NASA Astrophysics Data System (ADS)
Li, Jiangtong; Luo, Yongdao; Dai, Honglin
2018-01-01
Water is the source of life and the essential foundation of all life. With the development of industrialization, the phenomenon of water pollution is becoming more and more frequent, which directly affects the survival and development of human. Water quality detection is one of the necessary measures to protect water resources. Ultraviolet (UV) spectral analysis is an important research method in the field of water quality detection, which partial least squares regression (PLSR) analysis method is becoming predominant technology, however, in some special cases, PLSR's analysis produce considerable errors. In order to solve this problem, the traditional principal component regression (PCR) analysis method was improved by using the principle of PLSR in this paper. The experimental results show that for some special experimental data set, improved PCR analysis method performance is better than PLSR. The PCR and PLSR is the focus of this paper. Firstly, the principal component analysis (PCA) is performed by MATLAB to reduce the dimensionality of the spectral data; on the basis of a large number of experiments, the optimized principal component is extracted by using the principle of PLSR, which carries most of the original data information. Secondly, the linear regression analysis of the principal component is carried out with statistic package for social science (SPSS), which the coefficients and relations of principal components can be obtained. Finally, calculating a same water spectral data set by PLSR and improved PCR, analyzing and comparing two results, improved PCR and PLSR is similar for most data, but improved PCR is better than PLSR for data near the detection limit. Both PLSR and improved PCR can be used in Ultraviolet spectral analysis of water, but for data near the detection limit, improved PCR's result better than PLSR.
NASA Astrophysics Data System (ADS)
Ying, Yibin; Liu, Yande; Fu, Xiaping; Lu, Huishan
2005-11-01
The artificial neural networks (ANNs) have been used successfully in applications such as pattern recognition, image processing, automation and control. However, majority of today's applications of ANNs is back-propagate feed-forward ANN (BP-ANN). In this paper, back-propagation artificial neural networks (BP-ANN) were applied for modeling soluble solid content (SSC) of intact pear from their Fourier transform near infrared (FT-NIR) spectra. One hundred and sixty-four pear samples were used to build the calibration models and evaluate the models predictive ability. The results are compared to the classical calibration approaches, i.e. principal component regression (PCR), partial least squares (PLS) and non-linear PLS (NPLS). The effects of the optimal methods of training parameters on the prediction model were also investigated. BP-ANN combine with principle component regression (PCR) resulted always better than the classical PCR, PLS and Weight-PLS methods, from the point of view of the predictive ability. Based on the results, it can be concluded that FT-NIR spectroscopy and BP-ANN models can be properly employed for rapid and nondestructive determination of fruit internal quality.
NASA Astrophysics Data System (ADS)
Sahabiev, I. A.; Ryazanov, S. S.; Kolcova, T. G.; Grigoryan, B. R.
2018-03-01
The three most common techniques to interpolate soil properties at a field scale—ordinary kriging (OK), regression kriging with multiple linear regression drift model (RK + MLR), and regression kriging with principal component regression drift model (RK + PCR)—were examined. The results of the performed study were compiled into an algorithm of choosing the most appropriate soil mapping technique. Relief attributes were used as the auxiliary variables. When spatial dependence of a target variable was strong, the OK method showed more accurate interpolation results, and the inclusion of the auxiliary data resulted in an insignificant improvement in prediction accuracy. According to the algorithm, the RK + PCR method effectively eliminates multicollinearity of explanatory variables. However, if the number of predictors is less than ten, the probability of multicollinearity is reduced, and application of the PCR becomes irrational. In that case, the multiple linear regression should be used instead.
Seasonal forecasting of high wind speeds over Western Europe
NASA Astrophysics Data System (ADS)
Palutikof, J. P.; Holt, T.
2003-04-01
As financial losses associated with extreme weather events escalate, there is interest from end users in the forestry and insurance industries, for example, in the development of seasonal forecasting models with a long lead time. This study uses exceedences of the 90th, 95th, and 99th percentiles of daily maximum wind speed over the period 1958 to present to derive predictands of winter wind extremes. The source data is the 6-hourly NCEP Reanalysis gridded surface wind field. Predictor variables include principal components of Atlantic sea surface temperature and several indices of climate variability, including the NAO and SOI. Lead times of up to a year are considered, in monthly increments. Three regression techniques are evaluated; multiple linear regression (MLR), principal component regression (PCR), and partial least squares regression (PLS). PCR and PLS proved considerably superior to MLR with much lower standard errors. PLS was chosen to formulate the predictive model since it offers more flexibility in experimental design and gave slightly better results than PCR. The results indicate that winter windiness can be predicted with considerable skill one year ahead for much of coastal Europe, but that this deteriorates rapidly in the hinterland. The experiment succeeded in highlighting PLS as a very useful method for developing more precise forecasting models, and in identifying areas of high predictability.
Hemmateenejad, Bahram; Yazdani, Mahdieh
2009-02-16
Steroids are widely distributed in nature and are found in plants, animals, and fungi in abundance. A data set consists of a diverse set of steroids have been used to develop quantitative structure-electrochemistry relationship (QSER) models for their half-wave reduction potential. Modeling was established by means of multiple linear regression (MLR) and principle component regression (PCR) analyses. In MLR analysis, the QSPR models were constructed by first grouping descriptors and then stepwise selection of variables from each group (MLR1) and stepwise selection of predictor variables from the pool of all calculated descriptors (MLR2). Similar procedure was used in PCR analysis so that the principal components (or features) were extracted from different group of descriptors (PCR1) and from entire set of descriptors (PCR2). The resulted models were evaluated using cross-validation, chance correlation, application to prediction reduction potential of some test samples and accessing applicability domain. Both MLR approaches represented accurate results however the QSPR model found by MLR1 was statistically more significant. PCR1 approach produced a model as accurate as MLR approaches whereas less accurate results were obtained by PCR2 approach. In overall, the correlation coefficients of cross-validation and prediction of the QSPR models resulted from MLR1, MLR2 and PCR1 approaches were higher than 90%, which show the high ability of the models to predict reduction potential of the studied steroids.
Discrimination of serum Raman spectroscopy between normal and colorectal cancer
NASA Astrophysics Data System (ADS)
Li, Xiaozhou; Yang, Tianyue; Yu, Ting; Li, Siqi
2011-07-01
Raman spectroscopy of tissues has been widely studied for the diagnosis of various cancers, but biofluids were seldom used as the analyte because of the low concentration. Herein, serum of 30 normal people, 46 colon cancer, and 44 rectum cancer patients were measured Raman spectra and analyzed. The information of Raman peaks (intensity and width) and that of the fluorescence background (baseline function coefficients) were selected as parameters for statistical analysis. Principal component regression (PCR) and partial least square regression (PLSR) were used on the selected parameters separately to see the performance of the parameters. PCR performed better than PLSR in our spectral data. Then linear discriminant analysis (LDA) was used on the principal components (PCs) of the two regression method on the selected parameters, and a diagnostic accuracy of 88% and 83% were obtained. The conclusion is that the selected features can maintain the information of original spectra well and Raman spectroscopy of serum has the potential for the diagnosis of colorectal cancer.
2011-01-01
Background Hemorrhagic fever with renal syndrome (HFRS) is an important infectious disease caused by different species of hantaviruses. As a rodent-borne disease with a seasonal distribution, external environmental factors including climate factors may play a significant role in its transmission. The city of Shenyang is one of the most seriously endemic areas for HFRS. Here, we characterized the dynamic temporal trend of HFRS, and identified climate-related risk factors and their roles in HFRS transmission in Shenyang, China. Methods The annual and monthly cumulative numbers of HFRS cases from 2004 to 2009 were calculated and plotted to show the annual and seasonal fluctuation in Shenyang. Cross-correlation and autocorrelation analyses were performed to detect the lagged effect of climate factors on HFRS transmission and the autocorrelation of monthly HFRS cases. Principal component analysis was constructed by using climate data from 2004 to 2009 to extract principal components of climate factors to reduce co-linearity. The extracted principal components and autocorrelation terms of monthly HFRS cases were added into a multiple regression model called principal components regression model (PCR) to quantify the relationship between climate factors, autocorrelation terms and transmission of HFRS. The PCR model was compared to a general multiple regression model conducted only with climate factors as independent variables. Results A distinctly declining temporal trend of annual HFRS incidence was identified. HFRS cases were reported every month, and the two peak periods occurred in spring (March to May) and winter (November to January), during which, nearly 75% of the HFRS cases were reported. Three principal components were extracted with a cumulative contribution rate of 86.06%. Component 1 represented MinRH0, MT1, RH1, and MWV1; component 2 represented RH2, MaxT3, and MAP3; and component 3 represented MaxT2, MAP2, and MWV2. The PCR model was composed of three principal components and two autocorrelation terms. The association between HFRS epidemics and climate factors was better explained in the PCR model (F = 446.452, P < 0.001, adjusted R2 = 0.75) than in the general multiple regression model (F = 223.670, P < 0.000, adjusted R2 = 0.51). Conclusion The temporal distribution of HFRS in Shenyang varied in different years with a distinctly declining trend. The monthly trends of HFRS were significantly associated with local temperature, relative humidity, precipitation, air pressure, and wind velocity of the different previous months. The model conducted in this study will make HFRS surveillance simpler and the control of HFRS more targeted in Shenyang. PMID:22133347
Regression and multivariate models for predicting particulate matter concentration level.
Nazif, Amina; Mohammed, Nurul Izma; Malakahmad, Amirhossein; Abualqumboz, Motasem S
2018-01-01
The devastating health effects of particulate matter (PM 10 ) exposure by susceptible populace has made it necessary to evaluate PM 10 pollution. Meteorological parameters and seasonal variation increases PM 10 concentration levels, especially in areas that have multiple anthropogenic activities. Hence, stepwise regression (SR), multiple linear regression (MLR) and principal component regression (PCR) analyses were used to analyse daily average PM 10 concentration levels. The analyses were carried out using daily average PM 10 concentration, temperature, humidity, wind speed and wind direction data from 2006 to 2010. The data was from an industrial air quality monitoring station in Malaysia. The SR analysis established that meteorological parameters had less influence on PM 10 concentration levels having coefficient of determination (R 2 ) result from 23 to 29% based on seasoned and unseasoned analysis. While, the result of the prediction analysis showed that PCR models had a better R 2 result than MLR methods. The results for the analyses based on both seasoned and unseasoned data established that MLR models had R 2 result from 0.50 to 0.60. While, PCR models had R 2 result from 0.66 to 0.89. In addition, the validation analysis using 2016 data also recognised that the PCR model outperformed the MLR model, with the PCR model for the seasoned analysis having the best result. These analyses will aid in achieving sustainable air quality management strategies.
Allegrini, Franco; Braga, Jez W B; Moreira, Alessandro C O; Olivieri, Alejandro C
2018-06-29
A new multivariate regression model, named Error Covariance Penalized Regression (ECPR) is presented. Following a penalized regression strategy, the proposed model incorporates information about the measurement error structure of the system, using the error covariance matrix (ECM) as a penalization term. Results are reported from both simulations and experimental data based on replicate mid and near infrared (MIR and NIR) spectral measurements. The results for ECPR are better under non-iid conditions when compared with traditional first-order multivariate methods such as ridge regression (RR), principal component regression (PCR) and partial least-squares regression (PLS). Copyright © 2018 Elsevier B.V. All rights reserved.
Tipton, John; Hooten, Mevin B.; Goring, Simon
2017-01-01
Scientific records of temperature and precipitation have been kept for several hundred years, but for many areas, only a shorter record exists. To understand climate change, there is a need for rigorous statistical reconstructions of the paleoclimate using proxy data. Paleoclimate proxy data are often sparse, noisy, indirect measurements of the climate process of interest, making each proxy uniquely challenging to model statistically. We reconstruct spatially explicit temperature surfaces from sparse and noisy measurements recorded at historical United States military forts and other observer stations from 1820 to 1894. One common method for reconstructing the paleoclimate from proxy data is principal component regression (PCR). With PCR, one learns a statistical relationship between the paleoclimate proxy data and a set of climate observations that are used as patterns for potential reconstruction scenarios. We explore PCR in a Bayesian hierarchical framework, extending classical PCR in a variety of ways. First, we model the latent principal components probabilistically, accounting for measurement error in the observational data. Next, we extend our method to better accommodate outliers that occur in the proxy data. Finally, we explore alternatives to the truncation of lower-order principal components using different regularization techniques. One fundamental challenge in paleoclimate reconstruction efforts is the lack of out-of-sample data for predictive validation. Cross-validation is of potential value, but is computationally expensive and potentially sensitive to outliers in sparse data scenarios. To overcome the limitations that a lack of out-of-sample records presents, we test our methods using a simulation study, applying proper scoring rules including a computationally efficient approximation to leave-one-out cross-validation using the log score to validate model performance. The result of our analysis is a spatially explicit reconstruction of spatio-temporal temperature from a very sparse historical record.
Impact of multicollinearity on small sample hydrologic regression models
NASA Astrophysics Data System (ADS)
Kroll, Charles N.; Song, Peter
2013-06-01
Often hydrologic regression models are developed with ordinary least squares (OLS) procedures. The use of OLS with highly correlated explanatory variables produces multicollinearity, which creates highly sensitive parameter estimators with inflated variances and improper model selection. It is not clear how to best address multicollinearity in hydrologic regression models. Here a Monte Carlo simulation is developed to compare four techniques to address multicollinearity: OLS, OLS with variance inflation factor screening (VIF), principal component regression (PCR), and partial least squares regression (PLS). The performance of these four techniques was observed for varying sample sizes, correlation coefficients between the explanatory variables, and model error variances consistent with hydrologic regional regression models. The negative effects of multicollinearity are magnified at smaller sample sizes, higher correlations between the variables, and larger model error variances (smaller R2). The Monte Carlo simulation indicates that if the true model is known, multicollinearity is present, and the estimation and statistical testing of regression parameters are of interest, then PCR or PLS should be employed. If the model is unknown, or if the interest is solely on model predictions, is it recommended that OLS be employed since using more complicated techniques did not produce any improvement in model performance. A leave-one-out cross-validation case study was also performed using low-streamflow data sets from the eastern United States. Results indicate that OLS with stepwise selection generally produces models across study regions with varying levels of multicollinearity that are as good as biased regression techniques such as PCR and PLS.
NASA Astrophysics Data System (ADS)
Zhao, Hong; Li, Changjun; Li, Hongping; Lv, Kebo; Zhao, Qinghui
2016-06-01
The sea surface salinity (SSS) is a key parameter in monitoring ocean states. Observing SSS can promote the understanding of global water cycle. This paper provides a new approach for retrieving sea surface salinity from Soil Moisture and Ocean Salinity (SMOS) satellite data. Based on the principal component regression (PCR) model, SSS can also be retrieved from the brightness temperature data of SMOS L2 measurements and Auxiliary data. 26 pair matchup data is used in model validation for the South China Sea (in the area of 4°-25°N, 105°-125°E). The RMSE value of PCR model retrieved SSS reaches 0.37 psu (practical salinity units) and the RMSE of SMOS SSS1 is 1.65 psu when compared with in-situ SSS. The corresponding Argo daily salinity data during April to June 2013 is also used in our validation with RMSE value 0.46 psu compared to 1.82 psu for daily averaged SMOS L2 products. This indicates that the PCR model is valid and may provide us with a good approach for retrieving SSS from SMOS satellite data.
Elkhoudary, Mahmoud M; Naguib, Ibrahim A; Abdel Salam, Randa A; Hadad, Ghada M
2017-05-01
Four accurate, sensitive and reliable stability indicating chemometric methods were developed for the quantitative determination of Agomelatine (AGM) whether in pure form or in pharmaceutical formulations. Two supervised learning machines' methods; linear artificial neural networks (PC-linANN) preceded by principle component analysis and linear support vector regression (linSVR), were compared with two principle component based methods; principle component regression (PCR) as well as partial least squares (PLS) for the spectrofluorimetric determination of AGM and its degradants. The results showed the benefits behind using linear learning machines' methods and the inherent merits of their algorithms in handling overlapped noisy spectral data especially during the challenging determination of AGM alkaline and acidic degradants (DG1 and DG2). Relative mean squared error of prediction (RMSEP) for the proposed models in the determination of AGM were 1.68, 1.72, 0.68 and 0.22 for PCR, PLS, SVR and PC-linANN; respectively. The results showed the superiority of supervised learning machines' methods over principle component based methods. Besides, the results suggested that linANN is the method of choice for determination of components in low amounts with similar overlapped spectra and narrow linearity range. Comparison between the proposed chemometric models and a reported HPLC method revealed the comparable performance and quantification power of the proposed models.
Tchabo, William; Ma, Yongkun; Kwaw, Emmanuel; Zhang, Haining; Xiao, Lulu; Tahir, Haroon Elrasheid
2017-10-01
The present study was undertaken to assess accelerating aging effects of high pressure, ultrasound and manosonication on the aromatic profile and sensorial attributes of aged mulberry wines (AMW). A total of 166 volatile compounds were found amongst the AMW. The outcomes of the investigation were presented by means of geometric mean (GM), cluster analysis (CA), principal component analysis (PCA), partial least squares regressions (PLSR) and principal component regression (PCR). GM highlighted 24 organoleptic attributes responsible for the sensorial profile of the AMW. Moreover, CA revealed that the volatile composition of the non-thermal accelerated aged wines differs from that of the conventional aged wines. Besides, PCA discriminated the AMW on the basis of their main sensorial characteristics. Furthermore, PLSR identified 75 aroma compounds which were mainly responsible for the olfactory notes of the AMW. Finally, the overall quality of the AMW was noted to be better predicted by PLSR than PCR. Copyright © 2017 Elsevier Ltd. All rights reserved.
Determination of butter adulteration with margarine using Raman spectroscopy.
Uysal, Reyhan Selin; Boyaci, Ismail Hakki; Genis, Hüseyin Efe; Tamer, Ugur
2013-12-15
In this study, adulteration of butter with margarine was analysed using Raman spectroscopy combined with chemometric methods (principal component analysis (PCA), principal component regression (PCR), partial least squares (PLS)) and artificial neural networks (ANNs). Different butter and margarine samples were mixed at various concentrations ranging from 0% to 100% w/w. PCA analysis was applied for the classification of butters, margarines and mixtures. PCR, PLS and ANN were used for the detection of adulteration ratios of butter. Models were created using a calibration data set and developed models were evaluated using a validation data set. The coefficient of determination (R(2)) values between actual and predicted values obtained for PCR, PLS and ANN for the validation data set were 0.968, 0.987 and 0.978, respectively. In conclusion, a combination of Raman spectroscopy with chemometrics and ANN methods can be applied for testing butter adulteration. Copyright © 2013 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Polat, Esra; Gunay, Suleyman
2013-10-01
One of the problems encountered in Multiple Linear Regression (MLR) is multicollinearity, which causes the overestimation of the regression parameters and increase of the variance of these parameters. Hence, in case of multicollinearity presents, biased estimation procedures such as classical Principal Component Regression (CPCR) and Partial Least Squares Regression (PLSR) are then performed. SIMPLS algorithm is the leading PLSR algorithm because of its speed, efficiency and results are easier to interpret. However, both of the CPCR and SIMPLS yield very unreliable results when the data set contains outlying observations. Therefore, Hubert and Vanden Branden (2003) have been presented a robust PCR (RPCR) method and a robust PLSR (RPLSR) method called RSIMPLS. In RPCR, firstly, a robust Principal Component Analysis (PCA) method for high-dimensional data on the independent variables is applied, then, the dependent variables are regressed on the scores using a robust regression method. RSIMPLS has been constructed from a robust covariance matrix for high-dimensional data and robust linear regression. The purpose of this study is to show the usage of RPCR and RSIMPLS methods on an econometric data set, hence, making a comparison of two methods on an inflation model of Turkey. The considered methods have been compared in terms of predictive ability and goodness of fit by using a robust Root Mean Squared Error of Cross-validation (R-RMSECV), a robust R2 value and Robust Component Selection (RCS) statistic.
Evaluation of Aspergillus PCR protocols for testing serum specimens.
White, P Lewis; Mengoli, Carlo; Bretagne, Stéphane; Cuenca-Estrella, Manuel; Finnstrom, Niklas; Klingspor, Lena; Melchers, Willem J G; McCulloch, Elaine; Barnes, Rosemary A; Donnelly, J Peter; Loeffler, Juergen
2011-11-01
A panel of human serum samples spiked with various amounts of Aspergillus fumigatus genomic DNA was distributed to 23 centers within the European Aspergillus PCR Initiative to determine analytical performance of PCR. Information regarding specific methodological components and PCR performance was requested. The information provided was made anonymous, and meta-regression analysis was performed to determine any procedural factors that significantly altered PCR performance. Ninety-seven percent of protocols were able to detect a threshold of 10 genomes/ml on at least one occasion, with 83% of protocols reproducibly detecting this concentration. Sensitivity and specificity were 86.1% and 93.6%, respectively. Positive associations between sensitivity and the use of larger sample volumes, an internal control PCR, and PCR targeting the internal transcribed spacer (ITS) region were shown. Negative associations between sensitivity and the use of larger elution volumes (≥100 μl) and PCR targeting the mitochondrial genes were demonstrated. Most Aspergillus PCR protocols used to test serum generate satisfactory analytical performance. Testing serum requires less standardization, and the specific recommendations shown in this article will only improve performance.
Evaluation of Aspergillus PCR Protocols for Testing Serum Specimens▿†
White, P. Lewis; Mengoli, Carlo; Bretagne, Stéphane; Cuenca-Estrella, Manuel; Finnstrom, Niklas; Klingspor, Lena; Melchers, Willem J. G.; McCulloch, Elaine; Barnes, Rosemary A.; Donnelly, J. Peter; Loeffler, Juergen
2011-01-01
A panel of human serum samples spiked with various amounts of Aspergillus fumigatus genomic DNA was distributed to 23 centers within the European Aspergillus PCR Initiative to determine analytical performance of PCR. Information regarding specific methodological components and PCR performance was requested. The information provided was made anonymous, and meta-regression analysis was performed to determine any procedural factors that significantly altered PCR performance. Ninety-seven percent of protocols were able to detect a threshold of 10 genomes/ml on at least one occasion, with 83% of protocols reproducibly detecting this concentration. Sensitivity and specificity were 86.1% and 93.6%, respectively. Positive associations between sensitivity and the use of larger sample volumes, an internal control PCR, and PCR targeting the internal transcribed spacer (ITS) region were shown. Negative associations between sensitivity and the use of larger elution volumes (≥100 μl) and PCR targeting the mitochondrial genes were demonstrated. Most Aspergillus PCR protocols used to test serum generate satisfactory analytical performance. Testing serum requires less standardization, and the specific recommendations shown in this article will only improve performance. PMID:21940479
Introducing Chemometrics to the Analytical Curriculum: Combining Theory and Lab Experience
ERIC Educational Resources Information Center
Gilbert, Michael K.; Luttrell, Robert D.; Stout, David; Vogt, Frank
2008-01-01
Beer's law is an ideal technique that works only in certain situations. A method for dealing with more complex conditions needs to be integrated into the analytical chemistry curriculum. For that reason, the capabilities and limitations of two common chemometric algorithms, classical least squares (CLS) and principal component regression (PCR),…
Application of near-infrared spectroscopy for the rapid quality assessment of Radix Paeoniae Rubra
NASA Astrophysics Data System (ADS)
Zhan, Hao; Fang, Jing; Tang, Liying; Yang, Hongjun; Li, Hua; Wang, Zhuju; Yang, Bin; Wu, Hongwei; Fu, Meihong
2017-08-01
Near-infrared (NIR) spectroscopy with multivariate analysis was used to quantify gallic acid, catechin, albiflorin, and paeoniflorin in Radix Paeoniae Rubra, and the feasibility to classify the samples originating from different areas was investigated. A new high-performance liquid chromatography method was developed and validated to analyze gallic acid, catechin, albiflorin, and paeoniflorin in Radix Paeoniae Rubra as the reference. Partial least squares (PLS), principal component regression (PCR), and stepwise multivariate linear regression (SMLR) were performed to calibrate the regression model. Different data pretreatments such as derivatives (1st and 2nd), multiplicative scatter correction, standard normal variate, Savitzky-Golay filter, and Norris derivative filter were applied to remove the systematic errors. The performance of the model was evaluated according to the root mean square of calibration (RMSEC), root mean square error of prediction (RMSEP), root mean square error of cross-validation (RMSECV), and correlation coefficient (r). The results show that compared to PCR and SMLR, PLS had a lower RMSEC, RMSECV, and RMSEP and higher r for all the four analytes. PLS coupled with proper pretreatments showed good performance in both the fitting and predicting results. Furthermore, the original areas of Radix Paeoniae Rubra samples were partly distinguished by principal component analysis. This study shows that NIR with PLS is a reliable, inexpensive, and rapid tool for the quality assessment of Radix Paeoniae Rubra.
Lakshmi, KS; Lakshmi, S
2010-01-01
Two chemometric methods were developed for the simultaneous determination of telmisartan and hydrochlorothiazide. The chemometric methods applied were principal component regression (PCR) and partial least square (PLS-1). These approaches were successfully applied to quantify the two drugs in the mixture using the information included in the UV absorption spectra of appropriate solutions in the range of 200-350 nm with the intervals Δλ = 1 nm. The calibration of PCR and PLS-1 models was evaluated by internal validation (prediction of compounds in its own designed training set of calibration) and by external validation over laboratory prepared mixtures and pharmaceutical preparations. The PCR and PLS-1 methods require neither any separation step, nor any prior graphical treatment of the overlapping spectra of the two drugs in a mixture. The results of PCR and PLS-1 methods were compared with each other and a good agreement was found. PMID:21331198
Lakshmi, Ks; Lakshmi, S
2010-01-01
Two chemometric methods were developed for the simultaneous determination of telmisartan and hydrochlorothiazide. The chemometric methods applied were principal component regression (PCR) and partial least square (PLS-1). These approaches were successfully applied to quantify the two drugs in the mixture using the information included in the UV absorption spectra of appropriate solutions in the range of 200-350 nm with the intervals Δλ = 1 nm. The calibration of PCR and PLS-1 models was evaluated by internal validation (prediction of compounds in its own designed training set of calibration) and by external validation over laboratory prepared mixtures and pharmaceutical preparations. The PCR and PLS-1 methods require neither any separation step, nor any prior graphical treatment of the overlapping spectra of the two drugs in a mixture. The results of PCR and PLS-1 methods were compared with each other and a good agreement was found.
NASA Astrophysics Data System (ADS)
Kim, Young-Pil; Hong, Mi-Young; Shon, Hyun Kyong; Chegal, Won; Cho, Hyun Mo; Moon, Dae Won; Kim, Hak-Sung; Lee, Tae Geol
2008-12-01
Interaction between streptavidin and biotin on poly(amidoamine) (PAMAM) dendrimer-activated surfaces and on self-assembled monolayers (SAMs) was quantitatively studied by using time-of-flight secondary ion mass spectrometry (ToF-SIMS). The surface protein density was systematically varied as a function of protein concentration and independently quantified using the ellipsometry technique. Principal component analysis (PCA) and principal component regression (PCR) were used to identify a correlation between the intensities of the secondary ion peaks and the surface protein densities. From the ToF-SIMS and ellipsometry results, a good linear correlation of protein density was found. Our study shows that surface protein densities are higher on dendrimer-activated surfaces than on SAMs surfaces due to the spherical property of the dendrimer, and that these surface protein densities can be easily quantified with high sensitivity in a label-free manner by ToF-SIMS.
Bunaciu, Andrei A.; Udristioiu, Gabriela Elena; Ruţă, Lavinia L.; Fleschin, Şerban; Aboul-Enein, Hassan Y.
2009-01-01
A Fourier transform infrared (FT-IR) spectrometric method was developed for the rapid, direct measurement of diosmin in different pharmaceutical drugs. Conventional KBr-spectra were compared for best determination of active substance in commercial preparations. The Beer–Lambert law and two chemometric approaches, partial least squares (PLS) and principal component regression (PCR+) methods, were tried in data processing. PMID:23960715
NASA Astrophysics Data System (ADS)
Anggraeni, Anni; Arianto, Fernando; Mutalib, Abdul; Pratomo, Uji; Bahti, Husein H.
2017-05-01
Rare Earth Elements (REE) are elements that a lot of function for life, such as metallurgy, optical devices, and manufacture of electronic devices. Sources of REE is present in the mineral, in which each element has similar properties. Currently, to determining the content of REE is used instruments such as ICP-OES, ICP-MS, XRF, and HPLC. But in each instruments, there are still have some weaknesses. Therefore we need an alternative analytical method for the determination of rare earth metal content, one of them is by a combination of UV-Visible spectrophotometry and multivariate analysis, including Principal Component Analysis (PCA), Principal Component Regression (PCR), and Partial Least Square Regression (PLS). The purpose of this experiment is to determine the content of light and medium rare earth elements in the mineral monazite without chemical separation by using a combination of multivariate analysis and UV-Visible spectrophotometric methods. Training set created 22 variations of concentration and absorbance was measured using a UV-Vis spectrophotometer, then the data is processed by PCA, PCR, and PLSR. The results were compared and validated to obtain the mathematical equation with the smallest percent error. From this experiment, mathematical equation used PLS methods was better than PCR after validated, which has RMSE value for La, Ce, Pr, Nd, Gd, Sm, Eu, and Tb respectively 0.095; 0.573; 0.538; 0.440; 3.387; 1.240; 1.870; and 0.639.
Zhang, Ni; Liu, Xu; Jin, Xiaoduo; Li, Chen; Wu, Xuan; Yang, Shuqin; Ning, Jifeng; Yanne, Paul
2017-12-15
Phenolics contents in wine grapes are key indicators for assessing ripeness. Near-infrared hyperspectral images during ripening have been explored to achieve an effective method for predicting phenolics contents. Principal component regression (PCR), partial least squares regression (PLSR) and support vector regression (SVR) models were built, respectively. The results show that SVR behaves globally better than PLSR and PCR, except in predicting tannins content of seeds. For the best prediction results, the squared correlation coefficient and root mean square error reached 0.8960 and 0.1069g/L (+)-catechin equivalents (CE), respectively, for tannins in skins, 0.9065 and 0.1776 (g/L CE) for total iron-reactive phenolics (TIRP) in skins, 0.8789 and 0.1442 (g/L M3G) for anthocyanins in skins, 0.9243 and 0.2401 (g/L CE) for tannins in seeds, and 0.8790 and 0.5190 (g/L CE) for TIRP in seeds. Our results indicated that NIR hyperspectral imaging has good prospects for evaluation of phenolics in wine grapes. Copyright © 2017 Elsevier Ltd. All rights reserved.
Zhou, Yan; Cao, Hui
2013-01-01
We propose an augmented classical least squares (ACLS) calibration method for quantitative Raman spectral analysis against component information loss. The Raman spectral signals with low analyte concentration correlations were selected and used as the substitutes for unknown quantitative component information during the CLS calibration procedure. The number of selected signals was determined by using the leave-one-out root-mean-square error of cross-validation (RMSECV) curve. An ACLS model was built based on the augmented concentration matrix and the reference spectral signal matrix. The proposed method was compared with partial least squares (PLS) and principal component regression (PCR) using one example: a data set recorded from an experiment of analyte concentration determination using Raman spectroscopy. A 2-fold cross-validation with Venetian blinds strategy was exploited to evaluate the predictive power of the proposed method. The one-way variance analysis (ANOVA) was used to access the predictive power difference between the proposed method and existing methods. Results indicated that the proposed method is effective at increasing the robust predictive power of traditional CLS model against component information loss and its predictive power is comparable to that of PLS or PCR.
Martelo-Vidal, M J; Vázquez, M
2014-09-01
Spectral analysis is a quick and non-destructive method to analyse wine. In this work, trans-resveratrol, oenin, malvin, catechin, epicatechin, quercetin and syringic acid were determined in commercial red wines from DO Rías Baixas and DO Ribeira Sacra (Spain) by UV-VIS-NIR spectroscopy. Calibration models were developed using principal component regression (PCR) or partial least squares (PLS) regression. HPLC was used as reference method. The results showed that reliable PLS models were obtained to quantify all polyphenols for Rías Baixas wines. For Ribeira Sacra, feasible models were obtained to determine quercetin, epicatechin, oenin and syringic acid. PCR calibration models showed worst reliable of prediction than PLS models. For red wines from mencía grapes, feasible models were obtained for catechin and oenin, regardless the geographical origin. The results obtained demonstrate that UV-VIS-NIR spectroscopy can be used to determine individual polyphenolic compounds in red wines. Copyright © 2014 Elsevier Ltd. All rights reserved.
A Nonlinear Model for Gene-Based Gene-Environment Interaction.
Sa, Jian; Liu, Xu; He, Tao; Liu, Guifen; Cui, Yuehua
2016-06-04
A vast amount of literature has confirmed the role of gene-environment (G×E) interaction in the etiology of complex human diseases. Traditional methods are predominantly focused on the analysis of interaction between a single nucleotide polymorphism (SNP) and an environmental variable. Given that genes are the functional units, it is crucial to understand how gene effects (rather than single SNP effects) are influenced by an environmental variable to affect disease risk. Motivated by the increasing awareness of the power of gene-based association analysis over single variant based approach, in this work, we proposed a sparse principle component regression (sPCR) model to understand the gene-based G×E interaction effect on complex disease. We first extracted the sparse principal components for SNPs in a gene, then the effect of each principal component was modeled by a varying-coefficient (VC) model. The model can jointly model variants in a gene in which their effects are nonlinearly influenced by an environmental variable. In addition, the varying-coefficient sPCR (VC-sPCR) model has nice interpretation property since the sparsity on the principal component loadings can tell the relative importance of the corresponding SNPs in each component. We applied our method to a human birth weight dataset in Thai population. We analyzed 12,005 genes across 22 chromosomes and found one significant interaction effect using the Bonferroni correction method and one suggestive interaction. The model performance was further evaluated through simulation studies. Our model provides a system approach to evaluate gene-based G×E interaction.
Talpur, M Younis; Kara, Huseyin; Sherazi, S T H; Ayyildiz, H Filiz; Topkafa, Mustafa; Arslan, Fatma Nur; Naz, Saba; Durmaz, Fatih; Sirajuddin
2014-11-01
Single bounce attenuated total reflectance (SB-ATR) Fourier transform infrared (FTIR) spectroscopy in conjunction with chemometrics was used for accurate determination of free fatty acid (FFA), peroxide value (PV), iodine value (IV), conjugated diene (CD) and conjugated triene (CT) of cottonseed oil (CSO) during potato chips frying. Partial least square (PLS), stepwise multiple linear regression (SMLR), principal component regression (PCR) and simple Beer׳s law (SBL) were applied to develop the calibrations for simultaneous evaluation of five stated parameters of cottonseed oil (CSO) during frying of French frozen potato chips at 170°C. Good regression coefficients (R(2)) were achieved for FFA, PV, IV, CD and CT with value of >0.992 by PLS, SMLR, PCR, and SBL. Root mean square error of prediction (RMSEP) was found to be less than 1.95% for all determinations. Result of the study indicated that SB-ATR FTIR in combination with multivariate chemometrics could be used for accurate and simultaneous determination of different parameters during the frying process without using any toxic organic solvent. Copyright © 2014 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Yin, Jianhua; Xia, Yang
2014-12-01
Fourier transform infrared imaging (FTIRI) combining with principal component regression (PCR) analysis were used to determine the reduction of proteoglycan (PG) in articular cartilage after the transection of the anterior cruciate ligament (ACL). A number of canine knee cartilage sections were harvested from the meniscus-covered and meniscus-uncovered medial tibial locations from the control joints, the ACL joints at three time points after the surgery, and their contralateral joints. The PG loss in the ACL cartilage was related positively to the durations after the surgery. The PG loss in the contralateral knees was less than that of the ACL knees. The PG loss in the meniscus-covered cartilage was less than that of the meniscus-uncovered tissue in both ACL and contralateral knees. The quantitative mapping of PG loss could monitor the disease progression and repair processes in arthritis.
Dinç, Erdal; Ustündağ, Ozgür; Baleanu, Dumitru
2010-08-01
The sole use of pyridoxine hydrochloride during treatment of tuberculosis gives rise to pyridoxine deficiency. Therefore, a combination of pyridoxine hydrochloride and isoniazid is used in pharmaceutical dosage form in tuberculosis treatment to reduce this side effect. In this study, two chemometric methods, partial least squares (PLS) and principal component regression (PCR), were applied to the simultaneous determination of pyridoxine (PYR) and isoniazid (ISO) in their tablets. A concentration training set comprising binary mixtures of PYR and ISO consisting of 20 different combinations were randomly prepared in 0.1 M HCl. Both multivariate calibration models were constructed using the relationships between the concentration data set (concentration data matrix) and absorbance data matrix in the spectral region 200-330 nm. The accuracy and the precision of the proposed chemometric methods were validated by analyzing synthetic mixtures containing the investigated drugs. The recovery results obtained by applying PCR and PLS calibrations to the artificial mixtures were found between 100.0 and 100.7%. Satisfactory results obtained by applying the PLS and PCR methods to both artificial and commercial samples were obtained. The results obtained in this manuscript strongly encourage us to use them for the quality control and the routine analysis of the marketing tablets containing PYR and ISO drugs. Copyright © 2010 John Wiley & Sons, Ltd.
Multivariate methods for indoor PM10 and PM2.5 modelling in naturally ventilated schools buildings
NASA Astrophysics Data System (ADS)
Elbayoumi, Maher; Ramli, Nor Azam; Md Yusof, Noor Faizah Fitri; Yahaya, Ahmad Shukri Bin; Al Madhoun, Wesam; Ul-Saufie, Ahmed Zia
2014-09-01
In this study the concentrations of PM10, PM2.5, CO and CO2 concentrations and meteorological variables (wind speed, air temperature, and relative humidity) were employed to predict the annual and seasonal indoor concentration of PM10 and PM2.5 using multivariate statistical methods. The data have been collected in twelve naturally ventilated schools in Gaza Strip (Palestine) from October 2011 to May 2012 (academic year). The bivariate correlation analysis showed that the indoor PM10 and PM2.5 were highly positive correlated with outdoor concentration of PM10 and PM2.5. Further, Multiple linear regression (MLR) was used for modelling and R2 values for indoor PM10 were determined as 0.62 and 0.84 for PM10 and PM2.5 respectively. The Performance indicators of MLR models indicated that the prediction for PM10 and PM2.5 annual models were better than seasonal models. In order to reduce the number of input variables, principal component analysis (PCA) and principal component regression (PCR) were applied by using annual data. The predicted R2 were 0.40 and 0.73 for PM10 and PM2.5, respectively. PM10 models (MLR and PCR) show the tendency to underestimate indoor PM10 concentrations as it does not take into account the occupant's activities which highly affect the indoor concentrations during the class hours.
Gouvinhas, Irene; Machado, Nelson; Carvalho, Teresa; de Almeida, José M M M; Barros, Ana I R N A
2015-01-01
Extra virgin olive oils produced from three cultivars on different maturation stages were characterized using Raman spectroscopy. Chemometric methods (principal component analysis, discriminant analysis, principal component regression and partial least squares regression) applied to Raman spectral data were utilized to evaluate and quantify the statistical differences between cultivars and their ripening process. The models for predicting the peroxide value and free acidity of olive oils showed good calibration and prediction values and presented high coefficients of determination (>0.933). Both the R(2), and the correlation equations between the measured chemical parameters, and the values predicted by each approach are presented; these comprehend both PCR and PLS, used to assess SNV normalized Raman data, as well as first and second derivative of the spectra. This study demonstrates that a combination of Raman spectroscopy with multivariate analysis methods can be useful to predict rapidly olive oil chemical characteristics during the maturation process. Copyright © 2014 Elsevier B.V. All rights reserved.
Nazari, Seyed Saeed Hashemi; Mokhayeri, Yaser; Mansournia, Mohammad Ali; Khodakarim, Soheila; Soori, Hamid
2018-05-21
Some studies shed light on the association between dietary patterns and stroke, though, none of them applied reduced rank regression (RRR). Therefore, we sought to extract dietary patterns using RRR, and showed how well the extracted scores by RRR predict stroke in comparison to those scores produced by partial least squares (PLS) and principal components regression (PCR). Diet data at baseline with four response variables including body mass index (BMI), fibrinogen, IL-6, low-density lipoprotein (LDL) cholesterol were used to extract dietary patterns. Analyses were based on 5468 men and women aged 45-84 y who had no clinical cardiovascular diseases (CVD) from Multi-Ethnic Study of Atherosclerosis (MESA). Dietary patterns were created by three methods RRR, PLS, and PCR. The RRR1 was positively associated with stroke incidence in both models (for model 1 hazard ratio (HR): 7.49; 95% CI: 1.66, 33.69 P for trend = 0.01 and for model 2 HR: 6.83; 95% CI: 1.51, 30.87 for quintile 5 compared with the reference category P for trend = 0.02). The RRR1, PLS1, and PCR1 were high in fats and oils, poultry, tomatoes, fried potato and processed meat. Additionally, RRR1 and PLS1 were high in dark-yellow and cruciferous vegetables which negatively were correlated with the first dietary pattern. Mainly according to the RRR, we identified that a dietary pattern high in fats and oil, poultry, non-diet soda, processed meat, tomatoes, legumes, chicken, tuna and egg salad, fried potato and low in dark-yellow and cruciferous vegetables may increase the incidence of stroke.
NASA Astrophysics Data System (ADS)
Chen, Hua-cai; Chen, Xing-dan; Lu, Yong-jun; Cao, Zhi-qiang
2006-01-01
Near infrared (NIR) reflectance spectroscopy was used to develop a fast determination method for total ginsenosides in Ginseng (Panax Ginseng) powder. The spectra were analyzed with multiplicative signal correction (MSC) correlation method. The best correlative spectra region with the total ginsenosides content was 1660 nm~1880 nm and 2230nm~2380 nm. The NIR calibration models of ginsenosides were built with multiple linear regression (MLR), principle component regression (PCR) and partial least squares (PLS) regression respectively. The results showed that the calibration model built with PLS combined with MSC and the optimal spectrum region was the best one. The correlation coefficient and the root mean square error of correction validation (RMSEC) of the best calibration model were 0.98 and 0.15% respectively. The optimal spectrum region for calibration was 1204nm~2014nm. The result suggested that using NIR to rapidly determinate the total ginsenosides content in ginseng powder were feasible.
NASA Astrophysics Data System (ADS)
Hadad, Ghada M.; El-Gindy, Alaa; Mahmoud, Waleed M. M.
2008-08-01
High-performance liquid chromatography (HPLC) and multivariate spectrophotometric methods are described for the simultaneous determination of ambroxol hydrochloride (AM) and doxycycline (DX) in combined pharmaceutical capsules. The chromatographic separation was achieved on reversed-phase C 18 analytical column with a mobile phase consisting of a mixture of 20 mM potassium dihydrogen phosphate, pH 6-acetonitrile in ratio of (1:1, v/v) and UV detection at 245 nm. Also, the resolution has been accomplished by using numerical spectrophotometric methods as classical least squares (CLS), principal component regression (PCR) and partial least squares (PLS-1) applied to the UV spectra of the mixture and graphical spectrophotometric method as first derivative of the ratio spectra ( 1DD) method. Analytical figures of merit (FOM), such as sensitivity, selectivity, analytical sensitivity, limit of quantitation and limit of detection were determined for CLS, PLS-1 and PCR methods. The proposed methods were validated and successfully applied for the analysis of pharmaceutical formulation and laboratory-prepared mixtures containing the two component combination.
NASA Astrophysics Data System (ADS)
Metwally, Fadia H.
2008-02-01
The quantitative predictive abilities of the new and simple bivariate spectrophotometric method are compared with the results obtained by the use of multivariate calibration methods [the classical least squares (CLS), principle component regression (PCR) and partial least squares (PLS)], using the information contained in the absorption spectra of the appropriate solutions. Mixtures of the two drugs Nifuroxazide (NIF) and Drotaverine hydrochloride (DRO) were resolved by application of the bivariate method. The different chemometric approaches were applied also with previous optimization of the calibration matrix, as they are useful in simultaneous inclusion of many spectral wavelengths. The results found by application of the bivariate, CLS, PCR and PLS methods for the simultaneous determinations of mixtures of both components containing 2-12 μg ml -1 of NIF and 2-8 μg ml -1 of DRO are reported. Both approaches were satisfactorily applied to the simultaneous determination of NIF and DRO in pure form and in pharmaceutical formulation. The results were in accordance with those given by the EVA Pharma reference spectrophotometric method.
Hadad, Ghada M; El-Gindy, Alaa; Mahmoud, Waleed M M
2008-08-01
High-performance liquid chromatography (HPLC) and multivariate spectrophotometric methods are described for the simultaneous determination of ambroxol hydrochloride (AM) and doxycycline (DX) in combined pharmaceutical capsules. The chromatographic separation was achieved on reversed-phase C(18) analytical column with a mobile phase consisting of a mixture of 20mM potassium dihydrogen phosphate, pH 6-acetonitrile in ratio of (1:1, v/v) and UV detection at 245 nm. Also, the resolution has been accomplished by using numerical spectrophotometric methods as classical least squares (CLS), principal component regression (PCR) and partial least squares (PLS-1) applied to the UV spectra of the mixture and graphical spectrophotometric method as first derivative of the ratio spectra ((1)DD) method. Analytical figures of merit (FOM), such as sensitivity, selectivity, analytical sensitivity, limit of quantitation and limit of detection were determined for CLS, PLS-1 and PCR methods. The proposed methods were validated and successfully applied for the analysis of pharmaceutical formulation and laboratory-prepared mixtures containing the two component combination.
Zhou, Qingping; Jiang, Haiyan; Wang, Jianzhou; Zhou, Jianling
2014-10-15
Exposure to high concentrations of fine particulate matter (PM₂.₅) can cause serious health problems because PM₂.₅ contains microscopic solid or liquid droplets that are sufficiently small to be ingested deep into human lungs. Thus, daily prediction of PM₂.₅ levels is notably important for regulatory plans that inform the public and restrict social activities in advance when harmful episodes are foreseen. A hybrid EEMD-GRNN (ensemble empirical mode decomposition-general regression neural network) model based on data preprocessing and analysis is firstly proposed in this paper for one-day-ahead prediction of PM₂.₅ concentrations. The EEMD part is utilized to decompose original PM₂.₅ data into several intrinsic mode functions (IMFs), while the GRNN part is used for the prediction of each IMF. The hybrid EEMD-GRNN model is trained using input variables obtained from principal component regression (PCR) model to remove redundancy. These input variables accurately and succinctly reflect the relationships between PM₂.₅ and both air quality and meteorological data. The model is trained with data from January 1 to November 1, 2013 and is validated with data from November 2 to November 21, 2013 in Xi'an Province, China. The experimental results show that the developed hybrid EEMD-GRNN model outperforms a single GRNN model without EEMD, a multiple linear regression (MLR) model, a PCR model, and a traditional autoregressive integrated moving average (ARIMA) model. The hybrid model with fast and accurate results can be used to develop rapid air quality warning systems. Copyright © 2014 Elsevier B.V. All rights reserved.
Climatic change projections for winter streamflow in Guadalquivir river
NASA Astrophysics Data System (ADS)
Jesús Esteban Parra, María; Hidalgo Muñoz, José Manuel; García-Valdecasas-Ojeda, Matilde; Raquel Gámiz Fortis, Sonia; Castro Díez, Yolanda
2015-04-01
In this work we have obtained climate change projections for winter streamflow of the Guadalquivir River in the period 2071-2100 using the Principal Component Regression (PCR) method. The streamflow data base used has been provided by the Center for Studies and Experimentation of Public Works, CEDEX. Series from gauging stations and reservoirs with less than 10% of missing data (filled by regression with well correlated neighboring stations) have been considered. The homogeneity of these series has been evaluated through the Pettit test and degree of human alteration by the Common Area Index. The application of these criteria led to the selection of 13 streamflow time series homogeneously distributed over the basin, covering the period 1952-2011. For this streamflow data, winter seasonal values were obtained by averaging the monthly values from January to March. The PCR method has been applied using the Principal Components of the mean anomalies of sea level pressure (SLP) in winter (December to February averaged) as predictors of streamflow for the development of a downscaled statistical model. The SLP database is the NCEP reanalysis covering the North Atlantic region, and the calibration and validation periods used for fitting and evaluating the ability of the model are 1952-1992 and 1993-2011, respectively. In general, using four Principal Components, regression models are able to explain up to 70% of the variance of the streamflow data. Finally, the statistical model obtained for the observational data was applied to the SLP data for the period 2071-2100, using the outputs of different GCMs of the CMIP5 under the RPC8.5 scenario. The results found for the end of the century show no significant changes or moderate decrease in the streamflow of this river for most GCMs in winter, but for some of them the decrease is very strong. Keywords: Statistical downscaling, streamflow, Guadalquivir River, climate change. ACKNOWLEDGEMENTS This work has been financed by the projects P11-RNM-7941 (Junta de Andalucía-Spain) and CGL2013-48539-R (MINECO-Spain, FEDER).
Comprehensive GMO detection using real-time PCR array: single-laboratory validation.
Mano, Junichi; Harada, Mioko; Takabatake, Reona; Furui, Satoshi; Kitta, Kazumi; Nakamura, Kosuke; Akiyama, Hiroshi; Teshima, Reiko; Noritake, Hiromichi; Hatano, Shuko; Futo, Satoshi; Minegishi, Yasutaka; Iizuka, Tayoshi
2012-01-01
We have developed a real-time PCR array method to comprehensively detect genetically modified (GM) organisms. In the method, genomic DNA extracted from an agricultural product is analyzed using various qualitative real-time PCR assays on a 96-well PCR plate, targeting for individual GM events, recombinant DNA (r-DNA) segments, taxon-specific DNAs, and donor organisms of the respective r-DNAs. In this article, we report the single-laboratory validation of both DNA extraction methods and component PCR assays constituting the real-time PCR array. We selected some DNA extraction methods for specified plant matrixes, i.e., maize flour, soybean flour, and ground canola seeds, then evaluated the DNA quantity, DNA fragmentation, and PCR inhibition of the resultant DNA extracts. For the component PCR assays, we evaluated the specificity and LOD. All DNA extraction methods and component PCR assays satisfied the criteria set on the basis of previous reports.
Üstündağ, Özgür; Dinç, Erdal; Özdemir, Nurten; Tilkan, M Günseli
2015-01-01
In the development strategies of new drug products and generic drug products, the simultaneous in-vitro dissolution behavior of oral dosage formulations is the most important indication for the quantitative estimation of efficiency and biopharmaceutical characteristics of drug substances. This is to force the related field's scientists to improve very powerful analytical methods to get more reliable, precise and accurate results in the quantitative analysis and dissolution testing of drug formulations. In this context, two new chemometric tools, partial least squares (PLS) and principal component regression (PCR) were improved for the simultaneous quantitative estimation and dissolution testing of zidovudine (ZID) and lamivudine (LAM) in a tablet dosage form. The results obtained in this study strongly encourage us to use them for the quality control, the routine analysis and the dissolution test of the marketing tablets containing ZID and LAM drugs.
The Application of Censored Regression Models in Low Streamflow Analyses
NASA Astrophysics Data System (ADS)
Kroll, C.; Luz, J.
2003-12-01
Estimation of low streamflow statistics at gauged and ungauged river sites is often a daunting task. This process is further confounded by the presence of intermittent streamflows, where streamflow is sometimes reported as zero, within a region. Streamflows recorded as zero may be zero, or may be less than the measurement detection limit. Such data is often referred to as censored data. Numerous methods have been developed to characterize intermittent streamflow series. Logit regression has been proposed to develop regional models of the probability annual lowflows series (such as 7-day lowflows) are zero. In addition, Tobit regression, a method of regression that allows for censored dependent variables, has been proposed for lowflow regional regression models in regions where the lowflow statistic of interest estimated as zero at some sites in the region. While these methods have been proposed, their use in practice has been limited. Here a delete-one jackknife simulation is presented to examine the performance of Logit and Tobit models of 7-day annual minimum flows in 6 USGS water resource regions in the United States. For the Logit model, an assessment is made of whether sites are correctly classified as having at least 10% of 7-day annual lowflows equal to zero. In such a situation, the 7-day, 10-year lowflow (Q710), a commonly employed low streamflow statistic, would be reported as zero. For the Tobit model, a comparison is made between results from the Tobit model, and from performing either ordinary least squares (OLS) or principal component regression (PCR) after the zero sites are dropped from the analysis. Initial results for the Logit model indicate this method to have a high probability of correctly classifying sites into groups with Q710s as zero and non-zero. Initial results also indicate the Tobit model produces better results than PCR and OLS when more than 5% of the sites in the region have Q710 values calculated as zero.
Scampicchio, Matteo; Mimmo, Tanja; Capici, Calogero; Huck, Christian; Innocente, Nadia; Drusch, Stephan; Cesco, Stefano
2012-11-14
Stable isotope values were used to develop a new analytical approach enabling the simultaneous identification of milk samples either processed with different heating regimens or from different geographical origins. The samples consisted of raw, pasteurized (HTST), and ultrapasteurized (UHT) milk from different Italian origins. The approach consisted of the analysis of the isotope ratio of δ¹³C and δ¹⁵N for the milk samples and their fractions (fat, casein, and whey). The main finding of this work is that as the heat processing affects the composition of the milk fractions, changes in δ¹³C and δ¹⁵N were also observed. These changes were used as markers to develop pattern recognition maps based on principal component analysis and supervised classification models, such as linear discriminant analysis (LDA), multivariate regression (MLR), principal component regression (PCR), and partial least-squares (PLS). The results give proof of the concept that isotope ratio mass spectroscopy can discriminate simultaneously between milk samples according to their geographical origin and type of processing.
NASA Astrophysics Data System (ADS)
Boucher, Thomas F.; Ozanne, Marie V.; Carmosino, Marco L.; Dyar, M. Darby; Mahadevan, Sridhar; Breves, Elly A.; Lepore, Kate H.; Clegg, Samuel M.
2015-05-01
The ChemCam instrument on the Mars Curiosity rover is generating thousands of LIBS spectra and bringing interest in this technique to public attention. The key to interpreting Mars or any other types of LIBS data are calibrations that relate laboratory standards to unknowns examined in other settings and enable predictions of chemical composition. Here, LIBS spectral data are analyzed using linear regression methods including partial least squares (PLS-1 and PLS-2), principal component regression (PCR), least absolute shrinkage and selection operator (lasso), elastic net, and linear support vector regression (SVR-Lin). These were compared against results from nonlinear regression methods including kernel principal component regression (K-PCR), polynomial kernel support vector regression (SVR-Py) and k-nearest neighbor (kNN) regression to discern the most effective models for interpreting chemical abundances from LIBS spectra of geological samples. The results were evaluated for 100 samples analyzed with 50 laser pulses at each of five locations averaged together. Wilcoxon signed-rank tests were employed to evaluate the statistical significance of differences among the nine models using their predicted residual sum of squares (PRESS) to make comparisons. For MgO, SiO2, Fe2O3, CaO, and MnO, the sparse models outperform all the others except for linear SVR, while for Na2O, K2O, TiO2, and P2O5, the sparse methods produce inferior results, likely because their emission lines in this energy range have lower transition probabilities. The strong performance of the sparse methods in this study suggests that use of dimensionality-reduction techniques as a preprocessing step may improve the performance of the linear models. Nonlinear methods tend to overfit the data and predict less accurately, while the linear methods proved to be more generalizable with better predictive performance. These results are attributed to the high dimensionality of the data (6144 channels) relative to the small number of samples studied. The best-performing models were SVR-Lin for SiO2, MgO, Fe2O3, and Na2O, lasso for Al2O3, elastic net for MnO, and PLS-1 for CaO, TiO2, and K2O. Although these differences in model performance between methods were identified, most of the models produce comparable results when p ≤ 0.05 and all techniques except kNN produced statistically-indistinguishable results. It is likely that a combination of models could be used together to yield a lower total error of prediction, depending on the requirements of the user.
NASA Astrophysics Data System (ADS)
Sun, Ruiling; Wang, Yong; Ni, Yongnian; Kokot, Serge
2014-03-01
A simple, inexpensive and sensitive kinetic spectrophotometric method was developed for the simultaneous determination of three anti-carcinogenic flavonoids: catechin, quercetin and naringenin, in fruit samples. A yellow chelate product was produced in the presence neocuproine and Cu(I) - a reduction product of the reaction between the flavonoids with Cu(II), and this enabled the quantitative measurements with UV-vis spectrophotometry. The overlapping spectra obtained, were resolved with chemometrics calibration models, and the best performing method was the fast independent component analysis (fast-ICA/PCR (Principal component regression)); the limits of detection were 0.075, 0.057 and 0.063 mg L-1 for catechin, quercetin and naringenin, respectively. The novel method was found to outperform significantly the common HPLC procedure.
The Relationship between TOC and pH with Exchangeable Heavy Metal Levels in Lithuanian Podzols
NASA Astrophysics Data System (ADS)
Khaledian, Yones; Pereira, Paulo; Brevik, Eric C.; Pundyte, Neringa; Paliulis, Dainius
2017-04-01
Heavy metals can have a negative impact on public and environmental health. The objective of this study was to investigate the relationship between total organic carbon (TOC) and pH with exchangeable heavy metals (Pb, Cd, Cu and Zn) in order to predict exchangeable heavy metal content in soils sampled near Panevėžys and Kaunas, Lithuania. Principal component regression (PCR) and nonlinear regression methods were tested to find the statistical relationship between TOC and pH with heavy metals. The results of PCR [R2 = 0.68, RMSE = 0.07] and non-linear regression [R2 = 0.74, RMSE= 0.065] (pH with TOC and exchangeable parameters) were statistically significant. However, this was not observed in the relationships of pH and TOC separately with exchangeable heavy metals. The results indicated that pH had a higher correlation with exchangeable heavy metals (non-linear regression [R2 = 0.72, RMSE= 0.066]) than TOC with heavy metals [R2 = 0.30, RMSE= 0.004]. It can be concluded that even though there was a strong relationship between TOC and pH with exchangeable metals, the metal mobility (exchangeable metals) can be explained by pH better than TOC in this study. Finally, manipulating soil pH could likely be productive to assess and control heavy metals when financial and time limitations exist (Khaledian et al. 2016). Reference(s) Khaledian Y, Pereira P, Brevik E.C, Pundyte N, Paliulis D. 2016. The Influence of Organic Carbon and pH on Heavy Metals, Potassium, and Magnesium Levels in Lithuanian Podzols. Land Degradation and Development. DOI: 10.1002/ldr.2638
Comparison of three chemometrics methods for near-infrared spectra of glucose in the whole blood
NASA Astrophysics Data System (ADS)
Zhang, Hongyan; Ding, Dong; Li, Xin; Chen, Yu; Tang, Yuguo
2005-01-01
Principal Component Regression (PCR), Partial Least Square (PLS) and Artificial Neural Networks (ANN) methods are used in the analysis for the near infrared (NIR) spectra of glucose in the whole blood. The calibration model is built up in the spectrum band where there are the glucose has much more spectral absorption than the water, fat, and protein with these methods and the correlation coefficients of the model are showed in this paper. Comparing these results, a suitable method to analyze the glucose NIR spectrum in the whole blood is found.
Principal component reconstruction (PCR) for cine CBCT with motion learning from 2D fluoroscopy.
Gao, Hao; Zhang, Yawei; Ren, Lei; Yin, Fang-Fang
2018-01-01
This work aims to generate cine CT images (i.e., 4D images with high-temporal resolution) based on a novel principal component reconstruction (PCR) technique with motion learning from 2D fluoroscopic training images. In the proposed PCR method, the matrix factorization is utilized as an explicit low-rank regularization of 4D images that are represented as a product of spatial principal components and temporal motion coefficients. The key hypothesis of PCR is that temporal coefficients from 4D images can be reasonably approximated by temporal coefficients learned from 2D fluoroscopic training projections. For this purpose, we can acquire fluoroscopic training projections for a few breathing periods at fixed gantry angles that are free from geometric distortion due to gantry rotation, that is, fluoroscopy-based motion learning. Such training projections can provide an effective characterization of the breathing motion. The temporal coefficients can be extracted from these training projections and used as priors for PCR, even though principal components from training projections are certainly not the same for these 4D images to be reconstructed. For this purpose, training data are synchronized with reconstruction data using identical real-time breathing position intervals for projection binning. In terms of image reconstruction, with a priori temporal coefficients, the data fidelity for PCR changes from nonlinear to linear, and consequently, the PCR method is robust and can be solved efficiently. PCR is formulated as a convex optimization problem with the sum of linear data fidelity with respect to spatial principal components and spatiotemporal total variation regularization imposed on 4D image phases. The solution algorithm of PCR is developed based on alternating direction method of multipliers. The implementation is fully parallelized on GPU with NVIDIA CUDA toolbox and each reconstruction takes about a few minutes. The proposed PCR method is validated and compared with a state-of-art method, that is, PICCS, using both simulation and experimental data with the on-board cone-beam CT setting. The results demonstrated the feasibility of PCR for cine CBCT and significantly improved reconstruction quality of PCR from PICCS for cine CBCT. With a priori estimated temporal motion coefficients using fluoroscopic training projections, the PCR method can accurately reconstruct spatial principal components, and then generate cine CT images as a product of temporal motion coefficients and spatial principal components. © 2017 American Association of Physicists in Medicine.
Oliveira, Flavia C C; Brandão, Christian R R; Ramalho, Hugo F; da Costa, Leonardo A F; Suarez, Paulo A Z; Rubim, Joel C
2007-03-28
In this work it has been shown that the routine ASTM methods (ASTM 4052, ASTM D 445, ASTM D 4737, ASTM D 93, and ASTM D 86) recommended by the ANP (the Brazilian National Agency for Petroleum, Natural Gas and Biofuels) to determine the quality of diesel/biodiesel blends are not suitable to prevent the adulteration of B2 or B5 blends with vegetable oils. Considering the previous and actual problems with fuel adulterations in Brazil, we have investigated the application of vibrational spectroscopy (Fourier transform (FT) near infrared spectrometry and FT-Raman) to identify adulterations of B2 and B5 blends with vegetable oils. Partial least square regression (PLS), principal component regression (PCR), and artificial neural network (ANN) calibration models were designed and their relative performances were evaluated by external validation using the F-test. The PCR, PLS, and ANN calibration models based on the Fourier transform (FT) near infrared spectrometry and FT-Raman spectroscopy were designed using 120 samples. Other 62 samples were used in the validation and external validation, for a total of 182 samples. The results have shown that among the designed calibration models, the ANN/FT-Raman presented the best accuracy (0.028%, w/w) for samples used in the external validation.
Assessing the accuracy of ANFIS, EEMD-GRNN, PCR, and MLR models in predicting PM2.5
NASA Astrophysics Data System (ADS)
Ausati, Shadi; Amanollahi, Jamil
2016-10-01
Since Sanandaj is considered one of polluted cities of Iran, prediction of any type of pollution especially prediction of suspended particles of PM2.5, which are the cause of many diseases, could contribute to health of society by timely announcements and prior to increase of PM2.5. In order to predict PM2.5 concentration in the Sanandaj air the hybrid models consisting of an ensemble empirical mode decomposition and general regression neural network (EEMD-GRNN), Adaptive Neuro-Fuzzy Inference System (ANFIS), principal component regression (PCR), and linear model such as multiple liner regression (MLR) model were used. In these models the data of suspended particles of PM2.5 were the dependent variable and the data related to air quality including PM2.5, PM10, SO2, NO2, CO, O3 and meteorological data including average minimum temperature (Min T), average maximum temperature (Max T), average atmospheric pressure (AP), daily total precipitation (TP), daily relative humidity level of the air (RH) and daily wind speed (WS) for the year 2014 in Sanandaj were the independent variables. Among the used models, EEMD-GRNN model with values of R2 = 0.90, root mean square error (RMSE) = 4.9218 and mean absolute error (MAE) = 3.4644 in the training phase and with values of R2 = 0.79, RMSE = 5.0324 and MAE = 3.2565 in the testing phase, exhibited the best function in predicting this phenomenon. It can be concluded that hybrid models have accurate results to predict PM2.5 concentration compared with linear model.
NASA Astrophysics Data System (ADS)
Gholizadeh, H.; Robeson, S. M.
2015-12-01
Empirical models have been widely used to estimate global chlorophyll content from remotely sensed data. Here, we focus on the standard NASA empirical models that use blue-green band ratios. These band ratio ocean color (OC) algorithms are in the form of fourth-order polynomials and the parameters of these polynomials (i.e. coefficients) are estimated from the NASA bio-Optical Marine Algorithm Data set (NOMAD). Most of the points in this data set have been sampled from tropical and temperate regions. However, polynomial coefficients obtained from this data set are used to estimate chlorophyll content in all ocean regions with different properties such as sea-surface temperature, salinity, and downwelling/upwelling patterns. Further, the polynomial terms in these models are highly correlated. In sum, the limitations of these empirical models are as follows: 1) the independent variables within the empirical models, in their current form, are correlated (multicollinear), and 2) current algorithms are global approaches and are based on the spatial stationarity assumption, so they are independent of location. Multicollinearity problem is resolved by using partial least squares (PLS). PLS, which transforms the data into a set of independent components, can be considered as a combined form of principal component regression (PCR) and multiple regression. Geographically weighted regression (GWR) is also used to investigate the validity of spatial stationarity assumption. GWR solves a regression model over each sample point by using the observations within its neighbourhood. PLS results show that the empirical method underestimates chlorophyll content in high latitudes, including the Southern Ocean region, when compared to PLS (see Figure 1). Cluster analysis of GWR coefficients also shows that the spatial stationarity assumption in empirical models is not likely a valid assumption.
A SAR and QSAR study of new artemisinin compounds with antimalarial activity.
Santos, Cleydson Breno R; Vieira, Josinete B; Lobato, Cleison C; Hage-Melim, Lorane I S; Souto, Raimundo N P; Lima, Clarissa S; Costa, Elizabeth V M; Brasil, Davi S B; Macêdo, Williams Jorge C; Carvalho, José Carlos T
2013-12-30
The Hartree-Fock method and the 6-31G** basis set were employed to calculate the molecular properties of artemisinin and 20 derivatives with antimalarial activity. Maps of molecular electrostatic potential (MEPs) and molecular docking were used to investigate the interaction between ligands and the receptor (heme). Principal component analysis and hierarchical cluster analysis were employed to select the most important descriptors related to activity. The correlation between biological activity and molecular properties was obtained using the partial least squares and principal component regression methods. The regression PLS and PCR models built in this study were also used to predict the antimalarial activity of 30 new artemisinin compounds with unknown activity. The models obtained showed not only statistical significance but also predictive ability. The significant molecular descriptors related to the compounds with antimalarial activity were the hydration energy (HE), the charge on the O11 oxygen atom (QO11), the torsion angle O1-O2-Fe-N2 (D2) and the maximum rate of R/Sanderson Electronegativity (RTe+). These variables led to a physical and structural explanation of the molecular properties that should be selected for when designing new ligands to be used as antimalarial agents.
NASA Astrophysics Data System (ADS)
Liu, Yande; Ying, Yibin; Lu, Huishan; Fu, Xiaping
2004-12-01
This work evaluates the feasibility of Fourier transform near infrared (FT-NIR) spectrometry for rapid determining the total soluble solids content and acidity of apple fruit. Intact apple fruit were measured by reflectance FT-NIR in 800-2500 nm range. FT-NIR models were developed based on partial least square (PLS) regression and principal component regress (PCR) with respect to the reflectance and its first derivative, the logarithms of the reflectance reciprocal and its second derivative. The above regression models, related the FT-NIR spectra to soluble solids content (SSC), titratable acidity (TA) and available acidity (pH). The best combination, based on the prediction results, was PLS models with respect to the logarithms of the reflectance reciprocal. Predictions with PLS models resulted standard errors of prediction (SEP) of 0.455, 0.044 and 0.068, and correlation coefficients of 0.968, 0.728 and 0.831 for SSC, TA and pH, respectively. It was concluded that by using the FT-NIR spectrometry measurement system, in the appropriate spectral range, it is possible to nondestructively assess the maturity factors of apple fruit.
Analytics of Radioactive Materials Released in the Fukushima Daiichi Nuclear Accident
DOE Office of Scientific and Technical Information (OSTI.GOV)
Egarievwe, Stephen U.; Nuclear Engineering Department, University of Tennessee, Knoxville, TN; Coble, Jamie B.
The 2011 Fukushima Daiichi nuclear accident in Japan resulted in the release of radioactive materials into the atmosphere, the nearby sea, and the surrounding land. Following the accident, several meteorological models were used to predict the transport of the radioactive materials to other continents such as North America and Europe. Also of high importance is the dispersion of radioactive materials locally and within Japan. Based on the International Atomic Energy Agency (IAEA) Convention on Early Notification of a nuclear accident, several radiological data sets were collected on the accident by the Japanese authorities. Among the radioactive materials monitored, are I-131more » and Cs-137 which form the major contributions to the contamination of drinking water. The radiation dose in the atmosphere was also measured. It is impractical to measure contamination and radiation dose in every place of interest. Therefore, modeling helps to predict contamination and radiation dose. Some modeling studies that have been reported in the literature include the simulation of transport and deposition of I-131 and Cs-137 from the accident, Cs-137 deposition and contamination of Japanese soils, and preliminary estimates of I-131 and Cs-137 discharged from the plant into the atmosphere. In this paper, we present statistical analytics of I-131 and Cs-137 with the goal of predicting gamma dose from the Fukushima Daiichi nuclear accident. The data sets used in our study were collected from the IAEA Fukushima Monitoring Database. As part of this study, we investigated several regression models to find the best algorithm for modeling the gamma dose. The modeling techniques used in our study include linear regression, principal component regression (PCR), partial least square (PLS) regression, and ridge regression. Our preliminary results on the first set of data showed that the linear regression model with one variable was the best with a root mean square error of 0.0133 μSv/h, compared to 0.0210 μSv/h for PCR, 0.231 μSv/h for ridge regression L-curve, 0.0856 μSv/h for PLS, and 0.0860 μSv/h for ridge regression cross validation. Complete results using the full datasets for these models will also be presented. (authors)« less
Diversity of soil yeasts isolated from South Victoria Land, Antarctica
Connell, L.; Redman, R.; Craig, S.; Scorzetti, G.; Iszard, M.; Rodriguez, R.
2008-01-01
Unicellular fungi, commonly referred to as yeasts, were found to be components of the culturable soil fungal population in Taylor Valley, Mt. Discovery, Wright Valley, and two mountain peaks of South Victoria Land, Antarctica. Samples were taken from sites spanning a diversity of soil habitats that were not directly associated with vertebrate activity. A large proportion of yeasts isolated in this study were basidiomycetous species (89%), of which 43% may represent undescribed species, demonstrating that culturable yeasts remain incompletely described in these polar desert soils. Cryptococcus species represented the most often isolated genus (33%) followed by Leucosporidium (22%). Principle component analysis and multiple linear regression using stepwise selection was used to model the relation between abiotic variables (principle component 1 and principle component 2 scores) and yeast biodiversity (the number of species present at a given site). These analyses identified soil pH and electrical conductivity as significant predictors of yeast biodiversity. Species-specific PCR primers were designed to rapidly discriminate among the Dioszegia and Leucosporidium species collected in this study. ?? 2008 Springer Science+Business Media, LLC.
Linge, Annett; Schötz, Ulrike; Löck, Steffen; Lohaus, Fabian; von Neubeck, Cläre; Gudziol, Volker; Nowak, Alexander; Tinhofer, Inge; Budach, Volker; Sak, Ali; Stuschke, Martin; Balermpas, Panagiotis; Rödel, Claus; Bunea, Hatice; Grosu, Anca-Ligia; Abdollahi, Amir; Debus, Jürgen; Ganswindt, Ute; Lauber, Kirsten; Pigorsch, Steffi; Combs, Stephanie E; Mönnich, David; Zips, Daniel; Baretton, Gustavo B; Buchholz, Frank; Krause, Mechthild; Belka, Claus; Baumann, Michael
2018-04-01
To compare six HPV detection methods in pre-treatment FFPE tumour samples from patients with locally advanced head and neck squamous cell carcinoma (HNSCC) who received postoperative (N = 175) or primary (N = 90) radiochemotherapy. HPV analyses included detection of (i) HPV16 E6/E7 RNA, (ii) HPV16 DNA (PCR-based arrays, A-PCR), (iii) HPV DNA (GP5+/GP6+ qPCR, (GP-PCR)), (iv) p16 (immunohistochemistry, p16 IHC), (v) combining p16 IHC and the A-PCR result and (vi) combining p16 IHC and the GP-PCR result. Differences between HPV positive and negative subgroups were evaluated for the primary endpoint loco-regional control (LRC) using Cox regression. Correlation between the HPV detection methods was high (chi-squared test, p < 0.001). While p16 IHC analysis resulted in several false positive classifications, A-PCR, GP-PCR and the combination of p16 IHC and A-PCR or GP-PCR led to results comparable to RNA analysis. In both cohorts, Cox regression analyses revealed significantly prolonged LRC for patients with HPV positive tumours irrespective of the detection method. The most stringent classification was obtained by detection of HPV16 RNA, or combining p16 IHC with A-PCR or GP-PCR. This approach revealed the lowest rate of recurrence in patients with tumours classified as HPV positive and therefore appears most suited for patient stratification in HPV-based clinical studies. Copyright © 2017 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Darvishzadeh, R.; Skidmore, A. K.; Mirzaie, M.; Atzberger, C.; Schlerf, M.
2014-12-01
Accurate estimation of grassland biomass at their peak productivity can provide crucial information regarding the functioning and productivity of the rangelands. Hyperspectral remote sensing has proved to be valuable for estimation of vegetation biophysical parameters such as biomass using different statistical techniques. However, in statistical analysis of hyperspectral data, multicollinearity is a common problem due to large amount of correlated hyper-spectral reflectance measurements. The aim of this study was to examine the prospect of above ground biomass estimation in a heterogeneous Mediterranean rangeland employing multivariate calibration methods. Canopy spectral measurements were made in the field using a GER 3700 spectroradiometer, along with concomitant in situ measurements of above ground biomass for 170 sample plots. Multivariate calibrations including partial least squares regression (PLSR), principal component regression (PCR), and Least-Squared Support Vector Machine (LS-SVM) were used to estimate the above ground biomass. The prediction accuracy of the multivariate calibration methods were assessed using cross validated R2 and RMSE. The best model performance was obtained using LS_SVM and then PLSR both calibrated with first derivative reflectance dataset with R2cv = 0.88 & 0.86 and RMSEcv= 1.15 & 1.07 respectively. The weakest prediction accuracy was appeared when PCR were used (R2cv = 0.31 and RMSEcv= 2.48). The obtained results highlight the importance of multivariate calibration methods for biomass estimation when hyperspectral data are used.
A mutant screening method by critical annealing temperature-PCR for site-directed mutagenesis.
Liu, Ying; Wu, Ting; Song, Jian; Chen, Xuelian; Zhang, Yu; Wan, Yu
2013-03-11
Distinguishing desired mutants from parental templates and undesired mutants is a problem not well solved in Quikchange™ mutagenesis. Although Dpn I digestion can eliminate methylated parental (WT) DNA, the efficiency is not satisfying due to the existence of hemi-methylated DNA in the PCR products, which is resistant to Dpn I. The present study designed a novel critical annealing temperature (T(c))-PCR to replace Dpn I digestion for more perfect mutant distinguishing, in which part-overlapping primers containing mutation(s) were used to reduce initial concentration of template DNA in mutagenic PCR. A T(c)-PCR with the same mutagenic primers was performed without Dpn I digestion. The T(c) for each pair of the primers was identified by gradient PCR. The relationship between PCR-identified T(c) and T(m) of the primers was analyzed and modeled with correlation and regression. Gradient PCR identified a T(c) for each of 14 tested mutagenic primers, which could discriminate mismatched parental molecules and undesired mutants from desired mutants. The PCR-identified T(c) was correlated to the primer's T(m) (r = 0.804, P<0.0001). Thus, in practical applications, the T(c) can be easily calculated with a regression equation, T(c)= 48.81 + 0.253*T(m). The new protocol introduced a novel T(c)-PCR method for mutant screening which can more efficiently and accurately select against parental molecules and undesired mutations in mutagenic sequence segments.
Prediction of winter precipitation over northwest India using ocean heat fluxes
NASA Astrophysics Data System (ADS)
Nageswararao, M. M.; Mohanty, U. C.; Osuri, Krishna K.; Ramakrishna, S. S. V. S.
2016-10-01
The winter precipitation (December-February) over northwest India (NWI) is highly variable in terms of time and space. The maximum precipitation occurs over the Himalaya region and decreases towards south of NWI. The winter precipitation is important for water resources and agriculture sectors over the region and for the economy of the country. It is an exigent task to the scientific community to provide a seasonal outlook for the regional scale precipitation. The oceanic heat fluxes are known to have a strong linkage with the ocean and atmosphere. Henceforth, in this study, we obtained the relationship of NWI winter precipitation with total downward ocean heat fluxes at the global ocean surface, 15 regions with significant correlations are identified from August to November at 90 % confidence level. These strong relations encourage developing an empirical model for predicting winter precipitation over NWI. The multiple linear regression (MLR) and principal component regression (PCR) models are developed and evaluated using leave-one-out cross-validation. The developed regression models are able to predict the winter precipitation patterns over NWI with significant (99 % confidence level) index of agreement and correlations. Moreover, these models capture the signals of extremes, but could not reach the peaks (excess and deficit) of the observations. PCR performs better than MLR for predicting winter precipitation over NWI. Therefore, the total downward ocean heat fluxes at surface from August to November are having a significant impact on seasonal winter precipitation over the NWI. It concludes that these interrelationships are more useful for the development of empirical models and feasible to predict the winter precipitation over NWI with sufficient lead-time (in advance) for various risk management sectors.
Deriving Global Convection Maps From SuperDARN Measurements
NASA Astrophysics Data System (ADS)
Gjerloev, J. W.; Waters, C. L.; Barnes, R. J.
2018-04-01
A new statistical modeling technique for determining the global ionospheric convection is described. The principal component regression (PCR)-based technique is based on Super Dual Auroral Radar Network (SuperDARN) observations and is an advanced version of the PCR technique that Waters et al. (https//:doi.org.10.1002/2015JA021596) used for the SuperMAG data. While SuperMAG ground magnetic field perturbations are vector measurements, SuperDARN provides line-of-sight measurements of the ionospheric convection flow. Each line-of-sight flow has a known azimuth (or direction), which must be converted into the actual vector flow. However, the component perpendicular to the azimuth direction is unknown. Our method uses historical data from the SuperDARN database and PCR to determine a fill-in model convection distribution for any given universal time. The fill-in data process is driven by a list of state descriptors (magnetic indices and the solar zenith angle). The final solution is then derived from a spherical cap harmonic fit to the SuperDARN measurements and the fill-in model. When compared with the standard SuperDARN fill-in model, we find that our fill-in model provides improved solutions, and the final solutions are in better agreement with the SuperDARN measurements. Our solutions are far less dynamic than the standard SuperDARN solutions, which we interpret as being due to a lack of magnetosphere-ionosphere inertia and communication delays in the standard SuperDARN technique while it is inherently included in our approach. Rather, we argue that the magnetosphere-ionosphere system has inertia that prevents the global convection from changing abruptly in response to an interplanetary magnetic field change.
NASA Astrophysics Data System (ADS)
El-Kosasy, A. M.; Abdel-Aziz, Omar; Magdy, N.; El Zahar, N. M.
2016-03-01
New accurate, sensitive and selective spectrophotometric and chemometric methods were developed and subsequently validated for determination of Imipenem (IMP), ciprofloxacin hydrochloride (CIPRO), dexamethasone sodium phosphate (DEX), paracetamol (PAR) and cilastatin sodium (CIL) in human urine. These methods include a new derivative ratio method, namely extended derivative ratio (EDR), principal component regression (PCR) and partial least-squares (PLS) methods. A novel EDR method was developed for the determination of these drugs, where each component in the mixture was determined by using a mixture of the other four components as divisor. Peak amplitudes were recorded at 293.0 nm, 284.0 nm, 276.0 nm, 257.0 nm and 221.0 nm within linear concentration ranges 3.00-45.00, 1.00-15.00, 4.00-40.00, 1.50-25.00 and 4.00-50.00 μg mL- 1 for IMP, CIPRO, DEX, PAR and CIL, respectively. PCR and PLS-2 models were established for simultaneous determination of the studied drugs in the range of 3.00-15.00, 1.00-13.00, 4.00-12.00, 1.50-9.50, and 4.00-12.00 μg mL- 1 for IMP, CIPRO, DEX, PAR and CIL, respectively, by using eighteen mixtures as calibration set and seven mixtures as validation set. The suggested methods were validated according to the International Conference of Harmonization (ICH) guidelines and the results revealed that they were accurate, precise and reproducible. The obtained results were statistically compared with those of the published methods and there was no significant difference.
Beaver, A; Cazer, C L; Ruegg, P L; Gröhn, Y T; Schukken, Y H
2016-02-01
Mycobacterium avium ssp. paratuberculosis (MAP), the etiologic agent of Johne's disease in dairy cattle, may enter the bulk tank via environmental contamination or direct excretion into milk. Traditionally, diagnostics to identify MAP in milk target either MAP antibodies (by ELISA) or the organism itself (by culture or PCR). High ELISA titers may be directly associated with excretion of MAP into milk but only indirectly linked to environmental contamination of the bulk tank. Patterns of bulk-milk ELISA and bulk-milk PCR results could therefore provide insight into the routes of contamination and level of infection or environmental burden. Coupled with questionnaire responses pertaining to management, the results of these diagnostic tests could reveal correlations with herd characteristics or on-farm practices that distinguish herds with high and low environmental bulk-tank MAP contamination. A questionnaire on hygiene, management, and Johne's specific parameters was administered to 292 dairy farms in New York, Oregon, and Wisconsin. Bulk-tank samples were collected from each farm for evaluation by real-time PCR and ELISA. Before DNA extraction and testing of the unknown samples, bulk-milk template preparation was optimized with respect to parameters such as MAP fractionation patterns and lysis. Two regression models were developed to explore the relationships among bulk-tank PCR, ELISA, environmental predictors, and herd characteristics. First, ELISA optical density (OD) was designated as the outcome in a linear regression model. Second, the log odds of being PCR positive in the bulk tank were modeled using binary logistic regression with penalized maximum likelihood. The proportion of PCR-positive bulk tanks was highest for New York and for organic farms, providing a clue as to the geographical patterns of MAP-positive bulk-tank samples and relationship to production type. Bulk-milk PCR positivity was also higher for large relative to small herds. The models revealed that bulk-milk PCR result could predict ELISA OD, with PCR-positive results corresponding to high bulk-milk ELISA titers. Similarly, ELISA was a predictor of PCR result, although the association was stronger for organic farms. Despite agreement between high bulk-milk ELISA titers and positive PCR results, a large proportion of high ELISA farms had PCR-negative bulk tanks, suggesting that farms are able to maintain satisfactory hygiene and management despite a presence of MAP in these herds. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Mai, W.; Zhang, J.-F.; Zhao, X.-M.; Li, Z.; Xu, Z.-W.
2017-11-01
Wastewater from the dye industry is typically analyzed using a standard method for measurement of chemical oxygen demand (COD) or by a single-wavelength spectroscopic method. To overcome the disadvantages of these methods, ultraviolet-visible (UV-Vis) spectroscopy was combined with principal component regression (PCR) and partial least squares regression (PLSR) in this study. Unlike the standard method, this method does not require digestion of the samples for preparation. Experiments showed that the PLSR model offered high prediction performance for COD, with a mean relative error of about 5% for two dyes. This error is similar to that obtained with the standard method. In this study, the precision of the PLSR model decreased with the number of dye compounds present. It is likely that multiple models will be required in reality, and the complexity of a COD monitoring system would be greatly reduced if the PLSR model is used because it can include several dyes. UV-Vis spectroscopy with PLSR successfully enhanced the performance of COD prediction for dye wastewater and showed good potential for application in on-line water quality monitoring.
Principal component regression analysis with SPSS.
Liu, R X; Kuang, J; Gong, Q; Hou, X L
2003-06-01
The paper introduces all indices of multicollinearity diagnoses, the basic principle of principal component regression and determination of 'best' equation method. The paper uses an example to describe how to do principal component regression analysis with SPSS 10.0: including all calculating processes of the principal component regression and all operations of linear regression, factor analysis, descriptives, compute variable and bivariate correlations procedures in SPSS 10.0. The principal component regression analysis can be used to overcome disturbance of the multicollinearity. The simplified, speeded up and accurate statistical effect is reached through the principal component regression analysis with SPSS.
Bai, Yalong; Cui, Yan; Paoli, George C; Shi, Chunlei; Wang, Dapeng; Shi, Xianming
2015-06-24
Nanomaterials have been widely reported to affect the polymerase chain reaction (PCR). However, many studies in which these effects were observed were not comprehensive, and many of the proposed mechanisms have been primarily speculative. In this work, we used amino-modified silica-coated magnetic nanoparticles (ASMNPs, which can be collected very easily using an external magnetic field) as a model and compared them with gold nanoparticles (AuNPs, which have been studied extensively) to reveal the mechanisms by which nanoparticles affect PCR. We found that nanoparticles affect PCR primarily by binding to PCR components: (1) inhibition, (2) specifity, and (3) efficiency and yield of PCR are impacted. (1) Excess nanomaterials inhibit PCR by adsorbing to DNA polymerase, Mg(2+), oligonucleotide primers, or DNA templates. Nanoparticle surface-active groups are particularly important to this effect. (2, a) Nanomaterials do not inhibit nonspecific amplification products caused by false priming as previously surmised. It was shown that relatively low concentrations of nanoparticles inhibited the amplification of long amplicons, and increasing the amount of nanoparticles inhibited the amplification of short amplicons. This concentration phenomenon appears to be the result of the formation of "joints" upon the adsorption of ASMNPs to DNA templates. (b) Nanomaterials are able to inhibit nonspecific amplification products due to incomplete amplification by preferably adsorbing single-stranded incomplete amplification products. (3) Some types of nanomaterials, such as AuNPs, enhance the efficiency and yield of PCR because these types of nanoparticles can adsorb to single-stranded DNA more strongly than to double-stranded DNA. This behavior assists in the rapid and thorough denaturation of double-stranded DNA templates. Therefore, the interaction between the surface of nanoparticles and PCR components is sufficient to explain most of the effects of nanoparticles on PCR.
Statistical tools for transgene copy number estimation based on real-time PCR.
Yuan, Joshua S; Burris, Jason; Stewart, Nathan R; Mentewab, Ayalew; Stewart, C Neal
2007-11-01
As compared with traditional transgene copy number detection technologies such as Southern blot analysis, real-time PCR provides a fast, inexpensive and high-throughput alternative. However, the real-time PCR based transgene copy number estimation tends to be ambiguous and subjective stemming from the lack of proper statistical analysis and data quality control to render a reliable estimation of copy number with a prediction value. Despite the recent progresses in statistical analysis of real-time PCR, few publications have integrated these advancements in real-time PCR based transgene copy number determination. Three experimental designs and four data quality control integrated statistical models are presented. For the first method, external calibration curves are established for the transgene based on serially-diluted templates. The Ct number from a control transgenic event and putative transgenic event are compared to derive the transgene copy number or zygosity estimation. Simple linear regression and two group T-test procedures were combined to model the data from this design. For the second experimental design, standard curves were generated for both an internal reference gene and the transgene, and the copy number of transgene was compared with that of internal reference gene. Multiple regression models and ANOVA models can be employed to analyze the data and perform quality control for this approach. In the third experimental design, transgene copy number is compared with reference gene without a standard curve, but rather, is based directly on fluorescence data. Two different multiple regression models were proposed to analyze the data based on two different approaches of amplification efficiency integration. Our results highlight the importance of proper statistical treatment and quality control integration in real-time PCR-based transgene copy number determination. These statistical methods allow the real-time PCR-based transgene copy number estimation to be more reliable and precise with a proper statistical estimation. Proper confidence intervals are necessary for unambiguous prediction of trangene copy number. The four different statistical methods are compared for their advantages and disadvantages. Moreover, the statistical methods can also be applied for other real-time PCR-based quantification assays including transfection efficiency analysis and pathogen quantification.
