Transfer molding of PMR-15 polyimide resin

NASA Technical Reports Server (NTRS)

Reardon, J. P.; Moyer, D. W.; Nowak, B. E.

1985-01-01

Transfer molding is an economically viable method of producing small shapes of PMR-15 polyimide. It is shown that with regard to flexural, compressive, and tribological properties transfer-molded PMR-15 polyimide is essentially equivalent to PMR-15 polyimide produced by the more common method of compression molding. Minor variations in anisotropy are predictable effects of molding design and secondary finishing operations.

Deformable silicone grating fabricated with a photo-imprinted polymer mold

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yamada, Itsunari, E-mail: yamada.i@e.usp.ac.jp; Nishii, Junji; Saito, Mitsunori

A tunable transmission grating was fabricated by molding a silicone elastomer (polydimethylsiloxane). Its optical characteristics were then evaluated during compression. For fabrication, a glass plate with a photoimprinted polymer grating film was used as a mold. Both the grating period and diffraction transmittance of the molded elastomer were functions of the compressive stress. The grating period changed from 3.02 to 2.86 μm during compressing the elastomer in the direction perpendicular to the grooves.

Testing of molded high temperature plastic actuator road seals for use in advanced aircraft hydraulic systems

NASA Technical Reports Server (NTRS)

Waterman, A. W.; Huxford, R. L.; Nelson, W. G.

1976-01-01

Molded high temperature plastic first and second stage rod seal elements were evaluated in seal assemblies to determine performance characteristics. These characteristics were compared with the performance of machined seal elements. The 6.35 cm second stage Chevron seal assembly was tested using molded Chevrons fabricated from five molding materials. Impulse screening tests conducted over a range of 311 K to 478 K revealed thermal setting deficiencies in the aromatic polyimide molding materials. Seal elements fabricated from aromatic copolyester materials structurally failed during impulse cycle calibration. Endurance testing of 3.85 million cycles at 450 K using MIL-H-83283 fluid showed poorer seal performance with the unfilled aromatic polyimide material than had been attained with seals machined from Vespel SP-21 material. The 6.35 cm first stage step-cut compression loaded seal ring fabricated from copolyester injection molding material failed structurally during impulse cycle calibration. Molding of complex shape rod seals was shown to be a potentially controllable technique, but additional molding material property testing is recommended.

Low Cost Manufacturing Approach of High Temperature PMC Components

NASA Technical Reports Server (NTRS)

Kannmacher, Kevin

1997-01-01

The overall objective is to develop a satisfactory sheet molding compound (SMC) of a high temperature polyimide, such as PMR-11-50, VCAP-75, or NB2-76, and to develop compression molding processing parameters for a random, chopped fiber, high temperature, sheet molding compound that will be more affordable than the traditional hand lay-up fabrication methods. Compression molding will reduce manufacturing costs of composites by: (1) minimizing the conventional machining required after fabrication due to the use of full 360 deg matched tooling, (2) reducing fabrication time by minimizing the intensive hand lay-up operations associated with individual ply fabrication techniques, such as ply orientation and ply count and (3) possibly reducing component mold time by advanced B-staging prior to molding. This program is an integral part of Allison's T406/AE engine family's growth plan, which will utilize technologies developed under NASA's Sub-sonic Transport (AST) programs, UHPTET initiatives, and internally through Allison's IR&D projects. Allison is aggressively pursuing this next generation of engines, with both commercial and military applications, by reducing the overall weight of the engine through the incorporation of advanced, lightweight, high temperature materials, such as polymer matrix composites. This infusion of new materials into the engine is also a major factor in reducing engine cost because it permits the use of physically smaller structural components to achieve the same thrust levels as the generation that it replaced. A lighter, more efficient propulsion system translates to a substantial cost and weight savings to an airframe's structure.

Compression molded energy storage flywheels

NASA Astrophysics Data System (ADS)

Burdick, P. A.

Materials choices, manufacturing processes, and benefits of flywheels as an effective energy storage device are discussed. Tests at the LL Laboratories have indicated that compressing molding of plies of structural sheet molding compound (SMC) filled with randomly oriented fibers produces a laminated disk with transversely isotropic properties. Good performance has been realized with a carbon/epoxy system, which displays satisfactory stiffness and strength in flywheel applications. A core profile has been selected, consisting of a uniform 1 in cross sectional thickness and a 21 in diam. Test configurations using three different resin paste formulations were compared after being mounted elastomerically on aluminum hubs. Further development was found necessary on accurate balancing and hub bonding. It was concluded that the SMC flywheels display the low-cost, sufficient energy densities, suitable dynamic stability characteristics, and acceptably benign failure modes for automotive applications.

Micro-optical fabrication by ultraprecision diamond machining and precision molding

NASA Astrophysics Data System (ADS)

Li, Hui; Li, Likai; Naples, Neil J.; Roblee, Jeffrey W.; Yi, Allen Y.

2017-06-01

Ultraprecision diamond machining and high volume molding for affordable high precision high performance optical elements are becoming a viable process in optical industry for low cost high quality microoptical component manufacturing. In this process, first high precision microoptical molds are fabricated using ultraprecision single point diamond machining followed by high volume production methods such as compression or injection molding. In the last two decades, there have been steady improvements in ultraprecision machine design and performance, particularly with the introduction of both slow tool and fast tool servo. Today optical molds, including freeform surfaces and microlens arrays, are routinely diamond machined to final finish without post machining polishing. For consumers, compression molding or injection molding provide efficient and high quality optics at extremely low cost. In this paper, first ultraprecision machine design and machining processes such as slow tool and fast too servo are described then both compression molding and injection molding of polymer optics are discussed. To implement precision optical manufacturing by molding, numerical modeling can be included in the future as a critical part of the manufacturing process to ensure high product quality.

Method for Selective Cleaning of Mold Release from Composite Honeycomb Surfaces

NASA Technical Reports Server (NTRS)

Pugel, Diane

2011-01-01

Honeycomb structures are commonly employed as load- and force-bearing structures as they are structurally strong and lightweight. Manufacturing processes for heat-molded composite honeycomb structures commence with the placement of pre-impregnated composite layups over metal mandrels. To prevent permanent bonding between the composite layup and the metal mandrels, an agent, known as a mold release agent, is used. Mold release agents allow the molded composite material to be removed from mandrels after a heat-forming process. Without a specific removal process, mold release agents may continue to adhere to the surface of the composite material, thereby affecting the bonding of other materials that may come into contact with the composite surface in later stages of processing A constituent common to commercially available household cleaning agents is employed for the removal of mold release agents common to the manufacturing of heat-formed composite materials. The reliability of the solvent has been proven by the longevity and reliability of commercial household cleaners. At the time of this reporting, no one has attempted using constituent for this purpose. The material to be cleaned is immersed in the solution, vertically removed so that the solution is allowed to drain along cell walls and into a solvent bath, and then placed on a compressed airflow table for drying.

Staged mold for encapsulating hazardous wastes

DOEpatents

Unger, Samuel L.; Telles, Rodney W.; Lubowitz, Hyman R.

1990-01-01

A staged mold for stabilizing hazardous wastes for final disposal by molding an agglomerate of the hazardous wastes and encapsulating the agglomerate. Three stages are employed in the process. In the first stage, a first mold body is positioned on a first mold base, a mixture of the hazardous wastes and a thermosetting plastic is loaded into the mold, the mixture is mechanically compressed, heat is applied to cure the mixture to form a rigid agglomerate, and the first mold body is removed leaving the agglomerate sitting on the first mold base. In the second stage, a clamshell second mold body is positioned around the agglomerate and the first mold base, a powdered thermoplastic resin is poured on top of the agglomerate and in the gap between the sides of the agglomerate and the second mold body, the thermoplastic is compressed, heat is applied to melt the thermoplastic, and the plastic is cooled jacketing the agglomerate on the top and sides. In the third stage, the mold with the jacketed agglomerate is inverted, the first mold base is removed exposing the former bottom of the agglomerate, powdered thermoplastic is poured over the former bottom, the first mold base is replaced to compress the thermoplastic, heat is applied to melt the new thermoplastic and the top part of the jacket on the sides, the plastic is cooled jacketing the bottom and fusing with the jacketing on the sides to complete the seamless encapsulation of the agglomerate.

Staged mold for encapsulating hazardous wastes

DOEpatents

Unger, Samuel L.; Telles, Rodney W.; Lubowitz, Hyman R.

1988-01-01

A staged mold for stabilizing hazardous wastes for final disposal by molding an agglomerate of the hazardous wastes and encapsulating the agglomerate. Three stages are employed in the process. In the first stage, a first mold body is positioned on a first mold base, a mixture of the hazardous wastes and a thermosetting plastic is loaded into the mold, the mixture is mechanically compressed, heat is applied to cure the mixture to form a rigid agglomerate, and the first mold body is removed leaving the agglomerate sitting on the first mold base. In the second stage, a clamshell second mold body is positioned around the agglomerate and the first mold base, a powdered thermoplastic resin is poured on top of the agglomerate and in the gap between the sides of the agglomerate and the second mold body, the thermoplastic is compressed, heat is applied to melt the thermoplastic, and the plastic is cooled jacketing the agglomerate on the top and sides. In the third stage, the mold with the jacketed agglomerate is inverted, the first mold base is removed exposing the former bottom of the agglomerate, powdered thermoplastic is poured over the former bottom, the first mold base is replaced to compress the thermoplastic, heat is applied to melt the new thermoplastic and the top part of the jacket on the sides, the plastic is cooled jacketing the bottom and fusing with the jacketing on the sides to complete the seamless encapsulation of the agglomerate.

Method for encapsulating hazardous wastes using a staged mold

DOEpatents

Unger, Samuel L.; Telles, Rodney W.; Lubowitz, Hyman R.

1989-01-01

A staged mold and method for stabilizing hazardous wastes for final disposal by molding an agglomerate of the hazardous wastes and encapsulating the agglomerate. Three stages are employed in the process. In the first stage, a first mold body is positioned on a first mold base, a mixture of the hazardous wastes and a thermosetting plastic is loaded into the mold, the mixture is mechanically compressed, heat is applied to cure the mixture to form a rigid agglomerate, and the first mold body is removed leaving the agglomerate sitting on the first mold base. In the second stage, a clamshell second mold body is positioned around the agglomerate and the first mold base, a powdered thermoplastic resin is poured on top of the agglomerate and in the gap between the sides of the agglomerate and the second mold body, the thermoplastic is compressed, heat is applied to melt the thermoplastic, and the plastic is cooled jacketing the agglomerate on the top and sides. In the third stage, the mold with the jacketed agglomerate is inverted, the first mold base is removed exposing the former bottom of the agglomerate, powdered thermoplastic is poured over the former bottom, the first mold base is replaced to compress the thermoplastic, heat is applied to melt the new thermoplastic and the top part of the jacket on the sides, the plastic is cooled jacketing the bottom and fusing with the jacketing on the sides to complete the seamless encapsulation of the agglomerate.

Modes of fossil preservation

USGS Publications Warehouse

Schopf, J.M.

1975-01-01

The processes of geologic preservation are important for understanding the organisms represented by fossils. Some fossil differences are due to basic differences in organization of animals and plants, but the interpretation of fossils has also tended to be influenced by modes of preservation. Four modes of preservation generally can be distinguished: (1) Cellular permineralization ("petrifaction") preserves anatomical detail, and, occasionally, even cytologic structures. (2) Coalified compression, best illustrated by structures from coal but characteristic of many plant fossils in shale, preserves anatomical details in distorted form and produces surface replicas (impressions) on enclosing matrix. (3) Authigenic preservation replicates surface form or outline (molds and casts) prior to distortion by compression and, depending on cementation and timing, may intergrade with fossils that have been subject to compression. (4) Duripartic (hard part) preservation is characteristic of fossil skeletal remains, predominantly animal. Molds, pseudomorphs, or casts may form as bulk replacements following dissolution of the original fossil material, usually by leaching. Classification of the kinds of preservation in fossils will aid in identifying the processes responsible for modifying the fossil remains of both animals and plants. ?? 1975.

Study of parameters in precision optical glass molding

NASA Astrophysics Data System (ADS)

Ni, Ying; Wang, Qin-hua; Yu, Jing-chi

2010-10-01

Precision glass compression molding is an attractive approach to manufacture small precision optics in large volume over traditional manufacturing techniques because of its advantages such as lower cost, faster time to market and being environment friendly. In order to study the relationship between the surface figures of molded lenses and molding process parameters such as temperature, pressure, heating rate, cooling rate and so on, we present some glass compression molding experiments using same low Tg (transition temperature) glass material to produce two different kinds of aspheric lenses by different molding process parameters. Based on results from the experiments, we know the major factors influencing surface figure of molded lenses and the changing range of these parameters. From the knowledge we could easily catch proper molding parameters which are suitable for aspheric lenses with diameter from 10mm to 30mm.

Effect of molding conditions on fracture mechanisms and stiffness of a composite of grid structure

NASA Astrophysics Data System (ADS)

Nikolaev, V. P.; Pichugin, V. S.; Korobeinikov, A. G.

1999-01-01

Methods of determining a complex of stiffness and deformability characteristics of a composite with rhomb-type grid structure were elaborated. Rhomb-type specimens were used for testing the ribs of the structure in tension, compression, and bending and the nodal points in shear in the plane of the ribs. The effect of additional tensioning of the ribs preceding the curing of the binder was investigated (ten tensioning levels ranging from 8 to 70 N/bundle with a linear density of 390 tex were applied). In testing epoxy-carbon specimens (UKN-5000+EHD-MK) in compression and tension, the failure mode changed depending on the tensioning level, i.e., the presence or absence of delamination and the appearance of "dry" fibers were detected. Dependences of the mechanical properties on tensioning were of a markedly pronounced extreme nature. The methods elaborated allow us to investigate the effect of other molding parameters, as well as the conditions and nature of loading, on the mechanical characteristics of composites.

Direct molding of pavement tiles made of ground tire rubber

NASA Astrophysics Data System (ADS)

Quadrini, Fabrizio; Gagliardi, Donatella; Tedde, Giovanni Matteo; Santo, Loredana; Musacchi, Ettore

2016-10-01

Large rubber products can be molded by using only ground tire rubber (GTR) without any additive or binder due to a new technology called "direct molding". Rubber granules and powders from tire recycling are compression molded at elevated temperatures and pressures. The feasibility of this process was clearly shown in laboratory but the step to the industrial scale was missing. Thanks to an European Project (SMART "Sustainable Molding of Articles from Recycled Tires") this step has been made and some results are reported in this study. The press used for compression molding is described. Some tests were made to measure the energy consumption so as to evaluate costs for production in comparison with conventional technologies for GTR molding (by using binders). Results show that 1 m2 tiles can be easily molded with several thicknesses in a reasonable low time. Energy consumption is higher than conventional technologies but it is lower than the cost for binders.

Evaluation of Three Different Processing Techniques in the Fabrication of Complete Dentures

PubMed Central

Chintalacheruvu, Vamsi Krishna; Balraj, Rajasekaran Uttukuli; Putchala, Lavanya Sireesha; Pachalla, Sreelekha

2017-01-01

Aims and Objectives: The objective of the present study is to compare the effectiveness of three different processing techniques and to find out the accuracy of processing techniques through number of occlusal interferences and increase in vertical dimension after denture processing. Materials and Methods: A cross-sectional study was conducted on a sample of 18 patients indicated for complete denture fabrication was selected for the study and they were divided into three subgroups. Three processing techniques, compression molding and injection molding using prepolymerized resin and unpolymerized resin, were used to fabricate dentures for each of the groups. After processing, laboratory-remounted dentures were evaluated for number of occlusal interferences in centric and eccentric relations and change in vertical dimension through vertical pin rise in articulator. Data were analyzed using statistical test ANOVA and SPSS software version 19.0 by IBM was used. Results: Data obtained from three groups were subjected to one-way ANOVA test. After ANOVA test, results with significant variations were subjected to post hoc test. Number of occlusal interferences with compression molding technique was reported to be more in both centric and eccentric positions as compared to the two injection molding techniques with statistical significance in centric, protrusive, right lateral nonworking, and left lateral working positions (P < 0.05). Mean vertical pin rise (0.52 mm) was reported to more in compression molding technique as compared to injection molding techniques, which is statistically significant (P < 0.001). Conclusions: Within the limitations of this study, injection molding techniques exhibited less processing errors as compared to compression molding technique with statistical significance. There was no statistically significant difference in processing errors reported within two injection molding systems. PMID:28713763

Evaluation of Three Different Processing Techniques in the Fabrication of Complete Dentures.

PubMed

Chintalacheruvu, Vamsi Krishna; Balraj, Rajasekaran Uttukuli; Putchala, Lavanya Sireesha; Pachalla, Sreelekha

2017-06-01

The objective of the present study is to compare the effectiveness of three different processing techniques and to find out the accuracy of processing techniques through number of occlusal interferences and increase in vertical dimension after denture processing. A cross-sectional study was conducted on a sample of 18 patients indicated for complete denture fabrication was selected for the study and they were divided into three subgroups. Three processing techniques, compression molding and injection molding using prepolymerized resin and unpolymerized resin, were used to fabricate dentures for each of the groups. After processing, laboratory-remounted dentures were evaluated for number of occlusal interferences in centric and eccentric relations and change in vertical dimension through vertical pin rise in articulator. Data were analyzed using statistical test ANOVA and SPSS software version 19.0 by IBM was used. Data obtained from three groups were subjected to one-way ANOVA test. After ANOVA test, results with significant variations were subjected to post hoc test. Number of occlusal interferences with compression molding technique was reported to be more in both centric and eccentric positions as compared to the two injection molding techniques with statistical significance in centric, protrusive, right lateral nonworking, and left lateral working positions ( P < 0.05). Mean vertical pin rise (0.52 mm) was reported to more in compression molding technique as compared to injection molding techniques, which is statistically significant ( P < 0.001). Within the limitations of this study, injection molding techniques exhibited less processing errors as compared to compression molding technique with statistical significance. There was no statistically significant difference in processing errors reported within two injection molding systems.

Correlation between some technological parameters and properties of composite material based on recycled tires and polymer binder

NASA Astrophysics Data System (ADS)

Plesuma, Renate; Malers, Laimonis

2015-04-01

The present article is dedicated to the determination of a possible connection between the composition, specific properties of the composite material and molding pressure as an important technological parameter. Apparent density, Shore C hardness, compressive modulus of elasticity and compressive stress at 10% deformation was determined for composite material samples. Definite formation conditions - varying molding pressure conditions at ambient temperature and corresponding relative air humiditywere realized. The results obtained showed a significant effect of molding pressure on the apparent density, mechanical properties of composite material as well as on the compressive stress change at a cyclic mode of loading. Some general regularities were determined - mechanical properties of the composite material, as well as values of Shore C hardness increases with an increase of molding pressure.

Investigation of compression behavior of PE/EVA foam injection molded parts

NASA Astrophysics Data System (ADS)

Spina, Roberto

2017-10-01

The main objective of the presented work is to evaluate the compression behavior of a polymeric foam blend by using a robust framework for the testing sequence of foaming injection molded parts, with the aim of establishing a standard testing cycle for the evaluation of new matrix material. The research purpose is to assess parameters influencing compression behavior and give useful suggestions for the implementation of a finite element analysis. The polymeric blend consisted of a mixture of low density polyethylenes (LDPEs), a high-density polyethylene (HDPE), an ethylene-vinyl acetate (EVA) and an azodicarbonamide (ADC). The thermal, rheological and compression properties of the blend are fully described, as well as the injection molding process for two specimen types.

Development of fire resistant, nontoxic aircraft interior materials

NASA Technical Reports Server (NTRS)

Haley, G.; Silverman, B.; Tajima, Y.

1976-01-01

All available newly developed nonmetallic polymers were examined for possible usage in developing fire resistant, nontoxic nonmetallic parts or assemblies for aircraft interiors. Specifically, feasibility for the development of clear films for new decorative laminates, compression moldings, injection molded parts, thermoformed plastic parts, and flexible foams were given primary considerations. Preliminary data on the flame resistant characteristics of the materials were obtained. Preliminary toxicity data were generated from samples of materials submitted from the contractor. Preliminary data on the physical characteristics of various thermoplastic materials to be considered for either compression molded, injection molded, or thermoformed parts were obtained.

Improved compression molding technology for continuous fiber reinforced composite laminates. Part 2: AS-4/Polyimidesulfone prepreg system

NASA Technical Reports Server (NTRS)

Baucom, Robert M.; Hou, Tan-Hung; Kidder, Paul W.; Reddy, Rakasi M.

1991-01-01

AS-4/polyimidesulfone (PISO2) composite prepreg was utilized for the improved compression molding technology investigation. This improved technique employed molding stops which advantageously facilitate the escape of volatile by-products during the B-stage curing step, and effectively minimize the neutralization of the consolidating pressure by intimate interply fiber-fiber contact within the laminate in the subsequent molding cycle. Without the modifying the resin matrix properties, composite panels with both unidirectional and angled plies with outstanding C-scans and mechanical properties were successfully molded using moderate molding conditions, i.e., 660 F and 500 psi, using this technique. The size of the panels molded were up to 6.00 x 6.00 x 0.07 in. A consolidation theory was proposed for the understanding and advancement of the processing science. Processing parameters such as vacuum, pressure cycle design, prepreg quality, etc. were explored.

Molding apparatus. [for thermosetting plastic compositions

NASA Technical Reports Server (NTRS)

Heier, W. C. (Inventor)

1974-01-01

Apparatus for compression molding of thermosetting plastics compositions including interfitting hollow male and female components is reported. The components are adapted to be compressed to form a rocket nozzle in a cavity. A thermal jacket is provided exteriorly adjacent to the female component for circulating a thermal transfer fluid to effect curing of a thermosetting plastics material being molded. Each of the male and female components is provided with suitable inlets and outlets for circulating a thermal transfer fluid.

Evaluation of Ceramic Honeycomb Core Compression Behavior at Room Temperature

NASA Technical Reports Server (NTRS)

Bird, Richard K.; Lapointe, Thomas S.

2013-01-01

Room temperature flatwise compression tests were conducted on two varieties of ceramic honeycomb core specimens that have potential for high-temperature structural applications. One set of specimens was fabricated using strips of a commercially-available thin-gage "ceramic paper" sheet molded into a hexagonal core configuration. The other set was fabricated by machining honeycomb core directly from a commercially available rigid insulation tile material. This paper summarizes the results from these tests.

Volume-change indicator for molding plastic

NASA Technical Reports Server (NTRS)

Heler, W. C.

1979-01-01

Monitor consisting of two concentric disks measures change in volume of charge during compression/displacement molding. Device enables operator to decide whether process pressure and temperature are set properly or whether sufficient material has been placed in mold.

Development of improved asbestos reinforced phenolic insulating composites (optimization of physical properties as a function of molding technique and post cure conditions)

NASA Technical Reports Server (NTRS)

Hedges, L. M. (Editor)

1973-01-01

Detailed data are presented on phenolic-glass and phenolic-asbestos compounds which compare the effect of compression molding without degas to the effects of four variations of compression molding. These variations were designed to improve elimination of entrapped volatiles and the volatile products of the condensate reaction associated with the cure of phenolic resins. The utilization of conventional methods of degas plus degas by vacuum and directional heat flow methods are involved. Detailed data are also presented on these same compounds, comparing the effect of changes in post-bake time, and post-bake temperature for the five molding techniques.

High Cost/High Risk Components to Chalcogenide Molded Lens Model: Molding Preforms and Mold Technology

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bernacki, Bruce E.

2012-10-05

This brief report contains a critique of two key components of FiveFocal's cost model for glass compression molding of chalcogenide lenses for infrared applications. Molding preforms and mold technology have the greatest influence on the ultimate cost of the product and help determine the volumes needed to select glass molding over conventional single-point diamond turning or grinding and polishing. This brief report highlights key areas of both technologies with recommendations for further study.

A novel tool to standardize rheology testing of molten polymers for pharmaceutical applications.

PubMed

Treffer, Daniel; Troiss, Alexander; Khinast, Johannes

2015-11-10

Melt rheology provides information about material properties that are of great importance for equipment design and simulations, especially for novel pharmaceutical manufacturing operations, including extrusion, injection molding or 3d printing. To that end, homogeneous samples must be prepared, most commonly via compression or injection molding, both of which require costly equipment and might not be applicable for shear- and heat-sensitive pharmaceutical materials. Our study introduces a novel vacuum compression molding (VCM) tool for simple preparation of thermoplastic specimens using standard laboratory equipment: a hot plate and a vacuum source. Sticking is eliminated by applying polytetrafluoroethylene (PTFE) coated separation foils. The evacuation of the tool leads to compression of the sample chamber, which is cost-efficient compared to conventional methods, such as compression molding or injection molding that require special equipment. In addition, this compact design reduces the preparation time and the heat load. The VCM tool was used to prepare samples for a rheological study of three pharmaceutical polymers (Soluplus(®), Eudragit(®)E, EVA Rowalit(®) 300-1/28). The prepared samples were without any air inclusions or voids, and the measurements had a high reproducibility. All relative standard deviations were below 3%. The obtained data were fitted to the Carreau-Yasuda model and time-temperature superposition was applied. Copyright © 2015 Elsevier B.V. All rights reserved.

Fabrication of metallic microstructures by micromolding nanoparticles

DOEpatents

Morales, Alfredo M.; Winter, Michael R.; Domeier, Linda A.; Allan, Shawn M.; Skala, Dawn M.

2002-01-01

A method is provided for fabricating metallic microstructures, i.e., microcomponents of micron or submicron dimensions. A molding composition is prepared containing an optional binder and nanometer size (1 to 1000 nm in diameter) metallic particles. A mold, such as a lithographically patterned mold, preferably a LIGA or a negative photoresist mold, is filled with the molding composition and compressed. The resulting microstructures are then removed from the mold and the resulting metallic microstructures so provided are then sintered.

Molding process for imidazopyrrolone polymers

NASA Technical Reports Server (NTRS)

Johnson, C. L. (Inventor)

1973-01-01

A process is described for producing shaped articles of imidazopyrrolone polymers comprising molding imidazopyrrolone polymer molding power under pressure and at a temperature greater than 475 C. Moderate pressures may be employed. Preferably, prior to molding, a preform is prepared by isostatic compression. The preform may be molded at a relatively low initial pressure and temperature; as the temperature is increased to a value greater than 475 C., the pressure is also increased.

Effect of processing method on the mechanical and thermal of Silvergrass/HDPE composites

NASA Astrophysics Data System (ADS)

Liu, Bing; Jin, Yueqiang; Wang, Shuying

2017-05-01

This paper investigates the effect of compression and injection molding methods on properties of Silvergrass-HDPE (High Density Polyethylene) composites, with respect to mechanical behaviors. Maleated polyethylene (MAPE) was added in the composite and improved the mechanical property of the composite. The research founds MAPE can improve the mechanical property because it improved the interfacial compatibility as a coupling agent. When added a content of 8% of MAPE, Silvergrass-HDPE composites made from compression molding shows a better mechanical performance in tensile strength and flexural strength than that made from injection molding, with increasing Silvergrass fiber content from 30% to 50%. However, the WPCs (wood plastics composites) made from injection molding had a lower degree of crystallinity with or without MAPE treatment.

Development of processes and techniques for molding thermally stable, fire-retardant, low-smoke-emitting polymeric materials

NASA Technical Reports Server (NTRS)

Silverman, B.

1979-01-01

All available newly developed nonmetallic thermally stable polymers were examined for the development of processes and techniques by compression molding, injection molding, or thermoforming cabin interior parts. Efforts were directed toward developing molding techniques of new polymers to economically produce usable nonmetallic molded parts. Data on the flame resistant characteristics of the materials were generated from pilot plant batches. Preliminary information on the molding characteristics of the various thermoplastic materials was obtained by producing actual parts.

Electroforming of optical tooling in high-strength Ni-Co alloy

NASA Astrophysics Data System (ADS)

Stein, Berl

2003-05-01

Plastic optics are often mass produced by injection, compression or injection-compression molding. Optical quality molds can be directly machined in appropriate materials (tool steels, electroless nickel, aluminum, etc.), but much greater cost efficiency can be achieved with electroformed modl inserts. Traditionally, electroforming of optical quality mold inserts has been carried out in nickel, a material much softer than tool steels which, when hardened to 45 - 50 HRc usually exhibit high wear resistance and long service life (hundreds of thousands of impressions per mold). Because of their low hardness (< 20 HRc), nickel molds can produce only tens of thousands of parts before they are scrapped due to wear or accidental damage. This drawback prevented their wider usage in general plastic and optical mold making. Recently, NiCoForm has developed a proprietary Ni-CO electroforming bath combining the high strength and wear resistance of the alloy with the low stress and high replication fidelity typical of pure nickel electroforming. This paper will outline the approach to electroforming of optical quality tooling in low stress, high strength Ni-Co alloy and present several examples of electroformed NiColoy mold inserts.

Effect of injection parameters on mechanical and physical properties of super ultra-thin wall propylene packaging by Taguchi method

NASA Astrophysics Data System (ADS)

Ginghtong, Thatchanok; Nakpathomkun, Natthapon; Pechyen, Chiravoot

2018-06-01

The parameters of the plastic injection molding process have been investigated for the manufacture of a 64 oz. ultra-thin polypropylene bucket. The 3 main parameters, such as injection speed, melting temperature, holding pressure, were investigated to study their effect on the physical appearance and compressive strength. The orthogonal array of Taguchi's L9 (33) was used to carry out the experimental plan. The physical properties were measured and the compressive strength was determined using linear regression analysis. The differential scanning calorimeter (DSC) was used to analyze the crystalline structure of the product. The optimization results show that the proposed approach can help engineers identify optimal process parameters and achieve competitive advantages of energy consumption and product quality. In addition, the injection molding of the product includes 24 mm of shot stroke, 1.47 mm position transfer, 268 rpm screw speed, injection speed 100 mm/s, 172 ton clamping force, 800 kgf holding pressure, 0.9 s holding time and 1.4 s cooling time, make the products in the shape and proportion of the product satisfactory. The parameters of influence are injection speed 71.07%, melting temperature 23.31% and holding pressure 5.62%, respectively. The compressive strength of the product was able to withstand a pressure of up to 839 N before the product became plastic. The low melting temperature was caused by the superior crystalline structure of the super-ultra-thin wall product which leads to a lower compressive strength.

Test and analysis results for composite transport fuselage and wing structures

NASA Technical Reports Server (NTRS)

Deaton, Jerry W.; Kullerd, Susan M.; Madan, Ram C.; Chen, Victor L.

1992-01-01

Automated tow placement (ATP) and stitching of dry textile composite preforms followed by resin transfer molding (RTM) are being studied as cost effective manufacturing processes for obtaining damage tolerant fuselage and wing structures for transport aircraft. Data are presented to assess the damage tolerance of ATP and RTM fuselage elements with stitched-on stiffeners from compression tests of impacted three J-stiffened panels and from stiffener pull-off tests. Data are also presented to assess the damage tolerance of RTM wing elements which had stitched skin and stiffeners from impacted single stiffener and three blade stiffened compression tests and stiffener pull-off tests.

Fuel cell collector plate and method of fabrication

DOEpatents

Braun, James C.; Zabriskie, Jr., John E.; Neutzler, Jay K.; Fuchs, Michel; Gustafson, Robert C.

2001-01-01

An improved molding composition is provided for compression molding or injection molding a current collector plate for a polymer electrolyte membrane fuel cell. The molding composition is comprised of a polymer resin combined with a low surface area, highly-conductive carbon and/or graphite powder filler. The low viscosity of the thermoplastic resin combined with the reduced filler particle surface area provide a moldable composition which can be fabricated into a current collector plate having improved current collecting capacity vis-a-vis comparable fluoropolymer molding compositions.

Evacuated displacement compression molding

NASA Technical Reports Server (NTRS)

Heier, W. C. (Inventor)

1973-01-01

A process for molding long, thin-wall tubular bodies from thermosetting plastic molding compounds is described. The tubular bodies produced may have body lengths several times the diameters. The application of the process for manufacturing rocket engine cases and nozzles is discussed. The advantages of the system over other methods of circular tube manufacture are analyzed.

Rational preparation of waste coal mixture for production of bricks by the method of compression molding

NASA Astrophysics Data System (ADS)

Stolboushkin, A. Yu; Ivanov, A. I.; Temlyantsev, M. V.; Fomina, O. A.

2016-10-01

Rational preparation of the mixture containing technogenic raw material - waste coal for the production of wall ceramics is developed. It was established that the technology of high-quality ceramic bricks requires: grinding of raw materials to class 0.3 + 0 mm, its aggregation in the intensive mixers into granules 1-3 mm, compression molding of adobe to plastic deformation of granules, drying and firing.

Edgewise Compression Testing of STIPS-0 (Structurally Integrated Thermal Protection System)

NASA Technical Reports Server (NTRS)

Brewer, Amy R.

2011-01-01

The Structurally Integrated Thermal Protection System (SITPS) task was initiated by the NASA Hypersonics Project under the Fundamental Aeronautics Program to develop a structural load-carrying thermal protection system for use in aerospace applications. The initial NASA concept for SITPS consists of high-temperature composite facesheets (outer and inner mold lines) with a light-weight insulated structural core. An edgewise compression test was performed on the SITPS-0 test article at room temperature using conventional instrumentation and methods in order to obtain panel-level mechanical properties and behavior of the panel. Three compression loadings (10, 20 and 37 kips) were applied to the SITPS-0 panel. The panel behavior was monitored using standard techniques and non-destructive evaluation methods such as photogrammetry and acoustic emission. The elastic modulus of the SITPS-0 panel was determined to be 1.146x106 psi with a proportional limit at 1039 psi. Barrel-shaped bending of the panel and partial delamination of the IML occurred under the final loading.

Brightness field distributions of microlens arrays using micro molding.

PubMed

Cheng, Hsin-Chung; Huang, Chiung-Fang; Lin, Yi; Shen, Yung-Kang

2010-12-20

This study describes the brightness field distributions of microlens arrays fabricated by micro injection molding (μIM) and micro injection-compression molding (μICM). The process for fabricating microlens arrays used room-temperature imprint lithography, photoresist reflow, electroforming, μIM, μICM, and optical properties measurement. Analytical results indicate that the brightness field distribution of the molded microlens arrays generated by μICM is better than those made using μIM. Our results further demonstrate that mold temperature is the most important processing parameter for brightness field distribution of molded microlens arrays made by μIM or μICM.

Development of stitching reinforcement for transport wing panels

NASA Technical Reports Server (NTRS)

Palmer, Raymond J.; Dow, Marvin B.; Smith, Donald L.

1991-01-01

The NASA Advanced Composites Technology (ACT) program has the objective of providing the technology required to obtain the full benefit of weight savings and performance improvements offered by composite primary aircraft structures. Achieving the objective is dependent upon developing composite materials and structures which are damage tolerant and economical to manufacture. Researchers are investigating stitching reinforcement combined with resin transfer molding to produce materials meeting the ACT program objective. Research is aimed at materials, processes, and structural concepts for application in both transport wings and fuselages, but the emphasis to date has been on wing panels. Empirical guidelines are being established for stitching reinforcement in structures designed for heavy loads. Results are presented from evaluation tests investigating stitching types, threads, and density (penetrations per square inch). Tension strength, compression strength, and compression after impact data are reported.

Microcellular injection molding process for producing lightweight thermoplastic polyurethane with customizable properties

NASA Astrophysics Data System (ADS)

Ellingham, Thomas; Kharbas, Hrishikesh; Manitiu, Mihai; Scholz, Guenter; Turng, Lih-Sheng

2018-03-01

A three-stage molding process involving microcellular injection molding with core retraction and an "out-of-mold" expansion was developed to manufacture thermoplastic polyurethane into lightweight foams of varying local densities, microstructures, and mechanical properties in the same microcellular injection molded part. Two stages of cavity expansion through sequential core retractions and a third expansion in a separate mold at an elevated temperature were carried out. The densities varied from 0.25 to 0.42 g/cm3 (77% to 62% weight reduction). The mechanical properties varied as well. Cyclic compressive strengths and hysteresis loss ratios, together with the microstructures, were characterized and reported.

VIEW OF INTERIOR OF SOUTHERN DUCTILE CASTING COMPANY, CENTERVILLE FOUNDRY ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

VIEW OF INTERIOR OF SOUTHERN DUCTILE CASTING COMPANY, CENTERVILLE FOUNDRY SHOWING MOLD MAKING WITH PNEWMATIC JOLT SQUEEZE COPE AND DRAG MOLDING MACHINES THAT INDIVIDUALLY MADE EITHER A COPE OR DRAG AND A SMALL WHEELED MATCHPLATE JOLT-SQUEEZE MACHINE THAT COMPRESSED AN ENTIRE MOLD AT A SINGLE TIME USING A DOUBLE-SIDED PATTERN (MATCHPLATE). ALSO SHOWN ARE RAILED PALLET CAR CONVEYORS THAT CARRIED COMPLETED MOLDS FROM MOLDING MACHINES TO POURING AREAS WHERE WORKERS USED SMALL OVERHEAD CRANE TO LIFT JACKETS AND WEIGHTS ONTO THE MOLDS TO HOLD THEM TOGETHER WHILE POURING. - Southern Ductile Casting Company, Centerville Foundry, 101 Airport Road, Centreville, Bibb County, AL

Spatially Targeted Activation of a Shape Memory, Polymer-Based, Reconfigurable Skin System

DTIC Science & Technology

2014-02-01

bone samples described in ASTM Standard D638 using a CNC router. Compression test samples were cured in an aluminum cylinder mold treated with mold...release with Teflon end plugs and cut to length with a small lathe . 2.2 Tensile/Compressive Tests Tensile tests were conducted on a MTS QTest/1L...fixture with a CNC mill and a decal applied to the front surface for tracking by the DIC system. Figure 10: Shear Test Sample with DIC Decal 10

Numerical-experimental investigation of PE/EVA foam injection molded parts

NASA Astrophysics Data System (ADS)

Spina, Roberto

The main objective of the presented work is to propose a robust framework to test foaming injection molded parts, with the aim of establishing a standard testing cycle for the evaluation of a new foam material based on numerical and experimental results. The research purpose is to assess parameters influencing several aspects, such as foam morphology and compression behavior, using useful suggestions from finite element analysis. The investigated polymeric blend consisted of a mixture of low density polyethylenes (LDPEs), a high-density polyethylene (HDPE), an ethylene-vinyl acetate (EVA) and an azodicarbonamide (ADC). The thermal, rheological and compression properties of the blend are fully described, as well as the numerical models and the parameters of the injection molding process.

Effects of number of ply, compression temperature, pressure and time on mechanical properties of prepreg kenaf-polypropilene composites

NASA Astrophysics Data System (ADS)

Tomo, H. S. S.; Ujianto, O.; Rizal, R.; Pratama, Y.

2017-07-01

Composite material thermoplastic was prepared from polypropilen granule as matrix, kenaf fiber as reinforcement and grafted polypropylene copolymer maleic anhydride as coupling agent. Composite products were produced as sandwich structures using compression molding. This research aimed to observe the influence of number of ply, temperature, pressure, and compression time using factorial design. Effects of variables on tensile and flexural strength were analyzed. Experimental results showed that tensile and flexural strength were influenced by degradation, fiber compaction, and matrix - fiber interaction mechanisms. Flexural strength was significantly affected by number of ply and its interaction to another process parameters (temperature, pressure, and compression time), but no significant effect of process parameters on tensile strength. The highest tensile strength (62.0 MPa) was produced at 3 ply, 210 °C, 50 Bar, and 3 min compression time (low, high, high, low), while the highest flexural strength (80.3 MPa) was produced at 3 ply, 190 °C, 50 Bar, and 3 min compression time (low, low, high, low).

Making Plant-Support Structures From Waste Plant Fiber

NASA Technical Reports Server (NTRS)

Morrow, Robert C.; < oscjmocl. < attjew K/; {ertzbprm. A,amda; Ej (e. Cjad); Hunt, John

2006-01-01

Environmentally benign, biodegradable structures for supporting growing plants can be made in a process based on recycling of such waste plant fiber materials as wheat straw or of such derivative materials as paper and cardboard. Examples of structures that can be made in this way include plant plugs, pots, planter-lining mats, plant fences, and root and shoot barriers. No chemical binders are used in the process. First, the plant material is chopped into smaller particles. The particles are leached with water or steam to remove material that can inhibit plant growth, yielding a fibrous slurry. If the desired structures are plugs or sheets, then the slurry is formed into the desired shapes in a pulp molding subprocess. If the desired structures are root and shoot barriers, pots, or fences, then the slurry is compression-molded to the desired shapes in a heated press. The processed materials in these structures have properties similar to those of commercial pressboard, but unlike pressboard, these materials contain no additives. These structures have been found to withstand one growth cycle, even when wet

Evacuated, displacement compression mold. [of tubular bodies from thermosetting plastics

NASA Technical Reports Server (NTRS)

Heier, W. C. (Inventor)

1974-01-01

A process of molding long thin-wall tubular bodies from thermosetting plastic molding compounds is described wherein the tubular body lengths may be several times the diameters. The process is accomplished by loading a predetermined quantity of molding compound into a female mold cavity closed at one end by a force mandrel. After closing the other end of the female mold with a balance mandrel, the loaded cavity is evacuated by applying a vacuum of from one-to-five mm pressure for a period of fifteen-to-thirty minutes. The mold temperature is raised to the minimum temperature at which the resin constituent of the compound will soften or plasticize and a pressure of 2500 psi is applied.

Processing and Properties of Vacuum Assisted Resin Transfer Molded Phenylethynyl Terminated Imide Composites

NASA Technical Reports Server (NTRS)

Cano, Roberto J.; Ghose, Sayata; Watson, Kent A.; Chunchu, Prasad B.; Jensen, Brian J.; Connell, John W.

2012-01-01

Polyimide composites are very attractive for applications that require a high strength to weight ratio and thermal stability. Recent work at NASA Langley Research Center (LaRC) has concentrated on developing new polyimide resin systems that can be processed without the use of an autoclave for advanced aerospace applications. Due to their low melt viscosities and long melt stability, certain phenylethynyl terminated imides (PETI) can be processed into composites using high temperature vacuum assisted resin transfer molding (HT-VARTM). VARTM has shown the potential to reduce the manufacturing cost of composite structures. In the current study, two PETI resins, LARC(Trademark) PETI-330 and LARC(Trademark) PETI-9, were infused into carbon fiber preforms at 260 C and cured at temperatures up to 371 C. Photomicrographs of polished cross sections were taken and void contents, determined by acid digestion, were below 4.5%. Mechanical properties including short block compression (SBC), compression after impact (CAI), and open hole compression (OHC) were determined at room temperature, 177 C, and 288 C. Both PETI-9 and PETI-330 composites demonstrated very good retention of mechanical properties at elevated temperatures. SBC and OHC properties after aging for 1000 hours at temperatures up to 288 C were also determined.

Mechanical characterization of 2D, 2D stitched, and 3D braided/RTM materials

NASA Technical Reports Server (NTRS)

Deaton, Jerry W.; Kullerd, Susan M.; Portanova, Marc A.

1993-01-01

Braided composite materials have potential for application in aircraft structures. Fuselage frames, floor beams, wing spars, and stiffeners are examples where braided composites could find application if cost effective processing and damage tolerance requirements are met. Another important consideration for braided composites relates to their mechanical properties and how they compare to the properties of composites produced by other textile composite processes being proposed for these applications. Unfortunately, mechanical property data for braided composites do not appear extensively in the literature. Data are presented in this paper on the mechanical characterization of 2D triaxial braid, 2D triaxial braid plus stitching, and 3D (through-the-thickness) braid composite materials. The braided preforms all had the same graphite tow size and the same nominal braid architectures, (+/- 30 deg/0 deg), and were resin transfer molded (RTM) using the same mold for each of two different resin systems. Static data are presented for notched and unnotched tension, notched and unnotched compression, and compression after impact strengths at room temperature. In addition, some static results, after environmental conditioning, are included. Baseline tension and compression fatigue results are also presented, but only for the 3D braided composite material with one of the resin systems.

Test and analysis results for composite transport fuselage and wing structures

NASA Technical Reports Server (NTRS)

Deaton, Jerry W.; Kullerd, Susan M.; Madan, Ram C.; Chen, Victor L.

1992-01-01

Automated tow placement (ATP) and stitching of dry textile composite preforms followed by resin transfer molding (RTM) are being investigated by researchers at NASA LaRC and Douglas Aircraft Company as cost-effective manufacturing processes for obtaining damage tolerant fuselage and wing structures for transport aircraft. The Douglas work is being performed under a NASA contract entitled 'Innovative Composites Aircraft Primary Structures (ICAPS)'. Data are presented in this paper to assess the damage tolerance of ATP and RTM fuselage elements with stitched-on stiffeners from compression tests of impacted three-J-stiffened panels and from stiffener pull-off tests. Data are also presented to assess the damage tolerance of RTM wing elements which had stitched skin and stiffeners from impacted single stiffener and three blade-stiffened compression tests and stiffener pull-off tests.

Development and Evaluation of Stitched Sandwich Panels

NASA Technical Reports Server (NTRS)

Stanley, Larry E.; Adams, Daniel O.; Reeder, James R. (Technical Monitor)

2001-01-01

This study explored the feasibility and potential benefits provided by the addition of through-the-thickness reinforcement to sandwich structures. Through-the-thickness stitching is proposed to increase the interlaminar strength and damage tolerance of composite sandwich structures. A low-cost, out-of-autoclave processing method was developed to produce composite sandwich panels with carbon fiber face sheets, a closed-cell foam core, and through-the-thickness Kevlar stitching. The sandwich panels were stitched in a dry preform state, vacuum bagged, and infiltrated using Vacuum Assisted Resin Transfer Molding (VARTM) processing. For comparison purposes, unstitched sandwich panels were produced using the same materials and manufacturing methodology. Test panels were produced initially at the University of Utah and later at NASA Langley Research Center. Four types of mechanical tests were performed: flexural testing, flatwise tensile testing, core shear testing, and edgewise compression testing. Drop-weight impact testing followed by specimen sectioning was performed to characterize the damage resistance of stitched sandwich panels. Compression after impact (CAI) testing was performed to evaluate the damage tolerance of the sandwich panels. Results show significant increases in the flexural stiffness and strength, out-of-plane tensile strength, core shear strength, edgewise compression strength, and compression-after-impact strength of stitched sandwich structures.

40 CFR Table 4 to Subpart Wwww of... - Work Practice Standards

Code of Federal Regulations, 2010 CFR

2010-07-01

.... a new or existing closed molding operation using compression/injection molding uncover, unwrap or... new or existing cleaning operation not use cleaning solvents that contain HAP, except that styrene may... contacts resin. 3. a new or existing materials HAP-containing materials storage operation keep containers...

An in vitro study to compare the transverse strength of thermopressed and conventional compression-molded polymethylmethacrylate polymers.

PubMed

Raut, Anjana; Rao, Polsani Laxman; Vikas, B V J; Ravindranath, T; Paradkar, Archana; Malakondaiah, G

2013-01-01

Acrylic resins have been in the center stage of Prosthodontics for more than half a century. The flexural fatigue failure of denture base materials is the primary mode of clinical failure. Hence there is a need for superior physical and mechanical properties. This in vitro study compared the transverse strength of specimens of thermopressed injection-molded and conventional compression-molded polymethylmethacrylate polymers and examined the morphology and microstructure of fractured acrylic specimens. The following denture base resins were examined: Brecrystal (Thermopressed injection-molded, modified polymethylmethacrylate) and Pyrax (compression molded, control group). Specimens of each material were tested according to the American Society for Testing and Materials standard D790-03 for flexural strength testing of reinforced plastics and subsequently examined under SEM. The data was analyzed with Student unpaired t test. Flexural strength of Brecrystal (82.08 ± 1.27 MPa) was significantly higher than Pyrax (72.76 ± 0.97 MPa). The tested denture base materials fulfilled the requirements regarding flexural strength (>65 MPa). The scanning electron microscopy image of Brecrystal revealed a ductile fracture with crazing. The fracture pattern of control group specimens exhibited poorly defined crystallographic planes with a high degree of disorganization. Flexural strength of Brecrystal was significantly higher than the control group. Brecrystal showed a higher mean transverse strength value of 82.08 ± 1.27 MPa and a more homogenous pattern at microscopic level. Based on flexural strength properties and handling characteristics, Brecrystal may prove to be an useful alternative to conventional denture base resins.

Compression molding of aerogel microspheres

DOEpatents

Pekala, R.W.; Hrubesh, L.W.

1998-03-24

An aerogel composite material produced by compression molding of aerogel microspheres (powders) mixed together with a small percentage of polymer binder to form monolithic shapes in a cost-effective manner is disclosed. The aerogel composites are formed by mixing aerogel microspheres with a polymer binder, placing the mixture in a mold and heating under pressure, which results in a composite with a density of 50--800 kg/m{sup 3} (0.05--0.80 g/cc). The thermal conductivity of the thus formed aerogel composite is below that of air, but higher than the thermal conductivity of monolithic aerogels. The resulting aerogel composites are attractive for applications such as thermal insulation since fabrication thereof does not require large and expensive processing equipment. In addition to thermal insulation, the aerogel composites may be utilized for filtration, ICF target, double layer capacitors, and capacitive deionization. 4 figs.

Compression molding of aerogel microspheres

DOEpatents

Pekala, Richard W.; Hrubesh, Lawrence W.

1998-03-24

An aerogel composite material produced by compression molding of aerogel microspheres (powders) mixed together with a small percentage of polymer binder to form monolithic shapes in a cost-effective manner. The aerogel composites are formed by mixing aerogel microspheres with a polymer binder, placing the mixture in a mold and heating under pressure, which results in a composite with a density of 50-800 kg/m.sup.3 (0.05-0.80 g/cc). The thermal conductivity of the thus formed aerogel composite is below that of air, but higher than the thermal conductivity of monolithic aerogels. The resulting aerogel composites are attractive for applications such as thermal insulation since fabrication thereof does not require large and expensive processing equipment. In addition to thermal insulation, the aerogel composites may be utilized for filtration, ICF target, double layer capacitors, and capacitive deionization.

Development and demonstration of manufacturing processes for fabricating graphite/LARC 160 polyimide structural elements

NASA Technical Reports Server (NTRS)

Frost, R. K.; Jones, J. S.; Dynes, P. J.; Wykes, D. H.

1981-01-01

The development and demonstration of manufacturing technologies for the structural application of Celion graphite/LARC-160 polyimide composite material is discussed. Process development and fabrication of demonstration components are discussed. Process development included establishing quality assurance of the basic composite material and processing, nondestructive inspection of fabricated components, developing processes for specific structural forms, and qualification of processes through mechanical testing. Demonstration components were fabricated. The demonstration components consisted of flat laminates, skin/stringer panels, honeycomb panels, chopped fiber compression moldings, and a technology demonstrator segment (TDS) representative of the space shuttle aft body flap.

The beetle elytron plate: a lightweight, high-strength and buffering functional-structural bionic material.

PubMed

Zhang, Xiaoming; Xie, Juan; Chen, Jinxiang; Okabe, Yoji; Pan, Longcheng; Xu, Mengye

2017-06-30

To investigate the characteristics of compression, buffering and energy dissipation in beetle elytron plates (BEPs), compression experiments were performed on BEPs and honeycomb plates (HPs) with the same wall thickness in different core structures and using different molding methods. The results are as follows: 1) The compressive strength and energy dissipation capacity in the BEP are 2.44 and 5.0 times those in the HP, respectively, when the plates are prepared using the full integrated method (FIM). 2) The buckling stress is directly proportional to the square of the wall thickness (t). Thus, for core structures with equal wall thicknesses, although the core volume of the BEP is 42 percent greater than that of the HP, the mechanical properties of the BEP are several times higher than those of the HP. 3) It is also proven that even when the single integrated method (SIM) is used to prepare BEPs, the properties discussed above remain superior to those of HPs by a factor of several; this finding lays the foundation for accelerating the commercialization of BEPs based on modern manufacturing processes.

Gravity Effects in Small-Scale Structural Modeling

DTIC Science & Technology

1988-12-01

attenuating material (Reference 23). The materials tested were cellular concrete with fly ash, expanded polystyrene concrete with fly ash, foamed...polyurethane, foamed sulfer and molded expanded polystyrene . The studies showed that with proper adjustments in the cement content, water-cement ratio and foam...Compression (Ou,c) 4000 100 Tension (Ou,t) 400 10 E/Quc 1000 1000 Ou,c/Ou,t 10 10 Further analysis of the properties of expanded polystyrene concrete with

Fabrication of an infrared Shack-Hartmann sensor by combining high-speed single-point diamond milling and precision compression molding processes.

PubMed

Zhang, Lin; Zhou, Wenchen; Naples, Neil J; Yi, Allen Y

2018-05-01

A novel fabrication method by combining high-speed single-point diamond milling and precision compression molding processes for fabrication of discontinuous freeform microlens arrays was proposed. Compared with slow tool servo diamond broaching, high-speed single-point diamond milling was selected for its flexibility in the fabrication of true 3D optical surfaces with discontinuous features. The advantage of single-point diamond milling is that the surface features can be constructed sequentially by spacing the axes of a virtual spindle at arbitrary positions based on the combination of rotational and translational motions of both the high-speed spindle and linear slides. By employing this method, each micro-lenslet was regarded as a microstructure cell by passing the axis of the virtual spindle through the vertex of each cell. An optimization arithmetic based on minimum-area fabrication was introduced to the machining process to further increase the machining efficiency. After the mold insert was machined, it was employed to replicate the microlens array onto chalcogenide glass. In the ensuing optical measurement, the self-built Shack-Hartmann wavefront sensor was proven to be accurate in detecting an infrared wavefront by both experiments and numerical simulation. The combined results showed that precision compression molding of chalcogenide glasses could be an economic and precision optical fabrication technology for high-volume production of infrared optics.

Taking Impressions of Hidden Cavity Walls

NASA Technical Reports Server (NTRS)

Burley, D.; Mayer, W.

1987-01-01

Lightweight, portable internal-molding device makes it possible to measure radii of, or examine contours of, passageways in hidden or complicated cavities. With device, measurements made in field, without returning assemblies to shop or laboratory for inspection. Molding head expands when compressed air applied. Inflatable tubes around head perform dual sealing and aligning function.

Compact self-aligning assemblies with refractive microlens arrays made by contactless embossing

NASA Astrophysics Data System (ADS)

Schulze, Jens; Ehrfeld, Wolfgang; Mueller, Holger; Picard, Antoni

1998-04-01

The hybrid integration of microlenses and arrays of microlenses in micro-optical systems is simplified using contactless embossing of microlenses (CEM) in combination with LIGA microfabrication. CEM is anew fabrication technique for the production of precise refractive microlens arrays. A high precision matrix of holes made by LIGA technique is used as a compression molding tool to form the microlenses. The tool is pressed onto a thermoplastic sample which is heated close to the glass transformation temperature of the material. The material bulges into the openings of the molding tool due to the applied pressure and forms lens-like spherical structures. The name refers to the fact that the surface of the microlens does not get in contact with the compression molding tool during the shaping process and optical quality of the surface is maintained. Microlenses and arrays of microlenses with lens diameters from 30 micrometers up to 700 micrometers and numerical aperture values of up to 0.25 have been fabricated in different materials. Cost-effectiveness in the production process, excellent optical performance and the feature of easy replication are the main advantages of this technique. The most promising feature of this method is the possibility to obtain self- aligned assemblies then can be further integrated into a micro-optical bench setup. The CEM fabrication method in combination with LIGA microfabrication considerably enhances the hybrid integration in micro-optical devices which results in a more cost-effective production of compact micro-opto-electro-mechanical systems.

From micro- to nano-scale molding of metals : size effect during molding of single crystal Al with rectangular strip punches.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, K.; Meng, W. J.; Mei, F.

