. DNA denatures at high denaturant concentration. At low denaturant concentration, the enzyme creates complementary strands. DNA reaction kinetics are slower than buffer reactions involved in ITP. We demonstrate successful ccPCR amplification for detection of E. Coli. The ccPCR has the potential for simpler chemistry than traditional PCR.
Schalk, Catherine; Cognat, Valérie; Graindorge, Stéfanie; Vincent, Timothée; Voinnet, Olivier; Molinier, Jean
2017-01-01
As photosynthetic organisms, plants need to prevent irreversible UV-induced DNA lesions. Through an unbiased, genome-wide approach, we have uncovered a previously unrecognized interplay between Global Genome Repair and small interfering RNAs (siRNAs) in the recognition of DNA photoproducts, prevalently in intergenic regions. Genetic and biochemical approaches indicate that, upon UV irradiation, the DNA DAMAGE-BINDING PROTEIN 2 (DDB2) and ARGONAUTE 1 (AGO1) of Arabidopsis thaliana form a chromatin-bound complex together with 21-nt siRNAs, which likely facilitates recognition of DNA damages in an RNA/DNA complementary strand-specific manner. The biogenesis of photoproduct-associated siRNAs involves the noncanonical, concerted action of RNA POLYMERASE IV, RNA-DEPENDENT RNA POLYMERASE-2, and DICER-LIKE-4. Furthermore, the chromatin association/dissociation of the DDB2-AGO1 complex is under the control of siRNA abundance and DNA damage signaling. These findings reveal unexpected nuclear functions for DCL4 and AGO1, and shed light on the interplay between small RNAs and DNA repair recognition factors at damaged sites. PMID:28325872
Problem-Solving Test: Conditional Gene Targeting Using the Cre/loxP Recombination System
ERIC Educational Resources Information Center
Szeberényi, József
2013-01-01
Terms to be familiar with before you start to solve the test: gene targeting, knock-out mutation, bacteriophage, complementary base-pairing, homologous recombination, deletion, transgenic organisms, promoter, polyadenylation element, transgene, DNA replication, RNA polymerase, Shine-Dalgarno sequence, restriction endonuclease, polymerase chain…
Jo, Hyunbin; Ventura, Marc; Vidal, Nicolas; Gim, Jeong-Soo; Buchaca, Teresa; Barmuta, Leon A; Jeppesen, Erik; Joo, Gea-Jae
2016-01-01
Ecological monitoring contributes to the understanding of complex ecosystem functions. The diets of fish reflect the surrounding environment and habitats and may, therefore, act as useful integrating indicators of environmental status. It is, however, often difficult to visually identify items in gut contents to species level due to digestion of soft-bodied prey beyond visual recognition, but new tools rendering this possible are now becoming available. We used a molecular approach to determine the species identities of consumed diet items of an introduced generalist feeder, brown trout (Salmo trutta), in 10 Tasmanian lakes and compared the results with those obtained from visual quantification of stomach contents. We obtained 44 unique taxa (OTUs) belonging to five phyla, including seven classes, using the barcode of life approach from cytochrome oxidase I (COI). Compared with visual quantification, DNA analysis showed greater accuracy, yielding a 1.4-fold higher number of OTUs. Rarefaction curve analysis showed saturation of visually inspected taxa, while the curves from the DNA barcode did not saturate. The OTUs with the highest proportions of haplotypes were the families of terrestrial insects Formicidae, Chrysomelidae, and Torbidae and the freshwater Chironomidae. Haplotype occurrence per lake was negatively correlated with lake depth and transparency. Nearly all haplotypes were only found in one fish gut from a single lake. Our results indicate that DNA barcoding of fish diets is a useful and complementary method for discovering hidden biodiversity.
Zhu, Shuyan; Li, Hualin; Yang, Mengsu; Pang, Stella W
2018-05-31
Three-dimensional (3D) multilayered plasmonic structures consisting of Au submicrometric squares on top of SU-8 submicrometric pillars, Au asymmetrical submicrometric structures in the middle, and Au asymmetrical submicrometric holes at the bottom were fabricated through reversal nanoimprint technology. Compared with two-dimensional and quasi-3D plasmonic structures, the 3D multilayered plasmonic structures showed higher electromagnetic field intensity, longer plasmon decay length and larger plasmon sensing area, which are desirable for highly sensitive localized surface plasmonic resonance biosensors. The sensitivity and resonance peak wavelength of the 3D multilayered plasmonic structures could be adjusted by varying the offset between the top and bottom SU-8 submicrometric pillars from 31% to 56%, and the highest sensitivity of 382 and 442 nm/refractive index unit were observed for resonance peaks at 581 and 805 nm, respectively. Live lung cancer A549 cells with a low concentration of 5×103 cells/ml and a low sample volume of 2 µl could be detected by the 3D multilayered plasmonic structures integrated in a microfluidic system. The 3D plasmonic biosensors also had the advantages of detecting DNA hybridization by capturing the complementary target DNA in the low concentration range of 10-14 to 10-7 M, and providing a large peak shift of 82 nm for capturing 10-7 M complementary target DNA without additional signal amplification. Creative Commons Attribution license.
NASA Astrophysics Data System (ADS)
Matsishin, M.; Rachkov, A.; Lopatynskyi, A.; Chegel, V.; Soldatkin, A.; El'skaya, A.
2017-04-01
An experimental approach for improving the sensitivity of the surface plasmon resonance (SPR) DNA hybridization sensor using gold nanoparticles (GNPs), modified by specific oligonucleotides, was elaborated. An influence of the ionic strength on the aggregation stability of unmodified GNPs and GNPs modified by the thiolated oligonucleotides was investigated by monitoring a value of light extinction at 520 nm that can be considered as a measure of a quantity of the non-aggregated GNPs. While the unmodified GNPs started to aggregate in 0.2 × saline-sodium citrate (SSC), GNPs modified by the negatively charged oligonucleotides were more stable at increasing ionic strength up to 0.5 × SSC. A bioselective element of the SPR DNA hybridization sensor was formed by immobilization on the gold sensor surface of the thiolated oligonucleotides P2, the sequence of which is a fragment of the rpoB gene of Mycobacterium tuberculosis. The injections into the measuring flow cell of the SPR spectrometer of various concentrations of GNPs modified by the complementary oligonucleotides T2-18m caused the pronounced concentration-dependent sequence-specific sensor responses. The magnitude of the sensor responses was much higher than in the case of the free standing complementary oligonucleotides. According to the obtained experimental data, the usage of GNPs modified by specific oligonucleotides can amplify the sensor response of the SPR DNA hybridization sensor in 1200 times.
Kinetics and Thermodynamics of Watson-Crick Base Pairing Driven DNA Origami Dimerization.
Zenk, John; Tuntivate, Chanon; Schulman, Rebecca
2016-03-16
We investigate the kinetics and thermodynamics of DNA origami dimerization using flat rectangle origami components and different architectures of Watson-Crick complementary single-stranded DNA ("sticky end") linking strategies. We systematically vary the number of linkers, the length of the sticky ends on the linker, and linker architecture and measure the corresponding yields as well as forward and reverse reaction rate constants through fluorescence quenching assays. Yields were further verified using atomic force microscopy. We calculate values of H° and ΔS° for various interface designs and find nonlinear van't Hoff behavior, best described by two linear equations, suggesting distinct regimes of dimerization between those with and those without well-formed interfaces. We find that self-assembly reactions can be tuned by manipulating the interface architecture without suffering a loss in yield, even when yield is high, ∼75-80%. We show that the second-order forward reaction rate constant (k(on)) depends on both linker architecture and number of linkers used, with typical values on the order of 10(5)-10(6) (M·s)(-1), values that are similar to those of bimolecular association of small, complementary DNA strands. The k(on) values are generally non-Arrhenius, tending to increase with decreasing temperature. Finally, we use kinetic and thermodynamic information about the optimal linking architecture to extend the system to an infinite, two-component repeating lattice system and show that we can form micron-sized lattices, with well-formed structures up to 8 μm(2).
Hamilton, Kyra; Daniels, Lynne; White, Katherine M; Murray, Nicole; Walsh, Anne
2011-06-01
In Australia and other developed countries there is poor adherence to guidelines recommending the introduction of complementary feeding to infants at 6 months of age. We aimed to investigate, via adopting a theory of planned behaviour framework and incorporating additional normative and demographic influences, mothers' complementary feeding intentions and behaviour. Participants were 375 primiparas who completed an initial questionnaire (infant age 13±3 weeks) that assessed the theory of planned behaviour constructs of attitude, subjective norm, and perceived behavioural control, as well as group norm and additional maternal and infant variables of mothers' age, education level, weight status perception, current maternal feeding practices, and infant birth weight. Approximately, 3 months after completion of the main questionnaire, mothers completed a follow-up questionnaire that assessed the age in months at which the infant was first introduced to solids. The theory of planned behaviour variables of attitude and subjective norm, along with group norm, predicted intentions, with intention, mothers' age (older more likely), and weight status perception (overweight less likely) predicting behaviour. Overall, the results highlight the importance of attitudes, normative influences, and individual characteristics in complementary feeding decision-making which should be considered when designing interventions aimed at improving adherence to current maternal feeding guidelines. Crown Copyright © 2011. Published by Elsevier Ltd. All rights reserved.
Fully Automated Complementary DNA Microarray Segmentation using a Novel Fuzzy-based Algorithm.
Saberkari, Hamidreza; Bahrami, Sheyda; Shamsi, Mousa; Amoshahy, Mohammad Javad; Ghavifekr, Habib Badri; Sedaaghi, Mohammad Hossein
2015-01-01
DNA microarray is a powerful approach to study simultaneously, the expression of 1000 of genes in a single experiment. The average value of the fluorescent intensity could be calculated in a microarray experiment. The calculated intensity values are very close in amount to the levels of expression of a particular gene. However, determining the appropriate position of every spot in microarray images is a main challenge, which leads to the accurate classification of normal and abnormal (cancer) cells. In this paper, first a preprocessing approach is performed to eliminate the noise and artifacts available in microarray cells using the nonlinear anisotropic diffusion filtering method. Then, the coordinate center of each spot is positioned utilizing the mathematical morphology operations. Finally, the position of each spot is exactly determined through applying a novel hybrid model based on the principle component analysis and the spatial fuzzy c-means clustering (SFCM) algorithm. Using a Gaussian kernel in SFCM algorithm will lead to improving the quality in complementary DNA microarray segmentation. The performance of the proposed algorithm has been evaluated on the real microarray images, which is available in Stanford Microarray Databases. Results illustrate that the accuracy of microarray cells segmentation in the proposed algorithm reaches to 100% and 98% for noiseless/noisy cells, respectively.
Osawa, Takuo; Inanaga, Hideko; Numata, Tomoyuki
2015-06-01
Clustered regularly interspaced short palindromic repeat (CRISPR)-derived RNA (crRNA) and CRISPR-associated (Cas) proteins constitute a prokaryotic adaptive immune system (CRISPR-Cas system) that targets and degrades invading genetic elements. The type III-B CRISPR-Cas Cmr complex, composed of the six Cas proteins (Cmr1-Cmr6) and a crRNA, captures and cleaves RNA complementary to the crRNA guide sequence. Here, a Cmr1-deficient functional Cmr (CmrΔ1) complex composed of Pyrococcus furiosus Cmr2-Cmr3, Archaeoglobus fulgidus Cmr4-Cmr5-Cmr6 and the 39-mer P. furiosus 7.01-crRNA was prepared. The CmrΔ1 complex was cocrystallized with single-stranded DNA (ssDNA) complementary to the crRNA guide by the vapour-diffusion method. The crystals diffracted to 2.1 Å resolution using synchrotron radiation at the Photon Factory. The crystals belonged to the triclinic space group P1, with unit-cell parameters a = 75.5, b = 76.2, c = 139.2 Å, α = 90.3, β = 104.8, γ = 118.6°. The asymmetric unit of the crystals is expected to contain one CmrΔ1-ssDNA complex, with a Matthews coefficient of 2.03 Å(3) Da(-1) and a solvent content of 39.5%.
Zhang, Hui; Fang, Congcong; Wu, Shijia; Duan, Nuo; Wang, Zhouping
2015-11-15
In this work, a biosensor based on luminescence resonance energy transfer (LRET) from NaYF4:Yb,Tm upconversion nanoparticles (UCNPs) to SYBR Green I has been developed. The aptamers are covalently linked to UCNPs and hybridized with their complementary strands. The subsequent addition of SYBR Green allows SYBR Green I to insert into the formed double-stranded DNA (dsDNA) duplex and brings the energy donor and acceptor into close proximity, leading to the fluorescence of UCNPs transferred to SYBR Green I. When excited at 980 nm, the UCNPs emit luminescence at 477 nm, and this energy is transferred to SYBR Green I, which emits luminescence at 530 nm. In the presence of oxytetracycline (OTC), the aptamers prefer to bind to its corresponding analyte and dehybridize with the complementary DNA. This dehybridization leads to the liberation of SYBR Green I, which distances SYBR Green I from the UCNPs and recovers the UCNPs' luminescence. Under optimal conditions, a linear calibration is obtained between the ratio of I530 to I477 nm (I530/I477) and the OTC concentration, which ranges from 0.1 to 10 ng/ml with a limit of detection (LOD) of 0.054 ng/ml. Copyright © 2015 Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Reed, Jason; Hsueh, Carlin; Mishra, Bud; Gimzewski, James K.