NASA Astrophysics Data System (ADS)
Tewari, Jagdish; Strong, Richard; Boulas, Pierre
2017-02-01
This article summarizes the development and validation of a Fourier transform near infrared spectroscopy (FT-NIR) method for the rapid at-line prediction of active pharmaceutical ingredient (API) in a powder blend to optimize small molecule formulations. The method was used to determine the blend uniformity end-point for a pharmaceutical solid dosage formulation containing a range of API concentrations. A set of calibration spectra from samples with concentrations ranging from 1% to 15% of API (w/w) were collected at-line from 4000 to 12,500 cm- 1. The ability of the FT-NIR method to predict API concentration in the blend samples was validated against a reference high performance liquid chromatography (HPLC) method. The prediction efficiency of four different types of multivariate data modeling methods such as partial least-squares 1 (PLS1), partial least-squares 2 (PLS2), principal component regression (PCR) and artificial neural network (ANN), were compared using relevant multivariate figures of merit. The prediction ability of the regression models were cross validated against results generated with the reference HPLC method. PLS1 and ANN showed excellent and superior prediction abilities when compared to PLS2 and PCR. Based upon these results and because of its decreased complexity compared to ANN, PLS1 was selected as the best chemometric method to predict blend uniformity at-line. The FT-NIR measurement and the associated chemometric analysis were implemented in the production environment for rapid at-line determination of the end-point of the small molecule blending operation. FIGURE 1: Correlation coefficient vs Rank plot FIGURE 2: FT-NIR spectra of different steps of Blend and final blend FIGURE 3: Predictions ability of PCR FIGURE 4: Blend uniformity predication ability of PLS2 FIGURE 5: Prediction efficiency of blend uniformity using ANN FIGURE 6: Comparison of prediction efficiency of chemometric models TABLE 1: Order of Addition for Blending Steps
Error minimization algorithm for comparative quantitative PCR analysis: Q-Anal.
OConnor, William; Runquist, Elizabeth A
2008-07-01
Current methods for comparative quantitative polymerase chain reaction (qPCR) analysis, the threshold and extrapolation methods, either make assumptions about PCR efficiency that require an arbitrary threshold selection process or extrapolate to estimate relative levels of messenger RNA (mRNA) transcripts. Here we describe an algorithm, Q-Anal, that blends elements from current methods to by-pass assumptions regarding PCR efficiency and improve the threshold selection process to minimize error in comparative qPCR analysis. This algorithm uses iterative linear regression to identify the exponential phase for both target and reference amplicons and then selects, by minimizing linear regression error, a fluorescence threshold where efficiencies for both amplicons have been defined. From this defined fluorescence threshold, cycle time (Ct) and the error for both amplicons are calculated and used to determine the expression ratio. Ratios in complementary DNA (cDNA) dilution assays from qPCR data were analyzed by the Q-Anal method and compared with the threshold method and an extrapolation method. Dilution ratios determined by the Q-Anal and threshold methods were 86 to 118% of the expected cDNA ratios, but relative errors for the Q-Anal method were 4 to 10% in comparison with 4 to 34% for the threshold method. In contrast, ratios determined by an extrapolation method were 32 to 242% of the expected cDNA ratios, with relative errors of 67 to 193%. Q-Anal will be a valuable and quick method for minimizing error in comparative qPCR analysis.
Riahi, Siavash; Hadiloo, Farshad; Milani, Seyed Mohammad R; Davarkhah, Nazila; Ganjali, Mohammad R; Norouzi, Parviz; Seyfi, Payam
2011-05-01
The accuracy in predicting different chemometric methods was compared when applied on ordinary UV spectra and first order derivative spectra. Principal component regression (PCR) and partial least squares with one dependent variable (PLS1) and two dependent variables (PLS2) were applied on spectral data of pharmaceutical formula containing pseudoephedrine (PDP) and guaifenesin (GFN). The ability to derivative in resolved overlapping spectra chloropheniramine maleate was evaluated when multivariate methods are adopted for analysis of two component mixtures without using any chemical pretreatment. The chemometrics models were tested on an external validation dataset and finally applied to the analysis of pharmaceuticals. Significant advantages were found in analysis of the real samples when the calibration models from derivative spectra were used. It should also be mentioned that the proposed method is a simple and rapid way requiring no preliminary separation steps and can be used easily for the analysis of these compounds, especially in quality control laboratories. Copyright © 2011 John Wiley & Sons, Ltd.
Predictive Validity of National Basketball Association Draft Combine on Future Performance.
Teramoto, Masaru; Cross, Chad L; Rieger, Randall H; Maak, Travis G; Willick, Stuart E
2018-02-01
Teramoto, M, Cross, CL, Rieger, RH, Maak, TG, and Willick, SE. Predictive validity of national basketball association draft combine on future performance. J Strength Cond Res 32(2): 396-408, 2018-The National Basketball Association (NBA) Draft Combine is an annual event where prospective players are evaluated in terms of their athletic abilities and basketball skills. Data collected at the Combine should help NBA teams select right the players for the upcoming NBA draft; however, its value for predicting future performance of players has not been examined. This study investigated predictive validity of the NBA Draft Combine on future performance of basketball players. We performed a principal component analysis (PCA) on the 2010-2015 Combine data to reduce correlated variables (N = 234), a correlation analysis on the Combine data and future on-court performance to examine relationships (maximum pairwise N = 217), and a robust principal component regression (PCR) analysis to predict first-year and 3-year on-court performance from the Combine measures (N = 148 and 127, respectively). Three components were identified within the Combine data through PCA (= Combine subscales): length-size, power-quickness, and upper-body strength. As per the correlation analysis, the individual Combine items for anthropometrics, including height without shoes, standing reach, weight, wingspan, and hand length, as well as the Combine subscale of length-size, had positive, medium-to-large-sized correlations (r = 0.313-0.545) with defensive performance quantified by Defensive Box Plus/Minus. The robust PCR analysis showed that the Combine subscale of length-size was a predictor most significantly associated with future on-court performance (p ≤ 0.05), including Win Shares, Box Plus/Minus, and Value Over Replacement Player, followed by upper-body strength. In conclusion, the NBA Draft Combine has value for predicting future performance of players.
NASA Astrophysics Data System (ADS)
Pérez-Rodríguez, Marta; Horák-Terra, Ingrid; Rodríguez-Lado, Luis; Martínez Cortizas, Antonio
2016-11-01
Despite its potential, infrared spectroscopy combined with multivariate statistics has been seldom used to model peat properties with environmental value, such us the concentration of potentially toxic metals. In this research, we applied attenuated total reflectance (ATR) Fourier-Transform Infrared (FTIR) spectroscopy to evaluate the ability of the technique to predict mercury concentrations in late-Pleistocene/Holocene peat from a minerogenic peatland from Minas Gerais (Brazil). Mercury concentrations were analysed using a Milestone DMA-80 analyzer and attenuated total reflectance FTIR-ATR was performed using a Gladi-ATR (Pike Technologies) in the mid IR spectrum (4000-400 cm- 1). Concentrations were modelled using principal components (PCR) and partial least squares regression (PLS). The performance of the models varied between moderate and very good (R2 0.67-0.90), with low RMSD values (0.35-1.06). A PLS model based on three latent vectors (LV1 to LV3) provided the best (R2 0.90, RMSD 0.35) results. LV1 reflected total organic matter content versus mineral matter (mainly quartz from local fluxes), LV2 was related to dust deposition from regional sources, and LV3 reflected peat organic matter decomposition. Compared to a previous investigation based on geochemical data, the spectroscopy-based PLS model performed better, but it has to be complemented with additional data (as δ13 C ratios) to reliably reproduce the changes of the factors controlling mercury accumulation over time. This, time- and cost-effective, methodology may help to develop multi-core approaches to study the within and between mire (of a similar type and area) variability in mercury accumulation, and probably also other peat properties. Fig. S2 Loadings weights of the three and two significant components from the direct (dPCR) and transposed (trPCR) PCR models. Fig. S3 Depth records of the cumulative effects of the factors involved in the variation of mercury concentrations. Left, MIR-PLS model; centre, MIR-PLS + δ13 C data model; right, geochemical model from Pérez-Rodríguez et al. [44].
Paternò, Annalisa; Marchesi, Ugo; Gatto, Francesco; Verginelli, Daniela; Quarchioni, Cinzia; Fusco, Cristiana; Zepparoni, Alessia; Amaddeo, Demetrio; Ciabatti, Ilaria
2009-12-09
The comparison of five real-time polymerase chain reaction (PCR) methods targeted at maize ( Zea mays ) endogenous sequences is reported. PCR targets were the alcohol dehydrogenase (adh) gene for three methods and high-mobility group (hmg) gene for the other two. The five real-time PCR methods have been checked under repeatability conditions at several dilution levels on both pooled DNA template from several genetically modified (GM) maize certified reference materials (CRMs) and single CRM DNA extracts. Slopes and R(2) coefficients of all of the curves obtained from the adopted regression model were compared within the same method and among all of the five methods, and the limit of detection and limit of quantitation were analyzed for each PCR system. Furthermore, method equivalency was evaluated on the basis of the ability to estimate the target haploid genome copy number at each concentration level. Results indicated that, among the five methods tested, one of the hmg-targeted PCR systems can be considered equivalent to the others but shows the best regression parameters and a higher repeteability along the dilution range. Thereby, it is proposed as a valid module to be coupled to different event-specific real-time PCR for maize genetically modified organism (GMO) quantitation. The resulting practicability improvement on the analytical control of GMOs is discussed.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Koh, Chung-Yan; Light, Yooli Kim; Piccini, Matthew Ernest
Embodiments of the present invention are directed toward devices, systems, and methods for purifying nucleic acids to conduct polymerase chain reaction (PCR) assays. In one example, a method includes generating complexes of silica beads and nucleic acids in a lysis buffer, transporting the complexes through an immiscible fluid to remove interfering compounds from the complexes, further transporting the complexes into a density medium containing components required for PCR where the nucleic acids disassociate from the silica beads, and thermocycling the contents of the density medium to achieve PCR. Signal may be detected from labeling agents in the components required formore » PCR.« less
ERIC Educational Resources Information Center
Mugrage, Beverly; And Others
Three ridge regression solutions are compared with ordinary least squares regression and with principal components regression using all components. Ridge regression, particularly the Lawless-Wang solution, out-performed ordinary least squares regression and the principal components solution on the criteria of stability of coefficient and closeness…
Liu, Qi; Wu, Youcong; Yuan, Youhua; Bai, Li; Niu, Kun
2011-12-01
To research the relationship between the virulence factors of Saccharomyces albicans (S. albicans) and the random amplified polymorphic DNA (RAPD) bands of them, and establish the regression model by multiple regression analysis. Extracellular phospholipase, secreted proteinase, ability to generate germ tubes and adhere to oral mucosal cells of 92 strains of S. albicans were measured in vitro; RAPD-polymerase chain reaction (RAPD-PCR) was used to get their bands. Multiple regression for virulence factors of S. albicans and RAPD-PCR bands was established. The extracellular phospholipase activity was associated with 4 RAPD bands: 350, 450, 650 and 1 300 bp (P < 0.05); secreted proteinase activity of S. albicans was associated with 2 bands: 350 and 1 200 bp (P < 0.05); the ability of germ tube produce was associated with 2 bands: 400 and 550 bp (P < 0.05). Some RAPD bands will reflect the virulence factors of S. albicans indirectly. These bands would contain some important messages for regulation of S. albicans virulence factors.
Shibata, Tomoyuki; Solo-Gabriele, Helena M; Sinigalliano, Christopher D; Gidley, Maribeth L; Plano, Lisa R W; Fleisher, Jay M; Wang, John D; Elmir, Samir M; He, Guoqing; Wright, Mary E; Abdelzaher, Amir M; Ortega, Cristina; Wanless, David; Garza, Anna C; Kish, Jonathan; Scott, Troy; Hollenbeck, Julie; Backer, Lorraine C; Fleming, Lora E
2010-11-01
The objectives of this work were to compare enterococci (ENT) measurements based on the membrane filter, ENT(MF) with alternatives that can provide faster results including alternative enterococci methods (e.g., chromogenic substrate (CS), and quantitative polymerase chain reaction (qPCR)), and results from regression models based upon environmental parameters that can be measured in real-time. ENT(MF) were also compared to source tracking markers (Staphylococcus aureus, Bacteroidales human and dog markers, and Catellicoccus gull marker) in an effort to interpret the variability of the signal. Results showed that concentrations of enterococci based upon MF (<2 to 3320 CFU/100 mL) were significantly different from the CS and qPCR methods (p < 0.01). The correlations between MF and CS (r = 0.58, p < 0.01) were stronger than between MF and qPCR (r ≤ 0.36, p < 0.01). Enterococci levels by MF, CS, and qPCR methods were positively correlated with turbidity and tidal height. Enterococci by MF and CS were also inversely correlated with solar radiation but enterococci by qPCR was not. The regression model based on environmental variables provided fair qualitative predictions of enterococci by MF in real-time, for daily geometric mean levels, but not for individual samples. Overall, ENT(MF) was not significantly correlated with source tracking markers with the exception of samples collected during one storm event. The inability of the regression model to predict ENT(MF) levels for individual samples is likely due to the different sources of ENT impacting the beach at any given time, making it particularly difficult to to predict short-term variability of ENT(MF) for environmental parameters.
Principal Component Analysis for Enhancement of Infrared Spectra Monitoring
NASA Astrophysics Data System (ADS)
Haney, Ricky Lance
The issue of air quality within the aircraft cabin is receiving increasing attention from both pilot and flight attendant unions. This is due to exposure events caused by poor air quality that in some cases may have contained toxic oil components due to bleed air that flows from outside the aircraft and then through the engines into the aircraft cabin. Significant short and long-term medical issues for aircraft crew have been attributed to exposure. The need for air quality monitoring is especially evident in the fact that currently within an aircraft there are no sensors to monitor the air quality and potentially harmful gas levels (detect-to-warn sensors), much less systems to monitor and purify the air (detect-to-treat sensors) within the aircraft cabin. The specific purpose of this research is to utilize a mathematical technique called principal component analysis (PCA) in conjunction with principal component regression (PCR) and proportionality constant calculations (PCC) to simplify complex, multi-component infrared (IR) spectra data sets into a reduced data set used for determination of the concentrations of the individual components. Use of PCA can significantly simplify data analysis as well as improve the ability to determine concentrations of individual target species in gas mixtures where significant band overlap occurs in the IR spectrum region. Application of this analytical numerical technique to IR spectrum analysis is important in improving performance of commercial sensors that airlines and aircraft manufacturers could potentially use in an aircraft cabin environment for multi-gas component monitoring. The approach of this research is two-fold, consisting of a PCA application to compare simulation and experimental results with the corresponding PCR and PCC to determine quantitatively the component concentrations within a mixture. The experimental data sets consist of both two and three component systems that could potentially be present as air contaminants in an aircraft cabin. In addition, experimental data sets are analyzed for a hydrogen peroxide (H2O2) aqueous solution mixture to determine H2O2 concentrations at various levels that could be produced during use of a vapor phase hydrogen peroxide (VPHP) decontamination system. After the PCA application to two and three component systems, the analysis technique is further expanded to include the monitoring of potential bleed air contaminants from engine oil combustion. Simulation data sets created from database spectra were utilized to predict gas components and concentrations in unknown engine oil samples at high temperatures as well as time-evolved gases from the heating of engine oils.
Shan, Si-Ming; Luo, Jian-Guang; Huang, Fang; Kong, Ling-Yi
2014-02-01
Panax ginseng C.A. Meyer has been known as a valuable traditional Chinese medicines for thousands years of history. Ginsenosides, the main active constituents, exhibit prominent immunoregulation effect. The present study first describes a holistic method based on chemical characteristic and lymphocyte proliferative capacity to evaluate systematically the quality of P. ginseng in thirty samples from different seasons during 2-6 years. The HPLC fingerprints were evaluated using principle component analysis (PCA) and hierarchical clustering analysis (HCA). The spectrum-efficacy model between HPLC fingerprints and T-lymphocyte proliferative activities was investigated by principal component regression (PCR) and partial least squares (PLS). The results indicated that the growth of the ginsenosides could be grouped into three periods and from August of the fifth year, P. ginseng appeared significant lymphocyte proliferative capacity. Close correlation existed between the spectrum-efficacy relationship and ginsenosides Rb1, Ro, Rc, Rb2 and Re were the main contributive components to the lymphocyte proliferative capacity. This comprehensive strategy, providing reliable and adequate scientific evidence, could be applied to other TCMs to ameliorate their quality control. Copyright © 2013 Elsevier B.V. All rights reserved.
Electrochemiluminescence-PCR detection of genetically modified organisms
NASA Astrophysics Data System (ADS)
Liu, Jinfeng; Xing, Da; Shen, Xingyan; Zhu, Debin
2005-01-01
The detection methods for genetically modified (GM) components in foods have been developed recently. But many of them are complicated and time-consuming; some of them need to use the carcinogenic substance, and can"t avoid false-positive results. In this study, an electrochemiluminescence polymerase chain reaction (ECL-PCR) method for detection GM tobaccos is proposed. The Cauliflower mosaic virus 35S (CaMV35S) promoter was amplified by PCR, Then hybridized with a Ru(bpy)32+ (TBR)-labeled and a biotinylated probe. The hybridization products were captured onto streptavidin-coated paramagnetic beads, and detected by measuring the electrochemiluminescence (ECL) signal of the TBR label. Whether the tobaccos contain GM components was discriminated by detecting the ECL signal of CaMV35S promoter. The experiment results show that the detection limit for CaMV35S promoter is 100 fmol, and the GM components can be clearly identified in GM tobaccos. The ECL-PCR method provide a new means in GMOs detection due to its safety, simplicity and high efficiency.
Improved Quantitative Analysis of Ion Mobility Spectrometry by Chemometric Multivariate Calibration
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fraga, Carlos G.; Kerr, Dayle; Atkinson, David A.
2009-09-01
Traditional peak-area calibration and the multivariate calibration methods of principle component regression (PCR) and partial least squares (PLS), including unfolded PLS (U-PLS) and multi-way PLS (N-PLS), were evaluated for the quantification of 2,4,6-trinitrotoluene (TNT) and cyclo-1,3,5-trimethylene-2,4,6-trinitramine (RDX) in Composition B samples analyzed by temperature step desorption ion mobility spectrometry (TSD-IMS). The true TNT and RDX concentrations of eight Composition B samples were determined by high performance liquid chromatography with UV absorbance detection. Most of the Composition B samples were found to have distinct TNT and RDX concentrations. Applying PCR and PLS on the exact same IMS spectra used for themore » peak-area study improved quantitative accuracy and precision approximately 3 to 5 fold and 2 to 4 fold, respectively. This in turn improved the probability of correctly identifying Composition B samples based upon the estimated RDX and TNT concentrations from 11% with peak area to 44% and 89% with PLS. This improvement increases the potential of obtaining forensic information from IMS analyzers by providing some ability to differentiate or match Composition B samples based on their TNT and RDX concentrations.« less
Attia, Khalid A M; El-Abasawi, Nasr M; El-Olemy, Ahmed; Abdelazim, Ahmed H
2018-03-01
Three UV spectrophotometric methods have been developed for the simultaneous determination of two new Food and Drug Administration-approved drugs, elbasvir (EBV) and grazoprevir (GRV), in their combined pharmaceutical dosage form. These methods include dual wavelength (DW), classic least-squares (CLS), and principal component regression (PCR). To achieve the DW method, two wavelengths were chosen for each drug in a way to ensure the difference in absorbance was zero from one drug to the other. GRV revealed equal absorbance at 351 and 315 nm, for which the distinctions in absorbance were measured for the determination of EBV. In the same way, distinctions in absorbance at 375 and 334.5 nm were measured for the determination of GRV. Alternatively, the CLS and PCR models were applied to the spectra analysis because the synchronous inclusion of many unreal wavelengths rather than using a single wavelength greatly increased the precision and predictive ability of the methods. The proposed methods were successfully applied to the assay of these drugs in their pharmaceutical formulation. The obtained results were statistically compared with manufacturing methods. The results conclude that there was no significant difference between the proposed methods and the manufacturing method with respect to accuracy and precision.
NASA Astrophysics Data System (ADS)
Saad, Ahmed S.; Hamdy, Abdallah M.; Salama, Fathy M.; Abdelkawy, Mohamed
2016-10-01
Effect of data manipulation in preprocessing step proceeding construction of chemometric models was assessed. The same set of UV spectral data was used for construction of PLS and PCR models directly and after mathematically manipulation as per well known first and second derivatives of the absorption spectra, ratio spectra and first and second derivatives of the ratio spectra spectrophotometric methods, meanwhile the optimal working wavelength ranges were carefully selected for each model and the models were constructed. Unexpectedly, number of latent variables used for models' construction varied among the different methods. The prediction power of the different models was compared using a validation set of 8 mixtures prepared as per the multilevel multifactor design and results were statistically compared using two-way ANOVA test. Root mean squares error of prediction (RMSEP) was used for further comparison of the predictability among different constructed models. Although no significant difference was found between results obtained using Partial Least Squares (PLS) and Principal Component Regression (PCR) models, however, discrepancies among results was found to be attributed to the variation in the discrimination power of adopted spectrophotometric methods on spectral data.
Balne, Praveen Kumar; Modi, Rohit Ramesh; Choudhury, Nuzhat; Mohan, Neha; Barik, Manas Ranjan; Padhi, Tapas Ranjan; Sharma, Savitri; Panigrahi, Satya Ranjan; Basu, Soumyava
2014-03-25
Polymerase chain reaction (PCR) assay can be a useful method for definitive diagnosis in paucibacillary infections such as ocular tuberculosis (TB). In this study, we have evaluated factors affecting PCR outcomes in patients with clinically suspected ocular TB. Patients with clinically suspected ocular TB were investigated by PCR of aqueous or vitreous samples. Three control groups were also tested: group 1 included culture-proven non-tuberculous endophthalmitis, group 2 culture-negative non-tuberculous endophthalmitis, and group 3 patients undergoing surgery for uncomplicated cataract. PCR targeted one or more of following targets: IS6110, MPB64, and protein b genes of Mycobacterium tuberculosis complex. Multiple regression analysis (5% level of significance) was done to evaluate the associations between positive PCR outcome and laterality of disease, tuberculin skin test (TST)/interferon-gamma release assay (IGRA), chest radiography, and type of sample (aqueous or vitreous). The main outcome measures were positive PCR by one or more gene targets, and factors influencing positive PCR outcomes. All 114 samples were tested for MPB64, 110 for protein b, and 88 for IS6110. MPB64 was positive in 70.2% (n = 80) of tested samples, protein b in 40.0% (n = 44), and IS6110 in only 9.1% (n = 8). DNA sequencing of amplicons from four randomly chosen PCR reactions showed homology for M. tuberculosis complex. Of the 80 PCR-positive patients, 71 completed a full course of antitubercular therapy, of which 65 patients (91.5%) had complete resolution of inflammation at final follow-up. Among controls, 12.5% (3 out of 24) in group 1 and 18.7% (6 out of 32) in group 2 also tested positive by PCR. No PCR-positive outcome was observed in control group 3 (n = 25). Multiple regression analysis revealed significant association of positive PCR outcome with bilateral presentation, but not with a positive TST/IGRA, chest radiography, or type of sample (aqueous/vitreous) used. Careful selection of gene targets can yield high PCR positivity in clinically suspected ocular TB. Bilateral disease presentation but not any evidence of latent systemic TB influences PCR outcomes. False-positive results may be seen in ocular inflammation unrelated to ocular TB.
NASA Astrophysics Data System (ADS)
Barrett, Hannah G.; Jones, Julie M.; Bigg, Grant R.
2018-02-01
The meteorological information found within ships' logbooks is a unique and fascinating source of data for historical climatology. This study uses wind observations from logbooks covering the period 1815 to 1854 to reconstruct an index of El Niño Southern Oscillation (ENSO) for boreal winter (DJF). Statistically-based reconstructions of the Southern Oscillation Index (SOI) are obtained using two methods: principal component regression (PCR) and composite-plus-scale (CPS). Calibration and validation are carried out over the modern period 1979-2014, assessing the relationship between re-gridded seasonal ERA-Interim reanalysis wind data and the instrumental SOI. The reconstruction skill of both the PCR and CPS methods is found to be high with reduction of error skill scores of 0.80 and 0.75, respectively. The relationships derived during the fitting period are then applied to the logbook wind data to reconstruct the historical SOI. We develop a new method to assess the sensitivity of the reconstructions to using a limited number of observations per season and find that the CPS method performs better than PCR with a limited number of observations. A difference in the distribution of wind force terms used by British and Dutch ships is found, and its impact on the reconstruction assessed. The logbook reconstructions agree well with a previous SOI reconstructed from Jakarta rain day counts, 1830-1850, adding robustness to our reconstructions. Comparisons to additional documentary and proxy data sources are provided in a companion paper.
Karacan, Elif; Cağlayan, Mehmet Gokhan; Palabiyik, Ismail Murat; Onur, Feyyaz
2011-01-01
A new RP-LC method and two new spectrophotometric methods, principal component regression (PCR) and first derivative spectrophotometry, are proposed for simultaneous determination of diflucortolone valerate (DIF) and isoconazole nitrate (ISO) in cream formulations. An isocratic system consisting of an ACE C18 column and a mobile phase composed of methanol-water (95 + 5, v/v) was used for the optimal chromatographic separation. In PCR, the concentration data matrix was prepared by using synthetic mixtures containing these drugs in methanol-water (3 + 1, v/v). The absorbance data matrix corresponding to the concentration data matrix was obtained by measuring the absorbances at 29 wavelengths in the range of 242-298 nm for DIF and ISO in the zero-order spectra of their combinations. In first derivative spectrophotometry, dA/dlambda values were measured at 247.8 nm for DIF and at 240.2 nm for ISO in first derivative spectra of the solution of DIF and ISO in methanol-water (3 + 1, v/v). The linear ranges were 4.00-48.0 microg/mL for DIF and 50.0-400 microg/mL for ISO in the LC method, and 2.40-40.0 microg/mL for DIF and 60.0-260 microg/mL for ISO in the PCR and first derivative spectrophotometric methods. These methods were validated by analyzing synthetic mixtures. These three methods were successfully applied to two pharmaceutical cream preparations.
Li, Xiaozhou; Yang, Tianyue; Li, Caesar Siqi; Song, Youtao; Lou, Hong; Guan, Dagang; Jin, Lili
2018-01-01
In this paper, we discuss the use of a procedure based on polymerase chain reaction (PCR) and surface enhanced Raman spectroscopy (SERS) (PCR-SERS) to detect DNA mutations. Methods: This method was implemented by first amplifying DNA-containing target mutations, then by annealing probes, and finally by applying SERS detection. The obtained SERS spectra were from a mixture of fluorescence tags labeled to complementary sequences on the mutant DNA. Then, the SERS spectra of multiple tags were decomposed to component tag spectra by multiple linear regression (MLR). Results: The detection limit was 10-11 M with a coefficient of determination (R2) of 0.88. To demonstrate the applicability of this process on real samples, the PCR-SERS method was applied on blood plasma taken from 49 colorectal cancer patients to detect six mutations located at the BRAF, KRAS, and PIK3CA genes. The mutation rates obtained by the PCR-SERS method were in concordance with previous research. Fisher's exact test showed that only two detected mutations at BRAF (V600E) and PIK3CA (E542K) were significantly positively correlated with right-sided colon cancer. No other clinical feature such as gender, age, cancer stage, or differentiation was correlated with mutation (V600E at BRAF, G12C, G12D, G12V, G13D at KRAS, and E542K at PIK3CA). Visually, a dendrogram drawn through hierarchical clustering analysis (HCA) supported the results of Fisher's exact test. The clusters drawn by all six mutations did not conform to the distributions of cancer stages, differentiation or cancer positions. However, the cluster drawn by the two mutations of V600E and E542K showed that all samples with those mutations belonged to the right-sided colon cancer group. Conclusion: The suggested PCR-SERS method is multiplexed, flexible in probe design, easy to incorporate into existing PCR conditions, and was sensitive enough to detect mutations in blood plasma. PMID:29556349
USDA-ARS?s Scientific Manuscript database
Selective principal component regression analysis (SPCR) uses a subset of the original image bands for principal component transformation and regression. For optimal band selection before the transformation, this paper used genetic algorithms (GA). In this case, the GA process used the regression co...
Enumeration of verocytotoxigenic Escherichia coli (VTEC) O157 and O26 in milk by quantitative PCR.
Mancusi, Rocco; Trevisani, Marcello
2014-08-01
Quantitative real-time polymerase chain reaction (qPCR) can be a convenient alternative to the Most Probable Number (MPN) methods to count VTEC in milk. The number of VTEC is normally very low in milk; therefore with the aim of increasing the method sensitivity a qPCR protocol that relies on preliminary enrichment was developed. The growth pattern of six VTEC strains (serogroups O157 and O26) was studied using enrichment in Buffered Peptone Water (BPW) with or without acriflavine for 4-24h. Milk samples were inoculated with these strains over a five Log concentration range between 0.24-0.50 and 4.24-4.50 Log CFU/ml. DNA was extracted from the enriched samples in duplicate and each extract was analysed in duplicate by qPCR using pairs of primers specific for the serogroups O157 and O26. When samples were pre-enriched in BPW at 37°C for 8h, the relationship between threshold cycles (CT values) and VTEC Log numbers was linear over a five Log concentration range. The regression of PCR threshold cycle numbers on VTEC Log CFU/ml had a slope coefficient equal to -3.10 (R(2)=0.96) which is indicative of a 10-fold difference of the gene copy numbers between samples (with a 100 ± 10% PCR efficiency). The same 10-fold proportion used for inoculating the milk samples with VTEC was observed, therefore, also in the enriched samples at 8h. A comparison of the CT values of milk samples and controls revealed that the strains inoculated in milk grew with 3 Log increments in the 8h enrichment period. Regression lines that fitted the qPCR and MPN data revealed that the error of the qPCR estimates is lower than the error of the estimated MPN (r=0.982, R(2)=0.965 vs. r=0.967, R(2)=0.935). The growth rates of VTEC strains isolated from milk should be comparatively assessed before qPCR estimates based on the regression model are considered valid. Comparative assessment of the growth rates can be done using spectrophotometric measurements of standardized cultures of isolates and reference strains cultured in BPW at 37°C for 8h. The method developed for the serogroups O157 and O26 can be easily adapted to the other VTEC serogroups that are relevant for human health. The qPCR method is less laborious and faster than the standard MPN method and has been shown to be a good technique for quantifying VTEC in milk. Copyright © 2014 Elsevier B.V. All rights reserved.
Elbeik, Tarek; Dalessandro, Ralph; Loftus, Richard A; Beringer, Scott
2007-11-01
Comparative cost models were developed to assess cost-per-reportable result and annual costs for HIV-1 and HCV bDNA and AmpliPrep/TaqMan Test (PCR). Model cost components included kit, disposables, platform and related equipment, equipment service plan, equipment maintenance, equipment footprint, waste and labor. Model assessment was most cost-effective when run by bDNA with 36 or more clinical samples and PCR with 30 or fewer clinical samples. Lower costs are attained with maximum samples (84-168) run daily. Highest cost contributors include kit, platform and PCR proprietary disposables. Understanding component costs and the most economic use of HIV-1 and HCV viral load will aid in attaining lowest costs through selection of the appropriate assay and effective negotiations.
USDA-ARS?s Scientific Manuscript database
Nanomaterials have been widely reported to affect the polymerase chain reaction (PCR). However, many studies in which these effects were observed were not comprehensive, and many of the proposed mechanisms have been primarily speculative. In this work, we used amino-modified silica-coated magnetic n...
Assessing the determinants of evolutionary rates in the presence of noise.
Plotkin, Joshua B; Fraser, Hunter B
2007-05-01
Although protein sequences are known to evolve at vastly different rates, little is known about what determines their rate of evolution. However, a recent study using principal component regression (PCR) has concluded that evolutionary rates in yeast are primarily governed by a single determinant related to translation frequency. Here, we demonstrate that noise in biological data can confound PCRs, leading to spurious conclusions. When equalizing noise levels across 7 predictor variables used in previous studies, we find no evidence that protein evolution is dominated by a single determinant. Our results indicate that a variety of factors--including expression level, gene dispensability, and protein-protein interactions--may independently affect evolutionary rates in yeast. More accurate measurements or more sophisticated statistical techniques will be required to determine which one, if any, of these factors dominates protein evolution.
NASA Astrophysics Data System (ADS)
Darwish, Hany W.; Hassan, Said A.; Salem, Maissa Y.; El-Zeany, Badr A.
2013-09-01
Four simple, accurate and specific methods were developed and validated for the simultaneous estimation of Amlodipine (AML), Valsartan (VAL) and Hydrochlorothiazide (HCT) in commercial tablets. The derivative spectrophotometric methods include Derivative Ratio Zero Crossing (DRZC) and Double Divisor Ratio Spectra-Derivative Spectrophotometry (DDRS-DS) methods, while the multivariate calibrations used are Principal Component Regression (PCR) and Partial Least Squares (PLSs). The proposed methods were applied successfully in the determination of the drugs in laboratory-prepared mixtures and in commercial pharmaceutical preparations. The validity of the proposed methods was assessed using the standard addition technique. The linearity of the proposed methods is investigated in the range of 2-32, 4-44 and 2-20 μg/mL for AML, VAL and HCT, respectively.
Rapid Detection of Volatile Oil in Mentha haplocalyx by Near-Infrared Spectroscopy and Chemometrics.
Yan, Hui; Guo, Cheng; Shao, Yang; Ouyang, Zhen
2017-01-01
Near-infrared spectroscopy combined with partial least squares regression (PLSR) and support vector machine (SVM) was applied for the rapid determination of chemical component of volatile oil content in Mentha haplocalyx . The effects of data pre-processing methods on the accuracy of the PLSR calibration models were investigated. The performance of the final model was evaluated according to the correlation coefficient ( R ) and root mean square error of prediction (RMSEP). For PLSR model, the best preprocessing method combination was first-order derivative, standard normal variate transformation (SNV), and mean centering, which had of 0.8805, of 0.8719, RMSEC of 0.091, and RMSEP of 0.097, respectively. The wave number variables linking to volatile oil are from 5500 to 4000 cm-1 by analyzing the loading weights and variable importance in projection (VIP) scores. For SVM model, six LVs (less than seven LVs in PLSR model) were adopted in model, and the result was better than PLSR model. The and were 0.9232 and 0.9202, respectively, with RMSEC and RMSEP of 0.084 and 0.082, respectively, which indicated that the predicted values were accurate and reliable. This work demonstrated that near infrared reflectance spectroscopy with chemometrics could be used to rapidly detect the main content volatile oil in M. haplocalyx . The quality of medicine directly links to clinical efficacy, thus, it is important to control the quality of Mentha haplocalyx . Near-infrared spectroscopy combined with partial least squares regression (PLSR) and support vector machine (SVM) was applied for the rapid determination of chemical component of volatile oil content in Mentha haplocalyx . For SVM model, 6 LVs (less than 7 LVs in PLSR model) were adopted in model, and the result was better than PLSR model. It demonstrated that near infrared reflectance spectroscopy with chemometrics could be used to rapidly detect the main content volatile oil in Mentha haplocalyx . Abbreviations used: 1 st der: First-order derivative; 2 nd der: Second-order derivative; LOO: Leave-one-out; LVs: Latent variables; MC: Mean centering, NIR: Near-infrared; NIRS: Near infrared spectroscopy; PCR: Principal component regression, PLSR: Partial least squares regression; RBF: Radial basis function; RMSEC: Root mean square error of cross validation, RMSEC: Root mean square error of calibration; RMSEP: Root mean square error of prediction; SNV: Standard normal variate transformation; SVM: Support vector machine; VIP: Variable Importance in projection.
Blaya, Josefa; Lloret, Eva; Santísima-Trinidad, Ana B; Ros, Margarita; Pascual, Jose A
2016-04-01
Currently, real-time polymerase chain reaction (qPCR) is the technique most often used to quantify pathogen presence. Digital PCR (dPCR) is a new technique with the potential to have a substantial impact on plant pathology research owing to its reproducibility, sensitivity and low susceptibility to inhibitors. In this study, we evaluated the feasibility of using dPCR and qPCR to quantify Phytophthora nicotianae in several background matrices, including host tissues (stems and roots) and soil samples. In spite of the low dynamic range of dPCR (3 logs compared with 7 logs for qPCR), this technique proved to have very high precision applicable at very low copy numbers. The dPCR was able to detect accurately the pathogen in all type of samples in a broad concentration range. Moreover, dPCR seems to be less susceptible to inhibitors than qPCR in plant samples. Linear regression analysis showed a high correlation between the results obtained with the two techniques in soil, stem and root samples, with R(2) = 0.873, 0.999 and 0.995 respectively. These results suggest that dPCR is a promising alternative for quantifying soil-borne pathogens in environmental samples, even in early stages of the disease. © 2015 Society of Chemical Industry.
Developing and testing a global-scale regression model to quantify mean annual streamflow
NASA Astrophysics Data System (ADS)
Barbarossa, Valerio; Huijbregts, Mark A. J.; Hendriks, A. Jan; Beusen, Arthur H. W.; Clavreul, Julie; King, Henry; Schipper, Aafke M.
2017-01-01
Quantifying mean annual flow of rivers (MAF) at ungauged sites is essential for assessments of global water supply, ecosystem integrity and water footprints. MAF can be quantified with spatially explicit process-based models, which might be overly time-consuming and data-intensive for this purpose, or with empirical regression models that predict MAF based on climate and catchment characteristics. Yet, regression models have mostly been developed at a regional scale and the extent to which they can be extrapolated to other regions is not known. In this study, we developed a global-scale regression model for MAF based on a dataset unprecedented in size, using observations of discharge and catchment characteristics from 1885 catchments worldwide, measuring between 2 and 106 km2. In addition, we compared the performance of the regression model with the predictive ability of the spatially explicit global hydrological model PCR-GLOBWB by comparing results from both models to independent measurements. We obtained a regression model explaining 89% of the variance in MAF based on catchment area and catchment averaged mean annual precipitation and air temperature, slope and elevation. The regression model performed better than PCR-GLOBWB for the prediction of MAF, as root-mean-square error (RMSE) values were lower (0.29-0.38 compared to 0.49-0.57) and the modified index of agreement (d) was higher (0.80-0.83 compared to 0.72-0.75). Our regression model can be applied globally to estimate MAF at any point of the river network, thus providing a feasible alternative to spatially explicit process-based global hydrological models.
Devrim, Burcu; Dinç, Erdal; Bozkir, Asuman
2014-01-01
Diphenhydramine hydrochloride (DPH), a histamine H1-receptor antagonist, is widely used as antiallergic, antiemetic and antitussive drug found in many pharmaceutical preparations. In this study, a new reconstitutable syrup formulation of DPH was prepared because it is more stable in solid form than that in liquid form. The quantitative estimation of the DPH content of a reconstitutable syrup formulation in the presence of pharmaceutical excipients, D-sorbitol, sodium citrate, sodium benzoate and sodium EDTA is not possible by the direct absorbance measurement. Therefore, a signal processing approach based on continuous wavelet transform was used to determine the DPH in the reconstitutable syrup formulations and to eliminate the effect of excipients on the analysis. The absorption spectra of DPH in the range of 5.0-40.0 μg/mL were recorded between 200-300 nm. Various wavelet families were tested and Biorthogonal1.1 continuous wavelet transform (BIOR1.1-CWT) was found to be optimal signal processing family to get fast and desirable determination results and to overcome excipient interference effects. For a comparison of the experimental results obtained by partial least squares (PLS) and principal component regression (PCR) methods were applied to the quantitative prediction of DPH in the mentioned samples. The validity of the proposed BIOR1.1-CWT, PLS and PCR methods were achieved analyzing the prepared samples containing the mentioned excipients and using standard addition technique. It was observed that the proposed graphical and numerical approaches are suitable for the quantitative analysis of DPH in samples including excipients.
Svandova, E Budisova; Vesela, B; Lesot, H; Poliard, A; Matalova, E
2017-04-01
Elimination of the interdigital web is considered to be the classical model for assessing apoptosis. So far, most of the molecules described in the process have been connected to the intrinsic (mitochondrial) pathway. The extrinsic (receptor mediated) apoptotic pathway has been rather neglected, although it is important in development, immunomodulation and cancer therapy. This work aimed to investigate factors of the extrinsic apoptotic machinery during interdigital regression with a focus on three crucial initiators: Fas, Fas ligand and caspase-8. Immunofluorescent analysis of mouse forelimb histological sections revealed abundant expression of these molecules prior to digit separation. Subsequent PCR Array analyses indicated the expression of several markers engaged in the extrinsic pathway. Between embryonic days 11 and 13, statistically significant increases in the expression of Fas and caspase-8 were observed, along with other molecules involved in the extrinsic apoptotic pathway such as Dapk1, Traf3, Tnsf12, Tnfrsf1A and Ripk1. These results demonstrate for the first time the presence of extrinsic apoptotic components in mouse limb development and indicate novel candidates in the molecular network accompanying the regression of interdigital tissue during digitalisation.
Noncontact analysis of the fiber weight per unit area in prepreg by near-infrared spectroscopy.
Jiang, B; Huang, Y D
2008-05-26
The fiber weight per unit area in prepreg is an important factor to ensure the quality of the composite products. Near-infrared spectroscopy (NIRS) technology together with a noncontact reflectance sources has been applied for quality analysis of the fiber weight per unit area. The range of the unit area fiber weight was 13.39-14.14mgcm(-2). The regression method was employed by partial least squares (PLS) and principal components regression (PCR). The calibration model was developed by 55 samples to determine the fiber weight per unit area in prepreg. The determination coefficient (R(2)), root mean square error of calibration (RMSEC) and root mean square error of prediction (RMSEP) were 0.82, 0.092, 0.099, respectively. The predicted values of the fiber weight per unit area in prepreg measured by NIRS technology were comparable to the values obtained by the reference method. For this technology, the noncontact reflectance sources focused directly on the sample with neither previous treatment nor manipulation. The results of the paired t-test revealed that there was no significant difference between the NIR method and the reference method. Besides, the prepreg could be analyzed one time within 20s without sample destruction.
FRNA Bacteriophages as Viral Indicators of Faecal Contamination in Mexican Tropical Aquatic Systems.
Arredondo-Hernandez, Luis Jose Rene; Diaz-Avalos, Carlos; Lopez-Vidal, Yolanda; Castillo-Rojas, Gonzalo; Mazari-Hiriart, Marisa
2017-01-01
A particular challenge to water safety in populous intertropical regions is the lack of reliable faecal indicators to detect microbiological contamination of water, while the numerical relationships of specific viral indicators remain largely unexplored. The aim of this study was to investigate the numerical relationships of FRNA-bacteriophage genotypes, adenovirus 41, and human adenoviruses (HADV) in Mexican surface water systems to assess sewage contamination. We studied the presence of HADV, HADV41 and FRNA bacteriophage genotypes in water samples and quantified by qPCR and RT-qPCR. Virus and water quality indicator variances, as analyzed by principal component analysis and partial least squared regression, followed along the major percentiles of water faecal enterococci. FRNA bacteriophages adequately deciphered viral and point source water contamination. The strongest correlation for HADV was with FRNA bacteriophage type II, in water samples higher than the 50th percentiles of faecal enterococci, thus indicating urban pollution. FRNA bacteriophage genotypes I and III virus indicator performances were assisted by their associations with electrical conductivity and faecal enterococci. In combination, our methods are useful for inferring water quality degradation caused by sewage contamination. The methods used have potential for determining source contamination in water and, specifically, the presence of enteric viruses where clean and contaminated water have mixed.
Differential gene expression profiles of peripheral blood mononuclear cells in childhood asthma.
Kong, Qian; Li, Wen-Jing; Huang, Hua-Rong; Zhong, Ying-Qiang; Fang, Jian-Pei
2015-05-01
Asthma is a common childhood disease with strong genetic components. This study compared whole-genome expression differences between asthmatic young children and healthy controls to identify gene signatures of childhood asthma. Total RNA extracted from peripheral blood mononuclear cells (PBMC) was subjected to microarray analysis. QRT-PCR was performed to verify the microarray results. Classification and functional characterization of differential genes were illustrated by hierarchical clustering and gene ontology analysis. Multiple logistic regression (MLR) analysis, receiver operating characteristic (ROC) curve analysis, and discriminate power were used to scan asthma-specific diagnostic markers. For fold-change>2 and p < 0.05, there were 758 named differential genes. The results of QRT-PCR confirmed successfully the array data. Hierarchical clustering divided 29 highly possible genes into seven categories and the genes in the same cluster were likely to possess similar expression patterns or functions. Gene ontology analysis presented that differential genes primarily enriched in immune response, response to stress or stimulus, and regulation of apoptosis in biological process. MLR and ROC curve analysis revealed that the combination of ADAM33, Smad7, and LIGHT possessed excellent discriminating power. The combination of ADAM33, Smad7, and LIGHT would be a reliable and useful childhood asthma model for prediction and diagnosis.
NASA Astrophysics Data System (ADS)
Nizamuddin, Mohammad; Akhand, Kawsar; Roytman, Leonid; Kogan, Felix; Goldberg, Mitch
2015-06-01
Rice is a dominant food crop of Bangladesh accounting about 75 percent of agricultural land use for rice cultivation and currently Bangladesh is the world's fourth largest rice producing country. Rice provides about two-third of total calorie supply and about one-half of the agricultural GDP and one-sixth of the national income in Bangladesh. Aus is one of the main rice varieties in Bangladesh. Crop production, especially rice, the main food staple, is the most susceptible to climate change and variability. Any change in climate will, thus, increase uncertainty regarding rice production as climate is major cause year-to-year variability in rice productivity. This paper shows the application of remote sensing data for estimating Aus rice yield in Bangladesh using official statistics of rice yield with real time acquired satellite data from Advanced Very High Resolution Radiometer (AVHRR) sensor and Principal Component Regression (PCR) method was used to construct a model. The simulated result was compared with official agricultural statistics showing that the error of estimation of Aus rice yield was less than 10%. Remote sensing, therefore, is a valuable tool for estimating crop yields well in advance of harvest, and at a low cost.
FRNA Bacteriophages as Viral Indicators of Faecal Contamination in Mexican Tropical Aquatic Systems
Diaz-Avalos, Carlos; Lopez-Vidal, Yolanda; Castillo-Rojas, Gonzalo; Mazari-Hiriart, Marisa
2017-01-01
A particular challenge to water safety in populous intertropical regions is the lack of reliable faecal indicators to detect microbiological contamination of water, while the numerical relationships of specific viral indicators remain largely unexplored. The aim of this study was to investigate the numerical relationships of FRNA-bacteriophage genotypes, adenovirus 41, and human adenoviruses (HADV) in Mexican surface water systems to assess sewage contamination. We studied the presence of HADV, HADV41 and FRNA bacteriophage genotypes in water samples and quantified by qPCR and RT-qPCR. Virus and water quality indicator variances, as analyzed by principal component analysis and partial least squared regression, followed along the major percentiles of water faecal enterococci. FRNA bacteriophages adequately deciphered viral and point source water contamination. The strongest correlation for HADV was with FRNA bacteriophage type II, in water samples higher than the 50th percentiles of faecal enterococci, thus indicating urban pollution. FRNA bacteriophage genotypes I and III virus indicator performances were assisted by their associations with electrical conductivity and faecal enterococci. In combination, our methods are useful for inferring water quality degradation caused by sewage contamination. The methods used have potential for determining source contamination in water and, specifically, the presence of enteric viruses where clean and contaminated water have mixed. PMID:28114378
Doganay-Knapp, Kirsten; Orland, Annika; König, Gabriele M; Knöss, Werner
2018-04-01
Herbal substances and preparations thereof play an important role in healthcare systems worldwide. Due to the variety of these products regarding origin, composition and processing procedures, appropriate methodologies for quality assessment need to be considered. A majority of herbal substances is administered as multicomponent mixtures, especially in the field of Traditional Chinese Medicine and ayurvedic medicine, but also in finished medicinal products. Quality assessment of complex mixtures of herbal substances with conventional methods is challenging. Thus, emphasis of the present work was directed on the development of complementary methods to elucidate the composition of mixtures of herbal substances and finished herbal medicinal products. An indispensable prerequisite for the safe and effective use of herbal medicines is the unequivocal authentication of the medicinal plants used therein. In this context, we investigated the potential of three different PCR-related methods in the characterization and authentication of herbal substances. A multiplex PCR assay and a quantitative PCR (qPCR) assay were established to analyze defined mixtures of the herbal substances Quercus cortex, Juglandis folium, Aristolochiae herba, Matricariae flos and Salviae miltiorrhizae radix et rhizoma and a finished herbal medicinal product. Furthermore, a standard cloning approach using universal primers targeting the ITS region was established in order to allow the investigation of herbal mixtures with unknown content. The cloning approach had some limitations regarding the detection/recovery of the components in defined mixtures of herbal substances, but the complementary use of two sets of universal primer pairs increased the detection of components out of the mixture. While the multiplex PCR did not retrace all components in the defined mixtures of herbal substances, the established qPCR resulted in simultaneous and specific detection of the five target sequences in all defined mixtures. These data indicate that for authentication purposes, complementary PCR-related methods are highly recommendable for the analysis of herbal mixtures in parallel. Copyright © 2018 Elsevier GmbH. All rights reserved.
Can We Use Regression Modeling to Quantify Mean Annual Streamflow at a Global-Scale?
NASA Astrophysics Data System (ADS)
Barbarossa, V.; Huijbregts, M. A. J.; Hendriks, J. A.; Beusen, A.; Clavreul, J.; King, H.; Schipper, A.
2016-12-01
Quantifying mean annual flow of rivers (MAF) at ungauged sites is essential for a number of applications, including assessments of global water supply, ecosystem integrity and water footprints. MAF can be quantified with spatially explicit process-based models, which might be overly time-consuming and data-intensive for this purpose, or with empirical regression models that predict MAF based on climate and catchment characteristics. Yet, regression models have mostly been developed at a regional scale and the extent to which they can be extrapolated to other regions is not known. In this study, we developed a global-scale regression model for MAF using observations of discharge and catchment characteristics from 1,885 catchments worldwide, ranging from 2 to 106 km2 in size. In addition, we compared the performance of the regression model with the predictive ability of the spatially explicit global hydrological model PCR-GLOBWB [van Beek et al., 2011] by comparing results from both models to independent measurements. We obtained a regression model explaining 89% of the variance in MAF based on catchment area, mean annual precipitation and air temperature, average slope and elevation. The regression model performed better than PCR-GLOBWB for the prediction of MAF, as root-mean-square error values were lower (0.29 - 0.38 compared to 0.49 - 0.57) and the modified index of agreement was higher (0.80 - 0.83 compared to 0.72 - 0.75). Our regression model can be applied globally at any point of the river network, provided that the input parameters are within the range of values employed in the calibration of the model. The performance is reduced for water scarce regions and further research should focus on improving such an aspect for regression-based global hydrological models.
Regulation of bacterial photosynthesis genes by the small noncoding RNA PcrZ
Mank, Nils N.; Berghoff, Bork A.; Hermanns, Yannick N.; Klug, Gabriele
2012-01-01
The small RNA PcrZ (photosynthesis control RNA Z) of the facultative phototrophic bacterium Rhodobacter sphaeroides is induced upon a drop of oxygen tension with similar kinetics to those of genes for components of photosynthetic complexes. High expression of PcrZ depends on PrrA, the response regulator of the PrrB/PrrA two-component system with a central role in redox regulation in R. sphaeroides. In addition the FnrL protein, an activator of some photosynthesis genes at low oxygen tension, is involved in redox-dependent expression of this small (s)RNA. Overexpression of full-length PcrZ in R. sphaeroides affects expression of a small subset of genes, most of them with a function in photosynthesis. Some mRNAs from the photosynthetic gene cluster were predicted to be putative PcrZ targets and results from an in vivo reporter system support these predictions. Our data reveal a negative effect of PcrZ on expression of its target mRNAs. Thus, PcrZ counteracts the redox-dependent induction of photosynthesis genes, which is mediated by protein regulators. Because PrrA directly activates photosynthesis genes and at the same time PcrZ, which negatively affects photosynthesis gene expression, this is one of the rare cases of an incoherent feed-forward loop including an sRNA. Our data identified PcrZ as a trans acting sRNA with a direct regulatory function in formation of photosynthetic complexes and provide a model for the control of photosynthesis gene expression by a regulatory network consisting of proteins and a small noncoding RNA. PMID:22988125
Regulation of bacterial photosynthesis genes by the small noncoding RNA PcrZ.
Mank, Nils N; Berghoff, Bork A; Hermanns, Yannick N; Klug, Gabriele
2012-10-02
The small RNA PcrZ (photosynthesis control RNA Z) of the facultative phototrophic bacterium Rhodobacter sphaeroides is induced upon a drop of oxygen tension with similar kinetics to those of genes for components of photosynthetic complexes. High expression of PcrZ depends on PrrA, the response regulator of the PrrB/PrrA two-component system with a central role in redox regulation in R. sphaeroides. In addition the FnrL protein, an activator of some photosynthesis genes at low oxygen tension, is involved in redox-dependent expression of this small (s)RNA. Overexpression of full-length PcrZ in R. sphaeroides affects expression of a small subset of genes, most of them with a function in photosynthesis. Some mRNAs from the photosynthetic gene cluster were predicted to be putative PcrZ targets and results from an in vivo reporter system support these predictions. Our data reveal a negative effect of PcrZ on expression of its target mRNAs. Thus, PcrZ counteracts the redox-dependent induction of photosynthesis genes, which is mediated by protein regulators. Because PrrA directly activates photosynthesis genes and at the same time PcrZ, which negatively affects photosynthesis gene expression, this is one of the rare cases of an incoherent feed-forward loop including an sRNA. Our data identified PcrZ as a trans acting sRNA with a direct regulatory function in formation of photosynthetic complexes and provide a model for the control of photosynthesis gene expression by a regulatory network consisting of proteins and a small noncoding RNA.
Impact of implementing an EMR on physical exam documentation by ambulance personnel.
Katzer, R; Barton, D J; Adelman, S; Clark, S; Seaman, E L; Hudson, K B
2012-01-01
Georgetown University has a student run Emergency Medical Services (EMS) organization with over 100 emergency medical technicians (EMTs). We set out to determine whether implementing an electronic patient care report (ePCR) system was associated with improved physical exam documentation. This study evaluated documentation of the physical exam on prehospital patient care reports (PCRs). An ePCR system was implemented. ePCR documentation was compared to that of the previously used paper PCRs. This study looked retrospectively at 154 PCRs. 77 were hand written PCRs from before the electronic system. The PCRs involved chief complaints that were primarily respiratory, neurologic, or both. 77 ePCRs of matching chief complaint categories were used for comparison. Each chart was reviewed for completion of certain physical exam findings. The mean percentage of documented components from the ePCRs was compared to that of the hand written PCRs. The null hypothesis was that the absolute increase in the mean was not more than 20 percent. The two exclusion criteria were PCRs completed by study investigators after the design of the project and partially or completely missing PCRs. The absolute increase in mean physical exam component documentation was 36% (95% CI = 29-43%). A weighted kappa of 0.894 showed very good agreement between chart reviewers. This study rejected the null hypothesis that the ePCR system was associated with a mean increase of no more than 20%. It observed increase in physical exam documentation. Limitations of this study included the inability to determine whether documentation of physical exam findings reflected performance of the physical exam, and what components of the ePCR system bundle were responsible for the increase in physical exam component documentation.
Impact of implementing an EMR on physical exam documentation by ambulance personnel
Katzer, R.; Barton, D.J.; Adelman, S.; Clark, S.; Seaman, E.L.; Hudson, K.B.
2012-01-01
Objectives Georgetown University has a student run Emergency Medical Services (EMS) organization with over 100 emergency medical technicians (EMTs). We set out to determine whether implementing an electronic patient care report (ePCR) system was associated with improved physical exam documentation. Methods This study evaluated documentation of the physical exam on prehospital patient care reports (PCRs). An ePCR system was implemented. ePCR documentation was compared to that of the previously used paper PCRs. This study looked retrospectively at 154 PCRs. 77 were hand written PCRs from before the electronic system. The PCRs involved chief complaints that were primarily respiratory, neurologic, or both. 77 ePCRs of matching chief complaint categories were used for comparison. Each chart was reviewed for completion of certain physical exam findings. The mean percentage of documented components from the ePCRs was compared to that of the hand written PCRs. The null hypothesis was that the absolute increase in the mean was not more than 20 percent. The two exclusion criteria were PCRs completed by study investigators after the design of the project and partially or completely missing PCRs. Results The absolute increase in mean physical exam component documentation was 36% (95% CI = 29–43%). A weighted kappa of 0.894 showed very good agreement between chart reviewers. Conclusions This study rejected the null hypothesis that the ePCR system was associated with a mean increase of no more than 20%. It observed increase in physical exam documentation. Limitations of this study included the inability to determine whether documentation of physical exam findings reflected performance of the physical exam, and what components of the ePCR system bundle were responsible for the increase in physical exam component documentation. PMID:23646077
Zimmerman, Richard K; Rinaldo, Charles R; Nowalk, Mary Patricia; Gk, Balasubramani; Thompson, Mark G; Moehling, Krissy K; Bullotta, Arlene; Wisniewski, Stephen
2014-07-01
Respiratory tract infections are a major cause of outpatient visits, yet only a portion is tested to determine the etiologic organism. Multiplex reverse transcriptase polymerase chain reaction (MRT-PCR) assays for detection of multiple viruses are being used increasingly in clinical settings. During January-April 2012, outpatients with acute respiratory illness (≤ 7 days) were tested for influenza using singleplex RT-PCR (SRT-PCR). A subset was assayed for 18 viruses using MRT-PCR to compare detection of influenza and examine the distribution of viruses and characteristics of patients using multinomial logistic regression. Among 662 participants (6 months-82 years), detection of influenza was similar between the MRT-PCR and SRT-PCR (κ = 0.83). No virus was identified in 267 (40.3%) samples. Commonly detected viruses were human rhinovirus (HRV, 15.4%), coronavirus (CoV, 10.4%), respiratory syncytial virus (RSV, 8.4%), human metapneumovirus (hMPV, 8.3%), and influenza (6%). Co-detections were infrequent (6.9%) and most commonly occurred among those <18 years old. In regression analyses, compared with non-viral illnesses, RSV and hMPV were significantly more frequent in children and less frequent in 18- to 49-year-olds than in those ≥ 50 years (P = 0.01), fever was more common in hMPV and influenza infections (P = 0.008), nasal congestion was more frequent in CoV, HRV, hMPV, influenza and RSV infections (P = 0.001), and body mass index was higher among those with influenza (P = 0.036). Using MRT-PCR, a viral etiology was found in three-fifths of patients with medically attended outpatient visits for acute respiratory illness during the influenza season; co-detected viruses were infrequent. Symptoms varied by viral etiology. © 2014 The Authors. Influenza and Other Respiratory Viruses Published by John Wiley & Sons Ltd.
Wan, Cai-Feng; Liu, Xue-Song; Wang, Lin; Zhang, Jie; Lu, Jin-Song; Li, Feng-Hua
2018-06-01
To clarify whether the quantitative parameters of contrast-enhanced ultrasound (CEUS) can be used to predict pathological complete response (pCR) in patients with locally advanced breast cancer receiving neoadjuvant chemotherapy (NAC). Fifty-one patients with histologically proved locally advanced breast cancer scheduled for NAC were enrolled. The quantitative data for CEUS and the tumor diameter were collected at baseline and before surgery, and compared with the pathological response. Multiple logistic regression analysis was performed to examine quantitative parameters at CEUS and the tumor diameter to predict the pCR, and receiver operating characteristic (ROC) curve analysis was used as a summary statistic. Multiple logistic regression analysis revealed that PEAK (the maximum intensity of the time-intensity curve during bolus transit), PEAK%, TTP% (time to peak), and diameter% were significant independent predictors of pCR, and the area under the ROC curve was 0.932(Az 1 ), and the sensitivity and specificity to predict pCR were 93.7% and 80.0%. The area under the ROC curve for the quantitative parameters was 0.927(Az 2 ), and the sensitivity and specificity to predict pCR were 81.2% and 94.3%. For diameter%, the area under the ROC curve was 0.786 (Az 3 ), and the sensitivity and specificity to predict pCR were 93.8% and 54.3%. The values of Az 1 and Az 2 were significantly higher than that of Az 3 (P = 0.027 and P = 0.034, respectively). However, there was no significant difference between the values of Az 1 and Az 2 (P = 0.825). Quantitative analysis of tumor blood perfusion with CEUS is superior to diameter% to predict pCR, and can be used as a functional technique to evaluate tumor response to NAC. Copyright © 2018. Published by Elsevier B.V.
Omrani, Hengameh; Barnes, Jack A; Dudelzak, Alexander E; Loock, Hans-Peter; Waechter, Helen
2012-06-21
Excitation emission matrix (EEM) and cavity ring-down (CRD) spectral signatures have been used to detect and quantitatively assess contamination of jet fuels with aero-turbine lubricating oil. The EEM spectrometer has been fiber-coupled to permit in situ measurements of jet turbine oil contamination of jet fuel. Parallel Factor (PARAFAC) analysis as well as Principal Component Analysis and Regression (PCA/PCR) were used to quantify oil contamination in a range from the limit of detection (10 ppm) to 1000 ppm. Fiber-loop cavity ring-down spectroscopy using a pulsed 355 nm laser was used to quantify the oil contamination in the range of 400 ppm to 100,000 ppm. Both methods in combination therefore permit the detection of oil contamination with a linear dynamic range of about 10,000.
Darwish, Hany W; Hassan, Said A; Salem, Maissa Y; El-Zeany, Badr A
2013-09-01
Four simple, accurate and specific methods were developed and validated for the simultaneous estimation of Amlodipine (AML), Valsartan (VAL) and Hydrochlorothiazide (HCT) in commercial tablets. The derivative spectrophotometric methods include Derivative Ratio Zero Crossing (DRZC) and Double Divisor Ratio Spectra-Derivative Spectrophotometry (DDRS-DS) methods, while the multivariate calibrations used are Principal Component Regression (PCR) and Partial Least Squares (PLSs). The proposed methods were applied successfully in the determination of the drugs in laboratory-prepared mixtures and in commercial pharmaceutical preparations. The validity of the proposed methods was assessed using the standard addition technique. The linearity of the proposed methods is investigated in the range of 2-32, 4-44 and 2-20 μg/mL for AML, VAL and HCT, respectively. Copyright © 2013 Elsevier B.V. All rights reserved.
Simultaneous determination of three herbicides by differential pulse voltammetry and chemometrics.
Ni, Yongnian; Wang, Lin; Kokot, Serge
2011-01-01
A novel differential pulse voltammetry method (DPV) was researched and developed for the simultaneous determination of Pendimethalin, Dinoseb and sodium 5-nitroguaiacolate (5NG) with the aid of chemometrics. The voltammograms of these three compounds overlapped significantly, and to facilitate the simultaneous determination of the three analytes, chemometrics methods were applied. These included classical least squares (CLS), principal component regression (PCR), partial least squares (PLS) and radial basis function-artificial neural networks (RBF-ANN). A separately prepared verification data set was used to confirm the calibrations, which were built from the original and first derivative data matrices of the voltammograms. On the basis relative prediction errors and recoveries of the analytes, the RBF-ANN and the DPLS (D - first derivative spectra) models performed best and are particularly recommended for application. The DPLS calibration model was applied satisfactorily for the prediction of the three analytes from market vegetables and lake water samples.
Lamm, Ryan; Alves, Clark; Perrotta, Grace; Murphy, Meagan; Messina, Catherine; Sanchez, Juan F; Perez, Erika; Rosales, Luis Angel; Lescano, Andres G; Smith, Edward; Valdivia, Hugo; Fuhrer, Jack; Ballard, Sarah-Blythe
2018-06-04
Cutaneous leishmaniasis is endemic to South America where diagnosis is most commonly conducted via microscopy. Patients with suspected leishmaniasis were referred for enrollment by the Ministry of Health (MoH) in Lima, Iquitos, Puerto Maldonado, and several rural areas of Peru. A 43-question survey requesting age, gender, occupation, characterization of the lesion(s), history of leishmaniasis, and insect-deterrent behaviors was administered. Polymerase chain reaction (PCR) was conducted on lesion materials at the Naval Medical Research Unit No. 6 in Lima, and the results were compared with those obtained by the MoH using microscopy. Factors associated with negative microscopy and positive PCR results were identified using χ 2 test, t -test, and multivariate logistic regression analyses. Negative microscopy with positive PCR occurred in 31% (123/403) of the 403 cases. After adjusting for confounders, binary multivariate logistic regression analyses revealed that negative microscopy with positive PCR was associated with patients who were male (adjusted OR = 1.93 [1.06-3.53], P = 0.032), had previous leishmaniasis (adjusted OR = 2.93 [1.65-5.22], P < 0.0001), had larger lesions (adjusted OR = 1.02 [1.003-1.03], P = 0.016), and/or had a longer duration between lesion appearance and PCR testing (adjusted OR = 1.12 [1.02-1.22], P = 0.017). Future research should focus on further exploration of these underlying variables, discovery of other factors that may be associated with negative microscopy diagnosis, and the development and implementation of improved testing in endemic regions.
Vietina, Michelangelo; Agrimonti, Caterina; Marmiroli, Nelson
2013-12-15
Extra virgin olive oil is frequently subjected to adulterations with addition of oils obtained from plants other than olive. DNA analysis is a fast and economic tool to identify plant components in oils. Extraction and amplification of DNA by PCR was tested in olives, in milled seeds and in oils, to investigate its use in olive oil traceability. DNA was extracted from different oils made of hazelnut, maize, sunflower, peanut, sesame, soybean, rice and pumpkin. Comparing the DNA melting profiles in reference plant materials and in the oils, it was possible to identify any plant components in oils and mixtures of oils. Real-Time PCR (RT-PCR) platform has been added of the new methodology of high resolution melting (HRM), both were used to analyse olive oils mixed with different percentage of other oils. Results showed HRM a cost effective method for efficient detection of adulterations in olive oils. Copyright © 2013 Elsevier Ltd. All rights reserved.
Fernández-Martos, Carlos; Pericay, Carles; Aparicio, Jorge; Salud, Antonieta; Safont, Mariajose; Massuti, Bertomeu; Vera, Ruth; Escudero, Pilar; Maurel, Joan; Marcuello, Eugenio; Mengual, Jose Luis; Saigi, Eugenio; Estevan, Rafael; Mira, Moises; Polo, Sonia; Hernandez, Ana; Gallen, Manuel; Arias, Fernando; Serra, Javier; Alonso, Vicente
2010-02-10
PURPOSE The optimal therapeutic sequence of the adjuvant chemotherapy component of preoperative chemoradiotherapy (CRT) for patients with locally advanced rectal cancer is controversial. Induction chemotherapy before preoperative CRT may be associated with better efficacy and compliance. PATIENTS AND METHODS A total of 108 patients with locally advanced rectal cancer were randomly assigned to arm A-preoperative CRT with capecitabine, oxaliplatin, and concurrent radiation followed by surgery and four cycles of postoperative adjuvant capecitabine and oxaliplatin (CAPOX)-or arm B-induction CAPOX followed by CRT and surgery. The primary end point was pathologic complete response rate (pCR). Results On an intention-to-treat basis, the pCR for arms A and B were 13.5% (95% CI, 5.6% to 25.8%) and 14.3% (95% CI, 6.4% to 26.2%), respectively. There were no statistically significant differences in other end points, including downstaging, tumor regression, and R0 resection. Overall, chemotherapy treatment exposure was higher in arm B than in arm A for both oxaliplatin (P < .0001) and capecitabine (P < .0001). During CRT, grades 3 to 4 adverse events were similar in both arms but were significantly higher in arm A during postoperative adjuvant CT than with induction CT in arm B. There were three deaths in each arm during the treatment period. CONCLUSION Compared with postoperative adjuvant CAPOX, induction CAPOX before CRT had similar pCR and complete resection rates. It did achieve more favorable compliance and toxicity profiles. On the basis of these findings, a phase III study to definitively test the induction strategy is warranted.
Mendoza-Gallegos, Roberto A; Rios, Amelia; Garcia-Cordero, Jose L
2018-05-01
The polymerase chain reaction (PCR) is a sought-after nucleic acid amplification technique used in the detection of several diseases. However, one of the main limitations of this and other nucleic acid amplification assays is the complexity, size, maintenance, and cost of their operational instrumentation. This limits the use of PCR applications in settings that cannot afford the instruments but that may have access to basic electrical, electronic, and optical components and the expertise to build them. To provide a more accessible platform, we developed a low-cost, palm-size, and portable instrument to perform real-time PCR (qPCR). The thermocycler leverages a copper-sheathed power resistor and a computer fan, in tandem with basic electronic components controlled from a single-board computer. The instrument incorporates a 3D-printed chassis and a custom-made fluorescence optical setup based on a CMOS camera and a blue LED. Results are displayed in real-time on a tablet. We also fabricated simple acrylic microdevices consisting of four wells (2 μL in volume each) where PCR reactions take place. To test our instrument, we performed qPCR on a series of cDNA dilutions spanning 4 orders of magnitude, achieving similar limits of detection as those achieved by a benchtop thermocycler. We envision our instrument being utilized to enable routine monitoring and diagnosis of certain diseases in low-resource areas.
Giovanni, Mazza G; Shenvi, Rohit; Battles, Marcie; Orthner, Helmuth F
2008-11-06
The eMonitor is a component of the ePatient system; a prototype system used by emergency medical services (EMS) personnel in the field to record and transmits electronic patient care report (ePCR) information interactively. The eMonitor component allows each Mobile Data Terminal (MDT) on an unreliable Cisco MobileIP wireless network to securely send and received XML messages used to update patient information to and from the MDT before, during and after the transport of a patient.
Pathak, Ekta; Campos-Herrera, Raquel; El-Borai, Fahiem E; Duncan, Larry W
2017-03-01
Relationships between entomopathogenic nematodes (EPNs), nematophagous fungi (NF) and soil physical and chemical properties were studied in a survey of 53 citrus orchards in central ridge and flatwoods ecoregions of Florida. Seven species of NF associated with nematodes were quantified directly using a real time qPCR assay. All nematophagous fungi studied except Arthrobotrys musiformis and Hirsutella rhossiliensis were frequently detected (24-56%) in both regions. Paecilomyces lilacinus and Gamsylella gephyropagumwere encountered more frequently in the flatwoods (P=0.03) and on the ridge (P=0.02), respectively. Redundancy analysis revealed seven abiotic and biotic factors as significantly related to the NF occurrence. Multiple regression of fungi on these variables explained 78%, 66%, 48%, 36%, 23% and 4% of the variation in Catenaria sp., A. musiformis, A. dactyloides, P. lilacinus, A. oligospora and G. gepharopagum, respectively. When the data from citrus were pooled with those reported previously from natural areas and subjected to principle component analysis, the first two principle components explained 43% of the variation in NF communities. The surveys (citrus vs natural areas) were discriminated by PC2 (P<0.001) and the ecoregion by PC1 (P<0.002), and all but one NF species were related (P<0.01) to one or both components. NF communities tended to have more species and greater diversity in the flatwoods, where EPN richness and diversity were the least. However, the strength of associations between individual EPN and NF species as measured by SADIE reflected the associations between each species and ground water depth, suggesting that ecoregion preferences affected the species associations. Within each ecoregion, significant relationships between the individual NF and EPN species measured by stepwise regression tended to be positive. The results did not support the hypothesis that NF modulate the spatial patterns of EPN species between or within these two ecoregions. Copyright © 2017 Elsevier Inc. All rights reserved.
Kato, Junki; Masaki, Ayako; Fujii, Keiichiro; Takino, Hisashi; Murase, Takayuki; Yonekura, Kentaro; Utsunomiya, Atae; Ishida, Takashi; Iida, Shinsuke; Inagaki, Hiroshi
2016-11-01
Detection of HTLV-1 provirus using paraffin tumor sections may assist the diagnosis of adult T-cell leukemia/lymphoma (ATLL). For the detection, non-quantitative PCR assay has been reported, but its usefulness and limitations remain unclear. To our knowledge, quantitative PCR assay using paraffin tumor sections has not been reported. Using paraffin sections from ATLLs and non-ATLL T-cell lymphomas, we first performed non-quantitative PCR for HTLV-1 provirus. Next, we determined tumor ratios and carried out quantitative PCR to obtain provirus copy numbers. The results were analyzed with a simple regression model and a novel criterion, cut-off using 95 % rejection limits. Our quantitative PCR assay showed an excellent association between tumor ratios and the copy numbers (r = 0.89, P < 0.0001). The 95 % rejection limits provided a statistical basis for the range for the determination of HTLV-1 involvement. Its application suggested that results of non-quantitative PCR assay should be interpreted very carefully and that our quantitative PCR assay is useful to estimate the status of HTLV-1 involvement in the tumor cases. In conclusion, our quantitative PCR assay using paraffin tumor sections may be useful for the screening of ATLL cases, especially in HTLV-1 non-endemic areas where easy access to serological testing for HTLV-1 infection is limited. © 2016 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.
Detection and quantification of adulteration in sandalwood oil through near infrared spectroscopy.
Kuriakose, Saji; Thankappan, Xavier; Joe, Hubert; Venkataraman, Venkateswaran
2010-10-01
The confirmation of authenticity of essential oils and the detection of adulteration are problems of increasing importance in the perfumes, pharmaceutical, flavor and fragrance industries. This is especially true for 'value added' products like sandalwood oil. A methodical study is conducted here to demonstrate the potential use of Near Infrared (NIR) spectroscopy along with multivariate calibration models like principal component regression (PCR) and partial least square regression (PLSR) as rapid analytical techniques for the qualitative and quantitative determination of adulterants in sandalwood oil. After suitable pre-processing of the NIR raw spectral data, the models are built-up by cross-validation. The lowest Root Mean Square Error of Cross-Validation and Calibration (RMSECV and RMSEC % v/v) are used as a decision supporting system to fix the optimal number of factors. The coefficient of determination (R(2)) and the Root Mean Square Error of Prediction (RMSEP % v/v) in the prediction sets are used as the evaluation parameters (R(2) = 0.9999 and RMSEP = 0.01355). The overall result leads to the conclusion that NIR spectroscopy with chemometric techniques could be successfully used as a rapid, simple, instant and non-destructive method for the detection of adulterants, even 1% of the low-grade oils, in the high quality form of sandalwood oil.
Photo diagnosis of early pre cancer (LSIL) in genital tissue
NASA Astrophysics Data System (ADS)
Vaitkuviene, A.; Andersen-Engels, S.; Auksorius, E.; Bendsoe, N.; Gavriushin, V.; Gustafsson, U.; Oyama, J.; Palsson, S.; Soto Thompson, M.; Stenram, U.; Svanberg, K.; Viliunas, V.; De Weert, M. J.
2005-11-01
Permanent infections recognized as oncogenic factor. STD is common concomitant diseases in early precancerous genital tract lesions. Simple optical detection of early regressive pre cancer in cervix is the aim of this study. Hereditary immunosupression most likely is risk factor for cervical cancer development. Light induced fluorescence point monitoring fitted to live cervical tissue diagnostics in 42 patients. Human papilloma virus DNR in cervix tested by means of Hybrid Capture II method. Ultraviolet (337 nm) laser excited fluorescence spectra in the live cervical tissue analyzed by Principal Component (PrC) regression method and spectra decomposition method. PCr method best discriminated pathology group "CIN I and inflammation"(AUC=75%) related to fluorescence emission in short wave region. Spectra decomposition method suggested a few possible fluorophores in a long wave region. Ultraviolet (398 nm) light excitation of live cervix proved sharp selective spectra intensity enhancement in region above 600nm for High-grade cervical lesion. Conclusion: PC analysis of UV (337 nm) light excitation fluorescence spectra gives opportunity to obtain local immunity and Low-grade cervical lesion related information. Addition of shorter and longer wavelengths is promising for multi wave LIF point monitoring method progress in cervical pre-cancer diagnostics and utility for cancer prevention especially in developing countries.
Malhotra, Prashant; Luka, Arthur; McWilliams, Carla S; Poeth, Kaitlin G; Schwartz, Rebecca; Elfekey, Mohammed; Balwan, Sandy
2016-08-01
Respiratory viral illnesses (RVI) are reliably diagnosed by respiratory viral panel using polymerase chain reaction (RVP-PCR); however, owing to the scant data, clinical presentation alone is unreliable in establishing viral etiology. The primary objective of this study was to characterize signs and symptoms of RVI among inpatients in a major tertiary care hospital. Between 2013 and 2015, adult inpatients with RVI undergoing RVP-PCR were prospectively enrolled in our study. Clinical data were collected by interviews and electronic medical record reviews. Data analysis was performed using χ(2) testing, analysis of variance for continuous variables, and logistic regression modeling. Of 421 patients analyzed, 175 (41.7%) had a positive RVP-PCR. Patients were evenly matched at baseline except for renal disease. Multivariate logistic regression modeling demonstrated the following positive correlations: positive RVP-PCR with renal disease (odds ratio [OR] 2.08), cough (OR 2.28), and wheezing (OR 1.8); influenza with cough (OR 5.04), and renal disease (OR 2.17); metapneumovirus with age older than 65 (OR 3.24); respiratory syncytial viruses with wheezing (OR 3.42) and immunosuppression (OR 3.11); and parainfluenza with smoking (OR 3.16). Negative correlations included influenza with anosmia (OR 0.41); rhinovirus/enterovirus with feeling confined to bed (OR 0.3); metapneumovirus with smoking (OR 0.29); and parainfluenza with male sex (OR 0.22). In this descriptive study, we noted specific viral associations with clinical signs and symptoms among 421 inpatients with RVIs. With increasing RVP-PCR use, studies similar to ours may be able to better define the clinical presentation of RVIs and lead to evidence-based, clinical presentation-guided diagnostic and management algorithms.
Hall, Matthew D; Schultheiss, Timothy E; Smith, David D; Fakih, Marwan G; Wong, Jeffrey Y C; Chen, Yi-Jen
2016-12-01
Neoadjuvant chemoradiation therapy (CRT) increases pathological complete response (pCR) rates compared to radiotherapy alone in patients with stage II-III rectal cancer. Limited evidence addresses whether radiotherapy dose escalation further improves pCR rates. Our purpose is to measure the effects of radiotherapy dose and other factors on post-therapy pathologic tumor (ypT) and nodal stage in rectal cancer patients treated with neoadjuvant CRT followed by mesorectal excision. A non-randomized comparative effectiveness analysis was performed of rectal cancer patients treated in 2000-2013 from the National Oncology Data Alliance™ (NODA), a pooled database of cancer registries from >150 US hospitals. The NODA contains the same data submitted to state cancer registries and SEER combined with validated radiotherapy and chemotherapy records. Eligible patients were treated with neoadjuvant CRT followed by proctectomy and had complete data on treatment start dates, radiotherapy dose, clinical tumor (cT) and ypT stage, and number of positive nodes at surgery (n = 3298 patients). Multivariable logistic regression was used to assess the predictive value of independent variables on achieving a pCR. On multivariable regression, radiotherapy dose, cT stage, and time interval between CRT and surgery were significant predictors of achieving a pCR. After adjusting for the effect of other variates, patients treated with higher radiotherapy doses were also more likely to have negative nodes at surgery and be downstaged from cT3-T4 and/or node positive disease to ypT0-T2N0 after neoadjuvant CRT. Our study suggests that increasing dose significantly improved pCR rates and downstaging in rectal cancer patients treated with neoadjuvant CRT followed by surgery.
Humberg, Alexander; Leienbach, Viola; Fortmann, Mats I; Rausch, Tanja K; Buxmann, Horst; Müller, Andreas; Herting, Egbert; Härtel, Christoph; Göpel, Wolfgang
2018-04-18
To determine the prevalence of congenital CMV infection (cCMV) in very-low-birth-weight infants (VLBWI) and to evaluate epidemiological characteristics of VLBWI with antiviral therapy (AT). CMV-specific PCR in umbilical cord tissue was performed (n=3330). Univariate analyses and logistic regression models were used to identify associations with outcome. 22/3330 VLBWI received AT (0.66%). 4 of these (0.12%) were PCR positive, with 2 VLBWI showing pathological screening for hearing loss. VLBWI with AT and negative PCR had significantly reduced mean birth weight (BW) and higher rates of small-for-gestational-age (SGA). Clinical sepsis, bronchopulmonary dysplasia (BPD), use of reserve antibiotics (RA) and treatment for retinopathy of prematurity were significantly increased. We further observed a higher need of transfusion of red blood cells (RBC), fresh frozen plasma and platelets. Logistic regression (controlled for gender, gestational age, SGA and BW) showed associations for AT and BPD (OR 3.4 [1.2-10.1], p=0.024), RA (OR 20.4 [4.2-98.9], p≤0.001), transfusions of RBC (OR 11.9 [1.3-105.7], p=0.026) and platelets (OR 8.7 [2.9-26.4], p≤0.001). All VLBWI with positive PCR received AT. We hypothesize from our data by assuming a postnatal aquired CMV infection in VLBWI with AT and negative PCR that VLBWI born SGA have a different risk profile. Further prospective studies concerning postnatal transmission should take VLBWI born SGA into account and should study the impact of infection on short- and long-term complications in this supposed vulnerable group. © Georg Thieme Verlag KG Stuttgart · New York.
Farr, Alex; Stolz, Myriam; Baumann, Lukas; Bago-Horvath, Zsuzsanna; Oppolzer, Elisabeth; Pfeiler, Georg; Seifert, Michael; Singer, Christian F
2017-06-01
The effect of obesity in breast cancer patients undergoing neoadjuvant chemotherapy (NAC) remains controversial. The aim of this study was to determine the obesity-related effect on pathological complete response (pCR) and survival in women receiving full uncapped doses of NAC. We retrospectively analyzed the data of all consecutive women who underwent anthracycline-taxane-based NAC for primary breast cancer between 2005 and 2015 at the Department of Obstetrics and Gynecology, Medical University of Vienna. Following the WHO criteria, women with a body mass index (BMI) ≥30 kg/m 2 at baseline were considered obese, whereas those with a BMI <30 kg/m 2 were considered non-obese. Those with dose reductions or dose capping were not eligible for study inclusion. Cox regression and logistic regression were performed. The Kaplan-Meier method was used to analyze disease-free, progression-free, and overall survival. The pCR served as the main outcome measure. Among 120 women who received neoadjuvant epirubicin plus cyclophosphamide and docetaxel, 28 (23.3%) were obese and 92 (76.7%) were non-obese. In the multivariate logistic regression model that adjusted for potentially confounding variables, obesity had an independent positive predictive effect on pCR (OR 4.29, 95% CI, 1.42-13.91; p = 0.011), which was significant in the postmenopausal subgroup (OR 4.72, 95% CI, 1.47-15.84; p = 0.01). When comparing non-obese with obese women, we found that obese women experienced longer progression-free survival (HR 0.10, 95% CI, 8.448 × 10 -4 -0.81; p = 0.025). Obese women receiving full uncapped doses of anthracycline-taxane-based NAC have increased pCR and favorable progression-free survival. This could result from increased dose intensity with increased efficacy and toxicity. Copyright © 2017 Elsevier Ltd. All rights reserved.
Elfaki, Tayseer Elamin Mohamed; Arndts, Kathrin; Wiszniewsky, Anna; Ritter, Manuel; Goreish, Ibtisam A; Atti El Mekki, Misk El Yemen A; Arriens, Sandra; Pfarr, Kenneth; Fimmers, Rolf; Doenhoff, Mike; Hoerauf, Achim; Layland, Laura E
2016-05-01
In the Sudan, Schistosoma mansoni infections are a major cause of morbidity in school-aged children and infection rates are associated with available clean water sources. During infection, immune responses pass through a Th1 followed by Th2 and Treg phases and patterns can relate to different stages of infection or immunity. This retrospective study evaluated immunoepidemiological aspects in 234 individuals (range 4-85 years old) from Kassala and Khartoum states in 2011. Systemic immune profiles (cytokines and immunoglobulins) and epidemiological parameters were surveyed in n = 110 persons presenting patent S. mansoni infections (egg+), n = 63 individuals positive for S. mansoni via PCR in sera but egg negative (SmPCR+) and n = 61 people who were infection-free (Sm uninf). Immunoepidemiological findings were further investigated using two binary multivariable regression analysis. Nearly all egg+ individuals had no access to latrines and over 90% obtained water via the canal stemming from the Atbara River. With regards to age, infection and an egg+ status was linked to young and adolescent groups. In terms of immunology, S. mansoni infection per se was strongly associated with increased SEA-specific IgG4 but not IgE levels. IL-6, IL-13 and IL-10 were significantly elevated in patently-infected individuals and positively correlated with egg load. In contrast, IL-2 and IL-1β were significantly lower in SmPCR+ individuals when compared to Sm uninf and egg+ groups which was further confirmed during multivariate regression analysis. Schistosomiasis remains an important public health problem in the Sudan with a high number of patent individuals. In addition, SmPCR diagnostics revealed another cohort of infected individuals with a unique immunological profile and provides an avenue for future studies on non-patent infection states. Future studies should investigate the downstream signalling pathways/mechanisms of IL-2 and IL-1β as potential diagnostic markers in order to distinguish patent from non-patent individuals.
Li, Yongxin; Li, Yuanqian; Zheng, Bo; Qu, Lingli; Li, Can
2009-06-08
A rapid and sensitive method based on microchip capillary electrophoresis with condition optimization of genetic algorithm-support vector regression (GA-SVR) was developed and applied to simultaneous analysis of multiplex PCR products of four foodborne pathogenic bacteria. Four pairs of oligonucleotide primers were designed to exclusively amplify the targeted gene of Vibrio parahemolyticus, Salmonella, Escherichia coli (E. coli) O157:H7, Shigella and the quadruplex PCR parameters were optimized. At the same time, GA-SVR was employed to optimize the separation conditions of DNA fragments in microchip capillary electrophoresis. The proposed method was applied to simultaneously detect the multiplex PCR products of four foodborne pathogenic bacteria under the optimal conditions within 8 min. The levels of detection were as low as 1.2 x 10(2) CFU mL(-1) of Vibrio parahemolyticus, 2.9 x 10(2) CFU mL(-1) of Salmonella, 8.7 x 10(1) CFU mL(-1) of E. coli O157:H7 and 5.2 x 10(1) CFU mL(-1) of Shigella, respectively. The relative standard deviation of migration time was in the range of 0.74-2.09%. The results demonstrated that the good resolution and less analytical time were achieved due to the application of the multivariate strategy. This study offers an efficient alternative to routine foodborne pathogenic bacteria detection in a fast, reliable, and sensitive way.
Samson, Pamela; Robinson, Clifford; Bradley, Jeffrey; Lockhart, A Craig; Puri, Varun; Broderick, Stephen; Kreisel, Daniel; Krupnick, A Sasha; Patterson, G Alexander; Meyers, Bryan; Crabtree, Traves
2016-12-01
The aim of this study was to evaluate differences in pathologic complete response (pCR) rates and overall survival among patients receiving either neoadjuvant chemotherapy or chemoradiation before esophagectomy for locally advanced esophageal cancer. Patients with esophageal cancer receiving either neoadjuvant chemotherapy or chemoradiation before esophagectomy were identified using the National Cancer Database. Univariate analysis compared patient, tumor, and postoperative outcome characteristics. Logistic regression was performed to identify variables associated with achieving pCR. Kaplan-Meier analysis was performed to compare overall median survival by neoadjuvant therapy type and pCR status. Finally, a Cox proportional hazards model was fitted to identify variables associated with increased mortality hazard. From 2006 to 2012, a total of 916 of 7338 of patients (12.5%) received neoadjuvant chemotherapy whereas 6422 (87.5%) received neoadjuvant chemoradiation. Patients who received neoadjuvant chemoradiation were more likely to achieve a pCR (17.2% versus 6.4%, p < 0.001) and less likely to have positive margins (5.6% versus 11.5%, p < 0.001) than were patients who received neoadjuvant chemotherapy, with no difference in 30- or 90-day mortality. Achieving a pCR was associated with improved overall median survival (59.5 ± 4.0 months versus 30.1 ± 0.76 months for those with persistent disease, p < 0.001). On logistic regression, neoadjuvant chemoradiation therapy was independently associated with achieving a pCR (OR = 2.75, 95% confidence interval: 2.01-3.77, p < 0.001). Despite improvement in the pCR rate with neoadjuvant chemoradiation, neoadjuvant therapy type was not independently associated with long-term survival (hazard ratio = 1.12; 95% confidence interval: 0.97-1.30, p = 0.12). Although neoadjuvant chemoradiation is more successful in downstaging esophageal cancer before esophagectomy, it was not independently prognostic for improved long-term survival. Other factors affecting long-term survival among pathologic complete responders and among patients with persistent disease should be investigated to clarify this association. Copyright © 2016 International Association for the Study of Lung Cancer. Published by Elsevier Inc. All rights reserved.
