ERIC Educational Resources Information Center
Rudner, Lawrence M.; Glass Gene V.; Evartt, David L.; Emery, Patrick J.
This manual and the accompanying software are intended to provide a step-by-step guide to conducting a meta-analytic study along with references for further reading and free high-quality software, "Meta-Stat.""Meta-Stat" is a comprehensive package designed to help in the meta-analysis of research studies in the social and behavioral sciences.…
Bax, Leon; Yu, Ly-Mee; Ikeda, Noriaki; Tsuruta, Harukazu; Moons, Karel G M
2006-10-13
Meta-analysis has become a well-known method for synthesis of quantitative data from previously conducted research in applied health sciences. So far, meta-analysis has been particularly useful in evaluating and comparing therapies and in assessing causes of disease. Consequently, the number of software packages that can perform meta-analysis has increased over the years. Unfortunately, it can take a substantial amount of time to get acquainted with some of these programs and most contain little or no interactive educational material. We set out to create and validate an easy-to-use and comprehensive meta-analysis package that would be simple enough programming-wise to remain available as a free download. We specifically aimed at students and researchers who are new to meta-analysis, with important parts of the development oriented towards creating internal interactive tutoring tools and designing features that would facilitate usage of the software as a companion to existing books on meta-analysis. We took an unconventional approach and created a program that uses Excel as a calculation and programming platform. The main programming language was Visual Basic, as implemented in Visual Basic 6 and Visual Basic for Applications in Excel 2000 and higher. The development took approximately two years and resulted in the 'MIX' program, which can be downloaded from the program's website free of charge. Next, we set out to validate the MIX output with two major software packages as reference standards, namely STATA (metan, metabias, and metatrim) and Comprehensive Meta-Analysis Version 2. Eight meta-analyses that had been published in major journals were used as data sources. All numerical and graphical results from analyses with MIX were identical to their counterparts in STATA and CMA. The MIX program distinguishes itself from most other programs by the extensive graphical output, the click-and-go (Excel) interface, and the educational features. The MIX program is a valid tool for performing meta-analysis and may be particularly useful in educational environments. It can be downloaded free of charge via http://www.mix-for-meta-analysis.info or http://sourceforge.net/projects/meta-analysis.
Bax, Leon; Yu, Ly-Mee; Ikeda, Noriaki; Tsuruta, Harukazu; Moons, Karel GM
2006-01-01
Background Meta-analysis has become a well-known method for synthesis of quantitative data from previously conducted research in applied health sciences. So far, meta-analysis has been particularly useful in evaluating and comparing therapies and in assessing causes of disease. Consequently, the number of software packages that can perform meta-analysis has increased over the years. Unfortunately, it can take a substantial amount of time to get acquainted with some of these programs and most contain little or no interactive educational material. We set out to create and validate an easy-to-use and comprehensive meta-analysis package that would be simple enough programming-wise to remain available as a free download. We specifically aimed at students and researchers who are new to meta-analysis, with important parts of the development oriented towards creating internal interactive tutoring tools and designing features that would facilitate usage of the software as a companion to existing books on meta-analysis. Results We took an unconventional approach and created a program that uses Excel as a calculation and programming platform. The main programming language was Visual Basic, as implemented in Visual Basic 6 and Visual Basic for Applications in Excel 2000 and higher. The development took approximately two years and resulted in the 'MIX' program, which can be downloaded from the program's website free of charge. Next, we set out to validate the MIX output with two major software packages as reference standards, namely STATA (metan, metabias, and metatrim) and Comprehensive Meta-Analysis Version 2. Eight meta-analyses that had been published in major journals were used as data sources. All numerical and graphical results from analyses with MIX were identical to their counterparts in STATA and CMA. The MIX program distinguishes itself from most other programs by the extensive graphical output, the click-and-go (Excel) interface, and the educational features. Conclusion The MIX program is a valid tool for performing meta-analysis and may be particularly useful in educational environments. It can be downloaded free of charge via or . PMID:17038197
Zhai, Peng; Yang, Longshu; Guo, Xiao; Wang, Zhe; Guo, Jiangtao; Wang, Xiaoqi; Zhu, Huaiqiu
2017-10-02
During the past decade, the development of high throughput nucleic sequencing and mass spectrometry analysis techniques have enabled the characterization of microbial communities through metagenomics, metatranscriptomics, metaproteomics and metabolomics data. To reveal the diversity of microbial communities and interactions between living conditions and microbes, it is necessary to introduce comparative analysis based upon integration of all four types of data mentioned above. Comparative meta-omics, especially comparative metageomics, has been established as a routine process to highlight the significant differences in taxon composition and functional gene abundance among microbiota samples. Meanwhile, biologists are increasingly concerning about the correlations between meta-omics features and environmental factors, which may further decipher the adaptation strategy of a microbial community. We developed a graphical comprehensive analysis software named MetaComp comprising a series of statistical analysis approaches with visualized results for metagenomics and other meta-omics data comparison. This software is capable to read files generated by a variety of upstream programs. After data loading, analyses such as multivariate statistics, hypothesis testing of two-sample, multi-sample as well as two-group sample and a novel function-regression analysis of environmental factors are offered. Here, regression analysis regards meta-omic features as independent variable and environmental factors as dependent variables. Moreover, MetaComp is capable to automatically choose an appropriate two-group sample test based upon the traits of input abundance profiles. We further evaluate the performance of its choice, and exhibit applications for metagenomics, metaproteomics and metabolomics samples. MetaComp, an integrative software capable for applying to all meta-omics data, originally distills the influence of living environment on microbial community by regression analysis. Moreover, since the automatically chosen two-group sample test is verified to be outperformed, MetaComp is friendly to users without adequate statistical training. These improvements are aiming to overcome the new challenges under big data era for all meta-omics data. MetaComp is available at: http://cqb.pku.edu.cn/ZhuLab/MetaComp/ and https://github.com/pzhaipku/MetaComp/ .
The Effects of ABRACADABRA on Reading Outcomes: A Meta-Analysis of Applied Field Research
ERIC Educational Resources Information Center
Abrami, Philip; Borohkovski, Eugene; Lysenko, Larysa
2015-01-01
This meta-analysis summarizes research on the effects of a comprehensive, interactive web-based software (AXXX) on the development of reading competencies among kindergarteners and elementary students. Findings from seven randomized control trials and quasi-experimental studies undertaken in a variety of contexts across Canada, Australia and Kenya…
MetaGenyo: a web tool for meta-analysis of genetic association studies.
Martorell-Marugan, Jordi; Toro-Dominguez, Daniel; Alarcon-Riquelme, Marta E; Carmona-Saez, Pedro
2017-12-16
Genetic association studies (GAS) aims to evaluate the association between genetic variants and phenotypes. In the last few years, the number of this type of study has increased exponentially, but the results are not always reproducible due to experimental designs, low sample sizes and other methodological errors. In this field, meta-analysis techniques are becoming very popular tools to combine results across studies to increase statistical power and to resolve discrepancies in genetic association studies. A meta-analysis summarizes research findings, increases statistical power and enables the identification of genuine associations between genotypes and phenotypes. Meta-analysis techniques are increasingly used in GAS, but it is also increasing the amount of published meta-analysis containing different errors. Although there are several software packages that implement meta-analysis, none of them are specifically designed for genetic association studies and in most cases their use requires advanced programming or scripting expertise. We have developed MetaGenyo, a web tool for meta-analysis in GAS. MetaGenyo implements a complete and comprehensive workflow that can be executed in an easy-to-use environment without programming knowledge. MetaGenyo has been developed to guide users through the main steps of a GAS meta-analysis, covering Hardy-Weinberg test, statistical association for different genetic models, analysis of heterogeneity, testing for publication bias, subgroup analysis and robustness testing of the results. MetaGenyo is a useful tool to conduct comprehensive genetic association meta-analysis. The application is freely available at http://bioinfo.genyo.es/metagenyo/ .
Teaching meta-analysis using MetaLight.
Thomas, James; Graziosi, Sergio; Higgins, Steve; Coe, Robert; Torgerson, Carole; Newman, Mark
2012-10-18
Meta-analysis is a statistical method for combining the results of primary studies. It is often used in systematic reviews and is increasingly a method and topic that appears in student dissertations. MetaLight is a freely available software application that runs simple meta-analyses and contains specific functionality to facilitate the teaching and learning of meta-analysis. While there are many courses and resources for meta-analysis available and numerous software applications to run meta-analyses, there are few pieces of software which are aimed specifically at helping those teaching and learning meta-analysis. Valuable teaching time can be spent learning the mechanics of a new software application, rather than on the principles and practices of meta-analysis. We discuss ways in which the MetaLight tool can be used to present some of the main issues involved in undertaking and interpreting a meta-analysis. While there are many software tools available for conducting meta-analysis, in the context of a teaching programme such software can require expenditure both in terms of money and in terms of the time it takes to learn how to use it. MetaLight was developed specifically as a tool to facilitate the teaching and learning of meta-analysis and we have presented here some of the ways it might be used in a training situation.
ERIC Educational Resources Information Center
Wood, Sarah G.; Moxley, Jerad H.; Tighe, Elizabeth L.; Wagner, Richard K.
2018-01-01
Text-to-speech and related read-aloud tools are being widely implemented in an attempt to assist students' reading comprehension skills. Read-aloud software, including text-to-speech, is used to translate written text into spoken text, enabling one to listen to written text while reading along. It is not clear how effective text-to-speech is at…
GWAMA: software for genome-wide association meta-analysis.
Mägi, Reedik; Morris, Andrew P
2010-05-28
Despite the recent success of genome-wide association studies in identifying novel loci contributing effects to complex human traits, such as type 2 diabetes and obesity, much of the genetic component of variation in these phenotypes remains unexplained. One way to improving power to detect further novel loci is through meta-analysis of studies from the same population, increasing the sample size over any individual study. Although statistical software analysis packages incorporate routines for meta-analysis, they are ill equipped to meet the challenges of the scale and complexity of data generated in genome-wide association studies. We have developed flexible, open-source software for the meta-analysis of genome-wide association studies. The software incorporates a variety of error trapping facilities, and provides a range of meta-analysis summary statistics. The software is distributed with scripts that allow simple formatting of files containing the results of each association study and generate graphical summaries of genome-wide meta-analysis results. The GWAMA (Genome-Wide Association Meta-Analysis) software has been developed to perform meta-analysis of summary statistics generated from genome-wide association studies of dichotomous phenotypes or quantitative traits. Software with source files, documentation and example data files are freely available online at http://www.well.ox.ac.uk/GWAMA.
ERIC Educational Resources Information Center
Spencer, Mercedes; Wagner, Richard K.
2018-01-01
The purpose of this meta-analysis was to examine the comprehension problems of children who have a specific reading comprehension deficit (SCD), which is characterized by poor reading comprehension despite adequate decoding. The meta-analysis included 86 studies of children with SCD who were assessed in reading comprehension and oral language…
Pastor, Dena A; Lazowski, Rory A
2018-01-01
The term "multilevel meta-analysis" is encountered not only in applied research studies, but in multilevel resources comparing traditional meta-analysis to multilevel meta-analysis. In this tutorial, we argue that the term "multilevel meta-analysis" is redundant since all meta-analysis can be formulated as a special kind of multilevel model. To clarify the multilevel nature of meta-analysis the four standard meta-analytic models are presented using multilevel equations and fit to an example data set using four software programs: two specific to meta-analysis (metafor in R and SPSS macros) and two specific to multilevel modeling (PROC MIXED in SAS and HLM). The same parameter estimates are obtained across programs underscoring that all meta-analyses are multilevel in nature. Despite the equivalent results, not all software programs are alike and differences are noted in the output provided and estimators available. This tutorial also recasts distinctions made in the literature between traditional and multilevel meta-analysis as differences between meta-analytic choices, not between meta-analytic models, and provides guidance to inform choices in estimators, significance tests, moderator analyses, and modeling sequence. The extent to which the software programs allow flexibility with respect to these decisions is noted, with metafor emerging as the most favorable program reviewed.
Kang, Sang Wook; Kim, Su Kang; Jung, Hee-Jae; Kim, Kwan-Il; Kim, Jinju
2016-01-01
The relationship between polymorphism of the angiotensin I converting enzyme (ACE) gene and chronic obstructive pulmonary disease (COPD) has been examined in many previous studies. However, their results were controversial. Therefore, we performed a meta-analysis to evaluate the relationship between the ACE gene and the risk of COPD. Fourteen case-control studies were included in this meta-analysis. The pooled p value, odds ratio (OR), and 95% confidence interval (95% CI) were used to investigate the strength of the association. The meta-analysis was performed using comprehensive meta-analysis software. Our meta-analysis results revealed that ACE polymorphisms were not related to the risk of COPD (p > 0.05 in each model). In further analyses based on ethnicity, we observed an association between insertion/deletion polymorphism of the ACE gene and risk of COPD in the Asian population (codominant 2, OR = 3.126, 95% CI = 1.919–5.093, p < 0.001; recessive, OR = 3.326, 95% CI = 2.190–5.050, p < 0.001) but not in the Caucasian population (p > 0.05 in each model). In conclusion, the present meta-analysis indicated that the insertion/deletion polymorphism of the ACE gene may be associated with susceptibility to COPD in the Asian population but not in the Caucasian population. However, the results of the present meta-analysis need to be confirmed in a larger sample. PMID:27830153
MetaDP: a comprehensive web server for disease prediction of 16S rRNA metagenomic datasets.
Xu, Xilin; Wu, Aiping; Zhang, Xinlei; Su, Mingming; Jiang, Taijiao; Yuan, Zhe-Ming
2016-01-01
High-throughput sequencing-based metagenomics has garnered considerable interest in recent years. Numerous methods and tools have been developed for the analysis of metagenomic data. However, it is still a daunting task to install a large number of tools and complete a complicated analysis, especially for researchers with minimal bioinformatics backgrounds. To address this problem, we constructed an automated software named MetaDP for 16S rRNA sequencing data analysis, including data quality control, operational taxonomic unit clustering, diversity analysis, and disease risk prediction modeling. Furthermore, a support vector machine-based prediction model for intestinal bowel syndrome (IBS) was built by applying MetaDP to microbial 16S sequencing data from 108 children. The success of the IBS prediction model suggests that the platform may also be applied to other diseases related to gut microbes, such as obesity, metabolic syndrome, or intestinal cancer, among others (http://metadp.cn:7001/).
Clinical Effectiveness of Occupational Therapy in Mental Health: A Meta-Analysis.
Ikiugu, Moses N; Nissen, Ranelle M; Bellar, Cali; Maassen, Alexya; Van Peursem, Katlin
The purpose of this study was to estimate the effectiveness of theory-based occupational therapy interventions in improving occupational performance and well-being among people with a mental health diagnosis. The meta-analysis included 11 randomized controlled trials with a total of 520 adult participants with a mental health diagnosis. Outcomes were occupational performance, well-being, or both. We conducted meta-analyses using Comprehensive Meta-Analysis software (Version 3.0) with occupational performance and well-being as the dependent variables. Results indicated a medium effect of intervention on improving occupational performance (mean Hedge's g = 0.50, Z = 4.05, p < .001) and a small effect on well-being (mean Hedge's g = 0.46, Z = 4.96, p < .001). Theory-based occupational therapy interventions may be effective in improving occupational performance and well-being among people with a mental health diagnosis and should be an integral part of rehabilitation services in mental health. Copyright © 2017 by the American Occupational Therapy Association, Inc.
R classes and methods for SNP array data.
Scharpf, Robert B; Ruczinski, Ingo
2010-01-01
The Bioconductor project is an "open source and open development software project for the analysis and comprehension of genomic data" (1), primarily based on the R programming language. Infrastructure packages, such as Biobase, are maintained by Bioconductor core developers and serve several key roles to the broader community of Bioconductor software developers and users. In particular, Biobase introduces an S4 class, the eSet, for high-dimensional assay data. Encapsulating the assay data as well as meta-data on the samples, features, and experiment in the eSet class definition ensures propagation of the relevant sample and feature meta-data throughout an analysis. Extending the eSet class promotes code reuse through inheritance as well as interoperability with other R packages and is less error-prone. Recently proposed class definitions for high-throughput SNP arrays extend the eSet class. This chapter highlights the advantages of adopting and extending Biobase class definitions through a working example of one implementation of classes for the analysis of high-throughput SNP arrays.
Omrani-Navai, Versa; Alizadeh-Navaei, Reza; Yahyapour, Yousef; Hedayatizadeh-Omran, Akbar; Abediankenari, Saeid; Janbabaei, Ghasem; Toghani, Fatima
2017-01-01
Gastrointestinal (GI) malignancies are the most common cancers and account for nearly half of all cancer-related deaths in Iran. There was a strong association between human papillomavirus (HPV) infection and urogenital cancers, in particular the cervix. However, there is no clear causal relationship in all types of cancers, including gastrointestinal cancers. Therefore, the present study as a systematic review and meta-analysis was designed to evaluate the prevalence and relation of HPV in GI cancers. This systematic review and meta-analysis study assess the prevalence of human papillomavirus in GI cancers in Iran. Data were collected by searching electronic databases, including PubMed, Google Scholar, Scopus, SID and Iranmedex by English and Persian key words up to August 2016. Key words included: Human Papillomavirus, HPV, Cancer, Neoplasm, Carcinoma, Esophageal, colorectal, Gastrointestinal and Iran articles were entered in the EndNote software and duplicate papers were excluded. Data were extracted and analyzed by comprehensive meta-analysis software, Version 2 (CMA.V2) and random effects model. Finally, we included 17 studies in this meta-analysis. The prevalence of HPV in Iranian patients with GI cancers was 16.4% (CI95%: 10.4-24.9). Considering all HPV types, the odds ratio of GI cancers in positive patients was 3.03 (CI95%: 1.42-6.45) while in patients with HPV-16 was 3.62 (CI: 1.43-4.82). The results show a strong relationship between HPV infection especially high-risk HPV type 16 and GI cancers in Iranian population.
Effectiveness of Global Postural Re-education for Treatment of Spinal Disorders: A Meta-analysis.
Lomas-Vega, Rafael; Garrido-Jaut, María Victoria; Rus, Alma; Del-Pino-Casado, Rafael
2017-02-01
The aim of this study was to investigate the effects of global postural re-education (GPR) on the treatment of spinal disorders by performing a systematic review and a meta-analysis. MEDLINE, Scopus, and PEDro databases were searched without language or publication date restrictions. Data on pain and function were used to evaluate the effectiveness of GPR. Randomized controlled trials and controlled clinical trials analyzing the effectiveness of GPR on spinal disorders were selected. The standardized mean difference (SMD) and the corresponding 95% confidence interval (95% CI) were calculated. The meta-analysis was performed using the Comprehensive Meta-analysis 3.3 software. Seven randomized controlled trials and 4 controlled clinical trials were included in the meta-analysis. The results showed a medium improvement on pain (SMD = -0.63; 95% CI, -0.43 to -0.83) and function (SMD = -0.48; 95% CI, -0.25 to -0.72) after GPR treatment. The positive effect, which was greater in patients with ankylosing spondylitis followed by low back pain and neck pain, was more significant during the intermediate follow-up than immediately after treatment. This meta-analysis provides reliable evidence that GPR may be an effective method for treating spinal disorders by decreasing pain and improving function.
ERIC Educational Resources Information Center
Lan, Yi-Chin; Lo, Yu-Ling; Hsu, Ying-Shao
2014-01-01
Comprehension is the essence of reading. Finding appropriate and effective reading strategies to support students' reading comprehension has always been a critical issue for educators. This article presents findings from a meta-analysis of 17 studies of metacognitive strategy instruction on students' reading comprehension in computerized…
Meta-Analysis in Stata Using Gllamm
ERIC Educational Resources Information Center
Bagos, Pantelis G.
2015-01-01
There are several user-written programs for performing meta-analysis in Stata (Stata Statistical Software: College Station, TX: Stata Corp LP). These include metan, metareg, mvmeta, and glst. However, there are several cases for which these programs do not suffice. For instance, there is no software for performing univariate meta-analysis with…
Li, Gaoming; Yi, Dali; Wu, Xiaojiao; Liu, Xiaoyu; Zhang, Yanqi; Liu, Ling; Yi, Dong
2015-01-01
Background Although a substantial number of studies focus on the teaching and application of medical statistics in China, few studies comprehensively evaluate the recognition of and demand for medical statistics. In addition, the results of these various studies differ and are insufficiently comprehensive and systematic. Objectives This investigation aimed to evaluate the general cognition of and demand for medical statistics by undergraduates, graduates, and medical staff in China. Methods We performed a comprehensive database search related to the cognition of and demand for medical statistics from January 2007 to July 2014 and conducted a meta-analysis of non-controlled studies with sub-group analysis for undergraduates, graduates, and medical staff. Results There are substantial differences with respect to the cognition of theory in medical statistics among undergraduates (73.5%), graduates (60.7%), and medical staff (39.6%). The demand for theory in medical statistics is high among graduates (94.6%), undergraduates (86.1%), and medical staff (88.3%). Regarding specific statistical methods, the cognition of basic statistical methods is higher than of advanced statistical methods. The demand for certain advanced statistical methods, including (but not limited to) multiple analysis of variance (ANOVA), multiple linear regression, and logistic regression, is higher than that for basic statistical methods. The use rates of the Statistical Package for the Social Sciences (SPSS) software and statistical analysis software (SAS) are only 55% and 15%, respectively. Conclusion The overall statistical competence of undergraduates, graduates, and medical staff is insufficient, and their ability to practically apply their statistical knowledge is limited, which constitutes an unsatisfactory state of affairs for medical statistics education. Because the demand for skills in this area is increasing, the need to reform medical statistics education in China has become urgent. PMID:26053876
Wu, Yazhou; Zhou, Liang; Li, Gaoming; Yi, Dali; Wu, Xiaojiao; Liu, Xiaoyu; Zhang, Yanqi; Liu, Ling; Yi, Dong
2015-01-01
Although a substantial number of studies focus on the teaching and application of medical statistics in China, few studies comprehensively evaluate the recognition of and demand for medical statistics. In addition, the results of these various studies differ and are insufficiently comprehensive and systematic. This investigation aimed to evaluate the general cognition of and demand for medical statistics by undergraduates, graduates, and medical staff in China. We performed a comprehensive database search related to the cognition of and demand for medical statistics from January 2007 to July 2014 and conducted a meta-analysis of non-controlled studies with sub-group analysis for undergraduates, graduates, and medical staff. There are substantial differences with respect to the cognition of theory in medical statistics among undergraduates (73.5%), graduates (60.7%), and medical staff (39.6%). The demand for theory in medical statistics is high among graduates (94.6%), undergraduates (86.1%), and medical staff (88.3%). Regarding specific statistical methods, the cognition of basic statistical methods is higher than of advanced statistical methods. The demand for certain advanced statistical methods, including (but not limited to) multiple analysis of variance (ANOVA), multiple linear regression, and logistic regression, is higher than that for basic statistical methods. The use rates of the Statistical Package for the Social Sciences (SPSS) software and statistical analysis software (SAS) are only 55% and 15%, respectively. The overall statistical competence of undergraduates, graduates, and medical staff is insufficient, and their ability to practically apply their statistical knowledge is limited, which constitutes an unsatisfactory state of affairs for medical statistics education. Because the demand for skills in this area is increasing, the need to reform medical statistics education in China has become urgent.
Effects of Expository Text Structure Interventions on Comprehension: A Meta-Analysis
ERIC Educational Resources Information Center
Pyle, Nicole; Vasquez, Ariana C.; Lignugaris/Kraft, Benjamin; Gillam, Sandra L.; Reutzel, D. Ray; Olszewski, Abbie; Segura, Hugo; Hartzheim, Daphne; Laing, Woodrow; Pyle, Daniel
2017-01-01
This meta-analysis synthesizes results from expository text structure interventions designed to increase comprehension for students in kindergarten to grade 12 published between 1970 and 2013. Twenty-one studies were identified, 19 of which met criteria for a meta-analysis, including 48 studywise effect sizes that were meta-analyzed to determine…
Polymorphisms in interleukins 17A and 17F genes and periodontitis: results from a meta-analysis.
da Silva, Felipe Rodolfo Pereira; Pessoa, Larissa Dos Santos; Vasconcelos, Any Carolina Cardoso Guimarães; de Aquino Lima, Weberson; Alves, Even Herlany Pereira; Vasconcelos, Daniel Fernando Pereira
2017-12-01
Polymorphisms in inflammatory genes such as interleukins 17A and 17F are associated with the risk of development of periodontitis, although the results remain contradictory. Hence, the aim of this study was perform a meta-analysis focusing on two polymorphisms (rs2275913 and rs763780) in interleukins 17A and 17F genes, respectively, in both chronic (CP) and aggressive periodontitis (AgP). A review in literature was performed in several databases for studies published before 25, September 2016. The meta-analysis was obtained through the review manager statistical software (version 5.2) with odds ratio (OR) calculation and funnel plot (P < 0.05) for heterogeneity, as well as the comprehensive meta-analysis software (version 3.3.070) for the assessment of publication bias. Seven articles with 1540 participants composed the results in which the mutant allele in the rs2275913 polymorphism did not present significant association with the risk of CP or AgP (OR 1.56, 95% CI 0.77, 3.15, P = 0.21; OR 1.12, 95% CI 0.05, 23.44, P = 0.94, respectively) nor was the mutant allele in rs763780 associated with the risk of CP (OR 1.19, 95% CI 0.80, 1.76, P = 0.39) or AgP (OR 1.07, 95% CI 0.63, 1.84, P = 0.79). No bias of publication was observed by Egger's and Begg's tests in any allelic evaluation. This meta-analysis showed a non-significant association between the polymorphisms rs2275913 and rs763780 in interleukins 17A and 17F genes and chronic and aggressive periodontitis in the allelic evaluation.
ERIC Educational Resources Information Center
García, J. Ricardo; Cain, Kate
2014-01-01
The twofold purpose of this meta-analysis was to determine the relative importance of decoding skills to reading comprehension in reading development and to identify which reader characteristics and reading assessment characteristics contribute to differences in the decoding and reading comprehension correlation. A meta-analysis of 110 studies…
The 5-HTTLPR polymorphism and posttraumatic stress disorder: a meta-analysis.
Gressier, Florence; Calati, Raffaella; Balestri, Martina; Marsano, Agnese; Alberti, Siegfried; Antypa, Niki; Serretti, Alessandro
2013-12-01
Environmental and genetic factors contribute to the development of posttraumatic stress disorder (PTSD). Variation in the 5-HTTLPR polymorphism of the serotonin transporter gene has been hypothesized to affect risk for PTSD. With the aim of investigating this association, we conducted a meta-analysis to shed light on prior controversial results and increase statistical power to detect smaller effect sizes. PubMed and ISI databases were searched for studies published until December 2012. Twelve studies have been included, all based on trauma-exposed samples. Data were analyzed with Cochrane Collaboration Review Manager Software (Version 5). Quality and publication bias were assessed. Metaregressions were performed using Comprehensive Meta-Analysis software, Version 2. Taking into account all studies, no association was found between 5-HTTLPR and PTSD (p = .10), with evidence of between-study heterogeneity, which could be partly explained by gender differences. In sensitivity analyses, we found an association between SS genotype and PTSD in high trauma-exposed participants (p < .001). To be a carrier of the SS genotype seems to represent a risk factor for PTSD in high trauma exposure. Further studies focusing on Gene × Environment interactions are needed to better understand the role of this polymorphism in PTSD. Copyright © 2013 International Society for Traumatic Stress Studies.
Liu, Ying; Sun, Mei-Guo; Jiang, Rong; Ding, Rui; Che, Zhen; Chen, Yan-Yan; Yao, Ci-Jiang; Zhu, Xiao-Xia; Cao, Ji-Yu
2014-03-01
Several studies have reported that excessive amounts of plasminogen activator inhibitor-1(PAI-1) might increase the incidence of polycystic ovary syndrome(PCOS), but so far the published results were inconsistent. The aim of this study was to further investigate the association between PAI-1 gene polymorphism and the susceptibility to PCOS by performing a meta-analysis. A comprehensive literature search for relevant studies was conducted on google scholar, PubMed, the Chinese National Knowledge Infrastructure (CNKI) and the Chinese Biomedical Literature Database (CBM). This meta-analysis was performed using the STATA 11.0 software and the pooled odds ratio (OR) with 95% confidence interval (CI) was calculated. Ten case-control studies were included in this meta-analysis with a total of 2,079 cases and 1,556 controls. The results showed that PAI-1 -675 4G/5G polymorphism may increase the risk of PCOS, especially among Asian populations. However, there was no statistically significant association between the polymorphism and PCOS risk in Caucasians. Our meta-analysis suggests that PAI-1 -675 4G/5G polymorphism may contribute to increasing susceptibility to PCOS in Asians. Detection of the PAI-1 gene polymorphism might be a promising biomarker for the susceptibility of PCOS.
Liu, Wenjie; Duan, Yuchen; Cui, Wenyao; Li, Li; Wang, Xia; Dai, Heling; You, Chao; Chen, Maojun
2016-07-01
To compare the efficacy of several antiseptics in decreasing the blood culture contamination rate. Network meta-analysis. Electronic searches of PubMed and Embase were conducted up to November 2015. Only randomized controlled trials or quasi-randomized controlled trials were eligible. We applied no language restriction. A comprehensive review of articles in the reference lists was also accomplished for possible relevant studies. Relevant studies evaluating efficacy of different antiseptics in venous puncture site for decreasing the blood culture contamination rate were included. The data were extracted from the included randomized controlled trials by two authors independently. The risk of bias was evaluated using Detsky scale by two authors independently. We used WinBUGS1.43 software and statistic model described by Chaimani to perform this network meta-analysis. Then graphs of statistical results of WinBUGS1.43 software were generated using 'networkplot', 'ifplot', 'netfunnel' and 'sucra' procedure by STATA13.0. Odds ratio and 95% confidence intervals were assessed for dichotomous data. A probability of p less than 0.05 was considered to be statistically significant. Compared with ordinary meta-analyses, this network meta-analysis offered hierarchies for the efficacy of different antiseptics in decreasing the blood culture contamination rate. Seven randomized controlled trials involving 34,408 blood samples were eligible for the meta-analysis. No significant difference was found in blood culture contamination rate among different antiseptics. No significant difference was found between non-alcoholic antiseptics and alcoholic antiseptics, alcoholic chlorhexidine and povidone iodine, chlorhexidine and iodine compounds, povidone iodine and iodine tincture in this aspect, respectively. Different antiseptics may not affect the blood culture contamination rate. Different intervals between the skin disinfection and the venous puncture, the different settings (emergency room, medical wards, and intensive care units) and the performance of the phlebotomy may affect the blood culture contamination rate. Copyright © 2016 Elsevier Ltd. All rights reserved.
Periodontal disease and carotid atherosclerosis: A meta-analysis of 17,330 participants.
Zeng, Xian-Tao; Leng, Wei-Dong; Lam, Yat-Yin; Yan, Bryan P; Wei, Xue-Mei; Weng, Hong; Kwong, Joey S W
2016-01-15
The association between periodontal disease and carotid atherosclerosis has been evaluated primarily in single-center studies, and whether periodontal disease is an independent risk factor of carotid atherosclerosis remains uncertain. This meta-analysis aimed to evaluate the association between periodontal disease and carotid atherosclerosis. We searched PubMed and Embase for relevant observational studies up to February 20, 2015. Two authors independently extracted data from included studies, and odds ratios (ORs) with 95% confidence intervals (CIs) were calculated for overall and subgroup meta-analyses. Statistical heterogeneity was assessed by the chi-squared test (P<0.1 for statistical significance) and quantified by the I(2) statistic. Data analysis was conducted using the Comprehensive Meta-Analysis (CMA) software. Fifteen observational studies involving 17,330 participants were included in the meta-analysis. The overall pooled result showed that periodontal disease was associated with carotid atherosclerosis (OR: 1.27, 95% CI: 1.14-1.41; P<0.001) but statistical heterogeneity was substantial (I(2)=78.90%). Subgroup analysis of adjusted smoking and diabetes mellitus showed borderline significance (OR: 1.08; 95% CI: 1.00-1.18; P=0.05). Sensitivity and cumulative analyses both indicated that our results were robust. Findings of our meta-analysis indicated that the presence of periodontal disease was associated with carotid atherosclerosis; however, further large-scale, well-conducted clinical studies are needed to explore the precise risk of developing carotid atherosclerosis in patients with periodontal disease. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Stuart G. Baker, 2017 Introduction This software computes meta-analysis and extrapolation estimates for an instrumental variable meta-analysis of randomized trial or before-and-after studies (the latter also known as the paired availability design). The software also checks on the assumptions if sufficient data are available. |
ERIC Educational Resources Information Center
Melby-Lervag, Monica; Lervag, Arne
2011-01-01
We present a meta-analysis of cross-linguistic transfer of oral language (vocabulary and listening comprehension), phonology (decoding and phonological awareness) and reading comprehension. Our findings show a small meta-correlation between first (L1) and second (L2) oral language and a moderate to large correlation between L1 and L2 phonological…
Mägi, Reedik; Suleimanov, Yury V; Clarke, Geraldine M; Kaakinen, Marika; Fischer, Krista; Prokopenko, Inga; Morris, Andrew P
2017-01-11
Genome-wide association studies (GWAS) of single nucleotide polymorphisms (SNPs) have been successful in identifying loci contributing genetic effects to a wide range of complex human diseases and quantitative traits. The traditional approach to GWAS analysis is to consider each phenotype separately, despite the fact that many diseases and quantitative traits are correlated with each other, and often measured in the same sample of individuals. Multivariate analyses of correlated phenotypes have been demonstrated, by simulation, to increase power to detect association with SNPs, and thus may enable improved detection of novel loci contributing to diseases and quantitative traits. We have developed the SCOPA software to enable GWAS analysis of multiple correlated phenotypes. The software implements "reverse regression" methodology, which treats the genotype of an individual at a SNP as the outcome and the phenotypes as predictors in a general linear model. SCOPA can be applied to quantitative traits and categorical phenotypes, and can accommodate imputed genotypes under a dosage model. The accompanying META-SCOPA software enables meta-analysis of association summary statistics from SCOPA across GWAS. Application of SCOPA to two GWAS of high-and low-density lipoprotein cholesterol, triglycerides and body mass index, and subsequent meta-analysis with META-SCOPA, highlighted stronger association signals than univariate phenotype analysis at established lipid and obesity loci. The META-SCOPA meta-analysis also revealed a novel signal of association at genome-wide significance for triglycerides mapping to GPC5 (lead SNP rs71427535, p = 1.1x10 -8 ), which has not been reported in previous large-scale GWAS of lipid traits. The SCOPA and META-SCOPA software enable discovery and dissection of multiple phenotype association signals through implementation of a powerful reverse regression approach.
ERIC Educational Resources Information Center
Shintani, Natsuko; Li, Shaofeng; Ellis, Rod
2013-01-01
This article reports a meta-analysis of studies that investigated the relative effectiveness of comprehension-based instruction (CBI) and production-based instruction (PBI). The meta-analysis only included studies that featured a direct comparison of CBI and PBI in order to ensure methodological and statistical robustness. A total of 35 research…
ERIC Educational Resources Information Center
Sharp, William G.; Berry, Rashelle C.; McCracken, Courtney; Nuhu, Nadrat N.; Marvel, Elizabeth; Saulnier, Celine A.; Klin, Ami; Jones, Warren; Jaquess, David L.
2013-01-01
We conducted a comprehensive review and meta-analysis of research regarding feeding problems and nutrient status among children with autism spectrum disorders (ASD). The systematic search yielded 17 prospective studies involving a comparison group. Using rigorous meta-analysis techniques, we calculated the standardized mean difference (SMD) with…
Polyp detection rate may predict adenoma detection rate: a meta-analysis.
Niv, Yaron
2018-03-01
Adenoma detection rate (ADR) is defined as the number of colonoscopies with at least one adenoma, expressed as the ratio of the total number of colonoscopies performed. Recently, an application of a conversion factor to estimate the ADR from the polyp detection rate (PDR) was described. In this meta-analysis, we examined the correlation between ADR and PDR in the published studies and assessed the relative ratio of these ratios for a better and more accurate estimation. English Medical literature searches were performed for 'PDR' AND 'ADR'. A meta-analysis was carried out for papers that fulfilled the inclusion criteria using comprehensive meta-analysis software. Twenty-five studies and 42 sets of data, including 31 623 patients, from nine countries published till 31 August 2017, were found. Funnel plot did not indicate a significant publication bias. relative ratio for ADR calculated from PDR was 0.688, 95% confidence intervals: 0.680-0.695, P value of less than 0.0001 in the meta-analysis fixed model. Heterogeneity (the proportion of inconsistency in individual studies) between studies was significant, with Q=492.753, d.f. (Q) 41, P<0.0001, and I 91.679. We found the ratio of 0.688 can be used to calculate ADR from PDR for the individual endoscopist or for a group of endoscopists before receiving the formal results from the pathology department.
da Silva, Felipe Rodolfo Pereira; Vasconcelos, Any Carolina Cardoso Guimarães; de Carvalho França, Luiz Felipe; Di Lenardo, David; Nascimento, Hélio Mateus Silva; Vasconcelos, Daniel Fernando Pereira
2018-08-20
Several factors are involved in the periodontitis with host response through cytokines and as well as with influence of polymorphisms in cytokine genes, however the results remained contradictory. This study aimed at evaluating the rs1143634 polymorphism in interleukin-1B gene, a cytokine gene, and the risk of chronic periodontitis with conducting a meta-analysis focusing in ethnicity. A review in literature was performed in several databases to studies published before June 2017. Data extraction was performed by two calibrated investigators and the calculations of the meta-analysis were obtained through Review Manager version 5.2 statistical software with Odds Ratio (OR) calculation and Funnel plot (P < 0.05) to heterogeneity and the Comprehensive Meta-analysis version 3.3.070 to assessment publication bias by Egger's and Begg's tests. In overall, 54 case/control studies composed the meta-analysis. T allele was significantly associated with patients case (OR = 1.35, 95% CI: 1.24, 1.48, P < 0.00001) in the overall analysis. The stratified evaluation showed the rs1143634 polymorphism had significant association with disease in Caucasian, Asian and mixed population was excepted in African ethnicity (P > 0.05). No publication bias was found in allelic evaluation. This meta-analysis in 9376 participants with 54 case/control studies revealed the rs1143634 polymorphism was associated with elevated risk of chronic periodontitis in overall analysis as well as Caucasian and Asian ethnicities and Mixed population. Copyright © 2018 Elsevier B.V. All rights reserved.
Examining the Effects of Classroom Discussion on Students' Comprehension of Text: A Meta-Analysis
ERIC Educational Resources Information Center
Murphy, P. Karen; Wilkinson, Ian A. G.; Soter, Anna O.; Hennessey, Maeghan N.; Alexander, John F.
2009-01-01
The role of classroom discussions in comprehension and learning has been the focus of investigations since the early 1960s. Despite this long history, no syntheses have quantitatively reviewed the vast body of literature on classroom discussions for their effects on students' comprehension and learning. This comprehensive meta-analysis of…
Comprehensive School Reform and Student Achievement: A Meta-Analysis.
ERIC Educational Resources Information Center
Borman, Geoffrey D.; Hewes, Gina M.; Overman, Laura T.; Brown, Shelly
Using 232 studies, this meta analysis reviewed the research on the achievement effects of the nationally disseminated and externally developed school improvement programs known as "whole-school" or "comprehensive" reforms. In addition to reviewing the overall achievement effects of comprehensive school reform (CSR), the meta…
The Effects of Text Structure Instruction on Expository Reading Comprehension: A Meta-Analysis
ERIC Educational Resources Information Center
Hebert, Michael; Bohaty, Janet J.; Nelson, J. Ron; Brown, Jessica
2016-01-01
In this meta-analysis of 45 studies involving students in Grades 2-12, the authors present evidence on the effects of text structure instruction on the expository reading comprehension of students. The meta-analysis was deigned to answer 2 sets of questions. The first set of questions examined the effectiveness of text structure instruction on…
Neurological Soft Signs in Schizophrenia: A Meta-analysis
Chan, Raymond C. K.; Xu, Ting; Heinrichs, R. Walter; Yu, Yue; Wang, Ya
2010-01-01
Background: Neurological soft signs (NSS) are hypothesized as candidate endophenotypes for schizophrenia, but their prevalence and relations with clinical and demographic data are unknown. The authors undertook a quantification (meta-analysis) of the published literature on NSS in patients with schizophrenia and healthy controls. A systematic search was conducted for published articles reporting NSS and related data using standard measures in schizophrenia and healthy comparison groups. Method: A systematic search was conducted for published articles reporting data on the prevalence of NSS in schizophrenia using standard clinical rating scales and healthy comparison groups. Meta-analyses were performed using the Comprehensive Meta-analysis software package. Effect sizes (Cohen d) indexing the difference between schizophrenic patients and the healthy controls were calculated on the basis of reported statistics. Potential moderator variables evaluated included age of patient samples, level of education, sample sex proportions, medication doses, and negative and positive symptoms. Results: A total of 33 articles met inclusion criteria for the meta-analysis. A large and reliable group difference (Cohen d) indicated that, on average, a majority of patients (73%) perform outside the range of healthy subjects on aggregate NSS measures. Cognitive performance and positive and negative symptoms share 2%–10% of their variance with NSS. Conclusions: NSS occur in a majority of the schizophrenia patient population and are largely distinct from symptomatic and cognitive features of the illness. PMID:19377058
Brown, Stephen; Hutton, Brian; Clifford, Tammy; Coyle, Doug; Grima, Daniel; Wells, George; Cameron, Chris
2014-09-29
The use of network meta-analysis has increased dramatically in recent years. WinBUGS, a freely available Bayesian software package, has been the most widely used software package to conduct network meta-analyses. However, the learning curve for WinBUGS can be daunting, especially for new users. Furthermore, critical appraisal of network meta-analyses conducted in WinBUGS can be challenging given its limited data manipulation capabilities and the fact that generation of graphical output from network meta-analyses often relies on different software packages than the analyses themselves. We developed a freely available Microsoft-Excel-based tool called NetMetaXL, programmed in Visual Basic for Applications, which provides an interface for conducting a Bayesian network meta-analysis using WinBUGS from within Microsoft Excel. . This tool allows the user to easily prepare and enter data, set model assumptions, and run the network meta-analysis, with results being automatically displayed in an Excel spreadsheet. It also contains macros that use NetMetaXL's interface to generate evidence network diagrams, forest plots, league tables of pairwise comparisons, probability plots (rankograms), and inconsistency plots within Microsoft Excel. All figures generated are publication quality, thereby increasing the efficiency of knowledge transfer and manuscript preparation. We demonstrate the application of NetMetaXL using data from a network meta-analysis published previously which compares combined resynchronization and implantable defibrillator therapy in left ventricular dysfunction. We replicate results from the previous publication while demonstrating result summaries generated by the software. Use of the freely available NetMetaXL successfully demonstrated its ability to make running network meta-analyses more accessible to novice WinBUGS users by allowing analyses to be conducted entirely within Microsoft Excel. NetMetaXL also allows for more efficient and transparent critical appraisal of network meta-analyses, enhanced standardization of reporting, and integration with health economic evaluations which are frequently Excel-based.
2014-01-01
Background The use of network meta-analysis has increased dramatically in recent years. WinBUGS, a freely available Bayesian software package, has been the most widely used software package to conduct network meta-analyses. However, the learning curve for WinBUGS can be daunting, especially for new users. Furthermore, critical appraisal of network meta-analyses conducted in WinBUGS can be challenging given its limited data manipulation capabilities and the fact that generation of graphical output from network meta-analyses often relies on different software packages than the analyses themselves. Methods We developed a freely available Microsoft-Excel-based tool called NetMetaXL, programmed in Visual Basic for Applications, which provides an interface for conducting a Bayesian network meta-analysis using WinBUGS from within Microsoft Excel. . This tool allows the user to easily prepare and enter data, set model assumptions, and run the network meta-analysis, with results being automatically displayed in an Excel spreadsheet. It also contains macros that use NetMetaXL’s interface to generate evidence network diagrams, forest plots, league tables of pairwise comparisons, probability plots (rankograms), and inconsistency plots within Microsoft Excel. All figures generated are publication quality, thereby increasing the efficiency of knowledge transfer and manuscript preparation. Results We demonstrate the application of NetMetaXL using data from a network meta-analysis published previously which compares combined resynchronization and implantable defibrillator therapy in left ventricular dysfunction. We replicate results from the previous publication while demonstrating result summaries generated by the software. Conclusions Use of the freely available NetMetaXL successfully demonstrated its ability to make running network meta-analyses more accessible to novice WinBUGS users by allowing analyses to be conducted entirely within Microsoft Excel. NetMetaXL also allows for more efficient and transparent critical appraisal of network meta-analyses, enhanced standardization of reporting, and integration with health economic evaluations which are frequently Excel-based. PMID:25267416
Di, Baoshan; Pan, Bei; Ge, Long; Ma, Jichun; Wu, Yiting; Guo, Tiankang
2018-03-01
Pancreatic cancer (PC) is a devastating malignant tumor. Although surgical resection may offer a good prognosis and prolong survival, approximately 80% patients with PC are always diagnosed as unresectable tumor. National Comprehensive Cancer Network's (NCCN) recommended gemcitabine-based chemotherapy as efficient treatment. While, according to recent studies, targeted agents might be a better available option for advanced or metastatic pancreatic cancer patients. The aim of this systematic review and network meta-analysis will be to examine the differences of different targeted interventions for advanced/metastatic PC patients. We will conduct this systematic review and network meta-analysis using Bayesian method and according to Preferred Reporting Items for Systematic review and Meta-Analysis Protocols (PRISMA-P) statement. To identify relevant studies, 6 electronic databases including PubMed, EMBASE, the Cochrane Central Register of Controlled Trials (CENTRAL), Web of science, CNKI (Chinese National Knowledge Infrastructure), and CBM (Chinese Biological Medical Database) will be searched. The risk of bias in included randomized controlled trials (RCTs) will be assessed using the Cochrane Handbook version 5.1.0. And we will use GRADE approach to assess the quality of evidence from network meta-analysis. Data will be analyzed using R 3.4.1 software. To the best of our knowledge, this systematic review and network meta-analysis will firstly use both direct and indirect evidence to compare the differences of different targeted agents and targeted agents plus chemotherapy for advanced/metastatic pancreatic cancer patients. This is a protocol of systematic review and meta-analysis, so the ethical approval and patient consent are not required. We will disseminate the results of this review by submitting to a peer-reviewed journal.
ERIC Educational Resources Information Center
Spencer, Mercedes; Wagner, Richard K.
2017-01-01
We conducted a meta-analysis of 16 existing studies to examine the nature of the comprehension problems for children who were second-language learners with poor reading comprehension despite adequate decoding. Results indicated that these children had deficits in oral language (d = -0.80), but these deficits were not as severe as their reading…
ERIC Educational Resources Information Center
Shin, Jaehyun
2017-01-01
The purpose of this study was to examine the validity of two widely used Curriculum-Based Measurement (CBM) in reading--oral reading and maze task--in relation to reading comprehension on state tests using a meta-analysis. A total of 61 studies (132 correlations) were identified across Grades 1 to 10. A random-effects meta-analysis was conducted…
Nerve growth factor for Bell’s palsy: A meta-analysis
SU, YIPENG; DONG, XIAOMENG; LIU, JUAN; HU, YAOZHI; CHEN, JINBO
2015-01-01
A meta-analysis was performed to evaluate the efficacy and safety of nerve growth factor (NGF) in the treatment of Bell’s palsy. PubMed, the Cochrane Central Register of Controlled Trials, Embase and a number of Chinese databases, including the China National Knowledge Infrastructure, China Biology Medicine disc, VIP Database for Chinese Technical Periodicals and Wan Fang Data, were used to collect randomised controlled trials (RCTs) of NGF for Bell’s palsy. The span of the search covered data from the date of database establishment until December 2013. The included trials were screened comprehensively and rigorously. The efficacies of NGF were pooled via meta-analysis performed using Review Manager 5.2 software. Odds ratios (ORs) and 95% confidence intervals (CIs) were calculated using the fixed-effects model. The meta-analysis of eight RCTs showed favorable effects of NGF on the disease response rate (n=642; OR, 3.87; 95% CI, 2.13–7.03; P<0.01; I2=0%). However, evidence supporting the effectiveness of NGF for the treatment of Bell’s palsy is limited. The number and quality of trials are too low to form solid conclusions. Further meticulous RCTs are required to overcome the limitations identified in the present study. PMID:25574223
Park, Hae Jeong; Chung, Joo-Ho; Ban, Ju Yeon
2017-01-01
Genetic polymorphism of human 8-oxoguanine glycosylase 1 (hOGG1) has been reported to have a relationship with the risk of the development of various cancers. Many studies have described the influence of Ser326Cys polymorphism of the hOGG1 gene on cancer susceptibility. However, the results have remained inconclusive and controversial. Therefore, we performed a meta-analysis to more precisely determine the relationship between the hOGG1 polymorphism and the development of cancer. Electronic databases including PubMed, Embase, Google Scholar, and the Korean Studies Information Service System (KISS) were searched. The odds ratio (OR), 95% confidence interval (CI), and p value were calculated to assess the strength of the association with the risk of cancer using Comprehensive Meta-analysis software (Corporation, NJ, USA). The 127 studies including 38,757 cancer patients and 50,177 control subjects were analyzed for the meta-analysis. Our meta-analysis revealed that G allele of Ser326Cys polymorphism of the hOGG1 gene statistically increased the susceptibility of cancer (all population, OR = 1.092, 95% CI = 1.051-1.134, p < 0.001; in Asian, OR = 1.095, 95% CI = 1.048-1.145, p < 0.001; in Caucasian, OR = 1.097, 95% CI = 1.033-1.179, p = 0.002). Also, other genotype models showed significant association with cancer (p < 0.05, respectively). The present meta-analysis concluded that the G allele was associated with an increased risk of cancer. It suggested that the hOGG1 polymorphism may be a candidate marker of cancer. PMID:28415770
Broers, Valérie J V; De Breucker, Céline; Van den Broucke, Stephan; Luminet, Olivier
2017-10-01
Nudging refers to interventions that organize the choice architecture in order to alter people's behaviour in a predictable way without forbidding any options or significantly changing their economic incentives. As a strategy to encourage healthy behaviour, nudging can serve as a complement to health education. However, the empirical evidence regarding the effectiveness of nudging as a way to influence food choice remains contradictory. To address this issue, a systematic review and meta-analysis was conducted to test the effects of nudging to encourage people to select more fruit and vegetables. A systematic literature search was performed on PubMed, Medline, PsycInfo, Cochrane library, Scopus and Google Scholar. After quality assessment, 20 articles (23 studies) were retained for narrative synthesis. Twelve articles (14 studies) contained enough information to calculate effect-sizes for meta-analysis using Comprehensive Meta-analysis software. The meta-analysis shows that nudging interventions that aim to increase fruit and/or vegetable choice/sales/servings have a moderately significant effect (d = 0.30), with the largest effect for altering placement (d = 0.39) and combined nudges (d = 0.28). The results of this review provide an indication of the effectiveness of nudging on fruit and vegetable choice in terms of actual effect-sizes, while also highlighting the problems that must be addressed before more definitive conclusions can be drawn. © The Author 2017. Published by Oxford University Press on behalf of the European Public Health Association. All rights reserved.
Dynamic Geometry Software Improves Mathematical Achievement: Systematic Review and Meta-Analysis
ERIC Educational Resources Information Center
Chan, Kan Kan; Leung, Siu Wai
2014-01-01
Dynamic geometry software (DGS) aims to enhance mathematics education. This systematic review and meta-analysis evaluated the quasi-experimental studies on the effectiveness of DGS-based instruction in improving students' mathematical achievement. Research articles published between 1990 and 2013 were identified from major databases according to a…
Improving Reading Comprehension Using Digital Text: A Meta-Analysis of Interventions
ERIC Educational Resources Information Center
Berkeley, Sheri; Kurz, Leigh Ann; Boykin, Andrea; Evmenova, Anya S.
2015-01-01
Much is known about how to improve students' comprehension when reading printed text; less is known about outcomes when reading digital text. The purpose of this meta-analysis was to analyze research on the impact of digital text interventions. A comprehensive literature search resulted in 27 group intervention studies with 16,513 participants.…
Aghbari, Sana Maher Hasan; Abushouk, Abdelrahman Ibrahim; Attia, Attia; Elmaraezy, Ahmed; Menshawy, Amr; Ahmed, Mohamed Shehata; Elsaadany, Basma Abdelaleem; Ahmed, Eman Magdy
2017-05-01
For over a century, a heated debate existed over the possibility of malignant transformation of oral lichen planus (OLP). We performed this meta-analysis to evaluate the malignant potential of OLP and oral lichenoid lesions (OLL) and investigate the possible risk factors for OLP malignant transformation into oral squamous cell carcinoma (OSCC). We searched Medline, Scopus, and Web of Knowledge for relevant observational studies. Data on OLP malignant transformation were calculated as a pooled proportion (PP), using the Der-Simonian Liard method. We performed subgroup analyses by OLP diagnostic criteria, site, and clinical type, using Open Meta[Analyst] software. Data on possible risk factors for malignant transformation were pooled as odds ratios (ORs), using Comprehensive Meta-Analysis software. Pooling data for OLP malignant transformation from 57 studies (19,676 patients) resulted in an overall PP of 1.1% [95% CI: 0.9%, 1.4%], while pooling data from 14 recent studies that used the World Health Organization-2003 diagnostic criteria resulted in an overall-PP of 0.9% [95% CI: 0.5%, 1.3%]. The risk of malignant transformation was higher (PP=2.5%, 95% CI [1%, 4%]) in OLL patients (419 patients). A significant increase of malignant transformation risk was noted among smokers (OR=2, 95% CI [1.25, 3.22]), alcoholics (OR=3.52, 95% CI [1.54, 8.03]), and HCV-infected patients (OR=5, 95% CI [1.56, 16.07]), compared to patients without these risk factors. A small subset of OLP patients (1.1%) develop OSCC; therefore, regular follow-up for these patients is recommended. A higher incidence of malignant transformation was found among smokers, alcoholics, and HCV-infected patients; however, these associations should be further investigated. Copyright © 2017 Elsevier Ltd. All rights reserved.
The role of AMH and its receptor SNP in the pathogenesis of PCOS.
Wang, Fang; Niu, Wen-Bin; Kong, Hui-Juan; Guo, Yi-Hong; Sun, Ying-Pu
2017-01-05
The etiology of polycystic ovaries syndrome (PCOS) is unknown. Studies probing the role of genetic variants of anti-Mullerian hormone (AMH) and its type II receptor (AMHR2) in the pathogenesis of PCOS have yielded inconsistent results. Thus, we performed a systematic review and meta-analysis to determine the role of genetic variants of AMH/AMHR2 in the pathogenesis of PCOS. A systematic search of electronic databases was performed. Statistical analysis was performed using the Comprehensive Meta-Analysis software (Version 3). Pooled Odds Ratios (OR) (95% confidence intervals) were determined to assess the association between genetic variants of AMH/AMHR2 and PCOS. Five studies, involving a total of 2042 PCOS cases and 1071 controls, were included in the meta-analysis. Single nucleotide polymorphisms of AMH and AMHR2 did not appear to confer a heightened risk for PCOS (OR: 0.954, 95% CI: 0.848-1.073; P = 0.435; and OR: 1.074, 95% CI: 0.875-1.318; P = 0.494, respectively). In this study, genetic variants of AMH or AMHR2 were not found to be associated with a higher risk for PCOS. Copyright © 2016. Published by Elsevier Ireland Ltd.
The Clinicopathological Significance of MicroRNA-155 in Breast Cancer: A Meta-Analysis
Zeng, Hui; Fang, Cheng; Nam, Seungyoon; Cai, Qing; Long, Xinghua
2014-01-01
Objective. Previous studies demonstrated that the associations between expression level of microRNA-155 (miR-155) and clinicopathological significance of breast cancer remained inconsistent. Therefore, we performed a meta-analysis based on eligible studies to summarize the possible associations. Methods. We identified eligible studies published up to May 2014 by a comprehensive search of PubMed, EMBASE, CNKI, and VIP databases. The analysis was performed with RevMan. 5.0 software. Results. A total of 15 studies were included. The results of meta-analysis showed that miR-155 was positively correlated with breast cancer with standardized mean difference (SMD) = 1.22. Elevated miR-155 was found in Her-2 positive or lymph node metastasis positive, or p53 mutant type breast cancer. But the result showed to be insignificant in TNM comparison. With respect to estrogen receptor alpha (ER) and progesterone receptor (PR) status, both of them showed significant associations with SMD = −1.2 and −1.85, respectively. Conclusion. MiR-155 detection might have a diagnostic value in breast cancer patients. It might be used as an auxiliary biomarker for different clinicopathological breast cancer. PMID:25157366
Spencer, Mercedes; Wagner, Richard K
2018-06-01
The purpose of this meta-analysis was to examine the comprehension problems of children who have a specific reading comprehension deficit (SCD), which is characterized by poor reading comprehension despite adequate decoding. The meta-analysis included 86 studies of children with SCD who were assessed in reading comprehension and oral language (vocabulary, listening comprehension, storytelling ability, and semantic and syntactic knowledge). Results indicated that children with SCD had deficits in oral language ( d = -0.78, 95% CI [-0.89, -0.68], but these deficits were not as severe as their deficit in reading comprehension ( d = -2.78, 95% CI [-3.01, -2.54]). When compared to reading comprehension age-matched normal readers, the oral language skills of the two groups were comparable ( d = 0.32, 95% CI [-0.49, 1.14]), which suggests that the oral language weaknesses of children with SCD represent a developmental delay rather than developmental deviance. Theoretical and practical implications of these findings are discussed.
A systematic review and meta-analysis of sleep architecture and chronic traumatic brain injury.
Mantua, Janna; Grillakis, Antigone; Mahfouz, Sanaa H; Taylor, Maura R; Brager, Allison J; Yarnell, Angela M; Balkin, Thomas J; Capaldi, Vincent F; Simonelli, Guido
2018-02-02
Sleep quality appears to be altered by traumatic brain injury (TBI). However, whether persistent post-injury changes in sleep architecture are present is unknown and relatively unexplored. We conducted a systematic review and meta-analysis to assess the extent to which chronic TBI (>6 months since injury) is characterized by changes to sleep architecture. We also explored the relationship between sleep architecture and TBI severity. In the fourteen included studies, sleep was assessed with at least one night of polysomnography in both chronic TBI participants and controls. Statistical analyses, performed using Comprehensive Meta-Analysis software, revealed that chronic TBI is characterized by relatively increased slow wave sleep (SWS). A meta-regression showed moderate-severe TBI is associated with elevated SWS, reduced stage 2, and reduced sleep efficiency. In contrast, mild TBI was not associated with any significant alteration of sleep architecture. The present findings are consistent with the hypothesis that increased SWS after moderate-severe TBI reflects post-injury cortical reorganization and restructuring. Suggestions for future research are discussed, including adoption of common data elements in future studies to facilitate cross-study comparability, reliability, and replicability, thereby increasing the likelihood that meaningful sleep (and other) biomarkers of TBI will be identified. Copyright © 2018 Elsevier Ltd. All rights reserved.
Caspi, Ron; Altman, Tomer; Dale, Joseph M.; Dreher, Kate; Fulcher, Carol A.; Gilham, Fred; Kaipa, Pallavi; Karthikeyan, Athikkattuvalasu S.; Kothari, Anamika; Krummenacker, Markus; Latendresse, Mario; Mueller, Lukas A.; Paley, Suzanne; Popescu, Liviu; Pujar, Anuradha; Shearer, Alexander G.; Zhang, Peifen; Karp, Peter D.
2010-01-01
The MetaCyc database (MetaCyc.org) is a comprehensive and freely accessible resource for metabolic pathways and enzymes from all domains of life. The pathways in MetaCyc are experimentally determined, small-molecule metabolic pathways and are curated from the primary scientific literature. With more than 1400 pathways, MetaCyc is the largest collection of metabolic pathways currently available. Pathways reactions are linked to one or more well-characterized enzymes, and both pathways and enzymes are annotated with reviews, evidence codes, and literature citations. BioCyc (BioCyc.org) is a collection of more than 500 organism-specific Pathway/Genome Databases (PGDBs). Each BioCyc PGDB contains the full genome and predicted metabolic network of one organism. The network, which is predicted by the Pathway Tools software using MetaCyc as a reference, consists of metabolites, enzymes, reactions and metabolic pathways. BioCyc PGDBs also contain additional features, such as predicted operons, transport systems, and pathway hole-fillers. The BioCyc Web site offers several tools for the analysis of the PGDBs, including Omics Viewers that enable visualization of omics datasets on two different genome-scale diagrams and tools for comparative analysis. The BioCyc PGDBs generated by SRI are offered for adoption by any party interested in curation of metabolic, regulatory, and genome-related information about an organism. PMID:19850718
Wang, Qingzhong; Shelton, Richard C; Dwivedi, Yogesh
2018-01-01
Gene-environment interaction contributes to the risks of psychiatric disorders. Interactions between FKBP5 gene variants and early-life stress may enhance the risk not only for mood disorder, but also for a number of other behavioral phenotypes. The aim of the present study was to review and conduct a meta-analysis on the results from published studies examining interaction between FKBP5 gene variants and early-life stress and their associations with stress-related disorders such as major depression and PTSD. A literature search was conducted using PsychINFO and PubMed databases until May 2017. A total of 14 studies with a pooled total of 15109 participants met the inclusion criteria, the results of which were combined and a meta-analysis was performed using the differences in correlations as the effect measure. Based on literature, rs1360780, rs3800373, and rs9470080 SNPs were selected within the FKBP5 gene and systematic review was conducted. Based on the Comprehensive Meta-Analysis software, no publication bias was detected. Sensitivity analysis and credibility of meta-analysis results also indicated that the analyses were stable. The meta-analysis showed that individuals who carry T allele of rs1360780, C-allele of rs3800373 or T-allele of rs9470080 exposed to early-life trauma had higher risks for depression or PTSD. The effects of ethnicity, age, sex, and different stress measures were not examined due to limited sample size. These results provide strong evidence of interactions between FKBP5 genotypes and early-life stress, which could pose a significant risk factor for stress-associated disorders such as major depression and PTSD. Copyright © 2017 Elsevier B.V. All rights reserved.
The Empirical Review of Meta-Analysis Published in Korea
ERIC Educational Resources Information Center
Park, Sunyoung; Hong, Sehee
2016-01-01
Meta-analysis is a statistical method that is increasingly utilized to combine and compare the results of previous primary studies. However, because of the lack of comprehensive guidelines for how to use meta-analysis, many meta-analysis studies have failed to consider important aspects, such as statistical programs, power analysis, publication…
Meta-analysis in Stata using gllamm.
Bagos, Pantelis G
2015-12-01
There are several user-written programs for performing meta-analysis in Stata (Stata Statistical Software: College Station, TX: Stata Corp LP). These include metan, metareg, mvmeta, and glst. However, there are several cases for which these programs do not suffice. For instance, there is no software for performing univariate meta-analysis with correlated estimates, for multilevel or hierarchical meta-analysis, or for meta-analysis of longitudinal data. In this work, we show with practical applications that many disparate models, including but not limited to the ones mentioned earlier, can be fitted using gllamm. The software is very versatile and can handle a wide variety of models with applications in a wide range of disciplines. The method presented here takes advantage of these modeling capabilities and makes use of appropriate transformations, based on the Cholesky decomposition of the inverse of the covariance matrix, known as generalized least squares, in order to handle correlated data. The models described earlier can be thought of as special instances of a general linear mixed-model formulation, but to the author's knowledge, a general exposition in order to incorporate all the available models for meta-analysis as special cases and the instructions to fit them in Stata has not been presented so far. Source code is available at http:www.compgen.org/tools/gllamm. Copyright © 2015 John Wiley & Sons, Ltd.
A guide to understanding meta-analysis.
Israel, Heidi; Richter, Randy R
2011-07-01
With the focus on evidence-based practice in healthcare, a well-conducted systematic review that includes a meta-analysis where indicated represents a high level of evidence for treatment effectiveness. The purpose of this commentary is to assist clinicians in understanding meta-analysis as a statistical tool using both published articles and explanations of components of the technique. We describe what meta-analysis is, what heterogeneity is, and how it affects meta-analysis, effect size, the modeling techniques of meta-analysis, and strengths and weaknesses of meta-analysis. Common components like forest plot interpretation, software that may be used, special cases for meta-analysis, such as subgroup analysis, individual patient data, and meta-regression, and a discussion of criticisms, are included.
The prevalence of acne in Mainland China: a systematic review and meta-analysis
Li, Danhui; Chen, Qiang; Liu, Yi; Liu, Tingting; Tang, Wenhui; Li, Shengjie
2017-01-01
Introduction Acne, a very common skin disease, can result in psychological distress and sustain impairment in quality of life. Data on the prevalence of acne and the differences in gender, region and age are limited. The aim of this review is to estimate the prevalence of acne in Mainland China comprehensively and to quantify its association with gender, region and age. Methods We searched electronic databases with predetermined search terms to identify relevant studies published between 1 January 1996 and 30 September 2016. We pointed out repeated results using Note Express software and evaluated the studies for inclusion. Two independent reviewers extracted the data, followed with statistical analyses using Comprehensive Meta-Analysis software version 2.0. A random effects model was adopted to calculate the overall pooled prevalence and to merge categories, including gender (males and females), region (Northern China and Southern China) and age (primary and secondary students: 7–17 years old; undergraduates: 18–23 years old; overall: no limits of age) for subgroup analyses. Logistic meta-regression analysis was used to clarify the associations between acne and the predictors age, gender and region using OR and their associated 95% CI. Results 25 relevant studies were included in this meta-analysis. The overall pooled prevalence rates of acne were 39.2% (95% CI 0.310 to 0.479). The prevalence rates in different age groups were 10.2% overall (95% CI 0.059 to 0.171), 50.2% for primary and secondary students (95% CI 0.451 to 0.554), and 44.5% for undergraduates (95% CI 0.358 to 0.534); by gender, the prevalence rates were 35.7% for females (95% CI 0.275 to 0.448) and 39.7% for males (95% CI 0.317 to 0.482); and by region, the prevalence rates were 34.2% for Northern China (95% CI 0.242 to 0.458) and 46.3% for Southern China (95% CI 0.374 to 0.555). The associations between acne and the predictors age, gender and region were statistically significant. Conclusions In Mainland China, primary and secondary students exhibited higher prevalence rates than undergraduate students; males had higher prevalence rates of acne than females; and the prevalence rates of acne in Southern China was higher than Northern China. PMID:28432064
Long noncoding RNA CCAT2 can predict metastasis and a poor prognosis: A meta-analysis.
Jing, Xuan; Liang, Hongping; Cui, Xiangrong; Han, Chongyang; Hao, Chonghua; Huo, Kai
2017-05-01
Colon cancer associated transcript 2 (CCAT2), a novel long non-coding RNA (lncRNA), plays a key role in tumorigenesis. This meta-analysis systematically summarizes the relationship between CCAT2 and cancers. A comprehensive, computerized literature search was conducted in PubMed, Cochrane library, Chinese National Knowledge Infrastructure, and Chinese Wan Fang database. Odds ratios (ORs), hazard ratios (HRs) and their 95% confidence interval (95% CI) were calculated to assess the effect size. A total of 9 studies were enrolled in this meta-analysis, which was performed by Revman5.3 software and Stata12.0. Our meta-analysis indicates that patients with elevated expression of CCAT2 are prone to developing distant metastasis (DM) (OR=12.42; 95% CI=5.77-26.74; P < 0.00001), which is associated with a tendency for lymph nodes metastasis (LNM) (OR=3.60 95% CI=1.65-7.87, P=0.001). Further analyses reveal that patients with high CCAT2 expression have poorer overall survival (OS) (HR=1.53, 95% CI=1.15-2.02, P=0.003, random-effects) and progression-free survival (PFS) (HR=2.88, 95% CI=1.81-4.56, P < 0.00001, fixed-effects). Therefore, CCAT2 may be a potential novel biomarker for indicating clinical outcomes of human cancers. Copyright © 2017 Elsevier B.V. All rights reserved.
Mei, Lin; He, Lin; Song, Yuhua; Lv, Yang; Zhang, Lijiu; Hao, Fengxi; Xu, Mengmeng
2018-05-01
To investigate the relationship between obesity and disease-free survival (DFS) and overall survival (OS) of triple-negative breast cancer. Citations were searched in PubMed, Cochrane Library, and Web of Science. Random effect model meta-analysis was conducted by using Revman software version 5.0, and publication bias was evaluated by creating Egger regression with STATA software version 12. Nine studies (4412 patients) were included for DFS meta-analysis, 8 studies (4392 patients) include for OS meta-analysis. There were no statistical significances between obesity with DFS (P = .60) and OS (P = .71) in triple-negative breast cancer (TNBC) patients. Obesity has no impact on DFS and OS in patients with TNBC.
Tanner-Smith, Emily E; Tipton, Elizabeth
2014-03-01
Methodologists have recently proposed robust variance estimation as one way to handle dependent effect sizes in meta-analysis. Software macros for robust variance estimation in meta-analysis are currently available for Stata (StataCorp LP, College Station, TX, USA) and spss (IBM, Armonk, NY, USA), yet there is little guidance for authors regarding the practical application and implementation of those macros. This paper provides a brief tutorial on the implementation of the Stata and spss macros and discusses practical issues meta-analysts should consider when estimating meta-regression models with robust variance estimates. Two example databases are used in the tutorial to illustrate the use of meta-analysis with robust variance estimates. Copyright © 2013 John Wiley & Sons, Ltd.
Comprehensive School Reform and Achievement: A Meta-Analysis
ERIC Educational Resources Information Center
Borman, Geoffrey D.; Hewes, Gina M.; Overman, Laura T.; Brown, Shelly
2003-01-01
This meta-analysis reviews research on the achievement effects of comprehensive school reform (CSR) and summarizes the specific effects of 29 widely implemented models. There are limitations on the overall quantity and quality of the research base, but the overall effects of CSR appear promising. The combined quantity, quality, and statistical…
Yuan, Xi; Liu, Wen-Jie; Li, Bing; Shen, Ze-Tian; Shen, Jun-Shu; Zhu, Xi-Xu
2017-08-01
This study was conducted to compare the effects of whole brain radiotherapy (WBRT) and stereotactic radiotherapy (SRS) in treatment of brain metastasis.A systematical retrieval in PubMed and Embase databases was performed for relative literatures on the effects of WBRT and SRS in treatment of brain metastasis. A Bayesian network meta-analysis was performed by using the ADDIS software. The effect sizes included odds ratio (OR) and 95% confidence interval (CI). A random effects model was used for the pooled analysis for all the outcome measures, including 1-year distant control rate, 1-year local control rate, 1-year survival rate, and complication. The consistency was tested by using node-splitting analysis and inconsistency standard deviation. The convergence was estimated according to the Brooks-Gelman-Rubin method.A total of 12 literatures were included in this meta-analysis. WBRT + SRS showed higher 1-year distant control rate than SRS. WBRT + SRS was better for the 1-year local control rate than WBRT. SRS and WBRT + SRS had higher 1-year survival rate than the WBRT. In addition, there was no difference in complication among the three therapies.Comprehensively, WBRT + SRS might be the choice of treatment for brain metastasis.
Glória, José Cristiano Ramos; Martins, Carolina Castro; Armond, Anna Catharina Vieira; Galvão, Endi Lanza; Dos Santos, Cássio Roberto Rocha; Falci, Saulo Gabriel Moreira
2018-06-01
The aim of this meta-analysis was to determine which characteristics of mandibular third molars (MTMs) are more often associated with an increase in the prevalence/incidence of caries on the distal surface of mandibular second molars (MSMs). Three electronic databases were analyzed: PubMed; OVID and the Virtual Health Library. Observational studies were included, and the risk of bias was assessed using The Newcastle-Ottawa Scale. The Comprehensive Meta-Analysis software program was used for meta-analysis. Fifteen studies were included in this systematic review, and five were included in the meta-analysis. The distal surface of MSMs were more likely to exhibit caries in the following scenarios: when MTMs were found in the A position, rather than the C position (OR: 3.45, 95% CI: 2.28-5.22, p<0.001); when the horizontal position was compared with the vertical (OR: 8.12, 95% CI: 3.75-17.58, p<0.001) and distoangular (OR: 9.75, 95% CI: 3.49 - 27.25, p<0.001) positions; and when the mesioangular position was compared with the vertical (OR: 7.25, 95% CI: 3.48-15.10, p<0.001) and distoangular (OR: 9.54, 95% CI: 3.47 - 26.21, p<0.001) positions. The results of this study suggest that the presence of MTMs increases the incidence of caries on the distal surface of MSMs. Furthermore, caries on the distal surface of MSMs is more commonly associated with position A and horizontal and mesioangular mandibular molars.
Methicillin resistant Staphylococcus aureus in Ethiopia: a meta-analysis.
Eshetie, Setegn; Tarekegn, Fentahun; Moges, Feleke; Amsalu, Anteneh; Birhan, Wubet; Huruy, Kahsay
2016-11-21
The burden of methicillin resistant Staphylococcus aureus is a major public health concern worldwide; however the overall epidemiology of multidrug resistant strains is neither coordinated nor harmonized, particularly in developing countries including Ethiopia. Therefore, the aim of this meta-analysis was to assess the burden of methicillin resistant Staphylococcos aureus and its antibiotic resistance pattern in Ethiopia at large. PubMed, Google Scholar, and lancet databases were searched and a total of 20 studies have been selected for meta-analysis. Six authors have independently extracts data on the prevalence of methicillin resistant Staphylococcus aureus among clinical isolates of Staphylococcus aureus. Statistical analysis was achieved by using Open meta-analyst (version 3.13) and Comprehensive meta-analysis (version 3.3) softwares. The overall prevalence of methicillin resistant Staphylococcus aureus and its antibiotic resistance pattern were pooled by using the forest plot, table and figure with 95% CI. The pooled prevalence of methicillin resistant Staphylococcus aureus was 32.5% (95% CI, 24.1 to 40.9%). Moreover, methicillin resistant Staphylococcus aureus strains were found to be highly resistant to penicillin, ampicillin, erythromycin, and amoxicillin, with a pooled resistance ratio of 99.1, 98.1, 97.2 and 97.1%, respectively. On the other hand, comparably low levels of resistance ratio were noted to vancomycin, 5.3%. The overall burden of methicillin resistant Staphylococcus aureus is considerably high, besides these strains showed extreme resistance to penicillin, ampicillin, erythromycin and amoxicillin. In principle, appropriate use of antibiotics, applying safety precautions are the key to reduce the spread of multidrug resistant strains, methicillin resistant Staphylococcus aureus in particular.
[Application of Stata software to test heterogeneity in meta-analysis method].
Wang, Dan; Mou, Zhen-yun; Zhai, Jun-xia; Zong, Hong-xia; Zhao, Xiao-dong
2008-07-01
To introduce the application of Stata software to heterogeneity test in meta-analysis. A data set was set up according to the example in the study, and the corresponding commands of the methods in Stata 9 software were applied to test the example. The methods used were Q-test and I2 statistic attached to the fixed effect model forest plot, H statistic and Galbraith plot. The existence of the heterogeneity among studies could be detected by Q-test and H statistic and the degree of the heterogeneity could be detected by I2 statistic. The outliers which were the sources of the heterogeneity could be spotted from the Galbraith plot. Heterogeneity test in meta-analysis can be completed by the four methods in Stata software simply and quickly. H and I2 statistics are more robust, and the outliers of the heterogeneity can be clearly seen in the Galbraith plot among the four methods.
Estrogen receptor β expression and colorectal cancer: a systematic review and meta-analysis.
Niv, Yaron
2015-12-01
Estrogen receptor β (ERβ) is a potential tumor-suppressor gene in colorectal cancer (CRC). This hypothesis is supported by clinical and laboratory observations. In this meta-analysis, we looked at studies that investigated the relationship between ERβ protein expression and CRC, comparing the lesion with normal adjacent mucosa. English medical literature searches were performed for ERβ expression in patients with CRC, tumor tissue versus normal mucosa. Searches were performed up to 31 May 2015, using MEDLINE, PubMed, EMBASE, Scopus, and CENTRAL. Meta-analysis was carried out using Comprehensive Meta-analysis Software. Pooled odds ratios and 95% confidence intervals were calculated and ERβ expression was compared in individual studies using the fixed-effects model. The odds ratio of ERβ expression was 0.216 (95% confidence interval 0.152-0.307, P<0.0001), lower in cancer tissue than normal mucosa. Funnel plot did not indicate a significant publication bias. There was no significant heterogeneity in the studies included: Q=5.897, d.f.(Q)=9, I=0.000, P=0.750. In this meta-analysis, we confirm the observation of decreased ERβ expression in CRC. Our results support the hypothesis of ERβ being a tumor-suppressor gene in the large bowel, and the ERβ protein protects against carcinogenesis and development of CRC when activated by estrogen. Further studies are needed to examine the potential of selective/specific ligands to activate ERβ without the side effects found with estrogen and without activating ERα. In this meta-analysis, we looked at studies that investigated the relationship between CRC and ERβ expression in the tumor and normal mucosa of CRC patients. English medical literature searches were performed for studies comparing ERβ expression in the cancer and normal colonic mucosa in patients with CRC. Meta-analysis was carried out, pooled odds ratios were calculated, and ERβ expression was compared in individual studies.
Sá, Michel Pompeu Barros de Oliveira; Ferraz, Paulo Ernando; Escobar, Rodrigo Renda; Martins, Wendell Nunes; Lustosa, Pablo César; Nunes, Eliobas de Oliveira; Vasconcelos, Frederico Pires; Lima, Ricardo Carvalho
2012-12-01
Most recent published meta-analysis of randomized controlled trials (RCTs) showed that off-pump coronary artery bypass graft surgery (CABG) reduces incidence of stroke by 30% compared with on-pump CABG, but showed no difference in other outcomes. New RCTs were published, indicating need of new meta-analysis to investigate pooled results adding these further studies. MEDLINE, EMBASE, CENTRAL/CCTR, SciELO, LILACS, Google Scholar and reference lists of relevant articles were searched for RCTs that compared outcomes (30-day mortality for all-cause, myocardial infarction or stroke) between off-pump versus on-pump CABG until May 2012. The principal summary measures were relative risk (RR) with 95% Confidence Interval (CI) and P values (considered statistically significant when <0.05). The RR's were combined across studies using DerSimonian-Laird random effects weighted model. Meta-analysis and meta-regression were completed using the software Comprehensive Meta-Analysis version 2 (Biostat Inc., Englewood, New Jersey, USA). Forty-seven RCTs were identified and included 13,524 patients (6,758 for off-pump and 6,766 for on-pump CABG). There was no significant difference between off-pump and on-pump CABG groups in RR for 30-day mortality or myocardial infarction, but there was difference about stroke in favor to off-pump CABG (RR 0.793, 95% CI 0.660-0.920, P=0.049). It was observed no important heterogeneity of effects about any outcome, but it was observed publication bias about outcome "stroke". Meta-regression did not demonstrate influence of female gender, number of grafts or age in outcomes. Off-pump CABG reduces the incidence of post-operative stroke by 20.7% and has no substantial effect on mortality or myocardial infarction in comparison to on-pump CABG. Patient gender, number of grafts performed and age do not seem to explain the effect of off-pump CABG on mortality, myocardial infarction or stroke, respectively.
Shi, HaiCun; Yuan, CongHu; Dai, ZhenYu; Ma, HaiRong; Sheng, LiQin
2016-12-01
Studies employing voxel-based morphometry (VBM) have reported inconsistent findings on the association of gray matter (GM) abnormalities with fibromyalgia. The aim of the present study is to identify the most prominent and replicable GM areas that involved in fibromyalgia. A systematic search of the PubMed database from January 2000 to September 2015 was performed to identify eligible whole-brain VBM studies. Comprehensive meta-analyses to investigate regional GM abnormalities in fibromyalgia were conducted with the Seed-based d Mapping software package. Seven studies, reporting nine comparisons and including a grand total of 180 fibromyalgia patients and 126 healthy controls, were included in the meta-analyses. In fibromyalgia patients compared with healthy controls, regional GM decreases were consistently found in the bilateral anterior cingulate/paracingulate cortex/medial prefrontal cortex, the bilateral posterior cingulate/paracingulate cortex, the left parahippocampal gyrus/fusiform cortex, and the right parahippocampal gyrus/hippocampus. Regional GM increases were consistently found in the left cerebellum. Meta-regression demonstrated that age was correlated with GM anomalies in fibromyalgia patients. The current meta-analysis identified a characteristic pattern of GM alterations within the medial pain system, default mode network, and cerebro-cerebellar circuits, which further supports the concept that fibromyalgia is a symptom complex involving brain areas beyond those implicated in chronic pain. Copyright © 2016 Elsevier Inc. All rights reserved.
ERIC Educational Resources Information Center
Tanner-Smith, Emily E.; Tipton, Elizabeth
2014-01-01
Methodologists have recently proposed robust variance estimation as one way to handle dependent effect sizes in meta-analysis. Software macros for robust variance estimation in meta-analysis are currently available for Stata (StataCorp LP, College Station, TX, USA) and SPSS (IBM, Armonk, NY, USA), yet there is little guidance for authors regarding…
ERIC Educational Resources Information Center
Costa, Joana M.; Miranda, Guilhermina L.
2017-01-01
This paper presents the results of a systematic review of the literature, including a meta-analysis, about the effectiveness of the use of Alice software in programming learning when compared to the use of a conventional programming language. Our research included studies published between the years 2000 and 2014 in the main databases. We gathered…
L2 Reading Comprehension and Its Correlates: A Meta-Analysis
ERIC Educational Resources Information Center
Jeon, Eun Hee; Yamashita, Junko
2014-01-01
The present meta-analysis examined the overall average correlation (weighted for sample size and corrected for measurement error) between passage-level second language (L2) reading comprehension and 10 key reading component variables investigated in the research domain. Four high-evidence correlates (with 18 or more accumulated effect sizes: L2…
ERIC Educational Resources Information Center
Sencibaugh, Joseph M.