2008-09-01
We have used an atomic force microscope to examine a clinically derived sample of single-molecule gene transcripts, in the form of double-stranded cDNA, (c: complementary) obtained from human cardiac muscle without the use of polymerase chain reaction (PCR) amplification. We observed a log-normal distribution of transcript sizes, with most molecules being in the range of 0.4-7.0 kilobase pairs (kb) or 130-2300 nm in contour length, in accordance with the expected distribution of mRNA (m: messenger) sizes in mammalian cells. We observed novel branching structures not previously known to exist in cDNA, and which could have profound negative effects on traditional analysis of cDNA samples through cloning, PCR and DNA sequencing.
Effects of Different Buffers on the Construction of Aptamer Sensors
NASA Astrophysics Data System (ADS)
Yu, Quan; Dai, Zhao; Wu, Wenjing; Zhu, Haijia; Ji, Luyu
2017-12-01
In this paper, the effect of different buffers, PBS and TBE, on the construction of an aptamer sensor (apt sensor) for ATP was investigated. The apt sensor was based on fluorescence energy resonance transfer (FRET), when the energy donor was 5'-carboxyfluorescein (5'-FAM) and the energy receptor was Au nanoparticles (AuNPs), respectively. Both the donor and acceptor were conjugated with complementary and single stranded DNA (ssDNA). The fluorescent changes of the sensors were measured to investigate the influence of different buffers during the whole preparation and detection process. The results indicated that when the AuNPs and ssDNA (Au-DNA1) were conjugated in PBS buffer, the corresponding apt sensors would obtain a better detection ability of ATP than in TBE buffer.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Noy, A
2004-05-04
Modern force microscopy techniques allow researchers to use mechanical forces to probe interactions between biomolecules. However, such measurements often happen in non-equilibrium regime, which precludes straightforward extraction of the equilibrium energy information. Here we use the work averaging method based on Jarzynski equality to reconstruct the equilibrium interaction potential from the unbinding of a complementary 14-mer DNA duplex from the results of non-equilibrium single-molecule measurements. The reconstructed potential reproduces most of the features of the DNA stretching transition, previously observed only in equilibrium stretching of long DNA sequences. We also compare the reconstructed potential with the thermodynamic parameters of DNAmore » duplex unbinding and show that the reconstruction accurately predicts duplex melting enthalpy.« less
DNA nanomapping using CRISPR-Cas9 as a programmable nanoparticle.
Mikheikin, Andrey; Olsen, Anita; Leslie, Kevin; Russell-Pavier, Freddie; Yacoot, Andrew; Picco, Loren; Payton, Oliver; Toor, Amir; Chesney, Alden; Gimzewski, James K; Mishra, Bud; Reed, Jason
2017-11-21
Progress in whole-genome sequencing using short-read (e.g., <150 bp), next-generation sequencing technologies has reinvigorated interest in high-resolution physical mapping to fill technical gaps that are not well addressed by sequencing. Here, we report two technical advances in DNA nanotechnology and single-molecule genomics: (1) we describe a labeling technique (CRISPR-Cas9 nanoparticles) for high-speed AFM-based physical mapping of DNA and (2) the first successful demonstration of using DVD optics to image DNA molecules with high-speed AFM. As a proof of principle, we used this new "nanomapping" method to detect and map precisely BCL2-IGH translocations present in lymph node biopsies of follicular lymphoma patents. This HS-AFM "nanomapping" technique can be complementary to both sequencing and other physical mapping approaches.
Mariella, Jr., Raymond P.
2008-11-18
A method of synthesizing a desired double-stranded DNA of a predetermined length and of a predetermined sequence. Preselected sequence segments that will complete the desired double-stranded DNA are determined. Preselected segment sequences of DNA that will be used to complete the desired double-stranded DNA are provided. The preselected segment sequences of DNA are assembled to produce the desired double-stranded DNA.
Xuan, Feng; Luo, Xiaoteng; Hsing, I-Ming
2012-05-15
A highly sensitive electrochemical DNA sensor that requires no probe immobilization has been developed based on a target recycling mechanism utilizing a DNA polymerase with a strand displacement activity. The electrochemical detection is realized by taking advantage of the difference in diffusivity between a free ferrocene-labeled peptide nucleic acid (Fc-PNA) and a Fc-PNA hybridized with a complementary DNA, while the DNA polymerase-assisted target recycling leads to signal generation and amplification. The hybridization of the target DNA opens up a stem-loop template DNA with the Fc-PNA hybridized to its extruded 5' end and allows a DNA primer to anneal and be extended by the DNA polymerase, which results in sequential displacement of the target DNA and the Fc-PNA from the template DNA. The displaced target DNA will hybridize with another template DNA, triggering another round of primer extension and strand displacement. The released Fc-PNA, due to its neutral backbone, has much higher diffusivity towards a negatively charged electrode, compared to that when it is hybridized with a negatively charged DNA. Therefore, a significantly enhanced signal of Fc can be observed. The outstanding sensitivity and simplicity make this approach a promising candidate for next-generation electrochemical DNA sensing technologies. Copyright © 2012 Elsevier B.V. All rights reserved.
Fluorescent carbon nanoparticle-based lateral flow biosensor for ultrasensitive detection of DNA.
Takalkar, Sunitha; Baryeh, Kwaku; Liu, Guodong
2017-12-15
We report a fluorescent carbon nanoparticle (FCN)-based lateral flow biosensor for ultrasensitive detection of DNA. Fluorescent carbon nanoparticle with a diameter of around 15nm was used as a tag to label a detection DNA probe, which was complementary with the part of target DNA. A capture DNA probe was immobilized on the test zone of the lateral flow biosensor. Sandwich-type hybridization reactions among the FCN-labeled DNA probe, target DNA and capture DNA probe were performed on the lateral flow biosensor. In the presence of target DNA, FCNs were captured on the test zone of the biosensor and the fluorescent intensity of the captured FCNs was measured with a portable fluorescent reader. After systematic optimizations of experimental parameters (the components of running buffers, the concentration of detection DNA probe used in the preparation of FCN-DNA conjugates, the amount of FCN-DNA dispensed on the conjugate pad and the dispensing cycles of the capture DNA probes on the test-zone), the biosensor could detect a minimum concentration of 0.4 fM DNA. This study provides a rapid and low-cost approach for DNA detection with high sensitivity, showing great promise for clinical application and biomedical diagnosis. Copyright © 2017 Elsevier B.V. All rights reserved.
A Sequence-Dependent DNA Condensation Induced by Prion Protein
2018-01-01
Different studies indicated that the prion protein induces hybridization of complementary DNA strands. Cell culture studies showed that the scrapie isoform of prion protein remained bound with the chromosome. In present work, we used an oxazole dye, YOYO, as a reporter to quantitative characterization of the DNA condensation by prion protein. We observe that the prion protein induces greater fluorescence quenching of YOYO intercalated in DNA containing only GC bases compared to the DNA containing four bases whereas the effect of dye bound to DNA containing only AT bases is marginal. DNA-condensing biological polyamines are less effective than prion protein in quenching of DNA-bound YOYO fluorescence. The prion protein induces marginal quenching of fluorescence of the dye bound to oligonucleotides, which are resistant to condensation. The ultrastructural studies with electron microscope also validate the biophysical data. The GC bases of the target DNA are probably responsible for increased condensation in the presence of prion protein. To our knowledge, this is the first report of a human cellular protein inducing a sequence-dependent DNA condensation. The increased condensation of GC-rich DNA by prion protein may suggest a biological function of the prion protein and a role in its pathogenesis. PMID:29657864
A Sequence-Dependent DNA Condensation Induced by Prion Protein.
Bera, Alakesh; Biring, Sajal
2018-01-01
Different studies indicated that the prion protein induces hybridization of complementary DNA strands. Cell culture studies showed that the scrapie isoform of prion protein remained bound with the chromosome. In present work, we used an oxazole dye, YOYO, as a reporter to quantitative characterization of the DNA condensation by prion protein. We observe that the prion protein induces greater fluorescence quenching of YOYO intercalated in DNA containing only GC bases compared to the DNA containing four bases whereas the effect of dye bound to DNA containing only AT bases is marginal. DNA-condensing biological polyamines are less effective than prion protein in quenching of DNA-bound YOYO fluorescence. The prion protein induces marginal quenching of fluorescence of the dye bound to oligonucleotides, which are resistant to condensation. The ultrastructural studies with electron microscope also validate the biophysical data. The GC bases of the target DNA are probably responsible for increased condensation in the presence of prion protein. To our knowledge, this is the first report of a human cellular protein inducing a sequence-dependent DNA condensation. The increased condensation of GC-rich DNA by prion protein may suggest a biological function of the prion protein and a role in its pathogenesis.
Dragan, Anatoliy I; Golberg, Karina; Elbaz, Amit; Marks, Robert; Zhang, Yongxia; Geddes, Chris D
2011-03-07
For analyses of DNA fragment sequences in solution we introduce a 2-color DNA assay, utilizing a combination of the Metal-Enhanced Fluorescence (MEF) effect and microwave-accelerated DNA hybridization. The assay is based on a new "Catch and Signal" technology, i.e. the simultaneous specific recognition of two target DNA sequences in one well by complementary anchor-ssDNAs, attached to silver island films (SiFs). It is shown that fluorescent labels (Alexa 488 and Alexa 594), covalently attached to ssDNA fragments, play the role of biosensor recognition probes, demonstrating strong response upon DNA hybridization, locating fluorophores in close proximity to silver NPs, which is ideal for MEF. Subsequently the emission dramatically increases, while the excited state lifetime decreases. It is also shown that 30s microwave irradiation of wells, containing DNA molecules, considerably (~1000-fold) speeds up the highly selective hybridization of DNA fragments at ambient temperature. The 2-color "Catch and Signal" DNA assay platform can radically expedite quantitative analysis of genome DNA sequences, creating a simple and fast bio-medical platform for nucleic acid analysis. Copyright © 2010 Elsevier B.V. All rights reserved.
Polymorphic design of DNA origami structures through mechanical control of modular components.
Lee, Chanseok; Lee, Jae Young; Kim, Do-Nyun
2017-12-12
Scaffolded DNA origami enables the bottom-up fabrication of diverse DNA nanostructures by designing hundreds of staple strands, comprised of complementary sequences to the specific binding locations of a scaffold strand. Despite its exceptionally high design flexibility, poor reusability of staples has been one of the major hurdles to fabricate assorted DNA constructs in an effective way. Here we provide a rational module-based design approach to create distinct bent shapes with controllable geometries and flexibilities from a single, reference set of staples. By revising the staple connectivity within the desired module, we can control the location, stiffness, and included angle of hinges precisely, enabling the construction of dozens of single- or multiple-hinge structures with the replacement of staple strands up to 12.8% only. Our design approach, combined with computational shape prediction and analysis, can provide a versatile and cost-effective procedure in the design of DNA origami shapes with stiffness-tunable units.
2018-01-01
All-electronic DNA biosensors based on graphene field-effect transistors (GFETs) offer the prospect of simple and cost-effective diagnostics. For GFET sensors based on complementary probe DNA, the sensitivity is limited by the binding affinity of the target oligonucleotide, in the nM range for 20 mer targets. We report a ∼20 000× improvement in sensitivity through the use of engineered hairpin probe DNA that allows for target recycling and hybridization chain reaction. This enables detection of 21 mer target DNA at sub-fM concentration and provides superior specificity against single-base mismatched oligomers. The work is based on a scalable fabrication process for biosensor arrays that is suitable for multiplexed detection. This approach overcomes the binding-affinity-dependent sensitivity of nucleic acid biosensors and offers a pathway toward multiplexed and label-free nucleic acid testing with high accuracy and selectivity. PMID:29768011
Basics of DNA biosensors and cancer diagnosis.
Sohrabi, Nasrin; Valizadeh, Alireza; Farkhani, Samad Mussa; Akbarzadeh, Abolfazl
2016-01-01
The human genome is exposed to mutations during the life cycle because of many types of changes in the DNA. Viruses, radiation, transposons, mutagenic chemicals, or any errors that happen during DNA replication or the meiotic process in the cell, may cause the mutation. Many mutations have no effect on phenotype or health, while some mutations cause crucial diseases such as cancer or cardiac diseases; therefore, a better understanding of the effects of mutation on phenotype is a very important part of genetic studies. Biosensors based on DNA, RNA, and peptide nucleic acids are the most sensitive tools, due to a strong pairing of lined up nucleotide strands between bases in their complementary parts. These methods can provide information to assist clinicians in making successful treatment decisions and increase the patient survival rate. In this review, we discuss DNA biosensors based on peptide nucleic acids that have an important role in cancer diagnosis.
Gao, Zhaoli; Xia, Han; Zauberman, Jonathan; Tomaiuolo, Maurizio; Ping, Jinglei; Zhang, Qicheng; Ducos, Pedro; Ye, Huacheng; Wang, Sheng; Yang, Xinping; Lubna, Fahmida; Luo, Zhengtang; Ren, Li; Johnson, Alan T Charlie
2018-06-13
All-electronic DNA biosensors based on graphene field-effect transistors (GFETs) offer the prospect of simple and cost-effective diagnostics. For GFET sensors based on complementary probe DNA, the sensitivity is limited by the binding affinity of the target oligonucleotide, in the nM range for 20 mer targets. We report a ∼20 000× improvement in sensitivity through the use of engineered hairpin probe DNA that allows for target recycling and hybridization chain reaction. This enables detection of 21 mer target DNA at sub-fM concentration and provides superior specificity against single-base mismatched oligomers. The work is based on a scalable fabrication process for biosensor arrays that is suitable for multiplexed detection. This approach overcomes the binding-affinity-dependent sensitivity of nucleic acid biosensors and offers a pathway toward multiplexed and label-free nucleic acid testing with high accuracy and selectivity.