Hasan, Mohammad R; Tan, Rusung; Al-Rawahi, Ghada; Thomas, Eva; Tilley, Peter
2016-08-01
Quantitative, viral load monitoring for BK virus (BKV) by real-time PCR is an important tool in the management of polyomavirus associated nephropathy in renal transplant patients. However, variability in PCR results has been reported because of polymorphisms in viral genes among different subtypes of BKV, and lack of standardization of the PCR assays among different laboratories. In this study we have compared the performance of several laboratory developed PCR assays that target highly conserved regions of BKV genome with a commercially available, RealStar(®) BKV PCR Kit. Three real-time PCR assays (i) VP1 assay: selected from the literature that targets the major capsid protein (VP1) gene (ii) VP1MOD assay: VP1 assay with a modified probe, and (iii) BKLTA assay: newly designed assay that targets the large T antigen gene were assessed in parallel, using controls and clinical specimens that were previously tested using RealStar(®) BKV PCR Kit (Altona Diagnostics GmbH, Hamburg, Germany). Nucleic acid from all samples were extracted using the QIA symphony virus/bacteria kit on an automated DNA extraction platform QIA symphony SP (Qiagen). Primer and probe concentration, and reaction conditions for laboratory developed assays were optimized and the limit of detection of different assays was determined. Positive control for laboratory developed BK assays was prepared through construction of a plasmid carrying respective amplicon sequences. The 95% detection limit of VP1, VP1MOD and BKLTA assays were 1.8×10(2), 3×10(3) and 3.5×10(2) genomic copies/ml, respectively, as determined by Probit regression analysis of data obtained by testing a dilution series of a titered patient specimen, using RealStar(®) BKV PCR Kit. The inter-assay and intra-assay, coefficient of variations of these assays using calibrated, plasmid standards were <1%. All assays, including the RealStar(®) BKV PCR assay, were highly specific when tested against a panel of external proficiency specimens containing both BK and JC viruses. All assays, except the VP1MOD assay determined BK viral load in proficiency specimens within the same log values. With reference to results obtained by RealStar(®) BKV PCR assay, the sensitivity and specificity of different assays tested in 116 serum specimens submitted for BK viral load assay were 91% and 97% for VP1 assay, 88% and 97% for VP1MOD assay, and 97% and 98% for BKLTA assay, respectively. BK Viral load in positive specimens determined by various assays was highly correlated (R(2)>0.97), based on linear regression analysis. The performance characteristics of the newly designed, BKLTA assay were highly comparable to RealStar(®) BKV PCR assay, and can be used for routine detection and viral load monitoring of BKV in a cost-effective manner. Copyright © 2016 Elsevier B.V. All rights reserved.
Basatnia, Nabee; Hossein, Seyed Abbas; Rodrigo-Comino, Jesús; Khaledian, Yones; Brevik, Eric C; Aitkenhead-Peterson, Jacqueline; Natesan, Usha
2018-04-29
Coastal lagoon ecosystems are vulnerable to eutrophication, which leads to the accumulation of nutrients from the surrounding watershed over the long term. However, there is a lack of information about methods that could accurate quantify this problem in rapidly developed countries. Therefore, various statistical methods such as cluster analysis (CA), principal component analysis (PCA), partial least square (PLS), principal component regression (PCR), and ordinary least squares regression (OLS) were used in this study to estimate total organic matter content in sediments (TOM) using other parameters such as temperature, dissolved oxygen (DO), pH, electrical conductivity (EC), nitrite (NO 2 ), nitrate (NO 3 ), biological oxygen demand (BOD), phosphate (PO 4 ), total phosphorus (TP), salinity, and water depth along a 3-km transect in the Gomishan Lagoon (Iran). Results indicated that nutrient concentration and the dissolved oxygen gradient were the most significant parameters in the lagoon water quality heterogeneity. Additionally, anoxia at the bottom of the lagoon in sediments and re-suspension of the sediments were the main factors affecting internal nutrient loading. To validate the models, R 2 , RMSECV, and RPDCV were used. The PLS model was stronger than the other models. Also, classification analysis of the Gomishan Lagoon identified two hydrological zones: (i) a North Zone characterized by higher water exchange, higher dissolved oxygen and lower salinity and nutrients, and (ii) a Central and South Zone with high residence time, higher nutrient concentrations, lower dissolved oxygen, and higher salinity. A recommendation for the management of coastal lagoons, specifically the Gomishan Lagoon, to decrease or eliminate nutrient loadings is discussed and should be transferred to policy makers, the scientific community, and local inhabitants.
Wu, Xia; Zhu, Jian-Cheng; Zhang, Yu; Li, Wei-Min; Rong, Xiang-Lu; Feng, Yi-Fan
2016-08-25
Potential impact of lipid research has been increasingly realized both in disease treatment and prevention. An effective metabolomics approach based on ultra-performance liquid chromatography/quadrupole-time-of-flight mass spectrometry (UPLC/Q-TOF-MS) along with multivariate statistic analysis has been applied for investigating the dynamic change of plasma phospholipids compositions in early type 2 diabetic rats after the treatment of an ancient prescription of Chinese Medicine Huang-Qi-San. The exported UPLC/Q-TOF-MS data of plasma samples were subjected to SIMCA-P and processed by bioMark, mixOmics, Rcomdr packages with R software. A clear score plots of plasma sample groups, including normal control group (NC), model group (MC), positive medicine control group (Flu) and Huang-Qi-San group (HQS), were achieved by principal-components analysis (PCA), partial least-squares discriminant analysis (PLS-DA) and orthogonal partial least-squares discriminant analysis (OPLS-DA). Biomarkers were screened out using student T test, principal component regression (PCR), partial least-squares regression (PLS) and important variable method (variable influence on projection, VIP). Structures of metabolites were identified and metabolic pathways were deduced by correlation coefficient. The relationship between compounds was explained by the correlation coefficient diagram, and the metabolic differences between similar compounds were illustrated. Based on KEGG database, the biological significances of identified biomarkers were described. The correlation coefficient was firstly applied to identify the structure and deduce the metabolic pathways of phospholipids metabolites, and the study provided a new methodological cue for further understanding the molecular mechanisms of metabolites in the process of regulating Huang-Qi-San for treating early type 2 diabetes. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Preparation of DNA-containing extract for PCR amplification
Dunbar, John M.; Kuske, Cheryl R.
2006-07-11
Environmental samples typically include impurities that interfere with PCR amplification and DNA quantitation. Samples of soil, river water, and aerosol were taken from the environment and added to an aqueous buffer (with or without detergent). Cells from the sample are lysed, releasing their DNA into the buffer. After removing insoluble cell components, the remaining soluble DNA-containing extract is treated with N-phenacylthiazolium bromide, which causes rapid precipitation of impurities. Centrifugation provides a supernatant that can be used or diluted for PCR amplification of DNA, or further purified. The method may provide a DNA-containing extract sufficiently pure for PCR amplification within 5–10 minutes.
Williamson, Jeremy Stuart; Jones, Huw Geraint; Williams, Namor; Griffiths, Anthony Paul; Jenkins, Gareth; Beynon, John; Harris, Dean Anthony
2017-01-01
AIM To identify whether CpG island methylator phenotype (CIMP) is predictive of response to neoadjuvant chemoradiotherapy (NACRT) and outcomes in rectal cancer. METHODS Patients undergoing NACRT and surgical resection for rectal cancer in a tertiary referral centre between 2002-2011 were identified. Pre-treatment tumour biopsies were analysed for CIMP status (high, intermediate or low) using methylation specific PCR. KRAS and BRAF status were also determined using pyrosequencing analysis. Clinical information was extracted from case records and cancer services databases. Response to radiotherapy was measured by tumour regression scores determined upon histological examination of the resected specimen. The relationship between these molecular features, response to NACRT and oncological outcomes were analysed. RESULTS There were 160 patients analysed with a median follow-up time of 46.4 mo. Twenty-one (13%) patients demonstrated high levels of CIMP methylation (CIMP-H) and this was significantly associated with increased risk of extramural vascular invasion (EMVI) compared with CIMP-L [8/21 (38%) vs 15/99 (15%), P = 0.028]. CIMP status was not related to tumour regression after radiotherapy or survival, however EMVI was significantly associated with adverse survival (P < 0.001). Intermediate CIMP status was significantly associated with KRAS mutation (P = 0.01). There were 14 (9%) patients with a pathological complete response (pCR) compared to 116 (73%) patients having no or minimal regression after neoadjuvant chemoradiotherapy. Those patients with pCR had median survival of 106 mo compared to 65.8 mo with minimal regression, although this was not statistically significant (P = 0.26). Binary logistic regression analysis of the relationship between EMVI and other prognostic features revealed, EMVI positivity was associated with poor overall survival, advanced “T” stage and CIMP-H but not nodal status, age, sex, KRAS mutation status and presence of local or systemic recurrence. CONCLUSION We report a novel association of pre-treatment characterisation of CIMP-H with EMVI status which has prognostic implications and is not readily detectable on pre-treatment histological examination. PMID:28567185
Williamson, Jeremy Stuart; Jones, Huw Geraint; Williams, Namor; Griffiths, Anthony Paul; Jenkins, Gareth; Beynon, John; Harris, Dean Anthony
2017-05-15
To identify whether CpG island methylator phenotype (CIMP) is predictive of response to neoadjuvant chemoradiotherapy (NACRT) and outcomes in rectal cancer. Patients undergoing NACRT and surgical resection for rectal cancer in a tertiary referral centre between 2002-2011 were identified. Pre-treatment tumour biopsies were analysed for CIMP status (high, intermediate or low) using methylation specific PCR. KRAS and BRAF status were also determined using pyrosequencing analysis. Clinical information was extracted from case records and cancer services databases. Response to radiotherapy was measured by tumour regression scores determined upon histological examination of the resected specimen. The relationship between these molecular features, response to NACRT and oncological outcomes were analysed. There were 160 patients analysed with a median follow-up time of 46.4 mo. Twenty-one (13%) patients demonstrated high levels of CIMP methylation (CIMP-H) and this was significantly associated with increased risk of extramural vascular invasion (EMVI) compared with CIMP-L [8/21 (38%) vs 15/99 (15%), P = 0.028]. CIMP status was not related to tumour regression after radiotherapy or survival, however EMVI was significantly associated with adverse survival ( P < 0.001). Intermediate CIMP status was significantly associated with KRAS mutation ( P = 0.01). There were 14 (9%) patients with a pathological complete response (pCR) compared to 116 (73%) patients having no or minimal regression after neoadjuvant chemoradiotherapy. Those patients with pCR had median survival of 106 mo compared to 65.8 mo with minimal regression, although this was not statistically significant ( P = 0.26). Binary logistic regression analysis of the relationship between EMVI and other prognostic features revealed, EMVI positivity was associated with poor overall survival, advanced "T" stage and CIMP-H but not nodal status, age, sex, KRAS mutation status and presence of local or systemic recurrence. We report a novel association of pre-treatment characterisation of CIMP-H with EMVI status which has prognostic implications and is not readily detectable on pre-treatment histological examination.
Weiler, Natalie E C; Matai, Anuska S; Sijen, Titia
2012-01-01
Forensic laboratories employ various approaches to obtain short tandem repeat (STR) profiles from minimal traces (<100 pg DNA input). Most approaches aim to sensitize DNA profiling by increasing the amplification level by a higher cycle number or enlarging the amount of PCR products analyzed during capillary electrophoresis. These methods have limitations when unequal mixtures are genotyped, since the major component will be over-amplified or over-loaded. This study explores an alternative strategy for improved detection of the minor components in low template (LT) DNA typing that may be better suited for the detection of the minor component in mixtures. The strategy increases the PCR amplification efficiency by extending the primer annealing time several folds. When the AmpFℓSTR(®) Identifiler(®) amplification parameters are changed to an annealing time of 20 min during all 28 cycles, the drop-out frequency is reduced for both pristine DNA and single or multiple donor mock case work samples. In addition, increased peak heights and slightly more drop-ins are observed while the heterozygous peak balance remains similar as with the conventional Identifiler protocol. By this extended protocol, full DNA profiles were obtained from only 12 sperm heads (which corresponds to 36 pg of DNA) that were collected by laser micro dissection. Notwithstanding the improved detection, allele drop-outs do persist, albeit in lower frequencies. Thus a LT interpretation strategy such as deducing consensus profiles from multiple independent amplifications is appropriate. The use of extended PCR conditions represents a general approach to improve detection of unequal mixtures as shown using four commercially available kits (AmpFℓSTR(®) Identifiler, SEfiler Plus, NGM and Yfiler). The extended PCR protocol seems to amplify more of the molecules in LT samples during PCR, which results in a lower drop-out frequency. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.
Actuation method and apparatus, micropump, and PCR enhancement method
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ullakko, Kari; Mullner, Peter; Hampikian, Greg
An actuation apparatus includes at least one magnetic shape memory (MSM) element containing a material configured to expand and/or contract in response to exposure to a magnetic field. Among other things, the MSM element may be configured to pump fluid through a micropump by expanding and/or contracting in response to the magnetic field. The magnetic field may rotate about an axis of rotation and exhibit a distribution having a component substantially perpendicular to the axis of rotation. Further, the magnetic field distribution may include at least two components substantially orthogonal to one another lying in one or more planes perpendicularmore » to the axis of rotation. The at least one MSM element may contain nickel, manganese, and gallium. A polymerase chain reaction (PCR) may be enhanced by contacting a PCR reagent and DNA material with the MSM element.« less
Single-Cell RT-PCR in Microfluidic Droplets with Integrated Chemical Lysis.
Kim, Samuel C; Clark, Iain C; Shahi, Payam; Abate, Adam R
2018-01-16
Droplet microfluidics can identify and sort cells using digital reverse transcription polymerase chain reaction (RT-PCR) signals from individual cells. However, current methods require multiple microfabricated devices for enzymatic cell lysis and PCR reagent addition, making the process complex and prone to failure. Here, we describe a new approach that integrates all components into a single device. The method enables controlled exposure of isolated single cells to a high pH buffer, which lyses cells and inactivates reaction inhibitors but can be instantly neutralized with RT-PCR buffer. Using our chemical lysis approach, we distinguish individual cells' gene expression with data quality equivalent to more complex two-step workflows. Our system accepts cells and produces droplets ready for amplification, making single-cell droplet RT-PCR faster and more reliable.
Berget, Ellen; Helgeland, Lars; Liseth, Knut; Løkeland, Turid; Molven, Anders; Vintermyr, Olav Karsten
2014-01-01
Aims We aimed to evaluate the prognostic value of routine use of PCR amplification of immunoglobulin gene rearrangements in bone marrow (BM) staging in patients with follicular lymphoma (FL). Methods Clonal rearrangements were assessed by immunoglobulin heavy and light-chain gene rearrangement analysis in BM aspirates from 96 patients diagnosed with FL and related to morphological detection of BM involvement in biopsies. In 71 patients, results were also compared with concurrent flow cytometry analysis. Results BM involvement was detected by PCR in 34.4% (33/96) of patients. The presence of clonal rearrangements by PCR was associated with advanced clinical stage (I–III vs IV; p<0.001), high FL International Prognostic Index (FLIPI) score (0–1, 2 vs ≥3; p=0.003), and detection of BM involvement by morphology and flow cytometry analysis (p<0.001 for both). PCR-positive patients had a significantly poorer survival than PCR-negative patients (p=0.001, log-rank test). Thirteen patients positive by PCR but without morphologically detectable BM involvement, had significantly poorer survival than patients with negative morphology and negative PCR result (p=0.002). The poor survival associated with BM involvement by PCR was independent of the FLIPI score (p=0.007, Cox regression). BM involvement by morphology or flow cytometry did not show a significant impact on survival. Conclusions Our results showed that routine use of PCR-based clonality analysis significantly improved the prognostic impact of BM staging in patients with FL. BM involvement by PCR was also an independent adverse prognostic factor. PMID:25233852
Esteki, M; Nouroozi, S; Shahsavari, Z
2016-02-01
To develop a simple and efficient spectrophotometric technique combined with chemometrics for the simultaneous determination of methyl paraben (MP) and hydroquinone (HQ) in cosmetic products, and specifically, to: (i) evaluate the potential use of successive projections algorithm (SPA) to derivative spectrophotometric data in order to provide sufficient accuracy and model robustness and (ii) determine MP and HQ concentration in cosmetics without tedious pre-treatments such as derivatization or extraction techniques which are time-consuming and require hazardous solvents. The absorption spectra were measured in the wavelength range of 200-350 nm. Prior to performing chemometric models, the original and first-derivative absorption spectra of binary mixtures were used as calibration matrices. Variable selected by successive projections algorithm was used to obtain multiple linear regression (MLR) models based on a small subset of wavelengths. The number of wavelengths and the starting vector were optimized, and the comparison of the root mean square error of calibration (RMSEC) and cross-validation (RMSECV) was applied to select effective wavelengths with the least collinearity and redundancy. Principal component regression (PCR) and partial least squares (PLS) were also developed for comparison. The concentrations of the calibration matrix ranged from 0.1 to 20 μg mL(-1) for MP, and from 0.1 to 25 μg mL(-1) for HQ. The constructed models were tested on an external validation data set and finally cosmetic samples. The results indicated that successive projections algorithm-multiple linear regression (SPA-MLR), applied on the first-derivative spectra, achieved the optimal performance for two compounds when compared with the full-spectrum PCR and PLS. The root mean square error of prediction (RMSEP) was 0.083, 0.314 for MP and HQ, respectively. To verify the accuracy of the proposed method, a recovery study on real cosmetic samples was carried out with satisfactory results (84-112%). The proposed method, which is an environmentally friendly approach, using minimum amount of solvent, is a simple, fast and low-cost analysis method that can provide high accuracy and robust models. The suggested method does not need any complex extraction procedure which is time-consuming and requires hazardous solvents. © 2015 Society of Cosmetic Scientists and the Société Française de Cosmétologie.
Sun, Bing; Tao, Lian; Zheng, Yun-Ling
2014-06-01
Human telomerase reverse transcriptase (hTERT) is an essential component required for telomerase activity and telomere maintenance. Several alternatively spliced forms of hTERT mRNA have been reported in human primary and tumor cells. Currently, however, there is no sensitive and accurate method for the simultaneous quantification of multiple alternatively spliced RNA transcripts, such as in the case of hTERT. Here we show droplet digital PCR (ddPCR) provides sensitive, simultaneous digital quantification in a single reaction of two alternatively spliced single deletion hTERT transcripts (α-/β+ and α+/β-) as well as the opportunity to manually quantify non-deletion (α+/β+) and double deletion (α-/β-) transcripts. Our ddPCR method enables direct comparison among four alternatively spliced mRNAs without the need for internal standards or multiple primer pairs specific for each variant as real-time PCR (qPCR) requires, thus eliminating potential variation due to differences in PCR amplification efficiency.
Human adenovirus is relatively resistant to UV radiation and has been used as a conservative testing microbe for evaluations of UV disinfection systems as components of water treatment processes. In this study, we attempted to validate the applicability of integrated cell culture...
Templar, Alexander; Woodhouse, Stefan; Keshavarz-Moore, Eli; Nesbeth, Darren N
2016-08-01
Advances in synthetic genomics are now well underway in yeasts due to the low cost of synthetic DNA. These new capabilities also bring greater need for quantitating the presence, loss and rearrangement of loci within synthetic yeast genomes. Methods for achieving this will ideally; i) be robust to industrial settings, ii) adhere to a global standard and iii) be sufficiently rapid to enable at-line monitoring during cell growth. The methylotrophic yeast Pichia pastoris (P. pastoris) is increasingly used for industrial production of biotherapeutic proteins so we sought to answer the following questions for this particular yeast species. Is time-consuming DNA purification necessary to obtain accurate end-point polymerase chain reaction (e-pPCR) and quantitative PCR (qPCR) data? Can the novel linear regression of efficiency qPCR method (LRE qPCR), which has properties desirable in a synthetic biology standard, match the accuracy of conventional qPCR? Does cell cultivation scale influence PCR performance? To answer these questions we performed e-pPCR and qPCR in the presence and absence of cellular material disrupted by a mild 30s sonication procedure. The e-pPCR limit of detection (LOD) for a genomic target locus was 50pg (4.91×10(3) copies) of purified genomic DNA (gDNA) but the presence of cellular material reduced this sensitivity sixfold to 300pg gDNA (2.95×10(4) copies). LRE qPCR matched the accuracy of a conventional standard curve qPCR method. The presence of material from bioreactor cultivation of up to OD600=80 did not significantly compromise the accuracy of LRE qPCR. We conclude that a simple and rapid cell disruption step is sufficient to render P. pastoris samples of up to OD600=80 amenable to analysis using LRE qPCR which we propose as a synthetic biology standard. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Samadi; Wajizah, S.; Munawar, A. A.
2018-02-01
Feed plays an important factor in animal production. The purpose of this study is to apply NIRS method in determining feed values. NIRS spectra data were acquired for feed samples in wavelength range of 1000 - 2500 nm with 32 scans and 0.2 nm wavelength. Spectral data were corrected by de-trending (DT) and standard normal variate (SNV) methods. Prediction of in vitro dry matter digestibility (IVDMD) and in vitro organic matter digestibility (IVOMD) were established as model by using principal component regression (PCR) and validated using leave one out cross validation (LOOCV). Prediction performance was quantified using coefficient correlation (r) and residual predictive deviation (RPD) index. The results showed that IVDMD and IVOMD can be predicted by using SNV spectra data with r and RPD index: 0.93 and 2.78 for IVDMD ; 0.90 and 2.35 for IVOMD respectively. In conclusion, NIRS technique appears feasible to predict animal feed nutritive values.
Poláček, Roman; Májek, Pavel; Hroboňová, Katarína; Sádecká, Jana
2016-04-01
Fluoxetine is the most prescribed antidepressant chiral drug worldwide. Its enantiomers have a different duration of serotonin inhibition. A novel simple and rapid method for determination of the enantiomeric composition of fluoxetine in pharmaceutical pills is presented. Specifically, emission, excitation, and synchronous fluorescence techniques were employed to obtain the spectral data, which with multivariate calibration methods, namely, principal component regression (PCR) and partial least square (PLS), were investigated. The chiral recognition of fluoxetine enantiomers in the presence of β-cyclodextrin was based on diastereomeric complexes. The results of the multivariate calibration modeling indicated good prediction abilities. The obtained results for tablets were compared with those from chiral HPLC and no significant differences are shown by Fisher's (F) test and Student's t-test. The smallest residuals between reference or nominal values and predicted values were achieved by multivariate calibration of synchronous fluorescence spectral data. This conclusion is supported by calculated values of the figure of merit.
NASA Astrophysics Data System (ADS)
Lin, Z. D.; Wang, Y. B.; Wang, R. J.; Wang, L. S.; Lu, C. P.; Zhang, Z. Y.; Song, L. T.; Liu, Y.
2017-07-01
A total of 130 topsoil samples collected from Guoyang County, Anhui Province, China, were used to establish a Vis-NIR model for the prediction of organic matter content (OMC) in lime concretion black soils. Different spectral pretreatments were applied for minimizing the irrelevant and useless information of the spectra and increasing the spectra correlation with the measured values. Subsequently, the Kennard-Stone (KS) method and sample set partitioning based on joint x-y distances (SPXY) were used to select the training set. Successive projection algorithm (SPA) and genetic algorithm (GA) were then applied for wavelength optimization. Finally, the principal component regression (PCR) model was constructed, in which the optimal number of principal components was determined using the leave-one-out cross validation technique. The results show that the combination of the Savitzky-Golay (SG) filter for smoothing and multiplicative scatter correction (MSC) can eliminate the effect of noise and baseline drift; the SPXY method is preferable to KS in the sample selection; both the SPA and the GA can significantly reduce the number of wavelength variables and favorably increase the accuracy, especially GA, which greatly improved the prediction accuracy of soil OMC with Rcc, RMSEP, and RPD up to 0.9316, 0.2142, and 2.3195, respectively.
Brown, C. Erwin
1993-01-01
Correlation analysis in conjunction with principal-component and multiple-regression analyses were applied to laboratory chemical and petrographic data to assess the usefulness of these techniques in evaluating selected physical and hydraulic properties of carbonate-rock aquifers in central Pennsylvania. Correlation and principal-component analyses were used to establish relations and associations among variables, to determine dimensions of property variation of samples, and to filter the variables containing similar information. Principal-component and correlation analyses showed that porosity is related to other measured variables and that permeability is most related to porosity and grain size. Four principal components are found to be significant in explaining the variance of data. Stepwise multiple-regression analysis was used to see how well the measured variables could predict porosity and (or) permeability for this suite of rocks. The variation in permeability and porosity is not totally predicted by the other variables, but the regression is significant at the 5% significance level. ?? 1993.
Liu, Hong-Mei; Cheng, Peng; Huang, Xiaodan; Dai, Yu-Hua; Wang, Hai-Fang; Liu, Li-Juan; Zhao, Yu-Qiang; Wang, Huai-Wei; Gong, Mao-Qing
2013-02-01
The present study aimed to investigate deltamethrin resistance in Culex pipiens pallens (C. pipiens pallens) mosquitoes and its correlation with knockdown resistance (kdr) mutations. In addition, mosquito‑resistance testing methods were analyzed. Using specific primers in polymerase chain reaction (PCR) and allele-specific (AS)-PCR, kdr gene sequences isolated from wild C. pipiens pallens mosquitoes were sequenced. Linear regression analysis was used to determine the correlation between the mutations and deltamethrin resistance. A kdr allelic gene was cloned and sequenced. Analysis of the DNA sequences revealed the presence of two point mutations at the L1014 residue in the IIS6 transmembrane segment of the voltage‑gated sodium channel (VGSC): L1014F, TTA→TTT, replacing a leucine (L) with a phenylalanine (F); L1014S, TTA→TCA, replacing leucine (L) with serine (S). Two alternative kdr-like mutations, L1014F and L1014S, were identified to be positively correlated with the deltamethrin-resistant phenotype. In addition a novel mutation, TCT, was identified in the VGSC of C. pipiens pallens. PCR and AS-PCR yielded consistent results with respect to mosquito resistance. However, the detection rate of PCR was higher than that of AS-PCR. Further studies are required to determine the specific resistance mechanism. PCR and AS-PCR demonstrated suitability for mosquito resistance field tests, however, the former method may be superior to the latter.
Ceol, M; Forino, M; Gambaro, G; Sauer, U; Schleicher, E D; D'Angelo, A; Anglani, F
2001-01-01
Gene expression can be examined with different techniques including ribonuclease protection assay (RPA), in situ hybridisation (ISH), and quantitative reverse transcription-polymerase chain reaction (RT/PCR). These methods differ considerably in their sensitivity and precision in detecting and quantifying low abundance mRNA. Although there is evidence that RT/PCR can be performed in a quantitative manner, the quantitative capacity of this method is generally underestimated. To demonstrate that the comparative kinetic RT/PCR strategy-which uses a housekeeping gene as internal standard-is a quantitative method to detect significant differences in mRNA levels between different samples, the inhibitory effect of heparin on phorbol 12-myristate 13-acetate (PMA)-induced-TGF-beta1 mRNA expression was evaluated by RT/PCR and RPA, the standard method of mRNA quantification, and the results were compared. The reproducibility of RT/PCR amplification was calculated by comparing the quantity of G3PDH and TGF-beta1 PCR products, generated during the exponential phases, estimated from two different RT/PCR (G3PDH, r = 0.968, P = 0.0000; TGF-beta1, r = 0.966, P = 0.0000). The quantitative capacity of comparative kinetic RT/PCR was demonstrated by comparing the results obtained from RPA and RT/PCR using linear regression analysis. Starting from the same RNA extraction, but using only 1% of the RNA for the RT/PCR compared to RPA, significant correlation was observed (r = 0.984, P = 0.0004). Moreover the morphometric analysis of ISH signal was applied for the semi-quantitative evaluation of the expression and localisation of TGF-beta1 mRNA in the entire cell population. Our results demonstrate the close similarity of the RT/PCR and RPA methods in giving quantitative information on mRNA expression and indicate the possibility to adopt the comparative kinetic RT/PCR as reliable quantitative method of mRNA analysis. Copyright 2001 Wiley-Liss, Inc.
Sankar, A S Kamatchi; Vetrichelvan, Thangarasu; Venkappaya, Devashya
2011-09-01
In the present work, three different spectrophotometric methods for simultaneous estimation of ramipril, aspirin and atorvastatin calcium in raw materials and in formulations are described. Overlapped data was quantitatively resolved by using chemometric methods, viz. inverse least squares (ILS), principal component regression (PCR) and partial least squares (PLS). Calibrations were constructed using the absorption data matrix corresponding to the concentration data matrix. The linearity range was found to be 1-5, 10-50 and 2-10 μg mL-1 for ramipril, aspirin and atorvastatin calcium, respectively. The absorbance matrix was obtained by measuring the zero-order absorbance in the wavelength range between 210 and 320 nm. A training set design of the concentration data corresponding to the ramipril, aspirin and atorvastatin calcium mixtures was organized statistically to maximize the information content from the spectra and to minimize the error of multivariate calibrations. By applying the respective algorithms for PLS 1, PCR and ILS to the measured spectra of the calibration set, a suitable model was obtained. This model was selected on the basis of RMSECV and RMSEP values. The same was applied to the prediction set and capsule formulation. Mean recoveries of the commercial formulation set together with the figures of merit (calibration sensitivity, selectivity, limit of detection, limit of quantification and analytical sensitivity) were estimated. Validity of the proposed approaches was successfully assessed for analyses of drugs in the various prepared physical mixtures and formulations.
Jorge, Karina T O S; Souza, Renan P; Assis, Marieta T A; Araújo, Marcelo G; Locati, Massimo; Jesus, Amélia M R; Dias Baptista, Ida M F; Lima, Cristiano X; Teixeira, Antônio L; Teixeira, Mauro M; Soriani, Frederico M
2017-05-01
Leprosy is an important cause of disability in the developing world. Early diagnosis is essential to allow for cure and to interrupt transmission of this infection. MicroRNAs (miRNAs) are important factors for host-pathogen interaction and they have been identified as biomarkers for various infectious diseases. The expression profile of 377 microRNAs were analyzed by TaqMan low-density array (TLDA) in skin lesions of tuberculoid and lepromatous leprosy patients as well as skin specimens from healthy controls. In a second step, 16 microRNAs were selected for validation experiments with reverse transcription-quantitative PCR (qRT-PCR) in skin samples from new individuals. Principal-component analysis followed by logistic regression model and receiver operating characteristic (ROC) curve analyses were performed to evaluate the diagnostic potential of selected miRNAs. Four patterns of differential expression were identified in the TLDA experiment, suggesting a diagnostic potential of miRNAs in leprosy. After validation experiments, a combination of four miRNAs (miR-101, miR-196b, miR-27b, and miR-29c) was revealed as able to discriminate between healthy control and leprosy patients with 80% sensitivity and 91% specificity. This set of miRNAs was also able to discriminate between lepromatous and tuberculoid patients with a sensitivity of 83% and 80% specificity. In this work, it was possible to identify a set of miRNAs with good diagnostic potential for leprosy. Copyright © 2017 American Society for Microbiology.
Real-Time PCR Quantification Using A Variable Reaction Efficiency Model
Platts, Adrian E.; Johnson, Graham D.; Linnemann, Amelia K.; Krawetz, Stephen A.
2008-01-01
Quantitative real-time PCR remains a cornerstone technique in gene expression analysis and sequence characterization. Despite the importance of the approach to experimental biology the confident assignment of reaction efficiency to the early cycles of real-time PCR reactions remains problematic. Considerable noise may be generated where few cycles in the amplification are available to estimate peak efficiency. An alternate approach that uses data from beyond the log-linear amplification phase is explored with the aim of reducing noise and adding confidence to efficiency estimates. PCR reaction efficiency is regressed to estimate the per-cycle profile of an asymptotically departed peak efficiency, even when this is not closely approximated in the measurable cycles. The process can be repeated over replicates to develop a robust estimate of peak reaction efficiency. This leads to an estimate of the maximum reaction efficiency that may be considered primer-design specific. Using a series of biological scenarios we demonstrate that this approach can provide an accurate estimate of initial template concentration. PMID:18570886
Schwendimann, Livia; Kauf, Peter; Fieseler, Lars; Gantenbein-Demarchi, Corinne; Miescher Schwenninger, Susanne
2015-08-01
To monitor dominant species of lactic acid bacteria during cocoa bean fermentation, i.e. Lactobacillus plantarum and Lactobacillus fermentum, a fast and reliable culture-independent qPCR assay was developed. A modified DNA isolation procedure using a commercial kit followed by two species-specific qPCR assays resulted in 100% sensitivity for L. plantarum and L. fermentum. Kruskal-Wallis and post-hoc analyses of data obtained from experiments with cocoa beans that were artificially spiked with decimal concentrations of L. plantarum and L. fermentum strains allowed the calculation of a regression line suitable for the estimation of both species with a detection limit of 3 to 4 Log cells/g cocoa beans. This process was successfully tested for efficacy through the analyses of samples from laboratory-scale cocoa bean fermentations with both the qPCR assay and a culture-dependent method which resulted in comparable results. Copyright © 2015 Elsevier B.V. All rights reserved.
Raith, M R; Ebentier, D L; Cao, Y; Griffith, J F; Weisberg, S B
2014-03-01
To determine the extent to which discrepancies between qPCR and culture-based results in beach water quality monitoring can be attributed to: (i) within-method variability, (ii) between-method difference within each method class (qPCR or culture) and (iii) between-class difference. We analysed 306 samples using two culture-based (EPA1600 and Enterolert) and two qPCR (Taqman and Scorpion) methods, each in duplicate. Both qPCR methods correlated with EPA1600, but regression analyses indicated approximately 0·8 log10 unit overestimation by qPCR compared to culture methods. Differences between methods within a class were less than half of this and were minimal for between-replicate within a method. Using the 104 Enterococcus per 100 ml management decision threshold, Taqman qPCR indicated the same decisions as EPA1600 for 87% of the samples, but indicated beach posting for unhealthful water when EPA1600 did not for 12% of the samples. After accounting for within-method and within-class variability, 8% of the samples exhibited true between-class discrepancy where both qPCR methods indicated beach posting while both culture methods did not. Measurement target difference (DNA vs growth) accounted for the majority of the qPCR-vs-culture discrepancy, but its influence on monitoring application is outweighed by frequent incorrect posting with culture methods due to incubation time delay. This is the first study to quantify the frequency with which culture-vs-qPCR discrepancies can be attributed to target difference - vs - method variability. © 2013 The Society for Applied Microbiology.
Nham, Eric G; Pearl, David L; Slavic, Durda; Ouckama, Rachel; Ojkic, Davor; Guerin, Michele T
2017-08-01
Avian reovirus (ARV) is an economically significant pathogen of broiler chickens. Our objective was to determine the prevalence, geographical distribution, and seasonal variation of ARV infection among commercial broiler flocks in Ontario, Canada during grow-out. A cross-sectional study of 231 randomly selected flocks was conducted from July 2010 to January 2012. Fifteen blood samples, 15 whole intestines, and 15 cloacal swabs per flock were collected at slaughter; ELISA and PCR were used to determine a flock's ARV exposure status. Avian reovirus prevalence was 91% (95% CI: 87 to 94). District alone did not significantly explain the overall variation in the prevalence of ARV (univariable logistic regression; P = 0.073), although geographical differences were identified. The odds of ARV presence were significantly lower in the summer/autumn compared to the winter/spring (univariable exact logistic regression; P < 0.001). There was no association between flock mortality and flock ELISA mean titer or PCR status.
Nham, Eric G.; Pearl, David L.; Slavic, Durda; Ouckama, Rachel; Ojkic, Davor; Guerin, Michele T.
2017-01-01
Avian reovirus (ARV) is an economically significant pathogen of broiler chickens. Our objective was to determine the prevalence, geographical distribution, and seasonal variation of ARV infection among commercial broiler flocks in Ontario, Canada during grow-out. A cross-sectional study of 231 randomly selected flocks was conducted from July 2010 to January 2012. Fifteen blood samples, 15 whole intestines, and 15 cloacal swabs per flock were collected at slaughter; ELISA and PCR were used to determine a flock’s ARV exposure status. Avian reovirus prevalence was 91% (95% CI: 87 to 94). District alone did not significantly explain the overall variation in the prevalence of ARV (univariable logistic regression; P = 0.073), although geographical differences were identified. The odds of ARV presence were significantly lower in the summer/autumn compared to the winter/spring (univariable exact logistic regression; P < 0.001). There was no association between flock mortality and flock ELISA mean titer or PCR status. PMID:28761188
Wiszniewsky, Anna; Ritter, Manuel; Goreish, Ibtisam A.; Atti El Mekki, Misk El Yemen A.; Arriens, Sandra; Pfarr, Kenneth; Fimmers, Rolf; Doenhoff, Mike; Hoerauf, Achim; Layland, Laura E.
2016-01-01
Background In the Sudan, Schistosoma mansoni infections are a major cause of morbidity in school-aged children and infection rates are associated with available clean water sources. During infection, immune responses pass through a Th1 followed by Th2 and Treg phases and patterns can relate to different stages of infection or immunity. Methodology This retrospective study evaluated immunoepidemiological aspects in 234 individuals (range 4–85 years old) from Kassala and Khartoum states in 2011. Systemic immune profiles (cytokines and immunoglobulins) and epidemiological parameters were surveyed in n = 110 persons presenting patent S. mansoni infections (egg+), n = 63 individuals positive for S. mansoni via PCR in sera but egg negative (SmPCR+) and n = 61 people who were infection-free (Sm uninf). Immunoepidemiological findings were further investigated using two binary multivariable regression analysis. Principal Findings Nearly all egg+ individuals had no access to latrines and over 90% obtained water via the canal stemming from the Atbara River. With regards to age, infection and an egg+ status was linked to young and adolescent groups. In terms of immunology, S. mansoni infection per se was strongly associated with increased SEA-specific IgG4 but not IgE levels. IL-6, IL-13 and IL-10 were significantly elevated in patently-infected individuals and positively correlated with egg load. In contrast, IL-2 and IL-1β were significantly lower in SmPCR+ individuals when compared to Sm uninf and egg+ groups which was further confirmed during multivariate regression analysis. Conclusions/Significance Schistosomiasis remains an important public health problem in the Sudan with a high number of patent individuals. In addition, SmPCR diagnostics revealed another cohort of infected individuals with a unique immunological profile and provides an avenue for future studies on non-patent infection states. Future studies should investigate the downstream signalling pathways/mechanisms of IL-2 and IL-1β as potential diagnostic markers in order to distinguish patent from non-patent individuals. PMID:27152725
Ohno, Misa; Kida, Yuta; Sakaguchi, Masayoshi; Sugahara, Yasusato; Oyama, Fumitaka
2014-10-08
Mice and humans produce chitinase-like proteins (CLPs), which are highly homologous to chitinases but lack chitinolytic activity. Mice express primarily three CLPs, including breast regression protein-39 (BRP-39) [chitinase 3-like-1 (Chi3l1) or 38-kDa glycoprotein (gp38k)], Ym1 (Chi3l3) and Ym2 (Chi3l4). Recently, CLPs have attracted considerable attention due to their increased expression in a number of pathological conditions, including asthma, allergies, rheumatoid arthritis and malignant tumors. Although the exact functions of CLPs are largely unknown, the significance of their increased expression levels during pathophysiological states needs to be determined. The quantification of BRP-39, Ym1 and Ym2 is an important step in gaining insight into the in vivo regulation of the CLPs. We constructed a standard DNA for quantitative real-time PCR (qPCR) by containing three CLPs target fragments and five reference genes cDNA in a one-to-one ratio. We evaluated this system by analyzing the eight target cDNA sequences. Tissue cDNAs obtained by reverse transcription from total RNA from four embryonic stages and eight adult tissues were analyzed using the qPCR system with the standard DNA. We established a qPCR system detecting CLPs and comparing their expression levels with those of five reference genes using the same scale in mouse tissues. We found that BRP-39 and Ym1 were abundant in the mouse lung, whereas Ym2 mRNA was abundant in the stomach, followed by lung. The expression levels of BRP-39 and Ym1 in the mouse lung were higher than those of two active chitinases and were comparable to glyceraldehyde-3-phosphate dehydrogenase, a housekeeping gene which is constitutively expressed in all tissues. Our results indicate that catalytically inactive BRP-39 and Ym1 are constitutive genes in normal mouse lung.
Yip, Cyril C Y; Sridhar, Siddharth; Cheng, Andrew K W; Fung, Ami M Y; Cheng, Vincent C C; Chan, Kwok-Hung; Yuen, Kwok-Yung
2017-08-01
HHV-6 reactivation in immunocompromised patients is common and may be associated with serious morbidity and mortality; therefore, early detection and initiation of therapy might be of benefit. Real-time PCR assays allow for early identification of HHV-6 reactivation to assist in providing a timely response. Thus, we compared the performance of an in-house developed HHV-6 quantitative PCR assay with a commercially available kit, the RealStar ® HHV-6 PCR Kit. The analytical sensitivity, analytical specificity, linearity, precision and accuracy of the in-house developed HHV-6 qPCR assay were evaluated. The diagnostic performance of the in-house HHV-6 qPCR assay was compared with the RealStar ® HHV-6 PCR Kit, using 72 clinical specimens and 17 proficiency testing samples. Linear regression analysis of the quantitative results showed a dynamic range from 2 to 10 log 10 copies/ml and a coefficient of determination (R 2 ) of 0.999 for the in-house assay. A dilution series demonstrated a limit of detection and a limit of quantification of 1.7 log 10 and 2 log 10 copies/ml, respectively. The precision of the assay was highly reproducible among runs with coefficients of variance (CV) ranging from 0.27% to 4.37%. A comparison of 27 matched samples showed an excellent correlation between the quantitative viral loads measured by the in-house HHV-6 qPCR assay and the RealStar ® HHV-6 PCR Kit (R 2 =0.926; P<0.0001), with an average bias of -0.24 log 10 copies/ml. The in-house developed HHV-6 qPCR method is a sensitive and reliable assay with lower cost for the detection and quantification of HHV-6 DNA when compared to the RealStar ® HHV-6 PCR Kit. Copyright © 2017 Elsevier B.V. All rights reserved.
Zhang, Chi; Fang, Xin; Qiu, Haopu; Li, Ning
2015-01-01
Real-time PCR amplification of mitochondria gene could not be used for DNA quantification, and that of single copy DNA did not allow an ideal sensitivity. Moreover, cross-reactions among similar species were commonly observed in the published methods amplifying repetitive sequence, which hindered their further application. The purpose of this study was to establish a short interspersed nuclear element (SINE)-based real-time PCR approach having high specificity for species detection that could be used in DNA quantification. After massive screening of candidate Sus scrofa SINEs, one optimal combination of primers and probe was selected, which had no cross-reaction with other common meat species. LOD of the method was 44 fg DNA/reaction. Further, quantification tests showed this approach was practical in DNA estimation without tissue variance. Thus, this study provided a new tool for qualitative detection of porcine component, which could be promising in the QC of meat products.
Liquid Biopsy: A Future Tool for Posttreatment Surveillance in Head and Neck Cancer?
van Ginkel, Joost H; Huibers, Manon M H; Noorlag, Rob; de Bree, Remco; van Es, Robert J J; Willems, Stefan M
2017-01-01
The prognosis of head and neck squamous cell carcinoma (HNSCC) is largely based on disease stage. Despite improvements in treatment, recurrence rates are still considered high. Currently, disease progression or regression after curative treatment is monitored by clinical evaluation combined with flexible endoscopy and/or imaging. However, specificity of imaging is low due to the posttreatment effects. Detection of circulating tumor DNA (ctDNA) from blood samples of HNSCC patients is a minimally invasive technique that could lead to an earlier detection of recurrence. In addition, digital droplet PCR (ddPCR) could be used to sensitively detect these mutational targets. Future study on ctDNA using ddPCR in blood samples of HNSCC patients is recommended during the follow-up stage to detect recurrences in a timely manner. © 2016 S. Karger AG, Basel.
Smith, Matthew M.; Schmutz, Joel A.; Apelgren, Chloe; Ramey, Andy M.
2015-01-01
Microscopic examination of blood smears can be effective at diagnosing and quantifying hematozoa infections. However, this method requires highly trained observers, is time consuming, and may be inaccurate for detection of infections at low levels of parasitemia. To develop a molecular methodology for identifying and quantifying Leucocytozoon parasite infection in wild waterfowl (Anseriformes), we designed a real-time, quantitative PCR protocol to amplify Leucocytozoon mitochondrial DNA using TaqMan fluorogenic probes and validated our methodology using blood samples collected from waterfowl in interior Alaska during late summer and autumn (n = 105). By comparing our qPCR results to those derived from a widely used nested PCR protocol, we determined that our assay showed high levels of sensitivity (91%) and specificity (100%) in detecting Leucocytozoon DNA from host blood samples. Additionally, results of a linear regression revealed significant correlation between the raw measure of parasitemia produced by our qPCR assay (Ct values) and numbers of parasites observed on blood smears (R2 = 0.694, P = 0.003), indicating that our assay can reliably determine the relative parasitemia levels among samples. This methodology provides a powerful new tool for studies assessing effects of haemosporidian infection in wild avian species.
Trama, Jason P; Adelson, Martin E; Mordechai, Eli
2007-12-01
Laboratory diagnosis of molluscum contagiosum virus (MCV) is important as lesions can be confused with those caused by Cryptococcus neoformans, herpes simplex virus, human papillomavirus, and varicella-zoster virus. To develop a rapid method for identifying patients infected with MCV via swab sampling. Two dual-labeled probe real-time PCR assays, one homologous to the p43K gene and one to the MC080R gene, were designed. The p43K PCR was designed to be used in conjunction with Pyrosequencing for confirmation of PCR products and discrimination between MCV1 and MCV2. Both PCR assays were optimized with respect to reaction components, thermocycling parameters, and primer and probe concentrations. The specificities of both PCR assays were confirmed by non-amplification of 38 known human pathogens. Sensitivity assays demonstrated detection of as few as 10 copies per reaction. Testing 703 swabs, concordance between the two real-time PCR assays was 99.9%. Under the developed conditions, Pyrosequencing of the p43K PCR product was capable of providing enough nucleotide sequence to definitively differentiate MCV1 and MCV2. These real-time PCR assays can be used for the rapid, sensitive, and specific detection of MCV and, when combined with Pyrosequencing, can further discriminate between MCV1 and MCV2.
Karatas, Fatih; Erdem, Gokmen Umut; Sahin, Suleyman; Aytekin, Aydin; Yuce, Deniz; Sever, Ali R; Babacan, Taner; Ates, Ozturk; Ozisik, Yavuz; Altundag, Kadri
2017-04-01
The relation between higher body mass index (BMI) and pathological complete response (pCR) to neoadjuvant chemotherapy (NAC) in breast cancer (BC) is a controversial issue according to the data of Western and Asian patients. The aim of this study is to evaluate BMI and pCR to NAC and discuss the importance of pCR outcomes in Turkish BC patients as a bridging country between Europe and Asia. Of the 4423 BC patients diagnosed between the years 1994 and 2015 in Hacettepe University Cancer Institute, 295 female patients with stage II and III BC were enrolled in the study. Three different group divisions were done according to patients' BMI as normal or underweight (N/U) patients (BMI <25 kg/m 2 ), overweight (OW) patients (BMI = 25-29.9 kg/m 2 ) and obese (OB) patients (BMI ≥30 kg/m 2 ). BC subtypes were defined as luminal-like (ER/PR-positive and HER2-negative), HER2/luminal (ER/PR-positive and HER2-positive), HER2-type (ER/PR-negative and HER2-positive), and triple-negative (TNBC; ER/PR- and HER2-negative). The analysis of overall survival (OS) and recurrence-free survival (RFS) was performed according to Kaplan-Meier method. The Log-rank test was used to compare the subgroup analysis and logistic regression analysis to determine the independent prognostic factors. In this study, a total number of 93 (31.5%) patients were N/U, 107 (36.3%) patients were OW and 95 (32.2%) patients were OB. Among groups, except for the age, no baseline clinicopathological differences were found. In 70 (23.7%) patients, pCR was achieved. pCR rates in N/U, OW and OB were 31.2%, 22.4%, and 17.9% respectively, showing a considerable trend towards significance (P = 0.09 in chi-square test). In the multivariate logistic regression analysis, obesity was an independent adverse prognostic feature on pCR to NAC compared to N/U patients (OR, 0.34; 95% CI, 0.13 to 0.85, P = 0.02). The recurrence rates were slightly increased with the increase of BMI (N/U = 24.7%, OW = 29.0% and OB = 40%; P = 0.06 respectively). Median RFS was significantly higher in N/U group compared to OB patients (150 vs. 76 months respectively, P = 0.03) and was also higher in pCR group compared to non-pCR patients (151 vs. 77 months P = 0.004). Median OS was significantly higher in N/U patients compared to OB patients (N/U = not reached, OW = 211 and OB = 114 months; P = 0.01) and was also higher in pCR group compared to non-pCR patients (not reached vs. 211 months P = 0.04). In Cox regression analysis; pCR, histopathological grade and TNBC were found as independent prognostic factors on OS (HR, 0.29; 95% CI, 0.11 to 0.79, P = 0.015, HR, 2.09; 95% CI, 1.14 to 3.83, P = 0.017, HR, 1.95; 95% CI, 1.01 to 3.77, P = 0.046, respectively). It was observed that obesity was an important independent prognostic factor which has an adverse effect on pCR. Moreover it causes decreasing RFS and OS in BC patients who had received NAC. The probability of inefficient treatment in obese patients should be considered. Copyright © 2016 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Pal, I.; Lall, U.; Robertson, A. W.; Cane, M. A.; Bansal, R.
2013-06-01
Snowmelt-dominated streamflow of the Western Himalayan rivers is an important water resource during the dry pre-monsoon spring months to meet the irrigation and hydropower needs in northern India. Here we study the seasonal prediction of melt-dominated total inflow into the Bhakra Dam in northern India based on statistical relationships with meteorological variables during the preceding winter. Total inflow into the Bhakra Dam includes the Satluj River flow together with a flow diversion from its tributary, the Beas River. Both are tributaries of the Indus River that originate from the Western Himalayas, which is an under-studied region. Average measured winter snow volume at the upper-elevation stations and corresponding lower-elevation rainfall and temperature of the Satluj River basin were considered as empirical predictors. Akaike information criteria (AIC) and Bayesian information criteria (BIC) were used to select the best subset of inputs from all the possible combinations of predictors for a multiple linear regression framework. To test for potential issues arising due to multicollinearity of the predictor variables, cross-validated prediction skills of the best subset were also compared with the prediction skills of principal component regression (PCR) and partial least squares regression (PLSR) techniques, which yielded broadly similar results. As a whole, the forecasts of the melt season at the end of winter and as the melt season commences were shown to have potential skill for guiding the development of stochastic optimization models to manage the trade-off between irrigation and hydropower releases versus flood control during the annual fill cycle of the Bhakra Reservoir, a major energy and irrigation source in the region.
Statistical downscaling of summer precipitation over northwestern South America
NASA Astrophysics Data System (ADS)
Palomino Lemus, Reiner; Córdoba Machado, Samir; Raquel Gámiz Fortis, Sonia; Castro Díez, Yolanda; Jesús Esteban Parra, María
2015-04-01
In this study a statistical downscaling (SD) model using Principal Component Regression (PCR) for simulating summer precipitation in Colombia during the period 1950-2005, has been developed, and climate projections during the 2071-2100 period by applying the obtained SD model have been obtained. For these ends the Principal Components (PCs) of the SLP reanalysis data from NCEP were used as predictor variables, while the observed gridded summer precipitation was the predictand variable. Period 1950-1993 was utilized for calibration and 1994-2010 for validation. The Bootstrap with replacement was applied to provide estimations of the statistical errors. All models perform reasonably well at regional scales, and the spatial distribution of the correlation coefficients between predicted and observed gridded precipitation values show high values (between 0.5 and 0.93) along Andes range, north and north Pacific of Colombia. Additionally, the ability of the MIROC5 GCM to simulate the summer precipitation in Colombia, for present climate (1971-2005), has been analyzed by calculating the differences between the simulated and observed precipitation values. The simulation obtained by this GCM strongly overestimates the precipitation along a horizontal sector through the center of Colombia, especially important at the east and west of this country. However, the SD model applied to the SLP of the GCM shows its ability to faithfully reproduce the rainfall field. Finally, in order to get summer precipitation projections in Colombia for the period 1971-2100, the downscaled model, recalibrated for the total period 1950-2010, has been applied to the SLP output from MIROC5 model under the RCP2.6, RCP4.5 and RCP8.5 scenarios. The changes estimated by the SD models are not significant under the RCP2.6 scenario, while for the RCP4.5 and RCP8.5 scenarios a significant increase of precipitation appears regard to the present values in all the regions, reaching around the 27% in northern Colombia region under the RCP8.5 scenario. Keywords: Statistical downscaling, precipitation, Principal Component Regression, climate change, Colombia. ACKNOWLEDGEMENTS This work has been financed by the projects P11-RNM-7941 (Junta de Andalucía-Spain) and CGL2013-48539-R (MINECO-Spain, FEDER).
Warner, Erica T.; Ballman, Karla V.; Strand, Carrie; Boughey, Judy; Buzdar, Aman U.; Carey, Lisa A.; Sikov, William M.; Partridge, H.
2016-01-01
Purpose Previous studies demonstrated poor response to neoadjuvant systemic therapy (NST) for breast cancer among black women and women who are overweight or obese but this may be due to chemotherapy under dosing. We assessed associations of race, ethnicity and body mass index (BMI) with pathologic complete response (pCR) in clinical trial populations. Methods 1797 women enrolled in four NST trials (CALGB 40601, 40603; ACOSOG Z1041, Z1071) were included. Tumor subtypes were defined by estrogen receptor (ER) and HER2 status. Logistic regression generated odds ratios (OR) and 95% confidence intervals (CI) for the associations of race, ethnicity, and BMI with pCR adjusting for subtype, study arm, lymph node status, tumor size, and tumor grade. Results 253 (14.1%) were black, 199 (11.1%) Hispanic, 520 (28.9%) overweight, and 743 (41.4%) obese. Compared to whites, Blacks and Hispanics were more likely to be obese and Blacks were more likely to have triple-negative cancer. pCR rates differed significantly by tumor subtype. In multivariate analyses, neither race (black vs. white: OR: 1.18, 95% CI: 0.85–1.62) nor ethnicity (Hispanic vs. non-Hispanic: OR: 1.30, 95% CI: 0.67–2.53) were significant predictors of pCR overall or by subtype. Overweight and obese women had lower pCR rates in ER+/HER2+, but higher pCR rates in ER−/HER2+ cancers. Conclusions There was no difference in breast pCR according to race or ethnicity. Overall, there was no major difference in pCR rates by BMI. These findings suggest that pCR with optimally dosed NST is a function of tumor, rather than patient, biology. PMID:27449492
Warner, Erica T; Ballman, Karla V; Strand, Carrie; Boughey, Judy C; Buzdar, Aman U; Carey, Lisa A; Sikov, William M; Partridge, Ann H
2016-08-01
Previous studies demonstrated poor response to neoadjuvant systemic therapy (NST) for breast cancer among black women and women who are overweight or obese, but this may be due to chemotherapy underdosing. We assessed associations of race, ethnicity, and body mass index (BMI) with pathologic complete response (pCR) in clinical trial populations. 1797 women enrolled in four NST trials (CALGB 40601, 40603; ACOSOG Z1041, Z1071) were included. Tumor subtypes were defined by estrogen receptor (ER) and HER2 status. Logistic regression generated odds ratios (OR) and 95 % confidence intervals (CI) for the associations of race, ethnicity, and BMI with in-breast pCR adjusting for subtype, study arm, lymph node status, tumor size, and tumor grade. 253 (14.1 %) were black, 199 (11.1 %) Hispanic, 520 (28.9 %) overweight, and 743 (41.4 %) obese. Compared to whites, Blacks and Hispanics were more likely to be obese and Blacks were more likely to have triple-negative cancer. pCR rates differed significantly by tumor subtype. In multivariate analyses, neither race (black vs white: OR 1.18, 95 % CI 0.85-1.62) nor ethnicity (Hispanic vs non-Hispanic; OR 1.30, 95 % CI 0.67-2.53) were significant predictors of pCR overall or by subtype. Overweight and obese women had lower pCR rates in ER+/HER2+, but higher pCR rates in ER-/HER2+ cancers. There was no difference in pCR according to race or ethnicity. Overall, there was no major difference in pCR rates by BMI. These findings suggest that pCR with optimally dosed NST is a function of tumor, rather than patient, biology.
Mengoli, Carlo; Springer, Jan; Bretagne, Stéphane; Cuenca-Estrella, Manuel; Klingspor, Lena; Lagrou, Katrien; Melchers, Willem J. G.; Morton, C. Oliver; Barnes, Rosemary A.; Donnelly, J. Peter; White, P. Lewis
2015-01-01
The use of serum or plasma for Aspergillus PCR testing facilitates automated and standardized technology. Recommendations for serum testing are available, and while serum and plasma are regularly considered interchangeable for use in fungal diagnostics, differences in galactomannan enzyme immunoassay (GM-EIA) performance have been reported and are attributed to clot formation. Therefore, it is important to assess plasma PCR testing to determine if previous recommendations for serum are applicable and also to compare analytical performance with that of serum PCR. Molecular methods testing serum and plasma were compared through multicenter distribution of quality control panels, with additional studies to investigate the effect of clot formation and blood fractionation on DNA availability. Analytical sensitivity and time to positivity (TTP) were compared, and a regression analysis was performed to identify variables that enhanced plasma PCR performance. When testing plasma, sample volume, preextraction-to-postextraction volume ratio, PCR volume, duplicate testing, and the use of an internal control for PCR were positively associated with performance. When whole-blood samples were spiked and then fractionated, the analytical sensitivity and TTP were superior when testing plasma. Centrifugation had no effect on DNA availability, whereas the presence of clot material significantly lowered the concentration (P = 0.028). Technically, there are no major differences in the molecular processing of serum and plasma, but the formation of clot material potentially reduces available DNA in serum. During disease, Aspergillus DNA burdens in blood are often at the limits of PCR performance. Using plasma might improve performance while maintaining the methodological simplicity of serum testing. PMID:26085614
Loeffler, Juergen; Mengoli, Carlo; Springer, Jan; Bretagne, Stéphane; Cuenca-Estrella, Manuel; Klingspor, Lena; Lagrou, Katrien; Melchers, Willem J G; Morton, C Oliver; Barnes, Rosemary A; Donnelly, J Peter; White, P Lewis
2015-09-01
The use of serum or plasma for Aspergillus PCR testing facilitates automated and standardized technology. Recommendations for serum testing are available, and while serum and plasma are regularly considered interchangeable for use in fungal diagnostics, differences in galactomannan enzyme immunoassay (GM-EIA) performance have been reported and are attributed to clot formation. Therefore, it is important to assess plasma PCR testing to determine if previous recommendations for serum are applicable and also to compare analytical performance with that of serum PCR. Molecular methods testing serum and plasma were compared through multicenter distribution of quality control panels, with additional studies to investigate the effect of clot formation and blood fractionation on DNA availability. Analytical sensitivity and time to positivity (TTP) were compared, and a regression analysis was performed to identify variables that enhanced plasma PCR performance. When testing plasma, sample volume, preextraction-to-postextraction volume ratio, PCR volume, duplicate testing, and the use of an internal control for PCR were positively associated with performance. When whole-blood samples were spiked and then fractionated, the analytical sensitivity and TTP were superior when testing plasma. Centrifugation had no effect on DNA availability, whereas the presence of clot material significantly lowered the concentration (P = 0.028). Technically, there are no major differences in the molecular processing of serum and plasma, but the formation of clot material potentially reduces available DNA in serum. During disease, Aspergillus DNA burdens in blood are often at the limits of PCR performance. Using plasma might improve performance while maintaining the methodological simplicity of serum testing. Copyright © 2015 Loeffler et al.
Common rs5918 (PlA1/A2) polymorphism in the ITGB3 gene and risk of coronary artery disease
Heidari, Mohammad Mehdi; Soheilyfar, Sorour
2016-01-01
Introduction The T to C transition at nucleotide 1565 of the human glycoprotein IIIa (ITGB3) gene represents a genetic polymorphism (PlA1/A2) that can influence both platelet activation and aggregation and that has been associated with many types of disease. Here, we present a newly designed multiplex tetra-primer amplification refractory mutation system – polymerase chain reaction (T-ARMS-PCR) for genotyping a single nucleotide polymorphism (SNP) (dbSNP ID: rs5918) in the human ITGB3 gene. Material and methods We set up T-ARMS-PCR for the rs5918 SNP in a single-step PCR and the results were validated by the PCR-RFLP method in 132 coronary artery disease (CAD) patients and 122 unrelated healthy individuals. Results Full accordance was found for genotype determination by the PCR-RFLP method. The multiple logistic regression analysis showed a significant association of the rs5918 polymorphism and CAD according to dominant and recessive models (dominant model OR: 2.40, 95% CI: 1.33–4.35; p = 0.003, recessive model OR: 4.71, 95% CI: 1.32–16.80; p = 0.0067). Conclusions Our T-ARMS-PCR in comparison with RFLP and allele-specific PCR is more advantageous because this PCR method allows the evaluation of both the wild type and the mutant allele in the same tube. Our results suggest that the rs5918 (PlA1/A2) polymorphism in the ITGB3 gene may contribute to the susceptibility of sporadic Iranian coronary artery disease (CAD) patients. PMID:28905013
Lee, Hea Yon; Kang, Hye Seon; Lee, Hwa Young; Rhee, Chin Kook; Lee, Sook Young; Kim, Seok Chan; Kim, Seung Joon; Park, Yeon Joon; Kim, Young Kyoon; Kang, Ji Young
2017-05-01
Pneumocystis jirovecii polymerase chain reaction (PCR) can be helpful in diagnosing Pneumocystis pneumonia (PCP); however it has limitations. We evaluated the prevalence of positive P. jirovecii PCR from non-human immunodeficiency virus (HIV) immunocompromised patients and tried to determine the risk of PCP development. Between May 2009 and September 2012, P. jirovecii PCR was performed in bronchoscopic specimens from 1,231 adult non-HIV immunocompromised patients suspected of respiratory infection. Only 169 patients (13.7%) who were tested positive for P. jirovecii PCR were enrolled. Retrospective chart review was performed. PCP was defined in patients with positive P. jirovecii PCR who were treated for PCP based on the clinical decision. From 169 P. jirovecii PCR-positive patients, 90 patients were in the PCP group (53.3%) and 79 patients were in the non-PCP group (46.7%). In the PCP group, 38% of patients expired or aggravated after therapy, whereas the majority of patients (84%) in the non-PCP group recovered without treatment for PCP. Independent risk factors for PCP by binary logistic regression analysis were underlying conditions- hematological malignancies, solid tumors or solid organ transplantation, dyspnea, age < 60 years, and albumin < 2.9 g/dL. This study suggests that not all P. jirovecii PCR-positive patients need to be treated for PCP. Among P. jirovecii PCR-positive patients, those who are less than 60 years old, with hematological malignancies, solid tumors or solid organ transplantation, low albumin, and with symptoms of dyspnea, the possibility of PCP might be higher. Treatment should also be selected to these patients.
Comparative quantification of human intestinal bacteria based on cPCR and LDR/LCR
Tang, Zhou-Rui; Li, Kai; Zhou, Yu-Xun; Xiao, Zhen-Xian; Xiao, Jun-Hua; Huang, Rui; Gu, Guo-Hao
2012-01-01
AIM: To establish a multiple detection method based on comparative polymerase chain reaction (cPCR) and ligase detection reaction (LDR)/ligase chain reaction (LCR) to quantify the intestinal bacterial components. METHODS: Comparative quantification of 16S rDNAs from different intestinal bacterial components was used to quantify multiple intestinal bacteria. The 16S rDNAs of different bacteria were amplified simultaneously by cPCR. The LDR/LCR was examined to actualize the genotyping and quantification. Two beneficial (Bifidobacterium, Lactobacillus) and three conditionally pathogenic bacteria (Enterococcus, Enterobacterium and Eubacterium) were used in this detection. With cloned standard bacterial 16S rDNAs, standard curves were prepared to validate the quantitative relations between the ratio of original concentrations of two templates and the ratio of the fluorescence signals of their final ligation products. The internal controls were added to monitor the whole detection flow. The quantity ratio between two bacteria was tested. RESULTS: cPCR and LDR revealed obvious linear correlations with standard DNAs, but cPCR and LCR did not. In the sample test, the distributions of the quantity ratio between each two bacterial species were obtained. There were significant differences among these distributions in the total samples. But these distributions of quantity ratio of each two bacteria remained stable among groups divided by age or sex. CONCLUSION: The detection method in this study can be used to conduct multiple intestinal bacteria genotyping and quantification, and to monitor the human intestinal health status as well. PMID:22294830
Comparative quantification of human intestinal bacteria based on cPCR and LDR/LCR.
Tang, Zhou-Rui; Li, Kai; Zhou, Yu-Xun; Xiao, Zhen-Xian; Xiao, Jun-Hua; Huang, Rui; Gu, Guo-Hao
2012-01-21
To establish a multiple detection method based on comparative polymerase chain reaction (cPCR) and ligase detection reaction (LDR)/ligase chain reaction (LCR) to quantify the intestinal bacterial components. Comparative quantification of 16S rDNAs from different intestinal bacterial components was used to quantify multiple intestinal bacteria. The 16S rDNAs of different bacteria were amplified simultaneously by cPCR. The LDR/LCR was examined to actualize the genotyping and quantification. Two beneficial (Bifidobacterium, Lactobacillus) and three conditionally pathogenic bacteria (Enterococcus, Enterobacterium and Eubacterium) were used in this detection. With cloned standard bacterial 16S rDNAs, standard curves were prepared to validate the quantitative relations between the ratio of original concentrations of two templates and the ratio of the fluorescence signals of their final ligation products. The internal controls were added to monitor the whole detection flow. The quantity ratio between two bacteria was tested. cPCR and LDR revealed obvious linear correlations with standard DNAs, but cPCR and LCR did not. In the sample test, the distributions of the quantity ratio between each two bacterial species were obtained. There were significant differences among these distributions in the total samples. But these distributions of quantity ratio of each two bacteria remained stable among groups divided by age or sex. The detection method in this study can be used to conduct multiple intestinal bacteria genotyping and quantification, and to monitor the human intestinal health status as well.
Local Prediction Models on Mid-Atlantic Ridge MORB by Principal Component Regression
NASA Astrophysics Data System (ADS)
Ling, X.; Snow, J. E.; Chin, W.
2017-12-01
The isotopic compositions of the daughter isotopes of long-lived radioactive systems (Sr, Nd, Hf and Pb ) can be used to map the scale and history of mantle heterogeneities beneath mid-ocean ridges. Our goal is to relate the multidimensional structure in the existing isotopic dataset with an underlying physical reality of mantle sources. The numerical technique of Principal Component Analysis is useful to reduce the linear dependence of the data to a minimum set of orthogonal eigenvectors encapsulating the information contained (cf Agranier et al 2005). The dataset used for this study covers almost all the MORBs along mid-Atlantic Ridge (MAR), from 54oS to 77oN and 8.8oW to -46.7oW, including replicating the dataset of Agranier et al., 2005 published plus 53 basalt samples dredged and analyzed since then (data from PetDB). The principal components PC1 and PC2 account for 61.56% and 29.21%, respectively, of the total isotope ratios variability. The samples with similar compositions to HIMU and EM and DM are identified to better understand the PCs. PC1 and PC2 are accountable for HIMU and EM whereas PC2 has limited control over the DM source. PC3 is more strongly controlled by the depleted mantle source than PC2. What this means is that all three principal components have a high degree of significance relevant to the established mantle sources. We also tested the relationship between mantle heterogeneity and sample locality. K-means clustering algorithm is a type of unsupervised learning to find groups in the data based on feature similarity. The PC factor scores of each sample are clustered into three groups. Cluster one and three are alternating on the north and south MAR. Cluster two exhibits on 45.18oN to 0.79oN and -27.9oW to -30.40oW alternating with cluster one. The ridge has been preliminarily divided into 16 sections considering both the clusters and ridge segments. The principal component regression models the section based on 6 isotope ratios and PCs. The prediction residual is about 1-2km. It means that the combined 5 isotopes are a strong predictor of geographic location along the ridge, a slightly surprising result. PCR is a robust and powerful method for both visualizing and manipulating the multidimensional representation of isotope data.
Nunokawa, Takahiro; Yokogawa, Naoto; Shimada, Kota; Sugii, Shoji
2018-05-03
To evaluate the effect of sulfasalazine (SSZ) on the presence of Pneumocystis jirovecii (P. jirovecii) in the lungs of rheumatoid arthritis (RA) patients. We retrospectively studied episodes of suspected P. jirovecii pneumonia (PJP) which were examined for P. jirovecii with polymerase chain reaction (PCR). We employed a test negative design case-control study; the cases were episodes of suspected PJP that were positive for PCR, and the controls were episodes of suspected PJP that were negative for PCR. The odds ratio for the positive PCR result associated with SSZ use was estimated by Firth's logistic regression. Between 2003 and 2017, 36 cases and 83 controls were identified. While none of the cases received SSZ before the episode, 18 of the controls received the drug. In the primary analysis involving all the episodes, SSZ use was negatively associated with PCR positivity (adjusted odds ratio, 0.087; confidence interval, <0.001-0.789). The sensitivity analysis, excluding those who received PJP prophylaxis, showed the same association as the primary analysis (adjusted odds ratio 0.085, 95% CI <0.001-0.790). This study demonstrated that SSZ use is associated with the absence of P. jirovecii in the lung, suggesting the preventive efficacy of the drug against PJP.
Hung, Tran Quang; Chin, Wai Hoe; Sun, Yi; Wolff, Anders; Bang, Dang Duong
2017-04-15
Solid-phase PCR (SP-PCR) has become increasingly popular for molecular diagnosis and there have been a few attempts to incorporate SP-PCR into lab-on-a-chip (LOC) devices. However, their applicability for on-line diagnosis is hindered by the lack of sensitive and portable on-chip optical detection technology. In this paper, we addressed this challenge by combining the SP-PCR with super critical angle fluorescence (SAF) microlens array embedded in a microchip. We fabricated miniaturized SAF microlens array as part of a microfluidic chamber in thermoplastic material and performed multiplexed SP-PCR directly on top of the SAF microlens array. Attribute to the high fluorescence collection efficiency of the SAF microlens array, the SP-PCR assay on the LOC platform demonstrated a high sensitivity of 1.6 copies/µL, comparable to off-chip detection using conventional laser scanner. The combination of SP-PCR and SAF microlens array allows for on-chip highly sensitive and multiplexed pathogen detection with low-cost and compact optical components. The LOC platform would be widely used as a high-throughput biosensor to analyze food, clinical and environmental samples. Copyright © 2016 Elsevier B.V. All rights reserved.
A candidate pheromone receptor and two odorant receptors of the hawkmoth Manduca sexta.
Patch, Harland M; Velarde, Rodrigo A; Walden, Kimberly K O; Robertson, Hugh M
2009-05-01
In this study, we cloned and characterized three Manduca sexta odorant receptors (ORs). One receptor is a putative pheromone receptor expressed exclusively in a cell associated with male-specific type-I trichoid sensilla. We describe the results of real-time PCR (RT-PCR) and quantitative real-time PCR (qRT-PCR) experiments that show MsextaOR1 is expressed only in male antennae. In situ hybridization labels a single cell associated with type-1 trichoid sensilla, which houses two neurons that have been previously determined to respond to the major components of the pheromone blend. The second receptor, MsextaOR2, was discovered using degenerate primers designed to conserved motifs of a unique group ORs that share as much as 88% identity. Comparison of RT-PCR, qRT-PCR, and in situ hybridization results with those of ORs in the Drosophila melanogaster Or83b subfamily shows a strong sequence and expression pattern similarity. The third receptor, MsextaOR3, was found by 5'-end sequencing of a normalized and subtracted cDNA library from male M. sexta antennae. RT-PCR and qRT-PCR show that this receptor is expressed only in male and female antennae. These are the first ORs, including a putative pheromone receptor, to be described from M. sexta.
NASA Astrophysics Data System (ADS)
Jiang, Weiping; Ma, Jun; Li, Zhao; Zhou, Xiaohui; Zhou, Boye
2018-05-01
The analysis of the correlations between the noise in different components of GPS stations has positive significance to those trying to obtain more accurate uncertainty of velocity with respect to station motion. Previous research into noise in GPS position time series focused mainly on single component evaluation, which affects the acquisition of precise station positions, the velocity field, and its uncertainty. In this study, before and after removing the common-mode error (CME), we performed one-dimensional linear regression analysis of the noise amplitude vectors in different components of 126 GPS stations with a combination of white noise, flicker noise, and random walking noise in Southern California. The results show that, on the one hand, there are above-moderate degrees of correlation between the white noise amplitude vectors in all components of the stations before and after removal of the CME, while the correlations between flicker noise amplitude vectors in horizontal and vertical components are enhanced from un-correlated to moderately correlated by removing the CME. On the other hand, the significance tests show that, all of the obtained linear regression equations, which represent a unique function of the noise amplitude in any two components, are of practical value after removing the CME. According to the noise amplitude estimates in two components and the linear regression equations, more accurate noise amplitudes can be acquired in the two components.
Multivariate classification of the infrared spectra of cell and tissue samples
DOE Office of Scientific and Technical Information (OSTI.GOV)
Haaland, D.M.; Jones, H.D.; Thomas, E.V.
1997-03-01
Infrared microspectroscopy of biopsied canine lymph cells and tissue was performed to investigate the possibility of using IR spectra coupled with multivariate classification methods to classify the samples as normal, hyperplastic, or neoplastic (malignant). IR spectra were obtained in transmission mode through BaF{sub 2} windows and in reflection mode from samples prepared on gold-coated microscope slides. Cytology and histopathology samples were prepared by a variety of methods to identify the optimal methods of sample preparation. Cytospinning procedures that yielded a monolayer of cells on the BaF{sub 2} windows produced a limited set of IR transmission spectra. These transmission spectra weremore » converted to absorbance and formed the basis for a classification rule that yielded 100{percent} correct classification in a cross-validated context. Classifications of normal, hyperplastic, and neoplastic cell sample spectra were achieved by using both partial least-squares (PLS) and principal component regression (PCR) classification methods. Linear discriminant analysis applied to principal components obtained from the spectral data yielded a small number of misclassifications. PLS weight loading vectors yield valuable qualitative insight into the molecular changes that are responsible for the success of the infrared classification. These successful classification results show promise for assisting pathologists in the diagnosis of cell types and offer future potential for {ital in vivo} IR detection of some types of cancer. {copyright} {ital 1997} {ital Society for Applied Spectroscopy}« less
Otsuka, Makoto; Fukui, Yuya; Ozaki, Yukihiro
2009-03-01
The purpose of this study was to evaluate the enzymatic stability of colloidal trypsin powder during heating in a solid-state by using Fourier transform infrared (FT-IR) spectra with chemoinformatics and generalized two-dimensional (2D) correlation spectroscopy. Colloidal crystalline trypsin powders were heated using differential scanning calorimetry. The enzymatic activity of trypsin was assayed by the kinetic degradation method. Spectra of 10 calibration sample sets were recorded three times with a FT-IR spectrometer. The maximum intensity at 1634cm(-1) of FT-IR spectra and enzymatic activity of trypsin decreased as the temperature increased. The FT-IR spectra of trypsin samples were analyzed by a principal component regression analysis (PCR). A plot of the calibration data obtained was made between the actual and predicted trypsin activity based on a two-component model with gamma(2)=0.962. On the other hand, a 2D method was applied to FT-IR spectra of heat-treated trypsin. The result was consistent with that of the chemoinformetrical method. The results for deactivation of colloidal trypsin powder by heat-treatment indicated that nano-structure of crystalline trypsin changed by heating reflecting that the beta-sheet was mainly transformed, since the peak at 1634cm(-1) decreased with dehydration. The FT-IR chemoinformetrical method allows for a solid-state quantitative analysis of the bioactivity of the bulk powder of trypsin during drying.
Doescher, A; Loges, U; Petershofen, E K; Müller, T H
2017-11-01
Enumeration of residual white blood cells in leucoreduced blood components is essential part of quality control. Digital PCR has substantially facilitated quantitative PCR and was thus evaluated for measurements of leucocytes. Target for quantification of leucocytes by digital droplet PCR was the blood group gene RHCE. The SPEF1 gene was added as internal control for the entire assay starting with automated DNA extraction. The sensitivity of the method was determined by serial dilutions of standard samples. Quality control samples were analysed within 24 h, 7 days and 6 months after collection. Routine samples from leucodepleted red blood cell concentrates (n = 150) were evaluated in parallel by flow-cytometry (LeucoCount) and by digital PCR. Digital PCR reliably detected at least 0·4 leucocytes per assay. The mean difference between PCR and flow-cytometric results from 150 units was -0·01 (±1·0). DNA samples were stable for up to at least six months. PCR measurement of leucocytes in samples from plasma and platelet concentrates also provided valid results in a pilot study. Droplet digital PCR to enumerate leucocytes offers an alternative for quality control of leucoreduced blood products. Sensitivity, specificity and reproducibility are comparable to flow-cytometry. The option to collect samples over an extended period of time and the automatization introduce attractive features for routine quality control. © 2017 International Society of Blood Transfusion.
Multivariate statistics as means of tracking atmospheric pollution trends in Western Poland.
Astel, Aleksander M; Walna, Barbara; Simeonov, Vasil; Kurzyca, Iwona
2008-02-15
This study was carried out over a period of 4 years (2002-2005) at 2 sites located in western Poland differing as regards to human impact by analysis of chemical composition of bulk precipitation. The aim of the study was to determine the sources of pollutions and assess their quantitative contribution to the bulk precipitation composition and to analyse long term-changes in the chemical quality of precipitation. Based on this information the possible transboundary impacts of pollution were also determined. The samples were characterized by determining the values of pH, electrolytic conductivity and concentration levels of Cl(-), F(-), SO(4)(2-), NO(3)(-), Na(+), K(+), Mg(2+), Ca(2+) and NH(4)(+). Analytical measurements were connected with application of principal component regression (PCR) and time series analysis (TS). Based on PCR results three major sources of pollutants in central part of Poland have been identified and quantitatively assessed as follows: "combined" (Poznań - 31%, WNP - 32%), "soil-particulates" (Poznań - 2%, WNP - 26%), "anthropogenic-fossil fuels" (Poznań - 43%, WNP - 23%). Time series analysis enabled discovering 12-month time cycle for NO(3)(-), NH(4)(+), Cl(-), F(-) and SO(4)(2-) in average monthly concentration values in bulk precipitation collected in Wielkopolski National Park. Seasonal variation in the emission of precursors of NO(3)(-) and NH(4)(+) was caused by changes in intensity of fertilizer application in agriculture and automobile exhaust emissions. Decreasing trend was visible for sulphates, nitrates, chlorides and fluorides which is an important indication of the acid rain reduction in the ecologically protected area and in Poznań.
Davis, Ian J.; Wallis, Corrin; Deusch, Oliver; Colyer, Alison; Milella, Lisa; Loman, Nick; Harris, Stephen
2013-01-01
Periodontal disease is the most widespread oral disease in dogs which if left untreated results in significant pain to the pet and loss of dentition. The objective of this study was to identify bacterial species in canine plaque that are significantly associated with health, gingivitis and mild periodontitis (<25% attachment loss). In this survey subgingival plaque samples were collected from 223 dogs with healthy gingiva, gingivitis and mild periodontitis with 72 to 77 samples per health status. DNA was extracted from the plaque samples and subjected to PCR amplification of the V1-V3 region of the 16S rDNA. Pyrosequencing of the PCR amplicons identified a total of 274 operational taxonomic units after bioinformatic and statistical analysis. Porphyromonas was the most abundant genus in all disease stages, particularly in health along with Moraxella and Bergeyella. Peptostreptococcus, Actinomyces, and Peptostreptococcaceae were the most abundant genera in mild periodontitis. Logistic regression analysis identified species from each of these genera that were significantly associated with health, gingivitis or mild periodontitis. Principal component analysis showed distinct community profiles in health and disease. The species identified show some similarities with health and periodontal disease in humans but also major differences. In contrast to human, healthy canine plaque was found to be dominated by Gram negative bacterial species whereas Gram positive anaerobic species predominate in disease. The scale of this study surpasses previously published research and enhances our understanding of the bacterial species present in canine subgingival plaque and their associations with health and early periodontal disease. PMID:24349448
Davis, Ian J; Wallis, Corrin; Deusch, Oliver; Colyer, Alison; Milella, Lisa; Loman, Nick; Harris, Stephen
2013-01-01
Periodontal disease is the most widespread oral disease in dogs which if left untreated results in significant pain to the pet and loss of dentition. The objective of this study was to identify bacterial species in canine plaque that are significantly associated with health, gingivitis and mild periodontitis (<25% attachment loss). In this survey subgingival plaque samples were collected from 223 dogs with healthy gingiva, gingivitis and mild periodontitis with 72 to 77 samples per health status. DNA was extracted from the plaque samples and subjected to PCR amplification of the V1-V3 region of the 16S rDNA. Pyrosequencing of the PCR amplicons identified a total of 274 operational taxonomic units after bioinformatic and statistical analysis. Porphyromonas was the most abundant genus in all disease stages, particularly in health along with Moraxella and Bergeyella. Peptostreptococcus, Actinomyces, and Peptostreptococcaceae were the most abundant genera in mild periodontitis. Logistic regression analysis identified species from each of these genera that were significantly associated with health, gingivitis or mild periodontitis. Principal component analysis showed distinct community profiles in health and disease. The species identified show some similarities with health and periodontal disease in humans but also major differences. In contrast to human, healthy canine plaque was found to be dominated by Gram negative bacterial species whereas Gram positive anaerobic species predominate in disease. The scale of this study surpasses previously published research and enhances our understanding of the bacterial species present in canine subgingival plaque and their associations with health and early periodontal disease.
Tan, Thean Yen; Zou, Hao; Ong, Danny Chee Tiong; Ker, Khor Jia; Chio, Martin Tze Wei; Teo, Rachael Yu Lin; Koh, Mark Jean Aan
2013-12-01
Herpes simplex virus (HSV) and varicella zoster virus (VZV) are related members of the Herpesviridae family and are well-documented human pathogens causing a spectrum of diseases, from mucocutaneous disease to infections of the central nervous system. This study was carried out to evaluate and validate the performance of a multiplex real-time polymerase chain reaction (PCR) assay in detecting and differentiating HSV1, HSV2, and VZV from clinical samples. Consensus PCR primers for HSV were designed from the UL30 component of the DNA polymerase gene of HSV, with 2 separate hydrolysis probes designed to differentiate HSV1 and HSV2. Separate primers and a probe were also designed against the DNA polymerase gene of VZV. A total of 104 clinical samples were available for testing by real-time PCR, conventional PCR, and viral culture. The sensitivity and specificity of the real-time assay was calculated by comparing the multiplex PCR result with that of a combined standard of virus culture and conventional PCR. The sensitivity of the real-time assay was 100%, with specificity ranging from 98% to 100% depending on the target gene. Both PCR methods detected more positive samples for HSV or VZV, compared with conventional virus culture. This multiplex PCR assay provides accurate and rapid diagnostic capabilities for the diagnosis and differentiation of HSV1, HSV2, and VZV infections, with the presence of an internal control to monitor for inhibition of the PCR reaction.
Drosten, C.; Seifried, E.; Roth, W. K.
2001-01-01
Screening of blood donors for human immunodeficiency virus type 1 (HIV-1) infection by PCR permits the earlier diagnosis of HIV-1 infection compared with that by serologic assays. We have established a high-throughput reverse transcription (RT)-PCR assay based on 5′-nuclease PCR. By in-tube detection of HIV-1 RNA with a fluorogenic probe, the 5′-nuclease PCR technology (TaqMan PCR) eliminates the risk of carryover contamination, a major problem in PCR testing. We outline the development and evaluation of the PCR assay from a technical point of view. A one-step RT-PCR that targets the gag genes of all known HIV-1 group M isolates was developed. An internal control RNA detectable with a heterologous 5′-nuclease probe was derived from the viral target cDNA and was packaged into MS2 coliphages (Armored RNA). Because the RNA was protected against digestion with RNase, it could be spiked into patient plasma to control the complete sample preparation and amplification process. The assay detected 831 HIV-1 type B genome equivalents per ml of native plasma (95% confidence interval [CI], 759 to 936 HIV-1 B genome equivalents per ml) with a ≥95% probability of a positive result, as determined by probit regression analysis. A detection limit of 1,195 genome equivalents per ml of (individual) donor plasma (95% CI, 1,014 to 1,470 genome equivalents per ml of plasma pooled from individuals) was achieved when 96 samples were pooled and enriched by centrifugation. Up to 4,000 plasma samples per PCR run were tested in a 3-month trial period. Although data from the present pilot feasibility study will have to be complemented by a large clinical validation study, the assay is a promising approach to the high-throughput screening of blood donors and is the first noncommercial test for high-throughput screening for HIV-1. PMID:11724836
Tateishi, Ukihide; Miyake, Mototaka; Nagaoka, Tomoaki; Terauchi, Takashi; Kubota, Kazunori; Kinoshita, Takayuki; Daisaki, Hiromitsu; Macapinlac, Homer A
2012-04-01
To clarify whether fluorine 18 ((18)F) fluorodeoxyglucose (FDG) positron emission tomography (PET)/computed tomography (CT) and dynamic contrast-enhanced (DCE) magnetic resonance (MR) imaging performed after two cycles of neoadjuvant chemotherapy (NAC) can be used to predict pathologic response in breast cancer. Institutional human research committee approval and written informed consent were obtained. Accuracy after two cycles of NAC for predicting pathologic complete response (pCR) was examined in 142 women (mean age, 57 years: range, 43-72 years) with histologically proved breast cancer between December 2005 and February 2009. Quantitative PET/CT and DCE MR imaging were performed at baseline and after two cycles of NAC. Parameters of PET/CT and of blood flow and microvascular permeability at DCE MR were compared with pathologic response. Patients were also evaluated after NAC by using Response Evaluation Criteria in Solid Tumors (RECIST) 1.1 based on DCE MR measurements and European Organization for Research and Treatment of Cancer (EORTC) criteria and PET Response Criteria in Solid Tumors (PERCIST) 1.0 based on PET/CT measurements. Multiple logistic regression analyses were performed to examine continuous variables at PET/CT and DCE MR to predict pCR, and diagnostic accuracies were compared with the McNemar test. Significant decrease from baseline of all parameters at PET/CT and DCE MR was observed after NAC. Therapeutic response was obtained in 24 patients (17%) with pCR and 118 (83%) without pCR. Sensitivity, specificity, and accuracy to predict pCR were 45.5%, 85.5%, and 82.4%, respectively, with RECIST and 70.4%, 95.7%, and 90.8%, respectively, with EORTC and PERCIST. Multiple logistic regression revealed three significant independent predictors of pCR: percentage maximum standardized uptake value (%SUV(max)) (odds ratio [OR], 1.22; 95% confidence interval [CI]: 1.11, 1.34; P < .0001), percentage rate constant (%k(ep)) (OR, 1.07; CI: 1.03, 1.12; P = .002), and percentage area under the time-intensity curve over 90 seconds (%AUC(90)) (OR, 1.04; CI: 1.01, 1.07; P = .048). When diagnostic accuracies are compared, PET/CT is superior to DCE MR for the prediction of pCR (%SUV(max) [90.1%] vs %κ(ep) [83.8%] or %AUC(90) [76.8%]; P < .05). The sensitivities of %SUV(max) (66.7%), %k(ep) (51.7%), and %AUC(90) (50.0%) at (18)F-FDG PET/CT and DCE MR after two cycles of NAC are not acceptable, but the specificities (96.4%, 92.0%, and 95.2%, respectively) are high for stratification of pCR cases in breast cancer. © RSNA, 2012.