2011-02-01

A single crystal Al specimen was molded at room temperature with long, rectangular, strip diamond punches. Quantitative molding response curves were obtained at a series of punch widths, ranging from 5 {micro}m to 550 nm. A significant size effect was observed, manifesting itself in terms of significantly increasing characteristic molding pressure as the punch width decreases to 1.5 {micro}m and below. A detailed comparison of the present strip punch molding results was made with Berkovich pyramidal indentation on the same single crystal Al specimen. The comparison reveals distinctly different dependence of the characteristic pressure on corresponding characteristic length. The presentmore » results show the feasibility of micro-/nano-scale compression molding as a micro-/nano-fabrication technique, and offer an experimental test case for size-dependent plasticity theories.« less

Effect of volatile removal during molding on the properties of two phenolic-fiber composites

NASA Technical Reports Server (NTRS)

Price, H. L.; Lucy, M. H.

1974-01-01

A comparison has been made of the effect of three volatile-removing techniques during molding on the properties of phenolic-fiber composites. The first technique involved heating the molding compound from one side, initiating the volatile-producing reactions, and driving these volatiles through the compound toward the cooler side. The second technique involved the application of a vacuum to the molding cavity before and during the cure cycle. The third technique was a combination of the first two. These techniques were used in the compression molding of phenolic-asbestos and phenolic-glass composites. The effects of both the individual and combined techniques on the mechanical, thermal, and sorption properties of the composites are reported.

Mold Heating and Cooling Pump Package Operator Interface Controls Upgrade

DOE Office of Scientific and Technical Information (OSTI.GOV)

Josh A. Salmond

2009-08-07

The modernization of the Mold Heating and Cooling Pump Package Operator Interface (MHC PP OI) consisted of upgrading the antiquated single board computer with a proprietary operating system to off-the-shelf hardware and off-the-shelf software with customizable software options. The pump package is the machine interface between a central heating and cooling system that pumps heat transfer fluid through an injection or compression mold base on a local plastic molding machine. The operator interface provides the intelligent means of controlling this pumping process. Strict temperature control of a mold allows the production of high quality parts with tight tolerances and lowmore » residual stresses. The products fabricated are used on multiple programs.« less

Low pressure process for continuous fiber reinforced polyamic acid resin matrix composite laminates

NASA Technical Reports Server (NTRS)

Druyun, Darleen A. (Inventor); Hou, Tan-Hung (Inventor); Kidder, Paul W. (Inventor); Reddy, Rakasi M. (Inventor); Baucom, Robert M. (Inventor)

1994-01-01

A low pressure processor was developed for preparing a well-consolidated polyimide composite laminate. Prepreg plies were formed from unidirectional fibers and a polyamic acid resin solution. Molding stops were placed at the sides of a matched metal die mold. The prepreg plies were cut shorter than the length of the mold in the in-plane lateral direction and were stacked between the molding stops to a height which was higher than the molding stops. The plies were then compressed to the height of the stops and heated to allow the volatiles to escape and to start the imidization reaction. After removing the stops from the mold, the heat was increased and 0 - 500 psi was applied to complete the imidization reaction. The heat and pressure were further increased to form a consolidated polyimide composite laminate.

Mathematical modeling of the in-mold coating process for injection-molded thermoplastic parts

NASA Astrophysics Data System (ADS)

Chen, Xu

In-Mold Coating (IMC) has been successfully used for many years for exterior body panels made from compression molded Sheet Molding Compound (SMC). The coating material is a single component reactive fluid, designed to improve the surface quality of SMC moldings in terms of functional and cosmetic properties. When injected onto a cured SMC part, IMC cures and bonds to provide a pain-like surface. Because of its distinct advantages, IMC is being considered for application to injection molded thermoplastic parts. For a successful in mold coating operation, there are two key issues related to the flow of the coating. First, the injection nozzle should be located such that the thermoplastic substrate is totally covered and the potential for air trapping is minimized. The selected location should be cosmetically acceptable since it most likely will leave a mark on the coated surface. The nozzle location also needs to be accessible for easy of maintenance. Secondly, the hydraulic force generated by the coating injection pressure should not exceed the available clamping tonnage. If the clamping force is exceeded, coating leakage will occur. In this study, mathematical models for IMC flow on the compressible thermoplastic substrate have been developed. Finite Difference Method (FDM) is first used to solve the 1 dimensional (1D) IMC flow problem. In order to investigate the application of Control Volume based Finite Element Method (CV/FEM) to more complicated two dimensional IMC flow, that method is first evaluated by solving the 1D IMC flow problem. An analytical solution, which can be obtained when a linear relationship between the coating thickness and coating injection pressure is assumed, is used to verify the numerical results. The mathematical models for the 2 dimensional (2D) IMC flow are based on the generalized Hele-Shaw approximation. It has been found experimentally that the power law viscosity model adequately predicts the rheological behavior of the coating. The compressibility of the substrate is modeled by the 2-domain Tait PVT equation. CV/FEM is used to solve the discretized governing equations. A computer code has been developed to predict the fill pattern of the coating and the injection pressure. A number of experiments have been conducted to verify the numerical predictions of the computer code. It has been found both numerically and experimentally that the substrate thickness plays a significant role on the IMC fill pattern.

Development of stitched/RTM composite primary structures

NASA Technical Reports Server (NTRS)

Kullerd, Susan M.; Dow, Marvin B.

1992-01-01

The goal of the NASA Advanced Composites Technology (ACT) Program is to provide the technology required to gain the full benefit of weight savings and performance offered by composite primary structures. Achieving the goal is dependent on developing composite materials and structures which are damage tolerant and economical to manufacture. Researchers at NASA LaRC and Douglas Aircraft Company are investigating stitching reinforcement combined with resin transfer molding (RTM) to create structures meeting the ACT program goals. The Douglas work is being performed under a NASA contract entitled Innovative Composites Aircraft Primary Structures (ICAPS). The research is aimed at materials, processes and structural concepts for application in both transport wings and fuselages. Empirical guidelines are being established for stitching reinforcement in primary structures. New data are presented in this paper for evaluation tests of thick (90-ply) and thin (16-ply) stitched laminates, and from selection tests of RTM composite resins. Tension strength, compression strength and post-impact compression strength data are reported. Elements of a NASA LaRC program to expand the science base for stitched/RTM composites are discussed.

Additive Manufacturing of Parts and Tooling in Robotic Systems

DOE Office of Scientific and Technical Information (OSTI.GOV)

Love, Lonnie J.; Hassen, Ahmed A.; Chesser, Phillip C.

ORNL worked with Transcend Robotics, LLC to explore additive manufacturing of the two-piece compression body for their ARTI mobile robot platform. Extrusion compression molding was identified as an effective means of manufacturing these parts. ORNL consulted on modifications to the housing design to accommodate the selected manufacturing process. Parts were printed using ORNL's FDM machines for testing and evaluation of the design as a precursor to molding the parts. The assembly and evaluation of the parts proved favorable and minor design changes to improve assembly and performance were identified.The goal is to develop a light weight and rugged two-part roboticmore » enclosure for an unmanned ground vehicle UGV) that will be used in search and rescue applications. The FDM parts fabricated by ORNL allowed Transcend Robotics to assemble a prototype robot and verify that the new parts will meet the performance requirements. ORNL fabricated enclosure parts out of ABS and Nylon 12 materials such that the design could be tested prior to fabricating tooling for compression molding of Nylon 6 with carbon fiber fill. The robot was performance tested and compared with the previous manufacturing techniques and found to have superior performance.« less

Fabrication of tunable diffraction grating by imprint lithography with photoresist mold

NASA Astrophysics Data System (ADS)

Yamada, Itsunari; Ikeda, Yusuke; Higuchi, Tetsuya

2018-05-01

We fabricated a deformable transmission silicone [poly(dimethylsiloxane)] grating using a two-beam interference method and imprint lithography and evaluated its optical characteristics during a compression process. The grating pattern with 0.43 μm depth and 1.0 μm pitch was created on a silicone surface by an imprinting process with a photoresist mold to realize a simple, low-cost fabrication process. The first-order diffraction transmittance of this grating reached 10.3% at 632.8 nm wavelength. We also measured the relationship between the grating period and compressive stress to the fabricated elements. The grating period changed from 1.0 μm to 0.84 μm by 16.6% compression of the fabricated element in one direction, perpendicular to the grooves, and the first-order diffraction transmittance was 8.6%.

Multiscale finite element modeling of sheet molding compound (SMC) composite structure based on stochastic mesostructure reconstruction

DOE PAGES

Chen, Zhangxing; Huang, Tianyu; Shao, Yimin; ...

2018-03-15

Predicting the mechanical behavior of the chopped carbon fiber Sheet Molding Compound (SMC) due to spatial variations in local material properties is critical for the structural performance analysis but is computationally challenging. Such spatial variations are induced by the material flow in the compression molding process. In this work, a new multiscale SMC modeling framework and the associated computational techniques are developed to provide accurate and efficient predictions of SMC mechanical performance. The proposed multiscale modeling framework contains three modules. First, a stochastic algorithm for 3D chip-packing reconstruction is developed to efficiently generate the SMC mesoscale Representative Volume Element (RVE)more » model for Finite Element Analysis (FEA). A new fiber orientation tensor recovery function is embedded in the reconstruction algorithm to match reconstructions with the target characteristics of fiber orientation distribution. Second, a metamodeling module is established to improve the computational efficiency by creating the surrogates of mesoscale analyses. Third, the macroscale behaviors are predicted by an efficient multiscale model, in which the spatially varying material properties are obtained based on the local fiber orientation tensors. Our approach is further validated through experiments at both meso- and macro-scales, such as tensile tests assisted by Digital Image Correlation (DIC) and mesostructure imaging.« less

Multiscale finite element modeling of sheet molding compound (SMC) composite structure based on stochastic mesostructure reconstruction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Zhangxing; Huang, Tianyu; Shao, Yimin

Predicting the mechanical behavior of the chopped carbon fiber Sheet Molding Compound (SMC) due to spatial variations in local material properties is critical for the structural performance analysis but is computationally challenging. Such spatial variations are induced by the material flow in the compression molding process. In this work, a new multiscale SMC modeling framework and the associated computational techniques are developed to provide accurate and efficient predictions of SMC mechanical performance. The proposed multiscale modeling framework contains three modules. First, a stochastic algorithm for 3D chip-packing reconstruction is developed to efficiently generate the SMC mesoscale Representative Volume Element (RVE)more » model for Finite Element Analysis (FEA). A new fiber orientation tensor recovery function is embedded in the reconstruction algorithm to match reconstructions with the target characteristics of fiber orientation distribution. Second, a metamodeling module is established to improve the computational efficiency by creating the surrogates of mesoscale analyses. Third, the macroscale behaviors are predicted by an efficient multiscale model, in which the spatially varying material properties are obtained based on the local fiber orientation tensors. Our approach is further validated through experiments at both meso- and macro-scales, such as tensile tests assisted by Digital Image Correlation (DIC) and mesostructure imaging.« less

Synthesis of an Al-Mn-Based Alloy Containing In Situ-Formed Quasicrystals and Evaluation of Its Mechanical and Corrosion Properties

NASA Astrophysics Data System (ADS)

Naglič, Iztok; Samardžija, Zoran; Delijić, Kemal; Kobe, Spomenka; Leskovar, Blaž; Markoli, Boštjan

2018-05-01

An Al-Mn alloy with additions of copper, magnesium, and silicon was prepared and cast into a copper mold. It contains in situ-formed icosahedral quasicrystals (iQCs), as confirmed by electron backscatter diffraction. The aim of this work is to present the mechanical and corrosion properties of this alloy and compare its properties with some conventional commercial materials. The compressive strength and compressive yield strength were 751 MPa and 377 MPa, while the compressive fracture strain was 19%. It was observed that intensive shearing caused the final fracture of the specimens and the fractured iQC dendrites still showed cohesion with the α-Al matrix. The polarization resistance and corrosion rate of the artificially aged alloy were 7.30 kΩ and 1.2 μm/year. The evaluated properties are comparable to conventional, discontinuously reinforced aluminum metal-matrix composites and structural wrought aluminum alloys.

PERFORMANCE ENHANCEMENT OF COMPRESSION MOLDED KENAF FIBER REINFORCED VINYL ESTER COMPOSITES THROUGH RESIN ADDITIVE

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fifield, Leonard S.; Simmons, Kevin L.; Laddha, Sachin

2010-05-17

Plant-based bio-fiber has the potential to achieve weight and cost savings over glass fiber in automotive polymer composites if moisture stability and fiber-resin compatibility issues can be solved. This paper describes the compression molding of 50vol% 2 inch random nonwoven mat kenaf fiber vinyl ester composites with and without chemical resin additives intended to improve moisture stability and resin compatibility. The 2wt% addition of n-undecanoyl chloride or 10-undecenoyl chloride to the styrene-based resin prior to molding of the kenaf composites was observed to decrease the 24hr, 25oC moisture uptake of the molded panels by more than 50%. The tensile stiffnessmore » and flexural stiffness of the soaked panels containing these additives were seen to increase by more than 30% and 70%, respectively, relative to panels made with no additives. While ‘dry’ panel (50% relative humidity at 25oC) strengths did not significantly change in the presence of the additives, tensile strength was observed to increase by more than 40% and flexural strength more than doubled for the soaked panels.« less

Manufacturing Process Selection of Composite Bicycle’s Crank Arm using Analytical Hierarchy Process (AHP)

NASA Astrophysics Data System (ADS)

Luqman, M.; Rosli, M. U.; Khor, C. Y.; Zambree, Shayfull; Jahidi, H.

2018-03-01

Crank arm is one of the important parts in a bicycle that is an expensive product due to the high cost of material and production process. This research is aimed to investigate the potential type of manufacturing process to fabricate composite bicycle crank arm and to describe an approach based on analytical hierarchy process (AHP) that assists decision makers or manufacturing engineers in determining the most suitable process to be employed in manufacturing of composite bicycle crank arm at the early stage of the product development process to reduce the production cost. There are four types of processes were considered, namely resin transfer molding (RTM), compression molding (CM), vacuum bag molding and filament winding (FW). The analysis ranks these four types of process for its suitability in the manufacturing of bicycle crank arm based on five main selection factors and 10 sub factors. Determining the right manufacturing process was performed based on AHP process steps. Consistency test was performed to make sure the judgements are consistent during the comparison. The results indicated that the compression molding was the most appropriate manufacturing process because it has the highest value (33.6%) among the other manufacturing processes.

Topographic design and application of hierarchical polymer surfaces replicated by microinjection compression molding

NASA Astrophysics Data System (ADS)

Guan, Wei-Sheng; Huang, Han-Xiong; Wang, Bin

2013-10-01

In recent years, the fast growing demand for biomimetic surfaces featuring unique wettability and functionality in various fields highlights the necessity of developing a reliable technique for mass production. In this work, hierarchical topography designs of templates were applied to prepare superhydrophobic surfaces via microinjection compression molding, comprehensively considering the feasibility of mechanical demolding and the superhydrophobicity and mechanical robustness of the molded polypropylene parts. Mimicking the wettability of a lotus leaf or rose petal, superhydrophobic surfaces were replicated. An unstable wetting state formed on the surface exhibiting the petal effect. On such a surface, the increased water pressure could cause water penetration into the micro gaps between the hierarchical asperities featuring low-roughness sidewalls and bottom surface; the resultant water membrane led to drastically increased water adhesion of the surface. Moreover, the low-adhesion superhydrophobicity of the molded surface was changed into superhydrophilicity, by means of introducing carbonyl groups via ultraviolet/ozone treatment and the subsequent water membrane preserved in microstructures via the pre-wetting process. Patterning the superhydrophilic micro channel on the superhydrophobic surface developed the surface microfluidic devices for micro-liter fluid pumping and mixing processes driven by surface tension.

An improved compression molding technology for continuous fiber reinforced composite laminate. Part 1: AS-4/LaRC-TPI 1500 (HFG) Prepreg system

NASA Technical Reports Server (NTRS)

Hou, Tan-Hung; Kidder, Paul W.; Reddy, Rakasi M.

1991-01-01

Poor processability of fiber reinforced high performance polyimide thermoplastic resin composites is a well recognized issue which, in many cases, prohibits the fabrication of composite parts with satisfactorily consolidated quality. Without modifying the resin matrix chemistry, improved compression modeling procedures were proposed and investigated with the AS-4/LaRC-TPI 1500 High Flow Grade (HFG) prepreg system. Composite panels with excellent C-scans can be consistently molded by this method under 700 F and a consolidation pressure as low as 100 psi. A mechanism for the consolidation of the composite under this improved molding technique is discussed. This mechanism reveals that a certain degree of matrix shear and tow filament slippage and nesting between plies occur during consolidation, which leads to a reduction of the consolidating pressure necessary to offset the otherwise intimate inter fiber-fiber contact and consequently achieves a better consolidation quality. Outstanding short beam shear strength and flexural strength were obtained from the molded panels. A prolonged consolidation step under low pressure, i.e., 100 psi at 700 F for 75 minutes, was found to significantly enhance the composite mechanical properties.

Active bilayer films of thermoplastic starch and polycaprolactone obtained by compression molding.

PubMed

Ortega-Toro, Rodrigo; Morey, Iris; Talens, Pau; Chiralt, Amparo

2015-08-20

Bilayer films consisting of one layer of PCL with either one of thermoplastic starch (S) or one of thermoplastic starch with 5% PCL (S95) were obtained by compression molding. Before compression, aqueous solutions of ascorbic acid or potassium sorbate were sprayed onto the S or S95 layers in order to plasticize them and favor layer adhesion. S95 films formed bilayers with PCL with very good adhesion and good mechanical performance, especially when potassium sorbate was added at the interface. All bilayers enhanced their barrier properties to water vapour (up to 96% compared to net starch films) and oxygen (up to 99% compared to PCL pure). Bilayers consisting of PCL and starch containing 5% PCL, with potassium sorbate at the interface, showed the best mechanical and barrier properties and interfacial adhesion while having active properties, associated with the antimicrobial action of potassium sorbate. Copyright © 2015 Elsevier Ltd. All rights reserved.

Porous stable poly(lactic acid)/ethyl cellulose/hydroxyapatite composite scaffolds prepared by a combined method for bone regeneration.

PubMed

Mao, Daoyong; Li, Qing; Bai, Ningning; Dong, Hongzhou; Li, Daikun

2018-01-15

A major challenge in bone tissue engineering is the development of biomimetic scaffolds which should simultaneously meet mechanical strength and pore structure requirements. Herein, we combined technologies of high concentration solvent casting, particulate leaching, and room temperature compression molding to prepare a novel poly(lactic acid)/ethyl cellulose/hydroxyapatite (PLA/EC/HA) scaffold. The functional, structural and mechanical properties of the obtained porous scaffolds were characterized. The results indicated that the PLA/EC/HA scaffolds at the 20wt% HA loading level showed optimal mechanical properties and desired porous structure. Its porosity, contact angle, compressive yield strength and weight loss after 56days were 84.28±7.04%, 45.13±2.40°, 1.57±0.09MPa and 4.77±0.32%, respectively, which could satisfy the physiological demands to guide bone regeneration. Thus, the developed scaffolds have potential to be used as a bone substitute material for bone tissue engineering application. Copyright © 2017. Published by Elsevier Ltd.

Influence of fiber length on flexural and impact properties of Zalacca Midrib fiber/HDPE by compression molding

NASA Astrophysics Data System (ADS)

Pamungkas, Agil Fitri; Ariawan, Dody; Surojo, Eko; Triyono, Joko

2018-02-01

The aim of the research is to investigate the effect of fiber length on the flexural and impact properties of the composite of Zalacca Midrib Fiber (ZMF)/HDPE. The process of making composite was using compression molding method. The variation of fiber length were 1 mm, 3 mm, 5 mm, 7 mm and 9 mm, at 30% fiber volume fraction. The flexural and impact test according to ASTM D790 and ASTM D5941, respectively. Observing fracture surface was examained by using Scanning Electron Microscopy (SEM). The results showed that the flexural and impact strengths would be increase with the increase of fiber length.

Formulation and evaluation of controlled release antibiotic biodegradable implants for post operative site delivery.

PubMed

Mathur, Vijay; Mudnaik, Rajesh; Barde, Laxmikant; Roy, Arghya; Shivhare, Umesh; Bhusari, Kishore

2010-03-01

Biodegradable implants of ciprofloxacin hydrochloride for post operative site delivery were prepared using glyceryl monostearate and different concentrations of polyethylene glycol (PEG 6000), glycerol and Tween 80 as erosion enhancers by compression and molding technique. Formulations were subjected to in vitro drug release by the USP dissolution method, while promising formulations were subjected to in vitro drug release by the agar gel method and also to stability studies. It was observed that glyceryl monostearate formed hydrophobic matrix and delayed the drug delivery. Antibiotic release profile was controlled by using different combinations of erosion enhancers. The formulation prepared by the compression method showed more delayed release compared to formulations prepared by the molding method.

Compression Molding of Composite of Recycled HDPE and Recycled Tire Particles

NASA Technical Reports Server (NTRS)

Liu, Ping; Waskom, Tommy L.; Chen, Zhengyu; Li, Yanze; Peng, Linda

1996-01-01

Plastic and rubber recycling is an effective means of reducing solid waste to the environment and preserving natural resources. A project aimed at developing a new composite material from recycled high density polyethylene (HDPE) and recycled rubber is currently being conducted at Eastern Illinois University. The recycled plastic pellets with recycled rubber particles are extruded into some HDPE/rubber composite strands. The strand can be further cut into pellets that can be used to fabricate other material forms or products. This experiment was inspired by the above-mentioned research activity. In order to measure Durometer hardness of the extruded composite, a specimen with relatively large dimensions was needed. Thus, compression molding was used to form a cylindrical specimen of 1 in. diameter and 1 in. thickness. The initial poor quality of the molded specimen prompted a need to optimize the processing parameters such as temperature, holding time, and pressure. Design of experiment (DOE) was used to obtain optimum combination of the parameters.

The compression of wood/thermoplastic fiber mats during consolidation

Treesearch

Karl R. Englund; Michael P. Wolcott; John C. Hermanson

2004-01-01

Secondary processing of non-woven wood and wood/thermoplastic fiber mats is generally performed using compression molding, where heated platens or dies form the final product. Although the study and use of wood-fiber composites is widespread, few research efforts have explicitly described the fundamentals of mat consolidation. In contrast, the wood composite literature...

EMTA-NLA

DOE Office of Scientific and Technical Information (OSTI.GOV)

2009-10-14

EMTA-NLA is a computer program for analyzing the nonlinear stiffness, strength, and thermo-elastic properties of discontinuous fiber composite materials. Discontinuous fiber composites are chopped-fiber reinforced polymer materials that are formed by injection molding or compression molding techniques. The fibers tend to align during forming as the composite flows and fills the mold. EMTA-NLA can read the fiber orientation data from the molding software, Autodesk Moldflow Plastics Insight, and calculate the local material properties for accurately analyzing the warpage, stiffness, and strength of the as-formed composite part using the commercial NLA software. Therefore, EMTA-NLA is a unique assembly of mathematical algorithmsmore » that provide a one-of-a-kind composites constitutive model that links these two powerful commercial software packages.« less

High rate fabrication of compression molded components

DOE Office of Scientific and Technical Information (OSTI.GOV)

Matsen, Marc R.; Negley, Mark A.; Dykstra, William C.

2016-04-19

A method for fabricating a thermoplastic composite component comprises inductively heating a thermoplastic pre-form with a first induction coil by inducing current to flow in susceptor wires disposed throughout the pre-form, inductively heating smart susceptors in a molding tool to a leveling temperature with a second induction coil by applying a high-strength magnetic field having a magnetic flux that passes through surfaces of the smart susceptors, shaping the magnetic flux that passes through surfaces of the smart susceptors to flow substantially parallel to a molding surface of the smart susceptors, placing the heated pre-form between the heated smart susceptors; andmore » applying molding pressure to the pre-form to form the composite component.« less

Morphological and performance measures of polyurethane foams using X-ray CT and mechanical testing.

PubMed

Patterson, Brian M; Henderson, Kevin; Gilbertson, Robert D; Tornga, Stephanie; Cordes, Nikolaus L; Chavez, Manuel E; Smith, Zachary

2014-08-01

Meso-scale structure in polymeric foams determines the mechanical properties of the material. Density variations, even more than variations in the anisotropic void structure, can greatly vary the compressive and tensile response of the material. With their diverse use as both a structural material and space filler, polyurethane (PU) foams are widely studied. In this manuscript, quantitative measures of the density and anisotropic structure are provided by using micro X-ray computed tomography (microCT) to better understand the results of mechanical testing. MicroCT illustrates the variation in the density, cell morphology, size, shape, and orientation in different regions in blown foam due to the velocity profile near the casting surface. "Interrupted" in situ imaging of the material during compression of these sub-regions indicates the pathways of the structural response to the mechanical load and the changes in cell morphology as a result. It is found that molded PU foam has a 6 mm thick "skin" of higher density and highly eccentric morphological structure that leads to wide variations in mechanical performance depending upon sampling location. This comparison is necessary to understand the mechanical performance of the anisotropic structure.

Low cost tooling material and process for graphite and Kevlar composites

NASA Technical Reports Server (NTRS)

Childs, William I.

1987-01-01

An Extruded Sheet Tooling Compound (ESTC) was developed for use in quickly building low cost molds for fabricating composites. The ESTC is a very highly mineral-filled resin system formed into a 6 mm thick sheet. The sheet is laid on the pattern, vacuum (bag) is applied to remove air from the pattern surface, and the assembly is heat cured. The formed ESTC is then backed and/or framed and ready for use. The cured ESTC exhibits low coefficient of thermal expansion and maintains strength at temperatures of 180 to 200 C. Tools were made and used successfully for: Compression molding of high strength epoxy sheet molding compound, stamping of aluminum, resin transfer molding of polyester, and liquid resin molding of polyester. Several variations of ESTC can be made for specific requirements. Higher thermal conductivity can be achieved by using an aluminum particle filler. Room temperature gel is possible to allow use of foam patterns.

Evaluation of the microstructure, secondary dendrite arm spacing, and mechanical properties of Al-Si alloy castings made in sand and Fe-Cr slag molds

NASA Astrophysics Data System (ADS)

Narasimha Murthy, I.; Babu Rao, J.

2017-07-01

The microstructure and mechanical properties of as-cast A356 (Al-Si) alloy castings were investigated. A356 alloy was cast into three different molds composed of sand, ferrochrome (Fe-Cr) slag, and a mixture of sand and Fe-Cr. A sodium silicate-CO2 process was used to make the necessary molds. Cylindrical-shaped castings were prepared. Cast products with no porosity and a good surface finish were achieved in all of the molds. These castings were evaluated for their metallography, secondary dendrite arm spacing (SDAS), and mechanical properties, including hardness, compression, tensile, and impact properties. Furthermore, the tensile and impact samples were analyzed by fractography. The results show that faster heat transfer in the Fe-Cr slag molds than in either the silica sand or mixed molds led to lower SDAS values with a refined microstructure in the products cast in Fe-Cr slag molds. Consistent and enhanced mechanical properties were observed in the slag mold products than in the castings obtained from either sand or mixed molds. The fracture surface of the slag mold castings shows a dimple fracture morphology with a transgranular fracture nature. However, the fracture surfaces of the sand mold castings display brittle fracture. In conclusion, products cast in Fe-Cr slag molds exhibit an improved surface finish and enhanced mechanical properties compared to those of products cast in sand and mixed molds.

Fit of interim crowns fabricated using photopolymer-jetting 3D printing.

PubMed

Mai, Hang-Nga; Lee, Kyu-Bok; Lee, Du-Hyeong

2017-08-01

The fit of interim crowns fabricated using 3-dimensional (3D) printing is unknown. The purpose of this in vitro study was to evaluate the fit of interim crowns fabricated using photopolymer-jetting 3D printing and to compare it with that of milling and compression molding methods. Twelve study models were fabricated by making an impression of a metal master model of the mandibular first molar. On each study model, interim crowns (N=36) were fabricated using compression molding (molding group, n=12), milling (milling group, n=12), and 3D polymer-jetting methods. The crowns were prepared as follows: molding group, overimpression technique; milling group, a 5-axis dental milling machine; and polymer-jetting group using a 3D printer. The fit of interim crowns was evaluated in the proximal, marginal, internal axial, and internal occlusal regions by using the image-superimposition and silicone-replica techniques. The Mann-Whitney U test and Kruskal-Wallis tests were used to compare the results among groups (α=.05). Compared with the molding group, the milling and polymer-jetting groups showed more accurate results in the proximal and marginal regions (P<.001). In the axial regions, even though the mean discrepancy was smallest in the molding group, the data showed large deviations. In the occlusal region, the polymer-jetting group was the most accurate, and compared with the other groups, the milling group showed larger internal discrepancies (P<.001). Polymer-jet 3D printing significantly enhanced the fit of interim crowns, particularly in the occlusal region. Copyright © 2016 Editorial Council for the Journal of Prosthetic Dentistry. Published by Elsevier Inc. All rights reserved.

Lightweight and Compostable Fiberboard for the Military

DTIC Science & Technology

2012-08-01

individual sheets with compression molding methods. The second approach examined different biodegradable coatings for paper formation which enhanced wet...strength properties of paper based products. The third approach identified effective coated corrugated alternatives that exhibited comparable...fiberboard containers to different environmental conditions. Analysis of variance of compression data as a function of moisture, insert design and paper

Novel technique for fabrication of multi-layered microcoils in microelectromechanical systems (MEMS) applications

NASA Astrophysics Data System (ADS)

Chang, Hung-Pin; Qian, Jiangyuan; Bachman, Mark; Congdon, Philip; Li, Guann-pyng

2002-07-01

A novel planarization technique, compressive molding planarization (CMP) is developed for implementation of a multi-layered micro coil device. Applying CMP and other micromachining techniques, a multi-layered micro coil device has been designed and fabricated, and its use in the magnetic micro actuators for hard disk drive applications has been demonstrated, showing that it can produce milli-Newton of magnetic force suitable for driving a micro actuator. The novel CMP technique can be equally applicable in other MEMS devices fabrication to ease the process integration for the complicated structure.

Moisture and temperature influence on mechanical behavior of PPS/buckypapers carbon fiber laminates

NASA Astrophysics Data System (ADS)

Rojas, J. A.; Santos, L. F. P.; Costa, M. L.; Ribeiro, B.; Botelho, E. C.

2017-07-01

In this work, multiwall carbon nanotubes (MWCNT) were dispersed in water with the assistance of water based surfactant and then sonicated in order to obtain a very well dispersed solution. The suspension was filtrate under vaccum conditions, generating a thin film called buckypapers (BP). Poly (phenylene sulphide) (PPS) reinforced carbon fiber (CF) and PPS reinforced CF/BP composites were manufactured through hot compression molding technique. Subsequently the samples were exposed to extreme humidity (90% of moisture) combined with high temperature (80 °C). The mechanical properties of the laminates were evaluated by dynamic mechanical analysis, compression shear test, interlaminar shear strength and impulse excitation of vibration. Volume fraction of pores were 10.93% for PPS/CF and 16.18% for PPS/BP/CF, indicating that the hot compression molding parameters employed in this investigation (1.4 MPa, 5 min and 330 °C) affected both the consolidation quality of the composites and the mechanical properties of the final laminates.

Phenolic Molding Compounds

NASA Astrophysics Data System (ADS)

Koizumi, Koji; Charles, Ted; de Keyser, Hendrik

Phenolic Molding Compounds continue to exhibit well balanced properties such as heat resistance, chemical resistance, dimensional stability, and creep resistance. They are widely applied in electrical, appliance, small engine, commutator, and automotive applications. As the focus of the automotive industry is weight reduction for greater fuel efficiency, phenolic molding compounds become appealing alternatives to metals. Current market volumes and trends, formulation components and its impact on properties, and a review of common manufacturing methods are presented. Molding processes as well as unique advanced techniques such as high temperature molding, live sprue, and injection/compression technique provide additional benefits in improving the performance characterisitics of phenolic molding compounds. Of special interest are descriptions of some of the latest innovations in automotive components, such as the phenolic intake manifold and valve block for dual clutch transmissions. The chapter also characterizes the most recent developments in new materials, including long glass phenolic molding compounds and carbon fiber reinforced phenolic molding compounds exhibiting a 10-20-fold increase in Charpy impact strength when compared to short fiber filled materials. The role of fatigue testing and fatigue fracture behavior presents some insight into long-term reliability and durability of glass-filled phenolic molding compounds. A section on new technology outlines the important factors to consider in modeling phenolic parts by finite element analysis and flow simulation.

Highly oriented carbon fiber–polymer composites via additive manufacturing

DOE PAGES

Tekinalp, Halil L.; Kunc, Vlastimil; Velez-Garcia, Gregorio M.; ...

2014-10-16

Additive manufacturing, diverging from traditional manufacturing techniques, such as casting and machining materials, can handle complex shapes with great design flexibility without the typical waste. Although this technique has been mainly used for rapid prototyping, interest is growing in using this method to directly manufacture actual parts of complex shape. To use 3D-printing additive manufacturing in wide spread applications, the technique and the feedstock materials require improvements to meet the mechanical requirements of load-bearing components. Thus, we investigated the short fiber (0.2 mm to 0.4 mm) reinforced acrylonitrile-butadiene-styrene composites as a feedstock for 3D-printing in terms of their processibility, microstructuremore » and mechanical performance; and also provided comparison with traditional compression molded composites. The tensile strength and modulus of 3D-printed samples increased ~115% and ~700%, respectively. 3D-printer yielded samples with very high fiber orientation in printing direction (up to 91.5 %), whereas, compression molding process yielded samples with significantly less fiber orientation. Microstructure-mechanical property relationships revealed that although the relatively high porosity is observed in the 3D-printed composites as compared to those produced by the conventional compression molding technique, they both exhibited comparable tensile strength and modulus. Furthermore, this phenomena is explained based on the changes in fiber orientation, dispersion and void formation.« less

In vitro cytotoxicity and in vivo osseointergration properties of compression-molded HDPE-HA-Al2O3 hybrid biocomposites.

PubMed

Tripathi, Garima; Gough, Julie E; Dinda, Amit; Basu, Bikramjit

2013-06-01

The aim of this study was to investigate the in vivo biocompatibility in terms of healing of long segmental bone defect in rabbit model as well as in vitro cytotoxicity of eluates of compression-molded High density polyethylene (HDPE)-hydroxyapatite (HA)-aluminum oxide (Al2O3) composite-based implant material. Based on the physical property in terms of modulus and strength properties, as reported in our recent publication, HDPE-40 wt % HA and HDPE-20 wt % HA-20 wt % Al2O3 hybrid composites were used for biocompatibility assessment. Osteoblasts cells were cultured in conditioned media, which contains varying amount of composite eluate (0.01, 0.1, and 1.0 wt %). In vitro, the eluates did not exhibit any significant negative impact on proliferation, mineralization or on morphology of human osteoblast cells. In vivo, the histological assessment revealed neobone formation at the bone/implant interface, characterized by the presence of osteoid and osteoblasts. The observation of osteoclastic activity indicates the process of bone remodeling. No inflammation to any noticeable extent was observed at the implantation site. Overall, the combination of in vitro and in vivo results are suggestive of potential biomedical application of compression-molded HDPE- 20 wt % HA- 20 wt % Al2O3 composites to heal long segmental bone defects without causing any toxicity of bone cells. Copyright © 2012 Wiley Periodicals, Inc.

Fabrication of spherical microlens array by combining lapping on silicon wafer and rapid surface molding

NASA Astrophysics Data System (ADS)

Liu, Xiaohua; Zhou, Tianfeng; Zhang, Lin; Zhou, Wenchen; Yu, Jianfeng; Lee, L. James; Yi, Allen Y.

2018-07-01

Silicon is a promising mold material for compression molding because of its properties of hardness and abrasion resistance. Silicon wafers with carbide-bonded graphene coating and micro-patterns were evaluated as molds for the fabrication of microlens arrays. This study presents an efficient but flexible manufacturing method for microlens arrays that combines a lapping method and a rapid molding procedure. Unlike conventional processes for microstructures on silicon wafers, such as diamond machining and photolithography, this research demonstrates a unique approach by employing precision steel balls and diamond slurries to create microlenses with accurate geometry. The feasibility of this method was demonstrated by the fabrication of several microlens arrays with different aperture sizes and pitches on silicon molds. The geometrical accuracy and surface roughness of the microlens arrays were measured using an optical profiler. The measurement results indicated good agreement with the optical profile of the design. The silicon molds were then used to copy the microstructures onto polymer substrates. The uniformity and quality of the samples molded through rapid surface molding were also assessed and statistically quantified. To further evaluate the optical functionality of the molded microlens arrays, the focal lengths of the microlens arrays were measured using a simple optical setup. The measurements showed that the microlens arrays molded in this research were compatible with conventional manufacturing methods. This research demonstrated an alternative low-cost and efficient method for microstructure fabrication on silicon wafers, together with the follow-up optical molding processes.

Use of overburden rocks from open-pit coal mines and waste coals of Western Siberia for ceramic brick production with a defect-free structure

NASA Astrophysics Data System (ADS)

Stolboushkin, A. Yu; Ivanov, A. I.; Storozhenko, G. I.; Syromyasov, V. A.; Akst, D. V.

2017-09-01

The rational technology for the production of ceramic bricks with a defect-free structure from coal mining and processing wastes was developed. The results of comparison of physical and mechanical properties and the structure of ceramic bricks manufactured from overburden rocks and waste coal with traditional for semi-dry pressing mass preparation and according to the developed method are given. It was established that a homogeneous, defect-free brick texture obtained from overburden rocks of open-pit mines and waste coal improves the quality of ceramic wall materials produced by the method of compression molding by more than 1.5 times compared to the brick with a traditional mass preparation.

Challenges in mold manufacturing for high precision molded diffractive optical elements

NASA Astrophysics Data System (ADS)

Pongs, Guido; Bresseler, Bernd; Schweizer, Klaus; Bergs, Thomas

2016-09-01

Isothermal precision glass molding of imaging optics is the key technology for mass production of precise optical elements. Especially for numerous consumer applications (e.g. digital cameras, smart phones, …), high precision glass molding is applied for the manufacturing of aspherical lenses. The usage of diffractive optical elements (DOEs) can help to further reduce the number of lenses in the optical systems which will lead to a reduced weight of hand-held optical devices. But today the application of molded glass DOEs is limited due to the technological challenges in structuring the mold surfaces. Depending on the application submicrometer structures are required on the mold surface. Furthermore these structures have to be replicated very precisely to the glass lens surface. Especially the micro structuring of hard and brittle mold materials such as Tungsten Carbide is very difficult and not established. Thus a multitude of innovative approaches using diffractive optical elements cannot be realized. Aixtooling has investigated in different mold materials and different suitable machining technologies for the micro- and sub-micrometer structuring of mold surfaces. The focus of the work lays on ultra-precision grinding to generate the diffractive pattern on the mold surfaces. This paper presents the latest achievements in diffractive structuring of Tungsten Carbide mold surfaces by ultra-precision grinding.

Mechanical characterization and structural analysis of recycled fiber-reinforced-polymer resin-transfer-molded beams

NASA Astrophysics Data System (ADS)

Tan, Eugene Wie Loon

1999-09-01

The present investigation was focussed on the mechanical characterization and structural analysis of resin-transfer-molded beams containing recycled fiber-reinforced polymers. The beams were structurally reinforced with continuous unidirectional glass fibers. The reinforcing filler materials consisted entirely of recycled fiber-reinforced polymer wastes (trim and overspray). The principal resin was a 100-percent dicyclo-pentadiene unsaturated polyester specially formulated with very low viscosity for resin transfer molding. Variations of the resin transfer molding technique were employed to produce specimens for material characterization. The basic materials that constituted the structural beams, continuous-glass-fiber-reinforced, recycled-trim-filled and recycled-overspray-filled unsaturated polyesters, were fully characterized in axial and transverse compression and tension, and inplane and interlaminar shear, to ascertain their strengths, ultimate strains, elastic moduli and Poisson's ratios. Experimentally determined mechanical properties of the recycled-trim-filled and recycled-overspray-filled materials from the present investigation were superior to those of unsaturated polyester polymer concretes and Portland cement concretes. Mechanical testing and finite element analyses of flexure (1 x 1 x 20 in) and beam (2 x 4 x 40 in) specimens were conducted. These structurally-reinforced specimens were tested and analyzed in four-point, third-point flexure to determine their ultimate loads, maximum fiber stresses and mid-span deflections. The experimentally determined load capacities of these specimens were compared to those of equivalent steel-reinforced Portland cement concrete beams computed using reinforced concrete theory. Mechanics of materials beam theory was utilized to predict the ultimate loads and mid-span deflections of the flexure and beam specimens. However, these predictions proved to be severely inadequate. Finite element (fracture propagation) analyses of the flexure and beam specimens were also performed. These progressive failure analyses more closely approximated flexural behavior under actual testing conditions by reducing the elastic moduli of elements that were considered to have partially or totally failed. Individual element failures were predicted using the maximum stress, Tsai-Hill and Tsai-Wu failure criteria. Excellent predictions of flexural behavior were attributed to the progressive failure analyses combined with an appropriate failure criterion, and the reliable input material properties that were generated.

Improved high temperature resistant matrix resins

NASA Technical Reports Server (NTRS)

Chang, G. E.; Powell, S. H.; Jones, R. J.

1983-01-01

The objective was to develop organic matrix resins suitable for service at temperatures up to 644 K (700 F) and at air pressures up to 0.4 MPa (60 psia) for time durations of a minimum of 100 hours. Matrix resins capable of withstanding these extreme oxidative environmental conditions would lead to increased use of polymer matrix composites in aircraft engines and provide significant weight and cost savings. Six linear condensation, aromatic/heterocyclic polymers containing fluorinated and/or diphenyl linkages were synthesized. The thermo-oxidative stability of the resins was determined at 644 K and compressed air pressures up to 0.4 MPa. Two formulations, both containing perfluoroisopropylidene linkages in the polymer backbone structure, exhibited potential for 644 K service to meet the program objectives. Two other formulations could not be fabricated into compression molded zero defect specimens.

Tuning the superstructure of ultrahigh-molecular-weight polyethylene/low-molecular-weight polyethylene blend for artificial joint application.

PubMed

Xu, Ling; Chen, Chen; Zhong, Gan-Ji; Lei, Jun; Xu, Jia-Zhuang; Hsiao, Benjamin S; Li, Zhong-Ming

2012-03-01

An easy approach was reported to achieve high mechanical properties of ultrahigh-molecular-weight polyethylene (UHMWPE)-based polyethylene (PE) blend for artificial joint application without the sacrifice of the original excellent wear and fatigue behavior of UHMWPE. The PE blend with desirable fluidity was obtained by melt mixing UHMWPE and low molecular weight polyethylene (LMWPE), and then was processed by a modified injection molding technology-oscillatory shear injection molding (OSIM). Morphological observation of the OSIM PE blend showed LMWPE contained well-defined interlocking shish-kebab self-reinforced superstructure. Addition of a small amount of long chain polyethylene (2 wt %) to LMWPE greatly induced formation of rich shish-kebabs. The ultimate tensile strength considerably increased from 27.6 MPa for conventional compression molded UHMWPE up to 78.4 MPa for OSIM PE blend along the flow direction and up to 33.5 MPa in its transverse direction. The impact strength of OSIM PE blend was increased by 46% and 7% for OSIM PE blend in the direction parallel and vertical to the shear flow, respectively. Wear and fatigue resistance were comparable to conventional compression molded UHMWPE. The superb performance of the OSIM PE blend was originated from formation of rich interlocking shish-kebab superstructure while maintaining unique properties of UHMWPE. The present results suggested the OSIM PE blend has high potential for artificial joint application. © 2012 American Chemical Society

Energy Absorption in Chopped Carbon Fiber Compression Molded Composites

DOE Office of Scientific and Technical Information (OSTI.GOV)

Starbuck, J.M.

2001-07-20

In passenger vehicles the ability to absorb energy due to impact and be survivable for the occupant is called the ''crashworthiness'' of the structure. To identify and quantify the energy absorbing mechanisms in candidate automotive composite materials, test methodologies were developed for conducting progressive crush tests on composite plate specimens. The test method development and experimental set-up focused on isolating the damage modes associated with the frond formation that occurs in dynamic testing of composite tubes. Quasi-static progressive crush tests were performed on composite plates manufactured from chopped carbon fiber with an epoxy resin system using compression molding techniques. Themore » carbon fiber was Toray T700 and the epoxy resin was YLA RS-35. The effect of various material and test parameters on energy absorption was evaluated by varying the following parameters during testing: fiber volume fraction, fiber length, fiber tow size, specimen width, profile radius, and profile constraint condition. It was demonstrated during testing that the use of a roller constraint directed the crushing process and the load deflection curves were similar to progressive crushing of tubes. Of all the parameters evaluated, the fiber length appeared to be the most critical material parameter, with shorter fibers having a higher specific energy absorption than longer fibers. The combination of material parameters that yielded the highest energy absorbing material was identified.« less

Compliant Buckled Foam Actuators and Application in Patient-Specific Direct Cardiac Compression.

PubMed

Mac Murray, Benjamin C; Futran, Chaim C; Lee, Jeanne; O'Brien, Kevin W; Amiri Moghadam, Amir A; Mosadegh, Bobak; Silberstein, Meredith N; Min, James K; Shepherd, Robert F

2018-02-01

We introduce the use of buckled foam for soft pneumatic actuators. A moderate amount of residual compressive strain within elastomer foam increases the applied force ∼1.4 × or stroke ∼2 × compared with actuators without residual strain. The origin of these improved characteristics is explained analytically. These actuators are applied in a direct cardiac compression (DCC) device design, a type of implanted mechanical circulatory support that avoids direct blood contact, mitigating risks of clot formation and stroke. This article describes a first step toward a pneumatically powered, patient-specific DCC design by employing elastomer foam as the mechanism for cardiac compression. To form the device, a mold of a patient's heart was obtained by 3D printing a digitized X-ray computed tomography or magnetic resonance imaging scan into a solid model. From this model, a soft, robotic foam DCC device was molded. The DCC device is compliant and uses compressed air to inflate foam chambers that in turn apply compression to the exterior of a heart. The device is demonstrated on a porcine heart and is capable of assisting heart pumping at physiologically relevant durations (∼200 ms for systole and ∼400 ms for diastole) and stroke volumes (∼70 mL). Although further development is necessary to produce a fully implantable device, the material and processing insights presented here are essential to the implementation of a foam-based, patient-specific DCC design.

Importance of Tensile Strength on the Shear Behavior of Discontinuities

NASA Astrophysics Data System (ADS)

Ghazvinian, A. H.; Azinfar, M. J.; Geranmayeh Vaneghi, R.

2012-05-01

In this study, the shear behavior of discontinuities possessing two different rock wall types with distinct separate compressive strengths was investigated. The designed profiles consisted of regular artificial joints molded by five types of plaster mortars, each representing a distinct uniaxial compressive strength. The compressive strengths of plaster specimens ranged from 5.9 to 19.5 MPa. These specimens were molded considering a regular triangular asperity profile and were designed so as to achieve joint walls with different strength material combinations. The results showed that the shear behavior of discontinuities possessing different joint wall compressive strengths (DDJCS) tested under constant normal load (CNL) conditions is the same as those possessing identical joint wall strengths, but the shear strength of DDJCS is governed by minor joint wall compressive strength. In addition, it was measured that the predicted values obtained by Barton's empirical criterion are greater than the experimental results. The finding indicates that there is a correlation between the joint roughness coefficient (JRC), normal stress, and mechanical strength. It was observed that the mode of failure of asperities is either pure tensile, pure shear, or a combination of both. Therefore, Barton's strength criterion, which considers the compressive strength of joint walls, was modified by substituting the compressive strength with the tensile strength. The validity of the modified criterion was examined by the comparison of the predicted shear values with the laboratory shear test results reported by Grasselli (Ph.D. thesis n.2404, Civil Engineering Department, EPFL, Lausanne, Switzerland, 2001). These comparisons infer that the modified criterion can predict the shear strength of joints more precisely.

Durable, Low-Surface-Energy Treatments

NASA Technical Reports Server (NTRS)

Willis, Paul B.; Mcelroy, Paul M.; Hickey, Gregory S.

1992-01-01

Chemical treatment for creation of durable, low-surface-energy coatings for glass, ceramics and other protonated surfaces easily applied, and creates very thin semipermanent film with extremely low surface tension. Exhibits excellent stability; surfaces retreated if coating becomes damaged or eroded. Uses include water-repellent surfaces, oil-repellent surfaces, antimigration barriers, corrosion barriers, mold-release agents, and self-cleaning surfaces. Film resists wetting by water, alcohols, hydrocarbon solvents, and silicone oil. Has moderate resistance to abrasion, such as rubbing with cloths, and compression molding to polymers and composite materials.

Effect of pH on compressive strength of some modification of mineral trioxide aggregate

PubMed Central

Saghiri, Mohammad A.; Garcia-Godoy, Franklin; Asatourian, Armen; Lotfi, Mehrdad; Khezri-Boukani, Kaveh

2013-01-01

Objectives: Recently, it was shown that NanoMTA improved the setting time and promoted a better hydration process which prevents washout and the dislodgment of this novel biomaterial in comparison with WTMA. This study analyzed the compressive strength of ProRoot WMTA (Dentsply), a NanoWMTA (Kamal Asgar Research Center), and Bioaggregate (Innovative Bioceramix) after its exposure to a range of environmental pH conditions during hydration. Study Design: After mixing the cements under aseptic condition and based on the manufacturers` recommendations, the cements were condensed with moderate force using plugger into 9 × 6 mm split molds. Each type of cement was then randomly divided into three groups (n=10). Specimens were exposed to environments with pH values of 4.4, 7.4, or 10.4 for 3 days. Cement pellets were compressed by using an Instron testing machine. Values were recorded and compared. Data were analyzed by using one-way analysis of variance and a post hoc Tukey’s test. Results: After 3 days, the samples were solid when probed with an explorer before removing them from the molds. The greatest mean compressive strength 133.19±11.14 MPa was observed after exposure to a pH value of 10.4 for NanoWMTA. The values decreased to 111.41±8.26 MPa after exposure to a pH value of 4.4. Increasing of pH had a significant effect on the compressive strength of the groups (p<0.001). The mean compressive strength for the NanoWMTA was statistically higher than for ProRoot WMTA and Bioaggregate (p<0.001). Moreover, increasing of pH values had a significant effect on compressive strength of the experimental groups (p<0.001). Conclusion: The compressive strength of NanoWMTA was significantly higher than WMTA and Bioaggregate; the more acidic the environmental pH, the lower was the compressive strength. Key words:Compressive strength, mineral trioxide aggregate, Nano. PMID:23722137

Rapid localized heating of graphene coating on a silicon mold by induction for precision molding of polymer optics.

PubMed

Zhang, Lin; Zhou, Wenchen; Yi, Allen Y

2017-04-01

In compression molding of polymer optical components with micro/nanoscale surface features, rapid heating of the mold surface is critical for the implementation of this technology for large-scale applications. In this Letter, a novel method of a localized rapid heating process is reported. This process is based on induction heating of a thin conductive coating deposited on a silicon mold. Since the graphene coating is very thin (∼45  nm), a high heating rate of 10∼20°C/s can be achieved by employing a 1200 W 30 kHz electrical power unit. Under this condition, the graphene-coated surface and the polymer substrate can be heated above the polymer's glass transition temperature within 30 s and subsequently cooled down to room temperature within several tens of seconds after molding, resulting in an overall thermal cycle of about 3 min or shorter. The feasibility of this process was validated by fabrication of optical gratings, micropillar matrices, and microlens arrays on polymethylmethacrylate (PMMA) substrates with very high precision. The uniformity and surface geometries of the replicated optical elements are evaluated using an optical profilometer, a diffraction test setup, and a Shack-Hartmann wavefront sensor built with a molded PMMA microlens array. Compared with the conventional bulk heating molding process, this novel rapid localized induction heating process could improve replication efficiency with better geometrical fidelity.

Design of a bioresorbable polymeric scaffold for osteoblast culture

NASA Astrophysics Data System (ADS)

Ditaranto, Vincent M., Jr.

Bioresorbable polymeric scaffolds were designed for the purpose of growing rat osteosarcoma cells (ROS 17/2.8) using the compression molding method. The material used in the construction of the scaffolds was a mixture of polycaprolactone (PCL), Hydroxyapatite (HA), Glycerin (GL) and salt (NaCl) for porosity. The concentration of the several materials utilized, was determined by volume. Past research at the University of Massachusetts Lowell (UML) has successfully utilized the compression molding method for the construction of scaffolds, but was unable to accomplish the goal of long term cell survival and complete cellular proliferation throughout a three dimensional scaffold. This research investigated various concentrations of the materials and molding temperatures used for the manufacture of scaffolds in order to improve the scaffold design and address those issues. The design of the scaffold using the compression molding process is detailed in the Method and Materials section of this thesis. The porogen (salt) used for porosity was suspected as a possible source of contamination causing cell apoptosis in past studies. This research addressed the issues for cell survival and proliferation throughout a three dimensional scaffold. The leaching of the salt was one major design modification. This research successfully used ultrasonic leaching in addition to the passive method. Prior to cell culture, the scaffolds were irradiated to 2.75 Mrad, with cobalt-60 gamma radionuclide. The tissue culture consisted of two trials: (1) cell culture in scaffolds cleaned with passive leaching; (2) cell culture with scaffolds cleaned with ultrasonic leaching. Cell survival and proliferation was accomplished only with the addition of ultrasonic leaching of the scaffolds. Analysis of the scaffolds included Scanning Electron Microscopy (SEM), Nikon light microscopy and x-ray mapping of the calcium, sodium and chloride ion distribution. The cells were analyzed by Environmental Scanning Electron Microscopy (ESEM) and Nikon light microscopy. The high magnification of ESEM up to 60,000 x revealed an unexpected discovery. The osteoblasts appeared to be remodeling the PCL scaffold shown in the last two figures of this research.

Structure and Compressive Properties of Invar-Cenosphere Syntactic Foams.

PubMed

Luong, Dung; Lehmhus, Dirk; Gupta, Nikhil; Weise, Joerg; Bayoumi, Mohamed

2016-02-18

The present study investigates the mechanical performance of syntactic foams produced by means of the metal powder injection molding process having an Invar (FeNi36) matrix and including cenospheres as hollow particles at weight fractions (wt.%) of 5 and 10, respectively, corresponding to approximately 41.6 and 60.0 vol.% in relation to the metal content and at 0.6 g/cm³ hollow particle density. The synthesis process results in survival of cenospheres and provides low density syntactic foams. The microstructure of the materials is investigated as well as the mechanical performance under quasi-static and high strain rate compressive loads. The compressive stress-strain curves of syntactic foams reveal a continuous strain hardening behavior in the plastic region, followed by a densification region. The results reveal a strain rate sensitivity in cenosphere-based Invar matrix syntactic foams. Differences in properties between cenosphere- and glass microsphere-based materials are discussed in relation to the findings of microstructural investigations. Cenospheres present a viable choice as filler material in iron-based syntactic foams due to their higher thermal stability compared to glass microspheres.

Grinding aspheric and freeform micro-optical molds

NASA Astrophysics Data System (ADS)

Tohme, Yazid E.