2005-01-01
This paper examines research studies, which focus on interventions commonly used with students who are learning disabled and identify effective methods that produce substantial benefits concerning reading comprehension. This paper synthesizes previous observation studies by conducting a meta-analysis of strategies used to improve the reading…
ERIC Educational Resources Information Center
Sencibaugh, Joseph M.
2007-01-01
This paper examines research studies, which focus on interventions commonly used with students who are learning disabled and identifies effective methods that produce substantial benefits concerning reading comprehension. This paper synthesizes previous observation studies by conducting a meta-analysis of strategies used to improve the reading…
ERIC Educational Resources Information Center
Collins, Alyson A.; Lindström, Esther R.; Compton, Donald L.
2018-01-01
Researchers have increasingly investigated sources of variance in reading comprehension test scores, particularly with students with reading difficulties (RD). The purpose of this meta-analysis was to determine if the achievement gap between students with RD and typically developing (TD) students varies as a function of different reading…
The correlation of social support with mental health: A meta-analysis.
Harandi, Tayebeh Fasihi; Taghinasab, Maryam Mohammad; Nayeri, Tayebeh Dehghan
2017-09-01
Social support is an important factor that can affect mental health. In recent decades, many studies have been done on the impact of social support on mental health. The purpose of the present study is to investigate the effect size of the relationship between social support and mental health in studies in Iran. This meta-analysis was carried out in studies that were performed from 1996 through 2015. Databases included SID and Magiran, the comprehensive portal of human sciences, Noor specialized magazine databases, IRANDOC, Proquest, PubMed, Scopus, ERIC, Iranmedex and Google Scholar. The keywords used to search these websites included "mental health or general health," and "Iran" and "social support." In total, 64 studies had inclusion criteria meta-analysis. In order to collect data used from a meta-analysis worksheet that was made by the researcher and for data analysis software, CMA-2 was used. The mean of effect size of the 64 studies in the fixed-effect model and random-effect model was obtained respectively as 0.356 and 0.330, which indicated the moderate effect size of social support on mental health. The studies did not have publication bias, and enjoyed a heterogeneous effect size. The target population and social support questionnaire were moderator variables, but sex, sampling method, and mental health questionnaire were not moderator variables. Regarding relatively high effect size of the correlation between social support and mental health, it is necessary to predispose higher social support, especially for women, the elderly, patients, workers, and students.
Sun, Y; Zhou, R B; Chen, D M
2015-12-28
The aim of this study was to investigate correlations between apolipoprotein A-V (APOA5) -1131T>C and apolipoprotein C-III (APOC3) -455T>C polymorphisms and coronary heart disease (CHD). PubMed, Ovid, Cochrane Library, Embase, China National Knowledge Infrastructure, and Wanfang databases were searched using combinations of keywords relating to these polymorphisms and CHD. Studies retrieved from database searches were screened using our stringent inclusion and exclusion criteria, and Comprehensive Meta-Analysis Version 2.0 software was used for statistical analyses. In total, 115 studies were initially retrieved and after further selection, 11 were included in the meta-analysis. These 11 articles comprised 4840 patients with CHD in the case group and 4913 healthy participants in the control group. Meta-analysis revealed that APOA5 -1131T>C and APOC3 -455T>C polymorphisms increased CHD risk. In addition, subgroup analysis by ethnicity showed that while the -1131T>C polymorphism elevated the risk of CHD in the Caucasian population under both allelic and dominant models, this increased risk was observed only under a dominant model in the Asian population. The results of our meta-analysis point to a strong link between both APOA5 -1131T>C and APOC3 -455T>C polymorphisms and an increased risk of CHD. Thus, these polymorphisms constitute important predictive indicators of CHD susceptibility.
Neyeloff, Jeruza L; Fuchs, Sandra C; Moreira, Leila B
2012-01-20
Meta-analyses are necessary to synthesize data obtained from primary research, and in many situations reviews of observational studies are the only available alternative. General purpose statistical packages can meta-analyze data, but usually require external macros or coding. Commercial specialist software is available, but may be expensive and focused in a particular type of primary data. Most available softwares have limitations in dealing with descriptive data, and the graphical display of summary statistics such as incidence and prevalence is unsatisfactory. Analyses can be conducted using Microsoft Excel, but there was no previous guide available. We constructed a step-by-step guide to perform a meta-analysis in a Microsoft Excel spreadsheet, using either fixed-effect or random-effects models. We have also developed a second spreadsheet capable of producing customized forest plots. It is possible to conduct a meta-analysis using only Microsoft Excel. More important, to our knowledge this is the first description of a method for producing a statistically adequate but graphically appealing forest plot summarizing descriptive data, using widely available software.
2012-01-01
Background Meta-analyses are necessary to synthesize data obtained from primary research, and in many situations reviews of observational studies are the only available alternative. General purpose statistical packages can meta-analyze data, but usually require external macros or coding. Commercial specialist software is available, but may be expensive and focused in a particular type of primary data. Most available softwares have limitations in dealing with descriptive data, and the graphical display of summary statistics such as incidence and prevalence is unsatisfactory. Analyses can be conducted using Microsoft Excel, but there was no previous guide available. Findings We constructed a step-by-step guide to perform a meta-analysis in a Microsoft Excel spreadsheet, using either fixed-effect or random-effects models. We have also developed a second spreadsheet capable of producing customized forest plots. Conclusions It is possible to conduct a meta-analysis using only Microsoft Excel. More important, to our knowledge this is the first description of a method for producing a statistically adequate but graphically appealing forest plot summarizing descriptive data, using widely available software. PMID:22264277
ERIC Educational Resources Information Center
Adank, Patti
2012-01-01
The role of speech production mechanisms in difficult speech comprehension is the subject of on-going debate in speech science. Two Activation Likelihood Estimation (ALE) analyses were conducted on neuroimaging studies investigating difficult speech comprehension or speech production. Meta-analysis 1 included 10 studies contrasting comprehension…
Costigan, S A; Eather, N; Plotnikoff, R C; Taaffe, D R; Lubans, D R
2015-10-01
High-intensity interval training (HIIT) may be a feasible and efficacious strategy for improving health-related fitness in young people. The objective of this systematic review and meta-analysis was to evaluate the utility of HIIT to improve health-related fitness in adolescents and to identify potential moderators of training effects. Studies were considered eligible if they: (1) examined adolescents (13-18 years); (2) examined health-related fitness outcomes; (3) involved an intervention of ≥4 weeks in duration; (4) included a control or moderate intensity comparison group; and (5) prescribed high-intensity activity for the HIIT condition. Meta-analyses were conducted to determine the effect of HIIT on health-related fitness components using Comprehensive Meta-analysis software and potential moderators were explored (ie, study duration, risk of bias and type of comparison group). The effects of HIIT on cardiorespiratory fitness and body composition were large, and medium, respectively. Study duration was a moderator for the effect of HIIT on body fat percentage. Intervention effects for waist circumference and muscular fitness were not statistically significant. HIIT is a feasible and time-efficient approach for improving cardiorespiratory fitness and body composition in adolescent populations. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.
Identification of MS-Cleavable and Non-Cleavable Chemically Crosslinked Peptides with MetaMorpheus.
Lu, Lei; Millikin, Robert J; Solntsev, Stefan K; Rolfs, Zach; Scalf, Mark; Shortreed, Michael R; Smith, Lloyd M
2018-05-25
Protein chemical crosslinking combined with mass spectrometry has become an important technique for the analysis of protein structure and protein-protein interactions. A variety of crosslinkers are well developed, but reliable, rapid, and user-friendly tools for large-scale analysis of crosslinked proteins are still in need. Here we report MetaMorpheusXL, a new search module within the MetaMorpheus software suite that identifies both MS-cleavable and non-cleavable crosslinked peptides in MS data. MetaMorpheusXL identifies MS-cleavable crosslinked peptides with an ion-indexing algorithm, which enables an efficient large database search. The identification does not require the presence of signature fragment ions, an advantage compared to similar programs such as XlinkX. One complication associated with the need for signature ions from cleavable crosslinkers such as DSSO (disuccinimidyl sulfoxide) is the requirement for multiple fragmentation types and energy combinations, which is not necessary for MetaMorpheusXL. The ability to perform proteome-wide analysis is another advantage of MetaMorpheusXl compared to such programs as MeroX and DXMSMS. MetaMorpheusXL is also faster than other currently available MS-cleavable crosslink search software programs. It is imbedded in MetaMorpheus, an open-source and freely available software suite that provides a reliable, fast, user-friendly graphical user interface that is readily accessible to researchers.
The role of SISCOM in preoperative evaluation for patients with epilepsy surgery: A meta-analysis.
Chen, Tong; Guo, Liang
2016-10-01
To assess the specific value of subtraction ictal and inter-ictal SPECT co-registered to MRI (SISCOM) in identifying the epileptogenic zone (EZ) and predicting postoperative outcomes in epileptic surgical patients. A meta-analysis of studies published from January 1995 to June 2015 was conducted through a comprehensive literature search, and 11 studies were included. R software was first used to calculate a pooled positive rate, concordant rate and positive predictive value (PPV) for good outcomes. Stata software was then used to explore the relationship between SISCOM localization and surgical outcomes, including a subgroup analysis for extra-temporal lobe epilepsy. The unweighted positive and concordant rates of SISCOM were 85.9% and 65.3%, respectively. In 142 MRI-negative patients, the SISCOM positive rate was 83.8%. The pooled PPV of 178 surgical patients with concordant SISCOM was 56%. In the meta-analysis of 275 surgical patients, the seizure-free odds ratio was 3.28-times higher in concordant than in non-concordant SISCOM patients [95%CI (1.90, 5.67)]. For extra-temporal lobe epilepsy, the seizure-free odds ratio was 2.44-times higher in concordant than in non-concordant SISCOM patients [95%CI (1.34, 4.43)]. Our data indicate that SISCOM has moderate sensitivity in localizing the epileptogenic zone and can provide complementary information when MRI is negative. Furthermore, SISCOM localization concordant with the gold standard demonstrates slightly higher predictive value for good surgical outcomes. Further research is required to explore the influence of SISCOM localization results in temporal lobe versus extra-temporal lobe epilepsy. Copyright © 2016 British Epilepsy Association. Published by Elsevier Ltd. All rights reserved.
Talasaz, Zahra Hadizadeh; Sadeghi, Ramin; Askari, Fariba; Dadgar, Salmeh; Vatanchi, Atiyeh
2018-04-01
Detecting pregnant women at risk of diabetes in first months can help them by early intervention for delaying or preventing onset of GDM. In this study, we aimed to assess the Predictive value of first trimester Pregnancy related plasma protein-A (PAPP-A) levels for detecting Gestational diabetes Mellitus (GDM). This systematic review and meta-analysis was conducted through probing in databases. PubMed, Scopus, Medline and Google scholar citations were searched to find the published papers from 1974 to 2017. Studies were considered eligible if they were cohorts, case-control studies, reported GDM result, not other types, conducted on singleton pregnancy, measured Serum pregnancy associated plasma protein A in the first trimester and evaluated the relation of first trimester pregnancy associated plasma protein-A and GDM. Two reviewers independently assessed the quality with Newcastle-Ottawa and extracted data in the Pre-defined checklist. Analysis of the data was carried out by "Comprehensive Meta-analysis Version 2 (CAM)" and Metadisc software. 17 articles have our inclusion criteria and were considered in our systematic review, 5 studies included in Meta-analysis. Meta-analysis of these articles showed that the predictive value of PAPP-A for GDM has 55% sensitivity (53-58), 90% (89-90) specificity, LR + 2.48 (0.83-7.36) and LR - 0.70 (0.45-1.09) with 95% confidence intervals. In our study PAPP-A has low predictive accuracy overall, but it may be useful when combined with other tests, and this is an active part for future research. One limitation of our study is significant heterogeneity because of different adjusted variables and varied diagnostic criteria. Copyright © 2018. Published by Elsevier B.V.
Flipped classroom improves student learning in health professions education: a meta-analysis.
Hew, Khe Foon; Lo, Chung Kwan
2018-03-15
The use of flipped classroom approach has become increasingly popular in health professions education. However, no meta-analysis has been published that specifically examines the effect of flipped classroom versus traditional classroom on student learning. This study examined the findings of comparative articles through a meta-analysis in order to summarize the overall effects of teaching with the flipped classroom approach. We focused specifically on a set of flipped classroom studies in which pre-recorded videos were provided before face-to-face class meetings. These comparative articles focused on health care professionals including medical students, residents, doctors, nurses, or learners in other health care professions and disciplines (e.g., dental, pharmacy, environmental or occupational health). Using predefined study eligibility criteria, seven electronic databases were searched in mid-April 2017 for relevant articles. Methodological quality was graded using the Medical Education Research Study Quality Instrument (MERSQI). Effect sizes, heterogeneity estimates, analysis of possible moderators, and publication bias were computed using the COMPREHENSIVE META-ANALYSIS software. A meta-analysis of 28 eligible comparative studies (between-subject design) showed an overall significant effect in favor of flipped classrooms over traditional classrooms for health professions education (standardized mean difference, SMD = 0.33, 95% confidence interval, CI = 0.21-0.46, p < 0.001), with no evidence of publication bias. In addition, the flipped classroom approach was more effective when instructors used quizzes at the start of each in-class session. More respondents reported they preferred flipped to traditional classrooms. Current evidence suggests that the flipped classroom approach in health professions education yields a significant improvement in student learning compared with traditional teaching methods.
Chen, Si; Li, Yuan; Deng, Chuiwen; Li, Jing; Wen, Xiaoting; Wu, Ziyan; Hu, Chaojun; Zhang, Shulan; Li, Ping; Zhang, Xuan; Zhang, Fengchun; Li, Yongzhe
2016-01-01
Previous surveys had evaluated the effects of the PD-1, CTLA-4 gene polymorphisms on susceptibility to ankylosing spondylitis (AS), but the results remained controversial. To briefly examine these consequences, a comprehensive meta-analysis was conducted to estimate the relationships between PD-1 rs11568821, rs2227982, rs2227981, CTLA-4 +49 A/G and -318 C/T polymorphisms and AS risk. The available articles dated to December 2014 were searched in the PUBMED, MEDLINE and EMBASE databases. The data of the genotypes and/or alleles for the PD-1 rs11568821, rs2227982, rs2227981, CTLA-4 +49 A/G and -318 C/T polymorphisms in the AS and control subjects were extracted, and statistical analysis was conducted by STATA 11.2 software. Summary odds ratios (ORs) with their 95 % confidence intervals (95 % CIs) were calculated to determine the strength of associations with fixed-effects or random-effects models. A total of eight published studies were finally involved in this meta-analysis. Meta-analysis of PD-1 rs2227982 polymorphism under the T allele versus C allele (OR 1.744, 95 % CI 1.477-2.059, P < 0.0001), TT+TC versus CC (OR 2.292, 95 % CI 1.654-3.175, P < 0.0001), TT versus CC (OR 1.883, 95 % CI 1.299-2.729, P = 0.001) revealed a significant association with AS. Our meta-analysis demonstrated that the rs2227982 polymorphism in the PD-1 gene might contribute to AS susceptibility. However, further studies with large sample sizes and among different ethnicity populations should be required to confirm this association.
Weir, Christopher J; Butcher, Isabella; Assi, Valentina; Lewis, Stephanie C; Murray, Gordon D; Langhorne, Peter; Brady, Marian C
2018-03-07
Rigorous, informative meta-analyses rely on availability of appropriate summary statistics or individual participant data. For continuous outcomes, especially those with naturally skewed distributions, summary information on the mean or variability often goes unreported. While full reporting of original trial data is the ideal, we sought to identify methods for handling unreported mean or variability summary statistics in meta-analysis. We undertook two systematic literature reviews to identify methodological approaches used to deal with missing mean or variability summary statistics. Five electronic databases were searched, in addition to the Cochrane Colloquium abstract books and the Cochrane Statistics Methods Group mailing list archive. We also conducted cited reference searching and emailed topic experts to identify recent methodological developments. Details recorded included the description of the method, the information required to implement the method, any underlying assumptions and whether the method could be readily applied in standard statistical software. We provided a summary description of the methods identified, illustrating selected methods in example meta-analysis scenarios. For missing standard deviations (SDs), following screening of 503 articles, fifteen methods were identified in addition to those reported in a previous review. These included Bayesian hierarchical modelling at the meta-analysis level; summary statistic level imputation based on observed SD values from other trials in the meta-analysis; a practical approximation based on the range; and algebraic estimation of the SD based on other summary statistics. Following screening of 1124 articles for methods estimating the mean, one approximate Bayesian computation approach and three papers based on alternative summary statistics were identified. Illustrative meta-analyses showed that when replacing a missing SD the approximation using the range minimised loss of precision and generally performed better than omitting trials. When estimating missing means, a formula using the median, lower quartile and upper quartile performed best in preserving the precision of the meta-analysis findings, although in some scenarios, omitting trials gave superior results. Methods based on summary statistics (minimum, maximum, lower quartile, upper quartile, median) reported in the literature facilitate more comprehensive inclusion of randomised controlled trials with missing mean or variability summary statistics within meta-analyses.
Therapy of bovine endometritis with prostaglandin F2α: a meta-analysis.
Haimerl, P; Heuwieser, W; Arlt, S
2013-05-01
The objective of the conducted meta-analysis was to assess the efficacy of the treatment of bovine endometritis with PGF(2α) by statistical means. Postpartum uterine infections have a high prevalence and a very negative effect on reproductive performance in dairy cattle. Because of a wide discordance between research results, a meta-analysis of the efficacy of the treatment of bovine endometritis with PGF(2α) was conducted. A comprehensive literature search was performed using online databases to reveal a total of 2,307 references. In addition, 5 articles were retrieved by reviewing citations. After applying specific exclusion criteria and evaluating specific evidence parameters, 5 publications, comprising 6 trials, were eligible for being analyzed by means of meta-analysis. Data for each trial were extracted and analyzed using meta-analysis software Review Manager (version 5.1; The Nordic Cochrane Centre, Copenhagen, Denmark). Estimated effect sizes of PGF(2α) were calculated on calving to first service and calving to conception interval. Prostaglandin F(2α) treatment of cows with chronic endometritis had a negative effect on both reproductive performance parameters. Heterogeneity was substantial for calving to first service and calving to conception interval [I(2) (measure of variation beyond chance)=100 and 87%, respectively]; therefore, random-effects models were used. Sensitivity analysis as well as subgroup analysis showed that the performance of randomization was influential in modifying effect size of PGF(2α) treatment. The funnel plot illustrated a publication bias toward smaller studies that reported a prolonged calving to conception interval after a PGF(2α) treatment. We conclude that the investigation of this subject by means of meta-analysis did not reveal an improvement of reproductive performance of cows with endometritis after treatment with PGF(2α). Furthermore, there is a shortage of comparable high quality studies investigating reproductive performance after PGF(2α) treatment of cows with chronic endometritis. Copyright © 2013 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Khaledi, Azad; Bahador, Abbas; Esmaeili, Davood; Tafazoli, Alireza; Ghazvini, Kiarash; Mansury, Davood
2016-01-01
While the most nontuberculous mycobacteria (NTMs) species are considered as opportunistic pathogens, some of them are related to several human infections. It is believed that environment is the main source for these infections. Distribution and scattering pattern of NTMs has not been well studied in Iran and a few studies about this subject have been done, so the aim of this study was to determine prevalence of NTMs in environmental samples from Iran. Data about prevalence of NTMs in environmental samples from Iran were obtained by searching databases. The studies presenting cross-sectional or cohort and the papers with sample size ≥30 were included. Then, the meta-analysis was performed using Comprehensive Meta-Analysis software and Cochran's Q and I 2 tests. The strategy search was based PRISMA protocol is available online (PRISMA, http://www.prisma-statement.org). The results of this meta-analysis showed that overall combined prevalence of NTMs in environmental samples from Iran was 38.3%. The frequency of NTM was higher in the north of Iran (73.2%). The most prevalent rapid-growing mycobacterium was Mycobacterium fortuitum (19.8%), and the most dominant slow-growing mycobacterium was Mycobacterium flavescens (16.8%). In regard to increasing incidence of disease in immunocompromised patients and existence of different types of mycobacteria species in environmental samples, efforts should be focused on measures that will specifically remove NTMs from habitats where susceptible individuals are exposed.
Bates, A S; Knepil, G J
2016-01-01
Craniofacial surgery causes immediate postoperative pain, oedema, and functional limitations. Hilotherapy delivers cooled water to the face at 15°C and may reduce the postoperative recovery time. This work presents a meta-analysis of short-term postoperative outcomes after hilotherapy. Following a systematic literature search, comparative trials of patients undergoing surgical interventions in the maxillofacial region and receiving either hilotherapy or ice-cooling therapy were included for meta-analysis. Demographics and surgical outcomes were extracted. Data were analysed using Comprehensive Meta-Analysis software. Mean (SEM) data were calculated for demographic variables and standardized mean differences with the 95% confidence interval for surgical outcomes. Five trials were analysed, providing 206 patients for evaluation; mean patient age was 29.4 (9.4) years. Hilotherapy reduced pain (10-point visual analogue scale) at 48 h (P<0.010) and 72 h (P<0.050), as well as postoperative facial oedema (P<0.010), compared to ice-cooling treatment. Trismus and facial neurological scores were also improved (P=0.08). Patients preferred hilotherapy to other cooling methods (P<0.010). Hilotherapy appears to be effective in reducing postoperative facial pain, oedema, and trismus, and in improving patient-reported outcomes. Well-designed randomized controlled clinical trials are required to clarify the procedure-specific efficacy of postoperative hilotherapy and optimal durations of treatment. Copyright © 2015 International Association of Oral and Maxillofacial Surgeons. Published by Elsevier Ltd. All rights reserved.
Suh, Soon-Rim; Lee, Myung Kyung
2017-07-01
To evaluate the effects of nurse-led telephone-based supportive interventions (NTSIs) for patients with cancer. . Electronic databases, including EMBASE®, MEDLINE, Google Scholar, Cochrane Library CENTRAL, ProQuest Medical Library, and CINAHL®, were searched through February 2016. . 239 studies were identified; 16 were suitable for meta-analysis. Cochrane's risk of bias tool and the Comprehensive Meta-Analysis software were used. . The authors performed a meta-analysis of 16 trials that met eligibility criteria. Thirteen randomized, controlled trials (RCTs) and three non-RCTs examined a total of 2,912 patients with cancer. Patients who received NTSIs were compared with those who received attentional control or usual care (no intervention). . Telephone interventions delivered by a nurse in an oncology care setting reduced cancer symptoms with a moderate effect size (ES) (-0.33) and emotional distress with a small ES (-0.12), and improved self-care with a large ES (0.64) and health-related quality of life (HRQOL) with a small ES (0.3). Subgroup analyses indicated that the significant effects of NTSIs on cancer symptoms, emotional distress, and HRQOL were larger for studies that combined an application of a theoretical framework, had a control group given usual care, and used an RTC design. . The findings suggest that an additional tiered evaluation that has a theoretical underpinning and high-quality methodology is required to confirm the efficacy of NTSI for adoption of specific care models.
You, Tao; Yi, Kang; Ding, Zhao-Hong; Hou, Xiao-Dong; Liu, Xing-Guang; Wang, Xin-Kuan; Ge, Long; Tian, Jin-Hui
2017-06-21
Both transcatheter device closure and surgical repair are effective treatments with excellent midterm outcomes for perimembranous ventricular septal defects (pmVSDs) in children. The mini-invasive periventricular device occlusion technique has become prevalent in research and application, but evidence is limited for the assessment of transcatheter closure, mini-invasive closure and open-heart surgical repair. This study comprehensively compares the efficacy, safety and costs of transcatheter closure, mini-invasive closure and open-heart surgical repair for treatment of pmVSDs in children using Bayesian network meta-analysis. A systematic search will be performed using Chinese Biomedical Literature Database, China National Knowledge Infrastructure, PubMed, EMBASE.com and the Cochrane Central Register of Controlled Trials to include random controlled trials, prospective or retrospective cohort studies comparing the efficacy, safety and costs of transcatheter closure, mini-invasive closure and open-heart surgical repair. The risk of bias for the included prospective or retrospective cohort studies will be evaluated according to the risk of bias in non-randomised studies of interventions (ROBINS-I). For random controlled trials, we will use risk of bias tool from Cochrane Handbook version 5.1.0. A Bayesian network meta-analysis will be conducted using R-3.3.2 software. Ethical approval and patient consent are not required since this study is a network meta-analysis based on published trials. The results of this network meta-analysis will be submitted to a peer-reviewed journal for publication. CRD42016053352. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.
Wang, Hai-Yang; Zhang, Xiao-Xia; Si, Cui-Ping; Xu, Yang; Liu, Qian; Bian, He-Tao; Zhang, Bing-Wei; Li, Xue-Lin; Yan, Zhong-Rui
2018-01-01
Impairments in emotion regulation, and more specifically in cognitive reappraisal, are thought to play a key role in the pathogenesis of anxiety disorders. However, the available evidence on such deficits is inconsistent. To further illustrate the neurobiological underpinnings of anxiety disorder, the present meta-analysis summarizes functional magnetic resonance imaging (fMRI) findings for cognitive reappraisal tasks and investigates related brain areas. We performed a comprehensive series of meta-analyses of cognitive reappraisal fMRI studies contrasting patients with anxiety disorder with healthy control (HC) subjects, employing an anisotropic effect-size signed differential mapping approach. We also conducted a subgroup analysis of medication status, anxiety disorder subtype, data-processing software, and MRI field strengths. Meta-regression was used to explore the effects of demographics and clinical characteristics. Eight studies, with 11 datasets including 219 patients with anxiety disorder and 227 HC, were identified. Compared with HC, patients with anxiety disorder showed relatively decreased activation of the bilateral dorsomedial prefrontal cortex (dmPFC), bilateral dorsal anterior cingulate cortex (dACC), bilateral supplementary motor area (SMA), left ventromedial prefrontal cortex (vmPFC), bilateral parietal cortex, and left fusiform gyrus during cognitive reappraisal. The subgroup analysis, jackknife sensitivity analysis, heterogeneity analysis, and Egger's tests further confirmed these findings. Impaired cognitive reappraisal in anxiety disorder may be the consequence of hypo-activation of the prefrontoparietal network, consistent with insufficient top-down control. Our findings provide robust evidence that functional impairment in prefrontoparietal neuronal circuits may have a significant role in the pathogenesis of anxiety disorder.
ERIC Educational Resources Information Center
Reinwein, Joachim; Huberdeau, Lucie
A meta-analysis examined a series of studies by F.M. Dwyer on the effect of illustrations on text comprehension. Principal component analysis was used to reduce the four posttests used by Dwyer to more fundamental factors of learning, followed by analyses of variance. All nine studies (involving secondary-school and college students) in which…
ERIC Educational Resources Information Center
Gegenfurtner, Andreas; Lehtinen, Erno; Saljo, Roger
2011-01-01
This meta-analysis integrates 296 effect sizes reported in eye-tracking research on expertise differences in the comprehension of visualizations. Three theories were evaluated: Ericsson and Kintsch's ("Psychol Rev" 102:211-245, 1995) theory of long-term working memory, Haider and Frensch's ("J Exp Psychol Learn Mem Cognit" 25:172-190, 1999)…
ERIC Educational Resources Information Center
Elleman, Amy M.; Lindo, Endia J.; Morphy, Paul; Compton, Donald L.
2009-01-01
A meta-analysis of vocabulary interventions in grades pre-K to 12 was conducted with 37 studies to better understand the impact of vocabulary on comprehension. Vocabulary instruction was found to be effective at increasing students' ability to comprehend text with custom measures (d = 0.50), but was less effective for standardized measures (d =…
A meta-analysis of active video games on health outcomes among children and adolescents.
Gao, Z; Chen, S; Pasco, D; Pope, Z
2015-09-01
This meta-analysis synthesizes current literature concerning the effects of active video games (AVGs) on children/adolescents' health-related outcomes. A total of 512 published studies on AVGs were located, and 35 articles were included based on the following criteria: (i) data-based research articles published in English between 1985 and 2015; (ii) studied some types of AVGs and related outcomes among children/adolescents and (iii) had at least one comparison within each study. Data were extracted to conduct comparisons for outcome measures in three separate categories: AVGs and sedentary behaviours, AVGs and laboratory-based exercise, and AVGs and field-based physical activity. Effect size for each entry was calculated with the Comprehensive Meta-Analysis software in 2015. Mean effect size (Hedge's g) and standard deviation were calculated for each comparison. Compared with sedentary behaviours, AVGs had a large effect on health outcomes. The effect sizes for physiological outcomes were marginal when comparing AVGs with laboratory-based exercises. The comparison between AVGs and field-based physical activity had null to moderate effect sizes. AVGs could yield equivalent health benefits to children/adolescents as laboratory-based exercise or field-based physical activity. Therefore, AVGs can be a good alternative for sedentary behaviour and addition to traditional physical activity and sports in children/adolescents. © 2015 World Obesity.
Gifted Ethnic Minority Students and Academic Achievement: A Meta-Analysis
ERIC Educational Resources Information Center
Henfield, Malik S.; Woo, Hongryun; Bang, Na Mi
2017-01-01
We conducted a meta-analysis exploring ethnic minority students enrolled in gifted/advanced programs with an emphasis on their academic achievement outcomes. A comprehensive search based on the Transparent Reporting of Systematic Reviews and Meta-Analysis checklist, was performed to retrieve articles within a 30-year time period (1983-2014), which…
Comparing Active Pediatric Obesity Treatments Using Meta-Analysis
ERIC Educational Resources Information Center
Gilles, Allyson; Cassano, Michael; Shepherd, Elizabeth J.; Higgins, Diana; Hecker, Jeffrey E.; Nangle, Douglas W.
2008-01-01
The current meta-analysis reviews research on the treatment of pediatric obesity focusing on studies that have been published since 1994. Eleven studies (22 comparisons, 115 effect sizes, N = 447) were included in the present meta-analysis. Results indicated that comprehensive behavioral interventions may be improved in at least two ways:…
The prevalence of acne in Mainland China: a systematic review and meta-analysis.
Li, Danhui; Chen, Qiang; Liu, Yi; Liu, Tingting; Tang, Wenhui; Li, Shengjie
2017-04-20
Acne, a very common skin disease, can result in psychological distress and sustain impairment in quality of life. Data on the prevalence of acne and the differences in gender, region and age are limited. The aim of this review is to estimate the prevalence of acne in Mainland China comprehensively and to quantify its association with gender, region and age. We searched electronic databases with predetermined search terms to identify relevant studies published between 1 January 1996 and 30 September 2016. We pointed out repeated results using Note Express software and evaluated the studies for inclusion. Two independent reviewers extracted the data, followed with statistical analyses using Comprehensive Meta-Analysis software version 2.0. A random effects model was adopted to calculate the overall pooled prevalence and to merge categories, including gender (males and females), region (Northern China and Southern China) and age (primary and secondary students: 7-17 years old; undergraduates: 18-23 years old; overall: no limits of age) for subgroup analyses. Logistic meta-regression analysis was used to clarify the associations between acne and the predictors age, gender and region using OR and their associated 95% CI. 25 relevant studies were included in this meta-analysis. The overall pooled prevalence rates of acne were 39.2% (95% CI 0.310 to 0.479). The prevalence rates in different age groups were 10.2% overall (95% CI 0.059 to 0.171), 50.2% for primary and secondary students (95% CI 0.451 to 0.554), and 44.5% for undergraduates (95% CI 0.358 to 0.534); by gender, the prevalence rates were 35.7% for females (95% CI 0.275 to 0.448) and 39.7% for males (95% CI 0.317 to 0.482); and by region, the prevalence rates were 34.2% for Northern China (95% CI 0.242 to 0.458) and 46.3% for Southern China (95% CI 0.374 to 0.555). The associations between acne and the predictors age, gender and region were statistically significant. In Mainland China, primary and secondary students exhibited higher prevalence rates than undergraduate students; males had higher prevalence rates of acne than females; and the prevalence rates of acne in Southern China was higher than Northern China. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.
Dubovenko, Alexey; Nikolsky, Yuri; Rakhmatulin, Eugene; Nikolskaya, Tatiana
2017-01-01
Analysis of NGS and other sequencing data, gene variants, gene expression, proteomics, and other high-throughput (OMICs) data is challenging because of its biological complexity and high level of technical and biological noise. One way to deal with both problems is to perform analysis with a high fidelity annotated knowledgebase of protein interactions, pathways, and functional ontologies. This knowledgebase has to be structured in a computer-readable format and must include software tools for managing experimental data, analysis, and reporting. Here, we present MetaCore™ and Key Pathway Advisor (KPA), an integrated platform for functional data analysis. On the content side, MetaCore and KPA encompass a comprehensive database of molecular interactions of different types, pathways, network models, and ten functional ontologies covering human, mouse, and rat genes. The analytical toolkit includes tools for gene/protein list enrichment analysis, statistical "interactome" tool for the identification of over- and under-connected proteins in the dataset, and a biological network analysis module made up of network generation algorithms and filters. The suite also features Advanced Search, an application for combinatorial search of the database content, as well as a Java-based tool called Pathway Map Creator for drawing and editing custom pathway maps. Applications of MetaCore and KPA include molecular mode of action of disease research, identification of potential biomarkers and drug targets, pathway hypothesis generation, analysis of biological effects for novel small molecule compounds and clinical applications (analysis of large cohorts of patients, and translational and personalized medicine).
Meta-analysis of Odds Ratios: Current Good Practices
Chang, Bei-Hung; Hoaglin, David C.
2016-01-01
Background Many systematic reviews of randomized clinical trials lead to meta-analyses of odds ratios. The customary methods of estimating an overall odds ratio involve weighted averages of the individual trials’ estimates of the logarithm of the odds ratio. That approach, however, has several shortcomings, arising from assumptions and approximations, that render the results unreliable. Although the problems have been documented in the literature for many years, the conventional methods persist in software and applications. A well-developed alternative approach avoids the approximations by working directly with the numbers of subjects and events in the arms of the individual trials. Objective We aim to raise awareness of methods that avoid the conventional approximations, can be applied with widely available software, and produce more-reliable results. Methods We summarize the fixed-effect and random-effects approaches to meta-analysis; describe conventional, approximate methods and alternative methods; apply the methods in a meta-analysis of 19 randomized trials of endoscopic sclerotherapy in patients with cirrhosis and esophagogastric varices; and compare the results. We demonstrate the use of SAS, Stata, and R software for the analysis. Results In the example, point estimates and confidence intervals for the overall log-odds-ratio differ between the conventional and alternative methods, in ways that can affect inferences. Programming is straightforward in the three software packages; an appendix gives the details. Conclusions The modest additional programming required should not be an obstacle to adoption of the alternative methods. Because their results are unreliable, use of the conventional methods for meta-analysis of odds ratios should be discontinued. PMID:28169977
Wei, Jie; Lei, Guang-hua; Gao, Shu-Guang; Zeng, Chao; Qin, Jia-bi; Kong, Fan-jing; Yang, Tu-bao
2014-07-01
This meta-analysis compared the earliest clinical effects of intra-articular bupivacaine and morphine for pain management following arthroscopic knee surgery. A comprehensive literature search was conducted using MEDLINE (1966 to 2013), the Cochrane Central Register of Controlled Trials (CENTRAL), Embase, and Google Scholar databases for identification of randomized-controlled trials that compared IA bupivacaine and morphine for postoperative pain. The relative risk, weighted mean difference (WMD), and their corresponding 95% confidence intervals (CI) were calculated using RevMan statistical software. Bupivacaine and morphine group had similar acute postoperative pain scores (WMD: 0.07; 95% CI, -0.18 to 0.32; P=0.60); number of patients requiring supplementary analgesia (relative risk: 0.74; 95% CI, 0.42 to 1.31; P=0.30) for the trials in this meta-analysis (n=13); and side effects (relative risk: 0.63; 95% CI, 0.39 to 1.02, P=0.06). Even though, the time to first analgesic request resulted in a significant difference (WMD: 66.59; 95% CI, 11.75 to 122.14, P=0.02), this result was not supported by the sensitivity analysis. On the basis of the currently available literature, this study failed to demonstrate a significant difference between single-dose intra-articular bupivacaine and morphine at the end of the arthroscopic knee surgery in terms of pain relief, need for supplementary analgesics, times interval before the first request for additional analgesic, and short-term side effects. Level II-meta-analysis of Level I and II studies.
The correlation of social support with mental health: A meta-analysis
Harandi, Tayebeh Fasihi; Taghinasab, Maryam Mohammad; Nayeri, Tayebeh Dehghan
2017-01-01
Background and aim Social support is an important factor that can affect mental health. In recent decades, many studies have been done on the impact of social support on mental health. The purpose of the present study is to investigate the effect size of the relationship between social support and mental health in studies in Iran. Methods This meta-analysis was carried out in studies that were performed from 1996 through 2015. Databases included SID and Magiran, the comprehensive portal of human sciences, Noor specialized magazine databases, IRANDOC, Proquest, PubMed, Scopus, ERIC, Iranmedex and Google Scholar. The keywords used to search these websites included “mental health or general health,” and “Iran” and “social support.” In total, 64 studies had inclusion criteria meta-analysis. In order to collect data used from a meta-analysis worksheet that was made by the researcher and for data analysis software, CMA-2 was used. Results The mean of effect size of the 64 studies in the fixed-effect model and random-effect model was obtained respectively as 0.356 and 0.330, which indicated the moderate effect size of social support on mental health. The studies did not have publication bias, and enjoyed a heterogeneous effect size. The target population and social support questionnaire were moderator variables, but sex, sampling method, and mental health questionnaire were not moderator variables. Conclusion Regarding relatively high effect size of the correlation between social support and mental health, it is necessary to predispose higher social support, especially for women, the elderly, patients, workers, and students. PMID:29038699
Perceived Discrimination and Health: A Meta-Analytic Review
ERIC Educational Resources Information Center
Pascoe, Elizabeth A.; Richman, Laura Smart
2009-01-01
Perceived discrimination has been studied with regard to its impact on several types of health effects. This meta-analysis provides a comprehensive account of the relationships between multiple forms of perceived discrimination and both mental and physical health outcomes. In addition, this meta-analysis examines potential mechanisms by which…
Spencer, Mercedes; Wagner, Richard K.
2016-01-01
We conducted a meta-analysis of 16 existing studies to examine the nature of the comprehension problems for children who were second-language learners with poor reading comprehension despite adequate decoding. Results indicated that these children had deficits in oral language (d = −0.80), but these deficits were not as severe as their reading comprehension deficit (d = −2.47). Second-language learners also had weaker oral language skills compared to native-speaking children regardless of comprehension status (d = −0.84). We discuss theoretical and practical implications of the finding that second-language learners who are poor at reading comprehension despite adequate decoding have deficits in oral language but the deficit is not sufficient to explain their deficit in reading comprehension. PMID:28461711
Spencer, Mercedes; Wagner, Richard K
2017-05-01
We conducted a meta-analysis of 16 existing studies to examine the nature of the comprehension problems for children who were second-language learners with poor reading comprehension despite adequate decoding. Results indicated that these children had deficits in oral language ( d = -0.80), but these deficits were not as severe as their reading comprehension deficit ( d = -2.47). Second-language learners also had weaker oral language skills compared to native-speaking children regardless of comprehension status ( d = -0.84). We discuss theoretical and practical implications of the finding that second-language learners who are poor at reading comprehension despite adequate decoding have deficits in oral language but the deficit is not sufficient to explain their deficit in reading comprehension.
Reading abilities in school-aged preterm children: a review and meta-analysis
Kovachy, Vanessa N; Adams, Jenna N; Tamaresis, John S; Feldman, Heidi M
2014-01-01
AIM Children born preterm (at ≤32wk) are at risk of developing deficits in reading ability. This meta-analysis aims to determine whether or not school-aged preterm children perform worse than those born at term in single-word reading (decoding) and reading comprehension. METHOD Electronic databases were searched for studies published between 2000 and 2013, which assessed decoding or reading comprehension performance in English-speaking preterm and term-born children aged between 6 years and 13 years, and born after 1990. Standardized mean differences in decoding and reading comprehension scores were calculated. RESULTS Nine studies were suitable for analysis of decoding, and five for analysis of reading comprehension. Random-effects meta-analyses showed that children born preterm had significantly lower scores (reported as Cohen’s d values [d] with 95% confidence intervals [CIs]) than those born at term for decoding (d=−0.42, 95% CI −0.57 to −0.27, p<0.001) and reading comprehension (d=−0.57, 95% CI −0.68 to −0.46, p<0.001). Meta-regressions showed that lower gestational age was associated with larger differences in decoding (Q[1]=5.92, p=0.02) and reading comprehension (Q[1]=4.69, p=0.03) between preterm and term groups. Differences between groups increased with age for reading comprehension (Q[1]=5.10, p=0.02) and, although not significant, there was also a trend for increased group differences for decoding (Q[1]=3.44, p=0.06). INTERPRETATION Preterm children perform worse than peers born at term on decoding and reading comprehension. These findings suggest that preterm children should receive more ongoing monitoring for reading difficulties throughout their education. PMID:25516105
Workplace health promotion: a meta-analysis of effectiveness.
Rongen, Anne; Robroek, Suzan J W; van Lenthe, Frank J; Burdorf, Alex
2013-04-01
An unhealthy lifestyle may contribute to ill health, absence due to sickness, productivity loss at work, and reduced ability to work. Workplace health promotion programs (WHPPs) aim to improve lifestyle and consequently improve health, work ability, and work productivity. However, systematic reviews on intervention studies have reported small effects, and the overall evaluation of effectiveness of WHPPs is hampered by a large heterogeneity in interventions and study populations. This systematic review aims to investigate the influence of population, study and intervention characteristics, and study quality on the effectiveness of workplace health promotion programs. A systematic literature search was conducted identifying RCTs, published before June 2012, evaluating the effect of a WHPP aimed at smoking cessation, physical activity, healthy nutrition, and/or obesity on self-perceived health, work absence due to sickness, work productivity, or work ability. Studies were included in the meta-analyses if quantitative information was present to calculate an effect size (ES). A meta-analysis, stratified meta-analyses, and meta-regression analyses were performed in Spring 2012 using Comprehensive Meta-analysis software 2.0 and PAWS 17.0.2. In 18 studies describing 21 interventions, the overall effect of a WHPP was small (ES=0.24, 95% CI=0.14, 0.34). The effectiveness of a WHPP was larger in younger populations, in interventions with weekly contacts, and in studies in which the control group received no health promotion. A 2.6-fold lower effectiveness was observed for studies performing an intention-to-treat analysis and a 1.7-fold lower effectiveness for studies controlling for confounders. Studies of poor methodologic quality reported a 2.9-fold higher effect size of the WHPP. The effectiveness of a WHPP is partly determined by intervention characteristics and statistical analysis. High-quality RCTs reported lower effect sizes. It is important to determine the effectiveness of WHPPs in RCTs of high quality. Copyright © 2013 American Journal of Preventive Medicine. Published by Elsevier Inc. All rights reserved.
Doxycycline in Eradication Therapy of Helicobacter pylori--a Systematic Review and Meta-Analysis.
Niv, Yaron
2016-01-01
Since resistance of Helicobacter pylori is developing very fast all over the world, new treatment regimens for eradication are urgently needed. To compare eradication success rate of H. pylori treatment regimens with and without doxycycline. English medical literature searches were conducted for regimens including doxycycline for eradication of H. pylori. Searches were performed up to August 31, 2015, using MEDLINE, PubMed, EMBASE, Scopus and CENTRAL. Meta-analysis was performed by using comprehensive meta-analysis software. Pooled ORs and 95% CIs were calculated comparing treatment regimens for eradication of H. pylori infection with and without doxycycline. The OR for eradication success rate in a fixed model was in favor for treatment regimens with doxycycline: 1.292, 95% CI 1.048-1.594, p = 0.016. There was no significant heterogeneity in the included studies: Q = 15.130, d.f. (Q) = 8, I2 = 47.126, p > 0.10. When treatment regimens with doxycycline were compared only with treatment regimens with tetracycline, no significant difference was found in eradication success rate: OR 0.95, 95% CI 0.68-1.32, p = 0.77. But when treatment regimens with doxycycline were compared with treatment regimens without tetracycline, the OR in favor of doxycycline was even higher: OR 1.59, 95% CI 1.21-2.09, p < 0.001. In this meta-analysis, we confirmed doxycycline efficiency in the eradication of H. pylori. Thus, triple, quadruple or even high dose dual therapy with regimens containing doxycycline should be considered. © 2016 S. Karger AG, Basel.
Niv, Yaron
2017-07-01
Capsule endoscopy (CE) may be used for the evaluation and follow-up of patients with Crohn's disease. CE scores correspond to the degree of mucosal inflammation, a major therapeutic target. The aim of this meta-analysis and systematic review was to determine whether mucosal healing assessment by CE may serve as a predictor of clinical remission in patients with Crohn's disease. To identify observational or controlled English-language full-text studies assessing mucosal healing by CE in patients with Crohn's disease up to 30 September 2016, we searched PubMed, Embase, Central, Medline, and Scopus using the key words 'mucosal healing' and 'capsule endoscopy'. A meta-analysis was carried out using 'Comprehensive meta-analysis' software. Pooled odds ratios and 95% confidence intervals were calculated. Five observational studies including 142 patients from five countries fulfilled the inclusion criteria. No publication bias was found by funnel plot. The mucosal healing CE score was found to be significantly associated with improved outcome after a follow-up of 12 weeks to 24 months, with an odds ratio of 11.06 (95% confidence interval: 3.74-32.73, P<0.001). The degree of heterogeneity among the studies was small (Q=2.014, d.f.[Q]=3, P=0.569 and I=0). Endoscopy scores may play a role in the long-term prognostic evaluation of patients with Crohn's disease. Our results may be accepted as proof of concept, but larger studies are needed to corroborate these findings.
Circulating miR-128 as a potential diagnostic biomarker for glioma.
Liang, Ruo-Fei; Li, Mao; Yang, Yuan; Wang, Xiang; Mao, Qing; Liu, Yan-Hui
2017-09-01
miR-128 in circulation is a promising marker for early diagnosis of glioma. A meta-analysis was performed to evaluate the diagnostic accuracy and clinical value of circulating miR-128 in patients with glioma. A comprehensive literature search for relevant published articles (last search updated on December 29, 2016) was conducted in the Chinese Biomedical Literature Database, PubMed, and Embase. The quality assessment of diagnostic accuracy studies (QUADAS) tool was used to score the quality of the eligible studies. Meta-Disc 1.4 software was used to test for heterogeneity and to perform the meta-analysis. The three studies included in our study enrolled a total of 191 patients with glioma and 73 individuals without tumor. Using a fixed-effect model analysis, the summary assessments revealed that the pooled sensitivity, specificity, positive likelihood ratio, and negative likelihood ratio were 0.89 (95% CI: 0.84-0.93), 0.90 (95% CI: 0.81-0.96), 8.07 (95% CI: 4.21-15.46), and 0.13 (95% CI: 0.09-0.19), respectively. The diagnostic odds ratio (DOR) of miR-128 was 65.00 (95% CI: 26.90-157.10), indicating that the overall accuracy of the miR-128 test for detecting glioma was high. The value of I 2 was 0.0%, indicating that there was no significant heterogeneity among studies. The present meta-analysis showed that circulating miR-128 might be a promising noninvasive biomarker for diagnosing glioma. Copyright © 2017 Elsevier B.V. All rights reserved.
Yang, Jie; Andric, Michael; Mathew, Mili M
2015-10-01
Gestures play an important role in face-to-face communication and have been increasingly studied via functional magnetic resonance imaging. Although a large amount of data has been provided to describe the neural substrates of gesture comprehension, these findings have never been quantitatively summarized and the conclusion is still unclear. This activation likelihood estimation meta-analysis investigated the brain networks underpinning gesture comprehension while considering the impact of gesture type (co-speech gestures vs. speech-independent gestures) and task demand (implicit vs. explicit) on the brain activation of gesture comprehension. The meta-analysis of 31 papers showed that as hand actions, gestures involve a perceptual-motor network important for action recognition. As meaningful symbols, gestures involve a semantic network for conceptual processing. Finally, during face-to-face interactions, gestures involve a network for social emotive processes. Our finding also indicated that gesture type and task demand influence the involvement of the brain networks during gesture comprehension. The results highlight the complexity of gesture comprehension, and suggest that future research is necessary to clarify the dynamic interactions among these networks. Copyright © 2015 Elsevier Ltd. All rights reserved.
Meta-tools for software development and knowledge acquisition
NASA Technical Reports Server (NTRS)
Eriksson, Henrik; Musen, Mark A.
1992-01-01
The effectiveness of tools that provide support for software development is highly dependent on the match between the tools and their task. Knowledge-acquisition (KA) tools constitute a class of development tools targeted at knowledge-based systems. Generally, KA tools that are custom-tailored for particular application domains are more effective than are general KA tools that cover a large class of domains. The high cost of custom-tailoring KA tools manually has encouraged researchers to develop meta-tools for KA tools. Current research issues in meta-tools for knowledge acquisition are the specification styles, or meta-views, for target KA tools used, and the relationships between the specification entered in the meta-tool and other specifications for the target program under development. We examine different types of meta-views and meta-tools. Our current project is to provide meta-tools that produce KA tools from multiple specification sources--for instance, from a task analysis of the target application.
Weikang, Chen; Jie, Li; Likang, Lan; Weiwen, Qiu; Liping, Lu
2016-01-01
The aim of this meta-analysis was to evaluate whether there was an association between glutathione S-transferase M1(GSTM1)gene polymorphism and Parkinson's disease (PD) susceptibility by pooling published data. We performed comprehensive electronic database search for articles published between February12,2015 and April30 2016. The published case-control or cohort studies related to GSTM1 gene polymorphism and Parkinson's disease susceptibility were screened, reviewed, and included in this meta-analysis. The correlation between GSTM1 gene polymorphism and PD susceptibility was expressed by odds ratio (OR) and its corresponding 95% confidence interval (95%CI). Publication bias was evaluated by Begg's funnel plot and Egger's line regression test. All analysis was done by stata11.0 software. After searching the PubMed, EMBASE, and CNKI databases, seventeen case-control studies with 3,538 PD and 5,180 controls were included in the final meta-analysis. The data was pooled by a fixed-effect model for lack of statistical heterogeneity across the studies; the results showed GSTM1 null expression can significant increase the susceptibility of PD (OR=1.11, 95% CI:1.01-1.21, P<0.05). Subgroup analysis indicated GSTM1 gene polymorphism was associated with PD susceptibility in the Caucasian ethnic group (OR=1.15, 95% CI:1.05-1.27, P<0.05) but not in the Asian ethnic group (OR=0.89, 95% CI:0.70-1.12, P>0.05). Begg's funnel plot and Egger's line regression test showed no significant publication bias. Based on the present evidence, GSTM1 null expression can significant increase the susceptibility of PD in persons of Caucasian ethnicity.
Liu, Mingli; Wu, Lang; Ming, Qingsen
2015-01-01
To perform a systematic review and meta-analysis for the effects of physical activity intervention on self-esteem and self-concept in children and adolescents, and to identify moderator variables by meta-regression. A meta-analysis and meta-regression. Relevant studies were identified through a comprehensive search of electronic databases. Study inclusion criteria were: (1) intervention should be supervised physical activity, (2) reported sufficient data to estimate pooled effect sizes of physical activity intervention on self-esteem or self-concept, (3) participants' ages ranged from 3 to 20 years, and (4) a control or comparison group was included. For each study, study design, intervention design and participant characteristics were extracted. R software (version 3.1.3) and Stata (version 12.0) were used to synthesize effect sizes and perform moderation analyses for determining moderators. Twenty-five randomized controlled trial (RCT) studies and 13 non-randomized controlled trial (non-RCT) studies including a total of 2991 cases were identified. Significant positive effects were found in RCTs for intervention of physical activity alone on general self outcomes (Hedges' g = 0.29, 95% confidence interval [CI]: 0.14 to 0.45; p = 0.001), self-concept (Hedges' g = 0.49, 95%CI: 0.10 to 0.88, p = 0.014) and self-worth (Hedges' g = 0.31, 95%CI: 0.13 to 0.49, p = 0.005). There was no significant effect of intervention of physical activity alone on any outcomes in non-RCTs, as well as in studies with intervention of physical activity combined with other strategies. Meta-regression analysis revealed that higher treatment effects were associated with setting of intervention in RCTs (β = 0.31, 95%CI: 0.07 to 0.55, p = 0.013). Intervention of physical activity alone is associated with increased self-concept and self-worth in children and adolescents. And there is a stronger association with school-based and gymnasium-based intervention compared with other settings.
Cutting electrocautery versus scalpel for surgical incisions: a systematic review and meta-analysis.
Ismail, Ammar; Abushouk, Abdelrahman Ibrahim; Elmaraezy, Ahmed; Menshawy, Amr; Menshawy, Esraa; Ismail, Mahmoud; Samir, Esraa; Khaled, Anas; Zakarya, Hagar; El-Tonoby, Abdelrahman; Ghanem, Esraa
2017-12-01
Although cutting electrocautery can be superior to the scalpel in reducing blood loss and incisional time, several reports associated electrocautery with higher rates of wound infection, impaired healing, and worse cosmesis. We performed this systematic review and meta-analysis to compare cutting electrocautery versus scalpel for surgical incisions. We conducted a computerized literature search of five electronic databases and included all published original studies comparing cutting electrocautery and scalpel surgical incisions. Relevant data were extracted from eligible studies and pooled as odds ratios (ORs) or standardized mean difference (SMD) values in a meta-analysis model, using RevMan and Comprehensive Meta-analysis software. Forty-one studies (36 randomized trials, four observational, and one quasirandom study) were included in the pooled analysis (6422 participants). Compared with the scalpel incision, cutting electrocautery resulted in significantly less blood loss (SMD = -1.16, 95% CI [-1.60 to -0.72]), shorter incisional (SMD = -0.63, 95% CI [-0.96 to -0.29]) and operative times (SMD = -0.59, 95% CI [-1.12 to -0.05]), and lower pain scores (SMD = -0.91, 95% CI [-1.27 to -0.55]) with no significant differences in terms of wound infection rates (OR = 0.92, 95% CI [0.74-1.15]) or overall subjective scar score (SMD = -0.49, 95% CI [-1.72 to 0.75]). Surgical incision using electrocautery can be quicker with less blood loss and postoperative pain scores than the scalpel incision. No statistically significant difference was found between both techniques in terms of postoperative wound complications, hospital stay duration, and wound cosmetic characteristics. Therefore, we recommend routine use of cutting electrocautery for surgical incisions. Copyright © 2017 Elsevier Inc. All rights reserved.
ERIC Educational Resources Information Center
Kalandadze, Tamar; Norbury, Courtenay; Naerland, Terje; Naess, Kari-Anne B.
2018-01-01
We present a meta-analysis of studies that compare figurative language comprehension in individuals with autism spectrum disorder and in typically developing controls who were matched based on chronological age or/and language ability. A total of 41 studies and 45 independent effect sizes were included based on predetermined inclusion criteria.…
SLEEP AND MENTAL DISORDERS: A META-ANALYSIS OF POLYSOMNOGRAPHIC RESEARCH
Baglioni, Chiara; Nanovska, Svetoslava; Regen, Wolfram; Spiegelhalder, Kai; Feige, Bernd; Nissen, Christoph; Reynolds, Charles F.; Riemann, Dieter
2016-01-01
Investigating sleep in mental disorders has the potential to reveal both disorder-specific and transdiagnostic psychophysiological mechanisms. This meta-analysis aimed at determining the polysomnographic (PSG) characteristics of several mental disorders. Relevant studies were searched through standard strategies. Controlled PSG studies evaluating sleep in affective, anxiety, eating, pervasive developmental, borderline and antisocial personality disorders, ADHD, and schizophrenia were included. PSG variables of sleep continuity, depth, and architecture, as well as rapid-eye movement (REM) sleep were considered. Calculations were performed with the “Comprehensive Meta-Analysis” and “R” softwares. Using random effects modeling, for each disorder and each variable, a separate meta-analysis was conducted if at least 3 studies were available for calculation of effect sizes as standardized means (Hedges’g). Sources of variability, i.e., sex, age, and mental disorders comorbidity, were evaluated in subgroup analyses. Sleep alterations were evidenced in all disorders, with the exception of ADHD and seasonal affective disorders. Sleep continuity problems were observed in most mental disorders. Sleep depth and REM pressure alterations were associated with affective, anxiety, autism and schizophrenia disorders. Comorbidity was associated with enhanced REM sleep pressure and more inhibition of sleep depth. No sleep parameter was exclusively altered in one condition; however, no two conditions shared the same PSG profile. Sleep continuity disturbances imply a transdiagnostic imbalance in the arousal system likely representing a basic dimension of mental health. Sleep depth and REM variables might play a key role in psychiatric comorbidity processes. Constellations of sleep alterations may define distinct disorders better than alterations in one single variable. PMID:27416139
Niv, Yaron
2016-09-01
The mucus layer of the intestinal tract is the main barrier between luminal microbes and the mucosa, and has an essential role in the body defense mechanisms. Previous research could not establish consistent results for mucin genes expression in Crohn's disease (CD) patients. In this meta-analysis we looked at the mucin expression in CD patients and compared it with healthy controls. English medical literature searches were conducted for mucin expression in the mucosa of the ileum and colon of CD patients and compared it with normal mucosa. Case-control studies were included. Meta-analysis was performed by using Comprehensive meta-anaslysis software. Pooled odds ratios and 95% confidence intervals were calculated. We found 160 eligible studies. Twenty studies were rejected because they have been performed in animals or did not have full text, and 134 studies were excluded because of language, being editorials, review articles, or because of duplications. We were left with 6 case-control studies from 4 countries that fulfilled the inclusion criteria, published till 31.12.2015. No significant heterogeneity was demonstrated: Q = 149.256, df (Q) = 40.00, I2= 73.2% (less than 75%). We found a decrease of 34% in the total mucin expression in CD patients (Odds Ratio 0.660, 95% CI 0.486-0.897, P = 0.008). We also found a significantly decreased expression in CD patients for MUC5AC, MUC5B and MUC7. We demonstrated a global decrease in mucin expression in CD patients when compared with healthy controls.
Sudell, Maria; Kolamunnage-Dona, Ruwanthi; Tudur-Smith, Catrin
2016-12-05
Joint models for longitudinal and time-to-event data are commonly used to simultaneously analyse correlated data in single study cases. Synthesis of evidence from multiple studies using meta-analysis is a natural next step but its feasibility depends heavily on the standard of reporting of joint models in the medical literature. During this review we aim to assess the current standard of reporting of joint models applied in the literature, and to determine whether current reporting standards would allow or hinder future aggregate data meta-analyses of model results. We undertook a literature review of non-methodological studies that involved joint modelling of longitudinal and time-to-event medical data. Study characteristics were extracted and an assessment of whether separate meta-analyses for longitudinal, time-to-event and association parameters were possible was made. The 65 studies identified used a wide range of joint modelling methods in a selection of software. Identified studies concerned a variety of disease areas. The majority of studies reported adequate information to conduct a meta-analysis (67.7% for longitudinal parameter aggregate data meta-analysis, 69.2% for time-to-event parameter aggregate data meta-analysis, 76.9% for association parameter aggregate data meta-analysis). In some cases model structure was difficult to ascertain from the published reports. Whilst extraction of sufficient information to permit meta-analyses was possible in a majority of cases, the standard of reporting of joint models should be maintained and improved. Recommendations for future practice include clear statement of model structure, of values of estimated parameters, of software used and of statistical methods applied.
The Association between Adiposity and the Risk of Glaucoma: A Meta-Analysis
Ling, Jiawen; Chen, Yiyi; Wu, Yan
2017-01-01
Purpose This meta-analysis was conducted to determine the potential association between adiposity and glaucoma incidence. Materials and Methods A comprehensive literature search was performed in PubMed and ISI Web of Science. A meta-analysis was conducted using STATA software. Results Fifteen eligible studies involving 2,445,980 individuals were included to investigate the association between adiposity and glaucoma incidence. The relative risks (RRs) were pooled with 95% confidence intervals (CI) by using a random-effects model. The pooled RR between adiposity and elevated intraocular pressure (IOP) was 1.73 (95% CI, 1.18–2.54), whereas that between adiposity and open-angle glaucoma (OAG) was 0.97 (95% CI, 0.83–1.13). The pooled RR between abdominal adiposity and glaucoma was 1.28 (95% CI, 1.15–1.41), whereas that between general adiposity and glaucoma was 1.09 (95% CI, 0.87–1.37). Results of subgroup analysis by sex indicated the association between adiposity and glaucoma in the female group (RR, 1.31; 95% CI, 1.05–1.64), but not in the male group (RR, 1.11; 95% CI, 0.77–1.60). The pooled RR of cohort studies and cross-sectional studies were 1.00 (95% CI, 0.84–1.20) and 1.22 (95% CI, 0.89–1.66), respectively. Conclusions Adiposity has a higher risk of elevated IOP, and abdominal adiposity has a positive association with glaucoma, especially in female patients. PMID:28695005
SAATCHI, Masoud; SHOKRANEH, Ali; NAVAEI, Hooman; MARACY, Mohammad Reza; SHOJAEI, Hasan
2014-01-01
Objective Enterococcus faecalis (E. faecalis) is the most frequently isolated strain in failed endodontic therapy cases since it is resistant to calcium hydroxide (CH). Whether a combination of CH and chlorhexidine (CHX) is more effective than CH alone against E. faecalis is a matter of controversy. Thus, the aim of this study was to conduct a systematic review and meta-analysis of the literature. Material and Methods A comprehensive search in PubMed, EMbase, EBSCOhost, The Cochrane Library, SciELO, and BBO databases, Clinical trials registers, Open Grey, and conference proceedings from the earliest available date to February 1, 2013 was carried out and the relevant articles were identified by two independent reviewers. Backward and forward search was performed and then inclusion and exclusion criteria were applied. The included studies were divided into "comparisons" according to the depth of sampling and dressing period of each medicament. Meta-analysis was performed using Stata software 10.0. The level of significance was set at 0.05. Results Eighty-five studies were retrieved from databases and backward/forward searches. Fortyfive studies were considered as relevant (5 in vivo, 18 in vitro, 18 ex vivo, and 4 review articles). Nine studies were included for meta-analysis. Inter-observer agreement (Cohen kappa) was 0.93. The included studies were divided into 21 comparisons for meta-analysis. Chi-square test showed the comparisons were heterogeneous (p<0.001). Random effect model demonstrated no significant difference between CH/CHX mixture and CH alone in their effect on E. faecalis (p=0.115). Conclusions According to the evidence available now, mixing CH with CHX does not significantly increase the antimicrobial activity of CH against E. faecalis. It appears that mixing CH with CHX does not improve its ex vivo antibacterial property as an intracanal medicament against E. faecalis. Further in vivo studies are necessary to confirm and correlate the findings of this study with the clinical outcomes. PMID:25466470
A refined method for multivariate meta-analysis and meta-regression.
Jackson, Daniel; Riley, Richard D
2014-02-20
Making inferences about the average treatment effect using the random effects model for meta-analysis is problematic in the common situation where there is a small number of studies. This is because estimates of the between-study variance are not precise enough to accurately apply the conventional methods for testing and deriving a confidence interval for the average effect. We have found that a refined method for univariate meta-analysis, which applies a scaling factor to the estimated effects' standard error, provides more accurate inference. We explain how to extend this method to the multivariate scenario and show that our proposal for refined multivariate meta-analysis and meta-regression can provide more accurate inferences than the more conventional approach. We explain how our proposed approach can be implemented using standard output from multivariate meta-analysis software packages and apply our methodology to two real examples. Copyright © 2013 John Wiley & Sons, Ltd.
Sleep and mental disorders: A meta-analysis of polysomnographic research.
Baglioni, Chiara; Nanovska, Svetoslava; Regen, Wolfram; Spiegelhalder, Kai; Feige, Bernd; Nissen, Christoph; Reynolds, Charles F; Riemann, Dieter
2016-09-01
Investigating sleep in mental disorders has the potential to reveal both disorder-specific and transdiagnostic psychophysiological mechanisms. This meta-analysis aimed at determining the polysomnographic (PSG) characteristics of several mental disorders. Relevant studies were searched through standard strategies. Controlled PSG studies evaluating sleep in affective, anxiety, eating, pervasive developmental, borderline and antisocial personality disorders, attention-deficit-hyperactivity disorder (ADHD), and schizophrenia were included. PSG variables of sleep continuity, depth, and architecture, as well as rapid-eye movement (REM) sleep were considered. Calculations were performed with the "Comprehensive Meta-Analysis" and "R" software. Using random effects modeling, for each disorder and each variable, a separate meta-analysis was conducted if at least 3 studies were available for calculation of effect sizes as standardized means (Hedges' g). Sources of variability, that is, sex, age, and mental disorders comorbidity, were evaluated in subgroup analyses. Sleep alterations were evidenced in all disorders, with the exception of ADHD and seasonal affective disorders. Sleep continuity problems were observed in most mental disorders. Sleep depth and REM pressure alterations were associated with affective, anxiety, autism and schizophrenia disorders. Comorbidity was associated with enhanced REM sleep pressure and more inhibition of sleep depth. No sleep parameter was exclusively altered in 1 condition; however, no 2 conditions shared the same PSG profile. Sleep continuity disturbances imply a transdiagnostic imbalance in the arousal system likely representing a basic dimension of mental health. Sleep depth and REM variables might play a key role in psychiatric comorbidity processes. Constellations of sleep alterations may define distinct disorders better than alterations in 1 single variable. (PsycINFO Database Record (c) 2016 APA, all rights reserved).
Lv, Zhi-Fa; Wang, Fu-Cai; Zheng, Hui-Lie; Wang, Ben; Xie, Yong; Zhou, Xiao-Jiang; Lv, Nong-Hua
2015-02-28
To access the efficacy of combination with amoxicillin and tetracycline for eradication of Helicobacter pylori (H. pylori), thus providing clinical practice guidelines. PubMed, EMBASE, Cochrane Central Register of Controlled Trials, Science Citation Index, China National Knowledge Infrastructure, Wanfang, and Chinese Biomedical Literature databases and abstract books of major European, American, and Asian gastroenterological meetings were searched. All clinical trials that examined the efficacy of H. pylori eradication therapies and included both tetracycline and amoxicillin in one study arm were selected for this systematic review and meta-analysis. Statistical analysis was performed with Comprehensive Meta-Analysis Software (Version 2). Subgroup, meta-regression, and sensitivity analyses were also carried out. Thirty-three studies met the inclusion criteria. The pooled odds ratio (OR) was 0.90 (95%CI: 0.42-1.78) for quadruple therapy with amoxicillin and tetracycline vs other quadruple regimens, and total eradication rates were 78.1% by intention-to-treat (ITT) and 84.5% by per-protocol (PP) analyses in the experimental groups. The pooled eradication rates of 14-d quadruple regimens with a combination of amoxicillin and tetracycline were 82.3% by ITT and 89.0% by PP, and those of 10-d regimens were 84.6% by ITT and 93.7% by PP. The OR by ITT were 1.21 (95%CI: 0.64-2.28) for triple regimens with amoxicillin and tetracycline vs other regimens and 1.81 (95%CI: 1.37-2.41) for sequential treatment with amoxicillin and tetracycline vs other regimens, respectively. The effectiveness of regimens employing amoxicillin and tetracycline for H. pylori eradication may be not inferior to other regimens, but further study should be necessary.
Li, Shuchun; Lin, Han; Sun, WenHuan; Wang, YingLi; Ding, YouFang; Zhao, HuanHu; Liu, ShangJian
2017-06-01
To conduct a meta-analysis on the effect of CYP2D6 polymorphism on the pharmacokinetics and pharmacodynamics of metoprolol. A systematic review and meta-analysis of studies on the effect of CYP2D6 polymorphism on metoprolol pharmacokinetics and pharmacodynamics was performed by using the China national knowledge infrastructure (CNKI), database for Chinese technical periodicals (VIP), Wanfang, and PubMed databases up to the end of January 2015. Review Manager 5.3 (the coherence collaboration, www.gradepro.org) and comprehensive Meta-Analysis Software v2 (CMA) Biostat, Englewood, NJ, USA) were used for meta-analysis. A total of 567 cases from 7 studies were included in the present study. Meta-analysis results showed that the area under the curve (AUC)0-∞ (RR = -6.75, 95% CI (-9.18, -4.31), p < 0.00001); Cmax (RR = -2.40, 95% CI (-3.25, -1.54), p < 0.00001); T1/2 (RR = -4.81, 95% CI (-6.86, -2.76), p < 0.00001); CL/F (RR = 1.60, 95% CI (1.03,2.17), p < 0.00001); heart rate (RR = 1.48, 95% CI (0.03, 2.92), p = 0.05), systolic blood pressure (RR = -0.69, 95% CI (-1.85,0.47), p = 0.24); and diastolic blood pressure (RR = -1.95, 95% CI (-3.14, -0.76), p = 0.001). Begg's funnel plot test showed that the pharmacokinetic parameters (AUC0-∞, Cmax, T1/2, and CL/F) and pharmacodynamic parameters (HR, DBP, and SBP) were symmetric. Egger's test showed that the pharmacokinetic parameters were asymmetrical, and its intercept was statistically significant (p < 0.05), which was indicative of publication bias. The pharmacodynamic parameter intercept was not statistically significant (p > 0.05), indicating that no publication bias existed. CYP2D6 polymorphism significantly influenced the pharmacokinetic parameters of metoprolol. It also affected heart rate and diastolic blood pressure, whereas systolic pressure was not affected. .
Pascoe, Michaela C.; Thompson, David R.; Castle, David J.; Jenkins, Zoe M.; Ski, Chantal F.
2017-01-01
Purpose: A number of studies, including systematic reviews, show beneficial effects of psychosocial interventions for people with diabetes mellitus; however, they have not been assessed using meta-analysis. The purpose of this meta-analysis of randomized controlled trials is to investigate the effects of psychosocial interventions on depressive and anxiety symptoms, quality of life and self-efficacy in individuals with diabetes mellitus. Methods: The databases Pubmed, MEDLINE, CINAHL, PsycINFO, Scopus, Web of Science and SocINDEX were searched with no year restriction. Eligible studies were randomized controlled trials published in English that included individuals diagnosed with diabetes mellitus, aged 18 years or above, who engaged in a psychosocial intervention, with outcome measures addressing depressive or anxiety symptomology, quality of life or self-efficacy. Eligible studies needed to compare the intervention to usual care. Study selection was completed using Covidence and meta-analysis was undertaken using Comprehensive Meta-Analysis software. Results: Seven studies were included in the meta-analysis. Five studies investigated the effects of psychosocial interventions and showed a medium to large benefit for depressive symptoms (SMD: −0.70; CI: −1.27, −0.13) which persisted at follow up (SMD: −1.54, CI: −2.97, −0.12). Similar results were not seen immediately post-intervention in the three studies that assessed anxiety symptoms (SMD: −0.30; CI: −0.69, 0.10); however, a medium beneficial effect was seen at follow up (SMD = −0.61, CI = −0.92 to −0.31). Small benefits were seen in the three studies assessing quality of life outcomes (SMD: 0.30, CI: 0.06, 0.55). No benefit was seen in the two studies assessing self-efficacy (SMD: 0.23, CI: −0.11, 0.57). Conclusions: The results of the current study provide preliminary evidence that psychosocial interventions, compared to usual care, reduce depressive symptoms, and may improve quality of life in individuals with diabetes. However, only a few studies were included and the clinical significance of these findings is unknown. PMID:29259563
Multivariate Methods for Meta-Analysis of Genetic Association Studies.
Dimou, Niki L; Pantavou, Katerina G; Braliou, Georgia G; Bagos, Pantelis G
2018-01-01
Multivariate meta-analysis of genetic association studies and genome-wide association studies has received a remarkable attention as it improves the precision of the analysis. Here, we review, summarize and present in a unified framework methods for multivariate meta-analysis of genetic association studies and genome-wide association studies. Starting with the statistical methods used for robust analysis and genetic model selection, we present in brief univariate methods for meta-analysis and we then scrutinize multivariate methodologies. Multivariate models of meta-analysis for a single gene-disease association studies, including models for haplotype association studies, multiple linked polymorphisms and multiple outcomes are discussed. The popular Mendelian randomization approach and special cases of meta-analysis addressing issues such as the assumption of the mode of inheritance, deviation from Hardy-Weinberg Equilibrium and gene-environment interactions are also presented. All available methods are enriched with practical applications and methodologies that could be developed in the future are discussed. Links for all available software implementing multivariate meta-analysis methods are also provided.
ERIC Educational Resources Information Center
Elleman, Amy M.
2017-01-01
Inference ability is considered central to discourse processing and has been shown to be important across models of reading comprehension. To evaluate the impact of inference instruction, a meta-analysis of 25 inference studies in Grades K-12 was conducted. Results showed that inference instruction was effective for increasing students' general…
ExAtlas: An interactive online tool for meta-analysis of gene expression data.
Sharov, Alexei A; Schlessinger, David; Ko, Minoru S H
2015-12-01
We have developed ExAtlas, an on-line software tool for meta-analysis and visualization of gene expression data. In contrast to existing software tools, ExAtlas compares multi-component data sets and generates results for all combinations (e.g. all gene expression profiles versus all Gene Ontology annotations). ExAtlas handles both users' own data and data extracted semi-automatically from the public repository (GEO/NCBI database). ExAtlas provides a variety of tools for meta-analyses: (1) standard meta-analysis (fixed effects, random effects, z-score, and Fisher's methods); (2) analyses of global correlations between gene expression data sets; (3) gene set enrichment; (4) gene set overlap; (5) gene association by expression profile; (6) gene specificity; and (7) statistical analysis (ANOVA, pairwise comparison, and PCA). ExAtlas produces graphical outputs, including heatmaps, scatter-plots, bar-charts, and three-dimensional images. Some of the most widely used public data sets (e.g. GNF/BioGPS, Gene Ontology, KEGG, GAD phenotypes, BrainScan, ENCODE ChIP-seq, and protein-protein interaction) are pre-loaded and can be used for functional annotations.
The association between the SLC6A3 VNTR 9-repeat allele and alcoholism-a meta-analysis.
Du, Yanlei; Nie, Yuqiang; Li, Yuyuan; Wan, Yu-Jui Y
2011-09-01
Dopamine transporter gene (SLC6A3) represents a promising candidate involved in the development of alcoholism. This study aimed to explore the association between the 9-repeat allele (A9) of a 40-bp variable number tandem repeat (VNTR) polymorphism in the 3' un-translated region (3' UTR) of the SLC6A3 gene and alcoholism. The SLC6A3 VNTR was genotyped by PCR in unrelated Mexican Americans including 337 controls and 365 alcoholics. Pearson's chi-square test or Fisher's exact test was used to compare the genotype and allele distribution. Meta-analyses were performed for population-based case-control association studies of the SLC6A3 VNTR polymorphism with alcoholism. Data were analyzed under random effect models with the Comprehensive Meta-analysis (v.2) statistical software package. In Mexican Americans, no significant difference was found in allele and genotype distribution between controls and alcoholics or between controls and alcoholics with alcohol withdrawal seizure (AWS) or delirium tremens (DT) (unadjusted p > 0.05). A total of 13 research articles were included in the meta-analyses. No significant difference of the SLC6A3 VNTR A9 was noted between controls and alcoholics at the genotypic and allelic level when all ethnic populations, only Caucasian populations, or only Asian populations were considered (p > 0.05). Significant associations were observed between SLC6A3 VNTR A9 and alcoholics with AWS or DT at the genotypic as well as allelic level when all ethnic populations or only Caucasian populations were considered (p < 0.05, OR 1.5-2.1). Meta-analyses suggest a possible association between the SLC6A3 VNTR A9 and alcoholic subgroup with AWS or DT. 2011 by the Research Society on Alcoholism.
Ding, S N; Pan, H Y; Zhang, J G
2017-03-14
Objective: To evaluate the methodological quality and impacts on outcomes for systematic reviews (SRs) of accelerated rehabilitation versus traditional control for colorectal surgery. Methods: We comprehensively searched six databases and additional websites to collect SRs, or meta-analysis from inception to July 2016. The Overview Quality Assessment Questionnaire (OQAQ) was applied for quality assessment of the included studies, the tools recommended by the Cochrane Collaboration was applied for quality assessment for RCT and CCT and the Newcastle-Ottawa Scale (NOS) was applied to assess observational study. The relative ratios (RRs) and 95% confidence intervals (CIs) were integrated using Review Manager 5.3 software. Results: Fourteen meta-analyses were included in total. The mean OQAQ score was 3.8 with 95% CI 3.2 to 4.3. Only three meta-analyses were assessed as good quality. Two studies misused statistical models. A total of 42 primary studies referenced by meta-analyses were included, of which, 25 RCTs were levelled grade B and 1 CCT was levelled grade C. An estimated mean NOS score of 16 observation studies was 6.75 (totally scored 9 with 95% CI 6.4 to 7.1), of which, 10 studies scored ≥7 were high quality, 6 studies scored 6 were moderate quality. Conclusions: Currently, the overall quality of meta-analyses about comparing the effects and safety between accelerated rehabilitation and traditional control for colorectal surgery is fairly poor and the evidence level is lower. Health providers should apply the evidence with caution in clinical practice.
Yousefifard, Mahmoud; Baikpour, Masoud; Ghelichkhani, Parisa; Asady, Hadi; Darafarin, Abolfazl; Amini Esfahani, Mohammad Reza; Hosseini, Mostafa; Yaseri, Mehdi; Safari, Saeed
2016-01-01
Introduction: The potential benefit of ultrasonography for detection of thoracic bone fractures has been proven in various surveys but no comprehensive conclusion has been drawn yet; therefore, the present study aimed to conduct a thorough meta-analytic systematic review on this subject. Methods: Two reviewers independently carried out a comprehensive systematic search in Medline, EMBASE, ISI Web of Knowledge, Scopus, Cochrane Library, and ProQuest databases. Data were summarized as true positive, false positive, true negative and false negative and were analyzed via STATA 11.0 software using a mixed-effects binary regression model. Sources of heterogeneity were further assessed through subgroup analysis. Results: Data on 1667 patients (807 subjects with and 860 cases without thoracic fractures), whose age ranged from 0 to 92 years, were extracted from 17 surveys. Pooled sensitivity and specificity of ultrasonography in detection of thoracic bone fractures were 0.97 (95% CI: 0.90-0.99; I2= 88.88, p<0.001) and 0.94 (95% CI: 0.86-0.97; I2= 71.97, p<0.001), respectively. The same measures for chest radiography were found to be 0.77 (95% CI: 0.56-0.90; I2= 97.76, p<0.001) and 1.0 (95% CI: 0.91-1.00; I2= 97.24, p<0.001), respectively. The sensitivity of ultrasonography was higher in detection of rib fractures, compared to fractures of sternum or clavicle (97% vs. 91%). Moreover, the sensitivity was found to be higher when the procedure was carried out by a radiologist in comparison to an emergency medicine specialist (96% vs. 90%). Conclusion: Base on the findings of the present meta-analysis, screening performance characteristic of ultrasonography in detection of thoracic bone fractures was found to be higher than radiography. However, these characteristics were more prominent in detection of rib fractures and in cases where was performed by a radiologist. PMID:27274514
Yousefifard, Mahmoud; Baikpour, Masoud; Ghelichkhani, Parisa; Asady, Hadi; Darafarin, Abolfazl; Amini Esfahani, Mohammad Reza; Hosseini, Mostafa; Yaseri, Mehdi; Safari, Saeed
2016-01-01
The potential benefit of ultrasonography for detection of thoracic bone fractures has been proven in various surveys but no comprehensive conclusion has been drawn yet; therefore, the present study aimed to conduct a thorough meta-analytic systematic review on this subject. Two reviewers independently carried out a comprehensive systematic search in Medline, EMBASE, ISI Web of Knowledge, Scopus, Cochrane Library, and ProQuest databases. Data were summarized as true positive, false positive, true negative and false negative and were analyzed via STATA 11.0 software using a mixed-effects binary regression model. Sources of heterogeneity were further assessed through subgroup analysis. Data on 1667 patients (807 subjects with and 860 cases without thoracic fractures), whose age ranged from 0 to 92 years, were extracted from 17 surveys. Pooled sensitivity and specificity of ultrasonography in detection of thoracic bone fractures were 0.97 (95% CI: 0.90-0.99; I2= 88.88, p<0.001) and 0.94 (95% CI: 0.86-0.97; I2= 71.97, p<0.001), respectively. The same measures for chest radiography were found to be 0.77 (95% CI: 0.56-0.90; I2= 97.76, p<0.001) and 1.0 (95% CI: 0.91-1.00; I2= 97.24, p<0.001), respectively. The sensitivity of ultrasonography was higher in detection of rib fractures, compared to fractures of sternum or clavicle (97% vs. 91%). Moreover, the sensitivity was found to be higher when the procedure was carried out by a radiologist in comparison to an emergency medicine specialist (96% vs. 90%). Base on the findings of the present meta-analysis, screening performance characteristic of ultrasonography in detection of thoracic bone fractures was found to be higher than radiography. However, these characteristics were more prominent in detection of rib fractures and in cases where was performed by a radiologist.
Association between MASP-2 gene polymorphism and risk of infection diseases: A meta-analysis.