Lee, Hea Yon; Kang, Hye Seon; Lee, Hwa Young; Rhee, Chin Kook; Lee, Sook Young; Kim, Seok Chan; Kim, Seung Joon; Park, Yeon Joon; Kim, Young Kyoon; Kang, Ji Young
2017-01-01
Background/Aims Pneumocystis jirovecii polymerase chain reaction (PCR) can be helpful in diagnosing Pneumocystis pneumonia (PCP); however it has limitations. We evaluated the prevalence of positive P. jirovecii PCR from non-human immunodeficiency virus (HIV) immunocompromised patients and tried to determine the risk of PCP development. Methods Between May 2009 and September 2012, P. jirovecii PCR was performed in bronchoscopic specimens from 1,231 adult non-HIV immunocompromised patients suspected of respiratory infection. Only 169 patients (13.7%) who were tested positive for P. jirovecii PCR were enrolled. Retrospective chart review was performed. PCP was defined in patients with positive P. jirovecii PCR who were treated for PCP based on the clinical decision. Results From 169 P. jirovecii PCR-positive patients, 90 patients were in the PCP group (53.3%) and 79 patients were in the non-PCP group (46.7%). In the PCP group, 38% of patients expired or aggravated after therapy, whereas the majority of patients (84%) in the non-PCP group recovered without treatment for PCP. Independent risk factors for PCP by binary logistic regression analysis were underlying conditions- hematological malignancies, solid tumors or solid organ transplantation, dyspnea, age < 60 years, and albumin < 2.9 g/dL. Conclusions This study suggests that not all P. jirovecii PCR-positive patients need to be treated for PCP. Among P. jirovecii PCR-positive patients, those who are less than 60 years old, with hematological malignancies, solid tumors or solid organ transplantation, low albumin, and with symptoms of dyspnea, the possibility of PCP might be higher. Treatment should also be selected to these patients. PMID:27951623
Morton, C Oliver; White, P Lewis; Barnes, Rosemary A; Klingspor, Lena; Cuenca-Estrella, Manuel; Lagrou, Katrien; Bretagne, Stéphane; Melchers, Willem; Mengoli, Carlo; Caliendo, Angela M; Cogliati, Massimo; Debets-Ossenkopp, Yvette; Gorton, Rebecca; Hagen, Ferry; Halliday, Catriona; Hamal, Petr; Harvey-Wood, Kathleen; Jaton, Katia; Johnson, Gemma; Kidd, Sarah; Lengerova, Martina; Lass-Florl, Cornelia; Linton, Chris; Millon, Laurence; Morrissey, C Orla; Paholcsek, Melinda; Talento, Alida Fe; Ruhnke, Markus; Willinger, Birgit; Donnelly, J Peter; Loeffler, Juergen
2017-06-01
A wide array of PCR tests has been developed to aid the diagnosis of invasive aspergillosis (IA), providing technical diversity but limiting standardisation and acceptance. Methodological recommendations for testing blood samples using PCR exist, based on achieving optimal assay sensitivity to help exclude IA. Conversely, when testing more invasive samples (BAL, biopsy, CSF) emphasis is placed on confirming disease, so analytical specificity is paramount. This multicenter study examined the analytical specificity of PCR methods for detecting IA by blind testing a panel of DNA extracted from a various fungal species to explore the range of Aspergillus species that could be detected, but also potential cross reactivity with other fungal species. Positivity rates were calculated and regression analysis was performed to determine any associations between technical specifications and performance. The accuracy of Aspergillus genus specific assays was 71.8%, significantly greater (P < .0001) than assays specific for individual Aspergillus species (47.2%). For genus specific assays the most often missed species were A. lentulus (25.0%), A. versicolor (24.1%), A. terreus (16.1%), A. flavus (15.2%), A. niger (13.4%), and A. fumigatus (6.2%). There was a significant positive association between accuracy and using an Aspergillus genus PCR assay targeting the rRNA genes (P = .0011). Conversely, there was a significant association between rRNA PCR targets and false positivity (P = .0032). To conclude current Aspergillus PCR assays are better suited for detecting A. fumigatus, with inferior detection of most other Aspergillus species. The use of an Aspergillus genus specific PCR assay targeting the rRNA genes is preferential. © The Author 2016. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Smith, Matthew M; Schmutz, Joel; Apelgren, Chloe; Ramey, Andrew M
2015-04-01
Microscopic examination of blood smears can be effective at diagnosing and quantifying hematozoa infections. However, this method requires highly trained observers, is time consuming, and may be inaccurate for detection of infections at low levels of parasitemia. To develop a molecular methodology for identifying and quantifying Leucocytozoon parasite infection in wild waterfowl (Anseriformes), we designed a real-time, quantitative PCR protocol to amplify Leucocytozoon mitochondrial DNA using TaqMan fluorogenic probes and validated our methodology using blood samples collected from waterfowl in interior Alaska during late summer and autumn (n=105). By comparing our qPCR results to those derived from a widely used nested PCR protocol, we determined that our assay showed high levels of sensitivity (91%) and specificity (100%) in detecting Leucocytozoon DNA from host blood samples. Additionally, results of a linear regression revealed significant correlation between the raw measure of parasitemia produced by our qPCR assay (Ct values) and numbers of parasites observed on blood smears (R(2)=0.694, P=0.003), indicating that our assay can reliably determine the relative parasitemia levels among samples. This methodology provides a powerful new tool for studies assessing effects of haemosporidian infection in wild avian species. Published by Elsevier B.V.
Xue, Jia; Lamar, Frederica G; Zhang, Bowen; Lin, Siyu; Lamori, Jennifer G; Sherchan, Samendra P
2018-05-01
Brackish water samples from Lake Pontchartrain in Louisiana were assessed for the presence of pathogenic amoeba Naegleria fowleri, which causes primary amoebic meningoencephalitis (PAM). In our study, quantitative polymerase chain reaction (qPCR) methods were used to determine N. fowleri, E. coli, and enterococci in water collected from Lake Pontchartrain. N. fowleri target sequence was detected in 35.4% (56/158) of the water samples from ten sites around the lake. Statistically significant positive correlations between N. fowleri concentration and water temperature as well as E. coli (qPCR) were observed. Multiple linear regression (MLR) model shows seasonal factor (summer or winter) has significant effect on the concentration of N. fowleri, E. coli and enterococci (qPCR) concentration. Significant positive relationships between E. coli and enterococci was observed from both qPCR (r=0.25) and culture based method (r=0.54). Meanwhile, significant positive correlation between qPCR and culture based methods for enterococci concentration was observed (r=0.33). In our study, water temperature and E. coli concentration were indicative of N. fowleri concentrations in brackish water environment. Future research is needed to determine whether sediment is a source of N. fowleri found in the water column. Copyright © 2017 Elsevier B.V. All rights reserved.
Reactive oxygen species (ROS) activity of ambient fine particles (PM2.5) measured in Seoul, Korea.
Park, Jieun; Park, Eun Ha; Schauer, James J; Yi, Seung-Muk; Heo, Jongbae
2018-05-16
Substantial increase in level of particulate matter has raised concerns in South Korea recently. Ambient particulate matter is classified as Group I carcinogen (IARC, 2013) and multiple epidemiological studies has demonstrated adverse health effects due to exposure of particulate matter. Fine particulate matter (PM 2.5 ) which has a diameter <2.5 μm is likely to penetrate deeply into lung and is known to be eliciting adverse health effects. A number of epidemiological studies have been conducted on adverse health effects of PM-related diseases and mortality rate, yet particulate matter (PM)-induced reactive oxygen species (ROS) activity at the cellular level has not been actively studied in Korea. This study assessed PM-induced oxidative potential by exposure of collected ambient PM 2.5 samples to the rat alveolar macrophage cell line. The characteristics of PM 2.5 in Korea were further characterized by linking chemical constituents and contributing sources to ROS. PM 2.5 mass concentration during the cold season was relatively higher than mass concentration during the warm season and chemical constituents except for Secondary Organic Carbon (SOC) and SO 4 2- which both showed similar trends in both the cold and cold seasons. The concentration of crustal elements was especially high during the cold season which can be an indication of long range transport of Asian dust. Water soluble organic carbon and water soluble transition metals (Cr and Zn) were also shown to be correlated to oxidative potential and metals such as As and V were shown to have a high contribution to ROS activity according to stepwise multiple linear regression. Principal Component Analysis (PCA) results identified six factors that can be interpreted as soil, mobile, industry, secondary inorganic aerosol, secondary organic aerosol and oil combustion. Moreover, through Principal Component Regression (PCR), industry, soil, mobile and SIA were shown to be statistically significant sources in a relation to ROS activity. Copyright © 2018 Elsevier Ltd. All rights reserved.
Increased efficacy for in-house validation of real-time PCR GMO detection methods.
Scholtens, I M J; Kok, E J; Hougs, L; Molenaar, B; Thissen, J T N M; van der Voet, H
2010-03-01
To improve the efficacy of the in-house validation of GMO detection methods (DNA isolation and real-time PCR, polymerase chain reaction), a study was performed to gain insight in the contribution of the different steps of the GMO detection method to the repeatability and in-house reproducibility. In the present study, 19 methods for (GM) soy, maize canola and potato were validated in-house of which 14 on the basis of an 8-day validation scheme using eight different samples and five on the basis of a more concise validation protocol. In this way, data was obtained with respect to the detection limit, accuracy and precision. Also, decision limits were calculated for declaring non-conformance (>0.9%) with 95% reliability. In order to estimate the contribution of the different steps in the GMO analysis to the total variation variance components were estimated using REML (residual maximum likelihood method). From these components, relative standard deviations for repeatability and reproducibility (RSD(r) and RSD(R)) were calculated. The results showed that not only the PCR reaction but also the factors 'DNA isolation' and 'PCR day' are important factors for the total variance and should therefore be included in the in-house validation. It is proposed to use a statistical model to estimate these factors from a large dataset of initial validations so that for similar GMO methods in the future, only the PCR step needs to be validated. The resulting data are discussed in the light of agreed European criteria for qualified GMO detection methods.
Autoclave method for rapid preparation of bacterial PCR-template DNA.
Simmon, Keith E; Steadman, Dewey D; Durkin, Sarah; Baldwin, Amy; Jeffrey, Wade H; Sheridan, Peter; Horton, Rene; Shields, Malcolm S
2004-02-01
An autoclave method for preparing bacterial DNA for PCR template is presented, it eliminates the use of detergents, organic solvents, and mechanical cellular disruption approaches, thereby significantly reducing processing time and costs while increasing reproducibility. Bacteria are lysed by rapid heating and depressurization in an autoclave. The lysate, cleared by microcentrifugation, was either used directly in the PCR reaction, or concentrated by ultrafiltration. This approach was compared with seven established methods of DNA template preparation from four bacterial sources which included boiling Triton X-100 and SDS, bead beating, lysozyme/proteinase K, and CTAB lysis method components. Bacteria examined were Enterococcus and Escherichia coli, a natural marine bacterial community and an Antarctic cyanobacterial-mat. DNAs were tested for their suitability as PCR templates by repetitive element random amplified polymorphic DNA (RAPD) and denaturing gradient gel electrophoresis (DGGE) analysis. The autoclave method produced PCR amplifiable template comparable or superior to the other methods, with greater reproducibility, much shorter processing time, and at a significantly lower cost.
Near-infrared diffuse reflection systems for chlorophyll content of tomato leaves measurement
NASA Astrophysics Data System (ADS)
Jiang, Huanyu; Ying, Yibin; Lu, Huishan
2006-10-01
In this study, two measuring systems for chlorophyll content of tomato leaves were developed based on near-infrared spectral techniques. The systems mainly consists of a FT-IR spectrum analyzer, optic fiber diffuses reflection accessories and data card. Diffuse reflectance of intact tomato leaves was measured by an optics fiber optic fiber diffuses reflection accessory and a smart diffuses reflection accessory. Calibration models were developed from spectral and constituent measurements. 90 samples served as the calibration sets and 30 samples served as the validation sets. Partial least squares (PLS) and principal component regression (PCR) technique were used to develop the prediction models by different data preprocessing. The best model for chlorophyll content had a high correlation efficient of 0.9348 and a low standard error of prediction RMSEP of 4.79 when we select full range (12500-4000 cm -1), MSC path length correction method by the log(1/R). The results of this study suggest that FT-NIR method can be feasible to detect chlorophyll content of tomato leaves rapidly and nondestructively.
New formulation feed method in tariff model of solar PV in Indonesia
NASA Astrophysics Data System (ADS)
Djamal, Muchlishah Hadi; Setiawan, Eko Adhi; Setiawan, Aiman
2017-03-01
Geographically, Indonesia has 18 latitudes that correlated strongly with the potential of solar radiation for the implementation of solar photovoltaic (PV) technologies. This is becoming the basis assumption to develop a proportional model of Feed In Tariff (FIT), consequently the FIT will be vary, according to the various of latitudes in Indonesia. This paper proposed a new formulation of solar PV FIT based on the potential of solar radiation and some independent variables such as latitude, longitude, Levelized Cost of Electricity (LCOE), and also socio-economic. The Principal Component Regression (PCR) method is used to analyzed the correlation of six independent variables C1-C6 then three models of FIT are presented. Model FIT-2 is chosen because it has a small residual value and has higher financial benefit compared to the other models. This study reveals the value of variable FIT associated with solar energy potential in each region, can reduce the total FIT to be paid by the state around 80 billion rupiahs in 10 years of 1 MW photovoltaic operation at each 34 provinces in Indonesia.
NASA Astrophysics Data System (ADS)
Moustafa, Azza Aziz; Salem, Hesham; Hegazy, Maha; Ali, Omnia
2015-02-01
Simple, accurate, and selective methods have been developed and validated for simultaneous determination of a ternary mixture of Chlorpheniramine maleate (CPM), Pseudoephedrine HCl (PSE) and Ibuprofen (IBF), in tablet dosage form. Four univariate methods manipulating ratio spectra were applied, method A is the double divisor-ratio difference spectrophotometric method (DD-RD). Method B is double divisor-derivative ratio spectrophotometric method (DD-RD). Method C is derivative ratio spectrum-zero crossing method (DRZC), while method D is mean centering of ratio spectra (MCR). Two multivariate methods were also developed and validated, methods E and F are Principal Component Regression (PCR) and Partial Least Squares (PLSs). The proposed methods have the advantage of simultaneous determination of the mentioned drugs without prior separation steps. They were successfully applied to laboratory-prepared mixtures and to commercial pharmaceutical preparation without any interference from additives. The proposed methods were validated according to the ICH guidelines. The obtained results were statistically compared with the official methods where no significant difference was observed regarding both accuracy and precision.
Use of vegetation health data for estimation of aus rice yield in bangladesh.
Rahman, Atiqur; Roytman, Leonid; Krakauer, Nir Y; Nizamuddin, Mohammad; Goldberg, Mitch
2009-01-01
Rice is a vital staple crop for Bangladesh and surrounding countries, with interannual variation in yields depending on climatic conditions. We compared Bangladesh yield of aus rice, one of the main varieties grown, from official agricultural statistics with Vegetation Health (VH) Indices [Vegetation Condition Index (VCI), Temperature Condition Index (TCI) and Vegetation Health Index (VHI)] computed from Advanced Very High Resolution Radiometer (AVHRR) data covering a period of 15 years (1991-2005). A strong correlation was found between aus rice yield and VCI and VHI during the critical period of aus rice development that occurs during March-April (weeks 8-13 of the year), several months in advance of the rice harvest. Stepwise principal component regression (PCR) was used to construct a model to predict yield as a function of critical-period VHI. The model reduced the yield prediction error variance by 62% compared with a prediction of average yield for each year. Remote sensing is a valuable tool for estimating rice yields well in advance of harvest and at a low cost.
Use of Vegetation Health Data for Estimation of Aus Rice Yield in Bangladesh
Rahman, Atiqur; Roytman, Leonid; Krakauer, Nir Y.; Nizamuddin, Mohammad; Goldberg, Mitch
2009-01-01
Rice is a vital staple crop for Bangladesh and surrounding countries, with interannual variation in yields depending on climatic conditions. We compared Bangladesh yield of aus rice, one of the main varieties grown, from official agricultural statistics with Vegetation Health (VH) Indices [Vegetation Condition Index (VCI), Temperature Condition Index (TCI) and Vegetation Health Index (VHI)] computed from Advanced Very High Resolution Radiometer (AVHRR) data covering a period of 15 years (1991–2005). A strong correlation was found between aus rice yield and VCI and VHI during the critical period of aus rice development that occurs during March–April (weeks 8–13 of the year), several months in advance of the rice harvest. Stepwise principal component regression (PCR) was used to construct a model to predict yield as a function of critical-period VHI. The model reduced the yield prediction error variance by 62% compared with a prediction of average yield for each year. Remote sensing is a valuable tool for estimating rice yields well in advance of harvest and at a low cost. PMID:22574057
van Stiphout, Ruud G P M; Valentini, Vincenzo; Buijsen, Jeroen; Lammering, Guido; Meldolesi, Elisa; van Soest, Johan; Leccisotti, Lucia; Giordano, Alessandro; Gambacorta, Maria A; Dekker, Andre; Lambin, Philippe
2014-11-01
To develop and externally validate a predictive model for pathologic complete response (pCR) for locally advanced rectal cancer (LARC) based on clinical features and early sequential (18)F-FDG PETCT imaging. Prospective data (i.a. THUNDER trial) were used to train (N=112, MAASTRO Clinic) and validate (N=78, Università Cattolica del S. Cuore) the model for pCR (ypT0N0). All patients received long-course chemoradiotherapy (CRT) and surgery. Clinical parameters were age, gender, clinical tumour (cT) stage and clinical nodal (cN) stage. PET parameters were SUVmax, SUVmean, metabolic tumour volume (MTV) and maximal tumour diameter, for which response indices between pre-treatment and intermediate scan were calculated. Using multivariate logistic regression, three probability groups for pCR were defined. The pCR rates were 21.4% (training) and 23.1% (validation). The selected predictive features for pCR were cT-stage, cN-stage, response index of SUVmean and maximal tumour diameter during treatment. The models' performances (AUC) were 0.78 (training) and 0.70 (validation). The high probability group for pCR resulted in 100% correct predictions for training and 67% for validation. The model is available on the website www.predictcancer.org. The developed predictive model for pCR is accurate and externally validated. This model may assist in treatment decisions during CRT to select complete responders for a wait-and-see policy, good responders for extra RT boost and bad responders for additional chemotherapy. Copyright © 2014 The Authors. Published by Elsevier Ireland Ltd.. All rights reserved.
Inverse expression of survivin and reprimo correlates with poor patient prognosis in gastric cancer
Cerda-Opazo, Paulina; Valenzuela-Valderrama, Manuel; Wichmann, Ignacio; Rodríguez, Andrés; Contreras-Reyes, Daniel; Fernández, Elmer A.; Carrasco-Aviño, Gonzalo; Corvalán, Alejandro H.; Quest, Andrew F.G.
2018-01-01
BACKGROUND The objective of the study was to determine the relationship between Survivin and Reprimo transcript/protein expression levels, and gastric cancer outcome. METHODS In silico correlations between an agnostic set of twelve p53-dependent apoptosis and cell-cycle genes were explored in the gastric adenocarcinoma TCGA database, using cBioPortal. Findings were validated by regression analysis of RNAseq data. Separate regression analyses were performed to assess the impact of p53 status on Survivin and Reprimo. Quantitative reverse-transcription PCR (RT-qPCR) and immunohistochemistry confirmed in silico findings on fresh-frozen and paraffin-embedded gastric cancer tissues, respectively. Wild-type (AGS, SNU-1) and mutated p53 (NCI-N87) cell lines transfected with pEGFP-Survivin or pCMV6-Reprimo were evaluated by RT-qPCR and Western blotting. Kaplan-Meier method and Long-Rank test were used to assess differences in patient outcome. RESULTS cBioPortal analysis revealed an inverse correlation between Survivin and Reprimo expression (Pearson’s r= −0.3, Spearman’s ρ= −0.55). RNAseq analyses confirmed these findings (Spearman’s ρ= −0.37, p<4.2e-09) and revealed p53 dependence in linear regression models (p<0.05). mRNA and protein levels validated these observations in clinical samples (p<0.001). In vitro analysis in cell lines demonstrated that increasing Survivin reduced Reprimo, while increasing Reprimo reduced Survivin expression, but only did so in p53 wild-type gastric cells (p<0.05). Survivin-positive but Reprimo-negative patients displayed shorter overall survival rates (p=0.047, Long Rank Test) (HR=0.32; 95%IC: 0.11-0.97; p=0.044). CONCLUSIONS TCGA RNAseq data analysis, evaluation of clinical samples and studies in cell lines identified an inverse relationship between Survivin and Reprimo. Elevated Survivin and reduced Reprimo protein expression correlated with poor patient prognosis in gastric cancer. PMID:29560115
Inverse expression of survivin and reprimo correlates with poor patient prognosis in gastric cancer.
Cerda-Opazo, Paulina; Valenzuela-Valderrama, Manuel; Wichmann, Ignacio; Rodríguez, Andrés; Contreras-Reyes, Daniel; Fernández, Elmer A; Carrasco-Aviño, Gonzalo; Corvalán, Alejandro H; Quest, Andrew F G
2018-02-27
The objective of the study was to determine the relationship between Survivin and Reprimo transcript/protein expression levels, and gastric cancer outcome. In silico correlations between an agnostic set of twelve p53-dependent apoptosis and cell-cycle genes were explored in the gastric adenocarcinoma TCGA database, using cBioPortal. Findings were validated by regression analysis of RNAseq data. Separate regression analyses were performed to assess the impact of p53 status on Survivin and Reprimo. Quantitative reverse-transcription PCR (RT-qPCR) and immunohistochemistry confirmed in silico findings on fresh-frozen and paraffin-embedded gastric cancer tissues, respectively. Wild-type (AGS, SNU-1) and mutated p53 (NCI-N87) cell lines transfected with pEGFP-Survivin or pCMV6-Reprimo were evaluated by RT-qPCR and Western blotting. Kaplan-Meier method and Long-Rank test were used to assess differences in patient outcome. cBioPortal analysis revealed an inverse correlation between Survivin and Reprimo expression (Pearson's r= -0.3, Spearman's ρ= -0.55). RNAseq analyses confirmed these findings (Spearman's ρ= -0.37, p<4.2e-09) and revealed p53 dependence in linear regression models (p<0.05). mRNA and protein levels validated these observations in clinical samples (p<0.001). In vitro analysis in cell lines demonstrated that increasing Survivin reduced Reprimo, while increasing Reprimo reduced Survivin expression, but only did so in p53 wild-type gastric cells (p<0.05). Survivin-positive but Reprimo-negative patients displayed shorter overall survival rates (p=0.047, Long Rank Test) (HR=0.32; 95%IC: 0.11-0.97; p=0.044). TCGA RNAseq data analysis, evaluation of clinical samples and studies in cell lines identified an inverse relationship between Survivin and Reprimo. Elevated Survivin and reduced Reprimo protein expression correlated with poor patient prognosis in gastric cancer.
Portable low-power thermal cycler with dual thin-film Pt heaters for a polymeric PCR chip.
Jeong, Sangdo; Lim, Juhun; Kim, Mi-Young; Yeom, JiHye; Cho, Hyunmin; Lee, Hyunjung; Shin, Yong-Beom; Lee, Jong-Hyun
2018-01-29
Polymerase chain reaction (PCR) has been widely used for major definite diagnostic tool, but very limited its place used only indoor such as hospital or diagnosis lab. For the rapid on-site detection of pathogen in an outdoor environment, a low-power cordless polymerase chain reaction (PCR) thermal cycler is crucial module. At this point of view, we proposed a low-power PCR thermal cycler that could be operated in an outdoor anywhere. The disposable PCR chip was made of a polymeric (PI/PET) film to reduce the thermal mass. A dual arrangement of the Pt heaters, which were positioned on the top and bottom of the PCR chip, improved the temperature uniformity. The temperature sensor, which was made of the same material as the heater, utilized the temperature dependence of the Pt resistor to ensure simple fabrication of the temperature sensor. Cooling the PCR chip using dual blower fans enabled thermal cycling to operate with a lower power than that of a Peltier element with a high power consumption. The PCR components were electrically connected to a control module that could be operated with a Li-ion battery (12 V), and the PCR conditions (temperature, time, cycle, etc.) were inputted on a touch screen. For 30 PCR cycles, the accumulated power consumption of heating and cooling was 7.3 Wh, which is easily available from a compact battery. Escherichia coli genomic DNA (510 bp) was amplified using the proposed PCR thermal cycler and the disposable PCR chip. A similar DNA amplification capability was confirmed using the proposed portable and low-power thermal cycler compared with a conventional thermal cycler.
Regression Models for Identifying Noise Sources in Magnetic Resonance Images
Zhu, Hongtu; Li, Yimei; Ibrahim, Joseph G.; Shi, Xiaoyan; An, Hongyu; Chen, Yashen; Gao, Wei; Lin, Weili; Rowe, Daniel B.; Peterson, Bradley S.
2009-01-01
Stochastic noise, susceptibility artifacts, magnetic field and radiofrequency inhomogeneities, and other noise components in magnetic resonance images (MRIs) can introduce serious bias into any measurements made with those images. We formally introduce three regression models including a Rician regression model and two associated normal models to characterize stochastic noise in various magnetic resonance imaging modalities, including diffusion-weighted imaging (DWI) and functional MRI (fMRI). Estimation algorithms are introduced to maximize the likelihood function of the three regression models. We also develop a diagnostic procedure for systematically exploring MR images to identify noise components other than simple stochastic noise, and to detect discrepancies between the fitted regression models and MRI data. The diagnostic procedure includes goodness-of-fit statistics, measures of influence, and tools for graphical display. The goodness-of-fit statistics can assess the key assumptions of the three regression models, whereas measures of influence can isolate outliers caused by certain noise components, including motion artifacts. The tools for graphical display permit graphical visualization of the values for the goodness-of-fit statistic and influence measures. Finally, we conduct simulation studies to evaluate performance of these methods, and we analyze a real dataset to illustrate how our diagnostic procedure localizes subtle image artifacts by detecting intravoxel variability that is not captured by the regression models. PMID:19890478
Variable selection and model choice in geoadditive regression models.
Kneib, Thomas; Hothorn, Torsten; Tutz, Gerhard
2009-06-01
Model choice and variable selection are issues of major concern in practical regression analyses, arising in many biometric applications such as habitat suitability analyses, where the aim is to identify the influence of potentially many environmental conditions on certain species. We describe regression models for breeding bird communities that facilitate both model choice and variable selection, by a boosting algorithm that works within a class of geoadditive regression models comprising spatial effects, nonparametric effects of continuous covariates, interaction surfaces, and varying coefficients. The major modeling components are penalized splines and their bivariate tensor product extensions. All smooth model terms are represented as the sum of a parametric component and a smooth component with one degree of freedom to obtain a fair comparison between the model terms. A generic representation of the geoadditive model allows us to devise a general boosting algorithm that automatically performs model choice and variable selection.
Single-Cell Quantitative PCR: Advances and Potential in Cancer Diagnostics.
Ok, Chi Young; Singh, Rajesh R; Salim, Alaa A
2016-01-01
Tissues are heterogeneous in their components. If cells of interest are a minor population of collected tissue, it would be difficult to obtain genetic or genomic information of the interested cell population with conventional genomic DNA extraction from the collected tissue. Single-cell DNA analysis is important in the analysis of genetics of cell clonality, genetic anticipation, and single-cell DNA polymorphisms. Single-cell PCR using Single Cell Ampligrid/GeXP platform is described in this chapter.
A regression-adjusted approach can estimate competing biomass
James H. Miller
1983-01-01
A method is presented for estimating above-ground herbaceous and woody biomass on competition research plots. On a set of destructively-sampled plots, an ocular estimate of biomass by vegetative component is first made, after which vegetation is clipped, dried, and weighed. Linear regressions are then calculated for each component between estimated and actual weights...
Replaceable Microfluidic Cartridges for a PCR Biosensor
NASA Technical Reports Server (NTRS)
Francis, Kevin; Sullivan, Ron
2005-01-01
The figure depicts a replaceable microfluidic cartridge that is a component of a miniature biosensor that detects target deoxyribonucleic acid (DNA) sequences. The biosensor utilizes (1) polymerase chain reactions (PCRs) to multiply the amount of DNA to be detected, (2) fluorogenic polynucleotide probe chemicals for labeling the target DNA sequences, and (3) a high-sensitivity epifluorescence-detection optoelectronic subsystem. Microfluidics is a relatively new field of device development in which one applies techniques for fabricating microelectromechanical systems (MEMS) to miniature systems for containing and/or moving fluids. Typically, microfluidic devices are microfabricated, variously, from silicon or polymers. The development of microfluidic devices for applications that involve PCR and fluorescence-based detection of PCR products poses special challenges
Peng, Ying; Li, Su-Ning; Pei, Xuexue; Hao, Kun
2018-03-01
Amultivariate regression statisticstrategy was developed to clarify multi-components content-effect correlation ofpanaxginseng saponins extract and predict the pharmacological effect by components content. In example 1, firstly, we compared pharmacological effects between panax ginseng saponins extract and individual saponin combinations. Secondly, we examined the anti-platelet aggregation effect in seven different saponin combinations of ginsenoside Rb1, Rg1, Rh, Rd, Ra3 and notoginsenoside R1. Finally, the correlation between anti-platelet aggregation and the content of multiple components was analyzed by a partial least squares algorithm. In example 2, firstly, 18 common peaks were identified in ten different batches of panax ginseng saponins extracts from different origins. Then, we investigated the anti-myocardial ischemia reperfusion injury effects of the ten different panax ginseng saponins extracts. Finally, the correlation between the fingerprints and the cardioprotective effects was analyzed by a partial least squares algorithm. Both in example 1 and 2, the relationship between the components content and pharmacological effect was modeled well by the partial least squares regression equations. Importantly, the predicted effect curve was close to the observed data of dot marked on the partial least squares regression model. This study has given evidences that themulti-component content is a promising information for predicting the pharmacological effects of traditional Chinese medicine.
Pan, Pinliang; Tao, Xiaoxia; Zhang, Qi; Xing, Wenge; Sun, Xianguang; Pei, Lijian; Jiang, Yan
2007-12-01
To investigate the correlation between three viral load assays for circulating recombinant form (CRF)_BC. Recent studies in HIV-1 molecular epidemiology, reveals that CRF_BC is the dominant subtype of HIV-1 virus in mainland China, representing over 45% of the HIV-1 infected population. The performances of nucleic acid sequence-based amplification (NASBA), branched DNA (bDNA) and reverse transcriptase polymerase chain reaction (RT-PCR) were compared for the HIV-1 viral load detection and quantitation of CRF_BC in China. Sixteen HIV-1 positive and three HIV-1 negative samples were collected. Sequencing of the positive samples in the gp41 region was conducted. The HIV-1 viral load values were determined using bDNA, RT-PCR and NASBA assays. Deming regression analysis with SPSS 12.0 (SPS Inc., Chicago, Illinois, USA) was performed for data analysis. Sequencing and phylogenetic analysis of env gene (gp41) region of the 16 HIV-1 positive clinical specimens from Guizhou Province in southwest China revealed the dominance of the subtype CRF_BC in that region. A good correlation of their viral load values was observed among three assays. Pearson's correlation between RT-PCR and bDNA is 0.969, Lg(VL)RT-PCR = 0.969 * Lg(VL)bDNA + 0.55; Pearson's correlation between RT-PCR and NASBA is 0.968, Lg(VL)RT-PCR = 0.968 * Lg(VL)NASBA + 0.937; Pearson's correlation between NASBA and bDNA is 0.980, Lg(VL)NASBA = 0.980 * Lg(VL)bDNA - 0.318. When testing with 3 different assays, RT-PCR, bDNA and NASBA, the group of 16 HIV-1 positive samples showed the viral load value was highest for RT-PCR, followed by bDNA then NASBA, which is consistent with the former results in subtype B. The three viral load assays are highly correlative for CRF_BC in China.
Bhatti, Sadia; Cordina, Mark; Penna, Leonie; Sherwood, Roy; Dew, Tracy; Kametas, Nikos A
2018-05-01
The replacement of 24-h urine collection by protein-creatinine ratio (PCR) for the diagnosis of preeclampsia has been recently recommended. However, the literature is conflicting and there are concerns about the impact of demographic characteristics on the performance of PCR. This was an implementation audit of the introduction of PCR in a London Tertiary obstetric unit. The performance of PCR in the prediction of proteinuria ≥300 mg/day was assessed in 476 women with suspected preeclampsia who completed a 24-h urine collection and an untimed urine sample for PCR calculation. Multivariate logistic regression was used to assess the independent predictors of significant proteinuria. In a pregnant population, ethnicity and PCR are the main predictors of ≥300 mg proteinuria in a 24-h urine collection. A PCR cut-off of 30 mg/mmol would have incorrectly classified as non-proteinuric, 41.4% and 22.9% of black and non-black women, respectively. Sensitivity of 100% is achieved at cut-offs of 8.67 and 20.56 mg/mmol for black and non-black women, respectively. Applying these levels as a screening tool to inform the need to perform a 24-h urine collection in 1000 women, would lead to a financial saving of €2911 in non-black women and to an additional cost of €3269 in black women. Our data suggest that a move from screening for proteinuria with a 24-h urine collection to screening with urine PCR is not appropriate for black populations. However, the move may lead to cost-saving if used in the white population with a PCR cut-off of 20.5. © 2018 Nordic Federation of Societies of Obstetrics and Gynecology.
Gautam, Rashi; Esona, Mathew D; Mijatovic-Rustempasic, Slavica; Ian Tam, Ka; Gentsch, Jon R; Bowen, Michael D
2014-01-01
Group A rotaviruses (RVA) are the leading cause of severe diarrhea in young children worldwide. Two live-attenuated RVA vaccines, Rotarix(®) and RotaTeq(®) are recommended by World Health Organization (WHO) for routine immunization of all infants. Rotarix(®) and RotaTeq(®) vaccines have substantially reduced RVA associated mortality but occasionally have been associated with acute gastroenteritis (AGE) cases identified in vaccinees and their contacts. High-throughput assays are needed to monitor the prevalence of vaccine strains in AGE cases and emergence of new vaccine-derived strains following RVA vaccine introduction. In this study, we have developed quantitative real-time RT-PCR (qRT-PCR) assays for detection of Rotarix(®) and RotaTeq(®) vaccine components in stool samples. Real-time RT-PCR assays were designed for vaccine specific targets in the genomes of Rotarix(®) (NSP2, VP4) and RotaTeq(®) (VP6, VP3-WC3, VP3-human) and validated on sequence confirmed stool samples containing vaccine strains, wild-type RVA strains, and RVA-negative stools. For quantification, standard curves were generated using dsRNA transcripts derived from RVA gene segments. Rotarix(®) NSP2 and VP4 qRT-PCR assays exhibited 92-100% sensitivity, 99-100% specificity, 94-105% efficiency, and a limit of detection of 2-3 copies per reaction. RotaTeq(®) VP6, VP3-WC3, and VP3-human qRT-PCR assays displayed 100% sensitivity, 94-100% specificity, 91-102% efficiency and limits of detection of 1 copy, 2 copies, and 140 copies, respectively. These assays permit rapid identification of Rotarix(®) and RotaTeq(®) vaccine components in stool samples from clinical and surveillance studies and will be helpful in determining the frequency of vaccine strain-associated AGE.
Gautam, Rashi; Esona, Mathew D; Mijatovic-Rustempasic, Slavica; Ian Tam, Ka; Gentsch, Jon R; Bowen, Michael D
2014-01-01
Group A rotaviruses (RVA) are the leading cause of severe diarrhea in young children worldwide. Two live-attenuated RVA vaccines, Rotarix® and RotaTeq® are recommended by World Health Organization (WHO) for routine immunization of all infants. Rotarix® and RotaTeq® vaccines have substantially reduced RVA associated mortality but occasionally have been associated with acute gastroenteritis (AGE) cases identified in vaccinees and their contacts. High-throughput assays are needed to monitor the prevalence of vaccine strains in AGE cases and emergence of new vaccine-derived strains following RVA vaccine introduction. In this study, we have developed quantitative real-time RT-PCR (qRT-PCR) assays for detection of Rotarix® and RotaTeq® vaccine components in stool samples. Real-time RT-PCR assays were designed for vaccine specific targets in the genomes of Rotarix® (NSP2, VP4) and RotaTeq® (VP6, VP3-WC3, VP3-human) and validated on sequence confirmed stool samples containing vaccine strains, wild-type RVA strains, and RVA-negative stools. For quantification, standard curves were generated using dsRNA transcripts derived from RVA gene segments. Rotarix® NSP2 and VP4 qRT-PCR assays exhibited 92–100% sensitivity, 99–100% specificity, 94–105% efficiency, and a limit of detection of 2–3 copies per reaction. RotaTeq® VP6, VP3-WC3, and VP3-human qRT-PCR assays displayed 100% sensitivity, 94–100% specificity, 91–102% efficiency and limits of detection of 1 copy, 2 copies, and 140 copies, respectively. These assays permit rapid identification of Rotarix® and RotaTeq® vaccine components in stool samples from clinical and surveillance studies and will be helpful in determining the frequency of vaccine strain-associated AGE. PMID:24342877
ERIC Educational Resources Information Center
Beauducel, Andre
2007-01-01
It was investigated whether commonly used factor score estimates lead to the same reproduced covariance matrix of observed variables. This was achieved by means of Schonemann and Steiger's (1976) regression component analysis, since it is possible to compute the reproduced covariance matrices of the regression components corresponding to different…
Rahman, Md Mahfujur; Hamid, Sharifah Bee Abd; Basirun, Wan Jefrey; Bhassu, Subha; Rashid, Nur Raifana Abdul; Mustafa, Shuhaimi; Mohd Desa, Mohd Nasir; Ali, Md Eaqub
2016-01-01
This paper describes a short-amplicon-based TaqMan probe quantitative real-time PCR (qPCR) assay for the quantitative detection of canine meat in chicken nuggets, which are very popular across the world, including Malaysia. The assay targeted a 100-bp fragment of canine cytb gene using a canine-specific primer and TaqMan probe. Specificity against 10 different animals and plants species demonstrated threshold cycles (Ct) of 16.13 ± 0.12 to 16.25 ± 0.23 for canine DNA and negative results for the others in a 40-cycle reaction. The assay was tested for the quantification of up to 0.01% canine meat in deliberately spiked chicken nuggets with 99.7% PCR efficiency and 0.995 correlation coefficient. The analysis of the actual and qPCR predicted values showed a high recovery rate (from 87% ± 28% to 112% ± 19%) with a linear regression close to unity (R(2) = 0.999). Finally, samples of three halal-branded commercial chicken nuggets collected from different Malaysian outlets were screened for canine meat, but no contamination was demonstrated.
Discola, Karen F.; Förster, Andreas; Boulay, François; Simorre, Jean-Pierre; Attree, Ina; Dessen, Andréa; Job, Viviana
2014-01-01
The type III secretion system is a widespread apparatus used by pathogenic bacteria to inject effectors directly into the cytoplasm of eukaryotic cells. A key component of this highly conserved system is the translocon, a pore formed in the host membrane that is essential for toxins to bypass this last physical barrier. In Pseudomonas aeruginosa the translocon is composed of PopB and PopD, both of which before secretion are stabilized within the bacterial cytoplasm by a common chaperone, PcrH. In this work we characterize PopB, the major translocator, in both membrane-associated and PcrH-bound forms. By combining sucrose gradient centrifugation experiments, limited proteolysis, one-dimensional NMR, and β-lactamase reporter assays on eukaryotic cells, we show that PopB is stably inserted into bilayers with its flexible N-terminal domain and C-terminal tail exposed to the outside. In addition, we also report the crystal structure of the complex between PcrH and an N-terminal region of PopB (residues 51–59), which reveals that PopB lies within the concave face of PcrH, employing mostly backbone residues for contact. PcrH is thus the first chaperone whose structure has been solved in complex with both type III secretion systems translocators, revealing that both molecules employ the same surface for binding and excluding the possibility of formation of a ternary complex. The characterization of the major type III secretion system translocon component in both membrane-bound and chaperone-bound forms is a key step for the eventual development of antibacterials that block translocon assembly. PMID:24297169
Initial experience with a radiology imaging network to newborn and intensive care units.
Witt, R M; Cohen, M D; Appledorn, C R
1991-02-01
A digital image network has been installed in the James Whitcomb Riley Hospital for Children on the Indiana University Medical Center to create a limited all digital imaging system. The system is composed of commercial components, Philips/AT&T CommView system, (Philips Medical Systems, Shelton, CT; AT&T Bell Laboratories, West Long Beach, NJ) and connects an existing Philips Computed Radiology (PCR) system to two remote workstations that reside in the intensive care unit and the newborn nursery. The purpose of the system is to display images obtained from the PCR system on the remote workstations for direct viewing by referring clinicians, and to reduce many of their visits to the radiology reading room three floors away. The design criteria includes the ability to centrally control all image management functions on the remote workstations to relieve the clinicians from any image management tasks except for recalling patient images. The principal components of the system are the Philips PCR system, the acquisition module (AM), and the PCR interface to the Data Management Module (DMM). Connected to the DMM are an Enhanced Graphics Display Workstation (EGDW), an optical disk drive, and a network gateway to an ethernet link. The ethernet network is the connection to the two Results Viewing Stations (RVS) and both RVSs are approximately 100 m from the gateway. The DMM acts as an image file server and an image archive device. The DMM manages the image data base and can load images to the EGDW and the two RVSs. The system has met the initial design specifications and can successfully capture images from the PCR and direct them to the RVSs.(ABSTRACT TRUNCATED AT 250 WORDS)
A whole blood gene expression-based signature for smoking status
2012-01-01
Background Smoking is the leading cause of preventable death worldwide and has been shown to increase the risk of multiple diseases including coronary artery disease (CAD). We sought to identify genes whose levels of expression in whole blood correlate with self-reported smoking status. Methods Microarrays were used to identify gene expression changes in whole blood which correlated with self-reported smoking status; a set of significant genes from the microarray analysis were validated by qRT-PCR in an independent set of subjects. Stepwise forward logistic regression was performed using the qRT-PCR data to create a predictive model whose performance was validated in an independent set of subjects and compared to cotinine, a nicotine metabolite. Results Microarray analysis of whole blood RNA from 209 PREDICT subjects (41 current smokers, 4 quit ≤ 2 months, 64 quit > 2 months, 100 never smoked; NCT00500617) identified 4214 genes significantly correlated with self-reported smoking status. qRT-PCR was performed on 1,071 PREDICT subjects across 256 microarray genes significantly correlated with smoking or CAD. A five gene (CLDND1, LRRN3, MUC1, GOPC, LEF1) predictive model, derived from the qRT-PCR data using stepwise forward logistic regression, had a cross-validated mean AUC of 0.93 (sensitivity=0.78; specificity=0.95), and was validated using 180 independent PREDICT subjects (AUC=0.82, CI 0.69-0.94; sensitivity=0.63; specificity=0.94). Plasma from the 180 validation subjects was used to assess levels of cotinine; a model using a threshold of 10 ng/ml cotinine resulted in an AUC of 0.89 (CI 0.81-0.97; sensitivity=0.81; specificity=0.97; kappa with expression model = 0.53). Conclusion We have constructed and validated a whole blood gene expression score for the evaluation of smoking status, demonstrating that clinical and environmental factors contributing to cardiovascular disease risk can be assessed by gene expression. PMID:23210427
Nateghi Rostami, Mahmoud; Hossein Rashidi, Batool; Aghsaghloo, Fatemeh; Nazari, Razieh
2016-06-01
Chlamydia trachomatis is the most common sexually transmitted bacterial pathogen worldwide. Early detection and treatment of C.trachomatis genital infection prevent serious reproductive complications. Performances of enzyme immunoassay (EIA) and major outer membrane protein (MOMP)-polymerase chain reaction (PCR) for diagnosis of genital C.trachomatis infection in women were compared. In this cross sectional study a total of 518 women volunteers were included (33.67±8.3 yrs) who had been referred to Gynecology clinics of Qom province, Iran, were included. Endocervical swab specimens were collected to detect lipopolysaccharide (LPS) antigen in EIA and to amplify MOMP gene of C.trachomatis in PCR. Results were confirmed using ompI nested-PCR. Sensitivity, specificity, positive (PPV) and negative predictive values (NPV) were calculated for performance of the tests. Odds ratios were determined using binary logistic regression analysis. In total, 37 (7.14%) cases were positive by EIA and/or MOMP-PCR. All discrepant results were confirmed by nested-PCR. Sensitivity, specificity, PPV and NPV values of EIA were 59.46%, 100%, 100% and 96.98%, and those of MOMP-PCR were 97.30%, 100%, 100%, 99.79%, respectively. Reproductive complications including 2.7% ectopic pregnancy, 5.4% stillbirth, 5.4% infertility, and 10.8% PROM were recorded. The risk of developing chlamydiosis was increased 4.8-fold in volunteers with cervicitis (p<0.05; OR 4.80; 95% CI 1.25-18.48). C.trachomatis infection should be regarded in women of reproductive ages especially those with cervicitis. Primary screening of women by using the low cost antigen-EIA is recommended; however, due to the low sensitivity of Ag-EIA, verification of the negative results by a DNA amplification method is needed.
Löfström, Charlotta; Knutsson, Rickard; Axelsson, Charlotta Engdahl; Rådström, Peter
2004-01-01
A PCR procedure has been developed for routine analysis of viable Salmonella spp. in feed samples. The objective was to develop a simple PCR-compatible enrichment procedure to enable DNA amplification without any sample pretreatment such as DNA extraction or cell lysis. PCR inhibition by 14 different feed samples and natural background flora was circumvented by the use of the DNA polymerase Tth. This DNA polymerase was found to exhibit a high level of resistance to PCR inhibitors present in these feed samples compared to DyNAzyme II, FastStart Taq, Platinum Taq, Pwo, rTth, Taq, and Tfl. The specificity of the Tth assay was confirmed by testing 101 Salmonella and 43 non-Salmonella strains isolated from feed and food samples. A sample preparation method based on culture enrichment in buffered peptone water and DNA amplification with Tth DNA polymerase was developed. The probability of detecting small numbers of salmonellae in feed, in the presence of natural background flora, was accurately determined and found to follow a logistic regression model. From this model, the probability of detecting 1 CFU per 25 g of feed in artificially contaminated soy samples was calculated and found to be 0.81. The PCR protocol was evaluated on 155 naturally contaminated feed samples and compared to an established culture-based method, NMKL-71. Eight percent of the samples were positive by PCR, compared with 3% with the conventional method. The reasons for the differences in sensitivity are discussed. Use of this method in the routine analysis of animal feed samples would improve safety in the food chain. PMID:14711627
Chien, Yu-Wen; Vidal, Jorge E.; Grijalva, Carlos G.; Bozio, Catherine; Edwards, Kathryn M.; Williams, John V.; Griffin, Marie R.; Verastegui, Hector; Hartinger, Stella M.; Gil, Ana I.; Lanata, Claudio F.; Klugman, Keith P.
2012-01-01
Streptococcus pneumoniae, Haemophilus influenzae and Staphylococcus aureus are commonly carried in the nasopharynx (NP) of young children, and have been speculated to interact with each other. Although earlier studies used cultures alone to assess these interactions, the addition of real-time quantitative polymerase chain reaction (qPCR) provides further insight into these interactions. We compared results of culture and qPCR for the detection of these three bacteria in 446 NP samples collected from 360 healthy young children in a prospective cohort study in the Peruvian Andes. Patterns of concurrent bacterial colonization were studied using repeated measures logistic regression models with generalized estimating equations. Spearman correlation coefficients were employed to assess correlations among bacterial densities. At a bacterial density <105 colony forming units (CFU)/ml measured by qPCR, culture detected significantly less carriers (P<0.0001) for all three pathogens, than at a bacterial density >105 CFU/ml. In addition, there was a positive association between S. pneumoniae and H. influenzae colonization measured by both culture (OR 3.11 – 3.17, p < 0.001) and qPCR (OR 1.95 – 1.97, p < 0.01). The densities of S. pneumoniae and H. influenzae, measured by qPCR, were positively correlated (correlation coefficient 0.32, p < 0.001). A negative association was found between the presence of S. pneumoniae and S. aureus in carriage with both culture (OR 0.45, p = 0.024) and qPCR (OR 0.61, p < 0.05). The impact of density on detection by culture and the observed density-related interactions support use of qPCR in additional studies to examine vaccine effects on diverse bacterial species. PMID:22935873
Chien, Yu-Wen; Vidal, Jorge E; Grijalva, Carlos G; Bozio, Catherine; Edwards, Kathryn M; Williams, John V; Griffin, Marie R; Verastegui, Hector; Hartinger, Stella M; Gil, Ana I; Lanata, Claudio F; Klugman, Keith P
2013-01-01
Streptococcus pneumoniae, Haemophilus influenzae and Staphylococcus aureus are commonly carried in the nasopharynx of young children, and have been speculated to interact with each other. Although earlier studies used cultures alone to assess these interactions, the addition of real-time quantitative polymerase chain reaction (qPCR) provides further insight into these interactions. We compared results of culture and qPCR for the detection of these 3 bacteria in 446 nasopharynx samples collected from 360 healthy young children in a prospective cohort study in the Peruvian Andes. Patterns of concurrent bacterial colonization were studied using repeated measures logistic regression models with generalized estimating equations. Spearman correlation coefficients were used to assess correlations among bacterial densities. At a bacterial density <10 colony forming units/mL measured by qPCR, culture detected significantly less carriers (P < 0.0001) for all 3 pathogens, than at a bacterial density >10 colony forming units/mL. In addition, there was a positive association between S. pneumoniae and H. influenzae colonization measured by both culture (odds ratio [OR] 3.11-3.17, P < 0.001) and qPCR (OR 1.95-1.97, P < 0.01). The densities of S. pneumoniae and H. influenzae, measured by qPCR, were positively correlated (correlation coefficient 0.32, P < 0.001). A negative association was found between the presence of S. pneumoniae and Staphylococcus aureus in carriage with both culture (OR 0.45, P = 0.024) and qPCR (OR 0.61, P < 0.05). The impact of density on detection by culture and the observed density-related interactions support use of qPCR in additional studies to examine vaccine effects on diverse bacterial species.
Lee, Ji Eun; Kim, Hyun Woong; Lee, Sang Joon; Lee, Joo Eun
2015-05-01
To investigate vascular structural changes of choroidal neovascularization (CNV) followed by intravitreal ranibizumab injections using indocyanine green angiography. A total of 31 patients with exudative age-related macular degeneration and CNV whose structures were identifiable in indocyanine green angiography were included. Ranibizumab was injected into the vitreous cavity once a month for 3 months and then as needed for the next 3 months prospectively. Indocyanine green angiography was performed at baseline, 3, and 6 months. Early to midphase images of the indocyanine green angiography in the details of vascular structure of the CNV were discerned the best were used in the image analysis. Vascular structures of CNV were described as arteriovenular and capillary components, and structural changes were assessed. Arteriovenular components were observed in 29 eyes (94%). Regression of the capillary components was observed in most cases. Although regression of arteriovenular component was noted in 14 eyes (48%), complete resolution was not observed. The eyes were categorized into 3 groups according to CNV structural changes: the regressed (Group R, 10 eyes, 31%), the matured (Group M, 7 eyes, 23%), and the growing (Group G, 14 eyes, 45%). In Group R, there was no regrowth of CNV found at 6 months. In Group M, distinct vascular structures were observed at 3 months and persisted without apparent changes at 6 months. In Group G, growth or reperfusion of capillary components from the persisting arteriovenular components was noted at 6 months. Both capillary and arteriovenular components were regressed during monthly ranibizumab injections. However, CNV regrowth was observed in a group of patients during the as-needed treatment phase.
Rahman, Md. Jahanur; Shamim, Abu Ahmed; Klemm, Rolf D. W.; Labrique, Alain B.; Rashid, Mahbubur; Christian, Parul; West, Keith P.
2017-01-01
Birth weight, length and circumferences of the head, chest and arm are key measures of newborn size and health in developing countries. We assessed maternal socio-demographic factors associated with multiple measures of newborn size in a large rural population in Bangladesh using partial least squares (PLS) regression method. PLS regression, combining features from principal component analysis and multiple linear regression, is a multivariate technique with an ability to handle multicollinearity while simultaneously handling multiple dependent variables. We analyzed maternal and infant data from singletons (n = 14,506) born during a double-masked, cluster-randomized, placebo-controlled maternal vitamin A or β-carotene supplementation trial in rural northwest Bangladesh. PLS regression results identified numerous maternal factors (parity, age, early pregnancy MUAC, living standard index, years of education, number of antenatal care visits, preterm delivery and infant sex) significantly (p<0.001) associated with newborn size. Among them, preterm delivery had the largest negative influence on newborn size (Standardized β = -0.29 − -0.19; p<0.001). Scatter plots of the scores of first two PLS components also revealed an interaction between newborn sex and preterm delivery on birth size. PLS regression was found to be more parsimonious than both ordinary least squares regression and principal component regression. It also provided more stable estimates than the ordinary least squares regression and provided the effect measure of the covariates with greater accuracy as it accounts for the correlation among the covariates and outcomes. Therefore, PLS regression is recommended when either there are multiple outcome measurements in the same study, or the covariates are correlated, or both situations exist in a dataset. PMID:29261760
Kabir, Alamgir; Rahman, Md Jahanur; Shamim, Abu Ahmed; Klemm, Rolf D W; Labrique, Alain B; Rashid, Mahbubur; Christian, Parul; West, Keith P
2017-01-01
Birth weight, length and circumferences of the head, chest and arm are key measures of newborn size and health in developing countries. We assessed maternal socio-demographic factors associated with multiple measures of newborn size in a large rural population in Bangladesh using partial least squares (PLS) regression method. PLS regression, combining features from principal component analysis and multiple linear regression, is a multivariate technique with an ability to handle multicollinearity while simultaneously handling multiple dependent variables. We analyzed maternal and infant data from singletons (n = 14,506) born during a double-masked, cluster-randomized, placebo-controlled maternal vitamin A or β-carotene supplementation trial in rural northwest Bangladesh. PLS regression results identified numerous maternal factors (parity, age, early pregnancy MUAC, living standard index, years of education, number of antenatal care visits, preterm delivery and infant sex) significantly (p<0.001) associated with newborn size. Among them, preterm delivery had the largest negative influence on newborn size (Standardized β = -0.29 - -0.19; p<0.001). Scatter plots of the scores of first two PLS components also revealed an interaction between newborn sex and preterm delivery on birth size. PLS regression was found to be more parsimonious than both ordinary least squares regression and principal component regression. It also provided more stable estimates than the ordinary least squares regression and provided the effect measure of the covariates with greater accuracy as it accounts for the correlation among the covariates and outcomes. Therefore, PLS regression is recommended when either there are multiple outcome measurements in the same study, or the covariates are correlated, or both situations exist in a dataset.
Sanford, Ward E.; Nelms, David L.; Pope, Jason P.; Selnick, David L.
2012-01-01
This study by the U.S. Geological Survey, prepared in cooperation with the Virginia Department of Environmental Quality, quantifies the components of the hydrologic cycle across the Commonwealth of Virginia. Long-term, mean fluxes were calculated for precipitation, surface runoff, infiltration, total evapotranspiration (ET), riparian ET, recharge, base flow (or groundwater discharge) and net total outflow. Fluxes of these components were first estimated on a number of real-time-gaged watersheds across Virginia. Specific conductance was used to distinguish and separate surface runoff from base flow. Specific-conductance data were collected every 15 minutes at 75 real-time gages for approximately 18 months between March 2007 and August 2008. Precipitation was estimated for 1971–2000 using PRISM climate data. Precipitation and temperature from the PRISM data were used to develop a regression-based relation to estimate total ET. The proportion of watershed precipitation that becomes surface runoff was related to physiographic province and rock type in a runoff regression equation. Component flux estimates from the watersheds were transferred to flux estimates for counties and independent cities using the ET and runoff regression equations. Only 48 of the 75 watersheds yielded sufficient data, and data from these 48 were used in the final runoff regression equation. The base-flow proportion for the 48 watersheds averaged 72 percent using specific conductance, a value that was substantially higher than the 61 percent average calculated using a graphical-separation technique (the USGS program PART). Final results for the study are presented as component flux estimates for all counties and independent cities in Virginia.
Production of anti-digoxigenin antibody HRP conjugate for PCR-ELISA DIG detection system.
Gill, Pooria; Forouzandeh, Mehdi; Rahbarizadeh, Fatemeh; Ramezani, Reihaneh; Rasaee, Mohammad Javad
2006-01-01
There are several methods used to visualize the end product of polymerase chain reactions. One of these methods is an ELISA-based detection system (PCR-ELISA) which is very sensitive and can be used to measure the PCR products quantitatively by a colorimetric method. According to this technique, copies of DNA segments from genomic DNA are amplified by PCR with incorporation of digoxigenin-11-dUTP. Samples are analyzed in a microtiter plate format by alkaline denaturation and are hybridized to biotinylated allele-specific capture probes bound to streptavidin coated plates. Use of the produced anti-digoxigenin antibody horseradish peroxidase conjugate and the substrate 2,2'-azino-di-3-ethylbenzthiazolinsulfonate (ABTS) detected the hybridized DNA. One of the key components in this procedure is the anti-digoxigenin antibody HRP conjugate. Described here is the preparation, purification, and characterization of anti-digoxigenin antibody HRP conjugate for use in the PCR-ELISA DIG detection system. Several biochemical protocols and modifications were applied to increase the sensitivity and specificity of this conjugate for an efficient and cost-effective product.
Xiao, Xiao; Wu, Honghong; Zhou, Xinghu; Xu, Sheng; He, Jian; Shen, Wenbiao; Zhou, Guanghong; Huang, Ming
2012-06-01
With the widespread use of Roundup Ready soy (event 40-3-2) (RRS), the comprehensive detection of genetically modified component in foodstuffs is of significant interest, but few protein-based approaches have been found useful in processed foods. In this report, the combination of quantitative PCR (qPCR) and western blot was used to detect cp4-epsps gene and its protein product in different RRS plant tissues and commercial soy-containing foodstuffs. The foods included those of plant origin produced by different processing procedures and also some products containing both meat and plant protein concentrates. The validity of the 2 methods was confirmed first. We also showed that the CP4-EPSPS protein existed in different RRS plant tissues. In certain cases, the results from the western blot and the qPCR were not consistent. To be specific, at least 2 degraded fragments of CP4-EPSPS protein (35.5 and 24.6 kDa) were observed. For dried bean curd crust and deep-fried bean curd, a degraded protein fragment with the size of 24.6 kDa appeared, while cp4-epsps gene could not be traced by qPCR. In contrast, we found a signal of cp4-epsps DNA in 3 foodstuffs, including soy-containing ham cutlet product, meat ball, and sausage by qPCR, while CP4-EPSPS protein could not be detected by western blot in such samples. Our study therefore concluded that the combination of DNA- and protein-based methods would compensate each other, thus resulting in a more comprehensive detection from nucleic acid and protein levels. The combination of quantitative PCR (qPCR) and western blot was used to detect cp4-epsps gene and its protein product in different Roundup Ready soy (event 40-3-2) plant tissues and commercial soy-containing foodstuffs. The foods included those of plant origin produced by different processing procedures and also some products containing a combination of both meat and plant protein concentrates. This study indicated that the combination of DNA- and protein-based methods would supplement each other for genetically modified detection from nucleic acid and protein levels. Accordingly, qPCR and western blot could be used in CP4-EPSPS detection in a wide variety of soy-related foodstuffs. © 2012 Institute of Food Technologists®
Fan, Wei; Li, Rong; Li, Sifan; Ping, Wenli; Li, Shujun; Naumova, Alexandra; Peelen, Tamara; Yuan, Zheng; Zhang, Dabing
2016-01-01
Reliable methods are needed to detect the presence of tobacco components in tobacco products to effectively control smuggling and classify tariff and excise in tobacco industry to control illegal tobacco trade. In this study, two sensitive and specific DNA based methods, one quantitative real-time PCR (qPCR) assay and the other loop-mediated isothermal amplification (LAMP) assay, were developed for the reliable and efficient detection of the presence of tobacco (Nicotiana tabacum) in various tobacco samples and commodities. Both assays targeted the same sequence of the uridine 5′-monophosphate synthase (UMPS), and their specificities and sensitivities were determined with various plant materials. Both qPCR and LAMP methods were reliable and accurate in the rapid detection of tobacco components in various practical samples, including customs samples, reconstituted tobacco samples, and locally purchased cigarettes, showing high potential for their application in tobacco identification, particularly in the special cases where the morphology or chemical compositions of tobacco have been disrupted. Therefore, combining both methods would facilitate not only the detection of tobacco smuggling control, but also the detection of tariff classification and of excise. PMID:27635142
B. Desta Fekedulegn; J.J. Colbert; R.R., Jr. Hicks; Michael E. Schuckers
2002-01-01
The theory and application of principal components regression, a method for coping with multicollinearity among independent variables in analyzing ecological data, is exhibited in detail. A concrete example of the complex procedures that must be carried out in developing a diagnostic growth-climate model is provided. We use tree radial increment data taken from breast...
Juul, Nicolai; Szallasi, Zoltan; Eklund, Aron C; Li, Qiyuan; Burrell, Rebecca A; Gerlinger, Marco; Valero, Vicente; Andreopoulou, Eleni; Esteva, Francisco J; Symmans, W Fraser; Desmedt, Christine; Haibe-Kains, Benjamin; Sotiriou, Christos; Pusztai, Lajos; Swanton, Charles
2010-04-01
Addition of taxanes to preoperative chemotherapy in breast cancer increases the proportion of patients who have a pathological complete response (pCR). However, a substantial proportion of patients do not respond, and the prognosis is particularly poor for patients with oestrogen-receptor (ER)/progesterone-receptor (PR)/human epidermal growth factor receptor 2 (HER2; ERBB2)-negative (triple-negative) disease who do not achieve a pCR. Reliable identification of such patients is the first step in determining who might benefit from alternative treatment regimens in clinical trials. We previously identified genes involved in mitosis or ceramide metabolism that influenced sensitivity to paclitaxel, with an RNA interference (RNAi) screen in three cancer cell lines, including a triple-negative breast-cancer cell line. Here, we assess these genes as a predictor of pCR to paclitaxel combination chemotherapy in triple-negative breast cancer. We derived a paclitaxel response metagene based on mitotic and ceramide genes identified by functional genomics studies. We used area under the curve (AUC) analysis and multivariate logistic regression to retrospectively assess the metagene in six cohorts of patients with triple-negative breast cancer treated with neoadjuvant chemotherapy; two cohorts treated with paclitaxel (n=27, 30) and four treated without paclitaxel (n=88, 28, 48, 39). The metagene was associated with pCR in paclitaxel-treated cohorts (AUC 0.79 [95% CI 0.53-0.93], 0.72 [0.48-0.90]) but not in non-paclitaxel treated cohorts (0.53 [0.31-0.77], 0.59 [0.22-0.82], 0.53 [0.36-0.71], 0.64 [0.43-0.81]). In multivariate logistic regression, the metagene was associated with pCR (OR 19.92, 2.62-151.57; p=0.0039) with paclitaxel-containing chemotherapy. The paclitaxel response metagene shows promise as a paclitaxel-specific predictor of pCR in patients with triple-negative breast cancer. The metagene is suitable for development into a reverse transcription-PCR assay, for which clinically relevant thresholds could be established in randomised clinical trials. These results highlight the potential for functional genomics to accelerate development of drug-specific predictive biomarkers without the need for training clinical trial cohorts. UK Medical Research Council; Cancer Research UK; the National Institute for Health Research (UK); the Danish Council for Independent Research-Medical Sciences (FSS); Breast Cancer Research Foundation (New York); Fondation Luxembourgeoise contre le Cancer; the Fonds National de la Recherche Scientifique; Brussels Region (IRSIB-IP, Life Sciences 2007) and Walloon Region (Biowin-Keymarker); Sally Pearson Breast Cancer Fund; and the European Commission. 2010 Elsevier Ltd. All rights reserved.
Tessitore, Marion Vaglio; Sottini, Alessandra; Roccaro, Aldo M; Ghidini, Claudia; Bernardi, Simona; Martellosio, Giovanni; Serana, Federico; Imberti, Luisa
2017-04-05
A normal number of T-cell receptor excision circles (TRECs) and K-deleting recombination excision circles (KRECs) is considered a biomarker for adequate new T- and B-cell production. In newborns, detection of TRECs and KRECs by real time PCR from dried blood spotted on filter paper is used for the screening of severe immunodeficiency. In adults, elderly and during diseases, where the number of TRECs is lower than in newborns and children, a large amount of DNA and a sensitive method of amplification are necessary to identify newly produced lymphocytes. DNA was prepared from blood of 203 healthy adults (range: 18-91 years old) absorbed for 10 s on flocked swabs and let to dry, or from peripheral blood mononuclear cells. DNA was subjected to digital PCR and to well established conventional real time PCR-based method using TREC- and KREC-specific primers and probes. The number of TRECs and KRECs was expressed per mL of blood. Statistical analysis was performed by nested ANOVA, Pearson coefficient of determination, and by linear regression tests. The novel method for the storage of dried blood on nylon flocked swabs and the use of digital PCR allow quantification of TRECs and KRECs with high degree of sensitivity, specificity, accuracy, and precision. TRECs and KRECs were amplified by digital PCR in all tested blood samples, including those obtained from elderly individuals (>70 years old) and that were negative by real time PCR. Furthermore, values of TRECs and KRECs obtained by digital PCR were in the range of those acquired by real time PCR. Our findings demonstrate that DNA isolation from dried blood on flocked swabs followed by digital PCR-based analysis represents a useful tool for studying new lymphocyte production in adults and elderly individuals. This suggests the potential use of the methodology when monitoring of clinical variables is limited by the number of molecules that can be amplified and detected, such as in patients with immunodeficiency or under immunosuppressive therapies.
Shehata, Hanan R.; Li, Jiping; Redda, Helen; Cheng, Shumei; Tabujara, Nicole; Li, Honghong; Warriner, Keith; Hanner, Robert
2017-01-01
Food adulteration and feed contamination are significant issues in the food/feed industry, especially for meat products. Reliable techniques are needed to monitor these issues. Droplet Digital PCR (ddPCR) assays were developed and evaluated for detection and quantification of bovine, porcine, chicken and turkey DNA in food and feed samples. The ddPCR methods were designed based on mitochondrial DNA sequences and integrated with an artificial recombinant plasmid DNA to control variabilities in PCR procedures. The specificity of the ddPCR assays was confirmed by testing both target species and additional 18 non-target species. Linear regression established a detection range between 79 and 33200 copies of the target molecule from 0.26 to 176 pg of fresh animal tissue DNA with a coefficient of determination (R2) of 0.997–0.999. The quantification ranges of the methods for testing fortified heat-processed food and feed samples were 0.05–3.0% (wt/wt) for the bovine and turkey targets, and 0.01–1.0% (wt/wt) for pork and chicken targets. Our methods demonstrated acceptable repeatability and reproducibility for the analytical process for food and feed samples. Internal validation of the PCR process was monitored using a control chart for 74 consecutive ddPCR runs for quantifying bovine DNA. A matrix effect was observed while establishing calibration curves with the matrix type under testing, and the inclusion of an internal control in DNA extraction provides a useful means to overcome this effect. DNA degradation caused by heating, sonication or Taq I restriction enzyme digestion was found to reduce ddPCR readings by as much as 4.5 fold. The results illustrated the applicability of the methods to quantify meat species in food and feed samples without the need for a standard curve, and to potentially support enforcement activities for food authentication and feed control. Standard reference materials matching typical manufacturing processes are needed for future validation of ddPCR assays for absolute quantification of meat species. PMID:28796824
Shehata, Hanan R; Li, Jiping; Chen, Shu; Redda, Helen; Cheng, Shumei; Tabujara, Nicole; Li, Honghong; Warriner, Keith; Hanner, Robert
2017-01-01
Food adulteration and feed contamination are significant issues in the food/feed industry, especially for meat products. Reliable techniques are needed to monitor these issues. Droplet Digital PCR (ddPCR) assays were developed and evaluated for detection and quantification of bovine, porcine, chicken and turkey DNA in food and feed samples. The ddPCR methods were designed based on mitochondrial DNA sequences and integrated with an artificial recombinant plasmid DNA to control variabilities in PCR procedures. The specificity of the ddPCR assays was confirmed by testing both target species and additional 18 non-target species. Linear regression established a detection range between 79 and 33200 copies of the target molecule from 0.26 to 176 pg of fresh animal tissue DNA with a coefficient of determination (R2) of 0.997-0.999. The quantification ranges of the methods for testing fortified heat-processed food and feed samples were 0.05-3.0% (wt/wt) for the bovine and turkey targets, and 0.01-1.0% (wt/wt) for pork and chicken targets. Our methods demonstrated acceptable repeatability and reproducibility for the analytical process for food and feed samples. Internal validation of the PCR process was monitored using a control chart for 74 consecutive ddPCR runs for quantifying bovine DNA. A matrix effect was observed while establishing calibration curves with the matrix type under testing, and the inclusion of an internal control in DNA extraction provides a useful means to overcome this effect. DNA degradation caused by heating, sonication or Taq I restriction enzyme digestion was found to reduce ddPCR readings by as much as 4.5 fold. The results illustrated the applicability of the methods to quantify meat species in food and feed samples without the need for a standard curve, and to potentially support enforcement activities for food authentication and feed control. Standard reference materials matching typical manufacturing processes are needed for future validation of ddPCR assays for absolute quantification of meat species.
Influence of PCR reagents on DNA polymerase extension rates measured on real-time PCR instruments.
Montgomery, Jesse L; Wittwer, Carl T
2014-02-01
Radioactive DNA polymerase activity methods are cumbersome and do not provide initial extension rates. A simple extension rate assay would enable study of basic assumptions about PCR and define the limits of rapid PCR. A continuous assay that monitors DNA polymerase extension using noncovalent DNA dyes on common real-time PCR instruments was developed. Extension rates were measured in nucleotides per second per molecule of polymerase. To initiate the reaction, a nucleotide analog was heat activated at 95 °C for 5 min, the temperature decreased to 75 °C, and fluorescence monitored until substrate exhaustion in 30-90 min. The assay was linear with time for over 40% of the reaction and for polymerase concentrations over a 100-fold range (1-100 pmol/L). Extension rates decreased continuously with increasing monovalent cation concentrations (lithium, sodium, potassium, cesium, and ammonium). Melting-temperature depressors had variable effects. DMSO increased rates up to 33%, whereas glycerol had little effect. Betaine, formamide, and 1,2-propanediol decreased rates with increasing concentrations. Four common noncovalent DNA dyes inhibited polymerase extension. Heat-activated nucleotide analogs were 92% activated after 5 min, and hot start DNA polymerases were 73%-90% activated after 20 min. Simple DNA extension rate assays can be performed on real-time PCR instruments. Activity is decreased by monovalent cations, DNA dyes, and most melting temperature depressors. Rational inclusion of PCR components on the basis of their effects on polymerase extension is likely to be useful in PCR, particularly rapid-cycle or fast PCR.
Wahyuningsih, Hesty; K Cayami, Ferdy; Bahrudin, Udin; A Sobirin, Mochamad; Ep Mundhofir, Farmaditya; Mh Faradz, Sultana; Hisatome, Ichiro
2017-03-01
High resolution melting (HRM) is a post-PCR technique for variant screening and genotyping based on the different melting points of DNA fragments. The advantages of this technique are that it is fast, simple, and efficient and has a high output, particularly for screening of a large number of samples. APOA1 encodes apolipoprotein A1 (apoA1) which is a major component of high density lipoprotein cholesterol (HDL-C). This study aimed to obtain an optimal quantitative polymerase chain reaction (qPCR)-HRM condition for screening of APOA1 variance. Genomic DNA was isolated from a peripheral blood sample using the salting out method. APOA1 was amplified using the RotorGeneQ 5Plex HRM. The PCR product was visualized with the HRM amplification curve and confirmed using gel electrophoresis. The melting profile was confirmed by looking at the melting curve. Five sets of primers covering the translated region of APOA1 exons were designed with expected PCR product size of 100-400 bps. The amplified segments of DNA were amplicons 2, 3, 4A, 4B, and 4C. Amplicons 2, 3 and 4B were optimized at an annealing temperature of 60 °C at 40 PCR cycles. Amplicon 4A was optimized at an annealing temperature of 62 °C at 45 PCR cycles. Amplicon 4C was optimized at an annealing temperature of 63 °C at 50 PCR cycles. In addition to the suitable procedures of DNA isolation and quantification, primer design and an estimated PCR product size, the data of this study showed that appropriate annealing temperature and PCR cycles were important factors in optimization of HRM technique for variant screening in APOA1 .
Wahyuningsih, Hesty; K Cayami, Ferdy; Bahrudin, Udin; A Sobirin, Mochamad; EP Mundhofir, Farmaditya; MH Faradz, Sultana; Hisatome, Ichiro
2017-01-01
Background High resolution melting (HRM) is a post-PCR technique for variant screening and genotyping based on the different melting points of DNA fragments. The advantages of this technique are that it is fast, simple, and efficient and has a high output, particularly for screening of a large number of samples. APOA1 encodes apolipoprotein A1 (apoA1) which is a major component of high density lipoprotein cholesterol (HDL-C). This study aimed to obtain an optimal quantitative polymerase chain reaction (qPCR)-HRM condition for screening of APOA1 variance. Methods Genomic DNA was isolated from a peripheral blood sample using the salting out method. APOA1 was amplified using the RotorGeneQ 5Plex HRM. The PCR product was visualized with the HRM amplification curve and confirmed using gel electrophoresis. The melting profile was confirmed by looking at the melting curve. Results Five sets of primers covering the translated region of APOA1 exons were designed with expected PCR product size of 100–400 bps. The amplified segments of DNA were amplicons 2, 3, 4A, 4B, and 4C. Amplicons 2, 3 and 4B were optimized at an annealing temperature of 60 °C at 40 PCR cycles. Amplicon 4A was optimized at an annealing temperature of 62 °C at 45 PCR cycles. Amplicon 4C was optimized at an annealing temperature of 63 °C at 50 PCR cycles. Conclusion In addition to the suitable procedures of DNA isolation and quantification, primer design and an estimated PCR product size, the data of this study showed that appropriate annealing temperature and PCR cycles were important factors in optimization of HRM technique for variant screening in APOA1. PMID:28331418
Free creatine available to the creatine phosphate energy shuttle in isolated rat atria
DOE Office of Scientific and Technical Information (OSTI.GOV)
Savabi, F.
1988-10-01
To measure the actual percentage of intracellular free creatine participating in the process of energy transport, the incorporation of (1-{sup 14}C)creatine into the free creatine and phosphocreatine (PCr) pools in spontaneously beating isolated rat atria, under various conditions, was examined. The atria were subjected to three consecutive periods, control, anoxia, and postanoxic recover, in medium containing tracers of (1-{sup 14}C)creatine. The tissue content and specific activity of creatine and PCr were determined at the end of each period. The higher specific activity found for tissue PCr (1.87 times) than creatine, independent of the percentage of total intracellular creatine that wasmore » present as free creatine, provides evidence for the existence of two separate pools of free creatine. Analysis of the data shows that in the normal oxygenated state {approx} 9% of the total intracellular creatine is actually free to participate in the process of energy transport (shuttle pool). About 36% of the total creatine is bound to unknown intracellular components and the rest exists as PCr. The creatine that was taken up and the creatine that was released from the breakdown of PCr have much greater access to the site of phosphorylation than the rest of the intracellular creatine. A sharp increase in the specific activity of residual PCr on prolongation of anoxic time was also observed. This provides evidence for a nonhomogeneous pool of PCr, for the most recently formed (radioactive) PCr appeared to be hydrolyzed last.« less
da Silva, Thais Freitas; Vollú, Renata Estebanez; Jurelevicius, Diogo; Alviano, Daniela Sales; Alviano, Celuta Sales; Blank, Arie Fitzgerald; Seldin, Lucy
2013-02-07
Lippia sidoides Cham., also known as pepper-rosmarin, produces an essential oil in its leaves that is currently used by the pharmaceutical, perfumery and cosmetic industries for its antimicrobial and aromatic properties. Because of the antimicrobial compounds (mainly thymol and carvacrol) found in the essential oil, we believe that the endophytic microorganisms found in L. sidoides are selected to live in different parts of the plant. In this study, the endophytic microbial communities from the stems and leaves of four L. sidoides genotypes were determined using cultivation-dependent and cultivation-independent approaches. In total, 145 endophytic bacterial strains were isolated and further grouped using either ERIC-PCR or BOX-PCR, resulting in 76 groups composed of different genera predominantly belonging to the Gammaproteobacteria. The endophytic microbial diversity was also analyzed by PCR-DGGE using 16S rRNA-based universal and group-specific primers for total bacteria, Alphaproteobacteria, Betaproteobacteria and Actinobacteria and 18S rRNA-based primers for fungi. PCR-DGGE profile analysis and principal component analysis showed that the total bacteria, Alphaproteobacteria, Betaproteobacteria and fungi were influenced not only by the location within the plant (leaf vs. stem) but also by the presence of the main components of the L. sidoides essential oil (thymol and/or carvacrol) in the leaves. However, the same could not be observed within the Actinobacteria. The data presented here are the first step to begin shedding light on the impact of the essential oil in the endophytic microorganisms in pepper-rosmarin.
A girl with early-onset epileptic encephalopathy associated with microdeletion involving CDKL5.
Saitsu, Hirotomo; Osaka, Hitoshi; Nishiyama, Kiyomi; Tsurusaki, Yoshinori; Doi, Hiroshi; Miyake, Noriko; Matsumoto, Naomichi
2012-05-01
Recent studies have shown that aberrations of CDKL5 in female patients cause early-onset intractable seizures, severe developmental delay or regression, and Rett syndrome-like features. We report on a Japanese girl with early-onset epileptic encephalopathy, hypotonia, developmental regression, and Rett syndrome-like features. The patient showed generalized tonic seizures, and later, massive myoclonus induced by phone and light stimuli. Brain magnetic resonance imaging showed no structural brain anomalies but cerebral atrophy. Electroencephalogram showed frontal dominant diffuse poly spikes and waves. Through copy number analysis by genomic microarray, we found a microdeletion at Xp22.13. A de novo 137-kb deletion, involving exons 5-21 of CDKL5, RS1, and part of PPEF1 gene, was confirmed by quantitative PCR and breakpoint specific PCR analyses. Our report suggests that the clinical features associated with CDKL5 deletions could be implicated in Japanese patients, and that genetic testing of CDKL5, including both sequencing and deletion analyses, should be considered in girls with early-onset epileptic encephalopathy and RTT-like features. Copyright © 2011 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.
Otsuka, Makoto; Tanabe, Hideaki; Osaki, Kazuo; Otsuka, Kuniko; Ozaki, Yukihiro
2007-04-01
The purpose of this study was to use near-infrared spectrometry (NIR) with chemoinformetrics to predict the change of dissolution properties in indomethacin (IMC) tablets during the manufacturing process. A comparative evaluation of the dissolution properties of the tablets was performed by the diffused reflectance (DRNIR) and transmittance (TNIR) NIR spectroscopic methods. Various kinds of IMC tablets (200 mg) were obtained from a powder (20 mg of IMC, 18 mg of microcrystalline cellulose, 160 mg of lactose, and 2 mg of magnesium stearate) under various compression pressures (60-398 MPa). Dissolution tests were performed in phosphate buffer, and the time required for 75% dissolution (T75) and mean dissolution time (MDT) were calculated. DRNIR and TNIR spectra were recorded, and the both NIR spectra used to establish a calibration model for predicting the dissolution properties by principal component regression analysis (PCR). The T75 and MDT increased as the compression pressure increased, since tablet porosity decreased with increasing pressure. Intensity of the DRNIR spectra of the compressed tablets decreased as the compression pressure increased. However, the intensity of TNIR spectra increased along with the pressure. The calibration models used to evaluate the dissolution properties of tablets were established by using PCR based on both DRNIR and TNIR spectra of the tablets. The multiple correlation coefficients of the relationship between the actual and predictive T75 by the DRNIR and TNIR methods were 0.831 and 0.962, respectively. It is possible to predict the dissolution properties of pharmaceutical preparations using both DRNIR and TNIR chemoinformetric methods. The TNIR method was more accurate for predictions of the dissolution behavior of tablets than the DRNIR method. (c) 2007 Wiley-Liss, Inc.
Genetic variants in RNA-induced silencing complex genes and prostate cancer.
Nikolić, Z; Savić Pavićević, D; Vučić, N; Cerović, S; Vukotić, V; Brajušković, G
2017-04-01
The purpose of this study is to evaluate the potential association between genetic variants in genes encoding the components of RNA-induced silencing complex and prostate cancer (PCa) risk. Genetic variants chosen for this study are rs3742330 in DICER1, rs4961280 in AGO2, rs784567 in TARBP2, rs7813 in GEMIN4 and rs197414 in GEMIN3. The study involved 355 PCa patients, 360 patients with benign prostatic hyperplasia and 318 healthy controls. For individuals diagnosed with PCa, clinicopathological characteristics including serum prostate-specific antigen level at diagnosis, Gleason score (GS) and clinical stage were determined. Genotyping was performed using high-resolution melting analysis, PCR-RFLP, TaqMan SNP Genotyping Assay and real-time PCR-based genotyping assay using specific probes. Allelic and genotypic associations were evaluated by unconditional linear and logistic regression methods. The study provided no evidence of association between the analyzed genetic variants and PCa risk. Nevertheless, allele A of rs784567 was found to confer the reduced risk of higher serum PSA level at diagnosis (P = 0.046; Difference = -66.64, 95 % CI -131.93 to 1.35, for log-additive model). Furthermore, rs4961280, as well as rs3742330, were shown to be associated with GS. These variants, together with rs7813, were found to be associated with the lower clinical stage of PCa. Also, rs3742330 minor allele G was found to be associated with lower PCa aggressiveness (P = 0.036; OR 0.14, 95 % CI 0.023-1.22, for recessive model). According to our data, rs3742330, rs4961280 and rs7813 qualify for potentially protective genetic variants against PCa progression. These variants were not shown to be associated with PCa risk.
Wilhelm, B J; Leblanc, D; Avery, B; Pearl, D L; Houde, A; Rajić, A; McEwen, S A
2016-03-01
We collected 599 Canadian retail pork chops and 283 pork livers routinely (usually weekly) from April 2011 to March 2012 using the Canadian Integrated Program for Antimicrobial Resistance Surveillance (CIPARS) retail sampling platform. Samples were assayed using validated real-time (q) reverse transcriptase polymerase chain reaction (RT-PCR) and nested classical RT-PCR for the detection of hepatitis E virus (HEV), porcine enteric calicivirus (PEC) and rotavirus (RV). The presence of Escherichia coli, Salmonella spp. and Campylobacter spp. was measured on a subset of our samples. Exact logistic regression models were fitted for predictors for HEV detection, for each assay. For both assays, sample type (pork chop versus liver) was a significant predictor for HEV RNA detection. For nested classical RT-PCR but not qRT-PCR, region of sample collection was a significant predictor (P = 0.008) of HEV detection. Odds of HEV detection were greatest in spring relative to other seasons. E. coli was a significant predictor for HEV RNA detection using the qRT-PCR (P = 0.03). Overall, the prevalence of E. coli, Salmonella spp. and Campylobacter spp. was significantly greater than HEV, PEC or RV on our retail pork samples. Our sparse data set for the detection of PEC and RV precluded modelling of risk factors for the detection of these viruses. © 2015 Zoonoses and Public Health © 2015 Her Majesty the Queen in Right of Canada Reproduced with the permission of the Minister of the Public Health Agency of Canada.
Hagan, Melissa J; Roubinov, Danielle S; Adler, Nancy E; Boyce, William Thomas; Bush, Nicole R
We tested the hypothesis that socioeconomic status (SES) would predict children's physical health problems at the end of kindergarten among children whose parent reported greater parent-child relationship (PCR) negativity and/or who exhibited greater parasympathetic (RSA) reactivity. We also tested whether RSA and PCR negativity mediated the SES-health association. Data were collected from 338 children (mean [SD] age, 5.32 [.32] years) and their primary caregivers (87% biological mothers) during the fall and subsequent spring of kindergarten. In the fall, parents reported income and education level (SES) and PCR negativity, and RSA reactivity was assessed via a standardized challenge protocol for young children. In the fall and then spring, parents reported children's chronic medical conditions and physical health impairments. Multivariate regression was conducted within a structural equation-modeling framework to test hypotheses. Significant interactions were found between SES and PCR negativity (b = -0.074, p = .035) and between SES and RSA reactivity (b = 0.169, p = .019) as predicts children's spring health impairment, adjusting for health in the preceding fall. Lower SES was associated with greater health impairment among children whose parents reported more PCR negativity (b = -0.110, p = .024) and children who showed greater RSA reactivity (b = -0.106, p = .011). Socioeconomic status was unrelated to physical health at low PCR negativity or RSA reactivity. Mediation models were not supported. Parent-child relationship quality and individual differences in stress reactivity may modulate the influence of SES on physical health in childhood.
Almanaseer, Naser; Sankarasubramanian, A.; Bales, Jerad
2014-01-01
Recent studies have found a significant association between climatic variability and basin hydroclimatology, particularly groundwater levels, over the southeast United States. The research reported in this paper evaluates the potential in developing 6-month-ahead groundwater-level forecasts based on the precipitation forecasts from ECHAM 4.5 General Circulation Model Forced with Sea Surface Temperature forecasts. Ten groundwater wells and nine streamgauges from the USGS Groundwater Climate Response Network and Hydro-Climatic Data Network were selected to represent groundwater and surface water flows, respectively, having minimal anthropogenic influences within the Flint River Basin in Georgia, United States. The writers employ two low-dimensional models [principle component regression (PCR) and canonical correlation analysis (CCA)] for predicting groundwater and streamflow at both seasonal and monthly timescales. Three modeling schemes are considered at the beginning of January to predict winter (January, February, and March) and spring (April, May, and June) streamflow and groundwater for the selected sites within the Flint River Basin. The first scheme (model 1) is a null model and is developed using PCR for every streamflow and groundwater site using previous 3-month observations (October, November, and December) available at that particular site as predictors. Modeling schemes 2 and 3 are developed using PCR and CCA, respectively, to evaluate the role of precipitation forecasts in improving monthly and seasonal groundwater predictions. Modeling scheme 3, which employs a CCA approach, is developed for each site by considering observed groundwater levels from nearby sites as predictands. The performance of these three schemes is evaluated using two metrics (correlation coefficient and relative RMS error) by developing groundwater-level forecasts based on leave-five-out cross-validation. Results from the research reported in this paper show that using precipitation forecasts in climate models improves the ability to predict the interannual variability of winter and spring streamflow and groundwater levels over the basin. However, significant conditional bias exists in all the three modeling schemes, which indicates the need to consider improved modeling schemes as well as the availability of longer time-series of observed hydroclimatic information over the basin.
Liu, Jinbao; Han, Jichang; Zhang, Yang; Wang, Huanyuan; Kong, Hui; Shi, Lei
2018-06-05
The storage of soil organic carbon (SOC) should improve soil fertility. Conventional determination of SOC is expensive and tedious. Visible-near infrared reflectance spectroscopy is a practical and cost-effective approach that has been successfully used SOC concentration. Soil spectral inversion model could quickly and efficiently determine SOC content. This paper presents a study dealing with SOC estimation through the combination of soil spectroscopy and stepwise multiple linear regression (SMLR), partial least squares regression (PLSR), principal component regression (PCR). Spectral measurements for 106 soil samples were acquired using an ASD FieldSpec 4 standard-res spectroradiometer (350-2500 nm). Six types of transformations and three regression methods were applied to build for the quantification of different parent materials development soil. The results show that (1)the basaltic volcanic clastics development of SOC spectral response bands located in 500 nm, 800 nm; Trachyte spectral response of the soil quality, and the volcanic clastics development at 405 nm, 465 nm, 575 nm, 1105 nm. (2) Basaltic volcanic debris soil development, first deviation of maximum correlation coefficient is 0.8898; thick surface soil of the development of rocky volcanic debris from bottom reflectivity logarithm of first deviation of maximum correlation coefficient is 0.9029. (3) Soil organic matter content of basaltic volcanic clastics development optimal prediction model based on spectral reflectance inverse logarithms of first deviation of SMLR. Independent variable number is 7, Rv 2 = 0.9720, RMSEP = 2.0590, sig = 0.003. Trachyte qualitative volcanic clastics developed soil organic matter content of the optimal prediction model based on spectral reflectance inverse logarithms of first deviation of PLSR. Model number of the independent variables Pc = 5, Rc = 0.9872, Rc 2 = 0.9745, RMSEC = 0.4821, SEC = 0.4906, forecasts determine coefficient Rv 2 = 0.9702, RMSEP = 0.9563, SEP = 0.9711, Bias = 0.0637. Copyright © 2018 Elsevier B.V. All rights reserved.