2007-02-01

Fueled by the need for better performing optics, glass optics are now replacing plastic optics in many industrial and consumer electronic devices. One of these devices is the mobile phone camera. The optical sub-assembly in a mobile phone includes several micro lenses that are spherical and/or aspherical in shape and require form tolerances in the submicron range. These micro glass lenses are mass produced by a replication process known as glass press molding. The process entails the compression of a glass gob between two precise optical quality molds at an elevated temperature, usually near the transition temperature of the glass material. The elevated forces and temperatures required in the glass molding process limits the materials of the molds to very tough materials such as tungsten carbide or silicon carbide. These materials can withstand large pressing forces at high temperatures without any significant deformation. These materials offer great mechanical properties for glass press molding but they are also a challenge to machine to submicron accuracy. The work in this paper discusses a deterministic micro grinding manufacturing process referred to as wheel normal grinding, which is utilized to produce these optical quality molds. Wheel normal grinding is more accurate and more deterministic than most other grinding techniques and can produce molds to the form and finish tolerances required for optical molding. This method relies on the ability to recognize and compensate for grinding wheel wear and machine repeatable errors. Results will be presented to illustrate the accuracy of this micro grinding technique.

High Pressure Compression-Molding of α-Cellulose and Effects of Operating Conditions.

PubMed

Pintiaux, Thibaud; Viet, David; Vandenbossche, Virginie; Rigal, Luc; Rouilly, Antoine

2013-05-30

Commercial α-cellulose was compression-molded to produce 1A dog-bone specimens under various operating conditions without any additive. The resulting agromaterials exhibited a smooth, plastic-like surface, and constituted a suitable target as replacement for plastic materials. Tensile and three-points bending tests were conducted according to ISO standards related to the evaluation of plastic materials. The specimens had strengths comparable to classical petroleum-based thermoplastics. They also exhibited high moduli, which is characteristic of brittle materials. A higher temperature and higher pressure rate produced specimens with higher mechanical properties while low moisture content produced weaker specimens. Generally, the strong specimen had higher specific gravity and lower moisture content. However, some parameters did not follow the general trend e.g., thinner specimen showed much higher Young's Modulus, although their specific gravity and moisture content remained similar to control, revealing a marked skin-effect which was confirmed by SEM observations.

Effect of fiber orientation on tensile and impact properties of Zalacca Midrib fiber-HDPE composites by compression molding

NASA Astrophysics Data System (ADS)

Lasikun, Ariawan, Dody; Surojo, Eko; Triyono, Joko

2018-02-01

The research aims to investigate the fiber orientation effect on the tensile and impact properties of zalacca midrib fiber /HDPE composites. The composites were produced by compression molding with pressing temperature at 150°C, pressing pressure at 50 bar, and holding time of 25 minutes. The fiber orientations applied in composites were 0°, 15°, 30°, 45°, 60°, 75°, and 90°, at 10% fiber volume fraction. The samples were evaluated by using: Tensile test and Izod impact test according to ASTM D638 and ASTM D5941, respectively. The result of experiments indicate that the orientation of zalacca midrib fiber influences the characteristics of HDPE composite-zalacca midrib fiber. The composite mechanical strength decline with the increase of orientation fibers from 0° to 90°. The composite failure mode of composites are observed by Scanning Electron Microscope (SEM).

Compression Molding and Novel Sintering Treatments for Alnico Type-8 Permanent Magnets in Near-Final Shape with Preferred Orientation

NASA Astrophysics Data System (ADS)

Kassen, Aaron G.; White, Emma M. H.; Tang, Wei; Hu, Liangfa; Palasyuk, Andriy; Zhou, Lin; Anderson, Iver E.

2017-09-01

Economic uncertainty in the rare earth (RE) permanent magnet marketplace, as well as in an expanding electric drive vehicle market that favors permanent magnet alternating current synchronous drive motors, motivated renewed research in RE-free permanent magnets like "alnico," an Al-Ni-Co-Fe alloy. Thus, high-pressure, gas-atomized isotropic type-8H pre-alloyed alnico powder was compression molded with a clean burn- out binder to near-final shape and sintered to density >99% of cast alnico 8 (full density of 7.3 g/cm3). To produce aligned sintered alnico magnets for improved energy product and magnetic remanence, uniaxial stress was attempted to promote controlled grain growth, avoiding directional solidification that provides alignment in alnico 9. Successful development of solid-state powder processing may enable anisotropically aligned alnico magnets with enhanced energy density to be mass-produced.

High Pressure Compression-Molding of α-Cellulose and Effects of Operating Conditions

PubMed Central

Pintiaux, Thibaud; Viet, David; Vandenbossche, Virginie; Rigal, Luc; Rouilly, Antoine

2013-01-01

Commercial α-cellulose was compression-molded to produce 1A dog-bone specimens under various operating conditions without any additive. The resulting agromaterials exhibited a smooth, plastic-like surface, and constituted a suitable target as replacement for plastic materials. Tensile and three-points bending tests were conducted according to ISO standards related to the evaluation of plastic materials. The specimens had strengths comparable to classical petroleum-based thermoplastics. They also exhibited high moduli, which is characteristic of brittle materials. A higher temperature and higher pressure rate produced specimens with higher mechanical properties while low moisture content produced weaker specimens. Generally, the strong specimen had higher specific gravity and lower moisture content. However, some parameters did not follow the general trend e.g., thinner specimen showed much higher Young’s Modulus, although their specific gravity and moisture content remained similar to control, revealing a marked skin-effect which was confirmed by SEM observations. PMID:28809271

Thermoplastic matrix composite processing model

NASA Technical Reports Server (NTRS)

Dara, P. H.; Loos, A. C.

1985-01-01

The effects the processing parameters pressure, temperature, and time have on the quality of continuous graphite fiber reinforced thermoplastic matrix composites were quantitatively accessed by defining the extent to which intimate contact and bond formation has occurred at successive ply interfaces. Two models are presented predicting the extents to which the ply interfaces have achieved intimate contact and cohesive strength. The models are based on experimental observation of compression molded laminates and neat resin conditions, respectively. Identified as the mechanism explaining the phenomenon by which the plies bond to themselves is the theory of autohesion (or self diffusion). Theoretical predictions from the Reptation Theory between autohesive strength and contact time are used to explain the effects of the processing parameters on the observed experimental strengths. The application of a time-temperature relationship for autohesive strength predictions is evaluated. A viscoelastic compression molding model of a tow was developed to explain the phenomenon by which the prepreg ply interfaces develop intimate contact.

A programmable nanoreplica molding for the fabrication of nanophotonic devices.

PubMed

Liu, Longju; Zhang, Jingxiang; Badshah, Mohsin Ali; Dong, Liang; Li, Jingjing; Kim, Seok-min; Lu, Meng

2016-03-01

The ability to fabricate periodic structures with sub-wavelength features has a great potential for impact on integrated optics, optical sensors, and photovoltaic devices. Here, we report a programmable nanoreplica molding process to fabricate a variety of sub-micrometer periodic patterns using a single mold. The process utilizes a stretchable mold to produce the desired periodic structure in a photopolymer on glass or plastic substrates. During the replica molding process, a uniaxial force is applied to the mold and results in changes of the periodic structure, which resides on the surface of the mold. Direction and magnitude of the force determine the array geometry, including the lattice constant and arrangement. By stretching the mold, 2D arrays with square, rectangular, and triangular lattice structures can be fabricated. As one example, we present a plasmonic crystal device with surface plasmon resonances determined by the force applied during molding. In addition, photonic crystal slabs with different array patterns are fabricated and characterized. This unique process offers the capability of generating various periodic nanostructures rapidly and inexpensively.

A programmable nanoreplica molding for the fabrication of nanophotonic devices

PubMed Central

Liu, Longju; Zhang, Jingxiang; Badshah, Mohsin Ali; Dong, Liang; Li, Jingjing; Kim, Seok-min; Lu, Meng

2016-01-01

The ability to fabricate periodic structures with sub-wavelength features has a great potential for impact on integrated optics, optical sensors, and photovoltaic devices. Here, we report a programmable nanoreplica molding process to fabricate a variety of sub-micrometer periodic patterns using a single mold. The process utilizes a stretchable mold to produce the desired periodic structure in a photopolymer on glass or plastic substrates. During the replica molding process, a uniaxial force is applied to the mold and results in changes of the periodic structure, which resides on the surface of the mold. Direction and magnitude of the force determine the array geometry, including the lattice constant and arrangement. By stretching the mold, 2D arrays with square, rectangular, and triangular lattice structures can be fabricated. As one example, we present a plasmonic crystal device with surface plasmon resonances determined by the force applied during molding. In addition, photonic crystal slabs with different array patterns are fabricated and characterized. This unique process offers the capability of generating various periodic nanostructures rapidly and inexpensively. PMID:26925828

A new method of fabricating a blend scaffold using an indirect three-dimensional printing technique.

PubMed

Jung, Jin Woo; Lee, Hyungseok; Hong, Jung Min; Park, Jeong Hun; Shim, Jung Hee; Choi, Tae Hyun; Cho, Dong-Woo

2015-11-03

Due to its simplicity and effectiveness, the physical blending of polymers is considered to be a practical strategy for developing a versatile scaffold having desirable mechanical and biochemical properties. In the present work, an indirect three-dimensional (i3D) printing technique was proposed to fabricate a 3D free-form scaffold using a blend of immiscible materials, such as polycaprolactone (PCL) and gelatin. The i3D printing technique includes 3D printing of a mold and a sacrificial molding process. PCL/chloroform and gelatin/water were physically mixed to prepare the blend solution, which was subsequently injected into the cavity of a 3D printed mold. After solvent removal and gelatin cross-linking, the mold was dissolved to obtain a PCL-gelatin (PG) scaffold, with a specific 3D structure. Scanning electron microscopy and Fourier transform infrared spectroscopy analysis indicated that PCL masses and gelatin fibers in the PG scaffold homogenously coexisted without chemical bonding. Compression tests confirmed that gelatin incorporation into the PCL enhanced its mechanical flexibility and softness, to the point of being suitable for soft-tissue engineering, as opposed to pure PCL. Human adipose-derived stem cells, cultured on a PG scaffold, exhibited enhanced in vitro chondrogenic differentiation and tissue formation, compared with those on a PCL scaffold. The i3D printing technique can be used to blend a variety of materials, facilitating 3D scaffold fabrication for specific tissue regeneration. Furthermore, this convenient and versatile technique may lead to wider application of 3D printing in tissue engineering.

Effects of 401’. Phosphoric Acid Etch on the Compressive Strength of Biodentine

DTIC Science & Technology

2016-06-10

specification No. 96 for water based cements . Specimens were prepared using stainless steel cylindrical split molds with the internal dimension of 4.0...determined according to ISO 9917:2010 and ADA specification No. 96 for water based cements . Specimens were prepared using stainless steel ...Copyright Statement. ……………………………………………………………….. 26   iv   List of Figures Figure 1. Stainless Steel Cylindrical Split Molds

Analysis of the Effect of Surface Modification on Polyimide Composites Coated with Erosion Resistant Materials

NASA Technical Reports Server (NTRS)

Ndalama, Tchinga; Hirschfeld, Deidre; Sutter, James K. (Technical Monitor)

2003-01-01

The aim of this research is to enhance performance of composite coatings through modification of graphite-reinforced polyimide composite surfaces prior to metal bond coat/ hard topcoat application for use in the erosive and/or oxidative environments of advanced engines. Graphite reinforced polyimide composites, PMR-15 and PMR-II-50, formed by sheet molding and pre-pregging will be surface treated, overlaid with a bond coat and then coated with WC-Co. The surface treatment will include cleaning, RF plasma or ultraviolet light- ozone etching, and deposition of SiO(x) groups. These surface treatments will be studied in order to investigate and improve adhesion and oxidation resistance. The following panels were provided by NASA-Glenn Research Center(NASA-GRC): Eight compression molded PMR-II-50; 6 x 6 x 0.125 in. Two vacuum-bagged PMR-II-50; 12 x 12 x 0.125 in. Eight compression molded PMR-15; 6 x 6 x 0.125 in. One vacuum-bagged PMR-15; 12 x 12 x 0.125 in. All panels were made using a 12 x 12 in. T650-35 8HS (3K-tow) graphite fabric. A diamond-wafering blade, with deionized water as a cutting fluid, was used to cut PMR-II-50 and PMR-15 panels into 1 x 1 in. pieces for surface tests. The panel edges exhibiting delamination were used for the preliminary surface preparation tests as these would be unsuitable for strength and erosion testing. PMR-15 neat resin samples were also provided by NASA GRC. Surface profiles of the as-received samples were determined using a Dektak III Surface profile measuring system. Two samples of compression molded PMR-II-50 and PMR-15, vacuum-bagged PMR-II-50 and PMR-15 were randomly chosen for surface profile measurement according to ANSI/ASME B46.1. Prior to each measurement, the samples were blasted with compressed air to remove any artifacts. Five 10 mm-long scans were made on each sample. The short and long wavelength cutoff filter values were set at 100 and 1000 m, diamond stylus radius was 12.5 microns. Table 1 is a summary of the arithmetic average roughness (Ra) and waviness (Wa) for the composite surfaces.

Cross-stiffened continuous fiber structures

NASA Technical Reports Server (NTRS)

Ewen, John R.; Suarez, Jim A.

1993-01-01

Under NASA's Novel Composites for Wing and Fuselage Applications (NCWFA) program, Contract NAS1-18784, Grumman is evaluating the structural efficiency of graphite/epoxy cross-stiffened panel elements fabricated using innovative textile preforms and cost effective Resin Transfer Molding (RTM) and Resin Film Infusion (RFI) processes. Two three-dimensional woven preform assembly concepts have been defined for application to a representative window belt design typically found in a commercial transport airframe. The 3D woven architecture for each of these concepts is different; one is vertically woven in the plane of the window belt geometry and the other is loom woven in a compressed state similar to an unfolded eggcrate. The feasibility of both designs has been demonstrated in the fabrication of small test element assemblies. These elements and the final window belt assemblies will be structurally tested, and results compared.

Structural Performance of a Compressively Loaded Foam-Core Hat-Stiffened Textile Composite Panel

NASA Technical Reports Server (NTRS)

Ambur, Damodar R.; Dexter, Benson H.

1996-01-01

A structurally efficient hat-stiffened panel concept that utilizes a structural foam as a stiffener core material has been designed and developed for aircraft primary structural applications. This stiffener concept is fabricated from textile composite material forms with a resin transfer molding process. This foam-filled hat-stiffener concept is structurally more efficient than most other prismatically stiffened panel configurations in a load range that is typical for both fuselage and wing structures. The panel design is based on woven/stitched and braided graphite-fiber textile preforms, an epoxy resin system, and Rohacell foam core. The structural response of this panel design was evaluated for its buckling and postbuckling behavior with and without low-speed impact damage. The results from single-stiffener and multi-stiffener specimen tests suggest that this structural concept responds to loading as anticipated and has excellent damage tolerance characteristics compared to a similar panel design made from preimpregnated graphite-epoxy tape material.

Development of Ground Coils with Low Eddy Current Loss by Applying the Compression Molding Method after the Coil Winding

NASA Astrophysics Data System (ADS)

Suzuki, Masao; Aiba, Masayuki; Takahashi, Noriyuki; Ota, Satoru; Okada, Shigenori

In a magnetically levitated transportation (MAGLEV) system, a huge number of ground coils will be required because they must be laid for the whole line. Therefore, stable performance and reduced cost are essential requirements for the ground coil development. On the other hand, because the magnetic field changes when the superconducting magnet passes by, an eddy current will be generated in the conductor of the ground coil and will result in energy loss. The loss not only increases the magnetic resistance for the train running but also brings an increase in the ground coil temperature. Therefore, the reduction of the eddy current loss is extremely important. This study examined ground coils in which both the eddy current loss and temperature increase were small. Furthermore, quantitative comparison for the eddy current loss of various magnet wire samples was performed by bench test. On the basis of the comparison, a round twisted wire having low eddy current loss was selected as an effective ground coil material. In addition, the ground coils were manufactured on trial. A favorable outlook to improve the size accuracy of the winding coil and uneven thickness of molded resin was obtained without reducing the insulation strength between the coil layers by applying a compression molding after winding.

Silicon nitride sintered body

NASA Technical Reports Server (NTRS)

Suzuki, K.; Shinohara, N.

1984-01-01

The sintering of silicon carbide and it production are described. The method of production is by calcination in which molding is followed by sintering without compression. The invention improves the composition of the silicon carbide ceramic. Six examples of the invention are illustrated and discussed.

Macroscopic strain controlled ion current in an elastomeric microchannel

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kuo, Chin-Chang; Nguyen, Du; Buchsbaum, Steven

We report on the fabrication of an ultra-high aspect ratio ionically conductive single microchannel with tunable diameter from ≈ 20 μm to fully closed. The 4 mm-long channel is fabricated in a Polydimethylsiloxane (PDMS) mold and its cross-sectional area is controlled by applying macroscopic compressive strain to the mold in a direction perpendicular to the channel length. We investigated the ionic conduction properties of the channel. For a wide range of compressive strain up to ≈ 0.27, the strain dependence of the resistance is monotonic and fully reversible. For strain > 0.27, ionic conduction suddenly shuts off and the system becomes hystereticmore » (whereby a finite strain reduction is required to reopen the channel). Upon unloading, the original behavior is retrieved. This reversible behavior is observed over 200 compression cycles. The cross-sectional area of the channel can be inferred from the ion current measurement, as confirmed by a Nano-Computed Tomography investigation. We show that the cross-sectional area decreases monotonically with the applied compressive strain in the reversible range, in qualitative agreement with linear elasticity theory. We find that the shut-off strain is affected by the spatial extent of the applied strain, which provides additional tunability. Our tunable channel is well-suited for multiple applications in micro/nano-fluidic devices.« less

Castable plastic mold with electroplatable base

DOEpatents

Domeier, Linda A.; Morales, Alfredo M.; Gonzales, Marcela G.; Keifer, Patrick M.

2004-01-20

A sacrificial plastic mold having an electroplatable backing is provided as are methods of making such a mold via the infusion of a castable liquid formulation through a porous metal substrate (sheet, screen, mesh or foam) and into the features of a micro-scale master mold. Upon casting and demolding, the porous metal substrate is embedded within the cast formulation and projects a plastic structure with features determined by the mold tool. The plastic structure provides a sacrificial plastic mold mechanically bonded to the porous metal substrate, which provides a conducting support suitable for electroplating either contiguous or non-contiguous metal replicates. After electroplating and lapping, the sacrificial plastic can be dissolved, leaving the desired metal structure bonded to the porous metal substrate. Optionally, the electroplated structures may be debonded from the porous substrate by selective dissolution of the porous substrate or a coating thereon.

Morphological changes of the caudal cervical intervertebral foramina due to flexion-extension and compression-traction movements in the canine cervical vertebral column.

PubMed

Ramos, Renato M; da Costa, Ronaldo C; Oliveira, Andre L A; Kodigudla, Manoj K; Goel, Vijay K

2015-08-06

Previous studies in humans have reported that the dimensions of the intervertebral foramina change significantly with movement of the spine. Cervical spondylomyelopathy (CSM) in dogs is characterized by dynamic and static compressions of the neural components, leading to variable degrees of neurologic deficits and neck pain. Studies suggest that intervertebral foraminal stenosis has implications in the pathogenesis of CSM. The dimensions of the cervical intervertebral foramina may significantly change during neck movements. This could have implication in the pathogenesis of CSM and other diseases associated with radiculopathy such as intervertebral disc disease. The purpose of this study was to quantify the morphological changes in the intervertebral foramina of dogs during flexion, extension, traction, and compression of the canine cervical vertebral column. All vertebral columns were examined with magnetic resonance imaging prior to biomechanic testing. Eight normal vertebral columns were placed in Group 1 and eight vertebral columns with intervertebral disc degeneration or/and protrusion were assigned to Group 2. Molds of the left and right intervertebral foramina from C4-5, C5-6 and C6-7 were taken during all positions and loading modes. Molds were frozen and vertical (height) and horizontal (width) dimensions of the foramina were measured. Comparisons were made between neutral to flexion and extension, flexion to extension, and traction to compression in neutral position. Extension decreased all the foraminal dimensions significantly, whereas flexion increased all the foraminal dimensions significantly. Compression decreased all the foraminal dimensions significantly, and traction increased the foraminal height, but did not significantly change the foraminal width. No differences in measurements were seen between groups. Our results show movement-related changes in the dimensions of the intervertebral foramina, with significant foraminal narrowing in extension and compression.

Test results from large wing and fuselage panels

NASA Technical Reports Server (NTRS)

Madan, Ram C.; Voldman, Mike

1993-01-01

This paper presents the first results in an assessment of the strength, stiffness, and damage tolerance of stiffened wing and fuselage subcomponents. Under this NASA funded program, 10 large wing and fuselage panels, variously fabricated by automated tow placement and dry-stitched preform/resin transfer molding, are to be tested. The first test of an automated tow placement six-longeron fuselage panel under shear load was completed successfully. Using NASTRAN finite-element analysis the stiffness of the panel in the linear range prior to buckling was predicted within 3.5 percent. A nonlinear analysis predicted the buckling load within 10 percent and final failure load within 6 percent. The first test of a resin transfer molding six-stringer wing panel under compression was also completed. The panel failed unexpectedly in buckling because of inadequate supporting structure. The average strain was 0.43 percent with a line load of 20.3 kips per inch of width. This strain still exceeds the design allowable strains. Also, the stringers did not debond before failure, which is in contrast to the general behavior of unstitched panels.

The Influence of Multiple Nested Layer Waviness on the Compression Strength of Double Nested Wave Formations in a Carbon Fiber Composite Laminate

NASA Astrophysics Data System (ADS)

Khan, Z. M.; Adams, D. O.; Anas, S.

2016-01-01

As advanced composite materials having superior physical and mechanical properties are being developed, the optimization of their processing techniques is eagerly sought. One of the most common defects arising during processing of structural composites is layer waviness. The layer waviness is more pronounced in thick-section flat and cylindrical laminates, which are extensively used in large wind turbine blades, submersibles, and space platforms. The layer waviness undulates the entire layer of a multidirectional laminate in the throughthe-thickness direction, leading to a gross deterioration of its compressive strength. This research investigates the influence of multiple layer waviness in a double nest formation on the compression strength of a composite laminate. Different wave fractions of wavy 0° layers were fabricated in an IM/8551-7 carbon-epoxy composite laminate on a steel mold by using a single-step fabrication procedure. The test laminates were cured on a heated press according to the specific curing cycle of epoxy. Their static compression testing was performed using a NASA short block compression fixture on an MTS servohydraulic machine. The purpose of these tests was to determine the effects of multiple layer wave regions on the compression strength of the composite laminate. The experimental and analytical results obtained revealed that the reduction in the compression strength of composite laminate was constant after the fraction of the wavy 0° layers exceeded 35%. This analysis indicated that the percentage of the 0° wavy layer may be used to estimate the reduction in the compression strength of a double nested wave formation in a composite laminate.

Traditional Mold Analysis Compared to a DNA-based Method of Mold Analysis with Applications in Asthmatics' Homes

EPA Science Inventory

Traditional environmental mold analysis is based-on microscopic observations and counting of mold structures collected from the air on a sticky surface or culturing of molds on growth media for identification and quantification. A DNA-based method of mold analysis called mol...

Design of Revolute Joints for In-Mold Assembly Using Insert Molding.

PubMed

Ananthanarayanan, Arvind; Ehrlich, Leicester; Desai, Jaydev P; Gupta, Satyandra K

2011-12-01

Creating highly articulated miniature structures requires assembling a large number of small parts. This is a very challenging task and increases cost of mechanical assemblies. Insert molding presents the possibility of creating a highly articulated structure in a single molding step. This can be accomplished by placing multiple metallic bearings in the mold and injecting plastic on top of them. In theory, this idea can generate a multi degree of freedom structures in just one processing step without requiring any post molding assembly operations. However, the polymer material has a tendency to shrink on top of the metal bearings and hence jam the joints. Hence, until now insert molding has not been used to create articulated structures. This paper presents a theoretical model for estimating the extent of joint jamming that occurs due to the shrinkage of the polymer on top of the metal bearings. The level of joint jamming is seen as the effective torque needed to overcome the friction in the revolute joints formed by insert molding. We then use this model to select the optimum design parameters which can be used to fabricate functional, highly articulating assemblies while meeting manufacturing constraints. Our analysis shows that the strength of weld-lines formed during the in-mold assembly process play a significant role in determining the minimum joint dimensions necessary for fabricating functional revolute joints. We have used the models and methods described in this paper to successfully fabricate the structure for a minimally invasive medical robot prototype with potential applications in neurosurgery. To the best of our knowledge, this is the first demonstration of building an articulated structure with multiple degrees of freedom using insert molding.

Microstructure and Deformation Response of TRIP-Steel Syntactic Foams to Quasi-Static and Dynamic Compressive Loads

PubMed Central

Ehinger, David; Weise, Jörg; Baumeister, Joachim; Funk, Alexander; Krüger, Lutz; Martin, Ulrich

2018-01-01

The implementation of hollow S60HS glass microspheres and Fillite 106 cenospheres in a martensitically transformable AISI 304L stainless steel matrix was realized by means of metal injection molding of feedstock with varying fractions of the filler material. The so-called TRIP-steel syntactic foams were studied with respect to their behavior under quasi-static compression and dynamic impact loading. The interplay between matrix material behavior and foam structure was discussed in relation to the findings of micro-structural investigations, electron back scatter diffraction EBSD phase analyses and magnetic measurements. During processing, the cenospheres remained relatively stable retaining their shape while the glass microspheres underwent disintegration associated with the formation of pre-cracked irregular inclusions. Consequently, the AISI 304L/Fillite 106 syntactic foams exhibited a higher compression stress level and energy absorption capability as compared to the S60HS-containing variants. The α′ -martensite kinetic of the steel matrix was significantly influenced by material composition, strain rate and arising deformation temperature. The highest ferromagnetic α′-martensite phase fraction was detected for the AISI 304L/S60HS batches and the lowest for the TRIP-steel bulk material. Quasi-adiabatic sample heating, a gradual decrease in strain rate and an enhanced degree of damage controlled the mechanical deformation response of the studied syntactic foams under dynamic impact loading. PMID:29695107

Microstructure and Deformation Response of TRIP-Steel Syntactic Foams to Quasi-Static and Dynamic Compressive Loads.

PubMed

Ehinger, David; Weise, Jörg; Baumeister, Joachim; Funk, Alexander; Waske, Anja; Krüger, Lutz; Martin, Ulrich

2018-04-24

The implementation of hollow S60HS glass microspheres and Fillite 106 cenospheres in a martensitically transformable AISI 304L stainless steel matrix was realized by means of metal injection molding of feedstock with varying fractions of the filler material. The so-called TRIP-steel syntactic foams were studied with respect to their behavior under quasi-static compression and dynamic impact loading. The interplay between matrix material behavior and foam structure was discussed in relation to the findings of micro-structural investigations, electron back scatter diffraction EBSD phase analyses and magnetic measurements. During processing, the cenospheres remained relatively stable retaining their shape while the glass microspheres underwent disintegration associated with the formation of pre-cracked irregular inclusions. Consequently, the AISI 304L/Fillite 106 syntactic foams exhibited a higher compression stress level and energy absorption capability as compared to the S60HS-containing variants. The α ′ -martensite kinetic of the steel matrix was significantly influenced by material composition, strain rate and arising deformation temperature. The highest ferromagnetic α ′ -martensite phase fraction was detected for the AISI 304L/S60HS batches and the lowest for the TRIP-steel bulk material. Quasi-adiabatic sample heating, a gradual decrease in strain rate and an enhanced degree of damage controlled the mechanical deformation response of the studied syntactic foams under dynamic impact loading.

Inhibitory effect of essential oils on decay fungi and mold growth on wood

Treesearch

Vina W. Yang; Carol A. Clausen

2007-01-01

Structural damage and potential health risks caused by wood decay and mold fungi in residential structures have been a major concern for homeowners, building contractors and insurance companies alike. The combined damage from decay fungi and mold claims exceeds several billion US dollars annually. Protection against decay and mold growth on wood is a critical economic...

MOLD POLLUTION

EPA Science Inventory

Mold pollution is the growth of molds in a building resulting in a negative impact on the use of that structure. The negative impacts generally fall into two categories: destruction of the structure itself and adverse health impacts on the building's occupants. It is estimated...

Localized mold heating with the aid of selective induction for injection molding of high aspect ratio micro-features

NASA Astrophysics Data System (ADS)

Park, Keun; Lee, Sang-Ik

2010-03-01

High-frequency induction is an efficient, non-contact means of heating the surface of an injection mold through electromagnetic induction. Because the procedure allows for the rapid heating and cooling of mold surfaces, it has been recently applied to the injection molding of thin-walled parts or micro/nano-structures. The present study proposes a localized heating method involving the selective use of mold materials to enhance the heating efficiency of high-frequency induction heating. For localized induction heating, a composite injection mold of ferromagnetic material and paramagnetic material is used. The feasibility of the proposed heating method is investigated through numerical analyses in terms of its heating efficiency for localized mold surfaces and in terms of the structural safety of the composite mold. The moldability of high aspect ratio micro-features is then experimentally compared under a variety of induction heating conditions.

Optical clock signal distribution and packaging optimization

NASA Astrophysics Data System (ADS)

Wu, Linghui

Polymer-based waveguides for optoelectronic interconnects and packagings were fabricated by a fabrication process that is compatible with the Si CMOS packaging process. An optoelectronic interconnection layer (OIL) for the high-speed massive clock signal distribution for the Cray T-90 supercomputer board employing optical multimode channel waveguides in conjunction with surface-normal waveguide grating couplers and a 1-to-2 3 dB splitter was constructed. Equalized optical paths were realized using an optical H-tree structure having 48 optical fanouts. This device could be increased to 64 without introducing any additional complications. A 1-to-48 fanout H-tree structure using Ultradel 9000D series polyimide was fabricated. The propagation loss and splitting loss have been measured as 0.21 dB/cm and 0.4 dB/splitter at 850 nm. The power budget was discussed, and the H-tree waveguide fully satisfies the power budget requirement. A tapered waveguide coupler was employed to match the mode profile between the single-mode fiber and the multimode channel waveguides of the OIL. A thermo-optical based multimode switch was designed, fabricated, and tested. The finite difference method was used to simulate the thermal distribution in the polymer waveguide. Both stable and transient conditions have been calculated. The thermo-optical switch was fabricated and tested. The switching speed of 1 ms was experimentally confirmed, fitting well with the simulation results. Thermo-optic switching for randomly polarized light at wavelengths of 850 nm was experimental confirmed, as was a stable attenuation of 25 dB. The details of tapered waveguide fabrication were investigated. Compression-molded 3-D tapered waveguides were demonstrated for the first time. Not only the vertical depth variation but also the linear dimensions of the molded waveguides were well beyond the limits of what any other conventional waveguide fabrication method is capable of providing. Molded waveguides with vertical depths of 100 mum at one end and 5 mum at the other end and lengths of 1.0 cm were fabricated using a photolime gel polymer. A propagation loss of 0.5 dB/cm was achieved when light was coupled from the 5 mum x 5 mum end to the 100 mum x 100 mum end and that of 1.1 dB/cm was observed when light was coupled from the 100 mum x 100 mum end to the 5 mum x 5 mum. By confining the energy to the fundamental mode when coupling from the large end to the small end, low-loss packaging can be achieved bi-directionally. 3-D compression-molded polymeric waveguides present a promising solution to bridging the huge dynamic range of different optoelectronic device-depths varying from a few microns to several hundred microns.

33. BENCH CORE STATION, GREY IRON FOUNDRY CORE ROOM WHERE ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

33. BENCH CORE STATION, GREY IRON FOUNDRY CORE ROOM WHERE CORE MOLDS WERE HAND FILLED AND OFTEN PNEUMATICALLY COMPRESSED WITH A HAND-HELD RAMMER BEFORE THEY WERE BAKED. - Stockham Pipe & Fittings Company, Grey Iron Foundry, 4000 Tenth Avenue North, Birmingham, Jefferson County, AL

Compression Molding and Novel Sintering Treatments for Alnico Type-8 Permanent Magnets in Near-Final Shape with Preferred Orientation

DOE PAGES

Kassen, Aaron G.; White, Emma M. H.; Tang, Wei; ...

2017-07-14

We present economic uncertainty in the rare earth (RE) permanent magnet marketplace, as well as in an expanding electric drive vehicle market that favors permanent magnet alternating current synchronous drive motors, motivated renewed research in RE-free permanent magnets like “alnico,” an Al-Ni-Co-Fe alloy. Thus, high-pressure, gas-atomized isotropic type-8H pre-alloyed alnico powder was compression molded with a clean burn-out binder to near-final shape and sintered to density >99% of cast alnico 8 (full density of 7.3 g/cm 3). To produce aligned sintered alnico magnets for improved energy product and magnetic remanence, uniaxial stress was attempted to promote controlled grain growth, avoidingmore » directional solidification that provides alignment in alnico 9. Lastly, successful development of solid-state powder processing may enable anisotropically aligned alnico magnets with enhanced energy density to be mass-produced.« less

High resolution PFPE-based molding High resolution PFPE-based molding High resolution PFPE-based molding techniques for nanofabrication of high pattern density sub-20 nm features: A fundamental materials approach

DOE Office of Scientific and Technical Information (OSTI.GOV)

Williams, Stuart S; Samulski, Edward; Lopez, Renee

2010-01-01

ABSTRACT. Described herein is the development and investigation of PFPE-based elastomers for high resolution replica molding applications. The modulus of the elastomeric materials was increased through synthetic and additive approaches while maintaining relatively low surface energies (<25 mN/m). Using practically relevant large area master templates, we show that the resolution of the molds is strongly dependant upon the elastomeric mold modulus. A composite mold approach was used to form flexible molds out of stiff, high modulus materials that allow for replication of sub-20 nm post structures. Sub-100 nm line grating master templates, formed using e-beam lithography, were used to determinemore » the experimental stability of the molding materials. It was observed that as the feature spacing decreased, high modulus composite molds were able to effectively replicate the nano-grating structures without cracking or tear-out defects that typically occur with high modulus elastomers.« less

Performance of resin transfer molded multiaxial warp knit composites

NASA Technical Reports Server (NTRS)

Dexter, H. Benson; Hasko, Gregory H.

1993-01-01

Composite materials that are subjected to complex loads have traditionally been fabricated with multidirectionally oriented prepreg tape materials. Some of the problems associated with this type of construction include low delamination resistance, poor out-of-plane strength, and labor intensive fabrication processes. Textile reinforced composites with through-the-thickness reinforcement have the potential to solve some of these problems. Recently, a relatively new class of noncrimp fabrics designated as multiaxial warp knits have been developed to minimize some of the high cost and damage tolerance concerns. Multiple stacks of warp knit fabrics can be knitted or stitched together to reduce layup labor cost. The through-the-thickness reinforcement can provide significant improvements in damage tolerance and out-of-plane strength. Multilayer knitted/stitched preforms, in conjunction with resin transfer molding (RTM), offer potential for significant cost savings in fabrication of primary aircraft structures. The objectives of this investigation were to conduct RTM processing studies and to characterize the mechanical behavior of composites reinforced with three multiaxial warp knit fabrics. The three fabrics investigated were produced by Hexcel and Milliken in the United States, and Saerbeck in Germany. Two resin systems, British Petroleum E9O5L and 3M PR 500, were characterized for RTM processing. The performance of Hexcel and Milliken quasi-isotropic knitted fabrics are compared to conventional prepreg tape laminates. The performance of the Saerbeck fabric is compared to uniweave wing skin layups being investigated by Douglas Aircraft Company in the NASA Advanced Composites Technology (ACT) program. Tests conducted include tension, open hole tension, compression, open hole compression, and compression after impact. The effects of fabric defects, such as misaligned fibers and gaps between tows, on material performance are also discussed. Estimated material and labor cost savings are projected for the Saerbeck fabric as compared to uniweave fabric currently being used by Douglas in the NASA ACT wing development program.

The Influence of Phase Change Materials on the Properties of Self-Compacting Concrete.

PubMed

Fenollera, María; Míguez, José Luis; Goicoechea, Itziar; Lorenzo, Jaime; Ángel Álvarez, Miguel

2013-08-15

The aim of this paper is to research new thermally-efficient concrete walls, analyzing the mechanical behavior of a self-compacting concrete to manufacture an uncoated solid structural panel, with the incorporation of a micro-encapsulated phase change material as additive. Different dosages are tested and mechanical properties of the product obtained from the molding of concrete specimens are evaluated, testing mechanical compressive strength, slump flow, and density. The results reveal the optimum percentage of additive in the mixture that enables compliance with the technical specifications required by the product to be manufactured. A test is also performed for measuring the thermal conductivity for the optimal sample obtained and it evidences the reduction thereof.

Wooden wind turbine blade manufacturing process

DOEpatents

Coleman, Clint

1986-01-01

A wooden wind turbine blade is formed by laminating wood veneer in a compression mold having the exact curvature needed for one side of the blade, following which the other side of the blade is ground flat along its length but twisted with respect to the blade axis.

Fabrication of low-cost beta-type Ti-Mn alloys for biomedical applications by metal injection molding process and their mechanical properties.

PubMed

Santos, Pedro Fernandes; Niinomi, Mitsuo; Liu, Huihong; Cho, Ken; Nakai, Masaaki; Itoh, Yoshinori; Narushima, Takayuki; Ikeda, Masahiko

2016-06-01

Titanium and its alloys are suitable for biomedical applications owing to their good mechanical properties and biocompatibility. Beta-type Ti-Mn alloys (8-17 mass% Mn) were fabricated by metal injection molding (MIM) as a potential low cost material for use in biomedical applications. The microstructures and mechanical properties of the alloys were evaluated. For up to 13 mass% Mn, the tensile strength (1162-938MPa) and hardness (308-294HV) of the MIM fabricated alloys are comparable to those of Ti-Mn alloys fabricated by cold crucible levitation melting. Ti-9Mn exhibits the best balance of ultimate tensile strength (1046MPa) and elongation (4.7%) among the tested alloys, and has a Young's modulus of 89GPa. The observed low elongation of the alloys is attributed to the combined effects of high oxygen content, with the presence of interconnected pores and titanium carbides, the formation of which is due to carbon pickup during the debinding process. The elongation and tensile strength of the alloys decrease with increasing Mn content. The Ti-Mn alloys show good compressive properties, with Ti-17Mn showing a compressive 0.2% proof stress of 1034MPa, and a compressive strain of 50%. Copyright © 2016 Elsevier Ltd. All rights reserved.

Design Investigation on Applicable Mesh Structures for Medical Stent Applications

NASA Astrophysics Data System (ADS)

Asano, Shoji; He, Jianmei

2017-11-01

In recent years, utilization of medical stents is one of effective treatments for stenosis and occlusion occurring in a living body’s lumen indispensable for maintenance of human life such as superficial femoral artery (SFA) occlusion. However, there are concerns about the occurrence of fatigue fractures caused by stress concentrations, neointimal hyperplasia and the like due to the shape structure and the manufacturing method in the conventional stents, and a stent having high strength and high flexibility is required. Therefore, in this research, applicable mesh structures for medical stents based on the design concepts of high strength, high flexibility are interested to solve various problem of conventional stent. According to the shape and dimensions of SFA occlusion therapy stent and indwelling delivery catheter, shape design of the meshed stent are performed using 3-dimensional CAD software Solid Works first. Then analytical examination on storage characteristics and compression characteristics of such mesh structure applied stent models were carried out through finite element analysis software ANSYS Workbench. Meshed stent models with higher strength and higher flexibility with integral molding are investigated analytically. It was found that the storage characteristics and compression characteristics of meshed stent modles are highly dependent on the basic mesh shapes with same surface void ratio. Trade-off relationship between flexibility and storage characteristics is found exited, it is required to provide appropriate curvatures during basic mesh shape design.

Flow Kills Conductivity of Single Wall Carbon Nanotubes (SWNT) Composites

NASA Astrophysics Data System (ADS)

Bhatt, Sanjiv; Macosko, Christopher

2006-03-01

Most composites of polymer and single wall carbon nanotubes (SWNT) reported in the literature are made by solvent casting or simple compression molding. Commercial utility of these composites requires use of precision injection molding. We have observed a unique behavior wherein the SWNT composites made by injection molding or by extrusion are insulators but upon heating become electrically conductive. This behavior appears to be the result of a relaxation phenomenon in the SWNT composite. During flow into an injection mold or through an extrusion die the well-dispersed SWNT in the polymer matrix tend to align such that they are not in contact with each other and are farther than the minimum required distance, 5 nm (1), to achieve electrical percolation through electron hopping. Upon heating the SWNT relax and either touch each other or are at a distance less than or equal to 5 nm from each other to create a percolating. [1] Du, F., Scogna, R, C., Zhou, W., Brand, Stijn, Fischer, J. E., and Winey, K. I., Macromolecules 2004, 37, 9048-9055.

ILLUSTRATED HANDBOOK OF SOME COMMON MOLDS.

ERIC Educational Resources Information Center

CHANDLER, MARION N.

THIS DOCUMENT IS A PICTURE GUIDE FOR THE IDENTIFICATION OF TEN COMMON MOLDS. IT IS DESIGNED FOR USE WITH THE ELEMENTARY SCIENCE STUDY UNIT "MICROGARDENING" AND IS SUGGESTED FOR UPPER ELEMENTARY GRADES. INCLUDED FOR EACH MOLD ARE COLOR PHOTOGRAPHS AND PHOTOMICROGRAPHS OF THE INTACT MOLD MASS AND OF THE MOLD'S SPORE PRODUCING STRUCTURES.…

Mechanical properties and biocompatibility of melt processed, self-reinforced ultrahigh molecular weight polyethylene.

PubMed

Huang, Yan-Fei; Xu, Jia-Zhuang; Li, Jian-Shu; He, Ben-Xiang; Xu, Ling; Li, Zhong-Ming

2014-08-01

The low efficiency of fabrication of ultrahigh molecular weight polyethylene (UHMWPE)-based artificial knee joint implants is a bottleneck problem because of its extremely high melt viscosity. We prepared melt processable UHMWPE (MP-UHMWPE) by addition of 9.8 wt% ultralow molecular weight polyethylene (ULMWPE) as a flow accelerator. More importantly, an intense shear flow was applied during injection molding of MP-UHMWPE, which on one hand, promoted the self-diffusion of UHMWPE chains, thus effectively reducing the structural defects; on the other hand, increased the overall crystallinity and induced the formation of self-reinforcing superstructure, i.e., interlocked shish-kebabs and oriented lamellae. Aside from the good biocompatibility, and the superior fatigue and wear resistance to the compression-molded UHMWPE, the injection-molded MP-UHMWPE exhibits a noteworthy enhancement in tensile properties and impact strength, where the yield strength increases to 46.3 ± 4.4 MPa with an increment of 128.0%, the ultimate tensile strength and Young's modulus rise remarkably up to 65.5 ± 5.0 MPa and 1248.7 ± 45.3 MPa, respectively, and the impact strength reaches 90.6 kJ/m(2). These results suggested such melt processed and self-reinforced UHMWPE parts hold a great application promise for use of knee joint implants, particularly for younger and more active patients. Our work sets up a new method to fabricate high-performance UHMWPE implants by tailoring the superstructure during thermoplastic processing. Copyright © 2014 Elsevier Ltd. All rights reserved.

Method of making a wooden wind turbine blade

DOEpatents

Coleman, Clint

1984-01-01

A wooden wind turbine blade is formed by laminating wood veneer in a compression mold having the exact curvature needed for one side of the blade, following which the other side of the blade is ground flat along its length but twisted with respect to the blade axis.

Method of making a wooden wind turbine blade

DOEpatents

Coleman, C.

1984-08-14

A wooden wind turbine blade is formed by laminating wood veneer in a compression mold having the exact curvature needed for one side of the blade, following which the other side of the blade is ground flat along its length but twisted with respect to the blade axis. 8 figs.

Polymer composites prepared from heat-treated starch and styrene-butadiene latex

USDA-ARS?s Scientific Manuscript database

Thermoplastic starch/latex polymer composites were prepared using styrene–butadiene (SB) latex and heat-treated cornstarch. The composites were prepared in a compression mold at 130 °C, with starch content 20%. An amylose-free cornstarch, waxy maize, was used for this research and the heat treatment...

Determination of Machining Parameters of Corn Byproduct Filled Plastics

USDA-ARS?s Scientific Manuscript database

In a collaborative project between the USDA and Northern Illinois University, the use of ethanol corn processing by-products as bio-filler materials in the compression molding of phenolic plastics has been studied. This paper reports on the results of a machinability study in the milling of various ...

Determining Machining Parameters of Corn Byproduct Filled Plastics

USDA-ARS?s Scientific Manuscript database

In a collaborative project between the USDA and Northern Illinois University, the use of corn ethanol processing byproducts (i.e., DDGS) as bio-filler materials in the compression molding of phenolic plastics has been studied. This paper reports on the results of a machinability study in the milling...

High temperature resin matrix composites for aerospace structures

NASA Technical Reports Server (NTRS)

Davis, J. G., Jr.

1980-01-01

Accomplishments and the outlook for graphite-polyimide composite structures are briefly outlined. Laminates, skin-stiffened and honeycomb sandwich panels, chopped fiber moldings, and structural components were fabricated with Celion/LARC-160 and Celion/PMR-15 composite materials. Interlaminar shear and flexure strength data obtained on as-fabricated specimens and specimens that were exposed for 125 hours at 589 K indicate that epoxy sized and polyimide sized Celion graphite fibers exhibit essentially the same behavior in a PMR-15 matrix composite. Analyses and tests of graphite-polyimide compression and shear panels indicate that utilization in moderately loaded applications offers the potential for achieving a 30 to 50 percent reduction in structural mass compared to conventional aluminum panels. Data on effects of moisture, temperature, thermal cycling, and shuttle fluids on mechanical properties indicate that both LARC-160 and PMR-15 are suitable matrix materials for a graphite-polyimide aft body flap. No technical road blocks to building a graphite-polyimide composite aft body flap are identified.

Sacrificial plastic mold with electroplatable base

DOEpatents

Domeier, Linda A.; Hruby, Jill M.; Morales, Alfredo M.

2002-01-01

A sacrificial plastic mold having an electroplatable backing is provided. One embodiment consists of the infusion of a softened or molten thermoplastic through a porous metal substrate (sheet, screen, mesh or foam) and into the features of a micro-scale molding tool contacting the porous metal substrate. Upon demolding, the porous metal substrate will be embedded within the thermoplastic and will project a plastic structure with features determined by the mold tool. This plastic structure, in turn, provides a sacrificial plastic mold mechanically bonded to the porous metal substrate which provides a conducting support suitable for electroplating either contiguous or non-contiguous metal replicates. After electroplating and lapping, the sacrificial plastic can be dissolved to leave the desired metal structure bonded to the porous metal substrate. Optionally, the electroplated structures may be debonded from the porous substrate by selective dissolution of the porous substrate or a coating thereon.

Sacrificial Plastic Mold With Electroplatable Base

DOEpatents

Domeier, Linda A.; Hruby, Jill M.; Morales, Alfredo M.

2005-08-16

A sacrificial plastic mold having an electroplatable backing is provided. One embodiment consists of the infusion of a softened or molten thermoplastic through a porous metal substrate (sheet, screen, mesh or foam) and into the features of a micro-scale molding tool contacting the porous metal substrate. Upon demolding, the porous metal substrate will be embedded within the thermoplastic and will project a plastic structure with features determined by the mold tool. This plastic structure, in turn, provides a sacrificial plastic mold mechanically bonded to the porous metal substrate which provides a conducting support suitable for electroplating either contiguous or non-contiguous metal replicates. After electroplating and lapping, the sacrificial plastic can be dissolved to leave the desired metal structure bonded to the porous metal substrate. Optionally, the electroplated structures may be debonded from the porous substrate by selective dissolution of the porous substrate or a coating thereon.

Fabrication of high aspect ratio nanopillars and micro/nano combined structures with hydrophobic surface characteristics by injection molding

NASA Astrophysics Data System (ADS)

Zhou, Mingyong; Xiong, Xiang; Jiang, Bingyan; Weng, Can

2018-01-01

Polymer products with micro/nano-structures have excellent mechanical and optical properties, chemical resistance, and other advantages. Injection molding is one of the most potential techniques to fabricate polymer products with micro/nano-structures artificially in large numbers. In this study, a surface approach to fabricate high aspect ratio nanopillars and micro/nano combined structures was presented. Mold insert with micropillar arrays and nanopillars on its surface was prepared by combing anodic aluminum oxide (AAO) template and etched plate. Anti-sticking modification was done on the template to realize a better demolding quality. The influences of mold temperature and polymer material on the final replication quality were investigated. The results showed that the final replication quality of high aspect ratio nanopillars was greatly improved as compared with the unprocessed template. Polymer with low elongation at break was not suitable to fabricate structures with high aspect ratio via injection molding. For polypropylene surface, the experimental results of static contact angles were almost consistent with Cassie-Baxter equation. When the mold temperature reached 178 °C, hair-like polycarbonate nanopillars were observed, resulting in an excellent hydrophobic characteristic.

Additive technology of soluble mold tooling for embedded devices in composite structures: A study on manufactured tolerances

NASA Astrophysics Data System (ADS)

Roy, Madhuparna

Composite textiles have found widespread use and advantages in various industries and applications. The constant demand for high quality products and services requires companies to minimize their manufacturing costs, and delivery time in order to compete in general and niche marketplaces. Advanced manufacturing methods aim to provide economical methods of mold production. Creation of molding and tooling options for advanced composites encompasses a large portion of the fabrication time, making it a costly process and restraining factor. This research discusses a preliminary investigation into the use of soluble polymer compounds and additive manufacturing to fabricate soluble molds. These molds suffer from dimensional errors due to several factors, which have also been characterized. The basic soluble mold of a composite is 3D printed to meet the desired dimensions and geometry of holistic structures or spliced components. The time taken to dissolve the mold depends on the rate of agitation of the solvent. This process is steered towards enabling the implantation of optoelectronic devices within the composite to provide sensing capability for structural health monitoring. The shape deviation of the 3D printed mold is also studied and compared to its original dimensions to optimize the dimensional quality to produce dimensionally accurate parts. Mechanical tests were performed on compact tension (CT) resin samples prepared from these 3D printed molds and revealed crack propagation towards an embedded intact optical fiber.

Contact Behavior of Composite CrTiSiN Coated Dies in Compressing of Mg Alloy Sheets under High Pressure

PubMed Central

Yang, T.S.; Yao, S.H.; Chang, Y.Y.; Deng, J.H.

2018-01-01

Hard coatings have been adopted in cutting and forming applications for nearly two decades. The major purpose of using hard coatings is to reduce the friction coefficient between contact surfaces, to increase strength, toughness and anti-wear performance of working tools and molds, and then to obtain a smooth work surface and an increase in service life of tools and molds. In this report, we deposited a composite CrTiSiN hard coating, and a traditional single-layered TiAlN coating as a reference. Then, the coatings were comparatively studied by a series of tests. A field emission SEM was used to characterize the microstructure. Hardness was measured using a nano-indentation tester. Adhesion of coatings was evaluated using a Rockwell C hardness indentation tester. A pin-on-disk wear tester with WC balls as sliding counterparts was used to determine the wear properties. A self-designed compression and friction tester, by combining a Universal Testing Machine and a wear tester, was used to evaluate the contact behavior of composite CrTiSiN coated dies in compressing of Mg alloy sheets under high pressure. The results indicated that the hardness of composite CrTiSiN coating was lower than that of the TiAlN coating. However, the CrTiSiN coating showed better anti-wear performance. The CrTiSiN coated dies achieved smooth surfaces on the Mg alloy sheet in the compressing test and lower friction coefficient in the friction test, as compared with the TiAlN coating. PMID:29316687

Contact Behavior of Composite CrTiSiN Coated Dies in Compressing of Mg Alloy Sheets under High Pressure.

PubMed

Yang, T S; Yao, S H; Chang, Y Y; Deng, J H

2018-01-08

Hard coatings have been adopted in cutting and forming applications for nearly two decades. The major purpose of using hard coatings is to reduce the friction coefficient between contact surfaces, to increase strength, toughness and anti-wear performance of working tools and molds, and then to obtain a smooth work surface and an increase in service life of tools and molds. In this report, we deposited a composite CrTiSiN hard coating, and a traditional single-layered TiAlN coating as a reference. Then, the coatings were comparatively studied by a series of tests. A field emission SEM was used to characterize the microstructure. Hardness was measured using a nano-indentation tester. Adhesion of coatings was evaluated using a Rockwell C hardness indentation tester. A pin-on-disk wear tester with WC balls as sliding counterparts was used to determine the wear properties. A self-designed compression and friction tester, by combining a Universal Testing Machine and a wear tester, was used to evaluate the contact behavior of composite CrTiSiN coated dies in compressing of Mg alloy sheets under high pressure. The results indicated that the hardness of composite CrTiSiN coating was lower than that of the TiAlN coating. However, the CrTiSiN coating showed better anti-wear performance. The CrTiSiN coated dies achieved smooth surfaces on the Mg alloy sheet in the compressing test and lower friction coefficient in the friction test, as compared with the TiAlN coating.

Processing and Characterization of Cellulose Nanocrystals/Polylactic Acid Nanocomposite Films

Treesearch

Erin Sullivan; Robert Moon; Kyriaki Kalaitzidou

2015-01-01

The focus of this study is to examine the effect of cellulose nanocrystals (CNC) on the properties of polylactic acid (PLA) films. The films are fabricated via melt compounding and melt fiber spinning followed by compression molding. Film fracture morphology, thermal properties, crystallization behavior, thermo-mechanical behavior, and mechanical behavior were...

Composite hub/metal blade compressor rotor

NASA Technical Reports Server (NTRS)

Yao, S.

1978-01-01

A low cost compressor rotor was designed and fabricated for a small jet engine. The rotor hub and blade keepers were compression molded with graphite epoxy. Each pair of metallic blades was held in the hub by a keeper. All keepers were locked in the hub with circumferential windings. Feasibility of fabrication was demonstrated in this program.

Significant aspects on thermal degradation of hybrid biocomposite material

NASA Astrophysics Data System (ADS)

Bavan, D. Saravana; Kumar, G. C. Mohan

2013-06-01

Interest in use of bio fibers is increasing rapidly in structural and automotive applications because of few important properties such as low density, mechanical properties, renewability, biodegradation and sustainability. The present work is focused on fabricating a hybrid bio-composite material processed through compression molding technique. Natural fibers of maize and jute with bio polymeric resin of epoxidized soya bean oil are used as a matrix in obtaining a hybrid bio composite material. Thermal degradation of the prepared material is studied through Thermal gravimetric analyzer. Chemical treatment of the fibers was performed to have a better adhesion between the fibers and the matrix. The work is also surveyed on various parameters influencing the thermal properties and other aspects for a hybrid bio composite material.

The Influence of Phase Change Materials on the Properties of Self-Compacting Concrete

PubMed Central

Fenollera, María; Míguez, José Luis; Goicoechea, Itziar; Lorenzo, Jaime; Ángel Álvarez, Miguel

2013-01-01

The aim of this paper is to research new thermally-efficient concrete walls, analyzing the mechanical behavior of a self-compacting concrete to manufacture an uncoated solid structural panel, with the incorporation of a micro-encapsulated phase change material as additive. Different dosages are tested and mechanical properties of the product obtained from the molding of concrete specimens are evaluated, testing mechanical compressive strength, slump flow, and density. The results reveal the optimum percentage of additive in the mixture that enables compliance with the technical specifications required by the product to be manufactured. A test is also performed for measuring the thermal conductivity for the optimal sample obtained and it evidences the reduction thereof. PMID:28811450

Response of resin transfer molded (RTM) composites under reversed cyclic loading

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mahfuz, H.; Haque, A.; Yu, D.