Fu, Jie; Wang, Jingqiu; Luo, Yanping; Zhang, Lifeng; Zhang, Yuan; Dong, Xinfang; Yu, Hongjuan; Cao, Mingqiang; Ma, Xingming
2016-11-01
The role of MASP-2 is vital in the process of complement activation by the lectin pathway. It is generally considered that the functional activation of MASP-2 contribute to the infection disease development process. To analyze the association between MASP-2 functional gene (rs72550870) polymorphism and the infection disease risk by a meta-analysis. Relevant case-control studies were identified by searching Cochrane Library, PubMed, Emabase, DOAJ, CAB Abstracts, CSA, CINAHL, EBSCO, Scopus, Global Health, Index Copernicus, CA, China National Knowledge Infrastructure (CNKI) databases up to 10th January 2016. The data were extracted and the methodological quality of studies were evaluated. The STATA 12.0 software was used to perform statistical analysis. 9 studies were included. There was no significant association between masp-2 gene (p.D120G, rs72550870) polymorphism and the risk of infection disease under the allele model (G vs. A: OR = 0.89, 95%CI = 0.66-1.21)(P = 0.445>0.05) and the recessive model (AG + GG vs.AA: OR = 0.88, 95%CI = 0.65-1.20) (P = 0.428>0.05). This is the first comprehensive meta-analysis indicates that the MASP-2 functional gene (rs72550870) polymorphism is not associated with the infection diseases, and the key functional gene polymorphism of rs72550870 did not increase susceptibility to the infection diseases. Similarly, there were no obvious difference in subgroup analysis based on geographical areas and pathogenic microorganisms. Copyright © 2016 Elsevier Ltd. All rights reserved.
Qin, Xiao-Yan; Feng, Jin-Chao; Cao, Chang; Wu, Huan-Tong; Loh, Y Peng; Cheng, Yong
2016-11-01
Accumulating evidence suggests that brain-derived neurotrophic factor (BDNF) may be implicated in the developmental outcomes of children with autism spectrum disorder (ASD). To use meta-analysis to determine whether children with ASD have altered peripheral blood levels of BDNF. A systematic search of PubMed, PsycINFO, and Web of Science was performed for English-language literature through February 7, 2016. The search terms included brain-derived neurotrophic factor or BDNF in combination with autism, without year restriction. Two additional records were retrieved after a review of the reference lists of selected articles. Studies were included if they provided data on peripheral blood levels of BDNF in children with ASD and healthy control children. Studies that included adults or with overlapping samples were excluded. Data were extracted by 2 independent observers from 19 included studies. Data were pooled using a random-effects model with Comprehensive Meta-analysis software. Blood levels of BDNF in children with ASD compared with healthy controls. Altered levels of BDNF were hypothesized to be related to ASD. This meta-analysis included 19 studies with 2896 unique participants. Random-effects meta-analysis of all 19 studies showed that children with ASD had significantly increased peripheral blood levels of BDNF compared with healthy controls (Hedges g, 0.490; 95% CI, 0.185-0.794; P = .002). Subgroup analyses in 4 studies revealed that neonates diagnosed with ASD later in life had no association with blood levels of BDNF (Hedges g, 0.384; 95% CI, -0.244 to 1.011; P = .23), whereas children in the nonneonate ASD group (15 studies) demonstrated significantly increased BDNF levels compared with healthy controls (Hedges g, 0.524; 95% CI, 0.206 to 0.842; P = .001). Further analysis showed that children in the nonneonate ASD group had increased BDNF levels in serum (10 studies) (Hedges g, 0.564; 95% CI, 0.168 to 0.960; P = .005) but not in plasma (5 studies) (Hedges g, 0.436; 95% CI, -0.176 to 1.048; P = .16). Meta-regression analyses revealed that sample size had a moderating effect on the outcome of the meta-analysis in the nonneonate group. In addition, no publication bias was found in the meta-analysis. Children with ASD have increased peripheral blood levels of BDNF, strengthening the clinical evidence of an abnormal neurotrophic factor profile in this population.
Dispositional Variables and Work-Family Conflict: A Meta-Analysis
ERIC Educational Resources Information Center
Allen, Tammy D.; Johnson, Ryan C.; Saboe, Kristin N.; Cho, Eunae; Dumani, Soner; Evans, Sarah
2012-01-01
Meta-analysis was used to comprehensively summarize the relationship between dispositional variables and both directions of work-family conflict. The largest effects detected were those associated with negative affect, neuroticism, and self-efficacy; all were in expected directions. In general, negative trait-based variables (e.g., negative affect…
Meta-analyzing dependent correlations: an SPSS macro and an R script.
Cheung, Shu Fai; Chan, Darius K-S
2014-06-01
The presence of dependent correlation is a common problem in meta-analysis. Cheung and Chan (2004, 2008) have shown that samplewise-adjusted procedures perform better than the more commonly adopted simple within-sample mean procedures. However, samplewise-adjusted procedures have rarely been applied in meta-analytic reviews, probably due to the lack of suitable ready-to-use programs. In this article, we compare the samplewise-adjusted procedures with existing procedures to handle dependent effect sizes, and present the samplewise-adjusted procedures in a way that will make them more accessible to researchers conducting meta-analysis. We also introduce two tools, an SPSS macro and an R script, that researchers can apply to their meta-analyses; these tools are compatible with existing meta-analysis software packages.
Software and package applicating for network meta-analysis: A usage-based comparative study.
Xu, Chang; Niu, Yuming; Wu, Junyi; Gu, Huiyun; Zhang, Chao
2017-12-21
To compare and analyze the characteristics and functions of software applications for network meta-analysis (NMA). PubMed, EMbase, The Cochrane Library, the official websites of Bayesian inference Using Gibbs Sampling (BUGS), Stata and R, and Google were searched to collect the software and packages for performing NMA; software and packages published up to March 2016 were included. After collecting the software, packages, and their user guides, we used the software and packages to calculate a typical example. All characteristics, functions, and computed results were compared and analyzed. Ten types of software were included, including programming and non-programming software. They were developed mainly based on Bayesian or frequentist theory. Most types of software have the characteristics of easy operation, easy mastery, exact calculation, or excellent graphing. However, there was no single software that performed accurate calculations with superior graphing; this could only be achieved through the combination of two or more types of software. This study suggests that the user should choose the appropriate software according to personal programming basis, operational habits, and financial ability. Then, the choice of the combination of BUGS and R (or Stata) software to perform the NMA is considered. © 2017 Chinese Cochrane Center, West China Hospital of Sichuan University and John Wiley & Sons Australia, Ltd.
Wang, Ting-Ting; Li, Jin-Mei; Zhou, Dong
2016-01-01
With great interest, we read the paper "Polymorphisms in IL-4/IL-13 pathway genes and glioma risk: an updated meta-analysis" (by Chen PQ et al.) [1], which has reached important conclusions about the relationship between polymorphisms in interleukin (IL)-4/IL-13 pathway genes and glioma risk. Through quantitative analysis, the meta-analysis found no association between IL-4/IL-13 pathway genetic polymorphisms and glioma risk (Chen et al. in Tumor Biol 36:121-127, 2015). The meta-analysis is the most comprehensive study of polymorphisms in the IL-4/IL-13 pathway and glioma risk. Nevertheless, some deficiencies still exist in this meta-analysis that we would like to raise.
Comprehensive School Reform and Achievement: A Meta-Analysis. Educator's Summary
ERIC Educational Resources Information Center
Center for Data-Driven Reform in Education (NJ3), 2008
2008-01-01
Which comprehensive school reform programs have been proven to help elementary and secondary students achieve? To find out, this review summarizes evidence on comprehensive school reform (CSR) models in elementary and secondary schools. Comprehensive school reform models are programs used schoolwide to improve student achievement. They typically…
A refined method for multivariate meta-analysis and meta-regression
Jackson, Daniel; Riley, Richard D
2014-01-01
Making inferences about the average treatment effect using the random effects model for meta-analysis is problematic in the common situation where there is a small number of studies. This is because estimates of the between-study variance are not precise enough to accurately apply the conventional methods for testing and deriving a confidence interval for the average effect. We have found that a refined method for univariate meta-analysis, which applies a scaling factor to the estimated effects’ standard error, provides more accurate inference. We explain how to extend this method to the multivariate scenario and show that our proposal for refined multivariate meta-analysis and meta-regression can provide more accurate inferences than the more conventional approach. We explain how our proposed approach can be implemented using standard output from multivariate meta-analysis software packages and apply our methodology to two real examples. © 2013 The Authors. Statistics in Medicine published by John Wiley & Sons, Ltd. PMID:23996351
Machine Learning Meta-analysis of Large Metagenomic Datasets: Tools and Biological Insights.
Pasolli, Edoardo; Truong, Duy Tin; Malik, Faizan; Waldron, Levi; Segata, Nicola
2016-07-01
Shotgun metagenomic analysis of the human associated microbiome provides a rich set of microbial features for prediction and biomarker discovery in the context of human diseases and health conditions. However, the use of such high-resolution microbial features presents new challenges, and validated computational tools for learning tasks are lacking. Moreover, classification rules have scarcely been validated in independent studies, posing questions about the generality and generalization of disease-predictive models across cohorts. In this paper, we comprehensively assess approaches to metagenomics-based prediction tasks and for quantitative assessment of the strength of potential microbiome-phenotype associations. We develop a computational framework for prediction tasks using quantitative microbiome profiles, including species-level relative abundances and presence of strain-specific markers. A comprehensive meta-analysis, with particular emphasis on generalization across cohorts, was performed in a collection of 2424 publicly available metagenomic samples from eight large-scale studies. Cross-validation revealed good disease-prediction capabilities, which were in general improved by feature selection and use of strain-specific markers instead of species-level taxonomic abundance. In cross-study analysis, models transferred between studies were in some cases less accurate than models tested by within-study cross-validation. Interestingly, the addition of healthy (control) samples from other studies to training sets improved disease prediction capabilities. Some microbial species (most notably Streptococcus anginosus) seem to characterize general dysbiotic states of the microbiome rather than connections with a specific disease. Our results in modelling features of the "healthy" microbiome can be considered a first step toward defining general microbial dysbiosis. The software framework, microbiome profiles, and metadata for thousands of samples are publicly available at http://segatalab.cibio.unitn.it/tools/metaml.
A-Book: A Feedback-Based Adaptive System to Enhance Meta-Cognitive Skills during Reading.
Guerra, Ernesto; Mellado, Guido
2017-01-01
In the digital era, tech devices (hardware and software) are increasingly within hand's reach. Yet, implementing information and communication technologies for educational contexts that have robust and long-lasting effects on student learning outcomes is still a challenge. We propose that any such system must a) be theoretically motivated and designed to tackle specific cognitive skills (e.g., inference making) supporting a given cognitive task (e.g., reading comprehension) and b) must be able to identify and adapt to the user's profile. In the present study, we implemented a feedback-based adaptive system called A-book (assisted-reading book) and tested it in a sample of 4th, 5th, and 6th graders. To assess our hypotheses, we contrasted three experimental assisted-reading conditions; one that supported meta-cognitive skills and adapted to the user profile (adaptive condition), one that supported meta-cognitive skills but did not adapt to the user profile (training condition) and a control condition. The results provide initial support for our proposal; participants in the adaptive condition improved their accuracy scores on inference making questions over time, outperforming both the training and control groups. There was no evidence, however, of significant improvements on other tested meta-cognitive skills (i.e., text structure knowledge, comprehension monitoring). We discussed the practical implications of using the A-book for the enhancement of meta-cognitive skills in school contexts, as well as its current limitations and future developments that could improve the system.
Liu, Mingli; Wu, Lang; Ming, Qingsen
2015-01-01
Objective To perform a systematic review and meta-analysis for the effects of physical activity intervention on self-esteem and self-concept in children and adolescents, and to identify moderator variables by meta-regression. Design A meta-analysis and meta-regression. Method Relevant studies were identified through a comprehensive search of electronic databases. Study inclusion criteria were: (1) intervention should be supervised physical activity, (2) reported sufficient data to estimate pooled effect sizes of physical activity intervention on self-esteem or self-concept, (3) participants’ ages ranged from 3 to 20 years, and (4) a control or comparison group was included. For each study, study design, intervention design and participant characteristics were extracted. R software (version 3.1.3) and Stata (version 12.0) were used to synthesize effect sizes and perform moderation analyses for determining moderators. Results Twenty-five randomized controlled trial (RCT) studies and 13 non-randomized controlled trial (non-RCT) studies including a total of 2991 cases were identified. Significant positive effects were found in RCTs for intervention of physical activity alone on general self outcomes (Hedges’ g = 0.29, 95% confidence interval [CI]: 0.14 to 0.45; p = 0.001), self-concept (Hedges’ g = 0.49, 95%CI: 0.10 to 0.88, p = 0.014) and self-worth (Hedges’ g = 0.31, 95%CI: 0.13 to 0.49, p = 0.005). There was no significant effect of intervention of physical activity alone on any outcomes in non-RCTs, as well as in studies with intervention of physical activity combined with other strategies. Meta-regression analysis revealed that higher treatment effects were associated with setting of intervention in RCTs (β = 0.31, 95%CI: 0.07 to 0.55, p = 0.013). Conclusion Intervention of physical activity alone is associated with increased self-concept and self-worth in children and adolescents. And there is a stronger association with school-based and gymnasium-based intervention compared with other settings. PMID:26241879
Nouhjah, Sedigheh; Shahbazian, Hajieh; Amoori, Neda; Jahanfar, Shayesteh; Shahbazian, Nahid; Jahanshahi, Alireza; Cheraghian, Bahman
2017-12-01
Rate of postpartum screening and progression to glucose intolerance (diabetes and/or pre-diabetes) in Asian women with prior GDM and risk factors of diversion to abnormal glucose tolerance were reviewed. We searched Pub Med, Cochrane Library, Web of Science, EMBASE, and Ovid data base. About 1300 studies were screened and 27 articles were selected. Meta-analysis using Comprehensive Meta -Analysis software was conducted. All results were reported at the pooled ORs and 95% CI. Quantitative heterogeneity (I 2 ) was assessed. To estimate the variances between studies, the statistical method "tau-squared" was applied. Statistical models like fixed effect or Mantel-Haenszel, and random effect (REM) or Dersimonian-laird were used for the analysis and integration of results. Rate of glucose testing ranged from 13.1% to 81.9%. Prevalence of pre-diabetes was 3.9%-50.9%. Diabetes was reported in 2.8%-58% of women with history of gestational diabetes based on length of follow-up. Factor associated with postpartum diabetes mellitus included family History of diabetes mellitus, gestational age at diagnosis of GDM, insulin use during pregnancy and pre-pregnancy BMI. Rate of postpartum screening in most of the Asian countries population is sub-optimal, in spite of high rate of glucose intolerance in this high risk group of women. Risk factors of progression to pre-diabetes and diabetes are similar to previous reported in developed countries. Copyright © 2017 Diabetes India. All rights reserved.
ERIC Educational Resources Information Center
Abraham, Lee B.
2008-01-01
Language learners have unprecedented opportunities for developing second language literacy skills and intercultural understanding by reading authentic texts on the Internet and in multimedia computer-assisted language learning environments. This article presents findings from a meta-analysis of 11 studies of computer-mediated glosses in second…
A Re-Examination of the Education Production Function Using Individual Participant Data
ERIC Educational Resources Information Center
Pigott, Therese D.; Williams, Ryan T.; Polanin, Joshua R.
2011-01-01
The focus and purpose of this research is to examine the benefits, limitations, and implications of Individual Participant Data (IPD) meta-analysis in education. Comprehensive research reviews in education have been limited to the use of aggregated data (AD) meta- analysis, techniques based on quantitatively combining information from studies on…
Treatment for School Refusal among Children and Adolescents: A Systematic Review and Meta-Analysis
ERIC Educational Resources Information Center
Maynard, Brandy R.; Heyne, David; Brendel, Kristen Esposito; Bulanda, Jeffery J.; Thompson, Aaron M.; Pigott, Terri D.
2018-01-01
Objective: School refusal is a psychosocial problem associated with adverse short- and long-term consequences for children and adolescents. The authors conducted a systematic review and meta-analysis to examine the effects of psychosocial treatments for children and adolescents with school refusal. Method: A comprehensive search process was used…
A Meta-Analysis of Predictors of Offender Treatment Attrition and Its Relationship to Recidivism
ERIC Educational Resources Information Center
Olver, Mark E.; Stockdale, Keira C.; Wormith, J. Stephen
2011-01-01
Objective: The failure of offenders to complete psychological treatment can pose significant concerns, including increased risk for recidivism. Although a large literature identifying predictors of offender treatment attrition has accumulated, there has yet to be a comprehensive quantitative review. Method: A meta-analysis of the offender…
ERIC Educational Resources Information Center
Belland, Brian R.; Walker, Andrew E.; Kim, Nam Ju; Lefler, Mason
2017-01-01
Computer-based scaffolding assists students as they generate solutions to complex problems, goals, or tasks, helping increase and integrate their higher order skills in the process. However, despite decades of research on scaffolding in STEM (science, technology, engineering, and mathematics) education, no existing comprehensive meta-analysis has…
The Psychological Effects of Meditation: A Meta-Analysis
ERIC Educational Resources Information Center
Sedlmeier, Peter; Eberth, Juliane; Schwarz, Marcus; Zimmermann, Doreen; Haarig, Frederik; Jaeger, Sonia; Kunze, Sonja
2012-01-01
In this meta-analysis, we give a comprehensive overview of the effects of meditation on psychological variables that can be extracted from empirical studies, concentrating on the effects of meditation on nonclinical groups of adult meditators. Mostly because of methodological problems, almost 3/4 of an initially identified 595 studies had to be…
Rosen, G D
2006-06-01
Meta-analysis is a vague descriptor used to encompass very diverse methods of data collection analysis, ranging from simple averages to more complex statistical methods. Holo-analysis is a fully comprehensive statistical analysis of all available data and all available variables in a specified topic, with results expressed in a holistic factual empirical model. The objectives and applications of holo-analysis include software production for prediction of responses with confidence limits, translation of research conditions to praxis (field) circumstances, exposure of key missing variables, discovery of theoretically unpredictable variables and interactions, and planning future research. Holo-analyses are cited as examples of the effects on broiler feed intake and live weight gain of exogenous phytases, which account for 70% of variation in responses in terms of 20 highly significant chronological, dietary, environmental, genetic, managemental, and nutrient variables. Even better future accountancy of variation will be facilitated if and when authors of papers routinely provide key data for currently neglected variables, such as temperatures, complete feed formulations, and mortalities.
Liu, Ting; He, Xiang-ge
2006-05-01
To evaluate the overall diagnostic capabilities of frequency-doubling technology (FDT) in patients of primary glaucoma, with standard automated perimetry (SAP) and/or optic disc appearance as the gold standard. A comprehensive electric search in MEDLINE, EMBASE, Cochrane Library, BIOSIS, Previews, HMIC, IPA, OVID, CNKI, CBMdisc, VIP information, CMCC, CCPD, SSreader and 21dmedia and a manual search in related textbooks, journals, congress articles and their references were performed to identify relevant English and Chinese language articles. Criteria for adaptability were established according to validity criteria for diagnostic research published by the Cochrane Methods Group on Screening and Diagnostic Tests. Quality of the included articles was assessed and relevant materials were extracted for studying. Statistical analysis was performed with Meta Test version 0.6 software. Heterogeneity of the included articles was tested, which was used to select appropriate effect model to calculate pooled weighted sensitivity and specificity. Summary Receiver Operating Characteristic (SROC) curve was established and the area under the curve (AUC) was calculated. Finally, sensitivity analysis was performed. Fifteen English articles (21 studies) of 206 retrieved articles were included in the present study, with a total of 3172 patients. The reported sensitivity of FDT ranged from 0.51 to 1.00, and specificity from 0.58 to 1.00. The pooled weighted sensitivity and specificity for FDT with 95% confidence intervals (95% CI) after correction for standard error were 0.86 (0.80 - 0.90), 0.87 (0.81 - 0.91), respectively. The AUC of SROC was 93.01%. Sensitivity analysis demonstrated no disproportionate influences of individual study. The included articles are of good quality and FDT can be a highly efficient diagnostic test for primary glaucoma based on Meta-analysis. However, a high quality perspective study is still required for further analysis.
Huang, Baqun; Liu, Yuelong; Tang, Yan; Li, Qing; Zhu, Yihui
2017-01-01
Background and purpose Accelerated partial breast irradiation (APBI) technology has theoretical advantages in comparison with traditional adjuvant radiation therapy (whole-breast irradiation; WBI) after breast-conserving surgery. However, published randomized controlled trials have shown inconsistent outcomes. Therefore, a comprehensive assessment of the effectiveness and safety of APBI technology is needed. Results A total of 7 studies of 7452 patients were included in this analysis. All 7 studies reported local recurrence as an outcome. Meta-analysis of 5 trials that included 6486 patients showed significantly different 5-year local recurrence rates for APBI and WBI groups (hazard ratio = 4.54, 95% confidence interval: 1.78–11.61, p = 0.002). Further analysis showed that this difference may be related to the choice of treatment methods. Benefit was conferred to the APBI group for the outcome of non-breast cancer deaths. There was no significant difference between the two groups in terms of nodal recurrence, systemic recurrence, overall survival, or mortality rates. Toxicity side effects and cosmetic effects were similar in both groups, but intraoperative radiotherapy seemed to have a greater acute response. Material and methods Searches for relevant randomized controlled trials of APBI versus WBI were performed using the following sources: PubMed, EMBASE, Cochrane Library, Web of Science. Two independent observers evaluated the identified studies. The meta-analysis was conducted using RevMan 5.2 software. Conclusions Although the analysis showed that patients receiving APBI had a higher local recurrence rate, subgroup analyses suggested that this might be related to treatment options. Patients who receive accurate radiotherapy may have greater benefits. APBI is a promising treatment technology and more phase III clinical trials are expected based on new treatments. PMID:28938661
Li, Bin; Zhang, Jian; Wang, Lei; Li, Yan; Jin, Juping; Ai, Limei; Li, Chong; Li, Zhe; Mao, Shudan
2014-05-01
Chronic myelogenous leukemia (CML) is a complex disease with a genetic basis. The genetic association studies (GASs) that have investigated the association between adult CML and 5,10-methylenetetrahydrofolate reductase (MTHFR) C677T and A1298C polymorphisms have produced contradictory and inconclusive results. The aim of this meta-analysis is to provide a relatively comprehensive assessment of the association of these polymorphisms with adult CML risk. A literature search for eligible GAS published before September 15, 2013 was conducted in PubMed, Embase, Web of Science, Cochrane Library, and China National Knowledge Infrastructure (CNKI) databases. Pooled odds ratios (ORs) with their corresponding 95% confidence intervals (95% CIs) were used to evaluate the strength of the association under a fixed or random effect model according to heterogeneity test results. All analyses were performed using the Stata software, version 12.0. Twelve case-control studies were included in this meta-analysis with a total of 932 CML patients and 3,465 healthy controls. For MTHFR C677T (dbSNP: rs1801133, C>T), though the pooled ORs were not significant in the overall population, all the ORs greater than 1 suggested an increased risk of CML for carriers of the risk allele. However, stratified analysis based on genotyping method revealed a significant association in the PCR-restriction fragment length polymorphism (RFLP) subgroup, possibly as a result of heterogeneity. For MTHFR A1298C (dbSNP: rs1801131, A>C), the combined results showed that carriers of the C allele may be associated with a decreased risk of adult CML. Stratified analysis showed that the magnitude of this effect was especially significant among Asians, indicating ethnicity differences in adult CML susceptibility. This meta-analysis shows that the C allele of MTHFR A1298C may be associated with a decreased risk in adult CML, especially among Asians, while MTHFR C677T may not be associated with adult CML risk. However, the development of adult CML may be the result of gene-gene and gene-environment interactions, which should be considered in future individual GAS and subsequent meta-analyses.
Racism as a determinant of health: a protocol for conducting a systematic review and meta-analysis.
Paradies, Yin; Priest, Naomi; Ben, Jehonathan; Truong, Mandy; Gupta, Arpana; Pieterse, Alex; Kelaher, Margaret; Gee, Gilbert
2013-09-23
Racism is increasingly recognized as a key determinant of health. A growing body of epidemiological evidence shows strong associations between self-reported racism and poor health outcomes across diverse minority groups in developed countries. While the relationship between racism and health has received increasing attention over the last two decades, a comprehensive meta-analysis focused on the health effects of racism has yet to be conducted. The aim of this review protocol is to provide a structure from which to conduct a systematic review and meta-analysis of studies that assess the relationship between racism and health. This research will consist of a systematic review and meta-analysis. Studies will be considered for review if they are empirical studies reporting quantitative data on the association between racism and health for adults and/or children of all ages from any racial/ethnic/cultural groups. Outcome measures will include general health and well-being, physical health, mental health, healthcare use and health behaviors. Scientific databases (for example, Medline) will be searched using a comprehensive search strategy and reference lists will be manually searched for relevant studies. In addition, use of online search engines (for example, Google Scholar), key websites, and personal contact with experts will also be undertaken. Screening of search results and extraction of data from included studies will be independently conducted by at least two authors, including assessment of inter-rater reliability. Studies included in the review will be appraised for quality using tools tailored to each study design. Summary statistics of study characteristics and findings will be compiled and findings synthesized in a narrative summary as well as a meta-analysis. This review aims to examine associations between reported racism and health outcomes. This comprehensive and systematic review and meta-analysis of empirical research will provide a rigorous and reliable evidence base for future research, policy and practice, including information on the extent of available evidence for a range of racial/ethnic minority groups.
Agarwal, Silky; Changotra, Harish
2017-01-01
Protein tyrosine phosphatase, non-receptor type 22 gene, which translates to lymphoid tyrosine phosphatase, is considered to be a susceptibility gene marker associated with several autoimmune diseases. Several studies have demonstrated the association of protein tyrosine phosphatase, non-receptor type 22 +1858C→T polymorphism with vitiligo. However, these studies showed conflicting results. Meta-analysis of the same was conducted earlier that included fewer number of publications in their study. We performed a meta-analysis of a total of seven studies consisting of 2094 cases and 3613 controls to evaluate the possible association of protein tyrosine phosphatase, non-receptor type 22 +1858C>T polymorphism with vitiligo susceptibility. We conducted a literature search in PubMed, Google Scholar and Dogpile for all published paper on protein tyrosine phosphatase, non-receptor type 22 +1858C→T polymorphism and vitiligo risk till June 2016. Data analysis was performed by RevMan 5.3 and comprehensive meta-analysis v3.0 software. Meta-analysis showed an overall significant association of protein tyrosine phosphatase, non- receptor type 22 +1858C→T polymorphism with vitiligo in all models (allelic model [T vs. C]: odds ratio = 1.50, 95% confidence interval [1.32-1.71], P< 0.001; dominant model [TT + CT vs. CC]: odds ratio = 1.61, 95% confidence interval [1.16-2.24], P = 0.004; recessive model [TT vs. CT + CC]: odds ratio = 4.82, 95% confidence interval [1.11-20.92], P = 0.04; homozygous model [TT vs. CC]: odds ratio = 5.34, 95% confidence interval [1.23-23.24], P = 0.03; co-dominant model [CT vs. CC]: odds ratio = 1.52, 95% confidence interval [1.09-2.13], P = 0.01). No publication bias was detected in the funnel plot study. Limited ethnic-based studies, unable to satisfy data by gender or vitiligo-type are some limitations of the present meta-analysis. Stratifying data by ethnicity showed an association of protein tyrosine phosphatase, non-receptor type 22 +1858C→T with vitiligo in European population (odds ratio = 1.53, 95% confidence interval [1.34-1.75], P< 0.001) but not in Asian population (odds ratio = 0.59, 95% confidence interval [0.26-1.32], P = 0.2). In conclusion, protein tyrosine phosphatase, non-receptor type 22 +1858 T allele predisposes European individuals to vitiligo.
Li, Nuo; Wang, Bao-Ming; Cai, Shuang; Liu, Peng-Liang
2018-01-01
The purpose of this meta-analysis was to comprehensively investigate the correlation between high mobility group box 1 (HMGB1) and interleukin-6 (IL-6) in relation to acute pancreatitis. A highly regulated exploration of various electronic databases, supplemented by manual searching methods, was performed in an attempt to identify pertinent articles of a useful nature. Subsequently, high-quality cohort studies that were deemed to comply with the arduous inclusion and exclusion criteria were selected for our meta-analysis. The extensive data analyses reported in our meta-analysis were conducted in connection with the Comprehensive Meta-analysis 2.0 (CMA 2.0). A total of 395 studies (135 Chinese studies and 260 English studies) were initially retrieved. 27 of those studies were selected for our meta-analysis, comprising of 896 cases of mild acute pancreatitis (MAP), 700 cases of severe acute pancreatitis (SAP) as well as 312 healthy controls. Pooled data suggested that serum HMGB1 and IL-6 levels of SAP and MAP patients were higher than in healthy controls. Moreover, serum HMGB1 and IL-6 levels of SAP patients exhibited significantly higher levels than in that of MAP patients. Based on the rigorous investigation of our meta-analysis, it was concluded that serum HMGB1 and IL-6 levels might be used as effective indicators for pancreatic lesions as well as the degree of inflammatory response, owing ultimately to the observations and data analyses, suggesting that serum HMGB1 and IL-6 levels share a close correlation with the severity of pancreatitis. J. Cell. Biochem. 119: 616-624, 2018. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
Kan, Shun-Li; Yuan, Zhi-Fang; Chen, Ling-Xiao; Sun, Jing-Cheng; Ning, Guang-Zhi; Feng, Shi-Qing
2017-01-01
Introduction Osteoporotic vertebral compression fractures (OVCFs) commonly cause both acute and chronic back pain, substantial spinal deformity, functional disability and decreased quality of life and increase the risk of future vertebral fractures and mortality. Percutaneous vertebroplasty (PVP), balloon kyphoplasty (BK) and non-surgical treatment (NST) are mostly used for the treatment of OVCFs. However, which treatment is preferred is unknown. The purpose of this study is to comprehensively review the literature and ascertain the relative efficacy and safety of BK, PVP and NST for patients with OVCFs using a Bayesian network meta-analysis. Methods and analysis We will comprehensively search PubMed, EMBASE and the Cochrane Central Register of Controlled Trials, to include randomided controlled trials that compare BK, PVP or NST for treating OVCFs. The risk of bias for individual studies will be assessed according to the Cochrane Handbook. Bayesian network meta-analysis will be performed to compare the efficacy and safety of BK, PVP and NST. The quality of evidence will be evaluated by GRADE. Ethics and dissemination Ethical approval and patient consent are not required since this study is a meta-analysis based on published studies. The results of this network meta-analysis will be submitted to a peer-reviewed journal for publication. PROSPERO registration number CRD42016039452; Pre-results. PMID:28093431
The Effect of XPD Polymorphisms on Digestive Tract Cancers Risk: A Meta-Analysis
Zhang, Qian; Chen, Zhipeng; Lu, Kai; Shu, Yongqian; Chen, Tao; Zhu, Lingjun
2014-01-01
Background The Xeroderma pigmento-sum group D gene (XPD) plays a key role in nucleotide excision repair. Single nucleotide polymorphisms (SNP) located in its functional region may alter DNA repair capacity phenotype and cancer risk. Many studies have demonstrated that XPD polymorphisms are significantly associated with digestive tract cancers risk, but the results are inconsistent. We conducted a comprehensive meta-analysis to assess the association between XPD Lys751Gln polymorphism and digestive tract cancers risk. The digestive tract cancers that our study referred to, includes oral cancer, esophageal cancer, gastric cancer and colorectal cancer. Methods We searched PubMed and EmBase up to December 31, 2012 to identify eligible studies. A total of 37 case-control studies including 9027 cases and 16072 controls were involved in this meta-analysis. Statistical analyses were performed with Stata software (version 11.0, USA). Odds ratios (ORs) with 95% confidence intervals (CIs) were used to assess the strength of the association. Results The results showed that XPD Lys751Gln polymorphism was associated with the increased risk of digestive tract cancers (homozygote comparison (GlnGln vs. LysLys): OR = 1.12, 95% CI = 1.01–1.24, P = 0.029, P heterogeneity = 0.133). We found no statistical evidence for a significantly increased digestive tract cancers risk in the other genetic models. In the subgroup analysis, we also found the homozygote comparison increased the susceptibility of Asian population (OR = 1.28, 95% CI = 1.01–1.63, P = 0.045, P heterogeneity = 0.287). Stratified by cancer type and source of control, no significantly increased cancer risk was found in these subgroups. Additionally, risk estimates from hospital-based studies and esophageal studies were heterogeneous. Conclusions Our meta-analysis suggested that the XPD 751Gln/Gln genotype was a low-penetrate risk factor for developing digestive tract cancers, especially in Asian populations. PMID:24787743
The effect of XPD polymorphisms on digestive tract cancers risk: a meta-analysis.
Du, Haina; Guo, Nannan; Shi, Bin; Zhang, Qian; Chen, Zhipeng; Lu, Kai; Shu, Yongqian; Chen, Tao; Zhu, Lingjun
2014-01-01
The Xeroderma pigmento-sum group D gene (XPD) plays a key role in nucleotide excision repair. Single nucleotide polymorphisms (SNP) located in its functional region may alter DNA repair capacity phenotype and cancer risk. Many studies have demonstrated that XPD polymorphisms are significantly associated with digestive tract cancers risk, but the results are inconsistent. We conducted a comprehensive meta-analysis to assess the association between XPD Lys751Gln polymorphism and digestive tract cancers risk. The digestive tract cancers that our study referred to, includes oral cancer, esophageal cancer, gastric cancer and colorectal cancer. We searched PubMed and EmBase up to December 31, 2012 to identify eligible studies. A total of 37 case-control studies including 9027 cases and 16072 controls were involved in this meta-analysis. Statistical analyses were performed with Stata software (version 11.0, USA). Odds ratios (ORs) with 95% confidence intervals (CIs) were used to assess the strength of the association. The results showed that XPD Lys751Gln polymorphism was associated with the increased risk of digestive tract cancers (homozygote comparison (GlnGln vs. LysLys): OR = 1.12, 95% CI = 1.01-1.24, P = 0.029, P heterogeneity = 0.133). We found no statistical evidence for a significantly increased digestive tract cancers risk in the other genetic models. In the subgroup analysis, we also found the homozygote comparison increased the susceptibility of Asian population (OR = 1.28, 95% CI = 1.01-1.63, P = 0.045, P heterogeneity = 0.287). Stratified by cancer type and source of control, no significantly increased cancer risk was found in these subgroups. Additionally, risk estimates from hospital-based studies and esophageal studies were heterogeneous. Our meta-analysis suggested that the XPD 751Gln/Gln genotype was a low-penetrate risk factor for developing digestive tract cancers, especially in Asian populations.
Damron, T A; McBeath, A A
1995-04-01
With the increasing duration of follow up on total knee arthroplasties, more revision arthroplasties are being performed. When revision is not advisable, a salvage procedure such as arthrodesis or resection arthroplasty is indicated. This article provides a comprehensive review of the literature regarding arthrodesis following failed total knee arthroplasty. In addition, a statistical meta-analysis of five studies using modern arthrodesis techniques is presented. A statistically significant greater fusion rate with intramedullary nail arthrodesis compared to external fixation is documented. Gram negative and mixed infections are found to be significant risk factors for failure of arthrodesis.
Meta-Analysis as a Choice to Improve Research in Career and Technical Education
ERIC Educational Resources Information Center
Gordon, Howard R. D.; McClain, Clifford R.; Kim, Yeonsoo; Maldonado, Cecilia
2010-01-01
A search of the ERIC and Academic Search Premier data bases, and a comprehensive review of literature suggest that meta-analysis is ignored by career and technical education (CTE) researchers, a situation that is regrettable but remediable. The purpose of this theoretical paper is to provide CTE researchers and consumers with procedures for…
How Effective Are Family Literacy Programs? Results of a Meta-Analysis
ERIC Educational Resources Information Center
van Steensel, Roel; McElvany, Nele; Kurvers, Jeanne; Herppich, Stephanie
2011-01-01
This meta-analysis examines the effects of family literacy programs on children's literacy development. It analyzes the results of 30 recent effect studies (1990-2010), covering 47 samples, and distinguishes between effects in two domains: comprehension-related skills and code-related skills. A small but significant mean effect emerged (d = 0.18).…
ERIC Educational Resources Information Center
Williams, Stacy L.
2006-01-01
A comprehensive meta-analysis of the research following Glass, McGraw, and Smith's (1981) technique integrated findings from twenty-five comparative studies from 1990 to 2003 targeting student achievement and distance education in allied health professions. Student achievement was assessed through course grades and resulted in an overall effect…
ERIC Educational Resources Information Center
Van Iddekinge, Chad H.; Roth, Philip L.; Putka, Dan J.; Lanivich, Stephen E.
2011-01-01
A common belief among researchers is that vocational interests have limited value for personnel selection. However, no comprehensive quantitative summaries of interests validity research have been conducted to substantiate claims for or against the use of interests. To help address this gap, we conducted a meta-analysis of relations between…
ERIC Educational Resources Information Center
Takacs, Zsofia K.; Swart, Elise K.; Bus, Adriana G.
2015-01-01
A meta-analysis was conducted on the effects of technology-enhanced stories for young children's literacy development when compared to listening to stories in more traditional settings like storybook reading. A small but significant additional benefit of technology was found for story comprehension (g+ = 0.17) and expressive vocabulary (g+ =…
A-MADMAN: Annotation-based microarray data meta-analysis tool
Bisognin, Andrea; Coppe, Alessandro; Ferrari, Francesco; Risso, Davide; Romualdi, Chiara; Bicciato, Silvio; Bortoluzzi, Stefania
2009-01-01
Background Publicly available datasets of microarray gene expression signals represent an unprecedented opportunity for extracting genomic relevant information and validating biological hypotheses. However, the exploitation of this exceptionally rich mine of information is still hampered by the lack of appropriate computational tools, able to overcome the critical issues raised by meta-analysis. Results This work presents A-MADMAN, an open source web application which allows the retrieval, annotation, organization and meta-analysis of gene expression datasets obtained from Gene Expression Omnibus. A-MADMAN addresses and resolves several open issues in the meta-analysis of gene expression data. Conclusion A-MADMAN allows i) the batch retrieval from Gene Expression Omnibus and the local organization of raw data files and of any related meta-information, ii) the re-annotation of samples to fix incomplete, or otherwise inadequate, metadata and to create user-defined batches of data, iii) the integrative analysis of data obtained from different Affymetrix platforms through custom chip definition files and meta-normalization. Software and documentation are available on-line at . PMID:19563634
Network Meta-Analysis Using R: A Review of Currently Available Automated Packages
Neupane, Binod; Richer, Danielle; Bonner, Ashley Joel; Kibret, Taddele; Beyene, Joseph
2014-01-01
Network meta-analysis (NMA) – a statistical technique that allows comparison of multiple treatments in the same meta-analysis simultaneously – has become increasingly popular in the medical literature in recent years. The statistical methodology underpinning this technique and software tools for implementing the methods are evolving. Both commercial and freely available statistical software packages have been developed to facilitate the statistical computations using NMA with varying degrees of functionality and ease of use. This paper aims to introduce the reader to three R packages, namely, gemtc, pcnetmeta, and netmeta, which are freely available software tools implemented in R. Each automates the process of performing NMA so that users can perform the analysis with minimal computational effort. We present, compare and contrast the availability and functionality of different important features of NMA in these three packages so that clinical investigators and researchers can determine which R packages to implement depending on their analysis needs. Four summary tables detailing (i) data input and network plotting, (ii) modeling options, (iii) assumption checking and diagnostic testing, and (iv) inference and reporting tools, are provided, along with an analysis of a previously published dataset to illustrate the outputs available from each package. We demonstrate that each of the three packages provides a useful set of tools, and combined provide users with nearly all functionality that might be desired when conducting a NMA. PMID:25541687
Network meta-analysis using R: a review of currently available automated packages.
Neupane, Binod; Richer, Danielle; Bonner, Ashley Joel; Kibret, Taddele; Beyene, Joseph
2014-01-01
Network meta-analysis (NMA)--a statistical technique that allows comparison of multiple treatments in the same meta-analysis simultaneously--has become increasingly popular in the medical literature in recent years. The statistical methodology underpinning this technique and software tools for implementing the methods are evolving. Both commercial and freely available statistical software packages have been developed to facilitate the statistical computations using NMA with varying degrees of functionality and ease of use. This paper aims to introduce the reader to three R packages, namely, gemtc, pcnetmeta, and netmeta, which are freely available software tools implemented in R. Each automates the process of performing NMA so that users can perform the analysis with minimal computational effort. We present, compare and contrast the availability and functionality of different important features of NMA in these three packages so that clinical investigators and researchers can determine which R packages to implement depending on their analysis needs. Four summary tables detailing (i) data input and network plotting, (ii) modeling options, (iii) assumption checking and diagnostic testing, and (iv) inference and reporting tools, are provided, along with an analysis of a previously published dataset to illustrate the outputs available from each package. We demonstrate that each of the three packages provides a useful set of tools, and combined provide users with nearly all functionality that might be desired when conducting a NMA.
Polysomnographic Characteristics of Sleep in Stroke: A Systematic Review and Meta-Analysis
Baglioni, Chiara; Nissen, Christoph; Schweinoch, Adrian; Riemann, Dieter; Spiegelhalder, Kai; Berger, Mathias; Weiller, Cornelius; Sterr, Annette
2016-01-01
Background Research on sleep after stroke has focused mainly on sleep disordered breathing. However, the extend to which sleep physiology is altered in stroke survivors, how these alterations compare to healthy volunteers, and how sleep changes might affect recovery as well as physical and mental health has yet to be fully researched. Motivated by the view that a deeper understanding of sleep in stroke is needed to account for its role in health and well-being as well as its relevance for recovery and rehabilitation, we conducted a systematic review and meta-analysis of polysomnographic studies comparing stroke to control populations. Method Medline and PsycInfo databases were searched using "stroke" and words capturing polysomnographic parameters as search terms. This yielded 1692 abstracts for screening, with 15 meeting the criteria for systematic review and 9 for meta-analysis. Prisma best practice guidelines were followed for the systematic review; the Comprehensive Meta-Analysis software was used for random effects modelling. Results The meta-analysis revealed that patients with stroke have poorer sleep than controls. Patients had lower sleep efficiency (mean 75% vs 84%), shorter total-sleep-time (309.4 vs 340.3 min) and more wake-after-sleep-onset (97.2 vs 53.8 min). Patients also spend more time in stage 1 (13% vs 10%) and less time in stage 2 sleep (36% vs 45%) and slow-wave-sleep (10% vs 12%). No group differences were identified for REM sleep. The systematic review revealed a strong bias towards studies in the early recovery phase of stroke, with no study reporting specifically on patients in the chronic state. Moreover, participants in the control groups included community samples as well as other patients groups. Conclusions These results indicate poorer sleep in patients with stroke than controls. While strongly suggestive in nature, the evidence base is limited and methodologically diverse, and hands a clear mandate for further research. A particular need regards polysomnographic studies in chronic community-dwelling patients compared to age-matched individuals. PMID:26949966
2016-01-01
This review aimed to arrange the process of a systematic review of genome-wide association studies in order to practice and apply a genome-wide meta-analysis (GWMA). The process has a series of five steps: searching and selection, extraction of related information, evaluation of validity, meta-analysis by type of genetic model, and evaluation of heterogeneity. In contrast to intervention meta-analyses, GWMA has to evaluate the Hardy–Weinberg equilibrium (HWE) in the third step and conduct meta-analyses by five potential genetic models, including dominant, recessive, homozygote contrast, heterozygote contrast, and allelic contrast in the fourth step. The ‘genhwcci’ and ‘metan’ commands of STATA software evaluate the HWE and calculate a summary effect size, respectively. A meta-regression using the ‘metareg’ command of STATA should be conducted to evaluate related factors of heterogeneities. PMID:28092928
An Introduction to MAMA (Meta-Analysis of MicroArray data) System.
Zhang, Zhe; Fenstermacher, David
2005-01-01
Analyzing microarray data across multiple experiments has been proven advantageous. To support this kind of analysis, we are developing a software system called MAMA (Meta-Analysis of MicroArray data). MAMA utilizes a client-server architecture with a relational database on the server-side for the storage of microarray datasets collected from various resources. The client-side is an application running on the end user's computer that allows the user to manipulate microarray data and analytical results locally. MAMA implementation will integrate several analytical methods, including meta-analysis within an open-source framework offering other developers the flexibility to plug in additional statistical algorithms.
How to Perform a Systematic Review and Meta-analysis of Diagnostic Imaging Studies.
Cronin, Paul; Kelly, Aine Marie; Altaee, Duaa; Foerster, Bradley; Petrou, Myria; Dwamena, Ben A
2018-05-01
A systematic review is a comprehensive search, critical evaluation, and synthesis of all the relevant studies on a specific (clinical) topic that can be applied to the evaluation of diagnostic and screening imaging studies. It can be a qualitative or a quantitative (meta-analysis) review of available literature. A meta-analysis uses statistical methods to combine and summarize the results of several studies. In this review, a 12-step approach to performing a systematic review (and meta-analysis) is outlined under the four domains: (1) Problem Formulation and Data Acquisition, (2) Quality Appraisal of Eligible Studies, (3) Statistical Analysis of Quantitative Data, and (4) Clinical Interpretation of the Evidence. This review is specifically geared toward the performance of a systematic review and meta-analysis of diagnostic test accuracy (imaging) studies. Copyright © 2018 The Association of University Radiologists. Published by Elsevier Inc. All rights reserved.
Niv, Yaron; Ho, Samuel B; Fass, Ronnie; Rokkas, Theodore
2018-02-01
Mucins are heavily glycosylated glycoproteins, synthesized by mucosal surfaces and have an important role in healthy state and malignant diseases. Change in mucins synthesis or secretion may be primary event or secondary to inflammation or carcinogenesis. The aim of this study is to assess the current knowledge about mucin expression in esophageal lesions, and to establish a role for different mucin expressions as prognostic markers. English Medical literature searches were conducted for "mucin" and "esophagus." Observational studies were included. Meta-analysis was performed using comprehensive meta-analysis software. Pooled odds ratios (OR) and 95% confidence intervals (CI) were calculated. In the random-effect model, mucin expression was significantly higher in esophageal lesions than in normal esophageal mucosa with OR=5.456 (95% CI, 1.883-15.807, P=0.002). Measure of heterogeneity, demonstrated in the included studies, was high: Q=287.501, df (Q)=44.00, P<0.0001, I=84.696%. There is a gradient of mucin expression and complexity in esophageal premalignant to malignant lesions, lower in Barrett's mucosa with low grade dysplasia (LGD), increased in high grade dysplasia (HGD), and highest in esophageal adenocarcinoma (EAC). MUC2, MUC3, MUC5AC, and MUC6 expression was higher in EAC than HGD, and higher in HGD than in LGD mucosa. The opposite was found for MUC1 and MUC4. Increased expression of certain mucin genes in esophageal mucosa may be further studied as a potential diagnostic tool, and this may add important information in the surveillance of Barrett's esophagus.
Statins and New-Onset Diabetes in Cardiovascular and Kidney Disease Cohorts: A Meta-Analysis.
Kamran, Haroon; Kupferstein, Eric; Sharma, Navneet; Karam, Jocelyne G; Myers, Alyson K; Youssef, Irini; Sowers, James R; Gustafson, Deborah R; Salifu, Moro O; McFarlane, Samy I
2018-01-01
Statins have long been prescribed for the primary and secondary prevention of cardiovascular disease (CVD) and kidney disease. Their benefits and efficacy are widely accepted in current clinical practice, but like any other therapeutic agents, they have adverse effects. One of the emerging concerns with statin therapy is the development of new-onset diabetes mellitus (NODM), a dreaded risk factor for CVD and kidney disease and widely viewed as CVD equivalent. Accumulating evidence indicates that NODM is a consequence of statin use. We conducted a meta-analysis of studies reporting on associations between NODM and statin use. Based on strict exclusion criteria, a total of 11 studies were selected. Their data were analyzed using Comprehensive Meta-Analysis® statistical software and reported as odds ratios (OR) with 95% confidence intervals (CI). The cumulative fixed effect for use of statin therapy and incident NODM was an OR of 1.61 (95% CI 1.55-1.68, p < 0.001). Our results suggest that statin therapy is associated with NODM, such that there is a small but significant risk of NODM among patients receiving statin for CVD prevention therapy. However, this high-risk population also has other diabetes risk factors (such as obesity and hypertension) contributing to the development of NODM. It is imperative that patients on statin therapy be monitored carefully for NODM. However, it can be argued that the risk of statin therapy is offset by the multitude of cardiovascular and kidney-protective effects provided by such an important and highly effective therapeutic agent. © 2018 S. Karger AG, Basel.
Wei, Kongyuan; Pan, Bei; Yang, Huan; Lu, Cuncun; Ge, Long; Cao, Nong
2018-04-01
Gastrointestinal stromal tumor (GIST) is a rare cancer in gastrointestinal carcinomas and has been widely known as a curable disease among all the digestive tumors. However, early detection of malignant potential in patients with GIST has still been a huge challenge all around the world. CT, MRI, and F-18 FDG PET are all considered as good tests for diagnosing malignant GIST efficiently, but no recommended suggestions presents which test among the 3 is the prior one in detecting the malignant potential of GIST. We perform this study to assess the accuracy between CT, MRI, and F-18 FDG PET through network meta-analysis method, and to rank these tests. PubMed, EMBASE.com, CNKI, and CBM databases will be searched without search date and language restrictions. We will include diagnostic tests which assessed the accuracy of CT, MRI, and F-18 FDG PET in detecting the malignant potential of GIST. The risk of bias in each study will be independently assessed as low, moderate, or high using criteria adapted from Quality Assessment of Diagnostic Accuracy Studies 2 (QUADAS-2). Meta-analysis will be performed using STATA 12.0 and R 3.4.1 software. The competing diagnostic tests will be ranked by a superiority index. This study is ongoing, and will be submitted to a peer-reviewed journal for publication. This study will provide a comprehensive evidence summary of CT, MRI, and F-18 FDG PET in detecting the malignant potential of GIST.
Requirements for Next Generation Comprehensive Analysis of Rotorcraft
NASA Technical Reports Server (NTRS)
Johnson, Wayne; Data, Anubhav
2008-01-01
The unique demands of rotorcraft aeromechanics analysis have led to the development of software tools that are described as comprehensive analyses. The next generation of rotorcraft comprehensive analyses will be driven and enabled by the tremendous capabilities of high performance computing, particularly modular and scaleable software executed on multiple cores. Development of a comprehensive analysis based on high performance computing both demands and permits a new analysis architecture. This paper describes a vision of the requirements for this next generation of comprehensive analyses of rotorcraft. The requirements are described and substantiated for what must be included and justification provided for what should be excluded. With this guide, a path to the next generation code can be found.
Swanson, Elizabeth; Hairrell, Angela; Kent, Shawn; Ciullo, Stephen; Wanzek, Jeanne A; Vaughn, Sharon
2014-01-01
A synthesis and meta-analysis of the extant research on the effects of reading interventions delivered using social studies content for students with learning disabilities in kindergarten through Grade 12 is provided. A total of 27 studies met criteria for the synthesis, with 16 studies providing sufficient data for inclusion in the meta-analysis. Reading interventions implemented within the context of social studies have employed the use of graphic organizers, mnemonics, reading and answering questions, guided notes, and multicomponent comprehension instruction. The overall mean effect size for interventions included in the meta-analysis was 1.02, indicating that reading interventions delivered using social studies content have a substantial positive effect on outcomes among students with learning disabilities.
iMetaLab 1.0: A web platform for metaproteomics data analysis.
Liao, Bo; Ning, Zhibin; Cheng, Kai; Zhang, Xu; Li, Leyuan; Mayne, Janice; Figeys, Daniel
2018-06-15
The human gut microbiota, a complex, dynamic and biodiverse community, has been increasingly shown to influence many aspects of health and disease. Metaproteomic analysis has proven to be a powerful approach to study the functionality of the microbiota. However, the processing and analyses of metaproteomic mass spectrometry (MS) data remains a daunting task in metaproteomics data analysis. We developed iMetaLab, a web based platform to provide a user-friendly and comprehensive data analysis pipeline with a focus on lowering the technical barrier for metaproteomics data analysis. iMetaLab is freely available through at http://imetalab.ca. Supplementary data are available at Bioinformatics online.
Writing to Read: A Meta-Analysis of the Impact of Writing and Writing Instruction on Reading
ERIC Educational Resources Information Center
Graham, Steve; Hebert, Michael
2011-01-01
Reading is critical to students' success in and out of school. One potential means for improving students' reading is writing. In this meta-analysis of true and quasi-experiments, Graham and Herbert present evidence that writing about material read improves students' comprehension of it; that teaching students how to write improves their reading…
Qiu, Ruijin; Zhang, Xiaoyu; Zhao, Chen; Li, Min
2018-01-01
Background Dispensing granules have been developed for about 20 years. However, whether they are as effective as the traditional decoction kept unclear. This systematic review and meta-analysis was made to assess the efficacy of dispensing granules compared with traditional decoction. Methods We searched four databases since their inception to 9th September in 2016. Two authors independently identified trials, extracted data and assessed risk of bias with Cochrane Reviewer’s Handbook 5.0. We conducted meta-analysis with RevMan 5.1.0 software for eligible and appropriate trials. Results In the end, 7,035 participants from 51 randomized controlled trials (RCTs) which compared dispensing granules with traditional decoction were included in this systematic review. There were 33 different kinds of diseases for investigation, of which 8 RCTs observed common cold, 4 RCTs observed migraine. For rheumatoid arthritis, insomnia and hypertension, there were 3 RCTs reported respectively. The last RCTs reported different kinds of diseases in one or two trials. The majority of trials were in low methodological quality. Thirty-eight (74.5%) RCTs showed that the efficacy of dispensing granules were similar with traditional decoction, 6 (11.8%) RCTs reported that the therapeutic efficacy of dispensing granules were significantly better than traditional decoction. We conducted meta-analysis for 4 trials investigating patients with migraine. The results showed that dispensing granules reduced headache frequency by about 1.03 attacks per month as compared to traditional decoction. No evidence was found in terms of migraine intensity and duration. Conclusions The low quality of RCTs and conflicting results made it difficult to draw a definite conclusion. In the future, it needs much more evidence to explore the efficacy and safety of dispensing granules. N-of-1 trials and fuzzy comprehensive evaluation methods may be better choices for assessing the efficacy of them than RCTs. PMID:29610730
Kitson, Matthew T; Sarrazin, Christoph; Toniutto, Pierluigi; Eslick, Guy D; Roberts, Stuart K
2014-12-01
The baseline 25-hydroxyvitamin D (25[OH]D) level has recently been reported to be an independent predictor of sustained virologic response (SVR) to treatment with pegylated interferon (PEG-IFN) plus ribavirin (RBV) for chronic hepatitis C virus (HCV) infection. However, studies have yielded inconsistent results. Thus, we conducted a systematic review and meta-analysis to clarify any association between baseline 25(OH)D level and SVR in HCV therapy. Two reviewers searched four electronic databases (Medline, Embase, PubMed, and Cochrane trials register) and relevant international conference proceedings up to March 2014 for studies treating chronic HCV infection with PEG-IFN plus RBV where baseline 25(OH)D level was tested. Studies involving patients with HIV co-infection, previous liver transplantation or those receiving vitamin D supplementation were excluded. The mean baseline 25(OH)D level was compared between those who achieved and those who failed to achieve SVR. Pooled standard difference in mean 25(OH)D level, odds ratios (OR) and 95% confidence intervals (CI) were calculated with the Comprehensive Meta-Analysis software (version 2.0) using a random effects model. 11 studies comprising 2605 patients were included in the meta-analysis. There was no significant association between the baseline mean 25(OH)D level and SVR (OR 1.44, 95% CI 0.92-2.26; p=0.11), either in patients infected with genotypes 1/4/5 (OR 1.48, 95% CI 0.94-2.34; p=0.09) or genotypes 2/3 (OR 1.51, 95% CI 0.26-8.87; p=0.65). The baseline 25(OH)D level is not associated with SVR to PEG-IFN plus RBV therapy in chronic HCV infection, regardless of genotype. Any effect of vitamin D supplementation on SVR is yet to be definitively determined. Copyright © 2014 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.
A hands-on practical tutorial on performing meta-analysis with Stata.
Chaimani, Anna; Mavridis, Dimitris; Salanti, Georgia
2014-11-01
Statistical synthesis of research findings via meta-analysis is widely used to assess the relative effectiveness of competing interventions. A series of three papers aimed at familiarising mental health scientists with the key statistical concepts and problems in meta-analysis was recently published in this journal. One paper focused on the selection and interpretation of the appropriate model to synthesise results (fixed effect or random effects model) whereas the other two papers focused on two major threats that compromise the validity of meta-analysis results, namely publication bias and missing outcome data. In this paper we provide guidance on how to undertake meta-analysis using Stata, one of the most commonly used software packages for meta-analysis. We address the three topics covered in the previous issues of the journal, focusing on their implementation in Stata using a working example from mental health research. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.
Model and Interoperability using Meta Data Annotations
NASA Astrophysics Data System (ADS)
David, O.
2011-12-01
Software frameworks and architectures are in need for meta data to efficiently support model integration. Modelers have to know the context of a model, often stepping into modeling semantics and auxiliary information usually not provided in a concise structure and universal format, consumable by a range of (modeling) tools. XML often seems the obvious solution for capturing meta data, but its wide adoption to facilitate model interoperability is limited by XML schema fragmentation, complexity, and verbosity outside of a data-automation process. Ontologies seem to overcome those shortcomings, however the practical significance of their use remains to be demonstrated. OMS version 3 took a different approach for meta data representation. The fundamental building block of a modular model in OMS is a software component representing a single physical process, calibration method, or data access approach. Here, programing language features known as Annotations or Attributes were adopted. Within other (non-modeling) frameworks it has been observed that annotations lead to cleaner and leaner application code. Framework-supported model integration, traditionally accomplished using Application Programming Interfaces (API) calls is now achieved using descriptive code annotations. Fully annotated components for various hydrological and Ag-system models now provide information directly for (i) model assembly and building, (ii) data flow analysis for implicit multi-threading or visualization, (iii) automated and comprehensive model documentation of component dependencies, physical data properties, (iv) automated model and component testing, calibration, and optimization, and (v) automated audit-traceability to account for all model resources leading to a particular simulation result. Such a non-invasive methodology leads to models and modeling components with only minimal dependencies on the modeling framework but a strong reference to its originating code. Since models and modeling components are not directly bound to framework by the use of specific APIs and/or data types they can more easily be reused both within the framework as well as outside. While providing all those capabilities, a significant reduction in the size of the model source code was achieved. To support the benefit of annotations for a modeler, studies were conducted to evaluate the effectiveness of an annotation based framework approach with other modeling frameworks and libraries, a framework-invasiveness study was conducted to evaluate the effects of framework design on model code quality. A typical hydrological model was implemented across several modeling frameworks and several software metrics were collected. The metrics selected were measures of non-invasive design methods for modeling frameworks from a software engineering perspective. It appears that the use of annotations positively impacts several software quality measures. Experience to date has demonstrated the multi-purpose value of using annotations. Annotations are also a feasible and practical method to enable interoperability among models and modeling frameworks.
HaiBo, Tan; Xin, Kang; ShiHeng, Lu; Lin, Liu
2015-01-01
To compare the efficacy and safety of Ahmed glaucoma valve implantation (AGV) with trabeculectomy in the management of glaucoma patients. A comprehensive literature search (PubMed, Embase, Google, and the Cochrane library) was performed, including a systematic review with meta-analysis of controlled clinical trials comparing AGV versus trabeculectomy. Efficacy estimates were the weighted mean differences (WMDs) for the percentage intraocular pressure reduction (IOPR %) from baseline to end-point, the reduction in glaucoma medications, and the odds ratios (ORs) for complete and qualified success rates. Safety estimates were the relative risks (RRs) for adverse events. All outcomes were reported with a 95% confidence interval (CI). Statistical analysis was performed using the RevMan 5.0 software. Six controlled clinical trials were included in this meta-analysis. There was no significant difference between the AGV and trabeculectomy in the IOPR% (WMD = -3.04, 95% CI: -8.36- 2.26; P = 0.26). The pooled ORs comparing AGV with trabeculectomy were 0.46 (0.22, 0.99) for the complete success rate (P = 0.05) and 0.97 (0.78-1.20) for the quantified success rate (P = 0.76). No significant difference in the reduction in glaucoma medicines was observed (WMD = 0.24; 95% CI: -0.27-0.76; P = 0.35). AGV was found to be associated with a significantly lower frequency of all adverse events (RR = 0.71; 95%CI: 1.14-0.97; p = 0.001) than trabeculectomy, while the most common complications did not differ significantly (all p> 0.05). AGV was equivalent to trabeculectomy in reducing the IOP, the number of glaucoma medications, success rates, and rates of the most common complications. However, AGV was associated with a significantly lower frequency of overall adverse events.
Contrast-Enhanced Ultrasonography in Differential Diagnosis of Benign and Malignant Ovarian Tumors
Qiao, Jing-Jing; Yu, Jing; Yu, Zhe; Li, Na; Song, Chen; Li, Man
2015-01-01
Objective To evaluate the accuracy of contrast-enhanced ultrasonography (CEUS) in differential diagnosis of benign and malignant ovarian tumors. Methods The scientific literature databases PubMed, Cochrane Library and CNKI were comprehensively searched for studies relevant to the use of CEUS technique for differential diagnosis of benign and malignant ovarian cancer. Pooled summary statistics for specificity (Spe), sensitivity (Sen), positive and negative likelihood ratios (LR+/LR−), and diagnostic odds ratio (DOR) and their 95%CIs were calculated. Software for statistical analysis included STATA version 12.0 (Stata Corp, College Station, TX, USA) and Meta-Disc version 1.4 (Universidad Complutense, Madrid, Spain). Results Following a stringent selection process, seven high quality clinical trials were found suitable for inclusion in the present meta-analysis. The 7 studies contained a combined total of 375 ovarian cancer patients (198 malignant and 177 benign). Statistical analysis revealed that CEUS was associated with the following performance measures in differential diagnosis of ovarian tumors: pooled Sen was 0.96 (95%CI = 0.92∼0.98); the summary Spe was 0.91 (95%CI = 0.86∼0.94); the pooled LR+ was 10.63 (95%CI = 6.59∼17.17); the pooled LR− was 0.04 (95%CI = 0.02∼0.09); and the pooled DOR was 241.04 (95% CI = 92.61∼627.37). The area under the SROC curve was 0.98 (95% CI = 0.20∼1.00). Lastly, publication bias was not detected (t = −0.52, P = 0.626) in the meta-analysis. Conclusions Our results revealed the high clinical value of CEUS in differential diagnosis of benign and malignant ovarian tumors. Further, CEUS may also prove to be useful in differential diagnosis at early stages of this disease. PMID:25764442
A UML-based metamodel for software evolution process
NASA Astrophysics Data System (ADS)
Jiang, Zuo; Zhou, Wei-Hong; Fu, Zhi-Tao; Xiong, Shun-Qing
2014-04-01
A software evolution process is a set of interrelated software processes under which the corresponding software is evolving. An object-oriented software evolution process meta-model (OO-EPMM), abstract syntax and formal OCL constraint of meta-model are presented in this paper. OO-EPMM can not only represent software development process, but also represent software evolution.
Random-effects meta-analysis: the number of studies matters.
Guolo, Annamaria; Varin, Cristiano
2017-06-01
This paper investigates the impact of the number of studies on meta-analysis and meta-regression within the random-effects model framework. It is frequently neglected that inference in random-effects models requires a substantial number of studies included in meta-analysis to guarantee reliable conclusions. Several authors warn about the risk of inaccurate results of the traditional DerSimonian and Laird approach especially in the common case of meta-analysis involving a limited number of studies. This paper presents a selection of likelihood and non-likelihood methods for inference in meta-analysis proposed to overcome the limitations of the DerSimonian and Laird procedure, with a focus on the effect of the number of studies. The applicability and the performance of the methods are investigated in terms of Type I error rates and empirical power to detect effects, according to scenarios of practical interest. Simulation studies and applications to real meta-analyses highlight that it is not possible to identify an approach uniformly superior to alternatives. The overall recommendation is to avoid the DerSimonian and Laird method when the number of meta-analysis studies is modest and prefer a more comprehensive procedure that compares alternative inferential approaches. R code for meta-analysis according to all of the inferential methods examined in the paper is provided.
Zhang, Zheng; Zheng, Shu-Juan; Yu, Wen; Han, You-Feng; Chen, Hai; Chen, Yun; Dai, Yu-Tian
2017-01-01
The present meta-analysis was conducted to compare the clinical effect and patient experience of laparoendoscopic single-site varicocelectomy (LESSV) and conventional laparoscopic varicocelectomy. The candidate studies were included after literature search of database Cochrane Library, PubMed, EMBASE, and MEDLINE. Related information on essential data and outcome measures was extracted from the eligible studies by two independent authors, and a meta-analysis was conducted using STATA 12.0 software. Subgroup analyses were conducted by study design (RCT and non-RCT). The odds ratio (OR) or standardized mean difference (SMD) and their 95% confidence intervals (95% CIs) were used to estimate the outcome measures. Seven articles were included in our meta-analysis. The results indicated that patient who had undergone LESSV had a shorter duration of back to work (overall: SMD = −1.454, 95% CI: −2.502–−0.405, P = 0.007; non-RCT: SMD = −2.906, 95% CI: −3.796–−2.017, P = 0.000; and RCT: SMD = −0.841, 95% CI: −1.393–−0.289, P = 0.003) and less pain experience at 3 h or 6 h (SMD = −0.447, 95% CI: −0.754–−0.139, P = 0.004), day 1 (SMD = −0.477, 95% CI: −0.905–−0.05, P = 0.029), and day 2 (SMD = −0.612, 95% CI: −1.099–−0.125, P = 0.014) postoperatively based on RCT studies. However, the meta-analyses based on operation time, clinical effect (improvement of semen quality and scrotal pain relief), and complications (hydrocele and recurrence) yielded nonsignificant results. In conclusion, LESSV had a rapid recovery and less pain experience over conventional laparoscopic varicocelectomy. However, there was no statistically significant difference between the two varicocelectomy techniques in terms of the clinical effect and the incidence of hydrocele and varicocele recurrence. More high-quality studies are warranted for a comprehensive conclusion. PMID:27212128
GEOquery: a bridge between the Gene Expression Omnibus (GEO) and BioConductor.
Davis, Sean; Meltzer, Paul S
2007-07-15
Microarray technology has become a standard molecular biology tool. Experimental data have been generated on a huge number of organisms, tissue types, treatment conditions and disease states. The Gene Expression Omnibus (Barrett et al., 2005), developed by the National Center for Bioinformatics (NCBI) at the National Institutes of Health is a repository of nearly 140,000 gene expression experiments. The BioConductor project (Gentleman et al., 2004) is an open-source and open-development software project built in the R statistical programming environment (R Development core Team, 2005) for the analysis and comprehension of genomic data. The tools contained in the BioConductor project represent many state-of-the-art methods for the analysis of microarray and genomics data. We have developed a software tool that allows access to the wealth of information within GEO directly from BioConductor, eliminating many the formatting and parsing problems that have made such analyses labor-intensive in the past. The software, called GEOquery, effectively establishes a bridge between GEO and BioConductor. Easy access to GEO data from BioConductor will likely lead to new analyses of GEO data using novel and rigorous statistical and bioinformatic tools. Facilitating analyses and meta-analyses of microarray data will increase the efficiency with which biologically important conclusions can be drawn from published genomic data. GEOquery is available as part of the BioConductor project.
Teacher Attrition and Retention: A Meta-Analytic and Narrative Review of the Research
ERIC Educational Resources Information Center
Borman, Geoffrey D.; Dowling, N. Maritza
2008-01-01
This comprehensive meta-analysis on teacher career trajectories, consisting of 34 studies of 63 attrition moderators, seeks to understand why teaching attrition occurs, or what factors moderate attrition outcomes. Personal characteristics of teachers are important predictors of turnover. Attributes of teachers' schools, including organizational…
SAGA: A project to automate the management of software production systems
NASA Technical Reports Server (NTRS)
Campbell, Roy H.; Beckman, Carol S.; Benzinger, Leonora; Beshers, George; Hammerslag, David; Kimball, John; Kirslis, Peter A.; Render, Hal; Richards, Paul; Terwilliger, Robert
1985-01-01
The SAGA system is a software environment that is designed to support most of the software development activities that occur in a software lifecycle. The system can be configured to support specific software development applications using given programming languages, tools, and methodologies. Meta-tools are provided to ease configuration. The SAGA system consists of a small number of software components that are adapted by the meta-tools into specific tools for use in the software development application. The modules are design so that the meta-tools can construct an environment which is both integrated and flexible. The SAGA project is documented in several papers which are presented.
MPA Portable: A Stand-Alone Software Package for Analyzing Metaproteome Samples on the Go.
Muth, Thilo; Kohrs, Fabian; Heyer, Robert; Benndorf, Dirk; Rapp, Erdmann; Reichl, Udo; Martens, Lennart; Renard, Bernhard Y
2018-01-02
Metaproteomics, the mass spectrometry-based analysis of proteins from multispecies samples faces severe challenges concerning data analysis and results interpretation. To overcome these shortcomings, we here introduce the MetaProteomeAnalyzer (MPA) Portable software. In contrast to the original server-based MPA application, this newly developed tool no longer requires computational expertise for installation and is now independent of any relational database system. In addition, MPA Portable now supports state-of-the-art database search engines and a convenient command line interface for high-performance data processing tasks. While search engine results can easily be combined to increase the protein identification yield, an additional two-step workflow is implemented to provide sufficient analysis resolution for further postprocessing steps, such as protein grouping as well as taxonomic and functional annotation. Our new application has been developed with a focus on intuitive usability, adherence to data standards, and adaptation to Web-based workflow platforms. The open source software package can be found at https://github.com/compomics/meta-proteome-analyzer .
ERIC Educational Resources Information Center
Nowak, Christoph; Heinrichs, Nina
2008-01-01
A meta-analysis encompassing all studies evaluating the impact of the Triple P-Positive Parenting Program on parent and child outcome measures was conducted in an effort to identify variables that moderate the program's effectiveness. Hierarchical linear models (HLM) with three levels of data were employed to analyze effect sizes. The results (N =…
Racism as a determinant of health: a protocol for conducting a systematic review and meta-analysis
2013-01-01
Background Racism is increasingly recognized as a key determinant of health. A growing body of epidemiological evidence shows strong associations between self-reported racism and poor health outcomes across diverse minority groups in developed countries. While the relationship between racism and health has received increasing attention over the last two decades, a comprehensive meta-analysis focused on the health effects of racism has yet to be conducted. The aim of this review protocol is to provide a structure from which to conduct a systematic review and meta-analysis of studies that assess the relationship between racism and health. Methods This research will consist of a systematic review and meta-analysis. Studies will be considered for review if they are empirical studies reporting quantitative data on the association between racism and health for adults and/or children of all ages from any racial/ethnic/cultural groups. Outcome measures will include general health and well-being, physical health, mental health, healthcare use and health behaviors. Scientific databases (for example, Medline) will be searched using a comprehensive search strategy and reference lists will be manually searched for relevant studies. In addition, use of online search engines (for example, Google Scholar), key websites, and personal contact with experts will also be undertaken. Screening of search results and extraction of data from included studies will be independently conducted by at least two authors, including assessment of inter-rater reliability. Studies included in the review will be appraised for quality using tools tailored to each study design. Summary statistics of study characteristics and findings will be compiled and findings synthesized in a narrative summary as well as a meta-analysis. Discussion This review aims to examine associations between reported racism and health outcomes. This comprehensive and systematic review and meta-analysis of empirical research will provide a rigorous and reliable evidence base for future research, policy and practice, including information on the extent of available evidence for a range of racial/ethnic minority groups PMID:24059279
Elmaraezy, Ahmed; Ismail, Ammar; Abushouk, Abdelrahman Ibrahim; Eltoomy, Moutaz; Saad, Soha; Negida, Ahmed; Abdelaty, Osama Mahmoud; Abdallah, Ahmed Ramadan; Aboelfotoh, Ahmed Magdy; Hassan, Hossam Mahmoud; Elmaraezy, Aya Gamal; Morsi, Mahmoud; Althaher, Farah; Althaher, Moath; AlSafadi, Ammar M
2017-08-24
Recently, transcatheter aortic valve replacement (TAVR) has become the procedure of choice in high surgical risk patients with aortic stenosis (AS). However, its value is still debated in operable AS cases. We performed this meta-analysis to compare the safety and efficacy of TAVR to surgical aortic valve replacement (SAVR) in low-to-moderate surgical risk patients with AS. A systematic search of five authentic databases retrieved 11 eligible studies (20,056 patients). Relevant Data were pooled as risk ratios (RRs) or standardized mean differences (SMD), with their 95% confidence interval, using Comprehensive Meta-Analysis and RevMan software for windows. At one-year of follow-up, the pooled effect-estimates showed no significant difference between TAVR and SAVR groups in terms of all-cause mortality (RR 1.02, 95% CI [0.83, 1.26], stroke (RR 0.83, 95%CI [0.56, 1.21]), myocardial infarction (RR 0.82, 95% CI [0.57, 1.19]), and length of hospital stay (SMD -0.04, 95% CI [-0.34, 0.26]). The incidence of major bleeding (RR 0.45, 95% CI [0.24, 0.86]) and acute kidney injury (RR 0.52, 95% CI [0.30, 0.88]) was significantly lower in the TAVR group, compared to the SAVR group. However, TAVR was associated with a higher risk of permanent pacemaker implantation (RR 2.57, 95% CI [1.36, 4.86]), vascular-access complications at 1 year (RR 1.99, 95%CI [1.04, 3.80]), and paravalvular aortic regurgitation at 30 days (RR 3.90, 95% CI [1.25, 12.12]), compared to SAVR. Due to the comparable mortality rates in SAVR and TAVR groups and the lower risk of life-threatening complications in the TAVR group, TAVR can be an acceptable alternative to SAVR in low-to-moderate risk patients with AS. However, larger trials with longer follow-up periods are required to compare the long-term outcomes of both techniques.
Huang, Yuan-sheng; Yang, Zhi-rong; Zhan, Si-yan
2015-06-18
To investigate the use of simple pooling and bivariate model in meta-analyses of diagnostic test accuracy (DTA) published in Chinese journals (January to November, 2014), compare the differences of results from these two models, and explore the impact of between-study variability of sensitivity and specificity on the differences. DTA meta-analyses were searched through Chinese Biomedical Literature Database (January to November, 2014). Details in models and data for fourfold table were extracted. Descriptive analysis was conducted to investigate the prevalence of the use of simple pooling method and bivariate model in the included literature. Data were re-analyzed with the two models respectively. Differences in the results were examined by Wilcoxon signed rank test. How the results differences were affected by between-study variability of sensitivity and specificity, expressed by I2, was explored. The 55 systematic reviews, containing 58 DTA meta-analyses, were included and 25 DTA meta-analyses were eligible for re-analysis. Simple pooling was used in 50 (90.9%) systematic reviews and bivariate model in 1 (1.8%). The remaining 4 (7.3%) articles used other models pooling sensitivity and specificity or pooled neither of them. Of the reviews simply pooling sensitivity and specificity, 41(82.0%) were at the risk of wrongly using Meta-disc software. The differences in medians of sensitivity and specificity between two models were both 0.011 (P<0.001, P=0.031 respectively). Greater differences could be found as I2 of sensitivity or specificity became larger, especially when I2>75%. Most DTA meta-analyses published in Chinese journals(January to November, 2014) combine the sensitivity and specificity by simple pooling. Meta-disc software can pool the sensitivity and specificity only through fixed-effect model, but a high proportion of authors think it can implement random-effect model. Simple pooling tends to underestimate the results compared with bivariate model. The greater the between-study variance is, the more likely the simple pooling has larger deviation. It is necessary to increase the knowledge level of statistical methods and software for meta-analyses of DTA data.
Methicillin-resistant Staphylococcus aureus (MRSA) in Iran: A systematic review and meta-analysis.
Dadashi, Masoud; Nasiri, Mohammad Javad; Fallah, Fatemeh; Owlia, Parviz; Hajikhani, Bahareh; Emaneini, Mohammad; Mirpour, Mirsasan
2018-03-01
Methicillin-resistant Staphylococcus aureus (MRSA) is among the most prevalent pathogens causing healthcare-associated infections. Accurate and updated data describing the epidemiology of MRSA are crucial for the development of national policies to control MRSA infection in each country. This study aimed to estimate the prevalence of MRSA in different parts of Iran. Several databases, including MEDLINE, Embase, Web of Science and Scientific Information Database (http://www.sid.ir), were searched from 1 January 2000 to 31 March 2016 to identify studies addressing the frequency or prevalence of MRSA in Iran. Comprehensive Meta-Analysis software v.2.2 was used to analyse the data. Of the 725 records identified from the databases, 31 studies fulfilled the eligibility criteria. The analyses showed that the frequency of MRSA infections was 43.0% (95% confidence interval 36.3-50.0%) among confirmed S. aureus isolates. Further stratified analyses indicated that the prevalence of MRSA was higher in studies performed after the year 2000. Since a high rate of MRSA infections was seen in this analysis, regular surveillance of hospital-associated infections, monitoring of antibiotic sensitivity patterns, and formulation of definite antibiotic policy may facilitate more accurate action for the prevention and control of MRSA. Copyright © 2017 International Society for Chemotherapy of Infection and Cancer. Published by Elsevier Ltd. All rights reserved.
Meta-analysis of prognostic value of inflammation parameter in breast cancer.
Chen, Jie; Pan, Yuqin; He, Bangshun; Ying, Houqun; Sun, Huiling; Deng, Qiwen; Liu, Xian; Wang, Shukui
2018-01-01
Recently, increasing studies investigated the association between inflammation parameter such as neutrophil to lymphocyte ratio (NLR) and the prognosis of cancers. However, the clinical and prognostic significance of NLR in breast cancer remains controversial. This meta-analysis was conducted to establish the overall accuracy of the NLR test in the diagnosis of breast cancer. A comprehensive search of the literature was conducted using PubMed and Web of Science. Six studies dating up to July 2014 with 2267 patients were enrolled in the present study. STATA 11.0 software (STATA Corporation, College Station, TX, USA) was selected for data analysis. In order to evaluate the association between NLR and overall survival (OS), disease-free survival (DFS), recurrence-free survival or cancer-specific survival, the hazard ratios (HRs), and their 95% confidence intervals (CIs) were extracted. Subgroup analyses showed that NLR was a strong prognostic factor for OS in multivariate analysis (HR = 2.81, 95% CI = 2.13-3.71, P H = 0.992) and without metastasis (HR = 1.45, 95% CI = 0.37-5.66, P H < 0.001). Elevated NLR was associated with a high risk for DFS in subgroups of multivariate analysis (HR = 2.16, 95% CI = 1.67-2.80, P H = 0.977) and mixed metastasis (HR = 2.13, 95% CI = 1.38-3.30, P H = 0.84). In summary, NLR may be considered as a predictive factor for patients with breast cancer.
Kalandadze, Tamar; Norbury, Courtenay; Nærland, Terje; Næss, Kari-Anne B
2016-01-01
We present a meta-analysis of studies that compare figurative language comprehension in individuals with autism spectrum disorder and in typically developing controls who were matched based on chronological age or/and language ability. A total of 41 studies and 45 independent effect sizes were included based on predetermined inclusion criteria. Group matching strategy, age, types of figurative language, and cross-linguistic differences were examined as predictors that might explain heterogeneity in effect sizes. Overall, individuals with autism spectrum disorder showed poorer comprehension of figurative language than their typically developing peers (Hedges’ g = –0.57). A meta-regression analysis showed that group matching strategy and types of figurative language were significantly related to differences in effect sizes, whereas chronological age and cross-linguistic differences were not. Differences between the autism spectrum disorder and typically developing groups were small and nonsignificant when the groups were matched based on the language ability. Metaphors were more difficult to comprehend for individuals with autism spectrum disorder compared with typically developing controls than were irony and sarcasm. Our findings highlight the critical role of core language skills in figurative language comprehension. Interventions and educational programmes designed to improve social communication skills in individuals with autism spectrum disorder may beneficially target core language skills in addition to social skills. PMID:27899711
Compact Graphical Representation of Phylogenetic Data and Metadata with GraPh1An
2016-09-12
pipelines . This allows for a higher degree of analysis reproducibility, but the software must correspondingly be available for local installation and callable...these operations are available in the GraPhlAn software repository). Reproducible integration with existing analysis tools and pipelines Graphical...from different analysis pipelines , generating the necessary input files for GraPhlAn. Export2graphlan directly supports MetaPhlAn2, LEfSe, and HUMAnN
Wolle, Meraf A; DeMill, David L; Johnson, Lauren; Lentz, Stephen I; Woodward, Maria A; Mian, Shahzad I
2017-11-01
Availability of preloaded Descemet membrane endothelial keratoplasty (pDMEK) tissue may increase acceptance of DMEK in surgical management of endothelial disease. The goal of this study was to determine the safety of pDMEK grafts for 24 hours before surgery by analyzing endothelial cell loss (ECL) using 2 image analysis software programs. A total of 18 cadaveric corneas were prepared for DMEK using a standardized technique and loaded in a modified Jones tube injector. Nine of the corneas were injected into Calcein AM vital dye after 1 minute (controls), and the remaining 9 corneas were left preloaded for 24 hours before injection into vital dye for staining. The stained corneas were imaged using an inverted confocal microscope. ECL was then analyzed and quantified by 2 different graders using 2 image analysis software programs. The control DMEK tissue resulted in 22.0% ± 4.0% ECL compared with pDMEK tissue, which resulted in 19.2% ± 7.2% ECL (P = 0.31). Interobserver agreement was 0.93 for MetaMorph and 0.92 for Fiji. The average time required to process images with MetaMorph was 2 ± 1 minutes and with Fiji was 20 ± 10 minutes. Intraobserver agreement was 0.97 for MetaMorph and 0.93 for Fiji. Preloading DMEK tissue is safe and may provide an alternative technique for tissue distribution and surgery for DMEK. The use of MetaMorph software for quantifying ECL is a novel and accurate imaging method with increased efficiency and reproducibility compared with the previously validated Fiji.