Petrelli, Fausto; Borgonovo, Karen; Cabiddu, Mary; Ghilardi, Mara; Lonati, Veronica; Barni, Sandro
2017-02-01
We performed a literature-based analysis of randomized clinical trials to assess the pathologic complete response (pCR) (ypT0N0 after neoadjuvant therapy) and 3-year disease-free survival (DFS) as potential surrogate endpoints for 5-year overall survival (OS) in rectal cancer treated with neoadjuvant (chemo)radiotherapy (CT)RT. A systematic literature search of PubMed, EMBASE, the Web of Science, SCOPUS, CINAHL, and the Cochrane Library was performed. Treatment effects on 3-year DFS and 5-year OS were expressed as rates of patients alive (%), and those on pCR as differences in pCR rates (∆ pCR% ). A weighted regression analysis was performed at individual- and trial-level to test the association between treatment effects on surrogate (∆ pCR% and ∆ 3yDFS ) and the main clinical outcome (∆ 5yOS ). Twenty-two trials involving 10,050 patients, were included in the analysis. The individual level surrogacy showed that the pCR% and 3-year DFS were poorly correlated with 5-year OS (R=0.52; 95% CI, 0.31-0.91; P=0.002; and R=0.60; 95% CI, 0.36-1; P=0.002). The trial-level surrogacy analysis confirmed that the two treatment effects on surrogates (∆ pCR% and ∆ 3yDFS ) are not strong surrogates for treatment effects on 5-year OS % (R=0.2; 95% CI, -0.29-0.78; P=0.5 and R=0.64; 95% CI, 0.29-1; P=0.06). These findings were confirmed in neoadjuvant CTRT studies but not in phase III trials were 3-year DFS could still represent a valid surrogate. This analysis does not support the use of pCR and 3-year DFS% as appropriate surrogate endpoints for 5-year OS% in patients with rectal cancer treated with neoadjuvant therapy.
Byappanahalli, Muruleedhara N.; Whitman, Richard L.; Shively, Dawn A.; Nevers, Meredith B.
2010-01-01
Quantitative polymerase chain reaction (qPCR) measurement of enterococci has been proposed as a rapid technique for assessment of beach water quality, but the response of qPCR results to environmental conditions has not been fully explored. Culture-based E. coli and enterococci have been used in empirical predictive models to characterize their responses to environmental conditions and to increase monitoring frequency and efficiency. This approach has been attempted with qPCR results only in few studies. During the summer of 2006, water samples were collected from two southern Lake Michigan beaches and the nearby river outfall (Burns Ditch) and were analyzed for enterococci by culture-based and non-culture-based (i.e., qPCR) methods, as well as culture-based E. coli. Culturable enterococci densities (log CFU/100 ml) for the beaches were significantly correlated with enterococci qPCR cell equivalents (CE) (R = 0.650, P N = 32). Enterococci CE and CFU densities were highest in Burns Ditch relative to the beach sites; however, only CFUs were significantly higher (P R = 0.565, P N = 32). Culturable E. coli and enterococci densities were significantly correlated (R = 0.682, P N = 32). Regression analyses suggested that enterococci CFU could be predicted by lake turbidity, Burns Ditch discharge, and wind direction (adjusted R2 = 0.608); enterococci CE was best predicted by Burns Ditch discharge and log-transformed lake turbidity × wave height (adjusted R2 = 0.40). In summary, our results show that analytically, the qPCR method compares well to the non-culture-based method for measuring enterococci densities in beach water and that both these approaches can be predicted by hydrometeorological conditions. Selected predictors and model results highlight the differences between the environmental responses of the two method endpoints and the potentially high variance in qPCR results
[Effects of bkdAB interruption on avermectin biosynthesis].
Zhu, Hao-Jun; Liang, Yun-Xiang; Zhou, Jun-Chu; Zheng, Ying-Hua
2004-03-01
In this study, Streptomyces avermitilis Bjbm0006 which produces four avermectin B components was used as an original test strain. A replacement plasmid containing a gene cluster bkdAB (branched-chain alpha-keto acid dehydrogenase gene) involved in the biosynthesis of avermectin B in S. avermitilis Bjbm0006 was constructed by means of PCR technique and then named as pHJ5821 (pHZ1358::bkdAB&erm). A recombinant strain Bjbm5821 was obtained after the gene cluster was interrupted by double crossover. This strain was tested in laboratory conditions and analysed by PCR using the total DNA as template. The HPLC analysis showed that the strain Bjbm5821 synthesized the same 'a' components Bla and B2a as the original strain did. However, It lost the ability for the production of 'b'components for example B1b and B2b. A novel compound was detected in fermentation products. The results of present study suggests that the production of gene cluster bkdAB may play a main role similar to alpha-ketoisovaleric acid dehydrogenase in the pathway of avermectin synthesis.
Regression to fuzziness method for estimation of remaining useful life in power plant components
NASA Astrophysics Data System (ADS)
Alamaniotis, Miltiadis; Grelle, Austin; Tsoukalas, Lefteri H.
2014-10-01
Mitigation of severe accidents in power plants requires the reliable operation of all systems and the on-time replacement of mechanical components. Therefore, the continuous surveillance of power systems is a crucial concern for the overall safety, cost control, and on-time maintenance of a power plant. In this paper a methodology called regression to fuzziness is presented that estimates the remaining useful life (RUL) of power plant components. The RUL is defined as the difference between the time that a measurement was taken and the estimated failure time of that component. The methodology aims to compensate for a potential lack of historical data by modeling an expert's operational experience and expertise applied to the system. It initially identifies critical degradation parameters and their associated value range. Once completed, the operator's experience is modeled through fuzzy sets which span the entire parameter range. This model is then synergistically used with linear regression and a component's failure point to estimate the RUL. The proposed methodology is tested on estimating the RUL of a turbine (the basic electrical generating component of a power plant) in three different cases. Results demonstrate the benefits of the methodology for components for which operational data is not readily available and emphasize the significance of the selection of fuzzy sets and the effect of knowledge representation on the predicted output. To verify the effectiveness of the methodology, it was benchmarked against the data-based simple linear regression model used for predictions which was shown to perform equal or worse than the presented methodology. Furthermore, methodology comparison highlighted the improvement in estimation offered by the adoption of appropriate of fuzzy sets for parameter representation.
Störmer, M; Cassens, U; Kleesiek, K; Dreier, J
2007-02-01
Bacteria show differences in their growth kinetics depending on the type of blood component. On to storage at 22 degrees C, platelet concentrates (PCs) seem to be more prone to bacterial multiplication than red cell concentrates. Knowledge of the potential for bacterial proliferation in blood components, which are stored at a range of temperatures, is essential before considering implementation of a detection strategy. The efficacy of bacterial detection was determined, using real-time reverse transcriptase-polymerase chain reaction (RT-PCR), following bacterial growth in blood components obtained from a deliberately contaminated whole-blood (WB) unit. Cultivation was used as the reference method. WB was spiked with 2 colony-forming units mL(-1)Staphylococcus epidermidis or Klebsiella pneumoniae, kept for 15 h at room temperature and component preparation was processed. Samples were drawn, at intervals throughout the whole separation process, from each blood component. Nucleic acids were extracted using an automated high-volume extraction method. The 15-h storage revealed an insignificant increase in bacterial titre. No bacterial growth was detected in red blood cell or plasma units. K. pneumoniae showed rapid growth in the pooled PC and could be detected immediately after preparation using RT-PCR. S. epidermidis grew slowly and was detected 24 h after separation. These experiments show that sampling is indicative at 24 h after preparation of PCs at the earliest to minimize the sampling error.
Use of a fluorogenic probe in a PCR-based assay for the detection of Listeria monocytogenes.
Bassler, H A; Flood, S J; Livak, K J; Marmaro, J; Knorr, R; Batt, C A
1995-10-01
A PCR-based assay for Listeria monocytogenes that uses the hydrolysis of an internal fluorogenic probe to monitor the amplification of the target has been formatted. The fluorogenic 5' nuclease PCR assay takes advantage of the endogenous 5' --> 3' nuclease activity of Taq DNA polymerase to digest a probe which is labelled with two fluorescent dyes and hybridizes to the amplicon during PCR. When the probe is intact, the two fluorophores interact such that the emission of the reporter dye is quenched. During amplification, the probe is hydrolyzed, relieving the quenching of the reporter and resulting in an increase in its fluorescence intensity. This change in reporter dye fluorescence is quantitative for the amount of PCR product and, under appropriate conditions, for the amount of template. We have applied the fluorogenic 5' nuclease PCR assay to detect L. monocytogenes, using an 858-bp amplicon of hemolysin (hlyA) as the target. Maximum sensitivity was achieved by evaluating various fluorogenic probes and then optimizing the assay components and cycling parameters. With crude cell lysates, the total assay could be completed in 3 h with a detection limit of approximately 50 CFU. Quantification was linear over a range of 5 x 10(1) to 5 x 10(5) CFU.
Ganger, Michael T; Dietz, Geoffrey D; Ewing, Sarah J
2017-12-01
qPCR has established itself as the technique of choice for the quantification of gene expression. Procedures for conducting qPCR have received significant attention; however, more rigorous approaches to the statistical analysis of qPCR data are needed. Here we develop a mathematical model, termed the Common Base Method, for analysis of qPCR data based on threshold cycle values (C q ) and efficiencies of reactions (E). The Common Base Method keeps all calculations in the logscale as long as possible by working with log 10 (E) ∙ C q , which we call the efficiency-weighted C q value; subsequent statistical analyses are then applied in the logscale. We show how efficiency-weighted C q values may be analyzed using a simple paired or unpaired experimental design and develop blocking methods to help reduce unexplained variation. The Common Base Method has several advantages. It allows for the incorporation of well-specific efficiencies and multiple reference genes. The method does not necessitate the pairing of samples that must be performed using traditional analysis methods in order to calculate relative expression ratios. Our method is also simple enough to be implemented in any spreadsheet or statistical software without additional scripts or proprietary components.
Development of quantitative real-time PCR for detection and enumeration of Enterobacteriaceae.
Takahashi, Hajime; Saito, Rumi; Miya, Satoko; Tanaka, Yuichiro; Miyamura, Natsumi; Kuda, Takashi; Kimura, Bon
2017-04-04
The family Enterobacteriaceae, members of which are widely distributed in the environment, includes many important human pathogens. In this study, a rapid real-time PCR method targeting rplP, coding for L16 protein, a component of the ribosome large subunit, was developed for enumerating Enterobacteriaceae strains, and its efficiency was evaluated using naturally contaminated food products. The rplP-targeted real-time PCR amplified Enterobacteriaceae species with Ct values of 14.0-22.8, whereas the Ct values for non-Enterobacteriaceae species were >30, indicating the specificity of this method for the Enterobacteriaceae. Using a calibration curve of Ct=-3.025 (log CFU/g)+37.35, which was calculated from individual plots of the cell numbers in different concentrations of 5 Enterobacteriaceae species, the rplP-targeted real-time PCR was applied to 51 food samples. A <1log difference between the real-time PCR and culture methods was obtained in a majority of the food samples (81.8%), with good correlation (r 2 =0.8285). This study demonstrated that the rplP-targeted real-time PCR method could detect and enumerate Enterobacteriaceae species in foods rapidly and accurately, and therefore, it can be used for the microbiological risk analysis of foods. Copyright © 2017 Elsevier B.V. All rights reserved.
Tu, Yu-Kang; Krämer, Nicole; Lee, Wen-Chung
2012-07-01
In the analysis of trends in health outcomes, an ongoing issue is how to separate and estimate the effects of age, period, and cohort. As these 3 variables are perfectly collinear by definition, regression coefficients in a general linear model are not unique. In this tutorial, we review why identification is a problem, and how this problem may be tackled using partial least squares and principal components regression analyses. Both methods produce regression coefficients that fulfill the same collinearity constraint as the variables age, period, and cohort. We show that, because the constraint imposed by partial least squares and principal components regression is inherent in the mathematical relation among the 3 variables, this leads to more interpretable results. We use one dataset from a Taiwanese health-screening program to illustrate how to use partial least squares regression to analyze the trends in body heights with 3 continuous variables for age, period, and cohort. We then use another dataset of hepatocellular carcinoma mortality rates for Taiwanese men to illustrate how to use partial least squares regression to analyze tables with aggregated data. We use the second dataset to show the relation between the intrinsic estimator, a recently proposed method for the age-period-cohort analysis, and partial least squares regression. We also show that the inclusion of all indicator variables provides a more consistent approach. R code for our analyses is provided in the eAppendix.
Wang, Jie; Shen, Changwei; Liu, Na; Jin, Xin; Fan, Xueshan; Dong, Caixia; Xu, Yangchun
2017-03-08
Non-destructive and timely determination of leaf nitrogen (N) concentration is urgently needed for N management in pear orchards. A two-year field experiment was conducted in a commercial pear orchard with five N application rates: 0 (N0), 165 (N1), 330 (N2), 660 (N3), and 990 (N4) kg·N·ha -1 . The mid-portion leaves on the year's shoot were selected for the spectral measurement first and then N concentration determination in the laboratory at 50 and 80 days after full bloom (DAB). Three methods of in-field spectral measurement (25° bare fibre under solar conditions, black background attached to plant probe, and white background attached to plant probe) were compared. We also investigated the modelling performances of four chemometric techniques (principal components regression, PCR; partial least squares regression, PLSR; stepwise multiple linear regression, SMLR; and back propagation neural network, BPNN) and three vegetation indices (difference spectral index, normalized difference spectral index, and ratio spectral index). Due to the low correlation of reflectance obtained by the 25° field of view method, all of the modelling was performed on two spectral datasets-both acquired by a plant probe. Results showed that the best modelling and prediction accuracy were found in the model established by PLSR and spectra measured with a black background. The randomly-separated subsets of calibration ( n = 1000) and validation ( n = 420) of this model resulted in high R² values of 0.86 and 0.85, respectively, as well as a low mean relative error (<6%). Furthermore, a higher coefficient of determination between the leaf N concentration and fruit yield was found at 50 DAB samplings in both 2015 (R² = 0.77) and 2014 (R² = 0.59). Thus, the leaf N concentration was suggested to be determined at 50 DAB by visible/near-infrared spectroscopy and the threshold should be 24-27 g/kg.
HT-FRTC: a fast radiative transfer code using kernel regression
NASA Astrophysics Data System (ADS)
Thelen, Jean-Claude; Havemann, Stephan; Lewis, Warren
2016-09-01
The HT-FRTC is a principal component based fast radiative transfer code that can be used across the electromagnetic spectrum from the microwave through to the ultraviolet to calculate transmittance, radiance and flux spectra. The principal components cover the spectrum at a very high spectral resolution, which allows very fast line-by-line, hyperspectral and broadband simulations for satellite-based, airborne and ground-based sensors. The principal components are derived during a code training phase from line-by-line simulations for a diverse set of atmosphere and surface conditions. The derived principal components are sensor independent, i.e. no extra training is required to include additional sensors. During the training phase we also derive the predictors which are required by the fast radiative transfer code to determine the principal component scores from the monochromatic radiances (or fluxes, transmittances). These predictors are calculated for each training profile at a small number of frequencies, which are selected by a k-means cluster algorithm during the training phase. Until recently the predictors were calculated using a linear regression. However, during a recent rewrite of the code the linear regression was replaced by a Gaussian Process (GP) regression which resulted in a significant increase in accuracy when compared to the linear regression. The HT-FRTC has been trained with a large variety of gases, surface properties and scatterers. Rayleigh scattering as well as scattering by frozen/liquid clouds, hydrometeors and aerosols have all been included. The scattering phase function can be fully accounted for by an integrated line-by-line version of the Edwards-Slingo spherical harmonics radiation code or approximately by a modification to the extinction (Chou scaling).
NASA Astrophysics Data System (ADS)
Oguntunde, Philip G.; Lischeid, Gunnar; Dietrich, Ottfried
2018-03-01
This study examines the variations of climate variables and rice yield and quantifies the relationships among them using multiple linear regression, principal component analysis, and support vector machine (SVM) analysis in southwest Nigeria. The climate and yield data used was for a period of 36 years between 1980 and 2015. Similar to the observed decrease ( P < 0.001) in rice yield, pan evaporation, solar radiation, and wind speed declined significantly. Eight principal components exhibited an eigenvalue > 1 and explained 83.1% of the total variance of predictor variables. The SVM regression function using the scores of the first principal component explained about 75% of the variance in rice yield data and linear regression about 64%. SVM regression between annual solar radiation values and yield explained 67% of the variance. Only the first component of the principal component analysis (PCA) exhibited a clear long-term trend and sometimes short-term variance similar to that of rice yield. Short-term fluctuations of the scores of the PC1 are closely coupled to those of rice yield during the 1986-1993 and the 2006-2013 periods thereby revealing the inter-annual sensitivity of rice production to climate variability. Solar radiation stands out as the climate variable of highest influence on rice yield, and the influence was especially strong during monsoon and post-monsoon periods, which correspond to the vegetative, booting, flowering, and grain filling stages in the study area. The outcome is expected to provide more in-depth regional-specific climate-rice linkage for screening of better cultivars that can positively respond to future climate fluctuations as well as providing information that may help optimized planting dates for improved radiation use efficiency in the study area.
Accounting for measurement error in log regression models with applications to accelerated testing.
Richardson, Robert; Tolley, H Dennis; Evenson, William E; Lunt, Barry M
2018-01-01
In regression settings, parameter estimates will be biased when the explanatory variables are measured with error. This bias can significantly affect modeling goals. In particular, accelerated lifetime testing involves an extrapolation of the fitted model, and a small amount of bias in parameter estimates may result in a significant increase in the bias of the extrapolated predictions. Additionally, bias may arise when the stochastic component of a log regression model is assumed to be multiplicative when the actual underlying stochastic component is additive. To account for these possible sources of bias, a log regression model with measurement error and additive error is approximated by a weighted regression model which can be estimated using Iteratively Re-weighted Least Squares. Using the reduced Eyring equation in an accelerated testing setting, the model is compared to previously accepted approaches to modeling accelerated testing data with both simulations and real data.
Microfluidic system for the identification of bacterial pathogens causing urinary tract infections
NASA Astrophysics Data System (ADS)
Becker, Holger; Hlawatsch, Nadine; Haraldsson, Tommy; van der Wijngaart, Wouter; Lind, Anders; Malhotra-Kumar, Surbi; Turlej-Rogacka, Agata; Goossens, Herman
2015-03-01
Urinary tract infections (UTIs) are among the most common bacterial infections and pose a significant healthcare burden. The growing trend in antibiotic resistance makes it mandatory to develop diagnostic kits which allow not only the determination of a pathogen but also the antibiotic resistances. We have developed a microfluidic cartridge which takes a direct urine sample, extracts the DNA, performs an amplification using batch-PCR and flows the sample over a microarray which is printed into a microchannel for fluorescence detection. The cartridge is injection-molded out of COP and contains a set of two-component injection-molded rotary valves to switch between input and to isolate the PCR chamber during thermocycling. The hybridization probes were spotted directly onto a functionalized section of the outlet microchannel. We have been able to successfully perform PCR of E.coli in urine in this chip and perform a fluorescence detection of PCR products. An upgraded design of the cartridge contains the buffers and reagents in blisters stored on the chip.
Detection of adulterated murine components in meat products by TaqMan© real-time PCR.
Fang, Xin; Zhang, Chi
2016-02-01
Using murine meat to substitute mutton has been identified as a new type of meat fraud in China, yet no detection method for murine species has been reported. Here, three kinds of rodent were used as target species to establish a murine-specific real-time PCR method of detection. The mitochondrial cytochrome b gene (cytb) of each target was sequenced and a TaqMan probe was designed based on the cytb. Simultaneously, an internal positive control (IPC) plasmid along with its respective probe were designed to monitor the PCR reaction. As a result, the duplex real-time PCR system was verified to be specific. The limit of detection (LOD) was lower than 1 pg of DNA per reaction and 0.1% murine contamination in meat mixtures. Standard curves were generated for a quantitative analysis. Thus, this study provided a new tool to control the quality of meat products for official and third-party laboratories. Copyright © 2015. Published by Elsevier Ltd.
Practical aspects of estimating energy components in rodents
van Klinken, Jan B.; van den Berg, Sjoerd A. A.; van Dijk, Ko Willems
2013-01-01
Recently there has been an increasing interest in exploiting computational and statistical techniques for the purpose of component analysis of indirect calorimetry data. Using these methods it becomes possible to dissect daily energy expenditure into its components and to assess the dynamic response of the resting metabolic rate (RMR) to nutritional and pharmacological manipulations. To perform robust component analysis, however, is not straightforward and typically requires the tuning of parameters and the preprocessing of data. Moreover the degree of accuracy that can be attained by these methods depends on the configuration of the system, which must be properly taken into account when setting up experimental studies. Here, we review the methods of Kalman filtering, linear, and penalized spline regression, and minimal energy expenditure estimation in the context of component analysis and discuss their results on high resolution datasets from mice and rats. In addition, we investigate the effect of the sample time, the accuracy of the activity sensor, and the washout time of the chamber on the estimation accuracy. We found that on the high resolution data there was a strong correlation between the results of Kalman filtering and penalized spline (P-spline) regression, except for the activity respiratory quotient (RQ). For low resolution data the basal metabolic rate (BMR) and resting RQ could still be estimated accurately with P-spline regression, having a strong correlation with the high resolution estimate (R2 > 0.997; sample time of 9 min). In contrast, the thermic effect of food (TEF) and activity related energy expenditure (AEE) were more sensitive to a reduction in the sample rate (R2 > 0.97). In conclusion, for component analysis on data generated by single channel systems with continuous data acquisition both Kalman filtering and P-spline regression can be used, while for low resolution data from multichannel systems P-spline regression gives more robust results. PMID:23641217
A Simulation Investigation of Principal Component Regression.
ERIC Educational Resources Information Center
Allen, David E.
Regression analysis is one of the more common analytic tools used by researchers. However, multicollinearity between the predictor variables can cause problems in using the results of regression analyses. Problems associated with multicollinearity include entanglement of relative influences of variables due to reduced precision of estimation,…
Soria, M C; Soria, M A; Bueno, D J; Godano, E I; Gómez, S C; ViaButron, I A; Padin, V M; Rogé, A D
2017-08-01
The performance of detection methods (culture methods and polymerase chain reaction assay) and plating media used in the same type of samples were determined as well as the specificity of PCR primers to detected Salmonella spp. contamination in layer hen farms. Also, the association of farm characteristics with Salmonella presence was evaluated. Environmental samples (feces, feed, drinking water, air, boot-swabs) and eggs were taken from 40 layer hen houses. Salmonella spp. was most detected in boot-swabs taken around the houses (30% and 35% by isolation and PCR, respectively) follow by fecal samples (15.2% and 13.6% by isolation and PCR, respectively). Eggs, drinking water, and air samples were negative for Salmonella detection. Salmonella Schwarzengrund and S. Enteritidis were the most isolated serotypes. For plating media, relative specificity was 1, and the relative sensitivity was greater for EF-18 agar than XLDT agar in feed and fecal samples. However, relative sensitivity was greater in XLDT agar than EF-18 agar for boot-swab samples. Agreement was between fair to good depending on the sample, and it was good between isolation and PCR (feces and boot-swabs), without agreement for feed samples. Salmonella spp. PCR was positive for all strains, while S. Typhimurium PCR was negative. Salmonella Enteritidis PCR used was not specific. Based in the multiple logistic regression analyses, categorization by counties was significant for Salmonella spp. presence (P-value = 0.010). This study shows the importance of considering different types of samples, plating media and detection methods during a Salmonella spp. monitoring study. In addition, it is important to incorporate the sampling of floors around the layer hen houses to learn if biosecurity measures should be strengthened to minimize the entry and spread of Salmonella in the houses. Also, the performance of some PCR methods and S. Enteritidis PCR should be improved, and biosecurity measures in hen farms must be reinforced in the region of more concentrated layer hen houses to reduce the probability of Salmonella spp. presence. © 2017 Poultry Science Association Inc.
Añez, Germán; Heisey, Daniel A. R.; Chancey, Caren; Fares, Rafaelle C. G.; Espina, Luz M.; Souza, Kátia P. R.; Teixeira-Carvalho, Andréa; Krysztof, David E.; Foster, Gregory A.; Stramer, Susan L.; Rios, Maria
2016-01-01
Background Dengue is a mosquito-borne viral disease caused by the four dengue viruses (DENV-1 to 4) that can also be transmitted by blood transfusion and organ transplantation. The distribution of DENV in the components of blood from infected donors is poorly understood. Methods We used an in-house TaqMan qRT-PCR assay to test residual samples of plasma, cellular components of whole blood (CCWB), serum and clot specimens from the same collection from blood donors who were DENV-RNA-reactive in a parallel blood safety study. To assess whether DENV RNA detected by TaqMan was associated with infectious virus, DENV infectivity in available samples was determined by culture in mosquito cells. Results DENV RNA was detected by TaqMan in all tested blood components, albeit more consistently in the cellular components; 78.8% of CCWB, 73.3% of clots, 86.7% of sera and 41.8% of plasma samples. DENV-1 was detected in 48 plasma and 97 CCWB samples while DENV-4 was detected in 21 plasma and 31 CCWB samples. In mosquito cell cultures, 29/111 (26.1%) plasma and 32/97 (32.7%) CCWB samples were infectious. A subset of samples from 29 donors was separately analyzed to compare DENV viral loads in the available blood components. DENV viral loads did not differ significantly between components and ranged from 3–8 log10 PCR-detectable units/ml. Conclusions DENV was present in all tested components from most donors, and viral RNA was not preferentially distributed in any of the tested components. Infectious DENV was also present in similar proportions in cultured plasma, clot and CCWB samples, indicating that these components may serve as a resource when sample sizes are limited. However, these results suggest that the sensitivity of the nucleic acid tests (NAT) for these viruses would not be improved by testing whole blood or components other than plasma. PMID:26871560
Anez, German; Heisey, Daniel A. R.; Chancey, Caren; ...
2016-02-12
Dengue is a mosquito-borne viral disease caused by the four dengue viruses (DENV-1 to 4) that can also be transmitted by blood transfusion and organ transplantation. The distribution of DENV in the components of blood from infected donors is poorly understood. Here, we used an in-house TaqMan qRT-PCR assay to test residual samples of plasma, cellular components of whole blood (CCWB), serum and clot specimens from the same collection from blood donors who were DENV-RNA-reactive in a parallel blood safety study. To assess whether DENV RNA detected by TaqMan was associated with infectious virus, DENV infectivity in available samples wasmore » determined by culture in mosquito cells. As a result, DENV RNA was detected by TaqMan in all tested blood components, albeit more consistently in the cellular components; 78.8% of CCWB, 73.3% of clots, 86.7% of sera and 41.8% of plasma samples. DENV-1 was detected in 48 plasma and 97 CCWB samples while DENV-4 was detected in 21 plasma and 31 CCWB samples. In mosquito cell cultures, 29/111 (26.1%) plasma and 32/97 (32.7%) CCWB samples were infectious. A subset of samples from 29 donors was separately analyzed to compare DENV viral loads in the available blood components. DENV viral loads did not differ significantly between components and ranged from 3–8 log 10 PCR-detectable units/ml. In conclusion, DENV was present in all tested components from most donors, and viral RNA was not preferentially distributed in any of the tested components. Infectious DENV was also present in similar proportions in cultured plasma, clot and CCWB samples, indicating that these components may serve as a resource when sample sizes are limited. However, these results suggest that the sensitivity of the nucleic acid tests (NAT) for these viruses would not be improved by testing whole blood or components other than plasma.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Anez, German; Heisey, Daniel A. R.; Chancey, Caren
Dengue is a mosquito-borne viral disease caused by the four dengue viruses (DENV-1 to 4) that can also be transmitted by blood transfusion and organ transplantation. The distribution of DENV in the components of blood from infected donors is poorly understood. Here, we used an in-house TaqMan qRT-PCR assay to test residual samples of plasma, cellular components of whole blood (CCWB), serum and clot specimens from the same collection from blood donors who were DENV-RNA-reactive in a parallel blood safety study. To assess whether DENV RNA detected by TaqMan was associated with infectious virus, DENV infectivity in available samples wasmore » determined by culture in mosquito cells. As a result, DENV RNA was detected by TaqMan in all tested blood components, albeit more consistently in the cellular components; 78.8% of CCWB, 73.3% of clots, 86.7% of sera and 41.8% of plasma samples. DENV-1 was detected in 48 plasma and 97 CCWB samples while DENV-4 was detected in 21 plasma and 31 CCWB samples. In mosquito cell cultures, 29/111 (26.1%) plasma and 32/97 (32.7%) CCWB samples were infectious. A subset of samples from 29 donors was separately analyzed to compare DENV viral loads in the available blood components. DENV viral loads did not differ significantly between components and ranged from 3–8 log 10 PCR-detectable units/ml. In conclusion, DENV was present in all tested components from most donors, and viral RNA was not preferentially distributed in any of the tested components. Infectious DENV was also present in similar proportions in cultured plasma, clot and CCWB samples, indicating that these components may serve as a resource when sample sizes are limited. However, these results suggest that the sensitivity of the nucleic acid tests (NAT) for these viruses would not be improved by testing whole blood or components other than plasma.« less
Ameling, Sabine; Kacprowski, Tim; Chilukoti, Ravi Kumar; Malsch, Carolin; Liebscher, Volkmar; Suhre, Karsten; Pietzner, Maik; Friedrich, Nele; Homuth, Georg; Hammer, Elke; Völker, Uwe
2015-10-14
Non-cellular blood circulating microRNAs (plasma miRNAs) represent a promising source for the development of prognostic and diagnostic tools owing to their minimally invasive sampling, high stability, and simple quantification by standard techniques such as RT-qPCR. So far, the majority of association studies involving plasma miRNAs were disease-specific case-control analyses. In contrast, in the present study, plasma miRNAs were analysed in a sample of 372 individuals from a population-based cohort study, the Study of Health in Pomerania (SHIP). Quantification of miRNA levels was performed by RT-qPCR using the Exiqon Serum/Plasma Focus microRNA PCR Panel V3.M covering 179 different miRNAs. Of these, 155 were included in our analyses after quality-control. Associations between plasma miRNAs and the phenotypes age, body mass index (BMI), and sex were assessed via a two-step linear regression approach per miRNA. The first step regressed out the technical parameters and the second step determined the remaining associations between the respective plasma miRNA and the phenotypes of interest. After regressing out technical parameters and adjusting for the respective other two phenotypes, 7, 15, and 35 plasma miRNAs were significantly (q < 0.05) associated with age, BMI, and sex, respectively. Additional adjustment for the blood cell parameters identified 12 and 19 miRNAs to be significantly associated with age and BMI, respectively. Most of the BMI-associated miRNAs likely originate from liver. Sex-associated differences in miRNA levels were largely determined by differences in blood cell parameters. Thus, only 7 as compared to originally 35 sex-associated miRNAs displayed sex-specific differences after adjustment for blood cell parameters. These findings emphasize that circulating miRNAs are strongly impacted by age, BMI, and sex. Hence, these parameters should be considered as covariates in association studies based on plasma miRNA levels. The established experimental and computational workflow can now be used in future screening studies to determine associations of plasma miRNAs with defined disease phenotypes.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gao, Yuan-Hong; Department of Radiation Oncology, Sun Yat-sen University Cancer Center, Guangzhou; Lin, Jun-Zhong
Purpose: Systemic failure remains the major challenge in management of locally advanced rectal cancer (LARC). To optimize the timing of neoadjuvant treatment and enhance systemic control, we initiated a phase 2 trial to evaluate a new strategy of neoadjuvant sandwich treatment, integrating induction chemotherapy, concurrent chemoradiation therapy, and consolidation chemotherapy. Here, we present preliminary results of this trial, reporting the tumor response, toxicities, and surgical complications. Methods and Materials: Fifty-one patients with LARC were enrolled, among which were two patients who were ineligible because of distant metastases before treatment. Patients were treated first with one cycle of induction chemotherapy consistingmore » of oxaliplatin, 130 mg/m² on day 1, with capecitabine, 1000 mg/m² twice daily for 14 days every 3 weeks (the XELOX regimen), followed by chemoradiation therapy, 50 Gy over 5 weeks, with the modified XELOX regimen (oxaliplatin 100 mg/m²), and then with another cycle of consolidation chemotherapy with the XELOX regimen. Surgery was performed 6 to 8 weeks after completion of radiation therapy. Tumor responses, toxicities, and surgical complications were recorded. Results: All but one patent completed the planned schedule of neoadjuvant sandwich treatment. Neither life-threatening blood count decrease nor febrile neutropenia were observed. Forty-five patents underwent optimal surgery with total mesorectal excision (TME). Four patients refused surgery because of clinically complete response. There was no perioperative mortality in this cohort. Five patients (11.1%) developed postoperative complications. Among the 45 patients who underwent TME, pathologic complete response (pCR), pCR or major regression, and at least moderate regression were achieved in 19 (42.2%), 37 (82.2%), and 44 patients (97.8%), respectively. Conclusions: Preliminary results suggest that the strategy of neoadjuvant sandwich treatment using XELOX regimen as induction, concomitant, and consolidation chemotherapy to the conventional radiation is well tolerated. The strategy is highly effective in terms of pCR and major regression, which warrants further investigation.« less
James R. Wallis
1965-01-01
Written in Fortran IV and MAP, this computer program can handle up to 120 variables, and retain 40 principal components. It can perform simultaneous regression of up to 40 criterion variables upon the varimax rotated factor weight matrix. The columns and rows of all output matrices are labeled by six-character alphanumeric names. Data input can be from punch cards or...
NASA Astrophysics Data System (ADS)
Wang, Yang; Wang, Ping; Xu, Changhua; Sun, Suqin; Zhou, Qun; Shi, Zhe; Li, Jin; Chen, Tao; Li, Zheng; Cui, Weili
2015-11-01
Paeonia lactiflora, a commonly used herbal medicine (HM) in Traditional Chinese Medicine (TCM), mainly has two species, Radix Paeoniae Alba (RPA) and Radix Paeoniae Rubra (RPR), for different clinical applications in TCM. For expounding the chemical profile of RPA and RPR and ensuring the clinical efficacy and safety, an infrared macro-fingerprint analysis-through-separation method integrated with statistical pattern recognition was developed to analyze and discriminate the two Paeonia lactifloras. In IR spectra, the major difference between the two was in the range of 1200-900 cm-1: the strongest peak of RPA was at 1024 cm-1, while that of RPR was 1049 cm-1. The difference was magnified in second derivative spectra. The findings were further verified by investigating the separation process of total glucosides, stepwisely monitored by both of IR and UPLC-MS/MS. Simultaneously, the aqueous extracts of RPA and RPR had been separated continuously to acquire the comprehensively hierarchical chemical characteristics for undoubtedly identification and subsequently discrimination of the two herbs. Moreover, 60 batches of the two HMs (30 for each) were objectively classified by principal component regression (PCR) model based on IR macro-fingerprints.
Identification of informative features for predicting proinflammatory potentials of engine exhausts.
Wang, Chia-Chi; Lin, Ying-Chi; Lin, Yuan-Chung; Jhang, Syu-Ruei; Tung, Chun-Wei
2017-08-18
The immunotoxicity of engine exhausts is of high concern to human health due to the increasing prevalence of immune-related diseases. However, the evaluation of immunotoxicity of engine exhausts is currently based on expensive and time-consuming experiments. It is desirable to develop efficient methods for immunotoxicity assessment. To accelerate the development of safe alternative fuels, this study proposed a computational method for identifying informative features for predicting proinflammatory potentials of engine exhausts. A principal component regression (PCR) algorithm was applied to develop prediction models. The informative features were identified by a sequential backward feature elimination (SBFE) algorithm. A total of 19 informative chemical and biological features were successfully identified by SBFE algorithm. The informative features were utilized to develop a computational method named FS-CBM for predicting proinflammatory potentials of engine exhausts. FS-CBM model achieved a high performance with correlation coefficient values of 0.997 and 0.943 obtained from training and independent test sets, respectively. The FS-CBM model was developed for predicting proinflammatory potentials of engine exhausts with a large improvement on prediction performance compared with our previous CBM model. The proposed method could be further applied to construct models for bioactivities of mixtures.
NASA Astrophysics Data System (ADS)
Riad, Safaa M.; Salem, Hesham; Elbalkiny, Heba T.; Khattab, Fatma I.
2015-04-01
Five, accurate, precise, and sensitive univariate and multivariate spectrophotometric methods were developed for the simultaneous determination of a ternary mixture containing Trimethoprim (TMP), Sulphamethoxazole (SMZ) and Oxytetracycline (OTC) in waste water samples collected from different cites either production wastewater or livestock wastewater after their solid phase extraction using OASIS HLB cartridges. In univariate methods OTC was determined at its λmax 355.7 nm (0D), while (TMP) and (SMZ) were determined by three different univariate methods. Method (A) is based on successive spectrophotometric resolution technique (SSRT). The technique starts with the ratio subtraction method followed by ratio difference method for determination of TMP and SMZ. Method (B) is successive derivative ratio technique (SDR). Method (C) is mean centering of the ratio spectra (MCR). The developed multivariate methods are principle component regression (PCR) and partial least squares (PLS). The specificity of the developed methods is investigated by analyzing laboratory prepared mixtures containing different ratios of the three drugs. The obtained results are statistically compared with those obtained by the official methods, showing no significant difference with respect to accuracy and precision at p = 0.05.
Prediction of valid acidity in intact apples with Fourier transform near infrared spectroscopy.
Liu, Yan-De; Ying, Yi-Bin; Fu, Xia-Ping
2005-03-01
To develop nondestructive acidity prediction for intact Fuji apples, the potential of Fourier transform near infrared (FT-NIR) method with fiber optics in interactance mode was investigated. Interactance in the 800 nm to 2619 nm region was measured for intact apples, harvested from early to late maturity stages. Spectral data were analyzed by two multivariate calibration techniques including partial least squares (PLS) and principal component regression (PCR) methods. A total of 120 Fuji apples were tested and 80 of them were used to form a calibration data set. The influences of different data preprocessing and spectra treatments were also quantified. Calibration models based on smoothing spectra were slightly worse than that based on derivative spectra, and the best result was obtained when the segment length was 5 nm and the gap size was 10 points. Depending on data preprocessing and PLS method, the best prediction model yielded correlation coefficient of determination (r2) of 0.759, low root mean square error of prediction (RMSEP) of 0.0677, low root mean square error of calibration (RMSEC) of 0.0562. The results indicated the feasibility of FT-NIR spectral analysis for predicting apple valid acidity in a nondestructive way.
Riad, Safaa M; Salem, Hesham; Elbalkiny, Heba T; Khattab, Fatma I
2015-04-05
Five, accurate, precise, and sensitive univariate and multivariate spectrophotometric methods were developed for the simultaneous determination of a ternary mixture containing Trimethoprim (TMP), Sulphamethoxazole (SMZ) and Oxytetracycline (OTC) in waste water samples collected from different cites either production wastewater or livestock wastewater after their solid phase extraction using OASIS HLB cartridges. In univariate methods OTC was determined at its λmax 355.7 nm (0D), while (TMP) and (SMZ) were determined by three different univariate methods. Method (A) is based on successive spectrophotometric resolution technique (SSRT). The technique starts with the ratio subtraction method followed by ratio difference method for determination of TMP and SMZ. Method (B) is successive derivative ratio technique (SDR). Method (C) is mean centering of the ratio spectra (MCR). The developed multivariate methods are principle component regression (PCR) and partial least squares (PLS). The specificity of the developed methods is investigated by analyzing laboratory prepared mixtures containing different ratios of the three drugs. The obtained results are statistically compared with those obtained by the official methods, showing no significant difference with respect to accuracy and precision at p=0.05. Copyright © 2015 Elsevier B.V. All rights reserved.
Prediction of valid acidity in intact apples with Fourier transform near infrared spectroscopy*
Liu, Yan-de; Ying, Yi-bin; Fu, Xia-ping
2005-01-01
To develop nondestructive acidity prediction for intact Fuji apples, the potential of Fourier transform near infrared (FT-NIR) method with fiber optics in interactance mode was investigated. Interactance in the 800 nm to 2619 nm region was measured for intact apples, harvested from early to late maturity stages. Spectral data were analyzed by two multivariate calibration techniques including partial least squares (PLS) and principal component regression (PCR) methods. A total of 120 Fuji apples were tested and 80 of them were used to form a calibration data set. The influences of different data preprocessing and spectra treatments were also quantified. Calibration models based on smoothing spectra were slightly worse than that based on derivative spectra, and the best result was obtained when the segment length was 5 nm and the gap size was 10 points. Depending on data preprocessing and PLS method, the best prediction model yielded correlation coefficient of determination (r 2) of 0.759, low root mean square error of prediction (RMSEP) of 0.0677, low root mean square error of calibration (RMSEC) of 0.0562. The results indicated the feasibility of FT-NIR spectral analysis for predicting apple valid acidity in a nondestructive way. PMID:15682498
Pi, Liqun; Li, Xiang; Cao, Yiwei; Wang, Canhua; Pan, Liangwen; Yang, Litao
2015-04-01
Reference materials are important in accurate analysis of genetically modified organism (GMO) contents in food/feeds, and development of novel reference plasmid is a new trend in the research of GMO reference materials. Herein, we constructed a novel multi-targeting plasmid, pSOY, which contained seven event-specific sequences of five GM soybeans (MON89788-5', A2704-12-3', A5547-127-3', DP356043-5', DP305423-3', A2704-12-5', and A5547-127-5') and sequence of soybean endogenous reference gene Lectin. We evaluated the specificity, limit of detection and quantification, and applicability of pSOY in both qualitative and quantitative PCR analyses. The limit of detection (LOD) was as low as 20 copies in qualitative PCR, and the limit of quantification (LOQ) in quantitative PCR was 10 copies. In quantitative real-time PCR analysis, the PCR efficiencies of all event-specific and Lectin assays were higher than 90%, and the squared regression coefficients (R(2)) were more than 0.999. The quantification bias varied from 0.21% to 19.29%, and the relative standard deviations were from 1.08% to 9.84% in simulated samples analysis. All the results demonstrated that the developed multi-targeting plasmid, pSOY, was a credible substitute of matrix reference materials, and could be used as a reliable reference calibrator in the identification and quantification of multiple GM soybean events.
Goodell, Christa K.; Zhang, Jianqiang; Strait, Erin; Harmon, Karen; Patnayak, Devi; Otterson, Tracy; Culhane, Marie; Christopher-Hennings, Jane; Clement, Travis; Leslie-Steen, Pamela; Hesse, Richard; Anderson, Joe; Skarbek, Kevin; Vincent, Amy; Kitikoon, Pravina; Swenson, Sabrina; Jenkins-Moore, Melinda; McGill, Jodi; Rauh, Rolf; Nelson, William; O’Connell, Catherine; Shah, Rohan; Wang, Chong; Main, Rodger; Zimmerman, Jeffrey J.
2016-01-01
The probability of detecting influenza A virus (IAV) in oral fluid (OF) specimens was calculated for each of 13 assays based on real-time reverse-transcription polymerase chain reaction (rRT-PCR) and 7 assays based on virus isolation (VI). The OF specimens were inoculated with H1N1 or H3N2 IAV and serially diluted 10-fold (10−1 to 10−8). Eight participating laboratories received 180 randomized OF samples (10 replicates × 8 dilutions × 2 IAV subtypes plus 20 IAV-negative samples) and performed the rRT-PCR and VI procedure(s) of their choice. Analysis of the results with a mixed-effect logistic-regression model identified dilution and assay as variables significant (P < 0.0001) for IAV detection in OF by rRT-PCR or VI. Virus subtype was not significant for IAV detection by either rRT-PCR (P = 0.457) or VI (P = 0.101). For rRT-PCR the cycle threshold (Ct) values increased consistently with dilution but varied widely. Therefore, it was not possible to predict VI success on the basis of Ct values. The success of VI was inversely related to the dilution of the sample; the assay was generally unsuccessful at lower virus concentrations. Successful swine health monitoring and disease surveillance require assays with consistent performance, but significant differences in reproducibility were observed among the assays evaluated. PMID:26733728
Watanabe, Masaru; Kawaguchi, Tomoya; Isa, Shun-Ichi; Ando, Masahiko; Tamiya, Akihiro; Kubo, Akihito; Saka, Hideo; Takeo, Sadanori; Adachi, Hirofumi; Tagawa, Tsutomu; Kawashima, Osamu; Yamashita, Motohiro; Kataoka, Kazuhiko; Ichinose, Yukito; Takeuchi, Yukiyasu; Watanabe, Katsuya; Matsumura, Akihide; Koh, Yasuhiro
2017-07-01
Epidermal growth factor receptor (EGFR) mutations have been used as the strongest predictor of effectiveness of treatment with EGFR tyrosine kinase inhibitors (TKIs). Three most common EGFR mutations (L858R, exon 19 deletion, and T790M) are known to be major selection markers for EGFR-TKIs therapy. Here, we developed a multiplex picodroplet digital PCR (ddPCR) assay to detect 3 common EGFR mutations in 1 reaction. Serial-dilution experiments with genomic DNA harboring EGFR mutations revealed linear performance, with analytical sensitivity ~0.01% for each mutation. All 33 EGFR-activating mutations detected in formalin-fixed paraffin-embedded (FFPE) tissue samples by the conventional method were also detected by this multiplex assay. Owing to the higher sensitivity, an additional mutation (T790M; including an ultra-low-level mutation, <0.1%) was detected in the same reaction. Regression analysis of the duplex assay and multiplex assay showed a correlation coefficient (R 2 ) of 0.9986 for L858R, 0.9844 for an exon 19 deletion, and 0.9959 for T790M. Using ddPCR, we designed a multiplex ultrasensitive genotyping platform for 3 common EGFR mutations. Results of this proof-of-principle study on clinical samples indicate clinical utility of multiplex ddPCR for screening for multiple EGFR mutations concurrently with an ultra-rare pretreatment mutation (T790M). Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.
Validating internal controls for quantitative plant gene expression studies.
Brunner, Amy M; Yakovlev, Igor A; Strauss, Steven H
2004-08-18
Real-time reverse transcription PCR (RT-PCR) has greatly improved the ease and sensitivity of quantitative gene expression studies. However, accurate measurement of gene expression with this method relies on the choice of a valid reference for data normalization. Studies rarely verify that gene expression levels for reference genes are adequately consistent among the samples used, nor compare alternative genes to assess which are most reliable for the experimental conditions analyzed. Using real-time RT-PCR to study the expression of 10 poplar (genus Populus) housekeeping genes, we demonstrate a simple method for determining the degree of stability of gene expression over a set of experimental conditions. Based on a traditional method for analyzing the stability of varieties in plant breeding, it defines measures of gene expression stability from analysis of variance (ANOVA) and linear regression. We found that the potential internal control genes differed widely in their expression stability over the different tissues, developmental stages and environmental conditions studied. Our results support that quantitative comparisons of candidate reference genes are an important part of real-time RT-PCR studies that seek to precisely evaluate variation in gene expression. The method we demonstrated facilitates statistical and graphical evaluation of gene expression stability. Selection of the best reference gene for a given set of experimental conditions should enable detection of biologically significant changes in gene expression that are too small to be revealed by less precise methods, or when highly variable reference genes are unknowingly used in real-time RT-PCR experiments.
Madic, Jordan; Remon, Jordi; Honoré, Aurélie; Girard, Romain; Rouleau, Etienne; André, Barbara; Besse, Benjamin; Droniou, Magali; Lacroix, Ludovic
2017-01-01
Over the past years, targeted therapies using tyrosine kinase inhibitors (TKI) have led to an increase in progression-free survival and response rate for a subgroup of non-small cell lung cancer (NSCLC) patients harbouring specific gene abnormalities compared with chemotherapy. However long-lasting tumor regression is rarely achieved, due to the development of resistant tumoral subclones, which requires alternative therapeutic approaches. Molecular profile at progressive disease is a challenge for making adaptive treatment decisions. The aim of this study was to monitor EGFR-mutant tumors over time based on the quantity of mutant DNA circulating in plasma (ctDNA), comparing two different methods, Crystal™ Digital™ PCR and Massive Parallel Sequencing (MPS). In plasma circulating cell free DNA (cfDNA) of 61 advanced NSCLC patients we found an overall correlation of 78% between mutated allelic fraction measured by Crystal Digital PCR and MPS. 7 additional samples with sensitizing mutations and 4 additional samples with the resistance mutation were detected with Crystal Digital PCR, but not with MPS. Monitoring levels of both mutation types over time showed a correlation between levels and trends of mutated ctDNA detected and clinical assessment of disease for the 6 patients tested. In conclusion, Crystal Digital PCR exhibited good performance for monitoring mutational status in plasma cfDNA, and also appeared as better suited to the detection of known mutations than MPS in terms of features such as time to results. PMID:28829811
Steiner, Genevieve Z.; Barry, Robert J.; Gonsalvez, Craig J.
2016-01-01
In oddball tasks, increasing the time between stimuli within a particular condition (target-to-target interval, TTI; nontarget-to-nontarget interval, NNI) systematically enhances N1, P2, and P300 event-related potential (ERP) component amplitudes. This study examined the mechanism underpinning these effects in ERP components recorded from 28 adults who completed a conventional three-tone oddball task. Bivariate correlations, partial correlations and multiple regression explored component changes due to preceding ERP component amplitudes and intervals found within the stimulus series, rather than constraining the task with experimentally constructed intervals, which has been adequately explored in prior studies. Multiple regression showed that for targets, N1 and TTI predicted N2, TTI predicted P3a and P3b, and Processing Negativity (PN), P3b, and TTI predicted reaction time. For rare nontargets, P1 predicted N1, NNI predicted N2, and N1 predicted Slow Wave (SW). Findings show that the mechanism is operating on separate stages of stimulus-processing, suggestive of either increased activation within a number of stimulus-specific pathways, or very long component generator recovery cycles. These results demonstrate the extent to which matching-stimulus intervals influence ERP component amplitudes and behavior in a three-tone oddball task, and should be taken into account when designing similar studies. PMID:27445774
Steiner, Genevieve Z; Barry, Robert J; Gonsalvez, Craig J
2016-01-01
In oddball tasks, increasing the time between stimuli within a particular condition (target-to-target interval, TTI; nontarget-to-nontarget interval, NNI) systematically enhances N1, P2, and P300 event-related potential (ERP) component amplitudes. This study examined the mechanism underpinning these effects in ERP components recorded from 28 adults who completed a conventional three-tone oddball task. Bivariate correlations, partial correlations and multiple regression explored component changes due to preceding ERP component amplitudes and intervals found within the stimulus series, rather than constraining the task with experimentally constructed intervals, which has been adequately explored in prior studies. Multiple regression showed that for targets, N1 and TTI predicted N2, TTI predicted P3a and P3b, and Processing Negativity (PN), P3b, and TTI predicted reaction time. For rare nontargets, P1 predicted N1, NNI predicted N2, and N1 predicted Slow Wave (SW). Findings show that the mechanism is operating on separate stages of stimulus-processing, suggestive of either increased activation within a number of stimulus-specific pathways, or very long component generator recovery cycles. These results demonstrate the extent to which matching-stimulus intervals influence ERP component amplitudes and behavior in a three-tone oddball task, and should be taken into account when designing similar studies.
Sun, Bing; Zheng, Yun-Ling
2018-01-01
Currently there is no sensitive, precise, and reproducible method to quantitate alternative splicing of mRNA transcripts. Droplet digital™ PCR (ddPCR™) analysis allows for accurate digital counting for quantification of gene expression. Human telomerase reverse transcriptase (hTERT) is one of the essential components required for telomerase activity and for the maintenance of telomeres. Several alternatively spliced forms of hTERT mRNA in human primary and tumor cells have been reported in the literature. Using one pair of primers and two probes for hTERT, four alternatively spliced forms of hTERT (α-/β+, α+/β- single deletions, α-/β- double deletion, and nondeletion α+/β+) were accurately quantified through a novel analysis method via data collected from a single ddPCR reaction. In this chapter, we describe this ddPCR method that enables direct quantitative comparison of four alternatively spliced forms of the hTERT messenger RNA without the need for internal standards or multiple pairs of primers specific for each variant, eliminating the technical variation due to differential PCR amplification efficiency for different amplicons and the challenges of quantification using standard curves. This simple and straightforward method should have general utility for quantifying alternatively spliced gene transcripts.
Selection of reference genes for RT-qPCR studies in blood of beluga whales (Delphinapterus leucas)
Chen, I-Hua; Wang, Jiann-Hsiung; Chou, Shih-Jen; Wu, Yeong-Huey; Li, Tsung-Hsien; Leu, Ming-Yih; Chang, Wen-Been
2016-01-01
Reverse transcription quantitative PCR (RT-qPCR) is used for research in gene expression, and it is vital to choose appropriate housekeeping genes (HKGs) as reference genes to obtain correct results. The purpose of this study is to determine stably expressed HKGs in blood of beluga whales (Delphinapterus leucas) that can be the appropriate reference genes in relative quantification in gene expression research. Sixty blood samples were taken from four beluga whales. Thirteen candidate HKGs (ACTB, B2M, GAPDH, HPRT1, LDHB, PGK1, RPL4, RPL8, RPL18, RPS9, RPS18, TFRC, YWHAZ) were tested using RT-qPCR. The stability values of the HKGs were determined by four different algorithms. Comprehensive analysis of the results revealed that RPL4, PGK1 and ACTB are strongly recommended for use in future RT-qPCR studies in beluga blood samples. This research provides recommendation of reference gene selection, which may contribute to further mRNA relative quantification research in the peripheral blood leukocytes in captive cetaceans. The gene expression assessment of the immune components in blood have the potential to serve as an important approach to evaluating cetacean health influenced by environmental insults. PMID:26998411
Selection of reference genes for RT-qPCR studies in blood of beluga whales (Delphinapterus leucas).
Chen, I-Hua; Wang, Jiann-Hsiung; Chou, Shih-Jen; Wu, Yeong-Huey; Li, Tsung-Hsien; Leu, Ming-Yih; Chang, Wen-Been; Yang, Wei Cheng
2016-01-01
Reverse transcription quantitative PCR (RT-qPCR) is used for research in gene expression, and it is vital to choose appropriate housekeeping genes (HKGs) as reference genes to obtain correct results. The purpose of this study is to determine stably expressed HKGs in blood of beluga whales (Delphinapterus leucas) that can be the appropriate reference genes in relative quantification in gene expression research. Sixty blood samples were taken from four beluga whales. Thirteen candidate HKGs (ACTB, B2M, GAPDH, HPRT1, LDHB, PGK1, RPL4, RPL8, RPL18, RPS9, RPS18, TFRC, YWHAZ) were tested using RT-qPCR. The stability values of the HKGs were determined by four different algorithms. Comprehensive analysis of the results revealed that RPL4, PGK1 and ACTB are strongly recommended for use in future RT-qPCR studies in beluga blood samples. This research provides recommendation of reference gene selection, which may contribute to further mRNA relative quantification research in the peripheral blood leukocytes in captive cetaceans. The gene expression assessment of the immune components in blood have the potential to serve as an important approach to evaluating cetacean health influenced by environmental insults.
Dirichlet Component Regression and its Applications to Psychiatric Data.
Gueorguieva, Ralitza; Rosenheck, Robert; Zelterman, Daniel
2008-08-15
We describe a Dirichlet multivariable regression method useful for modeling data representing components as a percentage of a total. This model is motivated by the unmet need in psychiatry and other areas to simultaneously assess the effects of covariates on the relative contributions of different components of a measure. The model is illustrated using the Positive and Negative Syndrome Scale (PANSS) for assessment of schizophrenia symptoms which, like many other metrics in psychiatry, is composed of a sum of scores on several components, each in turn, made up of sums of evaluations on several questions. We simultaneously examine the effects of baseline socio-demographic and co-morbid correlates on all of the components of the total PANSS score of patients from a schizophrenia clinical trial and identify variables associated with increasing or decreasing relative contributions of each component. Several definitions of residuals are provided. Diagnostics include measures of overdispersion, Cook's distance, and a local jackknife influence metric.
Cook, Jackie; Sturrock, Hugh; Msellem, Mwinyi; Ali, Abdullah; Xu, Weiping; Molteni, Fabrizio; Gosling, Roly; Drakeley, Chris; Mårtensson, Andreas
2017-01-01
Abstract Background. Optimal use of mass/targeted screen-and-treat or mass or focal drug administration as malaria elimination strategies remains unclear. We therefore studied spatial distribution of Plasmodium falciparum infections to compare simulated effects of these strategies on reducing the parasite reservoir in a pre-elimination setting. Methods. P. falciparum rapid diagnostic tests (RDTs) and molecular (polymerase chain reaction [PCR]) and serological (enzyme-linked immunosorbent assay) analyses were performed on finger-prick blood samples from a population-based survey in 3 adjacent communities. Results. Among 5278 persons screened, 13 (0.2%) were positive by RDT and 123 (2.3%) by PCR. PCR-positive individuals were scattered over the study area, but logistic regression analysis suggested a propensity of these infections to cluster around RDT-positive individuals. The odds ratios for being PCR positive was 7.4 (95% confidence interval, 2.8–19.9) for those living in the household of an RDT-positive individual and 1.64 (1.0–2.8; P = .06) for those living within <300 m, compared with >1000 m. Treating everyone within households of RDT-positive individuals (1% population) would target 13% of those who are PCR positive. Treating all living within a radius of <300 or <1000 m (14% or 58% population) would target 30% or 66% of infections, respectively. Among 4431 serologically screened individuals, 26% were seropositive. Treating everyone within seropositive households (63% population) would target 77% of PCR-positive individuals. Conclusions. Presumptive malaria treatment seemed justified within RDT-positive households and potentially worth considering within, for example, a radius of <300 m. Serology was not discriminative enough in identifying ongoing infections for improving focal interventions in this setting but may rather be useful to detect larger transmission foci. PMID:28431115
Kong, J C; Guerra, G R; Warrier, S K; Lynch, A Craig; Michael, M; Ngan, S Y; Phillips, W; Ramsay, G; Heriot, A G
2018-03-27
The current standard of care for locally advanced rectal cancer involves neoadjuvant chemoradiotherapy (CRT) followed by total mesorectal excision. There is a spectrum of response to neoadjuvant therapy; however, the prognostic value of tumour regression grade (TRG) in predicting disease-free survival (DFS) or overall survival (OS) is inconsistent in the literature. This study was performed in accordance with the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) guidelines. A systematic search was undertaken using Ovid MEDLINE, Embase and Google Scholar. Inclusion criteria were Stage II and III locally advanced rectal cancer treated with long-course CRT followed by radical surgery. The aim of the meta-analysis was to assess the prognostic implication of each TRG for rectal cancer following neoadjuvant CRT. Long-term prognosis was assessed. The main outcome measures were DFS and OS. A random effects model was performed to pool the hazard ratio (HR) from all included studies. There were 4875 patients from 17 studies, with 775 (15.9%) attaining a pathological complete response (pCR) and 719 (29.9%) with no response. A significant association with OS was identified from a pooled-estimated HR for pCR (HR = 0.47, P = 0.002) and nonresponding tumours (HR = 2.97; P < 0.001). Previously known tumour characteristics, such as ypN, lymphovascular invasion and perineural invasion, were also significantly associated with DFS and OS, with estimated pooled HRs of 2.2, 1.4 and 2.3, respectively. In conclusion, the degree of TRG was of prognostic value in predicting long-term outcomes. The current challenge is the development of a high-validity tests to predict pCR. Colorectal Disease © 2018 The Association of Coloproctology of Great Britain and Ireland.
Namiki, Takeshi; Tanemura, Atsushi; Valencia, Julio C; Coelho, Sergio G; Passeron, Thierry; Kawaguchi, Masakazu; Vieira, Wilfred D; Ishikawa, Masashi; Nishijima, Wataru; Izumo, Toshiyuki; Kaneko, Yasuhiko; Katayama, Ichiro; Yamaguchi, Yuji; Yin, Lanlan; Polley, Eric C; Liu, Hongfang; Kawakami, Yutaka; Eishi, Yoshinobu; Takahashi, Eishi; Yokozeki, Hiroo; Hearing, Vincent J
2011-04-19
The identification of genes that participate in melanomagenesis should suggest strategies for developing therapeutic modalities. We used a public array comparative genomic hybridization (CGH) database and real-time quantitative PCR (qPCR) analyses to identify the AMP kinase (AMPK)-related kinase NUAK2 as a candidate gene for melanomagenesis, and we analyzed its functions in melanoma cells. Our analyses had identified a locus at 1q32 where genomic gain is strongly associated with tumor thickness, and we used real-time qPCR analyses and regression analyses to identify NUAK2 as a candidate gene at that locus. Associations of relapse-free survival and overall survival of 92 primary melanoma patients with NUAK2 expression measured using immunohistochemistry were investigated using Kaplan-Meier curves, log rank tests, and Cox regression models. Knockdown of NUAK2 induces senescence and reduces S-phase, decreases migration, and down-regulates expression of mammalian target of rapamycin (mTOR). In vivo analysis demonstrated that knockdown of NUAK2 suppresses melanoma tumor growth in mice. Survival analysis showed that the risk of relapse is greater in acral melanoma patients with high levels of NUAK2 expression than in acral melanoma patients with low levels of NUAK2 expression (hazard ratio = 3.88; 95% confidence interval = 1.44-10.50; P = 0.0075). These data demonstrate that NUAK2 expression is significantly associated with the oncogenic features of melanoma cells and with the survival of acral melanoma patients. NUAK2 may provide a drug target to suppress melanoma progression. This study further supports the importance of NUAK2 in cancer development and tumor progression, while AMPK has antioncogenic properties.
Dong, Yuying; Wang, Jie; Dong, Fusheng; Wang, Xu; Zhang, Yinghuai
2012-07-01
To evaluate relationships between the alteration of p16 gene and the clinical status and prognosis of the patients with squamous cell carcinoma of the buccal mucosa. Thirty buccal cancers were included in the analysis. Deletion analysis was performed by PCR. Point mutation analysis was used by PCR-SSCP and direct sequencing. Methylation-specific PCR methods were adopted for the evaluation of p16 methylation. The correlation between alteration of p16 gene and clinicopathological factors buccal cancer was evaluated by Fisher's exact test. Kaplan-Meier and Cox regression were used to investigate the relationship between p16 alteration and survival time. The frequency of p16 alteration was 63.3% in buccal carcinomas. P16 deletion was associated significantly with tumor size (P = 0.01). P16 point mutation was associated significantly with differentiation (P = 0.006). P16 methylation was associated significantly with nodes metastasis (P = 0.027). The overall survival rate of 30 buccal carcinomas was 53.3%. The Log-rank test (P = 0.021) and univariate Cox regression analysis (P = 0.030) revealed that p16 methylation was significantly associated with the overall survival rate. Multivariate analysis showed that p16 deletion, p16 mutation, and p16 methylation were not statistically significant. The alterations of p16 gene may play a major role in malignancy and development and metastases of buccal carcinoma and may be an excellent marker of aggressive clinical behavior. P16 methylation has a prognostic value in buccal carcinoma but not an independent prognosis factor. P16 point mutation and p16 deletion have not prognostic significance in buccal carcinoma. © 2012 John Wiley & Sons A/S.
Classical Testing in Functional Linear Models.
Kong, Dehan; Staicu, Ana-Maria; Maity, Arnab
2016-01-01
We extend four tests common in classical regression - Wald, score, likelihood ratio and F tests - to functional linear regression, for testing the null hypothesis, that there is no association between a scalar response and a functional covariate. Using functional principal component analysis, we re-express the functional linear model as a standard linear model, where the effect of the functional covariate can be approximated by a finite linear combination of the functional principal component scores. In this setting, we consider application of the four traditional tests. The proposed testing procedures are investigated theoretically for densely observed functional covariates when the number of principal components diverges. Using the theoretical distribution of the tests under the alternative hypothesis, we develop a procedure for sample size calculation in the context of functional linear regression. The four tests are further compared numerically for both densely and sparsely observed noisy functional data in simulation experiments and using two real data applications.
Classical Testing in Functional Linear Models
Kong, Dehan; Staicu, Ana-Maria; Maity, Arnab
2016-01-01
We extend four tests common in classical regression - Wald, score, likelihood ratio and F tests - to functional linear regression, for testing the null hypothesis, that there is no association between a scalar response and a functional covariate. Using functional principal component analysis, we re-express the functional linear model as a standard linear model, where the effect of the functional covariate can be approximated by a finite linear combination of the functional principal component scores. In this setting, we consider application of the four traditional tests. The proposed testing procedures are investigated theoretically for densely observed functional covariates when the number of principal components diverges. Using the theoretical distribution of the tests under the alternative hypothesis, we develop a procedure for sample size calculation in the context of functional linear regression. The four tests are further compared numerically for both densely and sparsely observed noisy functional data in simulation experiments and using two real data applications. PMID:28955155
Wang, Jian-Chang; Liu, Li-Bing; Han, Qing-An; Wang, Jin-Feng; Yuan, Wan-Zhe
2017-10-01
Recombinase polymerase amplification (RPA), an isothermal amplification technology, has been developed as an alternative to PCR in pathogen detection. A real-time RPA assay (rt-RPA) was developed to detect the porcine parvovirus (PPV) using primers and exo probe specific for the VP2 gene. The amplification was performed at 39°C for 20min. There was no cross-reaction with other pathogens tested. Using the recombinant plasmid pPPV-VP2 as template, the analytical sensitivity was 103 copies. The assay performance was evaluated by testing 115 field samples by rt-RPA and a real-time PCR assay. The diagnostic agreement between assays was 100%, and PPV DNA was detected in 94 samples. The R 2 value of rt-RPA and real-time PCR was 0.909 by linear regression analysis. The developed rt-RPA assay provides a useful alternative tool for rapid, simple and reliable detection of PPV in diagnostic laboratories and at point-of-care, especially in remote and rural areas. Copyright © 2017 Elsevier B.V. All rights reserved.
Nolte, Frederick S.; Boysza, Jodi; Thurmond, Cathy; Clark, W. Scott; Lennox, Jeffrey L.
1998-01-01
The performance characteristics of an enhanced-sensitivity branched-DNA assay (bDNA) (Quantiplex HIV-1 version 2.0; Chiron Corp., Emeryville, Calif.) and a reverse transcription (RT)-PCR assay (AMPLICOR HIV-1 Monitor; Roche Diagnostic Systems, Inc., Branchburg, N.J.) were compared in a molecular diagnostic laboratory. Samples used in this evaluation included linearity and reproducibility panels made by dilution of a human immunodeficiency virus type 1 (HIV-1) stock culture of known virus particle count in HIV-1-negative plasma, a subtype panel consisting of HIV-1 subtypes A through F at a standardized level, and 64 baseline plasma specimens from HIV-1-infected individuals. Plots of log10 HIV RNA copies per milliliter versus log10 nominal virus particles per milliliter demonstrated that both assays were linear over the stated dynamic ranges (bDNA, r = 0.98; RT-PCR, r = 0.99), but comparison of the slopes of the regression lines (bDNA, m = 0.96; RT-PCR, m = 0.83) suggested that RT-PCR had greater proportional systematic error. The between-run coefficients of variation for bDNA and RT-PCR were 24.3 and 34.3%, respectively, for a sample containing 1,650 nominal virus particles/ml and 44.0 and 42.7%, respectively, for a sample containing 165 nominal virus particles/ml. Subtypes B, C, and D were quantitated with similar efficiencies by bDNA and RT-PCR; however, RT-PCR was less efficient in quantitating subtypes A, E, and F. One non-B subtype was recognized in our clinical specimens based on the ratio of values obtained with the two methods. HIV-1 RNA was quantitated in 53 (83%) baseline plasma specimens by bDNA and in 55 (86%) specimens by RT-PCR. RT-PCR values were consistently greater than bDNA values, with population means of 142,419 and 67,580 copies/ml, respectively (P < 0.01). The results were highly correlated (r = 0.91), but the agreement was poor (mean difference in log10 copies per milliliter ± 2 standard deviations, 0.45 ± 0.61) for the 50 clinical specimens that gave discrete values with both methods. PMID:9508301
Screening of whole genome sequences identified high-impact variants for stallion fertility.
Schrimpf, Rahel; Gottschalk, Maren; Metzger, Julia; Martinsson, Gunilla; Sieme, Harald; Distl, Ottmar
2016-04-14
Stallion fertility is an economically important trait due to the increase of artificial insemination in horses. The availability of whole genome sequence data facilitates identification of rare high-impact variants contributing to stallion fertility. The aim of our study was to genotype rare high-impact variants retrieved from next-generation sequencing (NGS)-data of 11 horses in order to unravel harmful genetic variants in large samples of stallions. Gene ontology (GO) terms and search results from public databases were used to obtain a comprehensive list of human und mice genes predicted to participate in the regulation of male reproduction. The corresponding equine orthologous genes were searched in whole genome sequence data of seven stallions and four mares and filtered for high-impact genetic variants using SnpEFF, SIFT and Polyphen 2 software. All genetic variants with the missing homozygous mutant genotype were genotyped on 337 fertile stallions of 19 breeds using KASP genotyping assays or PCR-RFLP. Mixed linear model analysis was employed for an association analysis with de-regressed estimated breeding values of the paternal component of the pregnancy rate per estrus (EBV-PAT). We screened next generation sequenced data of whole genomes from 11 horses for equine genetic variants in 1194 human and mice genes involved in male fertility and linked through common gene ontology (GO) with male reproductive processes. Variants were filtered for high-impact on protein structure and validated through SIFT and Polyphen 2. Only those genetic variants were followed up when the homozygote mutant genotype was missing in the detection sample comprising 11 horses. After this filtering process, 17 single nucleotide polymorphism (SNPs) were left. These SNPs were genotyped in 337 fertile stallions of 19 breeds using KASP genotyping assays or PCR-RFLP. An association analysis in 216 Hanoverian stallions revealed a significant association of the splice-site disruption variant g.37455302G>A in NOTCH1 with the de-regressed estimated breeding values of the paternal component of the pregnancy rate per estrus (EBV-PAT). For 9 high-impact variants within the genes CFTR, OVGP1, FBXO43, TSSK6, PKD1, FOXP1, TCP11, SPATA31E1 and NOTCH1 (g.37453246G>C) absence of the homozygous mutant genotype in the validation sample of all 337 fertile stallions was obvious. Therefore, these variants were considered as potentially deleterious factors for stallion fertility. In conclusion, this study revealed 17 genetic variants with a predicted high damaging effect on protein structure and missing homozygous mutant genotype. The g.37455302G>A NOTCH1 variant was identified as a significant stallion fertility locus in Hanoverian stallions and further 9 candidate fertility loci with missing homozygous mutant genotypes were validated in a panel including 19 horse breeds. To our knowledge this is the first study in horses using next generation sequencing data to uncover strong candidate factors for stallion fertility.
Efficiency of MY09/11 consensus PCR in the detection of multiple HPV infections.
Şahiner, Fatih; Kubar, Ayhan; Gümral, Ramazan; Ardıç, Medine; Yiğit, Nuri; Şener, Kenan; Dede, Murat; Yapar, Mehmet
2014-09-01
Human papillomavirus (HPV) DNA testing has become an important component of cervical cancer screening programs. In this study, we aimed to evaluate the efficiency of MY09/11 consensus polymerase chain reaction (PCR) for the detection of multiple HPV infections. For this purpose, MY09/11 PCR was compared to an original TaqMan-based type-specific real-time PCR assay, which can detect 20 different HPV types. Of the 654 samples, 34.1% (223/654) were HPV DNA positive according to at least one method. The relative sensitivities of MY09/11 PCR and type-specific PCR were 80.7% (180/223) and 97.8% (218/223), respectively. In all, 352 different HPV isolates (66 low-risk and 286 high-risk or probable high-risk types) were identified in 218 samples, but 5 samples, which were positive by consensus PCR only, could not be genotyped. The distribution of the 286 high-risk or probable high-risk HPVs were as follows: 24.5% HPV-16, 8.4% HPV-52, 7.7% HPV-51, 6.3% HPV-39, 6.3% HPV-82, 5.6% HPV-35, 5.6% HPV-58, 5.6% HPV-66, 5.2% HPV-18, 5.2% HPV-68, and 19.6% the other 8 types. A single HPV type was detected in 57.3% (125/218) of the genotyped samples, and multiple HPV types were found in the remaining 42.7% (93/218). The false-negative rates of MY09/11 PCR were found to be 17.4% in single infections, 23.3% in multiple infections, and 34.6% in multiple infections that contained 3 or more HPV types, with the condition that the low-risk types HPV-6 and HPV-11 be considered as a monotype. These data suggest that broad-range PCR assays may lead to significant data loss and that type-specific PCR assays can provide accurate and reliable results during cervical cancer screening. Copyright © 2014 Elsevier Inc. All rights reserved.
Hidalgo-Tenorio, Carmen; Rivero-Rodriguez, Mar; Gil-Anguita, Concepción; Esquivias, Javier; López-Castro, Rodrigo; Ramírez-Taboada, Jessica; de Hierro, Mercedes López; López-Ruiz, Miguel A.; Martínez, R. Javier; Llaño, Juan P.
2015-01-01
Objectives To evaluate the advantages of cytology and PCR of high-risk human papilloma virus (PCR HR-HPV) infection in biopsy-derived diagnosis of high-grade squamous intraepithelial lesions (HSIL = AIN2/AIN3) in HIV-positive men having sex with men (MSM). Methods This is a single-centered study conducted between May 2010 and May 2014 in patients (n = 201, mean age 37 years) recruited from our outpatient clinic. Samples of anal canal mucosa were taken into liquid medium for PCR HPV analysis and for cytology. Anoscopy was performed for histology evaluation. Results Anoscopy showed 33.8% were normal, 47.8% low-grade squamous intraepithelial lesions (LSIL), and 18.4% HSIL; 80.2% had HR-HPV. PCR of HR-HPV had greater sensitivity than did cytology (88.8% vs. 75.7%) in HSIL screening, with similar positive (PPV) and negative predictive value (NPV) of 20.3 vs. 22.9 and 89.7 vs. 88.1, respectively. Combining both tests increased the sensitivity and NPV of HSIL diagnosis to 100%. Correlation of cytology vs. histology was, generally, very low and PCR of HR-HPV vs. histology was non-existent (<0.2) or low (<0.4). Area under the receiver operating characteristics (AUROC) curve analysis of cytology and PCR HR-HPV for the diagnosis of HSIL was poor (<0.6). Multivariate regression analysis showed protective factors against HSIL were: viral suppression (OR: 0.312; 95%CI: 0.099-0.984), and/or syphilis infection (OR: 0.193; 95%CI: 0.045-0.827). HSIL risk was associated with HPV-68 genotype (OR: 20.1; 95%CI: 2.04-197.82). Conclusions When cytology and PCR HR-HPV findings are normal, the diagnosis of pre-malignant HSIL can be reliably ruled-out in HIV-positive patients. HPV suppression with treatment protects against the appearance of HSIL. PMID:25849412
Nateghi Rostami, Mahmoud; Hossein Rashidi, Batool; Aghsaghloo, Fatemeh; Nazari, Razieh
2016-01-01
Background: Chlamydia trachomatis is the most common sexually transmitted bacterial pathogen worldwide. Early detection and treatment of C.trachomatis genital infection prevent serious reproductive complications. Objective: Performances of enzyme immunoassay (EIA) and major outer membrane protein (MOMP)-polymerase chain reaction (PCR) for diagnosis of genital C.trachomatis infection in women were compared. Materials and Methods: In this cross sectional study a total of 518 women volunteers were included (33.67±8.3 yrs) who had been referred to Gynecology clinics of Qom province, Iran, were included. Endocervical swab specimens were collected to detect lipopolysaccharide (LPS) antigen in EIA and to amplify MOMP gene of C.trachomatis in PCR. Results were confirmed using ompI nested-PCR. Sensitivity, specificity, positive (PPV) and negative predictive values (NPV) were calculated for performance of the tests. Odds ratios were determined using binary logistic regression analysis. Results: In total, 37 (7.14%) cases were positive by EIA and/or MOMP-PCR. All discrepant results were confirmed by nested-PCR. Sensitivity, specificity, PPV and NPV values of EIA were 59.46%, 100%, 100% and 96.98%, and those of MOMP-PCR were 97.30%, 100%, 100%, 99.79%, respectively. Reproductive complications including 2.7% ectopic pregnancy, 5.4% stillbirth, 5.4% infertility, and 10.8% PROM were recorded. The risk of developing chlamydiosis was increased 4.8-fold in volunteers with cervicitis (p<0.05; OR 4.80; 95% CI 1.25-18.48). Conclusion: C.trachomatis infection should be regarded in women of reproductive ages especially those with cervicitis. Primary screening of women by using the low cost antigen-EIA is recommended; however, due to the low sensitivity of Ag-EIA, verification of the negative results by a DNA amplification method is needed. PMID:27525325
Hidalgo-Tenorio, Carmen; Rivero-Rodriguez, Mar; Gil-Anguita, Concepción; Esquivias, Javier; López-Castro, Rodrigo; Ramírez-Taboada, Jessica; de Hierro, Mercedes López; López-Ruiz, Miguel A; Martínez, R Javier; Llaño, Juan P
2015-01-01
To evaluate the advantages of cytology and PCR of high-risk human papilloma virus (PCR HR-HPV) infection in biopsy-derived diagnosis of high-grade squamous intraepithelial lesions (HSIL = AIN2/AIN3) in HIV-positive men having sex with men (MSM). This is a single-centered study conducted between May 2010 and May 2014 in patients (n = 201, mean age 37 years) recruited from our outpatient clinic. Samples of anal canal mucosa were taken into liquid medium for PCR HPV analysis and for cytology. Anoscopy was performed for histology evaluation. Anoscopy showed 33.8% were normal, 47.8% low-grade squamous intraepithelial lesions (LSIL), and 18.4% HSIL; 80.2% had HR-HPV. PCR of HR-HPV had greater sensitivity than did cytology (88.8% vs. 75.7%) in HSIL screening, with similar positive (PPV) and negative predictive value (NPV) of 20.3 vs. 22.9 and 89.7 vs. 88.1, respectively. Combining both tests increased the sensitivity and NPV of HSIL diagnosis to 100%. Correlation of cytology vs. histology was, generally, very low and PCR of HR-HPV vs. histology was non-existent (<0.2) or low (<0.4). Area under the receiver operating characteristics (AUROC) curve analysis of cytology and PCR HR-HPV for the diagnosis of HSIL was poor (<0.6). Multivariate regression analysis showed protective factors against HSIL were: viral suppression (OR: 0.312; 95%CI: 0.099-0.984), and/or syphilis infection (OR: 0.193; 95%CI: 0.045-0.827). HSIL risk was associated with HPV-68 genotype (OR: 20.1; 95%CI: 2.04-197.82). When cytology and PCR HR-HPV findings are normal, the diagnosis of pre-malignant HSIL can be reliably ruled-out in HIV suppression with treatment protects against the appearance of HSIL [corrected].
Matsumura, Yasufumi; Ito, Yutaka; Yamamoto, Masaki; Matsushima, Aki; Nagao, Miki; Takakura, Shunji; Iinuma, Yoshitsugu; Ichiyama, Satoshi
2014-02-01
Pneumocystis polymerase chain reaction (PCR) and blood (1→3)-β-D-glucan assays are known to be useful for the diagnosis of Pneumocystis pneumonia (PCP). However, their impact on the outcome of clinically suspected PCP patients has not yet been elucidated. Between January 2008 and July 2011, we prospectively observed 190 immunocompromised patients who had ground-glass opacity on chest computed tomography scans and were suspected to have PCP. The blood β-D-glucan levels of these patients were measured, and PCR was used to detect Pneumocystis jirovecii in the respiratory samples. The 30-day mortality rates and related factors were assessed. The 30-day mortality rate of all included patients was 21.6%. Both β-D-glucan-positive (10.1%) and PCR-positive patients (15.0%) had significantly lower mortality rates than β-D-glucan-negative (28.1%) or PCR-negative patients (30.1%). All of the 13 definite PCP patients had positive PCR and β-D-glucan results, received anti-PCP treatments, and survived. Among the 72 patients who were negative for microscopic detection of P. jirovecii but received anti-PCP treatments, positive PCR results (odds ratio [OR], 0.14; 95% confidence interval [CI], 0.02-0.74), a high Sequential Organ Failure Assessment score (OR, 1.42; CI, 1.08-1.88), and positive β-D-glucan levels (OR 0.25, CI 0.06-1.02) were associated with mortality rates using stepwise logistic regression analyses. A positive Pneumocystis PCR or β-D-glucan test was a candidate predictor of survival in patients who were suspected of having PCP, even though negative for visual detection by microscopy. Copyright © 2013 Japanese Society of Chemotherapy and the Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.
Harshman, Dustin K.; Rao, Brianna M.; McLain, Jean E.; Watts, George S.; Yoon, Jeong-Yeol
2015-01-01
Molecular diagnostics offers quick access to information but fails to operate at a speed required for clinical decision-making. Our novel methodology, droplet-on-thermocouple silhouette real-time polymerase chain reaction (DOTS qPCR), uses interfacial effects for droplet actuation, inhibition relief, and amplification sensing. DOTS qPCR has sample-to-answer times as short as 3 min 30 s. In infective endocarditis diagnosis, DOTS qPCR demonstrates reproducibility, differentiation of antibiotic susceptibility, subpicogram limit of detection, and thermocycling speeds of up to 28 s/cycle in the presence of tissue contaminants. Langmuir and Gibbs adsorption isotherms are used to describe the decreasing interfacial tension upon amplification. Moreover, a log-linear relationship with low threshold cycles is presented for real-time quantification by imaging the droplet-on-thermocouple silhouette with a smartphone. DOTS qPCR resolves several limitations of commercially available real-time PCR systems, which rely on fluorescence detection, have substantially higher threshold cycles, and require expensive optical components and extensive sample preparation. Due to the advantages of low threshold cycle detection, we anticipate extending this technology to biological research applications such as single cell, single nucleus, and single DNA molecule analyses. Our work is the first demonstrated use of interfacial effects for sensing reaction progress, and it will enable point-of-care molecular diagnosis of infections. PMID:26601245
[New method of mixed gas infrared spectrum analysis based on SVM].
Bai, Peng; Xie, Wen-Jun; Liu, Jun-Hua
2007-07-01
A new method of infrared spectrum analysis based on support vector machine (SVM) for mixture gas was proposed. The kernel function in SVM was used to map the seriously overlapping absorption spectrum into high-dimensional space, and after transformation, the high-dimensional data could be processed in the original space, so the regression calibration model was established, then the regression calibration model with was applied to analyze the concentration of component gas. Meanwhile it was proved that the regression calibration model with SVM also could be used for component recognition of mixture gas. The method was applied to the analysis of different data samples. Some factors such as scan interval, range of the wavelength, kernel function and penalty coefficient C that affect the model were discussed. Experimental results show that the component concentration maximal Mean AE is 0.132%, and the component recognition accuracy is higher than 94%. The problems of overlapping absorption spectrum, using the same method for qualitative and quantitative analysis, and limit number of training sample, were solved. The method could be used in other mixture gas infrared spectrum analyses, promising theoretic and application values.
NASA Astrophysics Data System (ADS)
Wibowo, Wahyu; Wene, Chatrien; Budiantara, I. Nyoman; Permatasari, Erma Oktania
2017-03-01
Multiresponse semiparametric regression is simultaneous equation regression model and fusion of parametric and nonparametric model. The regression model comprise several models and each model has two components, parametric and nonparametric. The used model has linear function as parametric and polynomial truncated spline as nonparametric component. The model can handle both linearity and nonlinearity relationship between response and the sets of predictor variables. The aim of this paper is to demonstrate the application of the regression model for modeling of effect of regional socio-economic on use of information technology. More specific, the response variables are percentage of households has access to internet and percentage of households has personal computer. Then, predictor variables are percentage of literacy people, percentage of electrification and percentage of economic growth. Based on identification of the relationship between response and predictor variable, economic growth is treated as nonparametric predictor and the others are parametric predictors. The result shows that the multiresponse semiparametric regression can be applied well as indicate by the high coefficient determination, 90 percent.
Mazanderani, Ahmad Haeri; Moyo, Faith; Kufa, Tendesayi; Sherman, Gayle G
2018-02-01
To describe baseline HIV-1 RNA viral load (VL) trends within South Africa's Early Infant Diagnosis program 2010-2016, with reference to prevention of mother-to-child transmission guidelines. HIV-1 total nucleic acid polymerase chain reaction (TNA PCR) and RNA VL data from 2010 to 2016 were extracted from the South African National Health Laboratory Service's central data repository. Infants with a positive TNA PCR and subsequent baseline RNA VL taken at age <7 months were included. Descriptive statistics were performed for quantified and lower-than-quantification limit (LQL) results per annum and age in months. Trend analyses were performed using log likelihood ratio tests. Multivariable linear regression was used to model the relationship between RNA VL and predictor variables, whereas logistic regression was used to identify predictors associated with LQL RNA VL results. Among 13,606 infants with a positive HIV-1 TNA PCR linked to a baseline RNA VL, median age of first PCR was 57 days and VL was 98 days. Thirteen thousand one hundred ninety-five (97.0%) infants had a quantified VL and 411 (3.0%) had an LQL result. A significant decline in median VL was observed between 2010 and 2016, from 6.3 log10 (interquartile range: 5.6-6.8) to 5.6 log10 (interquartile range: 4.2-6.5) RNA copies per milliliter, after controlling for age (P < 0.001), with younger age associated with lower VL (P < 0.001). The proportion of infants with a baseline VL <4 Log10 RNA copies per milliliter increased from 5.4% to 21.8%. Subsequent to prevention of mother-to-child transmission Option B implementation in 2013, the proportion of infants with an LQL baseline VL increased from 1.5% to 6.1% (P < 0.001). Between 2010 and 2016, a significant decline in baseline viremia within South Africa's Early Infant Diagnosis program was observed, with loss of detectability among some HIV-infected infants.
Fuller, Nicholas J.; Wilson, William H.; Joint, Ian R.; Mann, Nicholas H.
1998-01-01
Viruses are ubiquitous components of marine ecosystems and are known to infect unicellular phycoerythrin-containing cyanobacteria belonging to the genus Synechococcus. A conserved region from the cyanophage genome was identified in three genetically distinct cyanomyoviruses, and a sequence analysis revealed that this region exhibited significant similarity to a gene encoding a capsid assembly protein (gp20) from the enteric coliphage T4. The results of a comparison of gene 20 sequences from three cyanomyoviruses and T4 allowed us to design two degenerate PCR primers, CPS1 and CPS2, which specifically amplified a 165-bp region from the majority of cyanomyoviruses tested. A competitive PCR (cPCR) analysis revealed that cyanomyovirus strains could be accurately enumerated, and it was demonstrated that quantification was log-linear over ca. 3 orders of magnitude. Different calibration curves were obtained for each of the three cyanomyovirus strains tested; consequently, cPCR performed with primers CPS1 and CPS2 could lead to substantial inaccuracies in estimates of phage abundance in natural assemblages. Further sequence analysis of cyanomyovirus gene 20 homologs would be necessary in order to design primers which do not exhibit phage-to-phage variability in priming efficiency. It was demonstrated that PCR products of the correct size could be amplified from seawater samples following 100× concentration and even directly without any prior concentration. Hence, the use of degenerate primers in PCR analyses of cyanophage populations should provide valuable data on the diversity of cyanophages in natural assemblages. Further optimization of procedures may ultimately lead to a sensitive assay which can be used to analyze natural cyanophage populations both quantitatively (by cPCR) and qualitatively following phylogenetic analysis of amplified products. PMID:9603813
Murray, James L.; Hu, Peixu; Shafer, David A.