1996-01-01

Compressive behavior and the tension-compression fatigue response of resin transfer molded IM7 PW/PR 500 composite laminate with a circular notch have been studied. Fatigue damage characteristics have been investigated through the changes in the laminate strength and stiffness by gradually incrementing the fatigue cycles at a preselected load level. Progressive damage in the surface of the laminate during fatigue has been investigated using cellulose replicas. Failure mechanisms during static and cyclic tests have been identified and presented in detail. Extensive debonding of filaments and complete fiber bundle fracture accompanied by delamination were found to be responsible for fatigue failures, whilemore » fiber buckling, partial fiber fracture and delamination were characterized as the failure modes during static tests. Weibull analysis of the static, cyclic and residual tests have been performed and described in detail. Fractured as well as untested specimens were C-scanned, and the progressive damage growth during fatigue is presented. Optical Microscopy (OM) and Scanning Electron Microscopy (SEM) for the fractured specimen were also performed and the analysis of the failure behavior is presented.« less

Fabrication Of Carbon-Boron Reinforced Dry Polymer Matrix Composite Tape

NASA Technical Reports Server (NTRS)

Belvin, Harry L.; Cano, Roberto J.; Treasure, Monte; Shahood, Thomas W.

1999-01-01

Future generation aerospace vehicles will require specialized hybrid material forms for component structure fabrication. For this reason, high temperature composite prepregs in both dry and wet forms are being developed at NASA Langley Research Center (LaRC). In an attempt to improve compressive properties of carbon fiber reinforced composites, a hybrid carbon-boron tape was developed and used to fabricate composite laminates which were subsequently cut into flexural and compression specimens and tested. The hybrid material, given the designation HYCARB, was fabricated by modifying a previously developed process for the manufacture of dry polymer matrix composite (PMC) tape at LaRC. In this work, boron fibers were processed with IM7/LaRC(TradeMark)IAX poly(amide acid) solution-coated prepreg to form a dry hybrid tape for Automated Tow Placement (ATP). Boron fibers were encapsulated between two (2) layers of reduced volatile, low fiber areal weight poly(amide acid) solution-coated prepreg. The hybrid prepreg was then fully imidized and consolidated into a dry tape suitable for ATP. The fabrication of a hybrid boron material form for tow placement aids in the reduction of the overall manufacturing cost of boron reinforced composites, while realizing the improved compression strengths. Composite specimens were press-molded from the hybrid material and exhibited excellent mechanical properties.

Know your fibers : process and properties, or, a material science approach to designing pulp molded products

Treesearch

John F. Hunt

1998-01-01

The following results are preliminary, but show some basic information that will be used in an attempt to model pulp molded structures so that by measuring several basic fundamental properties of a fiber furnish and specifying process conditions, a molded structure could be designed for a particular performance need.

Large structural, thin-wall castings made of metals subject to hot tearing, and their fabrication

NASA Technical Reports Server (NTRS)

Smashey, Russell W. (Inventor)

2001-01-01

An article, such as a gas turbine engine mixer, is made by providing a mold structure defining a thin-walled, hollow article, and a base metal that is subject to hot tear cracking when cast in a generally equiaxed polycrystalline form, such as Rene' 108 and Mar-M247. The article is fabricated by introducing the molten base metal into the mold structure, and directionally solidifying the base metal in the mold structure to form a directionally oriented structure. The directionally oriented structure may be formed of a single grain or oriented multiple grains.

Comparison of The Dimensional Stability of Kel-F 81 and Neoflon CTFE M400H Polychlorotrifluoroethylenes Used in Valve Seat Application

NASA Technical Reports Server (NTRS)

Waller, Jess M.; Beeson, Harold D.; Newton, Barry E.; Fries, Joseph (Technical Monitor)

2000-01-01

The dimensional stability of polychlorotrifluoroethylene (PCTFE) valve seats used in oxygen regulator applications was determined by thermomechanical analysis (TMA). Two traceable grades of PCTFE were tested; Kel-F 81 and Neoflon CTFE M400H. For these particular resins, the effect of percent crystallinity, zero strength time (ZST) molecular weight, resin grade, process history (compression-molded versus extruded) on the dimensional stability and annealing behavior was determined. In addition to the traceable Kel-F 81 and Neoflon CTFE M400H grades, actual PCI'PH valve seats of differing geometry and design were tested by TMA. The PCTFE valve seats were of unspecified resin grade, although certain inferences about the grade could be drawn based on knowledge of the valve seat fabrication date. Results consistently revealed dimensional instability of varying magnitude at temperatures ranging from 40 to 70 degrees Celsius. Furthermore, some of the pre- 1 995 seats appeared to be more dimensionally stable than those fabricated after 1995. The TMA results are discussed in the context of several proposed ignition mechanisms; namely, particle impact, presence of contaminant oils and fibers, and localized heating by flow friction and/or resonance. The effect of metal constraint on the dimensional stability of PCTFE is also discussed. Finally, the effect of percent crystallinity, ZST molecular weight, resin grade, process history (compression-molded versus extruded) on the AIT, delta Hc and impact sensitivity of various types of Neoflon CTFE M400H was determined using Kel-F 81 as a control. Results show that the AIT, delta Hc and impact sensitivity were essentially independent of Neoflon CTFE process history and structure.

Mechanical and toxicological evaluation of concrete artifacts containing waste foundry sand.

PubMed

Mastella, Miguel Angelo; Gislon, Edivelton Soratto; Pelisser, Fernando; Ricken, Cláudio; da Silva, Luciano; Angioletto, Elídio; Montedo, Oscar Rubem Klegues

2014-08-01

The creation of metal parts via casting uses molds that are generally made from sand and phenolic resin. The waste generated after the casting process is called waste foundry sand (WFS). Depending on the mold composition and the casting process, WFS can contain substances that prevent its direct emission to the environment. In Brazil, this waste is classified according to the Standard ABNT NBR 10004:2004 as a waste Class II (Non-Inert). The recycling of this waste is limited because its characteristics change significantly after use. Although the use (or reuse) of this byproduct in civil construction is a technically feasible alternative, its effects must be evaluated, especially from mechanical and environmental points of view. Thus, the objective of this study is to investigate the effect of the use of WFS in the manufacture of cement artifacts, such as masonry blocks for walls, structural masonry blocks, and paving blocks. Blocks containing different concentrations of WFS (up to 75% by weight) were produced and evaluated using compressive strength tests (35 MPa at 28 days) and toxicity tests on Daphnia magna, Allium cepa (onion root), and Eisenia foetida (earthworm). The results showed that there was not a considerable reduction in the compressive strength, with values of 35 ± 2 MPa at 28 days. The toxicity study with the material obtained from leaching did not significantly interfere with the development of D. magna and E. foetida, but the growth of the A. cepa species was reduced. The study showed that the use of this waste in the production of concrete blocks is feasible from both mechanical and environmental points of view. Copyright © 2014 Elsevier Ltd. All rights reserved.

Mold Flux Crystallization and Mold Thermal Behavior

NASA Astrophysics Data System (ADS)

Peterson, Elizabeth Irene

Mold flux plays a small but critical role in the continuous casting of steel. The carbon-coated powder is added at the top of the water-cooled copper mold, over time it melts and infiltrates the gap between the copper mold and the solidifying steel strand. Mold powders serve five primary functions: (1) chemical insulation, (2) thermal insulation, (3) lubrication between the steel strand and mold, (4) absorption of inclusions, and (5) promotion of even heat flux. All five functions are critical to slab casting, but surface defect prevention is primarily controlled through even heat flux. Glassy fluxes have high heat transfer and result in a thicker steel shell. Steels with large volumetric shrinkage on cooling must have a crystalline flux to reduce the radiative heat transfer and avoid the formation of cracks in the shell. Crystallinity plays a critical role in steel shell formation, therefore it is important to study the thermal conditions that promote each phase and its morphology. Laboratory tests were performed to generate continuous cooling transformation (CCT) and time-temperature-transformation (TTT) diagrams. Continuous cooling transformation tests were performed in an instrumented eight cell step chill mold. Results showed that cuspidine was the only phase formed in conventional fluxes and all observed structures were dendritic. An isothermal tin bath quench method was also developed to isothermally age glassy samples. Isothermal tests yielded different microstructures and different phases than those observed by continuous cooling. Comparison of aged tests with industrial flux films indicates similar faceted structures along the mold wall, suggesting that mold flux first solidifies as a glass along the mold wall, but the elevated temperature devitrifies the glassy structure forming crystals that cannot form by continuous cooling.

Study on axial strength of a channel-shaped pultruded GFRP member

NASA Astrophysics Data System (ADS)

Matsumoto, Yukihiro; Satake, Chito; Nisida, Kenji

2017-10-01

Fiber reinforced polymers (FRP) are widely used in vehicle and aerospace applications because of their lightweight and high-strength characteristics. Additionally, FRPs are increasingly applied to building structures. However, the elastic modulus of glass fiber reinforced polymers (GFRPs) is lower than that of steel. Hence, the evaluating the buckling strength of GFRP members for design purpose is necessary. The buckling strength is determined by Euler buckling mode as well as local buckling. In this study investigated the compressive strength of GFRP members subjected to axial compression through experiments and theoretical calculations. The adopted GFRP member was a channel-shaped GFRP, which was molded via pultrusion, at various lengths. Although, the mechanical properties as longitudinal elastic modulus and fiber volume fraction and strength of GFRP members subjected, to axial can be easily evaluated, evaluating transverse elastic modulus and shear modulus in typical material tests is difficult in standard section. Therefore the composite law was used in this study. As a result, we confirmed that the axial strength of a GFRP member could be calculated by a theoretical evaluation method utilizing longitudinal elastic modulus and fiber volume fraction.

Modeling rock specimens through 3D printing: Tentative experiments and prospects

NASA Astrophysics Data System (ADS)

Jiang, Quan; Feng, Xiating; Song, Lvbo; Gong, Yahua; Zheng, Hong; Cui, Jie

2016-02-01

Current developments in 3D printing (3DP) technology provide the opportunity to produce rock-like specimens and geotechnical models through additive manufacturing, that is, from a file viewed with a computer to a real object. This study investigated the serviceability of 3DP products as substitutes for rock specimens and rock-type materials in experimental analysis of deformation and failure in the laboratory. These experiments were performed on two types of materials as follows: (1) compressive experiments on printed sand-powder specimens in different shapes and structures, including intact cylinders, cylinders with small holes, and cuboids with pre-existing cracks, and (2) compressive and shearing experiments on printed polylactic acid cylinders and molded shearing blocks. These tentative tests for 3DP technology have exposed its advantages in producing complicated specimens with special external forms and internal structures, the mechanical similarity of its product to rock-type material in terms of deformation and failure, and its precision in mapping shapes from the original body to the trial sample (such as a natural rock joint). These experiments and analyses also successfully demonstrate the potential and prospects of 3DP technology to assist in the deformation and failure analysis of rock-type materials, as well as in the simulation of similar material modeling experiments.

Controle de la morphologie d'hydrogels poreux a partir de structures polymeres

NASA Astrophysics Data System (ADS)

Esquirol, Anne-Laure

This master thesis presents a new fabrication method to prepare hydrogels with fully interconnected and tunable macropore networks prepared with co-continuous polymer blends. The main contributions are: (1) a hydrogel fabrication process providing a high control over the average pore size diameter, their volume fraction and their interconnectivity; (2) the microstructural characterization of porous hydrogels with new techniques such as X-ray microtomography and (3) the preparation of porous gels with industrial equipment such as extruders and injection molding presses. The development and improvement of methods and techniques to prepare porous polymers and porous gels have been intensive areas of research in materials science over the past 20 years because of their potential use in fields as diverse as high performance membranes and filtration devices, supports for catalysis and biochemical reactions, encapsulating devices for drug release, and scaffolds for cells seeding and proliferation. For this last application, in tissue engineering, some typical parameters related to porosity must be rigorously controlled: (1) the average pore size diameter; (2) the pore volume fraction; (3) the pore interconnectivity. Porous hydrogels are excellent candidates due to their similarities with the extracellular matrix (composition, mechanical properties and diffusion properties). A certain number of methods and techniques have been developed and studied to prepare gels comprising microstructured 3-D networks of (more or less) interconnected pores (also called sometimes microfluidic gels or (macro)porous gels). Poly(L-lactide) (PLA) porous materials were realized from immiscible and co-continuous binary blends of polystyrene/poly(L-lactide) (PS/PLA) at 50/50 %vol prepared by different methods : (1) internal mixer (cubic samples with 0.8 mm sides) and (2) extrusion followed by injection molding which allows the fabrication of bars with superior dimensions (0.95 cm x 1.25 cm x 6.3 cm). Quiescent annealing of the binary blends was performed at 190 °C to tune the characteristic dimensions of the co-continuous morphology: (1) 0, 10, 30, 60 and 90 min for cubic samples and (2) 0, 10, 20 and 30 min for bars. Afterwards, the PLA phase has been isolated by a specific solvent extraction of the PS phase to obtain porous PLA molds. Gravimetric analysis have demonstrated a co-continuity superior to 95% for cubic samples and superior to 85% for the bars. This morphology was analyzed by scanning electron microscopy (SEM) for each annealing time (for the cubic samples). Image analysis performed on the SEM micrographs have demonstrated that the average pore diameter can range from 3 mum to over 400 mum and that the specific interfacial area ranges from 5800 cm-1 to 45 cm-1, for annealing times going from 0 min to 90 min). The porosity of the bars was observed by X-ray microtomography and shows that the average pore diameter ranges from 10 mum to 500 mum (annealing from 10 min to 30 min). Solutions of agar or alginate were subsequently injected into the PLA porous molds by using a manual injection system, followed by an in situ gelification. Visual inspections and optical microscope observations show a complete injection for molds with average pore sizes over 20 mum (cubic samples) and over 300 mum (for bars). These assumptions are also supported by the gels morphology characterization. The second polymer phase (PLA) was subsequently dissolved using a second selective solvent, leaving only the porous gel structures. X-ray microtomography analysis, which provide 2-D and 3-D images, have demonstrated that the morphologies of the porous gels are similar to the PLA molds microstructures. For example, porous gels prepared with cubic PLA molds annealed during 60 min, show an average pore size of about 285 mum (as compared to 200 mum for the PLA molds) and a specific interfacial area of 70 cm -1 (as compared to 100 cm-1 for the PLA molds). Similar results were obtained for the porous gels prepared with the porous PLA bars (qualitative observation). The effectiveness of two sterilization methods has been proven on nutrient agar (NA) and "Brain Heart Infusion" (BHI) with no bacterial colonies apparition. The first method is the freeze-drying followed by an oven treatment at 120 °C in a sterile environment. The porous gel morphology was characterized by X-ray microtomography before and after freeze-drying, and after rehydration, demonstrating the conservation of the macroscopic dimensions of the gels, of their morphologies and porosities. The second method is the successive baths in an ethanol solution. Finally mechanical compression tests have shown that porous gels, as can be expected, have a lower compressive resistance as compared to non-porous hydrogels. (Abstract shortened by UMI.).

Rotationally Molded Liquid Crystalline Polymers

NASA Technical Reports Server (NTRS)

Rogers, Martin; Stevenson, Paige; Scribben, Eric; Baird, Donald; Hulcher, Bruce

2002-01-01

Rotational molding is a unique process for producing hollow plastic parts. Rotational molding offers advantages of low cost tooling and can produce very large parts with complicated shapes. Products made by rotational molding include water tanks with capacities up to 20,000 gallons, truck bed liners, playground equipment, air ducts, Nylon fuel tanks, pipes, toys, stretchers, kayaks, pallets, and many others. Thermotropic liquid crystalline polymers are an important class of engineering resins employed in a wide variety of applications. Thermotropic liquid crystalline polymers resins are composed of semi-rigid, nearly linear polymeric chains resulting in an ordered mesomorphic phase between the crystalline solid and the isotropic liquid. Ordering of the rigid rod-like polymers in the melt phase yields microfibrous, self-reinforcing polymer structures with outstanding mechanical and thermal properties. Rotational molding of liquid crystalline polymer resins results in high strength and high temperature hollow structures useful in a variety of applications. Various fillers and reinforcements can potentially be added to improve properties of the hollow structures. This paper focuses on the process and properties of rotationally molded liquid crystalline polymers.

Characterization of hydroxyapatite whisker reinforced composites and scaffolds for mechanical and biological function in orthopaedic and spinal implants

NASA Astrophysics Data System (ADS)

Conrad, Timothy L.

The overall objective of this study was to investigate the mechanical and biological properties of HA whisker reinforced polyaryletherketone (PAEK) composites and scaffolds which are key to clinical translation for orthopedic and spinal implants. The fatigue behavior of polyetherketoneketone (PEKK) reinforced with 0, 20, and 40 vol% hydroxyapatite (HA) was investigated in four-point bending fatigue. The fatigue life decreased with increasing HA reinforcement. However, PEKK reinforced with 40 vol% HA whiskers exhibited a fatigue life greater than 2.106 cycles at 40 MPa. Moreover, HA whisker reinforcement resulted in decreased creep deformation and minimal modulus degradation. The effects of the mold temperature and polyetheretherketone (PEEK) powder were investigated on the mechanical properties and crystallinity of HA whisker reinforced PEEK scaffolds prepared using compression molding and porogen leaching. The mechanical properties of the scaffolds increased while the PEEK crystallinity decreased, with increasing mold temperature and suggested an optimal mold temperature of 370--375°C for PEEK scaffolds comprising of 75% porosity and 20 vol% HA whisker reinforcement, regardless of the PEEK powder size. The effects of the porogen morphology on the architecture, mechanical properties, and permeability of HA whisker reinforced PEEK scaffolds were investigated in 75--90% porous scaffolds. HA whisker reinforced PEEK scaffolds prepared with an ellipsoidal porogen exhibited a greater permeability than scaffolds prepared with a cubic porogen. The compressive modulus, yield strength, and yield strain were not affected by the porogen morphology. The effects of HA reinforcement morphology and content was investigated on the behavior of primary osteoblasts on dense HA reinforced PEEK substrates in vitro. At day 7, the number of osteoblasts attached to PEEK substrate surfaces increased with increasing HA content and for HA whiskers compared to equiaxed HA powder reinforcement. This suggests that the HA reinforcement content morphology can promote cellular attachment and proliferation at early time points.

Composite Structures and Materials Research at NASA Langley Research Center

NASA Technical Reports Server (NTRS)

Starnes, James H., Jr.; Dexter, H. Benson; Johnston, Norman J.; Ambur, Damodar R.; Cano, roberto J.

2003-01-01

A summary of recent composite structures and materials research at NASA Langley Research Center is presented. Fabrication research to develop low-cost automated robotic fabrication procedures for thermosetting and thermoplastic composite materials, and low-cost liquid molding processes for preformed textile materials is described. Robotic fabrication procedures discussed include ply-by-ply, cure-on-the-fly heated placement head and out-of-autoclave electron-beam cure methods for tow and tape thermosetting and thermoplastic materials. Liquid molding fabrication processes described include Resin Film Infusion (RFI), Resin Transfer Molding (RTM) and Vacuum-Assisted Resin Transfer Molding (VARTM). Results for a full-scale composite wing box are summarized to identify the performance of materials and structures fabricated with these low-cost fabrication methods.

Composite Structures and Materials Research at NASA Langley Research Center

NASA Technical Reports Server (NTRS)

Starnes, James H., Jr.; Dexter, H. Benson; Johnston, Norman J.; Ambur, Damodar R.; Cano, Roberto J.

2001-01-01

A summary of recent composite structures and materials research at NASA Langley Research Center is presented. Fabrication research to develop low-cost automated robotic fabrication procedures for thermosetting and thermoplastic composite materials, and low-cost liquid molding processes for preformed textile materials is described. Robotic fabrication procedures discussed include ply-by-ply, cure-on-the-fly heated placement head and out-of-autoclave electron-beam cure methods for tow and tape thermosetting and thermoplastic materials. Liquid molding fabrication processes described include Resin Film Infusion (RFI) Resin Transfer Molding (RTM) and Vacuum-Assisted Resin Transfer Molding (VARTM). Results for a full-scale composite wing box are summarized to identify the performance of materials and structures fabricated with these low-cost fabrication methods.

Processing and characterization of unidirectional thermoplastic nanocomposites

NASA Astrophysics Data System (ADS)

Narasimhan, Kameshwaran

The manufacture of continuous fibre-reinforced thermoplastic nanocomposites is discussed for the case of E-Glass reinforced polypropylene (PP) matrix and for E-Glass reinforced Polyamide-6 (Nylon-6), with and without dispersed nanoclay (montmorillonite) platelets. The E-Glass/PP nanocomposite was manufactured using pultrusion, whereas the E-Glass/Nylon-6 nanocomposite was manufactured using compression molding. Mechanical characterization of nanocomposites were performed and compared with traditional microcomposites. Compressive as well as shear strength of nanocomposites was improved by improving the yield strength of the surrounding matrix through the dispersion of nanoclay. Significant improvements were achieved in compressive strength and shear strength with relatively low nanoclay loadings. Initially, polypropylene with and without nanoclay were melt intercalated using a single-screw extruder and the pultruded nanocomposite was fabricated using extruded pre-impregnated (pre-preg) tapes. Compression tests were performed as mandated by ASTM guidelines. SEM and TEM characterization revealed presence of nanoclay in an intercalated and partially exfoliated morphology. Mechanical tests confirmed significant improvements in compressive strength (˜122% at 10% nanoclay loading) and shear strength (˜60% at 3% nanoclay loading) in modified pultruded E-Glass/PP nanocomposites in comparison with baseline properties. Uniaxial tensile tests showed a small increase in tensile strength (˜3.4%) with 3% nanoclay loading. Subsequently, E-Glass/Nylon-6 nanocomposite panels were manufactured by compression molding. Compression tests were performed according to IITRI guidelines, whereas short beam shear and uni-axial tensile tests were performed according to ASTM standards. Mechanical tests confirmed strength enhancement with nanoclay addition, with a significant improvement in compressive strength (50% at 4% nanoclay loading) and shear strength (˜36% at 4% nanoclay loading) when compared with the baseline E-Glass/Nylon-6. Uni-axial tensile tests resulted in a small increase in tensile strength (˜3.2%) with 4% nanoclay loading. Also, hygrothermal aging (50°C and 100% RH) of baseline and nanoclay modified (4%) E-Glass/Nylon-6 was studied. It was observed that the moisture diffusion process followed Fickian diffusion. E-Glass/Nylon-6 modified with 4% nanoclay loading showed improved barrier performance with a significant reduction (˜30%) in moisture uptake compared to baseline E-Glass/Nylon-6 composites. Significant improvement in mechanical properties was also observed in hygrothermally aged nanocomposite specimens when compared with the aged baseline composite.

Failure Analysis in Platelet Molded Composite Systems

NASA Astrophysics Data System (ADS)

Kravchenko, Sergii G.

Long-fiber discontinuous composite systems in the form of chopped prepreg tapes provide an advanced, structural grade, molding compound allowing for fabrication of complex three-dimensional components. Understanding of process-structure-property relationship is essential for application of prerpeg platelet molded components, especially because of their possible irregular disordered heterogeneous morphology. Herein, a structure-property relationship was analyzed in the composite systems of many platelets. Regular and irregular morphologies were considered. Platelet-based systems with more ordered morphology possess superior mechanical performance. While regular morphologies allow for a careful inspection of failure mechanisms derived from the morphological characteristics, irregular morphologies are representative of the composite architectures resulting from uncontrolled deposition and molding with chopped prerpegs. Progressive failure analysis (PFA) was used to study the damaged deformation up to ultimate failure in a platelet-based composite system. Computational damage mechanics approaches were utilized to conduct the PFA. The developed computational models granted understanding of how the composite structure details, meaning the platelet geometry and system morphology (geometrical arrangement and orientation distribution of platelets), define the effective mechanical properties of a platelet-molded composite system, its stiffness, strength and variability in properties.

Mold bolt and means for achieving close tolerances between bolts and bolt holes

NASA Technical Reports Server (NTRS)

Johnston, David L. (Inventor); Bryant, Phillip G. (Inventor)

1993-01-01

In the space shuttle, a cargo bay storage rack was required which was to be manufactured from a metal-plastic composite and bolted to a cargo structure. Following completion, utilization of the rack was disallowed due to tolerances, that is, the size differences between the outside bolt diameter and the inside hole diameter. In addition to the space shuttle problem there are other close tolerance requirements for bolts. Such environments often benefit from close tolerance bolting. Frequently such fabrication is not cost effective. Consequently there is a need for means of achieving close tolerances between bolts and bolt holes. Such means are provided. After compressing the elements together a strong rigid plastic, ceramic, or ceramic plastic fluid is forced into a channel extending through the bolt.

A Route for Polymer Nanocomposites with Engineered Electrical Conductivity and Percolation Threshold

PubMed Central

Kalaitzidou, Kyriaki; Fukushima, Hiroyuki; Drzal, Lawrence T.

2010-01-01

Polymer nanocomposites with engineered electrical properties can be made by tuning the fabrication method, processing conditions and filler’s geometric and physical properties. This work focuses on investigating the effect of filler’s geometry (aspect ratio and shape), intrinsic electrical conductivity, alignment and dispersion within the polymer, and polymer crystallinity, on the percolation threshold and electrical conductivity of polypropylene based nanocomposites. The conductive reinforcements used are exfoliated graphite nanoplatelets, carbon black, vapor grown carbon fibers and polyacrylonitrile carbon fibers. The composites are made using melt mixing followed by injection molding. A coating method is also employed to improve the nanofiller’s dispersion within the polymer and compression molding is used to alter the nanofiller’s alignment.

Graphite/epoxy composite stiffened panel fabrication development

NASA Technical Reports Server (NTRS)

Palmer, R. J.

1984-01-01

This report describes the manufacturing development procedures used to fabricate a series of carbon/epoxy panels with integrally molded stiffeners. Panel size was started at 6 inches by 18 inches and one stiffener and increased to 30 inches by 60 inches and six integral stiffeners. Stiffener concepts were optimized for minimum weight (or mass) to carry stress levels from 1500 lbs/inch to 25,000 lbs/inch compression load. Designs were created and manufactured with a stiffener configuration of integrally molded hat, J, I, sine wave I, solid blade, and honeycomb blade shapes. Successful and unsuccessful detail methods of tooling, lay-up methods, and bagging methods are documented. Recommendations are made for the best state-of-the-art manufacturing technique developed for type of stiffener construction.

Structural and compositional analysis of a casting mold sherd from ancient China.

PubMed

Zong, Yunbing; Yao, Shengkun; Lang, Jianfeng; Chen, Xuexiang; Fan, Jiadong; Sun, Zhibin; Duan, Xiulan; Li, Nannan; Fang, Hui; Zhou, Guangzhao; Xiao, Tiqiao; Li, Aiguo; Jiang, Huaidong

2017-01-01

Casting had symbolic significance and was strictly controlled in the Shang dynasty of ancient China. Vessel casting was mainly distributed around the Shang capital, Yin Ruins, which indicates a rigorous centralization of authority. Thus, for a casting mold to be excavated far from the capital region is rare. In addition to some bronze vessel molds excavated at the Buyao Village site, another key discovery of a bronze vessel mold occurred at Daxinzhuang. The Daxinzhuang site was a core area in the east of Shang state and is an important site to study the eastward expansion of the Shang. Here, combining synchrotron X-rays and other physicochemical analysis methods, nondestructive three-dimensional structure imaging and different elemental analyses were conducted on this mold sherd. Through high penetration X-ray tomography, we obtained insights on the internal structure and discovered some pores. We infer that the generation of pores inside the casting mold sherd was used to enhance air permeability during casting. Furthermore, we suppose that the decorative patterns on the surface were carved and not pasted onto it. Considering the previous compositional studies of bronze vessels, the copper and iron elements were analyzed by different methods. Unexpectedly, a larger amount of iron than of copper was detected on the surface. According to the data analysis and archaeological context, the source of iron on the casting mold sherd could be attributed to local soil contamination. A refined compositional analysis confirms that this casting mold was fabricated locally and used for bronze casting.

Dimensional Precision Research of Wax Molding Rapid Prototyping based on Droplet Injection

NASA Astrophysics Data System (ADS)

Mingji, Huang; Geng, Wu; yan, Shan

2017-11-01

The traditional casting process is complex, the mold is essential products, mold quality directly affect the quality of the product. With the method of rapid prototyping 3D printing to produce mold prototype. The utility wax model has the advantages of high speed, low cost and complex structure. Using the orthogonal experiment as the main method, analysis each factors of size precision. The purpose is to obtain the optimal process parameters, to improve the dimensional accuracy of production based on droplet injection molding.

Choline chloride based ionic liquid analogues as tool for the fabrication of agar films with improved mechanical properties

USDA-ARS?s Scientific Manuscript database

In the present paper, we test the suitability of Choline-Cl/urea (DES-U) and Choline-Cl/glycerol (DES-G) eutectic mixtures at 1:2 molar ratios for the production of agar biodegradable films. A three-step process is proposed: pre-solubilization of polymer in DES followed by compression-molding and s...

Pulp extrusion at ultra-high consistencies : selection of water soluble polymers for process optimization

Treesearch

C. Tim Scott

2002-01-01

Pulp extrusion at ultra-high consistencies (20% to 40% solids) is a new process developed at USDA Forest Service, Forest Products Laboratory (FPL) to convert recovered papers, wastepaper, and papermill residuals into solid sheets or profiles for compression molding. This process requires adding a water-soluble polymer (WSP) to alter the rheological properties of the...

Compression-Molding-Machine Tender (fabric. plastics prod.) 556.885--Technical Report on Development of USES Aptitude Test Battery.

ERIC Educational Resources Information Center

Manpower Administration (DOL), Washington, DC. U.S. Training and Employment Service.

The United States Training and Employment Service General Aptitude Test Battery (GATB), first published in 1947, has been included in a continuing program of research to validate the tests against success in many different occupations. The GATB consists of 12 tests which measure nine aptitudes: General Learning Ability; Verbal Aptitude; Numerical…

Fabrication of a Mechanically Robust Carbon Nanofiber Foam

DTIC Science & Technology

2015-06-01

Erlenmeyer exhaust trap utilizing zeolite and permanganate . ........................ 11   Figure 9.   Early CFF experimental mold...containing zeolite and permanganate to dilute the exhaust gases and trap unreacted ethylene prior to their release. Figure 7. MKS mass flow...controller (model MKS 647a). Figure 8. Erlenmeyer exhaust trap utilizing zeolite and permanganate . 12 c. Gas Mixture A flow of pure compressed

Effect of coal filler on the properties of soy protein plastics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, G.H.; Zhou, A.N.; Hu, M.B.

2006-11-15

The influence of ultrafine coal filler (UFC) content on tensile properties, water absorption, and biodegradability of soy protein plastics were investigated. The addition of UFC in the soy protein plastics, with different content of glycerol as a plasticizer, was at different ratio varying from 10:0 to 6:4. Blend sheets of the soy protein composites were prepared by the compression molding processing. The results show that, with 23.08 wt % glycerol, the tensile strength and elongation at break for the soy protein sheet with coal filler (range from 5 to 30 parts) can be enhanced as compared with nonfilled soy proteinmore » plastics. Water resistance of the soy protein plastics improves with the increase in UFC content. The derivative thermogravimetry (DTG) curves indicate a double-stage degradation process for defatted soy flour (SPF), while three-stage degradation process for soy plastics and the soy protein composites. FT-IR, XPS, and SEM were applied to study the interfacial interaction between coal macromolecules and soy protein molecules in UFC filled soy protein plastics. The results demonstrated that there is strong interfacial interaction in the soy protein plastics caused by the compression molding processing.« less

Rotationally Molded Liquid Crystalline Polymers

NASA Technical Reports Server (NTRS)

Rogers, Martin; Scribben, Eric; Baird, Donald; Hulcher, Bruce

2002-01-01

Rotational molding is a unique process for producing hollow plastic parts. Rotational molding offers low cost tooling and can produce very large parts with complicated shapes. Products made by rotational molding include water tanks with capacities up to 20,000 gallons, truck bed liners, playground equipment, air ducts, Nylon fuel tanks, pipes, toys, stretchers, kayaks, pallets, and many others. Thermotropic liquid crystalline polymers are an important class of engineering resins employed in a wide variety of applications. Thermotropic liquid crystalline polymers resins are composed of semirigid, nearly linear polymeric chains resulting in an ordered mesomorphic phase between the crystalline solid and the isotropic liquid. Ordering of the rigid rod-like polymers in the melt phase yields microfibrous, self-reinforcing polymer structures with outstanding mechanical and thermal properties. Rotational molding of liquid crystalline polymer resins results in high strength and high temperature hollow structures useful in a variety of applications. Various fillers and reinforcements can potentially be added to improve properties of the hollow structures. This paper focuses on the process and properties of rotationally molded liquid crystalline polymers. This paper will also highlight the interactions between academia and small businesses in developing new products and processes.

Effect of Aspect Ratio on Electrical, Rheological and Glass Transition Properties of PC/MWCNT Nanocomposites.

PubMed

Cruz, Heidy; Son, Younggon

2018-02-01

Since the discovery of carbon nanotubes (CNT), significant research works have focused on the application of CNT as conductive filler to polymer nanocomposites which can be used in several fields such as electrostatic dissipation (ESD), electrostatic painting and electromagnetic interference shielding (EMI-shielding). However, the main challenge in the large-scale manufacturing of this technology is the poor electrical conductivity of polymer nanocomposites produced by injection molding process. This study aims to investigate the effect of CNT aspect ratio in improving the electrical conductivity of injection molded nanocomposites. In this work, three types of multiwall carbon nanotubes with different lengths were melt-mixed with polycarbonate in a twin screw extruder followed by injection and compression molding. Results show that nanocomposites with higher CNT aspect ratio exhibit higher electrical conductivity. Longer nanotubes form a stronger conductive network during secondary agglomeration which can withstand the high shear forces during injection molding. Higher melt viscosity and storage modulus were observed in nanocomposites with higher CNT aspect ratio which is attributed to the effective constriction of polymer chains by longer nanotubes. It was also found that Tg of the composites increased with nanotube aspect ratio and the addition of CNT causes degradation which leads to the general Tg depression of polycarbonate.

Comparative study on the in vitro performance of blister molded and conventional lornoxicam immediate release liquitablets: accelerated stability study and anti-inflammatory and ulcerogenic effects.

PubMed

El-Setouhy, Doaa Ahmed; Gamiel, Alaa Abdel-Rahman; Badawi, Alia Abd El-Latif; Osman, Afaf Sayed; Labib, Dina Ahmed

2017-03-01

Lornoxicam is a potent non-steroidal anti-inflammatory drug (NSAID). It shows limited solubility in the gastric pH, delayed bioavailability and pharmacodynamic effects with aggravated gastric side effects (due to longer residence in the stomach wall). To enhance dissolution of lornoxicam in the gastric fluid and expectedly absorption and pharmacological action, with less ulcerogenic effects. Formulation of immediate release (IR) lornoxicam liquitablets containing both liquid and solid release modulators (wetting agent, solubilizers and microenvironmental pH modifiers). Beside the traditional direct compression technique employed for the preparation of liquitablets a new technique, blister molding, was also used. The effect of the two different manufacturing methods on the fast release characteristics (rapid disintegration and dissolution) was studied. Stability and pharmacological activity of the optimum formula were also explored. Similarity factor pointed out the superiority of molding technique in enhancing dissolution of lornoxicam owing to significant crystallinity reduction (XRD). Optimum formula showed negligible change in drug content and dissolution profiles over 12 weeks, significantly improved anti-inflammatory activity and significantly reduced gastric ulcerative effect over pure lornoxicam and commercial formula. Blister molded lornoxicam liquitablet of improved dissolution and pharmacological activity and less gastric erosion was successfully prepared.

The Design of 3D-Printed Lattice-Reinforced Thickness-Varying Shell Molds for Castings.

PubMed

Shangguan, Haolong; Kang, Jinwu; Yi, Jihao; Zhang, Xiaochuan; Wang, Xiang; Wang, Haibin; Huang, Tao

2018-03-30

3D printing technologies have been used gradually for the fabrication of sand molds and cores for castings, even though these molds and cores are dense structures. In this paper, a generation method for lattice-reinforced thickness-varying shell molds is proposed and presented. The first step is the discretization of the STL (Stereo Lithography) model of a casting into finite difference meshes. After this, a shell is formed by surrounding the casting with varying thickness, which is roughly proportional to the surface temperature distribution of the casting that is acquired by virtually cooling it in the environment. A regular lattice is subsequently constructed to support the shell. The outside surface of the shell and lattice in the cubic mesh format is then converted to STL format to serve as the external surface of the new shell mold. The internal surface of the new mold is the casting's surface with the normals of all of the triangles in STL format reversed. Experimental verification was performed on an Al alloy wheel hub casting. Its lattice-reinforced thickness-varying shell mold was generated by the proposed method and fabricated by the binder jetting 3D printing. The poured wheel hub casting was sound and of good surface smoothness. The cooling rate of the wheel hub casting was greatly increased due to the shell mold structure. This lattice-reinforced thickness-varying shell mold generation method is of great significance for mold design for castings to achieve cooling control.

The Design of 3D-Printed Lattice-Reinforced Thickness-Varying Shell Molds for Castings

PubMed Central

Shangguan, Haolong; Kang, Jinwu; Yi, Jihao; Zhang, Xiaochuan; Wang, Xiang; Wang, Haibin; Huang, Tao

2018-01-01

3D printing technologies have been used gradually for the fabrication of sand molds and cores for castings, even though these molds and cores are dense structures. In this paper, a generation method for lattice-reinforced thickness-varying shell molds is proposed and presented. The first step is the discretization of the STL (Stereo Lithography) model of a casting into finite difference meshes. After this, a shell is formed by surrounding the casting with varying thickness, which is roughly proportional to the surface temperature distribution of the casting that is acquired by virtually cooling it in the environment. A regular lattice is subsequently constructed to support the shell. The outside surface of the shell and lattice in the cubic mesh format is then converted to STL format to serve as the external surface of the new shell mold. The internal surface of the new mold is the casting’s surface with the normals of all of the triangles in STL format reversed. Experimental verification was performed on an Al alloy wheel hub casting. Its lattice-reinforced thickness-varying shell mold was generated by the proposed method and fabricated by the binder jetting 3D printing. The poured wheel hub casting was sound and of good surface smoothness. The cooling rate of the wheel hub casting was greatly increased due to the shell mold structure. This lattice-reinforced thickness-varying shell mold generation method is of great significance for mold design for castings to achieve cooling control. PMID:29601543

Application of atmospheric-pressure argon plasma jet for bread mold decontamination

NASA Astrophysics Data System (ADS)

Thonglor, P.; Amnuaycheewa, P.

2017-09-01

Atmospheric-pressure argon plasma (APAP) is a promising non-thermal technology for microbial control and prevention minimally affecting quality of foods. Effect of APAP jet on the growth of bread molds, including two Aspergillus sp., Rhizopus stolonifer, and Penicillium roqueforti, isolated from white bread were investigated. The molds were isolated, verified, cultured to fully grown on potato dextrose agar (PDA), and subsequently treated with APAP jet using plasma generating power at 24 W for 5, 10, and 20 min, respectively. The inhibition of mold growth was investigated by comparing fungal dry weights and the effect on fungal cell structure was observed using compound light microscope. The results indicated that the 20-min treatment time is most effective in retarding the growth of the three bread molds. However, this level of generating power did not lead to destruction of the cellular structures for all the four fungi. Plasma generating power and treatment time are significant parameters determining the success of bread mold decontamination and further investigation on real bread matrix is needed.

Low-cost conformable storage to maximize vehicle range

DOE Office of Scientific and Technical Information (OSTI.GOV)

Graham, R.P.

Liquefied petroleum gas (LPG) and compressed natural gas (CNG) are currently the leading fuel contenders for converting vehicles from gasoline and diesel to alternative fuels. Two factors that inhibit conversion are additional vehicle costs and reduced range compared to gasoline. In overcoming these barriers, a key element of the alternative fuel system becomes the storage tank for these pressurized fuels. Using cylindrical pressure vessels is the conventional approach, but they do not package well in the available vehicle volume. Thiokol Corporation has developed and is now producing a conformable (non-cylindrical) aluminum storage system for LPG vans. This system increases fuelmore » storage in a given rectangular envelope. The goal of this project was to develop the technology for a lower cost conformable tank made of injection-molded plastic. Much of the cost of the aluminum conformable tank is in the fabrication because several weld seams are required. The injection-molding process has the potential to greatly reduce the fabrication costs. The requirements of a pressurized fuel tank on a vehicle necessitate the proper combination of material properties. Material selection and tank design must be optimized for maximum internal volume and minimum material use to be competitive with other technologies. The material and the design must also facilitate the injection-molding process. Prototype tanks must be fabricated to reveal molding problems, prove solutions, and measure results. In production, efficient fabrication will be key to making these tanks cost competitive. The work accomplished during this project has demonstrated that conformable LPG tanks can be molded with thermoplastics. However, to achieve a competitive tank, improvements are needed in the effective material strength. If these improvements can be made, molded plastics should produce a lower cost tank that can store more LPG on a vehicle than conventional cylinders.« less

Final Shape of Precision Molded Optics: Part 2 - Validation and Sensitivity to Material Properties and Process Parameters

DTIC Science & Technology

2012-06-27

of the critical contributors to deviation include structural relaxation of the glass, thermal expansion of the molds, TRS and viscoelastic behavior...the critical contributors to deviation include structural relaxation of the glass, thermal expansion of the molds, TRS and viscoelastic behavior of the...data. In that article glass was modeled as purely viscous and thermal expansion was accounted for with a constant coefficient of thermal expansion (CTE

Interconnected porosity analysis by 3D X-ray microtomography and mechanical behavior of biomimetic organic-inorganic composite materials.

PubMed

Alonso-Sierra, S; Velázquez-Castillo, R; Millán-Malo, B; Nava, R; Bucio, L; Manzano-Ramírez, A; Cid-Luna, H; Rivera-Muñoz, E M

2017-11-01

Hydroxyapatite-based materials have been used for dental and biomedical applications. They are commonly studied due to their favorable response presented when used for replacement of bone tissue. Those materials should be porous enough to allow cell penetration, internal tissue growth, vascular incursion and nutrient supply. Furthermore, their morphology should be designed to guide the growth of new bone tissue in anatomically applicable ways. In this work, the mechanical performance and 3D X-ray microtomography (X-ray μCT) study of a biomimetic, organic-inorganic composite material, based on hydroxyapatite, with physicochemical, structural, morphological and mechanical properties very similar to those of natural bone tissue is reported. Ceramic pieces in different shapes and several porous sizes were produced using a Modified Gel Casting Method. Pieces with a controlled and 3D hierarchical interconnected porous structure were molded by adding polymethylmethacrylate microspheres. Subsequently, they were subject to a thermal treatment to remove polymers and to promote a sinterization of the ceramic particles, obtaining a HAp scaffold with controlled porosity. Then, two different organic phases were used to generate an organic-inorganic composite material, so gelatin and collagen, which was extracted from bovine tail, were used. The biomimetic organic-inorganic composite material was characterized by Scanning Electron Microscopy, Energy Dispersive X-ray Spectroscopy, X-ray Diffraction, Fourier Transform Infrared Spectroscopy and 3D X-ray microtomography techniques. Mechanical properties were characterized in compression tests, obtaining a dramatic and synergic increment in the mechanical properties due to the chemical and physical interactions between the two phases and to the open-cell cellular behavior of the final composite material; the maximum compressive strength obtained corresponds to about 3 times higher than that reported for natural cancellous bone. The pore size distribution obtained could be capable to allow cell penetration, internal tissue in-growth, vascular incursion and nutrient supply and this material has tremendous potential for use as a replacement of bone tissue or in the manufacture and molding of prosthesis with desired shapes. Copyright © 2017 Elsevier B.V. All rights reserved.

Testing single point incremental forming molds for thermoforming operations

NASA Astrophysics Data System (ADS)

Afonso, Daniel; de Sousa, Ricardo Alves; Torcato, Ricardo

2016-10-01

Low pressure polymer processing processes as thermoforming or rotational molding use much simpler molds then high pressure processes like injection. However, despite the low forces involved with the process, molds manufacturing for this operations is still a very material, energy and time consuming operation. The goal of the research is to develop and validate a method for manufacturing plastically formed sheets metal molds by single point incremental forming (SPIF) operation for thermoforming operation. Stewart platform based SPIF machines allow the forming of thick metal sheets, granting the required structural stiffness for the mold surface, and keeping the short lead time manufacture and low thermal inertia.

Design and Checking Analysis of Injection Mold for a Plastic Cup

NASA Astrophysics Data System (ADS)

Li, Xuebing

2018-03-01

A special injection mold was designed for the structural characteristics of a plastic cup part. The mold was simulated by Moldflow software and verified by calculating the stripping force, the pulling force and the clamping force of the mold so that to determine the appropriate injection parameters. It has been proved that the injection mold is effective and practical in the actual producing and can meet the quality requirements during the course of using it, which solved some problems for injection molding of this kind of parts and can provide some reference for the production of other products in the same industry.

Method and composition for molding low density desiccant syntactic foam articles

DOEpatents

Lula, James W.; Schicker, James R.

1984-01-01

A method and a composition are provided for molding low density desiccant syntactic foam articles. A low density molded desiccant article may be made as a syntactic foam by blending a thermosetting resin, microspheres and molecular sieve desiccant powder, molding and curing. Such articles have densities of 0.2-0.9 g/cc, moisture capacities of 1-12% by weight, and can serve as light weight structural supports.

Effect of fast mold surface temperature evolution on iPP part morphology gradients

NASA Astrophysics Data System (ADS)

Liparoti, Sara; Sorrentino, Andrea; Guzman, Gustavo; Cakmak, Mukerrem; Titomanlio, Giuseppe

2016-03-01

The control of mold surface temperature is an important factor that affects the sample surface morphology as well as the structural gradients (orientation crystal size, and type) as well as cooling stresses. The frozen layer thickness formed during the filling stage also has a very significant effect on the flow resistance and thus on the resulting pressure drop and flow length in thin wall parts. The possibility to have a hot mold during filling and a quick cooling soon afterward is a significant process enhancement particularly for specialized applications such as micro injection molding and for the reproduction of micro structured surfaces. Up to now, several methods (electromagnetic, infrared, hot vapor fleshing etc,) were tried to achieve fast temperature evolution of the mold. Unfortunately, all these methods require a complex balance between thermal and mechanical problems, equipment cost, energy consumption, safety, molding cycle time and part quality achievable. In this work, a thin electrical resistance was designed and used to generate a fast and confined temperature variation on mold surface (by joule effect). Since the whole temperature evolution can take place in a few seconds, one can couple the advantages of a high surface temperature during filling with the advantages of a low mold temperature, fast cooling and low heating dissipation. Some experiments were performed with a commercial iPP resin. The effects of the surface temperature and of the heating time (under constant electric power) on surface finishing and on the final morphology (thickness and structure of the different layers) are explored and discussed.

Structural and compositional analysis of a casting mold sherd from ancient China

PubMed Central

Zong, Yunbing; Yao, Shengkun; Lang, Jianfeng; Chen, Xuexiang; Fan, Jiadong; Sun, Zhibin; Duan, Xiulan; Li, Nannan; Fang, Hui; Zhou, Guangzhao; Xiao, Tiqiao; Li, Aiguo; Jiang, Huaidong

2017-01-01

Casting had symbolic significance and was strictly controlled in the Shang dynasty of ancient China. Vessel casting was mainly distributed around the Shang capital, Yin Ruins, which indicates a rigorous centralization of authority. Thus, for a casting mold to be excavated far from the capital region is rare. In addition to some bronze vessel molds excavated at the Buyao Village site, another key discovery of a bronze vessel mold occurred at Daxinzhuang. The Daxinzhuang site was a core area in the east of Shang state and is an important site to study the eastward expansion of the Shang. Here, combining synchrotron X-rays and other physicochemical analysis methods, nondestructive three-dimensional structure imaging and different elemental analyses were conducted on this mold sherd. Through high penetration X-ray tomography, we obtained insights on the internal structure and discovered some pores. We infer that the generation of pores inside the casting mold sherd was used to enhance air permeability during casting. Furthermore, we suppose that the decorative patterns on the surface were carved and not pasted onto it. Considering the previous compositional studies of bronze vessels, the copper and iron elements were analyzed by different methods. Unexpectedly, a larger amount of iron than of copper was detected on the surface. According to the data analysis and archaeological context, the source of iron on the casting mold sherd could be attributed to local soil contamination. A refined compositional analysis confirms that this casting mold was fabricated locally and used for bronze casting. PMID:28296963

Effect of fast mold surface temperature evolution on iPP part morphology gradients

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liparoti, Sara; Sorrentino, Andrea; Guzman, Gustavo

The control of mold surface temperature is an important factor that affects the sample surface morphology as well as the structural gradients (orientation crystal size, and type) as well as cooling stresses. The frozen layer thickness formed during the filling stage also has a very significant effect on the flow resistance and thus on the resulting pressure drop and flow length in thin wall parts. The possibility to have a hot mold during filling and a quick cooling soon afterward is a significant process enhancement particularly for specialized applications such as micro injection molding and for the reproduction of micromore » structured surfaces. Up to now, several methods (electromagnetic, infrared, hot vapor fleshing etc,) were tried to achieve fast temperature evolution of the mold. Unfortunately, all these methods require a complex balance between thermal and mechanical problems, equipment cost, energy consumption, safety, molding cycle time and part quality achievable. In this work, a thin electrical resistance was designed and used to generate a fast and confined temperature variation on mold surface (by joule effect). Since the whole temperature evolution can take place in a few seconds, one can couple the advantages of a high surface temperature during filling with the advantages of a low mold temperature, fast cooling and low heating dissipation. Some experiments were performed with a commercial iPP resin. The effects of the surface temperature and of the heating time (under constant electric power) on surface finishing and on the final morphology (thickness and structure of the different layers) are explored and discussed.« less

Porous media heat transfer for injection molding

DOEpatents

Beer, Neil Reginald

2016-05-31

The cooling of injection molded plastic is targeted. Coolant flows into a porous medium disposed within an injection molding component via a porous medium inlet. The porous medium is thermally coupled to a mold cavity configured to receive injected liquid plastic. The porous medium beneficially allows for an increased rate of heat transfer from the injected liquid plastic to the coolant and provides additional structural support over a hollow cooling well. When the temperature of the injected liquid plastic falls below a solidifying temperature threshold, the molded component is ejected and collected.

Polymer-based platform for microfluidic systems

DOEpatents

Benett, William [Livermore, CA; Krulevitch, Peter [Pleasanton, CA; Maghribi, Mariam [Livermore, CA; Hamilton, Julie [Tracy, CA; Rose, Klint [Boston, MA; Wang, Amy W [Oakland, CA

2009-10-13

A method of forming a polymer-based microfluidic system platform using network building blocks selected from a set of interconnectable network building blocks, such as wire, pins, blocks, and interconnects. The selected building blocks are interconnectably assembled and fixedly positioned in precise positions in a mold cavity of a mold frame to construct a three-dimensional model construction of a microfluidic flow path network preferably having meso-scale dimensions. A hardenable liquid, such as poly (dimethylsiloxane) is then introduced into the mold cavity and hardened to form a platform structure as well as to mold the microfluidic flow path network having channels, reservoirs and ports. Pre-fabricated elbows, T's and other joints are used to interconnect various building block elements together. After hardening the liquid the building blocks are removed from the platform structure to make available the channels, cavities and ports within the platform structure. Microdevices may be embedded within the cast polymer-based platform, or bonded to the platform structure subsequent to molding, to create an integrated microfluidic system. In this manner, the new microfluidic platform is versatile and capable of quickly generating prototype systems, and could easily be adapted to a manufacturing setting.

Method for Molding Structural Parts Utilizing Modified Silicone Rubber

NASA Technical Reports Server (NTRS)

Weiser, Erik S. (Inventor); Baucom, Robert M. (Inventor); Snoha, John J. (Inventor)

1998-01-01

This invention improves upon a method for molding structural parts from preform material. Preform material to be used for the part is provided. A silicone rubber composition containing entrained air voids is prepared. The silicone rubber and preform material assembly is situated within a rigid mold cavity used to shape the preform material to die desired shape. The entire assembly is heated in a standard heating device so that the thermal expansion of the silicone rubber exerts the pressure necessary to force the preform material into contact with the mold container. The introduction of discrete air voids into the silicone rubber allows for accurately controlled pressure application on the preform material at the cure temperature.

Modeling and control of flow during impregnation of heterogeneous porous media, with application to composite mold-filling processes

NASA Astrophysics Data System (ADS)

Bickerton, Simon

Liquid Composite Molding (LCM) encompasses a growing list of composite material manufacturing techniques. These processes have provided the promise for complex fiber reinforced plastics parts, manufactured from a single molding step. In recent years a significant research effort has been invested in development of process simulations, providing tools that have advanced current LCM technology and broadened the range of applications. The requirement for manufacture of larger, more complex parts has motivated investigation of active control of LCM processes. Due to the unlimited variety of part geometries that can be produced, finite element based process simulations will be used to some extent in design of actively controlled processes. Ongoing efforts are being made to improve material parameter specification for process simulations, increasing their value as design tools. Several phenomena occurring during mold filling have been addressed through flow visualization experimentation and analysis of manufactured composite parts. The influence of well defined air channels within a mold cavity is investigated, incorporating their effects within existing filling simulations. Three different flow configurations have been addressed, testing the application of 'equivalent permeabilities', effectively approximating air channels as representative porous media. LCM parts having doubly curved regions require preform fabrics to undergo significant, and varying deformation throughout a mold cavity. Existing methods for predicting preform deformation, and the resulting permeability distribution have been applied to a conical mold geometry. Comparisons between experiment and simulation are promising, while the geometry studied has required large deformation over much of the part, shearing the preform fabric beyond the scope of the models applied. An investigational study was performed to determine the magnitude of effect, if any, on mold filling caused by corners within LCM mold cavities. The molds applied in this study have required careful consideration of cavity thickness variations. Any effects on mold filling due to corner radii have been overshadowed by those due to preform compression. While numerical tools are available to study actively controlled mold filling in a virtual environment, some development is required for the physical equipment to implement this in practice. A versatile, multiple line fluid injection system is developed here. The equipment and control algorithms employed have provided servo control of flow rate, or injection pressure, and have been tested under very challenging conditions. The single injection line developed is expanded to a multiple line system, and shows great potential for application to actual resin systems. A case study is presented, demonstrating design and implementation of a simple actively controlled injection scheme. The experimental facility developed provides an excellent testbed for application of actively controlled mold filling concepts, an area that is providing great promise for the advancement of LCM processes.

Physical and mechanical properties of bio-composites from wood particles and liquefied wood resin

Treesearch

Hui Pan; Todd F. Shupe; Chung-Yun Hse

2009-01-01

Compression molded composites were made from wood particles and a liquefied wood/phenol/formaldehyde co-condensed resin. Based on our previous research, a phenol to wood (P/W) ratio of 2/1 was chosen for this study. The two experimental variables selected were: 1) liquefaction temperature (150o and 180oC) and 2) cooking method (atmospheric and sealed). Panels were...

Effect of Sericin on Mechanical Behavior of Composite Material Reinforced by Silk Woven Fabric

NASA Astrophysics Data System (ADS)

Kimura, Teruo; Ino, Haruhiro; Hanada, Koji; Katori, Sigetaka

Recent, attention has been given to shift from glass fibers and carbon fibers to natural fibers for FRP composites for the goal of protecting the environment. This paper concerned with the application of silk fabric for composite materials. Polypropylene (PP) was used for the matrix material and the silk fabric composites were molded using a compression molding method. Especially, the effect of sericin on mechanical behaviors of composite materials was discussed. Good adhesion between silk and PP was obtained by removing the sericin existing around the fibroin. The tensile modulus of composite decreased with decreasing the sericin because of the flexibility of silk fibers without sericin. In particular, the higher Izod impact value was obtained for the composites containing the silk fibers without sericin.