NASA Astrophysics Data System (ADS)
Shahrashoob, M.; Mohsenifar, A.; Tabatabaei, M.; Rahmani-Cherati, T.; Mobaraki, M.; Mota, A.; Shojaei, T. R.
2016-05-01
A novel optics-based nanobiosensor for sensitive determination of the Helicobacter pylori genome using a gold nanoparticles (AuNPs)-labeled probe is reported. Two specific thiol-modified capture and signal probes were designed based on a single-stranded complementary DNA (cDNA) region of the urease gene. The capture probe was immobilized on AuNPs, which were previously immobilized on an APTES-activated glass, and the signal probe was conjugated to different AuNPs as well. The presence of the cDNA in the reaction mixture led to the hybridization of the AuNPs-labeled capture probe and the signal probe with the cDNA, and consequently the optical density of the reaction mixture (AuNPs) was reduced proportionally to the cDNA concentration. The limit of detection was measured at 0.5 nM.
Guo, Qiuping; Yang, Xiaohai; Wang, Kemin; Tan, Weihong; Li, Wei; Tang, Hongxing; Li, Huimin
2009-02-01
Here we have developed a sensitive DNA amplified detection method based on isothermal strand-displacement polymerization reaction. This method takes advantage of both the hybridization property of DNA and the strand-displacement property of polymerase. Importantly, we demonstrate that our method produces a circular polymerization reaction activated by the target, which essentially allows it to self-detect. Functionally, this DNA system consists of a hairpin fluorescence probe, a short primer and polymerase. Upon recognition and hybridization with the target ssDNA, the stem of the hairpin probe is opened, after which the opened probe anneals with the primer and triggers the polymerization reaction. During this process of the polymerization reaction, a complementary DNA is synthesized and the hybridized target is displaced. Finally, the displaced target recognizes and hybridizes with another probe, triggering the next round of polymerization reaction, reaching a target detection limit of 6.4 x 10(-15) M.
Cheung, Andrew K
2015-07-01
The roles of two porcine circovirus replication initiator proteins, Rep and Rep׳, in generating copy-release and rolling-circle DNA replication intermediates were determined. Rep uses the supercoiled closed-circular genome (ccc) to initiate leading-strand synthesis (identical to copy-release replication) and generates the single-stranded circular (ssc) genome from the displaced DNA strand. In the process, a minus-genome primer (MGP) necessary for complementary-strand synthesis, from ssc to ccc, is synthesized. Rep׳ cleaves the growing nascent-strand to regenerate the parent ccc molecule. In the process, a Rep׳-DNA hybrid containing the right palindromic sequence (at the origin of DNA replication) is generated. Analysis of the virus particle showed that it is composed of four components: ssc, MGP, capsid protein and a novel Rep-related protein (designated Protein-3). Copyright © 2015. Published by Elsevier Inc.
EVIDENCE FOR BASE EXCISION REPAIR PROCESSING OF DNA INTERSTRAND CROSSLINKS
Kothandapani, Anbarasi; Patrick, Steve M
2013-01-01
Many bifunctional alkylating agents and anticancer drugs exert their cytotoxicity by producing cross links between the two complementary strands of DNA, termed interstrand crosslinks (ICLs). This blocks the strand separating processes during DNA replication and transcription, which can lead to cell cycle arrest and apoptosis. Cells use multiple DNA repair systems to eliminate the ICLs. Concerted action of repair proteins involved in Nucleotide Excision Repair and Homologous Recombination pathways are suggested to play a key role in the ICL repair. However, recent studies indicate a possible role for Base Excision Repair (BER) in mediating the cytotoxicity of ICL inducing agents in mammalian cells. Elucidating the mechanism of BER mediated modulation of ICL repair would help in understanding the recognition and removal of ICLs and aid in the development of potential therapeutic agents. In this review, the influence of BER proteins on ICL DNA repair and the possible mechanisms of action are discussed. PMID:23219605
Distinguishing Individual DNA Bases in a Network by Non-Resonant Tip-Enhanced Raman Scattering.
Zhang, Rui; Zhang, Xianbiao; Wang, Huifang; Zhang, Yao; Jiang, Song; Hu, Chunrui; Zhang, Yang; Luo, Yi; Dong, Zhenchao
2017-05-08
The importance of identifying DNA bases at the single-molecule level is well recognized for many biological applications. Although such identification can be achieved by electrical measurements using special setups, it is still not possible to identify single bases in real space by optical means owing to the diffraction limit. Herein, we demonstrate the outstanding ability of scanning tunneling microscope (STM)-controlled non-resonant tip-enhanced Raman scattering (TERS) to unambiguously distinguish two individual complementary DNA bases (adenine and thymine) with a spatial resolution down to 0.9 nm. The distinct Raman fingerprints identified for the two molecules allow to differentiate in real space individual DNA bases in coupled base pairs. The demonstrated ability of non-resonant Raman scattering with super-high spatial resolution will significantly extend the applicability of TERS, opening up new routes for single-molecule DNA sequencing. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Sheng, Gang; Zhao, Hongtu; Wang, Jiuyu; Rao, Yu; Tian, Wenwen; Swarts, Daan C.; van der Oost, John; Patel, Dinshaw J.; Wang, Yanli
2014-01-01
We report on crystal structures of ternary Thermus thermophilus Argonaute (TtAgo) complexes with 5′-phosphorylated guide DNA and a series of DNA targets. These ternary complex structures of cleavage-incompatible, cleavage-compatible, and postcleavage states solved at improved resolution up to 2.2 Å have provided molecular insights into the orchestrated positioning of catalytic residues, a pair of Mg2+ cations, and the putative water nucleophile positioned for in-line attack on the cleavable phosphate for TtAgo-mediated target cleavage by a RNase H-type mechanism. In addition, these ternary complex structures have provided insights into protein and DNA conformational changes that facilitate transition between cleavage-incompatible and cleavage-compatible states, including the role of a Glu finger in generating a cleavage-competent catalytic Asp-Glu-Asp-Asp tetrad. Following cleavage, the seed segment forms a stable duplex with the complementary segment of the target strand. PMID:24374628
Induction of vitellogenin (VTG) in oviparous animals has been proposed as a sensitive indicator of invironmental contaminants that activate the estrogen receptor. In the present study, a sensitive ribonuclease protection assay (RPA) for VTG messenger RNA (mRNA) was developed for ...
The architectonics of programmable RNA and DNA nanostructures.
Jaeger, Luc; Chworos, Arkadiusz
2006-08-01
The past several years have witnessed the emergence of a new world of nucleic-acid-based architectures with highly predictable and programmable self-assembly properties. For almost two decades, DNA has been the primary material for nucleic acid nanoconstruction. More recently, the dramatic increase in RNA structural information led to the development of RNA architectonics, the scientific study of the principles of RNA architecture with the aim of constructing RNA nanostructures of any arbitrary size and shape. The remarkable modularity and the distinct but complementary nature of RNA and DNA nanomaterials are revealed by the various self-assembly strategies that aim to achieve control of the arrangement of matter at a nanoscale level.
Screening unlabeled DNA targets with randomly ordered fiber-optic gene arrays.
Steemers, F J; Ferguson, J A; Walt, D R
2000-01-01
We have developed a randomly ordered fiber-optic gene array for rapid, parallel detection of unlabeled DNA targets with surface immobilized molecular beacons (MB) that undergo a conformational change accompanied by a fluorescence change in the presence of a complementary DNA target. Microarrays are prepared by randomly distributing MB-functionalized 3-microm diameter microspheres in an array of wells etched in a 500-microm diameter optical imaging fiber. Using several MBs, each designed to recognize a different target, we demonstrate the selective detection of genomic cystic fibrosis related targets. Positional registration and fluorescence response monitoring of the microspheres was performed using an optical encoding scheme and an imaging fluorescence microscope system.
Tramontano, A; Macchiato, M F
1986-01-01
An algorithm to determine the probability that a reading frame codifies for a protein is presented. It is based on the results of our previous studies on the thermodynamic characteristics of a translated reading frame. We also develop a prediction procedure to distinguish between coding and non-coding reading frames. The procedure is based on the characteristics of the putative product of the DNA sequence and not on periodicity characteristics of the sequence, so the prediction is not biased by the presence of overlapping translated reading frames or by the presence of translated reading frames on the complementary DNA strand. PMID:3753761
[Single-molecule detection and characterization of DNA replication based on DNA origami].
Wang, Qi; Fan, Youjie; Li, Bin
2014-08-01
To investigate single-molecule detection and characterization of DNA replication. Single-stranded DNA (ssDNA) as the template of DNA replication was attached to DNA origami by a hybridization reaction based on the complementary base-pairing principle. DNA replication catalyzed by E.coli DNA polymerase I Klenow Fragment (KF) was detected using atomic force microscopy (AFM). The height variations between the ssDNA and the double-stranded DNA (dsDNA), the distribution of KF during DNA replication and biotin-streptavidin (BA) complexes on the DNA strand after replication were detected. Agarose gel electrophoresis was employed to analyze the changes in the DNA after replication. The designed ssDNA could be anchored on the target positions of over 50% of the DNA origami. The KF was capable of binding to the ssDNA fixed on DNA origami and performing its catalytic activities, and was finally dissociated from the DNA after replication. The height of DNA strand increased by about 0.7 nm after replication. The addition of streptavidin also resulted in an DNA height increase to about 4.9 nm due to the formation of BA complexes on the biotinylated dsDNA. The resulting dsDNA and BA complex were subsequently confirmed by agarose gel electrophoresis. The combination of AFM and DNA origami allows detection and characterization of DNA replication at the single molecule level, and this approach provides better insights into the mechanism of DNA polymerase and the factors affecting DNA replication.
Stub, Trine; Quandt, Sara A; Arcury, Thomas A; Sandberg, Joanne C; Kristoffersen, Agnete E
2017-06-08
Effective interdisciplinary communication is important to achieve better quality in health care. The aims of this study were to compare conventional and complementary providers' experience of communication about complementary therapies and conventional medicine with their cancer patients, and to investigate how they experience interdisciplinary communication and cooperation. This study analyzed data from a self-administrated questionnaire. A total of 606 different health care providers, from four counties in Norway, completed the questionnaire. The survey was developed to describe aspects of the communication pattern among oncology doctors, nurses, family physicians and complementary therapists (acupuncturists, massage therapists and reflexologists/zone-therapists). Between-group differences were analyzed using chi-square, ANOVA and Fisher's exact tests. Significance level was defined as p < 0.05 without adjustment for multiple comparisons. Conventional providers and complementary therapists had different patterns of communication with their cancer patients regarding complementary therapies. While complementary therapists advised their patients to apply both complementary and conventional modalities, medical doctors were less supportive of their patients' use of complementary therapies. Of conventional providers, nurses expressed more positive attitudes toward complementary therapies. Opportunities to improve communication between conventional and complementary providers were most strongly supported by complementary providers and nurses; medical doctors were less supportive of such attempts. A number of doctors showed lack of respect for complementary therapists, but asked for more research, guidelines for complementary modalities and training in conventional medicine for complementary therapists. For better quality of care, greater communication about complementary therapy use is needed between cancer patients and their conventional and complementary providers. In addition, more communication between conventional and complementary providers is needed. Nurses may have a crucial role in facilitating communication, as they are positive toward complementary therapies and they have more direct communication with patients about their treatment preferences.
Xie, Bingkun; Yang, Wei; Ouyang, Yongchang; Chen, Lichan; Jiang, Hesheng; Liao, Yuying; Liao, D. Joshua
2016-01-01
Tens of thousands of chimeric RNAs have been reported. Most of them contain a short homologous sequence (SHS) at the joining site of the two partner genes but are not associated with a fusion gene. We hypothesize that many of these chimeras may be technical artifacts derived from SHS-caused mis-priming in reverse transcription (RT) or polymerase chain reactions (PCR). We cloned six chimeric complementary DNAs (cDNAs) formed by human mitochondrial (mt) 16S rRNA sequences at an SHS, which were similar to several expression sequence tags (ESTs).These chimeras, which could not be detected with cDNA protection assay, were likely formed because some regions of the 16S rRNA are reversely complementary to another region to form an SHS, which allows the downstream sequence to loop back and anneal at the SHS to prime the synthesis of its complementary strand, yielding a palindromic sequence that can form a hairpin-like structure.We identified a 16S rRNA that ended at the 4th nucleotide(nt) of the mt-tRNA-leu was dominant and thus should be the wild type. We also cloned a mouse Bcl2-Nek9 chimeric cDNA that contained a 5-nt unmatchable sequence between the two partners, contained two copies of the reverse primer in the same direction but did not contain the forward primer, making it unclear how this Bcl2-Nek9 was formed and amplified. Moreover, a cDNA was amplified because one primer has 4 nts matched to the template, suggesting that there may be many more artificial cDNAs than we have realized, because the nuclear and mt genomes have many more 4-nt than 5-nt or longer homologues. Altogether, the chimeric cDNAs we cloned are good examples suggesting that many cDNAs may be artifacts due to SHS-caused mis-priming and thus greater caution should be taken when new sequence is obtained from a technique involving DNA polymerization. PMID:27148738
Bejerman, Nicolás; de Breuil, Soledad; Nome, Claudia
2018-06-06
A single-stranded DNA (ssDNA) virus was detected in Yerba mate samples showing chlorotic linear patterns, chlorotic rings and vein yellowing. The full-genome sequences of six different isolates of this ssDNA circular virus were obtained, which share > 99% sequence identity with each other. The newly identified virus has been tentatively named as yerba mate-associated circular DNA virus (YMaCV). The 2707 nt-long viral genome has two and three open reading frame on its complementary and virion-sense strands, respectively. The coat protein is more similar to that of mastreviruses (44% identity), whereas the replication-associated protein of YMaCV is more similar (49% identity) to that encoded by a recently described, unclassified ssDNA virus isolated on trees in Brazil. This is the first report of a circular DNA virus associated with yerba mate. Its unique genome organization and phylogenetic relationships indicates that YMaCV represents a distinct evolutionary lineage within the ssDNA viruses and therefore this virus should be classified as a member of a new species within an unassigned genus or family.