2015-01-01
We have developed novel probe systems for real-time PCR that provide higher specificity, greater sensitivity, and lower cost relative to dual-labeled probes. The seven DNA Detection Switch (DDS)-probe systems reported here employ two interacting polynucleotide components: a fluorescently labeled probe and a quencher antiprobe. High-fidelity detection is achieved with three DDS designs: two internal probes (internal DDS and Flip probes) and a primer probe (ZIPR probe), wherein each probe is combined with a carefully engineered, slightly mismatched, error-checking antiprobe. The antiprobe blocks off-target detection over a wide range of temperatures and facilitates multiplexing. Other designs (Universal probe, Half-Universal probe, and MacMan probe) use generic components that enable low-cost detection. Finally, single-molecule G-Force probes employ guanine-mediated fluorescent quenching by forming a hairpin between adjacent C-rich and G-rich sequences. Examples provided show how these probe technologies discriminate drug-resistant Mycobacterium tuberculosis mutants, Escherichia coli O157:H7, oncogenic EGFR deletion mutations, hepatitis B virus, influenza A/B strains, and single-nucleotide polymorphisms in the human VKORC1 gene. PMID:25307756
Ismail, Ashrafali M.; Sivakumar, Jayashree; Anantharam, Raghavendran; Dayalan, Sujitha; Samuel, Prasanna; Fletcher, Gnanadurai J.; Gnanamony, Manu; Abraham, Priya
2011-01-01
Virological monitoring of hepatitis B virus (HBV) DNA is critical to the management of HBV infection. With several HBV DNA quantification assays available, it is important to use the most efficient testing system for virological monitoring. In this study, we evaluated the performance characteristics and comparability of three HBV DNA quantification systems: Abbott HBV real-time PCR (Abbott PCR), artus HBV real-time PCR with QIAamp DNA blood kit purification (artus-DB), and artus HBV real-time PCR with the QIAamp DSP virus kit purification (artus-DSP). The lower limits of detection of these systems were established against the WHO international standards for HBV DNA and were found to be 1.43, 82, and 9 IU/ml, respectively. The intra-assay and interassay coefficients of variation of plasma samples (1 to 6 log10 IU/ml) ranged between 0.05 to 8.34% and 0.16 to 3.48% for the Abbott PCR, 1.53 to 26.85% and 0.50 to 12.89% for artus-DB, and 0.29 to 7.42% and 0.94 to 3.01% for artus-DSP, respectively. Ninety HBV clinical samples were used for comparison of assays, and paired quantitative results showed strong correlation by linear regression analysis (artus-DB with Abbott PCR, r = 0.95; Abbott PCR with artus-DSP, r = 0.97; and artus-DSP with artus-DB, r = 0.94). Bland-Altman analysis showed a good level of agreement for Abbott PCR and artus-DSP, with a mean difference of 0.10 log10 IU/ml and limits of agreement of −0.91 to 1.11 log10 IU/ml. No genotype-specific bias was seen in all three systems for HBV genotypes A, C, and D, which are predominant in this region. This finding illustrates that the Abbott real-time HBV and artus-DSP systems show more comparable performance than the artus-DB system, meeting the current guidelines for assays to be used in the management of hepatitis B. PMID:21795507
Ismail, Ashrafali M; Sivakumar, Jayashree; Anantharam, Raghavendran; Dayalan, Sujitha; Samuel, Prasanna; Fletcher, Gnanadurai J; Gnanamony, Manu; Abraham, Priya
2011-09-01
Virological monitoring of hepatitis B virus (HBV) DNA is critical to the management of HBV infection. With several HBV DNA quantification assays available, it is important to use the most efficient testing system for virological monitoring. In this study, we evaluated the performance characteristics and comparability of three HBV DNA quantification systems: Abbott HBV real-time PCR (Abbott PCR), artus HBV real-time PCR with QIAamp DNA blood kit purification (artus-DB), and artus HBV real-time PCR with the QIAamp DSP virus kit purification (artus-DSP). The lower limits of detection of these systems were established against the WHO international standards for HBV DNA and were found to be 1.43, 82, and 9 IU/ml, respectively. The intra-assay and interassay coefficients of variation of plasma samples (1 to 6 log(10) IU/ml) ranged between 0.05 to 8.34% and 0.16 to 3.48% for the Abbott PCR, 1.53 to 26.85% and 0.50 to 12.89% for artus-DB, and 0.29 to 7.42% and 0.94 to 3.01% for artus-DSP, respectively. Ninety HBV clinical samples were used for comparison of assays, and paired quantitative results showed strong correlation by linear regression analysis (artus-DB with Abbott PCR, r = 0.95; Abbott PCR with artus-DSP, r = 0.97; and artus-DSP with artus-DB, r = 0.94). Bland-Altman analysis showed a good level of agreement for Abbott PCR and artus-DSP, with a mean difference of 0.10 log(10) IU/ml and limits of agreement of -0.91 to 1.11 log(10) IU/ml. No genotype-specific bias was seen in all three systems for HBV genotypes A, C, and D, which are predominant in this region. This finding illustrates that the Abbott real-time HBV and artus-DSP systems show more comparable performance than the artus-DB system, meeting the current guidelines for assays to be used in the management of hepatitis B.
Hughesman, Curtis; Fakhfakh, Kareem; Bidshahri, Roza; Lund, H Louise; Haynes, Charles
2015-02-17
Advances in real-time polymerase chain reaction (PCR), as well as the emergence of digital PCR (dPCR) and useful modified nucleotide chemistries, including locked nucleic acids (LNAs), have created the potential to improve and expand clinical applications of PCR through their ability to better quantify and differentiate amplification products, but fully realizing this potential will require robust methods for designing dual-labeled hydrolysis probes and predicting their hybridization thermodynamics as a function of their sequence, chemistry, and template complementarity. We present here a nearest-neighbor thermodynamic model that accurately predicts the melting thermodynamics of a short oligonucleotide duplexed either to its perfect complement or to a template containing mismatched base pairs. The model may be applied to pure-DNA duplexes or to duplexes for which one strand contains any number and pattern of LNA substitutions. Perturbations to duplex stability arising from mismatched DNA:DNA or LNA:DNA base pairs are treated at the Gibbs energy level to maintain statistical significance in the regressed model parameters. This approach, when combined with the model's accounting of the temperature dependencies of the melting enthalpy and entropy, permits accurate prediction of T(m) values for pure-DNA homoduplexes or LNA-substituted heteroduplexes containing one or two independent mismatched base pairs. Terms accounting for changes in solution conditions and terminal addition of fluorescent dyes and quenchers are then introduced so that the model may be used to accurately predict and thereby tailor the T(m) of a pure-DNA or LNA-substituted hydrolysis probe when duplexed either to its perfect-match template or to a template harboring a noncomplementary base. The model, which builds on classic nearest-neighbor thermodynamics, should therefore be of use to clinicians and biologists who require probes that distinguish and quantify two closely related alleles in either a quantitative PCR or dPCR assay. This potential is demonstrated by using the model to design allele-specific probes that completely discriminate and quantify clinically relevant mutant alleles (BRAF V600E and KIT D816V) in a dPCR assay.
NASA Astrophysics Data System (ADS)
Ni, Yongnian; Wang, Yong; Kokot, Serge
2008-10-01
A spectrophotometric method for the simultaneous determination of the important pharmaceuticals, pefloxacin and its structurally similar metabolite, norfloxacin, is described for the first time. The analysis is based on the monitoring of a kinetic spectrophotometric reaction of the two analytes with potassium permanganate as the oxidant. The measurement of the reaction process followed the absorbance decrease of potassium permanganate at 526 nm, and the accompanying increase of the product, potassium manganate, at 608 nm. It was essential to use multivariate calibrations to overcome severe spectral overlaps and similarities in reaction kinetics. Calibration curves for the individual analytes showed linear relationships over the concentration ranges of 1.0-11.5 mg L -1 at 526 and 608 nm for pefloxacin, and 0.15-1.8 mg L -1 at 526 and 608 nm for norfloxacin. Various multivariate calibration models were applied, at the two analytical wavelengths, for the simultaneous prediction of the two analytes including classical least squares (CLS), principal component regression (PCR), partial least squares (PLS), radial basis function-artificial neural network (RBF-ANN) and principal component-radial basis function-artificial neural network (PC-RBF-ANN). PLS and PC-RBF-ANN calibrations with the data collected at 526 nm, were the preferred methods—%RPE T ˜ 5, and LODs for pefloxacin and norfloxacin of 0.36 and 0.06 mg L -1, respectively. Then, the proposed method was applied successfully for the simultaneous determination of pefloxacin and norfloxacin present in pharmaceutical and human plasma samples. The results compared well with those from the alternative analysis by HPLC.
Occurrence of Legionella in UK household showers.
Collins, Samuel; Stevenson, David; Bennett, Allan; Walker, Jimmy
2017-04-01
Household water systems have been proposed as a source of sporadic, community acquired Legionnaires' disease. Showers represent a frequently used aerosol generating device in the domestic setting yet little is known about the occurrence of Legionella spp. in these systems. This study has investigated the prevalence of Legionella spp. by culture and qPCR in UK household showers. Ninety nine showers from 82 separate properties in the South of England were sampled. Clinically relevant Legionella spp. were isolated by culture in 8% of shower water samples representing 6% of households. Legionella pneumophila sg1 ST59 was isolated from two showers in one property and air sampling demonstrated its presence in the aerosol state. A further 31% of showers were positive by Legionella spp. qPCR. By multi-variable binomial regression modelling Legionella spp. qPCR positivity was associated with the age of the property (p=0.02), the age of the shower (p=0.01) and the frequency of use (p=0.09). The concentration of Legionella spp. detected by qPCR was shown to decrease with increased frequency of use (p=0.04) and more frequent showerhead cleaning (p=0.05). There was no association between Legionella spp. qPCR positivity and the cold water supply or the showerhead material (p=0.65 and p=0.71, respectively). Household showers may be important reservoirs of clinically significant Legionella and should be considered in source investigations. Simple public health advice may help to mitigate the risk of Legionella exposure in the domestic shower environment. Crown Copyright © 2016. Published by Elsevier GmbH. All rights reserved.
Ju, Na Rae; Jeffe, Donna B; Keune, Jason; Aft, Rebecca
2013-01-01
Breast cancer patients whose tumors achieve a pathological complete response (pCR) with neoadjuvant chemotherapy have a prognosis which is better than that predicted for the stage of their disease. However, within this subgroup of patients, recurrences have been observed. We sought to examine factors associated with recurrence in a population of breast cancer patients who achieved a pCR with neoadjuvant chemotherapy. A retrospective chart review was conducted of all patients with unilateral breast cancer treated with neoadjuvant chemotherapy from January 1, 2000 to December 31, 2010 at one comprehensive cancer center. A pCR was defined as no residual invasive cancer in the breast in the surgical specimen following neoadjuvant therapy. Recurrence was defined as visceral or bony reappearance of cancer after completion of all therapy. Of 818 patients who completed neoadjuvant chemotherapy, 144 (17.6 %) had pCR; six with bilateral breast cancer were excluded from further analysis. The mean time to follow-up was 47.2 months. Among the 138 patients with unilateral breast cancer, there were 14 recurrences (10.1 %). Using a binary multiple logistic regression model, examining types of chemotherapy and surgery, race, lymph node assessment, and lymph node status, breast cancer side, triple-negative status, and radiation receipt, only African-American patients (OR: 5.827, 95 % CI: 1.280-26.525; p = 0.023) were more likely to develop distant recurrence. The mean time to recurrence was 31.9 months. In our study, race was the only independent predictor of recurrence after achieving pCR with neoadjuvant chemotherapy. The reasons for this observation require further study.
Validating internal controls for quantitative plant gene expression studies
Brunner, Amy M; Yakovlev, Igor A; Strauss, Steven H
2004-01-01
Background Real-time reverse transcription PCR (RT-PCR) has greatly improved the ease and sensitivity of quantitative gene expression studies. However, accurate measurement of gene expression with this method relies on the choice of a valid reference for data normalization. Studies rarely verify that gene expression levels for reference genes are adequately consistent among the samples used, nor compare alternative genes to assess which are most reliable for the experimental conditions analyzed. Results Using real-time RT-PCR to study the expression of 10 poplar (genus Populus) housekeeping genes, we demonstrate a simple method for determining the degree of stability of gene expression over a set of experimental conditions. Based on a traditional method for analyzing the stability of varieties in plant breeding, it defines measures of gene expression stability from analysis of variance (ANOVA) and linear regression. We found that the potential internal control genes differed widely in their expression stability over the different tissues, developmental stages and environmental conditions studied. Conclusion Our results support that quantitative comparisons of candidate reference genes are an important part of real-time RT-PCR studies that seek to precisely evaluate variation in gene expression. The method we demonstrated facilitates statistical and graphical evaluation of gene expression stability. Selection of the best reference gene for a given set of experimental conditions should enable detection of biologically significant changes in gene expression that are too small to be revealed by less precise methods, or when highly variable reference genes are unknowingly used in real-time RT-PCR experiments. PMID:15317655
Manage, Dammika P; Lauzon, Jana; Atrazhev, Alexey; Morrissey, Yuen C; Edwards, Ann L; Stickel, Alexander J; Crabtree, H John; Pabbaraju, Kanti; Zahariadis, George; Yanow, Stephanie K; Pilarski, Linda M
2012-05-07
Herpes simplex virus (HSV) is one of the most prevalent viruses, with acute and recurrent infections in humans. The current gold standard for the diagnosis of HSV is viral culture which takes 2-14 days and has low sensitivity. In contrast, DNA amplification by polymerase chain reaction (PCR) can be performed within 1-2 h. We here describe a multiparameter PCR assay to simultaneously detect HSV-1 and HSV-2 DNA templates, together with integrated positive and negative controls, with product detection by melting curve analysis (MCA), in an array of semi-solid polyacrylamide gel posts. Each gel post is 0.67 μL in volume, and polymerized with all the components required for PCR. Both PCR and MCA can currently be performed in one hour and 20 min. Unprocessed genital swabs collected in universal transport medium were directly added to the reagents before or after polymerization, diffusing from atop the gel posts. The gel post platform detects HSV templates in as little as 2.5 nL of raw sample. In this study, 45 genital swab specimens were tested blindly as a preliminary validation of this platform. The concordance of PCR on gel posts with conventional PCR was 91%. The primer sequestration method introduced here (wherein different primers are placed in different sets of posts) enables the simultaneous detection of multiple pathogens for the same sample, together with positive and negative controls, on a single chip. This platform accepts unprocessed samples and is readily adaptable to detection of multiple different pathogens or biomarkers for point-of-care diagnostics.
Alcendor, Donald J
2017-07-15
Zika virus (ZIKV) infection in the human renal compartment has not been reported. Several clinical reports have describe high-level persistent viral shedding in the urine of infected patients, but the associated mechanisms have not been explored until now. The current study examined cellular components of the glomerulus of the human kidney for ZIKV infectivity. I infected primary human podocytes, renal glomerular endothelial cells (GECs), and mesangial cells with ZIKV. Viral infectivity was analyzed by means of microscopy, immunofluorescence, real-time reverse-transcription polymerase chain reaction (RT-PCR), and quantitative RT-PCR (qRT-PCR), and the proinflammatory cytokines interleukin 1β, interferon β, and RANTES (regulated on activation of normal T cells expressed and secreted) were assessed using qRT-PCR. I show that glomerular podocytes, renal GECs, and mesangial cells are permissive for ZIKV infection. ZIKV infectivity was confirmed in all 3 cell types by means of immunofluorescence staining, RT-PCR, and qRT-PCR, and qRT-PCR analysis revealed increased transcriptional induction of interleukin 1β, interferon β, and RANTES in ZIKV-infected podocytes at 72 hours, compared with renal GECs and mesangial cells. The findings of this study support the notion that the glomerulus may serve as an amplification reservoir for ZIKV in the renal compartment. The impact of ZIKV infection in the human renal compartment is unknown and will require further study. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.
PCR detection and identification of oral streptococci in saliva samples using gtf genes.
Hoshino, Tomonori; Kawaguchi, Mamoru; Shimizu, Noriko; Hoshino, Naoko; Ooshima, Takashi; Fujiwara, Taku
2004-03-01
Oral streptococci are major constituents of dental plaque, and their prevalence is implicated in various pathologies. Therefore, accurate identification of oral streptococci would be valuable for studies of cariogenic plaque and for diagnostic use in infective endocarditis. Many oral streptococci possess glucosyltransferase enzymes that synthesize glucan, which is an obligate component of dental plaque. We established a rapid and precise method to identify oral streptococci by PCR using the species-specific region from the glucosyltransferase gene. With the species-specific primers, Streptococcus mutans, S. sobrinus, S. salivarius, S. sanguinis, S. oralis, and S. gordonii could be successfully distinguished. Further, we developed a simple method to extract the bacterial DNA from saliva. Using the resultant DNA as a template, the proposed PCR detection was performed. Their distribution was in accord with results of conventional biochemical tests. These findings indicate that the present PCR method is useful for the analysis of oral streptococci and can be successfully used in clinical applications to identify pathogenic bacteria associated with oral infectious disease and/or endocarditis.
Modeling vertebrate diversity in Oregon using satellite imagery
NASA Astrophysics Data System (ADS)
Cablk, Mary Elizabeth
Vertebrate diversity was modeled for the state of Oregon using a parametric approach to regression tree analysis. This exploratory data analysis effectively modeled the non-linear relationships between vertebrate richness and phenology, terrain, and climate. Phenology was derived from time-series NOAA-AVHRR satellite imagery for the year 1992 using two methods: principal component analysis and derivation of EROS data center greenness metrics. These two measures of spatial and temporal vegetation condition incorporated the critical temporal element in this analysis. The first three principal components were shown to contain spatial and temporal information about the landscape and discriminated phenologically distinct regions in Oregon. Principal components 2 and 3, 6 greenness metrics, elevation, slope, aspect, annual precipitation, and annual seasonal temperature difference were investigated as correlates to amphibians, birds, all vertebrates, reptiles, and mammals. Variation explained for each regression tree by taxa were: amphibians (91%), birds (67%), all vertebrates (66%), reptiles (57%), and mammals (55%). Spatial statistics were used to quantify the pattern of each taxa and assess validity of resulting predictions from regression tree models. Regression tree analysis was relatively robust against spatial autocorrelation in the response data and graphical results indicated models were well fit to the data.
Cecconi, Elva; Incerti, Guido; Capozzi, Fiore; Adamo, Paola; Bargagli, Roberto; Benesperi, Renato; Candotto Carniel, Fabio; Favero-Longo, Sergio Enrico; Giordano, Simonetta; Puntillo, Domenico; Ravera, Sonia; Spagnuolo, Valeria; Tretiach, Mauro
2018-05-01
In biomonitoring, the knowledge of background element content (BEC) values is an essential pre-requisite for the correct assessment of pollution levels. Here, we estimated the BEC values of a highly performing biomonitor, the epiphytic lichen Pseudevernia furfuracea, by means of a careful review of literature data, integrated by an extensive field survey. Methodologically homogeneous element content datasets, reflecting different exposure conditions across European and extra-European countries, were compiled and comparatively analysed. Element content in samples collected in remote areas was compared to that of potentially enriched samples, testing differences between medians for 25 elements. This analysis confirmed that the former samples were substantially unaffected by anthropogenic contributions, and their metrics were therefore proposed as a first overview at supra-national background level. We also showed that bioaccumulation studies suffer a huge methodological variability. Limited to original field data, we investigated the background variability of 43 elements in 62 remote Italian sites, characterized in GIS environment for anthropization, land use, climate and lithology at different scale resolution. The relationships between selected environmental descriptors and BEC were tested using Principal Component Regression (PCR) modelling. Elemental composition resulted significantly dependent on land use, climate and lithology. In the case of lithogenic elements, regression models correctly reproduced the lichen content throughout the country at randomly selected sites. Further descriptors should be identified only for As, Co, and V. Through a multivariate approach we also identified three geographically homogeneous macro-regions for which specific BECs were provided for use as reference in biomonitoring applications. Copyright © 2017 Elsevier B.V. All rights reserved.
Fourier transform infrared spectroscopy for Kona coffee authentication.
Wang, Jun; Jun, Soojin; Bittenbender, H C; Gautz, Loren; Li, Qing X
2009-06-01
Kona coffee, the variety of "Kona typica" grown in the north and south districts of Kona-Island, carries a unique stamp of the region of Big Island of Hawaii, U.S.A. The excellent quality of Kona coffee makes it among the best coffee products in the world. Fourier transform infrared (FTIR) spectroscopy integrated with an attenuated total reflectance (ATR) accessory and multivariate analysis was used for qualitative and quantitative analysis of ground and brewed Kona coffee and blends made with Kona coffee. The calibration set of Kona coffee consisted of 10 different blends of Kona-grown original coffee mixture from 14 different farms in Hawaii and a non-Kona-grown original coffee mixture from 3 different sampling sites in Hawaii. Derivative transformations (1st and 2nd), mathematical enhancements such as mean centering and variance scaling, multivariate regressions by partial least square (PLS), and principal components regression (PCR) were implemented to develop and enhance the calibration model. The calibration model was successfully validated using 9 synthetic blend sets of 100% Kona coffee mixture and its adulterant, 100% non-Kona coffee mixture. There were distinct peak variations of ground and brewed coffee blends in the spectral "fingerprint" region between 800 and 1900 cm(-1). The PLS-2nd derivative calibration model based on brewed Kona coffee with mean centering data processing showed the highest degree of accuracy with the lowest standard error of calibration value of 0.81 and the highest R(2) value of 0.999. The model was further validated by quantitative analysis of commercial Kona coffee blends. Results demonstrate that FTIR can be a rapid alternative to authenticate Kona coffee, which only needs very quick and simple sample preparations.
Brummel, Sean S; Singh, Kumud K; Maihofer, Adam X.; Farhad, Mona; Qin, Min; Fenton, Terry; Nievergelt, Caroline M.; Spector, Stephen A.
2015-01-01
Background Ancestry informative markers (AIMs) measure genetic admixtures within an individual beyond self-reported racial/ethnic (SRR) groups. Here, we used genetically determined ancestry (GDA) across SRR groups and examine associations between GDA and HIV-1 RNA and CD4+ counts in HIV-positive children in the US. Methods 41 AIMs, developed to distinguish 7 continental regions, were detected by real-time-PCR in 994 HIV-positive, antiretroviral naïve children. GDA was estimated comparing each individual’s genotypes to allele frequencies found in a large set of reference individuals originating from global populations using STRUCTURE. The means of GDA were calculated for each category of SRR. Linear regression was used to model GDA on CD4+ count and log10 RNA, adjusting for SRR and age. Results Subjects were 61% Black, 25% Hispanic, 13% White and 1.3% Unknown. The mean age was 2.3 years (45% male), mean CD4+ count 981 cells/mm3, and mean log10 RNA 5.11. Marked heterogeneity was found for all SRR groups with high admixture for Hispanics. In adjusted linear regression models, subjects with 100% European ancestry were estimated to have 0.33 higher log10 RNA levels (95% CI: (0.03, 0.62), p=0.028) and 253 CD4+ cells /mm3 lower (95% CI: (−517, 11), p = 0.06) in CD4+ count, compared to subjects with 100% African ancestry. Conclusion Marked continental admixture was found among this cohort of HIV-infected children from the US. GDA contributed to differences in RNA and CD4+ counts beyond SRR, and should be considered when outcomes associated with HIV infection are likely to have a genetic component. PMID:26536313
NASA Astrophysics Data System (ADS)
Takahashi, Tomoko; Thornton, Blair
2017-12-01
This paper reviews methods to compensate for matrix effects and self-absorption during quantitative analysis of compositions of solids measured using Laser Induced Breakdown Spectroscopy (LIBS) and their applications to in-situ analysis. Methods to reduce matrix and self-absorption effects on calibration curves are first introduced. The conditions where calibration curves are applicable to quantification of compositions of solid samples and their limitations are discussed. While calibration-free LIBS (CF-LIBS), which corrects matrix effects theoretically based on the Boltzmann distribution law and Saha equation, has been applied in a number of studies, requirements need to be satisfied for the calculation of chemical compositions to be valid. Also, peaks of all elements contained in the target need to be detected, which is a bottleneck for in-situ analysis of unknown materials. Multivariate analysis techniques are gaining momentum in LIBS analysis. Among the available techniques, principal component regression (PCR) analysis and partial least squares (PLS) regression analysis, which can extract related information to compositions from all spectral data, are widely established methods and have been applied to various fields including in-situ applications in air and for planetary explorations. Artificial neural networks (ANNs), where non-linear effects can be modelled, have also been investigated as a quantitative method and their applications are introduced. The ability to make quantitative estimates based on LIBS signals is seen as a key element for the technique to gain wider acceptance as an analytical method, especially in in-situ applications. In order to accelerate this process, it is recommended that the accuracy should be described using common figures of merit which express the overall normalised accuracy, such as the normalised root mean square errors (NRMSEs), when comparing the accuracy obtained from different setups and analytical methods.
NASA Astrophysics Data System (ADS)
El-Zaher, Asmaa A.; Elkady, Ehab F.; Elwy, Hanan M.; Saleh, Mahmoud Abo El Makarim
2017-07-01
In the present work, pioglitazone and glimepiride, 2 widely used antidiabetics, were simultaneously determined by a chemometric-assisted UV-spectrophotometric method which was applied to a binary synthetic mixture and a pharmaceutical preparation containing both drugs. Three chemometric techniques - Concentration residual augmented classical least-squares (CRACLS), principal component regression (PCR), and partial least-squares (PLS) were implemented by using the synthetic mixtures containing the two drugs in acetonitrile. The absorbance data matrix corresponding to the concentration data matrix was obtained by the measurements of absorbencies in the range between 215 and 235 nm in the intervals with Δλ = 0.4 nm in their zero-order spectra. Then, calibration or regression was obtained by using the absorbance data matrix and concentration data matrix for the prediction of the unknown concentrations of pioglitazone and glimepiride in their mixtures. The described techniques have been validated by analyzing synthetic mixtures containing the two drugs showing good mean recovery values lying between 98 and 100%. In addition, accuracy and precision of the three methods have been assured by recovery values lying between 98 and 102% and R.S.D. % ˂0.6 for intra-day precision and ˂1.2 for inter-day precision. The proposed chemometric techniques were successfully applied to a pharmaceutical preparation containing a combination of pioglitazone and glimepiride in the ratio of 30: 4, showing good recovery values. Finally, statistical analysis was carried out to add a value to the verification of the proposed methods. It was carried out by an intrinsic comparison between the 3 chemometric techniques and by comparing values of present methods with those obtained by implementing reference pharmacopeial methods for each of pioglitazone and glimepiride.
Brummel, Sean S; Singh, Kumud K; Maihofer, Adam X; Farhad, Mona; Qin, Min; Fenton, Terry; Nievergelt, Caroline M; Spector, Stephen A
2016-04-15
Ancestry informative markers (AIMs) measure genetic admixtures within an individual beyond self-reported racial/ethnic (SRR) groups. Here, we used genetically determined ancestry (GDA) across SRR groups and examine associations between GDA and HIV-1 RNA and CD4 counts in HIV-positive children in the United States. Forty-one AIMs, developed to distinguish 7 continental regions, were detected by real-time PCR in 994 HIV-positive, antiretroviral naive children. GDA was estimated comparing each individual's genotypes to allele frequencies found in a large set of reference individuals originating from global populations using STRUCTURE. The means of GDA were calculated for each category of SRR. Linear regression was used to model GDA on CD4 count and log10 RNA, adjusting for SRR and age. Subjects were 61% black, 25% Hispanic, 13% white, and 1.3% Unknown. The mean age was 2.3 years (45% male), mean CD4 count of 981 cells per cubic millimeter, and mean log10 RNA of 5.11. Marked heterogeneity was found for all SRR groups with high admixture for Hispanics. In adjusted linear regression models, subjects with 100% European ancestry were estimated to have 0.33 higher log10 RNA levels (95% CI: 0.03 to 0.62, P = 0.028) and 253 CD4 cells per cubic millimeter lower (95% CI: -517 to 11, P = 0.06) in CD4 count, compared to subjects with 100% African ancestry. Marked continental admixture was found among this cohort of HIV-infected children from the United States. GDA contributed to differences in RNA and CD4 counts beyond SRR and should be considered when outcomes associated with HIV infection are likely to have a genetic component.
Capasso, Mario; Avvisati, Rosa Anna; Piscopo, Carmelo; Laforgia, Nicola; Raimondi, Francesco; de Angelis, Filomena; Iolascon, Achille
2007-03-01
In this study, we determined the genotype frequencies of polymorphisms of cytokine genes and investigated their association with the risk of respiratory distress syndrome (RDS) in preterm infants. Genetic polymorphisms in the cytokines interleukin (IL)-10, IL-8, and tumor necrosis factor (TNF) alpha, were studied in 342 white Italian newborns (112 without RDS, 66 prematurely born with RDS, and 164 infants born at term who were included as healthy controls). The polymorphisms were analyzed by polymerase chain reaction (PCR) restriction fragment length polymorphism (RFLP). The IL-10 mRNA levels were analyzed according to genotype by quantitative real-time PCR (QRT-PCR) in Epstein-Barr virus-transformed lymphoblastoid cell lines (EBV-LCLs) of 42 full-term healthy infants. Logistic regression analysis demonstrated the risk of RDS to be significantly lower in preterm infants with an IL-10 -1082 GG/GA genotype than in those with an AA genotype [odds ratio (OR) = 0.48, 95% confidence interval (CI): 0.24-0.95, p = 0.03]. QRT-PCR analyses showed that the IL-10 mRNA levels were significantly higher in 27 IL-10 -1082 GG/GA carriers compared with 15 IL-10 -1082 AA carriers (p = 0.03). We conclude that the IL-10 -1082 GG/GA polymorphism may have a role in RDS development in premature infants.
Schaeffer, Elizabeth; López-Bayghen, Bruno; Neumann, Adina; Porchia, Leonardo M; Camacho, Rafael; Garrido, Efraín; Gómez, Rocío; Camargo, Felipe; López-Bayghen, Esther
2017-01-01
Our objective was to determine if whole genome amplification (WGA) provides suitable DNA for qPCR-based genotyping for human embryos. Single blastomeres (Day 3) or trophoblastic cells (Day 5) were isolated from 342 embryos for WGA. Comparative Genomic Hybridization determined embryo sex as well as Trisomy 18 or Trisomy 21. To determine the embryo's sex, qPCR melting curve analysis for SRY and DYS14 was used. Logistic regression indicated a 4.4%, 57.1%, or 98.8% probability of a male embryo when neither gene, SRY only, or both genes were detected, respectively (accuracy = 94.1%, kappa = 0.882, and p < 0.001). Fluorescent Capillary Electrophoresis for the amelogenin genes (AMEL) was also used to determine sex. AMELY peak's height was higher and this peak's presence was highly predictive of male embryos (AUC = 0.93, accuracy = 81.7%, kappa = 0.974, and p < 0.001). Trisomy 18 and Trisomy 21 were determined using the threshold cycle difference for RPL17 and TTC3, respectively, which were significantly lower in the corresponding embryos. The Ct difference for TTC3 specifically determined Trisomy 21 (AUC = 0.89) and RPL17 for Trisomy 18 (AUC = 0.94). Here, WGA provides adequate DNA for PCR-based techniques for preimplantation genotyping.
Li, P; Jia, J W; Jiang, L X; Zhu, H; Bai, L; Wang, J B; Tang, X M; Pan, A H
2012-04-27
To ensure the implementation of genetically modified organism (GMO)-labeling regulations, an event-specific detection method was developed based on the junction sequence of an exogenous integrant in the transgenic carnation variety Moonlite. The 5'-transgene integration sequence was isolated by thermal asymmetric interlaced PCR. Based upon the 5'-transgene integration sequence, the event-specific primers and TaqMan probe were designed to amplify the fragments, which spanned the exogenous DNA and carnation genomic DNA. Qualitative and quantitative PCR assays were developed employing the designed primers and probe. The detection limit of the qualitative PCR assay was 0.05% for Moonlite in 100 ng total carnation genomic DNA, corresponding to about 79 copies of the carnation haploid genome; the limit of detection and quantification of the quantitative PCR assay were estimated to be 38 and 190 copies of haploid carnation genomic DNA, respectively. Carnation samples with different contents of genetically modified components were quantified and the bias between the observed and true values of three samples were lower than the acceptance criterion (<25%) of the GMO detection method. These results indicated that these event-specific methods would be useful for the identification and quantification of the GMO carnation Moonlite.
Dirichlet Component Regression and its Applications to Psychiatric Data
Gueorguieva, Ralitza; Rosenheck, Robert; Zelterman, Daniel
2011-01-01
Summary We describe a Dirichlet multivariable regression method useful for modeling data representing components as a percentage of a total. This model is motivated by the unmet need in psychiatry and other areas to simultaneously assess the effects of covariates on the relative contributions of different components of a measure. The model is illustrated using the Positive and Negative Syndrome Scale (PANSS) for assessment of schizophrenia symptoms which, like many other metrics in psychiatry, is composed of a sum of scores on several components, each in turn, made up of sums of evaluations on several questions. We simultaneously examine the effects of baseline socio-demographic and co-morbid correlates on all of the components of the total PANSS score of patients from a schizophrenia clinical trial and identify variables associated with increasing or decreasing relative contributions of each component. Several definitions of residuals are provided. Diagnostics include measures of overdispersion, Cook’s distance, and a local jackknife influence metric. PMID:22058582
Hanley, James A
2008-01-01
Most survival analysis textbooks explain how the hazard ratio parameters in Cox's life table regression model are estimated. Fewer explain how the components of the nonparametric baseline survivor function are derived. Those that do often relegate the explanation to an "advanced" section and merely present the components as algebraic or iterative solutions to estimating equations. None comment on the structure of these estimators. This note brings out a heuristic representation that may help to de-mystify the structure.
Criscitiello, Carmen; Golshan, Mehra; Barry, William T; Viale, Giulia; Wong, Stephanie; Santangelo, Michele; Curigliano, Giuseppe
2018-05-04
We conducted a meta-analysis of randomised trials evaluating pathological complete response (pCR) and surgical outcomes after neoadjuvant systemic therapy (NST) in patients with early breast cancer (EBC). The primary outcome was breast-conserving surgery (BCT) rate. Secondary outcomes were pCR rate and association to BCT. Meta-analyses were performed using random effects models that use inverse-variance weighting for each treatment arm based on evaluable patients. Point estimates are reported with 95% confidence interval (CI), and p < 0.05 was considered statistically significant. Thirty-six studies were identified (N = 12,311 patients). We selected for the analysis 16 of 36 studies reporting both pCR and BCT for at least one treatment arm. Arms per study ranged from one to six; 42 independent units were available to evaluate the association between pCR and BCT. BCT rate ranged 5-76% across arms with an average BCT of 57% (95% CI 52-62%). Significant heterogeneity was observed among the trials (Cochrane Q = 787, p < 0.001, I 2 = 97%). In the meta-regression model, BCT rates were not significantly associated with year of first patient-in (p = 0.89), grade (p = 0.93) and hormone-receptor status (p = 0.39). Clinical N-stage (p = 0.01) and human epidermal growth factor receptor (HER2) status (p = 0.03) were significantly associated with BCT. pCR rate ranged 3-60% across studies. The average pCR across all study arms was 24% (95% CI 19-29%). No association was observed between pCR rate in a study arm and the resulting BCT rate in a univariate model (p = 0.34) nor after adjusting for HER2 and clinical nodal status (p = 0.82). In the subset of 14 multi-arm studies, no significant association was seen between the differences in pCR and BCT between treatment arms (p = 0.27). pCR does not increase BCT in patients receiving NST for EBC. Copyright © 2018 Elsevier Ltd. All rights reserved.
Trophic interactions in contrating production systems: MiSeq versus multiplex PCR
USDA-ARS?s Scientific Manuscript database
Maintaining biodiversity is an important aspect of long-term agricultural sustainability. Generalist predators such as spiders and insect predators often prey upon common pest species, making them a beneficial component of agroecosystems. Much research has been devoted to understanding the roles of ...
Trophic interactions in contrasting production systems: MiSeq versus multiplex PCR
USDA-ARS?s Scientific Manuscript database
Maintaining biodiversity is an important aspect of long-term agricultural sustainability. Generalist predators such as spiders and insect predators oftern prey upon common species, making them a beneficial component of agroecosystems. Much research has been devoted to understanding the roles of ge...
Molecular defects leading to human complement component C6 deficiency in an African-American family
Zhu, Z-B; Totemchokchyakarn, K; Atkinson, T P; Volanakis, J E
1998-01-01
Complement component C6 deficiency (C6D) was diagnosed in a 16-year-old African-American male with meningococcal meningitis. The patient's father and two brothers also had C6D, but gave no history of meningitis or other neisserial infection. By using exon-specific polymerase chain reaction (PCR)/single-strand conformation polymorphism as a screening step and nucleotide sequencing of target exons, we determined that the proband was a compound heterozygote for two C6 gene mutations. The first, 1195delC located in exon 7, is a novel mutation, while the second, 1936delG in exon 12, has been described before to cause C6D in an unrelated African-American individual. Both mutations result in premature termination codons and C6 null alleles. Allele-specific PCR indicated that the proband's two brothers also inherited the 1195delC mutation from their heterozygous mother and the 1936delG mutation from their homozygous father. PMID:9472666
Biomass relations for components of five Minnesota shrubs.
Richard R. Buech; David J. Rugg
1995-01-01
Presents equations for estimating biomass of six components on five species of shrubs common to northeastern Minnesota. Regression analysis is used to compare the performance of three estimators of biomass.
Evaluation of the branched-chain DNA assay for measurement of RNA in formalin-fixed tissues.
Knudsen, Beatrice S; Allen, April N; McLerran, Dale F; Vessella, Robert L; Karademos, Jonathan; Davies, Joan E; Maqsodi, Botoul; McMaster, Gary K; Kristal, Alan R
2008-03-01
We evaluated the branched-chain DNA (bDNA) assay QuantiGene Reagent System to measure RNA in formalin-fixed, paraffin-embedded (FFPE) tissues. The QuantiGene Reagent System does not require RNA isolation, avoids enzymatic preamplification, and has a simple workflow. Five selected genes were measured by bDNA assay; quantitative polymerase chain reaction (qPCR) was used as a reference method. Mixed-effect statistical models were used to partition the overall variance into components attributable to xenograft, sample, and assay. For FFPE tissues, the coefficients of reliability were significantly higher for the bDNA assay (93-100%) than for qPCR (82.4-95%). Correlations between qPCR(FROZEN), the gold standard, and bDNA(FFPE) ranged from 0.60 to 0.94, similar to those from qPCR(FROZEN) and qPCR(FFPE). Additionally, the sensitivity of the bDNA assay in tissue homogenates was 10-fold higher than in purified RNA. In 9- to 13-year-old blocks with poor RNA quality, the bDNA assay allowed the correct identification of the overexpression of known cancer genes. In conclusion, the QuantiGene Reagent System is considerably more reliable, reproducible, and sensitive than qPCR, providing an alternative method for the measurement of gene expression in FFPE tissues. It also appears to be well suited for the clinical analysis of FFPE tissues with diagnostic or prognostic gene expression biomarker panels for use in patient treatment and management.
Kajbafnezhad, H; Ahadi, H; Heidarie, A; Askari, P; Enayati, M
2012-10-01
The aim of this study was to predict athletic success motivation by mental skills, emotional intelligence and its components. The research sample consisted of 153 male athletes who were selected through random multistage sampling. The subjects completed the Mental Skills Questionnaire, Bar-On Emotional Intelligence questionnaire and the perception of sport success questionnaire. Data were analyzed using Pearson correlation coefficient and multiple regressions. Regression analysis shows that between the two variables of mental skill and emotional intelligence, mental skill is the best predictor for athletic success motivation and has a better ability to predict the success rate of the participants. Regression analysis results showed that among all the components of emotional intelligence, self-respect had a significantly higher ability to predict athletic success motivation. The use of psychological skills and emotional intelligence as an mediating and regulating factor and organizer cause leads to improved performance and can not only can to help athletes in making suitable and effective decisions for reaching a desired goal.
NASA Astrophysics Data System (ADS)
Nordemann, D. J. R.; Rigozo, N. R.; de Souza Echer, M. P.; Echer, E.
2008-11-01
We present here an implementation of a least squares iterative regression method applied to the sine functions embedded in the principal components extracted from geophysical time series. This method seems to represent a useful improvement for the non-stationary time series periodicity quantitative analysis. The principal components determination followed by the least squares iterative regression method was implemented in an algorithm written in the Scilab (2006) language. The main result of the method is to obtain the set of sine functions embedded in the series analyzed in decreasing order of significance, from the most important ones, likely to represent the physical processes involved in the generation of the series, to the less important ones that represent noise components. Taking into account the need of a deeper knowledge of the Sun's past history and its implication to global climate change, the method was applied to the Sunspot Number series (1750-2004). With the threshold and parameter values used here, the application of the method leads to a total of 441 explicit sine functions, among which 65 were considered as being significant and were used for a reconstruction that gave a normalized mean squared error of 0.146.
Genotyping of Plant and Animal Samples without Prior DNA Purification
Chum, Pak Y.; Haimes, Josh D.; André, Chas P.; Kuusisto, Pia K.; Kelley, Melissa L.
2012-01-01
The Direct PCR approach facilitates PCR amplification directly from small amounts of unpurified samples, and is demonstrated here for several plant and animal tissues (Figure 1). Direct PCR is based on specially engineered Thermo Scientific Phusion and Phire DNA Polymerases, which include a double-stranded DNA binding domain that gives them unique properties such as high tolerance of inhibitors. PCR-based target DNA detection has numerous applications in plant research, including plant genotype analysis and verification of transgenes. PCR from plant tissues traditionally involves an initial DNA isolation step, which may require expensive or toxic reagents. The process is time consuming and increases the risk of cross contamination1, 2. Conversely, by using Thermo Scientific Phire Plant Direct PCR Kit the target DNA can be easily detected, without prior DNA extraction. In the model demonstrated here, an example of derived cleaved amplified polymorphic sequence analysis (dCAPS)3,4 is performed directly from Arabidopsis plant leaves. dCAPS genotyping assays can be used to identify single nucleotide polymorphisms (SNPs) by SNP allele-specific restriction endonuclease digestion3. Some plant samples tend to be more challenging when using Direct PCR methods as they contain components that interfere with PCR, such as phenolic compounds. In these cases, an additional step to remove the compounds is traditionally required2,5. Here, this problem is overcome by using a quick and easy dilution protocol followed by Direct PCR amplification (Figure 1). Fifteen year-old oak leaves are used as a model for challenging plants as the specimen contains high amounts of phenolic compounds including tannins. Gene transfer into mice is broadly used to study the roles of genes in development, physiology and human disease. The use of these animals requires screening for the presence of the transgene, usually with PCR. Traditionally, this involves a time consuming DNA isolation step, during which DNA for PCR analysis is purified from ear, tail or toe tissues6,7. However, with the Thermo Scientific Phire Animal Tissue Direct PCR Kit transgenic mice can be genotyped without prior DNA purification. In this protocol transgenic mouse genotyping is achieved directly from mouse ear tissues, as demonstrated here for a challenging example where only one primer set is used for amplification of two fragments differing greatly in size. PMID:23051689
A novel strategy for forensic age prediction by DNA methylation and support vector regression model
Xu, Cheng; Qu, Hongzhu; Wang, Guangyu; Xie, Bingbing; Shi, Yi; Yang, Yaran; Zhao, Zhao; Hu, Lan; Fang, Xiangdong; Yan, Jiangwei; Feng, Lei
2015-01-01
High deviations resulting from prediction model, gender and population difference have limited age estimation application of DNA methylation markers. Here we identified 2,957 novel age-associated DNA methylation sites (P < 0.01 and R2 > 0.5) in blood of eight pairs of Chinese Han female monozygotic twins. Among them, nine novel sites (false discovery rate < 0.01), along with three other reported sites, were further validated in 49 unrelated female volunteers with ages of 20–80 years by Sequenom Massarray. A total of 95 CpGs were covered in the PCR products and 11 of them were built the age prediction models. After comparing four different models including, multivariate linear regression, multivariate nonlinear regression, back propagation neural network and support vector regression, SVR was identified as the most robust model with the least mean absolute deviation from real chronological age (2.8 years) and an average accuracy of 4.7 years predicted by only six loci from the 11 loci, as well as an less cross-validated error compared with linear regression model. Our novel strategy provides an accurate measurement that is highly useful in estimating the individual age in forensic practice as well as in tracking the aging process in other related applications. PMID:26635134
Boosted Regression Tree Models to Explain Watershed Nutrient Concentrations and Biological Condition
Boosted regression tree (BRT) models were developed to quantify the nonlinear relationships between landscape variables and nutrient concentrations in a mesoscale mixed land cover watershed during base-flow conditions. Factors that affect instream biological components, based on ...
Romand, Stéphane; Chosson, Muriel; Franck, Jacqueline; Wallon, Martine; Kieffer, François; Kaiser, Karine; Dumon, Henri; Peyron, François; Thulliez, Philippe; Picot, Stéphane
2004-03-01
Our purpose was to evaluate Toxoplasma gondii concentration in amniotic fluid (AF) samples as a prognostic marker of congenital toxoplasmosis. A retrospective study was carried out in 88 consecutive AF samples from 86 pregnant women, which were found positive by prospective polymerase chain reaction (PCR) testing. Parasite AF concentrations were estimated by real-time quantitative PCR and analyzed in relation to the clinical outcome of infected fetuses during pregnancy and at birth, taking into account the gestational age at maternal infection. A significant negative linear regression was observed between gestational age at maternal infection and T gondii DNA loads in AF. After adjusting for time at maternal seroconversion by multivariate analysis, higher parasite concentrations were significantly associated with a severe outcome of congenital infection (odds ratio [OR]=15.38/log (parasites/mL AF) [95% CI=2.45-97.7]). PCR quantification of T gondii in AF can be highly contributive for early prognosis of congenital toxoplasmosis. Maternal infections acquired before 20 weeks with a parasite load greater than 100/mL of AF have the highest risk of severe fetal outcome.
Electrochemical DNA sensor for Neisseria meningitidis detection.
Patel, Manoj K; Solanki, Pratima R; Kumar, Ashok; Khare, Shashi; Gupta, Sunil; Malhotra, Bansi D
2010-08-15
Meningitis sensor based on nucleic acid probe of Neisseria meningitidis has been fabricated by immobilization of 5'-thiol end labeled single stranded deoxyribonucleic acid probe (ssDNA-SH) onto gold (Au) coated glass electrode. This ssDNA-SH/Au electrode hybridized with the genomic DNA (G-dsDNA/Au) and amplified DNA (PCR-dsDNA/Au) has been characterized using atomic force microscopy (AFM), Fourier transforms infrared spectroscopy (FT-IR) and electrochemical techniques. The ssDNA-SH/Au electrode can specifically detect upto 10-60 ng/microl of G-dsDNA-SH/Au and PCR-dsDNA-SH/Au of meningitis within 60s of hybridization time at 25 degrees C by cyclic voltammetry (CV) using methylene blue (MB) as electro-active DNA hybridization indicator. The values of sensitivities of the G-dsDNA-SH/Au and PCR-dsDNA-SH/Au electrodes have been determined as 0.0115 microA/ng cm(-2) and 0.0056 microA/ng cm(-2), respectively with regression coefficient (R) as 0.999. This DNA bioelectrode is stable for about 4 months when stored at 4 degrees C. Copyright 2010 Elsevier B.V. All rights reserved.
Bièche, I; Olivi, M; Champème, M H; Vidaud, D; Lidereau, R; Vidaud, M
1998-11-23
Gene amplification is a common event in the progression of human cancers, and amplified oncogenes have been shown to have diagnostic, prognostic and therapeutic relevance. A kinetic quantitative polymerase-chain-reaction (PCR) method, based on fluorescent TaqMan methodology and a new instrument (ABI Prism 7700 Sequence Detection System) capable of measuring fluorescence in real-time, was used to quantify gene amplification in tumor DNA. Reactions are characterized by the point during cycling when PCR amplification is still in the exponential phase, rather than the amount of PCR product accumulated after a fixed number of cycles. None of the reaction components is limited during the exponential phase, meaning that values are highly reproducible in reactions starting with the same copy number. This greatly improves the precision of DNA quantification. Moreover, real-time PCR does not require post-PCR sample handling, thereby preventing potential PCR-product carry-over contamination; it possesses a wide dynamic range of quantification and results in much faster and higher sample throughput. The real-time PCR method, was used to develop and validate a simple and rapid assay for the detection and quantification of the 3 most frequently amplified genes (myc, ccndl and erbB2) in breast tumors. Extra copies of myc, ccndl and erbB2 were observed in 10, 23 and 15%, respectively, of 108 breast-tumor DNA; the largest observed numbers of gene copies were 4.6, 18.6 and 15.1, respectively. These results correlated well with those of Southern blotting. The use of this new semi-automated technique will make molecular analysis of human cancers simpler and more reliable, and should find broad applications in clinical and research settings.
Regional Disparities in Online Map User Access Volume and Determining Factors
NASA Astrophysics Data System (ADS)
Li, R.; Yang, N.; Li, R.; Huang, W.; Wu, H.
2017-09-01
The regional disparities of online map user access volume (use `user access volume' in this paper to indicate briefly) is a topic of growing interest with the increment of popularity in public users, which helps to target the construction of geographic information services for different areas. At first place we statistically analysed the online map user access logs and quantified these regional access disparities on different scales. The results show that the volume of user access is decreasing from east to the west in China as a whole, while East China produces the most access volume; these cities are also the crucial economic and transport centres. Then Principal Component Regression (PCR) is applied to explore the regional disparities of user access volume. A determining model for Online Map access volume is proposed afterwards, which indicates that area scale is the primary determining factor for regional disparities, followed by public transport development level and public service development level. Other factors like user quality index and financial index have very limited influence on the user access volume. According to the study of regional disparities in user access volume, map providers can reasonably dispatch and allocate the data resources and service resources in each area and improve the operational efficiency of the Online Map server cluster.
Farouk, M; Elaziz, Omar Abd; Tawakkol, Shereen M; Hemdan, A; Shehata, Mostafa A
2014-04-05
Four simple, accurate, reproducible, and selective methods have been developed and subsequently validated for the determination of Benazepril (BENZ) alone and in combination with Amlodipine (AML) in pharmaceutical dosage form. The first method is pH induced difference spectrophotometry, where BENZ can be measured in presence of AML as it showed maximum absorption at 237nm and 241nm in 0.1N HCl and 0.1N NaOH, respectively, while AML has no wavelength shift in both solvents. The second method is the new Extended Ratio Subtraction Method (EXRSM) coupled to Ratio Subtraction Method (RSM) for determination of both drugs in commercial dosage form. The third and fourth methods are multivariate calibration which include Principal Component Regression (PCR) and Partial Least Squares (PLSs). A detailed validation of the methods was performed following the ICH guidelines and the standard curves were found to be linear in the range of 2-30μg/mL for BENZ in difference and extended ratio subtraction spectrophotometric method, and 5-30 for AML in EXRSM method, with well accepted mean correlation coefficient for each analyte. The intra-day and inter-day precision and accuracy results were well within the acceptable limits. Copyright © 2013 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Samadi-Maybodi, Abdolraouf; Darzi, S. K. Hassani Nejad
2008-10-01
Resolution of binary mixtures of vitamin B12, methylcobalamin and B12 coenzyme with minimum sample pre-treatment and without analyte separation has been successfully achieved by methods of partial least squares algorithm with one dependent variable (PLS1), orthogonal signal correction/partial least squares (OSC/PLS), principal component regression (PCR) and hybrid linear analysis (HLA). Data of analysis were obtained from UV-vis spectra. The UV-vis spectra of the vitamin B12, methylcobalamin and B12 coenzyme were recorded in the same spectral conditions. The method of central composite design was used in the ranges of 10-80 mg L -1 for vitamin B12 and methylcobalamin and 20-130 mg L -1 for B12 coenzyme. The models refinement procedure and validation were performed by cross-validation. The minimum root mean square error of prediction (RMSEP) was 2.26 mg L -1 for vitamin B12 with PLS1, 1.33 mg L -1 for methylcobalamin with OSC/PLS and 3.24 mg L -1 for B12 coenzyme with HLA techniques. Figures of merit such as selectivity, sensitivity, analytical sensitivity and LOD were determined for three compounds. The procedure was successfully applied to simultaneous determination of three compounds in synthetic mixtures and in a pharmaceutical formulation.
Jean, J-S; Guo, H-R; Chen, S-H; Liu, C-C; Chang, W-T; Yang, Y-J; Huang, M-C
2006-12-01
To determine the association between rainfall rate and occurrence of enterovirus infection related to contamination of drinking water. One fatality case and three cases of severe illness were observed during the enterovirus epidemic in a village in southern Taiwan from 16 September to 3 October 1998. Groundwater samples were collected from the public well in the village after heavy rainfall to test for enterovirus using the reverse transcription-polymerase chain reaction (RT-PCR) assay. The RT-PCR assay detected the enterovirus in the groundwater sample collected on 26 September 1998. The logistic regression model also revealed a statistically significant association between the rainfall rate and the observation of cases of enterovirus infection. According to the fitted logistic regression model, the probability of detecting cases of enterovirus infection was greater than 50% at rainfall rates >31 mm h(-1). The higher the rainfall rate, the higher the probability of enterovirus epidemic. Contamination of drinking water by the enterovirus may lead to epidemics that cause deaths and severe illness, and such contamination may be caused by heavy rainfall. The major finding in this study is that the enterovirus could be flushed to groundwater in an unconfined aquifer after a heavy rainfall. This work allows for a warning level so that an action can be taken to minimize future outbreaks and so protect public health.
Ranadive, Nikhil; Kunene, Simon; Darteh, Sarah; Ntshalintshali, Nyasatu; Nhlabathi, Nomcebo; Dlamini, Nomcebo; Chitundu, Stanley; Saini, Manik; Murphy, Maxwell; Soble, Adam; Schwartz, Alanna; Greenhouse, Bryan
2017-01-01
Abstract Background. The performance of Plasmodium falciparum–specific histidine-rich protein 2–based rapid diagnostic tests (RDTs) to evaluate suspected malaria in low-endemicity settings has not been well characterized. Methods. Using dried blood spot samples from patients with suspected malaria at 37 health facilities from 2012 to 2014 in the low-endemicity country of Swaziland, we investigated the diagnostic accuracy of histidine-rich protein 2–based RDTs using qualitative polymerase chain reaction (PCR) (nested PCR targeting the cytochrome b gene) and quantitative PCR as reference standards. To explore reasons for false-negative and/or false-positive results, we used pfhrp2/3-specific PCR and logistic regression analyses of potentially associated epidemiological factors. Results. From 1353 patients, 93.0% of RDT-positive (n = 185) and 31.2% of RDT-negative samples (n = 340) were available and selected for testing. Compared with nested PCR, the sensitivity, specificity, positive predictive value (PPV), and negative predictive value (NPV) of RDTs were 51.7%, 94.1%, 67.3%, and 89.1%, respectively. After exclusion of samples with parasite densities <100/μL, which accounted for 75.7% of false-negative results and 33.3% of PCR-detectable infections, the sensitivity, specificity, PPV, and NPV were 78.8%, 93.7%, 62.3%, and 97.1%. Deletions of pfhrp2 were not detected. False-positivity was more likely during the second year and was not associated with demographics, recent malaria, health facility testing characteristics, or potential DNA degradation. Conclusions. In the low-transmission setting of Swaziland, we demonstrated low sensitivity of RDT for malaria diagnosis, owing to an unexpectedly high proportion of low-density infection among symptomatic subjects. The PPV was also low, requiring further investigation. A more accurate point-of-care diagnostic may be needed to support malaria elimination efforts. PMID:28369268
Kondo, Douglas G; Forrest, Lauren N; Shi, Xianfeng; Sung, Young-Hoon; Hellem, Tracy L; Huber, Rebekah S; Renshaw, Perry F
2016-08-01
Major depressive disorder (MDD) often begins during adolescence and is projected to become the leading cause of global disease burden by the year 2030. Yet, approximately 40 % of depressed adolescents fail to respond to standard antidepressant treatment with a selective serotonin reuptake inhibitor (SSRI). Converging evidence suggests that depression is related to brain mitochondrial dysfunction. Our previous studies of MDD in adult and adolescent females suggest that augmentation of SSRI pharmacotherapy with creatine monohydrate (CM) may improve MDD outcomes. Neuroimaging with phosphorus-31 magnetic resonance spectroscopy ((31)P-MRS) can measure the high-energy phosphorus metabolites in vivo that reflect mitochondrial function. These include phosphocreatine (PCr), a substrate for the creatine kinase reaction that produces adenosine triphosphate. As part of the National Institute of Mental Health's experimental medicine initiative, we conducted a placebo-controlled dose-ranging study of adjunctive CM for adolescent females with SSRI-resistant MDD. Participants were randomized to receive placebo or CM 2, 4 or 10 g daily for 8 weeks. Pre- and post-treatment (31)P-MRS scans were used to measure frontal lobe PCr, to assess CM's target engagement with cerebral energy metabolism. Mean frontal lobe PCr increased by 4.6, 4.1 and 9.1 % in the 2, 4 and 10 g groups, respectively; in the placebo group, PCr fell by 0.7 %. There was no group difference in adverse events, weight gain or serum creatinine. Regression analysis of PCr and depression scores across the entire sample showed that frontal lobe PCr was inversely correlated with depression scores (p = 0.02). These results suggest that CM achieves target engagement with brain bioenergetics and that the target is correlated with a clinical signal. Further study of CM as a treatment for adolescent females with SSRI-resistant MDD is warranted.
Jankowski, Clémentine; Guiu, S; Cortet, M; Charon-Barra, C; Desmoulins, I; Lorgis, V; Arnould, L; Fumoleau, P; Coudert, B; Rouzier, R; Coutant, C; Reyal, F
2017-01-01
The aim of this study was to assess the Institut Gustave Roussy/M.D. Anderson Cancer Center (IGR/MDACC) nomogram in predicting pathologic complete response (pCR) to preoperative chemotherapy in a cohort of human epidermal growth factor receptor 2 (HER2)-positive tumors treated with preoperative chemotherapy with trastuzumab. We then combine clinical and pathological variables associated with pCR into a new nomogram specific to HER2-positive tumors treated by preoperative chemotherapy with trastuzumab. Data from 270 patients with HER2-positive tumors treated with preoperative chemotherapy with trastuzumab at the Institut Curie and at the Georges François Leclerc Cancer Center were used to assess the IGR/MDACC nomogram and to subsequently develop a new nomogram for pCR based on multivariate logistic regression. Model performance was quantified in terms of calibration and discrimination. We studied the utility of the new nomogram using decision curve analysis. The IGR/MDACC nomogram was not accurate for the prediction of pCR in HER2-positive tumors treated by preoperative chemotherapy with trastuzumab, with poor discrimination (AUC = 0.54, 95% CI 0.51-0.58) and poor calibration (p = 0.01). After uni- and multivariate analysis, a new pCR nomogram was built based on T stage (TNM), hormone receptor status, and Ki67 (%). The model had good discrimination with an area under the curve (AUC) at 0.74 (95% CI 0.70-0.79) and adequate calibration (p = 0.93). By decision curve analysis, the model was shown to be relevant between thresholds of 0.3 and 0.7. To the best of our knowledge, ours is the first nomogram to predict pCR in HER2-positive tumors treated by preoperative chemotherapy with trastuzumab. To ensure generalizability, this model needs to be externally validated.
Li, Dongmei; Fan, Qing-Hai; Waite, David W.; Gunawardana, Disna; George, Sherly; Kumarasinghe, Lalith
2015-01-01
Spider mites of the genus Tetranychus are difficult to identify due to their limited diagnostic characters. Many of them are morphologically similar and males are needed for species-level identification. Tetranychus urticae is a common interception and non-regulated pest at New Zealand’s borders, however, most of the intercepted specimens are females and the identification was left at Tetranychus sp. Consequently, the shipments need to be fumigated. DNA sequencing and PCR-restriction fragment length polymorphism (PCR-RFLP) protocols could be used to facilitate the accurate identification. However, in the context of border security practiced in New Zealand, insect identifications are required to be provided within four hours of receiving the samples; thus, those molecular methods are not sufficient to meet this requirement. Therefore, a real-time PCR TaqMan assay was developed for identification of T. urticae by amplification of a 142 bp Internal Transcribed Spacer (ITS) 1 sequence. The developed assay is rapid, detects all life stages of T. urticae within three hours, and does not react with closely related species. Plasmid DNA containing ITS1 sequence of T. uritcae was serially diluted and used as standards in the real-time PCR assay. The quantification cycle (Cq) value of the assay depicted a strong linear relationship with T. urticae DNA content, with a regression coefficient of 0.99 and efficiency of 98%. The detection limit was estimated to be ten copies of the T. urticae target region. The assay was validated against a range of T. urticae specimens from various countries and hosts in a blind panel test. Therefore the application of the assay at New Zealand will reduce the unnecessary fumigation and be beneficial to both the importers and exporters. It is expected that the implementation of this real-time PCR assay would have wide applications in diagnostic and research agencies worldwide. PMID:26147599
Ranadive, Nikhil; Kunene, Simon; Darteh, Sarah; Ntshalintshali, Nyasatu; Nhlabathi, Nomcebo; Dlamini, Nomcebo; Chitundu, Stanley; Saini, Manik; Murphy, Maxwell; Soble, Adam; Schwartz, Alanna; Greenhouse, Bryan; Hsiang, Michelle S
2017-05-01
The performance of Plasmodium falciparum-specific histidine-rich protein 2-based rapid diagnostic tests (RDTs) to evaluate suspected malaria in low-endemicity settings has not been well characterized. Using dried blood spot samples from patients with suspected malaria at 37 health facilities from 2012 to 2014 in the low-endemicity country of Swaziland, we investigated the diagnostic accuracy of histidine-rich protein 2-based RDTs using qualitative polymerase chain reaction (PCR) (nested PCR targeting the cytochrome b gene) and quantitative PCR as reference standards. To explore reasons for false-negative and/or false-positive results, we used pfhrp2/3-specific PCR and logistic regression analyses of potentially associated epidemiological factors. From 1353 patients, 93.0% of RDT-positive (n = 185) and 31.2% of RDT-negative samples (n = 340) were available and selected for testing. Compared with nested PCR, the sensitivity, specificity, positive predictive value (PPV), and negative predictive value (NPV) of RDTs were 51.7%, 94.1%, 67.3%, and 89.1%, respectively. After exclusion of samples with parasite densities <100/μL, which accounted for 75.7% of false-negative results and 33.3% of PCR-detectable infections, the sensitivity, specificity, PPV, and NPV were 78.8%, 93.7%, 62.3%, and 97.1%. Deletions of pfhrp2 were not detected. False-positivity was more likely during the second year and was not associated with demographics, recent malaria, health facility testing characteristics, or potential DNA degradation. In the low-transmission setting of Swaziland, we demonstrated low sensitivity of RDT for malaria diagnosis, owing to an unexpectedly high proportion of low-density infection among symptomatic subjects. The PPV was also low, requiring further investigation. A more accurate point-of-care diagnostic may be needed to support malaria elimination efforts. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Weiss, Christian, E-mail: christian.weiss@kgu.d; Arnold, Dirk; Dellas, Kathrin
2010-10-01
Purpose: A pooled analysis of three prospective trials of preoperative radiochemotherapy (RCT) for rectal cancer by using oxaliplatin and capecitabine with or without cetuximab was performed to evaluate the impact of additional cetuximab on pathologic complete response (pCR) rates and tumor regression (TRG) grades. Methods and Materials: Of 202 patients, 172 patients met the inclusion criteria (primary tumor stage II/III, M0). All patients received concurrent RCT, and 46 patients received additional cetuximab therapy. A correlation of pretreatment clinicopathologic factors and cetuximab treatment with early pCR rates (TRG > 50%) was performed with univariate and multivariate analyses. Toxicity data were recordedmore » for all patients. Results: Of 172 patients, 24 (14%) patients achieved a pCR, and 84 of 172 (71%) patients showed a TRG of >50% in the surgical specimen assessment after preoperative treatment. Age, gender, and T/N stages, as well as localization of the tumor, were not associated with pCR or good TRG. The pCR rate was 16% after preoperative RCT alone and 9% with concurrent cetuximab therapy (p = 0.32). A significantly reduced TRG of >50% was found after RCT with cetuximab compared to RCT alone (p = 0.0035). This was validated by a multivariate analysis with all available clinical factors (p = 0.0037). Acute toxicity and surgical complications were not increased with additional cetuximab. Conclusions: Triple therapy with RCT and cetuximab seems to be feasible, with no unexpected toxicity. Early response assessment (TRG), however, suggests subadditive interaction. A longer follow-up (and finally randomized trials) is needed to draw any firm conclusions with respect to local and distant failure rates.« less
Variant Profiling of Candidate Genes in Pancreatic Ductal Adenocarcinoma.
Huang, Jiaqi; Löhr, Johannes-Matthias; Nilsson, Magnus; Segersvärd, Ralf; Matsson, Hans; Verbeke, Caroline; Heuchel, Rainer; Kere, Juha; Iafrate, A John; Zheng, Zongli; Ye, Weimin
2015-11-01
Pancreatic ductal adenocarcinoma (PDAC) has a poor prognosis. Variant profiling is crucial for developing personalized treatment and elucidating the etiology of this disease. Patients with PDAC undergoing surgery from 2007 to 2012 (n = 73) were followed from diagnosis until death or the end of the study. We applied an anchored multiplex PCR (AMP)-based next-generation sequencing (NGS) method to a panel of 65 selected genes and assessed analytical performance by sequencing a quantitative multiplex DNA reference standard. In clinical PDAC samples, detection of low-level KRAS (Kirsten rat sarcoma viral oncogene homolog) mutations was validated by allele-specific PCR and digital PCR. We compared overall survival of patients according to KRAS mutation status by log-rank test and applied logistic regression to evaluate the association between smoking and tumor variant types. The AMP-based NGS method could detect variants with allele frequencies as low as 1% given sufficient sequencing depth (>1500×). Low-frequency KRAS G12 mutations (allele frequency 1%-5%) were all confirmed by allele-specific PCR and digital PCR. The most prevalent genetic alterations were in KRAS (78% of patients), TP53 (tumor protein p53) (25%), and SMAD4 (SMAD family member 4) (8%). Overall survival in T3-stage PDAC patients differed among KRAS mutation subtypes (P = 0.019). Transversion variants were more common in ever-smokers than in never-smokers (odds ratio 5.7; 95% CI 1.2-27.8). The AMP-based NGS method is applicable for profiling tumor variants. Using this approach, we demonstrated that in PDAC patients, KRAS mutant subtype G12V is associated with poorer survival, and that transversion variants are more common among smokers. © 2015 American Association for Clinical Chemistry.
Issa-Nummer, Yasmin; Darb-Esfahani, Silvia; Loibl, Sibylle; Kunz, Georg; Nekljudova, Valentina; Schrader, Iris; Sinn, Bruno Valentin; Ulmer, Hans-Ullrich; Kronenwett, Ralf; Just, Marianne; Kühn, Thorsten; Diebold, Kurt; Untch, Michael; Holms, Frank; Blohmer, Jens-Uwe; Habeck, Jörg-Olaf; Dietel, Manfred; Overkamp, Friedrich; Krabisch, Petra; von Minckwitz, Gunter; Denkert, Carsten
2013-01-01
We have recently described an increased lymphocytic infiltration rate in breast carcinoma tissue is a significant response predictor for anthracycline/taxane-based neoadjuvant chemotherapy (NACT). The aim of this study was to prospectively validate the tumor-associated lymphocyte infiltrate as predictive marker for response to anthracycline/taxane-based NACT. The immunological infiltrate was prospectively evaluated in a total of 313 core biopsies from HER2 negative patients of the multicenter PREDICT study, a substudy of the neoadjuvant GeparQuinto study. Intratumoral lymphocytes (iTuLy), stromal lymphocytes (strLy) as well as lymphocyte-predominant breast cancer (LPBC) were evaluated by histopathological assessment. Pathological complete response (pCR) rates were analyzed and compared between the defined subgroups using the exact test of Fisher. Patients with lymphocyte-predominant breast cancer (LPBC) had a significantly increased pCR rate of 36.6%, compared to non-LPBC patients (14.3%, p<0.001). LPBC and stromal lymphocytes were significantly independent predictors for pCR in multivariate analysis (LPBC: OR 2.7, p = 0.003, strLy: OR 1.2, p = 0.01). The amount of intratumoral lymphocytes was significantly predictive for pCR in univariate (OR 1.2, p = 0.01) but not in multivariate logistic regression analysis (OR 1.2, p = 0.11). Confirming previous investigations of our group, we have prospectively validated in an independent cohort that an increased immunological infiltrate in breast tumor tissue is predictive for response to anthracycline/taxane-based NACT. Patients with LPBC and increased stromal lymphocyte infiltration have significantly increased pCR rates. The lymphocytic infiltrate is a promising additional parameter for histopathological evaluation of breast cancer core biopsies.
Murray, James L; Hu, Peixu; Shafer, David A
2014-11-01
We have developed novel probe systems for real-time PCR that provide higher specificity, greater sensitivity, and lower cost relative to dual-labeled probes. The seven DNA Detection Switch (DDS)-probe systems reported here employ two interacting polynucleotide components: a fluorescently labeled probe and a quencher antiprobe. High-fidelity detection is achieved with three DDS designs: two internal probes (internal DDS and Flip probes) and a primer probe (ZIPR probe), wherein each probe is combined with a carefully engineered, slightly mismatched, error-checking antiprobe. The antiprobe blocks off-target detection over a wide range of temperatures and facilitates multiplexing. Other designs (Universal probe, Half-Universal probe, and MacMan probe) use generic components that enable low-cost detection. Finally, single-molecule G-Force probes employ guanine-mediated fluorescent quenching by forming a hairpin between adjacent C-rich and G-rich sequences. Examples provided show how these probe technologies discriminate drug-resistant Mycobacterium tuberculosis mutants, Escherichia coli O157:H7, oncogenic EGFR deletion mutations, hepatitis B virus, influenza A/B strains, and single-nucleotide polymorphisms in the human VKORC1 gene. Copyright © 2014 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.
USDA-ARS?s Scientific Manuscript database
Cylindrocarpon species are known to be a component of the pathogen/pest complex that incites apple replant disease. In South Africa, no information is available on apple associated Cylindrocarpon species and their pathogenicity. Therefore, these aspects were investigated. Additionally, a genus speci...
Plant, soil, and shadow reflectance components of row crops
NASA Technical Reports Server (NTRS)
Richardson, A. J.; Wiegand, C. L.; Gausman, H. W.; Cuellar, J. A.; Gerbermann, A. H.
1975-01-01
Data from the first Earth Resource Technology Satellite (LANDSAT-1) multispectral scanner (MSS) were used to develop three plant canopy models (Kubelka-Munk (K-M), regression, and combined K-M and regression models) for extracting plant, soil, and shadow reflectance components of cropped fields. The combined model gave the best correlation between MSS data and ground truth, by accounting for essentially all of the reflectance of plants, soil, and shadow between crop rows. The principles presented can be used to better forecast crop yield and to estimate acreage.
Kwok, Sylvia Lai Yuk Ching; Shek, Daniel Tan Lei
2010-03-05
Utilizing Daniel Goleman's theory of emotional competence, Beck's cognitive theory, and Rudd's cognitive-behavioral theory of suicidality, the relationships between hopelessness (cognitive component), social problem solving (cognitive-behavioral component), emotional competence (emotive component), and adolescent suicidal ideation were examined. Based on the responses of 5,557 Secondary 1 to Secondary 4 students from 42 secondary schools in Hong Kong, results showed that suicidal ideation was positively related to adolescent hopelessness, but negatively related to emotional competence and social problem solving. While standard regression analyses showed that all the above variables were significant predictors of suicidal ideation, hierarchical regression analyses showed that hopelessness was the most important predictor of suicidal ideation, followed by social problem solving and emotional competence. Further regression analyses found that all four subscales of emotional competence, i.e., empathy, social skills, self-management of emotions, and utilization of emotions, were important predictors of male adolescent suicidal ideation. However, the subscale of social skills was not a significant predictor of female adolescent suicidal ideation. Standard regression analysis also revealed that all three subscales of social problem solving, i.e., negative problem orientation, rational problem solving, and impulsiveness/carelessness style, were important predictors of suicidal ideation. Theoretical and practice implications of the findings are discussed.
C-Based Design Methodology and Topological Change for an Indian Agricultural Tractor Component
NASA Astrophysics Data System (ADS)
Matta, Anil Kumar; Raju, D. Ranga; Suman, K. N. S.; Kranthi, A. S.
2018-06-01
The failure of tractor components and their replacement has now become very common in India because of re-cycling, re-sale, and duplication. To over come the problem of failure we propose a design methodology for topological change co-simulating with software's. In the proposed Design methodology, the designer checks Paxial, Pcr, Pfailue, τ by hand calculations, from which refined topological changes of R.S.Arm are formed. We explained several techniques employed in the component for reduction, removal of rib material to change center of gravity and centroid point by using system C for mixed level simulation and faster topological changes. The design process in system C can be compiled and executed with software, TURBO C7. The modified component is developed in proE and analyzed in ANSYS. The topologically changed component with slot 120 × 4.75 × 32.5 mm at the center showed greater effectiveness than the original component.
C-Based Design Methodology and Topological Change for an Indian Agricultural Tractor Component
NASA Astrophysics Data System (ADS)
Matta, Anil Kumar; Raju, D. Ranga; Suman, K. N. S.; Kranthi, A. S.
2018-02-01
The failure of tractor components and their replacement has now become very common in India because of re-cycling, re-sale, and duplication. To over come the problem of failure we propose a design methodology for topological change co-simulating with software's. In the proposed Design methodology, the designer checks Paxial, Pcr, Pfailue, τ by hand calculations, from which refined topological changes of R.S.Arm are formed. We explained several techniques employed in the component for reduction, removal of rib material to change center of gravity and centroid point by using system C for mixed level simulation and faster topological changes. The design process in system C can be compiled and executed with software, TURBO C7. The modified component is developed in proE and analyzed in ANSYS. The topologically changed component with slot 120 × 4.75 × 32.5 mm at the center showed greater effectiveness than the original component.
Raphael, Jacques; Gandhi, Sonal; Li, Nim; Lu, Fang-I; Trudeau, Maureen
2017-07-01
Estrogen receptor (ER) negative (-) breast cancer (BC) patients have better tumor response rates than ER-positive (+) patients after neoadjuvant chemotherapy (NCT). We conducted a retrospective review using the institutional database "Biomatrix" to assess the value of quantitative ER status in predicting tumor response at surgery and to identify potential predictors of survival outcomes. Univariate followed by multivariable regression analyses were conducted to assess the association between quantitative ER and tumor response assessed as tumor size reduction and pathologic complete response (pCR). Predictors of recurrence-free survival (RFS) were identified using a cox proportional hazards model (CPH). A log-rank test was used to compare RFS between groups if a significant predictor was identified. 304 patients were included with a median follow-up of 43.3 months (Q1-Q3 28.7-61.1) and a mean age of 49.7 years (SD 10.9). Quantitative ER was inversely associated with tumor size reduction and pCR (OR 0.99, 95% CI 0.99-1.00, p = 0.027 and 0.98 95% CI 0.97-0.99, p < 0.0001, respectively). A cut-off of 60 and 80% predicted best the association with tumor size reduction and pCR, respectively. pCR was shown to be an independent predictor of RFS (HR 0.17, 95% CI 0.07-0.43, p = 0.0002) in all patients. At 5 years, 93% of patients with pCR and 72% of patients with residual tumor were recurrence-free, respectively (p = 0.0012). Quantitative ER status is inversely associated with tumor response in BC patients treated with NCT. A cut-off of 60 and 80% predicts best the association with tumor size reduction and pCR, respectively. Therefore, patients with an ER status higher than the cut-off might benefit from a neoadjuvant endocrine therapy approach. Patients with pCR had better survival outcomes independently of their tumor phenotype. Further prospective studies are needed to validate the clinical utility of quantitative ER as a predictive marker of tumor response.
Yadav, Reena; Paria, Anutosh; Mankame, Smruti; Makesh, M; Chaudhari, Aparna; Rajendran, K V
2015-12-01
Hepatopancreatic parvovirus (HPV) infects Penaeus monodon and causes mortality in the larval stages. Further, it has been implicated in the growth retardation in cultured P. monodon. Though different geographical isolates of HPV show large sequence variations, a sensitive PCR assay specific to Indian isolate has not yet been reported. Here, we developed a sensitive SYBR Green-based and TaqMan real-time PCR for the detection and quantification of the virus. A 441-bp PCR amplicon was cloned in pTZ57 R/T vector and the plasmid copy number was estimated. A 10-fold serial dilution of the plasmid DNA from 1 × 10(9) copies to 1 copy was prepared and used as the standard. The primers were tested initially using the standard on a conventional PCR format to determine the linearity of detection. The standards were further tested on real-time PCR format using SYBR Green and TaqMan chemistry and standard curves were generated based on the Ct values from three well replicates for each dilution. The assays were found to be sensitive, specific and reproducible with a wide dynamic range (1 × 10(9) to 10 copies) with coefficient of regression (R(2)) > 0.99, calculated average slope -3.196 for SYBR Green assay whereas, for TaqMan assay it was >0.99 and -3.367, respectively. The intra- and inter-assay variance of the Ct values ranged from 0.26% to 0.94% and 0.12% to 0.81%, respectively, for SYBR Green assay, and the inter-assay variance of the Ct values for TaqMan assay ranged from 0.07% to 1.93%. The specificity of the assays was proved by testing other DNA viruses of shrimp such as WSSV, IHHNV and MBV. Standardized assays were further tested to detect and quantify HPV in the post-larvae of P. monodon. The result was further compared with conventional PCR to test the reproducibility of the test. The assay was also used to screen Litopeneaus vannamei, Macrobrachium rosenbergii and Scylla serrata for HPV. Copyright © 2015 Elsevier Ltd. All rights reserved.
Nishio, Jun; Althof, Pamela A; Bailey, Jacqueline M; Zhou, Ming; Neff, James R; Barr, Frederic G; Parham, David M; Teot, Lisa; Qualman, Stephen J; Bridge, Julia A
2006-06-01
A valuable diagnostic adjunct and important prognostic parameter in alveolar rhabdomyosarcoma (ARMS) is the identification of translocations t(2;13)(q35;q14) and t(1;13)(p36;q14), and the associated PAX3-FKHR and PAX7-FKHR fusion transcripts, respectively. Most RMS fusion gene type studies have been based on reverse transcriptase-polymerase chain reaction (RT-PCR) detection of the fusion transcript, a technique limited by RNA quality and failure of devised primer sets to detect unusual variants. As an alternative approach, we developed a fluorescence in situ hybridization (FISH) assay that can: (1) distinguish between the two most common ARMS-associated fusion genes; (2) identify potential unusual variant translocations; (3) assess histologic components in mixed alveolar/embryonal RMS; and (4) be performed on paraffinized tissue. FISH analyses of 75 specimens (40 ARMS, 16 ERMS, 8 mixed ARMS/ERMS, and 11 non-RMS tumors) using selected cosmid clone, bacterial, P1-derived, and yeast artificial chromosome probe sets were successful in all but two cases. Among specimens with informative results for both FISH and RT-PCR or standard karyotyping, PAX/FKHR classification results were concordant in 94.6% (53/56). The three discordant cases included one exhibiting a t(2;13) by FISH that was subsequently confirmed by repeat RT-PCR, a second showing a rearrangement of the PAX3 locus only (consistent with the presence of a PAX3 variant translocation), and a third revealing a t(2;13) by FISH that lacked this translocation cytogenetically. Both alveolar and embryonal components of the mixed ARMS/ERMS subtype were negative for PAX3, PAX7, and FKHR rearrangements, a surprising finding confirmed by RT-PCR and/or conventional karyotyping. These data demonstrate that FISH with newly designed probe sets is a reliable and highly specific method of detecting t(1;13) and t(2;13) in routinely processed tissue and may be useful in differentiating ARMS from other small round cell tumors. The findings also suggest that FISH may be a more sensitive assay than RT-PCR in some settings, capable of revealing variant translocations.
Mohd Yusof, Mohd Yusmiaidil Putera; Cauwels, Rita; Deschepper, Ellen; Martens, Luc
2015-08-01
The third molar development (TMD) has been widely utilized as one of the radiographic method for dental age estimation. By using the same radiograph of the same individual, third molar eruption (TME) information can be incorporated to the TMD regression model. This study aims to evaluate the performance of dental age estimation in individual method models and the combined model (TMD and TME) based on the classic regressions of multiple linear and principal component analysis. A sample of 705 digital panoramic radiographs of Malay sub-adults aged between 14.1 and 23.8 years was collected. The techniques described by Gleiser and Hunt (modified by Kohler) and Olze were employed to stage the TMD and TME, respectively. The data was divided to develop three respective models based on the two regressions of multiple linear and principal component analysis. The trained models were then validated on the test sample and the accuracy of age prediction was compared between each model. The coefficient of determination (R²) and root mean square error (RMSE) were calculated. In both genders, adjusted R² yielded an increment in the linear regressions of combined model as compared to the individual models. The overall decrease in RMSE was detected in combined model as compared to TMD (0.03-0.06) and TME (0.2-0.8). In principal component regression, low value of adjusted R(2) and high RMSE except in male were exhibited in combined model. Dental age estimation is better predicted using combined model in multiple linear regression models. Copyright © 2015 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.
Helfer-Hungerbuehler, A Katrin; Widmer, Stefan; Kessler, Yvonne; Riond, Barbara; Boretti, Felicitas S; Grest, Paula; Lutz, Hans; Hofmann-Lehmann, Regina
2015-02-02
It is a remarkable feature for a retrovirus that an infection with feline leukemia virus (FeLV) can result in various outcomes. Whereas some cats contain the infection and show a regressive course, others stay viremic and succumb to the infection within a few years. We hypothesized, that differences in the infection outcome might be causally linked to the viral RNA and provirus loads within the host and these loads therefore may give additional insight into the pathogenesis of the virus. Thus, the goals of the present study were to follow-up on experimentally infected cats and investigate tissues from cats with different infection outcomes using sensitive, specific TaqMan real-time PCR and reverse transcriptase (RT)-PCR. Nineteen experimentally FeLV-A/Glasgow-1-infected cats were categorized into having regressive, progressive or reactivated FeLV infection according to follow-up of FeLV p27 antigen detection in the blood. Remarkably, regressively infected cats showed detectable provirus and viral RNA loads in almost all of the 27 tested tissues, even many years after virus exposure. Moreover, some regressively infected cats reactivated the infection, and these cats had intermediate to high viral RNA and provirus tissue loads. The highest loads were found in viremic cats, independent of their health status. Tissues that represented sites of virus replication and shedding revealed the highest viral RNA and provirus loads, while the lowest loads were present in muscle and nerve tissues. A supplementary analysis of 20 experimentally infected cats with progressive infection revealed a median survival time of 3.1 years (range from 0.6 to 6.5 years); ∼70% (n=14) of these cats developed lymphoma, while leukemia and non-regenerative anemia were observed less frequently. Our results demonstrate that the different infection outcomes are associated with differences in viral RNA and provirus tissue loads. Remarkably, no complete clearance of FeLV viral RNA or provirus was detected in cats with regressive infection, even up to 12 years after exposure. In several cases FeLV reactivation could be observed. Thus, retroviruses integrated as provirus into the host's genome, could not be eliminated completely by the host and maintained their full potential for replication and reactivation. Copyright © 2014 Elsevier B.V. All rights reserved.
Normalised quantitative polymerase chain reaction for diagnosis of tuberculosis-associated uveitis.
Barik, Manas Ranjan; Rath, Soveeta; Modi, Rohit; Rana, Rajkishori; Reddy, Mamatha M; Basu, Soumyava
2018-05-01
Polymerase chain reaction (PCR)-based diagnosis of tuberculosis-associated uveitis (TBU) in TB-endemic countries is challenging due to likelihood of latent mycobacterial infection in both immune and non-immune cells. In this study, we investigated normalised quantitative PCR (nqPCR) in ocular fluids (aqueous/vitreous) for diagnosis of TBU in a TB-endemic population. Mycobacterial copy numbers (mpb64 gene) were normalised to host genome copy numbers (RNAse P RNA component H1 [RPPH1] gene) in TBU (n = 16) and control (n = 13) samples (discovery cohort). The mpb64:RPPH1 ratios (normalised value) from each TBU and control sample were tested against the current reference standard i.e. clinically-diagnosed TBU, to generate Receiver Operating Characteristic (ROC) curves. The optimum cut-off value of mpb64:RPPH1 ratio (0.011) for diagnosing TBU was identified from the highest Youden index. This cut-off value was then tested in a different cohort of TBU and controls (validation cohort, 20 cases and 18 controls), where it yielded specificity, sensitivity and diagnostic accuracy of 94.4%, 85.0%, and 89.4% respectively. The above values for conventional quantitative PCR (≥1 copy of mpb64 per reaction) were 61.1%, 90.0%, and 74.3% respectively. Normalisation markedly improved the specificity and diagnostic accuracy of quantitative PCR for diagnosis of TBU. Copyright © 2018 Elsevier Ltd. All rights reserved.
Dash, Paban Kumar; Boutonnier, Alain; Prina, Eric; Sharma, Shashi; Reiter, Paul
2012-01-22
Yellow Fever virus (YFV) is an important arboviral pathogen in much of sub-Saharan Africa and the tropical Americas. It is the prototype member of the genus Flavivirus and is transmitted primarily by Aedes (Stegomyia) mosquitoes. The incidence of human infections in endemic areas has risen in recent years. Prompt and dependable identification of YFV is a critical component of response to suspect cases. We developed a one-step SYBR Green I-based real-time quantitative RT-PCR (qRT-PCR) assay targeting the 5'NTR and capsid-gene junction--for rapid detection and quantification of YFV. The detection limit was 1 PFU/mL, 10-fold more sensitive than conventional RT-PCR, and there was no cross-reactivity with closely related flaviviruses or with alphaviruses. Viral load in samples was determined by standard curve plotted from cycle threshold (Ct) values and virus concentration. The efficacy of the assay in mosquitoes was assessed with spiked samples. The utility of the assay for screening of pooled mosquitoes was also confirmed. Replication of a Cameroon isolate of YFV in Ae. aegypti revealed a marked variation in susceptibility among different colonies at different days post infection (pi). The SYBR Green-1 based qRT-PCR assay is a faster, simpler, more sensitive and less expensive procedure for detection and quantification of YFV than other currently used methods.
Xian, George Z.; Homer, Collin G.; Rigge, Matthew B.; Shi, Hua; Meyer, Debbie
2015-01-01
Accurate and consistent estimates of shrubland ecosystem components are crucial to a better understanding of ecosystem conditions in arid and semiarid lands. An innovative approach was developed by integrating multiple sources of information to quantify shrubland components as continuous field products within the National Land Cover Database (NLCD). The approach consists of several procedures including field sample collections, high-resolution mapping of shrubland components using WorldView-2 imagery and regression tree models, Landsat 8 radiometric balancing and phenological mosaicking, medium resolution estimates of shrubland components following different climate zones using Landsat 8 phenological mosaics and regression tree models, and product validation. Fractional covers of nine shrubland components were estimated: annual herbaceous, bare ground, big sagebrush, herbaceous, litter, sagebrush, shrub, sagebrush height, and shrub height. Our study area included the footprint of six Landsat 8 scenes in the northwestern United States. Results show that most components have relatively significant correlations with validation data, have small normalized root mean square errors, and correspond well with expected ecological gradients. While some uncertainties remain with height estimates, the model formulated in this study provides a cross-validated, unbiased, and cost effective approach to quantify shrubland components at a regional scale and advances knowledge of horizontal and vertical variability of these components.
Least Principal Components Analysis (LPCA): An Alternative to Regression Analysis.
ERIC Educational Resources Information Center
Olson, Jeffery E.
Often, all of the variables in a model are latent, random, or subject to measurement error, or there is not an obvious dependent variable. When any of these conditions exist, an appropriate method for estimating the linear relationships among the variables is Least Principal Components Analysis. Least Principal Components are robust, consistent,…
Antimicrobial peptide gene expression in periodontitis patients: A pilot study.
Jourdain, Marie-Laure; Pierrard, Loïc; Kanagaratnam, Lukshe; Velard, Frédéric; Sergheraert, Johan; Lefèvre, Benoît; Gangloff, Sophie C; Braux, Julien
2018-05-01
Antimicrobial peptides (AMPs) are one of the most active components of innate immunity and have characteristics that could place them at the heart of the pathogenesis of periodontal disease. This study investigated differences in the expression of AMP coding genes obtained using a simple harvesting technique, gingival smear, between two groups of patients: chronic periodontitis subjects versus healthy ones. Twenty-three patients were enrolled in two groups: 12 were diagnosed with moderate or severe generalized chronic periodontitis, and 11 were diagnosed as clinically healthy. Gingival smears were retrieved and studied using reverse transcription-quantitative PCR (RT-qPCR) after mRNA purification. Fifteen gene expressions were obtained using real-time RT-qPCR. Three AMP genes, histatin 3 (HTN3), α-defensin 4 (DEFA4) and lysozyme C (LYZ), presented different expression levels in periodontitis patients compared with healthy subjects. The relative expression level of DEFA4 appeared to be a protective factor against periodontitis. Gingival smears studied by RT-qPCR may be used to assess the expression of AMPs coding genes. A lack of expression of DEFA4 could be a potential indicator of periodontitis status. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Selection of suitable endogenous reference genes for relative copy number detection in sugarcane.