Tsivgoulis, Georgios; Zand, Ramin; Katsanos, Aristeidis H; Goyal, Nitin; Uchino, Ken; Chang, Jason; Dardiotis, Efthimios; Putaala, Jukka; Alexandrov, Anne W; Malkoff, Marc D; Alexandrov, Andrei V
2015-05-01
Shortening door-to-needle time may lead to inadvertent intravenous thrombolysis (IVT) administration in stroke mimics (SMs). We sought to determine the safety of IVT in SMs using prospective, single-center data and by conducting a comprehensive meta-analysis of reported case-series. We prospectively analyzed consecutive IVT-treated patients during a 5-year period at a tertiary care stroke center. A systematic review and meta-analysis of case-series reporting safety of IVT in SMs and confirmed acute ischemic stroke were conducted. Symptomatic intracerebral hemorrhage was defined as imaging evidence of ICH with an National Institutes of Health Stroke scale increase of ≥4 points. Favorable functional outcome at hospital discharge was defined as a modified Rankin Scale score of 0 to 1. Of 516 consecutive IVT patients at our tertiary care center (50% men; mean age, 60±14 years; median National Institutes of Health Stroke scale, 11; range, 3-22), SMs comprised 75 cases. Symptomatic intracerebral hemorrhage occurred in 1 patient, whereas we documented no cases of orolingual edema or major extracranial hemorrhagic complications. In meta-analysis of 9 studies (8942 IVT-treated patients), the pooled rates of symptomatic intracerebral hemorrhage and orolingual edema among 392 patients with SM treated with IVT were 0.5% (95% confidence interval, 0%-2%) and 0.3% (95% confidence interval, 0%-2%), respectively. Patients with SM were found to have a significantly lower risk for symptomatic intracerebral hemorrhage compared with patients with acute ischemic stroke (risk ratio=0.33; 95% confidence interval, 0.14-0.77; P=0.010), with no evidence of heterogeneity or publication bias. Favorable functional outcome was almost 3-fold higher in patients with SM in comparison with patients with acute ischemic stroke (risk ratio=2.78; 95% confidence interval, 2.07-3.73; P<0.00001). Our prospective, single-center experience coupled with the findings of the comprehensive meta-analysis underscores the safety of IVT in SM. © 2015 American Heart Association, Inc.
Calati, Raffaella; Courtet, Philippe
2016-08-01
To determine the efficacy of psychotherapy interventions for reducing suicidal attempts (SA) and non-suicidal self-injury (NSSI). Meta-analysis of randomized controlled trials (RCTs) comparing psychotherapy interventions and treatment as usual (TAU; including also enhanced usual care, psychotropic treatment alone, cognitive remediation, short-term problem-oriented approach, supportive relationship treatment, community treatment by non-behavioral psychotherapy experts, emergency care enhanced by provider education, no treatment) for SA/NSSI. RCTs were extracted from MEDLINE, EMBASE, PsycINFO and Cochrane Library and analyzed using the Cochrane Collaboration Review Manager Software and Comprehensive Meta-analysis. In the 32 included RCTs, 4114 patients were randomly assigned to receive psychotherapy (n = 2106) or TAU (n = 2008). Patients who received psychotherapy were less likely to attempt suicide during the follow-up. The pooled risk difference for SA was -0.08 (95% confidence intervals = -0.04 to -0.11). The absolute risk reduction was 6.59% (psychotherapy: 9.12%; TAU: 15.71%), yielding an estimated number needed to treat of 15. Sensitivity analyses showed that psychotherapy was effective for SA mainly in adults, outpatients, patients with borderline personality disorder, previously and non-previously suicidal patients (heterogeneous variable that included past history of SA, NSSI, deliberate self-harm, imminent suicidal risk or suicidal ideation), long- and short-term therapies, TAU only as a control condition, and mentalization-based treatment (MBT). No evidence of efficacy was found for NSSI, with the exception of MBT. Between-study heterogeneity and publication bias were detected. In the presence of publication bias, the Duval and Tweedie's "trim and fill" method was applied. Psychotherapy seems to be effective for SA treatment. However, trials with lower risk of bias, more homogeneous outcome measures and longer follow-up are needed. Copyright © 2016 Elsevier Ltd. All rights reserved.
Yavuz, H Melis; van Ijzendoorn, Marinus H; Mesman, Judi; van der Veek, Shelley
2015-06-01
Obesity is a growing problem even in very young childhood, resulting in high costs for individuals and society. As a response, numerous obesity prevention and intervention programs have been developed. Previous research has shown that early intervention programs are more effective when parents are involved, but the effectiveness of specific aspects of programs with parental involvement has not been investigated. This meta-analysis aims to investigate the features related to the effectiveness of different types of obesity intervention programs involving parents and targeting young children (0-6-year-olds). The Web of Science, PubMed, PsycInfo, CINAHL, and ERIC databases were searched for childhood obesity prevention and intervention programs involving parents. Data were analyzed using the Comprehensive Meta-analysis (CMA) software. Fifty studies with effect sizes measured at short-term follow-up (within 3 months from the end of the intervention) and 26 studies with effect sizes measured at long-term follow-up (all reported in a total of 49 publications) were identified. The combined effect size of interventions was small but significant at short-term follow-up (d = .08, p < .01). The results suggested the presence of a potential publication bias in studies providing results at long-term follow-up, with a nonsignificant adjusted effect size (d = .02), which indicated that obesity interventions were not effective at long-term follow-up. Multivariate meta-regression analyses showed that interventions were more effective when including either interactive sessions or educational materials as opposed to those including both interactive sessions and noninteractive educational materials. No other moderators regarding sample characteristics, study design, or methodological quality were significant. Interventions targeting young children that require parental involvement are effective at short-term follow-up, specifically when interventions include one mode of intervention rather than two. However, results were not retained in the long run. © 2014 Association for Child and Adolescent Mental Health.
Acellular dermal matrix for mucogingival surgery: a meta-analysis.
Gapski, Ricardo; Parks, Christopher Allen; Wang, Hom-Lay
2005-11-01
Many clinical studies revealed the effectiveness of acellular dermal matrix (ADM) in the treatment of mucogingival defects. The purpose of this meta-analysis was to compare the efficacy of ADM-based root coverage (RC) and ADM-based increase in keratinized tissues to other commonly used mucogingival surgeries. Meta-analysis was limited to randomized clinical trials (RCT). Articles from January 1, 1990 to October 2004 related to ADM were searched utilizing the MEDLINE database from the National Library of Medicine, the Cochrane Oral Health Group Specialized Trials Registry, and through hand searches of reviews and recent journals. Relevant studies were identified, ranked independently, and mean data from each were weighted accordingly. Selected outcomes were analyzed using a meta-analysis software program. The significant estimates of the treatment effects from different trials were assessed by means of Cochrane's test of heterogeneity. 1) Few RCT studies were found to compile the data. In summary, selection identified eight RCT that met the inclusion criteria. There were four studies comparing ADM versus a connective tissue graft for root coverage procedures, two studies comparing ADM versus coronally advanced flap (CAF) for root coverage procedures, and two studies comparing ADM to free gingival graft in augmentation of keratinized tissue. 2) There were no statistically significant differences between groups for any of the outcomes measured (recession coverage, keratinized tissue formation, probing depths, and clinical attachment levels). 3) The majority of the analyses demonstrated moderate to high levels of heterogeneity. 4) Considering the heterogeneity values found among the studies, certain trends could be found: a) three out of four studies favored the ADM-RC group for recession coverage; b) a connective tissue graft tended to increase keratinized tissue compared to ADM (0.52-mm difference; P = 0.11); c) there were trends of increased clinical attachment gains comparing ADM to CAF procedures (0.56-mm difference; P = 0.16). Differences in study design and lack of data precluded an adequate and complete pooling of data for a more comprehensive analysis. Therefore, considering the trends presented in this study, there is a need for further randomized clinical studies of ADM procedures in comparison to common mucogingival surgical procedures to confirm our findings. It is difficult to draw anything other than tentative conclusions from this meta-analysis of ADM for mucogingival surgery, primarily because of the weakness in the design and reporting of existing trials.
Distributed and Collaborative Software Analysis
NASA Astrophysics Data System (ADS)
Ghezzi, Giacomo; Gall, Harald C.
Throughout the years software engineers have come up with a myriad of specialized tools and techniques that focus on a certain type of
MetaPathways v2.5: quantitative functional, taxonomic and usability improvements.
Konwar, Kishori M; Hanson, Niels W; Bhatia, Maya P; Kim, Dongjae; Wu, Shang-Ju; Hahn, Aria S; Morgan-Lang, Connor; Cheung, Hiu Kan; Hallam, Steven J
2015-10-15
Next-generation sequencing is producing vast amounts of sequence information from natural and engineered ecosystems. Although this data deluge has an enormous potential to transform our lives, knowledge creation and translation need software applications that scale with increasing data processing and analysis requirements. Here, we present improvements to MetaPathways, an annotation and analysis pipeline for environmental sequence information that expedites this transformation. We specifically address pathway prediction hazards through integration of a weighted taxonomic distance and enable quantitative comparison of assembled annotations through a normalized read-mapping measure. Additionally, we improve LAST homology searches through BLAST-equivalent E-values and output formats that are natively compatible with prevailing software applications. Finally, an updated graphical user interface allows for keyword annotation query and projection onto user-defined functional gene hierarchies, including the Carbohydrate-Active Enzyme database. MetaPathways v2.5 is available on GitHub: http://github.com/hallamlab/metapathways2. shallam@mail.ubc.ca Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press.
Niv, Yaron
2016-11-01
The mucus layer of the colon is the main barrier between luminal microbes and the mucosa, and plays a significant role in the body defense mechanisms. Several studies have examined mucin gene (MUC) expression in ulcerative colitis (UC) without conclusive results. The aim of the study was to establish the knowledge of mucin expression in UC as a basis for further investigation. English medical literature searches were performed for mucin expression in the colonic mucosa of UC patients in comparison with controls. Case-control studies were included. A meta-analysis was carried out using 'Comprehensive meta-analysis' software. Pooled odds ratios (ORs) and 95% confidence intervals were calculated. Altogether, we found 311 eligible studies. Only 10 case-control studies from five countries fulfilled the inclusion criteria. A moderate heterogeneity was found in the studies included: Q=52.703, d.f. (Q)=15.000, I=71.539%. OR for mucin expression in UC patients versus healthy controls was 1.868 with a 95% confidence interval (CI) 1.263-2.764, P=0.002. Thus, we could find a significant increase of 87% of mucin expression in UC patients. OR for MUC2 was 2.520, 95% CI 1.320-4.809, P<0.001. MUC3 was also increased with OR 2.599, 95% CI 1.389-4.861, P=0.003. Funnel plot did not indicate a significant publication bias. We found a global increase in mucin expression in UC patients, specifically in MUC2 and MUC3. Further studies are needed, especially in patients treated with biologics for mucosal healing, to understand the role of mucin expression in the natural history of UC.
Wu, Xiangsong; Yang, Yong; Dong, Ping; Gu, Jun; Lu, Jianhua; Li, Maolan; Mu, Jiasheng; Wu, Wenguang; Yang, Jiahua; Zhang, Lin; Ding, Qichen; Liu, Yingbin
2012-08-01
To compare the safety and effectiveness of primary closure with those of T-tube drainage in laparoscopic common bile duct exploration (LCBDE) for choledocholithiasis. A comprehensive search was performed in the PubMed, EmBase, and Cochrane Library databases. Only randomized controlled trials comparing primary closure with T-tube drainage in LCBDE were considered eligible for this meta-analysis. The analyzed outcome variables included postoperative mortality, overall morbidity, biliary complication rate, biliary leak rate, reoperation, operating time, postoperative hospital stay, time to abdominal drain removal, and retained stone. All calculations and statistical tests were performed using ReviewerManager 5.1.2 software. A total of 295 patients (148 patients with primary closure and 147 patients with T-tube drainage) from three trials were identified and analyzed. No deaths occurred in any of the trials. Primary closure showed significantly better results in terms of morbidity (risk ratio (RR), 0.51; 95% confidence interval (CI), 0.30 to 0.88), biliary complication without a combination of retained stone (RR, 0.44; 95% CI, 0.20 to 0.97), reoperation (RR, 0.16; 95% CI, 0.03 to 0.87), operating time (mean difference (MD), -20.72; 95% CI, -29.59 to -11.85), postoperative hospital stay (MD, -3.24; 95% CI, -3.96 to -2.52), and time to abdominal drainage removal (MD, -0.45; 95% CI, -0.86 to -0.04). Statistically significant differences were not found between the two methods in terms of biliary leak, biliary complication, and retained stones. The current meta-analysis indicates that primary closure of the common bile duct is safer and more effective than T-tube drainage for LCBDE. Therefore, we do not recommend routine performance of T-tube drainage in LCBDE.
Reconstruction of metabolic pathways for the cattle genome
Seo, Seongwon; Lewin, Harris A
2009-01-01
Background Metabolic reconstruction of microbial, plant and animal genomes is a necessary step toward understanding the evolutionary origins of metabolism and species-specific adaptive traits. The aims of this study were to reconstruct conserved metabolic pathways in the cattle genome and to identify metabolic pathways with missing genes and proteins. The MetaCyc database and PathwayTools software suite were chosen for this work because they are widely used and easy to implement. Results An amalgamated cattle genome database was created using the NCBI and Ensembl cattle genome databases (based on build 3.1) as data sources. PathwayTools was used to create a cattle-specific pathway genome database, which was followed by comprehensive manual curation for the reconstruction of metabolic pathways. The curated database, CattleCyc 1.0, consists of 217 metabolic pathways. A total of 64 mammalian-specific metabolic pathways were modified from the reference pathways in MetaCyc, and two pathways previously identified but missing from MetaCyc were added. Comparative analysis of metabolic pathways revealed the absence of mammalian genes for 22 metabolic enzymes whose activity was reported in the literature. We also identified six human metabolic protein-coding genes for which the cattle ortholog is missing from the sequence assembly. Conclusion CattleCyc is a powerful tool for understanding the biology of ruminants and other cetartiodactyl species. In addition, the approach used to develop CattleCyc provides a framework for the metabolic reconstruction of other newly sequenced mammalian genomes. It is clear that metabolic pathway analysis strongly reflects the quality of the underlying genome annotations. Thus, having well-annotated genomes from many mammalian species hosted in BioCyc will facilitate the comparative analysis of metabolic pathways among different species and a systems approach to comparative physiology. PMID:19284618
Ketorolac does not increase perioperative bleeding: a meta-analysis of randomized controlled trials.
Gobble, Ryan M; Hoang, Han L T; Kachniarz, Bart; Orgill, Dennis P
2014-03-01
Postoperative pain control is essential for optimal patient outcomes. Ketorolac is an attractive alternative for achieving pain control postoperatively, but concerns over postoperative bleeding have limited its use. Computer searches of the MEDLINE, EMBASE, and Cochrane Library databases were performed. Twenty-seven double-blind, randomized, controlled studies were reviewed by two independent investigators for the incidence of adverse events, including postoperative bleeding. Comprehensive meta-analysis software was used to evaluate the differences between ketorolac and control groups. Twenty-seven studies with 2314 patients were analyzed. Postoperative bleeding occurred in 33 of 1304 patients (2.5 percent) in the ketorolac group compared with 21 of 1010 (2.1 percent) in the control group (OR, 1.1; 95 percent CI, 0.61 to 2.06; p = 0.72). Adverse events were similar in the groups, 31.7 percent in the control group and 27.9 percent in the ketorolac group (OR, 0.64; 95 percent CI, 0.41 to 1.01; p = 0.06). There was a lower incidence of adverse effects with low-dose ketorolac (OR, 0.49; 95 percent CI, 0.27 to 0.91; p = 0.02). Pain control with ketorolac was superior to controls and equivalent to opioids. This is the first meta-analysis of randomized controlled trials examining whether there is increased postoperative bleeding with ketorolac. Postoperative bleeding was not significantly increased with ketorolac compared with controls, and adverse effects were not statistically different between the groups. Pain control was found to be superior with ketorolac compared with controls. Ketorolac should be considered for postoperative pain control, especially to limit the use of opioid pain medications. Therapeutic, II.
MetaUniDec: High-Throughput Deconvolution of Native Mass Spectra
NASA Astrophysics Data System (ADS)
Reid, Deseree J.; Diesing, Jessica M.; Miller, Matthew A.; Perry, Scott M.; Wales, Jessica A.; Montfort, William R.; Marty, Michael T.
2018-04-01
The expansion of native mass spectrometry (MS) methods for both academic and industrial applications has created a substantial need for analysis of large native MS datasets. Existing software tools are poorly suited for high-throughput deconvolution of native electrospray mass spectra from intact proteins and protein complexes. The UniDec Bayesian deconvolution algorithm is uniquely well suited for high-throughput analysis due to its speed and robustness but was previously tailored towards individual spectra. Here, we optimized UniDec for deconvolution, analysis, and visualization of large data sets. This new module, MetaUniDec, centers around a hierarchical data format 5 (HDF5) format for storing datasets that significantly improves speed, portability, and file size. It also includes code optimizations to improve speed and a new graphical user interface for visualization, interaction, and analysis of data. To demonstrate the utility of MetaUniDec, we applied the software to analyze automated collision voltage ramps with a small bacterial heme protein and large lipoprotein nanodiscs. Upon increasing collisional activation, bacterial heme-nitric oxide/oxygen binding (H-NOX) protein shows a discrete loss of bound heme, and nanodiscs show a continuous loss of lipids and charge. By using MetaUniDec to track changes in peak area or mass as a function of collision voltage, we explore the energetic profile of collisional activation in an ultra-high mass range Orbitrap mass spectrometer. [Figure not available: see fulltext.
ERIC Educational Resources Information Center
Carretti, Barbara; Borella, Erika; Cornoldi, Cesare; De Beni, Rossana
2009-01-01
It is well established that working memory is related to reading comprehension ability. However, its role in explaining specific reading comprehension difficulties is still under debate: the issue mainly concerns whether the contribution of working memory is dependent on task modality (verbal tasks being more predictive than visuo-spatial tasks)…
ERIC Educational Resources Information Center
Bernard, Robert M.; Abrami, Philip C.; Wade, Anne; Borokhovski, Evgueni; Lou, Yiping
2004-01-01
Simonson, Schlosser and Hanson (1999) argue that a new theory called "equivalency theory" is needed to account for the unique features of the "teleconferencing" (synchronous) model of DE that is prevalent in many North American universities. Based on a comprehensive meta-analysis of the comparative literature of DE (Bernard,…
Gencrypt: one-way cryptographic hashes to detect overlapping individuals across samples
Turchin, Michael C.; Hirschhorn, Joel N.
2012-01-01
Summary: Meta-analysis across genome-wide association studies is a common approach for discovering genetic associations. However, in some meta-analysis efforts, individual-level data cannot be broadly shared by study investigators due to privacy and Institutional Review Board concerns. In such cases, researchers cannot confirm that each study represents a unique group of people, leading to potentially inflated test statistics and false positives. To resolve this problem, we created a software tool, Gencrypt, which utilizes a security protocol known as one-way cryptographic hashes to allow overlapping participants to be identified without sharing individual-level data. Availability: Gencrypt is freely available under the GNU general public license v3 at http://www.broadinstitute.org/software/gencrypt/ Contact: joelh@broadinstitute.org Supplementary information: Supplementary data are available at Bioinformatics online. PMID:22302573
Melby-Lervåg, Monica; Lervåg, Arne
2014-03-01
We report a systematic meta-analytic review of studies comparing reading comprehension and its underlying components (language comprehension, decoding, and phonological awareness) in first- and second-language learners. The review included 82 studies, and 576 effect sizes were calculated for reading comprehension and underlying components. Key findings were that, compared to first-language learners, second-language learners display a medium-sized deficit in reading comprehension (pooled effect size d = -0.62), a large deficit in language comprehension (pooled effect size d = -1.12), but only small differences in phonological awareness (pooled effect size d = -0.08) and decoding (pooled effect size d = -0.12). A moderator analysis showed that characteristics related to the type of reading comprehension test reliably explained the variation in the differences in reading comprehension between first- and second-language learners. For language comprehension, studies of samples from low socioeconomic backgrounds and samples where only the first language was used at home generated the largest group differences in favor of first-language learners. Test characteristics and study origin reliably contributed to the variations between the studies of language comprehension. For decoding, Canadian studies showed group differences in favor of second-language learners, whereas the opposite was the case for U.S. studies. Regarding implications, unless specific decoding problems are detected, interventions that aim to ameliorate reading comprehension problems among second-language learners should focus on language comprehension skills.
ERIC Educational Resources Information Center
Currier, Joseph M.; Neimeyer, Robert A.; Berman, Jeffrey S.
2008-01-01
Previous quantitative reviews of research on psychotherapeutic interventions for bereaved persons have yielded divergent findings and have not included many of the available controlled outcome studies. This meta-analysis summarizes results from 61 controlled studies to offer a more comprehensive integration of this literature. This review examined…
Berretta, Massimiliano; Micek, Agnieszka; Lafranconi, Alessandra; Rossetti, Sabrina; Di Francia, Raffaele; De Paoli, Paolo; Rossi, Paola; Facchini, Gaetano
2018-04-17
Coffee consumption has been associated with numerous cancers, but evidence on ovarian cancer risk is controversial. Therefore, we performed a meta-analysis on prospective cohort studies in order to review the evidence on coffee consumption and risk of ovarian cancer. Studies were identified through searching the PubMed and MEDLINE databases up to March 2017. Risk estimates were retrieved from the studies, and dose-response analysis was modelled by using restricted cubic splines. Additionally, a stratified analysis by menopausal status was performed. A total of 8 studies were eligible for the dose-response meta-analysis. Studies included in the analysis comprised 787,076 participants and 3,541 ovarian cancer cases. The results showed that coffee intake was not associated with ovarian cancer risk (RR = 1.06, 95% CI: 0.89, 1.26). Stratified and subgroup analysis showed consisted results. This comprehensive meta-analysis did not find evidence of an association between the consumption of coffee and risk of ovarian cancer.
Meta-Analyses of the Effects of Tier 2 Type Reading Interventions in Grades K-3.
Wanzek, Jeanne; Vaughn, Sharon; Scammacca, Nancy; Gatlin, Brandy; Walker, Melodee A; Capin, Philip
2016-09-01
This meta-analysis extends previous work on extensive Tier 3 type reading interventions (Wanzek & Vaughn, 2007; Wanzek et al., 2013) to Tier 2 type interventions by examining a non-overlapping set of studies addressing the effects of less extensive reading interventions for students with or at risk for reading difficulties in Grades K-3. We examined the overall effects of these interventions on students' foundational skills, language, and comprehension as well as the intervention features that may be associated with improved outcomes. We conducted four meta-analyses on 72 studies to examine effects on (1) standardized foundational skill measures (mean ES = 0.54), (2) not-standardized foundational skill measures (mean ES = 0.62), (3) standardized language/comprehension measures (mean ES = 0.36), and (4) not-standardized language/comprehension measures (mean ES = 1.02). There were no differences in effects related to intervention type, instructional group size, grade level, intervention implementer, or the number of intervention hours.
ERIC Educational Resources Information Center
Harrington, Robert; Jenkins, Peter; Marzke, Carolyn; Cohen, Carol
Prominent among the new models of social service delivery are organizations providing comprehensive, community-based supports and services (CCBSS) to children and their families. A needs analysis explored CCBSS sites' interest in and readiness to use a software tool designed to help them make more effective internal resource allocation decisions…
Dong, Liang; Xu, Zhengwei; Chen, Xiujin; Wang, Dongqi; Li, Dichen; Liu, Tuanjing; Hao, Dingjun
2017-10-01
Many meta-analyses have been performed to study the efficacy of cervical disc arthroplasty (CDA) compared with anterior cervical discectomy and fusion (ACDF); however, there are few data referring to adjacent segment within these meta-analyses, or investigators are unable to arrive at the same conclusion in the few meta-analyses about adjacent segment. With the increased concerns surrounding adjacent segment degeneration (ASDeg) and adjacent segment disease (ASDis) after anterior cervical surgery, it is necessary to perform a comprehensive meta-analysis to analyze adjacent segment parameters. To perform a comprehensive meta-analysis to elaborate adjacent segment motion, degeneration, disease, and reoperation of CDA compared with ACDF. Meta-analysis of randomized controlled trials (RCTs). PubMed, Embase, and Cochrane Library were searched for RCTs comparing CDA and ACDF before May 2016. The analysis parameters included follow-up time, operative segments, adjacent segment motion, ASDeg, ASDis, and adjacent segment reoperation. The risk of bias scale was used to assess the papers. Subgroup analysis and sensitivity analysis were used to analyze the reason for high heterogeneity. Twenty-nine RCTs fulfilled the inclusion criteria. Compared with ACDF, the rate of adjacent segment reoperation in the CDA group was significantly lower (p<.01), and the advantage of that group in reducing adjacent segment reoperation increases with increasing follow-up time by subgroup analysis. There was no statistically significant difference in ASDeg between CDA and ACDF within the 24-month follow-up period; however, the rate of ASDeg in CDA was significantly lower than that of ACDF with the increase in follow-up time (p<.01). There was no statistically significant difference in ASDis between CDA and ACDF (p>.05). Cervical disc arthroplasty provided a lower adjacent segment range of motion (ROM) than did ACDF, but the difference was not statistically significant. Compared with ACDF, the advantages of CDA were lower ASDeg and adjacent segment reoperation. However, there was no statistically significant difference in ASDis and adjacent segment ROM. Copyright © 2017 Elsevier Inc. All rights reserved.
2011-01-01
Background Clinical researchers have often preferred to use a fixed effects model for the primary interpretation of a meta-analysis. Heterogeneity is usually assessed via the well known Q and I2 statistics, along with the random effects estimate they imply. In recent years, alternative methods for quantifying heterogeneity have been proposed, that are based on a 'generalised' Q statistic. Methods We review 18 IPD meta-analyses of RCTs into treatments for cancer, in order to quantify the amount of heterogeneity present and also to discuss practical methods for explaining heterogeneity. Results Differing results were obtained when the standard Q and I2 statistics were used to test for the presence of heterogeneity. The two meta-analyses with the largest amount of heterogeneity were investigated further, and on inspection the straightforward application of a random effects model was not deemed appropriate. Compared to the standard Q statistic, the generalised Q statistic provided a more accurate platform for estimating the amount of heterogeneity in the 18 meta-analyses. Conclusions Explaining heterogeneity via the pre-specification of trial subgroups, graphical diagnostic tools and sensitivity analyses produced a more desirable outcome than an automatic application of the random effects model. Generalised Q statistic methods for quantifying and adjusting for heterogeneity should be incorporated as standard into statistical software. Software is provided to help achieve this aim. PMID:21473747
Meta-analysis of magnitudes, differences and variation in evolutionary parameters.
Morrissey, M B
2016-10-01
Meta-analysis is increasingly used to synthesize major patterns in the large literatures within ecology and evolution. Meta-analytic methods that do not account for the process of observing data, which we may refer to as 'informal meta-analyses', may have undesirable properties. In some cases, informal meta-analyses may produce results that are unbiased, but do not necessarily make the best possible use of available data. In other cases, unbiased statistical noise in individual reports in the literature can potentially be converted into severe systematic biases in informal meta-analyses. I first present a general description of how failure to account for noise in individual inferences should be expected to lead to biases in some kinds of meta-analysis. In particular, informal meta-analyses of quantities that reflect the dispersion of parameters in nature, for example, the mean absolute value of a quantity, are likely to be generally highly misleading. I then re-analyse three previously published informal meta-analyses, where key inferences were of aspects of the dispersion of values in nature, for example, the mean absolute value of selection gradients. Major biological conclusions in each original informal meta-analysis closely match those that could arise as artefacts due to statistical noise. I present alternative mixed-model-based analyses that are specifically tailored to each situation, but where all analyses may be implemented with widely available open-source software. In each example meta-re-analysis, major conclusions change substantially. © 2016 European Society For Evolutionary Biology. Journal of Evolutionary Biology © 2016 European Society For Evolutionary Biology.
A systematic review and meta-analysis of music therapy for the older adults with depression.
Zhao, K; Bai, Z G; Bo, A; Chi, I
2016-11-01
To determine the efficacy of music therapy in the management of depression in the elderly. We conducted a systematic review and meta-analysis of randomized controlled trials. Change in depressive symptoms was measured with various scales. Standardized mean differences were calculated for each therapy-control contrast. A comprehensive search yielded 2,692 citations; 19 articles met inclusion criteria. Meta-analysis suggests that music therapy plus standard treatment has statistical significance in reducing depressive symptoms among older adults (standardized mean differences = 1.02; 95% CI = 0.87, 1.17). This systematic review and meta-analysis suggests that music therapy has an effect on reducing depressive symptoms to some extent. However, high-quality trials evaluating the effects of music therapy on depression are required. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.
An interactive environment for agile analysis and visualization of ChIP-sequencing data.
Lerdrup, Mads; Johansen, Jens Vilstrup; Agrawal-Singh, Shuchi; Hansen, Klaus
2016-04-01
To empower experimentalists with a means for fast and comprehensive chromatin immunoprecipitation sequencing (ChIP-seq) data analyses, we introduce an integrated computational environment, EaSeq. The software combines the exploratory power of genome browsers with an extensive set of interactive and user-friendly tools for genome-wide abstraction and visualization. It enables experimentalists to easily extract information and generate hypotheses from their own data and public genome-wide datasets. For demonstration purposes, we performed meta-analyses of public Polycomb ChIP-seq data and established a new screening approach to analyze more than 900 datasets from mouse embryonic stem cells for factors potentially associated with Polycomb recruitment. EaSeq, which is freely available and works on a standard personal computer, can substantially increase the throughput of many analysis workflows, facilitate transparency and reproducibility by automatically documenting and organizing analyses, and enable a broader group of scientists to gain insights from ChIP-seq data.
The effects of probiotics on total cholesterol: A meta-analysis of randomized controlled trials.
Wang, Lang; Guo, Mao-Juan; Gao, Qing; Yang, Jin-Feng; Yang, Lin; Pang, Xiao-Li; Jiang, Xi-Juan
2018-02-01
Probiotics supplements provide a new nonpharmacological alternative to reduce cardiovascular risk factors. The impact of probiotics on the reduction of total cholesterol (TC) remains controversial. We conducted a meta-analysis to showcase the most updated and comprehensive evaluation of the studies. Randomized controlled trials (RCTs) were searched from electronic databases, including PubMed, Embase, Cochrane Central Register of Controlled Trials, Chinese Biomedical Literature Database, China National Knowledge Infrastructure, Wanfang database dating from January 2007 to January 2017. The curative effects of probiotics on the reduction of TC were assessed using mean difference (MD), as well as their 95% confidence interval (CI). RevMan software (version 5.3) was used to carry out this meta-analysis. Thirty-two RCTs including 1971 patients met the inclusion criteria. Results of this analysis showed that compared with the control group serum TC was significantly reduced in probiotics group [MD = -13.27, 95% CI (-16.74 to 9.80), P < .05]. In addition, specific strains also significantly reduced serum TC, L acidophilus and B lactis [MD = -8.30, 95% CI (-10.44, -6.15), P < .05]; VSL#3 [MD = -11.04, 95% CI (-19.61, -2.48), P < .05]; L plantarum t ≤ 6 weeks: [MD = -1.56, 95% CI (-6.97, -3.86), P < .05] or t > 6 weeks: [MD = -22.18, 95% CI (-28.73, -15.63), P < .05]. Subgroup analysis indicated that the difference of baseline TC, probiotics forms and intervention duration might have a significant impact on the results. However, strains and doses of probiotics had no significant influence on curative effects. Available evidence indicates that probiotics supplements can significantly reduce serum TC. Furthermore, higher baseline TC, longer intervention time, and probiotics in capsules form might contribute to a better curative effect.
Managing complex research datasets using electronic tools: A meta-analysis exemplar
Brown, Sharon A.; Martin, Ellen E.; Garcia, Theresa J.; Winter, Mary A.; García, Alexandra A.; Brown, Adama; Cuevas, Heather E.; Sumlin, Lisa L.
2013-01-01
Meta-analyses of broad scope and complexity require investigators to organize many study documents and manage communication among several research staff. Commercially available electronic tools, e.g., EndNote, Adobe Acrobat Pro, Blackboard, Excel, and IBM SPSS Statistics (SPSS), are useful for organizing and tracking the meta-analytic process, as well as enhancing communication among research team members. The purpose of this paper is to describe the electronic processes we designed, using commercially available software, for an extensive quantitative model-testing meta-analysis we are conducting. Specific electronic tools improved the efficiency of (a) locating and screening studies, (b) screening and organizing studies and other project documents, (c) extracting data from primary studies, (d) checking data accuracy and analyses, and (e) communication among team members. The major limitation in designing and implementing a fully electronic system for meta-analysis was the requisite upfront time to: decide on which electronic tools to use, determine how these tools would be employed, develop clear guidelines for their use, and train members of the research team. The electronic process described here has been useful in streamlining the process of conducting this complex meta-analysis and enhancing communication and sharing documents among research team members. PMID:23681256
Managing complex research datasets using electronic tools: a meta-analysis exemplar.
Brown, Sharon A; Martin, Ellen E; Garcia, Theresa J; Winter, Mary A; García, Alexandra A; Brown, Adama; Cuevas, Heather E; Sumlin, Lisa L
2013-06-01
Meta-analyses of broad scope and complexity require investigators to organize many study documents and manage communication among several research staff. Commercially available electronic tools, for example, EndNote, Adobe Acrobat Pro, Blackboard, Excel, and IBM SPSS Statistics (SPSS), are useful for organizing and tracking the meta-analytic process as well as enhancing communication among research team members. The purpose of this article is to describe the electronic processes designed, using commercially available software, for an extensive, quantitative model-testing meta-analysis. Specific electronic tools improved the efficiency of (a) locating and screening studies, (b) screening and organizing studies and other project documents, (c) extracting data from primary studies, (d) checking data accuracy and analyses, and (e) communication among team members. The major limitation in designing and implementing a fully electronic system for meta-analysis was the requisite upfront time to decide on which electronic tools to use, determine how these tools would be used, develop clear guidelines for their use, and train members of the research team. The electronic process described here has been useful in streamlining the process of conducting this complex meta-analysis and enhancing communication and sharing documents among research team members.
A meta-analysis of fear appeals: implications for effective public health campaigns.
Witte, K; Allen, M
2000-10-01
The fear appeal literature is examined in a comprehensive synthesis using meta-analytical techniques. The meta-analysis suggests that strong fear appeals produce high levels of perceived severity and susceptibility, and are more persuasive than low or weak fear appeals. The results also indicate that fear appeals motivate adaptive danger control actions such as message acceptance and maladaptive fear control actions such as defensive avoidance or reactance. It appears that strong fear appeals and high-efficacy messages produce the greatest behavior change, whereas strong fear appeals with low-efficacy messages produce the greatest levels of defensive responses. Future directions and practical implications are provided.
Rhodes, Kirsty M; Turner, Rebecca M; White, Ian R; Jackson, Dan; Spiegelhalter, David J; Higgins, Julian P T
2016-12-20
Many meta-analyses combine results from only a small number of studies, a situation in which the between-study variance is imprecisely estimated when standard methods are applied. Bayesian meta-analysis allows incorporation of external evidence on heterogeneity, providing the potential for more robust inference on the effect size of interest. We present a method for performing Bayesian meta-analysis using data augmentation, in which we represent an informative conjugate prior for between-study variance by pseudo data and use meta-regression for estimation. To assist in this, we derive predictive inverse-gamma distributions for the between-study variance expected in future meta-analyses. These may serve as priors for heterogeneity in new meta-analyses. In a simulation study, we compare approximate Bayesian methods using meta-regression and pseudo data against fully Bayesian approaches based on importance sampling techniques and Markov chain Monte Carlo (MCMC). We compare the frequentist properties of these Bayesian methods with those of the commonly used frequentist DerSimonian and Laird procedure. The method is implemented in standard statistical software and provides a less complex alternative to standard MCMC approaches. An importance sampling approach produces almost identical results to standard MCMC approaches, and results obtained through meta-regression and pseudo data are very similar. On average, data augmentation provides closer results to MCMC, if implemented using restricted maximum likelihood estimation rather than DerSimonian and Laird or maximum likelihood estimation. The methods are applied to real datasets, and an extension to network meta-analysis is described. The proposed method facilitates Bayesian meta-analysis in a way that is accessible to applied researchers. © 2016 The Authors. Statistics in Medicine Published by John Wiley & Sons Ltd. © 2016 The Authors. Statistics in Medicine Published by John Wiley & Sons Ltd.
Increasing physical activity with mobile devices: a meta-analysis.
Fanning, Jason; Mullen, Sean P; McAuley, Edward
2012-11-21
Regular physical activity has established physical and mental health benefits; however, merely one quarter of the U.S. adult population meets national physical activity recommendations. In an effort to engage individuals who do not meet these guidelines, researchers have utilized popular emerging technologies, including mobile devices (ie, personal digital assistants [PDAs], mobile phones). This study is the first to synthesize current research focused on the use of mobile devices for increasing physical activity. To conduct a meta-analysis of research utilizing mobile devices to influence physical activity behavior. The aims of this review were to: (1) examine the efficacy of mobile devices in the physical activity setting, (2) explore and discuss implementation of device features across studies, and (3) make recommendations for future intervention development. We searched electronic databases (PubMed, PsychINFO, SCOPUS) and identified publications through reference lists and requests to experts in the field of mobile health. Studies were included that provided original data and aimed to influence physical activity through dissemination or collection of intervention materials with a mobile device. Data were extracted to calculate effect sizes for individual studies, as were study descriptives. A random effects meta-analysis was conducted using the Comprehensive Meta-Analysis software suite. Study quality was assessed using the quality of execution portion of the Guide to Community Preventative Services data extraction form. Four studies were of "good" quality and seven of "fair" quality. In total, 1351 individuals participated in 11 unique studies from which 18 effects were extracted and synthesized, yielding an overall weight mean effect size of g = 0.54 (95% CI = 0.17 to 0.91, P = .01). Research utilizing mobile devices is gaining in popularity, and this study suggests that this platform is an effective means for influencing physical activity behavior. Our focus must be on the best possible use of these tools to measure and understand behavior. Therefore, theoretically grounded behavior change interventions that recognize and act on the potential of smartphone technology could provide investigators with an effective tool for increasing physical activity.
Liu, Weijun; Hu, Ling; Wang, Junwen; Liu, Ming; Wang, Xiaomei
2015-01-01
Purpose Meta-analysis was conducted to evaluate whether zero-profile anchored spacer (Zero-P) could reduce complication rates, while maintaining similar clinical outcomes compared to plate-cage construct (PCC) in the treatment of cervical spondylosis. Methods All prospective and retrospective comparative studies published up to May 2015 that compared the clinical outcomes of Zero-P versus PCC in the treatment of cervical spondylosis were acquired by a comprehensive search in PubMed and EMBASE. Exclusion criteria were non-English studies, noncomparative studies, hybrid surgeries, revision surgeries, and surgeries with less than a 12-month follow-up period. The main end points including Japanese Orthopedic Association (JOA) and Neck Disability Index (NDI) scores, cervical lordosis, fusion rate, subsidence, and dysphagia were analyzed. All studies were analyzed with the RevMan 5.2.0 software. Publication biases of main results were examined using Stata 12.0. Results A total of 12 studies were included in the meta-analysis. No statistical difference was observed with regard to preoperative or postoperative JOA and NDI scores, cervical lordosis, and fusion rate. The Zero-P group had a higher subsidence rate than the PCC group (P<0.05, risk difference =0.13, 95% confidence interval [CI] 0.00–0.26). However, the Zero-P group had a significantly lower postoperative dysphagia rate than the PCC group within the first 2 weeks (P<0.05, odds ratio [OR] =0.64, 95% CI 0.45–0.91), at the 6th month [P<0.05, OR =0.20, 95% CI 0.04–0.90], and at the final follow-up time [P<0.05, OR =0.13, 95% CI 0.04–0.45]. Conclusion Our meta-analysis suggested that surgical treatments of single or multiple levels of cervical spondylosis using Zero-P and PCC were similar in terms of JOA score, NDI score, cervical lordosis, and fusion rate. Although the Zero-P group had a higher subsidence rate than the PCC group, Zero-P had a lower postoperative dysphagia rate and might have a lower adjacent-level ossification rate. PMID:26445543
Liu, Weijun; Hu, Ling; Wang, Junwen; Liu, Ming; Wang, Xiaomei
2015-01-01
Meta-analysis was conducted to evaluate whether zero-profile anchored spacer (Zero-P) could reduce complication rates, while maintaining similar clinical outcomes compared to plate-cage construct (PCC) in the treatment of cervical spondylosis. All prospective and retrospective comparative studies published up to May 2015 that compared the clinical outcomes of Zero-P versus PCC in the treatment of cervical spondylosis were acquired by a comprehensive search in PubMed and EMBASE. Exclusion criteria were non-English studies, noncomparative studies, hybrid surgeries, revision surgeries, and surgeries with less than a 12-month follow-up period. The main end points including Japanese Orthopedic Association (JOA) and Neck Disability Index (NDI) scores, cervical lordosis, fusion rate, subsidence, and dysphagia were analyzed. All studies were analyzed with the RevMan 5.2.0 software. Publication biases of main results were examined using Stata 12.0. A total of 12 studies were included in the meta-analysis. No statistical difference was observed with regard to preoperative or postoperative JOA and NDI scores, cervical lordosis, and fusion rate. The Zero-P group had a higher subsidence rate than the PCC group (P<0.05, risk difference =0.13, 95% confidence interval [CI] 0.00-0.26). However, the Zero-P group had a significantly lower postoperative dysphagia rate than the PCC group within the first 2 weeks (P<0.05, odds ratio [OR] =0.64, 95% CI 0.45-0.91), at the 6th month [P<0.05, OR =0.20, 95% CI 0.04-0.90], and at the final follow-up time [P<0.05, OR =0.13, 95% CI 0.04-0.45]. Our meta-analysis suggested that surgical treatments of single or multiple levels of cervical spondylosis using Zero-P and PCC were similar in terms of JOA score, NDI score, cervical lordosis, and fusion rate. Although the Zero-P group had a higher subsidence rate than the PCC group, Zero-P had a lower postoperative dysphagia rate and might have a lower adjacent-level ossification rate.
Zhang, Xin-chang; Xu, Xiu-ping; Xu, Wen-tao; Hou, Wen-zhen; Cheng, Ying-ying; Li, Chang-xi; Ni, Guang-xia
2015-01-01
Acupuncture has commonly been used in China, either alone or in combination with Western medicine, to treat sudden sensorineural hearing loss (SSHL). The purpose of this systematic review is to assess the efficacy and safety of acupuncture therapy for patients with SSHL. We searched PubMed, the Cochrane Library, Embase, China National Knowledge Internet (CNKI), Database for Chinese Technical Periodicals (VIP), and Chinese Biomedical literature service system (SinoMed) to collect randomized controlled trials of acupuncture for SSHL published before July 2014. A meta-analysis was conducted according to the Cochrane systematic review method using RevMan 5.2 software. The evidence level for each outcome was assessed using the GRADE methodology. Twelve trials involving 863 patients were included. A meta-analysis showed that the effect of manual acupuncture combined with Western medicine comprehensive treatment (WMCT) was better than WMCT alone (RR 1.33, 95%CI 1.19-1.49) and the same as the effect of electroacupuncture combined with WMCT (RR 1.33, 95%CI 1.19-1.50). One study showed a better effect of electroacupuncture than of WMCT (RR 1.34, 95%CI 1.24-1.45). For mean changes in hearing over all frequencies, the meta-analysis showed a better effect with the combination of acupuncture and WMCT than with WMCT alone (MD 10.85, 95%CI 6.84-14.86). However, the evidence levels for these interventions were low or very low due to a high risk of bias and small sample sizes in the included studies. There was not sufficient evidence showing that acupuncture therapy alone was beneficial for treating SSHL. However, interventions combining acupuncture with WMCT had more efficacious results in the treatment of SSHL than WMCT alone. Electroacupuncture alone might be a viable alternative treatment besides WMCT for SSHL. However, given that there were fewer eligible RCTs and limitations in the included trials, such as methodological drawbacks and small sample sizes, large-scale RCTs are required to confirm the current findings regarding acupuncture therapy for SSHL.
Ammari, Michelle Mikhael; Soviero, Vera Mendes; da Silva Fidalgo, Tatiana Kelly; Lenzi, Michele; Ferreira, Daniele Masterson T P; Mattos, Cláudia Trindade; de Souza, Ivete Pomarico Ribeiro; Maia, Lucianne Cople
2014-10-01
The aim of this study was to perform a systematic review and meta-analysis on the effectiveness of sealing non-cavitated proximal caries lesions in primary and permanent teeth. Only controlled clinical trials and randomized controlled clinical trials that evaluated the effectiveness of sealing on non-cavitated proximal caries with a minimum follow-up of 12 months were included in the study. The primary outcome should be arrestment/progression of proximal caries evaluated by bitewing radiographs. A risk of bias evaluation based on the Cochrane Collaboration common scheme for bias was carried out for each study. The meta-analysis was performed on the studies considered low risk of bias and with pair-wise visual reading results through RevMan software. A comprehensive search was performed in the Systematic Electronic Databases: Pubmed, Cochrane Library, Scopus, IBI Web of Science, Lilacs, SIGLE, and on website Clinical trials.gov, through until June 2013. From 967 studies identified, 10 articles and 3 studies with partial results were assessed for eligibility. However three articles were excluded and our final sample included 10 studies. According to the risk of bias evaluation, six studies were considered "high" risk of bias, and four "low" risk of bias. The forest plot of the meta-analysis showed low heterogeneity (I(2)=29%) and a favourable outcome for the Infiltrant. The chance of caries progression when this technique was used was significantly lower (p=0.002) compared with Placebo. Our results suggest that the technique of sealing non-cavitated proximal caries seems to be effective in controlling proximal caries in the short and medium term. Further long-term randomized clinical trials are still necessary to increase this evidence. Contemporary dentistry is focused in minimally invasive approaches that prevent the destruction of sound dental tissues next to carious lesions. This paper searches for evidence of the efficacy of sealing/infiltrating non-cavitated proximal caries in arresting caries progression both in permanent and primary teeth. Copyright © 2014 Elsevier Ltd. All rights reserved.
Raza, Mushahid; Elkhodair, Samer; Zaheer, Asif; Yousaf, Sohail
2013-11-01
A true gold standard to rule out a significant cervical spine injury in subset of blunt trauma patients with altered sensorium is still to be agreed upon. The objective of this study is to determine whether in obtunded adult patients with blunt trauma, a clinically significant injury to the cervical spine be ruled out on the basis of a normal multidetector cervical spine computed tomography. Comprehensive database search was conducted to include all the prospective and retrospective studies on blunt trauma patients with altered sensorium undergoing cervical spine multidetector CT scan as core imaging modality to "clear" the cervical spine. The studies used two main gold standards, magnetic resonance imaging of the cervical spine and/or prolonged clinical follow-up. The data was extracted to report true positive, true negatives, false positives and false negatives. Meta-analysis of sensitivity, specificity, negative and positive predictive values was performed using Meta Analyst Beta 3.13 software. We also performed a retrospective investigation comparing a robust clinical follow-up and/or cervical spine MR findings in 53 obtunded blunt trauma patients, who previously had undergone a normal multidetector CT scan of the cervical spine reported by a radiologist. A total of 10 studies involving 1850 obtunded blunt trauma patients with initial cervical spine CT scan reported as normal were included in the final meta-analysis. The cumulative negative predictive value and specificity of cervical spine CT of the ten studies was 99.7% (99.4-99.9%, 95% confidence interval). The positive predictive value and sensitivity was 93.7% (84.0-97.7%, 95% confidence interval). In the retrospective review of our obtunded blunt trauma patients, none was later diagnosed to have significant cervical spine injury that required a change in clinical management. In a blunt trauma patient with altered sensorium, a normal cervical spine CT scan is conclusive to safely rule out a clinically significant cervical spine injury. The results of this meta-analysis strongly support the removal of cervical precautions in obtunded blunt trauma patient after normal cervical spine computed tomography. Any further imaging like magnetic resonance imaging of the cervical spine should be performed on case-to-case basis. Copyright © 2013 Elsevier Ltd. All rights reserved.
Telemedicine Technologies for Diabetes in Pregnancy: A Systematic Review and Meta-Analysis.
Ming, Wai-Kit; Mackillop, Lucy H; Farmer, Andrew J; Loerup, Lise; Bartlett, Katy; Levy, Jonathan C; Tarassenko, Lionel; Velardo, Carmelo; Kenworthy, Yvonne; Hirst, Jane E
2016-11-09
Diabetes in pregnancy is a global problem. Technological innovations present exciting opportunities for novel approaches to improve clinical care delivery for gestational and other forms of diabetes in pregnancy. To perform an updated and comprehensive systematic review and meta-analysis of the literature to determine whether telemedicine solutions offer any advantages compared with the standard care for women with diabetes in pregnancy. The review was developed using the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) framework. Randomized controlled trials (RCT) in women with diabetes in pregnancy that compared telemedicine blood glucose monitoring with the standard care were identified. Searches were performed in SCOPUS and PubMed, limited to English language publications between January 2000 and January 2016. Trials that met the eligibility criteria were scored for risk of bias using the Cochrane Collaborations Risk of Bias Tool. A meta-analysis was performed using Review Manager software version 5.3 (Nordic Cochrane Centre, Cochrane Collaboration). A total of 7 trials were identified. Meta-analysis demonstrated a modest but statistically significant improvement in HbA1c associated with the use of a telemedicine technology. The mean HbA1c of women using telemedicine was 5.33% (SD 0.70) compared with 5.45% (SD 0.58) in the standard care group, representing a mean difference of -0.12% (95% CI -0.23% to -0.02%). When this comparison was limited to women with gestational diabetes mellitus (GDM) only, the mean HbA1c of women using telemedicine was 5.22% (SD 0.70) compared with 5.37% (SD 0.61) in the standard care group, mean difference -0.14% (95% CI -0.25% to -0.04%). There were no differences in other maternal and neonatal outcomes reported. There is currently insufficient evidence that telemedicine technology is superior to standard care for women with diabetes in pregnancy; however, there was no evidence of harm. No trials were identified that assessed patient satisfaction or cost of care delivery, and it may be in these areas where these technologies may be found most valuable. ©Wai-Kit Ming, Lucy H Mackillop, Andrew J Farmer, Lise Loerup, Katy Bartlett, Jonathan C Levy, Lionel Tarassenko, Carmelo Velardo, Yvonne Kenworthy, Jane E Hirst. Originally published in the Journal of Medical Internet Research (http://www.jmir.org), 09.11.2016.
ERIC Educational Resources Information Center
Brock, Matthew E.; Cannella-Malone, Helen I.; Seaman, Rachel L.; Andzik, Natalie R.; Schaefer, John M.; Page, E. Justin; Barczak, Mary A.; Dueker, Scott A.
2017-01-01
Existing reviews address important questions about subsets of practitioner training studies in special education but leave important questions about the broader literature unanswered. In this comprehensive review, we identified 118 peer-reviewed single-case-design studies in which researchers tested the efficacy of practitioner training on…
ERIC Educational Resources Information Center
Brock, Matthew E.; Cannella-Malone, Helen I.; Seaman, Rachel L.; Andzik, Natalie R.; Schaefer, John M.; Page, E. Justin; Barczak, Mary A.; Dueker, Scott A.
2017-01-01
Existing reviews answer important questions about subsets of practitioner training studies in special education, but leave important questions about the broader literature unanswered. In this comprehensive review, we identified 118 peer-reviewed single-case design studies in which researchers tested the efficacy of practitioner training on…
MetaDB a Data Processing Workflow in Untargeted MS-Based Metabolomics Experiments.
Franceschi, Pietro; Mylonas, Roman; Shahaf, Nir; Scholz, Matthias; Arapitsas, Panagiotis; Masuero, Domenico; Weingart, Georg; Carlin, Silvia; Vrhovsek, Urska; Mattivi, Fulvio; Wehrens, Ron
2014-01-01
Due to their sensitivity and speed, mass-spectrometry based analytical technologies are widely used to in metabolomics to characterize biological phenomena. To address issues like metadata organization, quality assessment, data processing, data storage, and, finally, submission to public repositories, bioinformatic pipelines of a non-interactive nature are often employed, complementing the interactive software used for initial inspection and visualization of the data. These pipelines often are created as open-source software allowing the complete and exhaustive documentation of each step, ensuring the reproducibility of the analysis of extensive and often expensive experiments. In this paper, we will review the major steps which constitute such a data processing pipeline, discussing them in the context of an open-source software for untargeted MS-based metabolomics experiments recently developed at our institute. The software has been developed by integrating our metaMS R package with a user-friendly web-based application written in Grails. MetaMS takes care of data pre-processing and annotation, while the interface deals with the creation of the sample lists, the organization of the data storage, and the generation of survey plots for quality assessment. Experimental and biological metadata are stored in the ISA-Tab format making the proposed pipeline fully integrated with the Metabolights framework.
Executive Function and Reading Comprehension: A Meta-Analytic Review
ERIC Educational Resources Information Center
Follmer, D. Jake
2018-01-01
This article presents a meta-analytic review of the relation between executive function and reading comprehension. Results (N = 6,673) supported a moderate positive association between executive function and reading comprehension (r = 0.36). Moderator analyses suggested that correlations between executive function and reading comprehension did not…
The association between physical activity and renal cancer: systematic review and meta-analysis
Behrens, G; Leitzmann, M F
2013-01-01
Background: Physical activity may decrease renal cancer risk by reducing obesity, blood pressure, insulin resistance, and lipid peroxidation. Despite plausible biologic mechanisms linking increased physical activity to decreased risk for renal cancer, few epidemiologic studies have been able to report a clear inverse association between physical activity and renal cancer, and no meta-analysis is available on the topic. Methods: We searched the literature using PubMed and Web of Knowledge to identify published non-ecologic epidemiologic studies quantifying the relationship between physical activity and renal cancer risk in individuals without a cancer history. Following the PRISMA guidelines, we conducted a systematic review and meta-analysis, including information from 19 studies based on a total of 2 327 322 subjects and 10 756 cases. The methodologic quality of the studies was examined using a comprehensive scoring system. Results: Comparing high vs low levels of physical activity, we observed an inverse association between physical activity and renal cancer risk (summary relative risk (RR) from random-effects meta-analysis=0.88; 95% confidence interval (CI)=0.79–0.97). Summarising risk estimates from high-quality studies strengthened the inverse association between physical activity and renal cancer risk (RR=0.78; 95% CI=0.66–0.92). Effect modification by adiposity, hypertension, type 2 diabetes, smoking, gender, or geographic region was not observed. Conclusion: Our comprehensive meta-analysis provides strong support for an inverse relation of physical activity to renal cancer risk. Future high-quality studies are required to discern which specific types, intensities, frequencies, and durations of physical activity are needed for renal cancer risk reduction. PMID:23412105
Multivariate meta-analysis using individual participant data
Riley, R. D.; Price, M. J.; Jackson, D.; Wardle, M.; Gueyffier, F.; Wang, J.; Staessen, J. A.; White, I. R.
2016-01-01
When combining results across related studies, a multivariate meta-analysis allows the joint synthesis of correlated effect estimates from multiple outcomes. Joint synthesis can improve efficiency over separate univariate syntheses, may reduce selective outcome reporting biases, and enables joint inferences across the outcomes. A common issue is that within-study correlations needed to fit the multivariate model are unknown from published reports. However, provision of individual participant data (IPD) allows them to be calculated directly. Here, we illustrate how to use IPD to estimate within-study correlations, using a joint linear regression for multiple continuous outcomes and bootstrapping methods for binary, survival and mixed outcomes. In a meta-analysis of 10 hypertension trials, we then show how these methods enable multivariate meta-analysis to address novel clinical questions about continuous, survival and binary outcomes; treatment–covariate interactions; adjusted risk/prognostic factor effects; longitudinal data; prognostic and multiparameter models; and multiple treatment comparisons. Both frequentist and Bayesian approaches are applied, with example software code provided to derive within-study correlations and to fit the models. PMID:26099484
Little, Callie W; Haughbrook, Rasheda; Hart, Sara A
2017-01-01
Numerous twin studies have examined the genetic and environmental etiology of reading comprehension, though it is likely that etiological estimates are influenced by unidentified sample conditions (e.g. Tucker-Drob and Bates, Psychol Sci:0956797615612727, 2015). The purpose of this meta-analysis was to average the etiological influences of reading comprehension and to explore the potential moderators influencing these estimates. Results revealed an average heritability estimate of h 2 = 0.59, with significant variation in estimates across studies, suggesting potential moderation. Moderation results indicated publication year, grade level, project, zygosity methods, and response type moderated heritability estimates. The average shared environmental estimate was c 2 = 0.16, with publication year, grade and zygosity methods acting as significant moderators. These findings support the role of genetics on reading comprehension, and a small significant role of shared environmental influences. The results suggest that our interpretation of how genes and environments influence reading comprehension should reflect aspects of study and sample.
Dauwan, Meenakshi; Begemann, Marieke J. H.; Heringa, Sophie M.; Sommer, Iris E.
2016-01-01
Background: Physical exercise may be valuable for patients with schizophrenia spectrum disorders as it may have beneficial effect on clinical symptoms, quality of life and cognition. Methods: A systematic search was performed using PubMed (Medline), Embase, PsychInfo, and Cochrane Database of Systematic Reviews. Controlled and uncontrolled studies investigating the effect of any type of physical exercise interventions in schizophrenia spectrum disorders were included. Outcome measures were clinical symptoms, quality of life, global functioning, depression or cognition. Meta-analyses were performed using Comprehensive Meta-Analysis software. A random effects model was used to compute overall weighted effect sizes in Hedges’ g. Results: Twenty-nine studies were included, examining 1109 patients. Exercise was superior to control conditions in improving total symptom severity (k = 14, n = 719: Hedges’ g = .39, P < .001), positive (k = 15, n = 715: Hedges’ g = .32, P < .01), negative (k = 18, n = 854: Hedges’ g = .49, P < .001), and general (k = 10, n = 475: Hedges’ g = .27, P < .05) symptoms, quality of life (k = 11, n = 770: Hedges’ g = .55, P < .001), global functioning (k = 5, n = 342: Hedges’ g = .32, P < .01), and depressive symptoms (k = 7, n = 337: Hedges’ g = .71, P < .001). Yoga, specifically, improved the cognitive subdomain long-term memory (k = 2, n = 184: Hedges’ g = .32, P < .05), while exercise in general or in any other form had no effect on cognition. Conclusion: Physical exercise is a robust add-on treatment for improving clinical symptoms, quality of life, global functioning, and depressive symptoms in patients with schizophrenia. The effect on cognition is not demonstrated, but may be present for yoga. PMID:26547223
Wang, Qian; Ma, Junfen; Jiang, Zhiyun; Ming, Liang
2018-02-01
Neutrophil-to-lymphocyte ratio (NLR) and platelet-to-lymphocyte ratio (PLR) have been reported to predict prognosis of acute pulmonary embolism (PE). However, the prognostic value of NLR and PLR remained inconsistent between studies. The aim of this meta-analysis was to assess the prognostic role of NLR and PLR in acute PE. We systematically searched Pubmed, Embase, Web of Science and CNKI for relative literature up to March 2017. The pooled statistics for all outcomes were expressed as odds ratio (OR) and 95% confidence intervals (95% CI). The statistical analyses were performed using Review Manager 5.3.5 analysis software and Stata software. Totally 7 eligible studies consisting of 2323 patients were enrolled in our meta-analysis. Elevated NLR was significantly associated with overall (short-term and long-term) mortality (OR 10.13, 95% CI 6.57-15.64, P<0.001) and short-term (in-hospital and 30 days) mortality (OR 8.43, 95% CI 5.23-13.61, P<0.001). And elevated PLR was significantly associated with overall mortality (OR 6.32, 95% CI 4.52-8.84, P<0.001), short-term mortality (OR 6.69, 95% CI 2.86-15.66, P<0.001) and long-term mortality (OR 6.11, 95% CI 3.90-9.55, P<0.001). Our meta-analysis revealed that NLR and PLR are promising biomarkers in predicting prognosis in acute PE patients. We suggest NLR and PLR be used routinely in the PE prognostic assessment.
Perceived Discrimination and Health: A Meta-Analytic Review
Pascoe, Elizabeth A.; Richman, Laura Smart
2009-01-01
Perceived discrimination has been studied with regard to its impact on several types of health effects. This meta-analysis provides a comprehensive account of the relationships between multiple forms of perceived discrimination and both mental and physical health outcomes. In addition, this meta-analysis examines potential mechanisms by which perceiving discrimination may affect health, including through psychological and physiological stress responses and health behaviors. Analysis of 134 samples suggests that when weighting each study’s contribution by sample size, perceived discrimination has a significant negative effect on both mental and physical health. Perceived discrimination also produces significantly heightened stress responses and is related to participation in unhealthy and nonparticipation in healthy behaviors. These findings suggest potential pathways linking perceived discrimination to negative health outcomes. PMID:19586161
Behavior Therapy for Tourette Syndrome: A Systematic Review and Meta-analysis.
Wile, Daryl J; Pringsheim, Tamara M
2013-08-01
When tics caused by Tourette Syndrome cause meaningful impairment for patients, a comprehensive treatment approach includes education of patients, peers, and family, treatment of comorbid behavioral disorders if present, and consideration of behavior therapy and pharmacotherapy for tics themselves. This systematic review and meta-analysis demonstrates that behavior therapies based on Habit Reversal Therapy, including the Comprehensive Behavioral Intervention for Tics are effective in reducing tic severity when compared with supportive psychotherapy. When these behavior therapies are unavailable, Exposure with Response Prevention may also be effective. Both face-to-face and telehealth delivery methods for behavior therapy improve tic severity, and broader distribution of behavior therapy through increased training or telehealth methods is encouraged. High-quality randomized trials comparing behavior therapies for tics with pharmacotherapy are needed.
Association of Mycoplasma pneumoniae infection with increased risk of asthma in children.
Yin, Sha-Sha; Ma, Feng-Lian; Gao, Xing
2017-05-01
The present study was conducted to investigate the relationship between Mycoplasma pneumoniae (MP) infection and the risk of asthma among children by detecting the rate of MP immunoglobulin M (MP-IgM) and the eosinophil (EOS) count. A total of 139 asthmatic children were enrolled as the case group and assigned into three groups: Group A (aged <3 years, n=42), group B (aged 3-8 years, n=45) and group C (aged >8 years, n=52). Additionally, 115 healthy children were enrolled in the control group. Enzyme-linked immunosorbent assay was used to measure the MP-IgM-positive rate. EOS count was detected in the experimental and control groups by using a hemocytometer analyzer. A meta-analysis was performed by using the Comprehensive Meta-Analysis version 2.0 software. The positive rates of the MP-IgM and EOS count in the experimental group were significantly higher than those in control group (both P<0.001). Furthermore, the asthmatic children in group C had a higher MP-IgM-positive rate and EOS count as compared to those in groups A and B, respectively (all P<0.05). Results from groups A and B were not statistically significant (all P>0.05). The meta-analysis further confirmed that asthmatic children had a higher MP-IgM-positive rate as compared to the healthy controls (P<0.001). Age-stratified analysis revealed that the MP-IgM-positive rate in asthmatic children aged ≥8 and <8 years was significantly higher than that in the healthy controls (P=0.003 and P<0.001). Asthmatic children had a higher MP-IgM-positive rate and EOS count as compared with controls, suggesting that the MP infection may be closely associated with the risk of asthma. Additionally, the positive rate of MP-IgM may indicate an important biological marker in predicting the development of asthma.
Yang, Jiajia; Han, Renfang; Chen, Mengya; Yuan, Yaping; Hu, Xingxing; Ma, Yubo; Wu, Meng; Zhang, Xu; Wang, Mengmeng; Jiang, Shanqun; Pan, Faming
2018-06-01
The associations between PvuII (T>C) and XbaI (A>G) polymorphisms of estrogen receptor alpha (ESR1) gene with type 2 diabetes mellitus (T2DM) or metabolic syndrome (MetS) are reported in many studies, but the results are inconsistent. This present work aims to assess the associations by performing a comprehensive meta-analysis. Relevant studies were searched through several databases. The pooled odd ratios (ORs) with 95% confidence intervals (CIs) were calculated to evaluate the associations of PvuII and XbaI polymorphisms with the risk of T2DM and MetS by using the STATA 14.0 software. Eight studies for T2DM and three articles about MetS were included in this meta-analysis. The overall results indicated that PvuII, rather than XbaI polymorphism, was associated with T2DM (regressive model: OR=0.673, 95% CI=0.550 to 0.823, p raw <0.001, p FDR <0.003). The subgroup analysis based on race revealed an association of PvuII polymorphism with the decreased T2DM risk in Chinese population and a relationship between XbaI polymorphism and the reduced T2DM susceptibility in Caucasians. The difference of country may be one source of the heterogeneity for PvuII polymorphism and T2DM. However, neither PvuII nor XbaI polymorphism was related to the risk of MetS. The C allele of PvuII polymorphism presents a protective role in T2DM risk, especially in Chinese people. The G allele of XbaI polymorphism is related to a reduced risk for T2DM in Caucasian population. Nevertheless, neither of PvuII nor XbaI polymorphism is associated with MetS risk. © Georg Thieme Verlag KG Stuttgart · New York.
Semantic Metrics for Analysis of Software
NASA Technical Reports Server (NTRS)
Etzkorn, Letha H.; Cox, Glenn W.; Farrington, Phil; Utley, Dawn R.; Ghalston, Sampson; Stein, Cara
2005-01-01
A recently conceived suite of object-oriented software metrics focus is on semantic aspects of software, in contradistinction to traditional software metrics, which focus on syntactic aspects of software. Semantic metrics represent a more human-oriented view of software than do syntactic metrics. The semantic metrics of a given computer program are calculated by use of the output of a knowledge-based analysis of the program, and are substantially more representative of software quality and more readily comprehensible from a human perspective than are the syntactic metrics.
Weymann, Alexander; Ali-Hasan-Al-Saegh, Sadeq; Sabashnikov, Anton; Popov, Aron-Frederik; Mirhosseini, Seyed Jalil; Nombela-Franco, Luis; Testa, Luca; Lotfaliani, Mohammadreza; Zeriouh, Mohamed; Liu, Tong; Dehghan, Hamidreza; Yavuz, Senol; de Oliveira Sá, Michel Pompeu Barros; Baker, William L.; Jang, Jae-Sik; Gong, Mengqi; Benedetto, Umberto; Dohmen, Pascal M.; D’Ascenzo, Fabrizio; Deshmukh, Abhishek J.; Biondi-Zoccai, Giuseppe; Calkins, Hugh; Stone, Gregg W.
2017-01-01
Background This systematic review with meta-analysis aimed to determine the strength of evidence for evaluating the association of platelet cellular and functional characteristics including platelet count (PC), MPV, platelet distribution width (PDW), platelet factor 4, beta thromboglobulin (BTG), and p-selectin with the occurrence of atrial fibrillation (AF) and consequent stroke. Material/Methods We conducted a meta-analysis of observational studies evaluating platelet characteristics in patients with paroxysmal, persistent and permanent atrial fibrillations. A comprehensive subgroup analysis was performed to explore potential sources of heterogeneity. Results Literature search of all major databases retrieved 1,676 studies. After screening, a total of 73 studies were identified. Pooled analysis showed significant differences in PC (weighted mean difference (WMD)=−26.93 and p<0.001), MPV (WMD=0.61 and p<0.001), PDW (WMD=−0.22 and p=0.002), BTG (WMD=24.69 and p<0.001), PF4 (WMD=4.59 and p<0.001), and p-selectin (WMD=4.90 and p<0.001). Conclusions Platelets play a critical and precipitating role in the occurrence of AF. Whereas distribution width of platelets as well as factors of platelet activity was significantly greater in AF patients compared to SR patients, platelet count was significantly lower in AF patients. PMID:28302997
Rebar, Amanda L; Stanton, Robert; Geard, David; Short, Camille; Duncan, Mitch J; Vandelanotte, Corneel
2015-01-01
Amidst strong efforts to promote the therapeutic benefits of physical activity for reducing depression and anxiety in clinical populations, little focus has been directed towards the mental health benefits of activity for non-clinical populations. The objective of this meta-meta-analysis was to systematically aggregate and quantify high-quality meta-analytic findings of the effects of physical activity on depression and anxiety for non-clinical populations. A systematic search identified eight meta-analytic outcomes of randomised trials that investigated the effects of physical activity on depression or anxiety. The subsequent meta-meta-analyses were based on a total of 92 studies with 4310 participants for the effect of physical activity on depression and 306 study effects with 10,755 participants for the effect of physical activity on anxiety. Physical activity reduced depression by a medium effect [standardised mean difference (SMD) = -0.50; 95% CI: -0.93 to -0.06] and anxiety by a small effect (SMD = -0.38; 95% CI: -0.66 to -0.11). Neither effect showed significant heterogeneity across meta-analyses. These findings represent a comprehensive body of high-quality evidence that physical activity reduces depression and anxiety in non-clinical populations.
Implementation errors in the GingerALE Software: Description and recommendations.
Eickhoff, Simon B; Laird, Angela R; Fox, P Mickle; Lancaster, Jack L; Fox, Peter T
2017-01-01
Neuroscience imaging is a burgeoning, highly sophisticated field the growth of which has been fostered by grant-funded, freely distributed software libraries that perform voxel-wise analyses in anatomically standardized three-dimensional space on multi-subject, whole-brain, primary datasets. Despite the ongoing advances made using these non-commercial computational tools, the replicability of individual studies is an acknowledged limitation. Coordinate-based meta-analysis offers a practical solution to this limitation and, consequently, plays an important role in filtering and consolidating the enormous corpus of functional and structural neuroimaging results reported in the peer-reviewed literature. In both primary data and meta-analytic neuroimaging analyses, correction for multiple comparisons is a complex but critical step for ensuring statistical rigor. Reports of errors in multiple-comparison corrections in primary-data analyses have recently appeared. Here, we report two such errors in GingerALE, a widely used, US National Institutes of Health (NIH)-funded, freely distributed software package for coordinate-based meta-analysis. These errors have given rise to published reports with more liberal statistical inferences than were specified by the authors. The intent of this technical report is threefold. First, we inform authors who used GingerALE of these errors so that they can take appropriate actions including re-analyses and corrective publications. Second, we seek to exemplify and promote an open approach to error management. Third, we discuss the implications of these and similar errors in a scientific environment dependent on third-party software. Hum Brain Mapp 38:7-11, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Gutiérrez-Castrellón, Pedro; Ortíz-Hernández, Anna Alejandra; Llamosas-Gallardo, Beatriz; Acosta-Bastidas, Mario A; Jiménez-Gutiérrez, Carlos; Diaz-García, Luisa; Anzo-Osorio, Anahí; Estevez-Jiménez, Juliana; Jiménez-Escobar, Irma; Vidal-Vázquez, Rosa Patricia
2015-01-01
Despite major advances in treatment, acute diarrhea continues to be a public health problem in children under five years. There is no systematic approach to treatment and most evidence is assembled comparing active treatment vs. placebo. Systematic review of evidence on efficacy of adjuvants for treatment of acute diarrhea through a network meta-analysis. A systematic search of multiple databases searching clinical trials related to the use of racecadotril, smectite, Lactobacillus GG, Lactobacillus reuteri, Saccharomyces boulardii and zinc as adjuvants in acute diarrhea was done. The primary endpoint was duration of diarrhea. Information is displayed through network meta-analysis.The superiority of each coadjutant was analyzed by Sucra approach. Network meta-analysis showed race cadotril was better when compared with placebo and other adjuvants. Sucra analysis showed racecadotril as the first option followed by smectite and Lactobacillus reuteri. Considering a strategic decision making approach, network meta-analysis allows us to establish the therapeutic superiority of racecadotril as an adjunct for the comprehensive management of acute diarrhea in children aged less than five years.
ERIC Educational Resources Information Center
Finn, Diana Baker
2014-01-01
The purpose of this study was to examine the relationship of specific cognitive abilities and reading comprehension across a variety of norm referenced tests that align with Cattell-Horn-Carroll (CHC) theory of cognitive abilities and integrative models of reading. Data from existing studies was analyzed by comparing the relationships of four…
The Past, Present, and Future of Comprehensive School Reform. Research Brief
ERIC Educational Resources Information Center
Borman, Geoffrey D.
2009-01-01
The last major review of the achievement outcomes of comprehensive school reform (CSR) models was conducted in 2003. Despite the growing evidence base supporting CSR, the program was discontinued by the federal government in 2007. Now, six years after the 2003 meta-analysis, the study's lead author, Geoffrey Borman, revisits the results and…
Meta-analysis of global metabolomics and proteomics data to link alterations with phenotype
Patti, Gary J.; Tautenhahn, Ralf; Fonslow, Bryan R.; ...
2011-01-01
Global metabolomics has emerged as a powerful tool to interrogate cellular biochemistry at the systems level by tracking alterations in the levels of small molecules. One approach to define cellular dynamics with respect to this dysregulation of small molecules has been to consider metabolic flux as a function of time. While flux measurements have proven effective for model organisms, acquiring multiple time points at appropriate temporal intervals for many sample types (e.g., clinical specimens) is challenging. As an alternative, meta-analysis provides another strategy for delineating metabolic cause and effect perturbations. That is, the combination of untargeted metabolomic data from multiplemore » pairwise comparisons enables the association of specific changes in small molecules with unique phenotypic alterations. We recently developed metabolomic software called metaXCMS to automate these types of higher order comparisons. Here we discuss the potential of metaXCMS for analyzing proteomic datasets and highlight the biological value of combining meta-results from both metabolomic and proteomic analyses. The combined meta-analysis has the potential to facilitate efforts in functional genomics and the identification of metabolic disruptions related to disease pathogenesis.« less
A Meta-Analysis and Review of Holistic Face Processing
Richler, Jennifer J.; Gauthier, Isabel
2014-01-01
The concept of holistic processing is a cornerstone of face recognition research, yet central questions related to holistic processing remain unanswered, and debates have thus far failed to reach a resolution despite accumulating empirical evidence. We argue that a considerable source of confusion in this literature stems from a methodological problem. Specifically, two different measures of holistic processing based on the composite paradigm (complete design and partial design) are used in the literature, but they often lead to qualitatively different results. First, we present a comprehensive review of the work that directly compares the two designs, and which clearly favors the complete design over the partial design. Second, we report a meta-analysis of holistic face processing according to both designs, and use this as further evidence for one design over the other. The meta-analysis effect size of holistic processing in the complete design is nearly three times that of the partial design. Effect sizes were not correlated between measures, consistent with the suggestion that they do not measure the same thing. Our meta-analysis also examines the correlation between conditions in the complete design of the composite task, and suggests that in an individual differences context, little is gained by including a misaligned baseline. Finally, we offer a comprehensive review of the state of knowledge about holistic processing based on evidence gathered from the measure we favor based on the first sections of our review—the complete design—and outline outstanding research questions in that new context. PMID:24956123
Spedding, Simon
2014-04-11
Efficacy of Vitamin D supplements in depression is controversial, awaiting further literature analysis. Biological flaws in primary studies is a possible reason meta-analyses of Vitamin D have failed to demonstrate efficacy. This systematic review and meta-analysis of Vitamin D and depression compared studies with and without biological flaws. The systematic review followed the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) guidelines. The literature search was undertaken through four databases for randomized controlled trials (RCTs). Studies were critically appraised for methodological quality and biological flaws, in relation to the hypothesis and study design. Meta-analyses were performed for studies according to the presence of biological flaws. The 15 RCTs identified provide a more comprehensive evidence-base than previous systematic reviews; methodological quality of studies was generally good and methodology was diverse. A meta-analysis of all studies without flaws demonstrated a statistically significant improvement in depression with Vitamin D supplements (+0.78 CI +0.24, +1.27). Studies with biological flaws were mainly inconclusive, with the meta-analysis demonstrating a statistically significant worsening in depression by taking Vitamin D supplements (-1.1 CI -0.7, -1.5). Vitamin D supplementation (≥800 I.U. daily) was somewhat favorable in the management of depression in studies that demonstrate a change in vitamin levels, and the effect size was comparable to that of anti-depressant medication.
The heterogeneity statistic I(2) can be biased in small meta-analyses.
von Hippel, Paul T
2015-04-14
Estimated effects vary across studies, partly because of random sampling error and partly because of heterogeneity. In meta-analysis, the fraction of variance that is due to heterogeneity is estimated by the statistic I(2). We calculate the bias of I(2), focusing on the situation where the number of studies in the meta-analysis is small. Small meta-analyses are common; in the Cochrane Library, the median number of studies per meta-analysis is 7 or fewer. We use Mathematica software to calculate the expectation and bias of I(2). I(2) has a substantial bias when the number of studies is small. The bias is positive when the true fraction of heterogeneity is small, but the bias is typically negative when the true fraction of heterogeneity is large. For example, with 7 studies and no true heterogeneity, I(2) will overestimate heterogeneity by an average of 12 percentage points, but with 7 studies and 80 percent true heterogeneity, I(2) can underestimate heterogeneity by an average of 28 percentage points. Biases of 12-28 percentage points are not trivial when one considers that, in the Cochrane Library, the median I(2) estimate is 21 percent. The point estimate I(2) should be interpreted cautiously when a meta-analysis has few studies. In small meta-analyses, confidence intervals should supplement or replace the biased point estimate I(2).
Fan, Zhengrui; Ma, Jianxiong; Kuang, Mingjie; Zhang, Lukai; Han, Biao; Yang, Baocheng; Wang, Ying; Ma, Xinlong
2018-04-01
Total knee arthroplasty (TKA) is gradually emerging as the treatment of choice for end-stage osteoarthritis. In the past, Perioperative dexamethasone treatment is still a controversial subject in total knee arthroplasty. Therefore, we write this systematic review and meta-analysis to evaluate the efficacy of dexamethasone on pain and recovery after Total knee Arthroplasty. Embase, Pubmed, and Cochrane Library were comprehensively searched. Randomized controlled trials, cohort studies were included in our meta-analysis. Eight studies that compared dexamethasone groups with placebo groups were included in our meta-analysis. The research was reported according to the preferred reporting items for systematic reviews and meta-analysis (PRISMA) guidelines. Randomized controlled trials were included in our meta-analysis. Our study demonstrated that the dexamethasone group was more effective than the placebo group in term of VAS score at 24 h(P < 0.00001), 48 h(P = 0.0002); Opioid consumption (P < 0.00001); postoperative nausea (P < 0.00001); and Inflammatory factors of CPR at 24 h (P = 0.003). Our meta-analysis demonstrated that dexamethasone decreased postoperative pain, the incidence of POVN, and total opioid consumption effectively which played a critical role in rapid recovery to TKA. However, we still need large sample size, high quality studies to explore the relationship between complications and dose response to give the final conclusion. Copyright © 2018. Published by Elsevier Ltd.
Teaching Visual Texts with the Multimodal Analysis Software
ERIC Educational Resources Information Center
Lim Fei, Victor; O'Halloran, Kay L.; Tan, Sabine; E., Marissa K. L.
2015-01-01
This exploratory study introduces the systemic approach and the explicit teaching of a meta-language to provide conceptual tools for students for the analysis and interpretation of multimodal texts. Equipping students with a set of specialised vocabulary with conventionalised meanings associated with specific choices in multimodal texts empowers…
Comprehensive School Reform: Meta-Analytic Evidence of Black-White Achievement Gap Narrowing.
Gorey, Kevin M
2009-12-30
This meta-analysis extends a previous review of the achievement effects of comprehensive school reform (CSR) programs (Borman, Hewes, Overman, & Brown, 2003). That meta-analysis observed significant effects of well endowed and well-researched programs, but it did not account for race/ethnicity. This article synthesizes 34 cohort or quasi-experimental outcomes of studies that incorporated the policy-critical characteristic of race/ethnicity. compared with matched traditional schools, the black-white achievement gap narrowed significantly more among students in CSR schools. In addition, the aggregate effects were large, substantially to completely eliminating the achievement gap between African American and non-Hispanic white students in elementary and middle schools. Title I policies before or after the No Child Left Behind Act of 2001 seem to have had essentially no impact on the black-white achievement gap. Curricular and testing mandates along with the threat of sanctions without concomitant resource supports seem to have failed. This study suggests that educational achievement inequities need not be America's destiny. It seems that they could be eliminated through concerted political will and ample resource commitments to evidence-based educational programs.
Effectiveness of problem-based learning in Chinese pharmacy education: a meta-analysis.
Zhou, Jiyin; Zhou, Shiwen; Huang, Chunji; Xu, Rufu; Zhang, Zuo; Zeng, Shengya; Qian, Guisheng
2016-01-19
This review provides a critical overview of problem-based learning (PBL) practices in Chinese pharmacy education. PBL has yet to be widely applied in pharmaceutical education in China. The results of those studies that have been conducted are published in Chinese and thus may not be easily accessible to international researchers. Therefore, this meta-analysis was carried out to review the effectiveness of PBL. Databases were searched for studies in accordance with the inclusion criteria. Two reviewers independently performed the study identification and data extraction. A meta-analysis was conducted using Revman 5.3 software. Sixteen randomized controlled trials were included. The meta-analysis revealed that PBL had a positive association with higher theoretical scores (SMD = 1.17, 95% CI [0.77, 11.57], P < 0.00001). The questionnaire results show that PBL methods are superior to conventional teaching methods in improving students' learning interest, independent analysis skills, scope of knowledge, self-study, team spirit, and oral expression. This meta-analysis indicates that PBL pedagogy is superior to traditional lecture-based teaching in Chinese pharmacy education. PBL methods could be an optional, supplementary method of pharmaceutical teaching in China. However, Chinese pharmacy colleges and universities should revise PBL curricula according to their own needs, which would maximize the effectiveness of PBL.