Mg-Al-Ca In-Situ Composites with a Refined Eutectic Structure and Their Compressive Properties

NASA Astrophysics Data System (ADS)

Shi, Ling-Ling; Xu, Jian; Ma, Evan

2008-05-01

In a series of Mg x (Al2Ca)100- x (76 ≤ x ≤ 87) ternary alloys near the Mg-(Mg,Al)2Ca pseudo-binary eutectic point, different phases and morphologies based on ultrafine eutectic microstructure have been obtained by controlling the composition and changing the cooling rate via either induction melting or copper mold casting. For 81 ≤ x ≤ 87, the chill-cast alloys with ductile Mg dendrites embedded in an ultrafine [Mg + (Mg,Al)2Ca] eutectic matrix exhibit gradually increased fracture strength from 415 to 491 MPa with the decrease of Mg content. At x = 79, the Mg79Al14Ca7 alloy contains hard (Mg,Al)2Ca precipitates coexisting with ductile Mg dendrite, dispersed in the strong eutectic matrix. This alloy exhibits the highest compressive fracture strength (600 MPa), and the specific strength reaches 3.4 × 105 N·m·kg-1. The alloys all exhibit substantial plastic strain (5 to 6 pct). The attainment of such a combination of strength and plasticity is an interesting and useful step in improving the mechanical properties of lightweight Mg alloys.

Fabrication and characterization of nanoclay modified PMR type polyimide composites reinforced with 3D woven basalt fabric

NASA Astrophysics Data System (ADS)

Xie, Jianfei; Qiu, Yiping

2009-07-01

Nanoclay modified PMR type polyimide composites were prepared from 3D orthogonal woven basalt fiber performs and nanoclay modified polyimide matrix resin, which derived from methylene dianiline (MDA), dimethyl ester of 3,3',4,4'- oxydiphthalic acid (ODPE), monomethyl ester of cis-5-norbornene-endo-2,3-dicarboxylic acid (NE) and nanoclay. The Na+-montmorillonite was organically treated using a 1:1 molar ratio mixture of dodecylamine (C12) and MDA. The rheological properties of neat B-stage PMR polyimide and 2% clay modified B-stage PMR polyimide were investigated. Based on the results obtained from the rheological tests, a two step compression molding process can be established for the composites. In the first step, the 3D fabric preforms were impregnated with polyimide resin in a vacuum oven and heated up for degassing the volatiles and by-products. In the second step, composites were compressed. The internal structure of the composites was observed by a microscope. Incorporation of 2% clay showed an improvement in the Tg and stiffness of the PMR polyimide. The resulting composites exhibited high thermal stability and good mechanical properties.

Advanced fabrication of Si nanowire FET structures by means of a parallel approach.

PubMed

Li, J; Pud, S; Mayer, D; Vitusevich, S

2014-07-11

In this paper we present fabricated Si nanowires (NWs) of different dimensions with enhanced electrical characteristics. The parallel fabrication process is based on nanoimprint lithography using high-quality molds, which facilitates the realization of 50 nm-wide NW field-effect transistors (FETs). The imprint molds were fabricated by using a wet chemical anisotropic etching process. The wet chemical etch results in well-defined vertical sidewalls with edge roughness (3σ) as small as 2 nm, which is about four times better compared with the roughness usually obtained for reactive-ion etching molds. The quality of the mold was studied using atomic force microscopy and scanning electron microscopy image data. The use of the high-quality mold leads to almost 100% yield during fabrication of Si NW FETs as well as to an exceptional quality of the surfaces of the devices produced. To characterize the Si NW FETs, we used noise spectroscopy as a powerful method for evaluating device performance and the reliability of structures with nanoscale dimensions. The Hooge parameter of fabricated FET structures exhibits an average value of 1.6 × 10(-3). This value reflects the high quality of Si NW FETs fabricated by means of a parallel approach that uses a nanoimprint mold and cost-efficient technology.

Fast and cheap fabrication of molding tools for polymer replication

NASA Astrophysics Data System (ADS)

Richter, Christiane; Kirschner, Nadine; Worgull, Matthias; Rapp, Bastian E.

2017-02-01

Polymer replication is a prerequisite for low-cost microstructure components for consumer and end user market. The production of cost-effective microstructure in polymers requires metal molding tools which are often fabricated by direct structuring methods like milling or laser machining both of which are time-consuming and cost-intensive. We present an alternative fabrication method based on replication processes which allows the cheap ( 50 €) and fast ( 12 h) replication of complex microstructures into metal. The process comprises three steps: 1. Generation of the microstructure in a photoresist via lithography. 2. Casting of the structure into a high-temperature silicone which serves as original mold for creation of the metal molding tool. 3. Melting of an eutectic alloy of Sn, Ag and Cu under light pressure directly inside of the silicone within an oven. After cooling to room temperature the metal molding tool can be used for polymer replication into conventional thermoplastic polymers. As a first example we structured polymethylmethacrylate (PMMA) foils with a thickness of 1 mm via hot embossing and feature sizes of 100 μm could be replicated with high fidelity.

Carbon nano fibers reinforced composites origami inspired mechanical metamaterials with passive and active properties

NASA Astrophysics Data System (ADS)

Kshad, Mohamed Ali E.; D'Hondt, Clement; Naguib, Hani E.

2017-10-01

Core panels used for compression or impact damping are designed to dissipate energy and to reduce the transferred force and energy. They are designed to have high strain and deformation with low density. The geometrical configuration of such cores plays a significant role in redistributing the applied forces to dampen the compression and impact energy. Origami structures are renowned for affording large macroscopic deformation which can be employed for force redistribution and energy damping. The material selection for the fabrication of origami structures affects the core capacity to withstand compression and impact loads. Polymers are characterized by their high compression and impact resistance; the drawback of polymers is the low stiffness and elastic moduli compared with metallic materials. This work is focused on the study of the effect of Carbon Nano Fibers (CNF) on the global mechanical properties of the origami panel cores made of polymeric blends. The base matrix materials used were Polylactic Acid (PLA) and Thermoplastic Polyurethane (TPU) blends, and the percentages of the PLA/TPU were 100/0, 20/80, 65/35, 50/50, 20/80, and 0/100 as a percentage of weight. The weight percentages of CNF added to the polymeric blends were 1%, 3%, and 5%. This paper deals with the fabrication process of the polymeric reinforced blends and the origami cores, in order to predict the best fabrication conditions. The dynamic scanning calorimetry and the dynamic mechanical analyzer were used to test the reinforced blended base material for thermomechanical and viscoelastic properties. The origami core samples were fabricated using per-molded geometrical features and then tested for compression and impact properties. The results of the study were compared with previous published results which showed that there is considerable enhancement in the mechanical properties of the origami cores compared with the pure blended polymeric origami cores. The active properties of the origami unit cell made of composite polymers containing a low percentage of CNF were also investigated in this study, in which the shape memory effect test conducted on the origami unit cell.

Stress and Friction Distribution around Slab Corner in Continuous Casting Mold with Different Corner Structures

NASA Astrophysics Data System (ADS)

Yu, Sheng; Long, Mujun; Chen, Huabiao; Chen, Dengfu; Liu, Tao; Duan, Huamei; Cao, Junsheng

2018-06-01

The non-uniform friction and thermal stress in the mold are important as causes of the transverse cracks around strand corner. To analyze the stress distribution features around strand corner, a three-dimensional thermo-elastoplastic finite-element mold model with different corner structures (right-angle, big-chamfer, multi-chamfer, and fillet) was established. The temperature field in the mold was indirectly coupled through a three-dimensional fluid flow and heat transfer model. In addition, the non-uniform mold friction stress loaded on the strand surface was calculated through a friction model. The results show that the stress distribution on the shell is similar to the temperature distribution. The stress concentration appears in the strand corner and the lower part of wide face. The friction stress enhances the corner stress around the edge of the air-gap. For chamfered molds, the stress around the corner between the wide face and chamfer face is larger than that between the narrow face and chamfer face. Around the corner region, both the stress peak and the area of the large stress zone of the right-angle strand are the largest, while those of big-chamfered, multi-chamfered, and fillet strands decrease in that order. The stress peak position of the chamfered strands is closer to the mold exit than that of the right-angle strand. Compared with the use of the right-angle mold, the application of chamfered molds is able to reduce the stress concentration around the strand corner.

Stress and Friction Distribution around Slab Corner in Continuous Casting Mold with Different Corner Structures

NASA Astrophysics Data System (ADS)

Yu, Sheng; Long, Mujun; Chen, Huabiao; Chen, Dengfu; Liu, Tao; Duan, Huamei; Cao, Junsheng

2018-02-01

The non-uniform friction and thermal stress in the mold are important as causes of the transverse cracks around strand corner. To analyze the stress distribution features around strand corner, a three-dimensional thermo-elastoplastic finite-element mold model with different corner structures (right-angle, big-chamfer, multi-chamfer, and fillet) was established. The temperature field in the mold was indirectly coupled through a three-dimensional fluid flow and heat transfer model. In addition, the non-uniform mold friction stress loaded on the strand surface was calculated through a friction model. The results show that the stress distribution on the shell is similar to the temperature distribution. The stress concentration appears in the strand corner and the lower part of wide face. The friction stress enhances the corner stress around the edge of the air-gap. For chamfered molds, the stress around the corner between the wide face and chamfer face is larger than that between the narrow face and chamfer face. Around the corner region, both the stress peak and the area of the large stress zone of the right-angle strand are the largest, while those of big-chamfered, multi-chamfered, and fillet strands decrease in that order. The stress peak position of the chamfered strands is closer to the mold exit than that of the right-angle strand. Compared with the use of the right-angle mold, the application of chamfered molds is able to reduce the stress concentration around the strand corner.

Process for slip casting textured tubular structures

DOEpatents

Steinlage, Greg A.; Trumble, Kevin P.; Bowman, Keith J.

2002-01-01

A process for centrifugal slip casting a textured hollow tube. A slip made up of a carrier fluid and a suspended powder is introduced into a porous mold which is rotated at a speed sufficient to create a centrifugal force that forces the slip radially outward toward the inner surface of the mold. The suspended powder, which is formed of particles having large dimensional aspect ratios such as particles of superconductive BSCCO, settles in a textured fashion radially outward toward the mold surface. The carrier fluid of the slip passes by capillary action radially outward around the settled particles and into the absorbent mold. A layer of mold release material is preferably centrifugally slip cast to cover the mold inner surface prior to the introduction of the BSCCO slip, and the mold release layer facilitates removal of the BSCCO greenbody from the mold without fracturing.

Microfluidic systems with embedded materials and structures and method thereof

DOEpatents

Morse, Jeffrey D [Martinez, CA; Rose, Klint A [Boston, MA; Maghribi, Mariam [Livermore, CA; Benett, William [Livermore, CA; Krulevitch, Peter [Pleasanton, CA; Hamilton, Julie [Tracy, CA; Graff, Robert T [Modesto, CA; Jankowski, Alan [Livermore, CA

2007-03-06

Described herein is a process for fabricating microfluidic systems with embedded components in which micron-scale features are molded into the polymeric material polydimethylsiloxane (PDMS). Micromachining is used to create a mold master and the liquid precursors for PDMS are poured over the mold and allowed to cure. The PDMS is then removed form the mold and bonded to another material such as PDMS, glass, or silicon after a simple surface preparation step to form sealed microchannels.

Dimensional change in complete dentures fabricated by injection molding and microwave processing.

PubMed

Keenan, Phillip L J; Radford, David R; Clark, Robert K F

2003-01-01

Acrylic resin complete dentures undergo dimensional changes during polymerization. Techniques with injection molding and polymerization and microwave polymerization are reported to reduce these changes and thereby improve clinical fit. These dimensional changes need to be quantified. The purpose of this study was to compare differences in dimensional changes of simulated maxillary complete dentures during polymerization and storage in water after injection molding and conventional polymerization, or microwave polymerization against a control of conventionally packed and polymerized simulated maxillary complete dentures. Forty identical maxillary denture bases were prepared in dental wax with anatomic teeth. They were invested and the wax eliminated from the molds. Ten specimens each were randomly assigned to 1 of 4 groups. Group 1 was compression molded and conventionally polymerized; group 2 was injection molded and conventionally polymerized (Success); group 3 was injection molded and microwave polymerized (Acron MC); and group 4 was injection molded and microwave polymerized (Microbase). Intermolar width and changes in vertical dimension of occlusion, were determined after polymerization and after storage in water for 28 days. Measurements in triplicate were made between points scribed on the second molar teeth with a traveling microscope (accurate to 0.005 mm). Vertical dimension of occlusion was measured between points scribed on the upper and lower members of an articulator by use of an internal micrometer (accurate to 0.05 mm). Data were analyzed by use of a 1-way analysis of variance with Tukey post-hoc contrasts (P <.05). Polymerization contractions (intermolar widths) for each group were: group 1, -0.24%; group 2, -0.27%; group 3, -0.35%; and group 4, -0.37%. The Microbase specimens had greater shrinkage than conventionally polymerized specimens, but there were no significant differences between the groups. All injection methods had less postpolymerization increase in vertical dimension of occlusion (0.63 to 0.41 mm) than the conventional Trevalon control (0.74 mm), but only group 4 was significantly different (P<.004). After storage in water for 28 days, all specimens increased in vertical dimension of occlusion (0.10% to 0.16%) from polymerization techniques, but there were no significant differences between groups. Within the limitations of this study, injection molding resulted in a slightly less increase of vertical dimension of occlusion than conventional polymerization techniques, the difference being significant for Microbase compared with the conventional Trevalon control.

A simulated RTM process for fabricating polyimide (AMB-21) carbon fiber composites

NASA Technical Reports Server (NTRS)

Avva, V. Sarma; Sadler, Robert L.; Thomas, Shanon

1995-01-01

An experimental polyimide matrix, AMB-21 - supplied by NASA/LeRC, was especially formulated to be non-carcinogenic. It was also expected to be amenable to a Resin Transfer Molding Process (RTM). AMB-21 is a solid at room temperature and must be heated to a very high temperature to obtain a fluid state. However, even after heating it to a realistic high temperature, it was found to be too viscous for use in a RTM process. As a result, a promising approach was experimented leading to the introduction of the resin into a solvent solution in order to obtain a viscosity suitable for RTM. A mixture of methanol and tetrahydroferone was found to be a suitable solvent mixture. The matrix solution was introduced into carbon-fiber preform using two techniques: (1) injection of matrix into a Resin Transfer Mold after positioning the preform into the 'mold cavity', and (2) infiltration of matrix into the preform using the 'autoclave through-the-thickness transfer process'. After completing the resin transfer (infiltration) process, the 'filled' preform was heated to 300 F for one hour to reduce the solvent content. The temperature was then increased to 400 F under a vacuum to complete the solvent evaporation and to remove volatile products of the polyimide imidization. The impregnated preform was removed from the mold and press-cured at 200 psi and 600 FF for two hours. The resulting panel was found to be of reasonably good quality. This observation was based on the results obtained from short beam shear strength (700-8000 psi) tests and microscopic examination of the cross-section indicating a very low level of porosity. Further, the flash around the molded panels from the compression molding was free of porosity indicating the removal of volatiles, solvents, and other imidization products. Based on these studies, a new RTM mold containing a diaphragm capable of applying 200 psi at 600 F has been designed and constructed with the expectation that it will allow the incorporation of all of the above processing steps, including the consolidation with the preform in the mold cavity. Moreover, the new diaphragm design will enable to process larger preform panels. Processing studies with the diaphragm mold are being initiated.

Development of Metal Plate with Internal Structure Utilizing the Metal Injection Molding (MIM) Process.

PubMed

Shin, Kwangho; Heo, Youngmoo; Park, Hyungpil; Chang, Sungho; Rhee, Byungohk

2013-12-12

In this study, we focus on making a double-sided metal plate with an internal structure, such as honeycomb. The stainless steel powder was used in the metal injection molding (MIM) process. The preliminary studies were carried out for the measurement of the viscosity of the stainless steel feedstock and for the prediction of the filling behavior through Computer Aided Engineering (CAE) simulation. PE (high density polyethylene (HDPE) and low density polyethylene (LDPE)) and polypropylene (PP) resins were used to make the sacrificed insert with a honeycomb structure using a plastic injection molding process. Additionally, these sacrificed insert parts were inserted in the metal injection mold, and the metal injection molding process was carried out to build a green part with rectangular shape. Subsequently, debinding and sintering processes were adopted to remove the sacrificed polymer insert. The insert had a suitable rigidity that was able to endure the filling pressure. The core shift analysis was conducted to predict the deformation of the insert part. The 17-4PH feedstock with a low melting temperature was applied. The glass transition temperature of the sacrificed polymer insert would be of a high grade, and this insert should be maintained during the MIM process. Through these processes, a square metal plate with a honeycomb structure was made.

Development of Metal Plate with Internal Structure Utilizing the Metal Injection Molding (MIM) Process

PubMed Central

Shin, Kwangho; Heo, Youngmoo; Park, Hyungpil; Chang, Sungho; Rhee, Byungohk

2013-01-01

In this study, we focus on making a double-sided metal plate with an internal structure, such as honeycomb. The stainless steel powder was used in the metal injection molding (MIM) process. The preliminary studies were carried out for the measurement of the viscosity of the stainless steel feedstock and for the prediction of the filling behavior through Computer Aided Engineering (CAE) simulation. PE (high density polyethylene (HDPE) and low density polyethylene (LDPE)) and polypropylene (PP) resins were used to make the sacrificed insert with a honeycomb structure using a plastic injection molding process. Additionally, these sacrificed insert parts were inserted in the metal injection mold, and the metal injection molding process was carried out to build a green part with rectangular shape. Subsequently, debinding and sintering processes were adopted to remove the sacrificed polymer insert. The insert had a suitable rigidity that was able to endure the filling pressure. The core shift analysis was conducted to predict the deformation of the insert part. The 17-4PH feedstock with a low melting temperature was applied. The glass transition temperature of the sacrificed polymer insert would be of a high grade, and this insert should be maintained during the MIM process. Through these processes, a square metal plate with a honeycomb structure was made. PMID:28788427

Making High-Tensile-Strength Amalgam Components

NASA Technical Reports Server (NTRS)

Grugel, Richard

2008-01-01

Structural components made of amalgams can be made to have tensile strengths much greater than previously known to be possible. Amalgams, perhaps best known for their use in dental fillings, have several useful attributes, including room-temperature fabrication, corrosion resistance, dimensional stability, and high compressive strength. However, the range of applications of amalgams has been limited by their very small tensile strengths. Now, it has been discovered that the tensile strength of an amalgam depends critically on the sizes and shapes of the particles from which it is made and, consequently, the tensile strength can be greatly increased through suitable choice of the particles. Heretofore, the powder particles used to make amalgams have been, variously, in the form of micron-sized spheroids or flakes. The tensile reinforcement contributed by the spheroids and flakes is minimal because fracture paths simply go around these particles. However, if spheroids or flakes are replaced by strands having greater lengths, then tensile reinforcement can be increased significantly. The feasibility of this concept was shown in an experiment in which electrical copper wires, serving as demonstration substitutes for copper powder particles, were triturated with gallium by use of a mortar and pestle and the resulting amalgam was compressed into a mold. The tensile strength of the amalgam specimen was then measured and found to be greater than 10(exp 4) psi (greater than about 69 MPa). Much remains to be done to optimize the properties of amalgams for various applications through suitable choice of starting constituents and modification of the trituration and molding processes. The choice of wire size and composition are expected to be especially important. Perusal of phase diagrams of metal mixtures could give insight that would enable choices of solid and liquid metal constituents. Finally, whereas heretofore, only binary alloys have been considered for amalgams, ternary additions to liquid or solid components should be considered as means to impart desired properties to amalgams.

Modeling drying of three-dimensional pulp molded structures. Part I, Experimental program

Treesearch

Heike Nyist; John F. Hunt; Margit Tamasy-Bano

1998-01-01

Researchers at the USDA Forest Products Laboratory have developed a new three-dimensional structural panel, called FPL Spaceboard. This panel is formed using a U.S. patented three-dimensional mold capable of using a variety of fibrous materials with either the wet- or dry-forming process. Structurally, the panel departs from the traditional two-dimensional panel by...

A new class of sonic composites

NASA Astrophysics Data System (ADS)

Munteanu, Ligia; Chiroiu, Veturia; Donescu, Ştefania; Brişan, Cornel

2014-03-01

Transformation acoustics opens a new avenue towards the architecture, modeling and simulation of a new class of sonic composites with scatterers made of various materials and having various shapes embedded in an epoxy matrix. The design of acoustic scatterers is based on the property of Helmholtz equations to be invariant under a coordinate transformation, i.e., a specific spatial compression is equivalent to a new material in a new space. In this paper, the noise suppression for a wide full band-gap of frequencies is discussed for spherical shell scatterers made of auxetic materials (materials with negative Poisson's ratio). The original domain consists of spheres made from conventional foams with positive Poisson's ratio. The spatial compression is controlled by the coordinate transformation, and leads to an equivalent domain filled with an auxetic material. The coordinate transformation is strongly supported by the manufacturing of auxetics which is based on the pore size reduction through radial compression molds.

Test and Analyses of a Composite Multi-Bay Fuselage Panel Under Uni-Axial Compression

NASA Technical Reports Server (NTRS)

Li, Jian; Baker, Donald J.

2004-01-01

A composite panel containing three stringers and two frames cut from a vacuum-assisted resin transfer molded (VaRTM) stitched fuselage article was tested under uni-axial compression loading. The stringers and frames divided the panel into six bays with two columns of three bays each along the compressive loading direction. The two frames were supported at the ends with pins to restrict the out-of-plane translation. The free edges of the panel were constrained by knife-edges. The panel was modeled with shell finite elements and analyzed with ABAQUS nonlinear solver. The nonlinear predictions were compared with the test results in out-of-plane displacements, back-to-back surface strains on stringer flanges and back-to-back surface strains at the centers of the skin-bays. The analysis predictions were in good agreement with the test data up to post-buckling.

Synthesis of Messenger RNA and Chromosome Structure in the Cellular Slime Mold*

PubMed Central

Lodish, Harvey F.; Jacobson, Allan; Firtel, Richard; Alton, Tom; Tuchman, Jessica

1974-01-01

This paper summarizes our knowledge of the structure and biosynthesis of messenger RNA in the slime mold Dictyostelium discoideum, the arrangement of DNA sequences in the Dictyostelium chromosome, and the changes in the pattern of predominant polypeptides synthesized during Dictyostelium development. Images PMID:4531041

Materials to Engineer the Immune System

DTIC Science & Technology

2010-04-01

presentation of danger signals to regulate the ratio of distinct DC subtypes was next examined by immobilizing TLR-activating, polyethylenimine (PEI...compression molded. The resulting disc was allowed to equilibrate within a high-pressure CO2 environment, and a rapid reduction in pressure causes the...pressure CO2 process to foam macroporous PLG matrices incorporating tumor lysates. To incorporate CpG-ODNs into PLG scaffolds, we first con- densed CpG-ODN

Formability and mechanical properties of porous titanium produced by a moldless process.

PubMed

Naito, Yoshihito; Bae, Jiyoung; Tomotake, Yoritoki; Hamada, Kenichi; Asaoka, Kenzo; Ichikawa, Tetsuo

2013-08-01

Tailor-made porous titanium implants show great promise in both orthopedic and dental applications. However, traditional powder metallurgical processes require a high-cost mold, making them economically unviable for producing unique devices. In this study, a mixture of titanium powder and an inlay wax binder was developed for moldless forming and sintering. The formability of the mixture, the dimensional changes after sintering, and the physical and mechanical properties of the sintered porous titanium were evaluated. A 90:10 wt % mixture of Ti powder and wax binder was created manually at 70°C. After debindering, the specimen was sintered in Ar at 1100°C without any mold for 1, 5, and 10 h. The shrinkage, porosity, absorption ratio, bending and compressive strength, and elastic modulus were measured. The bending strength (135-356 MPa), compression strength (178-1226 MPa), and elastic modulus (24-54 GPa) increased with sintering time; the shrinkage also increased, whereas the porosity (from 37.1 to 29.7%) and absorption ratio decreased. The high formability of the binder/metal powder mixture presents a clear advantage for fabricating tailor-made bone and hard tissue substitution units. Moreover, the sintered compacts showed high strength and an elastic modulus comparable to that of cortical bone. Copyright © 2013 Wiley Periodicals, Inc.

Optically transparent super-hydrophobic thin film fabricated by reusable polyurethane-acrylate (PUA) mold

NASA Astrophysics Data System (ADS)

Park, J.-S.; Park, J.-H.; Lee, D.-W.

2018-02-01

In this paper, we describe a simple manufacturing method for producing an optically transparent super-hydrophobic polymer thin film using a reusable photo-curable polymer mold. Soluble photoresist (PR) molds were prepared with under-exposed and under-baked processes, which created unique hierarchical micro/nano structures. The reverse phase of the PR mold was replicated on the surface of polydimethylsiloxane (PDMS) substrates. The unique patterns on the replicated PDMS molds were successfully transferred back to the UV curable polyurethane-acrylate (PUA) using a laboratory-made UV exposure system. Continuous production of the super-hydrophobic PDMS thin film was demonstrated using the reusable PUA mold. In addition, hydrophobic nano-silica powder was sprayed onto the micro/nano structured PDMS surfaces to further improve hydrophobicity. The fabricated PDMS thin films with hierarchical surface texturing showed a water contact angle  ⩾150°. Excellent optical transmittance within the range of visible light of wavelengths between 400-800 nm was experimentally confirmed using a spectrophotometer. High efficiency of the super-hydrophobic PDMS film in optical transparency was also confirmed using solar panels. The fabricated PUA molds are very suitable for use in roll-to-roll or roll-to-plate systems which allow continuous production of super-hydrophobic thin films with an excellent optical transparency.

Microfluidic fuel cell systems with embedded materials and structures and method thereof

DOEpatents

Morse, Jeffrey D.; Rose, Klint A; Maghribi, Mariam; Benett, William; Krulevitch, Peter; Hamilton, Julie; Graff, Robert T.; Jankowski, Alan

2005-07-26

Described herein is a process for fabricating microfluidic systems with embedded components in which micron-scale features are molded into the polymeric material polydimethylsiloxane (PDMS). Micromachining is used to create a mold master and the liquid precursors for PDMS are poured over the mold and allowed to cure. The PDMS is then removed form the mold and bonded to another material such as PDMS, glass, or silicon after a simple surface preparation step to form sealed microchannels.

Virtual Manufacturing of Composite Structures for Ground Platforms, A DARPA Instant Foundry Adaptive Through Bits (iFAB) Program

DTIC Science & Technology

2012-08-01

This document contains color. 14. ABSTRACT This effort focused specifically on the Liquid Composite Molding (LCM) class of processes as they...SUBJECT TERMS Liquid Composite Molding (LCM), fabrication, manufacturability assessment 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF... Molding (LCM) .......................................................................... 2 1.1.1 LCM Process Variations

Mechanical properties of 2D and 3D braided textile composites

NASA Technical Reports Server (NTRS)

Norman, Timothy L.

1991-01-01

The purpose of this research was to determine the mechanical properties of 2D and 3D braided textile composite materials. Specifically, those designed for tension or shear loading were tested under static loading to failure to investigate the effects of braiding. The overall goal of the work was to provide a structural designer with an idea of how textile composites perform under typical loading conditions. From test results for unnotched tension, it was determined that the 2D is stronger, stiffer, and has higher elongation to failure than the 3D. It was also found that the polyetherether ketone (PEEK) resin system was stronger, stiffer, and had higher elongation at failure than the resin transfer molding (RTM) epoxy. Open hole tension tests showed that PEEK resin is more notch sensitive than RTM epoxy. Of greater significance, it was found that the 3D is less notch sensitive than the 2D. Unnotched compression tests indicated, as did the tension tests, that the 2D is stronger, stiffer, and has higher elongation at failure than the RTM epoxy. The most encouraging results were from compression after impact. The 3D braided composite showed a compression after impact failure stress equal to 92 percent of the unimpacted specimen. The 2D braided composite failed at about 67 percent of the unimpacted specimen. Higher damage tolerance is observed in textiles over conventional composite materials. This is observed in the results, especially in the 3D braided materials.

Production of three-dimensional tissue-engineered cartilage through mutual fusion of chondrocyte pellets.

PubMed

Hoshi, K; Fujihara, Y; Mori, Y; Asawa, Y; Kanazawa, S; Nishizawa, S; Misawa, M; Numano, T; Inoue, H; Sakamoto, T; Watanabe, M; Komura, M; Takato, T

2016-09-01

In this study, the mutual fusion of chondrocyte pellets was promoted in order to produce large-sized tissue-engineered cartilage with a three-dimensional (3D) shape. Five pellets of human auricular chondrocytes were first prepared, which were then incubated in an agarose mold. After 3 weeks of culture in matrix production-promoting medium under 5.78g/cm(2) compression, the tissue-engineered cartilage showed a sufficient mechanical strength. To confirm the usefulness of these methods, a transplantation experiment was performed using beagles. Tissue-engineered cartilage prepared with 50 pellets of beagle chondrocytes was transplanted subcutaneously into the cell-donor dog for 2 months. The tissue-engineered cartilage of the beagles maintained a rod-like shape, even after harvest. Histology showed fair cartilage regeneration. Furthermore, 20 pellets were made and placed on a beta-tricalcium phosphate prism, and this was then incubated within the agarose mold for 3 weeks. The construct was transplanted into a bone/cartilage defect in the cell-donor beagle. After 2 months, bone and cartilage regeneration was identified on micro-computed tomography and magnetic resonance imaging. This approach involving the fusion of small pellets into a large structure enabled the production of 3D tissue-engineered cartilage that was close to physiological cartilage tissue in property, without conventional polyper scaffolds. Copyright © 2016. Published by Elsevier Ltd.

Characterization and Evaluation of Incorporation the Casting Sand in Mortar

NASA Astrophysics Data System (ADS)

Zanelato, E. B.; Azevedo, A. R. G.; Alexandre, J.; Xavier, C. G.; Monteiro, S. N.; Mendonça, T. A. O.

The process of casting metals and alloys occurs through the fusion of this metal and its subsequent casting into a mold with the dimensions and geometry close to the final piece. Most foundries use sand casting molds for making you. This work aims to characterize and evaluate the foundry sand to allow its use in segments of Civil Engineering, creating a viable destination for a residue is that discarded. The following characterization tests were performer: particle size, chemical analysis, X-ray Diffraction and Density Real grain. For the execution of the test specimens was used to 1:3 cement and sand, and the incorporation of 10% and 20% of the total mass replacing the sand, and the trace reference. The results show that best results in compression and bending tests were obtained by replacing 10 % of common sand for sand casting.

Cyclic tests of P-bulb end-seal designs for a shuttle-type wing-elevon cove membrane seal

NASA Technical Reports Server (NTRS)

Hunt, L. R.

1979-01-01

Four P-bulb end seal designs were tested at room temperature in a cyclic seal test apparatus. Test results show that all the P-bulb end seals have the durability required for a 100 mission life (neglecting possible elevated-temperature effects) and three of the four P-bulbs provide an adequate seal against a 7.0-kPa air pressure differential. Antifriction material attached to the P-bulb rub surface reduced friction slightly but could degrade the sealing effectiveness. A flat rub surface molded into the P-bulb discouraged wrinkling and rolling and thereby reduced leakage. However, the P-bulbs lacked resilience, as indicated by increased leakage when P-bulb compression was reduced. The best P-bulb design tested included an antifriction interface bonded to a flat surface molded into the P-bulb.

Design variables for mechanical properties of bone tissue scaffolds.

PubMed

Howk, Daniel; Chu, Tien-Min G

2006-01-01

The reconstruction of segmental defect in long bone is a clinical challenge. Multiple surgeries are typically required to restore the structure and function of the affected defect site. In order to overcome this defect a biodegradable bone tissue engineering scaffold is used. This scaffold acts as a carrier of proteins and growth factors, while also supporting the load that the bone would normally sustain, until the natural bone can regenerate in its place. Work was done to optimize an existing solid free-form scaffold design. The goal of the optimization was to increase the porosity of the scaffold while maintaining the strength of a previously-tested prototype design. With this in mind, eight new designs were created. These designs were drawn using CAD software and then through the use of finite element analysis the theoretical ultimate compressive strength of each design was obtained. Each scaffold design was constructed by casting a thermal-curable poly(propylene fumarate)/tricalcium phosphate (PPF/TCP) suspension into wax molds fabricated on inkjet printing rapid prototyping machine. The constructs were then experimentally tested by applying a uniaxial compressive load. The theoretical and experimental values of ultimate compressive strength and specific strength of each design were compared. Theoretically, the best scaffold design produced from this work improved upon the current design by increasing the porosity by 46% and also increasing the ultimate compressive strength by 27%. The experimental data was found to match the theoretical strength in four designs, but deviate from the theoretical strength in five designs. The reasons for the deviations and their relation to the rapid prototyping manufacturing technique were discussed. The results of this work show that it is possible to increase the porosity and strength of a bone tissue engineering scaffold through simple iterations in architectural design.

Multi-component assembly casting

DOEpatents

James, Allister W.

2015-10-13

Multi-component vane segment and method for forming the same. Assembly includes: positioning a pre-formed airfoil component (12) and a preformed shroud heat resistant material (18) in a mold, wherein the airfoil component (12) and the shroud heat resistant material (18) each comprises an interlocking feature (24); preheating the mold; introducing molten structural material (46) into the mold; and solidifying the molten structural material such that it interlocks the pre-formed airfoil component (12) with respect to the preformed shroud heat resistant material (18) and is effective to provide structural support for the shroud heat resistant material (18). Surfaces between the airfoil component (12) and the structural material (46), between the airfoil component (12) and the shroud heat resistant material (18), and between the shroud heat resistant material (18) and the structural material (46) are free of metallurgical bonds.

Design and fabrication of optical homogenizer with micro structure by injection molding process

NASA Astrophysics Data System (ADS)

Chen, C.-C. A.; Chang, S.-W.; Weng, C.-J.

2008-08-01

This paper is to design and fabricate an optical homogenizer with hybrid design of collimator, toroidal lens array, and projection lens for beam shaping of Gaussian beam into uniform cylindrical beam. TracePro software was used to design the geometry of homogenizer and simulation of injection molding was preceded by Moldflow MPI to evaluate the mold design for injection molding process. The optical homogenizer is a cylindrical part with thickness 8.03 mm and diameter 5 mm. The micro structure of toroidal array has groove height designed from 12 μm to 99 μm. An electrical injection molding machine and PMMA (n= 1.4747) were selected to perform the experiment. Experimental results show that the optics homogenizer has achieved the transfer ratio of grooves (TRG) as 88.98% and also the optical uniformity as 68% with optical efficiency as 91.88%. Future study focuses on development of an optical homogenizer for LED light source.

Mycotoxins and antifungal drug interactions: implications in the treatment of illnesses due to indoor chronic toxigenic mold exposures.

PubMed

Anyanwu, Ebere C; Campbell, Andrew W; Ehiri, John E

2004-03-12

Chronic exposure to toxigenic molds in water-damaged buildings is an indoor environmental health problem to which escalating health and property insurance costs are raising a statewide concern in recent times. This paper reviews the structural and functional properties of mycotoxins produced by toxigenic molds and their interactive health implications with antifungal drugs. Fundamental bases of pathophysiological, neurodevelopmental, and cellular mechanisms of mycotoxic effects are evaluated. It is most likely that the interactions of mycotoxins with antifungal drugs may, at least in part, contribute to the observable persistent illnesses, antifungal drug resistance, and allergic reactions in patients exposed to chronic toxigenic molds. Safe dose level of mycotoxin in humans is not clear. Hence, the safety regulations in place at the moment remain inconclusive, precautionary, and arbitrary. Since some of the antifungal drugs are derived from molds, and since they have structural and functional groups similar to those of mycotoxins, the knowledge of their interactions are important in enhancing preventive measures.

Experimental analysis for fabrication of high-aspect-ratio piezoelectric ceramic structure by micro-powder injection molding process

NASA Astrophysics Data System (ADS)

Han, Jun Sae; Gal, Chang Woo; Park, Jae Man; Kim, Jong Hyun; Park, Seong Jin

2018-04-01

Aspect ratio effects in the micro-powder injection molding process were experimentally analyzed for fabrication of high-aspect-ratio piezoelectric ceramic structure. The mechanisms of critical defects have been studied according to individual manufacturing steps. In the molding process, incomplete filling phenomenon determines the critical aspect ratios of a micro pattern. According to mold temperature, an incomplete filling phenomenon has been analyzed with respect to different pattern sizes and aspect ratio. In demolding and drying process, the capillary behavior of sacrificial polymeric mold insert determines the critical aspect ratio of a micro pattern. With respect to pattern dimensions, slumping behavior has been analyzed. Based on our current systems, micro PZT feature has stability when it has lower aspect ratio than 5. Under optimized processing conditions, 20 μm and 40 μm ceramic rod array feature which has 5 of aspect ratio were successfully fabricated by the developed process. Further modification points to fabricate the smaller and higher feature were specifically addressed.

Using template/hotwire cutting to demonstrate moldless composite fabrication

NASA Technical Reports Server (NTRS)

Coleman, J. Mario

1990-01-01

The objective of this experiment is to provide a simple, inexpensive composite fabrication technique which can be easily performed with a minimum of equipment and facilities. This process eliminates expensive female molds and uses only male molds which are easily formed from foam blocks. Once the mold is shaped, it is covered with fiberglass and becomes a structural component of the product.

A 3D visualization system for molecular structures

NASA Technical Reports Server (NTRS)

Green, Terry J.

1989-01-01

The properties of molecules derive in part from their structures. Because of the importance of understanding molecular structures various methodologies, ranging from first principles to empirical technique, were developed for computing the structure of molecules. For large molecules such as polymer model compounds, the structural information is difficult to comprehend by examining tabulated data. Therefore, a molecular graphics display system, called MOLDS, was developed to help interpret the data. MOLDS is a menu-driven program developed to run on the LADC SNS computer systems. This program can read a data file generated by the modeling programs or data can be entered using the keyboard. MOLDS has the following capabilities: draws the 3-D representation of a molecule using stick, ball and ball, or space filled model from Cartesian coordinates, draws different perspective views of the molecule; rotates the molecule on the X, Y, Z axis or about some arbitrary line in space, zooms in on a small area of the molecule in order to obtain a better view of a specific region; and makes hard copy representation of molecules on a graphic printer. In addition, MOLDS can be easily updated and readily adapted to run on most computer systems.

RTM: Cost-effective processing of composite structures

NASA Technical Reports Server (NTRS)

Hasko, Greg; Dexter, H. Benson

1991-01-01

Resin transfer molding (RTM) is a promising method for cost effective fabrication of high strength, low weight composite structures from textile preforms. In this process, dry fibers are placed in a mold, resin is introduced either by vacuum infusion or pressure, and the part is cured. RTM has been used in many industries, including automotive, recreation, and aerospace. Each of the industries has different requirements of material strength, weight, reliability, environmental resistance, cost, and production rate. These requirements drive the selection of fibers and resins, fiber volume fractions, fiber orientations, mold design, and processing equipment. Research is made into applying RTM to primary aircraft structures which require high strength and stiffness at low density. The material requirements are discussed of various industries, along with methods of orienting and distributing fibers, mold configurations, and processing parameters. Processing and material parameters such as resin viscosity, perform compaction and permeability, and tool design concepts are discussed. Experimental methods to measure preform compaction and permeability are presented.

Casting materials

DOEpatents

Chaudhry, Anil R [Xenia, OH; Dzugan, Robert [Cincinnati, OH; Harrington, Richard M [Cincinnati, OH; Neece, Faurice D [Lyndurst, OH; Singh, Nipendra P [Pepper Pike, OH

2011-06-14

A foam material comprises a liquid polymer and a liquid isocyanate which is mixed to make a solution that is poured, injected or otherwise deposited into a corresponding mold. A reaction from the mixture of the liquid polymer and liquid isocyanate inside the mold forms a thermally collapsible foam structure having a shape that corresponds to the inside surface configuration of the mold and a skin that is continuous and unbroken. Once the reaction is complete, the foam pattern is removed from the mold and may be used as a pattern in any number of conventional casting processes.

Human visual system-based color image steganography using the contourlet transform

NASA Astrophysics Data System (ADS)

Abdul, W.; Carré, P.; Gaborit, P.

2010-01-01

We present a steganographic scheme based on the contourlet transform which uses the contrast sensitivity function (CSF) to control the force of insertion of the hidden information in a perceptually uniform color space. The CIELAB color space is used as it is well suited for steganographic applications because any change in the CIELAB color space has a corresponding effect on the human visual system as is very important for steganographic schemes to be undetectable by the human visual system (HVS). The perceptual decomposition of the contourlet transform gives it a natural advantage over other decompositions as it can be molded with respect to the human perception of different frequencies in an image. The evaluation of the imperceptibility of the steganographic scheme with respect to the color perception of the HVS is done using standard methods such as the structural similarity (SSIM) and CIEDE2000. The robustness of the inserted watermark is tested against JPEG compression.

Innovative Approach for High Strength, High Thermal Conductive Composite Materials: Data Base

DTIC Science & Technology

2013-11-01

pitch fiber types, from which we were able to down select K6356U pitch fiber with balanced TC and strength properties. A prepreg processing line was...Creating a robust prepreg processing line to infuse unidirectional pitch fiber tape that can be used with other fibers…Pan-based carbon or glass...pitch fiber composites • Compression molding process outperforms autoclaving in mechanical and thermal properties using the same prepreg material and

Silicon crystals: Process for manufacturing wafer-like silicon crystals with a columnar structure

NASA Technical Reports Server (NTRS)

Authier, B.

1978-01-01

Wafer-like crystals suitable for making solar cells are formed by pouring molten Si containing suitable dopants into a mold of the desired shape and allowing it to solidify in a temperature gradient, whereby the large surface of the melt in contact with the mold is kept at less than 200 D and the free surface is kept at a temperature of 200-1000 D higher, but below the melting point of Si. The mold can also be made in the form of a slit, whereby the 2 sides of the mold are kept at different temperatures. A mold was milled in the surface of a cylindrical graphite block 200 mm in diameter. The granite block was induction heated and the bottom of the mold was cooled by means of a water-cooled Cu plate, so that the surface of the mold in contact with one of the largest surfaces of the melt was held at approximately 800 D. The free surface of the melt was subjected to thermal radiation from a graphite plate located 2 mm from the surface and heated to 1500 D. The Si crystal formed after slow cooling to room temperature had a columnar structure and was cut with a diamond saw into wafers approximately 500 mm thick. Solar cells prepared from these wafers had efficiencies of 10 to 11%.

Mechanical and analytical screening of braided composites for transport fuselage applications

NASA Technical Reports Server (NTRS)

Fedro, Mark J.; Gunther, Christian; Ko, Frank K.

1991-01-01

The mechanics of materials progress in support of the goal of understanding the application of braided composites in a transport aircraft fuselage are summarized. Composites consisting of both 2-D and 3-D braid patterns are investigated. Both consolidation of commingled graphite/PEEK and resin transfer molding of graphite-epoxy braided composite processes are studied. Mechanical tests were used to examine unnotched tension, open hole tension, compression, compression after impact, in-plane shear, out-of-plane tension, bearing, and crippling. Analytical methods are also developed and applied to predict the stiffness and strengths of test specimens. A preliminary study using the test data and analytical results is performed to assess the applicability of braided composites to a commercial aircraft fuselage.

Validation of New Process Models for Large Injection-Molded Long-Fiber Thermoplastic Composite Structures

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nguyen, Ba Nghiep; Jin, Xiaoshi; Wang, Jin

2012-02-23

This report describes the work conducted under the CRADA Nr. PNNL/304 between Battelle PNNL and Autodesk whose objective is to validate the new process models developed under the previous CRADA for large injection-molded LFT composite structures. To this end, the ARD-RSC and fiber length attrition models implemented in the 2013 research version of Moldflow was used to simulate the injection molding of 600-mm x 600-mm x 3-mm plaques from 40% glass/polypropylene (Dow Chemical DLGF9411.00) and 40% glass/polyamide 6,6 (DuPont Zytel 75LG40HSL BK031) materials. The injection molding was performed by Injection Technologies, Inc. at Windsor, Ontario (under a subcontract by Oakmore » Ridge National Laboratory, ORNL) using the mold offered by the Automotive Composite Consortium (ACC). Two fill speeds under the same back pressure were used to produce plaques under slow-fill and fast-fill conditions. Also, two gating options were used to achieve the following desired flow patterns: flows in edge-gated plaques and in center-gated plaques. After molding, ORNL performed measurements of fiber orientation and length distributions for process model validations. The structure of this report is as follows. After the Introduction (Section 1), Section 2 provides a summary of the ARD-RSC and fiber length attrition models. A summary of model implementations in the latest research version of Moldflow is given in Section 3. Section 4 provides the key processing conditions and parameters for molding of the ACC plaques. The validations of the ARD-RSC and fiber length attrition models are presented and discussed in Section 5. The conclusions will be drawn in Section 6.« less

Effect of Additives on Green Sand Molding Properties using Design of Experiments and Taguchi's Quality Loss Function - An Experimental Study

NASA Astrophysics Data System (ADS)

Desai, Bhagyashree; Mokashi, Pavani; Anand, R. L.; Burli, S. B.; Khandal, S. V.

2016-09-01

The experimental study aims to underseek the effect of various additives on the green sand molding properties as a particular combination of additives could yield desired sand properties. The input parameters (factors) selected were water and powder (Fly ash, Coconut shell and Tamarind) in three levels. Experiments were planned using design of experiments (DOE). On the basis of plans, experiments were conducted to understand the behavior of sand mould properties such as compression strength, shear strength, permeability number with various additives. From the experimental results it could be concluded that the factors have significant effect on the sand properties as P-value found to be less than 0.05 for all the cases studied. The optimization based on quality loss function was also performed. The study revealed that the quality loss associated with the tamarind powder was lesser compared to other additives selected for the study. The optimization based on quality loss function and the parametric analysis using ANOVA suggested that the tamarind powder of 8 gm per Kg of molding sand and moisture content of 7% yield better properties to obtain sound castings.

Flow behavior in liquid molding

NASA Technical Reports Server (NTRS)

Hunston, D.; Phelan, F.; Parnas, R.

1992-01-01

The liquid molding (LM) process for manufacturing polymer composites with structural properties has the potential to significantly lower fabrication costs and increase production rates. LM includes both resin transfer molding and structural reaction injection molding. To achieve this potential, however, the underlying science base must be improved to facilitate effective process optimization and implementation of on-line process control. The National Institute of Standards and Technology (NIST) has a major program in LM that includes materials characterization, process simulation models, on-line process monitoring and control, and the fabrication of test specimens. The results of this program are applied to real parts through cooperative projects with industry. The key feature in the effort is a comprehensive and integrated approach to the processing science aspects of LM. This paper briefly outlines the NIST program and uses several examples to illustrate the work.

Method of casting pitch based foam

DOEpatents

Klett, James W.

2002-01-01

A process for producing molded pitch based foam is disclosed which minimizes cracking. The process includes forming a viscous pitch foam in a container, and then transferring the viscous pitch foam from the container into a mold. The viscous pitch foam in the mold is hardened to provide a carbon foam having a relatively uniform distribution of pore sizes and a highly aligned graphic structure in the struts.

Performance Characteristics of Borate Fatty Acid Formulations as Mold Inhibitors

Treesearch

Robert D. Coleman; Vina Yang; Carol A. Clausen

2013-01-01

The combination of boric acid (BA) or disodium octaborate tetrahydrate (DOT) and a fatty acid (FA) such as heptanoic, octanoic, and nonanoic acids (C7–C9) is an effective treatment solution for protecting wood structures against mold. BA or DOT alone have substantial potency against insects and decay fungi, but have negligible or no mold inhibitor activity. However,...

Feasibility of using Big Area Additive Manufacturing to Directly Manufacture Boat Molds

DOE Office of Scientific and Technical Information (OSTI.GOV)

Post, Brian K.; Chesser, Phillip C.; Lind, Randall F.

The goal of this project was to explore the feasibility of using Big Area Additive Manufacturing (BAAM) to directly manufacture a boat mold without the need for coatings. All prior tooling projects with BAAM required the use to thick coatings to overcome the surface finish limitations of the BAAM process. While the BAAM process significantly lowers the cost of building the mold, the high cost element rapidly became the coatings (cost of the material, labor on coating, and finishing). As an example, the time and cost to manufacture the molds for the Wind Turbine project with TPI Composites Inc. andmore » the molds for the submarine project with Carderock Naval Warfare Systems was a fraction of the time and cost of the coatings. For this project, a catamaran boat hull mold was designed, manufactured, and assembled with an additional 0.15” thickness of material on all mold surfaces. After printing, the mold was immediately machined and assembled. Alliance MG, LLC (AMG), the industry partner of this project, experimented with mold release agents on the carbon-fiber reinforced acrylonitrile butadiene styrene (CF ABS) to verify that the material can be directly used as a mold (rather than needing a coating). In addition, for large molds (such as the wind turbine mold with TPI Composites Inc.), the mold only provided the target surface. A steel subframe had to be manufactured to provide structural integrity. If successful, this will significantly reduce the time and cost necessary for manufacturing large resin infusion molds using the BAAM process.« less

Study of the Effect of Mold Corner Shape on the Initial Solidification Behavior of Molten Steel Using Mold Simulator

NASA Astrophysics Data System (ADS)

Lyu, Peisheng; Wang, Wanlin; Long, Xukai; Zhang, Kaixuan; Gao, Erzhuo; Qin, Rongshan

2018-02-01

The chamfered mold with a typical corner shape (angle between the chamfered face and hot face is 45 deg) was applied to the mold simulator study in this paper, and the results were compared with the previous results from a well-developed right-angle mold simulator system. The results suggested that the designed chamfered structure would increase the thermal resistance and weaken the two-dimensional heat transfer around the mold corner, causing the homogeneity of the mold surface temperatures and heat fluxes. In addition, the chamfered structure can decrease the fluctuation of the steel level and the liquid slag flow around the meniscus at mold corner. The cooling intensities at different longitudinal sections of shell are close to each other due to the similar time-average solidification factors, which are 2.392 mm/s1/2 (section A-A: chamfered center), 2.372 mm/s1/2 (section B-B: 135 deg corner), and 2.380 mm/s1/2 (section D-D: face), respectively. For the same oscillation mark (OM), the heights of OM roots at different positions (profile L1 (face), profile L2 (135 deg corner), and profile L3 (chamfered center)) are very close to each other. The average value of height difference (HD) between two OMs roots for L1 and L2 is 0.22 mm, and for L2 and L3 is 0.38 mm. Finally, with the help of metallographic examination, the shapes of different hooks were also discussed.

[A surface reacted layer study of titanium-zirconium alloy after dental casting].

PubMed

Zhang, Y; Guo, T; Li, Z; Li, C

2000-10-01

To investigate the influence of the mold temperature on the surface reacted layer of Ti-Zr alloy castings. Ti-Zr alloy was casted into a mold which was made of a zircon (ZrO2.SiO2) for inner coating and a phosphate-bonded material for outer investing with a casting machine (China) designed as vacuum, pressure and centrifuge. At three mold temperatures (room temperature, 300 degrees C, 600 degrees C) the Ti-Zr alloy was casted separately. The surface roughness of the castings was calculated by instrument of smooth finish (China). From the surface to the inner part the Knoop hardness and thickness in reacted layer of Ti-Zr alloy casting was measured. The structure of the surface reacted layer was analysed by SEM. Elemental analyses of the interfacial zone of the casting was made by element line scanning observation. The surface roughness of the castings was increased significantly with the mold temperature increasing. At a higher mold temperature the Knoop hardness of the reactive layer was increased. At the three mold temperature the outmost surface was very hard, and microhardness data decreased rapidly where they reached constant values. The thickness was about 85 microns for castings at room temperature and 300 degrees C, 105 microns for castings at 600 degrees C. From the SEM micrograph of the Ti-Zr alloy casting, the surface reacted layer could be divided into three different layers. The first layer was called non-structure layer, which thickness was about 10 microns for room temperature group, 20 microns for 300 degrees C and 25 microns for 600 degrees C. The second layer was characterized by coarse-grained acicular crystal, which thickness was about 50 microns for three mold temperatures. The third layer was Ti-Zr alloy. The element line scanning showed non-structure layer with higher level of element of O, Al, Si and Zr, The higher the mold temperature during casting, the deeper the Si permeating and in the second layer the element Si could also be found. The mold temperature is one of the major factors influencing to casting quality. In order to reduce the surface reacted layer of Ti-Zr alloy castings, the lower mold temperature and the investment without Si should be chosen.

Numerical prediction of flow induced fibers orientation in injection molded polymer composites

NASA Astrophysics Data System (ADS)

Oumer, A. N.; Hamidi, N. M.; Mat Sahat, I.

2015-12-01

Since the filling stage of injection molding process has important effect on the determination of the orientation state of the fibers, accurate analysis of the flow field for the mold filling stage becomes a necessity. The aim of the paper is to characterize the flow induced orientation state of short fibers in injection molding cavities. A dog-bone shaped model is considered for the simulation and experiment. The numerical model for determination of the fibers orientation during mold-filling stage of injection molding process was solved using Computational Fluid Dynamics (CFD) software called MoldFlow. Both the simulation and experimental results showed that two different regions (or three layers of orientation structures) across the thickness of the specimen could be found: a shell region which is near to the mold cavity wall, and a core region at the middle of the cross section. The simulation results support the experimental observations that for thin plates the probability of fiber alignment to the flow direction near the mold cavity walls is high but low at the core region. It is apparent that the results of this study could assist in decisions regarding short fiber reinforced polymer composites.

Superior Mechanical Properties of Epoxy Composites Reinforced by 3D Interconnected Graphene Skeleton.

PubMed

Ni, Ya; Chen, Lei; Teng, Kunyue; Shi, Jie; Qian, Xiaoming; Xu, Zhiwei; Tian, Xu; Hu, Chuansheng; Ma, Meijun

2015-06-03

Epoxy-based composites reinforced by three-dimensional graphene skeleton (3DGS) were fabricated in resin transfer molding method with respect to the difficulty in good dispersion and arrangement of graphene sheets in composites by directly mixing graphene and epoxy. 3DGS was synthesized in the process of self-assembly and reduction with poly(amidoamine) dendrimers. In the formation of 3DGS, graphene sheets were in good dispersion and ordered state, which resulted in exceptional mechanical properties and thermal stability for epoxy composites. For 3DGS/epoxy composites, the tensile and compressive strengths significantly increased by 120.9% and 148.3%, respectively, as well as the glass transition temperature, which increased by a notable 19 °C, unlike the thermal exfoliation graphene/epoxy composites via direct-mixing route, which increased by only 0.20 wt % content of fillers. Relative to the graphene/epoxy composites in direct-mixing method mentioned in literature, the increase in tensile and compressive strengths of 3DGS/epoxy composites was at least twofold and sevenfold, respectively. It can be expected that 3DGS, which comes from preforming graphene sheets orderly and dispersedly, would replace graphene nanosheets in polymer nanocomposite reinforcement and endow composites with unique structure and some unexpected performance.

Fatigue resistance of unnotched and post impact(+/- 30 deg/0 deg) 3-D braided composites

NASA Technical Reports Server (NTRS)

Portanova, Marc A.

1994-01-01

The fatigue resistance of a multiaxial braided (3-D) graphite/expoxy composite in both unnotched and post impacted conditions has been evaluated. The material tested is a (+/- 30/0 deg) multiaxial braid constructed from AS4/12K tow graphite fibers and British Petroleum E905L epoxy resin. These materials were braided as dry preforms and the epoxy was added using a resin transfer molding process (RTM). The unnotched and post-impact specimens were tested in compression-compression fatigue at 10 Hz with a stress ratio of R=10. The unnotched tension-tension fatigue specimens were tested at S Hz with a stress ration of R=0.1. Damage initiation and growth was documented through the application of radiography and ultrasonic through transmission (C-scans). Visible inspection of surface and edge damage was also noted to describe the initiation and progression of damage in these materials. The mechanisms leading to damage initiation were established and failure modes were determined. Stiffness and strength degradation were measured as a function of applied cycles. These 3-D braided composite results were compared to strain levels currently used to design primary structure in commercial aircraft composite components made from prepreg tape and autoclave cured.