Strand-invading linear probe combined with unmodified PNA.
Asanuma, Hiroyuki; Niwa, Rie; Akahane, Mariko; Murayama, Keiji; Kashida, Hiromu; Kamiya, Yukiko
2016-09-15
Efficient strand invasion by a linear probe to fluorescently label double-stranded DNA has been implemented by employing a probe and unmodified PNA. As a fluorophore, we utilized ethynylperylene. Multiple ethynylperylene residues were incorporated into the DNA probe via a d-threoninol scaffold. The ethynylperylene did not significantly disrupt hybridization with complementary DNA. The linear probe self-quenched in the absence of target DNA and did not hybridize with PNA. A gel-shift assay revealed that linear probe and PNA combination invaded the central region of double-stranded DNA upon heat-shock treatment to form a double duplex. To further suppress the background emission and increase the stability of the probe/DNA duplex, a probe containing anthraquinones as well as ethynylperylene was synthesized. This probe and PNA invader pair detected an internal sequence in a double-stranded DNA with high sensitivity when heat shock treatment was used. The probe and PNA pair was able to invade at the terminus of a long double-stranded DNA at 40°C at 100mM NaCl concentration. Copyright © 2016 Elsevier Ltd. All rights reserved.
Ordered Self-Assembled Monolayers of Peptide Nucleic Acids with DNA Recognition Capability
NASA Astrophysics Data System (ADS)
Briones, C.; Mateo-Marti, E.; Gómez-Navarro, C.; Parro, V.; Román, E.; Martín-Gago, J. A.
2004-11-01
We report on the formation of ordered self-assembled monolayers (SAMs) of single-stranded peptide nucleic acids (ssPNA). In spite of their remarkable length (7nm) thiolated PNAs assemble standing up on gold surfaces similarly to the SAMs of short alkanethiols. SAMs of ssPNA recognize complementary nucleic acids, acting as specific biosensors that discriminate even a point mutation in target ssDNA. These results are obtained by surface characterization techniques that avoid labeling of the target molecule: x-ray photoemission, x-ray absorption and atomic force microscopy.
Phosphoryl Guanidines: A New Type of Nucleic Acid Analogues
Kupryushkin, M. S.; Pyshnyi, D. V.; Stetsenko, D. A.
2014-01-01
A new type of nucleic acid analogues with a phosphoryl guanidine group is described. Oxidation of polymer-supported dinucleoside 2-cyanoethyl phosphite by iodine in the presence of 1,1,3,3-tetramethyl guanidine yields a dinucleotide with an internucleoside tetramethyl phosphoryl guanidine (Tmg) group as the main product. The Tmg group is stable under conditions of solid-phase DNA synthesis and subsequent cleavage and deprotection with ammonia. Oligonucleotides with one or more Tmg groups bind their complementary DNA or RNA with affinity similar to that of natural oligodeoxyribonucleotides. PMID:25558402
Descamps, Emeline; Duroure, Nathalie; Deiss, Frédérique; Leichlé, Thierry; Adam, Catherine; Mailley, Pascal; Aït-Ikhlef, Ali; Livache, Thierry; Nicu, Liviu; Sojic, Neso
2013-08-07
Optical nanotip arrays fabricated on etched fiber bundles were functionalized with DNA spots. Such unconventional substrates (3D and non-planar) are difficult to pattern with standard microfabrication techniques but, using an electrochemical cantilever, up to 400 spots were electrodeposited on the nanostructured optical surface in 5 min. This approach allows each spot to be addressed individually and multiplexed fluorescence detection is demonstrated. Finally, remote fluorescence detection was performed by imaging through the optical fiber bundle itself after hybridisation with the complementary sequence.
Method for promoting specific alignment of short oligonucleotides on nucleic acids
Studier, F. William; Kieleczawa, Jan; Dunn, John J.
1996-01-01
Disclosed is a method for promoting specific alignment of short oligonucleotides on a nucleic acid polymer. The nucleic acid polymer is incubated in a solution containing a single-stranded DNA-binding protein and a plurality of oligonucleotides which are perfectly complementary to distinct but adjacent regions of a predetermined contiguous nucleotide sequence in the nucleic acid polymer. The plurality of oligonucleotides anneal to the nucleic acid polymer to form a contiguous region of double stranded nucleic acid. Specific application of the methods disclosed include priming DNA synthesis and template-directed ligation.
Highly sensitive DNA sensors based on cerium oxide nanorods
NASA Astrophysics Data System (ADS)
Nguyet, Nguyen Thi; Hai Yen, Le Thi; Van Thu, Vu; lan, Hoang; Trung, Tran; Vuong, Pham Hung; Tam, Phuong Dinh
2018-04-01
In this work, a CeO2 nanorod (NR)-based electrochemical DNA sensor was developed to identify Salmonella that causes food-borne infections. CeO2 NRs were synthesized without templates via a simple and unexpensive hydrothermal approach at 170 °C for 12 h by using CeO(NO3)3·6H2O as a Ce source. The DNA probe was immobilized onto the CeO2 NR-modified electrode through covalent attachment. The characteristics of the hybridized DNA were analyzed through electrochemical impedance spectroscopy (EIS) with [Fe(CN)6]3-/4- as a redox probe. Experimental results showed that electron transfer resistance (Ret) increased after the DNA probe was attached to the electrode surface and increased further after the DNA probe hybridized with its complementary sequence. A linear response of Ret to the target DNA concentration was found from 0.01 μM to 2 μM. The detection limit and sensitivity of the DNA sensor were 0.01 μM and 3362.1 Ω μM-1 cm-2, respectively. Various parameters, such as pH value, ionic strength, DNA probe concentration, and hybridization time, influencing DNA sensor responses were also investigated.
High-speed DNA-based rolling motors powered by RNase H
Yehl, Kevin; Mugler, Andrew; Vivek, Skanda; Liu, Yang; Zhang, Yun; Fan, Mengzhen; Weeks, Eric R.
2016-01-01
DNA-based machines that walk by converting chemical energy into controlled motion could be of use in applications such as next generation sensors, drug delivery platforms, and biological computing. Despite their exquisite programmability, DNA-based walkers are, however, challenging to work with due to their low fidelity and slow rates (~1 nm/min). Here, we report DNA-based machines that roll rather than walk, and consequently have a maximum speed and processivity that is three-orders of magnitude greater than conventional DNA motors. The motors are made from DNA-coated spherical particles that hybridise to a surface modified with complementary RNA; motion is achieved through the addition of RNase H, which selectively hydrolyses hybridised RNA. Spherical motors move in a self-avoiding manner, whereas anisotropic particles, such as dimerised particles or rod-shaped particles travel linearly without a track or external force. Finally, we demonstrate detection of single nucleotide polymorphism by measuring particle displacement using a smartphone camera. PMID:26619152
NASA Astrophysics Data System (ADS)
Goodman, Samuel M.; Noh, Hyunwoo; Singh, Vivek; Cha, Jennifer N.; Nagpal, Prashant
2015-02-01
Quantum dot (QD), or semiconductor nanocrystal, thin films are being explored for making solution-processable devices due to their size- and shape-tunable bandgap and discrete higher energy electronic states. While DNA has been extensively used for the self-assembly of nanocrystals, it has not been investigated for the simultaneous conduction of multiple energy charges or excitons via exciton shelves (ES) formed in QD-DNA nano-bioelectronic thin films. Here, we present studies on charge conduction through exciton shelves, which are formed via chemically coupled QDs and DNA, between electronic states of the QDs and the HOMO-LUMO levels in the complementary DNA nucleobases. While several challenges need to be addressed in optimizing the formation of devices using QD-DNA thin films, a higher charge collection efficiency for hot-carriers and our detailed investigations of charge transport mechanism in these thin films highlight their potential for applications in nano-bioelectronic devices and biological transducers.
DNA-programmable multiplexing for scalable, renewable redox protein bio-nanoelectronics.
Withey, Gary D; Kim, Jin Ho; Xu, Jimmy
2008-11-01
A universal, site-addressable DNA linking strategy is deployed for the programmable assembly of multifunctional, long-lasting redox protein nanoelectronic devices. This addressable linker, the first incorporated into a redox enzyme-nanoelectronic system, promotes versatility and renewability by allowing the reconfiguration and replacement of enzymes at will. The linker is transferable to all redox proteins due to the simple conjugation chemistry involved. The efficacy of this linking strategy is assessed using two model enzymes, glucose oxidase (GOx) and alcohol dehydrogenase (ADH), self-assembled onto separate nanoelectrode regions comprised of a highly ordered carbon nanotube (CNT) array. The sequence-specificity of DNA hybridization provides the means of encoding spatial address to the self-assembling process that conjugates enzymes tagged with single-stranded DNA (ssDNA) to the tips of designated CNTs functionalized with the complementary strands. In this study, we demonstrate the feasibility of multiplexed, scalable, reconfigurable and renewable transduction of redox protein signals by virtue of DNA addressing.
NASA Astrophysics Data System (ADS)
Lee, Jooran; Choi, Sunyoung; Bae, Seon Joo; Yoon, Seok Min; Choi, Joon Sig; Yoon, Minjoong
2013-10-01
Nanoscale cell injection techniques combined with nanoscopic photoluminescence (PL) spectroscopy have been important issues in high-resolution optical biosensing, gene and drug delivery and single-cell endoscopy for medical diagnostics and therapeutics. However, the current nanoinjectors remain limited for optical biosensing and communication at the subwavelength level, requiring an optical probe such as semiconductor quantum dots, separately. Here, we show that waveguided red emission is observed at the tip of a single visible light-sensitive APTES-modified ZnO nanowire (APTES-ZnO NW) and it exhibits great enhancement upon interaction with a complementary sequence-based double stranded (ds) DNA, whereas it is not significantly affected by non-complementary ds DNA. Further, the tip of a single APTES-ZnO NW can be inserted into the subcellular region of living HEK 293 cells without significant toxicity, and it can also detect the enhancement of the tip emission from subcellular regions with high spatial resolution. These results indicate that the single APTES-ZnO NW would be useful as a potent nanoinjector which can guide visible light into intracellular compartments of mammalian cells, and can also detect nanoscopic optical signal changes induced by interaction with the subcellular specific target biomolecules without separate optical probes.Nanoscale cell injection techniques combined with nanoscopic photoluminescence (PL) spectroscopy have been important issues in high-resolution optical biosensing, gene and drug delivery and single-cell endoscopy for medical diagnostics and therapeutics. However, the current nanoinjectors remain limited for optical biosensing and communication at the subwavelength level, requiring an optical probe such as semiconductor quantum dots, separately. Here, we show that waveguided red emission is observed at the tip of a single visible light-sensitive APTES-modified ZnO nanowire (APTES-ZnO NW) and it exhibits great enhancement upon interaction with a complementary sequence-based double stranded (ds) DNA, whereas it is not significantly affected by non-complementary ds DNA. Further, the tip of a single APTES-ZnO NW can be inserted into the subcellular region of living HEK 293 cells without significant toxicity, and it can also detect the enhancement of the tip emission from subcellular regions with high spatial resolution. These results indicate that the single APTES-ZnO NW would be useful as a potent nanoinjector which can guide visible light into intracellular compartments of mammalian cells, and can also detect nanoscopic optical signal changes induced by interaction with the subcellular specific target biomolecules without separate optical probes. Electronic supplementary information (ESI) available: Synthesis of APTES-modified ZnO nanowires, DNA functionalization and spectroscopic measurements with additional fluorescence image ad fluorescence decay times, cell culture, injection of a single nanowire into living cells, subcellular imaging and determination of cytotoxicity. See DOI: 10.1039/c3nr03042c
Virtual Human Analogs to Rodent Spatial Pattern Separation and Completion Memory Tasks
ERIC Educational Resources Information Center
Paleja, Meera; Girard, Todd A.; Christensen, Bruce K.
2011-01-01
Spatial pattern separation (SPS) and spatial pattern completion (SPC) have played an increasingly important role in computational and rodent literatures as processes underlying associative memory. SPS and SPC are complementary processes, allowing the formation of unique representations and the reconstruction of complete spatial environments based…
Akberova, N I; Zhmurov, A A; Nevzorova, T A; Litvinov, R I
2016-01-01
Antibodies to DNA play an important role in the pathogenesis of autoimmune diseases. The elucidation of structural mechanisms of both the antigen recognition and the interaction of anti-DNA antibodies with DNA will help to understand the role of DNA-containing immune complexes in various pathologies and can provide a basis for new treatment modalities. Moreover, the DNA-antibody complex is an analog of specific intracellular DNA-protein interactions. In this work, we used in silico molecular dynamic simulations of bimolecular complexes of the dsDNA segment containing the Fab fragment of an anti-DNA antibody to obtain the detailed thermodynamic and structural characteristics of dynamic intermolecular interactions. Using computationally modified crystal structure of the Fab-DNA complex (PDB ID: 3VW3), we studied the equilibrium molecular dynamics of the 64M-5 antibody Fab fragment associated with the dsDNA fragment containing the thymine dimer, the product of DNA photodamage. Amino acid residues that constitute paratopes and the complementary nucleotide epitopes for the Fab-DNA construct were identified. Stacking and electrostatic interactions were found to play the main role in mediating the most specific antibody-dsDNA contacts, while hydrogen bonds were less significant. These findings may shed light on the formation and properties of pathogenic anti-DNA antibodies in autoimmune diseases, such as systemic lupus erythematosus associated with skin photosensitivity and DNA photodamage.