Ma, Mu-yuan; Ma, Zhi-bin; Xu, Hong-yu; Zhao, Jing-bo; Li, Ying; Gao, Meng
2013-03-01
To investigate the associations between polymorphisms of organic cation transporter OCTN1/2 (organic cation transporter 1/2) and the susceptibility of Crohn's disease (CD) through a meta-analysis. Databases of PubMed, EMBASE, MedLine, and CNKI (Chinese), Wanfang (Chinese) were searched for published case control studies on the association between polymorphisms of OCTN1/2 gene and the susceptibility of CD which were published before September 2012. The meta-analysis was applied with Review Manager 4.2 software and Stata 10.0 software. Nineteen eligible studies, including 14 from Europeans, 3 from Asians, 1 from Oceania, and 1 from the US were included in the meta-analysis. In total, significant associations were found between OCTN1/2 polymorphisms and the susceptibility of CD for all genetic models. In subgroup analyses, significant associations were found in the European population for OCTN1/2. Associations were not significant in the non-European population for OCTN1 (TT vs. CT: OR = 1.25, 95%CI: 0.75 - 1.98, P = 0.34; TT vs. CC + CT: OR = 1.48, 95%CI: 0.95 - 2.29, P = 0.08) and for OCTN2 (CC vs. GC: OR = 1.03, 95%CI: 0.68 - 1.56, P = 0.89; CC vs. GG + GC: OR = 1.23, 95%CI: 0.83 - 1.82, P = 0.31). However, there were significant associations found between OCTN1/2 (TT vs. CC, TT + CT vs. CC, CC vs. GG, CC + GC vs. GG) polymorphisms and the susceptibility of CD found in the non-European population. Results from this meta-analysis suggested that OCTN1/2 polymorphisms were associated with the susceptibility of CD in the European population. Associations between OCTN1/2 polymorphisms and the susceptibility of CD in the non-European population required searching for large samples to confirm the findings.
Sun, Hua-Min; Li, Xiao-Yan; Chow, Eric P F; Li, Tong; Xian, Yun; Lu, Yi-Hua; Tian, Tian; Zhuang, Xun; Zhang, Lei
2015-01-08
Methadone maintenance treatment (MMT) has been implemented in China since 2004 and has expanded into a nationwide programme. This study aims to evaluate changes in social functioning, family relations and drug-related criminal behaviour among MMT clients in China. Systematic review and meta-analysis. Both English and Chinese literature databases, including PubMed, Chongqing VIP Chinese Science and Technology Journals Database (CQVIP), China National Knowledge Infrastructure (CNKI) and Wanfang Data, were comprehensively searched over the period 2004-2014 for studied indicators. Study selection, quality assessment and data extraction were conducted according to the PRISMA (preferred reporting items for systematic reviews and meta-analyses) Statement. Meta-analyses were conducted using Comprehensive Meta-Analysis Biostat software. Thirty-eight articles were included in this review (1 in English and 37 in Chinese). The self-reported arrest rate decreased from 13.1% (95% CI 9.1% to 18.5%) at baseline to 3.4% (95% CI 1.5% to 7.7%) and 4.3% (95% CI 1.6% to 11.4%) after 6 and 12 months of MMT intervention, respectively. The rate of drug selling decreased from 7.6% (95% CI 3.8% to 14.8%) at baseline to 1.9% (95% CI 0.6% to 6.2%) and 3.0% (95% CI 1.0% to 8.9%) after 6 and 12 months of intervention, respectively. Similarly, the rates of selling sex for drugs and drug-related crime decreased from 5.3% (95% CI 2.4% to 11.1%) and 9.9% (95% CI 6.8% to 14.2%) at baseline to 1.1% (95% CI 0.5% to 2.3%) and 3.4% (95% CI 2.5% to 4.5%) at 6 months, then to 0.8% (95% CI 0.3% to 1.9%) and 3.4% (95% CI 0.8% to 13.1%) at 12 months after treatment initiation, respectively. In contrast, the rate of employment of clients and the proportion of clients having a good relationship with their family increased substantially from 26.4% (95% CI 22.9% to 30.1%) and 37.9% (95% CI 32.0% to 44.2%) to 41.6% (95% CI 36.6% to 48.0%) and 59.6% (95% CI 48.1% to 70.2%) at 6 months, then to 59.8% (95% CI 52.4% to 66.8%) and 75.0% (95% CI 69.0% to 80.2%) at 12 months after treatment initiation, respectively. MMT has significantly reduced criminal activity, and improved employment rate and social well-being, of clients of the MMT programme. MMT is an effective measure to help drug users to resume societal and familial functions in China. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.
Association between the BRCA2 rs144848 polymorphism and cancer susceptibility: a meta-analysis.
Li, Qiuyan; Guan, Rongwei; Qiao, Yuandong; Liu, Chang; He, Ning; Zhang, Xuelong; Jia, Xueyuan; Sun, Haiming; Yu, Jingcui; Xu, Lidan
2017-06-13
The BRCA2 gene plays an important role in cancer carcinogenesis, and polymorphisms in this gene have been associated with cancer risk. The BRCA2 rs144848 polymorphism has been associated with several cancers, but results have been inconsistent. In the present study, a meta-analysis was performed to assess the association between the rs144848 polymorphism and cancer risk. Literature was searched from the databases of PubMed, Embase and Google Scholar before April 2016. The fixed or random effects model was used to calculate pooled odd ratios on the basis of heterogeneity. Meta-regression, sensitivity analysis, subgroup analysis and publication bias assessment were also performed using STATA 11.0 software according to Preferred Reporting Items for Systematic Reviews and Meta-Analyses 2009. A total of 40 relevant studies from 30 publications including 34,911 cases and 48,329 controls were included in the final meta-analysis. Among them, 22 studies focused on breast cancer, seven on ovarian cancer, five on non-Hodgkin lymphoma, and the remaining six studies examined various other cancers. The meta-analysis results showed that there were significant associations between the rs144848 polymorphism and cancer risk in all genetic models. Stratified by cancer type, the rs144848 polymorphism was associated with non-Hodgkin lymphoma. Stratified by study design, the allele model was associated with breast cancer risk in population-based studies. The meta-analysis suggests that the BRCA2 rs144848 polymorphism may play a role in cancer risk. Further well-designed studies are warranted to confirm these results.
Reddy, Varikasuvu Seshadri; Bukke, Suman; Dutt, Naveen; Rana, Puneet; Pandey, Arun Kumar
2017-07-01
Available studies in the literature on the selenium levels in Alzheimer's disease (AD) are inconsistent with some studies reporting its decrease in the circulation, while others reported an increase or no change as compared to controls. The objective of this study was to perform a meta-analysis of circulatory (plasma/serum and blood), erythrocyte and cerebrospinal fluid (CSF) selenium levels in AD compared controls. We also performed a meta-analysis of the correlation coefficients (r) to demonstrate the associations between selenium and glutathione peroxidase (GPx) in AD patients. All major databases were searched for eligible studies. We included 12 case-control/observational studies reporting selenium concentrations in AD and controls. Pooled-overall effect size as standardized mean difference (SMD) and pooled r-values were generated using Review Manager 5.3 and MedCalc 15.8 software. Random-effects meta-analysis indicated a decrease in circulatory (SMD=-0.44), erythrocellular (SMD=-0.52) and CSF (SMD=-0.14) selenium levels in AD patients compared to controls. Stratified meta-analysis demonstrated that the selenium levels were decreased in both the subgroups with (SMD=-0.55) and without (SMD=-0.37) age matching between AD and controls. Our results also demonstrated a direct association between decreased selenium levels and GPx in AD. This meta-analysis suggests that circulatory selenium concentration is significantly lower in AD patients compared to controls and this decrease in selenium is directly correlated with an important antioxidant enzyme, the GPx, in AD. Copyright © 2017 Elsevier GmbH. All rights reserved.
2014-01-01
Background Meta-regression is becoming increasingly used to model study level covariate effects. However this type of statistical analysis presents many difficulties and challenges. Here two methods for calculating confidence intervals for the magnitude of the residual between-study variance in random effects meta-regression models are developed. A further suggestion for calculating credible intervals using informative prior distributions for the residual between-study variance is presented. Methods Two recently proposed and, under the assumptions of the random effects model, exact methods for constructing confidence intervals for the between-study variance in random effects meta-analyses are extended to the meta-regression setting. The use of Generalised Cochran heterogeneity statistics is extended to the meta-regression setting and a Newton-Raphson procedure is developed to implement the Q profile method for meta-analysis and meta-regression. WinBUGS is used to implement informative priors for the residual between-study variance in the context of Bayesian meta-regressions. Results Results are obtained for two contrasting examples, where the first example involves a binary covariate and the second involves a continuous covariate. Intervals for the residual between-study variance are wide for both examples. Conclusions Statistical methods, and R computer software, are available to compute exact confidence intervals for the residual between-study variance under the random effects model for meta-regression. These frequentist methods are almost as easily implemented as their established counterparts for meta-analysis. Bayesian meta-regressions are also easily performed by analysts who are comfortable using WinBUGS. Estimates of the residual between-study variance in random effects meta-regressions should be routinely reported and accompanied by some measure of their uncertainty. Confidence and/or credible intervals are well-suited to this purpose. PMID:25196829
Nikpay, Majid; Goel, Anuj; Won, Hong-Hee; Hall, Leanne M; Willenborg, Christina; Kanoni, Stavroula; Saleheen, Danish; Kyriakou, Theodosios; Nelson, Christopher P; Hopewell, Jemma C; Webb, Thomas R; Zeng, Lingyao; Dehghan, Abbas; Alver, Maris; Armasu, Sebastian M; Auro, Kirsi; Bjonnes, Andrew; Chasman, Daniel I; Chen, Shufeng; Ford, Ian; Franceschini, Nora; Gieger, Christian; Grace, Christopher; Gustafsson, Stefan; Huang, Jie; Hwang, Shih-Jen; Kim, Yun Kyoung; Kleber, Marcus E; Lau, King Wai; Lu, Xiangfeng; Lu, Yingchang; Lyytikäinen, Leo-Pekka; Mihailov, Evelin; Morrison, Alanna C; Pervjakova, Natalia; Qu, Liming; Rose, Lynda M; Salfati, Elias; Saxena, Richa; Scholz, Markus; Smith, Albert V; Tikkanen, Emmi; Uitterlinden, Andre; Yang, Xueli; Zhang, Weihua; Zhao, Wei; de Andrade, Mariza; de Vries, Paul S; van Zuydam, Natalie R; Anand, Sonia S; Bertram, Lars; Beutner, Frank; Dedoussis, George; Frossard, Philippe; Gauguier, Dominique; Goodall, Alison H; Gottesman, Omri; Haber, Marc; Han, Bok-Ghee; Huang, Jianfeng; Jalilzadeh, Shapour; Kessler, Thorsten; König, Inke R; Lannfelt, Lars; Lieb, Wolfgang; Lind, Lars; Lindgren, Cecilia M; Lokki, Marja-Liisa; Magnusson, Patrik K; Mallick, Nadeem H; Mehra, Narinder; Meitinger, Thomas; Memon, Fazal-Ur-Rehman; Morris, Andrew P; Nieminen, Markku S; Pedersen, Nancy L; Peters, Annette; Rallidis, Loukianos S; Rasheed, Asif; Samuel, Maria; Shah, Svati H; Sinisalo, Juha; Stirrups, Kathleen E; Trompet, Stella; Wang, Laiyuan; Zaman, Khan S; Ardissino, Diego; Boerwinkle, Eric; Borecki, Ingrid B; Bottinger, Erwin P; Buring, Julie E; Chambers, John C; Collins, Rory; Cupples, L Adrienne; Danesh, John; Demuth, Ilja; Elosua, Roberto; Epstein, Stephen E; Esko, Tõnu; Feitosa, Mary F; Franco, Oscar H; Franzosi, Maria Grazia; Granger, Christopher B; Gu, Dongfeng; Gudnason, Vilmundur; Hall, Alistair S; Hamsten, Anders; Harris, Tamara B; Hazen, Stanley L; Hengstenberg, Christian; Hofman, Albert; Ingelsson, Erik; Iribarren, Carlos; Jukema, J Wouter; Karhunen, Pekka J; Kim, Bong-Jo; Kooner, Jaspal S; Kullo, Iftikhar J; Lehtimäki, Terho; Loos, Ruth J F; Melander, Olle; Metspalu, Andres; März, Winfried; Palmer, Colin N; Perola, Markus; Quertermous, Thomas; Rader, Daniel J; Ridker, Paul M; Ripatti, Samuli; Roberts, Robert; Salomaa, Veikko; Sanghera, Dharambir K; Schwartz, Stephen M; Seedorf, Udo; Stewart, Alexandre F; Stott, David J; Thiery, Joachim; Zalloua, Pierre A; O'Donnell, Christopher J; Reilly, Muredach P; Assimes, Themistocles L; Thompson, John R; Erdmann, Jeanette; Clarke, Robert; Watkins, Hugh; Kathiresan, Sekar; McPherson, Ruth; Deloukas, Panos; Schunkert, Heribert; Samani, Nilesh J; Farrall, Martin
2015-10-01
Existing knowledge of genetic variants affecting risk of coronary artery disease (CAD) is largely based on genome-wide association study (GWAS) analysis of common SNPs. Leveraging phased haplotypes from the 1000 Genomes Project, we report a GWAS meta-analysis of ∼185,000 CAD cases and controls, interrogating 6.7 million common (minor allele frequency (MAF) > 0.05) and 2.7 million low-frequency (0.005 < MAF < 0.05) variants. In addition to confirming most known CAD-associated loci, we identified ten new loci (eight additive and two recessive) that contain candidate causal genes newly implicating biological processes in vessel walls. We observed intralocus allelic heterogeneity but little evidence of low-frequency variants with larger effects and no evidence of synthetic association. Our analysis provides a comprehensive survey of the fine genetic architecture of CAD, showing that genetic susceptibility to this common disease is largely determined by common SNPs of small effect size.
The Extended Language Network: A Meta-Analysis of Neuroimaging Studies on Text Comprehension
Ferstl, Evelyn C.; Neumann, Jane; Bogler, Carsten; von Cramon, D. Yves
2010-01-01
Language processing in context requires more than merely comprehending words and sentences. Important subprocesses are inferences for bridging successive utterances, the use of background knowledge and discourse context, and pragmatic interpretations. The functional neuroanatomy of these text comprehension processes has only recently been investigated. Although there is evidence for right-hemisphere contributions, reviews have implicated the left lateral prefrontal cortex, left temporal regions beyond Wernicke’s area, and the left dorso-medial prefrontal cortex (dmPFC) for text comprehension. To objectively confirm this extended language network and to evaluate the respective contribution of right hemisphere regions, meta-analyses of 23 neuroimaging studies are reported here. The analyses used replicator dynamics based on activation likelihood estimates. Independent of the baseline, the anterior temporal lobes (aTL) were active bilaterally. In addition, processing of coherent compared with incoherent text engaged the dmPFC and the posterior cingulate cortex. Right hemisphere activations were seen most notably in the analysis of contrasts testing specific subprocesses, such as metaphor comprehension. These results suggest task dependent contributions for the lateral PFC and the right hemisphere. Most importantly, they confirm the role of the aTL and the fronto-medial cortex for language processing in context. PMID:17557297
Lyzwinski, Lynnette Nathalie
2014-06-30
Overweight and obesity constitute leading global public health challenges. Tackling overweight and obesity by influencing human behaviour is a complex task, requiring novel emerging health psychology interventions. The aims of this review will be to determine whether mobile devices induce weight loss and improvements in diet and physical activity levels when compared with standard controls without a weight loss intervention or controls allocated to non-mobile device weight loss interventions. A systematic review on mobile devices and weight loss was conducted. The inclusion criteria were all randomized controlled trials with baseline and post-intervention weight measures in adult subjects >18 years of age without pre-specified co-morbidities. Mobile device specifications included modern, portable devices in the form of smartphones, PDAs, iPods, and Mp3 players. Cohen's d for standardized differences in mean weight loss was calculated. A random effects meta-analysis was generated using Comprehensive meta-analysis software. Theories and intervention content were coded and analysed. A total of 17 studies were identified, of which 12 were primary trials and 5 were secondary analyses. The meta-analysis generated a medium significant effect size of 0.430 (95% CI 0.252-0.609) (p-value ≤ 0.01), favouring mobile interventions. Throughout the systematic review, mobile devices were found to induce weight loss relative to baseline weight. When comparing them with standard no intervention controls as well as controls receiving non-mobile weight loss interventions, results favoured mobile devices for weight loss. Reductions in Body mass index, waist circumference, and percentage body fat were also found in the review. Improvements in the determinants of weight loss in the form of improved dietary intake and physical activity levels were also found. Theory appears to largely inform intervention design, with the most common theories being Social Cognitive Theory, Elaboration Likelihood Theory, Control Theory, and Goal Theory. The use of behavioural change techniques was widespread across the studies, with a minimum of five per intervention. Mobile devices appear to induce positive changes in the behavioural determinants of weight and subsequently are associated with weight loss. Mobile device interventions are heavily informed by theory and behaviour change techniques. The use of theory appears to effectively enhance levels of constructs targeted by interventions.
Helicobacter pylori and gastric mucin expression: A systematic review and meta-analysis.
Niv, Yaron
2015-08-21
To investigate the relationship between Helicobacter pylori (H. pylori) and mucin expression in gastric mucosa. English Medical literature searches were conducted for gastric mucin expression in H. pylori infected people vs uninfected people. Searches were performed up to December 31(th) 2014, using MEDLINE, PubMed, EMBASE, Scopus, and CENTRAL. Studies comparing mucin expression in the gastric mucosa in patients positive and negative for H. pylori infection, were included. Meta-analysis was performed by using Comprehensive meta-analysis software (Version 3, Biostat Inc., Englewood, NJ, United States). Pooled odds ratios (ORs) and 95% confidence intervals (CIs) were calculated compared mucin expression in individual studies by using the random effects model. Heterogeneity between studies was evaluated using the Cochran Q-test, and it was considered to be present if the Q-test P value was less than 0.10. I(2) statistic was used to measure the proportion of inconsistency in individual studies, with I(2) > 50% representing substantial heterogeneity. We also calculated a potential publication bias. Eleven studies, which represent 53 sub-studies of 15 different kinds of mucin expression, were selected according to the inclusion criteria. Every kind of mucin has been considered as one study. When a specific mucin has been studied in more than one paper, we combined the results in a nested meta-analysis of this particular mucin: MUC2, MUC6, STn, Paradoxical con A, Tn, T, Type 1 chain mucin, LeA, SLeA, LeB, AB-PAS, MUC1, and MUC5AC. The odds ratio of mucin expression in random analysis was 2.33, 95%CI: 1.230-4.411, P = 0.009, higher expression in H. pylori infected patients. Odds ratio for mucin expression in H. pylori positive patients was higher for MUC6 (9.244, 95%CI: 1.567-54.515, P = 0.014), and significantly lower for MUC5AC (0.447, 95%CI: 0.211-0.949, P = 0.036). Thus, H. pylori infection may increase MUC6 expression and decrease MUC5AC expression by 924% and 52%, respectively. H. pylori inhibits MUC5AC expression in the gastric epithelium, and facilitates colonization. In contrast, increased MUC6 expression may help inhibiting colonization, using MUC6 antibiotics properties.
Helicobacter pylori and gastric mucin expression: A systematic review and meta-analysis
Niv, Yaron
2015-01-01
AIM: To investigate the relationship between Helicobacter pylori (H. pylori) and mucin expression in gastric mucosa. METHODS: English Medical literature searches were conducted for gastric mucin expression in H. pylori infected people vs uninfected people. Searches were performed up to December 31th 2014, using MEDLINE, PubMed, EMBASE, Scopus, and CENTRAL. Studies comparing mucin expression in the gastric mucosa in patients positive and negative for H. pylori infection, were included. Meta-analysis was performed by using Comprehensive meta-analysis software (Version 3, Biostat Inc., Englewood, NJ, United States). Pooled odds ratios (ORs) and 95% confidence intervals (CIs) were calculated compared mucin expression in individual studies by using the random effects model. Heterogeneity between studies was evaluated using the Cochran Q-test, and it was considered to be present if the Q-test P value was less than 0.10. I2 statistic was used to measure the proportion of inconsistency in individual studies, with I2 > 50% representing substantial heterogeneity. We also calculated a potential publication bias. RESULTS: Eleven studies, which represent 53 sub-studies of 15 different kinds of mucin expression, were selected according to the inclusion criteria. Every kind of mucin has been considered as one study. When a specific mucin has been studied in more than one paper, we combined the results in a nested meta-analysis of this particular mucin: MUC2, MUC6, STn, Paradoxical con A, Tn, T, Type 1 chain mucin, LeA, SLeA, LeB, AB-PAS, MUC1, and MUC5AC. The odds ratio of mucin expression in random analysis was 2.33, 95%CI: 1.230-4.411, P = 0.009, higher expression in H. pylori infected patients. Odds ratio for mucin expression in H. pylori positive patients was higher for MUC6 (9.244, 95%CI: 1.567-54.515, P = 0.014), and significantly lower for MUC5AC (0.447, 95%CI: 0.211-0.949, P = 0.036). Thus, H. pylori infection may increase MUC6 expression and decrease MUC5AC expression by 924% and 52%, respectively. CONCLUSION: H. pylori inhibits MUC5AC expression in the gastric epithelium, and facilitates colonization. In contrast, increased MUC6 expression may help inhibiting colonization, using MUC6 antibiotics properties. PMID:26309370
Lyzwinski, Lynnette Nathalie
2014-01-01
Introduction: Overweight and obesity constitute leading global public health challenges. Tackling overweight and obesity by influencing human behaviour is a complex task, requiring novel emerging health psychology interventions. The aims of this review will be to determine whether mobile devices induce weight loss and improvements in diet and physical activity levels when compared with standard controls without a weight loss intervention or controls allocated to non-mobile device weight loss interventions. Methods: A systematic review on mobile devices and weight loss was conducted. The inclusion criteria were all randomized controlled trials with baseline and post-intervention weight measures in adult subjects >18 years of age without pre-specified co-morbidities. Mobile device specifications included modern, portable devices in the form of smartphones, PDAs, iPods, and Mp3 players. Cohen’s d for standardized differences in mean weight loss was calculated. A random effects meta-analysis was generated using Comprehensive meta-analysis software. Theories and intervention content were coded and analysed. Results: A total of 17 studies were identified, of which 12 were primary trials and 5 were secondary analyses. The meta-analysis generated a medium significant effect size of 0.430 (95% CI 0.252–0.609) (p-value ≤ 0.01), favouring mobile interventions. Throughout the systematic review, mobile devices were found to induce weight loss relative to baseline weight. When comparing them with standard no intervention controls as well as controls receiving non-mobile weight loss interventions, results favoured mobile devices for weight loss. Reductions in Body mass index, waist circumference, and percentage body fat were also found in the review. Improvements in the determinants of weight loss in the form of improved dietary intake and physical activity levels were also found. Theory appears to largely inform intervention design, with the most common theories being Social Cognitive Theory, Elaboration Likelihood Theory, Control Theory, and Goal Theory. The use of behavioural change techniques was widespread across the studies, with a minimum of five per intervention. Conclusion: Mobile devices appear to induce positive changes in the behavioural determinants of weight and subsequently are associated with weight loss. Mobile device interventions are heavily informed by theory and behaviour change techniques. The use of theory appears to effectively enhance levels of constructs targeted by interventions. PMID:25563356
MetaMetaDB: a database and analytic system for investigating microbial habitability.
Yang, Ching-chia; Iwasaki, Wataru
2014-01-01
MetaMetaDB (http://mmdb.aori.u-tokyo.ac.jp/) is a database and analytic system for investigating microbial habitability, i.e., how a prokaryotic group can inhabit different environments. The interaction between prokaryotes and the environment is a key issue in microbiology because distinct prokaryotic communities maintain distinct ecosystems. Because 16S ribosomal RNA (rRNA) sequences play pivotal roles in identifying prokaryotic species, a system that comprehensively links diverse environments to 16S rRNA sequences of the inhabitant prokaryotes is necessary for the systematic understanding of the microbial habitability. However, existing databases are biased to culturable prokaryotes and exhibit limitations in the comprehensiveness of the data because most prokaryotes are unculturable. Recently, metagenomic and 16S rRNA amplicon sequencing approaches have generated abundant 16S rRNA sequence data that encompass unculturable prokaryotes across diverse environments; however, these data are usually buried in large databases and are difficult to access. In this study, we developed MetaMetaDB (Meta-Metagenomic DataBase), which comprehensively and compactly covers 16S rRNA sequences retrieved from public datasets. Using MetaMetaDB, users can quickly generate hypotheses regarding the types of environments a prokaryotic group may be adapted to. We anticipate that MetaMetaDB will improve our understanding of the diversity and evolution of prokaryotes.
Relaxation training for anxiety: a ten-years systematic review with meta-analysis.
Manzoni, Gian Mauro; Pagnini, Francesco; Castelnuovo, Gianluca; Molinari, Enrico
2008-06-02
Relaxation training is a common treatment for anxiety problems. Lacking is a recent quantitative meta-analysis that enhances understanding of the variability and clinical significance of anxiety reduction outcomes after relaxation treatment. All studies (1997-2007), both RCT, observational and without control group, evaluating the efficacy of relaxation training (Jacobson's progressive relaxation, autogenic training, applied relaxation and meditation) for anxiety problems and disorders were identified by comprehensive electronic searches with Pubmed, Psychinfo and Cochrane Registers, by checking references of relevant studies and of other reviews. Our primary outcome was anxiety measured with psychometric questionnaires. Meta-analysis was undertaken synthesizing the data from all trials, distinguishing within and between effect sizes. 27 studies qualified for the inclusion in the meta-analysis. As hypothesized, relaxation training showed a medium-large effect size in the treatment of anxiety. Cohen's d was .57 (95% CI: .52 to .68) in the within analysis and .51 (95% CI: .46 to .634) in the between group analysis. Efficacy was higher for meditation, among volunteers and for longer treatments. Implications and limitations are discussed. The results show consistent and significant efficacy of relaxation training in reducing anxiety. This meta-analysis extends the existing literature through facilitation of a better understanding of the variability and clinical significance of anxiety improvement subsequent to relaxation training.
Therapeutic effects of Lactobacillus in treating irritable bowel syndrome: a meta-analysis.
Tiequn, Bian; Guanqun, Chao; Shuo, Zhang
2015-01-01
As the lack of reliable treatment for irritable bowel syndrome (IBS) prompts interest in the development of new therapies, we aimed to systematically evaluate the effect of Lactobacillus in treating this disease. We searched MEDLIINE, PubMed, Scopus, Web of Science and the Cochrane Central Register of Controlled Trials for the period from 1966 to August 2013 for double-blind, placebo-controlled trials investigating the efficacy of Lactobacillus treatment in the management of IBS. The studies were screened for inclusion based on randomization, controls and reported measurable outcomes. We used the Jadad score to assess the quality of the articles. The STATA 11.0 and Revman 5.0 software packages were used for the meta-analysis. The STATA 11.0 software program was also used to assess indicators of publication bias according to Begg's and Egger's tests. Six randomized, placebo-controlled clinical trials met the criteria and were included in the meta-analysis. The Jadad score of the articles was >3, and three articles were of high quality. We analyzed the heterogeneity of the studies and found no heterogeneity in the meta-analysis. In the forest plot, the diamond was on the right side of the vertical line and did not intersect with the line. The pooled relative risk for clinical improvement with Lactobacillus treatment was 7.69 (95% confidence interval: 2.33-25.43, p=0.0008). For adults, the pooled relative risk for clinical improvement with Lactobacillus treatment was 17.62 (95% confidence interval: 5.12-60.65, p<0.00001). For children, the pooled relative risk for clinical improvement with Lactobacillus treatment was 3.71 (95% confidence interval:1.05-13.11, p=0.04). Using the STATA 10.0 and Revman 5.0 software programs, we confirmed that Lactobacillus exhibited significant efficacy in treating IBS. Compared with the placebo, Lactobacillus treatment was found to be associated with a significantly higher rate of treatment responders in the overall population with IBS, without any side effects. As to limitations of the analysis, additional research is needed.
Petrou, Stavros; Kwon, Joseph; Madan, Jason
2018-05-10
Economic analysts are increasingly likely to rely on systematic reviews and meta-analyses of health state utility values to inform the parameter inputs of decision-analytic modelling-based economic evaluations. Beyond the context of economic evaluation, evidence from systematic reviews and meta-analyses of health state utility values can be used to inform broader health policy decisions. This paper provides practical guidance on how to conduct a systematic review and meta-analysis of health state utility values. The paper outlines a number of stages in conducting a systematic review, including identifying the appropriate evidence, study selection, data extraction and presentation, and quality and relevance assessment. The paper outlines three broad approaches that can be used to synthesise multiple estimates of health utilities for a given health state or condition, namely fixed-effect meta-analysis, random-effects meta-analysis and mixed-effects meta-regression. Each approach is illustrated by a synthesis of utility values for a hypothetical decision problem, and software code is provided. The paper highlights a number of methodological issues pertinent to the conduct of meta-analysis or meta-regression. These include the importance of limiting synthesis to 'comparable' utility estimates, for example those derived using common utility measurement approaches and sources of valuation; the effects of reliance on limited or poorly reported published data from primary utility assessment studies; the use of aggregate outcomes within analyses; approaches to generating measures of uncertainty; handling of median utility values; challenges surrounding the disentanglement of utility estimates collected serially within the context of prospective observational studies or prospective randomised trials; challenges surrounding the disentanglement of intervention effects; and approaches to measuring model validity. Areas of methodological debate and avenues for future research are highlighted.
Classifying oxidative stress by F2-isoprostane levels across human diseases: A meta-analysis.
van 't Erve, Thomas J; Kadiiska, Maria B; London, Stephanie J; Mason, Ronald P
2017-08-01
The notion that oxidative stress plays a role in virtually every human disease and environmental exposure has become ingrained in everyday knowledge. However, mounting evidence regarding the lack of specificity of biomarkers traditionally used as indicators of oxidative stress in human disease and exposures now necessitates re-evaluation. To prioritize these re-evaluations, published literature was comprehensively analyzed in a meta-analysis to quantitatively classify the levels of systemic oxidative damage across human disease and in response to environmental exposures. In this meta-analysis, the F 2 -isoprostane, 8-iso-PGF 2α , was specifically chosen as the representative marker of oxidative damage. To combine published values across measurement methods and specimens, the standardized mean differences (Hedges' g) in 8-iso-PGF 2α levels between affected and control populations were calculated. The meta-analysis resulted in a classification of oxidative damage levels as measured by 8-iso-PGF 2α across 50 human health outcomes and exposures from 242 distinct publications. Relatively small increases in 8-iso-PGF 2α levels (g<0.8) were found in the following conditions: hypertension (g=0.4), metabolic syndrome (g=0.5), asthma (g=0.4), and tobacco smoking (g=0.7). In contrast, large increases in 8-iso-PGF 2α levels were observed in pathologies of the kidney, e.g., chronic renal insufficiency (g=1.9), obstructive sleep apnoea (g=1.1), and pre-eclampsia (g=1.1), as well as respiratory tract disorders, e.g., cystic fibrosis (g=2.3). In conclusion, we have established a quantitative classification for the level of 8-iso-PGF 2α generation in different human pathologies and exposures based on a comprehensive meta-analysis of published data. This analysis provides knowledge on the true involvement of oxidative damage across human health outcomes as well as utilizes past research to prioritize those conditions requiring further scrutiny on the mechanisms of biomarker generation. Copyright © 2017. Published by Elsevier B.V.
Meader, Nicholas; Semaan, Salaam; Halton, Marie; Bhatti, Henna; Chan, Melissa; Llewellyn, Alexis; Des Jarlais, Don C
2013-07-01
This systematic review and meta-analysis examines the effectiveness of multisession psychosocial interventions compared with educational interventions and minimal interventions in reducing sexual risk in people who use drugs (51 studies; 19,209 participants). We conducted comprehensive searches (MEDLINE, EMBASE, CINAHL, Cochrane Central Register of Controlled Trials and PsychINFO 1998-2012). Outcomes (unprotected sex, condom use, or a composite outcome) were extracted by two authors and synthesised using meta-analysis. Subgroup analyses and meta-regression were conducted to explore heterogeneity. Multisession psychosocial interventions had modest additional benefits compared to educational interventions (K = 46; OR 0.86; 95% CI 0.77, 0.96), and large positive effects compared to minimal interventions (K = 7; OR 0.60; 95% CI 0.46, 0.78). Comparison with previous meta-analyses suggested limited progress in recent years in developing more effective interventions. Multisession psychosocial and educational interventions provided similar modest sexual risk reduction justifying offering educational interventions in settings with limited exposure to sexual risk reduction interventions, messages, and resources.
Suicide by occupation: systematic review and meta-analysis.
Milner, Allison; Spittal, Matthew J; Pirkis, Jane; LaMontagne, Anthony D
2013-12-01
Previous research has shown that those employed in certain occupations, such as doctors and farmers, have an elevated risk of suicide, yet little research has sought to synthesise these findings across working-age populations. To summarise published research in this area through systematic review and meta-analysis. Random effects meta-analyses were used to calculate a pooled risk of suicide across occupational skill-level groups. Thirty-four studies were included in the meta-analysis. Elementary professions (e.g. labourers and cleaners) were at elevated risk compared with the working-age population (rate ratio (RR) = 1.84, 95% CI 1.46-2.33), followed by machine operators and deck crew (RR = 1.78, 95% CI 1.22-2.60) and agricultural workers (RR = 1.64, 95% CI 1.19-2.28). Results suggested a stepwise gradient in risk, with the lowest skilled occupations being at greater risk of suicide than the highest skill-level group. This is the first comprehensive meta-analytical review of suicide and occupation. There is a need for future studies to investigate explanations for the observed skill-level differences, particularly in people employed in lower skill-level groups.
Multivariate meta-analysis using individual participant data.
Riley, R D; Price, M J; Jackson, D; Wardle, M; Gueyffier, F; Wang, J; Staessen, J A; White, I R
2015-06-01
When combining results across related studies, a multivariate meta-analysis allows the joint synthesis of correlated effect estimates from multiple outcomes. Joint synthesis can improve efficiency over separate univariate syntheses, may reduce selective outcome reporting biases, and enables joint inferences across the outcomes. A common issue is that within-study correlations needed to fit the multivariate model are unknown from published reports. However, provision of individual participant data (IPD) allows them to be calculated directly. Here, we illustrate how to use IPD to estimate within-study correlations, using a joint linear regression for multiple continuous outcomes and bootstrapping methods for binary, survival and mixed outcomes. In a meta-analysis of 10 hypertension trials, we then show how these methods enable multivariate meta-analysis to address novel clinical questions about continuous, survival and binary outcomes; treatment-covariate interactions; adjusted risk/prognostic factor effects; longitudinal data; prognostic and multiparameter models; and multiple treatment comparisons. Both frequentist and Bayesian approaches are applied, with example software code provided to derive within-study correlations and to fit the models. © 2014 The Authors. Research Synthesis Methods published by John Wiley & Sons, Ltd.
Catalani, Simona; Berra, Alessandro; Tomasi, Cesare; Romano, Canzio; Pira, Enrico; Garzaro, Giacomo; Apostoli, Pietro
2015-01-01
In recent years, due to the need to elaborate the amount of information available from the scientific literature, the meta-analyses and systematic reviews have become very numerous. The meta-analyses are carried out to evaluate the association between two events when single researches haven't provided comprehensive data. On the other hand, a good meta-analysis must satisfy certain criteria, from the selection of the studies until the evaluation of the outcomes; to this purpose, the application of methods for quality assessment is a crucial point to obtain data of adequate reliability. The aim of this review is to give some introductory tools for a critical approach to meta-analyses and systematic reviews, which have become useful instruments also in occupational medicine.
Zhang, Li; Tang, Min; Min, Zhiqian; Lu, Jun; Lei, Xiaoyan; Zhang, Xiaoling
2016-06-01
Magnetic resonance imaging (MRI) is increasingly being used to examine patients with suspected breast cancer. To determine the diagnostic performance of combined dynamic contrast-enhanced magnetic resonance imaging (DCE-MRI) and diffusion-weighted imaging (DWI) for breast cancer detection. A comprehensive search of the PUBMED, EMBASE, Web of Science, and Cochrane Library databases was performed up to September 2014. Statistical analysis included pooling of sensitivity and specificity, positive likelihood ratio (PLR), negative likelihood ratio (NLR), diagnostic odds ratio (DOR), and diagnostic accuracy using the summary receiver operating characteristic (SROC). All analyses were conducted using STATA (version 12.0), RevMan (version 5.2), and Meta-Disc 1.4 software programs. Fourteen studies were analyzed, which included a total of 1140 patients with 1276 breast lesions. The pooled sensitivity and specificity of combined DCE-MRI and DWI were 91.6% and 85.5%, respectively. The pooled sensitivity and specificity of DWI-MRI were 86.0% and 75.6%, respectively. The pooled sensitivity and specificity of DCE-MRI were 93.2% and 71.1%. The area under the SROC curve (AUC-SROC) of combined DCE-MRI and DWI was 0.94, the DCE-MRI of 0.85. Deeks testing confirmed no significant publication bias in all studies. Combined DCE-MRI and DWI had superior diagnostic accuracy than either DCE-MRI or DWI alone for the diagnosis of breast cancer. © The Foundation Acta Radiologica 2015.
Little, Callie W; Haughbrook, Rasheda; Hart, Sara A
2016-01-01
Numerous twin studies have been published examining the genetic and environmental etiology of reading comprehension, though the etiological estimates may be influenced currently unidentified sample conditions (e.g., Tucker-Drob & Bates, 2015). The purpose of the current meta-analysis was to average the etiological influences of reading comprehension and to explore the potential moderators that may be influencing these estimates. Results revealed an average heritability estimate of h2 = .59, with significant variation in estimates across studies, suggesting potential moderation. Heritability was moderated by publication year, grade level, project, zygosity determination method, and response type. The average shared environmental estimate was c2 = .16, with publication year, grade and zygosity determination method acting as significant moderators. These findings support the large role of genetic influences on reading comprehension, and a small but significant role of shared environmental influences. The significant moderators of etiological influences within the current synthesis suggest our interpretation of how genes and environment influence reading comprehension should reflect aspects of study and sample. PMID:27630039
Prevalence of aggression in hospitalized patients with schizophrenia in China: A meta-analysis.
Zhou, Jian-Song; Zhong, Bao-Liang; Xiang, Yu-Tao; Chen, Qiongni; Cao, Xiao-Lan; Correll, Christoph U; Ungvari, Gabor S; Chiu, Helen F K; Lai, Kelly Y C; Wang, Xiao-Ping
2016-03-01
Aggression is a major concern in psychiatric inpatient care. Variations in study designs, settings, populations and data collection methods render comparisons of the prevalence of aggressive behavior in high-risk settings difficult. We proposed to estimate the pooled prevalence of aggression among inpatients with schizophrenia in China. Reports on aggressive behaviour involving physical contact or risks of interpersonal violence, in schizophrenia in Chinese general psychiatric wards were retrieved by using computer-assisted searches and manual searches of the reference lists of the relevant literature. Statistical analyses were conducted using the Comprehensive Meta-Analysis V2 software. Potential sources of heterogeneity were analyzed with Cochrane's Q analysis. The search yielded 19 eligible studies involving a total of 3,941 schizophrenia patients. The prevalence of aggressive behavior in psychiatric wards ranged between 15.3% and 53.2%. The pooled prevalence of aggression was 35.4% (95% CI: 29.7%, 41.4%). The most commonly reported significant risk factors for aggression were positive psychotic symptoms: hostility or suspiciousness, 78.9% (15 studies); delusions, 63.2% (12 studies); disorganized behavior, 26.3% (5 studies); and auditory hallucinations, 10.5% (2 studies); together with: past history of aggression, 42.1% (8 studies); and involuntary admission, 10.5% (2 studies). Aggressive behaviour is common in Chinese inpatients with schizophrenia. The prevalence figures indicate the need to identify reliable clinical and illness predictors for aggression in inpatient psychiatric wards and to test investigations aimed at reducing aggressive episodes and their adverse outcomes. © 2015 Wiley Publishing Asia Pty Ltd.
Less is less: a systematic review of graph use in meta-analyses.
Schild, Anne H E; Voracek, Martin
2013-09-01
Graphs are an essential part of scientific communication. Complex datasets, of which meta-analyses are textbook examples, benefit the most from visualization. Although a number of graph options for meta-analyses exist, the extent to which these are used was hitherto unclear. A systematic review on graph use in meta-analyses in three disciplines (medicine, psychology, and business) and nine journals was conducted. Interdisciplinary differences, which are mirrored in the respective journals, were revealed, that is, graph use correlates with external factors rather than methodological considerations. There was only limited variation in graph types (with forest plots as the most important representatives), and diagnostic plots were very rare. Although an increase in graph use over time could be observed, it is unlikely that this phenomenon is specific to meta-analyses. There is a gaping discrepancy between available graphic methods and their application in meta-analyses. This may be rooted in a number of factors, namely, (i) insufficient dissemination of new developments, (ii) unsatisfactory implementation in software packages, and (iii) minor attention on graphics in meta-analysis reporting guidelines. Using visualization methods to their full capacity is a further step in using meta-analysis to its full potential. Copyright © 2013 John Wiley & Sons, Ltd.
Enhanced semantic interoperability by profiling health informatics standards.
López, Diego M; Blobel, Bernd
2009-01-01
Several standards applied to the healthcare domain support semantic interoperability. These standards are far from being completely adopted in health information system development, however. The objective of this paper is to provide a method and suggest the necessary tooling for reusing standard health information models, by that way supporting the development of semantically interoperable systems and components. The approach is based on the definition of UML Profiles. UML profiling is a formal modeling mechanism to specialize reference meta-models in such a way that it is possible to adapt those meta-models to specific platforms or domains. A health information model can be considered as such a meta-model. The first step of the introduced method identifies the standard health information models and tasks in the software development process in which healthcare information models can be reused. Then, the selected information model is formalized as a UML Profile. That Profile is finally applied to system models, annotating them with the semantics of the information model. The approach is supported on Eclipse-based UML modeling tools. The method is integrated into a comprehensive framework for health information systems development, and the feasibility of the approach is demonstrated in the analysis, design, and implementation of a public health surveillance system, reusing HL7 RIM and DIMs specifications. The paper describes a method and the necessary tooling for reusing standard healthcare information models. UML offers several advantages such as tooling support, graphical notation, exchangeability, extensibility, semi-automatic code generation, etc. The approach presented is also applicable for harmonizing different standard specifications.
Processes that Inform Multicultural Supervision: A Qualitative Meta-Analysis.
Tohidian, Nilou B; Quek, Karen Mui-Teng
2017-10-01
As the fields of counseling and psychotherapy have become more cognizant that individuals, couples, and families bring with them a myriad of diversity factors into therapy, multicultural competency has also become a crucial component in the development of clinicians during clinical supervision and training. We employed a qualitative meta-analysis to provide a detailed and comprehensive description of similar themes identified in primary qualitative studies that have investigated supervisory practices with an emphasis on diversity. Findings revealed six meta-categories, namely: (a) Supervisor's Multicultural Stances; (b) Supervisee's Multicultural Encounters; (c) Competency-Based Content in Supervision; (d) Processes Surrounding Multicultural Supervision; (e) Culturally Attuned Interventions; and (f) Multicultural Supervisory Alliance. Implications for practice are discussed. © 2017 American Association for Marriage and Family Therapy.
dbMDEGA: a database for meta-analysis of differentially expressed genes in autism spectrum disorder.
Zhang, Shuyun; Deng, Libin; Jia, Qiyue; Huang, Shaoting; Gu, Junwang; Zhou, Fankun; Gao, Meng; Sun, Xinyi; Feng, Chang; Fan, Guangqin
2017-11-16
Autism spectrum disorders (ASD) are hereditary, heterogeneous and biologically complex neurodevelopmental disorders. Individual studies on gene expression in ASD cannot provide clear consensus conclusions. Therefore, a systematic review to synthesize the current findings from brain tissues and a search tool to share the meta-analysis results are urgently needed. Here, we conducted a meta-analysis of brain gene expression profiles in the current reported human ASD expression datasets (with 84 frozen male cortex samples, 17 female cortex samples, 32 cerebellum samples and 4 formalin fixed samples) and knock-out mouse ASD model expression datasets (with 80 collective brain samples). Then, we applied R language software and developed an interactive shared and updated database (dbMDEGA) displaying the results of meta-analysis of data from ASD studies regarding differentially expressed genes (DEGs) in the brain. This database, dbMDEGA ( https://dbmdega.shinyapps.io/dbMDEGA/ ), is a publicly available web-portal for manual annotation and visualization of DEGs in the brain from data from ASD studies. This database uniquely presents meta-analysis values and homologous forest plots of DEGs in brain tissues. Gene entries are annotated with meta-values, statistical values and forest plots of DEGs in brain samples. This database aims to provide searchable meta-analysis results based on the current reported brain gene expression datasets of ASD to help detect candidate genes underlying this disorder. This new analytical tool may provide valuable assistance in the discovery of DEGs and the elucidation of the molecular pathogenicity of ASD. This database model may be replicated to study other disorders.
Comprehensive Quantitative Analysis on Privacy Leak Behavior
Fan, Lejun; Wang, Yuanzhuo; Jin, Xiaolong; Li, Jingyuan; Cheng, Xueqi; Jin, Shuyuan
2013-01-01
Privacy information is prone to be leaked by illegal software providers with various motivations. Privacy leak behavior has thus become an important research issue of cyber security. However, existing approaches can only qualitatively analyze privacy leak behavior of software applications. No quantitative approach, to the best of our knowledge, has been developed in the open literature. To fill this gap, in this paper we propose for the first time four quantitative metrics, namely, possibility, severity, crypticity, and manipulability, for privacy leak behavior analysis based on Privacy Petri Net (PPN). In order to compare the privacy leak behavior among different software, we further propose a comprehensive metric, namely, overall leak degree, based on these four metrics. Finally, we validate the effectiveness of the proposed approach using real-world software applications. The experimental results demonstrate that our approach can quantitatively analyze the privacy leak behaviors of various software types and reveal their characteristics from different aspects. PMID:24066046
Comprehensive quantitative analysis on privacy leak behavior.
Fan, Lejun; Wang, Yuanzhuo; Jin, Xiaolong; Li, Jingyuan; Cheng, Xueqi; Jin, Shuyuan
2013-01-01
Privacy information is prone to be leaked by illegal software providers with various motivations. Privacy leak behavior has thus become an important research issue of cyber security. However, existing approaches can only qualitatively analyze privacy leak behavior of software applications. No quantitative approach, to the best of our knowledge, has been developed in the open literature. To fill this gap, in this paper we propose for the first time four quantitative metrics, namely, possibility, severity, crypticity, and manipulability, for privacy leak behavior analysis based on Privacy Petri Net (PPN). In order to compare the privacy leak behavior among different software, we further propose a comprehensive metric, namely, overall leak degree, based on these four metrics. Finally, we validate the effectiveness of the proposed approach using real-world software applications. The experimental results demonstrate that our approach can quantitatively analyze the privacy leak behaviors of various software types and reveal their characteristics from different aspects.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pachuilo, Andrew R; Ragan, Eric; Goodall, John R
Visualization tools can take advantage of multiple coordinated views to support analysis of large, multidimensional data sets. Effective design of such views and layouts can be challenging, but understanding users analysis strategies can inform design improvements. We outline an approach for intelligent design configuration of visualization tools with multiple coordinated views, and we discuss a proposed software framework to support the approach. The proposed software framework could capture and learn from user interaction data to automate new compositions of views and widgets. Such a framework could reduce the time needed for meta analysis of the visualization use and lead tomore » more effective visualization design.« less
Tighe, Elizabeth L; Schatschneider, Christopher
2016-07-01
The current study employed a meta-analytic approach to investigate the relative importance of component reading skills to reading comprehension in struggling adult readers. A total of 10 component skills were consistently identified across 16 independent studies and 2,707 participants. Random effects models generated 76 predictor-reading comprehension effect sizes among the 10 constructs. The results indicated that six of the component skills exhibited strong relationships with reading comprehension (average rs ≥ .50): morphological awareness, language comprehension, fluency, oral vocabulary knowledge, real word decoding, and working memory. Three of the component skills yielded moderate relationships with reading comprehension (average rs ≥ .30 and < .50): pseudoword decoding, orthographic knowledge, and phonological awareness. Rapid automatized naming (RAN) was the only component skill that was weakly related to reading comprehension (r = .15). Morphological awareness was a significantly stronger correlate of reading comprehension than phonological awareness and RAN. This study provides the first attempt at a systematic synthesis of the recent research investigating the reading skills of adults with low literacy skills, a historically understudied population. Directions for future research, the relation of our results to the children's literature, and the implications for researchers and adult basic education programs are discussed. © Hammill Institute on Disabilities 2014.
Tighe, Elizabeth L.; Schatschneider, Christopher
2015-01-01
The current study employed a meta-analytic approach to investigate the relative importance of component reading skills to reading comprehension in struggling adult readers. A total of 10 component skills were consistently identified across 16 independent studies and 2,707 participants. Random effects models generated 76 predictor-reading comprehension effect sizes among the 10 constructs. The results indicated that six of the component skills exhibited strong relationships with reading comprehension (average rs ≥ .50): morphological awareness, language comprehension, fluency, oral vocabulary knowledge, real word decoding, and working memory. Three of the component skills yielded moderate relationships with reading comprehension (average rs ≥ .30 and < .50): pseudoword decoding, orthographic knowledge, and phonological awareness. Rapid automatized naming (RAN) was the only component skill that was weakly related to reading comprehension (r = .15). Morphological awareness was a significantly stronger correlate of reading comprehension than phonological awareness and RAN. This study provides the first attempt at a systematic synthesis of the recent research investigating the reading skills of adults with low literacy skills, a historically under-studied population. Directions for future research, the relation of our results to the children’s literature, and the implications for researchers and Adult Basic Education (ABE) programs are discussed. PMID:25350926
Zhu, Alyssa; Benzon, Hubert A; Anderson, T Anthony
2017-11-01
While a large number of studies has examined the efficacy of opioid-sparing analgesics in adult surgical populations, fewer studies are available to guide postoperative pain treatment in pediatric patients. We systematically reviewed available publications on the use of systemic nonopioid agents for postoperative analgesia in pediatric surgical populations. A comprehensive literature search identified meta-analyses and randomized controlled trials (RCTs) assessing the effects of systemic, nonopioid agents on postoperative narcotic requirements or pain scores in pediatric surgical populations. If a meta-analysis was located, we summarized its results and any RCTs published after it. We located and reviewed 11 acetaminophen RCTs, 1 nonsteroidal anti-inflammatory drug (NSAID) meta-analysis, 2 NSAID RCTs, 1 dexamethasone meta-analysis, 3 dexamethasone RCTs, 2 ketamine meta-analyses, 5 ketamine RCTs, 2 gabapentin RCTs, 1 clonidine meta-analysis, 3 magnesium RCTs, 2 dexmedetomidine meta-analyses, and 1 dextromethorphan RCT. No meta-analyses or RCTs were found assessing the perioperative efficacy of intravenous lidocaine, amantadine, pregabalin, esmolol, or caffeine in pediatric surgical patients. The available evidence is limited, but suggests that perioperative acetaminophen, NSAIDs, dexamethasone, ketamine, clonidine, and dexmedetomidine may decrease postoperative pain and opioid consumption in some pediatric surgical populations. Not enough, or no, data exist from which to draw conclusions on the perioperative use of gabapentin, magnesium, dextromethorphan, lidocaine, amantadine, pregabalin, esmolol, and caffeine in pediatric surgical patients. Further pharmacokinetic and pharmacodynamics studies to establish both the clinical benefit and efficacy of nonopioid analgesia in pediatric populations are needed.
Sun, Jian; Zhang, Lei; Cui, Jing; Li, Shanshan; Lu, Hongting; Zhang, Yong; Li, Haiming; Sun, Jianping; Baloch, Zulqarnain
2018-05-10
Previous studies have shown beneficial effects of dietary approaches for iron deficiency anemia (IDA) control. This study was design to investigate the effect of dietary intervention treatment on children with iron deficiency anemia. We performed a systematic review of published dietary interventions effect on IDA treatment through meta-analysis. CBM, CNKI, Wanfang database, EMBASE, VIP, PubMed and Web of science database were searched to identify studies published between January, 1980 and December, 2016. Statistical analysis was performed by Revmen5.2 software. Initially we retrieved for 373 studies, and then 6 studies with a total of 676 individuals were included in the analysis according to the inclusion and exclusion criteria for meta-analysis. The overall pooled estimate of odds ratio [(OR), 95% confidence intervals (95% CI)] in the dietary intervention on children with iron deficiency anemia was 6.54 (95% CI: 3.48-12.31, Z = 5.82, p<0.001) and funnel plot is symmetric. Our meta-analysis suggested that dietary interventions are effective in improving the iron deficiency in children with iron deficiency anemia (IDA) and should be considered in the overall strategy of IDA management.
Rowley, Dane A; Rogish, Miles; Alexander, Timothy; Riggs, Kevin J
2017-01-01
Effective pragmatic comprehension of language is critical for successful communication and interaction, but this ability is routinely impaired following Traumatic Brain Injury (TBI) (1,2). Individual studies have investigated the cognitive domains associated with impaired pragmatic comprehension, but there remains little understanding of the relative importance of these domains in contributing to pragmatic comprehension impairment following TBI. This paper presents a systematic meta-analytic review of the observed correlations between pragmatic comprehension and cognitive processes following TBI. Five meta-analyses were computed, which quantified the relationship between pragmatic comprehension and five key cognitive constructs (declarative memory; working memory; attention; executive functions; social cognition). Significant moderate-to-strong correlations were found between all cognitive measures and pragmatic comprehension, where declarative memory was the strongest correlate. Thus, our findings indicate that pragmatic comprehension in TBI is associated with an array of domain general cognitive processes, and as such deficits in these cognitive domains may underlie pragmatic comprehension difficulties following TBI. The clinical implications of these findings are discussed.
Fruit and vegetable intake and prostate cancer risk: a meta-analysis.
Meng, Hongzhou; Hu, Wenyi; Chen, Zhaodian; Shen, Yuehong
2014-06-01
Recent reports have examined the effect of fruit and vegetable intake on the risk of prostate cancer, but the results are inconsistent. A meta-analysis of prospective studies was conducted to arrive at quantitative conclusions about the contribution of vegetable and fruit intake to the incidence of prostate cancer. A comprehensive, systematic search of medical literature published up to June 2012 was performed to identify relevant studies. Separate meta-analyses were conducted for fruit and vegetable consumption. The presence of publication bias was assessed using Egger and Begg tests. In total, 16 cohort studies met the inclusion criteria and were included in the meta-analysis. The combined adjusted relative risk comparing highest with lowest categories showed that there was no association between vegetable and fruit consumption and prostate cancer incidence. The pooled relative risk was 0.97 (95%CI 0.93, 1.01) for vegetables and 1.02 (95%CI 0.98, 1.07) for fruit. There is no heterogeneity between the studies. No publication bias was detected. This meta-analysis suggests that total fruit or vegetable consumption may not exert a protective role in the risk of prostate cancer. © 2013 Wiley Publishing Asia Pty Ltd.
A Meta-Analysis of Referential Communication Studies: A Computer Readable Literature Review.
ERIC Educational Resources Information Center
Dickson, W. Patrick; Moskoff, Mary
A computer-assisted analysis of studies on referential communication (giving directions/explanations) located 66 reports involving 80 experiments, 114 referential tasks, and over 6,200 individuals. The studies were entered into a statistical software package system (SPSS) and analyzed for characteristics of the subjects and experimental designs,…
Multivariate meta-analysis: potential and promise.
Jackson, Dan; Riley, Richard; White, Ian R
2011-09-10
The multivariate random effects model is a generalization of the standard univariate model. Multivariate meta-analysis is becoming more commonly used and the techniques and related computer software, although continually under development, are now in place. In order to raise awareness of the multivariate methods, and discuss their advantages and disadvantages, we organized a one day 'Multivariate meta-analysis' event at the Royal Statistical Society. In addition to disseminating the most recent developments, we also received an abundance of comments, concerns, insights, critiques and encouragement. This article provides a balanced account of the day's discourse. By giving others the opportunity to respond to our assessment, we hope to ensure that the various view points and opinions are aired before multivariate meta-analysis simply becomes another widely used de facto method without any proper consideration of it by the medical statistics community. We describe the areas of application that multivariate meta-analysis has found, the methods available, the difficulties typically encountered and the arguments for and against the multivariate methods, using four representative but contrasting examples. We conclude that the multivariate methods can be useful, and in particular can provide estimates with better statistical properties, but also that these benefits come at the price of making more assumptions which do not result in better inference in every case. Although there is evidence that multivariate meta-analysis has considerable potential, it must be even more carefully applied than its univariate counterpart in practice. Copyright © 2011 John Wiley & Sons, Ltd.
Meta-analysis of workplace physical activity interventions.
Conn, Vicki S; Hafdahl, Adam R; Cooper, Pamela S; Brown, Lori M; Lusk, Sally L
2009-10-01
Most adults do not achieve adequate physical activity levels. Despite the potential benefits of worksite health promotion, no previous comprehensive meta-analysis has summarized health and physical activity behavior outcomes from such programs. This comprehensive meta-analysis integrated the extant wide range of worksite physical activity intervention research. Extensive searching located published and unpublished intervention studies reported from 1969 through 2007. Results were coded from primary studies. Random-effects meta-analytic procedures, including moderator analyses, were completed in 2008. Effects on most variables were substantially heterogeneous because diverse studies were included. Standardized mean difference (d) effect sizes were synthesized across approximately 38,231 subjects. Significantly positive effects were observed for physical activity behavior (0.21); fitness (0.57); lipids (0.13); anthropometric measures (0.08); work attendance (0.19); and job stress (0.33). The significant effect size for diabetes risk (0.98) is less robust given small sample sizes. The mean effect size for fitness corresponds to a difference between treatment minus control subjects' means on VO2max of 3.5 mL/kg/min; for lipids, -0.2 on the ratio of total cholesterol to high-density lipoprotein; and for diabetes risk, -12.6 mg/dL on fasting glucose. These findings document that some workplace physical activity interventions can improve both health and important worksite outcomes. Effects were variable for most outcomes, reflecting the diversity of primary studies. Future primary research should compare interventions to confirm causal relationships and further explore heterogeneity.
Spedding, Simon
2014-01-01
Efficacy of Vitamin D supplements in depression is controversial, awaiting further literature analysis. Biological flaws in primary studies is a possible reason meta-analyses of Vitamin D have failed to demonstrate efficacy. This systematic review and meta-analysis of Vitamin D and depression compared studies with and without biological flaws. The systematic review followed the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) guidelines. The literature search was undertaken through four databases for randomized controlled trials (RCTs). Studies were critically appraised for methodological quality and biological flaws, in relation to the hypothesis and study design. Meta-analyses were performed for studies according to the presence of biological flaws. The 15 RCTs identified provide a more comprehensive evidence-base than previous systematic reviews; methodological quality of studies was generally good and methodology was diverse. A meta-analysis of all studies without flaws demonstrated a statistically significant improvement in depression with Vitamin D supplements (+0.78 CI +0.24, +1.27). Studies with biological flaws were mainly inconclusive, with the meta-analysis demonstrating a statistically significant worsening in depression by taking Vitamin D supplements (−1.1 CI −0.7, −1.5). Vitamin D supplementation (≥800 I.U. daily) was somewhat favorable in the management of depression in studies that demonstrate a change in vitamin levels, and the effect size was comparable to that of anti-depressant medication. PMID:24732019
A meta-analysis and review of holistic face processing.
Richler, Jennifer J; Gauthier, Isabel
2014-09-01
The concept of holistic processing is a cornerstone of face recognition research, yet central questions related to holistic processing remain unanswered, and debates have thus far failed to reach a resolution despite accumulating empirical evidence. We argue that a considerable source of confusion in this literature stems from a methodological problem. Specifically, 2 measures of holistic processing based on the composite paradigm (complete design and partial design) are used in the literature, but they often lead to qualitatively different results. First, we present a comprehensive review of the work that directly compares the 2 designs, and which clearly favors the complete design over the partial design. Second, we report a meta-analysis of holistic face processing according to both designs and use this as further evidence for one design over the other. The meta-analysis effect size of holistic processing in the complete design is nearly 3 times that of the partial design. Effect sizes were not correlated between measures, consistent with the suggestion that they do not measure the same thing. Our meta-analysis also examines the correlation between conditions in the complete design of the composite task, and suggests that in an individual differences context, little is gained by including a misaligned baseline. Finally, we offer a comprehensive review of the state of knowledge about holistic processing based on evidence gathered from the measure we favor based on the 1st sections of our review-the complete design-and outline outstanding research questions in that new context. PsycINFO Database Record (c) 2014 APA, all rights reserved.
Soy intake and breast cancer risk: A meta-analysis of epidemiological studies
NASA Astrophysics Data System (ADS)
Bahrom, Suhaila; Idris, Nik Ruzni Nik
2016-06-01
The impact of soy intake on breast cancer risk has been investigated extensively. However, these studies reported conflicting results. The objective of this study is to perform comprehensive review and updated meta-analysis on the association between soy intake and breast cancer risk and to identify significant factors which may contribute to the inconsistencies of results of the individual studies. Based on reviews of existing meta-analysis, we identified four main factors which contributed to the inconsistencies of results of individual studies on the association of soy intake and breast cancer risk namely; region, menopausal status of the patients, soy type and study design. Accordingly, we performed an updated meta-analysis of 57 studies grouped by the identified factors. Pooled ORs of studies carried out in Asian countries suggested that soy isoflavones consumption was inversely associated with the risk of breast cancer among both pre and postmenopausal women (OR=0.63, 95% CI: 0.54-0.74 for premenopausal women; OR=0.63, 95% CI: 0.52-0.75 for postmenopausal women). However, pooled OR of studies carried out in Western countries shows that there is no statistically significant association between soy intake and breast cancer risk (OR=0.98, 95% CI: 0.93-1.03). Our study suggests that soy food intake is associated with significantly reduced risk of breast cancer for women in Asian but not in Western countries. Further epidemiological studies need to be conducted with more comprehensive information about the dietary intake and relative exposure among the women in these two different regions.
Wang, Yiyang; Tang, Jun; Zhou, Feiya; Yang, Lei; Wu, Jianbin
2017-06-01
The aim of the current meta-analysis was to assess the treatment effect of comprehensive geriatric care in reducing acute perioperative delirium in older patients with hip fractures, compared with the effect of a routine orthopedic treatment protocol. We conducted a search of multiple databases to identify randomized controlled trials (RCTs) and quasi-RCTs comparing comprehensive geriatric care and routine orthopedic treatment regarding the following outcomes: incidence of delirium, assessment of cognitive status, and duration of delirium. Odds ratios (ORs) and mean differences (MDs) were pooled using either a fixed-effects or a random-effects model, depending on the heterogeneity of the trials included in the analysis. Six RCTs and 1 quasi-RCT provided data from 1840 patients. These data revealed that comprehensive geriatric care may reduce the incidence of perioperative delirium (OR = 0.71; 95% confidence interval [CI], 0.57-0.89; P = .003) and that it was associated with higher cognitive status during hospitalization or at 1 month postoperatively (MD = 1.03; 95% CI, 0.93-1.13; P ≤ .00001). There was no significant difference in duration of perioperative delirium between the 2 treatment groups (MD = -2.48; 95% CI, -7.36 to 2.40; P = .32). Based on the quality of evidence provided, comprehensive geriatric care may reduce the incidence of perioperative delirium. To obtain evidence regarding the merits of comprehensive geriatric care in reducing severity of delirium and shortening the duration of delirium, there is a need for multicenter RCTs with high methodological quality.
Shah, Rahman; Mattox, Anthony; Khan, M Rehan; Berzingi, Chalak; Rashid, Abdul
2017-01-01
AIM To compare the amount of contrast used during percutaneous coronary intervention (PCI) via trans-radial access (TRA) vs trans-femoral access (TFA). METHODS Scientific databases and websites were searched for:randomizedcontrolledtrials (RCTs). Data were extracted by two independent reviewers and was summarized as the weighted mean difference (WMD) of contrast used with a 95%CI using a random-effects model. RESULTS The meta-analysis included 13 RCTs with a total of 3165 patients. There was no difference between the two strategies in the amount of contrast used (WMD = - 0.65 mL, 95%CI: -10.94-9.46 mL; P = 0.901). CONCLUSION This meta-analysis shows that in patients undergoing PCI, the amount of contrast volume used was not different between TRA and TFA. PMID:28515857
ERIC Educational Resources Information Center
Crismore, Avon, Ed.
The 594 studies referenced in this volume, the first of a two-volume set, synthesize reading comprehension research conducted from 1974 to 1984. The 12 chapters cover the following topics: (1) the necessity for both quantitative and qualitative meta-analysis for a complete state-of-the-art understanding of any domain, (2) the background of the…
Boorjian, Stephen
2014-08-01
Physical activity may decrease renal cancer risk by reducing obesity, blood pressure, insulin resistance, and lipid peroxidation. Despite plausible biologic mechanisms linking increased physical activity to decreased risk for renal cancer, few epidemiologic studies have been able to report a clear inverse association between physical activity and renal cancer, and no meta-analysis is available on the topic. We searched the literature using PubMed and Web of Knowledge to identify published non-ecologic epidemiologic studies quantifying the relationship between physical activity and renal cancer risk in individuals without a cancer history. Following the PRISMA guidelines, we conducted a systematic review and meta-analysis, including information from 19 studies based on a total of 2,327,322 subjects and 10,756 cases. The methodologic quality of the studies was examined using a comprehensive scoring system. Comparing high vs low levels of physical activity, we observed an inverse association between physical activity and renal cancer risk (summary relative risk (RR) from random-effects meta-analysis=0.88; 95% confidence interval (CI)=0.79-0.97). Summarising risk estimates from high-quality studies strengthened the inverse association between physical activity and renal cancer risk (RR=0.78; 95% CI=0.66-0.92). Effect modification by adiposity, hypertension, type 2 diabetes, smoking, gender, or geographic region was not observed. Our comprehensive meta-analysis provides strong support for an inverse relation of physical activity to renal cancer risk. Future high-quality studies are required to discern which specific types, intensities, frequencies, and durations of physical activity are needed for renal cancer risk reduction. Copyright © 2014 Elsevier Inc. All rights reserved.
Relationship Between Maternal Characteristics and Postpartum Hemorrhage: A Meta-Analysis Study.
Durmaz, Aysegul; Komurcu, Nuran
2017-12-06
Postpartum hemorrhage (PPH) is a leading cause of maternal death in low-income countries and the primary cause of approximately one of every four maternal deaths worldwide. The aim of this study was to determine the antenatal risk factors of PPH and its effects. The literature from nine databases was reviewed, and studies published between 2000 and 2012 were analyzed using terms such as "postpartum hemorrhage," "prevention of postpartum hemorrhage," and "management of postpartum hemorrhage." The full text of 1,061 articles was reviewed, and 29 studies were selected according to the inclusion criteria. Studies that determined bias using the funnel plot test were excluded, and 20 studies were included in the meta-analysis. The data were analyzed using Microsoft Office Excel 2010 and comprehensive meta-analysis. The meta-analysis included five studies and 1,286,752 women for maternal age, six studies and 607,822 women for body mass index, and six studies and 1,118,490 women for parity. The results of the analysis showed that body mass index ≥ 25.00 kg/m (OR = 1.43, 95% CI [1.40, 1.47]), primiparity of mothers (OR = 1.37, 95% CI [1.35, 1.40]), and hypertensive disorder in mothers (OR = 1.52, 95% CI [1.43, 1.61]) are risk factors for the development of PPH. No rela-tionship was found between maternal age ≥ 35 years and PPH (OR = 1.02, 95% CI [0.99, 1.04]). Midwives, obstetric nurses, and obstetricians should carefully evaluate mothers for the risk factors of PPH during the antepartum, intrapartum, and postpartum periods. Moreover, at-risk pregnant women should give birth in a unit with emergency initiative options. Future studies should examine relevant personal characteristics of mothers, as familiarity with the risk factors facilitates the management and treatment of PPH. Finally, meta-analyses should review more studies to detect risk factors more comprehensively.
Takacs, Zsofia K; Swart, Elise K; Bus, Adriana G
2014-01-01
The present meta-analysis challenges the notion that young children necessarily need adult scaffolding in order to understand a narrative story and learn words as long as they encounter optimally designed multimedia stories. Including 29 studies and 1272 children, multimedia stories were found more beneficial than encounters with traditional story materials that did not include the help of an adult for story comprehension (g+ = 0.40, k = 18) as well as vocabulary (g+ = 0.30, k = 11). However, no significant differences were found between the learning outcomes of multimedia stories and sharing traditional print-like stories with an adult. It is concluded that multimedia features like animated illustrations, background music and sound effects provide similar scaffolding of story comprehension and word learning as an adult.
Rodd, Jennifer M; Vitello, Sylvia; Woollams, Anna M; Adank, Patti
2015-02-01
We conducted an Activation Likelihood Estimation (ALE) meta-analysis to identify brain regions that are recruited by linguistic stimuli requiring relatively demanding semantic or syntactic processing. We included 54 functional MRI studies that explicitly varied the semantic or syntactic processing load, while holding constant demands on earlier stages of processing. We included studies that introduced a syntactic/semantic ambiguity or anomaly, used a priming manipulation that specifically reduced the load on semantic/syntactic processing, or varied the level of syntactic complexity. The results confirmed the critical role of the posterior left Inferior Frontal Gyrus (LIFG) in semantic and syntactic processing. These results challenge models of sentence comprehension highlighting the role of anterior LIFG for semantic processing. In addition, the results emphasise the posterior (but not anterior) temporal lobe for both semantic and syntactic processing. Crown Copyright © 2014. Published by Elsevier Inc. All rights reserved.
Takacs, Zsofia K.; Swart, Elise K.; Bus, Adriana G.
2014-01-01
The present meta-analysis challenges the notion that young children necessarily need adult scaffolding in order to understand a narrative story and learn words as long as they encounter optimally designed multimedia stories. Including 29 studies and 1272 children, multimedia stories were found more beneficial than encounters with traditional story materials that did not include the help of an adult for story comprehension (g+ = 0.40, k = 18) as well as vocabulary (g+ = 0.30, k = 11). However, no significant differences were found between the learning outcomes of multimedia stories and sharing traditional print-like stories with an adult. It is concluded that multimedia features like animated illustrations, background music and sound effects provide similar scaffolding of story comprehension and word learning as an adult. PMID:25520684
Association between Hypertension and Epistaxis: Systematic Review and Meta-analysis.
Min, Hyun Jin; Kang, Hyun; Choi, Geun Joo; Kim, Kyung Soo
2017-12-01
Objective Whether there is an association or a cause-and-effect relationship between epistaxis and hypertension is a subject of longstanding controversy. The objective of this systematic review and meta-analysis was to determine the association between epistaxis and hypertension and to verify whether hypertension is an independent risk factor of epistaxis. Data Sources A comprehensive search was performed using the MEDLINE, EMBASE, and Cochrane Library databases. Review Methods The review was performed according to the Meta-analysis of Observational Studies in Epidemiology guidelines and reported using the Preferred Reporting Items for Systematic Reviews and Meta-analysis guidelines. Results We screened 2768 unique studies and selected 10 for this meta-analysis. Overall, the risk of epistaxis was significantly increased for patients with hypertension (odds ratio, 1.532 [95% confidence interval (CI), 1.181-1.986]; number needed to treat, 14.9 [95% CI, 12.3-19.0]). Results of the Q test and I 2 statistics suggested considerable heterogeneity ([Formula: see text] = 0.038, I 2 = 49.3%). The sensitivity analysis was performed by excluding 1 study at a time, and it revealed no change in statistical significance. Conclusion Although this meta-analysis had some limitations, our study demonstrated that hypertension was significantly associated with the risk of epistaxis. However, since this association does not support a causal relationship between hypertension and epistaxis, further clinical trials with large patient populations will be required to determine the impact of hypertension on epistaxis.
Heavy Metal Level in Human Semen with Different Fertility: a Meta-Analysis.
Sun, Jiantao; Yu, Guangxia; Zhang, Yucheng; Liu, Xi; Du, Chuang; Wang, Lu; Li, Zhen; Wang, Chunhong
2017-03-01
There are conflicting reports on the heavy metal levels in human semen with different fertilities. The purpose of this analysis is to merge and analyze the differences of heavy metal lead (Pb), cadmium (Cd), zinc (Zn), and copper (Cu) levels in male semen with normal and low fertilities. All documents in both Chinese and English were collected from the PubMed, Web of Science, and Chinese National Knowledge Infrastructure (CNKI) database from inception date to February 19, 2016. We have used RevMan software (version 5.2) for the meta-analysis and Stata software (version 12.0) for the meta-regression and sensitivity analyses. A total of 20 literatures were included in the study. The results of the meta-analysis indicate a significant difference between fertility with three metal ions (Pb, Cd, Zn) while no significant difference with copper, detailed as follows: (i) 10 studies on the lead concentrations with a standardized mean difference (SMD) = 2.07, 95 %CI (0.97, 3.17), P < 0.01; (ii) 13 studies on the cadmium concentrations with an SMD = 0.75, 95 %CI (0.44, 1.07), P < 0.01; (iii) 8 studies on the concentrations of zinc with an SMD = -0.61, 95 %CI (-1.08, -0.14), P < 0.01; and (iv) 9 studies on the copper concentrations with an SMD = 0.42, 95 %CI (-0.29, 1.13), P = 0.247. The results indicate that the men with low fertility have higher semen Pb and Cd levels and lower semen Zn levels; more studies are needed to indicate the association of the semen copper level with fertility.
Lianhui, Yang; Meifei, Lian; Zhongyue, Hu; Yunzhi, Feng
2017-08-01
Objective The aim of this study is to evaluate the relationship between periodontitis and hyperlipidemia risks through Meta-analysis. Methods Two researchers conducted an electronic search on PubMed, Cochrane Library, Embase, CBM, CNKI, Wanfang and VIP databases established until July 2016 for observational studies on the association between periodontitis and hyperlipidemia. The language used was limited to Chinese and English. After data extraction and quality evaluation of included trials, Meta-analysis was conducted using the RevMan 5.3 software. The GRADE 3.6 software was used to evaluate the quality level of the evidence. Results Six case-control studies and one cohort study were included. The results of Meta-analysis showed that serum triglyceride (TG) in patients with periodontitis was significantly higher than that of the periodontal health group (MD=50.50, 95% confidence interval=39.57-61.42, P<0.000 01), as well as serum total cholesterol (TC) (MD=17.54, 95% confidence interval=10.91-24.18, P<0.000 01). Furthermore, the risks of TG and TC in the serum of patients with chronic periodontitis were 4.73 times (OR=4.73, 95% confidence interval=2.74-8.17, P<0.000 01) and 3.62 times (OR=3.62, 95% confidence interval=2.18-6.03, P<0.000 01) of that of periodontal healthy patients. No significant difference was observed between the group with high-density lipoprotein cholesterol (HDL-C) and that with low density lipoprotein cholesterol (LDL-C). Conclusion Current evidence indicates that a correlation exists between chronic periodontitis and hyperlipidemia, and chronic periodontitis is an independent risk factor for hyperlipidemia, especially for TC and TG in serum.
MetaMetaDB: A Database and Analytic System for Investigating Microbial Habitability
Yang, Ching-chia; Iwasaki, Wataru
2014-01-01
MetaMetaDB (http://mmdb.aori.u-tokyo.ac.jp/) is a database and analytic system for investigating microbial habitability, i.e., how a prokaryotic group can inhabit different environments. The interaction between prokaryotes and the environment is a key issue in microbiology because distinct prokaryotic communities maintain distinct ecosystems. Because 16S ribosomal RNA (rRNA) sequences play pivotal roles in identifying prokaryotic species, a system that comprehensively links diverse environments to 16S rRNA sequences of the inhabitant prokaryotes is necessary for the systematic understanding of the microbial habitability. However, existing databases are biased to culturable prokaryotes and exhibit limitations in the comprehensiveness of the data because most prokaryotes are unculturable. Recently, metagenomic and 16S rRNA amplicon sequencing approaches have generated abundant 16S rRNA sequence data that encompass unculturable prokaryotes across diverse environments; however, these data are usually buried in large databases and are difficult to access. In this study, we developed MetaMetaDB (Meta-Metagenomic DataBase), which comprehensively and compactly covers 16S rRNA sequences retrieved from public datasets. Using MetaMetaDB, users can quickly generate hypotheses regarding the types of environments a prokaryotic group may be adapted to. We anticipate that MetaMetaDB will improve our understanding of the diversity and evolution of prokaryotes. PMID:24475242
Fonner, Virginia A; Armstrong, Kevin S; Kennedy, Caitlin E; O'Reilly, Kevin R; Sweat, Michael D
2014-01-01
School-based sex education is a cornerstone of HIV prevention for adolescents who continue to bear a disproportionally high HIV burden globally. We systematically reviewed and meta-analyzed the existing evidence for school-based sex education interventions in low- and middle-income countries to determine the efficacy of these interventions in changing HIV-related knowledge and risk behaviors. We searched five electronic databases, PubMed, Embase, PsycInfo, CINAHL, and Sociological Abstracts, for eligible articles. We also conducted hand-searching of key journals and secondary reference searching of included articles to identify potential studies. Intervention effects were synthesized through random effects meta-analysis for five outcomes: HIV knowledge, self-efficacy, sexual debut, condom use, and number of sexual partners. Of 6191 unique citations initially identified, 64 studies in 63 articles were included in the review. Nine interventions either focused exclusively on abstinence (abstinence-only) or emphasized abstinence (abstinence-plus), whereas the remaining 55 interventions provided comprehensive sex education. Thirty-three studies were able to be meta-analyzed across five HIV-related outcomes. Results from meta-analysis demonstrate that school-based sex education is an effective strategy for reducing HIV-related risk. Students who received school-based sex education interventions had significantly greater HIV knowledge (Hedges g = 0.63, 95% Confidence Interval (CI): 0.49-0.78, p<0.001), self-efficacy related to refusing sex or condom use (Hedges g = 0.25, 95% CI: 0.14-0.36, p<0.001), condom use (OR = 1.34, 95% CI: 1.18-1.52, p<0.001), fewer sexual partners (OR = 0.75, 95% CI:0.67-0.84, p<0.001) and less initiation of first sex during follow-up (OR = 0.66, 95% CI: 0.54-0.83, p<0.001). The paucity of abstinence-only or abstinence-plus interventions identified during the review made comparisons between the predominant comprehensive and less common abstinence-focused programs difficult. Comprehensive school-based sex education interventions adapted from effective programs and those involving a range of school-based and community-based components had the largest impact on changing HIV-related behaviors.
Informed consent comprehension in African research settings.
Afolabi, Muhammed O; Okebe, Joseph U; McGrath, Nuala; Larson, Heidi J; Bojang, Kalifa; Chandramohan, Daniel
2014-06-01
Previous reviews on participants' comprehension of informed consent information have focused on developed countries. Experience has shown that ethical standards developed on Western values may not be appropriate for African settings where research concepts are unfamiliar. We undertook this review to describe how informed consent comprehension is defined and measured in African research settings. We conducted a comprehensive search involving five electronic databases: Medline, Embase, Global Health, EthxWeb and Bioethics Literature Database (BELIT). We also examined African Index Medicus and Google Scholar for relevant publications on informed consent comprehension in clinical studies conducted in sub-Saharan Africa. 29 studies satisfied the inclusion criteria; meta-analysis was possible in 21 studies. We further conducted a direct comparison of participants' comprehension on domains of informed consent in all eligible studies. Comprehension of key concepts of informed consent varies considerably from country to country and depends on the nature and complexity of the study. Meta-analysis showed that 47% of a total of 1633 participants across four studies demonstrated comprehension about randomisation (95% CI 13.9-80.9%). Similarly, 48% of 3946 participants in six studies had understanding about placebo (95% CI 19.0-77.5%), while only 30% of 753 participants in five studies understood the concept of therapeutic misconception (95% CI 4.6-66.7%). Measurement tools for informed consent comprehension were developed with little or no validation. Assessment of comprehension was carried out at variable times after disclosure of study information. No uniform definition of informed consent comprehension exists to form the basis for development of an appropriate tool to measure comprehension in African participants. Comprehension of key concepts of informed consent is poor among study participants across Africa. There is a vital need to develop a uniform definition for informed consent comprehension in low literacy research settings in Africa. This will be an essential step towards developing appropriate tools that can adequately measure informed consent comprehension. This may consequently suggest adequate measures to improve the informed consent procedure. © 2014 John Wiley & Sons Ltd.