Xue, Bantong; Guo, Jinlong; Que, Youxiong; Fu, Zhiwei; Wu, Luguang; Xu, Liping
2014-05-19
Transgene copy number has a great impact on the expression level and stability of exogenous gene in transgenic plants. Proper selection of endogenous reference genes is necessary for detection of genetic components in genetically modification (GM) crops by quantitative real-time PCR (qPCR) or by qualitative PCR approach, especially in sugarcane with polyploid and aneuploid genomic structure. qPCR technique has been widely accepted as an accurate, time-saving method on determination of copy numbers in transgenic plants and on detection of genetically modified plants to meet the regulatory and legislative requirement. In this study, to find a suitable endogenous reference gene and its real-time PCR assay for sugarcane (Saccharum spp. hybrids) DNA content quantification, we evaluated a set of potential "single copy" genes including P4H, APRT, ENOL, CYC, TST and PRR, through qualitative PCR and absolute quantitative PCR. Based on copy number comparisons among different sugarcane genotypes, including five S. officinarum, one S. spontaneum and two S. spp. hybrids, these endogenous genes fell into three groups: ENOL-3--high copy number group, TST-1 and PRR-1--medium copy number group, P4H-1, APRT-2 and CYC-2--low copy number group. Among these tested genes, P4H, APRT and CYC were the most stable, while ENOL and TST were the least stable across different sugarcane genotypes. Therefore, three primer pairs of P4H-3, APRT-2 and CYC-2 were then selected as the suitable reference gene primer pairs for sugarcane. The test of multi-target reference genes revealed that the APRT gene was a specific amplicon, suggesting this gene is the most suitable to be used as an endogenous reference target for sugarcane DNA content quantification. These results should be helpful for establishing accurate and reliable qualitative and quantitative PCR analysis of GM sugarcane.
Assessment of Weighted Quantile Sum Regression for Modeling Chemical Mixtures and Cancer Risk
Czarnota, Jenna; Gennings, Chris; Wheeler, David C
2015-01-01
In evaluation of cancer risk related to environmental chemical exposures, the effect of many chemicals on disease is ultimately of interest. However, because of potentially strong correlations among chemicals that occur together, traditional regression methods suffer from collinearity effects, including regression coefficient sign reversal and variance inflation. In addition, penalized regression methods designed to remediate collinearity may have limitations in selecting the truly bad actors among many correlated components. The recently proposed method of weighted quantile sum (WQS) regression attempts to overcome these problems by estimating a body burden index, which identifies important chemicals in a mixture of correlated environmental chemicals. Our focus was on assessing through simulation studies the accuracy of WQS regression in detecting subsets of chemicals associated with health outcomes (binary and continuous) in site-specific analyses and in non-site-specific analyses. We also evaluated the performance of the penalized regression methods of lasso, adaptive lasso, and elastic net in correctly classifying chemicals as bad actors or unrelated to the outcome. We based the simulation study on data from the National Cancer Institute Surveillance Epidemiology and End Results Program (NCI-SEER) case–control study of non-Hodgkin lymphoma (NHL) to achieve realistic exposure situations. Our results showed that WQS regression had good sensitivity and specificity across a variety of conditions considered in this study. The shrinkage methods had a tendency to incorrectly identify a large number of components, especially in the case of strong association with the outcome. PMID:26005323
Assessment of weighted quantile sum regression for modeling chemical mixtures and cancer risk.
Czarnota, Jenna; Gennings, Chris; Wheeler, David C
2015-01-01
In evaluation of cancer risk related to environmental chemical exposures, the effect of many chemicals on disease is ultimately of interest. However, because of potentially strong correlations among chemicals that occur together, traditional regression methods suffer from collinearity effects, including regression coefficient sign reversal and variance inflation. In addition, penalized regression methods designed to remediate collinearity may have limitations in selecting the truly bad actors among many correlated components. The recently proposed method of weighted quantile sum (WQS) regression attempts to overcome these problems by estimating a body burden index, which identifies important chemicals in a mixture of correlated environmental chemicals. Our focus was on assessing through simulation studies the accuracy of WQS regression in detecting subsets of chemicals associated with health outcomes (binary and continuous) in site-specific analyses and in non-site-specific analyses. We also evaluated the performance of the penalized regression methods of lasso, adaptive lasso, and elastic net in correctly classifying chemicals as bad actors or unrelated to the outcome. We based the simulation study on data from the National Cancer Institute Surveillance Epidemiology and End Results Program (NCI-SEER) case-control study of non-Hodgkin lymphoma (NHL) to achieve realistic exposure situations. Our results showed that WQS regression had good sensitivity and specificity across a variety of conditions considered in this study. The shrinkage methods had a tendency to incorrectly identify a large number of components, especially in the case of strong association with the outcome.
Azevedo, C F; Nascimento, M; Silva, F F; Resende, M D V; Lopes, P S; Guimarães, S E F; Glória, L S
2015-10-09
A significant contribution of molecular genetics is the direct use of DNA information to identify genetically superior individuals. With this approach, genome-wide selection (GWS) can be used for this purpose. GWS consists of analyzing a large number of single nucleotide polymorphism markers widely distributed in the genome; however, because the number of markers is much larger than the number of genotyped individuals, and such markers are highly correlated, special statistical methods are widely required. Among these methods, independent component regression, principal component regression, partial least squares, and partial principal components stand out. Thus, the aim of this study was to propose an application of the methods of dimensionality reduction to GWS of carcass traits in an F2 (Piau x commercial line) pig population. The results show similarities between the principal and the independent component methods and provided the most accurate genomic breeding estimates for most carcass traits in pigs.
Modeling Governance KB with CATPCA to Overcome Multicollinearity in the Logistic Regression
NASA Astrophysics Data System (ADS)
Khikmah, L.; Wijayanto, H.; Syafitri, U. D.
2017-04-01
The problem often encounters in logistic regression modeling are multicollinearity problems. Data that have multicollinearity between explanatory variables with the result in the estimation of parameters to be bias. Besides, the multicollinearity will result in error in the classification. In general, to overcome multicollinearity in regression used stepwise regression. They are also another method to overcome multicollinearity which involves all variable for prediction. That is Principal Component Analysis (PCA). However, classical PCA in only for numeric data. Its data are categorical, one method to solve the problems is Categorical Principal Component Analysis (CATPCA). Data were used in this research were a part of data Demographic and Population Survey Indonesia (IDHS) 2012. This research focuses on the characteristic of women of using the contraceptive methods. Classification results evaluated using Area Under Curve (AUC) values. The higher the AUC value, the better. Based on AUC values, the classification of the contraceptive method using stepwise method (58.66%) is better than the logistic regression model (57.39%) and CATPCA (57.39%). Evaluation of the results of logistic regression using sensitivity, shows the opposite where CATPCA method (99.79%) is better than logistic regression method (92.43%) and stepwise (92.05%). Therefore in this study focuses on major class classification (using a contraceptive method), then the selected model is CATPCA because it can raise the level of the major class model accuracy.
He, Y J; Li, X T; Fan, Z Q; Li, Y L; Cao, K; Sun, Y S; Ouyang, T
2018-01-23
Objective: To construct a dynamic enhanced MR based predictive model for early assessing pathological complete response (pCR) to neoadjuvant therapy in breast cancer, and to evaluate the clinical benefit of the model by using decision curve. Methods: From December 2005 to December 2007, 170 patients with breast cancer treated with neoadjuvant therapy were identified and their MR images before neoadjuvant therapy and at the end of the first cycle of neoadjuvant therapy were collected. Logistic regression model was used to detect independent factors for predicting pCR and construct the predictive model accordingly, then receiver operating characteristic (ROC) curve and decision curve were used to evaluate the predictive model. Results: ΔArea(max) and Δslope(max) were independent predictive factors for pCR, OR =0.942 (95% CI : 0.918-0.967) and 0.961 (95% CI : 0.940-0.987), respectively. The area under ROC curve (AUC) for the constructed model was 0.886 (95% CI : 0.820-0.951). Decision curve showed that in the range of the threshold probability above 0.4, the predictive model presented increased net benefit as the threshold probability increased. Conclusions: The constructed predictive model for pCR is of potential clinical value, with an AUC>0.85. Meanwhile, decision curve analysis indicates the constructed predictive model has net benefit from 3 to 8 percent in the likely range of probability threshold from 80% to 90%.
Accurate and predictive antibody repertoire profiling by molecular amplification fingerprinting.
Khan, Tarik A; Friedensohn, Simon; Gorter de Vries, Arthur R; Straszewski, Jakub; Ruscheweyh, Hans-Joachim; Reddy, Sai T
2016-03-01
High-throughput antibody repertoire sequencing (Ig-seq) provides quantitative molecular information on humoral immunity. However, Ig-seq is compromised by biases and errors introduced during library preparation and sequencing. By using synthetic antibody spike-in genes, we determined that primer bias from multiplex polymerase chain reaction (PCR) library preparation resulted in antibody frequencies with only 42 to 62% accuracy. Additionally, Ig-seq errors resulted in antibody diversity measurements being overestimated by up to 5000-fold. To rectify this, we developed molecular amplification fingerprinting (MAF), which uses unique molecular identifier (UID) tagging before and during multiplex PCR amplification, which enabled tagging of transcripts while accounting for PCR efficiency. Combined with a bioinformatic pipeline, MAF bias correction led to measurements of antibody frequencies with up to 99% accuracy. We also used MAF to correct PCR and sequencing errors, resulting in enhanced accuracy of full-length antibody diversity measurements, achieving 98 to 100% error correction. Using murine MAF-corrected data, we established a quantitative metric of recent clonal expansion-the intraclonal diversity index-which measures the number of unique transcripts associated with an antibody clone. We used this intraclonal diversity index along with antibody frequencies and somatic hypermutation to build a logistic regression model for prediction of the immunological status of clones. The model was able to predict clonal status with high confidence but only when using MAF error and bias corrected Ig-seq data. Improved accuracy by MAF provides the potential to greatly advance Ig-seq and its utility in immunology and biotechnology.
Zhu, Yi; Zhang, Jing-jing; Zhu, Rong; Zhu, Yan; Liang, Wen-biao; Gao, Wen-tao; Yu, Jun-bo; Xu, Ze-kuan; Miao, Yi
2011-12-01
The MUC4 gene could have a key role in the progression of pancreatic cancer, but the quantitative measurement of its expression in clinical tissue samples remains a challenge. The correlations between MUC4 promoter methylation status in vivo and either pancreatic cancer progression or MUC4 mRNA expression need to be demonstrated. We used the techniques of quantitative real-time PCR and DNA methylation-specific PCR combined microdissection to precisely detect MUC4 expression and promoter methylation status in 116 microdissected foci from 57 patients with pancreatic ductal adenocarcinoma. Both mRNA expression and hypomethylation frequency increased from normal to precancerous lesions to pancreatic cancer. Multivariate Cox regression analysis showed that high-level MUC4 expression (P = 0.008) and tumor-node-metastasis staging (P = 0.038) were significant independent risk factors for predicting the prognosis of 57 patients. The MUC4 mRNA expression was not significantly correlated with promoter methylation status in 30 foci of pancreatic ductal adenocarcinoma. These results suggest that high mRNA expression and hypomethylation of the MUC4 gene could be involved in carcinogenesis and in the malignant development of pancreatic ductal adenocarcinoma. The MUC4 mRNA expression may become a new prognostic marker for pancreatic cancer. Microdissection-based quantitative real-time PCR and methylation-specific PCR contribute to the quantitative detection of MUC4 expression in clinical samples and reflect the epigenetic regulatory mechanisms of MUC4 in vivo.
Accurate and predictive antibody repertoire profiling by molecular amplification fingerprinting
Khan, Tarik A.; Friedensohn, Simon; de Vries, Arthur R. Gorter; Straszewski, Jakub; Ruscheweyh, Hans-Joachim; Reddy, Sai T.
2016-01-01
High-throughput antibody repertoire sequencing (Ig-seq) provides quantitative molecular information on humoral immunity. However, Ig-seq is compromised by biases and errors introduced during library preparation and sequencing. By using synthetic antibody spike-in genes, we determined that primer bias from multiplex polymerase chain reaction (PCR) library preparation resulted in antibody frequencies with only 42 to 62% accuracy. Additionally, Ig-seq errors resulted in antibody diversity measurements being overestimated by up to 5000-fold. To rectify this, we developed molecular amplification fingerprinting (MAF), which uses unique molecular identifier (UID) tagging before and during multiplex PCR amplification, which enabled tagging of transcripts while accounting for PCR efficiency. Combined with a bioinformatic pipeline, MAF bias correction led to measurements of antibody frequencies with up to 99% accuracy. We also used MAF to correct PCR and sequencing errors, resulting in enhanced accuracy of full-length antibody diversity measurements, achieving 98 to 100% error correction. Using murine MAF-corrected data, we established a quantitative metric of recent clonal expansion—the intraclonal diversity index—which measures the number of unique transcripts associated with an antibody clone. We used this intraclonal diversity index along with antibody frequencies and somatic hypermutation to build a logistic regression model for prediction of the immunological status of clones. The model was able to predict clonal status with high confidence but only when using MAF error and bias corrected Ig-seq data. Improved accuracy by MAF provides the potential to greatly advance Ig-seq and its utility in immunology and biotechnology. PMID:26998518
An Excel Solver Exercise to Introduce Nonlinear Regression
ERIC Educational Resources Information Center
Pinder, Jonathan P.
2013-01-01
Business students taking business analytics courses that have significant predictive modeling components, such as marketing research, data mining, forecasting, and advanced financial modeling, are introduced to nonlinear regression using application software that is a "black box" to the students. Thus, although correct models are…
Oil and gas pipeline construction cost analysis and developing regression models for cost estimation
NASA Astrophysics Data System (ADS)
Thaduri, Ravi Kiran
In this study, cost data for 180 pipelines and 136 compressor stations have been analyzed. On the basis of the distribution analysis, regression models have been developed. Material, Labor, ROW and miscellaneous costs make up the total cost of a pipeline construction. The pipelines are analyzed based on different pipeline lengths, diameter, location, pipeline volume and year of completion. In a pipeline construction, labor costs dominate the total costs with a share of about 40%. Multiple non-linear regression models are developed to estimate the component costs of pipelines for various cross-sectional areas, lengths and locations. The Compressor stations are analyzed based on the capacity, year of completion and location. Unlike the pipeline costs, material costs dominate the total costs in the construction of compressor station, with an average share of about 50.6%. Land costs have very little influence on the total costs. Similar regression models are developed to estimate the component costs of compressor station for various capacities and locations.
Shi, J Q; Wang, B; Will, E J; West, R M
2012-11-20
We propose a new semiparametric model for functional regression analysis, combining a parametric mixed-effects model with a nonparametric Gaussian process regression model, namely a mixed-effects Gaussian process functional regression model. The parametric component can provide explanatory information between the response and the covariates, whereas the nonparametric component can add nonlinearity. We can model the mean and covariance structures simultaneously, combining the information borrowed from other subjects with the information collected from each individual subject. We apply the model to dose-response curves that describe changes in the responses of subjects for differing levels of the dose of a drug or agent and have a wide application in many areas. We illustrate the method for the management of renal anaemia. An individual dose-response curve is improved when more information is included by this mechanism from the subject/patient over time, enabling a patient-specific treatment regime. Copyright © 2012 John Wiley & Sons, Ltd.
Shi, W; Jiang, T; Nuciforo, P; Hatzis, C; Holmes, E; Harbeck, N; Sotiriou, C; Peña, L; Loi, S; Rosa, D D; Chia, S; Wardley, A; Ueno, T; Rossari, J; Eidtmann, H; Armour, A; Piccart-Gebhart, M; Rimm, D L; Baselga, J; Pusztai, L
2017-01-01
We performed whole-exome sequencing of pretreatment biopsies and examined whether genome-wide metrics of overall mutational load, clonal heterogeneity or alterations at variant, gene, and pathway levels are associated with treatment response and survival. Two hundred and three biopsies from the NeoALTTO trial were analyzed. Mutations were called with MuTect, and Strelka, using pooled normal DNA. Associations between DNA alterations and outcome were evaluated by logistic and Cox-proportional hazards regression. There were no recurrent single gene mutations significantly associated with pathologic complete response (pCR), except PIK3CA [odds ratio (OR) = 0.42, P = 0.0185]. Mutations in 33 of 714 pathways were significantly associated with response, but different genes were affected in different individuals. PIK3CA was present in 23 of these pathways defining a ‘trastuzumab resistance-network’ of 459 genes. Cases with mutations in this network had low pCR rates to trastuzumab (2/50, 4%) compared with cases with no mutations (9/16, 56%), OR = 0.035; P < 0.001. Mutations in the ‘Regulation of RhoA activity’ pathway were associated with higher pCR rate to lapatinib (OR = 14.8, adjusted P = 0.001), lapatinib + trastuzumab (OR = 3.0, adjusted P = 0.09), and all arms combined (OR = 3.77, adjusted P = 0.02). Patients (n = 124) with mutations in the trastuzumab resistance network but intact RhoA pathway had 2% (1/41) pCR rate with trastuzumab alone (OR = 0.026, P = 0.001) but adding lapatinib increased pCR rate to 45% (17/38, OR = 1.68, P = 0.3). Patients (n = 46) who had no mutations in either gene set had 6% pCR rate (1/15) with lapatinib, but had the highest pCR rate, 52% (8/15) with trastuzumab alone. Mutations in the RhoA pathway are associated with pCR to lapatinib and mutations in a PIK3CA-related network are associated with resistance to trastuzumab. The combined mutation status of these two pathways could define patients with very low response rate to trastuzumab alone that can be augmented by adding lapatinib or substituting trastuzumab with lapatinib.
Campos, Maria Doroteia; Valadas, Vera; Campos, Catarina; Morello, Laura; Braglia, Luca; Breviario, Diego; Cardoso, Hélia G
2018-01-01
Traceability of processed food and feed products has been gaining importance due to the impact that those products can have on human/animal health and to the associated economic and legal concerns, often related to adulterations and frauds as it can be the case for meat and milk. Despite mandatory traceability requirements for the analysis of feed composition, few reliable and accurate methods are presently available to enforce the legislative frame and allow the authentication of animal feeds. In this study, nine sensitive and species-specific real-time PCR TaqMan MGB assays are described for plant species detection in animal feed samples. The method is based on selective real-time qPCR (RT-qPCR) amplification of target genes belonging to the alternative oxidase (AOX) gene family. The plant species selected for detection in feed samples were wheat, maize, barley, soybean, rice and sunflower as common components of feeds, and cotton, flax and peanut as possible undesirable contaminants. The obtained results were compared with end-point PCR methodology. The applicability of the AOX TaqMan assays was evaluated through the screening of commercial feed samples, and by the analysis of plant mixtures with known composition. The RT-qPCR methodology allowed the detection of the most abundant species in feeds but also the identification of contaminant species present in lower amounts, down to 1% w/w. AOX-based methodology provides a suitable molecular marker approach to ascertain plant species composition of animal feed samples, thus supporting feed control and enforcement of the feed sector and animal production.
He, Qingfang; Fan, Chunhong; Yu, Min; Wallar, Gina; Zhang, Zuo-Feng; Wang, Lixin; Zhang, Xinwei; Hu, Ruying
2013-01-01
Background The present study was designed to explore the association of angiotensin converting enzyme (ACE) gene insertion/deletion (I/D, rs4646994) polymorphism, plasma ACE activity, and circulating ACE mRNA expression with essential hypertension (EH) in a Chinese population. In addition, a new detection method for circulating ACE mRNA expression was explored. Methods The research was approved by the ethics committee of Zhejiang Provincial Center for Disease Prevention and Control. Written informed consent was obtained prior to the investigation. 221 hypertensives (cases) and 221 normotensives (controls) were interviewed, subjected to a physical examination, and provided blood for biochemical and genetic tests. The ACE mRNA expression was analyzed by real time fluorescent quantitative Reverse Transcription PCR (FQ-RT-PCR). We performed logistic regression to assess associations of ACE I/D genotypes, ACE activity, and ACE mRNA expression levels with hypertension. Results The results of the multivariate logistic regression analysis showed that the additive model (ID, DD versus II) of the ACE genotype revealed an association with hypertension with adjusted OR of 1.43(95% CI: 1.04-1.97), and ACE ID genotype with adjusted OR of 1.72(95% CI: 1.01-2.92), DD genotype with adjusted OR of 1.94(95% CI: 1.01-3.73), respectively. In addition, our data also indicate that plasma ACE activity (adjusted OR was 1.13(95% CI: 1.08-1.18)) was significantly related to hypertension. However, the plasma ACE mRNA expressions were not different between the cases and controls. Conclusion ACE I/D polymorphism and ACE activity revealed significant influence on hypertension, while circulating ACE mRNA expression was not important factors associated with hypertension in this Chinese population. The detection of circulating ACE mRNA expression by FQ-RT-PCR might be a useful method for early screening and monitoring of EH. PMID:24098401
NASA Astrophysics Data System (ADS)
Sumantari, Y. D.; Slamet, I.; Sugiyanto
2017-06-01
Semiparametric regression is a statistical analysis method that consists of parametric and nonparametric regression. There are various approach techniques in nonparametric regression. One of the approach techniques is spline. Central Java is one of the most densely populated province in Indonesia. Population density in this province can be modeled by semiparametric regression because it consists of parametric and nonparametric component. Therefore, the purpose of this paper is to determine the factors that in uence population density in Central Java using the semiparametric spline regression model. The result shows that the factors which in uence population density in Central Java is Family Planning (FP) active participants and district minimum wage.
Attipa, Charalampos; Solano-Gallego, Laia; Papasouliotis, Kostas; Soutter, Francesca; Morris, David; Helps, Chris; Carver, Scott; Tasker, Séverine
2018-03-20
In the Mediterranean basin, Leishmania infantum is a major cause of disease in dogs, which are frequently co-infected with other vector-borne pathogens (VBP). However, the associations between dogs with clinical leishmaniosis (ClinL) and VBP co-infections have not been studied. We assessed the risk of VBP infections in dogs with ClinL and healthy controls. We conducted a prospective case-control study of dogs with ClinL (positive qPCR and ELISA antibody for L. infantum on peripheral blood) and clinically healthy, ideally breed-, sex- and age-matched, control dogs (negative qPCR and ELISA antibody for L. infantum on peripheral blood) from Paphos, Cyprus. We obtained demographic data and all dogs underwent PCR on EDTA-blood extracted DNA for haemoplasma species, Ehrlichia/Anaplasma spp., Babesia spp., and Hepatozoon spp., with DNA sequencing to identify infecting species. We used logistic regression analysis and structural equation modelling (SEM) to evaluate the risk of VBP infections between ClinL cases and controls. From the 50 enrolled dogs with ClinL, DNA was detected in 24 (48%) for Hepatozoon spp., 14 (28%) for Mycoplasma haemocanis, 6 (12%) for Ehrlichia canis and 2 (4%) for Anaplasma platys. In the 92 enrolled control dogs, DNA was detected in 41 (45%) for Hepatozoon spp., 18 (20%) for M. haemocanis, 1 (1%) for E. canis and 3 (3%) for A. platys. No Babesia spp. or "Candidatus Mycoplasma haematoparvum" DNA was detected in any dog. No statistical differences were found between the ClinL and controls regarding age, sex, breed, lifestyle and use of ectoparasitic prevention. A significant association between ClinL and E. canis infection (OR = 12.4, 95% CI: 1.5-106.0, P = 0.022) was found compared to controls by multivariate logistic regression. This association was confirmed using SEM, which further identified that younger dogs were more likely to be infected with each of Hepatozoon spp. and M. haemocanis, and dogs with Hepatozoon spp. were more likely to be co-infected with M. haemocanis. Dogs with ClinL are at a higher risk of co-infection with E. canis than clinically healthy dogs. We recommend that dogs diagnosed with ClinL should be tested for E. canis co-infection using PCR.
Wells, Greg D; Banks, Laura; Caterini, Jessica E; Thompson, Sara; Noseworthy, Michael D; Rayner, Tammy; Syme, Catriona; McCrindle, Brian W; Hamilton, Jill
2017-04-01
Obesity is associated with cardiometabolic disturbances, which may have significant implications for musculoskeletal health and exercise tolerance. We sought to determine the association between muscle structure, function, and metabolism in adolescents across the weight spectrum. This cross-sectional case-control study included overweight and obese participants (n = 24) 8-18 years of age with a body mass index (BMI) ≥ 85th percentile for age and gender, and non-obese participants (n = 24) with a BMI < 85 th percentile. Body composition, physical activity, peak aerobic capacity, cardiometabolic blood markers and insulin resistance (measured by the homeostatic model assessment of insulin resistance, HOMA-IR), skeletal muscle mitochondrial oxidative capacity (via 31 Phosphorous-Magnetic Resonance Spectroscopy, 31 P-MRS, to assess phosphocreatine (PCr) recovery after exercise), and extramyocellular and intramyocellular lipid (IMCL) levels (via 1 Hydrogen-MRS) were assessed. Stepwise regression was performed to examine the factors associated with oxidative capacity. bese and overweight patients had similar age, height, and physical activity to non-obese controls, but obese and overweight participants exhibited higher insulin resistance. Obese and overweight participants had longer PCr recovery than non-obese controls following 5x30s of moderate-intensity exercise (51.2 ± 20.1 s vs. 23.9 ± 7.5 s, p = 0.004). In univariate correlation analysis, impaired PCr recovery was associated with a higher BMI z-score (r s = 0.51, p < 0.001), circulating triglycerides (r s = 0.41, p = 0.005), and HOMA-IR (r s = 0.46, p = 0.001). In stepwise multivariate regression analysis, impaired PCr recovery was associated with a higher BMI z-score (β = 0.47, p = 0.002), but not insulin resistance (β = 0.07, p = 0.07) or circulating triglycerides (β = 0.16 p = 0.33). A slower phosphocreatine recovery following aerobic exercise is strongly associated with increasing adiposity. A slower metabolic recovery following aerobic exercise stress suggests that endurance exercise training in obese adolescents may be an optimal strategy to target exercise intolerance in this cohort. © 2016 World Obesity Federation.
Alahmad, Shoeb; Elfatatry, Hamed M; Mabrouk, Mokhtar M; Hammad, Sherin F; Mansour, Fotouh R
2018-01-01
The development and introduction of combined therapy represent a challenge for analysis due to severe overlapping of their UV spectra in case of spectroscopy or the requirement of a long tedious and high cost separation technique in case of chromatography. Quality control laboratories have to develop and validate suitable analytical procedures in order to assay such multi component preparations. New spectrophotometric methods for the simultaneous determination of simvastatin (SIM) and nicotinic acid (NIA) in binary combinations were developed. These methods are based on chemometric treatment of data, the applied chemometric techniques are multivariate methods including classical least squares (CLS), principal component regression (PCR) and partial least squares (PLS). In these techniques, the concentration data matrix were prepared by using the synthetic mixtures containing SIM and NIA dissolved in ethanol. The absorbance data matrix corresponding to the concentration data matrix was obtained by measuring the absorbance at 12 wavelengths in the range 216 - 240 nm at 2 nm intervals in the zero-order. The spectrophotometric procedures do not require any separation step. The accuracy, precision and the linearity ranges of the methods have been determined and validated by analyzing synthetic mixtures containing the studied drugs. Chemometric spectrophotometric methods have been developed in the present study for the simultaneous determination of simvastatin and nicotinic acid in their synthetic binary mixtures and in their mixtures with possible excipients present in tablet dosage form. The validation was performed successfully. The developed methods have been shown to be accurate, linear, precise, and so simple. The developed methods can be used routinely for the determination dosage form. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Mhashal, Anil R; Choudhury, Chandan Kumar; Roy, Sudip
2016-03-01
Helicases are enzymes that unwind double-stranded DNA (dsDNA) into its single-stranded components. It is important to understand the binding and unbinding of ATP from the active sites of helicases, as this knowledge can be used to elucidate the functionality of helicases during the unwinding of dsDNA. In this work, we investigated the unbinding of ATP and its effect on the active-site residues of the helicase PcrA using molecular dynamic simulations. To mimic the unbinding process of ATP from the active site of the helicase, we simulated the application of an external force that pulls ATP from the active site and computed the free-energy change during this process. We estimated an energy cost of ~85 kJ/mol for the transformation of the helicase from the ATP-bound state (1QHH) to the ATP-free state (1PJR). Unbinding led to conformational changes in the residues of the protein at the active site. Some of the residues at the ATP-binding site were significantly reoriented when the ATP was pulled. We observed a clear competition between reorientation of the residues and energy stabilization by hydrogen bonds between the ATP and active-site residues. We also checked the flexibility of the PcrA protein using a principal component analysis of domain motion. We found that the ATP-free state of the helicase is more flexible than the ATP-bound state.
Kovács, Judit K.; Felső, Péter; Makszin, Lilla; Pápai, Zoltán; Horváth, Györgyi; Ábrahám, Hajnalka; Palkovics, Tamás; Böszörményi, Andrea; Emődy, Levente
2016-01-01
ABSTRACT Our study investigated the antimicrobial action of clove (Syzygium aromaticum) essential oil (EO) on the zoonotic pathogen Campylobacter jejuni. After confirming the clove essential oil's general antibacterial effect, we analyzed the reference strain Campylobacter jejuni NCTC 11168. Phenotypic, proteomic, and transcriptomic methods were used to reveal changes in cell morphology and functions when exposed to sublethal concentrations of clove EO. The normally curved cells showed markedly straightened and shrunken morphology on the scanning electron micrographs as a result of stress. Although, oxidative stress, as a generally accepted response to essential oils, was also present, the dominance of a general stress response was demonstrated by reverse transcription-PCR (RT-PCR). The results of RT-PCR and two-dimensional (2D) PAGE revealed that clove oil perturbs the expression of virulence-associated genes taking part in the synthesis of flagella, PEB1, PEB4, lipopolysaccharide (LPS), and serine protease. Loss of motility was also detected by a phenotypic test. Bioautographic analysis revealed that besides its major component, eugenol, at least four other spots of clove EO possessed bactericidal activity against C. jejuni. Our findings show that clove EO has a marked antibacterial and potential virulence-modulating effect on C. jejuni. IMPORTANCE This study demonstrates that the components of clove essential oil influence not only the expression of general stress genes but also the expression of virulence-associated genes. Based on this finding, alternative strategies can be worked on to control this important foodborne pathogen. PMID:27520816
Bédard, Emilie; Laferrière, Céline; Charron, Dominique; Lalancette, Cindy; Renaud, Christian; Desmarais, Nadia; Déziel, Eric; Prévost, Michèle
2015-11-01
To perform a post-outbreak prospective study of the Pseudomonas aeruginosa contamination at the faucets (water, aerator and drain) by culture and quantitative polymerase chain reaction (qPCR) and to assess environmental factors influencing occurrence A 450-bed pediatric university hospital in Montreal, Canada Water, aerator swab, and drain swab samples were collected from faucets and analyzed by culture and qPCR for the post-outbreak investigation. Water microbial and physicochemical parameters were measured, and a detailed characterization of the sink environmental and design parameters was performed. The outbreak genotyping investigation identified drains and aerators as the source of infection. The implementation of corrective measures was effective, but post-outbreak sampling using qPCR revealed 50% positivity for P. aeruginosa remaining in the water compared with 7% by culture. P. aeruginosa was recovered in the water, the aerator, and the drain in 21% of sinks. Drain alignment vs the faucet and water microbial quality were significant factors associated with water positivity, whereas P. aeruginosa load in the water was an average of 2 log higher for faucets with a positive aerator. P. aeruginosa contamination in various components of sink environments was still detected several years after the resolution of an outbreak in a pediatric university hospital. Although contamination is often not detectable in water samples by culture, P. aeruginosa is present and can recover its culturability under favorable conditions. The importance of having clear maintenance protocols for water systems, including the drainage components, is highlighted.
Additivity of nonlinear biomass equations
Bernard R. Parresol
2001-01-01
Two procedures that guarantee the property of additivity among the components of tree biomass and total tree biomass utilizing nonlinear functions are developed. Procedure 1 is a simple combination approach, and procedure 2 is based on nonlinear joint-generalized regression (nonlinear seemingly unrelated regressions) with parameter restrictions. Statistical theory is...
A Demonstration of Regression False Positive Selection in Data Mining
ERIC Educational Resources Information Center
Pinder, Jonathan P.
2014-01-01
Business analytics courses, such as marketing research, data mining, forecasting, and advanced financial modeling, have substantial predictive modeling components. The predictive modeling in these courses requires students to estimate and test many linear regressions. As a result, false positive variable selection ("type I errors") is…
Aydin-Schmidt, Berit; Xu, Weiping; González, Iveth J; Polley, Spencer D; Bell, David; Shakely, Delér; Msellem, Mwinyi I; Björkman, Anders; Mårtensson, Andreas
2014-01-01
Loop mediated isothermal amplification (LAMP) provides an opportunity for improved, field-friendly detection of malaria infections in endemic areas. However data on the diagnostic accuracy of LAMP for active case detection, particularly low-density parasitaemias, are lacking. We therefore evaluated the performance of a new LAMP kit compared with PCR using DNA from filter paper blood spots. Samples from 865 fever patients and 465 asymptomatic individuals collected in Zanzibar were analysed for Pan (all species) and Pf (P. falciparum) DNA with the Loopamp MALARIA Pan/Pf kit. Samples were amplified at 65°C for 40 minutes in a real-time turbidimeter and results were compared with nested PCR. Samples with discordant results between LAMP and nested PCR were analysed with real-time PCR. The real-time PCR corrected nested PCR result was defined as gold standard. Among the 117 (13.5%) PCR detected P. falciparum infections from fever patients (mean parasite density 7491/µL, range 6-782,400) 115, 115 and 111 were positive by Pan-LAMP, Pf-LAMP and nested PCR, respectively. The sensitivities were 98.3% (95%CI 94-99.8) for both Pan and Pf-LAMP. Among the 54 (11.6%) PCR positive samples from asymptomatic individuals (mean parasite density 10/µL, range 0-4972) Pf-LAMP had a sensitivity of 92.7% (95%CI 80.1-98.5) for detection of the 41 P. falciparum infections. Pan-LAMP had sensitivities of 97% (95%CI 84.2-99.9) and 76.9% (95%CI 46.2-95) for detection of P. falciparum and P. malariae, respectively. The specificities for both Pan and Pf-LAMP were 100% (95%CI 99.1-100) in both study groups. Both components of the Loopamp MALARIA Pan/Pf detection kit revealed high diagnostic accuracy for parasite detection among fever patients and importantly also among asymptomatic individuals of low parasite densities from minute blood volumes preserved on filter paper. These data support LAMPs potential role for improved detection of low-density malaria infections in pre-elimination settings.
González, Iveth J.; Polley, Spencer D.; Bell, David; Shakely, Delér; Msellem, Mwinyi I.; Björkman, Anders; Mårtensson, Andreas
2014-01-01
Background Loop mediated isothermal amplification (LAMP) provides an opportunity for improved, field-friendly detection of malaria infections in endemic areas. However data on the diagnostic accuracy of LAMP for active case detection, particularly low-density parasitaemias, are lacking. We therefore evaluated the performance of a new LAMP kit compared with PCR using DNA from filter paper blood spots. Methods and Findings Samples from 865 fever patients and 465 asymptomatic individuals collected in Zanzibar were analysed for Pan (all species) and Pf (P. falciparum) DNA with the Loopamp MALARIA Pan/Pf kit. Samples were amplified at 65°C for 40 minutes in a real-time turbidimeter and results were compared with nested PCR. Samples with discordant results between LAMP and nested PCR were analysed with real-time PCR. The real-time PCR corrected nested PCR result was defined as gold standard. Among the 117 (13.5%) PCR detected P. falciparum infections from fever patients (mean parasite density 7491/µL, range 6–782,400) 115, 115 and 111 were positive by Pan-LAMP, Pf-LAMP and nested PCR, respectively. The sensitivities were 98.3% (95%CI 94–99.8) for both Pan and Pf-LAMP. Among the 54 (11.6%) PCR positive samples from asymptomatic individuals (mean parasite density 10/µL, range 0–4972) Pf-LAMP had a sensitivity of 92.7% (95%CI 80.1–98.5) for detection of the 41 P. falciparum infections. Pan-LAMP had sensitivities of 97% (95%CI 84.2–99.9) and 76.9% (95%CI 46.2–95) for detection of P. falciparum and P. malariae, respectively. The specificities for both Pan and Pf-LAMP were 100% (95%CI 99.1–100) in both study groups. Conclusion Both components of the Loopamp MALARIA Pan/Pf detection kit revealed high diagnostic accuracy for parasite detection among fever patients and importantly also among asymptomatic individuals of low parasite densities from minute blood volumes preserved on filter paper. These data support LAMPs potential role for improved detection of low-density malaria infections in pre-elimination settings. PMID:25105591
Identification and characterization of aldehyde oxidases (AOXs) in the cotton bollworm
NASA Astrophysics Data System (ADS)
Xu, Wei; Liao, Yalin
2017-12-01
Aldehyde oxidases (AOXs) are a family of metabolic enzymes that oxidize aldehydes into carboxylic acids; therefore, they play critical roles in detoxification and degradation of chemicals. By using transcriptomic and genomic approaches, we successfully identified six putative AOX genes (HarmAOX1-6) from cotton bollworm, Helicoverpa armigera (Hübner) (Lepidoptera: Noctuidae). In silico expression profile, reverse transcription (RT)-PCR, and quantitative PCR (qPCR) analyses showed that HarmAOX1 is highly expressed in adult antennae, tarsi, and larval mouthparts, so they may play an important role in degrading plant-derived compounds. HarmAOX2 is highly and specifically expressed in adult antennae, suggesting a candidate pheromone-degrading enzyme (PDE) to inactivate the sex pheromone components (Z)-11-hexadecenal and (Z)-9-hexadecenal. RNA sequencing data further demonstrated that a number of host plants they feed on could significantly upregulate the expression levels of HarmAOX1 in larvae. This study improves our understanding of insect aldehyde oxidases and insect-plant interactions.
Cankar, Katarina; Štebih, Dejan; Dreo, Tanja; Žel, Jana; Gruden, Kristina
2006-01-01
Background Real-time PCR is the technique of choice for nucleic acid quantification. In the field of detection of genetically modified organisms (GMOs) quantification of biotech products may be required to fulfil legislative requirements. However, successful quantification depends crucially on the quality of the sample DNA analyzed. Methods for GMO detection are generally validated on certified reference materials that are in the form of powdered grain material, while detection in routine laboratories must be performed on a wide variety of sample matrixes. Due to food processing, the DNA in sample matrixes can be present in low amounts and also degraded. In addition, molecules of plant origin or from other sources that affect PCR amplification of samples will influence the reliability of the quantification. Further, the wide variety of sample matrixes presents a challenge for detection laboratories. The extraction method must ensure high yield and quality of the DNA obtained and must be carefully selected, since even components of DNA extraction solutions can influence PCR reactions. GMO quantification is based on a standard curve, therefore similarity of PCR efficiency for the sample and standard reference material is a prerequisite for exact quantification. Little information on the performance of real-time PCR on samples of different matrixes is available. Results Five commonly used DNA extraction techniques were compared and their suitability for quantitative analysis was assessed. The effect of sample matrix on nucleic acid quantification was assessed by comparing 4 maize and 4 soybean matrixes. In addition 205 maize and soybean samples from routine analysis were analyzed for PCR efficiency to assess variability of PCR performance within each sample matrix. Together with the amount of DNA needed for reliable quantification, PCR efficiency is the crucial parameter determining the reliability of quantitative results, therefore it was chosen as the primary criterion by which to evaluate the quality and performance on different matrixes and extraction techniques. The effect of PCR efficiency on the resulting GMO content is demonstrated. Conclusion The crucial influence of extraction technique and sample matrix properties on the results of GMO quantification is demonstrated. Appropriate extraction techniques for each matrix need to be determined to achieve accurate DNA quantification. Nevertheless, as it is shown that in the area of food and feed testing matrix with certain specificities is impossible to define strict quality controls need to be introduced to monitor PCR. The results of our study are also applicable to other fields of quantitative testing by real-time PCR. PMID:16907967
Improving indoor air quality has been a priority at the US EPA for many years. Among the components of indoor air, molds present a growing concern for the public. A primary information source on indoor molds is the news media, which often confuses rather than clarifies the situa...
QSAR modeling of flotation collectors using principal components extracted from topological indices.
Natarajan, R; Nirdosh, Inderjit; Basak, Subhash C; Mills, Denise R
2002-01-01
Several topological indices were calculated for substituted-cupferrons that were tested as collectors for the froth flotation of uranium. The principal component analysis (PCA) was used for data reduction. Seven principal components (PC) were found to account for 98.6% of the variance among the computed indices. The principal components thus extracted were used in stepwise regression analyses to construct regression models for the prediction of separation efficiencies (Es) of the collectors. A two-parameter model with a correlation coefficient of 0.889 and a three-parameter model with a correlation coefficient of 0.913 were formed. PCs were found to be better than partition coefficient to form regression equations, and inclusion of an electronic parameter such as Hammett sigma or quantum mechanically derived electronic charges on the chelating atoms did not improve the correlation coefficient significantly. The method was extended to model the separation efficiencies of mercaptobenzothiazoles (MBT) and aminothiophenols (ATP) used in the flotation of lead and zinc ores, respectively. Five principal components were found to explain 99% of the data variability in each series. A three-parameter equation with correlation coefficient of 0.985 and a two-parameter equation with correlation coefficient of 0.926 were obtained for MBT and ATP, respectively. The amenability of separation efficiencies of chelating collectors to QSAR modeling using PCs based on topological indices might lead to the selection of collectors for synthesis and testing from a virtual database.
Analysis and improvement measures of flight delay in China
NASA Astrophysics Data System (ADS)
Zang, Yuhang
2017-03-01
Firstly, this paper establishes the principal component regression model to analyze the data quantitatively, based on principal component analysis to get the three principal component factors of flight delays. Then the least square method is used to analyze the factors and obtained the regression equation expression by substitution, and then found that the main reason for flight delays is airlines, followed by weather and traffic. Aiming at the above problems, this paper improves the controllable aspects of traffic flow control. For reasons of traffic flow control, an adaptive genetic queuing model is established for the runway terminal area. This paper, establish optimization method that fifteen planes landed simultaneously on the three runway based on Beijing capital international airport, comparing the results with the existing FCFS algorithm, the superiority of the model is proved.
Structured functional additive regression in reproducing kernel Hilbert spaces.
Zhu, Hongxiao; Yao, Fang; Zhang, Hao Helen
2014-06-01
Functional additive models (FAMs) provide a flexible yet simple framework for regressions involving functional predictors. The utilization of data-driven basis in an additive rather than linear structure naturally extends the classical functional linear model. However, the critical issue of selecting nonlinear additive components has been less studied. In this work, we propose a new regularization framework for the structure estimation in the context of Reproducing Kernel Hilbert Spaces. The proposed approach takes advantage of the functional principal components which greatly facilitates the implementation and the theoretical analysis. The selection and estimation are achieved by penalized least squares using a penalty which encourages the sparse structure of the additive components. Theoretical properties such as the rate of convergence are investigated. The empirical performance is demonstrated through simulation studies and a real data application.
Introduction to uses and interpretation of principal component analyses in forest biology.
J. G. Isebrands; Thomas R. Crow
1975-01-01
The application of principal component analysis for interpretation of multivariate data sets is reviewed with emphasis on (1) reduction of the number of variables, (2) ordination of variables, and (3) applications in conjunction with multiple regression.
Kao, Hao-Hsi; Chen, Kuo-Su; Lin, Chih-Lang; Chang, Jia-Jang; Lee, Chien-Hung
2015-01-01
Hepatitis C virus (HCV) infection is a common cause of acute and chronic hepatitis among the hemodialysis population. To prevent cross infection between hemodialysis patients during the hemodialysis procedure, routine screening of anti-HCV antibody is recommended. However, a reactive anti-HCV EIA test is not equal to active HCV infection. An expensive RT-PCR study is required to confirm HCV viremia. This will significantly increase the cost burden because payment for each hemodialysis treatment is very low in Taiwan. Thus, it is useful to identify parameters that could predict HCV viremia among anti-HCV-reactive patients. In this study, we examined the usefulness of signal-to-cut (S/CO) ratio of anti-HCV antibody in discriminating HCV viremia from non-viremia among the anti-HCV-reactive hemodialysis population. In a cross-sectional measurement of anti-HCV antibody among 369 chronic hemodialysis patients, 44 showed reactive and 9 grey zone reaction for anti-HCV. These 53 patients underwent further blood tests for the measurement of AST, ALT and HCV RNA (by RT-PCR). The results of RT-PCR were used as a dependent variable. Then, S/CO ratios of anti-HCV, serum AST, ALT levels, age and duration of hemodialysis were used as independent variables to undergo ROC curve and logistic regression analysis. Thirty-six of the 53 reactive and grey zone patients were positive for HCV RNA in the RT-PCR study. Patients who were positive for HCV RNA had a higher S/CO ratio (p < 0.01), higher AST and ALT levels (p < 0.01), and longer duration on hemodialysis (p < 0.05) than those negative for HCV RNA. Logistic regression revealed that only S/CO ratio was a significant predictor for HCV viremia (p = 0.004). ROC curve analysis showed that S/CO ratio had a highest area under curve (0.967, p < 0.001), followed by ALT (0.826, p < 0.001), AST (0.778, p = 0.001), duration on hemodialysis (0.606, p = 0.215) and age (0.426, p = 0.386) in discriminating HCV viremia from non-viremia. Using a cutoff S/CO ratio of 65, we can confirm HCV viremia with a diagnostic specificity of 100%, sensitivity of 80.1% and positive predictive value of 100%. S/CO ratio is a useful indicator in predicting HCV viremia among anti-HCV-reactive hemodialysis patients. Patients with an S/CO ratio >65 can be regarded as those with active HCV infection. Alternatively, patients with reactive anti-HCV but with an S/CO ratio <65 should receive further RT-PCR test. © 2015 S. Karger AG, Basel.
Austin, Peter C
2010-04-22
Multilevel logistic regression models are increasingly being used to analyze clustered data in medical, public health, epidemiological, and educational research. Procedures for estimating the parameters of such models are available in many statistical software packages. There is currently little evidence on the minimum number of clusters necessary to reliably fit multilevel regression models. We conducted a Monte Carlo study to compare the performance of different statistical software procedures for estimating multilevel logistic regression models when the number of clusters was low. We examined procedures available in BUGS, HLM, R, SAS, and Stata. We found that there were qualitative differences in the performance of different software procedures for estimating multilevel logistic models when the number of clusters was low. Among the likelihood-based procedures, estimation methods based on adaptive Gauss-Hermite approximations to the likelihood (glmer in R and xtlogit in Stata) or adaptive Gaussian quadrature (Proc NLMIXED in SAS) tended to have superior performance for estimating variance components when the number of clusters was small, compared to software procedures based on penalized quasi-likelihood. However, only Bayesian estimation with BUGS allowed for accurate estimation of variance components when there were fewer than 10 clusters. For all statistical software procedures, estimation of variance components tended to be poor when there were only five subjects per cluster, regardless of the number of clusters.
Dreier, Jens; Störmer, Melanie; Kleesiek, Knut
2007-07-01
Bacterial contamination of blood components, particularly of platelet concentrates (PCs), represents the greatest infectious risk in blood transfusion. Although the incidence of platelet bacterial contamination is approximately 1 per 2,000 U, the urgent need for a method for the routine screening of PCs to improve safety for patients had not been considered for a long time. Besides the culturing systems, which will remain the criterion standard, rapid methods for sterility screening will play a more important role in transfusion medicine in the future. In particular, nucleic acid amplification techniques (NATs) are powerful potential tools for bacterial screening assays. The combination of excellent sensitivity and specificity, reduced contamination risk, ease of performance, and speed has made real-time polymerase chain reaction (PCR) technology an appealing alternative to conventional culture-based testing methods. When using real-time PCR for the detection of bacterial contamination, several points have to be considered. The main focus is the choice of the target gene; the assay format; the nucleic acid extraction method, depending on the sample type; and the evaluation of an ideal sampling strategy. However, several factors such as the availability of bacterial-derived nucleic acid amplification reagents, the impracticability, and the cost have limited the use of NATs until now. Attempts to reduce the presence of contaminating nucleic acids from reagents in real-time PCR have been described, but none of these approaches have proven to be very effective or to lower the sensitivity of the assay. Recently, a number of broad-range NAT assays targeting the 16S ribosomal DNA or 23S ribosomal RNA for the detection of bacteria based on real-time technology have been reported. This review will give a short survey of current approaches to and the limitations of the application of real-time PCR for bacterial detection in blood components, with emphasis on the bacterial contamination of PCs.
2010-01-01
Introduction Delays in adequate antimicrobial treatment contribute to high cost and mortality in sepsis. Polymerase chain reaction (PCR) assays are used alongside conventional cultures to accelerate the identification of microorganisms. We analyze the impact on medical outcomes and healthcare costs if improved adequacy of antimicrobial therapy is achieved by providing immediate coverage after positive PCR reports. Methods A mathematical prediction model describes the impact of PCR-based rapid adjustment of antimicrobial treatment. The model is applied to predict cost and medical outcomes for 221 sepsis episodes of 189 post-surgical and intensive care unit (ICU) sepsis patients with available PCR data from a prospective, observational trial of a multiplex PCR assay in five hospitals. While this trial demonstrated reduction of inadequate treatment days, data on outcomes associated with reduced inadequate initial antimicrobial treatment had to be obtained from two other, bigger, studies which involved 1,147 (thereof 316 inadequately treated) medical or surgical ICU patients. Our results are reported with the (5% to 95%) percentile ranges from Monte Carlo simulation in which the input parameters were randomly and independently varied according to their statistical characterization in the three underlying studies. The model allows predictions also for different patient groups or PCR assays. Results A total of 13.1% of PCR tests enabled earlier adequate treatment. We predict that cost for PCR testing (300 €/test) can be fully recovered for patients above 717 € (605 € to 1,710 €) daily treatment cost. A 2.6% (2.0 to 3.2%) absolute reduction of mortality is expected. Cost per incremental survivor calculates to 11,477 € (9,321 € to 14,977 €) and incremental cost-effectiveness ratio to 3,107 € (2,523 € to 4,055 €) per quality-adjusted life-year. Generally, for ICU patients with >25% incidence of inadequate empiric antimicrobial treatment, and at least 15% with a positive blood culture, PCR represents a cost-neutral adjunct method. Conclusions Rapid PCR identification of microorganisms has the potential to become a cost-effective component for managing sepsis. The prediction model tested with data from three observational trials should be utilized as a framework to deepen insights when integrating more complementary data associated with utilization of molecular assays in the management of sepsis. PMID:20950442
Kuang, Hua; Ma, Wei; Xu, Liguang; Wang, Libing; Xu, Chuanlai
2013-11-19
Polymerase chain reaction (PCR) is an essential tool in biotechnology laboratories and is becoming increasingly important in other areas of research. Extensive data obtained over the last 12 years has shown that the combination of PCR with nanoscale dispersions can resolve issues in the preparation DNA-based materials that include both inorganic and organic nanoscale components. Unlike conventional DNA hybridization and antibody-antigen complexes, PCR provides a new, effective assembly platform that both increases the yield of DNA-based nanomaterials and allows researchers to program and control assembly with predesigned parameters including those assisted and automated by computers. As a result, this method allows researchers to optimize to the combinatorial selection of the DNA strands for their nanoparticle conjugates. We have developed a PCR approach for producing various nanoscale assemblies including organic motifs such as small molecules, macromolecules, and inorganic building blocks, such as nanorods (NRs), metal, semiconductor, and magnetic nanoparticles (NPs). We start with a nanoscale primer and then modify that building block using the automated steps of PCR-based assembly including initialization, denaturation, annealing, extension, final elongation, and final hold. The intermediate steps of denaturation, annealing, and extension are cyclic, and we use computer control so that the assembled superstructures reach their predetermined complexity. The structures assembled using a small number of PCR cycles show a lower polydispersity than similar discrete structures obtained by direct hybridization between the nanoscale building blocks. Using different building blocks, we assembled the following structural motifs by PCR: (1) discrete nanostructures (NP dimers, NP multimers including trimers, pyramids, tetramers or hexamers, etc.), (2) branched NP superstructures and heterochains, (3) NP satellite-like superstructures, (4) Y-shaped nanostructures and DNA networks, (5) protein-DNA co-assembly structures, and (6) DNA block copolymers including trimers and pentamers. These results affirm that this method can produce a variety of chemical structures and in yields that are tunable. Using PCR-based preparation of DNA-bridged nanostructures, we can program the assembly of the nanoscale blocks through the adjustment of the primer intensity on the assembled units, the number of PCR cycles, or both. The resulting structures are highly complex and diverse and have interesting dynamics and collective properties. Potential applications of these materials include chirooptical materials, probe fabrication, and environmental and biomedical sensors.
Sanford, Ward E.; Nelms, David L.; Pope, Jason P.; Selnick, David L.
2015-01-01
Mean long-term hydrologic budget components, such as recharge and base flow, are often difficult to estimate because they can vary substantially in space and time. Mean long-term fluxes were calculated in this study for precipitation, surface runoff, infiltration, total evapotranspiration (ET), riparian ET, recharge, base flow (or groundwater discharge) and net total outflow using long-term estimates of mean ET and precipitation and the assumption that the relative change in storage over that 30-year period is small compared to the total ET or precipitation. Fluxes of these components were first estimated on a number of real-time-gaged watersheds across Virginia. Specific conductance was used to distinguish and separate surface runoff from base flow. Specific-conductance (SC) data were collected every 15 minutes at 75 real-time gages for approximately 18 months between March 2007 and August 2008. Precipitation was estimated for 1971-2000 using PRISM climate data. Precipitation and temperature from the PRISM data were used to develop a regression-based relation to estimate total ET. The proportion of watershed precipitation that becomes surface runoff was related to physiographic province and rock type in a runoff regression equation. A new approach to estimate riparian ET using seasonal SC data gave results consistent with those from other methods. Component flux estimates from the watersheds were transferred to flux estimates for counties and independent cities using the ET and runoff regression equations. Only 48 of the 75 watersheds yielded sufficient data, and data from these 48 were used in the final runoff regression equation. Final results for the study are presented as component flux estimates for all counties and independent cities in Virginia. The method has the potential to be applied in many other states in the U.S. or in other regions or countries of the world where climate and stream flow data are plentiful.
Wathuo, Miriam; Medley, Graham F; Nokes, D James; Munywoki, Patrick K
2016-12-14
Background A better understanding of respiratory syncytial virus (RSV) epidemiology requires realistic estimates of RSV shedding patterns, quantities shed, and identification of the related underlying factors. Methods RSV infection data arise from a cohort study of 47 households with 493 occupants, in coastal Kenya, during the 2009/2010 RSV season. Nasopharyngeal swabs were taken every 3 to 4 days and screened for RSV using a real time polymerase chain reaction (PCR) assay. The amount of virus shed was quantified by calculating the 'area under the curve' using the trapezoidal rule applied to rescaled PCR cycle threshold output. Multivariable linear regression was used to identify correlates of amount of virus shed. Results The median quantity of virus shed per infection episode was 29.4 (95% CI: 15.2, 54.2) log 10 ribonucleic acid (RNA) copies. Young age (<1 year), presence of upper respiratory symptoms, intra-household acquisition of infection, an individual's first infection episode in the RSV season, and having a co-infection of RSV group A and B were associated with increased amount of virus shed. Conclusions The findings provide insight into which groups of individuals have higher potential for transmission, information which may be useful in designing RSV prevention strategies.
Payne, Matthew S; Goss, Kevin C W; Connett, Gary J; Kollamparambil, Tanoj; Legg, Julian P; Thwaites, Richard; Ashton, Mark; Puddy, Victoria; Peacock, Janet L; Bruce, Kenneth D
2010-04-01
The role of infection in bronchopulmonary dysplasia (BPD) is unknown. We present an observational study of 55 premature infants born weighing less than 1.3 kg within two level III neonatal intensive care units. Endotracheal aspirates (ETA) and nasogastric aspirates (NGA) were studied with denaturing gradient gel electrophoresis (DGGE) profiling to elucidate the total bacterial community, and species-specific PCR was used to detect the presence of Mycoplasma hominis, Ureaplasma urealyticum, and Ureaplasma parvum. DGGE identified bacterial species in 59% of NGA and ETA samples combined. A diverse range of species were identified including several implicated in preterm labor. Species-specific PCR identified M. hominis in 25% of NGA and 11% of ETA samples. Among the 48 infants surviving up to 36 wk-postconceptual age, ordinal logistic regression showed the odds ratio for BPD or death where Ureaplasma was present/absent as 4.80 (95% CI 1.15-20.13). After adjusting for number of days ventilated, this was reduced to 2.04 (0.41-10.25). These data demonstrate how the combined use of DGGE and species-specific PCR identifies a high exposure in utero and around the time of birth to bacteria that might be causally related to preterm delivery and subsequent lung injury.
Miniaturized technology for DNA typing: cassette PCR.
Manage, Dammika P; Pilarski, Linda M
2015-01-01
With the smaller size, low cost, and rapid testing capabilities, miniaturized lab-on-a-chip devices can change the way medical diagnostics are currently performed in the health-care system. We have demonstrated such a device that is self-contained, simple, disposable, and inexpensive. It is capable of performing DNA amplification on an inexpensive instrument suitable for near point of care settings. This technology will enable on the spot evaluation of patients in the clinic for faster medical decision-making and more informed therapeutic choices. Our device, a gel capillary cassette, termed cassette PCR, contains capillary reaction units each holding a defined primer set, with arrays of capillary reaction units for simultaneously detecting multiple targets. With the exception of the sample to be tested, each capillary reaction unit holds all the reagents needed for PCR in a desiccated form that can be stored at room temperature for up to 3 months and even longer in colder conditions. It relies on capillary forces for sample delivery of microliter volumes through capillaries, hence avoiding the need for pumps or valves. In the assembled cassette, the wax architecture supporting the capillaries melts during the PCR and acts as a vapor barrier as well as segregating capillaries with different primer sets. No other chip sealing techniques are required. Cassette PCR accepts raw samples such as urine, genital swabs, and blood. The cassette is made with off-the-shelf components and contains integrated positive and negative controls.
Patil, R; Shankar, K M; Kumar, B T N; Kulkarni, A; Patil, P; Moger, N
2013-09-01
A flow-through immunoassay (FTA), an improved version of immunodot, was developed using a nitrocellulose membrane baked onto adsorbent pads enclosed in a plastic cassette to detect white spot syndrome virus (WSSV) in shrimp. Sharp purple dots developed with WSSV against the white background of the nitrocellulose membrane. The detection limits of WSSV by the FTA and immunodot were 0.312 and 1.2 μg mL(-1) crude WSSV protein, respectively. The FTA could be completed in 8-10 min compared with 90 min for immunodot. The FTA was 100 times more sensitive than 1-step polymerase chain reaction (PCR) and in between that of the 1- and 2-step PCR protocol recommended by the Office of International Epizootics (OIE). In experimental, orally infected shrimp post-larvae, WSSV was first detected 14, 16 and 18 h post-infection (hpi) by FTA, immunodot and one-step PCR, respectively. The FTA detected WSSV 2 and 4 h earlier than immunodot and one-step PCR, respectively. The FTA was more sensitive (25/27) than one-step PCR (23/27) and immunodot (23/27) for the detection of WSSV from white spot disease outbreak ponds. The reagent components of the FTA were stable giving expected results for 6 m at 4-8 °C. The FTA is available as a rapid test kit called 'RapiDot' for the early detection of WSSV under field conditions. © 2013 John Wiley & Sons Ltd.
Keller, Mark; Naue, Jana; Zengerle, Roland; von Stetten, Felix; Schmidt, Ulrike
2015-01-01
Nested PCR remains a labor-intensive and error-prone biomolecular analysis. Laboratory workflow automation by precise control of minute liquid volumes in centrifugal microfluidic Lab-on-a-Chip systems holds great potential for such applications. However, the majority of these systems require costly custom-made processing devices. Our idea is to augment a standard laboratory device, here a centrifugal real-time PCR thermocycler, with inbuilt liquid handling capabilities for automation. We have developed a microfluidic disk segment enabling an automated nested real-time PCR assay for identification of common European animal groups adapted to forensic standards. For the first time we utilize a novel combination of fluidic elements, including pre-storage of reagents, to automate the assay at constant rotational frequency of an off-the-shelf thermocycler. It provides a universal duplex pre-amplification of short fragments of the mitochondrial 12S rRNA and cytochrome b genes, animal-group-specific main-amplifications, and melting curve analysis for differentiation. The system was characterized with respect to assay sensitivity, specificity, risk of cross-contamination, and detection of minor components in mixtures. 92.2% of the performed tests were recognized as fluidically failure-free sample handling and used for evaluation. Altogether, augmentation of the standard real-time thermocycler with a self-contained centrifugal microfluidic disk segment resulted in an accelerated and automated analysis reducing hands-on time, and circumventing the risk of contamination associated with regular nested PCR protocols.
Evaluation of nested PCR in diagnosis of fungal rhinosinusitis.
Badiee, Parisa; Gandomi, Behrooz; Sabz, Gholamabbass; Khodami, Bijan; Choopanizadeh, Maral; Jafarian, Hadis
2015-02-01
Given the importance of rapid diagnosis for fungal rhinosinusitis, this study aimed to evaluate the use of nested PCR to identify Aspergillus and Mucor species in clinical samples from patients with suspected fungal rhinosinusitis. Functional endoscopic sinus surgery specimens were collected from 98 patients with rhinosinusitis from 2012 to 2013. All samples were ground and cultured on sabouraud dextrose agar. The isolated fungi were identified based on their macroscopic and microscopic features. Fungal DNA was extracted from the tissue samples and nested PCR was performed with two sets of primers for Mucor and Aspergillus. Direct microscopic showed that 5.1% contained fungal components and 9.2% exhibited growth of fungi in culture. The most common agents isolated were Aspergillus fumigatus (n= 3), Aspergillus flavus (n=2), Penicillium sp (n=3) and Alternaria sp. (n=1). Mucor sp. was identified in the pathology smear from 1 patient. Positive results for fungal rhinosinusitis were obtained for a total of 10.2% by culture or pathology smear. Positive PCR results were obtained in 72 samples for Aspergillus and 31 samples for Mucor. Our results suggest that endoscopic sinus surgery specimens are not suitable for nested PCR, probably because of the accumulation of fungi that contaminate the environmental air. This drawback is a limiting factor for diagnosis with nasal cavity specimens. Therefore, molecular methods and conventional culture techniques are helpful complementary diagnostic methods to detect fungal rhinosinusitis and determine appropriate management for these patients.
Bacterial diversity characterization in petroleum samples from Brazilian reservoirs
de Oliveira, Valéria Maia; Sette, Lara Durães; Simioni, Karen Christina Marques; dos Santos Neto, Eugênio Vaz
2008-01-01
This study aimed at evaluating potential differences among the bacterial communities from formation water and oil samples originated from biodegraded and non-biodegraded Brazilian petroleum reservoirs by using a PCR-DGGE based approach. Environmental DNA was isolated and used in PCR reactions with bacterial primers, followed by separation of 16S rDNA fragments in the DGGE. PCR products were also cloned and sequenced, aiming at the taxonomic affiliation of the community members. The fingerprints obtained allowed the direct comparison among the bacterial communities from oil samples presenting distinct degrees of biodegradation, as well as between the communities of formation water and oil sample from the non-biodegraded reservoir. Very similar DGGE band profiles were observed for all samples, and the diversity of the predominant bacterial phylotypes was shown to be low. Cloning and sequencing results revealed major differences between formation water and oil samples from the non-biodegraded reservoir. Bacillus sp. and Halanaerobium sp. were shown to be the predominant components of the bacterial community from the formation water sample, whereas the oil sample also included Alicyclobacillus acidoterrestris, Rhodococcus sp., Streptomyces sp. and Acidithiobacillus ferrooxidans. The PCR-DGGE technique, combined with cloning and sequencing of PCR products, revealed the presence of taxonomic groups not found previously in these samples when using cultivation-based methods and 16S rRNA gene library assembly, confirming the need of a polyphasic study in order to improve the knowledge of the extent of microbial diversity in such extreme environments. PMID:24031244
Zhou, Xiaodie; Song, Yong; Zhou, Xiaojun; Yu, Like; Wang, Jiandong
2015-01-01
Anaplastic lymphoma kinase (ALK) and echinoderm microtubule-associated protein-like 4 (EML4) gene rearrangements occur in approximately 5% of non-small-cell lung cancers (NSCLC), leading to the overexpression of anaplastic lymphoma kinase and predicting a response to the targeted inhibitor, crizotinib. Malignant pleural effusion occurs in most patients with advanced lung cancer, especially adenocarcinoma, and tissue samples are not always available from these patients. We attempted to clarify the feasibility of detecting the EML4-ALK fusion gene in pleural effusion cells using different methods. We obtained 66 samples of pleural effusion from NSCLC patients. The pleural effusion fluid was centrifuged, and the cellular components obtained were formalin fixed and paraffin embedded. The EML4-ALK fusion gene status was determined with fluorescent in situ hybridization (FISH), reverse transcription—polymerase chain reaction (RT-PCR), and immunohistochemistry (IHC). EML4-ALK was detected in three of 66 patient samples (4.5%) with RT-PCR. When the RT-PCR data were used as the standard, one false positive and one false negative samples were identified with IHC; and one false negative sample was identified with FISH. These results suggest that a block of pleural effusion cells can be used to detect the EML4-ALK fusion gene. IHC had good sensitivity, but low specificity. FISH had low sensitivity, but high specificity. RT-PCR is a good candidate method for detecting EML4-ALK in blocks of pleural effusion cells from lung cancer patients. PMID:25785456
Liu, Leilei; Zhan, Ping; Zhou, Xiaodie; Song, Yong; Zhou, Xiaojun; Yu, Like; Wang, Jiandong
2015-01-01
Anaplastic lymphoma kinase (ALK) and echinoderm microtubule-associated protein-like 4 (EML4) gene rearrangements occur in approximately 5% of non-small-cell lung cancers (NSCLC), leading to the overexpression of anaplastic lymphoma kinase and predicting a response to the targeted inhibitor, crizotinib. Malignant pleural effusion occurs in most patients with advanced lung cancer, especially adenocarcinoma, and tissue samples are not always available from these patients. We attempted to clarify the feasibility of detecting the EML4-ALK fusion gene in pleural effusion cells using different methods. We obtained 66 samples of pleural effusion from NSCLC patients. The pleural effusion fluid was centrifuged, and the cellular components obtained were formalin fixed and paraffin embedded. The EML4-ALK fusion gene status was determined with fluorescent in situ hybridization (FISH), reverse transcription-polymerase chain reaction (RT-PCR), and immunohistochemistry (IHC). EML4-ALK was detected in three of 66 patient samples (4.5%) with RT-PCR. When the RT-PCR data were used as the standard, one false positive and one false negative samples were identified with IHC; and one false negative sample was identified with FISH. These results suggest that a block of pleural effusion cells can be used to detect the EML4-ALK fusion gene. IHC had good sensitivity, but low specificity. FISH had low sensitivity, but high specificity. RT-PCR is a good candidate method for detecting EML4-ALK in blocks of pleural effusion cells from lung cancer patients.
Energetic Profile of the Basketball Exercise Simulation Test in Junior Elite Players.
Latzel, Richard; Hoos, Olaf; Stier, Sebastian; Kaufmann, Sebastian; Fresz, Volker; Reim, Dominik; Beneke, Ralph
2017-11-28
To analyze the energetic profile of the basketball exercise simulation test (BEST). 10 male elite junior basketball players (age: 15.5±0.6yrs, height: 180±9cm, body mass: 66.1±11.2kg) performed a modified BEST (20 circuits consisting of jumping, sprinting, jogging, shuffling, and short breaks) simulating professional basketball game play. Circuit time, sprint time, sprint decrement, oxygen uptake (VO2), heart rate (HR), and blood lactate concentration (BLC) were obtained. Metabolic energy and metabolic power above rest (W tot , P tot ) as well as energy share in terms of aerobic (W aer ), glycolytic (W blc ), and high energy phosphates (W PCr ) were calculated from VO2 during exercise, net lactate production, and the fast component of post-exercise VO2 kinetics, respectively. W aer , W blc , and W PCr reflect 89±2%, 5±1%, and 6±1% of total energy needed, respectively. Assuming an aerobic replenishment of PCr energy stores during short breaks, the adjusted energy share yielded W aer : 66±4%, W blc : 5±1%, and W PCr : 29±1%. W aer and W PCr were negatively correlated (-0.72, -0.59) with sprint time, which was not the case for W blc . Consistent with general findings on energy system interaction during repeated high intensity exercise bouts, the intermittent profile of the BEST relies primarily on aerobic energy combined with repetitive supplementation by anaerobic utilization of high energy phosphates.
2012-01-01
Background Yellow Fever virus (YFV) is an important arboviral pathogen in much of sub-Saharan Africa and the tropical Americas. It is the prototype member of the genus Flavivirus and is transmitted primarily by Aedes (Stegomyia) mosquitoes. The incidence of human infections in endemic areas has risen in recent years. Prompt and dependable identification of YFV is a critical component of response to suspect cases. Results We developed a one-step SYBR Green I-based real-time quantitative RT-PCR (qRT-PCR) assay targeting the 5'NTR and capsid-gene junction--for rapid detection and quantification of YFV. The detection limit was 1 PFU/mL, 10-fold more sensitive than conventional RT-PCR, and there was no cross-reactivity with closely related flaviviruses or with alphaviruses. Viral load in samples was determined by standard curve plotted from cycle threshold (Ct) values and virus concentration. The efficacy of the assay in mosquitoes was assessed with spiked samples. The utility of the assay for screening of pooled mosquitoes was also confirmed. Replication of a Cameroon isolate of YFV in Ae. aegypti revealed a marked variation in susceptibility among different colonies at different days post infection (pi). Conclusions The SYBR Green-1 based qRT-PCR assay is a faster, simpler, more sensitive and less expensive procedure for detection and quantification of YFV than other currently used methods. PMID:22264275
Krishna P. Poudel; Temesgen Hailemariam
2016-01-01
Using data from destructively sampled Douglas-fir and lodgepole pine trees, we evaluated the performance of regional volume and component biomass equations in terms of bias and RMSE. The volume and component biomass equations were calibrated using three different adjustment methods that used: (a) a correction factor based on ordinary least square regression through...
Khazaei, Salman; Rezaeian, Shahab; Khazaei, Somayeh; Mansori, Kamyar; Sanjari Moghaddam, Ali; Ayubi, Erfan
2016-01-01
Geographic disparity for colorectal cancer (CRC) incidence and mortality according to the human development index (HDI) might be expected. This study aimed at quantifying the effect measure of association HDI and its components on the CRC incidence and mortality. In this ecological study, CRC incidence and mortality was obtained from GLOBOCAN, the global cancer project for 172 countries. Data were extracted about HDI 2013 for 169 countries from the World Bank report. Linear regression was constructed to measure effects of HDI and its components on CRC incidence and mortality. A positive trend between increasing HDI of countries and age-standardized rates per 100,000 of CRC incidence and mortality was observed. Among HDI components education was the strongest effect measure of association on CRC incidence and mortality, regression coefficients (95% confidence intervals) being 2.8 (2.4, 3.2) and 0.9 (0.8, 1), respectively. HDI and its components were positively related with CRC incidence and mortality and can be considered as targets for prevention and treatment intervention or tracking geographic disparities.
NASA Astrophysics Data System (ADS)
Nakamuta, Y.; Urata, K.; Shibata, Y.; Kuwahara, Y.
2017-03-01
In Lindsley's thermometry, a revised sequence of calculation of components is proposed for clinopyroxene, in which kosmochlor component is added. Temperatures obtained for the components calculated by the revised method are about 50 °C lower than those obtained for the components calculated by the Lindsley's original method and agree well with temperatures obtained from orthopyroxenes. Ca-partitioning between clino- and orthopyroxenes is then thought to be equilibrated in types 5 to 7 ordinary chondrites. The temperatures for Tuxtuac (LL5), Dhurmsala (LL6), NWA 2092 (LL6/7), and Dho 011 (LL7) are 767-793°, 818-835°, 872-892°, and 917-936°C, respectively, suggesting that chondrites of higher petrographic types show higher equilibrium temperatures of pyroxenes. The regression equations which relate temperature and Wo and Fs contents in the temperature-contoured pyroxene quadrilateral of 1 atm of Lindsley (1983) are also determined by the least squares method. It is possible to reproduce temperatures with an error less than 20 °C (2SE) using the regression equations.
Liu, Hui-lin; Wan, Xia; Yang, Gong-huan
2013-02-01
To explore the relationship between the strength of tobacco control and the effectiveness of creating smoke-free hospital, and summarize the main factors that affect the program of creating smoke-free hospitals. A total of 210 hospitals from 7 provinces/municipalities directly under the central government were enrolled in this study using stratified random sampling method. Principle component analysis and regression analysis were conducted to analyze the strength of tobacco control and the effectiveness of creating smoke-free hospitals. Two principal components were extracted in the strength of tobacco control index, which respectively reflected the tobacco control policies and efforts, and the willingness and leadership of hospital managers regarding tobacco control. The regression analysis indicated that only the first principal component was significantly correlated with the progression in creating smoke-free hospital (P<0.001), i.e. hospitals with higher scores on the first principal component had better achievements in smoke-free environment creation. Tobacco control policies and efforts are critical in creating smoke-free hospitals. The principal component analysis provides a comprehensive and objective tool for evaluating the creation of smoke-free hospitals.
Sung, Young-Hoon; Yurgelun-Todd, Deborah A.; Kondo, Douglas G.; Shi, Xian-Feng; Lundberg, Kelly J.; Hellem, Tracy L.; Huber, Rebekah S.; McGlade, Erin C.; Jeong, Eun-Kee; Renshaw, Perry F.
2015-01-01
Background A high prevalence of tobacco smoking has been observed in methamphetamine users, but there have been no in vivo brain neurochemistry studies addressing gender effects of tobacco smoking in methamphetamine users. Methamphetamine addiction is associated with increased risk of depression and anxiety in females. There is increasing evidence that selective analogues of nicotine, a principal active component of tobacco smoking, may improve depression and cognitive performance in animals and humans. Objectives To investigate the effects of tobacco smoking and gender on brain phosphocreatine (PCr) levels, a marker of brain energy metabolism reported to be reduced in methamphetamine-dependent subjects. Methods Thirty female and twenty-seven male methamphetamine-dependent subjects were evaluated with phosphorus-31 magnetic resonance spectroscopy (31P-MRS) to measure PCr levels within the pregenual anterior cingulate, which has been implicated in methamphetamine neurotoxicity. Results Analysis of covariance revealed that there were statistically significant slope (PCr versus lifetime amount of tobacco smoking) differences between female and male methamphetamine-dependent subjects (p=0.03). In females, there was also a statistically significant interaction between lifetime amounts of tobacco smoking and methamphetamine in regard to PCr levels (p=0.01), which suggests that tobacco smoking may have a more significant positive impact on brain PCr levels in heavy, as opposed to light to moderate, methamphetamine-dependent females. Conclusion These results indicate that tobacco smoking has gender-specific effects in terms of increased anterior cingulate high energy PCr levels in methamphetamine-dependent subjects. Cigarette smoking in methamphetamine-dependent women, particularly those with heavy methamphetamine use, may have a potentially protective effect upon neuronal metabolism. PMID:25871447
NASA Astrophysics Data System (ADS)
Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen
2015-09-01
Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.
Chair-side detection of Prevotella Intermedia in mature dental plaque by its fluorescence.
Nomura, Yoshiaki; Takeuchi, Hiroaki; Okamoto, Masaaki; Sogabe, Kaoru; Okada, Ayako; Hanada, Nobuhiro
2017-06-01
Prevotella intermedia/nigrescens is one of the well-known pathogens causing periodontal diseases, and the red florescence excited by the visible blue light caused by the protoporphyrin IX in the bacterial cells could be useful for the chair-side detection. The aim of this study was to evaluated levels of periodontal pathogen, especially P. intermedia in clinical samples of red fluorescent dental plaque. Thirty two supra gingival plaque samples from six individuals were measured its fluorescence at 640nm wavelength excited by 409nm. Periodontopathic bacteria were counted by the Invader PLUS PCR assay. Co-relations the fluorescence intensity and bacterial counts were analyzed by Person's correlation coefficient and simple and multiple regression analysis. Positive and negative predictive values of the fluorescence intensities for with or without P. intermedia in supragingival plaque was calculated. When relative fluorescence unit (RFU) were logarithmic transformed, statistically significant linear relations between RFU and bacterial counts were obtained for P. intermedia, Porphyromonas gingivalis and Tannerella forsythia. By the multiple regression analysis, only P. intermedia had statistically significant co-relation with fluorescence intensities. All of the fluorescent dental plaque contained P. intermedia m. In contrast, 28% of non-fluorescent plaques contained P. intermedia. To check the fluorescence dental plaque in the oral cavity could be the simple chair-side screening of the mature dental plaque before examining the periodontal pathogens especially P. intermedia by the PCR method. Copyright © 2017 Elsevier B.V. All rights reserved.
Naval Research Logistics Quarterly. Volume 28. Number 3,
1981-09-01
denotes component-wise maximum. f has antone (isotone) differences on C x D if for cl < c2 and d, < d2, NAVAL RESEARCH LOGISTICS QUARTERLY VOL. 28...or negative correlations and linear or nonlinear regressions. Given are the mo- ments to order two and, for special cases, (he regression function and...data sets. We designate this bnb distribution as G - B - N(a, 0, v). The distribution admits only of positive correlation and linear regressions
Impact of cystic fibrosis disease on archaea and bacteria composition of gut microbiota.
Miragoli, Francesco; Federici, Sara; Ferrari, Susanna; Minuti, Andrea; Rebecchi, Annalisa; Bruzzese, Eugenia; Buccigrossi, Vittoria; Guarino, Alfredo; Callegari, Maria Luisa
2017-02-01
Cystic fibrosis is often associated with intestinal inflammation due to several factors, including altered gut microbiota composition. In this study, we analyzed the fecal microbiota among patients with cystic fibrosis of 10-22 years of age, and compared the findings with age-matched healthy subjects. The participating patients included 14 homozygotes and 14 heterozygotes with the delF508 mutation, and 2 heterozygotes presenting non-delF508 mutations. We used PCR-DGGE and qPCR to analyze the presence of bacteria, archaea and sulfate-reducing bacteria. Overall, our findings confirmed disruption of the cystic fibrosis gut microbiota. Principal component analysis of the qPCR data revealed no differences between homozygotes and heterozygotes, while both groups were distinct from healthy subjects who showed higher biodiversity. Archaea were under the detection limit in all homozygotes subjects, whereas methanogens were detected in 62% of both cystic fibrosis heterozygotes and healthy subjects. Our qPCR results revealed a low frequency of sulfate-reducing bacteria in the homozygote (13%) and heterozygote (13%) patients with cystic fibrosis compared with healthy subjects (87.5%). This is a pioneer study showing that patients with cystic fibrosis exhibit significant reduction of H 2 -consuming microorganisms, which could increase hydrogen accumulation in the colon and the expulsion of this gas through non-microbial routes. © FEMS 2016.
Lei, Jun; Xue, Ying; Liu, Yi-Ming; Liao, Xun
2017-01-01
The peels of citrus fruits (Pericarpium Citri Reticulatae, PCR) have long been used in traditional Chinese medicines (TCMs). Polymethoxylated flavonoids (PMFs) were found to be the main components present in PCR extracts, but their metabolism remains unclear which restrain the utilization of this TCM. In the present work, rat liver microsomes were immobilized on magnetic nanoparticles (LMMNPs) for in vitro metabolic study on the whole PMFs of PCR. LMMNPs were characterized by transmission electron microscope and Fourier-transform infrared spectrum. The relative enzyme binding capacity of LMMNPs was estimated to be about 428 μg/mg from thermogravimetric analysis. Incubation of LMMNPs with PMFs produced demethylated metabolites of PMFs, six of which were identified by ultrahigh pressure liquid chromatography-mass spectrometry (UPLC-MS/MS). The 3'-hydroxylated tangeretin (T3) was detected from the metabolites of tangeretin for the first time, which suggested that 4'-demethylated and 3'-hydroxylated derivative of tangeretin (3'-hydroxy-5,6,7,8,4'-pentamethoxyflavone, T4) was not only derived from 4'-demethylated tangeretin (T2) as previously reported, but also from T3. This is the first investigation of the metabolism of the whole PMFs, which may shed light on the mechanism of action of PCR.
Hubalkova, Zora; Rencova, Eva
2011-10-01
A one-step polymerase chain reaction (PCR) method for the simultaneous detection of the major allergens of pecan and Brazil nuts was developed. Primer pairs for the amplification of partial sequences of genes encoding the allergens were designed and tested for their specificity on a range of food components. The targeted amplicon size was 173 bp of Ber e 1 gene of Brazil nuts and 72 bp of vicilin-like seed storage protein gene in pecan nuts. The primer pair detecting the noncoding region of the chloroplast DNA was used as the internal control of amplification. The intrinsic detection limit of the PCR method was 100 pg mL(-1) pecan or Brazil nuts DNA. The practical detection limit was 0.1% w/w (1 g kg(-1)). The method was applied for the investigation of 63 samples with the declaration of pecans, Brazil nuts, other different nut species or nuts generally. In 15 food samples pecans and Brazil nuts allergens were identified in the conformity with the food declaration. The presented multiplex PCR method is specific enough and can be used as a fast approach for the detection of major allergens of pecan or Brazil nuts in food. Copyright © 2011 Society of Chemical Industry.
Happyana, Nizar; Kayser, Oliver
2016-08-01
Cannabis sativa trichomes are glandular structures predominantly responsible for the biosynthesis of cannabinoids, the biologically active compounds unique to this plant. To the best of our knowledge, most metabolomic works on C. sativa that have been reported previously focused their investigations on the flowers and leaves of this plant. In this study, (1)H NMR-based metabolomics and real-time PCR analysis were applied for monitoring the metabolite profiles of C. sativa trichomes, variety Bediol, during the last 4 weeks of the flowering period. Partial least squares discriminant analysis models successfully classified metabolites of the trichomes based on the harvest time. Δ (9)-Tetrahydrocannabinolic acid (1) and cannabidiolic acid (2) constituted the vital differential components of the organic preparations, while asparagine, glutamine, fructose, and glucose proved to be their water-extracted counterparts. According to RT-PCR analysis, gene expression levels of olivetol synthase and olivetolic acid cyclase influenced the accumulation of cannabinoids in the Cannabis trichomes during the monitoring time. Moreover, quantitative (1)H NMR and RT-PCR analysis of the Cannabis trichomes suggested that the gene regulation of cannabinoid biosynthesis in the C. sativa variety Bediol is unique when compared with other C. sativa varieties. Georg Thieme Verlag KG Stuttgart · New York.
Pombo-Suarez, Manuel; Calaza, Manuel; Gomez-Reino, Juan J; Gonzalez, Antonio
2008-01-29
Assessment of gene expression is an important component of osteoarthritis (OA) research, greatly improved by the development of quantitative real-time PCR (qPCR). This technique requires normalization for precise results, yet no suitable reference genes have been identified in human articular cartilage. We have examined ten well-known reference genes to determine the most adequate for this application. Analyses of expression stability in cartilage from 10 patients with hip OA, 8 patients with knee OA and 10 controls without OA were done with classical statistical tests and the software programs geNorm and NormFinder. Results from the three methods of analysis were broadly concordant. Some of the commonly used reference genes, GAPDH, ACTB and 18S RNA, performed poorly in our analysis. In contrast, the rarely used TBP, RPL13A and B2M genes were the best. It was necessary to use together several of these three genes to obtain the best results. The specific combination depended, to some extent, on the type of samples being compared. Our results provide a satisfactory set of previously unused reference genes for qPCR in hip and knee OA This confirms the need to evaluate the suitability of reference genes in every tissue and experimental situation before starting the quantitative assessment of gene expression by qPCR.
Jin, Ting; Fei, Baoying; Zhang, Yu; He, Xujun
2017-01-01
Intestinal tuberculosis (ITB) and Crohn's disease (CD) are important differential diagnoses that can be difficult to distinguish. Polymerase chain reaction (PCR) for Mycobacterium tuberculosis (MTB) is an efficient and promising tool. This meta-analysis was performed to systematically and objectively assess the potential diagnostic accuracy and clinical value of PCR for MTB in distinguishing ITB from CD. We searched PubMed, Embase, Web of Science, Science Direct, and the Cochrane Library for eligible studies, and nine articles with 12 groups of data were identified. The included studies were subjected to quality assessment using the revised Quality Assessment of Diagnostic Accuracy Studies (QUADAS-2) tool. The summary estimates were as follows: sensitivity 0.47 (95% CI: 0.42-0.51); specificity 0.95 (95% CI: 0.93-0.97); the positive likelihood ratio (PLR) 10.68 (95% CI: 6.98-16.35); the negative likelihood ratio (NLR) 0.49 (95% CI: 0.33-0.71); and diagnostic odds ratio (DOR) 21.92 (95% CI: 13.17-36.48). The area under the curve (AUC) was 0.9311, with a Q* value of 0.8664. Heterogeneity was found in the NLR. The heterogeneity of the studies was evaluated by meta-regression analysis and subgroup analysis. The current evidence suggests that PCR for MTB is a promising and highly specific diagnostic method to distinguish ITB from CD. However, physicians should also keep in mind that negative results cannot exclude ITB for its low sensitivity. Additional prospective studies are needed to further evaluate the diagnostic accuracy of PCR.
Apt, Werner; Arribada, Arturo; Zulantay, Inés; Rodríguez, Jorge; Saavedra, Miguel; Muñoz, Andrea
2013-09-01
To evaluate cases of chronic Chagas' disease for the long-term effects of treatment with itraconazole on Trypanosoma cruzi infections and the regression or development of ECG abnormalities. In March 1992, we treated 46 patients with chronic Chagas' disease with 6 mg/kg/day of itraconazole for 120 days in a blind evaluation. The patients came from an area of Chile where the disease was endemic and were checked for ECG abnormalities and with xenodiagnosis (XD) or real-time XD-quantitative PCR (XD-qPCR) for Trypanosoma cruzi infection before treatment and once a year for 20 years. Twenty-one patients proved to be uninfected after 20 years and 15 of the patients had a normal ECG. Of the latter cases, 32.6% could be considered cured, although all of them had positive serology. Itraconazole prevents the development of ECG abnormalities, because after 20 years of treatment only 10.86% of patients developed ECG abnormalities (Z = 1.70, P = 0.046). XD-qPCR performed on 16 patients demonstrated 10 cases with <1.42 parasites/mL: eight with <1 parasite/mL, one with 1.42 parasites/mL and one with 1.01 parasites/mL. Five patients had more than 11.75 parasites/mL, all of them with a positive XD; these cases correspond to therapy failure, since re-infection was ruled out. In one case, XD-qPCR did not present amplification. Itraconazole is useful in the treatment of chronic Chagas' disease as it prevented the development of ECG abnormalities and cured 32.6% of patients.
Agardh, Elisabet; Gustavsson, Carin; Hagert, Per; Nilsson, Marie; Agardh, Carl-David
2006-02-01
The aim of the study was to evaluate messenger RNA and protein expression in limited amounts of tissue with low protein content. The Chomczynski method was used for simultaneous extraction of RNA, and protein was modified in the protein isolation step. Template mass and cycling time for the complementary DNA synthesis step of real-time reverse transcription-polymerase chain reaction (RT-PCR) for analysis of catalase, copper/zinc superoxide dismutase, manganese superoxide dismutase, the catalytic subunit of glutamylcysteine ligase, glutathione peroxidase 1, and the endogenous control cyclophilin B (CypB) were optimized before PCR. Polymerase chain reaction accuracy and efficacy were demonstrated by calculating the regression (R2) values of the separate amplification curves. Appropriate antibodies, blocking buffers, and running conditions were established for Western blot, and protein detection and multiplex assays with CypB were performed for each target. During the extraction procedure, the protein phase was dissolved in a modified washing buffer containing 0.1% sodium dodecyl sulfate, followed by ultrafiltration. Enzyme expression on real-time RT-PCR was accomplished with high reliability and reproducibility (R2, 0.990-0.999), and all enzymes except for glutathione peroxidase 1 were detectable in individual retinas on Western blot. Western blot multiplexing with CypB was possible for all targets. In conclusion, connecting gene expression directly to protein levels in the individual rat retina was possible by simultaneous extraction of RNA and protein. Real-time RT-PCR and Western blot allowed accurate detection of retinal protein expressions and levels.