Interface conditions of two-shot molded parts

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kisslinger, Thomas, E-mail: thomas.kisslinger@pccl.at; Bruckmoser, Katharina, E-mail: katharina.bruckmoser@unileoben.ac.at; Resch, Katharina, E-mail: katharina.resch@unileoben.ac.at

2014-05-15

The focus of this work is on interfaces of two-shot molded parts. It is well known that e.g. material combination, process parameters and contact area structures show significant effects on the bond strength of multi-component injection molded parts. To get information about the bond strength at various process parameter settings and material combinations a test mold with core back technology was used to produce two-component injection molded tensile test specimens. At the core back process the different materials are injected consecutively, so each component runs through the whole injection molding cycle (two-shot process). Due to this consecutive injection molding processes,more » a cold interface is generated. This is defined as overmolding of a second melt to a solidified polymer preform. Strong interest lies in the way the interface conditions change during the adhesion formation between the individual components. Hence the interface conditions were investigated by computed tomography and Raman spectroscopy. By analyzing these conditions the understanding of the adhesion development during the multi-component injection molding was improved.« less

Producing Zirconium Diboride Components with Complex, Near-Net Shape Geometries by Aqueous Room-Temperature Injection Molding

NASA Technical Reports Server (NTRS)

Wiesner, Valerie L.; Youngblood, Jeffrey; Trice, Rodney

2014-01-01

Room-temperature injection molding is proposed as a novel, low-cost and more energy efficient manufacturing process capable of forming complex-shaped zirconium diboride (ZrB2) parts. This innovative processing method utilized aqueous suspensions with high powder loading and a minimal amount (5 vol.) of water-soluble polyvinylpyrrolidone (PVP), which was used as a viscosity modifier. Rheological characterization was performed to evaluate the room-temperature flow properties of ZrB2-PVP suspensions. ZrB2 specimens were fabricated with high green body strength and were machinable prior to binder removal despite their low polymer content. After binder burnout and pressureless sintering, the bulk density and microstructure of specimens were characterized using Archimedes technique and scanning electron microscopy. X-Ray Diffraction was used to determine the phase compositions present in sintered specimens. Ultimate strength of sintered specimens will be determined using ASTM C1323-10 compressive C-ring test.

Cartilage formation in the CELLS 'double bubble' hardware

NASA Technical Reports Server (NTRS)

Duke, P. J.; Arizpe, Jorge; Montufar-Solis, Dina

1991-01-01

The CELLS experiment scheduled to be flown on the first International Microgravity Laboratory is designed to study the effect of microgravity on the cartilage formation, by measuring parameters of growth in a differentiating cartilage cell culture. This paper investigates the conditions for this experiment by studying cartilage differentiation in the 'bubble exchange' hardware with the 'double bubble' design in which the bubbles are joined by a flange which also overlays the gasket. Four types of double bubbles (or double gas permeable membranes) were tested: injection-molded bubbles 0.01- and 0.005-in. thick, and compression molded bubbles 0.015- and 0.01-in. thick. It was found that double bubble membranes of 0.005- and 0.010-in. thickness supported cartilage differentiation, while the 0.015-in. bubbles did not. It was also found that nodule count, used in this study as a parameter, is not the best measure of the amount of cartilage differentiation.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Weizhao; Zhang, Zixuan; Lu, Jie

Carbon fiber composites have received growing attention because of their high performance. One economic method to manufacturing the composite parts is the sequence of forming followed by the compression molding process. In this sequence, the preforming procedure forms the prepreg, which is the composite with the uncured resin, to the product geometry while the molding process cures the resin. Slip between different prepreg layers is observed in the preforming step and this paper reports a method to characterize the properties of the interaction between different prepreg layers, which is critical to predictive modeling and design optimization. An experimental setup wasmore » established to evaluate the interactions at various industrial production conditions. The experimental results were analyzed for an in-depth understanding about how the temperature, the relative sliding speed, and the fiber orientation affect the tangential interaction between two prepreg layers. The interaction factors measured from these experiments will be implemented in the computational preforming program.« less

Helmet of a laminate construction of polycarbonate and polysulfone polymeric material

NASA Technical Reports Server (NTRS)

Kosmo, Joseph J. (Inventor); Dawn, Frederic S. (Inventor)

1991-01-01

An article of laminate construction is disclosed which is comprised of an underlayer of polycarbonate polymer material to which is applied a chemically resistant outer layer of polysulfone. The layers which are joined by compression-heat molding, are molded to form the shape of a body protective shell such as a space helmet comprising a shell of polycarbonate, polysulfone laminate construction attached at its open end to a sealing ring adapted for connection to a space suit. The front portion of the shell provides a transparent visor for the helmet. An outer visor of polycarbonate polysulfone laminate construction is pivotally mounted to the sealing ring for covering the transparent visor portion of the shell during extravehicular activities. The polycarbonate under layer of the outer visor is coated on its inner surface with a vacuum deposit of gold to provide additional thermal radiation resistance.

On processing development for fabrication of fiber reinforced composite, part 2

NASA Technical Reports Server (NTRS)

Hou, Tan-Hung; Hou, Gene J. W.; Sheen, Jeen S.

1989-01-01

Fiber-reinforced composite laminates are used in many aerospace and automobile applications. The magnitudes and durations of the cure temperature and the cure pressure applied during the curing process have significant consequences for the performance of the finished product. The objective of this study is to exploit the potential of applying the optimization technique to the cure cycle design. Using the compression molding of a filled polyester sheet molding compound (SMC) as an example, a unified Computer Aided Design (CAD) methodology, consisting of three uncoupled modules, (i.e., optimization, analysis and sensitivity calculations), is developed to systematically generate optimal cure cycle designs. Various optimization formulations for the cure cycle design are investigated. The uniformities in the distributions of the temperature and the degree with those resulting from conventional isothermal processing conditions with pre-warmed platens. Recommendations with regards to further research in the computerization of the cure cycle design are also addressed.

Nde of Lumber and Natural Fiber Based Products with Air Coupled Ultrasound

NASA Astrophysics Data System (ADS)

Hsu, David K.; Utrata, David; Kuo, Monlin

2010-02-01

Due to the porous nature of wood and natural fiber based products, conventional fluid or gel coupled ultrasonic inspection is unsuitable. Air-coupled ultrasonic transmission scanning, being non-contact, is ideally suited for inspecting lumber, wood and natural fiber based products. We report here several successful applications of air-coupled ultrasound for the inspection of wood. Air-coupled ultrasonic scan at 120 kHz can easily detect "sinker-stock" lumber in which bacterial damage of ray tissue cells had occurred during anaerobic pond storage. Channels in ash lumber board caused by insect bore were imaged in transmission scan. Delamination and material inhomogeneities were mapped out in manufactured wood and natural fiber products including medium density fiberboards, compression molded shredded waste wood with formaldehyde resin, and acoustic panels molded with kenaf fibers. The study has demonstrated some of the capabilities of air-coupled ultrasound in the NDE of forest products.

Scalable Inkjet-Based Structural Color Printing by Molding Transparent Gratings on Multilayer Nanostructured Surfaces.

PubMed

Jiang, Hao; Kaminska, Bozena

2018-04-24

To enable customized manufacturing of structural colors for commercial applications, up-scalable, low-cost, rapid, and versatile printing techniques are highly demanded. In this paper, we introduce a viable strategy for scaling up production of custom-input images by patterning individual structural colors on separate layers, which are then vertically stacked and recombined into full-color images. By applying this strategy on molded-ink-on-nanostructured-surface printing, we present an industry-applicable inkjet structural color printing technique termed multilayer molded-ink-on-nanostructured-surface (M-MIONS) printing, in which structural color pixels are molded on multiple layers of nanostructured surfaces. Transparent colorless titanium dioxide nanoparticles were inkjet-printed onto three separate transparent polymer substrates, and each substrate surface has one specific subwavelength grating pattern for molding the deposited nanoparticles into structural color pixels of red, green, or blue primary color. After index-matching lamination, the three layers were vertically stacked and bonded to display a color image. Each primary color can be printed into a range of different shades controlled through a half-tone process, and full colors were achieved by mixing primary colors from three layers. In our experiments, an image size as big as 10 cm by 10 cm was effortlessly achieved, and even larger images can potentially be printed on recombined grating surfaces. In one application example, the M-MIONS technique was used for printing customizable transparent color optical variable devices for protecting personalized security documents. In another example, a transparent diffractive color image printed with the M-MIONS technique was pasted onto a transparent panel for overlaying colorful information onto one's view of reality.

Soft Lithography

NASA Astrophysics Data System (ADS)

Xia, Younan; Whitesides, George M.

1998-08-01

Soft lithography represents a non-photolithographic strategy based on selfassembly and replica molding for carrying out micro- and nanofabrication. It provides a convenient, effective, and low-cost method for the formation and manufacturing of micro- and nanostructures. In soft lithography, an elastomeric stamp with patterned relief structures on its surface is used to generate patterns and structures with feature sizes ranging from 30 nm to 100 mum. Five techniques have been demonstrated: microcontact printing (muCP), replica molding (REM), microtransfer molding (muTM), micromolding in capillaries (MIMIC), and solvent-assisted micromolding (SAMIM). In this chapter we discuss the procedures for these techniques and their applications in micro- and nanofabrication, surface chemistry, materials science, optics, MEMS, and microelectronics.

Method for rapid fabrication of fiber preforms and structural composite materials

DOEpatents

Klett, James W.; Burchell, Timothy D.; Bailey, Jeffrey L.

1998-01-01

A densified carbon matrix carbon fiber composite preform is made by vacuum molding an aqueous slurry of carbon fibers and carbonizable organic powder to form a molded part. The molded part is dried in an oven at 50.degree. C. for 14 hours and hot pressed at 2000 psi at 400.degree. C. for 3 hours. The hot pressed part is carbonized at 650.degree. C. under nitrogen for 3 hours and graphitized at 2400.degree. C. to form a graphitic structure in the matrix of the densified carbon matrix carbon fiber composite preform. The densified preform has a density greater than 1.1 g/cc.

Method for rapid fabrication of fiber preforms and structural composite materials

DOEpatents

Klett, J.W.; Burchell, T.D.; Bailey, J.L.

1998-04-28

A densified carbon matrix carbon fiber composite preform is made by vacuum molding an aqueous slurry of carbon fibers and carbonizable organic powder to form a molded part. The molded part is dried in an oven at 50 C for 14 hours and hot pressed at 2,000 psi at 400 C for 3 hours. The hot pressed part is carbonized at 650 C under nitrogen for 3 hours and graphitized at 2,400 C to form a graphitic structure in the matrix of the densified carbon matrix carbon fiber composite preform. The densified preform has a density greater than 1.1 g/cc. 12 figs.

Method for rapid fabrication of fiber preforms and structural composite materials

DOEpatents

Klett, J.W.; Burchell, T.D.; Bailey, J.L.

1999-02-16

A densified carbon matrix carbon fiber composite preform is made by vacuum molding an aqueous slurry of carbon fibers and carbonizable organic powder to form a molded part. The molded part is dried in an oven at 50 C for 14 hours and hot pressed at 2000 psi at 400 C for 3 hours. The hot pressed part is carbonized at 650 C under nitrogen for 3 hours and graphitized at 2400 C to form a graphitic structure in the matrix of the densified carbon matrix carbon fiber composite preform. The densified preform has a density greater than 1.1 g/cc. 12 figs.

Method for rapid fabrication of fiber preforms and structural composite materials

DOEpatents

Klett, James W.; Burchell, Timothy D.; Bailey, Jeffrey L.

1999-01-01

A densified carbon matrix carbon fiber composite preform is made by vacuum molding an aqueous slurry of carbon fibers and carbonizable organic powder to form a molded part. The molded part is dried in an oven at 50.degree. C. for 14 hours and hot pressed at 2000 psi at 400.degree. C. for 3 hours. The hot pressed part is carbonized at 650.degree. C. under nitrogen for 3 hours and graphite at 2400.degree. C. to form a graphitic structure in the matrix of the densified carbon matrix carbon fiber composite preform. The densified preform has a density greater than 1.1 g/cc.

Resin transfer molding for advanced composite primary aircraft structures

NASA Technical Reports Server (NTRS)

Markus, Alan; Palmer, Ray

1991-01-01

Resin Transfer Molding (RTM) has been identified by Douglas Aircraft Company (DAC) and industry to be one of the promising processes being developed today which can break the cost barrier of implementing composite primary structures into a commercial aircraft production environment. The RTM process developments and scale-up plans Douglas Aircrart will be conducting under the NASA ACT contract are discussed.

Resin transfer molding for advanced composite primary wing and fuselage structures

NASA Technical Reports Server (NTRS)

Markus, Alan

1992-01-01

The stitching and resin transfer molding (RTM) processes developed at Douglas Aircraft Co. are successfully demonstrating significant cost reductions with good damage tolerance properties. These attributes were identified as critical to application of advanced composite materials to commercial aircraft primary structures. The RTM/stitching developments, cost analyses, and test results are discussed of the NASA Advanced Composites Technology program.

Fabrication of sinterable silicon nitride by injection molding

NASA Technical Reports Server (NTRS)

Quackenbush, C. L.; French, K.; Neil, J. T.

1982-01-01

Transformation of structural ceramics from the laboratory to production requires development of near net shape fabrication techniques which minimize finish grinding. One potential technique for producing large quantities of complex-shaped parts at a low cost, and microstructure of sintered silicon nitride fabricated by injection molding is discussed and compared to data generated from isostatically dry-pressed material. Binder selection methodology, compounding of ceramic and binder components, injection molding techniques, and problems in binder removal are discussed. Strength, oxidation resistance, and microstructure of sintered silicon nitride fabricated by injection molding is discussed and compared to data generated from isostatically dry-pressed material.

Processing study of injection molding of silicon nitride for engine applications

NASA Technical Reports Server (NTRS)

Rorabaugh, M. E.; Yeh, H. C.

1985-01-01

The high hardness of silicon nitride, which is currently under consideration as a structural material for such hot engine components as turbine blades, renders machining of the material prohibitively costly; the near net shape forming technique of injection molding is accordingly favored as a means for component fabrication. Attention is presently given to the relationships between injection molding processing parameters and the resulting microstructural and mechanical properties of the resulting engine parts. An experimental program has been conducted under NASA sponsorship which tests the quality of injection molded bars of silicon nitride at various stages of processing.

Porous electrode apparatus for electrodeposition of detailed metal structures or microelectronic interconnections

DOEpatents

Griffiths, Stewart K.; Nilson, Robert H.; Hruby, Jill M.

2002-01-01

An apparatus and procedure for performing microfabrication of detailed metal structures by electroforming metal deposits within small cavities. Two primary areas of application are: the LIGA process which manufactures complex three-dimensional metal parts and the damascene process used for electroplating line and via interconnections of microelectronic devices. A porous electrode held in contact or in close proximity with a plating substrate or mold top to ensure one-dimensional and uniform current flow into all mold cavities is used. Electrolyte is pumped over the exposed surface of the porous electrode to ensure uniform ion concentrations at this external surface. The porous electrode prevents electrolyte circulation within individual mold cavities, avoiding preferential enhancement of ion transport in cavities having favorable geometries. Both current flow and ion transport are one-dimensional and identical in all mold cavities, so all metal deposits grow at the same rate eliminating nonuniformities of the prior art.

Foam patterns

DOEpatents

Chaudhry, Anil R; Dzugan, Robert; Harrington, Richard M; Neece, Faurice D; Singh, Nipendra P; Westendorf, Travis

2013-11-26

A method of creating a foam pattern comprises mixing a polyol component and an isocyanate component to form a liquid mixture. The method further comprises placing a temporary core having a shape corresponding to a desired internal feature in a cavity of a mold and inserting the mixture into the cavity of the mold so that the mixture surrounds a portion of the temporary core. The method optionally further comprises using supporting pins made of foam to support the core in the mold cavity, with such pins becoming integral part of the pattern material simplifying subsequent processing. The method further comprises waiting for a predetermined time sufficient for a reaction from the mixture to form a foam pattern structure corresponding to the cavity of the mold, wherein the foam pattern structure encloses a portion of the temporary core and removing the temporary core from the pattern independent of chemical leaching.

Effects of Moisture and Other Contaminants in Friction Composites

DTIC Science & Technology

1993-01-30

NC 126, (Cardolite Corporation, Newark, NJ), a cashew nut shell liquid modified phenolic resin. NC126 is different from a straight phenolic resin in...that there is an alkyl chain substituent in the meta position of the phenol. The resin is derived from cashew nut shell liquid and is a solid...crosslinked cashew resin and is often referred to as cashew particles. The friction materials were processed by compression molding at 160 °C and 1000 psi

Heat Transfer in the LCCM Thermal Reserve Battery

DTIC Science & Technology

2009-09-01

and Molded Sheet 3M Corporation, Elkhart IN 46516 Microtherm Sheet Microtherm Inc., Alcoa TN 37701 AR5401 Flexible Blanket Aspen Aerogels, Inc...heated Microtherm side wall and axial thermal insulation 90.9 GPS9I 04/27/07 All batteries after GPS9H used six silicone rubber gaskets to form...pressure before ignition. Thin Microtherm side wrap next to cell stack. No pre- compression of any side wall insulation or side wall heat paper (– 40

Fabrication and Properties of polyacrylic acid by ionic surfactant disturbance method

NASA Astrophysics Data System (ADS)

Lawan, S.; Osotchan, T.; Chuajiw, W.; Subannajui, K.

2017-09-01

The formation of polymeric materials can be achieved by several methods such as melting and casting, screw extrusion, cross-linking of resin or rubber in a mold, and so on. In this work, the polyacrylic acid is formed by using the emulsion disturbance method. Despite extensively used in the colour painting and coating industries, acrylic emulsion can be processed into a foam and powder configuration by a reaction between acrylic emulsion and salt. The solidification hardly changes the volume between liquid emulsion and solidified polymer which means the final structure of polyacrylic acid is filled with opened air cells. The opened air cell structure is confirmed by the result from scanning electron microscopy. The chemical analysis and crystallography of acrylic powder and foam are examined by Fourier-transform infrared spectroscopy and X-ray diffraction respectively. The phase transformation and Thermal stability are studied by differential scanning calorimetry and thermo gravimetric analysis. Moreover, the mechanical properties of acrylic foam were observed by tensile, compressive and hardness test. In addition to the basic property analysis, acrylic foam was also used in the particle filtration application.

Fabrication of hierarchically structured superhydrophobic PDMS surfaces by Cu and CuO casting

NASA Astrophysics Data System (ADS)

Migliaccio, Christopher P.; Lazarus, Nathan

2015-10-01

Poly(dimethylsiloxane) (PDMS) films decorated with hierarchically structured pillars are cast from large area copper and copper oxide negative molds. The molds are fabricated using a single patterning step and electroplating. The process of casting structured PDMS films is simpler and cheaper than alternatives based on deep reactive ion etching or laser roughening of bulk silicone. Texture imparted to the pillars from the mold walls renders the PDMS films superhydrophobic, with the contact angle/hysteresis of the most non-wetting surfaces measuring 164°/9° and 158°/10° for surfaces with and without application of a low surface energy coating. The usefulness of patterned PDMS films as a "self-cleaning" solar cell module covering is demonstrated and other applications are discussed.

Cold isopressing method

DOEpatents

Chen, Jack C.; Stawisuck, Valerie M.; Prasad, Ravi

2003-01-01

A cold isopressing method in which two or more layers of material are formed within an isopressing mold. One of the layers consists of a tape-cast film. The layers are isopressed within the isopressing mold, thereby to laminate the layers and to compact the tape-cast film. The isopressing mold can be of cylindrical configuration with the layers being coaxial cylindrical layers. The materials used in forming the layers can contain green ceramic materials and the resultant structure can be fired and sintered as necessary and in accordance with known methods to produce a finished composite, ceramic structure. Further, such green ceramic materials can be of the type that are capable of conducting hydrogen or oxygen ions at high temperature with the object of utilizing the finished composite ceramic structure as a ceramic membrane element.

The Temperature and Structure Dependence of Surface Tension of CaO-SiO2-Na2O-CaF2 Mold Fluxes

NASA Astrophysics Data System (ADS)

Gao, Qiang; Min, Yi; Jiang, Maofa

2018-06-01

The surface tension of mold flux is one of the most important properties and varies with the temperature from the top to the bottom of the mold, which influences the adhesion and lubrication between the liquid mold flux and the solidified shell, further influencing the quality of the continuous billet. In the present paper, the effect of temperature on the surface tension of CaO-SiO2-Na2O-CaF2 mold-flux melts with different CaO/SiO2 mass ratios was investigated using the maximum-pull method. Furthermore, the microstructure of mold fluxes was analyzed using FT-IR and Raman spectra to discuss the change mechanism of surface tension. The results indicated that the temperature dependence of surface tension was different with different CaO/SiO2 mass ratios, and agreed with the modification of melt structure. When the CaO/SiO2 mass ratio was 0.67 and 0.85, the change of surface tension with temperature was relatively stable, and the influence of temperature on the structure was small. When the CaO/SiO2 mass ratio was 1.03 and 1.16, with an increase of temperature, the surface tension decreased linearly and the changing amplitude was large; the degree of polymerization of melts and average radii of silicon-oxygen anions also decreased, which intensified the molecular thermal motion and weakened the intermolecular interaction, resulting in a decrease of surface tension of melts.

The Temperature and Structure Dependence of Surface Tension of CaO-SiO2-Na2O-CaF2 Mold Fluxes

NASA Astrophysics Data System (ADS)

Gao, Qiang; Min, Yi; Jiang, Maofa

2018-02-01

The surface tension of mold flux is one of the most important properties and varies with the temperature from the top to the bottom of the mold, which influences the adhesion and lubrication between the liquid mold flux and the solidified shell, further influencing the quality of the continuous billet. In the present paper, the effect of temperature on the surface tension of CaO-SiO2-Na2O-CaF2 mold-flux melts with different CaO/SiO2 mass ratios was investigated using the maximum-pull method. Furthermore, the microstructure of mold fluxes was analyzed using FT-IR and Raman spectra to discuss the change mechanism of surface tension. The results indicated that the temperature dependence of surface tension was different with different CaO/SiO2 mass ratios, and agreed with the modification of melt structure. When the CaO/SiO2 mass ratio was 0.67 and 0.85, the change of surface tension with temperature was relatively stable, and the influence of temperature on the structure was small. When the CaO/SiO2 mass ratio was 1.03 and 1.16, with an increase of temperature, the surface tension decreased linearly and the changing amplitude was large; the degree of polymerization of melts and average radii of silicon-oxygen anions also decreased, which intensified the molecular thermal motion and weakened the intermolecular interaction, resulting in a decrease of surface tension of melts.

Thermoplastic composites for veneering posterior teeth-a feasibility study.

PubMed

Gegauff, Anthony G; Garcia, Jose L; Koelling, Kurt W; Seghi, Robert R

2002-09-01

This pilot study was conducted to explore selected commercially-available thermoplastic composites that potentially had physical properties superior to currently available dental systems for restoring esthetic posterior crowns. Polyurethane, polycarbonate, and poly(ethylene/tetrafluoroethylene) (ETFE) composites and unfilled polyurethane specimens were injection molded to produce shapes adaptive to five standardized mechanical tests. The mechanical testing included abrasive wear rate, yield strength, apparent fracture toughness (strength ratio), flexural strength, and compressive strength. Compared to commercially available dental composites, abrasion wear rates were lower for all materials tested, yield strength was greater for the filled polycarbonates and filled polyurethane resins, fracture toughness testing was invalid (strength ratios were calculated for comparison of the pilot test materials), flexural strength was roughly similar except for the filled ETFE which was significantly greater, and compressive strength was lower. Commercially available thermoplastic resin composites, such as polyurethane, demonstrate the potential for development of an artificial crown material which exceeds the mechanical properties of currently available esthetic systems, if compressive strength can be improved.

Process simulations for manufacturing of thick composites

NASA Astrophysics Data System (ADS)

Kempner, Evan A.

The availability of manufacturing simulations for composites can significantly reduce the costs associated with process development. Simulations provide a tool for evaluating the effect of processing conditions on the quality of parts produced without requiring numerous experiments. This is especially significant in parts that have troublesome features such as large thickness. The development of simulations for thick walled composites has been approached by examining the mechanics of resin flow and fiber deformation during processing, applying these evaluations to develop simulations, and evaluating the simulation with experimental results. A unified analysis is developed to describe the three-dimensional resin flow and fiber preform deformation during processing regardless of the manufacturing process used. It is shown how the generic governing evaluations in the unified analysis can be applied to autoclave molding, compression molding, pultrusion, filament winding, and resin transfer molding. A comparison is provided with earlier models derived individually for these processes. The evaluations described for autoclave curing were used to produce a one-dimensional cure simulation for autoclave curing of thick composites. The simulation consists of an analysis for heat transfer and resin flow in the composite as well as bleeder plies used to absorb resin removed from the part. Experiments were performed in a hot press to approximate curing in an autoclave. Graphite/epoxy laminates of 3 cm and 5 cm thickness were cured while monitoring temperatures at several points inside the laminate and thickness. The simulation predicted temperatures fairly closely, but difficulties were encountered in correlation of thickness results. This simulation was also used to study the effects of prepreg aging on processing of thick composites. An investigation was also performed on filament winding with prepreg tow. Cylinders were wound of approximately 12 mm thickness with pressure gages at the mandrel-composite interface. Cylinders were hoop wound with tensions ranging from 13-34 N. An analytical model was developed to calculate change in stress due to relaxation during winding. Although compressive circumferential stresses occurred throughout each of the cylinders, the magnitude was fairly low.

Low-cost endoscopic third ventriculostomy simulator with mimetic endoscope.

PubMed

Garling, Richard Justin; Jin, Xin; Yang, Jianzhong; Khasawneh, Ahmad H; Harris, Carolyn Anne

2018-05-11

OBJECTIVE Hydrocephalus affects approximately 1 in 500 people in the US, yet ventricular shunting, the gold standard of treatment, has a nearly 85% failure rate. Endoscopic third ventriculostomy (ETV) is an alternative surgical approach for a specific subset of hydrocephalic patients, but can be limited by the inability of neurosurgical residents to practice prior to patient contact. The goal of this study was to create an affordable ETV model and endoscope for resident training. METHODS Open-source software was used to isolate the skull and brain from the CT and MR images of a 2-year-old boy with hydrocephalus. A 3D printer created the skull and a 3D mold of the brain. A mixture of silicone and silicone tactile mutator was used to cast the brain mold prior to subsequent compression and shearing modulus testing. A mimetic endoscope was then created from basic supplies and a 3D printed frame. A small cohort of neurosurgical residents and attending physicians evaluated the ETV simulator with mimetic endoscope. RESULTS The authors successfully created a mimetic endoscope and ETV simulator. After compression and shearing modulus testing, a silicone/Slacker ratio between 10:6 and 10:7 was found to be similar to that of human brain parenchyma. Eighty-seven percent of participants strongly agreed that the simulator was useful for resident training, and 93% strongly agreed that the simulator helped them understand how to orient themselves with the endoscope. CONCLUSIONS The authors created an affordable (US$123, excluding 3D printer), easy-to-use ETV simulator with endoscope. Previous models have required expensive software and costly operative endoscopes that may not be available to most residents. Instead, this attempt takes advantage of open-source software for the manipulation and fabrication of a patient-specific mold. This model can assist with resident development, allowing them to safely practice use of the endoscope in ETV.

Microfluidic structures and methods for integrating a functional component into a microfluidic device

DOEpatents

Simmons, Blake [San Francisco, CA; Domeier, Linda [Danville, CA; Woo, Noble [San Gabriet, CA; Shepodd, Timothy [Livermore, CA; Renzi, Ronald F [Tracy, CA

2008-04-01

Injection molding is used to form microfluidic devices with integrated functional components. One or more functional components are placed in a mold cavity which is then closed. Molten thermoplastic resin is injected into the mold and then cooled, thereby forming a solid substrate including the functional component(s). The solid substrate including the functional component(s) is then bonded to a second substrate which may include microchannels or other features.

Processing-microstructure relationships in thermotropic liquid crystalline polymers: Experimental and numerical modeling studies

NASA Astrophysics Data System (ADS)

Fang, Jun

Thermotropic liquid crystalline polymers (TLCPs) are a class of promising engineering materials for high-demanding structural applications. Their excellent mechanical properties are highly correlated to the underlying molecular orientation states, which may be affected by complex flow fields during melt processing. Thus, understanding and eventually predicting how processing flows impact molecular orientation is a critical step towards rational design work in order to achieve favorable, balanced physical properties in finished products. This thesis aims to develop deeper understanding of orientation development in commercial TLCPs during processing by coordinating extensive experimental measurements with numerical computations. In situ measurements of orientation development of LCPs during processing are a focal point of this thesis. An x-ray capable injection molding apparatus is enhanced and utilized for time-resolved measurements of orientation development in multiple commercial TLCPs during injection molding. Ex situ wide angle x-ray scattering is also employed for more thorough characterization of molecular orientation distributions in molded plaques. Incompletely injection molded plaques ("short shots") are studied to gain further insights into the intermediate orientation states during mold filling. Finally, two surface orientation characterization techniques, near edge x-ray absorption fine structure (NEXAFS) and infrared attenuated total reflectance (FTIR-ATR) are combined to investigate the surface orientation distribution of injection molded plaques. Surface orientation states are found to be vastly different from their bulk counterparts due to different kinematics involved in mold filling. In general, complex distributions of orientation in molded plaques reflect the spatially varying competition between shear and extension during mold filling. To complement these experimental measurements, numerical calculations based on the Larson-Doi polydomain model are performed. The implementation of the Larson-Doi in complex processing flows is performed using a commercial process modeling software suite (MOLDFLOWRTM), exploiting a nearly exact analogy between the Larson-Doi model and a fiber orientation model that has been widely used in composites processing simulations. The modeling scheme is first verified by predicting many qualitative and quantitative features of molecular orientation distributions in isothermal extrusion-fed channel flows. In coordination with experiments, the model predictions are found to capture many qualitative features observed in injection molded plaques (including short shots). The final, stringent test of Larson-Doi model performance is prediction of in situ transient orientation data collected during mold filling. The model yields satisfactory results, though certain numerical approximations limit performance near the mold front.

Development and modeling of multi-phase polymeric origami inspired architecture by using pre-molded geometrical features

NASA Astrophysics Data System (ADS)

Kshad, Mohamed Ali E.; Naguib, Hani E.

2017-02-01

Using Origami folded cores in sandwich structures for lightweight applications has attracted attention in different engineering applications, especially in the applications where the stiffness to weight ratio is a critical design parameter. Recently, common sandwich cores such as honey-comb and foamed cores have been replaced with origami core panels due to their way of force redistribution and energy absorption; these unique characteristics give origami cores high stiffness to weight ratio and high bending and twisting resistance. This paper presents the results of experimental investigations of the effect of base material on the mechanical properties and the impact resistance of Miura-Origami sandwich cores; then, the experimental results are compared with FEA simulation results. The materials used in the study for the origami cores were polymer blends composed of polylactic acid (PLA) and thermoplastic polyurethane (TPU). PLA/TPU blend compositions are (100/0, 80/20, 65/35, 50/50, 20/80, and 0/100) as a weight percentage. The geometrical parameters of the unit cell, base material thickness, and the panel thickness were considered to be constants in this study. The study shows the behavior of the origami cores under impact test and the energy absorbed by the origami folded cores. It was found that 20/80 PLA/TPU blend demonstrated the highest specific energy absorption efficiency both in quasi-static compression and impact tests. Fractured Origami structures were observed to fail at folded edges (creases lines), while the facets exhibit rigid body rotations. The FEM simulation showed a consistency in the impact behavior of the origami cores, and the directional deformational of origami core units which explain the ability of the structure to redistribute the applied force and absorb energy. In this work the origami folded core features were molded directly from the blended material.

Precision glass molding: Toward an optimal fabrication of optical lenses

NASA Astrophysics Data System (ADS)

Zhang, Liangchi; Liu, Weidong

2017-03-01

It is costly and time consuming to use machining processes, such as grinding, polishing and lapping, to produce optical glass lenses with complex features. Precision glass molding (PGM) has thus been developed to realize an efficient manufacture of such optical components in a single step. However, PGM faces various technical challenges. For example, a PGM process must be carried out within the super-cooled region of optical glass above its glass transition temperature, in which the material has an unstable non-equilibrium structure. Within a narrow window of allowable temperature variation, the glass viscosity can change from 105 to 1012 Pas due to the kinetic fragility of the super-cooled liquid. This makes a PGM process sensitive to its molding temperature. In addition, because of the structural relaxation in this temperature window, the atomic structure that governs the material properties is strongly dependent on time and thermal history. Such complexity often leads to residual stresses and shape distortion in a lens molded, causing unexpected changes in density and refractive index. This review will discuss some of the central issues in PGM processes and provide a method based on a manufacturing chain consideration from mold material selection, property and deformation characterization of optical glass to process optimization. The realization of such optimization is a necessary step for the Industry 4.0 of PGM.

Interfacial crystalline structures in injection over-molded polypropylene and bond strength.

PubMed

Yan, Bowen; Wu, Hong; Jiang, Genjie; Guo, Shaoyun; Huang, Jian

2010-11-01

This paper describes interfacial crystalline structures found in injection overmolded polypropylene components and the relationship of these structures to bond strength between the components. The combined effects of the development of hierarchical gradient structures and the particular thermomechanical environment near the interface on the interfacial crystalline structures were investigated in detail by PLM, SEM, DSC, WAXD, and infrared dichroism spectroscopy. The experimental results showed that during molding there was competitive formation of interfacial crystalline structures consisted of "shish-kebab" layer (SKL) and a transcrystalline layers (TCL). Variation in shear stress (controlled by injection pressure and injection speed) plays an important role in the formation of the SKL. The formation of TCL is influenced by the thermal environment, namely melt temperature and mold temperature. Increasing within certain limits, interfacial temperature and the thermal gradient near the interface promotes β-iPP growth. The relationship between interfacial crystalline structures and interfacial bond strength was established by lap shear measurement. The interfacial bond strength is improved by enhancing the formation of TCL, but reduced if SKL predominates.

Soft lithography using perfluorinated polyether molds and PRINT technology for fabrication of 3-D arrays on glass substrates

NASA Astrophysics Data System (ADS)

Wiles, Kenton B.; Wiles, Natasha S.; Herlihy, Kevin P.; Maynor, Benjamin W.; Rolland, Jason P.; DeSimone, Joseph M.

2006-03-01

The fabrication of nanometer size structures and complex devices for microelectronics is of increasing importance so as to meet the challenges of large-scale commercial applications. Soft lithography typically employs elastomeric polydimethylsiloxane (PDMS) molds to replicate micro- and nanoscale features. However, the difficulties of PDMS for nanoscale fabrication include inherent incompatibility with organic liquids and the production of a residual scum or flash layer that link features where the nano-structures meet the substrate. An emerging technologically advanced technique known as Pattern Replication in Non-wetting Templates (PRINT) avoids both of these dilemmas by utilizing photocurable perfluorinated polyether (PFPE) rather than PDMS as the elastomeric molding material. PFPE is a liquid at room temperature that exhibits low modulus and high gas permeability when cured. The highly fluorinated PFPE material allows for resistance to swelling by organic liquids and very low surface energies, thereby preventing flash layer formation and ease of separation of PFPE molds from the substrates. These enhanced characteristics enable easy removal of the stamp from the molded material, thereby minimizing damage to the nanoscale features. Herein we describe that PRINT can be operated in two different modes depending on whether the objects to be molded are to be removed and harvested (i.e. to make shape specific organic particles) or whether scum free objects are desired which are adhered onto the substrate (i.e. for scum free pattern generation using imprint lithography). The former can be achieved using a non-reactive, low surface energy substrate (PRINT: Particle Replication in Non-wetting Templates) and the latter can be achieved using a reactive, low surface energy substrate (PRINT: Pattern Replication in Non-wetting Templates). We show that the PRINT technology can been used to fabricate nano-particle arrays covalently bound to a glass substrate with no scum layer. The nanometer size arrays were fabricated using a PFPE mold and a self-assembled monolayer (SAM) fluorinated glass substrate that was also functionalized with free-radically reactive SAM methacrylate moieties. The molded polymeric materials were covalently bound to the glass substrate through thermal curing with the methacrylate groups to permit three dimensional array fabrication. The low surface energies of the PFPE mold and fluorinated glass substrate allowed for no flash layer formation, permitting well resolved structures.

The design and improvement of radial tire molding machine

NASA Astrophysics Data System (ADS)

Wang, Wenhao; Zhang, Tao

2018-04-01

This paper presented that the high accuracy semisteel meridian tire molding machine structure configurations, combining tyre high precision characteristics, the original structure and parameter optimization, technology improvement innovation design period of opening and closing machine rotary shaping drum institutions. This way out of the shaft from the structure to the push-pull type movable shaping drum of thinking limit, compared with the specifications and shaping drum can smaller contraction, is conducive to forming the tire and reduce the tire deformation.

Textile composite fuselage structures development

NASA Technical Reports Server (NTRS)

Jackson, Anthony C.; Barrie, Ronald E.; Chu, Robert L.

1993-01-01

Phase 2 of the NASA ACT Contract (NAS1-18888), Advanced Composite Structural Concepts and Materials Technology for Transport Aircraft Structures, focuses on textile technology, with resin transfer molding or powder coated tows. The use of textiles has the potential for improving damage tolerance, reducing cost and saving weight. This program investigates resin transfer molding (RTM), as a maturing technology for high fiber volume primary structures and powder coated tows as an emerging technology with a high potential for significant cost savings and superior structural properties. Powder coated tow technology has promise for significantly improving the processibility of high temperature resins such as polyimides.

Injection-Molded Long-Fiber Thermoplastic Composites: From Process Modeling to Prediction of Mechanical Properties

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nguyen, Ba Nghiep; Kunc, Vlastimil; Jin, Xiaoshi

2013-12-18

This article illustrates the predictive capabilities for long-fiber thermoplastic (LFT) composites that first simulate the injection molding of LFT structures by Autodesk® Simulation Moldflow® Insight (ASMI) to accurately predict fiber orientation and length distributions in these structures. After validating fiber orientation and length predictions against the experimental data, the predicted results are used by ASMI to compute distributions of elastic properties in the molded structures. In addition, local stress-strain responses and damage accumulation under tensile loading are predicted by an elastic-plastic damage model of EMTA-NLA, a nonlinear analysis tool implemented in ABAQUS® via user-subroutines using an incremental Eshelby-Mori-Tanaka approach. Predictedmore » stress-strain responses up to failure and damage accumulations are compared to the experimental results to validate the model.« less

3D Printed Prisms with Tunable Dispersion for the THz Frequency Range

NASA Astrophysics Data System (ADS)

Busch, Stefan F.; Castro-Camus, Enrique; Beltran-Mejia, Felipe; Balzer, Jan C.; Koch, Martin

2018-04-01

Here, we present a 3D printed prism for THz waves made out of an artificial dielectric material in which the dispersion can be tuned by external compression. The artificial material consists of thin dielectric layers with variable air spacings which has been produced using a fused deposition molding process. The material properties are carefully characterized and the functionality of the prisms is in a good agreement with the underlying theory. These prisms are durable, lightweight, inexpensive, and easy to produce.

3D Printed Prisms with Tunable Dispersion for the THz Frequency Range

NASA Astrophysics Data System (ADS)

Busch, Stefan F.; Castro-Camus, Enrique; Beltran-Mejia, Felipe; Balzer, Jan C.; Koch, Martin

2018-06-01

Here, we present a 3D printed prism for THz waves made out of an artificial dielectric material in which the dispersion can be tuned by external compression. The artificial material consists of thin dielectric layers with variable air spacings which has been produced using a fused deposition molding process. The material properties are carefully characterized and the functionality of the prisms is in a good agreement with the underlying theory. These prisms are durable, lightweight, inexpensive, and easy to produce.

The Formation of Novel Thermoplastic Composites from Liquid Crystalline Polymers and Their Blends

DTIC Science & Technology

1991-07-01

melting point of the Vectra. This is due to the long relaxation time of the LCPs ccjzIed with the much higher viscosity of the matrix polymer. Ultem...the LCP reinforcing characteristics i.e. orientation and morphology can be retained upon post-processing provided that the melting point of the LCP is...isothermal compression molding and involves deforming the composites in a cold press after heating the blends at temperatures below the melting point of

Low cost damage tolerant composite fabrication

NASA Technical Reports Server (NTRS)

Palmer, R. J.; Freeman, W. T.

1988-01-01

The resin transfer molding (RTM) process applied to composite aircraft parts offers the potential for using low cost resin systems with dry graphite fabrics that can be significantly less expensive than prepreg tape fabricated components. Stitched graphite fabric composites have demonstrated compression after impact failure performance that equals or exceeds that of thermoplastic or tough thermoset matrix composites. This paper reviews methods developed to fabricate complex shape composite parts using stitched graphite fabrics to increase damage tolerance with RTM processes to reduce fabrication cost.

3D-glass molds for facile production of complex droplet microfluidic chips.

PubMed

Tovar, Miguel; Weber, Thomas; Hengoju, Sundar; Lovera, Andrea; Munser, Anne-Sophie; Shvydkiv, Oksana; Roth, Martin

2018-03-01

In order to leverage the immense potential of droplet microfluidics, it is necessary to simplify the process of chip design and fabrication. While polydimethylsiloxane (PDMS) replica molding has greatly revolutionized the chip-production process, its dependence on 2D-limited photolithography has restricted the design possibilities, as well as further dissemination of microfluidics to non-specialized labs. To break free from these restrictions while keeping fabrication straighforward, we introduce an approach to produce complex multi-height (3D) droplet microfluidic glass molds and subsequent chip production by PDMS replica molding. The glass molds are fabricated with sub-micrometric resolution using femtosecond laser machining technology, which allows directly realizing designs with multiple levels or even continuously changing heights. The presented technique significantly expands the experimental capabilities of the droplet microfluidic chip. It allows direct fabrication of multilevel structures such as droplet traps for prolonged observation and optical fiber integration for fluorescence detection. Furthermore, the fabrication of novel structures based on sloped channels (ramps) enables improved droplet reinjection and picoinjection or even a multi-parallelized drop generator based on gradients of confinement. The fabrication of these and other 3D-features is currently only available at such resolution by the presented strategy. Together with the simplicity of PDMS replica molding, this provides an accessible solution for both specialized and non-specialized labs to customize microfluidic experimentation and expand their possibilities.

Dietary Glutamate Supplementation Ameliorates Mycotoxin-Induced Abnormalities in the Intestinal Structure and Expression of Amino Acid Transporters in Young Pigs

PubMed Central

Wu, Miaomiao; Liao, Peng; Deng, Dun; Liu, Gang; Wen, Qingqi; Wang, Yongfei; Qiu, Wei; Liu, Yan; Wu, Xingli; Ren, Wenkai; Tan, Bie; Chen, Minghong; Xiao, Hao; Wu, Li; Li, Tiejun; Nyachoti, Charles M.; Adeola, Olayiwola; Yin, Yulong

2014-01-01

The purpose of this study was to investigate the hypothesis that dietary supplementation with glutamic acid has beneficial effects on growth performance, antioxidant system, intestinal morphology, serum amino acid profile and the gene expression of intestinal amino acid transporters in growing swine fed mold-contaminated feed. Fifteen pigs (Landrace×Large White) with a mean body weight (BW) of 55 kg were randomly divided into control group (basal feed), mycotoxin group (contaminated feed) and glutamate group (2% glutamate+contaminated feed). Compared with control group, mold-contaminated feed decreased average daily gain (ADG) and increased feed conversion rate (FCR). Meanwhile, fed mold-contaminated feed impaired anti-oxidative system and intestinal morphology, as well as modified the serum amino acid profile in growing pigs. However, supplementation with glutamate exhibited potential positive effects on growth performance of pigs fed mold-contaminated feed, ameliorated the imbalance antioxidant system and abnormalities of intestinal structure caused by mycotoxins. In addition, dietary glutamate supplementation to some extent restored changed serum amino acid profile caused by mold-contaminated feed. In conclusion, glutamic acid may be act as a nutritional regulating factor to ameliorate the adverse effects induced by mycotoxins. PMID:25405987

The Influence of Addition of Plastiment-VZ to Concrete Characteristics in Riau Province

NASA Astrophysics Data System (ADS)

Wahyuni Megasari, Shanti; Winayati

2017-12-01

Riau Province has an area of 8,702,000 ha consisting of 7,121.344,00 ha of forest and 3,867,000 ha in the form of peatlands. Peat structures are soft and have pores that make it easy to hold water. Peat water has a high color intensity, low pH, high organic content and has an acidic properties So it does not qualify as a mixture of concrete. To meet the needs of water in the concrete mix then water should be obtained from another place but it will require a greater cost and time. To resolve the issue, the advancement of concrete technology has resulted in admixture that can help in maintaining the quality of concrete. Plastiment-VZ is a plasticizer material that can increase workability of concrete without adding water. However, for the use in the field, the selection of admixture must be adjusted to the planned concrete situation and condition. Excessive use of admixture will also result in uneconomical concrete. The design of the job mix using the Department of Environment (DOE) method with compressive strength concrete plan fc ' = 25 MPa. The percentage of Plastiment-VZ addition is 0%, 0,05%; 0,10%; 0,15% and 0,20% to the weight of cement. The reduction of the amount of water in this study is 10% of the total amount of water. Specimens in each variation were made using cylinder mold with 15 cm in diameter and 30 cm high. After specimens are created and maintained, testing of compressive strength concrete held in 28 days. The test results show that the trend of average compressive strength has increased along with the addition of Plastiment-VZ percentage. The equation resulting from the average compressive strength is y = -362,7x2 + 133,3x + 28,10 with value R2 = 0,969. The highest average compressive strength value was obtained in the addition of 0,20% Plastiment-VZ at 40,76 MPa. Statistical testing with Analysis of Variance - ANOVA states that there is a very real interaction or treatment between the compressive strength of the concrete with the addition of Plastiment-VZ. So it can be concluded that the reduction of the amount of water with the addition of Plastiment-VZ has an effect on the increasing of concrete compressive strength characteristics.

Sealing ceramic material in low melting point glass

NASA Technical Reports Server (NTRS)

Moritoki, M.; Fujikawa, T.; Miyanaga, J.

1984-01-01

A structured device placed in an aerated crucible to pack ceramics molding substance that is to be processed was designed. The structure is wrapped by sealing material made of pyrex glass and graphite foil or sheet with a weight attached on top of it. The crucible is made of carbon; the ceramics material to be treated through heat intervenient press process is molding substance consisting mainly of silicon nitride.

Applications of thin carbon coatings and films in injection molding

NASA Astrophysics Data System (ADS)

Cabrera, Eusebio Duarte

In this research, the technical feasibility of two novel applications of thin carbon coatings is demonstrated. The first application consists of using thin carbon coatings on molds for molding ultra-thin plastic parts (<0.5 mm thickness) with lower pressures by promoting wall slip. The second application consists of a new approach to provide electromagnetic interference (EMI) shielding for plastic parts using in mold coated nanoparticle thin films or nanopapers to create a conductive top layer. During this research, the technical feasibility of a new approach was proven which provides injection molding of ultra-thin parts at lower pressures, without the need of fast heating/fast cooling or other expensive mold modification. An in-house developed procedure by other members of our group, was employed for coating the mold surface using chemical vapor deposition (CVD) resulting in a graphene coating with carbide bonding to the mold surface. The coating resulted in a significant decrease of surface friction and consequently easiness of flow when compared to their uncoated counterparts. Thermoplastic polymers and their composites are a very attractive alternative but are hindered by the non-conductive nature of polymers. There are two general approaches used to date to achieve EMI shielding for plastic products. One is to spray a conductive metal coating onto the plastic surface forming a layer that must maintain its shielding effectiveness (SE), and its adhesion to the plastic throughout the expected life of the product. However, metal coatings add undesirable weight and tend to corrode over time. Furthermore, scratching the coating may create shielding failure; therefore, a protective topcoat may be required. The other approach is to use polymer composites filled with conductive fillers such as carbon black (CB), carbon nanofiber (CNF), and carbon nanotube (CNT). While conductive fillers may increase the electrical conductivity of polymer composites, the loading of such fillers often cannot reach a high level (<10 wt. %) due to the dispersion difficulty and exponential increase in viscosity. In this research, the technical feasibility of a new approach to EMI shielding of plastic parts was proven using in mold coated nanoparticle thin films or nanopapers to create a conductive top layer. For many years, in-mold coating (IMC) has been commercially applied to Sheet Molding Compound (SMC) compression molded parts, as an environmentally friendly approach to improve its surface quality and provide the required conductivity for electrostatic painting using carbon black (CB). Such process can also be applied to injection molding for creating a top conductive layer. Increasing the amount of CB will increase the surface conductivity of the coated part, thus improving the paint transfer efficiency. However the CB levels needed to achieve the conductivity levels required for achieving EMI shielding would make the coating viscosity too large for proper coating. Nanopaper based composites are excellent candidates for EMI shielding because of the nanopaper's high concentration of carbon nanofibers (CNFs) (~2 wt% to 10 wt% depending on nanopaper/thermoplastic thickness and 71wt.% to 79wt.% in the nanopaper itself after resin infusion) and high conductivity of the nanopaper. Instead of premixing nanoparticles with IMC coating, nanopapers enable the use of low viscosity IMC without CB coating to impregnate the CNF network in order to reach high electrical conductivity and EMI shielding values. (Abstract shortened by UMI.).

Developing the elastic modulus measurement of asphalt concrete using the compressive strength test

NASA Astrophysics Data System (ADS)

Setiawan, Arief; Suparma, Latif Budi; Mulyono, Agus Taufik

2017-11-01

Elastic modulus is a fundamental property of an asphalt mixture. An analytical method of the elastic modulus is needed to determine the thickness of flexible pavement. It has a role as one of the input values on a stress-strain analysis in the finite element method. The aim of this study was to develop the measurement of the elastic modulus by using compressive strength testing. This research used a set of specimen mold tool and Delta Dimensi software to record strain changes occurring in the proving ring of compression machine and the specimens. The elastic modulus of the five types of aggregate gradation and 2 types of asphalt were measured at optimum asphalt content. Asphalt Cement 60/70 and Elastomer Modified Asphalt (EMA) were used as a binder. Manufacturing success indicators of the specimens used void-in-the-mix (VIM) 3-5 % criteria. The success rate of the specimen manufacturing was more than 76%. Thus, the procedure and the compressive strength test equipment could be used for the measurement of the elastic modulus. The aggregate gradation and asphalt types significantly affected the elastic modulus of the asphalt concrete.

Minimally invasive repair of pectus carinatum and how to deal with complications

PubMed Central

Aragone, Xavier; Blanco, Javier Borbore; Ciano, Alejandro; Abramson, Leonardo

2016-01-01

While less common than pectus excavatum, pectus carinatum is also a chest wall deformity affecting males in higher proportion than women. Patient requests for a solution of this disease occur especially during the growth spurt of puberty when this malformation becomes more obvious and difficult to conceal. Those people suffering from pectus carinatum are very likely subject to behavioral changes and negative personality impacts. By compressing the protruding anterior region of the chest wall we achieve correction of the chest contour and simultaneous lateral expansion of the depressed costochondral arches. This original technique and the procedure to apply it fit within the category of minimally invasive surgery. The compression system acts in a way similar to that of orthodontic braces. Two rectangular fixation plates are fixed to the compression strut with screws. The plates have threaded holes along a groove in the central portion, and two holes at both ends used to attach them to the ribs by means of steel wire suture. The compression strut has to be modified into a convex shape to adapt it to the particular characteristics of the patient’s malformation. This molding is done using benders designed as part of the procedure. PMID:29078492

Minimally invasive repair of pectus carinatum and how to deal with complications.

PubMed

Abramson, Horacio; Aragone, Xavier; Blanco, Javier Borbore; Ciano, Alejandro; Abramson, Leonardo

2016-01-01

While less common than pectus excavatum, pectus carinatum is also a chest wall deformity affecting males in higher proportion than women. Patient requests for a solution of this disease occur especially during the growth spurt of puberty when this malformation becomes more obvious and difficult to conceal. Those people suffering from pectus carinatum are very likely subject to behavioral changes and negative personality impacts. By compressing the protruding anterior region of the chest wall we achieve correction of the chest contour and simultaneous lateral expansion of the depressed costochondral arches. This original technique and the procedure to apply it fit within the category of minimally invasive surgery. The compression system acts in a way similar to that of orthodontic braces. Two rectangular fixation plates are fixed to the compression strut with screws. The plates have threaded holes along a groove in the central portion, and two holes at both ends used to attach them to the ribs by means of steel wire suture. The compression strut has to be modified into a convex shape to adapt it to the particular characteristics of the patient's malformation. This molding is done using benders designed as part of the procedure.

[Correlation between physical characteristics of sticks and quality of traditional Chinese medicine pills prepared by plastic molded method].

PubMed

Wang, Ling; Xian, Jiechen; Hong, Yanlong; Lin, Xiao; Feng, Yi

2012-05-01

To quantify the physical characteristics of sticks of traditional Chinese medicine (TCM) honeyed pills prepared by the plastic molded method and the correlation of adhesiveness and plasticity-related parameters of sticks and quality of pills, in order to find major parameters and the appropriate range impacting pill quality. Sticks were detected by texture analyzer for their physical characteristic parameters such as hardness and compression action, and pills were observed by visual evaluation for their quality. The correlation of both data was determined by the stepwise discriminant analysis. Stick physical characteristic parameter l(CD) can exactly depict the adhesiveness, with the discriminant equation of Y0 - Y1 = 6.415 - 41.594l(CD). When Y0 < Y1, pills were scattered well; when Y0 > Y1, pills were adhesive with each other. Pills' physical characteristic parameters l(CD) and l(AC), Ar, Tr can exactly depict smoothness of pills, with the discriminant equation of Z0 - Z1 = -195.318 + 78.79l(AC) - 3 258. 982Ar + 3437.935Tr. When Z0 < Z1, pills were smooth on surface. When Z0 > Z1, pills were rough on surface. The stepwise discriminant analysis is made to show the obvious correlation between key physical characteristic parameters l(CD) and l(AC), Ar, Tr of sticks and appearance quality of pills, defining the molding process for preparing pills by the plastic molded and qualifying ranges of key physical characteristic parameters characterizing intermediate sticks, in order to provide theoretical basis for prescription screening and technical parameter adjustment for pills.

An apparatus for in situ x-ray scattering measurements during polymer injection molding.

PubMed

Rendon, Stanley; Fang, Jun; Burghardt, Wesley R; Bubeck, Robert A

2009-04-01

We report a novel instrument for synchrotron-based in situ x-ray scattering measurements during injection molding processing. It allows direct, real-time monitoring of molecular-scale structural evolution in polymer materials undergoing a complex processing operation. The instrument is based on a laboratory-scale injection molding machine, and employs customized mold tools designed to allow x-ray access during mold filling and subsequent solidification, while providing sufficient robustness to withstand high injection pressures. The use of high energy, high flux synchrotron radiation, and a fast detector allows sufficiently rapid data acquisition to resolve time-dependent orientation dynamics in this transient process. Simultaneous monitoring of temperature and pressure signals allows transient scattering data to be referenced to various stages of the injection molding cycle. Representative data on a commercial liquid crystalline polymer, Vectra(R) B950, are presented to demonstrate the features of this apparatus; however, it may find application in a wide range of polymeric materials such as nanocomposites, semicrystalline polymers and fiber-reinforced thermoplastics.

Study on temperature and near-infrared driving characteristics of hydrogel actuator fabricated via molding and 3D printing.