2011-01-01
Background Meta-analysis is a popular methodology in several fields of medical research, including genetic association studies. However, the methods used for meta-analysis of association studies that report haplotypes have not been studied in detail. In this work, methods for performing meta-analysis of haplotype association studies are summarized, compared and presented in a unified framework along with an empirical evaluation of the literature. Results We present multivariate methods that use summary-based data as well as methods that use binary and count data in a generalized linear mixed model framework (logistic regression, multinomial regression and Poisson regression). The methods presented here avoid the inflation of the type I error rate that could be the result of the traditional approach of comparing a haplotype against the remaining ones, whereas, they can be fitted using standard software. Moreover, formal global tests are presented for assessing the statistical significance of the overall association. Although the methods presented here assume that the haplotypes are directly observed, they can be easily extended to allow for such an uncertainty by weighting the haplotypes by their probability. Conclusions An empirical evaluation of the published literature and a comparison against the meta-analyses that use single nucleotide polymorphisms, suggests that the studies reporting meta-analysis of haplotypes contain approximately half of the included studies and produce significant results twice more often. We show that this excess of statistically significant results, stems from the sub-optimal method of analysis used and, in approximately half of the cases, the statistical significance is refuted if the data are properly re-analyzed. Illustrative examples of code are given in Stata and it is anticipated that the methods developed in this work will be widely applied in the meta-analysis of haplotype association studies. PMID:21247440
Network meta-analysis: a technique to gather evidence from direct and indirect comparisons
2017-01-01
Systematic reviews and pairwise meta-analyses of randomized controlled trials, at the intersection of clinical medicine, epidemiology and statistics, are positioned at the top of evidence-based practice hierarchy. These are important tools to base drugs approval, clinical protocols and guidelines formulation and for decision-making. However, this traditional technique only partially yield information that clinicians, patients and policy-makers need to make informed decisions, since it usually compares only two interventions at the time. In the market, regardless the clinical condition under evaluation, usually many interventions are available and few of them have been studied in head-to-head studies. This scenario precludes conclusions to be drawn from comparisons of all interventions profile (e.g. efficacy and safety). The recent development and introduction of a new technique – usually referred as network meta-analysis, indirect meta-analysis, multiple or mixed treatment comparisons – has allowed the estimation of metrics for all possible comparisons in the same model, simultaneously gathering direct and indirect evidence. Over the last years this statistical tool has matured as technique with models available for all types of raw data, producing different pooled effect measures, using both Frequentist and Bayesian frameworks, with different software packages. However, the conduction, report and interpretation of network meta-analysis still poses multiple challenges that should be carefully considered, especially because this technique inherits all assumptions from pairwise meta-analysis but with increased complexity. Thus, we aim to provide a basic explanation of network meta-analysis conduction, highlighting its risks and benefits for evidence-based practice, including information on statistical methods evolution, assumptions and steps for performing the analysis. PMID:28503228
Zhang, Xiaona; Sun, Xiaoxuan; Wang, Junhong; Tang, Liou; Xie, Anmu
2017-01-01
Rapid eye movement sleep behavior disorder (RBD) is thought to be one of the most frequent preceding symptoms of Parkinson's disease (PD). However, the prevalence of RBD in PD stated in the published studies is still inconsistent. We conducted a meta and meta-regression analysis in this paper to estimate the pooled prevalence. We searched the electronic databases of PubMed, ScienceDirect, EMBASE and EBSCO up to June 2016 for related articles. STATA 12.0 statistics software was used to calculate the available data from each research. The prevalence of RBD in PD patients in each study was combined to a pooled prevalence with a 95 % confidence interval (CI). Subgroup analysis and meta-regression analysis were performed to search for the causes of the heterogeneity. A total of 28 studies with 6869 PD cases were deemed eligible and included in our meta-analysis based on the inclusion and exclusion criteria. The pooled prevalence of RBD in PD was 42.3 % (95 % CI 37.4-47.1 %). In subgroup analysis and meta-regression analysis, we found that the important causes of heterogeneity were the diagnosis criteria of RBD and age of PD patients (P = 0.016, P = 0.019, respectively). The results indicate that nearly half of the PD patients are suffering from RBD. Older age and longer duration are risk factors for RBD in PD. We can use the minimal diagnosis criteria for RBD according to the International Classification of Sleep Disorders to diagnose RBD patients in our daily work if polysomnography is not necessary.
A META-COMPOSITE SOFTWARE DEVELOPMENT APPROACH FOR TRANSLATIONAL RESEARCH
Sadasivam, Rajani S.; Tanik, Murat M.
2013-01-01
Translational researchers conduct research in a highly data-intensive and continuously changing environment and need to use multiple, disparate tools to achieve their goals. These researchers would greatly benefit from meta-composite software development or the ability to continuously compose and recompose tools together in response to their ever-changing needs. However, the available tools are largely disconnected, and current software approaches are inefficient and ineffective in their support for meta-composite software development. Building on the composite services development approach, the de facto standard for developing integrated software systems, we propose a concept-map and agent-based meta-composite software development approach. A crucial step in composite services development is the modeling of users’ needs as processes, which can then be specified in an executable format for system composition. We have two key innovations. First, our approach allows researchers (who understand their needs best) instead of technicians to take a leadership role in the development of process models, reducing inefficiencies and errors. A second innovation is that our approach also allows for modeling of complex user interactions as part of the process, overcoming the technical limitations of current tools. We demonstrate the feasibility of our approach using a real-world translational research use case. We also present results of usability studies evaluating our approach for future refinements. PMID:23504436
A meta-composite software development approach for translational research.
Sadasivam, Rajani S; Tanik, Murat M
2013-06-01
Translational researchers conduct research in a highly data-intensive and continuously changing environment and need to use multiple, disparate tools to achieve their goals. These researchers would greatly benefit from meta-composite software development or the ability to continuously compose and recompose tools together in response to their ever-changing needs. However, the available tools are largely disconnected, and current software approaches are inefficient and ineffective in their support for meta-composite software development. Building on the composite services development approach, the de facto standard for developing integrated software systems, we propose a concept-map and agent-based meta-composite software development approach. A crucial step in composite services development is the modeling of users' needs as processes, which can then be specified in an executable format for system composition. We have two key innovations. First, our approach allows researchers (who understand their needs best) instead of technicians to take a leadership role in the development of process models, reducing inefficiencies and errors. A second innovation is that our approach also allows for modeling of complex user interactions as part of the process, overcoming the technical limitations of current tools. We demonstrate the feasibility of our approach using a real-world translational research use case. We also present results of usability studies evaluating our approach for future refinements.
MetaSeq: privacy preserving meta-analysis of sequencing-based association studies.
Singh, Angad Pal; Zafer, Samreen; Pe'er, Itsik
2013-01-01
Human genetics recently transitioned from GWAS to studies based on NGS data. For GWAS, small effects dictated large sample sizes, typically made possible through meta-analysis by exchanging summary statistics across consortia. NGS studies groupwise-test for association of multiple potentially-causal alleles along each gene. They are subject to similar power constraints and therefore likely to resort to meta-analysis as well. The problem arises when considering privacy of the genetic information during the data-exchange process. Many scoring schemes for NGS association rely on the frequency of each variant thus requiring the exchange of identity of the sequenced variant. As such variants are often rare, potentially revealing the identity of their carriers and jeopardizing privacy. We have thus developed MetaSeq, a protocol for meta-analysis of genome-wide sequencing data by multiple collaborating parties, scoring association for rare variants pooled per gene across all parties. We tackle the challenge of tallying frequency counts of rare, sequenced alleles, for metaanalysis of sequencing data without disclosing the allele identity and counts, thereby protecting sample identity. This apparent paradoxical exchange of information is achieved through cryptographic means. The key idea is that parties encrypt identity of genes and variants. When they transfer information about frequency counts in cases and controls, the exchanged data does not convey the identity of a mutation and therefore does not expose carrier identity. The exchange relies on a 3rd party, trusted to follow the protocol although not trusted to learn about the raw data. We show applicability of this method to publicly available exome-sequencing data from multiple studies, simulating phenotypic information for powerful meta-analysis. The MetaSeq software is publicly available as open source.
Hypoxia-Inducible Factor-1α Polymorphisms and Risk of Cancer Metastasis: A Meta-Analysis
Shi, Bin; Weng, Wenjun; Chen, Zhipeng; Guo, Nannan; Hua, Yibing; Zhu, Lingjun
2013-01-01
Background HIF-1α is a major regulator in tumor progression and metastasis which responds to hypoxia. Many studies have demonstrated that hypoxia-inducible factor1-α (HIF-1α) polymorphisms are significantly associated with cancer metastasis, but the results are inconsistent. We conducted a comprehensive meta-analysis to estimate the associations between HIF-1α C1772 T polymorphism and cancer metastasis. Methods Comprehensive searches were conducted on PubMed and EMBASE database. Fifteen studies were included in the meta-analysis. We used the OR and 95%CI to assess the associations between HIF-1α C1772T polymorphism and cancer metastasis. Heterogeneity and publication bias were also assessed by Q test, I 2, and funnel plot. Results Totally, fifteen studies including 1239 cases with metastasis-positive (M+) and 2711 cases with metastasis-negative (M−) were performed in this meta-analysis. The results showed that HIF-1a C1772T polymorphism was associated with the increased risk of cancer metastasis (T allele vs. C allele, OR = 1.36, 95% CI = 1.12–1.64; TT+ TC vs. CC, OR = 1.39, 95% CI = 1.13–1.71; TT vs. TC+ CC, OR = 1.93, 95% CI = 0.86–4.36). In the subgroup analyses, the significant associations remained significant among Asians, Caucasians and other cancers in the dominant model. Publication bias was not observed in the analysis. Conclusions Our results indicate that the HIF-1αC1772T polymorphism T allele may increase the risk of cancer metastasis, which might be a potential risk factor of cancer progress. PMID:24015181
Razi, Bahman; Anani Sarab, Gholamreza; Omidkhoda, Azadeh; Alizadeh, Shahab
2018-03-01
Several studies have evaluated the association between the multidrug resistance 1 (MDR1) polymorphism (rs1045642 C > T) and multiple myeloma (MM). However, the results were not consistent. Therefore, to reach a comprehensive and reliable answer we determined the association of the MDR1 (rs1045642 C > T) polymorphism and MM in the context of meta-analysis. All eligible studies published in EMBASE, PubMed, and Web of Science databases before July 2017 were reviewed. Subsequently, to assess the strength of association in the dominant model, recessive model, allelic model, homozygotes contrast, and heterozygotes contrast, pooled odds ratios and 95% confidence intervals (CIs) were calculated by the fixed effects model. A total of four case-control studies with 395 MM cases and 418 healthy controls were included in the meta-analysis. The overall results showed no significant association between the MDR1 (rs1045642 C > T) polymorphism and the risk of MM in genetic models (dominant model: OR = 1.04, 95% CI = 0.78-1.38; recessive model: OR = 0.74, 95% CI = 0.52-1.06; allelic model: OR = 0.90, 95% CI = 0.73-1.11; TT vs. CC: OR = 0.80, 95% CI = 0.51-1.25; and CT vs. CC: OR = 1.12, 95% CI = 0.77-1.62). No evidence of publication bias was detected except for the analysis of the recessive model. This meta-analysis suggests that the MDR1 C > T polymorphism was not associated with the risk of MM. To confirm these findings, further comprehensive and well-designed studies are needed.
Vitamin B6 Intake and the Risk of Colorectal Cancer: A Meta-Analysis of Prospective Cohort Studies.
Jia, Kai; Wang, Rong; Tian, Jingfeng
2017-07-01
We performed this meta-analysis to estimate the association between vitamin B 6 intake and colorectal cancer risk. Prospective cohort studies on vitamin B 6 intake and colorectal cancer risk were identified by searching databases from the period of 1960 to 2016. Results from individual studies were synthetically combined using Stata 13.0 software. A total of 10 prospective cohort studies including 13 data sets were included in our meta-analysis, containing 7,817 cases and 784,550 subjects. The combined relative risks (RR) of colorectal cancer for the highest vitamin B 6 intake compared with the lowest vitamin B 6 intake was 0.88 [95% confidence intervals (CIs): 0.77-1.02]. Dose-response meta-analysis based on five eligible studies showed that for each additional 3 and 5 mg of vitamin B 6 intake, the risk would decrease by 11% (RR: 0.89, 95%CI: 0.81-0.98) and 17% (RR: 0.83, 95%CI: 0.71-0.97), respectively. Little evidence of publication bias was found. This meta-analysis provides evidence of a nonsignificant decrease in colorectal cancer risk associated with the high level of vitamin B 6 intake, but the risk in dose-response analysis is significant. However, the latter finding is based on a limited number of studies, which should be interpreted with caution.
Almasri, Nihad A; An, Mihee; Palisano, Robert J
2017-07-28
Understanding parent perceptions of family-centered care (FCC) is important to improve processes and outcomes of children's services. A systematic review and meta-analysis of research on the Measures of Processes of Care (MPOC-20) were performed to determine the extent parents of children with physical disabilities perceive they received FCC. A comprehensive literature search was conducted using four databases. A total of 129 studies were retrieved; 15 met the criteria for the synthesis. Meta-analysis involving 2,582 mothers and fathers of children with physical disabilities mainly cerebral palsy was conducted for the five scales of the MPOC-20. Aggregated mean ratings varied from 5.0 to 5.5 for Providing Specific Information about the Child; Coordinated and Comprehensive Care; and Respectful and Supportive Care (relational behaviors) and Enabling and Partnership (participatory behaviors) indicating that, on average, parents rated FCC as having been provided to "a fairly great extent." The aggregated mean rating was 4.1 for Providing General Information, indicating FCC was provided "to a moderate extent." Service providers are encouraged to focus on child and family needs for general information. Research is needed to better understand parent perspectives of service provider participatory behaviors which are important for engaging families in intervention processes.
Long non-coding RNA HULC as a potential prognostic biomarker in human cancers: a meta-analysis.
Fan, Yang-Hua; Wu, Miao-Jing; Jiang, Yuan; Ye, Minhua; Lu, Shi-Gang; Wu, Lei; Zhu, Xin-Gen
2017-03-28
Since the long non-coding RNA HULC (Highly Upregulated in Liver Cancer) is dysregulated in many cancers, we performed a meta-analysis to determine its prognostic potential in malignant tumors. We searched electronic databases, including PubMed, Medline, OVID, Cochrane Library and Web of Science from inception until August 14, 2016 and identified seven studies with 730 cancer patients for the meta-analysis. We analyzed the hazard ratios (HRs) and 95% confidence intervals (CIs) to determine the relationship between HULC expression and overall survival (OS). We also using RevMan5.3 software to calculate odds ratio (ORs) to assess the association between HULC expression and pathological parameters, including lymph node metastasis (LNM), distant metastasis (DM) and the tumor stage. Our analysis showed that higher HULC expression was associated with OS (HR= 0.50, 95% CI: 0.35-0.70, P <0.00001), LNM (OR=0.20, 95 % CI 0.06-0.64), DM (OR=0.27, 95% CI: 0.13-0.54) and the tumor stage (OR=0.39, 95 % CI 0.25-0.64). These meta-analysis data demonstrate that higher HULC expression can be a useful prognostic biomarker in human cancers.
Fu, Lingyu; Jin, Lei; Yan, Lei; Shi, Jingpu; Wang, Hailong; Zhou, Bo; Wu, Xiaomei
2016-01-01
MicroRNAs (miRNAs), small RNA molecules, play a role in the development and differentiation of immune cells in both innate and adaptive immune responses. Our study was aimed to investigate the association between three miRNA polymorphism and rheumatoid arthritis (RA) or systemic lupus erythematosus (SLE) by using meta-analysis approach. A PubMed database search was conducted during August 2013 to identify case-control studies of miRNAs and RA or SLE risk. Two authors independently extracted information on the study design, the characteristics of the study participants, exposure and outcome assessments. The fix-effects and random-effects models were used for the risk estimates by Stata 11.0 software. Our meta-analysis of six case-control studies involving a total of 998 RA cases and 1493 controls identified no significant association between mir-146a rs2910164 and RA, with an overall OR of 0.843 (95% CI=0.642-1.105; CC vs. GG). No association was observed in three studies with a total of 1532 cases and 2168 controls between miR-146a rs2910164 and SLE risk (OR=0.911, 95% CI=0.710-1.171; CC vs. GG). Three studies with a total of 529 cases and 595 controls evaluated the mir-499 rs3746444 polymorphism and its association with RA. There was a decreased overall risk of RA under the allelic and genotypic models [OR=0.616, 95% CI=0.384-0.981, (T vs. C allele) and OR=0.386, 95% CI=0.226-0.659, (TT vs. CC)]. Two studies with 4826 cases and 4181 controls evaluated miR-146a rs57095329 and its association with SLE. There was a significant association between miR-146a rs57095329 and SLE (OR=1.263, 95% CI=1.136-1.405, G vs. A allele). The present meta-analysis suggests important roles for the mir-499 rs3746444 polymorphism in RA, especially in the Caucasian population and for miR-146a rs57095329 polymorphism in SLE. Further studies with large sample size are needed to confirm these associations. Copyright © 2014. Published by Elsevier Inc.
Efficacy and safety of parecoxib sodium for acute postoperative pain: A meta-analysis.
Wei, Wei; Zhao, Tianyun; Li, Yuantao
2013-08-01
This meta-analysis was performed to evaluate the efficacy and safety of parecoxib sodium for acute postoperative pain. PubMed, Cochrane Central Register of Controlled Trials, EBSCO, Springer, Ovid and Chinese National Knowledge Infrastructure (CNKI) databases were searched from January 1999 to January 2013 to comprehensively collect randomized controlled trials (RCTs) of parecoxib sodium for acute postoperative pain. The methodological quality of the included RCTs were assessed and the data were extracted by two reviewers independently according to the Cochrane Handbook. Efficacies and safety (respiratory depression, pruritus, fever, headache, and nausea and vomiting) were pooled using meta-analysis performed by Review Manager 5.1 software. Relative risk (RR) and 95% confidence interval (CI) were calculated in a fixed-effects model. Seven RCTs involving 1,939 patients met the inclusion criteria. The results of the meta-analysis revealed that the rate of 'effective' treatment as described by the patients' global evaluation of study medication (PGESM) was higher in the patient-controlled analgesia (PCA) combined with parecoxib sodium group 24, 48, and 72 h after the initial intravenous dose of 40 mg parecoxib compared with that in the control group [PCA alone; RR=1.41, 95% CI (1.13-1.75); RR=1.25, 95% CI (1.15-1.35); and RR=1.30, 95% CI (1.21-1.40), respectively]. The rate of 'ineffective' treatment in the PCA combined with parecoxib sodium group was lower compared with that of the control group [RR=0.43, 95% CI (0.26-0.72); RR= 0.44, 95% CI (0.34-0.57); and RR= 0.33, 95% CI (0.23-0.48), respectively]. Combination of PCA with parecoxib sodium reduced the incidence of postoperative fever [RR=0.34, 95% CI (0.22-0.53)], as well as nausea and vomiting [RR=0.69, 95% CI (0.57-0.83)]; however, it did not significantly reduce respiratory depression [RR= 0.84, 95% CI (0.38-1.83)], pruritus [RR= 0.91, 95% CI (0.54-1.52)] or headache [RR=0.77, 95% CI (0.47-1.28)]. The combination of PCA with parecoxib sodium successively injected for <3 days significantly increases the scores of PGESM and reduces the incidence of adverse effects and postoperative complications.
Efficacy and safety of parecoxib sodium for acute postoperative pain: A meta-analysis
WEI, WEI; ZHAO, TIANYUN; LI, YUANTAO
2013-01-01
This meta-analysis was performed to evaluate the efficacy and safety of parecoxib sodium for acute postoperative pain. PubMed, Cochrane Central Register of Controlled Trials, EBSCO, Springer, Ovid and Chinese National Knowledge Infrastructure (CNKI) databases were searched from January 1999 to January 2013 to comprehensively collect randomized controlled trials (RCTs) of parecoxib sodium for acute postoperative pain. The methodological quality of the included RCTs were assessed and the data were extracted by two reviewers independently according to the Cochrane Handbook. Efficacies and safety (respiratory depression, pruritus, fever, headache, and nausea and vomiting) were pooled using meta-analysis performed by Review Manager 5.1 software. Relative risk (RR) and 95% confidence interval (CI) were calculated in a fixed-effects model. Seven RCTs involving 1,939 patients met the inclusion criteria. The results of the meta-analysis revealed that the rate of ‘effective’ treatment as described by the patients’ global evaluation of study medication (PGESM) was higher in the patient-controlled analgesia (PCA) combined with parecoxib sodium group 24, 48, and 72 h after the initial intravenous dose of 40 mg parecoxib compared with that in the control group [PCA alone; RR=1.41, 95% CI (1.13–1.75); RR=1.25, 95% CI (1.15–1.35); and RR=1.30, 95% CI (1.21–1.40), respectively]. The rate of ‘ineffective’ treatment in the PCA combined with parecoxib sodium group was lower compared with that of the control group [RR=0.43, 95% CI (0.26–0.72); RR= 0.44, 95% CI (0.34–0.57); and RR= 0.33, 95% CI (0.23–0.48), respectively]. Combination of PCA with parecoxib sodium reduced the incidence of postoperative fever [RR=0.34, 95% CI (0.22–0.53)], as well as nausea and vomiting [RR=0.69, 95% CI (0.57–0.83)]; however, it did not significantly reduce respiratory depression [RR= 0.84, 95% CI (0.38–1.83)], pruritus [RR= 0.91, 95% CI (0.54–1.52)] or headache [RR=0.77, 95% CI (0.47–1.28)]. The combination of PCA with parecoxib sodium successively injected for <3 days significantly increases the scores of PGESM and reduces the incidence of adverse effects and postoperative complications. PMID:24137220
Robinson, Jo; Spittal, Matthew J; Carter, Greg
2016-01-01
Objective To examine the efficacy of psychological and psychosocial interventions for reductions in repeated self-harm. Design We conducted a systematic review, meta-analysis and meta-regression to examine the efficacy of psychological and psychosocial interventions to reduce repeat self-harm in adults. We included a sensitivity analysis of studies with a low risk of bias for the meta-analysis. For the meta-regression, we examined whether the type, intensity (primary analyses) and other components of intervention or methodology (secondary analyses) modified the overall intervention effect. Data sources A comprehensive search of MEDLINE, PsycInfo and EMBASE (from 1999 to June 2016) was performed. Eligibility criteria for selecting studies Randomised controlled trials of psychological and psychosocial interventions for adult self-harm patients. Results Forty-five trials were included with data available from 36 (7354 participants) for the primary analysis. Meta-analysis showed a significant benefit of all psychological and psychosocial interventions combined (risk ratio 0.84; 95% CI 0.74 to 0.96; number needed to treat=33); however, sensitivity analyses showed that this benefit was non-significant when restricted to a limited number of high-quality studies. Meta-regression showed that the type of intervention did not modify the treatment effects. Conclusions Consideration of a psychological or psychosocial intervention over and above treatment as usual is worthwhile; with the public health benefits of ensuring that this practice is widely adopted potentially worth the investment. However, the specific type and nature of the intervention that should be delivered is not yet clear. Cognitive–behavioural therapy or interventions with an interpersonal focus and targeted on the precipitants to self-harm may be the best candidates on the current evidence. Further research is required. PMID:27660314
XU, Chen; CHEN, Shiwen; YUAN, Lutao; JING, Yao
2016-01-01
There is controversy among neurosurgeons regarding whether irrigation or drainage is necessary for achieving a lower revision rate for the treatment of chronic subdural hematoma (CSDH) using burr-hole craniostomy (BHC). Therefore, we performed a meta-analysis of all available published reports. Multiple electronic health databases were searched to identify all studies published between 1989 and June 2012 that compared irrigation and drainage. Data were processed by using Review Manager 5.1.6. Effect sizes are expressed as pooled odds ratio (OR) estimates. Due to heterogeneity between studies, we used the random effect of the inverse variance weighted method to perform the meta-analysis. Thirteen published reports were selected for this meta-analysis. The comprehensive results indicated that there were no statistically significant differences in mortality or complication rates between drainage and no drainage (P > 0.05). Additionally, there were no differences in recurrence between irrigation and no irrigation (P > 0.05). However, the difference between drainage and no drainage in recurrence rate reached statistical significance (P < 0.01). The results from this meta-analysis suggest that burr-hole surgery with closed-system drainage can reduce the recurrence of CSDH; however, irrigation is not necessary for every patient. PMID:26377830
Li, Mingchao; Wang, Zhengyun
2016-01-01
Objective To perform a meta-analysis of data from available published studies comparing laparoendoscopic single-site surgery varicocelectomy (LESSV) with conventional transperitoneal laparoscopic varicocele ligation. Methods A comprehensive data search was performed in PubMed and Embase to identify randomized controlled trials and comparative studies that compared the two surgical approaches for the treatment of varicoceles. Results Six studies were included in the meta-analysis. LESSV required a significantly longer operative time than conventional laparoscopic varicocelectomy but was associated with significantly less postoperative pain at 6 h and 24 h, a shorter recovery time and greater patient satisfaction with the cosmetic outcome. There was no difference between the two surgical approaches in terms of postoperative semen quality or the incidence of complications. Conclusion These data suggest that LESSV offers a well tolerated and efficient alternative to conventional laparoscopic varicocelectomy, with less pain, a shorter recovery time and better cosmetic satisfaction. Further well-designed studies are required to confirm these findings and update the results of this meta-analysis. PMID:27688686
GEOPACK, a comprehensive user-friendly geostatistical software system, was developed to help in the analysis of spatially correlated data. The software system was developed to be used by scientists, engineers, regulators, etc., with little experience in geostatistical techniques...
Quality control and conduct of genome-wide association meta-analyses.
Winkler, Thomas W; Day, Felix R; Croteau-Chonka, Damien C; Wood, Andrew R; Locke, Adam E; Mägi, Reedik; Ferreira, Teresa; Fall, Tove; Graff, Mariaelisa; Justice, Anne E; Luan, Jian'an; Gustafsson, Stefan; Randall, Joshua C; Vedantam, Sailaja; Workalemahu, Tsegaselassie; Kilpeläinen, Tuomas O; Scherag, André; Esko, Tonu; Kutalik, Zoltán; Heid, Iris M; Loos, Ruth J F
2014-05-01
Rigorous organization and quality control (QC) are necessary to facilitate successful genome-wide association meta-analyses (GWAMAs) of statistics aggregated across multiple genome-wide association studies. This protocol provides guidelines for (i) organizational aspects of GWAMAs, and for (ii) QC at the study file level, the meta-level across studies and the meta-analysis output level. Real-world examples highlight issues experienced and solutions developed by the GIANT Consortium that has conducted meta-analyses including data from 125 studies comprising more than 330,000 individuals. We provide a general protocol for conducting GWAMAs and carrying out QC to minimize errors and to guarantee maximum use of the data. We also include details for the use of a powerful and flexible software package called EasyQC. Precise timings will be greatly influenced by consortium size. For consortia of comparable size to the GIANT Consortium, this protocol takes a minimum of about 10 months to complete.
Quality control and conduct of genome-wide association meta-analyses
Winkler, Thomas W; Day, Felix R; Croteau-Chonka, Damien C; Wood, Andrew R; Locke, Adam E; Mägi, Reedik; Ferreira, Teresa; Fall, Tove; Graff, Mariaelisa; Justice, Anne E; Luan, Jian'an; Gustafsson, Stefan; Randall, Joshua C; Vedantam, Sailaja; Workalemahu, Tsegaselassie; Kilpeläinen, Tuomas O; Scherag, André; Esko, Tonu; Kutalik, Zoltán; Heid, Iris M; Loos, Ruth JF
2014-01-01
Rigorous organization and quality control (QC) are necessary to facilitate successful genome-wide association meta-analyses (GWAMAs) of statistics aggregated across multiple genome-wide association studies. This protocol provides guidelines for [1] organizational aspects of GWAMAs, and for [2] QC at the study file level, the meta-level across studies, and the meta-analysis output level. Real–world examples highlight issues experienced and solutions developed by the GIANT Consortium that has conducted meta-analyses including data from 125 studies comprising more than 330,000 individuals. We provide a general protocol for conducting GWAMAs and carrying out QC to minimize errors and to guarantee maximum use of the data. We also include details for use of a powerful and flexible software package called EasyQC. For consortia of comparable size to the GIANT consortium, the present protocol takes a minimum of about 10 months to complete. PMID:24762786
A comprehensive review of the SLMTA literature part 2: Measuring success.
Luman, Elizabeth T; Yao, Katy; Nkengasong, John N
2014-01-01
Since its introduction in 2009, the Strengthening Laboratory Management Toward Accreditation (SLMTA) programme has been implemented in 617 laboratories in 47 countries. We completed a systematic review of the published literature on SLMTA. The review consists of two companion papers; this article examines quantitative evidence presented in the publications along with a meta-analysis of selected results. We identified 28 published articles with data from SLMTA implementation. The SLMTA programme was evaluated through audits based on a standard checklist, which is divided into 12 sections corresponding to the 12 Quality System Essentials (QSEs). Several basic service delivery indicators reported by programmes were also examined. Results for various components of the programme were reviewed and summarised; a meta-analysis of QSE results grouped by the three stages of the quality cycle was conducted for 126 laboratories in 12 countries. Global programme data show improved quality in SLMTA laboratories in every country, with average improvements on audit scores of 25 percentage points. Meta-analysis identified Improvement Management as the weakest stage, with internal audit (8%) and occurrence management (16%) showing the lowest scores. Studies documented 19% - 95% reductions in turn-around times, 69% - 93% reductions in specimen rejection rates, 76% - 81% increases in clinician satisfaction rates, 67% - 85% improvements in external quality assessment results, 50% - 66% decreases in nonconformities and 67% increases in staff punctuality. The wide array of results reported provides a comprehensive picture of the SLMTA programme overall, suggesting a substantive impact on provision of quality laboratory services and patient care. These comprehensive results establish a solid data-driven foundation for program improvement and further expansion.
Multivariate meta-analysis: Potential and promise
Jackson, Dan; Riley, Richard; White, Ian R
2011-01-01
The multivariate random effects model is a generalization of the standard univariate model. Multivariate meta-analysis is becoming more commonly used and the techniques and related computer software, although continually under development, are now in place. In order to raise awareness of the multivariate methods, and discuss their advantages and disadvantages, we organized a one day ‘Multivariate meta-analysis’ event at the Royal Statistical Society. In addition to disseminating the most recent developments, we also received an abundance of comments, concerns, insights, critiques and encouragement. This article provides a balanced account of the day's discourse. By giving others the opportunity to respond to our assessment, we hope to ensure that the various view points and opinions are aired before multivariate meta-analysis simply becomes another widely used de facto method without any proper consideration of it by the medical statistics community. We describe the areas of application that multivariate meta-analysis has found, the methods available, the difficulties typically encountered and the arguments for and against the multivariate methods, using four representative but contrasting examples. We conclude that the multivariate methods can be useful, and in particular can provide estimates with better statistical properties, but also that these benefits come at the price of making more assumptions which do not result in better inference in every case. Although there is evidence that multivariate meta-analysis has considerable potential, it must be even more carefully applied than its univariate counterpart in practice. Copyright © 2011 John Wiley & Sons, Ltd. PMID:21268052
Comprehensive School Reform: Meta-Analytic Evidence of Black-White Achievement Gap Narrowing1
Gorey, Kevin M.
2016-01-01
This meta-analysis extends a previous review of the achievement effects of comprehensive school reform (CSR) programs (Borman, Hewes, Overman, & Brown, 2003). That meta-analysis observed significant effects of well endowed and well-researched programs, but it did not account for race/ethnicity. This article synthesizes 34 cohort or quasi-experimental outcomes of studies that incorporated the policy-critical characteristic of race/ethnicity. Findings: compared with matched traditional schools, the black-white achievement gap narrowed significantly more among students in CSR schools. In addition, the aggregate effects were large, substantially to completely eliminating the achievement gap between African American and non-Hispanic white students in elementary and middle schools. Title I policies before or after the No Child Left Behind Act of 2001 seem to have had essentially no impact on the black-white achievement gap. Curricular and testing mandates along with the threat of sanctions without concomitant resource supports seem to have failed. This study suggests that educational achievement inequities need not be America’s destiny. It seems that they could be eliminated through concerted political will and ample resource commitments to evidence-based educational programs. PMID:27453681
Jha, Prabhash Kumar; Vijay, Aatira; Sahu, Anita; Ashraf, Mohammad Zahid
2016-01-01
Thrombosis is a leading cause of morbidity and mortality in patients with myeloproliferative disorders (MPDs), particularly polycythemia vera (PV) and essential thrombocythemia (ET). Despite the attempts to establish a link between them, the shared biological mechanisms are yet to be characterized. An integrated gene expression meta-analysis of five independent publicly available microarray data of the three diseases was conducted to identify shared gene expression signatures and overlapping biological processes. Using INMEX bioinformatic tool, based on combined Effect Size (ES) approaches, we identified a total of 1,157 differentially expressed genes (DEGs) (697 overexpressed and 460 underexpressed genes) shared between the three diseases. EnrichR tool’s rich library was used for comprehensive functional enrichment and pathway analysis which revealed “mRNA Splicing” and “SUMO E3 ligases SUMOylate target proteins” among the most enriched terms. Network based meta-analysis identified MYC and FN1 to be the most highly ranked hub genes. Our results reveal that the alterations in biomarkers of the coagulation cascade like F2R, PROS1, SELPLG and ITGB2 were common between the three diseases. Interestingly, the study has generated a novel database of candidate genetic markers, pathways and transcription factors shared between thrombosis and MPDs, which might aid in the development of prognostic therapeutic biomarkers. PMID:27892526
The pterygoalar bar: A meta-analysis of its prevalence, morphology and morphometry.
Pękala, Przemysław A; Henry, Brandon Michael; Pękala, Jakub R; Frączek, Paulina A; Taterra, Dominik; Natsis, Konstantinos; Piagkou, Maria; Skrzat, Janusz; Tomaszewska, Iwona M
2017-09-01
The pterygoalar (PA) bar is a bony bridge resulting from the partial or complete ossification of a PA ligament. The aim of this meta-analysis was to systematically analyze and provide the most comprehensive data on the prevalence, morphology and topographical anatomy of the PA bar. A comprehensive search of the major electronic databases (PubMed, Embase, ScienceDirect, SciELO, BIOSIS, and Web of Science) was conducted in order to identify relevant studies. Studies reporting the prevalence, side of occurrence, gender dimorphism and morphometry of the PA bar were included in the current study. A total of 25 articles (n = 16,168 subjects) were included in the meta-analysis. The overall pooled prevalence of the complete PA bar was 4.4% (95% CI: 3.0-6.0) and of the incomplete was 8.4% (95% CI: 4.6-13.3). The PA bar was most often observed unilaterally, on the left side. Analysis of geographical subgroups revealed considerable differences, with the lowest prevalence rates in Europe for both incomplete and complete PA bars. Considering the prevalence and anatomical characteristics of the PA bar, caution is recommended while planning or performing transfacial needle approach to the foramen ovale and when considering a differential diagnosis for nerve compression or entrapment syndromes. Copyright © 2017 European Association for Cranio-Maxillo-Facial Surgery. Published by Elsevier Ltd. All rights reserved.
Relaxation training for anxiety: a ten-years systematic review with meta-analysis
Manzoni, Gian Mauro; Pagnini, Francesco; Castelnuovo, Gianluca; Molinari, Enrico
2008-01-01
Background Relaxation training is a common treatment for anxiety problems. Lacking is a recent quantitative meta-analysis that enhances understanding of the variability and clinical significance of anxiety reduction outcomes after relaxation treatment. Methods All studies (1997–2007), both RCT, observational and without control group, evaluating the efficacy of relaxation training (Jacobson's progressive relaxation, autogenic training, applied relaxation and meditation) for anxiety problems and disorders were identified by comprehensive electronic searches with Pubmed, Psychinfo and Cochrane Registers, by checking references of relevant studies and of other reviews. Our primary outcome was anxiety measured with psychometric questionnaires. Meta-analysis was undertaken synthesizing the data from all trials, distinguishing within and between effect sizes. Results 27 studies qualified for the inclusion in the meta-analysis. As hypothesized, relaxation training showed a medium-large effect size in the treatment of anxiety. Cohen's d was .57 (95% CI: .52 to .68) in the within analysis and .51 (95% CI: .46 to .634) in the between group analysis. Efficacy was higher for meditation, among volunteers and for longer treatments. Implications and limitations are discussed. Conclusion The results show consistent and significant efficacy of relaxation training in reducing anxiety. This meta-analysis extends the existing literature through facilitation of a better understanding of the variability and clinical significance of anxiety improvement subsequent to relaxation training. PMID:18518981
Meta-analysis of diagnostic test data: a bivariate Bayesian modeling approach.
Verde, Pablo E
2010-12-30
In the last decades, the amount of published results on clinical diagnostic tests has expanded very rapidly. The counterpart to this development has been the formal evaluation and synthesis of diagnostic results. However, published results present substantial heterogeneity and they can be regarded as so far removed from the classical domain of meta-analysis, that they can provide a rather severe test of classical statistical methods. Recently, bivariate random effects meta-analytic methods, which model the pairs of sensitivities and specificities, have been presented from the classical point of view. In this work a bivariate Bayesian modeling approach is presented. This approach substantially extends the scope of classical bivariate methods by allowing the structural distribution of the random effects to depend on multiple sources of variability. Meta-analysis is summarized by the predictive posterior distributions for sensitivity and specificity. This new approach allows, also, to perform substantial model checking, model diagnostic and model selection. Statistical computations are implemented in the public domain statistical software (WinBUGS and R) and illustrated with real data examples. Copyright © 2010 John Wiley & Sons, Ltd.
Ngugi, Henry K; Esker, Paul D; Scherm, Harald
2011-01-01
The continuing exponential increase in scientific knowledge, the growing availability of large databases containing raw or partially annotated information, and the increased need to document impacts of large-scale research and funding programs provide a great incentive for integrating and adding value to previously published (or unpublished) research through quantitative synthesis. Meta-analysis has become the standard for quantitative evidence synthesis in many disciplines, offering a broadly accepted and statistically powerful framework for estimating the magnitude, consistency, and homogeneity of the effect of interest across studies. Here, we review previous and current uses of meta-analysis in plant pathology with a focus on applications in epidemiology and disease management. About a dozen formal meta-analyses have been published in the plant pathological literature in the past decade, and several more are currently in progress. Three broad research questions have been addressed, the most common being the comparative efficacy of chemical treatments for managing disease and reducing yield loss across environments. The second most common application has been the quantification of relationships between disease intensity and yield, or between different measures of disease, across studies. Lastly, meta-analysis has been applied to assess factors affecting pathogen-biocontrol agent interactions or the effectiveness of biological control of plant disease or weeds. In recent years, fixed-effects meta-analysis has been largely replaced by random- (or mixed-) effects analysis owing to the statistical benefits associated with the latter and the wider availability of computer software to conduct these analyses. Another recent trend has been the more common use of multivariate meta-analysis or meta-regression to analyze the impacts of study-level independent variables (moderator variables) on the response of interest. The application of meta-analysis to practical problems in epidemiology and disease management is illustrated with case studies from our work on Phakopsora pachyrhizi on soybean and Erwinia amylovora on apple. We show that although meta-analyses are often used to corroborate and validate general conclusions drawn from more traditional, qualitative reviews, they can also reveal new patterns and interpretations not obvious from individual studies.
A comprehensive, user-friendly geostatistical software system called GEOPACk has been developed. The purpose of this software is to make available the programs necessary to undertake a geostatistical analysis of spatially correlated data. The programs were written so that they ...
TNF-308 G/A polymorphism and risk of acne vulgaris: a meta-analysis.
Yang, Jian-Kang; Wu, Wen-Juan; Qi, Jue; He, Li; Zhang, Ya-Ping
2014-01-01
The -308 G/A polymorphism in the tumor necrosis factor (TNF) gene has been implicated in the risk of acne vulgaris, but the results are inconclusive. The present meta-analysis aimed to investigate the overall association between the -308 G/A polymorphism and acne vulgaris risk. We searched in Pubmed, Embase, Web of Science and CNKI for studies evaluating the association between the -308 G/A gene polymorphism and acne vulgaris risk. Data were extracted and statistical analysis was performed using STATA 12.0 software. A total of five publications involving 1553 subjects (728 acne vulgaris cases and 825 controls) were included in this meta-analysis. Combined analysis revealed a significant association between this polymorphism and acne vulgaris risk under recessive model (OR = 2.73, 95% CI: 1.37-5.44, p = 0.004 for AA vs. AG + GG). Subgroup analysis by ethnicity showed that the acne vulgaris risk associated with the -308 G/A gene polymorphism was significantly elevated among Caucasians under recessive model (OR = 2.34, 95% CI: 1.13-4.86, p = 0.023). This meta-analysis suggests that the -308 G/A polymorphism in the TNF gene contributes to acne vulgaris risk, especially in Caucasian populations. Further studies among different ethnicity populations are needed to validate these findings.
ERIC Educational Resources Information Center
Trapman, Mirjam; van Gelderen, Amos; van Steensel, Roel; van Schooten, Erik; Hulstijn, Jan
2014-01-01
In this study we investigate the role of linguistic knowledge, fluency and meta-cognitive knowledge in Dutch reading comprehension of monolingual and bilingual adolescent academic low achievers in the Netherlands. Results show that these components are substantially associated with reading comprehension. However, their role appears to be different…
Liu, Xu; Wang, Lina; Guo, Yongtie
2016-10-01
To systematically evaluate the relationship of the methylation of the human-runt-related transcription factor 3 (RUNX3) promoter region and gastric cancer risk through meta-analysis. The studies published in PubMed, EMBASE, Ovid, and CNKI were retrieved. The association between RUNX3 gene promoter methylation and gastric cancer was analyzed using Stata 11.0 (http://www.stata.com; Stata Corporation, College Station, TX, USA) and Review Man 5.0 software (http://ims.cochrane.org/revman/download). Seventeen studies are included in the analysis. Meta-analysis reveals that the odds ratio of the methylation of the RUNX3 promoter region in gastric was 7.32 (95% confidence interval: 5.12-10.47), which was significant higher than the normal gastric tissues (P < 0.05). The RUNX3 gene promoter methylation rate was much higher in tumor tissue than that in normal gastric tissue in patient with gastric cancer, which indicates a close association between gastric cancer and RUNX3 gene promoter methylation.
Collins, Alyson A; Lindström, Esther R; Compton, Donald L
Researchers have increasingly investigated sources of variance in reading comprehension test scores, particularly with students with reading difficulties (RD). The purpose of this meta-analysis was to determine if the achievement gap between students with RD and typically developing (TD) students varies as a function of different reading comprehension response formats (e.g., multiple choice, cloze). A systematic literature review identified 82 eligible studies. All studies administered reading comprehension assessments to students with RD and TD students in Grades K-12. Hedge's g standardized mean difference effect sizes were calculated, and random effects robust variance estimation techniques were used to aggregate average weighted effect sizes for each response format. Results indicated that the achievement gap between students with RD and TD students was larger for some response formats (e.g., picture selection ES g = -1.80) than others (e.g., retell ES g = -0.60). Moreover, for multiple-choice, cloze, and open-ended question response formats, single-predictor metaregression models explored potential moderators of heterogeneity in effect sizes. No clear patterns, however, emerged in regard to moderators of heterogeneity in effect sizes across response formats. Findings suggest that the use of different response formats may lead to variability in the achievement gap between students with RD and TD students.
Association between Homocysteine and Cerebral Small Vessel Disease: A Meta-Analysis.
Piao, Xiangyu; Wu, Guangyao; Yang, Pei; Shen, Jing; De, Ailing; Wu, Jianlin; Qu, Qiumin
2018-05-22
This study aimed to evaluate whether elevated homocysteine levels is associated with risk of different subtypes of cerebral small vessel disease (CSVD) by using meta-analysis. Electronic databases were systematically searched up to April 2018 for collecting the studies reporting homocysteine levels in CSVD or CSVD subtypes. After an inclusion and exclusion criteria, the data was extracted. All data was analyzed using Stata software v.12.0 (Stata Corp LP, College Station, TX). The standardized mean difference (SMD) and 95% confidence interval (CI) were used to compare continuous variables. Eighteen studies met eligibility criteria with 5088 participants (1987 patients with CSVD and 3101 controls) included in the meta-analysis. Meta-analysis revealed that, compared with the controls group, the CSVD group had significantly higher homocysteine levels, with the SMD of .50 and 95% CI (.36-.64). Subgroup analyses suggested white matter lesion had significantly higher levels of homocysteine compared with controls (SMD = .56, 95% CI .39-.73), followed by silent brain infarction (SMD = .33, 95% CI .24-.42) and lacunar infarction (SMD = .17, 95% CI -.06 to .40). This meta-analysis found that CSVD or CSVD subtypes have a significantly higher homocysteine levels than in controls. Further prospective population-based studies are needed to longitudinally evaluate the association between homocysteine levels and progression of different CSVD subtypes. Copyright © 2018 National Stroke Association. Published by Elsevier Inc. All rights reserved.
Valipour, Ghazaleh; Saneei, Parvane; Esmaillzadeh, Ahmad
2014-10-01
Although several observational studies have investigated the association between vitamin D status and schizophrenia, we are aware of no comprehensive meta-analysis in this regard. We aimed to conduct a systematic review and a meta-analysis of observational studies to summarize the available data on the association between serum vitamin D levels and schizophrenia. A systematic research on all published articles until October 2013 was conducted in PubMed, ISI (Web of science), SCOPUS, and Google Scholar. All observational studies that had measured serum vitamin D levels in schizophrenic patients were included in the systematic review. After considering exclusion criteria, we had 19 studies for the systematic review that were included in three separate meta-analyses: 1) a meta-analysis on mean levels of 25-hydroxyvitamin D [25(OH)D] (n = 13); 2) a meta-analysis on the prevalence of vitamin D deficiency (n = 8); 3) a meta-analysis on odds ratios (n = 8). Findings from a meta-analysis on means revealed that the overall mean difference in serum 25(OH)D levels between schizophrenic patients and control participants was -5.91 ng/mL [95% confidence interval (CI) -10.68, -1.14]. Subgroup analyses based on study design, the patient's hospitalization status, study quality, and study location did not explain between-study heterogeneity; however, type of biomarker assessed [25-hydroxyvitamin D3 vs 25-hydroxyvitamin D (D2 & D3)] could account for some degree of heterogeneity. RESULTS from the meta-analysis on the prevalence of vitamin D deficiency indicated that the overall prevalence of vitamin D deficiency in schizophrenic patients was 65.3% (95% CI 46.4%-84.2%). Findings from the meta-analysis on odds ratios indicated that vitamin D-deficient persons were 2.16 times (95% CI 1.32, 3.56) more likely to have schizophrenia than those with vitamin D sufficiency. No evidence of heterogeneity was detected. We found a strong association between vitamin D deficiency and schizophrenia. However, randomized clinical trials are required to confirm our findings.
Zhang, Beibei; Zhang, Weiming; Yan, Liang; Wang, Daogang
2017-03-01
The methylenetetrahydrofolate reductase (MTHFR) gene C677T polymorphism is closely related to the acute lymphoblastic leukaemia (ALL) indicated by many previous epidemiologic studies. However, their conclusions were still conflicting. Our aim is to evaluate their associations using a more comprehensive updated meta-analysis. Electronic searches were conducted to select published studies prior to February, 2016. Totally, 39 case-control studies including 6551 ALL cases and 10,918 controls were selected in current meta-analysis. The association was detected significantly between MTHFR C677T polymorphism and ALL reducing susceptibility. Our results indicate that the MTHFR C677T polymorphism may be a promising ALL biomarker and studies to explore the protein levels of the variants and their functional role are required for the definitive conclusions. Copyright © 2017 Elsevier B.V. All rights reserved.
Rapid Automatized Naming and Reading Performance: A Meta-Analysis
ERIC Educational Resources Information Center
Araújo, Susana; Reis, Alexandra; Petersson, Karl Magnus; Faísca, Luís
2015-01-01
Evidence that rapid naming skill is associated with reading ability has become increasingly prevalent in recent years. However, there is considerable variation in the literature concerning the magnitude of this relationship. The objective of the present study was to provide a comprehensive analysis of the evidence on the relationship between rapid…
He, Weiwei; An, Xiaofei; Li, Ling; Shao, Xiaoqing; Li, Qian; Yao, Qiuming; Zhang, Jin-An
2017-01-01
Previous studies propose that hypothyroidism might play a crucial role in the pathogenesis of non-alcoholic fatty liver disease (NAFLD), but findings from published studies on the relationship between hypothyroidism and NAFLD are still controversial. Our study aimed to make a comprehensive evaluation of the relationship between hypothyroidism and NAFLD through a meta-analysis. PubMed, China Dissertation Database, and EMBASE databases were searched to find observational studies assessing the relationship between hypothyroidism and NAFLD. The pooled odds ratios (ORs) with 95% confidence intervals (95% CIs) were calculated to evaluate the strength of the relationship between hypothyroidism and NAFLD through meta-analysis. Thirteen articles were ultimately included in our meta-analysis. Meta-analysis of the 13 studies found a high correlation between hypothyroidism and NAFLD (OR = 1.52, 95% CI 1.24-1.87, P < 0.001). Meta-analysis of 9 studies providing adjusted ORs found that hypothyroidism was independently correlated with NAFLD (OR = 1.72, 95% CI 1.32-2.23, P < 0.001). Subgroup analysis found that both overt hypothyroidism and subclinical hypothyroidism were significantly correlated with NAFLD, and the pooled ORs were 1.70 (95% CI 1.23-2.36, P = 0.002) and 1.40 (95% CI 1.10-1.77, P = 0.006), respectively. Besides, meta-analysis of studies providing adjusted ORs also found that both overt hypothyroidism and subclinical hypothyroidism were independently correlated with NAFLD, and the pooled ORs were 1.81 (95% CI 1.30-2.52, P < 0.001) and 1.63 (95% CI 1.19-2.24, P = 0.002), respectively. The meta-analysis provides strong epidemiological evidence for the relationship between hypothyroidism and NAFLD. Both individuals with subclinical and overt hypothyroidism are at higher risk for NAFLD than euthyroid subjects.
A Database-Based and Web-Based Meta-CASE System
NASA Astrophysics Data System (ADS)
Eessaar, Erki; Sgirka, Rünno
Each Computer Aided Software Engineering (CASE) system provides support to a software process or specific tasks or activities that are part of a software process. Each meta-CASE system allows us to create new CASE systems. The creators of a new CASE system have to specify abstract syntax of the language that is used in the system and functionality as well as non-functional properties of the new system. Many meta-CASE systems record their data directly in files. In this paper, we introduce a meta-CASE system, the enabling technology of which is an object-relational database system (ORDBMS). The system allows users to manage specifications of languages and create models by using these languages. The system has web-based and form-based user interface. We have created a proof-of-concept prototype of the system by using PostgreSQL ORDBMS and PHP scripting language.
Methodology and reporting of meta-analyses in the neurosurgical literature.
Klimo, Paul; Thompson, Clinton J; Ragel, Brian T; Boop, Frederick A
2014-04-01
Neurosurgeons are inundated with vast amounts of new clinical research on a daily basis, making it difficult and time-consuming to keep up with the latest literature. Meta-analysis is an extension of a systematic review that employs statistical techniques to pool the data from the literature in order to calculate a cumulative effect size. This is done to answer a clearly defined a priori question. Despite their increasing popularity in the neurosurgery literature, meta-analyses have not been scrutinized in terms of reporting and methodology. The authors performed a literature search using PubMed/MEDLINE to locate all meta-analyses that have been published in the JNS Publishing Group journals (Journal of Neurosurgery, Journal of Neurosurgery: Pediatrics, Journal of Neurosurgery: Spine, and Neurosurgical Focus) or Neurosurgery. Accepted checklists for reporting (PRISMA) and methodology (AMSTAR) were applied to each meta-analysis, and the number of items within each checklist that were satisfactorily fulfilled was recorded. The authors sought to answer 4 specific questions: Are meta-analyses improving 1) with time; 2) when the study met their definition of a meta-analysis; 3) when clinicians collaborated with a potential expert in meta-analysis; and 4) when the meta-analysis was the only focus of the paper? Seventy-two meta-analyses were published in the JNS Publishing Group journals and Neurosurgery between 1990 and 2012. The number of published meta-analyses has increased dramatically in the last several years. The most common topics were vascular, and most were based on observational studies. Only 11 papers were prepared using an established checklist. The average AMSTAR and PRISMA scores (proportion of items satisfactorily fulfilled divided by the total number of eligible items in the respective instrument) were 31% and 55%, respectively. Major deficiencies were identified, including the lack of a comprehensive search strategy, study selection and data extraction, assessment of heterogeneity, publication bias, and study quality. Almost one-third of the papers did not meet our basic definition of a meta-analysis. The quality of reporting and methodology was better 1) when the study met our definition of a meta-analysis; 2) when one or more of the authors had experience or expertise in conducting a meta-analysis; 3) when the meta-analysis was not conducted alongside an evaluation of the authors' own data; and 4) in more recent studies. Reporting and methodology of meta-analyses in the neurosurgery literature is excessively variable and overall poor. As these papers are being published with increasing frequency, neurosurgical journals need to adopt a clear definition of a meta-analysis and insist that they be created using checklists for both reporting and methodology. Standardization will ensure high-quality publications.
Prevalence of Enterobius vermicularis among Children in Iran: A Systematic Review and Meta-analysis.
Moosazadeh, Mahmood; Abedi, Ghasem; Afshari, Mahdi; Mahdavi, Seif Ali; Farshidi, Fereshteh; Kheradmand, Elham
2017-04-01
Enterobius vermicularis is a parasitic disease that is common in crowded areas such as schools and kindergartens. Primary investigations of electronic evidence have reported different prevalences of E. vermicularis in Iran. Therefore, we aimed to estimate the total prevalence of this infection among Iranian children using a meta-analysis. Relevant studies were identified in national and international databases. We selected eligible papers for meta-analysis after investigating titles, abstracts, and full texts; assessing study quality; and applying inclusion/exclusion criteria. Data were extracted by two independent researchers. The results were combined using a random effects model in Stata v. 11 software. Among 19 eligible articles including 11,676 participants, the prevalences of E. vermicularis among all children, boys, and girls were 1.2%-66.1%, 2.3%-65.5%, and 1.7%-65.5%, respectively. Pooled prevalences (95% confidence interval) of E. vermicularis among all children, boys, and girls were 17.2% (12.6%-21.8%), 17.2% (12.6%-21.8%), and 16.9% (9.03%-24.8%), respectively. This meta-analysis showed that a great majority of Iranian children are infected with E. vermicularis , possibly due to poor public health.
Brunetti, Natale Daniele; Santoro, Francesco; De Gennaro, Luisa; Correale, Michele; Gaglione, Antonio; Di Biase, Matteo
2016-07-01
In a recent paper Singh et al. analyzed the effect of drug treatment on recurrence of takotsubo cardiomyopathy (TTC) in a comprehensive meta-analysis. The study found that recurrence rates were independent of clinic utilization of BB prescription, but inversely correlated with ACEi/ARB prescription: authors therefore conclude that ACEi/ARB rather than BB may reduce risk of recurrence. We aimed to re-analyze data reported in the study, now weighted for populations' size, in a meta-regression analysis. After multiple meta-regression analysis, we found a significant regression between rates of prescription of ACEi and rates of recurrence of TTC; regression was not statistically significant for BBs. On the bases of our re-analysis, we confirm that rates of recurrence of TTC are lower in populations of patients with higher rates of treatment with ACEi/ARB. That could not necessarily imply that ACEi may prevent recurrence of TTC, but barely that, for example, rates of recurrence are lower in cohorts more compliant with therapy or more prescribed with ACEi because more carefully followed. Randomized prospective studies are surely warranted. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Metaprop: a Stata command to perform meta-analysis of binomial data.
Nyaga, Victoria N; Arbyn, Marc; Aerts, Marc
2014-01-01
Meta-analyses have become an essential tool in synthesizing evidence on clinical and epidemiological questions derived from a multitude of similar studies assessing the particular issue. Appropriate and accessible statistical software is needed to produce the summary statistic of interest. Metaprop is a statistical program implemented to perform meta-analyses of proportions in Stata. It builds further on the existing Stata procedure metan which is typically used to pool effects (risk ratios, odds ratios, differences of risks or means) but which is also used to pool proportions. Metaprop implements procedures which are specific to binomial data and allows computation of exact binomial and score test-based confidence intervals. It provides appropriate methods for dealing with proportions close to or at the margins where the normal approximation procedures often break down, by use of the binomial distribution to model the within-study variability or by allowing Freeman-Tukey double arcsine transformation to stabilize the variances. Metaprop was applied on two published meta-analyses: 1) prevalence of HPV-infection in women with a Pap smear showing ASC-US; 2) cure rate after treatment for cervical precancer using cold coagulation. The first meta-analysis showed a pooled HPV-prevalence of 43% (95% CI: 38%-48%). In the second meta-analysis, the pooled percentage of cured women was 94% (95% CI: 86%-97%). By using metaprop, no studies with 0% or 100% proportions were excluded from the meta-analysis. Furthermore, study specific and pooled confidence intervals always were within admissible values, contrary to the original publication, where metan was used.
A methodological systematic review of what's wrong with meta-ethnography reporting.
France, Emma F; Ring, Nicola; Thomas, Rebecca; Noyes, Jane; Maxwell, Margaret; Jepson, Ruth
2014-11-19
Syntheses of qualitative studies can inform health policy, services and our understanding of patient experience. Meta-ethnography is a systematic seven-phase interpretive qualitative synthesis approach well-suited to producing new theories and conceptual models. However, there are concerns about the quality of meta-ethnography reporting, particularly the analysis and synthesis processes. Our aim was to investigate the application and reporting of methods in recent meta-ethnography journal papers, focusing on the analysis and synthesis process and output. Methodological systematic review of health-related meta-ethnography journal papers published from 2012-2013. We searched six electronic databases, Google Scholar and Zetoc for papers using key terms including 'meta-ethnography.' Two authors independently screened papers by title and abstract with 100% agreement. We identified 32 relevant papers. Three authors independently extracted data and all authors analysed the application and reporting of methods using content analysis. Meta-ethnography was applied in diverse ways, sometimes inappropriately. In 13% of papers the approach did not suit the research aim. In 66% of papers reviewers did not follow the principles of meta-ethnography. The analytical and synthesis processes were poorly reported overall. In only 31% of papers reviewers clearly described how they analysed conceptual data from primary studies (phase 5, 'translation' of studies) and in only one paper (3%) reviewers explicitly described how they conducted the analytic synthesis process (phase 6). In 38% of papers we could not ascertain if reviewers had achieved any new interpretation of primary studies. In over 30% of papers seminal methodological texts which could have informed methods were not cited. We believe this is the first in-depth methodological systematic review of meta-ethnography conduct and reporting. Meta-ethnography is an evolving approach. Current reporting of methods, analysis and synthesis lacks clarity and comprehensiveness. This is a major barrier to use of meta-ethnography findings that could contribute significantly to the evidence base because it makes judging their rigour and credibility difficult. To realise the high potential value of meta-ethnography for enhancing health care and understanding patient experience requires reporting that clearly conveys the methodology, analysis and findings. Tailored meta-ethnography reporting guidelines, developed through expert consensus, could improve reporting.
Improving Crop Yield and Nutrient Use Efficiency via Biofertilization—A Global Meta-analysis
Schütz, Lukas; Gattinger, Andreas; Meier, Matthias; Müller, Adrian; Boller, Thomas; Mäder, Paul; Mathimaran, Natarajan
2018-01-01
The application of microbial inoculants (biofertilizers) is a promising technology for future sustainable farming systems in view of rapidly decreasing phosphorus stocks and the need to more efficiently use available nitrogen (N). Various microbial taxa are currently used as biofertilizers, based on their capacity to access nutrients from fertilizers and soil stocks, to fix atmospheric nitrogen, to improve water uptake or to act as biocontrol agents. Despite the existence of a considerable knowledge on effects of specific taxa of biofertilizers, a comprehensive quantitative assessment of the performance of biofertilizers with different traits such as phosphorus solubilization and N fixation applied to various crops at a global scale is missing. We conducted a meta-analysis to quantify benefits of biofertilizers in terms of yield increase, nitrogen and phosphorus use efficiency, based on 171 peer reviewed publications that met eligibility criteria. Major findings are: (i) the superiority of biofertilizer performance in dry climates over other climatic regions (yield response: dry climate +20.0 ± 1.7%, tropical climate +14.9 ± 1.2%, oceanic climate +10.0 ± 3.7%, continental climate +8.5 ± 2.4%); (ii) meta-regression analyses revealed that yield response due to biofertilizer application was generally small at low soil P levels; efficacy increased along higher soil P levels in the order arbuscular mycorrhizal fungi (AMF), P solubilizers, and N fixers; (iii) meta-regressions showed that the success of inoculation with AMF was greater at low organic matter content and at neutral pH. Our comprehensive analysis provides a basis and guidance for proper choice and application of biofertilizers. PMID:29375594
Improving Crop Yield and Nutrient Use Efficiency via Biofertilization-A Global Meta-analysis.
Schütz, Lukas; Gattinger, Andreas; Meier, Matthias; Müller, Adrian; Boller, Thomas; Mäder, Paul; Mathimaran, Natarajan
2017-01-01
The application of microbial inoculants (biofertilizers) is a promising technology for future sustainable farming systems in view of rapidly decreasing phosphorus stocks and the need to more efficiently use available nitrogen (N). Various microbial taxa are currently used as biofertilizers, based on their capacity to access nutrients from fertilizers and soil stocks, to fix atmospheric nitrogen, to improve water uptake or to act as biocontrol agents. Despite the existence of a considerable knowledge on effects of specific taxa of biofertilizers, a comprehensive quantitative assessment of the performance of biofertilizers with different traits such as phosphorus solubilization and N fixation applied to various crops at a global scale is missing. We conducted a meta-analysis to quantify benefits of biofertilizers in terms of yield increase, nitrogen and phosphorus use efficiency, based on 171 peer reviewed publications that met eligibility criteria. Major findings are: (i) the superiority of biofertilizer performance in dry climates over other climatic regions (yield response: dry climate +20.0 ± 1.7%, tropical climate +14.9 ± 1.2%, oceanic climate +10.0 ± 3.7%, continental climate +8.5 ± 2.4%); (ii) meta-regression analyses revealed that yield response due to biofertilizer application was generally small at low soil P levels; efficacy increased along higher soil P levels in the order arbuscular mycorrhizal fungi (AMF), P solubilizers, and N fixers; (iii) meta-regressions showed that the success of inoculation with AMF was greater at low organic matter content and at neutral pH. Our comprehensive analysis provides a basis and guidance for proper choice and application of biofertilizers.
Meta-Analysis of Workplace Physical Activity Interventions
Conn, Vicki S.; Hafdahl, Adam R.; Cooper, Pamela S.; Brown, Lori M.; Lusk, Sally L.
2009-01-01
Context Most adults do not achieve adequate physical activity. Despite the potential benefits of worksite health promotion, no previous comprehensive meta-analysis has summarized health and physical activity behavior outcomes from these programs. This comprehensive meta-analysis integrated the extant wide range of worksite physical activity intervention research. Evidence acquisition Extensive searching located published and unpublished intervention studies reported from 1969 through 2007. Results were coded from primary studies. Random-effects meta-analytic procedures, including moderator analyses, were completed in 2008. Evidence synthesis Effects on most variables were substantially heterogeneous because diverse studies were included. Standardized mean difference (d) effect sizes were synthesized across approximately 38,231 subjects. Significantly positive effects were observed for physical activity behavior (0.21), fitness (0.57), lipids (0.13), anthropometric measures (0.08), work attendance (0.19), and job stress (0.33). The significant effect size for diabetes risk (0.98) is more tentative given small sample sizes. Significant heterogeneity documents intervention effects varied across studies. The mean effect size for fitness corresponds to a difference between treatment minus control subjects' means on V02max of 3.5 mL/kg/min; for lipids, −0.2 on total cholesterol:HDL; and for diabetes risk, −12.6 mg/dL on fasting glucose. Conclusions These findings document that some workplace physical activity interventions can improve both health and important worksite outcomes. Effects were variable for most outcomes, reflecting the diversity of primary studies. Future primary research should compare interventions to confirm causal relationships and further explore heterogeneity. PMID:19765506
Xue, Y. N.; Li, Z. W.; Zhang, W.; Ji, X. P.; Fan, Z.
2018-01-01
Pityriasis rosea (PR), a skin rash, causes substantial discomfort in patients. There is a lack of effective therapies for PR. A combination of ultraviolet irradiation and indigo naturalis treatment has been shown to be a safe and effective regime for control of PR; however, the data have been largely inconsistent. Tis meta-analysis further evaluated the efficacy and safety of this combination in patients with PR. The PubMed, Embase, Cochrane Library, CNKI, VIP, and Wan Fang databases were searched for relevant RCTs of this combination therapy in patients with PR. A total of eight studies with a combined study population of 688 patients published between January 2006 and March 2016 were eligible for this meta-analysis. The RevMan 5.3 software was used for the meta-analysis. The regimen of compound indigo naturalis plus NB-UVB showed much better control of PR as compared to that achieved with use of compound indigo naturalis or NB-UVB alone in terms of cure rate or effective rate. However, no significant difference was observed between the two with respect to incidence of adverse effects. The analysis was affected by publication bias as revealed by funnel plot analysis. Further studies with large sample sizes are required to confirm our findings. PMID:29770152
Wang, L; Xue, Y N; Li, Z W; Zhang, W; Ji, X P; Fan, Z; Li, Y J
2018-01-01
Pityriasis rosea (PR), a skin rash, causes substantial discomfort in patients. There is a lack of effective therapies for PR. A combination of ultraviolet irradiation and indigo naturalis treatment has been shown to be a safe and effective regime for control of PR; however, the data have been largely inconsistent. Tis meta-analysis further evaluated the efficacy and safety of this combination in patients with PR. The PubMed, Embase, Cochrane Library, CNKI, VIP, and Wan Fang databases were searched for relevant RCTs of this combination therapy in patients with PR. A total of eight studies with a combined study population of 688 patients published between January 2006 and March 2016 were eligible for this meta-analysis. The RevMan 5.3 software was used for the meta-analysis. The regimen of compound indigo naturalis plus NB-UVB showed much better control of PR as compared to that achieved with use of compound indigo naturalis or NB-UVB alone in terms of cure rate or effective rate. However, no significant difference was observed between the two with respect to incidence of adverse effects. The analysis was affected by publication bias as revealed by funnel plot analysis. Further studies with large sample sizes are required to confirm our findings.
Seqcrawler: biological data indexing and browsing platform.
Sallou, Olivier; Bretaudeau, Anthony; Roult, Aurelien
2012-07-24
Seqcrawler takes its roots in software like SRS or Lucegene. It provides an indexing platform to ease the search of data and meta-data in biological banks and it can scale to face the current flow of data. While many biological bank search tools are available on the Internet, mainly provided by large organizations to search their data, there is a lack of free and open source solutions to browse one's own set of data with a flexible query system and able to scale from a single computer to a cloud system. A personal index platform will help labs and bioinformaticians to search their meta-data but also to build a larger information system with custom subsets of data. The software is scalable from a single computer to a cloud-based infrastructure. It has been successfully tested in a private cloud with 3 index shards (pieces of index) hosting ~400 millions of sequence information (whole GenBank, UniProt, PDB and others) for a total size of 600 GB in a fault tolerant architecture (high-availability). It has also been successfully integrated with software to add extra meta-data from blast results to enhance users' result analysis. Seqcrawler provides a complete open source search and store solution for labs or platforms needing to manage large amount of data/meta-data with a flexible and customizable web interface. All components (search engine, visualization and data storage), though independent, share a common and coherent data system that can be queried with a simple HTTP interface. The solution scales easily and can also provide a high availability infrastructure.
Metaplot: a novel stata graph for assessing heterogeneity at a glance.
Poorolajal, J; Mahmoodi, M; Majdzadeh, R; Fotouhi, A
2010-01-01
Heterogeneity is usually a major concern in meta-analysis. Although there are some statistical approaches for assessing variability across studies, here we present a new approach to heterogeneity using "MetaPlot" that investigate the influence of a single study on the overall heterogeneity. MetaPlot is a two-way (x, y) graph, which can be considered as a complementary graphical approach for testing heterogeneity. This method shows graphically as well as numerically the results of an influence analysis, in which Higgins' I(2) statistic with 95% (Confidence interval) CI are computed omitting one study in each turn and then are plotted against reciprocal of standard error (1/SE) or "precision". In this graph, "1/SE" lies on x axis and "I(2) results" lies on y axe. Having a first glance at MetaPlot, one can predict to what extent omission of a single study may influence the overall heterogeneity. The precision on x-axis enables us to distinguish the size of each trial. The graph describes I(2) statistic with 95% CI graphically as well as numerically in one view for prompt comparison. It is possible to implement MetaPlot for meta-analysis of different types of outcome data and summary measures. This method presents a simple graphical approach to identify an outlier and its effect on overall heterogeneity at a glance. We wish to suggest MetaPlot to Stata experts to prepare its module for the software.
Metaplot: A Novel Stata Graph for Assessing Heterogeneity at a Glance
Poorolajal, J; Mahmoodi, M; Majdzadeh, R; Fotouhi, A
2010-01-01
Background: Heterogeneity is usually a major concern in meta-analysis. Although there are some statistical approaches for assessing variability across studies, here we present a new approach to heterogeneity using “MetaPlot” that investigate the influence of a single study on the overall heterogeneity. Methods: MetaPlot is a two-way (x, y) graph, which can be considered as a complementary graphical approach for testing heterogeneity. This method shows graphically as well as numerically the results of an influence analysis, in which Higgins’ I2 statistic with 95% (Confidence interval) CI are computed omitting one study in each turn and then are plotted against reciprocal of standard error (1/SE) or “precision”. In this graph, “1/SE” lies on x axis and “I2 results” lies on y axe. Results: Having a first glance at MetaPlot, one can predict to what extent omission of a single study may influence the overall heterogeneity. The precision on x-axis enables us to distinguish the size of each trial. The graph describes I2 statistic with 95% CI graphically as well as numerically in one view for prompt comparison. It is possible to implement MetaPlot for meta-analysis of different types of outcome data and summary measures. Conclusion: This method presents a simple graphical approach to identify an outlier and its effect on overall heterogeneity at a glance. We wish to suggest MetaPlot to Stata experts to prepare its module for the software. PMID:23113013
Zhao, Kun; Yang, Ming; Lu, Yanxia; Sun, Shusen; Li, Wei; Li, Xingang; Zhao, Zhigang
2018-05-23
Some studies have reported an association between P2Y12 gene polymorphisms and clopidogrel adverse outcomes with inconsistent results. We aimed to explore the relationship between P2Y12 polymorphisms and the risk of adverse clinical events in patients treated with clopidogrel through a meta-analysis. A systematic search of PubMed, Web of Science and the Cochrane Library was conducted. Retrieved articles were comprehensively reviewed and eligible studies were included, and the relevant data was extracted for this meta-analysis. All statistical tests were performed by the Review Manager 5.3 software. A total of 14 studies involving 8,698 patients were included. In the Han Chinese population, ischemic events were associated with P2Y12 T744C polymorphism in the CC vs TT+CT genetic model (OR=3.32, 95%CI=1.62-6.82, P =0.001), and the events were associated with P2Y12 C34T polymorphism in the TT+TC vs CC genetic model (OR=1.70, 95%CI=1.22-2.36, P =0.002). However, ischemic events were not related to P2Y12 G52T polymorphism (TT+TG vs GG: OR=1.13, 95%CI=0.76-1.68, P =0.56; TT vs GG+TG: OR=2.02, 95%CI=0.65-6.28, P =0.22). The associations between the P2Y12 polymorphism and ischemic events were not significant in T744C, G52T and C34T genotype for another subgroup of the Caucasian population ( P >0.05). Only two studies referring to bleeding events were included in this analysis of C34T polymorphism, and no significant association was found (TT+TC vs CC: OR=1.07, 95%CI=0.37-3.15, P =0.90). In the Caucasian population, P2Y12 gene polymorphisms are not associated with clinical events. However, in the Chinese Han population, P2Y12 T744C and C34T polymorphisms are significantly associated with adverse clinical events. © Georg Thieme Verlag KG Stuttgart · New York.
When is hub gene selection better than standard meta-analysis?
Langfelder, Peter; Mischel, Paul S; Horvath, Steve
2013-01-01
Since hub nodes have been found to play important roles in many networks, highly connected hub genes are expected to play an important role in biology as well. However, the empirical evidence remains ambiguous. An open question is whether (or when) hub gene selection leads to more meaningful gene lists than a standard statistical analysis based on significance testing when analyzing genomic data sets (e.g., gene expression or DNA methylation data). Here we address this question for the special case when multiple genomic data sets are available. This is of great practical importance since for many research questions multiple data sets are publicly available. In this case, the data analyst can decide between a standard statistical approach (e.g., based on meta-analysis) and a co-expression network analysis approach that selects intramodular hubs in consensus modules. We assess the performance of these two types of approaches according to two criteria. The first criterion evaluates the biological insights gained and is relevant in basic research. The second criterion evaluates the validation success (reproducibility) in independent data sets and often applies in clinical diagnostic or prognostic applications. We compare meta-analysis with consensus network analysis based on weighted correlation network analysis (WGCNA) in three comprehensive and unbiased empirical studies: (1) Finding genes predictive of lung cancer survival, (2) finding methylation markers related to age, and (3) finding mouse genes related to total cholesterol. The results demonstrate that intramodular hub gene status with respect to consensus modules is more useful than a meta-analysis p-value when identifying biologically meaningful gene lists (reflecting criterion 1). However, standard meta-analysis methods perform as good as (if not better than) a consensus network approach in terms of validation success (criterion 2). The article also reports a comparison of meta-analysis techniques applied to gene expression data and presents novel R functions for carrying out consensus network analysis, network based screening, and meta analysis.
Weymann, Alexander; Ali-Hasan-Al-Saegh, Sadeq; Sabashnikov, Anton; Popov, Aron-Frederik; Mirhosseini, Seyed Jalil; Liu, Tong; Lotfaliani, Mohammadreza; de Oliveira Sá, Michel Pompeu Barros; Baker, William L.; Yavuz, Senol; Zeriouh, Mohamed; Jang, Jae-Sik; Dehghan, Hamidreza; Meng, Lei; Testa, Luca; D’Ascenzo, Fabrizio; Benedetto, Umberto; Tse, Gary; Nombela-Franco, Luis; Dohmen, Pascal M.; Deshmukh, Abhishek J.; Linde, Cecilia; Biondi-Zoccai, Giuseppe; Stone, Gregg W.; Calkins, Hugh
2017-01-01
Background Atrial fibrillation (AF) is one of the most critical and frequent arrhythmias precipitating morbidities and mortalities. The complete blood count (CBC) test is an important blood test in clinical practice and is routinely used in the workup of cardiovascular diseases. This systematic review with meta-analysis aimed to determine the strength of evidence for evaluating the association of hematological parameters in the CBC test with new-onset and recurrent AF. Material/Methods We conducted a meta-analysis of observational studies evaluating hematologic parameters in patients with new-onset AF and recurrent AF. A comprehensive subgroup analysis was performed to explore potential sources of heterogeneity. Results The literature search of all major databases retrieved 2150 studies. After screening, 70 studies were analyzed in the meta-analysis on new-onset AF and 23 studies on recurrent AF. Pooled analysis on new-onset AF showed platelet count (PC) (weighted mean difference (WMD)=WMD of −26.39×109/L and p<0.001), mean platelet volume (MPV) (WMD=0.42 FL and p<0.001), white blood cell (WBC) (WMD=−0.005×109/L and p=0.83), neutrophil to lymphocyte ratio (NLR) (WMD=0.89 and p<0.001), and red blood cell distribution width (RDW) (WMD=0.61% and p<0.001) as associated factors. Pooled analysis on recurrent AF revealed PC (WMD=−2.71×109/L and p=0.59), WBC (WMD=0.20×109/L (95% CI: 0.08 to 0.32; p=0.002), NLR (WMD=0.37 and p<0.001), and RDW (WMD=0.28% and p<0.001). Conclusions Hematological parameters have significant ability to predict occurrence and recurrence of AF. Therefore, emphasizing the potential predictive role of hematological parameters for new-onset and recurrent AF, we recommend adding the CBC test to the diagnostic modalities of AF in clinical practice. PMID:28496093
Weymann, Alexander; Ali-Hasan-Al-Saegh, Sadeq; Sabashnikov, Anton; Popov, Aron-Frederik; Mirhosseini, Seyed Jalil; Liu, Tong; Lotfaliani, Mohammadreza; Sá, Michel Pompeu Barros de Oliveira; Baker, William L L; Yavuz, Senol; Zeriouh, Mohamed; Jang, Jae-Sik; Dehghan, Hamidreza; Meng, Lei; Testa, Luca; D'Ascenzo, Fabrizio; Benedetto, Umberto; Tse, Gary; Nombela-Franco, Luis; Dohmen, Pascal M; Deshmukh, Abhishek J; Linde, Cecilia; Biondi-Zoccai, Giuseppe; Stone, Gregg W; Calkins, Hugh; Surgery And Cardiology-Group Imcsc-Group, Integrated Meta-Analysis Of Cardiac
2017-05-12
BACKGROUND Atrial fibrillation (AF) is one of the most critical and frequent arrhythmias precipitating morbidities and mortalities. The complete blood count (CBC) test is an important blood test in clinical practice and is routinely used in the workup of cardiovascular diseases. This systematic review with meta-analysis aimed to determine the strength of evidence for evaluating the association of hematological parameters in the CBC test with new-onset and recurrent AF. MATERIAL AND METHODS We conducted a meta-analysis of observational studies evaluating hematologic parameters in patients with new-onset AF and recurrent AF. A comprehensive subgroup analysis was performed to explore potential sources of heterogeneity. RESULTS The literature search of all major databases retrieved 2150 studies. After screening, 70 studies were analyzed in the meta-analysis on new-onset AF and 23 studies on recurrent AF. Pooled analysis on new-onset AF showed platelet count (PC) (weighted mean difference (WMD)=WMD of -26.39×10^9/L and p<0.001), mean platelet volume (MPV) (WMD=0.42 FL and p<0.001), white blood cell (WBC) (WMD=-0.005×10^9/L and p=0.83), neutrophil to lymphocyte ratio (NLR) (WMD=0.89 and p<0.001), and red blood cell distribution width (RDW) (WMD=0.61% and p<0.001) as associated factors. Pooled analysis on recurrent AF revealed PC (WMD=-2.71×109/L and p=0.59), WBC (WMD=0.20×10^9/L (95% CI: 0.08 to 0.32; p=0.002), NLR (WMD=0.37 and p<0.001), and RDW (WMD=0.28% and p<0.001). CONCLUSIONS Hematological parameters have significant ability to predict occurrence and recurrence of AF. Therefore, emphasizing the potential predictive role of hematological parameters for new-onset and recurrent AF, we recommend adding the CBC test to the diagnostic modalities of AF in clinical practice.
Nagendran, Myura; Maruthappu, Mahiben; Gordon, Anthony C; Gurusamy, Kurinchi S
2016-05-01
Septic shock is a life-threatening condition requiring vasopressor agents to support the circulatory system. Several agents exist with choice typically guided by the specific clinical scenario. We used a network meta-analysis approach to rate the comparative efficacy and safety of vasopressors for mortality and arrhythmia incidence in septic shock patients. We performed a comprehensive electronic database search including Medline, Embase, Science Citation Index Expanded and the Cochrane database. Randomised trials investigating vasopressor agents in septic shock patients and specifically assessing 28-day mortality or arrhythmia incidence were included. A Bayesian network meta-analysis was performed using Markov chain Monte Carlo methods. Thirteen trials of low to moderate risk of bias in which 3146 patients were randomised were included. There was no pairwise evidence to suggest one agent was superior over another for mortality. In the network meta-analysis, vasopressin was significantly superior to dopamine (OR 0.68 (95% CI 0.5 to 0.94)) for mortality. For arrhythmia incidence, standard pairwise meta-analyses confirmed that dopamine led to a higher incidence of arrhythmias than norepinephrine (OR 2.69 (95% CI 2.08 to 3.47)). In the network meta-analysis, there was no evidence of superiority of one agent over another. In this network meta-analysis, vasopressin was superior to dopamine for 28-day mortality in septic shock. Existing pairwise information supports the use of norepinephrine over dopamine. Our findings suggest that dopamine should be avoided in patients with septic shock and that other vasopressor agents should continue to be based on existing guidelines and clinical judgement of the specific presentation of the patient.
Immigrant women's experience of maternity services in Canada: a meta-ethnography.
Higginbottom, Gina M A; Hadziabdic, Emina; Yohani, Sophie; Paton, Patricia
2014-05-01
to synthesise data on immigrant women's experiences of maternity services in Canada. a qualitative systematic literature review using a meta-ethnographic approach a comprehensive search strategy of multiple databases was employed in consultation with an information librarian, to identify qualitative research studies published in English or French between 1990 and December 2011 on maternity care experiences of immigrant women in Canada. A modified version of Noblit and Hare's meta-ethnographic theoretical approach was undertaken to develop an inductive and interpretive form of knowledge synthesis. The seven-phase process involved comparative textual analysis of published qualitative studies, including the translation of key concepts and meanings from one study to another to derive second and third-order concepts encompassing more than that offered by any individual study. ATLAS.ti qualitative data analysis software was used to store and manage the studies and synthesise their findings. the literature search identified 393 papers, of which 22 met the inclusion criteria and were synthesised. The literature contained seven key concepts related to maternity service experiences including social (professional and informal) support, communication, socio-economic barriers, organisational environment, knowledge about maternity services and health care, cultural beliefs and practices, and different expectations between health care staff and immigrant women. Three second-order interpretations served as the foundation for two third-order interpretations. Societal positioning of immigrant women resulted in difficulties receiving high quality maternity health care. Maternity services were an experience in which cultural knowledge and beliefs, and religious and traditional preferences were highly relevant as well but often overlooked in Canadian maternity settings. in order to implement woman-centered care, to enhance access to maternity services, and to promote immigrant women's health, it is important to consider these women's social position, cultural knowledge and beliefs, and traditional customs in the health care. Copyright © 2013 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gao, Jianzhao; Wu, Zhonghua; Hu, Gang
Selection of proper targets for the X-ray crystallography will benefit biological research community immensely. Several computational models were proposed to predict propensity of successful protein production and diffraction quality crystallization from protein sequences. We reviewed a comprehensive collection of 22 such predictors that were developed in the last decade. We found that almost all of these models are easily accessible as webservers and/or standalone software and we demonstrated that some of them are widely used by the research community. We empirically evaluated and compared the predictive performance of seven representative methods. The analysis suggests that these methods produce quite accuratemore » propensities for the diffraction-quality crystallization. We also summarized results of the first study of the relation between these predictive propensities and the resolution of the crystallizable proteins. We found that the propensities predicted by several methods are significantly higher for proteins that have high resolution structures compared to those with the low resolution structures. Moreover, we tested a new meta-predictor, MetaXXC, which averages the propensities generated by the three most accurate predictors of the diffraction-quality crystallization. MetaXXC generates putative values of resolution that have modest levels of correlation with the experimental resolutions and it offers the lowest mean absolute error when compared to the seven considered methods. We conclude that protein sequences can be used to fairly accurately predict whether their corresponding protein structures can be solved using X-ray crystallography. Moreover, we also ascertain that sequences can be used to reasonably well predict the resolution of the resulting protein crystals.« less
Zhang, Hao; Tang, Hao; He, Qianyun; Wei, Qiang; Tong, Dake; Wang, Chuangfeng; Wu, Dajiang; Wang, Guangchao; Zhang, Xin; Ding, Wenbin; Li, Di; Ding, Chen; Liu, Kang; Ji, Fang
2015-11-01
Although many meta-analyses comparing surgical intervention with conservative treatment have been conducted for acute Achilles tendon rupture, discordant conclusions are shown. This study systematically reviewed the overlapping meta-analyses relating to surgical versus conservative intervention of acute Achilles tendon rupture to assist decision makers select among conflicting meta-analyses, and to offer intervention recommendations based on the currently best evidence.Multiple databases were comprehensively searched for meta-analyses comparing surgical with conservative treatment of acute Achilles tendon rupture. Meta-analyses only comprising randomized controlled trials (RCTs) were included. Two authors independently evaluated the meta-analysis quality and extracted data. The Jadad decision algorithm was applied to ascertain which meta-analysis offered the best evidence.A total of 9 meta-analyses were included. Only RCTs were determined as Level-II evidence. The scores of Assessment of Multiple Systematic Reviews (AMSTAR) ranged from 5 to 10 (median 7). A high-quality meta-analysis with more RCTs was selected according to the Jadad decision algorithm. This study found that when functional rehabilitation was used, conservative intervention was equal to surgical treatment regarding the incidence of rerupture, range of motion, calf circumference, and functional outcomes, while reducing the incidence of other complications. Where functional rehabilitation was not performed, conservative intervention could significantly increase rerupture rate.Conservative intervention may be preferred for acute Achilles tendon rupture at centers offering functional rehabilitation, because it shows a similar rerupture rate with a lower risk of other complications when compared with surgical treatment. However, surgical treatment should be considered at centers without functional rehabilitation as this can reduce the incidence of rerupture.