Physical mapping of complex genomes
Evans, G.A.
1993-06-15
A method for the simultaneous identification of overlapping cosmid clones among multiple cosmid clones and the use of the method for mapping complex genomes are provided. A library of cosmid clones that contains the DNA to be mapped is constructed and arranged in a manner such that individual clones can be identified and replicas of the arranged clones prepared. In preferred embodiments, the clones are arranged in a two dimensional matrix. In such embodiments, the cosmid clones in a row are pooled, mixed probes complementary to the ends of the DNA inserts in the pooled clones are synthesized, hybridized to a first replica of the library. Hybridizing clones, which include the pooled row, are identified. A second portion of clones is prepared by pooling cosmid clones that correspond to a column in the matrix. The second pool thereby includes one clone from the first portion pooled clones. This common clone is located on the replica at the intersection of the column and row. Mixed probes complementary to the ends of the DNA inserts in the second pooled portion of clones are prepared and hybridized to a second replica of the library. The hybridization pattern on the first and second replicas of the library are compared and cross-hybridizing clones, other than the clones in the pooled column and row, that hybridize to identical clones in the first and second replicas are identified. These clones necessarily include DNA inserts that overlap with the DNA insert in the common clone located at the intersection of the pooled row and pooled column. The DNA in the entire library may be mapped by pooling the clones in each of the rows and columns of the matrix, preparing mixed end-specific probes and hybridizing the probes from each row or column to a replica of the library. Since all clones in the library are located at the intersection of a column and a row, the overlapping clones for all clones in the library may be identified and a physical map constructed.
Integrated signal probe based aptasensor for dual-analyte detection.
Xiang, Juan; Pi, Xiaomei; Chen, Xiaoqing; Xiang, Lei; Yang, Minghui; Ren, Hao; Shen, Xiaojuan; Qi, Ning; Deng, Chunyan
2017-10-15
For the multi-analyte detection, although the sensitivity has commonly met the practical requirements, the reliability, reproducibility and stability need to be further improved. In this work, two different aptamer probes labeled with redox tags were used as signal probe1 (sP1) and signal probe2 (sP2), which were integrated into one unity DNA architecture to develop the integrated signal probe (ISP). Comparing with the conventional independent signal probes for the simultaneous multi-analyte detection, the proposed ISP was more reproducible and accurate. This can be due to that ISP in one DNA structure can ensure the completely same modification condition and an equal stoichiometric ratio between sP1 and sP2, and furthermore the cross interference between sP1 and sP2 can be successfully prevented by regulating the complementary position of sP1 and sP2. The ISP-based assay system would be a great progress for the dual-analyte detection. Combining with gold nanoparticles (AuNPs) signal amplification, the ISP/AuNPs-based aptasensor for the sensitive dual-analyte detection was explored. Based on DNA structural switching induced by targets binding to aptamer, the simultaneous dual-analyte detection was simply achieved by monitoring the electrochemical responses of methylene blue (MB) and ferrocene (Fc) This proposed detection system possesses such advantages as simplicity in design, easy operation, good reproducibility and accuracy, high sensitivity and selectivity, which indicates the excellent application of this aptasensor in the field of clinical diagnosis or other molecular sensors. Copyright © 2017 Elsevier B.V. All rights reserved.
Application of LANDSAT data to delimitation of avalanche hazards in Montane, Colorado
NASA Technical Reports Server (NTRS)
Knepper, D. H. (Principal Investigator); Summer, R.
1976-01-01
The author has identified the following significant results. With rare exceptions, avalanche areas cannot be identified on LANDSAT imagery. Avalanche hazard mapping on a regional scale is best conducted using LANDSAT imagery in conjunction with complementary data sources. Level of detail of such maps will be limited by the amount and completeness of the complementary information used.
Method of artificial DNA splicing by directed ligation (SDL).
Lebedenko, E N; Birikh, K R; Plutalov, O V; Berlin YuA
1991-01-01
An approach to directed genetic recombination in vitro has been devised, which allows for joining together, in a predetermined way, a series of DNA segments to give a precisely spliced polynucleotide sequence (DNA splicing by directed ligation, SDL). The approach makes use of amplification, by means of several polymerase chain reactions (PCR), of a chosen set of DNA segments. Primers for the amplifications contain recognition sites of the class IIS restriction endonucleases, which transform blunt ends of the amplification products into protruding ends of unique primary structures, the ends to be used for joining segments together being mutually complementary. Ligation of the mixture of the segments so synthesized gives the desired sequence in an unambiguous way. The suggested approach has been exemplified by the synthesis of a totally processed (intronless) gene encoding human mature interleukin-1 alpha. Images PMID:1662363
Analysis of a DNA simulation model through hairpin melting experiments.
Linak, Margaret C; Dorfman, Kevin D
2010-09-28
We compare the predictions of a two-bead Brownian dynamics simulation model to melting experiments of DNA hairpins with complementary AT or GC stems and noninteracting loops in buffer A. This system emphasizes the role of stacking and hydrogen bonding energies, which are characteristics of DNA, rather than backbone bending, stiffness, and excluded volume interactions, which are generic characteristics of semiflexible polymers. By comparing high throughput data on the open-close transition of various DNA hairpins to the corresponding simulation data, we (1) establish a suitable metric to compare the simulations to experiments, (2) find a conversion between the simulation and experimental temperatures, and (3) point out several limitations of the model, including the lack of G-quartets and cross stacking effects. Our approach and experimental data can be used to validate similar coarse-grained simulation models.
Branchpoint expansion in a fully complementary three-way DNA junction.
Sabir, Tara; Toulmin, Anita; Ma, Long; Jones, Anita C; McGlynn, Peter; Schröder, Gunnar F; Magennis, Steven W
2012-04-11
Branched nucleic acid molecules serve as key intermediates in DNA replication, recombination, and repair; architectural elements in RNA; and building blocks and functional components for nanoscience applications. Using a combination of high-resolution single-molecule FRET, time-resolved spectroscopy, and molecular modeling, we have probed the local and global structure of a DNA three-way junction (3WJ) in solution. We found that it adopts a Y-shaped, pyramidal structure, in which the bases adjacent to the branchpoint are unpaired, despite the full Watson-Crick complementarity of the molecule. The unpairing allows a nanoscale cavity to form at the junction center. Our structure accounts for earlier observations made of the structure, flexibility, and reactivity of 3WJs. We anticipate that these results will guide the development of new DNA-based supramolecular receptors and nanosystems. © 2012 American Chemical Society
Wang, Jiajia; Jia, Zhenhong
2018-02-23
A porous silicon microcavity (PSiMC) with resonant peak wavelength of 635 nm was fabricated by electrochemical etching. Metal nanoparticles (NPs)/PSiMC enhanced fluorescence substrates were prepared by the electrostatic adherence of Au NPs that were distributed in PSiMC. The Au NPs/PSiMC device was used to characterize the target DNA immobilization and hybridization with its complementary DNA sequences marked with Rhodamine red (RRA). Fluorescence enhancement was observed on the Au NPs/PSiMC device substrate; and the minimum detection concentration of DNA ran up to 10 pM. The surface plasmon resonance (SPR) of the MC substrate; which is so well-positioned to improve fluorescence enhancement rather the fluorescence enhancement of the high reflection band of the Bragg reflector; would welcome such a highly sensitive in biosensor.
RNA-guided transcriptional regulation
Church, George M.; Mali, Prashant G.; Esvelt, Kevin M.
2016-02-23
Methods of modulating expression of a target nucleic acid in a cell are provided including introducing into the cell a first foreign nucleic acid encoding one or more RNAs complementary to DNA, wherein the DNA includes the target nucleic acid, introducing into the cell a second foreign nucleic acid encoding a nuclease-null Cas9 protein that binds to the DNA and is guided by the one or more RNAs, introducing into the cell a third foreign nucleic acid encoding a transcriptional regulator protein or domain, wherein the one or more RNAs, the nuclease-null Cas9 protein, and the transcriptional regulator protein or domain are expressed, wherein the one or more RNAs, the nuclease-null Cas9 protein and the transcriptional regulator protein or domain co-localize to the DNA and wherein the transcriptional regulator protein or domain regulates expression of the target nucleic acid.
Tan, Hongliang; Tang, Gonge; Wang, Zhixiong; Li, Qian; Gao, Jie; Wu, Shimeng
2016-10-12
Metal-organic frameworks (MOFs) have emerged as very fascinating functional materials due to their tunable nature and diverse applications. In this work, we prepared a magnetic porous carbon (MPC) nanocomposite by employing iron-containing MOFs (MIL-88A) as precursors through a one-pot thermolysis method. It was found that the MPC can absorb selectively single-stranded DNA (ssDNA) probe to form MPC/ssDNA complex and subsequently quench the labelled fluorescent dye of the ssDNA probe, which is resulted from the synergetic effect of magnetic nanoparticles and carbon matrix. Upon the addition of complementary target DNA, however, the absorbed ssDNA probe could be released from MPC surface by forming double-stranded DNA with target DNA, and accompanied by the recovery of the fluorescence of ssDNA probe. Based on these findings, a sensing platform with low background signal for DNA fluorescent detection was developed. The proposed sensing platform exhibits high sensitivity with detection limit of 1 nM and excellent selectivity to specific target DNA, even single-base mismatched nucleotide can be distinguished. We envision that the presented study would provide a new perspective on the potential applications of MOF-derived nanocomposites in biomedical fields. Copyright © 2016 Elsevier B.V. All rights reserved.
Sudheera, Y; Vishnu Vardhan, G P; Hema, M; Krishna Reddy, M; Sreenivasulu, P
2014-01-01
A virus isolate associated with yellow mosaic disease was purified from commercially cultivated jasmine (Jasminum sambac) from Andhra Pradesh, India and it contained flexuous filamentous particles of ~720 × 13 nm. The denatured purified virus had single major polypeptide of molecular weight 32 kDa. Complementary DNA representing 1678 nucleotides (nt) of the 3' terminus of viral RNA was cloned and sequenced. Comparisons of complete coat protein (CP) gene nucleotide and amino acid sequences of the present virus isolate with certain reported potyviruses revealed 86.1 and 92.7 % identity, respectively with jasmine potyvirus T (JaVT) reported from Taiwan and less than 70 % with other potyviruses. Based on the phylogenetic analysis of 3' UTR and CP gene, the present virus isolate was identified as an isolate of JaVT that belongs to the genus Potyvirus and the name Jasmine yellow mosaic virus-Andhra Pradesh (JaYMV-AP) is proposed.
Experimental annotation of the human genome using microarray technology.
Shoemaker, D D; Schadt, E E; Armour, C D; He, Y D; Garrett-Engele, P; McDonagh, P D; Loerch, P M; Leonardson, A; Lum, P Y; Cavet, G; Wu, L F; Altschuler, S J; Edwards, S; King, J; Tsang, J S; Schimmack, G; Schelter, J M; Koch, J; Ziman, M; Marton, M J; Li, B; Cundiff, P; Ward, T; Castle, J; Krolewski, M; Meyer, M R; Mao, M; Burchard, J; Kidd, M J; Dai, H; Phillips, J W; Linsley, P S; Stoughton, R; Scherer, S; Boguski, M S
2001-02-15
The most important product of the sequencing of a genome is a complete, accurate catalogue of genes and their products, primarily messenger RNA transcripts and their cognate proteins. Such a catalogue cannot be constructed by computational annotation alone; it requires experimental validation on a genome scale. Using 'exon' and 'tiling' arrays fabricated by ink-jet oligonucleotide synthesis, we devised an experimental approach to validate and refine computational gene predictions and define full-length transcripts on the basis of co-regulated expression of their exons. These methods can provide more accurate gene numbers and allow the detection of mRNA splice variants and identification of the tissue- and disease-specific conditions under which genes are expressed. We apply our technique to chromosome 22q under 69 experimental condition pairs, and to the entire human genome under two experimental conditions. We discuss implications for more comprehensive, consistent and reliable genome annotation, more efficient, full-length complementary DNA cloning strategies and application to complex diseases.
Vladimirov, N V; Likhoshvaĭ, V A; Matushkin, Iu G
2007-01-01
Gene expression is known to correlate with degree of codon bias in many unicellular organisms. However, such correlation is absent in some organisms. Recently we demonstrated that inverted complementary repeats within coding DNA sequence must be considered for proper estimation of translation efficiency, since they may form secondary structures that obstruct ribosome movement. We have developed a program for estimation of potential coding DNA sequence expression in defined unicellular organism using its genome sequence. The program computes elongation efficiency index. Computation is based on estimation of coding DNA sequence elongation efficiency, taking into account three key factors: codon bias, average number of inverted complementary repeats, and free energy of potential stem-loop structures formed by the repeats. The influence of these factors on translation is numerically estimated. An optimal proportion of these factors is computed for each organism individually. Quantitative translational characteristics of 384 unicellular organisms (351 bacteria, 28 archaea, 5 eukaryota) have been computed using their annotated genomes from NCBI GenBank. Five potential evolutionary strategies of translational optimization have been determined among studied organisms. A considerable difference of preferred translational strategies between Bacteria and Archaea has been revealed. Significant correlations between elongation efficiency index and gene expression levels have been shown for two organisms (S. cerevisiae and H. pylori) using available microarray data. The proposed method allows to estimate numerically the coding DNA sequence translation efficiency and to optimize nucleotide composition of heterologous genes in unicellular organisms. http://www.mgs.bionet.nsc.ru/mgs/programs/eei-calculator/.