PubMed

Zhao, Qian; Liang, Yunhong; Ren, Lei; Qiu, Feng; Zhang, Zhihui; Ren, Luquan

2018-02-01

A hydrogel material system which was fit for molding and 3D printing was developed to fabricate bilayer hydrogel actuators with controllable temperature and near infrared laser responses. Polymerization on interface boundary of layered structure enhanced the bonding strength of hydrogel actuators. By utilizing anisotropic of microstructure along with thickness direction, bilayer hydrogel actuators fabricated via molding realized intelligent bending/shrinking responses, which guided the preparation of hydrogel ink for 3D printing. In-situ free radical polymerization under vacuum realized the solidification of printed hydrogel actuators with graphene oxide. Based on anisotropic swelling/deswelling behaviors of precise structure fabricated via 3D printing, the printed bilayer hydrogel actuators achieved temperature and near infrared laser responsive deformation. Changes of programmable printing path effectively resulted in corresponding deformation patterns. Combination of advantages of molding and 3D printing can promote the design and fabrication of hydrogel actuators with high mechanical strength, response speed and deformation ability. Copyright © 2017 Elsevier Ltd. All rights reserved.

Fabrication of Microfluidic Valves Using a Hydrogel Molding Method

NASA Astrophysics Data System (ADS)

Sugiura, Yusuke; Hirama, Hirotada; Torii, Toru

2015-08-01

In this paper, a method for fabricating a microfluidic valve made of polydimethylsiloxane (PDMS) using a rapid prototyping method for microchannels through hydrogel cast molding is discussed. Currently, the valves in microchannels play an important role in various microfluidic devices. The technology to prototype microfluidic valves rapidly is actively being developed. For the rapid prototyping of PDMS microchannels, a method that uses a hydrogel as the casting mold has been recently developed. This technique can be used to prepare a three-dimensional structure through simple and uncomplicated methods. In this study, we were able to fabricate microfluidic valves easily using this rapid prototyping method that utilizes hydrogel cast molding. In addition, we confirmed that the valve displacement could be predicted within a range of constant pressures. Moreover, because microfluidic valves fabricated using this method can be directly observed from a cross-sectional direction, we anticipate that this technology will significantly contribute to clarifying fluid behavior and other phenomena in microchannels and microfluidic valves with complex structures.

Fabrication of Microfluidic Valves Using a Hydrogel Molding Method.

PubMed

Sugiura, Yusuke; Hirama, Hirotada; Torii, Toru

2015-08-24

In this paper, a method for fabricating a microfluidic valve made of polydimethylsiloxane (PDMS) using a rapid prototyping method for microchannels through hydrogel cast molding is discussed. Currently, the valves in microchannels play an important role in various microfluidic devices. The technology to prototype microfluidic valves rapidly is actively being developed. For the rapid prototyping of PDMS microchannels, a method that uses a hydrogel as the casting mold has been recently developed. This technique can be used to prepare a three-dimensional structure through simple and uncomplicated methods. In this study, we were able to fabricate microfluidic valves easily using this rapid prototyping method that utilizes hydrogel cast molding. In addition, we confirmed that the valve displacement could be predicted within a range of constant pressures. Moreover, because microfluidic valves fabricated using this method can be directly observed from a cross-sectional direction, we anticipate that this technology will significantly contribute to clarifying fluid behavior and other phenomena in microchannels and microfluidic valves with complex structures.

Severe Sequelae to Mold-Related Illness as Demonstrated in Two Finnish Cohorts.

PubMed

Tuuminen, Tamara; Rinne, Kyösti Sakari

2017-01-01

The presence of toxic indoor molds with accompanying bacterial growth is clearly detrimental to human health. The pathophysiological and toxicological effects of toxins and structural components of molds and bacteria have been clarified in experiments conducted in tissue culture and animals, and there is convincing epidemiologic evidence; nonetheless their implications for human health are either ignored or denied, at least in Finland. In this communication, we describe two cohorts suffering severe sequelae to mold-related illness. One cohort is a nine-member family with pets that moved into a new house, which soon proved to be infested with pathogenic molds. The other cohort consists of 30 teachers and 50 students from a mold-infested school building. The first cohort experienced a plethora of mucosal irritation, neurological, skin, allergic, and other symptoms, with all family members ultimately developing a multiple chemical syndrome. In the second cohort, we detected a greatly elevated prevalence of autoimmune conditions and malignancies. We claim that mold-related illness exists in multiple facets; if not simply a transient mucosal irritation or even an increased risk of asthma onset or its exacerbation. We propose a scheme to explain the natural course of the mold-related illness. We recommend that future studies should combine data from, e.g., cancer, autoimmune, and endocrine disorder registers and neurological and mental health or neuropsychological registers with mold-exposed individuals being monitored for prolonged follow-up times.

Fabrication of turbine components and properties of sintered silicon nitride

NASA Technical Reports Server (NTRS)

Neil, J. T.; French, K. W.; Quackenbush, C. L.; Smith, J. T.

1982-01-01

This paper presents a status report on the injection molding of sinterable silicon nitride at GTE Laboratories. The effort involves fabrication of single axial turbine blades and monolithic radial turbine rotors. The injection molding process is reviewed and the fabrication of the turbine components discussed. Oxidation resistance and strength results of current injection molded sintered silicon nitride as well as dimensional checks on sintered turbine blades demonstrate that this material is a viable candidate for high temperature structural applications.

Using a micro-molding process to fabricate polymeric wavelength filters

NASA Astrophysics Data System (ADS)

Chuang, Wei-Ching; Lee, An-Chen; Ho, Chi-Ting

2008-08-01

A procedure for fabricating a high aspect ratio periodic structure on a UV polymer at submicron order using holographic interferometry and molding processes is described. First, holographic interferometry using a He-Cd (325 nm) laser was used to create the master of the periodic line structure on an i-line sub-micron positive photoresist film. A 20 nm nickel thin film was then sputtered on the photoresist. The final line pattern on a UV polymer was obtained from casting against the master mold. Finally, a SU8 polymer was spun on the polymer grating to form a planar waveguide or a channel waveguide. The measurement results show that the waveguide length could be reduced for the waveguide having gratings with a high aspect ratio.

Transparent ceramic photo-optical semiconductor high power switches

DOEpatents

Werne, Roger W.; Sullivan, James S.; Landingham, Richard L.

2016-01-19

A photoconductive semiconductor switch according to one embodiment includes a structure of sintered nanoparticles of a high band gap material exhibiting a lower electrical resistance when excited by light relative to an electrical resistance thereof when not exposed to the light. A method according to one embodiment includes creating a mixture comprising particles, at least one dopant, and at least one solvent; adding the mixture to a mold; forming a green structure in the mold; and sintering the green structure to form a transparent ceramic. Additional system, methods and products are also presented.

A comparative study between melt granulation/compression and hot melt extrusion/injection molding for the manufacturing of oral sustained release thermoplastic polyurethane matrices.

PubMed

Verstraete, G; Mertens, P; Grymonpré, W; Van Bockstal, P J; De Beer, T; Boone, M N; Van Hoorebeke, L; Remon, J P; Vervaet, C

2016-11-20

During this project 3 techniques (twin screw melt granulation/compression (TSMG), hot melt extrusion (HME) and injection molding (IM)) were evaluated for the manufacturing of thermoplastic polyurethane (TPU)-based oral sustained release matrices, containing a high dose of the highly soluble metformin hydrochloride. Whereas formulations with a drug load between 0 and 70% (w/w) could be processed via HME/(IM), the drug content of granules prepared via melt granulation could only be varied between 85 and 90% (w/w) as these formulations contained the proper concentration of binder (i.e. TPU) to obtain a good size distribution of the granules. While release from HME matrices and IM tablets could be sustained over 24h, release from the TPU-based TSMG tablets was too fast (complete release within about 6h) linked to their higher drug load and porosity. By mixing hydrophilic and hydrophobic TPUs the in vitro release kinetics of both formulations could be adjusted: a higher content of hydrophobic TPU was correlated with a slower release rate. Although mini-matrices showed faster release kinetics than IM tablets, this observation was successfully countered by changing the hydrophobic/hydrophilic TPU ratio. In vivo experiments via oral administration to dogs confirmed the versatile potential of the TPU platform as intermediate-strong and low-intermediate sustained characteristics were obtained for the IM tablets and HME mini-matrices, respectively. Copyright © 2016 Elsevier B.V. All rights reserved.

The Development of Layered Photonic Band Gap Structures Using a Micro-Transfer Molding Technique

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sutherland, Kevin Jerome

Over the last ten years, photonic band gap (PBG) theory and technology have become an important area of research because of the numerous possible applications ranging from high-efficiency laser diodes to optical circuitry. This research concentrates on reducing the length scale in the fabrication of layered photonic band gap structures and developing procedures to improve processing consistency. Various procedures and materials have been used in the fabrication of layered PBG structures. This research focused on an economical micro transfer molding approach to create the final PBG structure. A poly dimethylsiloxane (PDMS) rubber mold was created from a silicon substrate. Itmore » was filled with epoxy and built layer-by-layer to create a 3-D epoxy structure. This structure was infiltrated with nanoparticle titania or a titania sol-gel, then fired to remove the polymer mold, leaving a monolithic ceramic inverse of the epoxy structure. The final result was a lattice of titania rolds that resembles a face-centered tetragonal structure. The original intent of this research was to miniaturize this process to a bar size small enough to create a photonic band gap for wavelengths of visible electro-magnetic radiation. The factor limiting progress was the absence of a silicon master mold of small enough dimensions. The Iowa State Microelectronics Research Center fabricated samples with periodicities of 2.5 and 1.0 microns with the existing technology, but a sample was needed on the order of 0.3 microns or less. A 0.4 micron sample was received from Sandia National Laboratory, which was made through an electron beam lithography process, but it contained several defects. The results of the work are primarily from the 2.5 and 1.0 micron samples. Most of the work focused on changing processing variables in order to optimize the infiltration procedure for the best results. Several critical parameters were identified, ranging from the ambient conditions to the specifics of the procedure. It is believed that most critical for fabrication of high quality samples is control of the temperature of the sample during and after infiltration, and the rate and amount of time spent applying epoxy to the PDMS.« less

The study about forming high-precision optical lens minimalized sinuous error structures for designed surface

NASA Astrophysics Data System (ADS)

Katahira, Yu; Fukuta, Masahiko; Katsuki, Masahide; Momochi, Takeshi; Yamamoto, Yoshihiro

2016-09-01

Recently, it has been required to improve qualities of aspherical lenses mounted on camera units. Optical lenses in highvolume production generally are applied with molding process using cemented carbide or Ni-P coated steel, which can be selected from lens material such as glass and plastic. Additionally it can be obtained high quality of the cut or ground surface on mold due to developments of different mold product technologies. As results, it can be less than 100nmPV as form-error and 1nmRa as surface roughness in molds. Furthermore it comes to need higher quality, not only formerror( PV) and surface roughness(Ra) but also other surface characteristics. For instance, it can be caused distorted shapes at imaging by middle spatial frequency undulations on the lens surface. In this study, we made focus on several types of sinuous structures, which can be classified into form errors for designed surface and deteriorate optical system performances. And it was obtained mold product processes minimalizing undulations on the surface. In the report, it was mentioned about the analyzing process by using PSD so as to evaluate micro undulations on the machined surface quantitatively. In addition, it was mentioned that the grinding process with circumferential velocity control was effective for large aperture lenses fabrication and could minimalize undulations appeared on outer area of the machined surface, and mentioned about the optical glass lens molding process by using the high precision press machine.

Precision lens molding of asphero diffractive surfaces in chalcogenide materials

NASA Astrophysics Data System (ADS)

Nelson, J.; Scordato, M.; Schwertz, K.; Bagwell, J.

2015-10-01

Finished lens molding, and the similar process of precision lens molding, have long been practiced for high volume, accurate replication of optical surfaces on oxide glass. The physics surrounding these processes are well understood, and the processes are capable of producing high quality optics with great fidelity. However, several limitations exist due to properties inherent with oxide glasses. Tooling materials that can withstand the severe environmental conditions of oxide glass molding cannot easily be machined to produce complex geometries such as diffractive surfaces, lens arrays, and off axis features. Current machining technologies coupled with a limited selection of tool materials greatly limits the type of structures that can be molded into the finished optic. Tooling for chalcogenide glasses are not bound by these restrictions since the molding temperatures required are much lower than for oxide glasses. Innovations in tooling materials and manufacturing techniques have enabled the production of complex geometries to optical quality specifications and have demonstrated the viability of creating tools for molding diffractive surfaces, off axis features, datums, and arrays. Applications for optics having these features are found in automotive, defense, security, medical, and industrial domains. This paper will discuss results achieved in the study of various molding techniques for the formation of positive diffractive features on a concave spherical surface molded from As2Se3 chalcogenide glass. Examples and results of molding with tools having CTE match with the glass and non CTE match will be reviewed. The formation of stress within the glass during molding will be discussed, and methods of stress management will also be demonstrated and discussed. Results of process development methods and production of good diffractive surfaces will be shown.

Mold growth in on-reserve homes in Canada: the need for research, education, policy, and funding.

PubMed

Optis, Michael; Shaw, Karena; Stephenson, Peter; Wild, Peter

2012-01-01

The impact of mold growth in homes located on First Nations reserves in Canada is part of a national housing crisis that has not been adequately studied. Nearly half of the homes on reserves contain mold at levels of contamination associated with high rates of respiratory and other illnesses to residents. Mold thrives due to increased moisture levels in building envelopes and interior spaces. Increased moisture stems from several deficiencies in housing conditions, including structural damage to the building envelope, overcrowding and insufficient use of ventilation systems, and other moisture-control strategies. These deficiencies have developed due to a series of historical and socioeconomic factors, including disenfranchisement from traditional territory, environmentally inappropriate construction, high unemployment rates, lack of home ownership, and insufficient federal funding for on-reserve housing and socioeconomic improvements. The successful, long-term reduction of mold growth requires increased activity in several research and policy areas. First, the actual impacts on health need to be studied and associated with comprehensive experimental data on mold growth to understand the unique environmental conditions that permit the germination and growth of toxic mold species. Second, field data documenting the extent of mold growth in on-reserve homes do not exist but are essential in understanding the full extent of the crisis. Third, current government initiatives to educate homeowners in mold remediation and prevention techniques must be long lasting and effective. Finally, and most importantly, the federal government must make a renewed and lasting commitment to improve the socioeconomic conditions on reserves that perpetuate mold growth in homes. Without such improvement, the mold crisis will surely persist and likely worsen.

Surface-structured bacterial cellulose with guided assembly-based biolithography (GAB).

PubMed

Bottan, Simone; Robotti, Francesco; Jayathissa, Prageeth; Hegglin, Alicia; Bahamonde, Nicolas; Heredia-Guerrero, José A; Bayer, Ilker S; Scarpellini, Alice; Merker, Hannes; Lindenblatt, Nicole; Poulikakos, Dimos; Ferrari, Aldo

2015-01-27

A powerful replica molding methodology to transfer on-demand functional topographies to the surface of bacterial cellulose nanofiber textures is presented. With this method, termed guided assembly-based biolithography (GAB), a surface-structured polydimethylsiloxane (PDMS) mold is introduced at the gas-liquid interface of an Acetobacter xylinum culture. Upon bacterial fermentation, the generated bacterial cellulose nanofibers are assembled in a three-dimensional network reproducing the geometric shape imposed by the mold. Additionally, GAB yields directional alignment of individual nanofibers and memory of the transferred geometrical features upon dehydration and rehydration of the substrates. Scanning electron and atomic force microscopy are used to establish the good fidelity of this facile and affordable method. Interaction of surface-structured bacterial cellulose substrates with human fibroblasts and keratinocytes illustrates the efficient control of cellular activities which are fundamental in skin wound healing and tissue regeneration. The deployment of surface-structured bacterial cellulose substrates in model animals as skin wound dressing or body implant further proves the high durability and low inflammatory response to the material over a period of 21 days, demonstrating beneficial effects of surface structure on skin regeneration.

Exotensioned structural members with energy-absorbing effects

DOEpatents

Brockwell, Michael Ian

2014-01-07

Structural members having enhanced load bearing capacity per unit mass include a skeleton structure formed from strips of material. Notches may be placed on the strips and a weave of tensile material placed in the notches and woven around the skeleton structure. At least one pair of structural members can be jointed together to provide very strong joints due to a weave patterns of tensile material, such as Kevlar, that distributes stress throughout the structure, preventing stress from concentrating in one area. Methods of manufacturing such structural members include molding material into skeletons of desired cross section using a matrix of molding segments. Total catastrophic failures in composite materials are substantially avoided and the strength to weight ratio of structures can be increased.

Exotensioned structural members with energy-absorbing effects

DOEpatents

Brockwell, Michael Ian

2017-08-22

Structural members having enhanced load bearing capacity per unit mass include a skeleton structure formed from strips of material. Notches may be placed on the strips and a weave of tensile material placed in the notches and woven around the skeleton structure. At least one pair of structural members can be jointed together to provide very strong joints due to a weave patterns of tensile material, such as Kevlar, that distributes stress throughout the structure, preventing stress from concentrating in one area. Methods of manufacturing such structural members include molding material into skeletons of desired cross section using a matrix of molding segments. Total catastrophic failures in composite materials are substantially avoided and the strength to weight ratio of structures can be increased.

Exotensioned structural members with energy-absorbing effects

DOEpatents

Brockwell, Michael Ian

2015-08-11

Structural members having enhanced load bearing capacity per unit mass include a skeleton structure formed from strips of material. Notches may be placed on the strips and a weave of tensile material placed in the notches and woven around the skeleton structure. At least one pair of structural members can be jointed together to provide very strong joints due to a weave patterns of tensile material, such as Kevlar, that distributes stress throughout the structure, preventing stress from concentrating in one area. Methods of manufacturing such structural members include molding material into skeletons of desired cross section using a matrix of molding segments. Total catastrophic failures in composite materials are substantially avoided and the strength to weight ratio of structures can be increased.

Ring-Mold Craters on Lineated Valley Fill, Lobate Debris Aprons, and Concentric Crater Fill on Mars: Implications for Near-Surface Structure, Composition, and Age.

NASA Astrophysics Data System (ADS)

Kress, A.; Head, J. W.

2009-03-01

Analysis of ring-mold crater populations on lineated valley fill, lobate debris aprons, and concentric crater fill on Mars and of ice-impact experiments suggest crater-count-derived ages may be erroneously old.

Detecting Mold in School Buildings: An Exercise in Biodiversity

ERIC Educational Resources Information Center

Farone, Anthony L.

2005-01-01

A project was designed to introduce students to fungi in which students surveyed their school buildings for different types of mold. The students were able to make connections between structure and function of the fungal components and learn how these different components enhance survival in the environment.

The Development of Layered Photonic Band Gap Structures Using a Micro-Transfer Molding Technique

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sutherland, Kevin Jerome

Photonic band gap (PBG) crystals are periodic dielectric structures that manipulate electromagnetic radiation in a manner similar to semiconductor devices manipulating electrons. Whereas a semiconductor material exhibits an electronic band gap in which electrons cannot exist, similarly, a photonic crystal containing a photonic band gap does not allow the propagation of specific frequencies of electromagnetic radiation. This phenomenon results from the destructive Bragg diffraction interference that a wave propagating at a specific frequency will experience because of the periodic change in dielectric permitivity. This gives rise to a variety of optical applications for improving the efficiency and effectiveness of opto-electronicmore » devices. These applications are reviewed later. Several methods are currently used to fabricate photonic crystals, which are also discussed in detail. This research involves a layer-by-layer micro-transfer molding ({mu}TM) and stacking method to create three-dimensional FCC structures of epoxy or titania. The structures, once reduced significantly in size can be infiltrated with an organic gain media and stacked on a semiconductor to improve the efficiency of an electronically pumped light-emitting diode. Photonic band gap structures have been proven to effectively create a band gap for certain frequencies of electro-magnetic radiation in the microwave and near-infrared ranges. The objective of this research project was originally two-fold: to fabricate a three dimensional (3-D) structure of a size scaled to prohibit electromagnetic propagation within the visible wavelength range, and then to characterize that structure using laser dye emission spectra. As a master mold has not yet been developed for the micro transfer molding technique in the visible range, the research was limited to scaling down the length scale as much as possible with the current available technology and characterizing these structures with other methods.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gilbertson, Robert D.; Patterson, Brian M.; Smith, Zachary

An accelerated aging study of BKC 44306-10 rigid polyurethane foam was carried out. Foam samples were aged in a nitrogen atmosphere at three different temperatures: 50 °C, 65 °C, and 80 °C. Foam samples were periodically removed from the aging canisters at 1, 3, 6, 9, 12, and 15 month intervals when FT-IR spectroscopy, dimensional analysis, and mechanical testing experiments were performed. Micro Computed Tomography imaging was also employed to study the morphology of the foams. Over the course of the aging study the foams the decreased in size by a magnitude of 0.001 inches per inch of foam. Micromore » CT showed the heterogeneous nature of the foam structure likely resulting from flow effects during the molding process. The effect of aging on the compression and tensile strength of the foam was minor and no cause for concern. FT-IR spectroscopy was used to follow the foam chemistry. However, it was difficult to draw definitive conclusions about the changes in chemical nature of the materials due to large variability throughout the samples.« less

Development of an impact- and solvent-resistant thermoplastic composite matrix, phase 4

NASA Technical Reports Server (NTRS)

Delano, C. B.

1987-01-01

Polyimides from BTDA with m-phenylenediamine and three aliphatic diamines were prepared in cresol and characterized. Characterization tests included compression strength and modulus, stressed solvent resistance, and melt-flow tests. Efforts to reduce the molecular weights of these polymers by either stoichiometric imbalance or phthalic anhydride end capping produced opacity in the polymer moldings when the stoichiometry was less than 99 percent. Use of 2,4-diaminotoluene in place of the m-phenylenediamine allowed clear polymer moldings to be obtained at all stoichiometries by end capping or stoichiometric imbalance. After melt-flow/molecular-weight studies, carbon fabric composites were prepared from three polyimide compositions containing BTDA, 2,4-diaminotoluene and two aliphatic diamines. Flexural strengths of two of the resins were in excess of 689 MPa (100 ksi) at both room temperature and 93 C. The polyimide from BTDA was selected for scale-up and neat resin characterization tests. The Tg of this polymer was 233 C.

3D Printer Generated Tissue iMolds for Cleared Tissue Using Single- and Multi-Photon Microscopy for Deep Tissue Evaluation.

PubMed

Miller, Sean J; Rothstein, Jeffrey D

2017-01-01

Pathological analyses and methodology has recently undergone a dramatic revolution. With the creation of tissue clearing methods such as CLARITY and CUBIC, groups can now achieve complete transparency in tissue samples in nano-porous hydrogels. Cleared tissue is then imagined in a semi-aqueous medium that matches the refractive index of the objective being used. However, one major challenge is the ability to control tissue movement during imaging and to relocate precise locations post sequential clearing and re-staining. Using 3D printers, we designed tissue molds that fit precisely around the specimen being imaged. First, images are taken of the specimen, followed by importing and design of a structural mold, then printed with affordable plastics by a 3D printer. With our novel design, we have innovated tissue molds called innovative molds (iMolds) that can be generated in any laboratory and are customized for any organ, tissue, or bone matter being imaged. Furthermore, the inexpensive and reusable tissue molds are made compatible for any microscope such as single and multi-photon confocal with varying stage dimensions. Excitingly, iMolds can also be generated to hold multiple organs in one mold, making reconstruction and imaging much easier. Taken together, with iMolds it is now possible to image cleared tissue in clearing medium while limiting movement and being able to relocate precise anatomical and cellular locations on sequential imaging events in any basic laboratory. This system provides great potential for screening widespread effects of therapeutics and disease across entire organ systems.

Energy Absorption Capacity in Natural Fiber Reinforcement Composites Structures

PubMed Central

López-Alba, Elías; Díaz, Francisco

2018-01-01

The study of natural fiber reinforcement composite structures has focused the attention of the automobile industry due to the new regulation in relation to the recyclability and the reusability of the materials preserving and/or improving the mechanical characteristics. The influence of different parameters on the material behavior of natural fiber reinforced plastic structures has been investigated, showing the potential for transport application in energy absorbing structures. Two different woven fabrics (twill and hopsack) made of flax fibers as well as a non-woven mat made of a mixture of hemp and kenaf fibers were employed as reinforcing materials. These reinforcing textiles were impregnated with both HD-PE (high-density polyethylen) and PLA (polylactic acid) matrix, using a continuous compression molding press. The impregnated semi-finished laminates (so-called organic sheets) were thermoformed in a second step to half-tubes that were assembled through vibration-welding process to cylindric crash absorbers. The specimens were loaded by compression to determine the specific energy absorption capacity. Quasi-static test results were compared to dynamic test data obtained on a catapult arrangement. The differences on the specific energies absorption (SEA) as a function of different parameters, such as the wall thickness, the weave material type, the reinforced textiles, and the matrix used, depending on the velocity rate application were quantified. In the case of quasi-static analysis it is observed a 20% increment in the SEA value when wove Hopsack fabric reinforcement is employed. No velocity rate influence from the material was observed on the SEA evaluation at higher speeds used to perform the experiments. The influence of the weave configuration (Hopsack) seems to be more stable against buckling effects at low loading rates with 10% higher SEA values. An increase of SEA level of up to 72% for PLA matrix was observed when compared with HD-PE matrix. PMID:29534003

Energy Absorption Capacity in Natural Fiber Reinforcement Composites Structures.

PubMed

López-Alba, Elías; Schmeer, Sebastian; Díaz, Francisco

2018-03-13

The study of natural fiber reinforcement composite structures has focused the attention of the automobile industry due to the new regulation in relation to the recyclability and the reusability of the materials preserving and/or improving the mechanical characteristics. The influence of different parameters on the material behavior of natural fiber reinforced plastic structures has been investigated, showing the potential for transport application in energy absorbing structures. Two different woven fabrics (twill and hopsack) made of flax fibers as well as a non-woven mat made of a mixture of hemp and kenaf fibers were employed as reinforcing materials. These reinforcing textiles were impregnated with both HD-PE (high-density polyethylen) and PLA (polylactic acid) matrix, using a continuous compression molding press. The impregnated semi-finished laminates (so-called organic sheets) were thermoformed in a second step to half-tubes that were assembled through vibration-welding process to cylindric crash absorbers. The specimens were loaded by compression to determine the specific energy absorption capacity. Quasi-static test results were compared to dynamic test data obtained on a catapult arrangement. The differences on the specific energies absorption (SEA) as a function of different parameters, such as the wall thickness, the weave material type, the reinforced textiles, and the matrix used, depending on the velocity rate application were quantified. In the case of quasi-static analysis it is observed a 20% increment in the SEA value when wove Hopsack fabric reinforcement is employed. No velocity rate influence from the material was observed on the SEA evaluation at higher speeds used to perform the experiments. The influence of the weave configuration (Hopsack) seems to be more stable against buckling effects at low loading rates with 10% higher SEA values. An increase of SEA level of up to 72% for PLA matrix was observed when compared with HD-PE matrix.

Severe Sequelae to Mold-Related Illness as Demonstrated in Two Finnish Cohorts

PubMed Central

Tuuminen, Tamara; Rinne, Kyösti Sakari

2017-01-01

The presence of toxic indoor molds with accompanying bacterial growth is clearly detrimental to human health. The pathophysiological and toxicological effects of toxins and structural components of molds and bacteria have been clarified in experiments conducted in tissue culture and animals, and there is convincing epidemiologic evidence; nonetheless their implications for human health are either ignored or denied, at least in Finland. In this communication, we describe two cohorts suffering severe sequelae to mold-related illness. One cohort is a nine-member family with pets that moved into a new house, which soon proved to be infested with pathogenic molds. The other cohort consists of 30 teachers and 50 students from a mold-infested school building. The first cohort experienced a plethora of mucosal irritation, neurological, skin, allergic, and other symptoms, with all family members ultimately developing a multiple chemical syndrome. In the second cohort, we detected a greatly elevated prevalence of autoimmune conditions and malignancies. We claim that mold-related illness exists in multiple facets; if not simply a transient mucosal irritation or even an increased risk of asthma onset or its exacerbation. We propose a scheme to explain the natural course of the mold-related illness. We recommend that future studies should combine data from, e.g., cancer, autoimmune, and endocrine disorder registers and neurological and mental health or neuropsychological registers with mold-exposed individuals being monitored for prolonged follow-up times. PMID:28421079

Micromolded thick PZT sol gel composite structures for ultrasound transducer devices operating at high frequencies

NASA Astrophysics Data System (ADS)

Pang, Guofeng

The objective of this work has been to design and develop a micromolding technique useful for batch fabrication to microfabricate 3D ceramic structures for device purposes using a sol gel composite processing technique and deep photolithography (UV LIGA). These structures may be the elements of ultrasound transducers, the structures associated with electronic packaging, or microstructures for microfluidic applications. To demonstrate the technique, the project has focused on the design and fabrication of annular and linear arrays for high frequency (>20 MHz) ultrasound imaging applications, particularly where an electronically steered imaging modality is employed. Other typical micromolded structures have been demonstrated to show the potential for micromolding. The transferability of the technique for industrial purposes is proposed. Using a sol gel composite process, the critical components in this technique are mold making, mold filling, material-processing, demolding, top electrode and essential material characterization. Two types of molds have been created using UV LIGA and/or electroplating. A purely organic mold made of Su-8 epoxy based photo-resist has shown tremendous performance for micromolding. The transducer packaging process has also been designed and evaluated at the laboratory level. A Su-8 micro bridge and bond pad has been used for wire bonding purposes. A 5-element annular array transducer has been fabricated by this technique and fully packaged. The micromolded piezoceramic structures have been characterized. The pulse echo performance of each element and the focusing performance of 5 elements of a packaged transducer array have been evaluated using a coaxial cable and a cable delay system.

Metal Injection Molding of Thin-Walled Titanium Glasses Arms: A Case Study

NASA Astrophysics Data System (ADS)

Ye, Shulong; Mo, Wei; Lv, Yonghu; Li, Xia; Kwok, Chi Tat; Yu, Peng

2018-02-01

Commercially pure titanium (CP Ti) and Ti-6Al-4V arms for a new brand of augmented reality smart glasses, which are over 170 mm in length, with thin wall structures and extremely complex surfaces, have been successfully fabricated via metal injection molding. After sintering, both the metal injection-molded (MIMed) CP Ti and Ti-6Al-4V can reach relative densities of over 95% with an oxygen content 2200 ppm, thus imparting mechanical properties comparable to cast alloys. The ductility of the MIMed CP Ti and Ti-6Al-4V are about 15% and 8%, respectively. This is a good example of applying metal injection molding to mass production of precise Ti alloy parts with complicated shapes.

A thermoplastic polyimidesulfone

NASA Technical Reports Server (NTRS)

St.clair, T. L.; Yamaki, D. A.

1982-01-01

A polymer system has been prepared which has the excellent thermoplastic properties generally associated with polysulfones, and the solvent resistance and thermal stability of aromatic polyimides. This material, with improved processability over the base polyimide, can be processed in the 260-325 C range in such a manner as to yield high quality, tough unfilled moldings; strong, high-temperature-resistant adhesive bonds; and well consolidated, graphite-fiber-reinforced moldings (composities). The unfilled moldings have physical properties that are similar to aromatic polysulfones which demonstrates the potential as an engineering thermoplastic. The adhesive bonds exhibit excellent retention of initial strength levels even after thermal aging for 5000 hours at 232 C. The graphite-fiber-reinforced moldings have mechanical properties which makes this polymer attractive for the fabrication of structural composites.

Systems and Methods for Fabricating Structures Including Metallic Glass-Based Materials Using Low Pressure Casting

NASA Technical Reports Server (NTRS)

Hofmann, Douglas C. (Inventor); Kennett, Andrew (Inventor)

2018-01-01

Systems and methods to fabricate objects including metallic glass-based materials using low-pressure casting techniques are described. In one embodiment, a method of fabricating an object that includes a metallic glass-based material includes: introducing molten alloy into a mold cavity defined by a mold using a low enough pressure such that the molten alloy does not conform to features of the mold cavity that are smaller than 100 microns; and cooling the molten alloy such that it solidifies, the solid including a metallic glass-based material.

Manufacturing Methods and Technology (MANTECH) Program Manufacturing Techniques for a Composite Tail Section for the Advanced Attack Helicopter.

DTIC Science & Technology

1981-10-01

Protection Resin Nomex Composite Structure Tooling Graphite Electrolysis Ballistic Survivability 24. AUMT ACT’ (Zim llea m di nemsy mitily by block minubr...angles required by the design. 105 , ~ ii i w d q 100 Aluminum male molds (Figure 69) are u~tri to lay up prepreg material to form the angles that attach...aluminum male mold shaped to the airfoil contour as Figure 78 indicates. The spars and ribs are laid up in matched metal molds with silicone rubber

Foam injection molding of poly(lactic acid) with physical blowing agents

NASA Astrophysics Data System (ADS)

Pantani, R.; Sorrentino, A.; Volpe, V.; Titomanlio, G.

2014-05-01

Foam injection molding uses environmental friendly blowing agents under high pressure and temperature to produce parts having a cellular core and a compact solid skin (the so-called "structural foam"). The addition of a supercritical gas reduces the part weight and at the same time improves some physical properties of the material through the promotion of a faster crystallization; it also leads to the reduction of both the viscosity and the glass transition temperature of the polymer melt, which therefore can be injection molded adopting lower temperatures and pressures. These aspects are of extreme interest for biodegradable polymers, which often present a very narrow processing window, with the suitable processing temperatures close to the degradation conditions. In this work, foam injection molding was carried out by an instrumented molding machine, able to measure the pressure evolution in different positions along the flow-path. The material adopted was a biodegradable polymer, namely the Poly(lactic acid), PLA. The effect of a physical blowing agent (PBA) on the viscosity was measured. The density reduction and the morphology of parts obtained by different molding conditions was assessed.

Advanced nondestructive techniques applied for the detection of discontinuities in aluminum foams

NASA Astrophysics Data System (ADS)

Katchadjian, Pablo; García, Alejandro; Brizuela, Jose; Camacho, Jorge; Chiné, Bruno; Mussi, Valerio; Britto, Ivan

2018-04-01

Metal foams are finding an increasing range of applications by their lightweight structure and physical, chemical and mechanical properties. Foams can be used to fill closed moulds for manufacturing structural foam parts of complex shape [1]; foam filled structures are expected to provide good mechanical properties and energy absorption capabilities. The complexity of the foaming process and the number of parameters to simultaneously control, demand a preliminary and hugely wide experimental activity to manufacture foamed components with a good quality. That is why there are many efforts to improve the structure of foams, in order to obtain a product with good properties. The problem is that even for seemingly identical foaming conditions, the effective foaming can vary significantly from one foaming trial to another. The variation of the foams often is related by structural imperfections, joining region (foam-foam or foam-wall mold) or difficulties in achieving a complete filling of the mould. That is, in a closed mold, the result of the mold filling and its structure or defects are not known a priori and can eventually vary significantly. These defects can cause a drastic deterioration of the mechanical properties [2] and lead to a low performance in its application. This work proposes the use of advanced nondestructive techniques for evaluating the foam distribution after filling the mold to improve the manufacturing process. To achieved this purpose ultrasonic technique (UT) and cone beam computed tomography (CT) were applied on plate and structures of different thicknesses filled with foam of different porosity. UT was carried out on transmission mode with low frequency air-coupled transducers [3], in focused and unfocused configurations.

Mechanical characterization of injection-molded macro porous bioceramic bone scaffolds.

PubMed

Vivanco, Juan; Aiyangar, Ameet; Araneda, Aldo; Ploeg, Heidi-Lynn

2012-05-01

Bioactive ceramic materials like tricalcium phosphate (TCP) have been emerging as viable material alternatives to the current therapies of bone scaffolding to target fracture healing and osteoporosis. Both material and architectural characteristics play a critical role in the osteoconductive capacity and strength of bone scaffolds. Thus, the objective of this research was to investigate the sintering temperature effect of a cost-effective manufacturing process on the architecture and mechanical properties of a controlled macro porous bioceramic bone scaffold. In this study the physical and mechanical properties of β-TCP bioceramic scaffolds were investigated as a function of the sintering temperature in the range of 950-1150 °C. Physical properties investigated included bulk dimensions, pore size, and strut thickness; and, compressive mechanical properties were evaluated in air at room temperature and in saline solution at body temperature. Statistically significant increases in apparent elastic modulus were measured for scaffolds sintered at higher temperatures. Structural stiffness for all the specimens was significantly reduced when tested at body temperature in saline solution. These findings support the development of clinically successful bioceramic scaffolds that may stimulate bone regeneration and scaffold integration while providing structural integrity. Copyright © 2012 Elsevier Ltd. All rights reserved.

Development and Testing of a Post-Installable Deepwater Monitoring System Using Fiber-Optic Sensors

NASA Technical Reports Server (NTRS)

Seaman, Calvin H.; Brower, David V.; Le, Suy Q.; Tang, Henry H.

2015-01-01

This paper addresses the design and development of a fiber-optic monitoring system that can be deployed on existing deepwater risers and flowlines; and provides a summary of test article fabrication and the subsequent laboratory testing performed at the National Aeronautics and Space Administration-Johnson Space Center (NASA-JSC). A major challenge of a post-installed instrumentation system is to ensure adequate coupling between the instruments and the riser or flowline of interest. This work investigates the sensor coupling for pipelines that are suspended in a water column (from topside platform to seabed) using a fiber-optic sensor clamp and subsea bonding adhesive. The study involved the design, fabrication, and test of several prototype clamps that contained fiber-optic sensors. A mold was produced by NASA using 3-D printing methods that allowed the casting of polyurethane clamp test articles to accommodate 4-inch and 8-inch diameter pipes. The prototype clamps were installed with a subsea adhesive in a "wet" environment and then tested in the NASA Structures Test Laboratory (STL). The tension, compression, and bending test data showed that the prototype sensor clamps achieved good structural coupling, and could provide high quality strain measurement for active monitoring.

Effect of simulated mechanical recycling processes on the structure and properties of poly(lactic acid).

PubMed

Beltrán, F R; Lorenzo, V; Acosta, J; de la Orden, M U; Martínez Urreaga, J

2018-06-15

The aim of this work is to study the effects of different simulated mechanical recycling processes on the structure and properties of PLA. A commercial grade of PLA was melt compounded and compression molded, then subjected to two different recycling processes. The first recycling process consisted of an accelerated ageing and a second melt processing step, while the other recycling process included an accelerated ageing, a demanding washing process and a second melt processing step. The intrinsic viscosity measurements indicate that both recycling processes produce a degradation in PLA, which is more pronounced in the sample subjected to the washing process. DSC results suggest an increase in the mobility of the polymer chains in the recycled materials; however the degree of crystallinity of PLA seems unchanged. The optical, mechanical and gas barrier properties of PLA do not seem to be largely affected by the degradation suffered during the different recycling processes. These results suggest that, despite the degradation of PLA, the impact of the different simulated mechanical recycling processes on the final properties is limited. Thus, the potential use of recycled PLA in packaging applications is not jeopardized. Copyright © 2017 Elsevier Ltd. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huang, Tianyu; Xu, Hongyi; Chen, Wei

Fiber-reinforced polymer composites are strong candidates for structural materials to replace steel and light alloys in lightweight vehicle design because of their low density and relatively high strength. In the integrated computational materials engineering (ICME) development of carbon fiber composites, microstructure reconstruction algorithms are needed to generate material microstructure representative volume element (RVE) based on the material processing information. The microstructure RVE reconstruction enables the material property prediction by finite element analysis (FEA)This paper presents an algorithm to reconstruct the microstructure of a chopped carbon fiber/epoxy laminate material system produced by compression molding, normally known as sheet molding compounds (SMC).more » The algorithm takes the result from material’s manufacturing process as inputs, such as the orientation tensor of fibers, the chopped fiber sheet geometry, and the fiber volume fraction. The chopped fiber sheets are treated as deformable rectangle chips and a random packing algorithm is developed to pack these chips into a square plate. The RVE is built in a layer-by-layer fashion until the desired number of lamina is reached, then a fine tuning process is applied to finalize the reconstruction. Compared to the previous methods, this new approach has the ability to model bended fibers by allowing limited amount of overlaps of rectangle chips. Furthermore, the method does not need SMC microstructure images, for which the image-based characterization techniques have not been mature enough, as inputs. Case studies are performed and the results show that the statistics of the reconstructed microstructures generated by the algorithm matches well with the target input parameters from processing.« less

Surface chemical structure for soft contact lenses as a function of polymer processing.

PubMed

Grobe, G L; Valint, P L; Ammon, D M

1996-09-01

The surface chemistry and topography of cast-molded Etafilcon-A and doubled-sided lathed Etafilcon-A soft contact lenses were determined to be significantly different. The variations in surface chemical and morphologic structure between the two lenses were the result of contact lens manufacturing methods. The surface of the cast-molded Etafilcon-A had a consistently less rough surface compared to the doubled sided lathed Etafilcon-A as determined by atomic force microscopy. The surface of the doubled sided lathed Etafilcon-A contained primarily silicone and wax contamination in addition to minute amounts of HEMA. The cast-molded Etafilcon-A had an elemental and chemical content which was consistent with the polymer stoichiometry. Contact angle wettability profiles revealed inherent wettability differences between the two lenses types. The cast-molded Etafilcon-A had an inherently greater water wettability, polarity, and critical surface tension. This means that these two lenses cannot be compared as similar or identical lens materials in terms of surface composition. The manufacturing method used to produce a soft contact lens directly determines the surface elemental and chemical structure as well as the morphology of the finished lens material. These results suggest possible differences in the clinical comfort, spoilage, and lubricity felt during patient wear.

MOLD-SHAPED, NANOFIBER SCAFFOLD-BASED CARTILAGE ENGINEERING USING HUMAN MESENCHYMAL STEM CELLS AND BIOREACTOR

PubMed Central

Janjanin, Sasa; Li, Wan-Ju; Morgan, Meredith T.; Shanti, Rabie M.; Tuan, Rocky S.

2008-01-01

Background Mesenchymal stem cell (MSC)-based tissue engineering is a promising future alternative to autologous cartilage grafting. This study evaluates the potential of using MSCs, seeded into electrospun, biodegradable polymeric nanofibrous scaffolds, to engineer cartilage with defined dimensions and shape, similar to grafts used for subcutaneous implantation in plastic and reconstructive surgery. Materials and methods Human bone marrow derived MSCs seeded onto nanofibrous scaffolds and placed in custom-designed molds were cultured for up to 42 days in bioreactors. Chondrogenesis was induced with either transforming growth factor-β1 (TGF-β1) alone or in combination with insulin-like growth factor-I (IGF-I). Results Constructs exhibited hyaline cartilage histology with desired thickness and shape as well as favorable tissue integrity and shape retention, suggesting the presence of elastic tissue. Time-dependent increase in cartilage matrix gene expression was seen in both types of culture; at Day 42, TGF-β1/IGF-I treated cultures showed higher collagen type II and aggrecan expression. Both culture conditions showed significant time-dependent increase in sulfated glycosaminoglycan and hydroxyproline contents. TGF-β1/IGF-I treated samples were significantly stiffer; with equilibrium compressive Young’s modulus values reaching 17 kPa by Day 42. Conclusions The successful ex vivo development of geometrically defined cartilaginous construct using customized molding suggests the potential of cell-based cartilage tissue for reconstructive surgery. PMID:18316094

Demineralized bone matrix fibers formable as general and custom 3D printed mold-based implants for promoting bone regeneration.

PubMed

Rodriguez, Rudy U; Kemper, Nathan; Breathwaite, Erick; Dutta, Sucharita M; Hsu, Erin L; Hsu, Wellington K; Francis, Michael P

2016-07-26

Bone repair frequently requires time-consuming implant construction, particularly when using un-formed implants with poor handling properties. We therefore developed osteoinductive, micro-fibrous surface patterned demineralized bone matrix (DBM) fibers for engineering both defect-matched and general three-dimensional implants. Implant molds were filled with demineralized human cortical bone fibers there were compressed and lyophilized, forming mechanically strong shaped DBM scaffolds. Enzyme linked immunosorbent assays and mass spectrometry confirmed that DBM fibers contained abundant osteogenic growth factors (bone morphogenetic proteins, insulin-like growth factor-I) and extracellular matrix proteins. Mercury porosimetry and mechanical testing showed interconnected pores within the mechanically stable, custom DBM fiber scaffolds. Mesenchymal stem cells readily attached to the DBM and showed increasing metabolic activity over time. DBM fibers further increased alkaline phosphatase activity in C2C12 cells. In vivo, DBM implants elicited osteoinductive potential in a mouse muscle pouch, and also promoted spine fusion in a rat arthrodesis model. DBM fibers can be engineered into custom-shaped, osteoinductive and osteoconductive implants with potential for repairing osseous defects with precise fitment, potentially reducing operating time. By providing pre-formed and custom implants, this regenerative allograft may improve patient outcomes following surgical bone repair, while further advancing personalized orthopedic and craniomaxillofacial medicine using three-dimensional-printed tissue molds.

Low home ventilation rate in combination with moldy odor from the building structure increase the risk for allergic symptoms in children.

PubMed

Hägerhed-Engman, L; Sigsgaard, T; Samuelson, I; Sundell, J; Janson, S; Bornehag, C-G

2009-06-01

There are consistent findings on associations between asthma and allergy symptoms and residential mold and moisture. However, definitions of 'dampness' in studies are diverse because of differences in climate and building construction. Few studies have estimated mold problems inside the building structure by odor assessments. In a nested case-control study of 400 Swedish children, observations and measurements were performed in their homes by inspectors, and the children were examined by physicians for diagnoses of asthma, eczema, and rhinitis. In conclusion, we found an association between moldy odor along the skirting board and allergic symptoms among children, mainly rhinitis. No associations with any of the allergic symptoms were found for discoloured stains, 'floor dampness' or a general mold odor in the room. A moldy odor along the skirting board can be a proxy for hidden moisture problem inside the outer wall construction or in the foundation construction. There are indications that such dampness problems increase the risk for sensitization but the interpretation of data in respect of sensitization is difficult as about 80% of the children with rhinitis were sensitized. Furthermore, low ventilation rate in combination with moldy odor along the skirting board further increased the risk for three out of four studied outcomes, indicating that the ventilation rate is an effect modifier for indoor pollutants. This study showed that mold odor at the skirting board level is strongly associated with allergic symptoms among children. Such odor at that specific place can be seen as a proxy for some kind of hidden moisture or mold problem in the building structure, such as the foundation or wooden ground beam. In houses with odor along the skirting board, dismantling of the structure is required for an investigation of possible moisture damage, measurements, and choice of actions. In homes with low ventilation in combination with mold odor along the skirting board, there was even a higher risk of health effects. This emphasizes the need for the appropriate remediation as this is an ever increasing problem in poorly ventilated houses that are damp.

Manufacture of mold of polymeric composite water pipe reinforced charcoal

NASA Astrophysics Data System (ADS)

Zulfikar; Misdawati; Idris, M.; Nasution, F. K.; Harahap, U. N.; Simanjuntak, R. K.; Jufrizal; Pranoto, S.

2018-03-01

In general, household wastewater pipelines currently use thermoplastic pipes of Polyvinyl Chloride (PVC). This material is known to be not high heat resistant, contains hazardous chemicals (toxins), relatively inhospitable, and relatively more expensive. Therefore, researchers make innovations utilizing natural materials in the form of wood charcoal as the basic material of making the water pipe. Making this pipe requires a simple mold design that can be worked in the scale of household and intermediate industries. This research aims to produce water pipe mold with simple design, easy to do, and making time relatively short. Some considerations for molding materials are weight of mold, ease of raw material, strong, sturdy, and able to cast. Pipe molds are grouped into 4 (four) main parts, including: outer diameter pipe molding, pipe inside diameter, pipe holder, and pipe alignment control. Some materials have been tested as raw materials for outer diameter of pipes, such as wood, iron / steel, cement, and thermoset. The best results are obtained on thermoset material, where the process of disassembling is easier and the resulting mold weight is relatively lighter. For the inside diameter of the pipe is used stainless steel, because in addition to be resistant to chemical processes that occur, in this part of the mold must hold the press load due to shrinkage of raw materials of the pipe during the process of hardening (polymerization). Therefore, it needs high pressure resistant material and does not blend with the raw material of the pipe. The base of the mold is made of stainless steel material because it must be resistant to corrosion due to chemical processes. As for the adjustment of the pipe is made of ST 37 carbon steel, because its function is only as a regulator of the alignment of the pipe structure.

Polymeric waveguide array with 45 degree slopes fabricated by bottom side tilted exposure

NASA Astrophysics Data System (ADS)

Lin, Xiaohui; Dou, Xinyuan; Wang, Alan X.; Chen, Ray T.

2011-01-01

This paper demonstrated a practical fabrication process of polymeric waveguide array (12 channels) with 50μm(W)×50μm(H)×23mm(L) dimension and mirror embedded 45° degree slopes for vertical coupling purpose. The entire process contained three main parts: a SU8 pre-mold with 45° slope, a PDMS mold and the final waveguide array device. The key step of fabricating the pre-mold included a bottom side tilted exposure of SU8 photo resist. By placing the sample upside down, tilting by 58.7° and immersing into DI water, the ultraviolet (UV) beam that shined vertically was directed to go through from the bottom of the glass substrate into top side SU8 resist with 45° angle to form the surface. This method was able to guarantee no-gap contact between the mask pattern and the photo resist when exposing. By comparing the process complexity and achieved structure of the top and bottom side exposure, the later was proved to be a promising method for making high quality tilted structure without any tailing effect. The reversed PDMS mold was then fabricated on the SU8 pre-mold. The PDMS mold was used to imprint the cladding layer of the waveguide array. After metal deposition, core filling and top cladding layer coating, the final polymeric waveguide array device was achieved. For performance evaluation, 850nm laser beam from VCSEL was modulated to 10Gbps signals and vertically coupled into the waveguide array. The eye diagrams revealed high Q factor when transmitting signals along these waveguide array.

Compression response of tri-axially braided textile composites

NASA Astrophysics Data System (ADS)

Song, Shunjun

2007-12-01

This thesis is concerned with characterizing the compression stiffness and compression strength of 2D tri-axially braided textile composites (2DTBC). Two types of 2DTBC are considered differing only on the resin type, while the textile fiber architecture is kept the same with bias tows at 45 degrees to the axial tows. Experimental, analytical and computational methods are described based on the results generated in this study. Since these composites are manufactured using resin transfer molding, the intended and as manufactured composite samples differ in their microstructure due to consolidation and thermal history effects in the manufacturing cycle. These imperfections are measured and the effect of these imperfections on the compression stiffness and strength are characterized. Since the matrix is a polymer material, the nonuniform thermal history undergone by the polymer at manufacturing (within the composite and in the presence of fibers) renders its properties to be non-homogenous. The effects of these non-homogeneities are captured through the definition of an equivalent in-situ matrix material. A method to characterize the mechanical properties of the in-situ matrix is also described. Fiber tow buckling, fiber tow kinking and matrix microcracking are all observed in the experiments. These failure mechanisms are captured through a computational model that uses the finite element (FE) technique to discretize the structure. The FE equations are solved using the commercial software ABAQUS version 6.5. The fiber tows are modeled as transversely isotropic elastic-plastic solids and the matrix is modeled as an isotropic elastic-plastic solid with and without microcracking damage. Because the 2DTBC is periodic, the question of how many repeat units are necessary to model the compression stiffness and strength are examined. Based on the computational results, the correct representative unit cell for this class of materials is identified. The computational models and results presented in the thesis provide a means to assess the compressive strength of 2DTBC and its dependence on various microstructural parameters. The essential features (for example, fiber kinking) of 2DTBC under compressive loading are captured accurately and the results are validated by the compression experiments. Due to the requirement of large computational resources for the unit cell studies, simplified models that use less computer resources but sacrifice some accuracy are presented for use in engineering design. A combination of the simplified models is shown to provide a good prediction of the salient features (peak strength and plateau strength) of these materials under compression loading. The incorporation of matrix strain rate effects, a study of the effect of the bias tow angle and the inclusion of viscoelastic/viscoplastic behavior for the study of fatigue are suggested as extensions to this work.

Design and fabrication of label-free biochip using a guided mode resonance filter with nano grating structures by injection molding process.

PubMed

Cho, E; Kim, B; Choi, S; Han, J; Jin, J; Han, J; Lim, J; Heo, Y; Kim, S; Sung, G Y; Kang, S

2011-01-01

This paper introduces technology to fabricate a guided mode resonance filter biochip using injection molding. Of the various nanofabrication processes that exist, injection molding is the most suitable for the mass production of polymer nanostructures. Fabrication of a nanograting pattern for guided mode resonance filters by injection molding requires a durable metal stamp, because of the high injection temperature and pressure. Careful consideration of the optimized process parameters is also required to achieve uniform sub-wavelength gratings with high fidelity. In this study, a metallic nanostructure pattern to be used as the stamp for the injection molding process was fabricated using electron beam lithography, a UV nanoimprinting process, and an electroforming process. A one-dimensional nanograting substrate was replicated by injection molding, during which the process parameters were controlled. To evaluate the geometric quality of the injection molded nanograting patterns, the surface profile of the fabricated nanograting for different processing conditions was analyzed using an atomic force microscope and a scanning electron microscope. Finally, to demonstrate the feasibility of the proposed process for fabricating guided mode resonance filter biochips, a high-refractive-index material was deposited on the polymer nanograting and its guided mode resonance characteristics were analyzed.

Molecular orientation distributions during injection molding of liquid crystalline polymers: Ex situ investigation of partially filled moldings

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fang, Jun; Burghardt, Wesley R.; Bubeck, Robert A.

The development of molecular orientation in thermotropic liquid crystalline polymers (TLCPs) during injection molding has been investigated using two-dimensional wide-angle X-ray scattering coordinated with numerical computations employing the Larson-Doi polydomain model. Orientation distributions were measured in 'short shot' moldings to characterize structural evolution prior to completion of mold filling, in both thin and thick rectangular plaques. Distinct orientation patterns are observed near the filling front. In particular, strong extension at the melt front results in nearly transverse molecular alignment. Far away from the flow front shear competes with extension to produce complex spatial distributions of orientation. The relative influence ofmore » shear is stronger in the thin plaque, producing orientation along the filling direction. Exploiting an analogy between the Larson-Doi model and a fiber orientation model, we test the ability of process simulation tools to predict TLCP orientation distributions during molding. Substantial discrepancies between model predictions and experimental measurements are found near the flow front in partially filled short shots, attributed to the limits of the Hele-Shaw approximation used in the computations. Much of the flow front effect is however 'washed out' by subsequent shear flow as mold filling progresses, leading to improved agreement between experiment and corresponding numerical predictions.« less

Effect of MnO content on the interfacial property of mold flux and steel

NASA Astrophysics Data System (ADS)

Wang, Wanlin; Li, Jingwen; Zhou, Lejun; Yang, Jian

2016-07-01

The interfacial property between liquid mold flux and steel has significant impact on the quality of casting slab, and this property is mainly determined by the chemical composition of mold flux and the reaction between the flux and steel. The effect of MnO content on the contact angle and interfacial tension between liquid mold flux and ultra-low carbon steel was investigated by sessile drop method in this article, and the results suggested that both the contact angle and interfacial tension decreased with the increase of MnO content in the mold flux. The increase of Si and Mn and the reduction of Al and Ti in the interaction layer were caused by the chemical reactions occurred in the vicinity of interface between mold flux and steel substrate. Besides, the thickness of the interaction layer increased from 4 μm to 7 μm, then to 9 μm, 11 μm and 15 μm when the MnO content was added from 1 wt% to 3 wt%, then to 5 wt%, 7 wt%, and 9 wt% due to the fact that MnO can simplify the polymerized structure of the melt and improve the penetrability of molten mold flux to make the interfacial reaction easier.