Celiac Disease and Increased Risk of Pneumococcal Infection: A Systematic Review and Meta-Analysis.
Simons, Malorie; Scott-Sheldon, Lori A J; Risech-Neyman, Yesenia; Moss, Steven F; Ludvigsson, Jonas F; Green, Peter H R
2018-01-01
Celiac disease has been associated with hyposplenism, and multiple case reports link celiac disease and pneumococcal infections; however, increased risk of pneumococcal infection in celiac disease has not been confirmed. The purpose of this study was to conduct a systematic review to determine the risk of pneumococcal infections in celiac disease. Relevant studies were identified using electronic bibliographic searches of PubMed, OVID, Medline, and EMBASE (1980 to February 2017) and reviewing abstracts from major conferences in gastroenterology. Using number of events in celiac patients and referent patients, we calculated a summary relative risk of pneumococcal infections. All analyses were conducted in Comprehensive Meta-Analysis software using random-effects assumptions. Of a total of 156 articles, 3, representing 3 large databases (the Swedish National Inpatient Register; the Oxford Record Linkage Study; and the English National Hospital Episode Statistics) were included. Each compared patients with celiac disease and confirmed pneumococcal infection to a specific reference group: inpatients and/or the general population. Overall, the odds of pneumococcal infection were higher among hospitalized celiac patients compared with controls (odds ratio 1.66; 95% confidence interval 1.43-1.92). There was no evidence of heterogeneity (Q[1] = 1.17, P = .56, I 2 = 0%). Celiac disease is associated with an increased risk of pneumococcal infection. Preventive pneumococcal vaccination should be considered for those with celiac disease, with special attention to those aged 15-64 years who have not received the scheduled pneumococcal vaccination series as a child. Copyright © 2018 Elsevier Inc. All rights reserved.
Li, B B; Lin, F; Cai, L H; Chen, Y; Lin, Z J
2017-08-01
Objective: To evaluate the effects of parallel versus perpendicular double plating for distal humerus fracture of type C. Methods: A standardized comprehensive literature search was performed by PubMed, Embase, Cochrane library, CMB, CNKI and Medline datebase.Randomized controlled studies on comparison between parallel versus perpendicular double plating for distal humerus fracture of type C before December 2015 were enrolled in the study.All date were analyzed by the RevMan 5.2 software. Results: Six studies, including 284 patients, met the inclusion criteria.There were 155 patients in perpendicular double plating group, 129 patients in parallel double plating group.The results of Meta-analysis indicated that there were statistically significant difference between the two groups in complications ( OR =2.59, 95% CI : 1.03 to 6.53, P =0.04). There was no significant difference between the two groups in surgical duration ( MD =-1.84, 95% CI : -9.06 to 5.39, P =0.62), bone union time ( MD =0.09, 95% CI : -0.06 to 0.24, P =0.22), Mayo Elbow Performance Score ( MD =0.09, 95% CI : -0.06 to 0.24, P =0.22), Range of Motions ( MD =-0.92, 95% CI : -4.65 to 2.81, P =0.63) and the rate of excellent and good results ( OR =0.64, 95% CI : 0.27 to 1.52, P =0.31). Conclusion: Both perpendicular and parallel double plating are effective in distal humerus fracture of type C, parallel double plating has less complications.
Jha, Ashwini Kumar; Tang, Wen Hao; Bai, Zhi Bin; Xiao, Jia Quan
2014-01-01
To perform a meta-analysis to review the sensitivity and specificity of computed tomography and different known computed yomography signs for the diagnosis of strangulation in patients with acute small bowel obstruction. A comprehensive Pubmed search was performed for all reports that evaluated the use of CT and discussed different CT criteria for the diagnosis of acute SBO. Articles published in English language from January 1978 to June 2008 were included. Review articles, case reports, pictorial essays and articles without original data were excluded. The bivariate random effect model was used to obtain pooled sensitivity and pooled specificity. Summary receiver operating curve was calculated using Meta-Disc. Software Openbugs 3.0.3 was used to summarize the data. A total of 12 studies fulfilled the inclusion criteria. The pooled sensitivity and specificity of CT in the diagnosis of strangulation was 0.720 (95% CI 0.674 to 0.763) and 0.866 (95% CI 0.837 to 0.892) respectively. Among different CT signs, mesenteric edema had highest Pooled sensitivity of 0. 741 and lack of bowel wall enhancement had highest pooled specificity of 0.991. This review demonstrates that CT is highly sensitive as well as specific in the preoperative diagnosis of strangulation SBO which are in accordance with the published studies. Our analysis also shows that "presence of mesenteric fluid" is most sensitive, and "lack of bowel wall enhancement" is most specific CT sign of strangulation, and also justifies need of large scale prospective studies to validate the results obtained as well as to determine a clinical protocol.
RELAP-7 Software Verification and Validation Plan
DOE Office of Scientific and Technical Information (OSTI.GOV)
Smith, Curtis L.; Choi, Yong-Joon; Zou, Ling
This INL plan comprehensively describes the software for RELAP-7 and documents the software, interface, and software design requirements for the application. The plan also describes the testing-based software verification and validation (SV&V) process—a set of specially designed software models used to test RELAP-7. The RELAP-7 (Reactor Excursion and Leak Analysis Program) code is a nuclear reactor system safety analysis code being developed at Idaho National Laboratory (INL). The code is based on the INL’s modern scientific software development framework – MOOSE (Multi-Physics Object-Oriented Simulation Environment). The overall design goal of RELAP-7 is to take advantage of the previous thirty yearsmore » of advancements in computer architecture, software design, numerical integration methods, and physical models. The end result will be a reactor systems analysis capability that retains and improves upon RELAP5’s capability and extends the analysis capability for all reactor system simulation scenarios.« less
Doi, Suhail A R; Barendregt, Jan J; Khan, Shahjahan; Thalib, Lukman; Williams, Gail M
2015-11-01
This article examines an improved alternative to the random effects (RE) model for meta-analysis of heterogeneous studies. It is shown that the known issues of underestimation of the statistical error and spuriously overconfident estimates with the RE model can be resolved by the use of an estimator under the fixed effect model assumption with a quasi-likelihood based variance structure - the IVhet model. Extensive simulations confirm that this estimator retains a correct coverage probability and a lower observed variance than the RE model estimator, regardless of heterogeneity. When the proposed IVhet method is applied to the controversial meta-analysis of intravenous magnesium for the prevention of mortality after myocardial infarction, the pooled OR is 1.01 (95% CI 0.71-1.46) which not only favors the larger studies but also indicates more uncertainty around the point estimate. In comparison, under the RE model the pooled OR is 0.71 (95% CI 0.57-0.89) which, given the simulation results, reflects underestimation of the statistical error. Given the compelling evidence generated, we recommend that the IVhet model replace both the FE and RE models. To facilitate this, it has been implemented into free meta-analysis software called MetaXL which can be downloaded from www.epigear.com. Copyright © 2015 Elsevier Inc. All rights reserved.
Advances in the meta-analysis of heterogeneous clinical trials II: The quality effects model.
Doi, Suhail A R; Barendregt, Jan J; Khan, Shahjahan; Thalib, Lukman; Williams, Gail M
2015-11-01
This article examines the performance of the updated quality effects (QE) estimator for meta-analysis of heterogeneous studies. It is shown that this approach leads to a decreased mean squared error (MSE) of the estimator while maintaining the nominal level of coverage probability of the confidence interval. Extensive simulation studies confirm that this approach leads to the maintenance of the correct coverage probability of the confidence interval, regardless of the level of heterogeneity, as well as a lower observed variance compared to the random effects (RE) model. The QE model is robust to subjectivity in quality assessment down to completely random entry, in which case its MSE equals that of the RE estimator. When the proposed QE method is applied to a meta-analysis of magnesium for myocardial infarction data, the pooled mortality odds ratio (OR) becomes 0.81 (95% CI 0.61-1.08) which favors the larger studies but also reflects the increased uncertainty around the pooled estimate. In comparison, under the RE model, the pooled mortality OR is 0.71 (95% CI 0.57-0.89) which is less conservative than that of the QE results. The new estimation method has been implemented into the free meta-analysis software MetaXL which allows comparison of alternative estimators and can be downloaded from www.epigear.com. Copyright © 2015 Elsevier Inc. All rights reserved.
Wang, Taiwu; Xu, Cong; Pan, Keli; Xiong, Hongyan
2017-03-23
As the etiology of chronic fatigue syndrome (CFS) is unclear and the treatment is still a big issue. There exists a wide range of literature about acupuncture and moxibustion (AM) for CFS in traditional Chinese medicine (TCM). But there are certain doubts as well in the effectiveness of its treatment due to the lack of a comprehensive and evidence-based medical proof to dispel the misgivings. Current study evaluated systematically the effectiveness of acupuncture and moxibustion treatments on CFS, and clarified the difference among them and Chinese herbal medicine, western medicine and sham-acupuncture. We comprehensively reviewed literature including PubMed, EMBASE, Cochrane library, CBM (Chinese Biomedical Literature Database) and CNKI (China National Knowledge Infrastructure) up to May 2016, for RCT clinical research on CFS treated by acupuncture and moxibustion. Traditional direct meta-analysis was adopted to analyze the difference between AM and other treatments. Analysis was performed based on the treatment in experiment and control groups. Network meta-analysis was adopted to make comprehensive comparisons between any two kinds of treatments. The primary outcome was total effective rate, while relative risks (RR) and 95% confidence intervals (CI) were used as the final pooled statistics. A total of 31 randomized controlled trials (RCTs) were enrolled in analyses. In traditional direct meta-analysis, we found that in comparison to Chinese herbal medicine, CbAM (combined acupuncture and moxibustion, which meant two or more types of acupuncture and moxibustion were adopted) had a higher total effective rate (RR (95% CI), 1.17 (1.09 ~ 1.25)). Compared with Chinese herbal medicine, western medicine and sham-acupuncture, SAM (single acupuncture or single moxibustion) had a higher total effective rate, with RR (95% CI) of 1.22 (1.14 ~ 1.30), 1.51 (1.31-1.74), 5.90 (3.64-9.56). In addition, compared with SAM, CbAM had a higher total effective rate (RR (95% CI), 1.23 (1.12 ~ 1.36)). In network meta-analyses, similar results were recorded. Subsequently, we ranked all treatments from high to low effective rate and the order was CbAM, SAM, Chinese herbal medicine, western medicine and sham-acupuncture. In the treatment of CFS, CbAM and SAM may have better effect than other treatments. However, the included trials have relatively poor quality, hence high quality studies are needed to confirm our finding.
Pournaghi Azar, F; Mamizadeh, M; Nikniaz, Z; Ghojazadeh, M; Hajebrahimi, S; Salehnia, F; Mashhadi Abdolahi, H
2018-03-01
The evidence about the content of TV advertisements broadcast during children's viewing times with an emphasis on the number of food advertisements and the number of cariogenic food advertisements was systematically reviewed and meta-analyzed. A systematic review and meta-analysis. Articles published up until October 2017 in PubMed, Scopus, Embase, Web of Science, Cochrane Library, and Persian databases such as Magiran, IranDoc, and Iranmedex with the keywords that were related to advertising and oral health in children were searched and screened by two reviewers independently, and the outcomes of interest were extracted. Meta-analysis was performed using the Comprehensive Meta-Analysis, version 2.0. A total of 480 titles were retrieved and reduced to 256 eligible studies after deletion of duplicates, and finally, after closer assessment of titles and abstracts, five articles were selected for systematic review and meta-analysis. Of the included studies, three were conducted in the UK, one in India, and one in Greece. About 38.0% (95% confidence interval: 19.6-60.6, P = 0.296) of advertisements were related to food and also about 70.6% (95% confidence interval: 53.7-83.3, P < 0.019) of food advertisements were related to cariogenic foods. Food advertising during children's programs is dominated by food items that are potentially harmful to oral health. Moreover, the advertisements shifted toward food items that appeared healthy but contain a large amount of hidden sugar. Copyright © 2017 The Royal Society for Public Health. Published by Elsevier Ltd. All rights reserved.
Meyer, Rüdiger; Freitag-Wolf, Sandra; Blindow, Silke; Büning, Jürgen; Habermann, Jens K
2017-02-01
Cancer risk assessment for ulcerative colitis patients by evaluating histological changes through colonoscopy surveillance is still challenging. Thus, additional parameters of high prognostic impact for the development of colitis-associated carcinoma are necessary. This meta-analysis was conducted to clarify the value of aneuploidy as predictor for individual cancer risk compared with current surveillance parameters. A systematic web-based search identified studies published in English that addressed the relevance of the ploidy status for individual cancer risk during surveillance in comparison to neoplastic mucosal changes. The resulting data were included into a meta-analysis, and odds ratios (OR) were calculated for aneuploidy or dysplasia or aneuploidy plus dysplasia. Twelve studies addressing the relevance of aneuploidy compared to dyplasia were comprehensively evaluated and further used for meta-analysis. The meta-analysis revealed that aneuploidy (OR 5.31 [95 % CI 2.03, 13.93]) is an equally effective parameter for cancer risk assessment in ulcerative colitis patients as dysplasia (OR 4.93 [1.61, 15.11]). Strikingly, the combined assessment of dysplasia and aneuploidy is superior compared to applying each parameter alone (OR 8.99 [3.08, 26.26]). This meta-analysis reveals that aneuploidy is an equally effective parameter for individual cancer risk assessment in ulcerative colitis as the detection of dysplasia. More important, the combined assessment of dysplasia and aneuploidy outperforms the use of each parameter alone. We suggest image cytometry for ploidy assessment to become an additional feature of consensus criteria to individually assess cancer risk in UC.
Yu, Shuai; Chen, Ying; Hou, Xu; Xu, Donghua; Che, Kui; Li, Changgui; Yan, Shengli; Wang, Yangang; Wang, Bin
2016-03-01
Previous studies suggested a possible association between serum uric acid levels and peripheral neuropathy in patients with type 2 diabetes, but no definite evidence was available. A systematic review and meta-analysis of relevant studies were performed to comprehensively estimate the association. Pubmed, Web of Science, Embase, and China Biology Medicine (CBM) databases were searched for eligible studies. Study-specific data were combined using random-effect or fixed-effect models of meta-analysis according to between-study heterogeneity. Twelve studies were finally included into the meta-analysis, which involved a total of 1388 type 2 diabetic patients with peripheral neuropathy and 4746 patients without peripheral neuropathy. Meta-analysis showed that there were obvious increased serum uric acid levels in diabetic patients with peripheral neuropathy (weighted mean difference [WMD] = 50.03 μmol/L, 95% confidence interval [95%CI] 22.14-77.93, P = 0.0004). Hyperuricemia was also significantly associated with increased risk of peripheral neuropathy in patients with type 2 diabetes (risk ratio [RR] = 2.83, 95%CI 2.13-3.76, P < 0.00001). Meta-analysis of two studies with adjusted risk estimates showed that hyperuricemia was independently associated with increased risk of peripheral neuropathy in type 2 diabetic patients (RR = 1.95, 95%CI 1.23-3.11, P = 0.005). Type 2 diabetic patients with peripheral neuropathy have obvious increased serum uric acid levels, and hyperuricemia is associated with increased risk of peripheral neuropathy. Further prospective cohort studies are needed to validate the impact of serum uric acid levels on peripheral neuropathy risk.
A comprehensive review of the SLMTA literature part 2: Measuring success
Yao, Katy; Nkengasong, John N.
2014-01-01
Background Since its introduction in 2009, the Strengthening Laboratory Management Toward Accreditation (SLMTA) programme has been implemented in 617 laboratories in 47 countries. Objective We completed a systematic review of the published literature on SLMTA. The review consists of two companion papers; this article examines quantitative evidence presented in the publications along with a meta-analysis of selected results. Methods We identified 28 published articles with data from SLMTA implementation. The SLMTA programme was evaluated through audits based on a standard checklist, which is divided into 12 sections corresponding to the 12 Quality System Essentials (QSEs). Several basic service delivery indicators reported by programmes were also examined. Results for various components of the programme were reviewed and summarised; a meta-analysis of QSE results grouped by the three stages of the quality cycle was conducted for 126 laboratories in 12 countries. Results Global programme data show improved quality in SLMTA laboratories in every country, with average improvements on audit scores of 25 percentage points. Meta-analysis identified Improvement Management as the weakest stage, with internal audit (8%) and occurrence management (16%) showing the lowest scores. Studies documented 19% – 95% reductions in turn-around times, 69% – 93% reductions in specimen rejection rates, 76% – 81% increases in clinician satisfaction rates, 67% – 85% improvements in external quality assessment results, 50% – 66% decreases in nonconformities and 67% increases in staff punctuality. Conclusions The wide array of results reported provides a comprehensive picture of the SLMTA programme overall, suggesting a substantive impact on provision of quality laboratory services and patient care. These comprehensive results establish a solid data-driven foundation for program improvement and further expansion. PMID:29043201
A meta-analysis of the variables related to job satisfaction among Korean nurses.
Choi, So Eun; Kim, Sang Dol
2016-08-01
The shortage of nursing workforce has been a critical and global issue and associated with job satisfaction. To evaluate the strength of the relationships between job satisfaction and organizational commitment, job stress, and turnover intention among Korean nurses. Preferred Reporting Items for Systematic Reviews and Meta-Analyses; Korean Education & Research Information Service, KISS, DB pia, PubMed, and CINAHL databases were searched. The meta-analysis software package, R program (version 3.0.1), was used. Thirty-eight of 1245 screened studies had appropriate data. The overall relationships were high and significant, and increased organizational commitment (WES = .62), decreased turnover intention (WES = -.47), and decreased job stress (WES = -.37) were associated with job satisfaction. The strongest relationship was identified between organizational commitment and job satisfaction. These findings have important implications for improving organizational commitment to increase job satisfaction among nurses.
Expression and clinical significance of survivin in ovarian cancer: A meta-analysis.
He, Xiaoyan; Yang, Kehu; Wang, Hailin; Chen, Xiaohong; Wu, Huifang; Yao, Liang; Ma, Shouye
2018-01-01
To assess the clinicopathological significance of survivin in ovarian carcinoma through this meta-analysis. PubMed, EMBASE, Web of Science, and The Cochrane Library databases were searched for relevant studies published through September, 2017. Included studies reported the case-control study of surviving expression with ovarian cancer and its clinicopathological characteristics. The quality assessment was performed according to the Newcastle-Ottawa Scale (NOS) for quality assessment of case-control studies. Statistical analysis was performed with the software Stata 12.0. Twelve eligible studies with a total of 1097 patients were included in this meta-analysis. Survivin overexpression was closely related to FIGO stage (I-II vs. III-IV) of ovarian carcinoma (odds ratio [OR] = 0.26,95% confidence interval [CI]:0.16,0.42),P<0.00001),tumor grade (G1-G2 vs. G3) (OR = 0.29,95%CI(0.17, 0.51),P <0.0001), but was not significantly associated with lymphatic metastasis (OR = 1.53, 95%CI(0.77, 3.03, P = 0.23),ascites (OR = 0.89,95%CI(0.39,2.05),P = 0.79). Our meta-analysis shows that survivin is strongly associated with FIGO stage and tumor grade of ovarian carcinoma. Maybe survivin is a novel clinicopathological marker of ovarian carcinoma.
Chen, Si; Luan, Haixia; Li, Liubing; Zeng, Xiaoli; Wang, Tian; Li, Yongzhe; Yuan, Hui
2017-01-01
We performed a meta-analysis to determine whether combined evidence shows an association between HLA-B*51 and HLA-B*52 alleles and TNF-α-308A/G polymorphism and the susceptibility to Takayasu arteritis (TA). Relevant articles dated November 2015 were acquired from the PubMed, Embase and Cochrane databases. The number of genotypes and/or alleles for HLA-B*51 and HLA-B*52 alleles and TNF-α-308 A/G polymorphism in cases and control subjects was extracted, and statistical analysis was conducted using STATA 11.2 software. We included 20 studies with 1864 TA patients and 6973 controls. The HLA-B*52 allele was found to be associated with TA (pooled OR 3.91, 95 % CI 3.22-4.74, P < 0.0001). The meta-analysis of TNF-α-308 A/G polymorphism for the A allele vs. G allele (P = 0.006) and AA + AG vs. GG (P = 0.023) revealed a significant association with TA. However, we did not find that the HLA-B*51 allele was associated with TA. This meta-analysis demonstrated that the HLA-B*52 allele and TNF-α-308 A/G polymorphism may contribute to TA susceptibility.
Talaska, Cara A.; Chaiken, Shelly
2013-01-01
Investigations of racial bias have emphasized stereotypes and other beliefs as central explanatory mechanisms and as legitimating discrimination. In recent theory and research, emotional prejudices have emerged as another, more direct predictor of discrimination. A new comprehensive meta-analysis of 57 racial attitude-discrimination studies finds a moderate relationship between overall attitudes and discrimination. Emotional prejudices are twices as closely related to racial discrimination as stereotypes and beliefs are. Moreover, emotional prejudices are closely related to both observed and self-reported discrimination, whereas stereotypes and beliefs are related only to self-reported discrimination. Implications for justifying discrimination are discussed. PMID:24052687
Couple Therapy for Intimate Partner Violence: A Systematic Review and Meta-Analysis
Karakurt, Gunnur; Whiting, Kate; Van Esch, Chantal; Bolen, Shari; Calabrese, Joseph
2016-01-01
Intimate partner violence is a serious public health problem accompanied by substantial morbidity and mortality. Despite its documented impact on health, there is no widely recognized treatment of choice. Some studies indicate that couples suffering from situational violence may benefit from couples therapy, but professionals are cautious to risk the possibility of violent retaliation between partners. After a comprehensive literature search of 1733 citations, this systematic review and meta-analysis compiles the results of six studies to investigate the effectiveness of couple therapy as a treatment for violence. Preliminary data suggest that couples therapy is a viable treatment in select situations. PMID:27377617
Cortessis, Victoria K; Azadian, Moosa; Buxbaum, James; Sanogo, Fatimata; Song, Ashley Y; Sriprasert, Intira; Wei, Pengxiao C; Yu, Jing; Chung, Karine; Siegmund, Kimberly D
2018-04-25
To determine whether a history of conception by assisted reproductive technology (ART) is associated with occurrence of one or more imprinting disorders of either maternal or paternal origin. We implemented a systematic review of scholarly literature followed by comprehensive meta-analysis to quantitatively synthesize data from reports relating to use of ART to occurrence of any imprinting disorder of humans, including Beckwith-Wiedemann (BWS), Angelman (AS), Prader-Willi (PWS), and Silver-Russell (SRS) syndromes, as well as transient neonatal diabetes mellitus (TNDB) and sporadic retinoblasoma (RB). The systematic review identified 13 reports presenting unique data from 23 studies that related conception following ART to occurrence of imprinting disorders. Multiple studies of four disorder were identified, for which meta-analysis yielded the following summary estimates of associations with a history of ART: AS, summary odds ratio (sOR) = 4.7 (95% confidence interval (CI) 2.6-8.5, 4 studies); BWS, sOR = 5.8 (95% CI 3.1-11.1, 8 studies); PWS, sOR = 2.2 (95% CI 1.6-3.0, 6 studies); SRS, sOR = 11.3 (95% CI 4.5-28.5, 3 studies). Only one study reported on each of TNDB and RB. Published data reveal positive associations between history of ART conception and each of four imprinting disorders. Reasons for these associations warrant further investigation.
Parker, Deborah; Mills, Sandra; Abbey, Jennifer
The objective of this review was to assess the effectiveness of interventions that assist caregivers to provide support for people living with dementia in the community. Types of participants Adult caregivers who provide support for people with dementia living in the community (non-institutional care).Types of interventions Interventions designed to support caregivers in their role such as skills training, education to assist in caring for a person living with dementia and support groups/programs. Interventions of formal approaches to care designed to support caregivers in their role, care planning, case management and specially designated members of the healthcare team - for example dementia nurse specialist or volunteers trained in caring for someone with dementia.Types of studies This review considered any meta-analyses, systematic reviews, randomised control trials, quasi-experimental studies, cohort studies, case control studies and observational studies without control groups that addressed the effectiveness of interventions that assist caregivers to provide support for people living with dementia in the community. The search sought to identify published studies from 2000 to 2005 through the use of electronic databases. Only studies in English were considered for inclusion. The initial search was conducted of the databases, CINAHL, MEDLINE and PsychINFO using search strategies adapted from the Cochrane Dementia and Cognitive Improvement Group. A second more extensive search was then conducted using the appropriate Medical Subject Headings (MeSH) and keywords for other available databases. Finally, hand searching of reference lists of articles retrieved and of core dementia, geriatric and psycho geriatric journals was undertaken. Methodological quality of each of the articles was assessed by two independent reviewers using appraisal checklist developed by the Joanna Briggs Institute and based on the work of the Cochrane Collaboration and Centre for Reviews and Dissemination. Standardised mean differences or weighted mean differences and their 95% confidence intervals were calculated for each included study reported in the meta-analysis. Results from comparable groups of studies were pooled in statistical meta-analysis using Review Manager Software from the Cochrane Collaboration. Heterogeneity between combined studies was tested using standard chi-square test. Where statistical pooling was not appropriate or possible, the findings are summarised in narrative form. A comprehensive search of relevant databases, hand searching and cross referencing found 685 articles that were assessed for relevance to the review. Eighty-five papers appeared to meet the inclusion criteria based on title and abstract, and the full paper was retrieved. Of the 85 full papers reviewed, 40 were accepted for inclusion, three were systematic reviews, three were meta-analysis, and the remaining 34 were randomised controlled trials. For the randomised controlled trials that were able to be included in a meta-analysis, standardised mean differences or weighted mean differences and their 95% confidence intervals were calculated for each. Results from comparable groups of studies were pooled in statistical meta-analysis using Review Manager Software and heterogeneity between combined studies was assessed by using the chi-square test. Where statistical pooling was not appropriate or possible, the findings are summarised in narrative form.The results are discussed in two main sections. Firstly it was possible to assess the effectiveness of different types of caregiver interventions on the outcome categories of depression, health, subjective well-being, self-efficacy and burden. Secondly, results are reported by main outcome category. For each of these sections, meta-analysis was conducted where it was possible; otherwise, a narrative summary describes the findings. Four categories of intervention were included in the review - psycho-educational, support, multi-component and other.Psycho-educational Thirteen studies used psycho-educational interventions, and all but one showed positive results across a range of outcomes. Eight studies were entered in a meta-analysis. No significant impact of psycho-educational interventions was found for the outcome categories of subjective well-being, self-efficacy or health. However, small but significant results were found for the categories of depression and burden.Support Seven studies discussed support only interventions and two of these showed significant results. These two studies were suitable for meta-analysis and demonstrated a small but significant improvement on caregiver burden.Multi-component Twelve of the studies report multi-component interventions and 10 of these report significant outcomes across a broad range of outcome measures including self-efficacy, depression, subjective well-being and burden. Unfortunately because of the heterogeneity of study designs and outcome measures, no meta-analysis was possible.Other interventions Other interventions included the use of exercise or nutrition which resulted in improvements in psychological distress and health benefits. Case management and a computer aided support intervention provided mixed results. One cognitive behavioural therapy study reported a reduction in anxiety and positive impacts on patient behaviour. In addition to analysis by type of intervention it was possible to analyse results based on some outcome categories that were used across the studies. In particular the impact of interventions on caregiver depression was available for meta-analysis from eight studies. This indicated that multi-component and psycho-educational interventions showed a small but significant positive effect on caregiver depression.Five studies using the outcome category of caregiver burden were entered into a meta-analysis and findings indicated that there were no significant effects of any of interventions. No meta-analysis was possible for the outcome categories of health, self-efficacy or subjective well-being. From this review there is evidence to support the use of well-designed psycho-educational or multi-component interventions for caregivers of people with dementia who live in the community. Factors that appear to positively contribute to effective interventions are those which:Factors which do not appear to have benefit in interventions are those which.
Zhang, Le-Le; Zhang, Zi-Ning; Wu, Xian; Jiang, Yong-Jun; Fu, Ya-Jing; Shang, Hong
2017-09-12
A small proportion of HIV-infected patients remain clinically and/or immunologically stable for years, including elite controllers (ECs) who have undetectable viremia (<50 copies/ml) and long-term nonprogressors (LTNPs) who maintain normal CD4 + T cell counts for prolonged periods (>10 years). However, the mechanism of nonprogression needs to be further resolved. In this study, a transcriptome meta-analysis was performed on nonprogressor and progressor microarray data to identify differential transcriptome pathways and potential biomarkers. Using the INMEX (integrative meta-analysis of expression data) program, we performed the meta-analysis to identify consistently differentially expressed genes (DEGs) in nonprogressors and further performed functional interpretation (gene ontology analysis and pathway analysis) of the DEGs identified in the meta-analysis. Five microarray datasets (81 cases and 98 controls in total), including whole blood, CD4 + and CD8 + T cells, were collected for meta-analysis. We determined that nonprogressors have reduced expression of important interferon-stimulated genes (ISGs), CD38, lymphocyte activation gene 3 (LAG-3) in whole blood, CD4 + and CD8 + T cells. Gene ontology (GO) analysis showed a significant enrichment in DEGs that function in the type I interferon signaling pathway. Upregulated pathways, including the PI3K-Akt signaling pathway in whole blood, cytokine-cytokine receptor interaction in CD4 + T cells and the MAPK signaling pathway in CD8 + T cells, were identified in nonprogressors compared with progressors. In each metabolic functional category, the number of downregulated DEGs was more than the upregulated DEGs, and almost all genes were downregulated DEGs in the oxidative phosphorylation (OXPHOS) and tricarboxylic acid (TCA) cycle in the three types of samples. Our transcriptomic meta-analysis provides a comprehensive evaluation of the gene expression profiles in major blood types of nonprogressors, providing new insights in the understanding of HIV pathogenesis and developing strategies to delay HIV disease progression.
Forcier, Kathleen; Stroud, Laura R; Papandonatos, George D; Hitsman, Brian; Reiches, Meredith; Krishnamoorthy, Jenelle; Niaura, Raymond
2006-11-01
A meta-analysis of published studies with adult human participants was conducted to evaluate whether physical fitness attenuates cardiovascular reactivity and improves recovery from acute psychological stressors. Thirty-three studies met selection criteria; 18 were included in recovery analyses. Effect sizes and moderator influences were calculated by using meta-analysis software. A fixed effects model was fit initially; however, between-studies heterogeneity could not be explained even after inclusion of moderators. Therefore, to account for residual heterogeneity, a random effects model was estimated. Under this model, fit individuals showed significantly attenuated heart rate and systolic blood pressure reactivity and a trend toward attenuated diastolic blood pressure reactivity. Fit individuals also showed faster heart rate recovery, but there were no significant differences in systolic blood pressure or diastolic blood pressure recovery. No significant moderators emerged. Results have important implications for elucidating mechanisms underlying effects of fitness on cardiovascular disease and suggest that fitness may be an important confound in studies of stress reactivity. Copyright 2006 APA, all rights reserved.
[Meta-analysis on common causes of paraesthesia pharyngis in China].
Ding, H L; Fang, P
2016-09-05
Objective: To evaluate the common causes of paraesthesia pharyngis in China. Method: By means of searching CBM,and VIP,CNKI,CSCD,WanFang Database,etiology of paraesthesia pharyngis cross-sectional studies published from January 2005 to December 2015.were chosen and R software was used for meta analysis. Result: Sixteen cross-sectional study were chosen with a total of 6 624 cases.Meta analysis results showed that the etiology ratio of non-organic disease,nose and throat inflammation,digestive system disease,thyroid disease,cervical vertebra disease (95% CI )were 17.07(10.06-27.49),55.37(45.86-64.50),15.36(11.95-19.52),1.38(0.89-2.11),1.40(0.89-2.21) respectively. Conclusion: Inflammation of the nose and throat is the most important cause of paraesthesia pharyngis in China,and non organic diseases,digestive system and thyroid,cervical disease are the common causes of paraesthesia pharyngis. Copyright© by the Editorial Department of Journal of Clinical Otorhinolaryngology Head and Neck Surgery.
Individual Participant Data Meta-Analysis of Mechanical Workplace Risk Factors and Low Back Pain
Shannon, Harry S.; Wells, Richard P.; Walter, Stephen D.; Cole, Donald C.; Côté, Pierre; Frank, John; Hogg-Johnson, Sheilah; Langlois, Lacey E.
2012-01-01
Objectives. We used individual participant data from multiple studies to conduct a comprehensive meta-analysis of mechanical exposures in the workplace and low back pain. Methods. We conducted a systematic literature search and contacted an author of each study to request their individual participant data. Because outcome definitions and exposure measures were not uniform across studies, we conducted 2 substudies: (1) to identify sets of outcome definitions that could be combined in a meta-analysis and (2) to develop methods to translate mechanical exposure onto a common metric. We used generalized estimating equation regression to analyze the data. Results. The odds ratios (ORs) for posture exposures ranged from 1.1 to 2.0. Force exposure ORs ranged from 1.4 to 2.1. The magnitudes of the ORs differed according to the definition of low back pain, and heterogeneity was associated with both study-level and individual-level characteristics. Conclusions. We found small to moderate ORs for the association of mechanical exposures and low back pain, although the relationships were complex. The presence of individual-level OR modifiers in such an area can be best understood by conducting a meta-analysis of individual participant data. PMID:22390445
Learners' Metacognitive Strategy Use and Reading Comprehension: Insights from a Vietnamese Context
ERIC Educational Resources Information Center
Nguyen, Thao M. T.; Trinh, Lap Q.
2011-01-01
The effects of meta-cognitive strategy use on learning reading comprehension have gained much interest of researchers and educators (Chumpavan, 2000; Shmais, 2002; Phakiti, 2003; Aegpongpaow 2008; Subasi, 2009; Zhang and Wu, 2009). Available literature indicated a positive correlation between learners' meta-cognitive strategy use and their…
Novel citation-based search method for scientific literature: application to meta-analyses.
Janssens, A Cecile J W; Gwinn, M
2015-10-13
Finding eligible studies for meta-analysis and systematic reviews relies on keyword-based searching as the gold standard, despite its inefficiency. Searching based on direct citations is not sufficiently comprehensive. We propose a novel strategy that ranks articles on their degree of co-citation with one or more "known" articles before reviewing their eligibility. In two independent studies, we aimed to reproduce the results of literature searches for sets of published meta-analyses (n = 10 and n = 42). For each meta-analysis, we extracted co-citations for the randomly selected 'known' articles from the Web of Science database, counted their frequencies and screened all articles with a score above a selection threshold. In the second study, we extended the method by retrieving direct citations for all selected articles. In the first study, we retrieved 82% of the studies included in the meta-analyses while screening only 11% as many articles as were screened for the original publications. Articles that we missed were published in non-English languages, published before 1975, published very recently, or available only as conference abstracts. In the second study, we retrieved 79% of included studies while screening half the original number of articles. Citation searching appears to be an efficient and reasonably accurate method for finding articles similar to one or more articles of interest for meta-analysis and reviews.
Komaki, Yuga; Komaki, Fukiko; Micic, Dejan; Yamada, Akihiro; Suzuki, Yasuo; Sakuraba, Atsushi
2017-06-01
A limited option of therapies is available for hospitalized patients with severe steroid refractory ulcerative colitis (UC). Furthermore, there exists a paucity of direct comparisons between them. To provide a comparative evaluation of the efficacy and safety of pharmacologic therapies, we conducted a network meta-analysis combined with a benefit-risk analysis of randomized controlled trials (RCTs) performed in hospitalized patients with severe steroid refractory UC. Electronic databases were searched through November 2015 for RCTs evaluating the efficacy of therapies for severe steroid refractory hospitalized UC. The outcomes were clinical response, colectomy free rate, and severe adverse events leading to discontinuation of therapy. The primary endpoints were the rank of therapies based on network meta-analysis combined with benefit-risk analysis between clinical response and severe adverse events as well as colectomy free rate and severe adverse events. Eight RCTs of 421 patients were identified. Cyclosporine, infliximab, and tacrolimus as well as placebo were included in our analysis. Network meta-analysis with benefit-risk analysis simultaneously assessing clinical response and severe adverse events demonstrated the rank order of efficacy as infliximab, cyclosporine, tacrolimus, and placebo. Similar analysis for colectomy-free rate and severe adverse events demonstrated the same rank order of efficacy. The differences among infliximab, cyclosporine, and tacrolimus were small in all analyses. The results of the present comprehensive benefit-risk assessment using network meta-analysis provide RCT-based evidence on efficacy and safety of infliximab, cyclosporine, and tacrolimus for hospitalized patients with severe steroid refractory UC. © 2016 Journal of Gastroenterology and Hepatology Foundation and John Wiley & Sons Australia, Ltd.
TNF -308 G/A Polymorphism and Risk of Acne Vulgaris: A Meta-Analysis
Yang, Jian-Kang; Wu, Wen-Juan; Qi, Jue; He, Li; Zhang, Ya-Ping
2014-01-01
Background The -308 G/A polymorphism in the tumor necrosis factor (TNF) gene has been implicated in the risk of acne vulgaris, but the results are inconclusive. The present meta-analysis aimed to investigate the overall association between the -308 G/A polymorphism and acne vulgaris risk. Methods We searched in Pubmed, Embase, Web of Science and CNKI for studies evaluating the association between the -308 G/A gene polymorphism and acne vulgaris risk. Data were extracted and statistical analysis was performed using STATA 12.0 software. Results A total of five publications involving 1553 subjects (728 acne vulgaris cases and 825 controls) were included in this meta-analysis. Combined analysis revealed a significant association between this polymorphism and acne vulgaris risk under recessive model (OR = 2.73, 95% CI: 1.37–5.44, p = 0.004 for AA vs. AG + GG). Subgroup analysis by ethnicity showed that the acne vulgaris risk associated with the -308 G/A gene polymorphism was significantly elevated among Caucasians under recessive model (OR = 2.34, 95% CI: 1.13–4.86, p = 0.023). Conclusion This meta-analysis suggests that the -308 G/A polymorphism in the TNF gene contributes to acne vulgaris risk, especially in Caucasian populations. Further studies among different ethnicity populations are needed to validate these findings. PMID:24498378
da Silva, Felipe-Rodolfo-Pereira; Guimarães-Vasconcelos, Any-Carolina-Cardoso; de-Carvalho-França, Luiz-Felipe; di-Lenardo, David; Rodrigues, Luana-Silva; Barreto-do-Nascimento, Maria-Luísa-Lima
2017-01-01
Background Periodontitis results from an inflammatory response caused by accumulative microorganisms in periodontal sites. Several factors are involved in pathogenesis of periodontitis, for example the -889 C/T polymorphism in interleukin-1A gene. This study aimed to evaluate the relationship between this polymorphism and risk of development of chronic periodontitis by a meta-analysis based in new published findings. Material and Methods Thereunto a review in literature was performed in the electronic biomedical and education databases (Cochrane Library, Google Scholar, MEDLINE and PubMed) to studies published before August 2, 2015, the abstracts were evaluated and the data extraction performed by two calibrated examiners. The calculations of the meta-analysis were obtained through statistical software Review Manager version 5.2 with calculation of Odds Ratio (OR), heterogeneity (I²) and Funnel plots with P <0.05. Results In overall, twenty-one case/control studies were selected with 2,174 patients with chronic periodontitis and 1, 756 controls. The meta-analysis showed T allele was associated with chronic periodontitis (OR = 1.22, 95% CI: 1.09, 1.36, P = 0.0004) with decreased value to heterogeneity (I² = 15%, P = 0.28). TT genotype was associated to patients with chronic periodontitis (OR = 1.40, 95% CI: 1.07, 1.83, P = 0.01). No publication bias was found in this meta-analysis by asymmetry in Funnel plots. Conclusions This meta-analysis with 2,174 patients with chronic periodontitis and 1, 756 controls evidenced the -889 C/T polymorphism is associated to risk of development of chronic periodontitis with no significant value to heterogeneity to allelic evaluation. Key words:Alleles, odds ratio, periodontal disease, cytokines. PMID:27918732
da Silva, F-R-P; Guimarães-Vasconcelos, A-C-C; de-Carvalho-França, L-F; di-Lenardo, D; Rodrigues, L-S; Barreto-do-Nascimento, M-L-L; Vasconcelos, D-F-P
2017-01-01
Periodontitis results from an inflammatory response caused by accumulative microorganisms in periodontal sites. Several factors are involved in pathogenesis of periodontitis, for example the -889 C/T polymorphism in interleukin-1A gene. This study aimed to evaluate the relationship between this polymorphism and risk of development of chronic periodontitis by a meta-analysis based in new published findings. Thereunto a review in literature was performed in the electronic biomedical and education databases (Cochrane Library, Google Scholar, MEDLINE and PubMed) to studies published before August 2, 2015, the abstracts were evaluated and the data extraction performed by two calibrated examiners. The calculations of the meta-analysis were obtained through statistical software Review Manager version 5.2 with calculation of Odds Ratio (OR), heterogeneity (I²) and Funnel plots with P < 0.05. In overall, twenty-one case/control studies were selected with 2,174 patients with chronic periodontitis and 1, 756 controls. The meta-analysis showed T allele was associated with chronic periodontitis (OR = 1.22, 95% CI: 1.09, 1.36, P = 0.0004) with decreased value to heterogeneity (I² = 15%, P = 0.28). TT genotype was associated to patients with chronic periodontitis (OR = 1.40, 95% CI: 1.07, 1.83, P = 0.01). No publication bias was found in this meta-analysis by asymmetry in Funnel plots. This meta-analysis with 2,174 patients with chronic periodontitis and 1, 756 controls evidenced the -889 C/T polymorphism is associated to risk of development of chronic periodontitis with no significant value to heterogeneity to allelic evaluation.
Shi, Hong-Bin; Yu, Jia-Xing; Yu, Jian-Xiu; Feng, Zheng; Zhang, Chao; Li, Guang-Yong; Zhao, Rui-Ning; Yang, Xiao-Bo
2017-08-03
Previous studies have revealed the importance of microRNAs' (miRNAs) function as biomarkers in diagnosing human bladder cancer (BC). However, the results are discordant. Consequently, the possibility of miRNAs to be BC biomarkers was summarized in this meta-analysis. In this study, the relevant articles were systematically searched from CBM, PubMed, EMBASE, and Chinese National Knowledge Infrastructure (CNKI). The bivariate model was used to calculate the pooled diagnostic parameters and summary receiver operator characteristic (SROC) curve in this meta-analysis, thereby estimating the whole predictive performance. STATA software was used during the whole analysis. Thirty-one studies from 10 articles, including 1556 cases and 1347 controls, were explored in this meta-analysis. In short, the pooled sensitivity, area under the SROC curve, specificity, positive likelihood ratio, diagnostic odds ratio, and negative likelihood ratio were 0.72 (95%CI 0.66-0.76), 0.80 (0.77-0.84), 0.76 (0.71-0.81), 3.0 (2.4-3.8), 8 (5.0-12.0), and 0.37 (0.30-0.46) respectively. Additionally, sub-group and meta-regression analyses revealed that there were significant differences between ethnicity, miRNA profiling, and specimen sub-groups. These results suggested that Asian population-based studies, multiple-miRNA profiling, and blood-based assays might yield a higher diagnostic accuracy than their counterparts. This meta-analysis demonstrated that miRNAs, particularly multiple miRNAs in the blood, might be novel, useful biomarkers with relatively high sensitivity and specificity and can be used for the diagnosis of BC. However, further prospective studies with more samples should be performed for further validation.
Peng, Qiliang; Zhang, Xueli; Min, Ming; Zou, Li; Shen, Peipei; Zhu, Yaqun
2017-07-04
This systematic analysis aimed to investigate the value of microRNA-21 (miR-21) in colorectal cancer for multiple purposes, including diagnosis and prognosis, as well as its predictive power in combination biomarkers. Fifty-seven eligible studies were included in our meta-analysis, including 25 studies for diagnostic meta-analysis and 32 for prognostic meta-analysis. For the diagnostic meta-analysis of miR-21 alone, the overall pooled results for sensitivity, specificity, and area under the curve (AUC) were 0.64 (95% CI: 0.53-0.74), 0.85 (0.79-0.90), and 0.85 (0.81-0.87), respectively. Circulating samples presented corresponding values of 0.72 (0.63-0.79), 0.84 (0.78-0.89), and 0.86 (0.83-0.89), respectively. For the diagnostic meta-analysis of miR-21-related combination biomarkers, the above three parameters were 0.79 (0.69-0.86), 0.79 (0.68-0.87), and 0.86 (0.83-0.89), respectively. Notably, subgroup analysis suggested that miRNA combination markers in circulation exhibited high predictive power, with sensitivity of 0.85 (0.70-0.93), specificity of 0.86 (0.77-0.92), and AUC of 0.92 (0.89-0.94). For the prognostic meta-analysis, patients with higher expression of miR-21 had significant shorter disease-free survival [DFS; pooled hazard ratio (HR): 1.60; 95% CI: 1.20-2.15] and overall survival (OS; 1.54; 1.27-1.86). The combined HR in tissues for DFS and OS were 1.76 (1.31-2.36) and 1.58 (1.30-1.93), respectively. Our comprehensive systematic review revealed that circulating miR-21 may be suitable as a diagnostic biomarker, while tissue miR-21 could be a prognostic marker for colorectal cancer. In addition, miRNA combination biomarkers may provide a new approach for clinical application.
Nafisi Moghadam, Reza; Amlelshahbaz, Amir Pasha; Namiranian, Nasim; Sobhan-Ardekani, Mohammad; Emami-Meybodi, Mahmood; Dehghan, Ali; Rahmanian, Masoud; Razavi-Ratki, Seid Kazem
2017-12-28
Objective: Ultrasonography (US) and parathyroid scintigraphy (PS) with 99mTc-MIBI are common methods for preoperative localization of parathyroid adenomas but there discrepancies exist with regard to diagnostic accuracy. The aim of the study was to compare PS and US for localization of parathyroid adenoma with a systematic review and meta-analysis of the literature. Methods: Pub Med, Scopus (EMbase), Web of Science and the reference lists of all included studies were searched up to 1st January 2016. The search strategy was according PICO characteristics. Heterogeneity between the studies was accounted by P < 0.1. Point estimates were pooled estimate of sensitivity, specificity and positive predictive value of SPECT and ultrasonography with 99% confidence intervals (CIs) by pooling available data. Data analysis was performed using Meta-DiSc software (version 1.4). Results: Among 188 studies and after deletion of duplicated studies (75), a total of 113 titles and abstracts were studied. From these, 12 studies were selected. The meta-analysis determined a pooled sensitivity for scintigraphy of 83% [99% confidence interval (CI) 96.358 -97.412] and for ultra-sonography of 80% [99% confidence interval (CI) 76-83]. Similar results for specificity were also obtained for both approache. Conclusion: According this meta- analysis, there were no significant differences between the two methods in terms of sensitivity and specificity. There were overlaps in 99% confidence intervals. Also features of the two methods are similar. Creative Commons Attribution License
Meta-analysis of CHEK2 1100delC variant and colorectal cancer susceptibility.
Xiang, He-ping; Geng, Xiao-ping; Ge, Wei-wei; Li, He
2011-11-01
Cell cycle checkpoint kinase 2 (CHEK2) gene has been inconsistently associated with colorectal cancer (CRC), particularly the 1100delC variant. To generate large-scale evidence on whether the CHEK2 1100delC variant is associated with CRC susceptibility we have conducted a meta-analysis. Data were collected from the following electronic databases: PubMed, Excerpta Medica Database and Chinese Biomedical Literature Database, with the last report up to November 2010. The odds ratio (OR) and its 95% confidence interval (95% CI) were used to assess the strength of association. We evaluated the contrast of carriers versus non-carriers. Meta-analysis was performed in a fixed/random effect model by using the software Review Manager 4.2. A total of six studies including 4194 cases and 10,010 controls based on the search criteria were involved in this meta-analysis. A significant association of the CHEK2 1100delC variant with unselected CRC was found (OR=2.11, 95% CI=1.41-3.16, P=0.0003). We also found an association of the CHEK2 1100delC variant with familial CRC (OR=2.80, 95% CI=1.74-4.51, P<0.0001). However, the association was not established for sporadic CRC (OR=1.45, 95% CI=0.49-4.30, P=0.50). This meta-analysis demonstrates that the CHEK2 1100delC variant may be an important CRC-predisposing gene, which increases CRC risk. Copyright © 2011. Published by Elsevier Ltd.
Loley, Christina; Alver, Maris; Assimes, Themistocles L; Bjonnes, Andrew; Goel, Anuj; Gustafsson, Stefan; Hernesniemi, Jussi; Hopewell, Jemma C; Kanoni, Stavroula; Kleber, Marcus E; Lau, King Wai; Lu, Yingchang; Lyytikäinen, Leo-Pekka; Nelson, Christopher P; Nikpay, Majid; Qu, Liming; Salfati, Elias; Scholz, Markus; Tukiainen, Taru; Willenborg, Christina; Won, Hong-Hee; Zeng, Lingyao; Zhang, Weihua; Anand, Sonia S; Beutner, Frank; Bottinger, Erwin P; Clarke, Robert; Dedoussis, George; Do, Ron; Esko, Tõnu; Eskola, Markku; Farrall, Martin; Gauguier, Dominique; Giedraitis, Vilmantas; Granger, Christopher B; Hall, Alistair S; Hamsten, Anders; Hazen, Stanley L; Huang, Jie; Kähönen, Mika; Kyriakou, Theodosios; Laaksonen, Reijo; Lind, Lars; Lindgren, Cecilia; Magnusson, Patrik K E; Marouli, Eirini; Mihailov, Evelin; Morris, Andrew P; Nikus, Kjell; Pedersen, Nancy; Rallidis, Loukianos; Salomaa, Veikko; Shah, Svati H; Stewart, Alexandre F R; Thompson, John R; Zalloua, Pierre A; Chambers, John C; Collins, Rory; Ingelsson, Erik; Iribarren, Carlos; Karhunen, Pekka J; Kooner, Jaspal S; Lehtimäki, Terho; Loos, Ruth J F; März, Winfried; McPherson, Ruth; Metspalu, Andres; Reilly, Muredach P; Ripatti, Samuli; Sanghera, Dharambir K; Thiery, Joachim; Watkins, Hugh; Deloukas, Panos; Kathiresan, Sekar; Samani, Nilesh J; Schunkert, Heribert; Erdmann, Jeanette; König, Inke R
2016-10-12
In recent years, genome-wide association studies have identified 58 independent risk loci for coronary artery disease (CAD) on the autosome. However, due to the sex-specific data structure of the X chromosome, it has been excluded from most of these analyses. While females have 2 copies of chromosome X, males have only one. Also, one of the female X chromosomes may be inactivated. Therefore, special test statistics and quality control procedures are required. Thus, little is known about the role of X-chromosomal variants in CAD. To fill this gap, we conducted a comprehensive X-chromosome-wide meta-analysis including more than 43,000 CAD cases and 58,000 controls from 35 international study cohorts. For quality control, sex-specific filters were used to adequately take the special structure of X-chromosomal data into account. For single study analyses, several logistic regression models were calculated allowing for inactivation of one female X-chromosome, adjusting for sex and investigating interactions between sex and genetic variants. Then, meta-analyses including all 35 studies were conducted using random effects models. None of the investigated models revealed genome-wide significant associations for any variant. Although we analyzed the largest-to-date sample, currently available methods were not able to detect any associations of X-chromosomal variants with CAD.
Azami, Milad; Jaafari, Zahra; Rahmati, Shoboo; Farahani, Afsar Dastjani; Badfar, Gholamreza
2018-04-02
Retinopathy of prematurity (ROP) refers to the developmental disorder of the retina in premature infants and is one of the most serious and most dangerous complications in premature infants. The prevalence of ROP in Iran is different in various parts of Iran and its prevalence is reported to be 1-70% in different regions. This study aims to determine the prevalence and risk factors of ROP in Iran. This review article was conducted based on the preferred reporting items for systematic review and meta-analysis (PRISMA) protocols. To find literature about ROP in Iran, a comprehensive search was done using MeSH keywords in several online databases such as PubMed, Ovid, Science Direct, EMBASE, Web of Science, CINAHL, EBSCO, Magiran, Iranmedex, SID, Medlib, IranDoc, as well as the Google Scholar search engine until May 2017. Comprehensive Meta-analysis Software (CMA) Version 2 was used for data analysis. According to 42 studies including 18,000 premature infants, the prevalence of ROP was reported to be 23.5% (95% CI: 20.4-26.8) in Iran. The prevalence of ROP stages 1, 2, 3, 4 and 5 was 7.9% (95% CI: 5.3-11.5), 9.7% (95% CI: 6.1-15.3), 2.8% (95% CI: 1.6-4.9), 2.9% (95% CI: 1.9-4.5) and 3.6% (95% CI: 2.4-5.2), respectively. The prevalence of ROP in Iranian girls and boys premature infants was 18.3% (95% CI: 12.8-25.4) and 18.9% (95% CI: 11.9-28.5), respectively. The lowest prevalence of ROP was in the West of Iran (12.3% [95% CI: 7.6-19.1]), while the highest prevalence was associated with the Center of Iran (24.9% [95% CI: 21.8-28.4]). The prevalence of ROP is increasing according to the year of study, and this relationship is not significant (p = 0.181). The significant risk factors for ROP were small gestational age (p < 0.001), low birth weight (p < 0.001), septicemia (p = 0.021), respiratory distress syndrome (p = 0.036), intraventricular hemorrhage (p = 0.005), continuous positive pressure ventilation (p = 0.023), saturation above 50% (p = 0.023), apnea (p = 0.002), frequency and duration of blood transfusion, oxygen therapy and phototherapy (p < 0.05), whereas pre-eclampsia decreased the prevalence of ROP (p = 0.014). Considering the high prevalence of ROP in Iran, screening and close supervision by experienced ophthalmologists to diagnose and treat the common complications of pre-maturity and prevent visual impairment or blindness is necessary.
Fonner, Virginia A.; Armstrong, Kevin S.; Kennedy, Caitlin E.; O'Reilly, Kevin R.; Sweat, Michael D.
2014-01-01
Objectives School-based sex education is a cornerstone of HIV prevention for adolescents who continue to bear a disproportionally high HIV burden globally. We systematically reviewed and meta-analyzed the existing evidence for school-based sex education interventions in low- and middle-income countries to determine the efficacy of these interventions in changing HIV-related knowledge and risk behaviors. Methods We searched five electronic databases, PubMed, Embase, PsycInfo, CINAHL, and Sociological Abstracts, for eligible articles. We also conducted hand-searching of key journals and secondary reference searching of included articles to identify potential studies. Intervention effects were synthesized through random effects meta-analysis for five outcomes: HIV knowledge, self-efficacy, sexual debut, condom use, and number of sexual partners. Results Of 6191 unique citations initially identified, 64 studies in 63 articles were included in the review. Nine interventions either focused exclusively on abstinence (abstinence-only) or emphasized abstinence (abstinence-plus), whereas the remaining 55 interventions provided comprehensive sex education. Thirty-three studies were able to be meta-analyzed across five HIV-related outcomes. Results from meta-analysis demonstrate that school-based sex education is an effective strategy for reducing HIV-related risk. Students who received school-based sex education interventions had significantly greater HIV knowledge (Hedges g = 0.63, 95% Confidence Interval (CI): 0.49–0.78, p<0.001), self-efficacy related to refusing sex or condom use (Hedges g = 0.25, 95% CI: 0.14–0.36, p<0.001), condom use (OR = 1.34, 95% CI: 1.18–1.52, p<0.001), fewer sexual partners (OR = 0.75, 95% CI:0.67–0.84, p<0.001) and less initiation of first sex during follow-up (OR = 0.66, 95% CI: 0.54–0.83, p<0.001). Conclusions The paucity of abstinence-only or abstinence-plus interventions identified during the review made comparisons between the predominant comprehensive and less common abstinence-focused programs difficult. Comprehensive school-based sex education interventions adapted from effective programs and those involving a range of school-based and community-based components had the largest impact on changing HIV-related behaviors. PMID:24594648
Dong, Fan; Shen, Yifan; Xu, Tianyuan; Wang, Xianjin; Gao, Fengbin; Zhong, Shan; Chen, Shanwen; Shen, Zhoujun
2018-03-21
Previous researches pointed out that the measurement of urine fibronectin (Fn) could be a potential diagnostic test for bladder cancer (BCa). We conducted this meta-analysis to fully assess the diagnostic value of urine Fn for BCa detection. A systematic literature search in PubMed, ISI Web of Science, EMBASE, Cochrane library, and CBM was carried out to identify eligible studies evaluating the urine Fn in diagnosing BCa. Pooled sensitivity, specificity, and diagnostic odds ratio (DOR) with their 95% confidence intervals (CIs) were calculated, and summary receiver operating characteristic (SROC) curves were established. We applied the STATA 13.0, Meta-Disc 1.4, and RevMan 5.3 software to the meta-analysis. Eight separate studies with 744 bladder cancer patients were enrolled in this meta-analysis. The pooled sensitivity, specificity, and DOR were 0.80 (95%CI = 0.77-0.83), 0.79 (95%CI = 0.73-0.84), and 15.18 (95%CI = 10.07-22.87), respectively, and the area under the curve (AUC) of SROC was 0.83 (95%CI = 0.79-0.86). The diagnostic power of a combined method (urine Fn combined with urine cytology) was also evaluated, and its sensitivity and AUC were significantly higher (0.86 (95%CI = 0.82-0.90) and 0.89 (95%CI = 0.86-0.92), respectively). Meta-regression along with subgroup analysis based on various covariates revealed the potential sources of the heterogeneity and the detailed diagnostic value of each subgroup. Sensitivity analysis supported that the result was robust. No threshold effect and publication bias were found in this meta-analysis. Urine Fn may become a promising non-invasive biomarker for bladder cancer with a relatively satisfactory diagnostic power. And the combination of urine Fn with cytology could be an alternative option for detecting BCa in clinical practice. The potential value of urine Fn still needs to be validated in large, multi-center, and prospective studies.
Nikzad, Hossein; Karimian, Mohammad; Sareban, Kobra; Khoshsokhan, Maryam; Hosseinzadeh Colagar, Abasalt
2015-11-01
Methylenetetrahydrofolate reductase (MTHFR) functions as a main regulatory enzyme in folate metabolism. The association of MTHFR gene Ala222Val polymorphism with male infertility in an Iranian population was investigated by undertaking a meta-analysis and in-silico approach. A genetic association study included 497 men; 242 had unexplained infertility and 255 were healthy controls. Polymerase chain reaction restriction fragment length polymorphism was used for genotyping MTHFR-Ala222Val. OpenMeta[Analyst] software was used to conduct the analysis; 22 studies were identified by searching PubMed and the currently reported genetic association study. A novel in-silico approach was used to analyse the effects of Ala222Val substitution on the structure of mRNA and protein. Genetic association study revealed a significant association of MTHFR-222Val/Val genotype with oligozoospermia (OR 2.32; 95% CI, 1.12 to 4.78; P = 0.0451) and azoospermia (OR 2.59; 95% CI 1.09 to 6.17; P = 0.0314). Meta-analysis for allelic, dominant and codominant models showed a significant association between Ala222Val polymorphism and the risk of male infertility (P < 0.001). In silico-analysis showed MTHFR-Ala222Val affects enzyme structure and could also change the mRNA properties (P = 0.1641; P < 0.2 is significant). The meta-analysis suggested significant association of MTHFR-Ala222Val with risk of male infertility, especially in Asian populations. Copyright © 2015 Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved.
Meta-analytic framework for liquid association.
Wang, Lin; Liu, Silvia; Ding, Ying; Yuan, Shin-Sheng; Ho, Yen-Yi; Tseng, George C
2017-07-15
Although coexpression analysis via pair-wise expression correlation is popularly used to elucidate gene-gene interactions at the whole-genome scale, many complicated multi-gene regulations require more advanced detection methods. Liquid association (LA) is a powerful tool to detect the dynamic correlation of two gene variables depending on the expression level of a third variable (LA scouting gene). LA detection from single transcriptomic study, however, is often unstable and not generalizable due to cohort bias, biological variation and limited sample size. With the rapid development of microarray and NGS technology, LA analysis combining multiple gene expression studies can provide more accurate and stable results. In this article, we proposed two meta-analytic approaches for LA analysis (MetaLA and MetaMLA) to combine multiple transcriptomic studies. To compensate demanding computing, we also proposed a two-step fast screening algorithm for more efficient genome-wide screening: bootstrap filtering and sign filtering. We applied the methods to five Saccharomyces cerevisiae datasets related to environmental changes. The fast screening algorithm reduced 98% of running time. When compared with single study analysis, MetaLA and MetaMLA provided stronger detection signal and more consistent and stable results. The top triplets are highly enriched in fundamental biological processes related to environmental changes. Our method can help biologists understand underlying regulatory mechanisms under different environmental exposure or disease states. A MetaLA R package, data and code for this article are available at http://tsenglab.biostat.pitt.edu/software.htm. ctseng@pitt.edu. Supplementary data are available at Bioinformatics online. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com
A new computer code for discrete fracture network modelling
NASA Astrophysics Data System (ADS)
Xu, Chaoshui; Dowd, Peter
2010-03-01
The authors describe a comprehensive software package for two- and three-dimensional stochastic rock fracture simulation using marked point processes. Fracture locations can be modelled by a Poisson, a non-homogeneous, a cluster or a Cox point process; fracture geometries and properties are modelled by their respective probability distributions. Virtual sampling tools such as plane, window and scanline sampling are included in the software together with a comprehensive set of statistical tools including histogram analysis, probability plots, rose diagrams and hemispherical projections. The paper describes in detail the theoretical basis of the implementation and provides a case study in rock fracture modelling to demonstrate the application of the software.
MetaBar - a tool for consistent contextual data acquisition and standards compliant submission.
Hankeln, Wolfgang; Buttigieg, Pier Luigi; Fink, Dennis; Kottmann, Renzo; Yilmaz, Pelin; Glöckner, Frank Oliver
2010-06-30
Environmental sequence datasets are increasing at an exponential rate; however, the vast majority of them lack appropriate descriptors like sampling location, time and depth/altitude: generally referred to as metadata or contextual data. The consistent capture and structured submission of these data is crucial for integrated data analysis and ecosystems modeling. The application MetaBar has been developed, to support consistent contextual data acquisition. MetaBar is a spreadsheet and web-based software tool designed to assist users in the consistent acquisition, electronic storage, and submission of contextual data associated to their samples. A preconfigured Microsoft Excel spreadsheet is used to initiate structured contextual data storage in the field or laboratory. Each sample is given a unique identifier and at any stage the sheets can be uploaded to the MetaBar database server. To label samples, identifiers can be printed as barcodes. An intuitive web interface provides quick access to the contextual data in the MetaBar database as well as user and project management capabilities. Export functions facilitate contextual and sequence data submission to the International Nucleotide Sequence Database Collaboration (INSDC), comprising of the DNA DataBase of Japan (DDBJ), the European Molecular Biology Laboratory database (EMBL) and GenBank. MetaBar requests and stores contextual data in compliance to the Genomic Standards Consortium specifications. The MetaBar open source code base for local installation is available under the GNU General Public License version 3 (GNU GPL3). The MetaBar software supports the typical workflow from data acquisition and field-sampling to contextual data enriched sequence submission to an INSDC database. The integration with the megx.net marine Ecological Genomics database and portal facilitates georeferenced data integration and metadata-based comparisons of sampling sites as well as interactive data visualization. The ample export functionalities and the INSDC submission support enable exchange of data across disciplines and safeguarding contextual data.
MetaBar - a tool for consistent contextual data acquisition and standards compliant submission
2010-01-01
Background Environmental sequence datasets are increasing at an exponential rate; however, the vast majority of them lack appropriate descriptors like sampling location, time and depth/altitude: generally referred to as metadata or contextual data. The consistent capture and structured submission of these data is crucial for integrated data analysis and ecosystems modeling. The application MetaBar has been developed, to support consistent contextual data acquisition. Results MetaBar is a spreadsheet and web-based software tool designed to assist users in the consistent acquisition, electronic storage, and submission of contextual data associated to their samples. A preconfigured Microsoft® Excel® spreadsheet is used to initiate structured contextual data storage in the field or laboratory. Each sample is given a unique identifier and at any stage the sheets can be uploaded to the MetaBar database server. To label samples, identifiers can be printed as barcodes. An intuitive web interface provides quick access to the contextual data in the MetaBar database as well as user and project management capabilities. Export functions facilitate contextual and sequence data submission to the International Nucleotide Sequence Database Collaboration (INSDC), comprising of the DNA DataBase of Japan (DDBJ), the European Molecular Biology Laboratory database (EMBL) and GenBank. MetaBar requests and stores contextual data in compliance to the Genomic Standards Consortium specifications. The MetaBar open source code base for local installation is available under the GNU General Public License version 3 (GNU GPL3). Conclusion The MetaBar software supports the typical workflow from data acquisition and field-sampling to contextual data enriched sequence submission to an INSDC database. The integration with the megx.net marine Ecological Genomics database and portal facilitates georeferenced data integration and metadata-based comparisons of sampling sites as well as interactive data visualization. The ample export functionalities and the INSDC submission support enable exchange of data across disciplines and safeguarding contextual data. PMID:20591175
Caird, Jeff K; Johnston, Katherine A; Willness, Chelsea R; Asbridge, Mark
2014-06-01
Three important and inter-related topics are addressed in this paper. First, the importance of meta-analysis and research synthesis methods to combine studies on traffic safety, in general, and on driver distraction, in particular, is briefly reviewed. Second, naturalistic, epidemiologic, and driving simulation studies on driver distraction are used to illustrate convergent and divergent results that have accumulated thus far in this domain of research. In particular, mobile phone conversation, passenger presence, and text messaging naturalistic studies use meta-analyses and research syntheses to illustrate important patterns of results that are in need of more in-depth study. Third, a number of driver distraction study limitations such as poorly defined dependent variables, lack of methodological detail, and omission of statistical information prevent the integration of many studies into meta-analyses. In addition, the overall quality of road safety studies suffers from these same limitations and suggestions for improvement are made to guide researchers and reviewers. Practical Applications. The use of research synthesis and meta-analysis provide comprehensive estimates of the impact of distractions on driving performance, which can be used to guide public policy and future research. Copyright © 2014 National Safety Council and Elsevier Ltd. All rights reserved.
Emura, Takeshi; Nakatochi, Masahiro; Matsui, Shigeyuki; Michimae, Hirofumi; Rondeau, Virginie
2017-01-01
Developing a personalized risk prediction model of death is fundamental for improving patient care and touches on the realm of personalized medicine. The increasing availability of genomic information and large-scale meta-analytic data sets for clinicians has motivated the extension of traditional survival prediction based on the Cox proportional hazards model. The aim of our paper is to develop a personalized risk prediction formula for death according to genetic factors and dynamic tumour progression status based on meta-analytic data. To this end, we extend the existing joint frailty-copula model to a model allowing for high-dimensional genetic factors. In addition, we propose a dynamic prediction formula to predict death given tumour progression events possibly occurring after treatment or surgery. For clinical use, we implement the computation software of the prediction formula in the joint.Cox R package. We also develop a tool to validate the performance of the prediction formula by assessing the prediction error. We illustrate the method with the meta-analysis of individual patient data on ovarian cancer patients.
Bilingualism and Working Memory Capacity: A Comprehensive Meta-Analysis
ERIC Educational Resources Information Center
Grundy, John G.; Timmer, Kalinka
2017-01-01
Bilinguals often outperform monolinguals on executive function tasks, including tasks that tap cognitive flexibility, conflict monitoring, and task-switching abilities. Some have suggested that bilinguals also have greater working memory capacity than comparable monolinguals, but evidence for this suggestion is mixed. We therefore conducted a…
Near-road air pollution has been associated with various health risks in human populations living near roadways. To better understand relationship between vehicle emissions and spatial profiles of traffic-related air pollutants we performed a comprehensive and systematic literat...
Mode Deactivation Therapy (MDT) Comprehensive Meta-Analysis
ERIC Educational Resources Information Center
Apsche, Jack A.; Bass, Christopher K.; DiMeo, Lucia
2011-01-01
MDT provides an empirically based treatment for adolescents with behavioral problems such as anger, oppositional defiant and sexual and physical aggression (Apsche & DiMeo, 2010). It offers therapists a more efficient and timely intervention that positively effects recidivism rates (Apsche, Bass & Murphy, 2004). Based on Cognitive Behavioral…
Wu, Xin Yin; Du, Xin Jian; Ho, Robin S T; Lee, Clarence C Y; Yip, Benjamin H K; Wong, Martin C S; Wong, Samuel Y S; Chung, Vincent C H
2017-02-01
Methodological quality of meta-analyses on hypertension treatments can affect treatment decision-making. The authors conducted a cross-sectional study to investigate the methodological quality of meta-analyses on hypertension treatments. One hundred and fifty-eight meta-analyses were identified. Overall, methodological quality was unsatisfactory in the following aspects: comprehensive reporting of financial support (1.9%), provision of included and excluded lists of studies (22.8%), inclusion of grey literature (27.2%), and inclusion of protocols (32.9%). The 126 non-Cochrane meta-analyses had poor performance on almost all the methodological items. Non-Cochrane meta-analyses focused on nonpharmacologic treatments were more likely to consider scientific quality of included studies when making conclusions. The 32 Cochrane meta-analyses generally had good methodological quality except for comprehensive reporting of the sources of support. These results highlight the need for cautious interpretation of these meta-analyses, especially among physicians and policy makers when guidelines are formulated. Future meta-analyses should pay attention to improving these methodological aspects. ©2016 Wiley Periodicals, Inc.
High Ki-67 Immunohistochemical Reactivity Correlates With Poor Prognosis in Bladder Carcinoma
Luo, Yihuan; Zhang, Xin; Mo, Meile; Tan, Zhong; Huang, Lanshan; Zhou, Hong; Wang, Chunqin; Wei, Fanglin; Qiu, Xiaohui; He, Rongquan; Chen, Gang
2016-01-01
Abstract Ki-67 is considered as one of prime biomarkers to reflect cell proliferation and immunohistochemical Ki-67 staining has been widely applied in clinical pathology. To solve the widespread controversy whether Ki-67 reactivity significantly predicts clinical prognosis of bladder carcinoma (BC), we performed a comprehensive meta-analysis by combining results from different literature. A comprehensive search was conducted in the Chinese databases of WanFang, China National Knowledge Infrastructure and Chinese VIP as well as English databases of PubMed, ISI web of science, EMBASE, Science Direct, and Wiley online library. Independent studies linking Ki-67 to cancer-specific survival (CSS), disease-free survival (DFS), overall survival (OS), progression-free survival (PFS), and recurrence-free survival (RFS) were included in our meta-analysis. With the cut-off values literature provided, hazard ratio (HR) values between the survival distributions were extracted and later combined with STATA 12.0. In total, 76 studies (n = 13,053 patients) were eligible for the meta-analysis. It was indicated in either univariate or multivariate analysis for survival that high Ki-67 reactivity significantly predicted poor prognosis. In the univariate analysis, the combined HR for CSS, DFS, OS, PFS, and RFS were 2.588 (95% confidence interval [CI]: 1.623–4.127, P < 0.001), 2.697 (95%CI: 1.874–3.883, P < 0.001), 2.649 (95%CI: 1.632–4.300, P < 0.001), 3.506 (95%CI: 2.231–5.508, P < 0.001), and 1.792 (95%CI: 1.409–2.279, P < 0.001), respectively. The pooled HR of multivariate analysis for CSS, DFS, OS, PFS, and RFS were 1.868 (95%CI: 1.343–2.597, P < 0.001), 2.626 (95%CI: 2.089–3.301, P < 0.001), 1.104 (95%CI: 1.008–1.209, P = 0.032), 1.518 (95%CI: 1.299–1.773, P < 0.001), and 1.294 (95%CI: 1.203–1.392, P < 0.001), respectively. Subgroup analysis of univariate analysis by origin showed that Ki-67 reactivity significantly correlated with all 5 clinical outcome in Asian and European-American patients (P < 0.05). For multivariate analysis, however, the pooled results were only significant for DFS, OS, and RFS in Asian patients, for CSS, DFS, PFS, and RFS in European-American patients (P < 0.05). In the subgroup with low cut-off value (<20%), our meta-analysis indicated that high Ki-67 reactivity was significantly correlated with worsened CSS, DFS, OS, PFS, and RFS on univariate analysis (P < 0.05). For multivariate analysis, the meta-analysis of literature with low cut-off value (<20%) demonstrated that high Ki-67 reactivity predicted shorter DFS, PFS, and RFS in BC patients (P < 0.05). In the subgroup analysis of high cut-off value (≥20%), our meta-analysis indicated that high Ki-67 reactivity, in either univariate or multivariate analysis, significantly correlated with all five clinical outcomes in BC patients (P < 0.05). The meta-analysis indicates that high Ki-67 reactivity significantly correlates with deteriorated clinical outcomes in BC patients and that Ki-67 can be considered as an independent indicator for the prognosis by the meta-analyses of multivariate analysis. PMID:27082587
SOX9 Is a Progressive Factor in Prostate Cancer
2013-09-01
immunohis- tochemical analyses of BCa xenografts or mouse mammary tis- sues are detailed in the supplemental data. Meta- analysis of Gene Expression—SOX9mRNA...accession no. GSE5460) using dChip software (29). The analysis of variance function in dChip identified gene probes with significant correlation to...tumor grade groups (right panel). The p values of the difference analysis (Fisher’s Exact Test) are indicated. SOX9 Controlled Wnt/-catenin Activity
Crowther, Michael J; Look, Maxime P; Riley, Richard D
2014-09-28
Multilevel mixed effects survival models are used in the analysis of clustered survival data, such as repeated events, multicenter clinical trials, and individual participant data (IPD) meta-analyses, to investigate heterogeneity in baseline risk and covariate effects. In this paper, we extend parametric frailty models including the exponential, Weibull and Gompertz proportional hazards (PH) models and the log logistic, log normal, and generalized gamma accelerated failure time models to allow any number of normally distributed random effects. Furthermore, we extend the flexible parametric survival model of Royston and Parmar, modeled on the log-cumulative hazard scale using restricted cubic splines, to include random effects while also allowing for non-PH (time-dependent effects). Maximum likelihood is used to estimate the models utilizing adaptive or nonadaptive Gauss-Hermite quadrature. The methods are evaluated through simulation studies representing clinically plausible scenarios of a multicenter trial and IPD meta-analysis, showing good performance of the estimation method. The flexible parametric mixed effects model is illustrated using a dataset of patients with kidney disease and repeated times to infection and an IPD meta-analysis of prognostic factor studies in patients with breast cancer. User-friendly Stata software is provided to implement the methods. Copyright © 2014 John Wiley & Sons, Ltd.
Gong, Xiu; Wu, Jinsong; Mao, Ying; Zhou, Liangfu
2014-10-28
The hypothesis that "cell phone induces brain tumor" has become a target of much controversy for several decades and is still a matter of debate even now. We aim to make a systematic review and meta-analysis based on published studies on glioma to identify current evidences for evaluating mobile phones and glioma risk, especially on long-term use of mobile phones. The study was conducted according to the Cochrane systematic review methods and reported according to the PRISMA (Preferred Reporting Items for Systematic reviews and Meta-Analyses) statement according to a prospective research protocol accessed via http://www.crd.york.ac.uk/prospero. The software RevMan 5 was used for statistic analysis. Latency and lateralization were used for the examining the dose-response relationship. Overall evidence suggested the increased risk of glioma among long-term ipsilateral users of mobile phone with an odds ratio (OR) of 1.46[1.12, 1.92] based on meta-analysis. Especially, for low-grade glioma, long-term use yielded an OR value of 2.27 [1.81, 2.85]. The evidence is currently insufficient on this issue, especially on long-term use of mobile phone. Neither a definite answer nor a clear explanation may be offered for the relationship. And larger prospective trials are warranted.
Baldoni, Nayara Ragi; Aquino, Jéssica Azevedo; Sanches-Giraud, Cristina; Di Lorenzo Oliveira, Cláudia; de Figueiredo, Roberta Carvalho; Cardoso, Clareci Silva; Santos, Thiago Reis; Alves, Geisa Cristina Silva; Dal Fabbro, Amaury Lelis; Baldoni, André Oliveira
2017-04-01
To perform a systematic review and meta-analysis to identify and analyze collective empowerment strategies for patients with Diabetes Mellitus (DM). The systematic review was performed using PubMed/MEDLINE, Science Direct and BVS. The term "Diabetes Mellitus" was used with each of the following describers, along with the connector "AND": "self-care", "health education", "motivation" and "empowerment". Inclusion criteria were: intervention study with control group published between 2004 and 2014. For meta-analysis, RevMan V 5.3 software was used. Among the nine analyzed articles, 66.7% (n=6) were developed in patients diagnosed with DM2. Concerning the indicators for intervention effectiveness evaluation, all articles (n=9) used glycated hemoglobin (HbA1c) and the most used instrument was Summary of Diabetes Self Care Activities Measure, representing 44.4% (n=4) of the studies. The types of strategies used were similar in the articles. There was evidence of a decrease in HbA1c levels in 66.7% (n=6). The meta-analysis found significant evidence indicating beneficial effects of empowerment. Programs based on collective empowerment in DM have shown the interventions lead to improvement in clinical parameters, behavior, increased knowledge about DM, and self-care. Copyright © 2016 Primary Care Diabetes Europe. Published by Elsevier Ltd. All rights reserved.
Prevalence of Enterobius vermicularis among Children in Iran: A Systematic Review and Meta-analysis
Moosazadeh, Mahmood; Abedi, Ghasem; Afshari, Mahdi; Mahdavi, Seif Ali; Farshidi, Fereshteh; Kheradmand, Elham
2017-01-01
Objectives Enterobius vermicularis is a parasitic disease that is common in crowded areas such as schools and kindergartens. Primary investigations of electronic evidence have reported different prevalences of E. vermicularis in Iran. Therefore, we aimed to estimate the total prevalence of this infection among Iranian children using a meta-analysis. Methods Relevant studies were identified in national and international databases. We selected eligible papers for meta-analysis after investigating titles, abstracts, and full texts; assessing study quality; and applying inclusion/exclusion criteria. Data were extracted by two independent researchers. The results were combined using a random effects model in Stata v. 11 software. Results Among 19 eligible articles including 11,676 participants, the prevalences of E. vermicularis among all children, boys, and girls were 1.2%–66.1%, 2.3%–65.5%, and 1.7%–65.5%, respectively. Pooled prevalences (95% confidence interval) of E. vermicularis among all children, boys, and girls were 17.2% (12.6%–21.8%), 17.2% (12.6%–21.8%), and 16.9% (9.03%–24.8%), respectively. Conclusion This meta-analysis showed that a great majority of Iranian children are infected with E. vermicularis, possibly due to poor public health. PMID:28540154
Dong, Jiaqi; Zhang, Rui; Lu, Meixia; Kong, Weijia
2014-01-01
Background Studies have reported inconsistent findings regarding the relationship between obstructive sleep apnea (OSA) and homocysteine (HCY) level. This study aimed to assess the difference in plasma HCY level between OSA patients and controls by conducting a meta-analysis of published studies. Methods Database of PubMed, SCI, and China National Knowledge Internet (CNKI) were comprehensively searched. Eligible studies regarding plasma HCY level in OSA patients were identified by two independent reviewers. RevMan (version 5.2) and STATA (version 12.0) were employed for data synthesis. Results A total of 10 studies involving 432 subjects were included. Meta-analysis showed that plasma HCY levels in OSA group were 3.11 µmol/l higher than that in control group (95% confidence interval: 2.08 to 4.15, P<0.01). Subgroup analysis revealed a more significant differences between OSA patients and controls when average body mass index ≥30 (the total weighted mean difference (WMD) was 3.64), average age<50 (the total WMD was 3.96) and average apnea hypopnea index ≥35 (the total WMD was 4.54). Conclusions In this meta-analysis, plasma HCY levels were found to be higher in OSA patients compared to control subjects. PMID:24769854
Tan, Xingrong; Li, Shengbing; Chang, Ying; Fang, Chao; Liu, Hua; Zhang, Xingping; Wang, Yi
2016-09-11
Some previous studies have found that continued metformin use is beneficial in the management of polycystic ovary syndrome (PCOS) in pregnant women. A systemic review and meta-analysis were needed to more fully assess the effects of metformin on pregnant PCOS patients. The literature was fully searched using MEDLINE, EMBASE, SCOPUS, and COCHRANE for continued metformin use during pregnancy in women with PCOS. A systematic review and meta-analysis were performed to evaluate the comprehensive effects of continued metformin treatment on pregnancy-related outcomes in these women. Eleven eligible studies out of 127 relevant publications were included in meta-analysis. The rates of early pregnancy loss and preterm delivery were found to be significantly decreased in metformin-treated PCOS women. A non-significant difference was found in fetal abnormality and fetal birth weight between the metformin-treated and the non-treated groups. The incidence of gestational diabetes mellitus (GDM) and hypertension/preeclampsia were not significantly different in the two groups, probably because of inconsistent results in the subgroup analysis. Our results showed that continued use during of metformin, during pregnancy in women with PCOS, had no effect on incidence of fetal abnormalities or fetal birth weight. The effects of metformin on GDM and hypertension/preeclampsia should be determined through high-quality randomized controlled trials.