Huang, Ke-Jing; Liu, Yu-Jie; Zhang, Ji-Zong; Cao, Jun-Tao; Liu, Yan-Ming
2015-05-15
We have developed a sensitive sensing platform for 17β-estradiol by combining the aptamer probe and hybridization reaction. In this assay, 2-dimensional cobalt sulfide nanosheet (CoS) was synthesized by a simple hydrothermal method with L-cysteine as sulfur donor. An electrochemical aptamer biosensor was constructed by assembling a thiol group tagged 17β-estradiol aptamer on CoS and gold nanoparticles (AuNPs) modified electrode. Methylene blue was applied as a tracer and a guanine-rich complementary DNA sequence was designed to bind with the unbound 17β-estradiol aptamer for signal amplification. The binding of guanine-rich DNA to the aptamer was inhibited when the aptamer captured 17β-estradiol. Using guanine-rich DNA in the assay greatly amplified the redox signal of methylene blue bound to the detection probe. The CoS/AuNPs film formed on the biosensor surface appeared to be a good conductor for accelerating the electron transfer. The method demonstrated a high sensitivity of detection with the dynamic concentration range spanning from 1.0×10(-9) to 1.0×10(-12) M and a detection limit of 7.0×10(-13) M. Besides, the fabricated biosensor exhibited good selectivity toward 17β-estradiol even when interferents were presented at 100-fold concentrations. Our attempt will extend the application of the CoS nanosheet and this signal amplification assay to biosensing areas. Copyright © 2014 Elsevier B.V. All rights reserved.
Tsuruoka, H; Shohda, K; Wada, T; Sekine, M
2000-11-03
To synthesize oligonucleotides containing 2'-O-phosphate groups, four kinds of ribonucleoside 3'-phosphoramidite building blocks 6a-d having the bis(2-cyano-1,1-dimethylethoxy)thiophosphoryl (BCMETP) group were prepared according to our previous phosphorylation procedure. These phosphoramidite units 6a-d were not contaminated with 3'-regioisomers and were successfully applied to solid-phase synthesis to give oligodeoxyuridylates 15, 16 and oligouridylates 21, 22. Self-complementary Drew-Dickerson DNA 12mers 24-28 replaced by a 2'-O-phosphorylated ribonucleotide at various positions were similarly synthesized. In these syntheses, it turned out that KI(3) was the most effective reagent for oxidative desulfurization of the initially generated thiophosphate group to the phosphate group on polymer supports. Without using this conversion step, a tridecadeoxyuridylate 17 incorporating a 2'-O-thiophosphorylated uridine derivative was also synthesized. To investigate the effect of the 2'-phosphate group on the thermal stability and 3D-structure of DNA(RNA) duplexes, T(m) measurement of the self-complementary oligonucleotides obtained and MD simulation of heptamer duplexes 33-36 were carried out. According to these analyses, it was suggested that the nucleoside ribose moiety phosphorylated at the 2'-hydroxyl function predominantly preferred C2'-endo to C3'-endo conformation in DNA duplexes so that it did not significantly affect the stability of the DNA duplex. On the other hand, the 2'-modified ribose moiety was expelled to give a C3'-endo conformation in RNA duplexes so that the RNA duplexes were extremely destabilized.
Molecular analysis of a phytohemagglutinin-defective cultivar of Phaseolus vulgaris L.
Vitale, A; Ceriotti, A; Bollini, R
1985-10-01
The seeds of Phaseolus vulgaris cv. Pinto III are known to lack detectable amounts of phytohemagglutinin (PHA) and to accumulate very reduced levels of PHA mRNA compared with normal cultivars. Using PHA complementary-DNA clones and monospecific antibodies we analyzed cv. Pinto III genomic DNA and cotyledonary proteins synthesized both in vitro and in vivo. We detected genomic DNA sequences that hybridize with complementary-DNA clones for the two different classes of PHA polypeptides (PHA-E and PHA-L), at levels comparable to a normal bean cultivar. This indicates that the cv. Pinto III phenotype is not the result of a large deletion of the PHA structural genes. Messenger RNA isolated from cv. Pinto III developing cotyledons synthesizes in vitro very small amounts of a protein which is recognized by antibodies specific for PHA, and gives, on sodium dodecyl sulfate-polyacrylamide gel electrophoresis, a single band with molecular weight similar but not identical to that of PHA-L polypeptides. This protein is also synthesized in vivo at a very reduced level, less than 1% compared with PHA in normal cultivars, and has mitogenic activity comparable to that of the PHA-L subunit, while it shows very weak erythroagglutinating activity. The initial steps in the synthesis and processing of this protein are identical to those already identified for PHA polypeptides. The cv. Pinto III protein could be either a PHA-L polypeptide whose synthesis is not affected by the mutation or a PHA-like lectin present normally at low levels in P. vulgaris.
Microchip method for the enrichment of specific DNA sequences
Mirzabekov, A.D.; Lysov, Y.P.; Shick, V.V.; Dubiley, S.A.
1998-12-22
A method for enriching specific genetic material sequences is provided, whereby oligonucleotide molecules complementary to the desired genetic material is first used to isolate the genetic material from a first source of genomic material. Then the genetic material is used as a label to isolate similar genetic sequences from other sources. 4 figs.
Microchip method for the enrichment of specific DNA sequences
Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Shick, Valentine Vladimirovich; Dubiley, Svetlana Alekseevna
1998-01-01
A method for enriching specific genetic material sequences is provided, whereby oligonucleotide molecules complementary to the desired genetic material is first used to isolate the genetic material from a first source of genomic material. Then the genetic material is used as a label to isolate similar genetic sequences from other sources.
Stepwise nanoassembly of a single hairpin probe and its biosensing.
Xu, Jianguo; Zheng, Tingting; Le, Jingqing; Jia, Lee
2018-09-01
Herein, we describe a novel trigger-induced DNA nanoassembly method using only one loop-stem shaped hairpin probe (HP) that consists of three different functional regions as a single building unit. The Region I is designed complementary to the trigger, while the Region II and Region III are projected to complementary with each other. When hybridized with the trigger, a toehold mediated strand displacement (TMSD) occurred on the strand of Region I, leading to the release of Region III for further hybridization with the Region II on another HP molecule and in turn inducing a stepwise growth of HP with the aid of polymerase. Unlike the conventional assembly approaches that rely on the sophisticated sequence design and complex operation, the single-HP nanoassembly is easy and fast. Moreover, because many HPs are opened during the assembly process, we exemplified the nanoassembly strategy by re-designing a new labeled hairpin probe to analyze the Kras oncogene with a high sensitivity and specificity. The present study demonstrated a novel promising DNA nanoassembly strategy for biological applications. Copyright © 2018 Elsevier B.V. All rights reserved.
Sengupta, Partha Pratim; Gloria, Jared N; Amato, Dahlia N; Amato, Douglas V; Patton, Derek L; Murali, Beddhu; Flynt, Alex S
2015-10-12
Detection of specific RNA or DNA molecules by hybridization to "probe" nucleic acids via complementary base-pairing is a powerful method for analysis of biological systems. Here we describe a strategy for transducing hybridization events through modulating intrinsic properties of the electroconductive polymer polyaniline (PANI). When DNA-based probes electrostatically interact with PANI, its fluorescence properties are increased, a phenomenon that can be enhanced by UV irradiation. Hybridization of target nucleic acids results in dissociation of probes causing PANI fluorescence to return to basal levels. By monitoring restoration of base PANI fluorescence as little as 10(-11) M (10 pM) of target oligonucleotides could be detected within 15 min of hybridization. Detection of complementary oligos was specific, with introduction of a single mismatch failing to form a target-probe duplex that would dissociate from PANI. Furthermore, this approach is robust and is capable of detecting specific RNAs in extracts from animals. This sensor system improves on previously reported strategies by transducing highly specific probe dissociation events through intrinsic properties of a conducting polymer without the need for additional labels.
NASA Astrophysics Data System (ADS)
Voccia, Diego; Bettazi, Francesca; Palchetti, Ilaria
2015-10-01
In recent years various kinds of biosensors for the detection of pathogens have been developed. A genosensor consists in the immobilization, onto the surface of a chosen transducer, of an oligonucleotide with a specific base sequence called capture probe. The complementary sequence (the analytical target, i.e. a specific sequence of the DNA/RNA of the pathogen) present in the sample is recognized and captured by the probe through the hybridization reaction. The evaluation of the extent of the hybridization allows one to confirm whether the sample contains the complementary sequence of the probe or not. Electrochemical transducers have received considerable attention in connection with the detection of DNA hybridization. Moreover, recently, with the emergence of novel photoelectrochemically active species and new detection schemes, photoelectrochemistry has resulted in substantial progress in its analytical performance for biosensing applications. In this paper, some examples of electrochemical genosensors for multiplexed pathogen detection are shown. Moreover, the preliminary experiments towards the development of a photoelectrochemical genosensor using a TiO2 - nanocrystal-modified ITO electrode are discussed.
Simplified Microarray Technique for Identifying mRNA in Rare Samples
NASA Technical Reports Server (NTRS)
Almeida, Eduardo; Kadambi, Geeta
2007-01-01
Two simplified methods of identifying messenger ribonucleic acid (mRNA), and compact, low-power apparatuses to implement the methods, are at the proof-of-concept stage of development. These methods are related to traditional methods based on hybridization of nucleic acid, but whereas the traditional methods must be practiced in laboratory settings, these methods could be practiced in field settings. Hybridization of nucleic acid is a powerful technique for detection of specific complementary nucleic acid sequences, and is increasingly being used for detection of changes in gene expression in microarrays containing thousands of gene probes. A traditional microarray study entails at least the following six steps: 1. Purification of cellular RNA, 2. Amplification of complementary deoxyribonucleic acid [cDNA] by polymerase chain reaction (PCR), 3. Labeling of cDNA with fluorophores of Cy3 (a green cyanine dye) and Cy5 (a red cyanine dye), 4. Hybridization to a microarray chip, 5. Fluorescence scanning the array(s) with dual excitation wavelengths, and 6. Analysis of the resulting images. This six-step procedure must be performed in a laboratory because it requires bulky equipment.
Downie, Kelsey; Adetola, Gbolagade; Carstens, Eric B
2013-11-01
Autographa californica nucleopolyhedrovirus late expression factor 3 (LEF-3) is required for late viral gene expression probably through its numerous functions related to DNA replication, including nuclear localization of the virus helicase P143 and binding to ssDNA. LEF-3 appears to interact with itself as a homo-oligomer, although the details of this oligomeric structure are not yet known. To examine LEF-3-LEF-3 interactions, a bimolecular fluorescent protein complementation assay was used. Pairs of recombinant plasmids expressing full-length LEF-3 fused to one of two complementary fragments (V1 or V2) of a variant of yellow fluorescent protein named 'Venus' were constructed. Plasmids expressing fusions with complementary fragments of Venus were co-transfected into Sf21 cells and analysed by fluorescence microscopy. Co-transfected plasmids expressing full-length V1-LEF-3 and V2-LEF-3 showed positive fluorescence, confirming the formation of homo-oligomers. A series of truncated V1/V2-LEF-3 fusions was constructed and used to investigate interactions with one another as well as with full-length LEF-3.
Intrinsic flexibility of B-DNA: the experimental TRX scale.
Heddi, Brahim; Oguey, Christophe; Lavelle, Christophe; Foloppe, Nicolas; Hartmann, Brigitte
2010-01-01
B-DNA flexibility, crucial for DNA-protein recognition, is sequence dependent. Free DNA in solution would in principle be the best reference state to uncover the relation between base sequences and their intrinsic flexibility; however, this has long been hampered by a lack of suitable experimental data. We investigated this relationship by compiling and analyzing a large dataset of NMR (31)P chemical shifts in solution. These measurements reflect the BI <--> BII equilibrium in DNA, intimately correlated to helicoidal descriptors of the curvature, winding and groove dimensions. Comparing the ten complementary DNA dinucleotide steps indicates that some steps are much more flexible than others. This malleability is primarily controlled at the dinucleotide level, modulated by the tetranucleotide environment. Our analyses provide an experimental scale called TRX that quantifies the intrinsic flexibility of the ten dinucleotide steps in terms of Twist, Roll, and X-disp (base pair displacement). Applying the TRX scale to DNA sequences optimized for nucleosome formation reveals a 10 base-pair periodic alternation of stiff and flexible regions. Thus, DNA flexibility captured by the TRX scale is relevant to nucleosome formation, suggesting that this scale may be of general interest to better understand protein-DNA recognition.
A Modified Gibson Assembly Method for Cloning Large DNA Fragments with High GC Contents.
Li, Lei; Jiang, Weihong; Lu, Yinhua
2018-01-01
Gibson one-step, isothermal assembly method (Gibson assembly) can be used to efficiently assemble large DNA molecules by in vitro recombination involving a 5'-exonuclease, a DNA polymerase and a DNA ligase. In the past few years, this robust DNA assembly method has been widely applied to seamlessly construct genes, genetic pathways and even entire genomes. Here, we expand this method to clone large DNA fragments with high GC contents, such as antibiotic biosynthetic gene clusters from Streptomyces . Due to the low isothermal condition (50 °C) in the Gibson reaction system, the complementary overlaps with high GC contents are proposed to easily form mismatched linker pairings, which leads to low assembly efficiencies mainly due to vector self-ligation. So, we modified this classic method by the following two steps. First, a pair of universal terminal single-stranded DNA overhangs with high AT contents are added to the ends of the BAC vector. Second, two restriction enzyme sites are introduced into the respective sides of the designed overlaps to achieve the hierarchical assembly of large DNA molecules. The optimized Gibson assembly method facilitates fast acquisition of large DNA fragments with high GC contents from Streptomyces.