Delaney, Michael P; Stevens, Paul E; Witham, Helen J; Judge, Caroline; Eaglestone, Gillian L; Carter, Joanne L; Bassett, Paul; Lamb, Edmund J
2016-01-01
♦ Small solute clearance, especially that derived from residual renal function (RRF), is an independent risk factor for death in peritoneal dialysis (PD) patients. Assessment of solute clearance is time-consuming and prone to multiple errors. Cystatin C is a small protein which has been used as a glomerular filtration rate (GFR) marker. We investigated whether serum cystatin C concentrations are related to mortality in patients receiving PD. ♦ New and prevalent PD patients (n = 235) underwent assessment of Kt/Vurea, RRF, weekly creatinine clearance (CCr), normalized protein catabolic rate (nPCR) and a peritoneal equilibration test (PET) at intervals. Blood was collected simultaneously for cystatin C measurement. Patients were followed for a median of 1,429 days (range 12 to 2,964 days) until death or study closure. Cause of death was recorded where given. Cox regression was performed to determine whether cystatin C had prognostic value either independently or with adjustment for other factors (age, sex, dialysis modality, diabetic status, cardiovascular comorbidity, Kt/V, CCr, RRF, nPCR or 4 h dialysate to plasma creatinine ratio (4 h D/Pcr) during the PET). The primary outcomes were all-cause mortality and treatment failure. ♦ There were 93 deaths. Increasing age and 4 h D/Pcr ratio, decreased RRF and presence of diabetes were significantly [p < 0.05] negatively associated with survival and treatment failure. Serum cystatin C was not related to either outcome. ♦ Serum cystatin C concentration does not predict mortality or treatment failure in patients receiving PD. Copyright © 2016 International Society for Peritoneal Dialysis.
Stochastic sampling effects in STR typing: Implications for analysis and interpretation.
Timken, Mark D; Klein, Sonja B; Buoncristiani, Martin R
2014-07-01
The analysis and interpretation of forensic STR typing results can become more complicated when reduced template amounts are used for PCR amplification due to increased stochastic effects. These effects are typically observed as reduced heterozygous peak-height balance and increased frequency of undetected alleles (allelic "dropout"). To investigate the origins of these effects, a study was performed using the AmpFlSTR(®) Identifiler Plus(®) and MiniFiler(®) kits to amplify replicates from a dilution series of NIST Human DNA Quantitation Standard (SRM(®) 2372A). The resulting amplicons were resolved and detected on two different genetic analyzer platforms, the Applied Biosystems 3130xL and 3500 analyzers. Results from our study show that the four different STR/genetic analyzer combinations exhibited very similar peak-height ratio statistics when normalized for the amount of template DNA in the PCR. Peak-height ratio statistics were successfully modeled using the Poisson distribution to simulate pre-PCR stochastic sampling of the alleles, confirming earlier explanations that sampling is the primary source for peak-height imbalance in reduced template dilutions. In addition, template-based pre-PCR sampling simulations also successfully predicted allelic dropout frequencies, as modeled by logistic regression methods, for the low-template DNA dilutions. We discuss the possibility that an accurately quantified DNA template might be used to characterize the linear signal response for data collected using different STR kits or genetic analyzer platforms, so as to provide a standardized approach for comparing results obtained from different STR/CE combinations and to aid in validation studies. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Detection and forecasting of oyster norovirus outbreaks: recent advances and future perspectives.
Wang, Jiao; Deng, Zhiqiang
2012-09-01
Norovirus is a highly infectious pathogen that is commonly found in oysters growing in fecally contaminated waters. Norovirus outbreaks can cause the closure of oyster harvesting waters and acute gastroenteritis in humans associated with consumption of contaminated raw oysters. Extensive efforts and progresses have been made in detection and forecasting of oyster norovirus outbreaks over the past decades. The main objective of this paper is to provide a literature review of methods and techniques for detecting and forecasting oyster norovirus outbreaks and thereby to identify the future directions for improving the detection and forecasting of norovirus outbreaks. It is found that (1) norovirus outbreaks display strong seasonality with the outbreak peak occurring commonly in December-March in the U.S. and April-May in the Europe; (2) norovirus outbreaks are affected by multiple environmental factors, including but not limited to precipitation, temperature, solar radiation, wind, and salinity; (3) various modeling approaches may be employed to forecast norovirus outbreaks, including Bayesian models, regression models, Artificial Neural Networks, and process-based models; and (4) diverse techniques are available for near real-time detection of norovirus outbreaks, including multiplex PCR, seminested PCR, real-time PCR, quantitative PCR, and satellite remote sensing. The findings are important to the management of oyster growing waters and to future investigations into norovirus outbreaks. It is recommended that a combined approach of sensor-assisted real time monitoring and modeling-based forecasting should be utilized for an efficient and effective detection and forecasting of norovirus outbreaks caused by consumption of contaminated oysters. Copyright © 2012 Elsevier Ltd. All rights reserved.
Lakshmi, I Karthika; Putty, Kalyani; Raut, Satya Samparna; Patil, Sunil R; Rao, P P; Bhagyalakshmi, B; Jyothi, Y Krishna; Susmitha, B; Reddy, Y Vishnuvardhan; Kasulanati, Sowmya; Jyothi, J Shiva; Reddy, Y N
2018-04-01
The present study was designed to standardize real-time polymerase chain reaction (PCR) for detecting the bluetongue virus from blood samples of sheep collected during outbreaks of bluetongue disease in the year 2014 in Andhra Pradesh and Telangana states of India. A 10-fold serial dilution of Plasmid PUC59 with bluetongue virus (BTV) NS3 insert was used to plot the standard curve. BHK-21 and KC cells were used for in vitro propagation of virus BTV-9 at a TCID50/ml of 10 5 ml and RNA was isolated by the Trizol method. Both reverse transcription-PCR and real-time PCR using TaqMan probe were carried out with RNA extracted from virus-spiked culture medium and blood to compare the sensitivity by means of finding out the limit of detection (LoD). The results were verified by inoculating the detected and undetected dilutions onto cell cultures with further cytological (cytopathic effect) and molecular confirmation (by BTV-NS1 group-specific PCR). The standardized technique was then applied to field samples (blood) for detecting BTV. The slope of the standard curve obtained was -3.23, and the efficiency was 103%. The LoD with RT-PCR was 8.269E×10 3 number of copies of plasmid, whereas it was 13 with real-time PCR for plasmid dilutions. Similarly, LoD was determined for virus-spiked culture medium, and blood with both the types of PCR and the values were 10 3 TCID 50/ml and 10 4 TCID 50/ml with RT-PCR and 10° TCID 50/ml and 10 2 TCID 50/ml with real-time PCR, respectively. The standardized technique was applied to blood samples collected from BTV suspected animals; 10 among 20 samples were found positive with Cq values ranging from 27 to 39. The Cq value exhibiting samples were further processed in cell cultures and were confirmed to be BT positive. Likewise, Cq undetected samples on processing in cell cultures turned out to be BTV negative. Real-time PCR was found to be a very sensitive as well as reliable method to detect BTV present in different types of samples, including blood samples collected from BTV-infected sheep, compared to RT-PCR. The LoD of BTV is likely influenced by sample type, possibly by the interference by the other components present in the sample.
An Alternative Way to Model Population Ability Distributions in Large-Scale Educational Surveys
ERIC Educational Resources Information Center
Wetzel, Eunike; Xu, Xueli; von Davier, Matthias
2015-01-01
In large-scale educational surveys, a latent regression model is used to compensate for the shortage of cognitive information. Conventionally, the covariates in the latent regression model are principal components extracted from background data. This operational method has several important disadvantages, such as the handling of missing data and…
Modeling health survey data with excessive zero and K responses.
Lin, Ting Hsiang; Tsai, Min-Hsiao
2013-04-30
Zero-inflated Poisson regression is a popular tool used to analyze data with excessive zeros. Although much work has already been performed to fit zero-inflated data, most models heavily depend on special features of the individual data. To be specific, this means that there is a sizable group of respondents who endorse the same answers making the data have peaks. In this paper, we propose a new model with the flexibility to model excessive counts other than zero, and the model is a mixture of multinomial logistic and Poisson regression, in which the multinomial logistic component models the occurrence of excessive counts, including zeros, K (where K is a positive integer) and all other values. The Poisson regression component models the counts that are assumed to follow a Poisson distribution. Two examples are provided to illustrate our models when the data have counts containing many ones and sixes. As a result, the zero-inflated and K-inflated models exhibit a better fit than the zero-inflated Poisson and standard Poisson regressions. Copyright © 2012 John Wiley & Sons, Ltd.
Özkarata, Emre; Özkarataş, Emre; Özbek, Ö Alpay; Avkan Oğuz, Vildan; Sayıner, A Arzu
2016-01-01
Cytomegalovirus (CMV) infection is among the most common important viral infections in solid organ transplant (SOT) recipients. Diagnostic tests for detecting CMV replication are widely used for this group of patients, however there is no clear agreement on the cut-off levels for interpretation of clinical decisions especially when the low level of viral load is detected. In this study, CMV pp65 antigenemia test results were compared with plasma CMV-DNA levels detected by quantitative real-time polymerase chain reaction (qPCR) in samples of kidney and liver transplant recipients in the Central Laboratory of Dokuz Eylul University Hospital between 2011 and 2013, and the correlation between these two tests and viral load equivalent to antigenemia positivity were determined. In the study, pp65 antigenemia and CMV-DNA qPCR results were evaluated retrospectively. The samples from the same patients were included if the time between antigenemia and CMV-DNA qPCR tests were less than 48 hours. SPSS v15.0 was used for correlation, regression and ROC curve analysis. The results of the 217 samples collected from 100 patients (59 male, 41 female; age range: 16-71, mean age: 46 ± 13 years), 36 liver and 64 kidney recipients were evaluated in the study. Of the patients 80% were CMV IgM negative, IgG positive; 1% was CMV IgG and IgM positive; 2% were CMV IgM and IgG negative, while for 17 patients serological results could not be reached. CMV pp65 antigenemia and CMV-DNA were both negative in 102 (47%) samples, while both were positive in 37 (17%) samples. The single sample from a case with CMV IgM and IgG positivity yielded negative results for both antigenemia and CMV-DNA tests. In 78 samples antigenemia were negative and CMV-DNA qPCR were positive, while there were no samples with antigenemia positive and qPCR negative. Mean values of antigenemia and qPCR tests were 23 positive cells/200.000 leukocytes (range: 1 to 230 positive cells) and 12.595 copies/ml (range: 180 to 106.311 copies/ml), respectively. There was a significant correlation between antigenemia and qPCR results among the samples that were positive by both assays (r= 0.785). ROC curve analysis showed that CMV viral load of 205 copies/ml in plasma corresponds to ≥ 1 pp65 antigen positive cells per 200.000 leukocytes (sensitivity: 91.7%, specificity: 90.3%). Higher analytical sensitivity of qPCR test can be explained by the results of CMV-DNA PCR positive and antigenemia negative samples. Non-existence of samples with antigen positive and PCR negative results supported this finding. ROC analysis showed that any sample with CMV-DNA qPCR result less than 205 copies/ml, could be accepted as pp65 antigenemia negative. This viral load value is valid only for the studied patient group and assays, therefore could be changed according to study population and tests.
USDA-ARS?s Scientific Manuscript database
Water deficit stress is a major component of agricultural drought events and contributes greatly to yield loss in all crops. Genetic modification to improve water deficit tolerance is an obvious strategy to mitigate this problem and an understanding of the mechanism of adaptation to water deficit is...
Structured functional additive regression in reproducing kernel Hilbert spaces
Zhu, Hongxiao; Yao, Fang; Zhang, Hao Helen
2013-01-01
Summary Functional additive models (FAMs) provide a flexible yet simple framework for regressions involving functional predictors. The utilization of data-driven basis in an additive rather than linear structure naturally extends the classical functional linear model. However, the critical issue of selecting nonlinear additive components has been less studied. In this work, we propose a new regularization framework for the structure estimation in the context of Reproducing Kernel Hilbert Spaces. The proposed approach takes advantage of the functional principal components which greatly facilitates the implementation and the theoretical analysis. The selection and estimation are achieved by penalized least squares using a penalty which encourages the sparse structure of the additive components. Theoretical properties such as the rate of convergence are investigated. The empirical performance is demonstrated through simulation studies and a real data application. PMID:25013362
Sahadeo, Nikita; Mohammed, Hamish; Allicock, Orchid M.; Auguste, Albert J.; Widen, Steven G.; Badal, Kimberly; Pulchan, Krishna; Foster, Jerome E.; Weaver, Scott C.; Carrington, Christine V. F.
2015-01-01
Local transmission of Chikungunya virus (CHIKV) was first documented in Trinidad and Tobago (T&T) in July 2014 preceding a large epidemic. At initial presentation, it is difficult to distinguish chikungunya fever (CHIKF) from other acute undifferentiated febrile illnesses (AUFIs), including life-threatening dengue disease. We characterised and compared dengue virus (DENV) and CHIKV infections in 158 patients presenting with suspected dengue fever (DF) and CHIKF at a major hospital in T&T, and performed phylogenetic analyses on CHIKV genomic sequences recovered from 8 individuals. The characteristics of patients with and without PCR-confirmed CHIKV were compared using Pearson’s χ2 and student’s t-tests, and adjusted odds ratios (aORs) and 95% confidence intervals (CIs) were determined using logistic regression. We then compared signs and symptoms of people with RT-qPCR-confirmed CHIKV and DENV infections using the Mann-Whitney U, Pearson’s χ2 and Fisher’s exact tests. Among the 158 persons there were 8 (6%) RT-qPCR-confirmed DENV and 30 (22%) RT-qPCR-confirmed CHIKV infections. Phylogenetic analyses showed that the CHIKV strains belonged to the Asian genotype and were most closely related to a British Virgin Islands strain isolated at the beginning of the 2013/14 outbreak in the Americas. Compared to persons who were RT-qPCR-negative for CHIKV, RT-qPCR-positive individuals were significantly more likely to have joint pain (aOR: 4.52 [95% CI: 1.28–16.00]), less likely to be interviewed at a later stage of illness (days post onset of fever—aOR: 0.56 [0.40–0.78]) and had a lower white blood cell count (aOR: 0.83 [0.71–0.96]). Among the 38 patients with RT-qPCR-confirmed CHIKV or DENV, there were no significant differences in symptomatic presentation. However when individuals with serological evidence of recent DENV or CHIKV infection were included in the analyses, there were key differences in clinical presentation between CHIKF and other AUFIs including DF, which can be used to triage patients for appropriate care in the clinical setting. PMID:26580074
Exertional oxygen uptake kinetics: a stamen of stamina?
Whipp, Brian J; Rossiter, H B; Ward, S A
2002-04-01
The fundamental pulmonary O(2) uptake (.VO(2)) response to moderate, constant-load exercise can be characterized as (d.VO(2)/dt)(tau)+Delta.VO(2) (t)=Delta.VO(2SS) where Delta.VO(2SS) is the steady-state response, and tau is the time constant, with the .VO(2) kinetics reflecting intramuscular O(2) uptake (.QO(2)) kinetics, to within 10%. The role of phosphocreatine (PCr) turnover in .QO(2) control can be explored using (31)P-MR spectroscopy, simultaneously with .VO(2). Although tau.VO(2) and tauPCr vary widely among subjects (approx. 20-65 s), they are not significantly different from each other, either at the on- or off-transient. A caveat to interpreting the "well-fit" exponential is that numerous units of similar Delta.VO(2SS) but with a wide tau distribution can also yield a .VO(2) response with an apparent single tau. This tau is, significantly, inversely correlated with lactate threshold and .VO(2max)(but is poorly predictive; a frail stamen, therefore), consistent with tau not characterizing a compartment with uniform kinetics. At higher intensities, the fundamental kinetics become supplemented with a slowly-developing phase, setting .VO(2)on a trajectory towards maximum .VO(2). This slow component is also demonstrable in Delta[PCr]: the decreased efficiency thereby reflecting a predominantly high phosphate-cost of force production rather than a high O(2)-cost of phosphate production. We also propose that the O(2)-deficit for the slow-component is more likely to reflect shifting Delta.VO(2SS) rather than a single one with a single tau.
Kovács, Judit K; Felső, Péter; Makszin, Lilla; Pápai, Zoltán; Horváth, Györgyi; Ábrahám, Hajnalka; Palkovics, Tamás; Böszörményi, Andrea; Emődy, Levente; Schneider, György
2016-10-15
Our study investigated the antimicrobial action of clove (Syzygium aromaticum) essential oil (EO) on the zoonotic pathogen Campylobacter jejuni After confirming the clove essential oil's general antibacterial effect, we analyzed the reference strain Campylobacter jejuni NCTC 11168. Phenotypic, proteomic, and transcriptomic methods were used to reveal changes in cell morphology and functions when exposed to sublethal concentrations of clove EO. The normally curved cells showed markedly straightened and shrunken morphology on the scanning electron micrographs as a result of stress. Although, oxidative stress, as a generally accepted response to essential oils, was also present, the dominance of a general stress response was demonstrated by reverse transcription-PCR (RT-PCR). The results of RT-PCR and two-dimensional (2D) PAGE revealed that clove oil perturbs the expression of virulence-associated genes taking part in the synthesis of flagella, PEB1, PEB4, lipopolysaccharide (LPS), and serine protease. Loss of motility was also detected by a phenotypic test. Bioautographic analysis revealed that besides its major component, eugenol, at least four other spots of clove EO possessed bactericidal activity against C. jejuni Our findings show that clove EO has a marked antibacterial and potential virulence-modulating effect on C. jejuni IMPORTANCE: This study demonstrates that the components of clove essential oil influence not only the expression of general stress genes but also the expression of virulence-associated genes. Based on this finding, alternative strategies can be worked on to control this important foodborne pathogen. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Bayesian kernel machine regression for estimating the health effects of multi-pollutant mixtures.
Bobb, Jennifer F; Valeri, Linda; Claus Henn, Birgit; Christiani, David C; Wright, Robert O; Mazumdar, Maitreyi; Godleski, John J; Coull, Brent A
2015-07-01
Because humans are invariably exposed to complex chemical mixtures, estimating the health effects of multi-pollutant exposures is of critical concern in environmental epidemiology, and to regulatory agencies such as the U.S. Environmental Protection Agency. However, most health effects studies focus on single agents or consider simple two-way interaction models, in part because we lack the statistical methodology to more realistically capture the complexity of mixed exposures. We introduce Bayesian kernel machine regression (BKMR) as a new approach to study mixtures, in which the health outcome is regressed on a flexible function of the mixture (e.g. air pollution or toxic waste) components that is specified using a kernel function. In high-dimensional settings, a novel hierarchical variable selection approach is incorporated to identify important mixture components and account for the correlated structure of the mixture. Simulation studies demonstrate the success of BKMR in estimating the exposure-response function and in identifying the individual components of the mixture responsible for health effects. We demonstrate the features of the method through epidemiology and toxicology applications. © The Author 2014. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Sparse modeling of spatial environmental variables associated with asthma
Chang, Timothy S.; Gangnon, Ronald E.; Page, C. David; Buckingham, William R.; Tandias, Aman; Cowan, Kelly J.; Tomasallo, Carrie D.; Arndt, Brian G.; Hanrahan, Lawrence P.; Guilbert, Theresa W.
2014-01-01
Geographically distributed environmental factors influence the burden of diseases such as asthma. Our objective was to identify sparse environmental variables associated with asthma diagnosis gathered from a large electronic health record (EHR) dataset while controlling for spatial variation. An EHR dataset from the University of Wisconsin’s Family Medicine, Internal Medicine and Pediatrics Departments was obtained for 199,220 patients aged 5–50 years over a three-year period. Each patient’s home address was geocoded to one of 3,456 geographic census block groups. Over one thousand block group variables were obtained from a commercial database. We developed a Sparse Spatial Environmental Analysis (SASEA). Using this method, the environmental variables were first dimensionally reduced with sparse principal component analysis. Logistic thin plate regression spline modeling was then used to identify block group variables associated with asthma from sparse principal components. The addresses of patients from the EHR dataset were distributed throughout the majority of Wisconsin’s geography. Logistic thin plate regression spline modeling captured spatial variation of asthma. Four sparse principal components identified via model selection consisted of food at home, dog ownership, household size, and disposable income variables. In rural areas, dog ownership and renter occupied housing units from significant sparse principal components were associated with asthma. Our main contribution is the incorporation of sparsity in spatial modeling. SASEA sequentially added sparse principal components to Logistic thin plate regression spline modeling. This method allowed association of geographically distributed environmental factors with asthma using EHR and environmental datasets. SASEA can be applied to other diseases with environmental risk factors. PMID:25533437
Sparse modeling of spatial environmental variables associated with asthma.
Chang, Timothy S; Gangnon, Ronald E; David Page, C; Buckingham, William R; Tandias, Aman; Cowan, Kelly J; Tomasallo, Carrie D; Arndt, Brian G; Hanrahan, Lawrence P; Guilbert, Theresa W
2015-02-01
Geographically distributed environmental factors influence the burden of diseases such as asthma. Our objective was to identify sparse environmental variables associated with asthma diagnosis gathered from a large electronic health record (EHR) dataset while controlling for spatial variation. An EHR dataset from the University of Wisconsin's Family Medicine, Internal Medicine and Pediatrics Departments was obtained for 199,220 patients aged 5-50years over a three-year period. Each patient's home address was geocoded to one of 3456 geographic census block groups. Over one thousand block group variables were obtained from a commercial database. We developed a Sparse Spatial Environmental Analysis (SASEA). Using this method, the environmental variables were first dimensionally reduced with sparse principal component analysis. Logistic thin plate regression spline modeling was then used to identify block group variables associated with asthma from sparse principal components. The addresses of patients from the EHR dataset were distributed throughout the majority of Wisconsin's geography. Logistic thin plate regression spline modeling captured spatial variation of asthma. Four sparse principal components identified via model selection consisted of food at home, dog ownership, household size, and disposable income variables. In rural areas, dog ownership and renter occupied housing units from significant sparse principal components were associated with asthma. Our main contribution is the incorporation of sparsity in spatial modeling. SASEA sequentially added sparse principal components to Logistic thin plate regression spline modeling. This method allowed association of geographically distributed environmental factors with asthma using EHR and environmental datasets. SASEA can be applied to other diseases with environmental risk factors. Copyright © 2014 Elsevier Inc. All rights reserved.
Ali, H Raza; Dariush, Aliakbar; Provenzano, Elena; Bardwell, Helen; Abraham, Jean E; Iddawela, Mahesh; Vallier, Anne-Laure; Hiller, Louise; Dunn, Janet A; Bowden, Sarah J; Hickish, Tamas; McAdam, Karen; Houston, Stephen; Irwin, Mike J; Pharoah, Paul D P; Brenton, James D; Walton, Nicholas A; Earl, Helena M; Caldas, Carlos
2016-02-16
There is a need to improve prediction of response to chemotherapy in breast cancer in order to improve clinical management and this may be achieved by harnessing computational metrics of tissue pathology. We investigated the association between quantitative image metrics derived from computational analysis of digital pathology slides and response to chemotherapy in women with breast cancer who received neoadjuvant chemotherapy. We digitised tissue sections of both diagnostic and surgical samples of breast tumours from 768 patients enrolled in the Neo-tAnGo randomized controlled trial. We subjected digital images to systematic analysis optimised for detection of single cells. Machine-learning methods were used to classify cells as cancer, stromal or lymphocyte and we computed estimates of absolute numbers, relative fractions and cell densities using these data. Pathological complete response (pCR), a histological indicator of chemotherapy response, was the primary endpoint. Fifteen image metrics were tested for their association with pCR using univariate and multivariate logistic regression. Median lymphocyte density proved most strongly associated with pCR on univariate analysis (OR 4.46, 95 % CI 2.34-8.50, p < 0.0001; observations = 614) and on multivariate analysis (OR 2.42, 95 % CI 1.08-5.40, p = 0.03; observations = 406) after adjustment for clinical factors. Further exploratory analyses revealed that in approximately one quarter of cases there was an increase in lymphocyte density in the tumour removed at surgery compared to diagnostic biopsies. A reduction in lymphocyte density at surgery was strongly associated with pCR (OR 0.28, 95 % CI 0.17-0.47, p < 0.0001; observations = 553). A data-driven analysis of computational pathology reveals lymphocyte density as an independent predictor of pCR. Paradoxically an increase in lymphocyte density, following exposure to chemotherapy, is associated with a lack of pCR. Computational pathology can provide objective, quantitative and reproducible tissue metrics and represents a viable means of outcome prediction in breast cancer. ClinicalTrials.gov NCT00070278 ; 03/10/2003.
Tanaka, Satoshi; Oka, Hidehiro; Fujii, Kiyotaka; Watanabe, Kaoru; Nagao, Kumi; Kakimoto, Atsushi
2005-09-01
1. O6-methylguanine-DNA methyltransferase (MGMT) mRNA was measured in 50 malignant gliomas that had received 1-(4-amino-2-methyl-5-pyrimidynyl) methyl-3-(2-chloroethyl)-3-nitrosourea hydrochloride (ACNU) after the resection of the tumor by real-time reverse transcription-polymerase chain reaction (RT-PCR) using TaqMan probe. 2. The mean absolute value of MGMTmRNA normalized to the level of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) for 50 tumors was 1.29 x 10(4)+/- 1.28 x 10(4) copy/microg RNA (mean +/- SD). The amount of MGMTmRNA less than 6 x 10(3) copy/microg RNA was the most significant factor in predicting the initial effect of treatment with ACNU by multi-variant regression analysis (p = 0.0157). 3. These results suggest that quantitation of MGMTmRNA is the excellent method for predicting for the effect of ACNU in glioma therapy.
Nguyen, Von D.; Sreenivasan, Nandini; Lam, Eugene; Ayers, Tracy; Kargbo, David; Dafae, Foday; Jambai, Amara; Alemu, Wondimagegnehu; Kamara, Abdul; Islam, M. Sirajul; Stroika, Steven; Bopp, Cheryl; Quick, Robert; Mintz, Eric D.; Brunkard, Joan M.
2014-01-01
During 2012, Sierra Leone experienced a cholera epidemic with 22,815 reported cases and 296 deaths. We conducted a matched case-control study to assess risk factors, enrolling 49 cases and 98 controls. Stool specimens were analyzed by culture, polymerase chain reaction (PCR), and pulsed-field gel electrophoresis (PFGE). Conditional logistic regression found that consuming unsafe water (matched odds ratio [mOR]: 3.4; 95% confidence interval [CI]: 1.1, 11.0), street-vended water (mOR: 9.4; 95% CI: 2.0, 43.7), and crab (mOR: 3.3; 95% CI: 1.03, 10.6) were significant risk factors for cholera infection. Of 30 stool specimens, 13 (43%) showed PCR evidence of toxigenic Vibrio cholerae O1. Six specimens yielded isolates of V. cholerae O1, El Tor; PFGE identified a pattern previously observed in seven countries. We recommended ensuring the quality of improved water sources, promoting household chlorination, and educating street vendors on water handling practices. PMID:24470563
Nguyen, Von D; Sreenivasan, Nandini; Lam, Eugene; Ayers, Tracy; Kargbo, David; Dafae, Foday; Jambai, Amara; Alemu, Wondimagegnehu; Kamara, Abdul; Islam, M Sirajul; Stroika, Steven; Bopp, Cheryl; Quick, Robert; Mintz, Eric D; Brunkard, Joan M
2014-03-01
During 2012, Sierra Leone experienced a cholera epidemic with 22,815 reported cases and 296 deaths. We conducted a matched case-control study to assess risk factors, enrolling 49 cases and 98 controls. Stool specimens were analyzed by culture, polymerase chain reaction (PCR), and pulsed-field gel electrophoresis (PFGE). Conditional logistic regression found that consuming unsafe water (matched odds ratio [mOR]: 3.4; 95% confidence interval [CI]: 1.1, 11.0), street-vended water (mOR: 9.4; 95% CI: 2.0, 43.7), and crab (mOR: 3.3; 95% CI: 1.03, 10.6) were significant risk factors for cholera infection. Of 30 stool specimens, 13 (43%) showed PCR evidence of toxigenic Vibrio cholerae O1. Six specimens yielded isolates of V. cholerae O1, El Tor; PFGE identified a pattern previously observed in seven countries. We recommended ensuring the quality of improved water sources, promoting household chlorination, and educating street vendors on water handling practices.
El-Diasty, Mohamed M; Ahmed, Heba A; Sayour, Ashraf E; El Hofy, Fatma I; Tahoun, Asmaa B M B; Shafik, Saleh M
2016-12-01
The objective of the present study was to estimate the seroprevalence of Brucella spp. in humans and cattle at Sharkia Governorate, Egypt. In addition, identification of Brucella spp. in milk samples by PCR and culture with the evaluation of the risk factors associated with Brucella spp. seroprevalence in humans were carried out. Overall, the seroprevalence of Brucella antibodies in the examined cattle was 23.8%, while in human participants it was 21%. The examination of 205 milk samples using PCR revealed that 6.3% were positive for B. abortus biovar 1 and the results were confirmed by culture methods. Multivariate logistic regression revealed that consumption of unpasteurized dairy products, occupational contact with animals, and knowledge about the disease are risk factors associated with infection in humans. This study documented the endemic status of brucellosis in Egypt. Hygienic measures and increased awareness about the disease are recommended to minimize the spread of infection from animals to humans.
Anti-Pigmentary Effect of (-)-4-Hydroxysattabacin from the Marine-Derived Bacterium Bacillus sp.
Kim, Kyuri; Leutou, Alain S; Jeong, Haein; Kim, Dayoung; Seong, Chi Nam; Nam, Sang-Jip; Lim, Kyung-Min
2017-05-13
Bioactivity-guided isolation of a crude extract from a culture broth of Bacillus sp. has led to the isolation of (-)-4-hydroxysattabacin (1). The inhibitory effect of (-)-4-hydroxysattabacin (1) was investigated on melanogenesis in the murine melanoma cell line, B16F10, and human melanoma cell line, MNT-1, as well as a pigmented 3D-human skin model. (-)-4-Hydroxysattabacin treatment decreased melanin contents in a dose-dependent manner in α-melanocyte stimulating hormone (α-MSH)-stimulated B16F10 cells. Quantitative real time PCR (qRT-PCR) demonstrated that treatment with (-)-4-hydroxysattabacin down-regulated several melanogenic genes, including tyrosinase, tyrosinase-related protein 1 (TRP-1), and tyrosinase-related protein 2 (TRP-2) while their enzymatic activities were unaffected. The anti-melanogenic effects of (-)-4-hydroxysattabacin were further demonstrated in a pigmented 3D human epidermal skin model, MelanodermTM, and manifested as whitening and regression of melanocyte activation in the tissue.
Anti-Pigmentary Effect of (-)-4-Hydroxysattabacin from the Marine-Derived Bacterium Bacillus sp.
Kim, Kyuri; Leutou, Alain S.; Jeong, Haein; Kim, Dayoung; Seong, Chi Nam; Nam, Sang-Jip; Lim, Kyung-Min
2017-01-01
Bioactivity-guided isolation of a crude extract from a culture broth of Bacillus sp. has led to the isolation of (-)-4-hydroxysattabacin (1). The inhibitory effect of (-)-4-hydroxysattabacin (1) was investigated on melanogenesis in the murine melanoma cell line, B16F10, and human melanoma cell line, MNT-1, as well as a pigmented 3D-human skin model. (-)-4-Hydroxysattabacin treatment decreased melanin contents in a dose-dependent manner in α-melanocyte stimulating hormone (α-MSH)-stimulated B16F10 cells. Quantitative real time PCR (qRT–PCR) demonstrated that treatment with (-)-4-hydroxysattabacin down-regulated several melanogenic genes, including tyrosinase, tyrosinase-related protein 1 (TRP-1), and tyrosinase-related protein 2 (TRP-2) while their enzymatic activities were unaffected. The anti-melanogenic effects of (-)-4-hydroxysattabacin were further demonstrated in a pigmented 3D human epidermal skin model, MelanodermTM, and manifested as whitening and regression of melanocyte activation in the tissue. PMID:28505073
Rawat, Vinita; Singh, Rajesh Kumar; Kumar, Ashok; Saxena, Sandip R; Varshney, Umesh; Kumar, Mukesh
2018-04-01
We analysed the epidemiology, clinical and laboratory data of the 168 scrub typhus cases confirmed by a combination of any one of the following: real time polymerase chain reaction (RT-PCR) and/or immunofluorescence assay (IFA) (IgM and/or IgG). The peak season for scrub typhus was from July to October. By multivariate binary logistic regression analysis, the risk of scrub typhus was about four times in those working in occupation related to forest work. Major clinical manifestations were fever (100%), myalgia (65%), cough (51%) and vomiting (46%); major complications were meningitis/meningoencephatilitis (12.5%) and multi-organ failure (MOF) and pneumonia (5.3% each). Laboratory investigations revealed raised aminotranferase levels and thrombocytopenia in most confirmed cases. We conclude that scrub typhus is an important cause of febrile illness in the Kumaon hills of Uttarakhand where this disease had not previously been considered to exist.
Spontaneous Resolution of Intravitreal Steroid-Induced Bilateral Cytomegalovirus Retinitis
Cho, Won Bin; Kim, Hyung Chan
2012-01-01
A 73-year-old woman underwent vitrectomy and intravitreal triamcinolone acetonide (IVTA) of the right eye and cataract surgery with IVTA of the left eye, for bilateral diabetic macular edema. The patient presented with visual loss in both eyes three-months postoperatively. The fundoscopic examination revealed white-yellow, necrotic peripheral lesions in the superotemporal quadrant of both eyes. Although bilateral acute retinal necrosis was suspected, azotemia resulting from diabetic nephropathy limited the use of acyclovir. Antiviral treatment was not started. A sample of the aqueous humor for polymerase chain reaction (PCR) analysis was obtained. One week later, the PCR results indicated the presence of cytomegalovirus (CMV). Since the retinal lesions did not progress and did not threaten the macula, the patient was followed without treatment for CMV. The retinal lesions progressively regressed and completely resolved in both eyes by six months of follow-up. Patients with IVTA-induced CMV retinitis may not require systemic treatment with ganciclovir. PMID:22511845
Estimated long-term outdoor air pollution concentrations in a cohort study
NASA Astrophysics Data System (ADS)
Beelen, Rob; Hoek, Gerard; Fischer, Paul; Brandt, Piet A. van den; Brunekreef, Bert
Several recent studies associated long-term exposure to air pollution with increased mortality. An ongoing cohort study, the Netherlands Cohort Study on Diet and Cancer (NLCS), was used to study the association between long-term exposure to traffic-related air pollution and mortality. Following on a previous exposure assessment study in the NLCS, we improved the exposure assessment methods. Long-term exposure to nitrogen dioxide (NO 2), nitrogen oxide (NO), black smoke (BS), and sulphur dioxide (SO 2) was estimated. Exposure at each home address ( N=21 868) was considered as a function of a regional, an urban and a local component. The regional component was estimated using inverse distance weighed interpolation of measurement data from regional background sites in a national monitoring network. Regression models with urban concentrations as dependent variables, and number of inhabitants in different buffers and land use variables, derived with a Geographic Information System (GIS), as predictor variables were used to estimate the urban component. The local component was assessed using a GIS and a digital road network with linked traffic intensities. Traffic intensity on the nearest road and on the nearest major road, and the sum of traffic intensity in a buffer of 100 m around each home address were assessed. Further, a quantitative estimate of the local component was estimated. The regression models to estimate the urban component explained 67%, 46%, 49% and 35% of the variances of NO 2, NO, BS, and SO 2 concentrations, respectively. Overall regression models which incorporated the regional, urban and local component explained 84%, 44%, 59% and 56% of the variability in concentrations for NO 2, NO, BS and SO 2, respectively. We were able to develop an exposure assessment model using GIS methods and traffic intensities that explained a large part of the variations in outdoor air pollution concentrations.
Poisson Mixture Regression Models for Heart Disease Prediction.
Mufudza, Chipo; Erol, Hamza
2016-01-01
Early heart disease control can be achieved by high disease prediction and diagnosis efficiency. This paper focuses on the use of model based clustering techniques to predict and diagnose heart disease via Poisson mixture regression models. Analysis and application of Poisson mixture regression models is here addressed under two different classes: standard and concomitant variable mixture regression models. Results show that a two-component concomitant variable Poisson mixture regression model predicts heart disease better than both the standard Poisson mixture regression model and the ordinary general linear Poisson regression model due to its low Bayesian Information Criteria value. Furthermore, a Zero Inflated Poisson Mixture Regression model turned out to be the best model for heart prediction over all models as it both clusters individuals into high or low risk category and predicts rate to heart disease componentwise given clusters available. It is deduced that heart disease prediction can be effectively done by identifying the major risks componentwise using Poisson mixture regression model.
Poisson Mixture Regression Models for Heart Disease Prediction
Erol, Hamza
2016-01-01
Early heart disease control can be achieved by high disease prediction and diagnosis efficiency. This paper focuses on the use of model based clustering techniques to predict and diagnose heart disease via Poisson mixture regression models. Analysis and application of Poisson mixture regression models is here addressed under two different classes: standard and concomitant variable mixture regression models. Results show that a two-component concomitant variable Poisson mixture regression model predicts heart disease better than both the standard Poisson mixture regression model and the ordinary general linear Poisson regression model due to its low Bayesian Information Criteria value. Furthermore, a Zero Inflated Poisson Mixture Regression model turned out to be the best model for heart prediction over all models as it both clusters individuals into high or low risk category and predicts rate to heart disease componentwise given clusters available. It is deduced that heart disease prediction can be effectively done by identifying the major risks componentwise using Poisson mixture regression model. PMID:27999611
Quantitative determination of wool in textile by near-infrared spectroscopy and multivariate models.
Chen, Hui; Tan, Chao; Lin, Zan
2018-08-05
The wool content in textiles is a key quality index and the corresponding quantitative analysis takes an important position due to common adulterations in both raw and finished textiles. Conventional methods are maybe complicated, destructive, time-consuming, environment-unfriendly. Developing a quick, easy-to-use and green alternative method is interesting. The work focuses on exploring the feasibility of combining near-infrared (NIR) spectroscopy and several partial least squares (PLS)-based algorithms and elastic component regression (ECR) algorithms for measuring wool content in textile. A total of 108 cloth samples with wool content ranging from 0% to 100% (w/w) were collected and all the compositions are really existent in the market. The dataset was divided equally into the training and test sets for developing and validating calibration models. When using local PLS, the original spectrum axis was split into 20 sub-intervals. No obvious difference of performance can be seen for the local PLS models. The ECR model is comparable or superior to the other models due its flexibility, i.e., being transition state from PCR to PLS. It seems that ECR combined with NIR technique may be a potential method for determining wool content in textile products. In addition, it might have regulatory advantages to avoid time-consuming and environmental-unfriendly chemical analysis. Copyright © 2018 Elsevier B.V. All rights reserved.
El-Gindy, Alaa; Emara, Samy; Shaaban, Heba
2007-02-19
Three methods are developed for the determination of two multicomponent mixtures containing guaiphenesine (GU) with salbutamol sulfate (SL), methylparaben (MP) and propylparaben (PP) [mixture 1]; and acephylline piperazine (AC) with bromhexine hydrochloride (BX), methylparaben (MP) and propylparaben (PP) [mixture 2]. The resolution of the two multicomponent mixtures has been accomplished by using numerical spectrophotometric methods such as partial least squares (PLS-1) and principal component regression (PCR) applied to UV absorption spectra of the two mixtures. In addition HPLC method was developed using a RP 18 column at ambient temperature with mobile phase consisting of acetonitrile-0.05 M potassium dihydrogen phosphate, pH 4.3 (60:40, v/v), with UV detection at 243 nm for mixture 1, and mobile phase consisting of acetonitrile-0.05 M potassium dihydrogen phosphate, pH 3 (50:50, v/v), with UV detection at 245 nm for mixture 2. The methods were validated in terms of accuracy, specificity, precision and linearity in the range of 20-60 microg ml(-1) for GU, 1-3 microg ml(-1) for SL, 20-80 microg ml(-1) for AC, 0.2-1.8 microgml(-1) for PP and 1-5 microg ml(-1) for BX and MP. The proposed methods were successfully applied for the determination of the two multicomponent combinations in laboratory prepared mixtures and commercial syrups.
Kaestli, Mirjam; Mayo, Mark; Harrington, Glenda; Ward, Linda; Watt, Felicity; Hill, Jason V.; Cheng, Allen C.; Currie, Bart J.
2009-01-01
Background The soil-dwelling saprophyte bacterium Burkholderia pseudomallei is the cause of melioidosis, a severe disease of humans and animals in southeast Asia and northern Australia. Despite the detection of B. pseudomallei in various soil and water samples from endemic areas, the environmental habitat of B. pseudomallei remains unclear. Methodology/Principal Findings We performed a large survey in the Darwin area in tropical Australia and screened 809 soil samples for the presence of these bacteria. B. pseudomallei were detected by using a recently developed and validated protocol involving soil DNA extraction and real-time PCR targeting the B. pseudomallei–specific Type III Secretion System TTS1 gene cluster. Statistical analyses such as multivariable cluster logistic regression and principal component analysis were performed to assess the association of B. pseudomallei with environmental factors. The combination of factors describing the habitat of B. pseudomallei differed between undisturbed sites and environmentally manipulated areas. At undisturbed sites, the occurrence of B. pseudomallei was found to be significantly associated with areas rich in grasses, whereas at environmentally disturbed sites, B. pseudomallei was associated with the presence of livestock animals, lower soil pH and different combinations of soil texture and colour. Conclusions/Significance This study contributes to the elucidation of environmental factors influencing the occurrence of B. pseudomallei and raises concerns that B. pseudomallei may spread due to changes in land use. PMID:19156200
Study on rapid valid acidity evaluation of apple by fiber optic diffuse reflectance technique
NASA Astrophysics Data System (ADS)
Liu, Yande; Ying, Yibin; Fu, Xiaping; Jiang, Xuesong
2004-03-01
Some issues related to nondestructive evaluation of valid acidity in intact apples by means of Fourier transform near infrared (FTNIR) (800-2631nm) method were addressed. A relationship was established between the diffuse reflectance spectra recorded with a bifurcated optic fiber and the valid acidity. The data were analyzed by multivariate calibration analysis such as partial least squares (PLS) analysis and principal component regression (PCR) technique. A total of 120 Fuji apples were tested and 80 of them were used to form a calibration data set. The influence of data preprocessing and different spectra treatments were also investigated. Models based on smoothing spectra were slightly worse than models based on derivative spectra and the best result was obtained when the segment length was 5 and the gap size was 10. Depending on data preprocessing and multivariate calibration technique, the best prediction model had a correlation efficient (0.871), a low RMSEP (0.0677), a low RMSEC (0.056) and a small difference between RMSEP and RMSEC by PLS analysis. The results point out the feasibility of FTNIR spectral analysis to predict the fruit valid acidity non-destructively. The ratio of data standard deviation to the root mean square error of prediction (SDR) is better to be less than 3 in calibration models, however, the results cannot meet the demand of actual application. Therefore, further study is required for better calibration and prediction.
Rebelo, Ana Cristina; Verlengia, Rozangela; Kunz, Vandeni; Tamburus, Nayara; Cerda, Alvaro; Hirata, Rosario; Hirata, Mario; Silva, Ester
2012-01-01
This study examined the association of estrogen receptor alpha gene (ESR1) polymorphisms with cardiorespiratory and metabolic parameters in young women. In total, 354 healthy women were selected for cardiopulmonary exercise testing and short-term heart rate (HR) variability (HRV) evaluation. The HRV analysis was determined by the temporal indices rMSSD (square root of the mean squared differences of successive R–R intervals (RRi) divided by the number of RRi minus one), SDNN (root mean square of differences from mean RRi, divided by the number of RRi) and power spectrum components by low frequency (LF), high frequency (HF) and LF/HF ratio. Blood samples were obtained for serum lipids, estradiol and DNA extraction. ESR1 rs2234693 and rs9340799 polymorphisms were analyzed by PCR and fragment restriction analysis. HR and oxygen uptake (VO2) values did not differ between the ESR1 polymorphisms with respect to autonomic modulation. We not find a relationship between ESR1 T–A, T–G, C–A and C–G haplotypes and cardiorespiratory and metabolic variables. Multiple linear regression analysis demonstrated that VO2, total cholesterol and triglycerides influence HRV (p < 0.05). The results suggest that ESR1 variants have no effect on cardiorespiratory and metabolic variables, while HRV indices are influenced by aerobic capacity and lipids in healthy women. PMID:23202974
Dalla Valle, L; Toffolo, V; Lamprecht, M; Maltese, C; Bovo, G; Belvedere, P; Colombo, L
2005-10-31
The aim of the present work was to develop two new independent SYBR Green I-based real-time PCR assays for both detection and quantification of betanodavirus, an RNA virus that infects several species of marine teleost fish causing massive mortalities in larvae and juveniles. The assays utilized two pairs of primers targeting highly conserved regions of both the RNA molecules forming the betanodavirus genome: RNA1 encoding the RNA-dependent RNA polymerase (RdRP) and RNA2 encoding the coat protein (CP). The specificity of amplifications was monitored by the melting analysis and agarose gel electrophoresis of the amplified products. The applicability of these assays was confirmed with 21 betanodavirus strains, covering all the four main clades. In addition, a BLAST (NCBI) search with the primer sequences showed no genomic cross-reactivity with other viruses. The new assays were able to quantify concentrations of betanodavirus genes ranging from 10(1) to 10(8) copies per reaction. The intra-assay coefficients of variation (CV) of threshold cycle (Ct) values of the assays were 1.5% and 1.4% for CP and RdRP RNAs, respectively. The inter-assay CVs of Ct values were 2.3% and 2.4% for CP and RdRP RNAs, respectively. Moreover, regression analysis showed a significant correlation (R2>0.97) between genome number, as determined by real-time PCR assays and the corresponding virus titer expressed as TCID50/ml of two different betanodavirus strains propagated in cell culture. The two assays were compared with a previously established one-step RT-PCR assay and with the classical virus isolation test and found to be more sensitive. In conclusion, the developed real-time RT-PCR assays are a reliable, specific and sensitive tool for the quantitative diagnosis of betanodavirus.
Fei, F; Messina, C; Slaets, L; Chakiba, C; Cameron, D; Bogaerts, J; Bonnefoi, H
2015-02-01
Although achieving a pathological complete response (pCR) after neoadjuvant chemotherapy (NACT) in breast cancer predicts a better outcome, some patients still relapse. The objectives of this study were to describe the types of events in this group of patients and to identify predictive factors for relapse. Patients with large operable or locally advanced breast cancers (T4d tumours were excluded) were randomised to receive either six cycles of anthracycline-based chemotherapy or three cycles of docetaxel followed by three cycles of eprirubicin/docetaxel. pCR was defined as no evidence of residual invasive cancer (or very few scattered tumour cells) in the primary tumour and axillary lymph nodes at surgery. Two Cox regression analyses were performed to identify predictive factors of relapse: one for recurrence-free interval (RFI) and one for distant recurrence-free interval (DRFI). Out of 283 eligible patients who achieved a pCR, 40 (14.1%) and 28 (9.9%) presented an event of interest for the RFI and DRFI analyses, respectively. Five-year RFI, DRFI and overall survival (OS) were 85.3% (95% confidence interval (CI), 80.1-89.3), 89.6% (95% CI, 85.0-92.9) and 91.9% (95% CI, 87.2-94.9), respectively. No predictors for RFI after pCR were identified. For DRFI, tumour size was the only predictor: Hazard ratio (HR) T3 versus T1-2=3.62 (95% CI, 1.66-7.89); HR T4 versus T1-2: HR, 2.80 (95% CI, 0.62-12.64) p=0.0048. In this study, clinical tumour size emerged as the only predictor for DRFI after pCR, with T3 and T4 tumours having an increased risk for distant recurrence compared to T1-2 tumours. Copyright © 2014 Elsevier Ltd. All rights reserved.
Guinta, Margaret M; Bunnell, Kristen; Harrington, Amanda; Bleasdale, Susan; Danziger, Larry; Wenzler, Eric
2017-12-04
The clinical outcomes and cost implications of a diagnostic shift from an EIA- to PCR-based assay for Clostridium difficile infection (CDI) have not been completely described in the literature. The impact of the PCR-based assay on the incidence and duration of CDI therapy was compared to the EIA assay for patients with a negative CDI diagnostic result. Secondary clinical and economic outcomes were also evaluated. Independent predictors of receipt of antibiotic therapy were assessed via logistic regression. 141 EIA and 140 PCR patients were included. Significantly more patients were started or continued on anti-CDI antibiotic therapy after a known negative assay result in the EIA group (26 patients vs. 8 patients, P = 0.002). Duration of antibiotic therapy after a known negative result was significantly shorter in the PCR group (1 vs. 4 days, P = 0.029) and a 23% reduction in the number of tests obtained per patient was observed (1.41 ± 0.86 vs. 1.82 ± 1.35, P = 0.007). The over fourfold difference in per-test cost of the EIA assay ($8.33 vs. $42.86, P < 0.0001) was offset by the overall medication costs required for the increased treatment in the EIA group ($546.60 vs. $188.96, P = 0.191). Utilization of the EIA-based CDI assay was associated with increased odds of CDI treatment after a negative test (aOR 4.71, 95% CI 1.93-11.46, P = 0.001). The transition from an EIA to PCR-based assay for diagnosing CDI resulted in a significant decrease in the number of patients treated and the duration of treatment in response to a negative test result. This significant decrease in treatment resulted in decreased costs offsetting the utilization of a more expensive molecular test for patients with a negative CDI diagnostic result.
NASA Technical Reports Server (NTRS)
Kalton, G.
1983-01-01
A number of surveys were conducted to study the relationship between the level of aircraft or traffic noise exposure experienced by people living in a particular area and their annoyance with it. These surveys generally employ a clustered sample design which affects the precision of the survey estimates. Regression analysis of annoyance on noise measures and other variables is often an important component of the survey analysis. Formulae are presented for estimating the standard errors of regression coefficients and ratio of regression coefficients that are applicable with a two- or three-stage clustered sample design. Using a simple cost function, they also determine the optimum allocation of the sample across the stages of the sample design for the estimation of a regression coefficient.
Low-power microwave-mediated heating for microchip-based PCR.
Marchiarullo, Daniel J; Sklavounos, Angelique H; Oh, Kyudam; Poe, Brian L; Barker, N Scott; Landers, James P
2013-09-07
Microwave energy has been used to rapidly heat food and drinks for decades, in addition to assisting other chemical reactions. However, only recently has microwave energy been applied in microfluidic systems to heat solution in reaction chambers, in particular, the polymerase chain reaction (PCR). One of the difficulties in developing microwave-mediated heating on a microchip is the construction of the appropriate architecture for delivery of the energy to specific micro-areas on the microchip. This work employs commercially-available microwave components commonly used in the wireless communications industry to generate a microwave signal, and a microstrip transmission line to deliver the energy to a 1 μL reaction chamber fabricated in plastic microdevices. A model was developed to create transmission lines that would optimally transmit energy to the reaction chamber at a given frequency, minimizing energy usage while focusing microwave delivery to the target chamber. Two different temperature control methods were demonstrated, varying microwave power or frequency. This system was used to amplify a fragment of the lambda-phage genome, thereby demonstrating its potential for integration into a portable PCR system.
Construction of mathematical model for measuring material concentration by colorimetric method
NASA Astrophysics Data System (ADS)
Liu, Bing; Gao, Lingceng; Yu, Kairong; Tan, Xianghua
2018-06-01
This paper use the method of multiple linear regression to discuss the data of C problem of mathematical modeling in 2017. First, we have established a regression model for the concentration of 5 substances. But only the regression model of the substance concentration of urea in milk can pass through the significance test. The regression model established by the second sets of data can pass the significance test. But this model exists serious multicollinearity. We have improved the model by principal component analysis. The improved model is used to control the system so that it is possible to measure the concentration of material by direct colorimetric method.
USDA-ARS?s Scientific Manuscript database
Phosphorus (P) is often a limiting macronutrient because of its low availability in soils. White lupin (Lupinus albus L.) plants are well adapted to growth under P-deficient conditions. White lupin acclimation to P-deficiency includes changes in root architecture and enhanced expression of numerous ...
DNA-based authentication method for detection of yak (Bos grunniens) in meat products.
Wang, Ping; Hu, Yue; Yang, Hairong; Han, Jiangxun; Zhao, Yongsheng; Chen, Ying
2013-01-01
A TaqMan probe real-time PCR method was developed for rapid detection of yak component in raw and cooked meat products. Specific primers and TaqMan probes of yak (Bos grunniens) were designed in the cytochrome b gene. The specificity of the method was evaluated using pure meat of eight yak breeds (Jiulong, Qinghai plateau, Maiwa, Gannan, Bazhou, Sibu, Zhongdian, and Jiali) samples and nine non-Bos grunniens animals (sheep, goat, pig, chicken, cattle, water buffalo, donkey, horse, and rabbit). DNA showed no cross-reaction with non-Bos grunniens animal DNA. This method proved to be sensitive in detecting the presence of low levels of target DNA obtained from 0.001% (w/w) component in a mixed meat sample. The method also successfully identified commercial yak meat products. The results showed that some yak meat might be involved in business fraud by using cattle meat (in this paper, cattle meat means meat of Bos taurus) instead of yak meat. In conclusion, real-time PCR assay used in this study was shown to be a rapid and sensitive method for detection of yak DNA in fresh meat and cooked meat products.
Suppression of hedgehog signaling regulates hepatic stellate cell activation and collagen secretion.
Li, Tao; Leng, Xi-Sheng; Zhu, Ji-Ye; Wang, Gang
2015-01-01
Hepatic stellate cells (HSCs) play an important role in liver fibrosis. This study investigates the expression of hedgehog in HSC and the role of hedgehog signaling on activation and collagen secretion of HSC. Liver ex vivo perfusion with collagenase IV and density gradient centrifugation were used to isolate HSC. Expression of hedgehog signaling components Ihh, Smo, Ptc, Gli2 and Gli3 in HSC were detected by RT-PCR. Hedgehog siRNA vectors targeting Ihh, Smo and Gli2 were constructed and transfected into HSC respectively. Suppression of hedgehog signaling were detected by SYBR Green fluorescence quantitative RT-PCR. Effects of hedgehog signaling inhibition on HSC activation and collagen I secretion were analyzed. Hedgehog signaling components Ihh, Smo, Ptc, Gli2 and Gli3 were expressed in HSC. siRNA vectors targeting Ihh, Smo and Gli2 were successfully constructed and decreased target gene expression. Suppression of hedgehog signaling significantly decreased the expression of α-SMA in HSC (P<0.01). Collagen type I secretion of HSC were also significantly decreased (P<0.01). In summary, HSC activation and collagen secretion can be regulated by hedgehog signaling. Hedgehog may play a role in the pathogenesis of liver fibrosis.
Baumstummler, A; Lehmann, D; Janjic, N; Ochsner, UA
2014-01-01
Slow off-rate modified aptamer (SOMAmer) reagents were generated to several Staphylococcus aureus cell surface-associated proteins via SELEX with multiple modified DNA libraries using purified recombinant or native proteins. High-affinity binding agents with sub-nanomolar Kd's were obtained for staphylococcal protein A (SpA), clumping factors (ClfA, ClfB), fibronectin-binding proteins (FnbA, FnbB) and iron-regulated surface determinants (Isd). Further screening revealed several SOMAmers that specifically bound to Staph. aureus cells from all strains that were tested, but not to other staphylococci or other bacteria. SpA and ClfA SOMAmers proved useful for the selective capture and enrichment of Staph. aureus cells, as shown by culture and PCR, leading to improved limits of detection and efficient removal of PCR inhibitors. Detection of Staph. aureus cells was enhanced by several orders of magnitude when the bacterial cell surface was coated with SOMAmers followed by qPCR of the SOMAmers. Furthermore, fluorescence-labelled SpA SOMAmers demonstrated their utility as direct detection agents in flow cytometry. Significance and Impact of the Study Monitoring for microbial contamination of food, water, nonsterile products or the environment is typically based on culture, PCR or antibodies. Aptamers that bind with high specificity and affinity to well-conserved cell surface epitopes represent a promising novel type of reagents to detect bacterial cells without the need for culture or cell lysis, including for the capture and enrichment of bacteria present at low cell densities and for the direct detection via qPCR or fluorescent staining. PMID:24935714
Zengerle, Roland; von Stetten, Felix; Schmidt, Ulrike
2015-01-01
Nested PCR remains a labor-intensive and error-prone biomolecular analysis. Laboratory workflow automation by precise control of minute liquid volumes in centrifugal microfluidic Lab-on-a-Chip systems holds great potential for such applications. However, the majority of these systems require costly custom-made processing devices. Our idea is to augment a standard laboratory device, here a centrifugal real-time PCR thermocycler, with inbuilt liquid handling capabilities for automation. We have developed a microfluidic disk segment enabling an automated nested real-time PCR assay for identification of common European animal groups adapted to forensic standards. For the first time we utilize a novel combination of fluidic elements, including pre-storage of reagents, to automate the assay at constant rotational frequency of an off-the-shelf thermocycler. It provides a universal duplex pre-amplification of short fragments of the mitochondrial 12S rRNA and cytochrome b genes, animal-group-specific main-amplifications, and melting curve analysis for differentiation. The system was characterized with respect to assay sensitivity, specificity, risk of cross-contamination, and detection of minor components in mixtures. 92.2% of the performed tests were recognized as fluidically failure-free sample handling and used for evaluation. Altogether, augmentation of the standard real-time thermocycler with a self-contained centrifugal microfluidic disk segment resulted in an accelerated and automated analysis reducing hands-on time, and circumventing the risk of contamination associated with regular nested PCR protocols. PMID:26147196
A microfluidic approach to parallelized transcriptional profiling of single cells.
Sun, Hao; Olsen, Timothy; Zhu, Jing; Tao, Jianguo; Ponnaiya, Brian; Amundson, Sally A; Brenner, David J; Lin, Qiao
2015-12-01
The ability to correlate single-cell genetic information with cellular phenotypes is of great importance to biology and medicine, as it holds the potential to gain insight into disease pathways that is unavailable from ensemble measurements. We present a microfluidic approach to parallelized, rapid, quantitative analysis of messenger RNA from single cells via RT-qPCR. The approach leverages an array of single-cell RT-qPCR analysis units formed by a set of parallel microchannels concurrently controlled by elastomeric pneumatic valves, thereby enabling parallelized handling and processing of single cells in a drastically simplified operation procedure using a relatively small number of microvalves. All steps for single-cell RT-qPCR, including cell isolation and immobilization, cell lysis, mRNA purification, reverse transcription and qPCR, are integrated on a single chip, eliminating the need for off-chip manual cell and reagent transfer and qPCR amplification as commonly used in existing approaches. Additionally, the approach incorporates optically transparent microfluidic components to allow monitoring of single-cell trapping without the need for molecular labeling that can potentially alter the targeted gene expression and utilizes a polycarbonate film as a barrier against evaporation to minimize the loss of reagents at elevated temperatures during the analysis. We demonstrate the utility of the approach by the transcriptional profiling for the induction of the cyclin-dependent kinase inhibitor 1a and the glyceraldehyde 3-phosphate dehydrogenase in single cells from the MCF-7 breast cancer cell line. Furthermore, the methyl methanesulfonate is employed to allow measurement of the expression of the genes in individual cells responding to a genotoxic stress.
Lembke, Bryndon D.; Ramachandran, Kalpana; Body, Barbara A.; Nye, Melinda B.; Rivers, Charles A.; Schwebke, Jane R.
2012-01-01
Quantitative PCR assays were developed for 4 organisms reported previously to be useful positive indicators for the diagnosis of bacterial vaginosis (BV)—Atopobium vaginae, Bacterial Vaginosis-Associated Bacterium 2 (BVAB-2), Gardnerella vaginalis, and Megasphaera-1—and a single organism (Lactobacillus crispatus) that has been implicated as a negative indicator for BV. Vaginal samples (n = 169), classified as positive (n = 108) or negative (n = 61) for BV based on a combination of the Nugent Gram stain score and Amsel clinical criteria, were analyzed for the presence and quantity of each of the marker organisms, and the results were used to construct a semiquantitative, multiplex PCR assay for BV based on detection of 3 positive indicator organisms (A. vaginae, BVAB-2, and Megasphaera-1) and classification of samples using a combinatorial scoring system. The prototype BV PCR assay was then used to analyze the 169-member developmental sample set and, in a prospective, blinded manner, an additional 227 BV-classified vaginal samples (110 BV-positive samples and 117 BV-negative samples). The BV PCR assay demonstrated a sensitivity of 96.7% (202/209), a specificity of 92.2% (153/166), a positive predictive value of 94.0%, and a negative predictive value of 95.6%, with 21 samples (5.3%) classified as indeterminate for BV. This assay provides a reproducible and objective means of evaluating critical components of the vaginal microflora in women with signs and symptoms of vaginitis and is comparable in diagnostic accuracy to the conventional gold standard for diagnosis of BV. PMID:22535982
González-Costa, Juan José; Reigosa, Manuel Joaquín; Matías, José María; Fernández-Covelo, Emma
2017-01-01
This study determines the influence of the different soil components and of the cation-exchange capacity on the adsorption and retention of different heavy metals: cadmium, chromium, copper, nickel, lead and zinc. In order to do so, regression models were created through decision trees and the importance of soil components was assessed. Used variables were: humified organic matter, specific cation-exchange capacity, percentages of sand and silt, proportions of Mn, Fe and Al oxides and hematite, and the proportion of quartz, plagioclase and mica, and the proportions of the different clays: kaolinite, vermiculite, gibbsite and chlorite. The most important components in the obtained models were vermiculite and gibbsite, especially for the adsorption of cadmium and zinc, while clays were less relevant. Oxides are less important than clays, especially for the adsorption of chromium and lead and the retention of chromium, copper and lead. PMID:28072849
On the influence of high-pass filtering on ICA-based artifact reduction in EEG-ERP.
Winkler, Irene; Debener, Stefan; Müller, Klaus-Robert; Tangermann, Michael
2015-01-01
Standard artifact removal methods for electroencephalographic (EEG) signals are either based on Independent Component Analysis (ICA) or they regress out ocular activity measured at electrooculogram (EOG) channels. Successful ICA-based artifact reduction relies on suitable pre-processing. Here we systematically evaluate the effects of high-pass filtering at different frequencies. Offline analyses were based on event-related potential data from 21 participants performing a standard auditory oddball task and an automatic artifactual component classifier method (MARA). As a pre-processing step for ICA, high-pass filtering between 1-2 Hz consistently produced good results in terms of signal-to-noise ratio (SNR), single-trial classification accuracy and the percentage of `near-dipolar' ICA components. Relative to no artifact reduction, ICA-based artifact removal significantly improved SNR and classification accuracy. This was not the case for a regression-based approach to remove EOG artifacts.
Differentiating Botulinum Neurotoxin-Producing Clostridia with a Simple, Multiplex PCR Assay.
Williamson, Charles H D; Vazquez, Adam J; Hill, Karen; Smith, Theresa J; Nottingham, Roxanne; Stone, Nathan E; Sobek, Colin J; Cocking, Jill H; Fernández, Rafael A; Caballero, Patricia A; Leiser, Owen P; Keim, Paul; Sahl, Jason W
2017-09-15
Diverse members of the genus Clostridium produce botulinum neurotoxins (BoNTs), which cause a flaccid paralysis known as botulism. While multiple species of clostridia produce BoNTs, the majority of human botulism cases have been attributed to Clostridium botulinum groups I and II. Recent comparative genomic studies have demonstrated the genomic diversity within these BoNT-producing species. This report introduces a multiplex PCR assay for differentiating members of C. botulinum group I, C. sporogenes , and two major subgroups within C. botulinum group II. Coding region sequences unique to each of the four species/subgroups were identified by in silico analyses of thousands of genome assemblies, and PCR primers were designed to amplify each marker. The resulting multiplex PCR assay correctly assigned 41 tested isolates to the appropriate species or subgroup. A separate PCR assay to determine the presence of the ntnh gene (a gene associated with the botulinum neurotoxin gene cluster) was developed and validated. The ntnh gene PCR assay provides information about the presence or absence of the botulinum neurotoxin gene cluster and the type of gene cluster present ( ha positive [ ha + ] or orfX + ). The increased availability of whole-genome sequence data and comparative genomic tools enabled the design of these assays, which provide valuable information for characterizing BoNT-producing clostridia. The PCR assays are rapid, inexpensive tests that can be applied to a variety of sample types to assign isolates to species/subgroups and to detect clostridia with botulinum neurotoxin gene ( bont ) clusters. IMPORTANCE Diverse clostridia produce the botulinum neurotoxin, one of the most potent known neurotoxins. In this study, a multiplex PCR assay was developed to differentiate clostridia that are most commonly isolated in connection with human botulism cases: C. botulinum group I, C. sporogenes , and two major subgroups within C. botulinum group II. Since BoNT-producing and nontoxigenic isolates can be found in each species, a PCR assay to determine the presence of the ntnh gene, which is a universally present component of bont gene clusters, and to provide information about the type ( ha + or orfX + ) of bont gene cluster present in a sample was also developed. The PCR assays provide simple, rapid, and inexpensive tools for screening uncharacterized isolates from clinical or environmental samples. The information provided by these assays can inform epidemiological studies, aid with identifying mixtures of isolates and unknown isolates in culture collections, and confirm the presence of bacteria of interest. Copyright © 2017 Williamson et al.
Methods for molecular surveillance of influenza.
Wang, Ruixue; Taubenberger, Jeffery K
2010-05-01
Molecular-based techniques for detecting influenza viruses have become an integral component of human and animal surveillance programs in the last two decades. The recent pandemic of the swine-origin influenza A virus (H1N1) and the continuing circulation of highly pathogenic avian influenza A virus (H5N1) further stress the need for rapid and accurate identification and subtyping of influenza viruses for surveillance, outbreak management, diagnosis and treatment. There has been remarkable progress on the detection and molecular characterization of influenza virus infections in clinical, mammalian, domestic poultry and wild bird samples in recent years. The application of these techniques, including reverse transcriptase-PCR, real-time PCR, microarrays and other nucleic acid sequencing-based amplifications, have greatly enhanced the capability for surveillance and characterization of influenza viruses.
NASA Astrophysics Data System (ADS)
Sutanudjaja, Edwin H.; van Beek, Ludovicus P. H.; Wada, Yoshihide; Wisser, Dominik; de Graaf, Inge E. M.; Straatsma, Menno W.; Bierkens, Marc F. P.
2014-05-01
PCR-GLOBWB (PCRaster Global Water Balance) is a grid-based global hydrological model developed at the Department of Physical Geography, Utrecht University. For each grid cell, PCR-GLOBWB simulates moisture storage in vertically stacked soil layers, as well as the water exchange to the atmosphere and underlying groundwater reservoir. Exchange to the atmosphere comprises of precipitation, evaporation and transpiration, as well as snow accumulation and melt. All fluxes are all simulated by considering vegetation phenology and sub-grid variations in elevation, land cover and soil saturation. The model includes physically-based schemes for runoff-infiltration partitioning, interflow, groundwater recharge and baseflow, as well as river routing of discharge. Here we present and summarize the latest developments of PCR-GLOBWB. The new version of the model, PCR-GLOBWB 2.0, now runs at a spatial resolution of 5 arc min (about 10 km at the equator) and supersedes the previous generation of the model (30 arc min PCR-GLOBWB 1.0, van Beek et al., 2011). PCR-GLOBWB 2.0 consolidates all components that have been introduced since PCR-GLOWB 1.0 was first published (2011). Examples of these new components are: A comprehensive water demand and irrigation module (Wada et al., 2012). A dynamic attribution and return flow of water demand to surface water and groundwater resources (de Graaf et al., 2013). An advanced surface water routing scheme with wetland, lakes and floodplains of variable extent, thus simulating flooding and flood wave attenuation (Winsemius et al., 2013). An online scheme for dynamic withdrawal, allocation and consumptive use of groundwater and surface water resources, including a progressive introduction of reservoirs (Wada et al., 2013). Further development will include the inclusion of a dynamic reservoir operation/optimization scheme and a MODFLOW lateral groundwater flow module (Sutanudjaja et al., 2011; Sutanudjaja et al., 2014). Also, scripts used for deriving the parameterization from global data sources for the original model have been coupled with the model, resulting in a near-scalable model that facilitates its application for different domains and at varying resolutions. Results are very promising. When comparing simulated discharges to those observed by GRDC stations, the coefficient-of-determination is high. Human impacts, altering the seasonal and inter-annual variability of terrestrial water storage (TWS) signals, are well simulated by PCR-GLOBWB 2.0 and evident in the validation of simulated TWS with GRACE satellite observation (Tapley et al., 2004). Moreover, the simulation results of PCR-GLOBWB 2.0 compare well to several other remote sensing products, such as the soil moisture datasets of ERS/MetOp (Wagner et al., 1999) and AMSR-E (de Jeu and Owe, 2003), as well as the GLEAM evaporation product (Miralles et al., 2011). References: de Graaf et al., Advances in Water Resources (2013), http://dx.doi.org/10.1016/j.advwatres.2013.12.002 de Jeu and Owe, International Journal of Remote Sensing (2003), http://dx.doi.org/10.1080/0143116031000095934 Miralles et al., Hydrology and Earth System Sciences (2011), http://dx.doi.org/10.5194/hess-15-967-2011 Sutanudjaja et al., Hydrology and Earth System Sciences (2011), http://dx.doi.org/10.5194/hess-15-2913-2011 Sutanudjaja et al., Water Resources Research (2014), http://dx.doi.org/10.1002/2013WR013807 Tapley et al., Science (2004), http://dx.doi.org/10.1126/science.1099192 van Beek et al., Water Resources Research (2011), http://dx.doi.org/10.1029/2010WR009791 Wada et al., Water Resources Research (2012), http://dx.doi.org/10.1029/2011WR010562 Wada et al., Earth System Dynamics Discussion (2013), http://dx.doi.org/10.5194/esdd-4-355-2013 Wagner et al., Remote Sensing of Environment (1999), http://dx.doi.org/10.1016/S0034-4257(99)00036-X Winsemius et al., Hydrology and Earth System Sciences (2013), http://dx.doi.org/10.5194/hess-17-1871-2013
Orthogonal decomposition of left ventricular remodeling in myocardial infarction
Zhang, Xingyu; Medrano-Gracia, Pau; Ambale-Venkatesh, Bharath; Bluemke, David A.; Cowan, Brett R; Finn, J. Paul; Kadish, Alan H.; Lee, Daniel C.; Lima, Joao A. C.; Young, Alistair A.; Suinesiaputra, Avan
2017-01-01
Abstract Left ventricular size and shape are important for quantifying cardiac remodeling in response to cardiovascular disease. Geometric remodeling indices have been shown to have prognostic value in predicting adverse events in the clinical literature, but these often describe interrelated shape changes. We developed a novel method for deriving orthogonal remodeling components directly from any (moderately independent) set of clinical remodeling indices. Results: Six clinical remodeling indices (end-diastolic volume index, sphericity, relative wall thickness, ejection fraction, apical conicity, and longitudinal shortening) were evaluated using cardiac magnetic resonance images of 300 patients with myocardial infarction, and 1991 asymptomatic subjects, obtained from the Cardiac Atlas Project. Partial least squares (PLS) regression of left ventricular shape models resulted in remodeling components that were optimally associated with each remodeling index. A Gram–Schmidt orthogonalization process, by which remodeling components were successively removed from the shape space in the order of shape variance explained, resulted in a set of orthonormal remodeling components. Remodeling scores could then be calculated that quantify the amount of each remodeling component present in each case. A one-factor PLS regression led to more decoupling between scores from the different remodeling components across the entire cohort, and zero correlation between clinical indices and subsequent scores. Conclusions: The PLS orthogonal remodeling components had similar power to describe differences between myocardial infarction patients and asymptomatic subjects as principal component analysis, but were better associated with well-understood clinical indices of cardiac remodeling. The data and analyses are available from www.cardiacatlas.org. PMID:28327972
Hidalgo-Tenorio, Carmen; Rivero-Rodriguez, Mar; Gil-Anguita, Concepción; Lopez De Hierro, Mercedes; Palma, Pablo; Ramírez-Taboada, Jessica; Esquivias, Javier; López-Ruz, Miguel Angel; Javier-Martínez, Rosario; Pasquau-Liaño, Juan
2014-01-01
Objectives Chronic infection with oncogenic HPV genotype is associated with the development of anal dysplasia. Antiretroviral therapy (ART) has been shown to decrease the incidence of cervical carcinoma in women with HIV. We sought to: 1) describe the prevalence and grade of anal dysplasia and HPV infection in our study subjects; 2) analyze the grade of correlation between anal cytology, PCR of high-risk HPV, and histology; 3) identify the factors associated with the appearance of ≥AIN2 lesions. Design Cross-sectional, prospective study. Methods A cohort of HIV-positive males (n = 140, mean age = 37 years) who have sex with males (MSM) had epidemiological, clinical and analytical data collected. Anal mucosa samples were taken for cytology, HPV PCR genotyping, and anoscopy for histological analysis. Results Within the cohort, 77.1% were being treated with ART, 8.5% anoscopy findings were AIN2, and 11.4% carcinoma in situ; 74.2% had high-risk (HR), 59.7% low-risk (LR) HPV genotypes and 46.8% had both. The combination of cytology with PCR identifying HR-HPV better predicts the histology findings than either of these factors alone. Logistic regression highlighted ART as a protective factor against ≥AIN2 lesions (OR: 0.214; 95%CI: 0.054–0.84). Anal/genital condylomas (OR: 4.26; 95%CI: 1.27–14.3), and HPV68 genotype (OR: 10.6; 95%CI: 1.23–91.47) were identified as risk factors. Conclusions In our cohort, ART has a protective effect against dysplastic anal lesions. Anal/genital warts and HPV68 genotype are predictors of ≥AIN2 lesions. Introducing PCR HPV genotype evaluation improves screening success over that of cytology alone. PMID:24676139
A Java program for LRE-based real-time qPCR that enables large-scale absolute quantification.
Rutledge, Robert G
2011-03-02
Linear regression of efficiency (LRE) introduced a new paradigm for real-time qPCR that enables large-scale absolute quantification by eliminating the need for standard curves. Developed through the application of sigmoidal mathematics to SYBR Green I-based assays, target quantity is derived directly from fluorescence readings within the central region of an amplification profile. However, a major challenge of implementing LRE quantification is the labor intensive nature of the analysis. Utilizing the extensive resources that are available for developing Java-based software, the LRE Analyzer was written using the NetBeans IDE, and is built on top of the modular architecture and windowing system provided by the NetBeans Platform. This fully featured desktop application determines the number of target molecules within a sample with little or no intervention by the user, in addition to providing extensive database capabilities. MS Excel is used to import data, allowing LRE quantification to be conducted with any real-time PCR instrument that provides access to the raw fluorescence readings. An extensive help set also provides an in-depth introduction to LRE, in addition to guidelines on how to implement LRE quantification. The LRE Analyzer provides the automated analysis and data storage capabilities required by large-scale qPCR projects wanting to exploit the many advantages of absolute quantification. Foremost is the universal perspective afforded by absolute quantification, which among other attributes, provides the ability to directly compare quantitative data produced by different assays and/or instruments. Furthermore, absolute quantification has important implications for gene expression profiling in that it provides the foundation for comparing transcript quantities produced by any gene with any other gene, within and between samples.
Sabry, Dina; Ahmed, Rasha; Abdalla, Sayed; Fathy, Wael; Eldemery, Ahmed; Elamir, Azza
2016-06-01
We aimed to study MLH1 and MGMT methylation status in Helicobacter pylori-associated chronic gastritis in Egyptian patients with and without gastric cancer. 39 patients were included in our study. They were divided into 2 groups; patients without (group I) and with gastric adenocarcinoma (group II). Patients were subjected to clinical examination, abdominal ultrasound and upper endoscopy for gastric biopsy. Biopsies were subjected to urease test, histological examination, and DNA purification. H. pylori, Braf, Kras, MLH1 and MGMT methylation were assessed by quantitative PCR. DNA sequencing was performed to assess Braf and Kras genes mutation. qPCR of H. pylori was significantly higher in patients with adenocarcinoma (group II) than those without adenocarcinoma (group I); with a p < 0.001 as well as in patients with age above 50 years with a p value = 0.008. By applying logistic regression analysis it was reported that the H. pylori qPCR is a significant predictor to the adenocarcinoma with OR = 1.025 (95 % CI: 1. 002-1.048), with sensitivity of 90 % and specificity of 100 %. Adenocarcinoma patients had a significantly higher mean age and levels of H. Pylori, Braf, K-ras, methylated MGMT and methylated MLH1 than those of gastritis patients. DNA sequence analysis of Braf (codon 12) and Kras (codon 600) had genes mutation in gastric adenocarcinoma versus chronic gastritis. H. pylori may cause epigenetic changes predisposing the patients to cancer stomach. Estimation of H. pylori by qPCR can be a good predictor to adenocarcinoma. Braf and Kras genes mutation were reveled in gastritis and adenocarcinoma patients.
Liu, Kaihua; Zhang, Bin; Teng, Zhaochun; Wang, Youtao; Dong, Guodong; Xu, Cong; Qin, Bo; Song, Chunlian; Chai, Jun; Li, Yang; Shi, Xianwei; Shu, Xianghua; Zhang, Yifang
2017-03-01
We investigated the associations between SLC11A1 polymorphisms and susceptibility to tuberculosis (TB) in Chinese Holstein cattle, using a case-control study of 136 animals that had positive reactions to TB tests and showed symptoms and 96 animals that had negative reactions to tests and showed no symptoms. Polymerase chain reaction (PCR) sequencing and the restriction fragment length polymorphism (RFLP) technique were used to detect and determine SLC11A1 polymorphisms. Association analysis identified significant correlations between SLC11A1 polymorphisms and susceptibility/resistance to TB, and two genetic markers for SLC11A1 were established using PCR-RFLP. Sequence alignment of SLC11A1 revealed seven single-nucleotide polymorphisms (SNPs). This is the first report of MaeII PCR-RFLP markers for the SLC11A1-SNP3 site and PstI PCR-RFLP markers for the SLC11A1-SNP5 and SLC11A1-SNP6 sites in Chinese Holstein cattle. Logistic regression analysis indicated that SLC11A1-SNP1, SLC11A1-SNP3, and SLC11A1-SNP5 were significantly associated with susceptibility/resistance to TB. Two genotypes of SLC11A1-SNP3 were susceptible to TB, whereas one genotype of SLC11A1-SNP1 and two genotypes of SLC11A1-SNP5 were resistant. Haplotype analysis showed that nine haplotypes were potentially resistant to TB. After Bonferroni correction, three of the haplotypes remained significantly associated with TB resistance. SLC11A1 is a useful candidate gene related to TB in Chinese Holstein cattle. Copyright © 2016 Elsevier Ltd. All rights reserved.
Masud, Rizwan; Qureshi, Irfan Zia
2011-09-01
Cardiovascular disorders and coronary artery disease (CAD) are significant contributors to morbidity and mortality in heart patients. As genes of the folate/homocysteine pathway have been linked with the vascular disease, we investigated association of these gene polymorphisms with CAD/myocardial infarction (MI) using the novel approach of tetraprimer ARMS-PCR. A total of 230 participants (129 MI cases, 101 normal subjects) were recruited. We genotyped rs1801133 and rs1801131 SNPs in 5'10' methylenetetrahydrofolate reductase (MTHFR), rs1805087 SNP in 5' methyltetrahydrofolate homocysteine methyltransferase (MTR), rs662 SNP in paroxanse1 (PON1), and rs5742905 polymorphism in cystathionine beta synthase (CBS). Angiotensin converting enzyme (ACE) insertion/deletion polymorphism was detected through conventional PCR. Covariates included blood pressure, fasting blood sugar, serum cholesterol, and creatinine concentrations. Our results showed allele frequencies at rs1801133, rs1801131, rs1805087 and the ACE insertion/deletion (I/D) polymorphism varied between cases and controls. Logistic regression, after adjusting for covariates, demonstrated significant associations of rs1801133 and rs1805087 with CAD in the additive, dominant, and genotype model. In contrast, ACE I/D polymorphism was significantly related with CAD where recessive model was applied. Gene-gene interaction against the disease status revealed two polymorphism groups: rs1801133, rs662, and rs1805087; and rs1801131, rs662, and ACE I/D. Only the latter interaction maintained significance after adjusted for covariates. Our study concludes that folate pathway variants exert contributory influence on susceptibility to CAD. We further suggest that tetraprimer ARMS-PCR successfully resolves the genotypes in selected samples and might prove to be a superior technique compared to the conventional approach.
Mycoplasma Pneumoniae among Children Hospitalized with Community-acquired Pneumonia.
Kutty, Preeta K; Jain, Seema; Taylor, Thomas H; Bramley, Anna M; Diaz, Maureen H; Ampofo, Krow; Arnold, Sandra R; Williams, Derek J; Edwards, Kathryn M; McCullers, Jonathan A; Pavia, Andrew T; Winchell, Jonas M; Schrag, Stephanie J; Hicks, Lauri A
2018-05-17
The burden and epidemiology of Mycoplasma pneumoniae (Mp) among U.S. children (<18 years) hospitalized with community-acquired pneumonia (CAP) are poorly understood. In the Etiology of Pneumonia in the Community (EPIC) study, we prospectively enrolled 2254 children hospitalized with radiographically-confirmed pneumonia from January 2010-June 2012 and tested nasopharyngeal/oropharyngeal swabs for Mp using real-time polymerase chain reaction (PCR). Clinical and epidemiological features of Mp-PCR-positive and -negative children were compared using logistic regression. Macrolide susceptibility was assessed by genotyping isolates. In the EPIC study, 182(8%) children were Mp-PCR-positive (median age: 7 years); 12% required intensive care and 26% had pleural effusion. No in-hospital deaths occurred. Macrolide resistance was found in 6/169(4%) isolates. Of 178(98%) Mp-PCR-positive children tested for co-pathogens, 50(28%) had ≥1 co-pathogen detected. Variables significantly associated with higher odds of Mp detection included age {10-17 years [adjusted odds ratio (aOR): 7.9 (95% confidence interval (CI): 4.5-13.6)] and 5-9 years [aOR: 4.8 (CI: 2.9-7.8)] vs. 2-4 years}, outpatient antibiotics ≤5 days pre-admission [aOR: 2.3 (CI: 1.5-3.4)], and co-pathogen detection [aOR: 2.1 (CI: 1.3-3.1)]. Clinical characteristics often seen included hilar lymphadenopathy, rales, headache, sore throat, and decreased breath sounds. Usually considered as a mild respiratory infection, M. pneumoniae was the most commonly detected bacteria among children ≥5 years hospitalized with CAP; one-quarter of whom had co-detections. Although associated with clinically non-specific symptoms, there was a need for intensive care support in some cases. M. pneumoniae should be included in the differential diagnosis for school-aged children hospitalized with CAP.
A Java Program for LRE-Based Real-Time qPCR that Enables Large-Scale Absolute Quantification
Rutledge, Robert G.
2011-01-01
Background Linear regression of efficiency (LRE) introduced a new paradigm for real-time qPCR that enables large-scale absolute quantification by eliminating the need for standard curves. Developed through the application of sigmoidal mathematics to SYBR Green I-based assays, target quantity is derived directly from fluorescence readings within the central region of an amplification profile. However, a major challenge of implementing LRE quantification is the labor intensive nature of the analysis. Findings Utilizing the extensive resources that are available for developing Java-based software, the LRE Analyzer was written using the NetBeans IDE, and is built on top of the modular architecture and windowing system provided by the NetBeans Platform. This fully featured desktop application determines the number of target molecules within a sample with little or no intervention by the user, in addition to providing extensive database capabilities. MS Excel is used to import data, allowing LRE quantification to be conducted with any real-time PCR instrument that provides access to the raw fluorescence readings. An extensive help set also provides an in-depth introduction to LRE, in addition to guidelines on how to implement LRE quantification. Conclusions The LRE Analyzer provides the automated analysis and data storage capabilities required by large-scale qPCR projects wanting to exploit the many advantages of absolute quantification. Foremost is the universal perspective afforded by absolute quantification, which among other attributes, provides the ability to directly compare quantitative data produced by different assays and/or instruments. Furthermore, absolute quantification has important implications for gene expression profiling in that it provides the foundation for comparing transcript quantities produced by any gene with any other gene, within and between samples. PMID:21407812
Ohseto, Hisashi; Ishikuro, Mami; Kikuya, Masahiro; Obara, Taku; Igarashi, Yuko; Takahashi, Satomi; Kikuchi, Daisuke; Shigihara, Michiko; Yamanaka, Chizuru; Miyashita, Masako; Mizuno, Satoshi; Nagai, Masato; Matsubara, Hiroko; Sato, Yuki; Metoki, Hirohito; Tachibana, Hirofumi; Maeda-Yamamoto, Mari; Kuriyama, Shinichi
2018-04-01
Metabolic syndrome and the presence of metabolic syndrome components are risk factors for cardiovascular disease (CVD). However, the association between personality traits and metabolic syndrome remains controversial, and few studies have been conducted in East Asian populations. We measured personality traits using the Japanese version of the Eysenck Personality Questionnaire (Revised Short Form) and five metabolic syndrome components-elevated waist circumference, elevated triglycerides, reduced high-density lipoprotein cholesterol, elevated blood pressure, and elevated fasting glucose-in 1322 participants aged 51.1±12.7years old from Kakegawa city, Japan. Metabolic syndrome score (MS score) was defined as the number of metabolic syndrome components present, and metabolic syndrome as having the MS score of 3 or higher. We performed multiple logistic regression analyses to examine the relationship between personality traits and metabolic syndrome components and multiple regression analyses to examine the relationship between personality traits and MS scores adjusted for age, sex, education, income, smoking status, alcohol use, and family history of CVD and diabetes mellitus. We also examine the relationship between personality traits and metabolic syndrome presence by multiple logistic regression analyses. "Extraversion" scores were higher in those with metabolic syndrome components (elevated waist circumference: P=0.001; elevated triglycerides: P=0.01; elevated blood pressure: P=0.004; elevated fasting glucose: P=0.002). "Extraversion" was associated with the MS score (coefficient=0.12, P=0.0003). No personality trait was significantly associated with the presence of metabolic syndrome. Higher "extraversion" scores were related to higher MS scores, but no personality trait was significantly associated with the presence of metabolic syndrome. Copyright © 2018 Elsevier Inc. All rights reserved.
Su'udi, Mukhamad; Park, Jong-Mi; Kang, Woo-Ri; Park, Sang-Ryeol; Hwang, Duk-Ju; Ahn, Il-Pyung
2012-12-01
Rice brown leaf spot is a major disease in the rice paddy field. The causal agent Cochliobolus miyabeanus is an ascomycete fungus and a representative necrotrophic pathogen in the investigation of rice-microbe interactions. The aims of this research were to identify a quantitative evaluation method to determine the amount of C. miyabeanus proliferation in planta and determine the method's sensitivity. Real-time polymerase chain reaction (PCR) was employed in combination with the primer pair and Taqman probe specific to CmSCD1, a C. miyabeanus unigene encoding SCYTALONE DEHYDRATASE, which is involved in fungal melanin biosynthesis. Comparative analysis of the nucleotide sequences of CmSCD1 from Korean strains with those from the Japanese and Taiwanese strains revealed some sequence differences. Based on the crossing point (CP) values from Taqman real-time PCR containing a series of increasing concentrations of cloned amplicon or fungal genomic DNA, linear regressions with a high level of reliability (R(2)>0.997) were constructed. This system was able to estimate fungal genomic DNA at the picogram level. The reliability of this equation was further confirmed using DNA samples from both resistant and susceptible cultivars infected with C. miyabeanus. In summary, our quantitative system is a powerful alternative in brown leaf spot forecasting and in the consistent evaluation of disease progression.