Cai, Xiaopeng; Liu, Xu; Yu, Haitao; Li, Jiguang; Zheng, Xinyu
2012-01-01
Breast cancer has a high incidence worldwide, while Chinese patients have some special characteristics compared to Western patients. A meta-analysis was carried out to determine the effectiveness of breast-conserving therapy (BCT) or mastectomy therapy (MT) for early-stage breast cancers in Chinese women. A fully recursive literature search was conducted in the Chinese Biomedical Literature Database. Case-control trials were considered for inclusion. Analyses were carried out using the Review Manager software (RevMan, version 5.0). The meta-analysis showed that the 3-year or 5-year overall survival, the locoregional recurrence rate, and the metastasis rate were not statistically different between the BCT group and the MT group, but the complication recurrence rate increased in the MT group. Subgroup analysis indicated that no significant differences were observed in the affected limb swelling recurrence rate between the BCT group and the MT group. BCT was the better choice than MT for Chinese women with early-stage breast cancer. Copyright © 2012 S. Karger AG, Basel.
Su, Qiang; Zhang, Xiaochen; Shen, Xinhua; Hou, Yanli; Sun, Zhigang; Gao, Zu Hua
2018-01-01
Background: We performed a meta-analysis to evaluate the risk of immune-related colitis associated with PD1/PD-L1 inhibitors as compared to chemotherapy in solid tumor patients. Methods: Eligible studies were identified through a comprehensive search of multiple databases and included solid tumor patients in randomized controlled trials (RCTs) with PD-1/PD-L1 inhibitors. The data was analyzed by Stata version 12.0 software. Results: After exclusion of ineligible studies, 11 clinical trials were considered eligible for the meta-analysis, including 5751 patients. Compared with chemotherapy, the risk ratios (RRs) of all-grade colitis were significant for the PD-1 inhibitor subgroup (RR 2.69, 95% confidence interval (CI): 1.15-6.29, p=0.023), and for pembrolizumab subgroup (RR 3.17, 95% CI: 1.08-9.37, p=0.037), but not for nivolumab treatment and PD-L1 inhibitor (atezolizumab) treatment (RR 2.05, 95% CI: 0.52-8.13, p=0.305; RR 4.75,95% CI: 0.56-40.50, p=0.154, respectively). The RR of all-grade colitis was significant for PD-1/PD-L1 inhibitor in NSCLC (RR 4.34, 95% CI: 1.37-13.82, p=0.013), and not significant in melanoma (RR 2.11, 95% CI: 0.54-8.34, p=0.285). Moreover, the RRs of all-grade diarrhea were significant for the PD-1 inhibitor subgroup (RR 0.61, 95% CI: 0.44-0.83, p=0.002), for the nivolumab subgroup (RR 0.54, 95% CI: 0.34-0.87, p=0.012), and for atezolizumab subgroup (RR 0.48, 95% CI: 0.25-0.89, p=0.021). The RR of high-grade diarrhea was significant for atezolizumab subgroup (RR 0.34, 95% CI: 0.12-0.94, p=0.037). Conclusions: Our meta-analysis demonstrates that compared with chemotherapy, pembrolizumab may result in a higher risk of all-grade immune-mediated colitis. PD-1/PD-L1 inhibitor treatment in NSCLC patients, but not in melanoma patients, increases the risk of all-grade colitis incidence.
GWAR: robust analysis and meta-analysis of genome-wide association studies.
Dimou, Niki L; Tsirigos, Konstantinos D; Elofsson, Arne; Bagos, Pantelis G
2017-05-15
In the context of genome-wide association studies (GWAS), there is a variety of statistical techniques in order to conduct the analysis, but, in most cases, the underlying genetic model is usually unknown. Under these circumstances, the classical Cochran-Armitage trend test (CATT) is suboptimal. Robust procedures that maximize the power and preserve the nominal type I error rate are preferable. Moreover, performing a meta-analysis using robust procedures is of great interest and has never been addressed in the past. The primary goal of this work is to implement several robust methods for analysis and meta-analysis in the statistical package Stata and subsequently to make the software available to the scientific community. The CATT under a recessive, additive and dominant model of inheritance as well as robust methods based on the Maximum Efficiency Robust Test statistic, the MAX statistic and the MIN2 were implemented in Stata. Concerning MAX and MIN2, we calculated their asymptotic null distributions relying on numerical integration resulting in a great gain in computational time without losing accuracy. All the aforementioned approaches were employed in a fixed or a random effects meta-analysis setting using summary data with weights equal to the reciprocal of the combined cases and controls. Overall, this is the first complete effort to implement procedures for analysis and meta-analysis in GWAS using Stata. A Stata program and a web-server are freely available for academic users at http://www.compgen.org/tools/GWAR. pbagos@compgen.org. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com
Spectrum analysis on quality requirements consideration in software design documents.
Kaiya, Haruhiko; Umemura, Masahiro; Ogata, Shinpei; Kaijiri, Kenji
2013-12-01
Software quality requirements defined in the requirements analysis stage should be implemented in the final products, such as source codes and system deployment. To guarantee this meta-requirement, quality requirements should be considered in the intermediate stages, such as the design stage or the architectural definition stage. We propose a novel method for checking whether quality requirements are considered in the design stage. In this method, a technique called "spectrum analysis for quality requirements" is applied not only to requirements specifications but also to design documents. The technique enables us to derive the spectrum of a document, and quality requirements considerations in the document are numerically represented in the spectrum. We can thus objectively identify whether the considerations of quality requirements in a requirements document are adapted to its design document. To validate the method, we applied it to commercial software systems with the help of a supporting tool, and we confirmed that the method worked well.
Rocha, Renan Boeira; Dondossola, Eduardo Ronconi; Grande, Antônio José; Colonetti, Tamy; Ceretta, Luciane Bisognin; Passos, Ives C; Quevedo, Joao; da Rosa, Maria Inês
2016-12-01
We performed a systematic review and meta-analysis to estimate brain-derived neurotrophic factor (BDNF) level in patients with major depressive disorder (MDD) after electroconvulsive therapy (ECT). A comprehensive search of the Cochrane Library, MEDLINE, LILACS, Grey literature, and EMBASE was performed for papers published from January 1990 to April 2016. The following key terms were searched: "major depressive disorder", "unipolar depression", "brain-derived neurotrophic factor", and "electroconvulsive therapy". A total of 252 citations were identified by the search strategy, and nine studies met the inclusion criteria of the meta-analysis. BDNF levels were increased among patients with MDD after ECT (P value = 0.006). The standardized mean difference was 0.56 (95% CI: 0.17-0.96). Additionally, we found significant heterogeneity between studies (I 2 = 73%). Our findings suggest a potential role of BDNF as a marker of treatment response after ECT in patients with MDD. Copyright © 2016 Elsevier Ltd. All rights reserved.
Yang, Jheng-Dao; Tam, Ka-Wai; Huang, Tsai-Wei; Huang, Shih-Wei; Liou, Tsan-Hon; Chen, Hung-Chou
2017-07-01
A meta-analysis. The aim of this study was to perform a comprehensive search of current literature and conduct a meta-analysis of randomized controlled trials (RCTs) to assess the neck pain relieving effect of intermittent cervical traction (ICT). Neck pain is a common and disabling problem with a high prevalence in general population. It causes a considerable burden on the health care system with a substantial expenditure. ICT is a common component of physical therapy for neck pain in the outpatient clinic. However, the evidence regarding the effectiveness of ICT for neck pain is insufficient. Data were obtained from the PubMed, Cochrane Library, Embase, and Scopus databases from the database inception date to July 02, 2016. RCTs reporting the effects of ICT on neck pain, including those comparing the effects of ICT with those of a placebo treatment, were included. Two reviewers independently reviewed the studies, conducted a risk of bias assessment, and extracted data. The data were pooled in a meta-analysis by using a random-effects model. The meta-analysis included seven RCTs. The results indicated that patients who received ICT for neck pain had significantly lower pain scores than those receiving placebos did immediately after treatment (standardized mean difference = -0.26, 95% confidence interval = -0.46 to -0.07). The pain scores during the follow-up period and the neck disability index scores immediately after treatment and during the follow-up period did not differ significantly. ICT may have a short-term neck pain-relieving effect. Some risks of bias were noted in the included studies, reducing the evidence level of this meta-analysis. Additional high-quality RCTs are required to clarify the long-term effects of ICT on neck pain. 1.
Kuang, Ming-Jie; Du, Yuren; Ma, Jian-Xiong; He, Weiwei; Fu, Lin; Ma, Xin-Long
2017-04-01
Total knee arthroplasty (TKA) is gradually emerging as the treatment of choice for end-stage osteoarthritis. In the past, the method of liposomal bupivacaine by periarticular injection (PAI) showed better effects on pain reduction and opioid consumption after surgery. However, some recent studies have reported that liposomal bupivacaine by PAI did not improve pain control and functional recovery in patients undergoing TKA. Therefore, this meta-analysis was conducted to determine whether liposomal bupivacaine provides better pain relief and functional recovery after TKA. Web of Science, PubMed, Embase, and the Cochrane Library were comprehensively searched. Randomized controlled trials, controlled clinical trials, and cohort studies were included in our meta-analysis. Eleven studies that compared liposomal bupivacaine using the PAI technique with the conventional PAI method were included in our meta-analysis. The preferred reporting items for systematic reviews and meta-analyses (PRISMA) guidelines and Cochrane Handbook were applied to assess the quality of the results published in all included studies to ensure that the results of our meta-analysis were reliable and veritable. Our pooled data analysis demonstrated that liposomal bupivacaine was as effective as the control group in terms of visual analog scale score at 24 hours (P = .46), 48 hours (P = .43), 72 hours (P = .21), total amount of opioid consumption (P = .25), range of motion (P = .28), length of hospital stay (P = .53), postoperative nausea (P = .34), and ambulation distance (P = .07). Compared with the conventional PAI method, liposomal bupivacaine shows similar pain control and functional recovery after TKA. Considering the cost for pain control, liposomal bupivacaine is not worthy of being recommended as a long-acting alternative analgesic agent using the PAI method. Copyright © 2016 Elsevier Inc. All rights reserved.
Tan, Minmin; Chai, Zhaowu; Sun, Chengjun; Hu, Bo; Gao, Xiang; Chen, Yunjia; Song, Jinlin
2018-06-13
Teeth treated endodontically are more susceptible to vertical root fracture (VRF). Some studies have suggested that obturating the root canals with Gutta-percha or Resilon can reinforce endodontically treated teeth, but a few others have presented conflicting results. These inconsistent results cannot guide clinicians in determining clinical approaches. The objective of this meta-analysis is to evaluate and compare the vertical fracture resistance of endodontically treated root canals obturated with Gutta-percha/AH plus and the Resilon system. Comprehensive literature searches were performed in the PubMed, Cochrane Library, ScienceDirect, Web of Science and Embase databases. The titles and abstracts of all of the retrieved articles were independently assessed by two authors according to predefined selection criteria. Data in the included articles were independently extracted. Statistical analyses were conducted using Review Manager 5.3 and Stata 12.0 software. The pooled standardized mean differences (SMDs) with 95% confidence intervals (CIs) were calculated for the outcome indicators. The level of statistical significance was set at p < 0.05. The Cochran Q test (I 2 test) was used to test for heterogeneity among studies. Fourteen randomized controlled in vitro trials were included in the meta-analysis. The results demonstrated that the vertical root fracture resistance of unprepared and unfilled roots was significantly higher than that of roots obturated with Gutta-percha/AH plus (SMD = - 0.69, 95% CI = - 1.34 to - 0.04, p = 0.04) or the Resilon system (SMD = - 0.54, 95% CI = - 1.07 to - 0.00, p = 0.05). The differences in fracture resistance between the roots filled with Gutta-percha/AH plus and the prepared unfilled root canals was not significant (SMD = 0.59, 95% CI = - 0.02 to 1.21, p = 0.06). Roots obturated with Resilon had higher fracture resistance than instrumented unfilled roots (SMD = 0.83, 95% CI = 0.44 to 1.22, p < 0.0001) or roots filled with Gutta-percha/AH plus (SMD = 0.62, 95% CI = 0.01 to 1.23, p = 0.05). The present study suggests that filling with Gutta-percha/AH plus dose not reinforce endodontically treated roots, whereas obturating with the Resilon system can increase vertical root fracture resistance of prepared roots. As this meta-analysis was based on in vitro studies, it should be careful to extrapolate its conclusion to the clinical context.
McNeely, Heather; Losier, Bruno; Parlar, Melissa; King, Matthew; Hasey, Gary; Fervaha, Gagan; Graham, Allyson C; Gregory, Caitlin; Hanford, Lindsay; Nazarov, Anthony; Restivo, Maria; Tatham, Erica; Truong, Wanda; Hall, Geoffrey B C; Lanius, Ruth; McKinnon, Margaret
2015-01-01
Introduction Depression is the leading cause of disability worldwide, affecting approximately 350 million people. Evidence indicates that only 60–70% of persons with major depressive disorder who tolerate antidepressants respond to first-line drug treatment; the remainder become treatment resistant. Electroconvulsive therapy (ECT) is considered an effective therapy in persons with treatment-resistant depression. The use of ECT is controversial due to concerns about temporary cognitive impairment in the acute post-treatment period. We will conduct a meta-analysis to examine the effects of ECT on cognition in persons with depression. Methods This systematic review and meta-analysis has been registered with PROSPERO (registration number: CRD42014009100). We developed our methods following the Preferred Reporting Items for Systematic Reviews and Meta-Analysis (PRISMA) statement. We are searching MEDLINE, PsychINFO, EMBASE, CINAHL and Cochrane from the date of database inception to the end of October 2014. We are also searching the reference lists of published reviews and evidence reports for additional citations. Comparative studies (randomised controlled trials, cohort and case–control) published in English will be included in the meta-analysis. Three clinical neuropsychologists will group the cognitive tests in each included article into a set of mutually exclusive cognitive subdomains. The risk of bias of randomised controlled trials will be assessed using the Jadad scale. We will supplement the Jadad scale with additional questions based on the Cochrane risk of bias tool. The risk of bias of cohort and case–control studies will be assessed using the Newcastle-Ottawa Scale. We will employ the Grading of Recommendations Assessment, Development, and Evaluation (GRADE) to assess the strength of evidence. Statistical analysis Separate meta-analyses will be conducted for each ECT treatment modality and cognitive subdomain using Comprehensive Meta-Analysis V.2.0. PMID:25762234
Jia, Yongliang; Leung, Siu-Wai
2017-09-01
More than 230 randomized controlled trials (RCTs) of danshen dripping pill (DSP) and isosorbide dinitrate (ISDN) in treating angina pectoris after the first preferred reporting items for systematic reviews and meta-analyses-compliant comprehensive meta-analysis were published in 2010. Other meta-analyses had flaws in study selection, statistical meta-analysis, and evidence assessment. This study completed the meta-analysis with an extensive assessment of the evidence. RCTs published from 1994 to 2016 on DSP and ISDN in treating angina pectoris for at least 4 weeks were included. The risk of bias (RoB) of included RCTs was assessed with the Cochrane's tool for assessing RoB. Meta-analyses based on a random-effects model were performed on two outcome measures: symptomatic (SYM) and electrocardiography (ECG) improvements. Subgroup analysis, sensitivity analysis, metaregression, and publication bias analysis were also conducted. The evidence strength was evaluated with the Grades of Recommendation, Assessment, Development, and Evaluation (GRADE) method. Among the included 109 RCTs with 11,973 participants, 49 RCTs and 5042 participants were new (after 2010). The RoB of included RCTs was high in randomization and blinding. Overall effect sizes in odds ratios for DSP over ISDN were 2.94 (95% confidence interval [CI]: 2.53-3.41) on SYM (n = 108) and 2.37 (95% CI: 2.08-2.69) by ECG (n = 81) with significant heterogeneities (I 2 = 41%, p < 0.0001 on SYM and I 2 = 44%, p < 0.0001 on ECG). Subgroup, sensitivity, and metaregression analyses showed consistent results without publication bias. However, the evidence strength was low in GRADE. The efficacy of DSP was still better than ISDN in treating angina pectoris, but the confidence decreased due to high RoB and heterogeneities.
Depression and risk of fracture and bone loss: an updated meta-analysis of prospective studies.
Wu, Q; Liu, B; Tonmoy, S
2018-03-12
This meta-analysis pooled results from 23 qualifying individual cohort studies and found that depression was significantly associated with an increased risk of fractures and bone loss. The association between depression and risk of fracture remains controversial. We conducted a comprehensive meta-analysis to examine the effect of depression on the risk of osteoporotic fractures and bone loss. We searched databases and reviewed citations in relevant articles for eligible cohort studies. Two investigators independently conducted study selection, appraisal, and data abstraction through the use of a standardized protocol. Random effect models were used for meta-analysis. Cochrane Q and I 2 statistics were used to assess heterogeneity. Funnel plots and rank correlation tests were used to evaluate publication bias. Twenty-three studies were included for meta-analysis. In studies that reported hazard ratio (HR) as the outcome (nine studies [n = 309,862]), depression was associated with 26% increase in fracture risk (HR = 1.26, 95% CI, 1.10-1.43, p < 0.001). Studies that reported risk ratio (RR) as the outcome (seven studies [n = 64,975]) suggested that depression was associated with 39% increase in fracture risk (RR = 1.39, 95% CI, 1.19-1.62, p < 0.001). Among studies that reported hip bone mineral density (BMD) as an outcome (eight studies [n = 15,442]), depression was associated with a reduced mean annual bone loss rate of 0.35% (0.18-0.53%, p < 0.001). The increased risk of fracture and bone loss associated with depression was consistent in all meta-analysis having modified inclusion criteria and in different subgroup analyses as well. Significant heterogeneity was observed in the meta-analysis; however, no significant publication bias was detected. Depression is associated with a significant increased risk in fracture and bone loss. Effective prevention may decrease such risk.
A Meta-Analysis of the Taped Problems Intervention
ERIC Educational Resources Information Center
Kleinert, Whitney L.; Codding, Robin S.; Minami, Takuya; Gould, Kaitlin
2018-01-01
Taped problems is an intervention strategy for addressing mathematics fluency that has been evaluated in multiple single-case design studies. Although its efficacy has been supported in individual studies, no comprehensive quantitative synthesis has been conducted on taped problems. The purpose of this study was to synthesize the literature that…
A Comprehensive Leadership Education Model To Train, Teach, and Develop Leadership in Youth.
ERIC Educational Resources Information Center
Ricketts, John C.; Rudd, Rick D.
2002-01-01
Meta-analysis of youth leadership development literature resulted in a conceptual model and curriculum framework. Model dimensions are leadership knowledge and information; leadership attitudes, will, and desire; decision making, reasoning, and critical thinking; oral and written communication; and intra/interpersonal relations. Dimensions have…
Melatonin in Autism Spectrum Disorders: A Systematic Review and Meta-Analysis
ERIC Educational Resources Information Center
Rossignol, Daniel A.; Frye, Richard E.
2011-01-01
Aim: The aim of this study was to investigate melatonin-related findings in autism spectrum disorders (ASD), including autistic disorder, Asperger syndrome, Rett syndrome, and pervasive developmental disorders, not otherwise specified. Method: Comprehensive searches were conducted in the PubMed, Google Scholar, CINAHL, EMBASE, Scopus, and ERIC…
Synchronous Computer-Mediated Communication and Interaction: A Research Synthesis and Meta-Analysis
ERIC Educational Resources Information Center
Ziegler, Nicole
2013-01-01
The interaction approach to second language acquisition (SLA) suggests that changes that occur during conversation facilitate second language development by providing learners with opportunities to receive modified comprehensible input and interactional feedback, to produce output, and to notice gaps between their interlanguage and the target…
Education with ICT in South Korea and Chile
ERIC Educational Resources Information Center
Sanchez, Jaime; Salinas, Alvaro; Harris, Jordan
2011-01-01
This article presents a linear-analytical case study on the development of ICT within the educational systems of Chile and South Korea. Through a comprehensive meta-data analysis and bibliographic review, we collected information on both educational systems and their ICT adoption policies. Key differences necessary to understand how both countries…
Gomes, Ciro Martins; Mazin, Suleimy Cristina; dos Santos, Elisa Raphael; Cesetti, Mariana Vicente; Bächtold, Guilherme Albergaria Brízida; Cordeiro, João Henrique de Freitas; Theodoro, Fabrício Claudino Estrela Terra; Damasco, Fabiana dos Santos; Carranza, Sebastián Andrés Vernal; Santos, Adriana de Oliveira; Roselino, Ana Maria; Sampaio, Raimunda Nonata Ribeiro
2015-01-01
The diagnosis of mucocutaneous leishmaniasis (MCL) is hampered by the absence of a gold standard. An accurate diagnosis is essential because of the high toxicity of the medications for the disease. This study aimed to assess the ability of polymerase chain reaction (PCR) to identify MCL and to compare these results with clinical research recently published by the authors. A systematic literature review based on the Preferred Reporting Items for Systematic Reviews and Meta-Analyses: the PRISMA Statement was performed using comprehensive search criteria and communication with the authors. A meta-analysis considering the estimates of the univariate and bivariate models was performed. Specificity near 100% was common among the papers. The primary reason for accuracy differences was sensitivity. The meta-analysis, which was only possible for PCR samples of lesion fragments, revealed a sensitivity of 71% [95% confidence interval (CI) = 0.59; 0.81] and a specificity of 93% (95% CI = 0.83; 0.98) in the bivariate model. The search for measures that could increase the sensitivity of PCR should be encouraged. The quality of the collected material and the optimisation of the amplification of genetic material should be prioritised. PMID:25946238
Dinu, Monica; Abbate, Rosanna; Gensini, Gian Franco; Casini, Alessandro; Sofi, Francesco
2017-11-22
Beneficial effects of vegetarian and vegan diets on health outcomes have been supposed in previous studies. Aim of this study was to clarify the association between vegetarian, vegan diets, risk factors for chronic diseases, risk of all-cause mortality, incidence, and mortality from cardio-cerebrovascular diseases, total cancer and specific type of cancer (colorectal, breast, prostate and lung), through meta-analysis. A comprehensive search of Medline, EMBASE, Scopus, The Cochrane Library, and Google Scholar was conducted. Eighty-six cross-sectional and 10 cohort prospective studies were included. The overall analysis among cross-sectional studies reported significant reduced levels of body mass index, total cholesterol, LDL-cholesterol, and glucose levels in vegetarians and vegans versus omnivores. With regard to prospective cohort studies, the analysis showed a significant reduced risk of incidence and/or mortality from ischemic heart disease (RR 0.75; 95% CI, 0.68 to 0.82) and incidence of total cancer (RR 0.92; 95% CI 0.87 to 0.98) but not of total cardiovascular and cerebrovascular diseases, all-cause mortality and mortality from cancer. No significant association was evidenced when specific types of cancer were analyzed. The analysis conducted among vegans reported significant association with the risk of incidence from total cancer (RR 0.85; 95% CI, 0.75 to 0.95), despite obtained only in a limited number of studies. This comprehensive meta-analysis reports a significant protective effect of a vegetarian diet versus the incidence and/or mortality from ischemic heart disease (-25%) and incidence from total cancer (-8%). Vegan diet conferred a significant reduced risk (-15%) of incidence from total cancer.
Parents' experiences of neonatal transfer. A meta-study of qualitative research 2000-2017.
Aagaard, Hanne; Hall, Elisabeth O C; Ludvigsen, Mette S; Uhrenfeldt, Lisbeth; Fegran, Liv
2018-02-15
Transfers of critically ill neonates are frequent phenomena. Even though parents' participation is regarded as crucial in neonatal care, a transfer often means that parents and neonates are separated. A systematic review of the parents' experiences of neonatal transfer is lacking. This paper describes a meta-study addressing qualitative research about parents' experiences of neonatal transfer. Through deconstruction and reflections of theories, methods, and empirical data, the aim was to achieve a deeper understanding of theoretical, empirical, contextual, historical, and methodological issues of qualitative studies concerning parents' experiences of neonatal transfer over the course of this meta-study (2000-2017). Meta-theory and meta-method analyses showed that caring, transition, and family-centered care were main theoretical frames applied and that interviewing with a small number of participants was the preferred data collection method. The meta-data-analysis showed that transfer was a scary, unfamiliar, and threatening experience for the parents; they were losing familiar context, were separated from their neonate, and could feel their parenthood disrupted. We identified 'wavering and wandering' as a metaphoric representation of the parents' experiences. The findings add knowledge about meta-study as an approach for comprehensive qualitative research and point at the value of meta-theory and meta-method analyses. © 2018 John Wiley & Sons Ltd.
Risk of malignancy in ankylosing spondylitis: a systematic review and meta-analysis.
Deng, Chuiwen; Li, Wenli; Fei, Yunyun; Li, Yongzhe; Zhang, Fengchun
2016-08-18
Current knowledge about the overall and site-specific risk of malignancy associated with ankylosing spondylitis (AS) is inconsistent. We conducted a systematic review and meta-analysis to address this knowledge gap. Five databases (PubMed, EMBASE, Web of Science, the Cochrane library and the virtual health library) were systematically searched. A manual search of publications within the last 2 years in key journals in the field (Annals of the Rheumatic Diseases, Rheumatology and Arthritis &rheumatology) was also performed. STATA 11.2 software was used to conduct the meta-analysis. After screening, twenty-three studies, of different designs, were eligible for meta-analysis. AS is associated with a 14% (pooled RR 1.14; 95% CI 1.03-1.25) increase in the overall risk for malignancy. Compared to controls, patients with AS are at a specific increased risk for malignancy of the digestive system (pooled RR 1.20; 95% CI 1.01 to 1.42), multiple myelomas (pooled RR 1.92; 95% CI 1.37 to 3.69) and lymphomas (pooled RR 1.32; 95% CI 1.11 to 1.57). On subgroup analysis, evidence from high quality cohort studies indicated that AS patients from Asia are at highest risk for malignancy overall. Confirmation of findings from large-scale longitudinal studies is needed to identify specific risk factors and to evaluate treatment effects.
He, Yuan-Mei; Feng, Li; Huo, Dong-Mei; Yang, Zhen-Hua; Liao, Yun-Hua
2013-09-01
Both enalapril and losartan are effective and widely used in patients with chronic kidney disease (CKD). This review aimed to evaluate the benefits of enalapril and losartan in adults with CKD. PubMed, EMBASE, the Cochrane Library and ClinicalTrials.gov were searched, without language limitations, for randomized controlled trials (RCT), in which enalapril and losartan were compared in adults with CKD. Standard methods, consistent with the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) guidelines, were used. Reviewer Manager software, ver. 5.2, was used for meta-analysis. Of 318 citations retrieved, 17 RCT (14 parallel-group and three cross-over) met our inclusion criteria. The pooled analysis for parallel RCT showed that the effects of enalapril and losartan on blood pressure, renal function and serum uric acid (UA) were similar. Meta-analysis indicated that patients taking enalapril had a higher risk of dry cough (risk ratio, 2.88; 95% CI, 1.11-7.48; P=0.03). Sensitivity analysis showed good robustness of these findings. Enalapril has similar effects to losartan on systemic blood pressure, renal function and serum UA in patients with CKD, but carries a higher risk of dry cough. Larger trials are required to evaluate the effects of these medications on clinical outcomes. © 2013 The Authors. Nephrology © 2013 Asian Pacific Society of Nephrology.
The Effects of Music on Pain: A Meta-Analysis.
Lee, Jin Hyung
2016-01-01
Numerous meta-analyses have been conducted on the topic of music and pain, with the latest comprehensive study published in 2006. Since that time, more than 70 randomized controlled trials (RCTs) have been published, necessitating a new and comprehensive review. The aim of this meta-analysis was to examine published RCT studies investigating the effect of music on pain. The present study included RCTs published between 1995 and 2014. Studies were obtained by searching 12 databases and hand-searching related journals and reference lists. Main outcomes were pain intensity, emotional distress from pain, vital signs, and amount of analgesic intake. Study quality was evaluated according to the Cochrane Collaboration guidelines. Analysis of the 97 included studies revealed that music interventions had statistically significant effects in decreasing pain on 0-10 pain scales (MD = -1.13), other pain scales (SMD = -0.39), emotional distress from pain (MD = -10.83), anesthetic use (SMD = -0.56), opioid intake (SMD = -0.24), non-opioid intake (SMD = -0.54), heart rate (MD = -4.25), systolic blood pressure (MD = -3.34), diastolic blood pressure (MD = -1.18), and respiration rate (MD = -1.46). Subgroup and moderator analyses yielded additional clinically informative outcomes. Considering all the possible benefits, music interventions may provide an effective complementary approach for the relief of acute, procedural, and cancer/chronic pain in the medical setting. © the American Music Therapy Association 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Overview and Software Architecture of the Copernicus Trajectory Design and Optimization System
NASA Technical Reports Server (NTRS)
Williams, Jacob; Senent, Juan S.; Ocampo, Cesar; Mathur, Ravi; Davis, Elizabeth C.
2010-01-01
The Copernicus Trajectory Design and Optimization System represents an innovative and comprehensive approach to on-orbit mission design, trajectory analysis and optimization. Copernicus integrates state of the art algorithms in optimization, interactive visualization, spacecraft state propagation, and data input-output interfaces, allowing the analyst to design spacecraft missions to all possible Solar System destinations. All of these features are incorporated within a single architecture that can be used interactively via a comprehensive GUI interface, or passively via external interfaces that execute batch processes. This paper describes the Copernicus software architecture together with the challenges associated with its implementation. Additionally, future development and planned new capabilities are discussed. Key words: Copernicus, Spacecraft Trajectory Optimization Software.
2012-08-05
equivalents from the B-MBP [15]. 2.4. ATR-FTIR analysis of the reactivity of individual components ATR-FTIR spectroscopy measurements were conducted...isocyanate (de- scribed in greater detail in the Supplementary Data). The analysis was completed in triplicate (n = 3) for each reaction analyzed...using MetaMorph 7.1 im- age analysis software (MDS Analytical Technologies). The mass of each slice was used to obtain the density, and the measured den
Li, Shuangjiang; Fan, Jun; Zhou, Jian; Ren, Yutao; Shen, Cheng; Che, Guowei
2016-01-01
OBJECTIVES Residual disease at the bronchial stump (RDBS) is regarded as an important factor possibly resulting in bronchopleural fistula (BPF) after lung cancer surgery, but this has not been confirmed. We conducted this meta-analysis to evaluate the effects of RDBS on BPF formation in patients undergoing lung cancer surgery. METHODS PubMed and EMBASE databases were searched for full-text articles that met our eligibility criteria. Odds ratios (ORs) with 95% confidence interval (95% CI) served as the summarized outcomes. Q-test and I2 statistic were used to evaluate the level of heterogeneity, determining the fixed-effect model or random-effect model for quantitative synthesis. Sensitivity analysis was conducted to identify the possible origins of heterogeneity. The publication bias was assessed by Begg's test. RESULTS A total of eight retrospective observational studies were included in our meta-analysis. In overall analysis, the pooled outcomes indicated that RDBS was significantly associated with BPF formation after lung cancer surgery (OR: 3.12; 95% CI: 1.72–5.64; P < 0.001). In subgroup analysis, the pooled outcomes revealed a significantly increased risk of post-pneumonectomy BPF in patients with RDBS (OR: 2.78; 95% CI: 1.06–7.28; P = 0.037). The subgroup analysis assessing the effects of RDBS on post-lobectomy BPF was given up due to the scarcity of available data. No heterogeneity was revealed within this meta-analysis. No evidence for publication bias was detected by Begg's test. CONCLUSIONS Our meta-analysis indicates that RDBS is positively associated with the increased risk of BPF in patients undergoing lung cancer surgery. The further analysis also reveals an increased risk of post-pneumonectomy BPF in patients with RDBS. More accurate and comprehensive evidence should be collected and summarized in updated meta-analyses. PMID:26614527
Guo, Hui-Wen; Yuan, Tang-Zhan; Chen, Jia-Xi; Zheng, Yang
2018-01-01
The albumin/globulin ratio (AGR) has been widely reported to be a potential predictor of prognosis in digestive system cancers (DSCs), but convincing conclusions have not been made. Therefore, herein, we performed a meta-analysis of relevant studies regarding this topic to evaluate the prognostic value of AGR in patients with DSCs. Three databases, including PubMed, EMBase, and Web of science, were searched comprehensively for eligible studies through September 8, 2017. The outcomes of interest included overall survival (OS), disease-free survival (DFS), and cancer-specific survival (CSS). In our meta-analysis, pooled analysis of 13 studies with 9269 patients showed that a low AGR was significantly correlated with poor OS (HR = 1.94; 95% CI: 1.57-2.38; P <0.001). Five studies with 6538 participants involved DFS, and our pooled analysis of these studies also demonstrated that there was a significant association of a low AGR with worse DFS (HR = 1.49; 95% CI: 1.10 to 2.00; P < 0.001). In addition, only 2 studies referred to CSS, and we also detected a significant relationship between a low AGR and worse CSS from the results of our meta-analysis. In summary, a low pretreatment AGR was related to unfavorable survival in human digestive system cancers. A low pretreatment AGR may be a useful predictive prognostic biomarker in human digestive system cancers.
Databases, Repositories, and Other Data Resources in Structural Biology.
Zheng, Heping; Porebski, Przemyslaw J; Grabowski, Marek; Cooper, David R; Minor, Wladek
2017-01-01
Structural biology, like many other areas of modern science, produces an enormous amount of primary, derived, and "meta" data with a high demand on data storage and manipulations. Primary data come from various steps of sample preparation, diffraction experiments, and functional studies. These data are not only used to obtain tangible results, like macromolecular structural models, but also to enrich and guide our analysis and interpretation of various biomedical problems. Herein we define several categories of data resources, (a) Archives, (b) Repositories, (c) Databases, and (d) Advanced Information Systems, that can accommodate primary, derived, or reference data. Data resources may be used either as web portals or internally by structural biology software. To be useful, each resource must be maintained, curated, as well as integrated with other resources. Ideally, the system of interconnected resources should evolve toward comprehensive "hubs", or Advanced Information Systems. Such systems, encompassing the PDB and UniProt, are indispensable not only for structural biology, but for many related fields of science. The categories of data resources described herein are applicable well beyond our usual scientific endeavors.
Effects of foot reflexology on fatigue, sleep and pain: a systematic review and meta-analysis.
Lee, Jeongsoon; Han, Misook; Chung, Younghae; Kim, Jinsun; Choi, Jungsook
2011-12-01
The purpose of this study was to evaluate the effectiveness of foot reflexology on fatigue, sleep and pain. A systematic review and meta-analysis were conducted. Electronic database and manual searches were conducted on all published studies reporting the effects of foot reflexology on fatigue, sleep, and pain. Forty four studies were eligible including 15 studies associated with fatigue, 18 with sleep, and 11 with pain. The effects of foot reflexology were analyzed using Comprehensive Meta-Analysis Version 2.0. The homogeneity and the fail-safe N were calculated. Moreover, a funnel plot was used to assess publication bias. The effects on fatigue, sleep, and pain were not homogeneous and ranged from 0.63 to 5.29, 0.01 to 3.22, and 0.43 to 2.67, respectively. The weighted averages for fatigue, sleep, and pain were 1.43, 1.19, and 1.35, respectively. No publication bias was detected as evaluated by fail-safe N. Foot reflexology had a larger effect on fatigue and sleep and a smaller effect on pain. This meta-analysis indicates that foot reflexology is a useful nursing intervention to relieve fatigue and to promote sleep. Further studies are needed to evaluate the effects of foot reflexology on outcome variables other than fatigue, sleep and pain.
Garlic intake lowers fasting blood glucose: meta-analysis of randomized controlled trials.
Hou, Li-qiong; Liu, Yun-hui; Zhang, Yi-yi
2015-01-01
Garlic is a common spicy flavouring agent also used for certain therapeutic purposes. Garlic's effects on blood glucose have been the subject of many clinical and animal studies, however, studies reporting hypoglycemic effects of garlic in humans are conflicting. A comprehensive literature search was conducted to identify relevant trials of garlic or garlic extracts on markers of glycemic control [fasting blood glucose (FBG), postprandial glucose (PPG), glycosylated haemoglobin (HbA1c)]. A meta-analysis of the effect of garlic intake on human was done to assess garlic's effectiveness in lowering glucose levels. Two reviewers extracted data from each of the identified studies. Seven eligible randomized controlled trials with 513 subjects were identified. Pooled analyses showed that garlic intake results in a statistically significant lowering in FBG [SMD=-1.67; 95% CI (-2.80, -0.55), p=0.004]. Our pooled analyses did not include PPG control and HbA1c outcomes. Because only 1 study included in the meta-analysis reported PPG variables and only 2 studies reported HbA1c variables. In conclusion, the current meta-analysis showed that the administration of garlic resulted in a significant reduction in FBG concentrations. More trials are needed to investigate the effectiveness of garlic on HbA1c and PPG.
Care management for Type 2 diabetes in the United States: a systematic review and meta-analysis.
Egginton, Jason S; Ridgeway, Jennifer L; Shah, Nilay D; Balasubramaniam, Saranya; Emmanuel, Joann R; Prokop, Larry J; Montori, Victor M; Murad, Mohammad Hassan
2012-03-22
This systematic review and meta-analysis aims at assessing the composition and performance of care management models evaluated in the last decade and their impact on patient important outcomes. A comprehensive literature search of electronic bibliographic databases was performed to identify care management trials in type 2 diabetes. Random effects meta-analysis was used when feasible to pool outcome measures. Fifty-two studies were eligible. Most commonly reported were surrogate outcomes (such as HbA1c and LDL), followed by process measures (clinic visit or testing frequency). Less frequently reported were quality of life, patient satisfaction, self-care, and healthcare utilization. Most care management modalities were carved out from primary care. Meta-analysis demonstrated a statistically significant but trivial reduction of HbA1c (weighted difference in means -0.21%, 95% confidence interval -0.40 to -0.03, p < .03) and LDL-cholesterol (weighted difference in means -3.38 mg/dL, 95% confidence interval -6.27 to -0.49, p < .02). Most care management programs for patients with type 2 diabetes are 'carved-out', accomplish limited effects on metabolic outcomes, and have unknown effects on patient important outcomes. Comparative effectiveness research of different models of care management is needed to inform the design of medical homes for patients with chronic conditions.
The oxytocin receptor gene (OXTR) is associated with autism spectrum disorder: a meta-analysis.
LoParo, D; Waldman, I D
2015-05-01
The oxytocin receptor gene (OXTR) has been studied as a risk factor for autism spectrum disorder (ASD) owing to converging evidence from multiple levels of analysis that oxytocin (OXT) has an important role in the regulation of affiliative behavior and social bonding in both nonhuman mammals and humans. Inconsistency in the effect sizes of the OXTR variants included in association studies render it unclear whether OXTR is truly associated with ASD, and, if so, which OXTR single-nucleotide polymorphisms (SNPs) are associated. Thus, a meta-analytic review of extant studies is needed to determine whether OXTR shows association with ASD, and to elucidate which specific SNPs have a significant effect on ASD. The current meta-analysis of 16 OXTR SNPs included 3941 individuals with ASD from 11 independent samples, although analyses of each individual SNP included a subset of this total. We found significant associations between ASD and the SNPs rs7632287, rs237887, rs2268491 and rs2254298. OXTR was also significantly associated with ASD in a gene-based test. The current meta-analysis is the largest and most comprehensive investigation of the association of OXTR with ASD and the findings suggest directions for future studies of the etiology of ASD.
Subjective Socioeconomic Status and Adolescent Health: A Meta-Analysis
Quon, Elizabeth C.; McGrath, Jennifer J.
2017-01-01
Objective To comprehensively and quantitatively examine the association between subjective socioeconomic status (SES) and health outcomes during adolescence. Methods Forty-four studies met criteria for inclusion in the meta-analysis. Information on study quality, demographics, subjective SES, health outcomes, and covariates were extracted from each study. Fisher’s Z was selected as the common effect size metric across studies. Random-effect meta-analytic models were employed and fail-safe numbers were generated to address publication bias. Results Overall, subjective SES was associated with health during adolescence (Fisher’s Z = .10). The magnitude of the effect varied by type of health outcome, with larger effects observed for mental health outcomes, self-rated health, and general health symptoms; and nonsignificant effects observed for biomarkers of health and substance-use-related health behaviors. Of the measures of subjective SES employed in the reviewed studies, perception of financial constraints, was most strongly associated with adolescent health outcomes. Analysis of covariates indicated that inclusion of objective SES covariates did not affect the association between subjective SES and health. Conclusions This meta-analysis has implications for the measurement of subjective SES in adolescents, for the conceptualization of subjective and objective SES, and for the pathways between SES and health in adolescents. PMID:24245837
Zhang, Di; Chen, LingXiao; Chen, XingYu; Wang, XiaoBo; Li, YuLin; Ning, GuangZhi; Feng, ShiQing
2016-03-01
The aim of this meta-analysis was to evaluate the postdural puncture headache after spinal anesthesia with Whitacre spinal needles compared with Quincke spine needles. We searched several databases, including PubMed, Embase, ISI Web of Knowledge, and Cochrane Central Register of Controlled Trials until October 10th, 2014, for randomized controlled trials that compared spinal anesthesia with Whitacre spinal needles or Quincke spine needles for postdural puncture headache. Two reviewers independently screened the literature, assessed the risk for bias and extracted data. We used RevMan 5.3 software to perform the meta-analysis. Studies were included for the main end points if they addressed the following: frequency of postdural puncture headache, severity of postdural puncture headache as assessed by limitation of activities, and frequency of epidural blood patch. Nine randomized controlled trials were included for meta-analysis. The meta-analysis showed that spinal anesthesia with Whitacre spinal needles achieved lower incidence of postdural puncture headache(RR 0.34; 95% CI [0.22, 0.52]; P < .00001); in addition, the severity of postdural puncture headache was lower in the Whitacre spinal needle group (RR 0.32; 95% CI [0.16, 0.66]; P = .002). Furthermore, the frequency of an epidural blood patch in the Whitacre spinal needle group was lower compared with that in the Quincke spine needle group (RR 0.15; 95% CI [0.04, 0.51]; P = .002). We suggest the Whitacre spinal needles as a superior choice for spinal anesthesia compared with Quincke spine needles. © 2016 American Headache Society.
Effect of Desflurane versus Sevoflurane in Pediatric Anesthesia: A Meta-Analysis.
He, Jiaxuan; Zhang, Yong; Xue, Rongliang; Lv, Jianrui; Ding, Xiaoying; Zhang, Zhenni
2015-01-01
To compare the effect of desflurane versus sevoflurane in pediatric anesthesia by conducting meta-analysis. Studies were searched from PubMed, Medline, Springer, Elsevier Science Direct, Cochrane Library and Google Scholar up to July 2014. Weighted mean difference (WMD) or risk ratio (RR) and 95% confidence intervals (CIs) were considered as effect sizes. Heterogeneity across studies was assessed by Cochran Q test and I2 statistic. The random effects model was performed in the meta-analysis when heterogeneity was observed, or the fixed effect model was used. Review Manager 5.1 software was applied for the meta-analysis. A total of 11 studies (13 comparisons) involving 1,273 objects were included in this meta-analysis. No heterogeneity was observed between studies for any comparison but for postoperative extubation time. The results showed significant differences between desflurane and sevoflurane groups for postoperative extubation time (WMD = -3.87, 95%CI = -6.14 to -1.60, P < 0.01), eye opening time (WMD = -1.11, 95%CI = -1.49 to -0.72, P < 0.01), awakening time (WMD = -4.27, 95%CI = -5.28 to -3.26, P < 0.01) and agitation (RR = 1.44, 95%CI = 1.05 to 1.96, P = 0.02). No significant differences (P > 0.05) were detected for discharge from the recovery room, oculocardiac reflex, nausea and vomiting and severe pain. Desflurane may have less adverse effects than sevoflurane when used in pediatric anesthesia with significantly shorter postoperative extubation time, eye opening time and awakening time as well as slighter agitation.
Viswanatha, Gollapalle Lakshminarayanashastry; Shylaja, H; Moolemath, Yogananda
2017-10-01
Naringin is a bioflavonoid, very abundantly found in citrus species. In literature, naringin has been scientifically well documented for its beneficial effects in various neurological disorders. In this systematic review and meta-analysis, we have made an attempt to correlate the protective role of naringin against oxidative stress-induced neurological disorders in rodents. The systematic search was performed using electronic databases; the search was mainly focused on the role of naringin in oxidative stress-induced neuropathological conditions in rodents. While, the meta-analysis was performed on the effect of naringin on oxidative stress markers [superoxide dismutase (SOD), catalase (CAT), glutathione-S-transferase (GST), reduced glutathione (GSH), lipid peroxidation (LPO)], nitrite, mitochondrial complexes (I to IV) and enzymes (acetylcholinesterase, Na + -K + -ATPase, Ca 2+ -ATPase, and Mg 2+ -ATPase) in the rodent brain. The data was analyzed using Review Manager Software. Based on the inclusion and exclusion criteria, twenty studies were selected. The meta-analysis revealed that, naringin could significantly inhibit various physical and chemical stimuli- induced neurological perturbances in the rodent brain, mediated through oxidative stress. Further, naringin also significantly restored the levels of all the oxidative stress markers (oxidative, nitrosative, enzymes, and mitochondrial complexes) in different parts of the rodent brain. This systematic review and meta-analysis supports the available scientific evidence on the beneficial role of naringin in the management of various neurological ailments. However, further studies involving human subjects is recommended to establish the safety and therapeutic efficacy in humans. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Huang, Ruixue; Wang, Ke; Hu, Jianan
2016-08-06
It has been reported that gut probiotics play a major role in the bidirectional communication between the gut and the brain. Probiotics may be essential to people with depression, which remains a global health challenge, as depression is a metabolic brain disorder. However, the efficacy of probiotics for depression is controversial. This study aimed to systematically review the existing evidence on the effect of probiotics-based interventions on depression. Randomized, controlled trials, identified through screening multiple databases and grey literature, were included in the meta-analysis. The meta-analysis was performed using Review Manager 5.3 software using a fixed-effects model. The meta-analysis showed that probiotics significantly decreased the depression scale score (MD (depressive disorder) = -0.30, 95% CI (-0.51--0.09), p = 0.005) in the subjects. Probiotics had an effect on both the healthy population (MD = -0.25, 95% CI (-0.47--0.03), p = 0.03) and patients with major depressive disorder (MDD) (MD = -0.73, 95% CI (-1.37--0.09), p = 0.03). Probiotics had an effect on the population aged under 60 (MD = -0.43, 95% CI (-0.72--0.13), p = 0.005), while it had no effect on people aged over 65 (MD = -0.18, 95% CI (-0.47-0.11), p = 0.22). This is the first systematic review and meta-analysis with the goal of determining the effect of probiotics on depression. We found that probiotics were associated with a significant reduction in depression, underscoring the need for additional research on this potential preventive strategy for depression.
Genetic polymorphisms in the ESR1 gene and cerebral infarction risk: a meta-analysis.
Gao, Hong-Hua; Gao, Lian-Bo; Wen, Jia-Mei
2014-09-01
A number of studies have documented that estrogen receptor α (ESR1) may play an important role in the development and progression of cerebral infarction, but many existing studies have yielded inconclusive results. This meta-analysis was performed to evaluate the relationships between ESR1 genetic polymorphisms and cerebral infarction risk. The PubMed, CISCOM, CINAHL, Web of Science, Google Scholar, EBSCO, Cochrane Library, and CBM databases were searched for relevant articles published before October 1, 2013, without any language restrictions. Meta-analysis was conducted using the STATA 12.0 software. Seven case-control studies were included with a total of 1471 patients with cerebral infarction and 4688 healthy control subjects. Two common single-nucleotide polymorphisms (SNPs) in the ESR1 gene (rs2234693 T>C and rs9340799 A>G) were assessed. Our meta-analysis results revealed that ESR1 genetic polymorphisms might increase the risk of cerebral infarction. Subgroup analysis by SNP type indicated that both rs2234693 and rs9340799 polymorphisms in the ESR1 gene were strongly associated with an increased risk of cerebral infarction. Further subgroup analysis by ethnicity showed significant associations between ESR1 genetic polymorphisms and increased risk of cerebral infarction among both Asians and Caucasians. In the stratified subgroup analysis by gender, the results suggested that ESR1 genetic polymorphisms were associated with an increased risk of cerebral infarction in the female population. However, there were no statistically significant associations between ESR1 genetic polymorphisms and cerebral infarction risk in the male population. Meta-regression analyses also confirmed that gender might be a main source of heterogeneity. Our findings indicate that ESR1 genetic polymorphisms may contribute to the development of cerebral infarction, especially in the female population.
Meta-analysis of gene-level associations for rare variants based on single-variant statistics.
Hu, Yi-Juan; Berndt, Sonja I; Gustafsson, Stefan; Ganna, Andrea; Hirschhorn, Joel; North, Kari E; Ingelsson, Erik; Lin, Dan-Yu
2013-08-08
Meta-analysis of genome-wide association studies (GWASs) has led to the discoveries of many common variants associated with complex human diseases. There is a growing recognition that identifying "causal" rare variants also requires large-scale meta-analysis. The fact that association tests with rare variants are performed at the gene level rather than at the variant level poses unprecedented challenges in the meta-analysis. First, different studies may adopt different gene-level tests, so the results are not compatible. Second, gene-level tests require multivariate statistics (i.e., components of the test statistic and their covariance matrix), which are difficult to obtain. To overcome these challenges, we propose to perform gene-level tests for rare variants by combining the results of single-variant analysis (i.e., p values of association tests and effect estimates) from participating studies. This simple strategy is possible because of an insight that multivariate statistics can be recovered from single-variant statistics, together with the correlation matrix of the single-variant test statistics, which can be estimated from one of the participating studies or from a publicly available database. We show both theoretically and numerically that the proposed meta-analysis approach provides accurate control of the type I error and is as powerful as joint analysis of individual participant data. This approach accommodates any disease phenotype and any study design and produces all commonly used gene-level tests. An application to the GWAS summary results of the Genetic Investigation of ANthropometric Traits (GIANT) consortium reveals rare and low-frequency variants associated with human height. The relevant software is freely available. Copyright © 2013 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.
Chin, Helen B; Sipe, Theresa Ann; Elder, Randy; Mercer, Shawna L; Chattopadhyay, Sajal K; Jacob, Verughese; Wethington, Holly R; Kirby, Doug; Elliston, Donna B; Griffith, Matt; Chuke, Stella O; Briss, Susan C; Ericksen, Irene; Galbraith, Jennifer S; Herbst, Jeffrey H; Johnson, Robert L; Kraft, Joan M; Noar, Seth M; Romero, Lisa M; Santelli, John
2012-03-01
Adolescent pregnancy, HIV, and other sexually transmitted infections (STIs) are major public health problems in the U.S. Implementing group-based interventions that address the sexual behavior of adolescents may reduce the incidence of pregnancy, HIV, and other STIs in this group. Methods for conducting systematic reviews from the Guide to Community Preventive Services were used to synthesize scientific evidence on the effectiveness of two strategies for group-based behavioral interventions for adolescents: (1) comprehensive risk reduction and (2) abstinence education on preventing pregnancy, HIV, and other STIs. Effectiveness of these interventions was determined by reductions in sexual risk behaviors, pregnancy, HIV, and other STIs and increases in protective sexual behaviors. The literature search identified 6579 citations for comprehensive risk reduction and abstinence education. Of these, 66 studies of comprehensive risk reduction and 23 studies of abstinence education assessed the effects of group-based interventions that address the sexual behavior of adolescents, and were included in the respective reviews. Meta-analyses were conducted for each strategy on the seven key outcomes identified by the coordination team-current sexual activity; frequency of sexual activity; number of sex partners; frequency of unprotected sexual activity; use of protection (condoms and/or hormonal contraception); pregnancy; and STIs. The results of these meta-analyses for comprehensive risk reduction showed favorable effects for all of the outcomes reviewed. For abstinence education, the meta-analysis showed a small number of studies, with inconsistent findings across studies that varied by study design and follow-up time, leading to considerable uncertainty around effect estimates. Based on these findings, group-based comprehensive risk reduction was found to be an effective strategy to reduce adolescent pregnancy, HIV, and STIs. No conclusions could be drawn on the effectiveness of group-based abstinence education. Published by Elsevier Inc.
Oremus, Carolina; Oremus, Mark; McNeely, Heather; Losier, Bruno; Parlar, Melissa; King, Matthew; Hasey, Gary; Fervaha, Gagan; Graham, Allyson C; Gregory, Caitlin; Hanford, Lindsay; Nazarov, Anthony; Restivo, Maria; Tatham, Erica; Truong, Wanda; Hall, Geoffrey B C; Lanius, Ruth; McKinnon, Margaret
2015-03-11
Depression is the leading cause of disability worldwide, affecting approximately 350 million people. Evidence indicates that only 60-70% of persons with major depressive disorder who tolerate antidepressants respond to first-line drug treatment; the remainder become treatment resistant. Electroconvulsive therapy (ECT) is considered an effective therapy in persons with treatment-resistant depression. The use of ECT is controversial due to concerns about temporary cognitive impairment in the acute post-treatment period. We will conduct a meta-analysis to examine the effects of ECT on cognition in persons with depression. This systematic review and meta-analysis has been registered with PROSPERO (registration number: CRD42014009100). We developed our methods following the Preferred Reporting Items for Systematic Reviews and Meta-Analysis (PRISMA) statement. We are searching MEDLINE, PsychINFO, EMBASE, CINAHL and Cochrane from the date of database inception to the end of October 2014. We are also searching the reference lists of published reviews and evidence reports for additional citations. Comparative studies (randomised controlled trials, cohort and case-control) published in English will be included in the meta-analysis. Three clinical neuropsychologists will group the cognitive tests in each included article into a set of mutually exclusive cognitive subdomains. The risk of bias of randomised controlled trials will be assessed using the Jadad scale. We will supplement the Jadad scale with additional questions based on the Cochrane risk of bias tool. The risk of bias of cohort and case-control studies will be assessed using the Newcastle-Ottawa Scale. We will employ the Grading of Recommendations Assessment, Development, and Evaluation (GRADE) to assess the strength of evidence. Separate meta-analyses will be conducted for each ECT treatment modality and cognitive subdomain using Comprehensive Meta-Analysis V.2.0. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.
Shen, Yi; Zhang, Sheng; Wang, Xulin; Wang, Yuanyuan; Zhang, Jian; Qin, Gang; Li, Wenchao; Ding, Kun; Zhang, Lei; Liang, Feng
2017-10-01
Because whether hepatitis B virus infection increases the risk of type 2 diabetes mellitus has been a controversial topic, pair-wise and network meta-analyses of published literature were carried out to accurately evaluate the association between different phases of hepatitis B virus infection and the risk of type 2 diabetes mellitus. A comprehensive literature retrieval was conducted from the PubMed, Embase, Cochrane Library and Chinese Database to identify epidemiological studies on the association between hepatitis B virus infection and the risk of type 2 diabetes mellitus that were published from 1999 to 2015. A pair-wise meta-analysis of direct evidence was performed to estimate the pooled odds ratios and 95% confidence intervals. A network meta-analysis was conducted, including the construction of a network plot, inconsistency plot, predictive interval plot, comparison-adjusted funnel plot and rank diagram, to graphically link the direct and indirect comparisons between different hepatitis B virus infective phases. Eighteen publications (n=113 639) describing 32 studies were included in this meta-analysis. In the pair-wise meta-analysis, the pooled odds ratio for type 2 diabetes mellitus in chronic hepatitis B cirrhosis patients was 1.76 (95% confidence interval: 1.44-2.14) when compared with non-cirrhotic chronic hepatitis B patients. In the network meta-analysis, six comparisons of four hepatitis B virus infectious states indicated the following descending order for the risk of type 2 diabetes mellitus: hepatitis B cirrhosis patients, non-cirrhotic chronic hepatitis B patients, hepatitis B virus carriers and non-hepatitis B virus controls. This study suggests that hepatitis B virus infection is not an independent risk factor for type 2 diabetes mellitus, but the development of cirrhosis may increase the incidence of type 2 diabetes mellitus cirrhosis. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
[Meta analysis of the changes of blood coagulation in patients with active ulcerative colitis].
Zha, Ansheng; Wang, Yue; Zha, Ruiyao
2015-11-01
To evaluate the changes of blood coagulation in patients with active ulcerative colitis. We searched the PubMed, Medline, EMBASE, Web of Science, the Cochrane Library, China National Knowledge Infrastructure (CNKI), China Biology Medicine (CBM), Wanfang Database for the Chinese or English literatures published until January 2015. The data that met the inclusion criteria were screened and evaluated. After evaluation, the eligible ones were subjected to Newcastle-Ottawa Scale (NOS) and meta analysis using the Stata12.0 software. A total of 28 case-control studies were recruited for the meta analysis. The analysis results showed that the levels of platelet (PLT), fibrinogen (FIB) and D-dimer significantly increased in active ulcerative colitis group compared with normal control group. The levels of mean platelet volume (MPV) and prothrombin time (PT) significantly decreased in active ulcerative colitis group compared with normal control group. Sensitivity analysis showed that the evaluation result was stable. Egger and Begg tests suggested no evidence of substantial publication bias except for the literatures about D-dimer. Abnormal blood coagulation indexes of active ulcerative colitis patients indicate there may be high coagulation state in ulcerative colitis.
Effect of biotin on milk performance of dairy cattle: a meta-analysis.
Chen, B; Wang, C; Wang, Y M; Liu, J X
2011-07-01
A meta-analysis of the effect of biotin on production outcomes of dairy cattle was conducted following a literature review. A total of 11 studies from 9 papers, with information on the milk production and composition data from a total number of 238 cows were extracted and analyzed using meta-analysis software in Stata. Estimated size of effect of biotin was calculated for dry matter intake (DMI), milk production, and composition. Heterogeneity was not significant for all of the parameters (the highest I(2)=12%). Therefore, fixed effects models were used for analysis. With the addition of biotin to lactating dairy cattle, DMI and milk production increased by 0.87 and 1.66 kg/d. No significant effect on percentage of milk fat and milk protein was observed. Additionally, Begg's test indicated no evidence of substantial publication bias for all variables. The influence analysis shows that the removal of any study did not change the direction or significance of the point estimates. It can be concluded that the use of biotin supplements increases DMI and milk yield in lactating dairy cows. Copyright © 2011 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Khatami, Fatemeh; Larijani, Bagher; Heshmat, Ramin; Keshtkar, Abbasali; Mohammadamoli, Mahsa; Teimoori-Toolabi, Ladan; Nasiri, Shirzad; Tavangar, Seyed Mohammad
2017-01-01
Promoter methylation in a number of tumor-suppressor genes (TSGs) can play crucial roles in the development of thyroid carcinogenesis. The focus of the current meta-analysis was to determine the impact of promoter methylation of eight selected candidate TSGs on thyroid cancer and to identify the most important molecules in this carcinogenesis pathway. A comprehensive search was performed using Pub Med, Scopus, and ISI Web of Knowledge databases, and eligible studies were included. The methodological quality of the included studies was evaluated according to the Newcastle Ottawa scale table and pooled odds ratios (ORs); 95% confidence intervals (CIs) were used to estimate the strength of the associations with Stata 12.0 software. Egger's and Begg's tests were applied to detect publication bias, in addition to the "Metatrim" method. A total of 55 articles were selected, and 135 genes with altered promoter methylation were found. Finally, we included eight TSGs that were found in more than four studies (RASSF1, TSHR, PTEN, SLC5A, DAPK, P16, RARβ2, and CDH1). The order of the pooled ORs for these eight TSGs from more to less significant was CDH1 (OR = 6.73), SLC5 (OR = 6.15), RASSF1 (OR = 4.16), PTEN (OR = 3.61), DAPK (OR = 3.51), P16 (OR = 3.31), TSHR (OR = 2.93), and RARβ2 (OR = 1.50). Analyses of publication bias and sensitivity confirmed that there was very little bias. Thus, our findings showed that CDH1 and SCL5A8 genes were associated with the risk of thyroid tumor genesis.
Ouyang, Yi-An; Jiang, Yugang; Yu, Mengqiang; Zhang, Yunze; Huang, Hao
2015-01-01
To investigate both short-term and long-term therapeutic efficacy and safety of carotid artery stenting (CAS) and carotid artery endarterectomy (CEA) for elderly patients with severe and symptomatic carotid artery stenosis. PubMed, EMBASE, Cochrane Library, Clinical Trials Register Centers, and Google Scholar were comprehensively searched. After identifying relevant randomized controlled trials, methodological quality was assessed by using Cochrane tools of bias assessment. Meta-analysis was performed by RevMan software, and subgroup analyses according to different follow-up periods were also conducted. Sixteen articles of nine randomized controlled trials containing 6,984 patients were included. Compared with CEA, CAS was associated with high risks of stroke during periprocedural 30 days (risk ratio [RR]=1.47, 95% confidence interval [CI]: 1.15-1.88), 48 months (RR=1.37, 95% CI: 1.11-1.70), and >48 months (RR=1.76, 95% CI: 1.34-2.31). There was no significant difference in the aspects of death, disabling stroke, or death at any time between the groups. For other periprocedural complications, CAS decreased the risk of myocardial infarction (RR=0.44, 95% CI: 0.26-0.75), cranial nerve palsy (RR=0.09, 95% CI: 0.04-0.22) and hematoma (RR=0.31, 95% CI: 0.14-0.68) compared with CEA, while it increased the risk of bradycardia or hypotension (RR=8.45, 95% CI 2.91-24.58). Compared with CEA, CAS reduced hematoma, periprocedural myocardial infarction, and cranial nerve palsy, while it was associated with higher risks of both short-term and long-term nondisabling stroke. And they seemed to be equivalent in other outcome measures. As regards to its minimal invasion, it should be applied only in specific patients.
Azami, M; Sayehmiri, K; YektaKooshali, M H; HafeziAhmadi, M R
2016-12-01
Age increasing is caused physiological changes in the human body, such as reducing the power of the immune system. Weakened immune systems are more susceptible to bacterial infections like tuberculosis. So, this present study was performed for evaluating the prevalence of tuberculosis among Iranian elderly patients admitted to the infectious ward of a hospital. This systematic review and meta-analysis study has been done based on PRISMA guidelines. A comprehensive search was conducted in Iranian and International databases included: Magiran, Iranmedex, IranDoc, SID, Medlib, Scopus, PubMed, Science Direct, Cochrane, Web of Science, Springer, Wiley Online Library as well as the Google Scholar search engine in the period 1990-2016 by two independent researchers using the Mesh keywords. All of the reviewed studies that had inclusion criterion were been evaluated. The diagnosis of tuberculosis were considered results of physical examination, PPD (Purified Protein Derivative) test, Blood tests, Imaging tests and sputum test. The data were analyzed by using random effects model with the software Stata-Ver.11.1. Five studies with a total number of 2,956 elderly patients were included. The prevalence of tuberculosis among Iranian elderly patients admitted to the infectious ward of the hospital was estimated to be 15% (95%CI: 1-30). The relationship between prevalence of tuberculosis with a year of study was not statistically significant (P=0.371). This will be the first systematic review of tuberculosis prevalence among elderly patients admitted to the infectious ward in Iran. This study showed a high prevalence of Tuberculosis and it is recommended considering tuberculosis as a differential diagnosis in elderly patients with infectious symptoms. Copyright © 2016.
Wang, Li; Li, Wen; Xu, Rui; Long, Lihui
2016-04-01
To evaluate the anesthesia effect of etomidate and propofol on painless abortion surgery. After screening the Cochrane Library, Pubmed, China National Knowledge Infrastructure (CNKI), WANFANG, VIP database, the literatures regarding the anesthesia effect of etomidate and propofol on painless abortion surgery were collected from 1995 to 2014. The randomized controlled trials (RCTs) were selected, the quality evaluation was performed and the data was analyzed by using RevMan5.3 software. A total of 1 130 patients were included in 9 RCTs. The results of Meta analysis were as follows: the anesthesia induction time in the etomidate group was less than that in propofol group (MD=-0.14, 95% CI -0.24 to -0.04, P=0.004); there were more adverse reactions, such as myoclonus, nausea and vomiting, in the etomidate group compared with the propofol group (P<0.001); the incidence of pain in the etomidate group was less than that in the propofol group (P<0.001); there was no significant difference in the incidence of respiratory depression between the 2 groups (P>0.05); the surgery time, analgesia and duration from withdrawal to the wake-up was not significantly different between the 2 groups (P>0.05). Etomidate had a shorter anesthesia induction time than propofol in the painless abortion surgery. The incidence of reverse reactions such as myoclonus, nausea and vomiting, was more common in application of etomidate, whereas the incidence of injection pain was more common in the use of propofol group. There was no significant difference in respiratory depression between the 2 drugs. The comprehensive efficacy of propofol is better than etomidate.
Li, Jing-Yang; Chen, Shang-Qin; Yan, Yan-Yan; Hu, Ying-Ying; Wei, Jia; Wu, Qiu-Ping; Lin, Zhen-Lang; Lin, Jing
2018-06-01
The purpose of this study was to analyze the distribution and antimicrobial resistance of common bacterial pathogens causing neonatal septicemia based on a systematic review of published studies in China. Articles on neonatal sepsis published in the Chinese literature from 2009 to 2014 were identified according to the inclusion and exclusion criteria. Data were extracted and analyzed using Comprehensive Meta-Analysis software. A total of 71 studies were included, in which a total of 8080 bacterial species were isolated from culture-positive blood samples. The pooled distribution rates of common bacterial pathogens were as follows: Staphylococcus 67.1% (95% confidence interval (CI) 63.3-70.6%), Enterococcus 4.1% (95% CI 3.5-4.8%), Streptococcus 2.3% (95% CI 1.6-3.2%), Escherichia coli 7.4% (95% CI 6.4-8.7%), Klebsiella 6.5% (95% CI 5.2-8.2%), Enterobacterium 2.3% (95% CI 1.9-2.8%), Acinetobacter 1.6% (95% CI 1.3-2.0%), Pseudomonas 1.7% (95% CI 1.3-2.2%). Among the Staphylococcus aureus strains isolated, more than 60% were methicillin-resistant (MRSA). In addition, over 50% of the Gram-negative isolates, including Escherichia and Klebsiella, were resistant to the commonly used third-generation cephalosporins. Most of the Gram-positive and Gram-negative bacteria isolated were sensitive to aminoglycosides, especially amikacin. It is concluded that Staphylococcus, especially coagulase-negative Staphylococcus, continues to be the principal organism responsible for neonatal septicemia in China; Enterobacteriaceae are common among the Gram-negative isolates. Significant numbers of MRSA and multidrug-resistant Gram-negative bacteria are being isolated as pathogens responsible for neonatal septicemia in China. Copyright © 2018 The Author(s). Published by Elsevier Ltd.. All rights reserved.
Byrska-Bishop, Marta; Wallace, John; Frase, Alexander T; Ritchie, Marylyn D
2018-01-01
Abstract Motivation BioBin is an automated bioinformatics tool for the multi-level biological binning of sequence variants. Herein, we present a significant update to BioBin which expands the software to facilitate a comprehensive rare variant analysis and incorporates novel features and analysis enhancements. Results In BioBin 2.3, we extend our software tool by implementing statistical association testing, updating the binning algorithm, as well as incorporating novel analysis features providing for a robust, highly customizable, and unified rare variant analysis tool. Availability and implementation The BioBin software package is open source and freely available to users at http://www.ritchielab.com/software/biobin-download Contact mdritchie@geisinger.edu Supplementary information Supplementary data are available at Bioinformatics online. PMID:28968757
Uddin, Jamal; Zwisler, Ann-Dorthe; Lewinter, Christian; Moniruzzaman, Mohammad; Lund, Ken; Tang, Lars H; Taylor, Rod S
2016-05-01
The aim of this study was to undertake a comprehensive assessment of the patient, intervention and trial-level factors that may predict exercise capacity following exercise-based rehabilitation in patients with coronary heart disease and heart failure. Meta-analysis and meta-regression analysis. Randomized controlled trials of exercise-based rehabilitation were identified from three published systematic reviews. Exercise capacity was pooled across trials using random effects meta-analysis, and meta-regression used to examine the association between exercise capacity and a range of patient (e.g. age), intervention (e.g. exercise frequency) and trial (e.g. risk of bias) factors. 55 trials (61 exercise-control comparisons, 7553 patients) were included. Following exercise-based rehabilitation compared to control, overall exercise capacity was on average 0.95 (95% CI: 0.76-1.41) standard deviation units higher, and in trials reporting maximum oxygen uptake (VO2max) was 3.3 ml/kg.min(-1) (95% CI: 2.6-4.0) higher. There was evidence of a high level of statistical heterogeneity across trials (I(2) statistic > 50%). In multivariable meta-regression analysis, only exercise intervention intensity was found to be significantly associated with VO2max (P = 0.04); those trials with the highest average exercise intensity had the largest mean post-rehabilitation VO2max compared to control. We found considerable heterogeneity across randomized controlled trials in the magnitude of improvement in exercise capacity following exercise-based rehabilitation compared to control among patients with coronary heart disease or heart failure. Whilst higher exercise intensities were associated with a greater level of post-rehabilitation exercise capacity, there was no strong evidence to support other intervention, patient or trial factors to be predictive. © The European Society of Cardiology 2015.
Dynamic visualization techniques for high consequence software
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pollock, G.M.
1998-02-01
This report documents a prototype tool developed to investigate the use of visualization and virtual reality technologies for improving software surety confidence. The tool is utilized within the execution phase of the software life cycle. It provides a capability to monitor an executing program against prespecified requirements constraints provided in a program written in the requirements specification language SAGE. The resulting Software Attribute Visual Analysis Tool (SAVAnT) also provides a technique to assess the completeness of a software specification. The prototype tool is described along with the requirements constraint language after a brief literature review is presented. Examples of howmore » the tool can be used are also presented. In conclusion, the most significant advantage of this tool is to provide a first step in evaluating specification completeness, and to provide a more productive method for program comprehension and debugging. The expected payoff is increased software surety confidence, increased program comprehension, and reduced development and debugging time.« less
ERIC Educational Resources Information Center
Suggate, Sebastian P.
2016-01-01
Much is known about short-term--but very little about the long-term--effects of reading interventions. To rectify this, a detailed analysis of follow-up effects as a function of intervention, sample, and methodological variables was conducted. A total of 71 intervention-control groups were selected (N = 8,161 at posttest) from studies reporting…
The Need for Anticoagulation Following Inferior Vena Cava Filter Placement: Systematic Review
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ray, Charles E.; Prochazka, Allan
Purpose. To perform a systemic review to determine the effect of anticoagulation on the rates of venous thromboembolism (pulmonary embolus, deep venous thrombosis, inferior vena cava (IVC) filter thrombosis) following placement of an IVC filter. Methods. A comprehensive computerized literature search was performed to identify relevant articles. Data were abstracted by two reviewers. Studies were included if it could be determined whether or not subjects received anticoagulation following filter placement, and if follow-up data were presented. A meta-analysis of patients from all included studies was performed. A total of 14 articles were included in the final analysis, but the datamore » from only nine articles could be used in the meta-analysis; five studies were excluded because they did not present raw data which could be analyzed in the meta-analysis. A total of 1,369 subjects were included in the final meta-analysis. Results. The summary odds ratio for the effect of anticoagulation on venous thromboembolism rates following filter deployment was 0.639 (95% CI 0.351 to 1.159, p = 0.141). There was significant heterogeneity in the results from different studies [Q statistic of 15.95 (p = 0.043)]. Following the meta-analysis, there was a trend toward decreased venous thromboembolism rates in patients with post-filter anticoagulation (12.3% vs. 15.8%), but the result failed to reach statistical significance. Conclusion. Inferior vena cava filters can be placed in patients who cannot receive concomitant anticoagulation without placing them at significantly higher risk of development of venous thromboembolism.« less
Night shift work and breast cancer risk: what do the meta-analyses tell us?
Pahwa, Manisha; Labrèche, France; Demers, Paul A
2018-05-22
Objectives This paper aims to compare results, assess the quality, and discuss the implications of recently published meta-analyses of night shift work and breast cancer risk. Methods A comprehensive search was conducted for meta-analyses published from 2007-2017 that included at least one pooled effect size (ES) for breast cancer associated with any night shift work exposure metric and were accompanied by a systematic literature review. Pooled ES from each meta-analysis were ascertained with a focus on ever/never exposure associations. Assessments of heterogeneity and publication bias were also extracted. The AMSTAR 2 checklist was used to evaluate quality. Results Seven meta-analyses, published from 2013-2016, collectively included 30 cohort and case-control studies spanning 1996-2016. Five meta-analyses reported pooled ES for ever/never night shift work exposure; these ranged from 0.99 [95% confidence interval (CI) 0.95-1.03, N=10 cohort studies) to 1.40 (95% CI 1.13-1.73, N=9 high quality studies). Estimates for duration, frequency, and cumulative night shift work exposure were scant and mostly not statistically significant. Meta-analyses of cohort, Asian, and more fully-adjusted studies generally resulted in lower pooled ES than case-control, European, American, or minimally-adjusted studies. Most reported statistically significant between-study heterogeneity. Publication bias was not evident in any of the meta-analyses. Only one meta-analysis was strong in critical quality domains. Conclusions Fairly consistent elevated pooled ES were found for ever/never night shift work and breast cancer risk, but results for other shift work exposure metrics were inconclusive. Future evaluations of shift work should incorporate high quality meta-analyses that better appraise individual study quality.
Manyevitch, Roni; Protas, Matthew; Scarpiello, Sean; Deliso, Marisa; Bass, Brittany; Nanajian, Anthony; Chang, Matthew; Thompson, Stefani M.; Khoury, Neil; Gonnella, Rachel; Trotz, Margit; Moore, D. Blaine; Harms, Emily; Perry, George; Clunes, Lucy; Ortiz, Angélica; Friedrich, Jan O.; Murray, Ian V.J.
2018-01-01
Background: Alzheimer’s disease (AD) is currently incurable and a majority of investigational drugs have failed clinical trials. One explanation for this failure may be the invalidity of hypotheses focus-ing on amyloid to explain AD pathogenesis. Recently, hypotheses which are centered on synaptic and met-abolic dysfunction are increasingly implicated in AD. Objective: Evaluate AD hypotheses by comparing neurotransmitter and metabolite marker concentrations in normal versus AD CSF. Methods: Meta-analysis allows for statistical comparison of pooled, existing cerebrospinal fluid (CSF) marker data extracted from multiple publications, to obtain a more reliable estimate of concentrations. This method also provides a unique opportunity to rapidly validate AD hypotheses using the resulting CSF con-centration data. Hubmed, Pubmed and Google Scholar were comprehensively searched for published Eng-lish articles, without date restrictions, for the keywords “AD”, “CSF”, and “human” plus markers selected for synaptic and metabolic pathways. Synaptic markers were acetylcholine, gamma-aminobutyric acid (GABA), glutamine, and glycine. Metabolic markers were glutathione, glucose, lactate, pyruvate, and 8 other amino acids. Only studies that measured markers in AD and controls (Ctl), provided means, standard er-rors/deviation, and subject numbers were included. Data were extracted by six authors and reviewed by two others for accuracy. Data were pooled using ratio of means (RoM of AD/Ctl) and random effects meta-analysis using Cochrane Collaboration’s Review Manager software. Results: Of the 435 identified publications, after exclusion and removal of duplicates, 35 articles were in-cluded comprising a total of 605 AD patients and 585 controls. The following markers of synaptic and met-abolic pathways were significantly changed in AD/controls: acetylcholine (RoM 0.36, 95% CI 0.24-0.53, p<0.00001), GABA (0.74, 0.58-0.94, p<0.01), pyruvate (0.48, 0.24-0.94, p=0.03), glutathione (1.11, 1.01-1.21, p=0.03), alanine (1.10, 0.98-1.23, p=0.09), and lower levels of significance for lactate (1.2, 1.00-1.47, p=0.05). Of note, CSF glucose and glutamate levels in AD were not significantly different than that of the controls. Conclusion: This study provides proof of concept for the use of meta-analysis validation of AD hypothe-ses, specifically via robust evidence for the cholinergic hypothesis of AD. Our data disagree with the other synaptic hypotheses of glutamate excitotoxicity and GABAergic resistance to neurodegeneration, given ob-served unchanged glutamate levels and decreased GABA levels. With regards to metabolic hypotheses, the data supported upregulation of anaerobic glycolysis, pentose phosphate pathway (glutathione), and anaple-rosis of the tricarboxylic acid cycle using glutamate. Future applications of meta-analysis indicate the pos-sibility of further in silico evaluation and generation of novel hypotheses in the AD field. PMID:28933272
Manyevitch, Roni; Protas, Matthew; Scarpiello, Sean; Deliso, Marisa; Bass, Brittany; Nanajian, Anthony; Chang, Matthew; Thompson, Stefani M; Khoury, Neil; Gonnella, Rachel; Trotz, Margit; Moore, D Blaine; Harms, Emily; Perry, George; Clunes, Lucy; Ortiz, Angelica; Friedrich, Jan O; Murray, Ian V J
2018-01-01
Alzheimer's disease (AD) is currently incurable and a majority of investigational drugs have failed clinical trials. One explanation for this failure may be the invalidity of hypotheses focusing on amyloid to explain AD pathogenesis. Recently, hypotheses which are centered on synaptic and metabolic dysfunction are increasingly implicated in AD. Evaluate AD hypotheses by comparing neurotransmitter and metabolite marker concentrations in normal versus AD CSF. Meta-analysis allows for statistical comparison of pooled, existing cerebrospinal fluid (CSF) marker data extracted from multiple publications, to obtain a more reliable estimate of concentrations. This method also provides a unique opportunity to rapidly validate AD hypotheses using the resulting CSF concentration data. Hubmed, Pubmed and Google Scholar were comprehensively searched for published English articles, without date restrictions, for the keywords "AD", "CSF", and "human" plus markers selected for synaptic and metabolic pathways. Synaptic markers were acetylcholine, gamma-aminobutyric acid (GABA), glutamine, and glycine. Metabolic markers were glutathione, glucose, lactate, pyruvate, and 8 other amino acids. Only studies that measured markers in AD and controls (Ctl), provided means, standard errors/deviation, and subject numbers were included. Data were extracted by six authors and reviewed by two others for accuracy. Data were pooled using ratio of means (RoM of AD/Ctl) and random effects meta-analysis using Cochrane Collaboration's Review Manager software. Of the 435 identified publications, after exclusion and removal of duplicates, 35 articles were included comprising a total of 605 AD patients and 585 controls. The following markers of synaptic and metabolic pathways were significantly changed in AD/controls: acetylcholine (RoM 0.36, 95% CI 0.24-0.53, p<0.00001), GABA (0.74, 0.58-0.94, p<0.01), pyruvate (0.48, 0.24-0.94, p=0.03), glutathione (1.11, 1.01- 1.21, p=0.03), alanine (1.10, 0.98-1.23, p=0.09), and lower levels of significance for lactate (1.2, 1.00-1.47, p=0.05). Of note, CSF glucose and glutamate levels in AD were not significantly different than that of the controls. This study provides proof of concept for the use of meta-analysis validation of AD hypotheses, specifically via robust evidence for the cholinergic hypothesis of AD. Our data disagree with the other synaptic hypotheses of glutamate excitotoxicity and GABAergic resistance to neurodegeneration, given observed unchanged glutamate levels and decreased GABA levels. With regards to metabolic hypotheses, the data supported upregulation of anaerobic glycolysis, pentose phosphate pathway (glutathione), and anaplerosis of the tricarboxylic acid cycle using glutamate. Future applications of meta-analysis indicate the possibility of further in silico evaluation and generation of novel hypotheses in the AD field. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
2012-10-01
ASIC3, TGAGAGCCACCAGCTTACCT/ACATGTCCTCAAGGGAGTGG (30 cycles); mouse TRPV1 , GTGACCCTCTTGGTGGAGAA/ CTTCAGTGTGGGGTGGAGTT (30 cycles), mouse GAPDH...densitometry assisted by the image analysis software MetaMorph Image ( xx). Sizes are as follows: ASIC1a 506bp, ASCI1b 563bp, ASCI3 245pb, TRPV1
Jiménez-Jiménez, Félix Javier; Alonso-Navarro, Hortensia; García-Martín, Elena; Agúndez, José A.G.
2016-01-01
Abstract Background/aims: Several neuropathological, biochemical, and pharmacological data suggested a possible role of histamine in the etiopathogenesis of Parkinson disease (PD). The single nucleotide polymorphism (SNP) rs11558538 in the histamine N-methyltransferase (HNMT) gene has been associated with the risk of developing PD by several studies but not by some others. We carried out a systematic review that included all the studies published on PD risk related to the rs11558538 SNP, and we conducted a meta-analysis following Preferred Reporting Items for Systematic Reviews and Meta-Analyses guidelines. Methods: We used several databases to perform the systematic review, the software Meta-DiSc 1.1.1 to perform the meta-analysis of the eligible studies, and the Q-statistic to test heterogeneity between studies. Results: The meta-analysis included 4 eligible case–control association studies for the HNMT rs11558538 SNP and the risk for PD (2108 patients, 2158 controls). The frequency of the minor allele positivity showed a statistically significant association with a decreased risk for PD, both in the total series and in Caucasians. Although homozygosity for the minor allele did not reach statistical significance, the test for trend indicates the occurrence of a gene–dose effect. Global diagnostic odds ratios (95% confidence intervals) for rs11558538T were 0.61 (0.46–0.81) for the total group, and 0.63 (0.45–0.88) for Caucasian patients. Conclusion: The present meta-analysis confirms published evidence suggesting that the HNMT rs11558538 minor allele is related to a reduced risk of developing PD. PMID:27399132