Blinkowa, A
1976-01-01
The possible role of DNA polimerase III in conjugation was studied in a series of mutants temperature-sensitive for DNA polymerase III synthesis. The temperature-sensitive DNA mutation called dnaE 486 (ts) prohibits vegetative DNA replication at 41-45 degrees. Transfer of episome and chromosome from temperature-sensitive donor, carrying dnaE mutation to wild-type recipient strains, revertants and dnaE recipients was investigated. In the first two cases the number of Lac+ sexductants being even slightly higher at 43 degrees. Conjugational synthesis accompanying transfer involving the combination of dnaE (ts) thymine dependent and thymine independent donor and recipient strains measured by incorporation of 14C thymine was observed at the restrictive temperature. In the case of conjugation with temperaturesensitive recipient strains a drop of Lac+ sexductants and Pro+ recombinants may be as a result of disturbances in the synthesis of complementary strand in recipient, known to be dependent on pol III. However, the episome investigated by centrifugation in neutral CsC1 gradient after its transfer to the recipient with faulty polymerase III was double stranded (replicated) at the restrictive temperature.
Hieke, Stefanie; Benner, Axel; Schlenl, Richard F; Schumacher, Martin; Bullinger, Lars; Binder, Harald
2016-08-30
High-throughput technology allows for genome-wide measurements at different molecular levels for the same patient, e.g. single nucleotide polymorphisms (SNPs) and gene expression. Correspondingly, it might be beneficial to also integrate complementary information from different molecular levels when building multivariable risk prediction models for a clinical endpoint, such as treatment response or survival. Unfortunately, such a high-dimensional modeling task will often be complicated by a limited overlap of molecular measurements at different levels between patients, i.e. measurements from all molecular levels are available only for a smaller proportion of patients. We propose a sequential strategy for building clinical risk prediction models that integrate genome-wide measurements from two molecular levels in a complementary way. To deal with partial overlap, we develop an imputation approach that allows us to use all available data. This approach is investigated in two acute myeloid leukemia applications combining gene expression with either SNP or DNA methylation data. After obtaining a sparse risk prediction signature e.g. from SNP data, an automatically selected set of prognostic SNPs, by componentwise likelihood-based boosting, imputation is performed for the corresponding linear predictor by a linking model that incorporates e.g. gene expression measurements. The imputed linear predictor is then used for adjustment when building a prognostic signature from the gene expression data. For evaluation, we consider stability, as quantified by inclusion frequencies across resampling data sets. Despite an extremely small overlap in the application example with gene expression and SNPs, several genes are seen to be more stably identified when taking the (imputed) linear predictor from the SNP data into account. In the application with gene expression and DNA methylation, prediction performance with respect to survival also indicates that the proposed approach might work well. We consider imputation of linear predictor values to be a feasible and sensible approach for dealing with partial overlap in complementary integrative analysis of molecular measurements at different levels. More generally, these results indicate that a complementary strategy for integrating different molecular levels can result in more stable risk prediction signatures, potentially providing a more reliable insight into the underlying biology.
Ben-Yoav, Hadar; Dykstra, Peter H; Bentley, William E; Ghodssi, Reza
2017-01-01
A microfluidic electrochemical lab-on-a-chip (LOC) device for DNA hybridization detection has been developed. The device comprises a 3 × 3 array of microelectrodes integrated with a dual layer microfluidic valved manipulation system that provides controlled and automated capabilities for high throughput analysis of microliter volume samples. The surface of the microelectrodes is functionalized with single-stranded DNA (ssDNA) probes which enable specific detection of complementary ssDNA targets. These targets are detected by a capacitive technique which measures dielectric variation at the microelectrode-electrolyte interface due to DNA hybridization events. A quantitative analysis of the hybridization events is carried out based on a sensing modeling that includes detailed analysis of energy storage and dissipation components. By calculating these components during hybridization events the device is able to demonstrate specific and dose response sensing characteristics. The developed microfluidic LOC for DNA hybridization detection offers a technology for real-time and label-free assessment of genetic markers outside of laboratory settings, such as at the point-of-care or in-field environmental monitoring.
A Sensitive DNA Capacitive Biosensor Using Interdigitated Electrodes
Wang, Lei; Veselinovic, Milena; Yang, Lang; Geiss, Brian J.; Dandy, David S.; Chen, Tom
2017-01-01
This paper presents a label-free affinity-based capacitive biosensor using interdigitated electrodes. Using an optimized process of DNA probe preparation to minimize the effect of contaminants in commercial thiolated DNA probe, the electrode surface was functionalized with the 24-nucleotide DNA probes based on the West Nile virus sequence (Kunjin strain). The biosensor has the ability to detect complementary DNA fragments with a detection limit down to 20 DNA target molecules (1.5 aM range), making it suitable for a practical point-of-care (POC) platform for low target count clinical applications without the need for amplification. The reproducibility of the biosensor detection was improved with efficient covalent immobilization of purified single-stranded DNA probe oligomers on cleaned gold microelectrodes. In addition to the low detection limit, the biosensor showed a dynamic range of detection from 1 μL−1 to 105 μL−1 target molecules (20 to 2 million targets), making it suitable for sample analysis in a typical clinical application environment. The binding results presented in this paper were validated using fluorescent oligomers. PMID:27619528
Petersen, Philippe A D; Silva, Andreia S; Gonçalves, Marcos B; Lapolli, André L; Ferreira, Ana Maria C; Carbonari, Artur W; Petrilli, Helena M
2014-06-03
In this work, perturbed angular correlation (PAC) spectroscopy is used to study differences in the nuclear quadrupole interactions of Cd probes in DNA molecules of mice infected with the Y-strain of Trypanosoma cruzi. The possibility of investigating the local genetic alterations in DNA, which occur along generations of mice infected with T. cruzi, using hyperfine interactions obtained from PAC measurements and density functional theory (DFT) calculations in DNA bases is discussed. A comparison of DFT calculations with PAC measurements could determine the type of Cd coordination in the studied molecules. To the best of our knowledge, this is the first attempt to use DFT calculations and PAC measurements to investigate the local environment of Cd ions bound to DNA bases in mice infected with Chagas disease. The obtained results also allowed the detection of local changes occurring in the DNA molecules of different generations of mice infected with T. cruzi, opening the possibility of using this technique as a complementary tool in the characterization of complicated biological systems.
Li, Feng; Feng, Yan; Dong, Pingjun; Yang, Limin; Tang, Bo
2011-01-15
A novel protocol for development of DNA electrochemical biosensor based on gold nanoparticles (AuNPs) modified glassy carbon electrode (GCE) was proposed, which was carried out by the self-assembly of AuNPs on the mercaptophenyl film (MPF) via simple electrografting of in situ generated mercaptophenyl diazonium cations. The resulting MPF was covalently immobilized on GCE surface via C-C bond with high stability, which was desirable in fabrication of excellent performance biosensors. Probe DNA was self-assembled on AuNPs through the well-known Au-thiol binding. The recognition of fabricated DNA electrochemical biosensor toward complementary single-stranded DNA was determined by differential pulse voltammetry with the use of Co(phen)(3)(3+) as the electrochemical indicator. Taking advantage of amplification effects of AuNPs and stability of MPF, the developed biosensor could detect target DNA with the detection limit of 7.2×10(-11) M, which also exhibits good selectivity, stability and regeneration ability for DNA detection. Copyright © 2010 Elsevier B.V. All rights reserved.
Hughesman, Curtis; Fakhfakh, Kareem; Bidshahri, Roza; Lund, H Louise; Haynes, Charles
2015-02-17
Advances in real-time polymerase chain reaction (PCR), as well as the emergence of digital PCR (dPCR) and useful modified nucleotide chemistries, including locked nucleic acids (LNAs), have created the potential to improve and expand clinical applications of PCR through their ability to better quantify and differentiate amplification products, but fully realizing this potential will require robust methods for designing dual-labeled hydrolysis probes and predicting their hybridization thermodynamics as a function of their sequence, chemistry, and template complementarity. We present here a nearest-neighbor thermodynamic model that accurately predicts the melting thermodynamics of a short oligonucleotide duplexed either to its perfect complement or to a template containing mismatched base pairs. The model may be applied to pure-DNA duplexes or to duplexes for which one strand contains any number and pattern of LNA substitutions. Perturbations to duplex stability arising from mismatched DNA:DNA or LNA:DNA base pairs are treated at the Gibbs energy level to maintain statistical significance in the regressed model parameters. This approach, when combined with the model's accounting of the temperature dependencies of the melting enthalpy and entropy, permits accurate prediction of T(m) values for pure-DNA homoduplexes or LNA-substituted heteroduplexes containing one or two independent mismatched base pairs. Terms accounting for changes in solution conditions and terminal addition of fluorescent dyes and quenchers are then introduced so that the model may be used to accurately predict and thereby tailor the T(m) of a pure-DNA or LNA-substituted hydrolysis probe when duplexed either to its perfect-match template or to a template harboring a noncomplementary base. The model, which builds on classic nearest-neighbor thermodynamics, should therefore be of use to clinicians and biologists who require probes that distinguish and quantify two closely related alleles in either a quantitative PCR or dPCR assay. This potential is demonstrated by using the model to design allele-specific probes that completely discriminate and quantify clinically relevant mutant alleles (BRAF V600E and KIT D816V) in a dPCR assay.
Preparation of Small RNAs Using Rolling Circle Transcription and Site-Specific RNA Disconnection.
Wang, Xingyu; Li, Can; Gao, Xiaomeng; Wang, Jing; Liang, Xingguo
2015-01-13
A facile and robust RNA preparation protocol was developed by combining rolling circle transcription (RCT) with RNA cleavage by RNase H. Circular DNA with a complementary sequence was used as the template for promoter-free transcription. With the aid of a 2'-O-methylated DNA, the RCT-generated tandem repeats of the desired RNA sequence were disconnected at the exact end-to-end position to harvest the desired RNA oligomers. Compared with the template DNA, more than 4 × 10(3) times the amount of small RNA products were obtained when modest cleavage was carried out during transcription. Large amounts of RNA oligomers could easily be obtained by simply increasing the reaction volume.
Vasselon, Valentin; Ballorain, Katia; Carpentier, Alice; Wetzel, Carlos E.; Ector, Luc; Bouchez, Agnès; Rimet, Frédéric
2018-01-01
Sea turtles are distributed in tropical and subtropical seas worldwide. They play several ecological roles and are considered important indicators of the health of marine ecosystems. Studying epibiotic diatoms living on turtle shells suggestively has great potential in the study of turtle behavior because diatoms are always there. However, diatom identification at the species level is time consuming, requires well-trained specialists, and there is a high probability of finding new taxa growing on turtle shells, which makes identification tricky. An alternative approach based on DNA barcoding and high throughput sequencing (HTS), metabarcoding, has been developed in recent years to identify species at the community level by using a DNA reference library. The suitabilities of morphological and molecular approaches were compared. Diatom assemblages were sampled from seven juvenile green turtles (Chelonia mydas) from Mayotte Island, France. The structures of the epibiotic diatom assemblages differed between both approaches. This resulted in different clustering of the turtles based on their diatom communities. Metabarcoding allowed better discrimination between turtles based on their epibiotic diatom assemblages and put into evidence the presence of a cryptic diatom diversity. Microscopy, for its part, provided more ecological information of sea turtles based on historical bibliographical data and the abundances of ecological guilds of the diatom species present in the samples. This study shows the complementary nature of these two methods for studying turtle behavior. PMID:29659610
Daru, Barnabas H; van der Bank, Michelle; Bello, Abubakar; Yessoufou, Kowiyou
2017-04-01
Although a standard DNA barcode has been identified for plants, it does not always provide species-level specimen identifications for investigating important ecological questions. In this study, we assessed the species-level discriminatory power of standard (rbcLa + matK) and complementary barcodes (ITS1 and trnH-psbA) within the subfamily Alooideae (Asphodelaceae), a large and recent plant radiation, whose species are important in horticulture yet are threatened. Alooideae has its centre of endemism in southern Africa, with some outlier species occurring elsewhere in Africa and Madagascar. We sampled 360 specimens representing 235 species within all 11 genera of the subfamily. With three distance-based methods, all markers performed poorly for our combined data set, with the highest proportion of correct species-level specimen identifications (30%) found for ITS1. However, when performance was assessed across genera, the discriminatory power varied from 0% for all single markers and combinations in Gasteria to 63% in Haworthiopsis, again for ITS1, suggesting that DNA barcoding success may be related to the evolutionary history of the lineage considered. Although ITS1 could be a good barcode for Haworthiopsis, the generally poor performance of all markers suggests that Alooideae remains a challenge. As species boundaries within Alooideae remain controversial, we call for continued search for suitable markers or the use of genomics approaches to further explore species discrimination in the group.
Rivera, Sinziana F; Vasselon, Valentin; Ballorain, Katia; Carpentier, Alice; Wetzel, Carlos E; Ector, Luc; Bouchez, Agnès; Rimet, Frédéric
2018-01-01
Sea turtles are distributed in tropical and subtropical seas worldwide. They play several ecological roles and are considered important indicators of the health of marine ecosystems. Studying epibiotic diatoms living on turtle shells suggestively has great potential in the study of turtle behavior because diatoms are always there. However, diatom identification at the species level is time consuming, requires well-trained specialists, and there is a high probability of finding new taxa growing on turtle shells, which makes identification tricky. An alternative approach based on DNA barcoding and high throughput sequencing (HTS), metabarcoding, has been developed in recent years to identify species at the community level by using a DNA reference library. The suitabilities of morphological and molecular approaches were compared. Diatom assemblages were sampled from seven juvenile green turtles (Chelonia mydas) from Mayotte Island, France. The structures of the epibiotic diatom assemblages differed between both approaches. This resulted in different clustering of the turtles based on their diatom communities. Metabarcoding allowed better discrimination between turtles based on their epibiotic diatom assemblages and put into evidence the presence of a cryptic diatom diversity. Microscopy, for its part, provided more ecological information of sea turtles based on historical bibliographical data and the abundances of ecological guilds of the diatom species present in the samples. This study shows the complementary nature of these two methods for studying turtle behavior.
Caetano-Anollés, G; Gresshoff, P M
1996-06-01
DNA amplification fingerprinting (DAF) with mini-hairpins harboring arbitrary "core" sequences at their 3' termini were used to fingerprint a variety of templates, including PCR products and whole genomes, to establish genetic relationships between plant tax at the interspecific and intraspecific level, and to identify closely related fungal isolates and plant accessions. No correlation was observed between the sequence of the arbitrary core, the stability of the mini-hairpin structure and DAF efficiency. Mini-hairpin primers with short arbitrary cores and primers complementary to simple sequence repeats present in microsatellites were also used to generate arbitrary signatures from amplification profiles (ASAP). The ASAP strategy is a dual-step amplification procedure that uses at least one primer in each fingerprinting stage. ASAP was able to reproducibly amplify DAF products (representing about 10-15 kb of sequence) following careful optimization of amplification parameters such as primer and template concentration. Avoidance of primer sequences partially complementary to DAF product termini was necessary in order to produce distinct fingerprints. This allowed the combinatorial use of oligomers in nucleic acid screening, with numerous ASAP fingerprinting reactions based on a limited number of primer sequences. Mini-hairpin primers and ASAP analysis significantly increased detection of polymorphic DNA, separating closely related bermudagrass (Cynodon) cultivars and detecting putatively linked markers in bulked segregant analysis of the soybean (Glycine max) supernodulation (nitrate-tolerant symbiosis) locus.
Paiva, Anthony M; Sheardy, Richard D
2005-04-20
The formation of unusual structures during DNA replication has been invoked for gene expansion in genomes possessing triplet repeat sequences, CNG, where N = A, C, G, or T. In particular, it has been suggested that the daughter strand of the leading strand partially dissociates from the parent strand and forms a hairpin. The equilibrium between the fully duplexed parent:daugter species and the parent:hairpin species is dependent upon their relative stabilities and the rates of reannealing of the daughter strand back to the parent. These stabilities and rates are ultimately influenced by the sequence context of the DNA and its length. Previous work has demonstrated that longer strands are more stable than shorter strands and that the identity of N also influences the thermal stability [Paiva, A. M.; Sheardy, R. D. Biochemistry 2004, 43, 14218-14227]. Here, we show that the rate of duplex formation from complementary hairpins is also sequence context and length dependent. In particular, longer duplexes have higher activation energies than shorter duplexes of the same sequence context. Further, [(CCG):(GGC)] duplexes have lower activation energies than corresponding [(CAG):(GTC)] duplexes of the same length. Hence, hairpins formed from long CNG sequences are more thermodynamically stable and have slower kinetics for reannealing to their complement than shorter analogues. Gene expansion can now be explained in terms of thermodynamics and kinetics.
Hughes, Stephen R; Butt, Tauseef R; Bartolett, Scott; Riedmuller, Steven B; Farrelly, Philip
2011-08-01
The molecular biological techniques for plasmid-based assembly and cloning of gene open reading frames are essential for elucidating the function of the proteins encoded by the genes. High-throughput integrated robotic molecular biology platforms that have the capacity to rapidly clone and express heterologous gene open reading frames in bacteria and yeast and to screen large numbers of expressed proteins for optimized function are an important technology for improving microbial strains for biofuel production. The process involves the production of full-length complementary DNA libraries as a source of plasmid-based clones to express the desired proteins in active form for determination of their functions. Proteins that were identified by high-throughput screening as having desired characteristics are overexpressed in microbes to enable them to perform functions that will allow more cost-effective and sustainable production of biofuels. Because the plasmid libraries are composed of several thousand unique genes, automation of the process is essential. This review describes the design and implementation of an automated integrated programmable robotic workcell capable of producing complementary DNA libraries, colony picking, isolating plasmid DNA, transforming yeast and bacteria, expressing protein, and performing appropriate functional assays. These operations will allow tailoring microbial strains to use renewable feedstocks for production of biofuels, bioderived chemicals, fertilizers, and other coproducts for profitable and sustainable biorefineries. Published by Elsevier Inc.
Milton, James A.; Patole, Samson; Yin, Huabing; Xiao, Qiang; Brown, Tom; Melvin, Tracy
2013-01-01
Although strategies for the immobilization of DNA oligonucleotides onto surfaces for bioanalytical and top-down bio-inspired nanobiofabrication approaches are well developed, the effect of introducing spacer molecules between the surface and the DNA oligonucleotide for the hybridization of nanoparticle–DNA conjugates has not been previously assessed in a quantitative manner. The hybridization efficiency of DNA oligonucleotides end-labelled with gold nanoparticles (1.4 or 10 nm diameter) with DNA sequences conjugated to silicon surfaces via hexaethylene glycol phosphate diester oligomer spacers (0, 1, 2, 6 oligomers) was found to be independent of spacer length. To quantify both the density of DNA strands attached to the surfaces and hybridization with the surface-attached DNA, new methodologies have been developed. Firstly, a simple approach based on fluorescence has been developed for determination of the immobilization density of DNA oligonucleotides. Secondly, an approach using mass spectrometry has been created to establish (i) the mean number of DNA oligonucleotides attached to the gold nanoparticles and (ii) the hybridization density of nanoparticle–oligonucleotide conjugates with the silicon surface–attached complementary sequence. These methods and results will be useful for application with nanosensors, the self-assembly of nanoelectronic devices and the attachment of nanoparticles to biomolecules for single-molecule biophysical studies. PMID:23361467
DNA Dosimetry Assessment for Sunscreen Genotoxic Photoprotection
Schuch, André Passaglia; Lago, Juliana Carvalhães; Yagura, Teiti; Menck, Carlos Frederico Martins
2012-01-01
Background Due to the increase of solar ultraviolet radiation (UV) incidence over the last few decades, the use of sunscreen has been widely adopted for skin protection. However, considering the high efficiency of sunlight-induced DNA lesions, it is critical to improve upon the current approaches that are used to evaluate protection factors. An alternative approach to evaluate the photoprotection provided by sunscreens against daily UV radiation-induced DNA damage is provided by the systematic use of a DNA dosimeter. Methodology/Principal Findings The Sun Protection Factor for DNA (DNA-SPF) is calculated by using specific DNA repair enzymes, and it is defined as the capacity for inhibiting the generation of cyclobutane pyrimidine dimers (CPD) and oxidised DNA bases compared with unprotected control samples. Five different commercial brands of sunscreen were initially evaluated, and further studies extended the analysis to include 17 other products representing various formulations and Sun Protection Factors (SPF). Overall, all of the commercial brands of SPF 30 sunscreens provided sufficient protection against simulated sunlight genotoxicity. In addition, this DNA biosensor was useful for rapidly screening the biological protection properties of the various sunscreen formulations. Conclusions/Significance The application of the DNA dosimeter is demonstrated as an alternative, complementary, and reliable method for the quantification of sunscreen photoprotection at the level of DNA damage. PMID:22768281
Luan, Qian; Gan, Ning; Cao, Yuting; Li, Tianhua
2017-07-19
A mimicking-enzyme-based colorimetric aptasensor was developed for the detection of kanamycin (KANA) in milk using magnetic loop-DNA-NMOF-Pt (m-L-DNA) probes and catalytic hairpin assembly (CHA)-assisted target recycling for signal amplification. The m-L-DNA probes were constructed via hybridization of hairpin DNA H1 (containing aptamer sequence) immobilized magnetic beads (m-H1) and signal DNA (sDNA, partial hybridization with H1) labeled nano Fe-MIL-88NH 2 -Pt (NMOF-Pt-sDNA). In the presence of KANA and complementary hairpin DNA H2, the m-L-DNA probes decomposed and formed an m-H1/KANA intermediate, which triggered the CHA reaction to form a stable duplex strand (m-H1-H2) while releasing KANA again for recycling. Consequently, numerous NMOF-Pt-sDNA as mimicking enzymes can synergistically catalyze 3,3',5,5'-tetramethylbenzidine (TMB) for color development. The aptasensor exhibited high selectivity and sensitivity for KANA in milk with a detection limit of 0.2 pg mL -1 within 30 min. The assay can be conveniently extended for on-site screening of other antibiotics in foods by simply changing the base sequence of the probes.
Structural basis for bifunctional zinc(II) macrocyclic complex recognition of thymine bulges in DNA.
del Mundo, Imee Marie A; Siters, Kevin E; Fountain, Matthew A; Morrow, Janet R
2012-05-07
The zinc(II) complex of 1-(4-quinoylyl)methyl-1,4,7,10-tetraazacyclododecane (cy4q) binds selectively to thymine bulges in DNA and to a uracil bulge in RNA. Binding constants are in the low-micromolar range for thymine bulges in the stems of hairpins, for a thymine bulge in a DNA duplex, and for a uracil bulge in an RNA hairpin. Binding studies of Zn(cy4q) to a series of hairpins containing thymine bulges with different flanking bases showed that the complex had a moderate selectivity for thymine bulges with neighboring purines. The dissociation constants of the most strongly bound Zn(cy4q)-DNA thymine bulge adducts were 100-fold tighter than similar sequences with fully complementary stems or than bulges containing cytosine, guanine, or adenine. In order to probe the role of the pendent group, three additional zinc(II) complexes containing 1,4,7,10-tetraazacyclododecane (cyclen) with aromatic pendent groups were studied for binding to DNA including 1-(2-quinolyl)methyl-1,4,7,10-tetraazacyclododecane (cy2q), 1-(4-biphenyl)methyl-1,4,7,10-tetraazacyclododecane (cybp), and 5-(1,4,7,10-tetraazacyclododecan-1-ylsulfonyl)-N,N-dimethylnaphthalen-1-amine (dsc). The Zn(cybp) complex binds with moderate affinity but little selectivity to DNA hairpins with thymine bulges and to DNA lacking bulges. Similarly, Zn(dsc) binds weakly both to thymine bulges and hairpins with fully complementary stems. The zinc(II) complex of cy2q has the 2-quinolyl moiety bound to the Zn(II) center, as shown by (1)H NMR spectroscopy and pH-potentiometric titrations. As a consequence, only weak (500 μM) binding is observed to DNA with no appreciable selectivity. An NMR structure of a thymine-bulge-containing hairpin shows that the thymine is extrahelical but rotated toward the major groove. NMR data for Zn(cy4q) bound to DNA containing a thymine bulge is consistent with binding of the zinc(II) complex to the thymine N3(-) and stacking of the quinoline on top of the thymine. The thymine-bulge bound zinc(II) complex is pointed into the major groove, and there are interactions with the guanine positioned 5' to the thymine bulge.
Kim, Saetbyeol; Tran Ngoc, Huan; Kim, Joohoon; Yoo, So Young; Chung, Hoeil
2015-07-23
A simple and sensitive surface enhanced Raman scattering (SERS)-based DNA sensor that utilizes the toehold-mediated DNA displacement reaction as a target-capturing scheme has been demonstrated. For a SERS substrate, Au-Ag bimetallic nanodendrites were electrochemically synthesized and used as a sensor platform. The incorporation of both Ag and Au was employed to simultaneously secure high sensitivity and stability of the substrate. An optimal composition of Ag and Au that satisfied these needs was determined. A double-strand composed of 'a probe DNA (pDNA)' complementary to 'a target DNA (tDNA)' and 'an indicator DNA tagged with a Raman reporter (iDNA)' was conjugated on the substrate. The conjugation made the reporter molecule close to the surface and induced generation of the Raman signal. The tDNA released the pre-hybridized iDNA from the pDNA via toehold-mediated displacement, and the displacement of the iDNA resulted in the decrease of Raman intensity. The variation of percent intensity change was sensitive and linear in the concentration range from 200fM to 20nM, and the achieved limit of detection (LOD) was 96.3fM, superior to those reported in previous studies that adopted different signal taggings based on such as fluorescence and electrochemistry. Copyright © 2015 Elsevier B.V. All rights reserved.
All-DNA finite-state automata with finite memory
Wang, Zhen-Gang; Elbaz, Johann; Remacle, F.; Levine, R. D.; Willner, Itamar
2010-01-01
Biomolecular logic devices can be applied for sensing and nano-medicine. We built three DNA tweezers that are activated by the inputs H+/OH-; ; nucleic acid linker/complementary antilinker to yield a 16-states finite-state automaton. The outputs of the automata are the configuration of the respective tweezers (opened or closed) determined by observing fluorescence from a fluorophore/quencher pair at the end of the arms of the tweezers. The system exhibits a memory because each current state and output depend not only on the source configuration but also on past states and inputs. PMID:21135212
Analysis of the C. elegans Nucleolus by Immuno-DNA FISH.
Lanctôt, Christian
2016-01-01
Caenorhabditis elegans is a well-established model organism which allows, among others, to investigate the link between nucleolar structure/function on the one hand and cell fate choices and cellular differentiation on the other. In addition, C. elegans can be used to study the role of the nucleolus in processes that can be difficult to faithfully reproduce in vitro, such as gametogenesis, disease development, and aging. Here I present two complementary techniques, immunofluorescent staining and DNA fluorescence in situ hybridization, that have been adapted to label nucleolar components at various stages of the life cycle of the worm.