Effects of curing conditions on the structure of sodium carboxymethyl starch/mineral matrix system: FT-IR investigation.

PubMed

Kaczmarska, Karolina; Grabowska, Beata; Bobrowski, Artur; Cukrowicz, Sylwia

2018-04-24

Strength properties of the microwave cured molding sands containing binders in a form of the aqueous solution of sodium carboxymethyl starch (CMS-Na) are higher than the same molding composition cured by conventional heating. Finding the reason of this effect was the main purpose in this study. Structural changes caused by both physical curing methods of molding sands systems containing mineral matrix (silica sand) and polymer water-soluble binder (CMS-Na) were compared. It was shown, by means of the FT-IR spectroscopic studies, that the activation of the polar groups in the polymer macromolecules structure as well as silanol groups on the mineral matrix surfaces was occurred in the microwave radiation. Binding process in microwave-cured samples was an effect of formation the hydrogen bonds network between hydroxyl and/or carbonyl groups present in polymer and silanol groups present in mineral matrix. FT-IR studies of structural changes in conventional and microwave cured samples confirm that participation of hydrogen bonds is greater after microwave curing than conventional heating. Copyright © 2018 Elsevier B.V. All rights reserved.

Development of the manufacture of billets based on high-strength aluminum alloys

NASA Astrophysics Data System (ADS)

Korostelev, V. F.; Denisov, M. S.; Bol'shakov, A. E.; Van Khieu, Chan

2017-09-01

When pressure is applied upon casting as a factor of external impact on melt, the problems related mainly to filling of molds are solved; however, some casting defects cannot be avoided. The experimental results demonstrate that complete compensation of shrinkage under pressure can be achieved by compressing of casting by 8-10% prior to beginning of solidification and by 2-3% during the transition of a metal from the liquid to the solid state. It is mentioned that the procedure based on compressing a liquid metal can be efficiently applied for manufacture of high-strength aluminum alloy castings. The selection of engineering parameters is substantiated. Examples of castings made of V95 alloy according to the developed procedure are given. In addition, the article discusses the problems related to designing of engineering and special-purpose equipment, software, and control automation.

Mechanical properties of new dental pulp-capping materials.

PubMed

Nielsen, Matthew J; Casey, Jeffery A; VanderWeele, Richard A; Vandewalle, Kraig S

2016-01-01

The mechanical properties of pulp-capping materials may affect their resistance to fracture during placement of a final restorative material or while supporting an overlying restoration over time. The purpose of this study was to compare the compressive strength, flexural strength, and flexural modulus of 2 new pulp-capping materials (TheraCal LC and Biodentine), mineral trioxide aggregate (MTA), and calcium hydroxide over time. Specimens were created in molds and tested to failure in a universal testing machine after 15 minutes, 3 hours, and 24 hours. The MTA specimens did not set at 15 minutes. At all time periods, TheraCal LC had the greatest compressive and flexural strengths. After 3 and 24 hours, Biodentine had the greatest flexural modulus. TheraCal LC had greater early strength to potentially resist fracture during immediate placement of a final restorative material. Biodentine had greater stiffness after 3 hours to potentially provide better support of an overlying restoration under function over time.

Test methods for textile composites

NASA Technical Reports Server (NTRS)

Minguet, Pierre J.; Fedro, Mark J.; Gunther, Christian K.

1994-01-01

Various test methods commonly used for measuring properties of tape laminate composites were evaluated to determine their suitability for the testing of textile composites. Three different types of textile composites were utilized in this investigation: two-dimensional (2-D) triaxial braids, stitched uniweave fabric, and three-dimensional (3-D) interlock woven fabric. Four 2-D braid architectures, five stitched laminates, and six 3-D woven architectures were tested. All preforms used AS4 fibers and were resin-transfer-molded with Shell RSL-1895 epoxy resin. Ten categories of material properties were investigated: tension, open-hole tension, compression, open-hole compression, in-plane shear, filled-hole tension, bolt bearing, interlaminar tension, interlaminar shear, and interlaminar fracture toughness. Different test methods and specimen sizes were considered for each category of test. Strength and stiffness properties obtained with each of these methods are documented in this report for all the material systems mentioned above.

Presurgical nasoalveolar molding for cleft lip and palate: the application of digitally designed molds.

PubMed

Shen, Congcong; Yao, Caroline A; Magee, William; Chai, Gang; Zhang, Yan

2015-06-01

The authors present a novel nasoalveolar molding protocol by prefabricating sets of nasoalveolar molding appliances using three-dimensional technology. Prospectively, 17 infants with unilateral complete cleft lip and palate underwent the authors' protocol before primary cheiloplasty. An initial nasoalveolar molding appliance was created based on the patient's first and only in-person maxillary cast, produced from a traditional intraoral dental impression. Thereafter, each patient's molding course was simulated using computer software that aimed to narrow the alveolar gap by 1 mm each week by rotating the greater alveolar segment. A maxillary cast of each predicted molding stage was created using three-dimensional printing. Subsequent appliances were constructed in advance, based on the series of computer-generated casts. Each patient had a total three clinic visits spaced 1 month apart. Anthropometric measurements and bony segment volumes were recorded before and after treatment. Alveolar cleft widths narrowed significantly (p < 0.01), soft-tissue volume of each segment expanded (p < 0.01), and the arc of the alveolus became more contiguous across the cleft (p < 0.01). One patient required a new appliance at the second visit because of bleeding and discomfort. Eleven patients had mucosal irritation and two experienced minor mucosal ulceration. Three-dimensional technology can precisely represent anatomic structures in pediatric clefts. Results from the authors' algorithm are equivalent to those of traditional nasoalveolar molding therapies; however, the number of required clinic visits and appliance adjustments decreased. As three-dimensional technology costs decrease, multidisciplinary teams may design customized nasoalveolar molding treatment with improved efficiency and less burden to medical staff, patients, and families. Therapeutic, IV.

A molded surface-micromachining and bulk etching release (MOSBE) fabrication platform on (1 1 1) Si for MOEMS

NASA Astrophysics Data System (ADS)

Wu, Mingching; Fang, Weileun

2006-02-01

This work attempts to integrate poly-Si thin film and single-crystal-silicon (SCS) structures in a monolithic process. The process integrated multi-depth DRIE (deep reactive ion etching), trench-refilled molding, a two poly-Si MUMPs process and (1 1 1) Si bulk micromachining to accomplish multi-thickness and multi-depth structures for superior micro-optical devices. In application, a SCS scanning mirror driven by self-aligned vertical comb-drive actuators was demonstrated. The stiffness of the mirror was significantly increased by thick SCS structures. The thin poly-Si film served as flexible torsional springs and electrical routings. The depth difference of the vertical comb electrodes was tuned by DRIE to increase the devices' stroke. Finally, a large moving space was available after the bulk Si etching. In summary, the present fabrication process, named (1 1 1) MOSBE (molded surface-micromachining and bulk etching release on (1 1 1) Si substrate), can further integrate with the MUMPs devices to establish a more powerful platform.

A thermoplastic polyimidesulfone. [synthesis of processable and solvent resistant system

NASA Technical Reports Server (NTRS)

St. Clair, T. L.; Yamaki, D. A.

1984-01-01

A polymer system has been prepared which has the excellent thermoplastic properties generally associated with polysulfones, and the solvent resistance and thermal stability of aromatic polyimides. This material, with improved processability over the base polyimide, can be processed in the 260-325 C range in such a manner as to yield high quality, tough unfilled moldings; strong, high-temperature-resistant adhesive bonds; and well consolidated, graphite-fiber-reinforced moldings (composites). The unfilled moldings have physical properties that are similar to aromatic polysulfones which demonstrates the potential as an engineering thermoplastic. The adhesive bonds exhibit excellent retention of initial strength levels even after thermal aging for 5000 hours at 232 C. The graphite-fiber-reinforced moldings have mechanical properties which makes this polymer attractive for the fabrication of structural composites.

Multicomponent micropatterned sol-gel materials by capillary molding

NASA Astrophysics Data System (ADS)

Lochhead, Michael J.; Yager, Paul

1997-10-01

A physically and chemically benign method for patterning multiple sol-gel materials onto a single substrate is described. Structures are demonstrated for potential micro- optical chemical sensor, biosensor, and waveguiding applications. Fabrication is based on the micro molding in capillaries (MIMIC) approach. A novel mold design allows several sols to be cast simultaneously. Closely spaced, organically modified silica ridges containing fluorescent dyes are demonstrated. Ridges have cross sectional dimensions from one to 50 micrometers and are centimeters in length. Processing issues, particularly those related to mold filling, are discussed in detail. Because sol-gel MIMIC avoids the harsh physical and chemical environments normally associated with patterning, the approach allows full exploitation of sol- gel processing advantages, such as the ability to entrap sensitive organic dopant molecules in the sol-gel matrix.

Fabrication of PDMS architecture

NASA Astrophysics Data System (ADS)

Adam, Tijjani; Hashim, U.

2017-03-01

The study report novel, yet simple and flexible fabrication method for micro channel patterning PDMS thin mold on glass surfaces, the method allows microstructures with critical dimensions to be formed using PDMS. Micro channel production is a two-step process. First, soft photolithography methods are implemented to fabricate a reusable mold. The mold is then used to create the micro channel, which consists of SU8, PDMS and glass. The micro channel design was performed using AutoCAD and the fabrication begins by creating a replicable mold. The mold is created on a glass slide. by spin-coating speed between 500 to 1250rpm with an acceleration of 100 rpm/s for 100 and 15 second ramp up and down speed respectively. Channel flow rate based on concentration were measured by analyzing the recorded flow profiles which was collected from the high powered microscope at. 80µ, 70µm, 50µm for inlet channel 1, 2, 3 respectively the channel flow were compared for flow efficiency at different concentrations and Re. Thus, the simplicity of device structure and fabrication makes it feasible to miniaturize it for the development of point-of-care kits, facilitating its use in both clinical and non-clinical environments. With its simple geometric structure and potential for mass commercial fabrication, the device can be developed to become a portable photo detection sensor that can be use for both environmental and diagnostic application.

Fabrication of low cost soft tissue prostheses with the desktop 3D printer

NASA Astrophysics Data System (ADS)

He, Yong; Xue, Guang-Huai; Fu, Jian-Zhong

2014-11-01

Soft tissue prostheses such as artificial ear, eye and nose are widely used in the maxillofacial rehabilitation. In this report we demonstrate how to fabricate soft prostheses mold with a low cost desktop 3D printer. The fabrication method used is referred to as Scanning Printing Polishing Casting (SPPC). Firstly the anatomy is scanned with a 3D scanner, then a tissue casting mold is designed on computer and printed with a desktop 3D printer. Subsequently, a chemical polishing method is used to polish the casting mold by removing the staircase effect and acquiring a smooth surface. Finally, the last step is to cast medical grade silicone into the mold. After the silicone is cured, the fine soft prostheses can be removed from the mold. Utilizing the SPPC method, soft prostheses with smooth surface and complicated structure can be fabricated at a low cost. Accordingly, the total cost of fabricating ear prosthesis is about $30, which is much lower than the current soft prostheses fabrication methods.

Fabrication of low cost soft tissue prostheses with the desktop 3D printer

PubMed Central

He, Yong; Xue, Guang-huai; Fu, Jian-zhong

2014-01-01

Soft tissue prostheses such as artificial ear, eye and nose are widely used in the maxillofacial rehabilitation. In this report we demonstrate how to fabricate soft prostheses mold with a low cost desktop 3D printer. The fabrication method used is referred to as Scanning Printing Polishing Casting (SPPC). Firstly the anatomy is scanned with a 3D scanner, then a tissue casting mold is designed on computer and printed with a desktop 3D printer. Subsequently, a chemical polishing method is used to polish the casting mold by removing the staircase effect and acquiring a smooth surface. Finally, the last step is to cast medical grade silicone into the mold. After the silicone is cured, the fine soft prostheses can be removed from the mold. Utilizing the SPPC method, soft prostheses with smooth surface and complicated structure can be fabricated at a low cost. Accordingly, the total cost of fabricating ear prosthesis is about $30, which is much lower than the current soft prostheses fabrication methods. PMID:25427880

Fabrication of low cost soft tissue prostheses with the desktop 3D printer.

PubMed

He, Yong; Xue, Guang-huai; Fu, Jian-zhong

2014-11-27

Soft tissue prostheses such as artificial ear, eye and nose are widely used in the maxillofacial rehabilitation. In this report we demonstrate how to fabricate soft prostheses mold with a low cost desktop 3D printer. The fabrication method used is referred to as Scanning Printing Polishing Casting (SPPC). Firstly the anatomy is scanned with a 3D scanner, then a tissue casting mold is designed on computer and printed with a desktop 3D printer. Subsequently, a chemical polishing method is used to polish the casting mold by removing the staircase effect and acquiring a smooth surface. Finally, the last step is to cast medical grade silicone into the mold. After the silicone is cured, the fine soft prostheses can be removed from the mold. Utilizing the SPPC method, soft prostheses with smooth surface and complicated structure can be fabricated at a low cost. Accordingly, the total cost of fabricating ear prosthesis is about $30, which is much lower than the current soft prostheses fabrication methods.

Low void content autoclave molded titanium alloy and polyimide graphite composite structures.

NASA Technical Reports Server (NTRS)

Vaughan, R. W.; Jones, R. J.; Creedon, J. F.

1972-01-01

This paper discusses a resin developed for use in autoclave molding of polyimide graphite composite stiffened, titanium alloy structures. Both primary and secondary bonded structures were evaluated that were produced by autoclave processing. Details of composite processing, adhesive formulary, and bonding processes are provided in this paper, together with mechanical property data for structures. These data include -65 F, room temperature, and 600 F shear strengths; strength retention after aging; and stress rupture properties at 600 F under various stress levels for up to 1000 hours duration. Typically, shear strengths in excess of 16 ksi at room temperature with over 60% strength retention at 600 F were obtained with titanium alloy substrates.

Structure determination and total synthesis of a novel antibacterial substance, AB0022A, produced by a cellular slime mold.

PubMed

Sawada, T; Aono, M; Asakawa, S; Ito, A; Awano, K

2000-09-01

A novel antibacterial substance, AB0022A, was isolated from the cellular slime mold Dictyostelium purpureum K1001. It inhibited the growth of Gram-positive bacteria, and its MICs ranged from 0.39 to 50 microg/ml. Because AB0022A was a highly substituted aromatic compound, we could not determine its structure based on only its physico-chemical and spectral data. We therefore used a dehalogenated derivative from AB0022A and deduced that its structure was 1,9-dihydroxy-3,7-dimethoxy-2-hexanoyl-4,6,8-trichlorodibenzofuran . To confirm this structure, we synthesized the compound having the deduced structure. The synthetic compound was identical to naturally occurring AB0022A.

Cell-micropatterning by micromolding in capillary technique based on UV polymerization

NASA Astrophysics Data System (ADS)

Park, Min J.; Choi, Won M.; Park, O. O.

2006-01-01

Although optical lithography or photolithography is one of the most well-established techniques for micro, nano-fabrication, its usage with proteins and cells is restricted by steps that must be carried out in harsh organic solvents. Here, we present simple methods for cell-micropatterning using poly(dimethylsiloxane) (PDMS) as a mold. Cell non-adhesive surface or nonfouling surface providing a physico-chemical barrier to cell attachment was introduced for biomaterial pattering, where cells fail to interact with the surface over desired periods of time determined by each application. Poly(ethylene glycol) (PEG) was selected as nonfouling material to inhibit protein adsorption from biological media. The fouling resistance of PEG polymer is often explained by a steric repulsion interaction, resulting from the compression of PEG chains as proteins approach the surface. We also chose fibronectin to direct cell attachment because it is an extracellular matrix protein that is involved in the adhesion and spreading of anchorage-dependent cells. In our experiment, we propose two methods by application of micromolding in capillary (MIMIC) method based on UV polymerization to obtain a surface of alternating PEG and fibronectin. First to fabricate PEG microstructure via MIMIC method, a pre-patterned PDMS mold is placed on a desired substrate, and then the relief structure in the mold forms a network of empty channels. A drop of ethylene glycol monomer solution containing initiator for UV polymerization is placed at the open ends of the network of channels, which is then polymerized by exposure to UV light at room temperature. Once PEG microstructure is fabricated, incubation of the patterned surface in a fibronectin-containing solution allows back-filling of only the bare regions with fibronectin via adsorption. In the alternative method, a substrate is first incubated in a fibronectin-containing solution, leading to the adsorption of fibronectin over the entire surface, and the fibronectin-adsorbed substrate is then micropatterned with the PEG by MIMIC based on UV polymerization. Both methods create reproducible alternating PEG and fibronectin patterns applicable to cell-surface interactions on the microscale.

Fatigue-propagation du melange polymere polystyrene/polyethylene

NASA Astrophysics Data System (ADS)

Bureau, Martin N.

The interrelations between the morphology of PS/HDPE and PS/SEBS/HDPE immiscible polymer blends and their mechanical behavior, namely in monotonic loading and in cyclic loading, were studied. As predicted by theory, high shear rates encountered during extrusion blending led to efficient minor phase emulsification in PS/HDPE blends for which the viscosity ratio approaches unity. Consequently, the emulsifying effect of an SEBS triblock copolymer employed as a compatibilizer was found to be negligible. In subsequent molding process, disintegration, shape relaxation and coarsening of the minor phase domains were responsible for the morphological evolution of the blends. In the compression molding process, morphological observations showed that the rate of minor phase coarsening followed the predictions of the Ostwald ripening theory, in agreement with the rheological analysis. In the injection molding process, minor phase coarsening was attributed to shear coalescence. The fatigue crack propagation behavior of injection-molded specimens of pure PS as well as of 95/5, 85/15 and 70/30 PS/HDPE blends and of 95/(0.5/4.5), 85/(1.5/13.5) and 70/(3/27) PS/(SEBS/HDPE) blends was then studied. The fatigue fracture surface features of specimens of pure PS as well as of PS/HDPE and PS/SEBS/HDPE blends were analyzed in detail in order to interpret their fatigue crack propagation behavior. In pure PS specimens, discontinuous growth bands, associated with the fracture of crazes in the plastic zone, formed at low fatigue crack growth rates, large dimple-like features at intermediate fatigue crack growth rates and fatigue striations at high fatigue crack growth rates. The fracture toughness of injection-molded specimens of pure PS as well as of 95/5, 85/15 and 70/30 PS/HDPE blends and of 95/(0.5/4.5) PS/(SEBS/HDPE), 85/(1.5/13.5) and 70/(3/27) PS/(SEBS/HDPE) was finally studied. The results showed that the addition of HDPE to PS led to a reduction of the fracture toughness KQ following ASTM E-399 when compared to that of pure PS. This effect was attributed to the very fine minor phase morphology of the blends obtained after extrusion blending and injection molding. (Abstract shortened by UMI.)

Engineering properties of lightweight geopolymer synthesized from coal bottom ash and rice husk ash

NASA Astrophysics Data System (ADS)

Thang, Nguyen Hoc; Hoa, Nguyen Ngoc; Quyen, Pham Vo Thi Ha; Tuyen, Nguyen Ngoc Kim; Anh, Tran Vu Thao; Kien, Pham Trung

2018-04-01

Geopolymer technology was developed by Joseph Davidovits in 1970s based on reactions among alumino-silicate resources in high alkaline conditions. Geopolymer has been recently gaining attention as an alternative binder for Ordinary Portland cement (OPC) due to its low energy and CO2 burden. The raw materials used for geopolymerization normally contain high SiO2 and Al2O3 in the chemical compositions such as meta-kaoline, rice husk ash, fly ash, bottom ash, blast furnace slag, red mud, and others. Moreover, in this paper, coal bottom ash (CBA) and rice husk ash (RHA), which are industrial and agricultural wastes, respectively, were used as raw materials with high alumino-silicate resources. Both CBA and RHA were mixed with sodium hydroxide (NaOH) solution for 20 minutes to obtain the geopolymer pastes. The pastes were filled in 5-cm cube molds according to ASTM C109/C109M 99, and then cured at room condition for hardening of the geopolymer specimens. After 24 hours, the specimens were removed out of the molds and continuously cured at room condition for 27 days. The geopolymer-based materials were then tested for engineering properties such as compressive strength (MPa), volumetric weight (kg/m3), and water absorption (kg/m3). Results indicated that the material can be considered lightweight with volumetric weight from 1192 to 1425 kg/m3; compressive strength at 28 days is in the range of 12.38 to 37.41 MPa; and water absorption is under 189.92 kg/m3.

Improvements in Fabrication of Sand/Binder Cores for Casting

NASA Technical Reports Server (NTRS)

Bakhitiyarov, Sayavur I.; Overfelt, Ruel A.; Adanur, Sabit

2005-01-01

Three improvements have been devised for the cold-box process, which is a special molding process used to make sand/binder cores for casting hollow metal parts. These improvements are: The use of fiber-reinforced composite binder materials (in contradistinction to the non-fiber-reinforced binders used heretofore), The substitution of a directed-vortex core-blowing subprocess for a prior core-blowing process that involved a movable gassing plate, and The use of filters made from filtration-grade fabrics to prevent clogging of vents. For reasons that exceed the scope of this article, most foundries have adopted the cold-box process for making cores for casting metals. However, this process is not widely known outside the metal-casting industry; therefore, a description of pertinent aspects of the cold-box process is prerequisite to a meaningful description of the aforementioned improvements. In the cold-box process as practiced heretofore, sand is first mixed with a phenolic resin (considered to be part 1 of a three-part binder) and an isocyanate resin (part 2 of the binder). Then by use of compressed air, the mixture is blown into a core box, which is a mold for forming the core. Next, an amine gas (part 3 of the binder) that acts as a catalyst for polymerization of parts 1 and 2 is blown through the core box. Alternatively, a liquid amine that vaporizes during polymerization can be incorporated into the sand/resin mixture. Once polymerization is complete, the amine gas is purged from the core box by use of compressed air. The finished core is then removed from the core box.

Investigations on injection molded, glass-fiber reinforced polyamide 6 integral foams using breathing mold technology

NASA Astrophysics Data System (ADS)

Roch, A.; Kehret, L.; Huber, T.; Henning, F.; Elsner, P.

2015-05-01

Investigations on PA6-GF50 integral foams have been carried out using different material systems: longfiber- and shortfiber-reinforced PA6 as well as unreinforced PA6 as a reference material. Both chemical and physical blowing agents were applied. Breathing mold technology (decompression of the mold) was selected for the foaming process. The integral foam design, which can be conceived as a sandwich structure, helps to save material in the neutral axis area and maintains a distance between load-bearing, unfoamed skin layers. For all test series an initial mold gap of 2.5 mm was chosen and the same amount of material was injected. In order to realize different density reductions, the mold opening stroke was varied. The experiments showed that, at a constant mass per unit area, integral polyamide 6 foams have a significantly higher bending stiffness than compact components, due to their higher area moment of inertia after foaming. At a constant surface weight the bending stiffness in these experiments could be increased by up to 600 %. Both shortfiber- and longfiber-reinforced polyamide 6 showed an increase in energy absorption during foaming.

Fabrication of hierarchical polymer surfaces with superhydrophobicity by injection molding from nature and function-oriented design

NASA Astrophysics Data System (ADS)

Weng, Can; Wang, Fei; Zhou, Mingyong; Yang, Dongjiao; Jiang, Bingyan

2018-04-01

A comparison of processes and wettability characteristics was presented for injection molded superhydrophobic polypropylene surfaces from two fabricating strategies. One is the biomimetic replication of patterns from indocalamus leaf in nature. The contact angle of water sitting on this PP surface was measured as 152 ± 2°, with comparable wetting behavior to natural indocalamus leaf surface. The other strategy is the fabrication of superhydrophobic structure by combining methods that produce structures at different length scales. Regarding both the machinability of mold inserts and function-oriented design, three micro-quadrangular arrays and one hierarchical micro-nano cylinder array were designed with the goal of superhydrophobicity. Particularly, a simple approach to the fabrication of hierarchical structures was proposed by combining the anodized plate and the punching plate. The function-oriented design targets as superhydrophobicity were all reached for the designed four structures. The measured contact angles of droplet for these structures were almost consistent with the calculated equilibrium contact angles from thermodynamic analysis. Among them, the contact angle of droplet on the surface of designed hierarchical structure reached about 163° with the sliding angle of 5°, resulting in self-cleaning characteristic. The superhydrophobicity of function-oriented designed polymer surfaces could be modified and controlled, which is exactly the limitation of replicating from natural organisms.

Development and demonstration of manufacturing processes for fabricating graphite/Larc-160 polyimide structural elements, part 4, paragraph B

NASA Technical Reports Server (NTRS)

1981-01-01

Progress in the development of processes for production of Celion/LARC-160 graphite-polyimide materials, quality control, and the fabrication of Space Shuttle composite structure components is reported. Liquid chromatographic analyses of three repeatibility batches were performed and are compared to previous Hexcel standard production and to variables study LARC-160 intermediate resins. Development of processes for chopped fiber molding are described and flexural strength, elastic modulus, and other physical and mechanical properties of the molding are presented.

Controlling Radiative Heat Transfer Across the Mold Flux Layer by the Scattering Effect of the Borosilicate Mold Flux System with Metallic Iron

NASA Astrophysics Data System (ADS)

Yoon, Dae-Woo; Cho, Jung-Wook; Kim, Seon-Hyo

2017-08-01

The present study proposes a countermeasure for regulating total heat flux through the mold flux layer by designed mold flux with additive metallic iron particles. The heat flux through the B2O3-CaO-SiO2-Na2O-CaF2-Fe system was investigated using the infrared emitter technique to evaluate total flux density across the mold flux film. Both scanning electron microscope (SEM) and X-ray diffraction analysis were employed in order to identify the morphological and compositional changes of the crystalline phase, according to increasing iron contents in the mold flux. It was confirmed that the crystalline layer of studied mold fluxes does not have a meaningful effect on the total heat flux density due to the similar structure and fraction of the crystalline phase. The extinction coefficient was measured for glassy mold fluxes using an ultraviolet/visible and a Fourier transformation-infrared ray spectrometer in the range of 0.5 to 5 μm. For analyzing the scattering behavior of iron particles on the extinction coefficient, the number density and diameter of particles were observed by an automated SEM (auto-SEM). With these data, Mie scattering theory is adopted to define the scattering behavior of dispersed iron droplets in glassy matrix. It was found that the theoretical scattering coefficient demonstrated about 1623 to 3295 m-1, which is in accordance with the experimental results. In doing so, this study successfully achieves the strong scattering behavior that would contribute greatly to the optimization of overall heat flux through the mold flux film during the casting process.

Physarum can compute shortest paths.

PubMed

Bonifaci, Vincenzo; Mehlhorn, Kurt; Varma, Girish

2012-09-21

Physarum polycephalum is a slime mold that is apparently able to solve shortest path problems. A mathematical model has been proposed by Tero et al. (Journal of Theoretical Biology, 244, 2007, pp. 553-564) to describe the feedback mechanism used by the slime mold to adapt its tubular channels while foraging two food sources s(0) and s(1). We prove that, under this model, the mass of the mold will eventually converge to the shortest s(0)-s(1) path of the network that the mold lies on, independently of the structure of the network or of the initial mass distribution. This matches the experimental observations by Tero et al. and can be seen as an example of a "natural algorithm", that is, an algorithm developed by evolution over millions of years. Copyright © 2012 Elsevier Ltd. All rights reserved.

Fabrication Process for Large Size Mold and Alignment Method for Nanoimprint System

NASA Astrophysics Data System (ADS)

Ishibashi, Kentaro; Kokubo, Mitsunori; Goto, Hiroshi; Mizuno, Jun; Shoji, Shuichi

Nanoimprint technology is considered one of the mass production methods of the display for cellular phone or notebook computer, with Anti-Reflection Structures (ARS) pattern and so on. In this case, the large size mold with nanometer order pattern is very important. Then, we describe the fabrication process for large size mold, and the alignment method for UV nanoimprint system. We developed the original mold fabrication process using nanoimprint method and etching techniques. In 66 × 45 mm2 area, 200nm period seamless patterns were formed using this process. And, we constructed original alignment system that consists of the CCD-camera system, X-Y-θ table, method of moiré fringe, and image processing system, because the accuracy of pattern connection depends on the alignment method. This alignment system accuracy was within 20nm.

Moisture damage and asthma: a birth cohort study.

PubMed

Karvonen, Anne M; Hyvärinen, Anne; Korppi, Matti; Haverinen-Shaughnessy, Ulla; Renz, Harald; Pfefferle, Petra I; Remes, Sami; Genuneit, Jon; Pekkanen, Juha

2015-03-01

Excess moisture and visible mold are associated with increased risk of asthma. Only a few studies have performed detailed home visits to characterize the extent and location of moisture damage and mold growth. Structured home inspections were performed in a birth cohort study when the children were 5 months old (on average). Children (N = 398) were followed up to the age of 6 years. Specific immunoglobulin E concentrations were determined at 6 years. Moisture damage and mold at an early age in the child's main living areas (but not in bathrooms or other interior spaces) were associated with the risk of developing physician-diagnosed asthma ever, persistent asthma, and respiratory symptoms during the first 6 years. Associations with asthma ever were strongest for moisture damage with visible mold in the child's bedroom (adjusted odds ratio: 4.82 [95% confidence interval: 1.29-18.02]) and in the living room (adjusted odds ratio: 7.51 [95% confidence interval: 1.49-37.83]). Associations with asthma ever were stronger in the earlier part of the follow-up and among atopic children. No consistent associations were found between moisture damage with or without visible mold and atopic sensitization. Moisture damage and mold in early infancy in the child's main living areas were associated with asthma development. Atopic children may be more susceptible to the effects of moisture damage and mold. Copyright © 2015 by the American Academy of Pediatrics.

The Effect of Nasoalveolar Molding on Nasal Airway Anatomy: A 9-Year Follow-up of Patients With Unilateral Cleft Lip and Palate.

PubMed

Massie, Jonathan P; Bruckman, Karl; Rifkin, William J; Runyan, Christopher M; Shetye, Pradip R; Grayson, Barry; Flores, Roberto L

2018-04-01

To determine the effects of nasoalveolar molding (NAM) on nasal airway architecture. Retrospective case-control study of patients with unilateral cleft lip treated with NAM vs without NAM. Tertiary referral center specializing in cleft and craniofacial care. Patients, Participants, and Interventions: Thirty-six patients with complete unilateral cleft lip and alveolus: 19 with NAM therapy and 17 without NAM therapy. Cone beam computed tomography (CBCT) scans were compared in multiple coronal sections and were evaluated for linear and angular septal deviation, inferior turbinate hypertrophy, and linear and 2-dimensional airway area. There were no significant differences in linear or angular septal deviation, inferior turbinate area, linear stenosis, or airway area between NAM- and non-NAM-treated patients. NAM effectively molds the external nasal cartilage and structures but may have limited effects on internal nasal structures.

Development of a low-cost, modified resin transfer molding process using elastomeric tooling and automated preform fabrication

NASA Technical Reports Server (NTRS)

Doane, William J.; Hall, Ronald G.

1992-01-01

This paper describes the design and process development of low-cost structural parts made by a modified resin transfer molding process. Innovative application of elastomeric tooling to increase laminate fiber volume and automated forming of fiber preforms are discussed, as applied to fabrication of a representative section of a cruise missile fuselage.

The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

PubMed Central

Hori, H; Osawa, S; Iwabuchi, M

1980-01-01

The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%). Images PMID:7465421

Refractory materials from lunar resources

NASA Technical Reports Server (NTRS)

Fabes, B. D.; Poisl, W. H.

1991-01-01

Refractories - materials which are able to withstand extremely high temperatures - are sure to be an important part of any processing facility or human outpost which is built on Mars. Containers for processing lunar oxygen will need high temperature components. Fabrication of structural material from lunar resources need both containment vessels to hold high temperature melts and molds in which to form the final shapes. Certainly, it would be desirable to fabricate such vessels and molds on the Moon, rather than carrying them up from the Earth. At first glance, this might appear to be a trivial task, since the Moon's surface consists of a variety of refractory compositions. To turn the regolith into a useful fire brick or mold, however, will require water or other binders and additives which are likely to be in extremely short supply on the Moon. The steps needed to make fire bricks and molds for lunar-derived structural materials are examined, pointing out the critical steps and resources which will be needed. While these processes and applications may seem somewhat mundane, it is emphasized that it is precisely these rudimentary processes which must be mastered before discussing making aerobrakes, and other fancier refractories from lunar resources.

Induction Consolidation of Thermoplastic Composites Using Smart Susceptors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Matsen, Marc R

2012-06-14

This project has focused on the area of energy efficient consolidation and molding of fiber reinforced thermoplastic composite components as an energy efficient alternative to the conventional processing methods such as autoclave processing. The expanding application of composite materials in wind energy, automotive, and aerospace provides an attractive energy efficiency target for process development. The intent is to have this efficient processing along with the recyclable thermoplastic materials ready for large scale application before these high production volume levels are reached. Therefore, the process can be implemented in a timely manner to realize the maximum economic, energy, and environmental efficiencies.more » Under this project an increased understanding of the use of induction heating with smart susceptors applied to consolidation of thermoplastic has been achieved. This was done by the establishment of processing equipment and tooling and the subsequent demonstration of this fabrication technology by consolidating/molding of entry level components for each of the participating industrial segments, wind energy, aerospace, and automotive. This understanding adds to the nation's capability to affordably manufacture high quality lightweight high performance components from advanced recyclable composite materials in a lean and energy efficient manner. The use of induction heating with smart susceptors is a precisely controlled low energy method for the consolidation and molding of thermoplastic composites. The smart susceptor provides intrinsic thermal control based on the interaction with the magnetic field from the induction coil thereby producing highly repeatable processing. The low energy usage is enabled by the fact that only the smart susceptor surface of the tool is heated, not the entire tool. Therefore much less mass is heated resulting in significantly less required energy to consolidate/mold the desired composite components. This energy efficiency results in potential energy savings of {approx}75% as compared to autoclave processing in aerospace, {approx}63% as compared to compression molding in automotive, and {approx}42% energy savings as compared to convectively heated tools in wind energy. The ability to make parts in a rapid and controlled manner provides significant economic advantages for each of the industrial segments. These attributes were demonstrated during the processing of the demonstration components on this project.« less

Thermal aging of melt-spun NdFeB magnetic powder in hydrogen

NASA Astrophysics Data System (ADS)

Pinkerton, Frederick E.; Balogh, Michael P.; Ellison, Nicole; Foto, Aldo; Sechan, Martin; Tessema, Misle M.; Thompson, Margarita P.

2016-11-01

High energy product neodymium-iron-boron (NdFeB) magnets are the premier candidate for demanding electrified vehicle traction motor applications. Injection molded (IM) or compression molded (CM) magnets made using NdFeB powders are promising routes to improve motor efficiency, cost, and manufacturability. However, IM and CM NdFeB magnets are susceptible to substantial thermal aging losses at motor operating temperatures when exposed to the automatic transmission fluid (ATF) used as a lubricant and cooling medium. The intrinsic coercivity Hci of NdFeB IM and CM magnets degrades by as much as 18% when aged for 1000 h in ATF at 150 °C, compared to a 3% loss when aged in air. Here we report aging studies of rapidly quenched NdFeB powder in air, ATF, and H2 gas. Expansion of the NdFeB crystal lattice in both ATF and H2 identified hydrogen dissociated from the ATF during aging and diffused into the primary NdFeB phase as the probable cause of the coercivity loss of IM and CM magnets.

Correlation between failure and local material property in chopped carbon fiber chip-reinforced sheet molding compound composites under tensile load

DOE PAGES

Tang, Haibin; Chen, Zhangxing; Zhou, Guowei; ...

2018-02-06

To develop further understanding towards the role of a heterogeneous microstructure on tensile crack initiation and failure behavior in chopped carbon fiber chip-reinforced composites, uni-axial tensile tests are performed on coupons cut from compression molded plaque with varying directions. Our experimental results indicate that failure initiation is relevant to the strain localization, and a new criterion with the nominal modulus to predict the failure location is proposed based on the strain analysis. Furthermore, optical microscopic images show that the nominal modulus is determined by the chip orientation distribution. At the area with low nominal modulus, it is found that chipsmore » are mostly aligning along directions transverse to loading direction and/or less concentrated, while at the area with high nominal modulus, more chips are aligning to tensile direction. On the basis of failure mechanism analysis, it is concluded that transversely-oriented chips or resin-rich regions are easier for damage initiation, while longitudinally-oriented chips postpone the fracture. Good agreement is found among failure mechanism, strain localization and chip orientation distribution.« less

Correlation between failure and local material property in chopped carbon fiber chip-reinforced sheet molding compound composites under tensile load

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tang, Haibin; Chen, Zhangxing; Zhou, Guowei

To develop further understanding towards the role of a heterogeneous microstructure on tensile crack initiation and failure behavior in chopped carbon fiber chip-reinforced composites, uni-axial tensile tests are performed on coupons cut from compression molded plaque with varying directions. Our experimental results indicate that failure initiation is relevant to the strain localization, and a new criterion with the nominal modulus to predict the failure location is proposed based on the strain analysis. Furthermore, optical microscopic images show that the nominal modulus is determined by the chip orientation distribution. At the area with low nominal modulus, it is found that chipsmore » are mostly aligning along directions transverse to loading direction and/or less concentrated, while at the area with high nominal modulus, more chips are aligning to tensile direction. On the basis of failure mechanism analysis, it is concluded that transversely-oriented chips or resin-rich regions are easier for damage initiation, while longitudinally-oriented chips postpone the fracture. Good agreement is found among failure mechanism, strain localization and chip orientation distribution.« less

INTEGRATION OF COST MODELS AND PROCESS SIMULATION TOOLS FOR OPTIMUM COMPOSITE MANUFACTURING PROCESS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pack, Seongchan; Wilson, Daniel; Aitharaju, Venkat

Manufacturing cost of resin transfer molded composite parts is significantly influenced by the cycle time, which is strongly related to the time for both filling and curing of the resin in the mold. The time for filling can be optimized by various injection strategies, and by suitably reducing the length of the resin flow distance during the injection. The curing time can be reduced by the usage of faster curing resins, but it requires a high pressure injection equipment, which is capital intensive. Predictive manufacturing simulation tools that are being developed recently for composite materials are able to provide variousmore » scenarios of processing conditions virtually well in advance of manufacturing the parts. In the present study, we integrate the cost models with process simulation tools to study the influence of various parameters such as injection strategies, injection pressure, compression control to minimize high pressure injection, resin curing rate, and demold time on the manufacturing cost as affected by the annual part volume. A representative automotive component was selected for the study and the results are presented in this paper« less

Nanocomposites Derived From a Low-Color Aromatic Polyimide (CP2) and Amine-Functionalized Vapor-Grown Carbon Nanofibers: In Situ Polymerization and Characterization (Preprint)

DTIC Science & Technology

2007-01-01

small metal catalyst (e.g., ferrocene, Fe (CO)5, etc.). They have an outer diameter of 60-200 nm, a hollow core of 30-90 nm, and length on the order...diffractions (WAXS) of compression-molded samples were recorded with a Rigaku RU-200 diffractometer using Ni-filtered Cu KR radiation (40 kV, 100 mA, λ...attributable to the sp3 C-H and sp2 C-H defects as methane is used as the major component in the feedstock for its production . Based on hydrogen

Polymeric compositions and their method of manufacture. [forming filled polymer systems using cryogenics

NASA Technical Reports Server (NTRS)

Moser, B. G.; Landel, R. F. (Inventor)

1972-01-01

Filled polymer compositions are made by dissolving the polymer binder in a suitable sublimable solvent, mixing the filler material with the polymer and its solvent, freezing the resultant mixture, and subliming the frozen solvent from the mixture from which it is then removed. The remaining composition is suitable for conventional processing such as compression molding or extruding. A particular feature of the method of manufacture is pouring the mixed solution slowly in a continuous stream into a cryogenic bath wherein frozen particles of the mixture result. The frozen individual particles are then subjected to the sublimation.

3D printing of polypropylene using the fused filament fabrication technique

NASA Astrophysics Data System (ADS)

Silva, A. F.; Carneiro, O. S.; Gomes, R.

2017-10-01

This work addresses the potential of polypropylene, neat (PP) and reinforced with short glass fibers (GRPP), as a candidate for the Fused Filament Fabrication (FFF)-based 3D printing technique. The entire production chain was evaluated, i.e., starting with PP and GRPP pellets, filaments were produced by extrusion and test samples were printed in different process conditions (different layers' thicknesses, deposition orientation and infill) with the in-house produced filaments. This strategy enabled a true comparison between parts printed (FFF) with parts manufactured by compression molding (CM), using exactly the same grade of raw material.

[Oral disintegrating tablets. A new, modern, solid dosage form].

PubMed

Popa, Graţiela; Gafiţanu, Eliza

2003-01-01

The pharmaceutical market shows lately an increasing interest in orally disintegrating tablets, due to their good acceptability among certain age categories (ex. elderly, children), and other patients with difficulties in swallowing classic solid dosage forms. Some of the methods of preparing such tablets have gained industrial applicability: molding, lyophilization, direct compression with highly soluble excipients, super disintegrants and/or effervescent systems. Some of the patients have had a good impact on the pharmaceutical market and more improvements are expected in the next few years, with new drugs to be formulated as fast dissolving dosage formulations.

Methods for freeform fabrication of structures

DOEpatents

Kaufman, Stephen G.; Spletzer, Barry L.

2000-01-01

Rapid prototyping methods and apparatuses that produce structures made of continuous-fiber polymer-matrix composites without the use of molds. Instead of using molds, the composite structure is fabricated patch by patch in layers or wraps, using a two- or three-axis stage connected to a rapidly-reconfigurable forming surface, and a robot arm to position the evolving composite structure, which are both programmable devices. Because programmable devices are included, i.e., a robot and a two- or three-axis stage connected to the reconfigurable forming surface, the control program needed to produce a desired shape can be easily modified to automatically generate the desired shape from an electronic model (e.g., using a CAD/CAM system) of the desired (predetermined) shape.

Analytical modeling and sensor monitoring for optimal processing of advanced textile structural composites by resin transfer molding

NASA Technical Reports Server (NTRS)

Loos, Alfred C.; Macrae, John D.; Hammond, Vincent H.; Kranbuehl, David E.; Hart, Sean M.; Hasko, Gregory H.; Markus, Alan M.

1993-01-01

A two-dimensional model of the resin transfer molding (RTM) process was developed which can be used to simulate the infiltration of resin into an anisotropic fibrous preform. Frequency dependent electromagnetic sensing (FDEMS) has been developed for in situ monitoring of the RTM process. Flow visualization tests were performed to obtain data which can be used to verify the sensor measurements and the model predictions. Results of the tests showed that FDEMS can accurately detect the position of the resin flow-front during mold filling, and that the model predicted flow-front patterns agreed well with the measured flow-front patterns.

Apparatus And Method For Producing Single Crystal Metallic Objects

DOEpatents

Huang, Shyh-Chin; Gigliotti, Jr., Michael Francis X.; Rutkowski, Stephen Francis; Petterson, Roger John; Svec, Paul Steven

2006-03-14

A mold is provided for enabling casting of single crystal metallic articles including a part-defining cavity, a sorter passage positioned vertically beneath and in fluid communication with the part-defining cavity, and a seed cavity positioned vertically beneath and in fluid communication with the sorter passage. The sorter passage includes a shape suitable for encouraging a single crystal structure in solidifying molten metal. Additionally, a portion of the mold between the sorter passage and the part-defining cavity includes a notch for facilitating breakage of a cast article proximate the notch during thermal stress build-up, so as to prevent mold breakage or the inclusion of part defects.

Implementation of New Process Models for Tailored Polymer Composite Structures into Processing Software Packages

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nguyen, Ba Nghiep; Jin, Xiaoshi; Wang, Jin

2010-02-23

This report describes the work conducted under the Cooperative Research and Development Agreement (CRADA) (Nr. 260) between the Pacific Northwest National Laboratory (PNNL) and Autodesk, Inc. to develop and implement process models for injection-molded long-fiber thermoplastics (LFTs) in processing software packages. The structure of this report is organized as follows. After the Introduction Section (Section 1), Section 2 summarizes the current fiber orientation models developed for injection-molded short-fiber thermoplastics (SFTs). Section 3 provides an assessment of these models to determine their capabilities and limitations, and the developments needed for injection-molded LFTs. Section 4 then focuses on the development of amore » new fiber orientation model for LFTs. This model is termed the anisotropic rotary diffusion - reduced strain closure (ARD-RSC) model as it explores the concept of anisotropic rotary diffusion to capture the fiber-fiber interaction in long-fiber suspensions and uses the reduced strain closure method of Wang et al. to slow down the orientation kinetics in concentrated suspensions. In contrast to fiber orientation modeling, before this project, no standard model was developed to predict the fiber length distribution in molded fiber composites. Section 5 is therefore devoted to the development of a fiber length attrition model in the mold. Sections 6 and 7 address the implementations of the models in AMI, and the conclusions drawn from this work is presented in Section 8.« less

Effect of Flow Rate Controller on Liquid Steel Flow in Continuous Casting Mold using Numerical Modeling

NASA Astrophysics Data System (ADS)

Gursoy, Kadir Ali; Yavuz, Mehmet Metin

2014-11-01

In continuous casting operation of steel, the flow through tundish to the mold can be controlled by different flow rate control systems including stopper rod and slide-gate. Ladle changes in continuous casting machines result in liquid steel level changes in tundishes. During this transient event of production, the flow rate controller opening is increased to reduce the pressure drop across the opening which helps to keep the mass flow rate at the desired level for the reduced liquid steel level in tundish. In the present study, computational fluid dynamic (CFD) models are developed to investigate the effect of flow rate controller on mold flow structure, and particularly to understand the effect of flow controller opening on meniscus flow. First, a detailed validation of the CFD models is conducted using available experimental data and the performances of different turbulence models are compared. Then, the constant throughput casting operations for different flow rate controller openings are simulated to quantify the opening effect on meniscus region. The results indicate that the meniscus velocities are significantly affected by the flow rate controller and its opening level. The steady state operations, specified as constant throughput casting, do not provide the same mold flow if the controller opening is altered. Thus, for quality and castability purposes, adjusting the flow controller opening to obtain the fixed mold flow structure is proposed. Supported by Middle East Technical University (METU) BAP (Scientific Research Projects) Coordination.

Micro-structure and Air-tightness of Squeeze Casting Motor housing for New Energy Vehicle

NASA Astrophysics Data System (ADS)

Jiang, Y. F.; Kang, Z. Q.; Jiang, W. F.; Wang, K. W.; Sha, D. L.; Li, M. L.; Sun, J.

2018-05-01

In order to improve the performance of automobile parts, the influence of squeeze casting process parameters on casting defects, material structure and air-tightness of aluminum alloy motor housing for new energy vehicle was studied. The results show that the density of the castings increases with the increase in pressure and mold temperature. With increase in pouring temperature, it increases first and then decreases. Pressure has the greatest influence on the density of the castings. Under a certain pressure, with moderate increase in casting temperature and mold temperature, the grain growth begins to increase; the dendrites become less, the new α - Al grains are spherical and granular, the micro-structure is uniform. Also, with increase in pressure, this effect is more pronounced, the air-tightness of castings improve. In conclusion, when the pressure is 110MPa, pouring temperature is 680° C, mold temperature is 280° C, pressure holding for 30s, and punch speed of 0.1m/s, there is no clear shrinkage in the casting, the structure is uniform, the qualified rate of air-tightness of production reaches 86%, and the performance is excellent.

Polyimide Composites from 'Salt-Like' Solution Precursors

NASA Technical Reports Server (NTRS)

Cano, Roberto J.; Hou, Tan H.; Weiser, Erik S.; SaintClair, Terry L.

2001-01-01

Four NASA Langley-developed polyimide matrix resins, LaRC(TM)-IA, LaRC(TM)-IAX, LaRC(TM)-8515 and LaRC(TM)-PETI-5, were produced via a 'saltlike' process developed by Unitika Ltd. The salt-like solutions (65% solids in NMP) were prepregged onto Hexcel IM7 carbon fiber using the NASA LaRC multipurpose tape machine. Process parameters were determined and composite panels fabricated. The temperature dependent volatile depletion rates, the thermal crystallization behavior and the resin rheology were characterized. Composite molding cycles were developed which consistently yielded well consolidated, void-free laminated parts. Composite mechanical properties such as the short beam shear strength; the longitudinal and transverse flexural strength and flexural modulus; the longitudinal compression strength and modulus; and the open hole compression strength and compression after impact strength were measured at room temperature and elevated temperatures. The processing characteristics and the composite mechanical properties of the four intermediate modulus carbon fiber/polyimide matrix composites were compared to existing data on the same polyimide resin systems and IM7 carbon fiber manufactured via poly(amide acid) solutions (30-35% solids in NMP). This work studies the effects of varying the synthetic route on the processing and mechanical properties of the polyimide composites.

Reuse of waste iron as a partial replacement of sand in concrete.

PubMed

Ismail, Zainab Z; Al-Hashmi, Enas A

2008-11-01

One of the major environmental issues in Iraq is the large quantity of waste iron resulting from the industrial sector which is deposited in domestic waste and in landfills. A series of 109 experiments and 586 tests were carried out in this study to examine the feasibility of reusing this waste iron in concrete. Overall, 130 kg of waste iron were reused to partially replace sand at 10%, 15%, and 20% in a total of 1703 kg concrete mixtures. The tests performed to evaluate waste-iron concrete quality included slump, fresh density, dry density, compressive strength, and flexural strength tests: 115 cubes of concrete were molded for the compressive strength and dry density tests, and 87 prisms were cast for the flexural strength tests. This work applied 3, 7, 14, and 28 days curing ages for the concrete mixes. The results confirm that reuse of solid waste material offers an approach to solving the pollution problems that arise from an accumulation of waste in a production site; in the meantime modified properties are added to the concrete. The results show that the concrete mixes made with waste iron had higher compressive strengths and flexural strengths than the plain concrete mixes.

Evidence that Arrhenius high-temperature aging behavior for an EPDM o-ring does not extrapolate to lower temperatures

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gillen, K.T.; Wise, J.; Celina, M.

1997-09-01

Because of the need to significantly extend the lifetimes of weapons, and because of potential implications of environmental O-ring failure on degradation of critical internal weapon components, the authors have been working on improved methods of predicting and verifying O-ring lifetimes. In this report, they highlight the successful testing of a new predictive method for deriving more confident lifetime extrapolations. This method involves ultrasensitive oxygen consumption measurements. The material studied is an EPDM formulation use for the environmental O-ring the W88. Conventional oven aging (155 C to 111 C) was done on compression molded sheet material; periodically, samples were removedmore » from the ovens and subjected to various measurements, including ultimate tensile elongation, density and modulus profiles. Compression stress relaxation (CSR) measurements were made at 125 C and 111 C on disc shaped samples (12.7 mm diameter by 6 mm thick) using a Shawbury Wallace Compression Stress Relaxometer MK 2. Oxygen consumption measurements were made versus time, at temperatures ranging from 160 C to 52 C, using chromatographic quantification of the change in oxygen content caused by reaction with the EPDM material in sealed containers.« less

3D patterned stem cell differentiation using thermo-responsive methylcellulose hydrogel molds.

PubMed

Lee, Wonjae; Park, Jon

2016-07-06

Tissue-specific patterned stem cell differentiation serves as the basis for the development, remodeling, and regeneration of the multicellular structure of the native tissues. We herein proposed a cytocompatible 3D casting process to recapitulate this patterned stem cell differentiation for reconstructing multicellular tissues in vitro. We first reconstituted the 2D culture conditions for stem cell fate control within 3D hydrogel by incorporating the sets of the diffusible signal molecules delivered through drug-releasing microparticles. Then, utilizing thermo-responsivity of methylcellulose (MC), we developed a cytocompatible casting process to mold these hydrogels into specific 3D configurations, generating the targeted spatial gradients of diffusible signal molecules. The liquid phase of the MC solution was viscous enough to adopt the shapes of 3D impression patterns, while the gelated MC served as a reliable mold for patterning the hydrogel prepolymers. When these patterned hydrogels were integrated together, the stem cells in each hydrogel distinctly differentiated toward individually defined fates, resulting in the formation of the multicellular tissue structure bearing the very structural integrity and characteristics as seen in vascularized bones and osteochondral tissues.

3D patterned stem cell differentiation using thermo-responsive methylcellulose hydrogel molds

NASA Astrophysics Data System (ADS)

Lee, Wonjae; Park, Jon

2016-07-01

Tissue-specific patterned stem cell differentiation serves as the basis for the development, remodeling, and regeneration of the multicellular structure of the native tissues. We herein proposed a cytocompatible 3D casting process to recapitulate this patterned stem cell differentiation for reconstructing multicellular tissues in vitro. We first reconstituted the 2D culture conditions for stem cell fate control within 3D hydrogel by incorporating the sets of the diffusible signal molecules delivered through drug-releasing microparticles. Then, utilizing thermo-responsivity of methylcellulose (MC), we developed a cytocompatible casting process to mold these hydrogels into specific 3D configurations, generating the targeted spatial gradients of diffusible signal molecules. The liquid phase of the MC solution was viscous enough to adopt the shapes of 3D impression patterns, while the gelated MC served as a reliable mold for patterning the hydrogel prepolymers. When these patterned hydrogels were integrated together, the stem cells in each hydrogel distinctly differentiated toward individually defined fates, resulting in the formation of the multicellular tissue structure bearing the very structural integrity and characteristics as seen in vascularized bones and osteochondral tissues.

3D patterned stem cell differentiation using thermo-responsive methylcellulose hydrogel molds

PubMed Central

Lee, Wonjae; Park, Jon

2016-01-01

Tissue-specific patterned stem cell differentiation serves as the basis for the development, remodeling, and regeneration of the multicellular structure of the native tissues. We herein proposed a cytocompatible 3D casting process to recapitulate this patterned stem cell differentiation for reconstructing multicellular tissues in vitro. We first reconstituted the 2D culture conditions for stem cell fate control within 3D hydrogel by incorporating the sets of the diffusible signal molecules delivered through drug-releasing microparticles. Then, utilizing thermo-responsivity of methylcellulose (MC), we developed a cytocompatible casting process to mold these hydrogels into specific 3D configurations, generating the targeted spatial gradients of diffusible signal molecules. The liquid phase of the MC solution was viscous enough to adopt the shapes of 3D impression patterns, while the gelated MC served as a reliable mold for patterning the hydrogel prepolymers. When these patterned hydrogels were integrated together, the stem cells in each hydrogel distinctly differentiated toward individually defined fates, resulting in the formation of the multicellular tissue structure bearing the very structural integrity and characteristics as seen in vascularized bones and osteochondral tissues. PMID:27381562

Status of Initial Assessment of Physical and Mechanical Properties of Graphite Grades for NGNP Appkications

DOE Office of Scientific and Technical Information (OSTI.GOV)

Strizak, Joe P; Burchell, Timothy D; Windes, Will

2011-12-01

Current candidate graphite grades for the core structures of NGNP include grades NBG-17, NBG-18, PCEA and IG-430. Both NBG-17 and NBG-18 are manufactured using pitch coke, and are vibrationally molded. These medium grain products are produced by SGL Carbon SAS (France). Tayo Tanso (Japan) produces IG-430 which is a petroleum coke, isostatically molded, nuclear grade graphite. And PCEA is a medium grain, extruded graphite produced by UCAR Carbon Co. (USA) from petroleum coke. An experimental program has been initiated to develop physical and mechanical properties data for these current candidate graphites. The results will be judged against the requirements formore » nuclear grade graphites set forth in ASTM standard D 7219-05 "Standard Specification for Isotropic and Near-isotropic Nuclear Graphites". Physical properties data including thermal conductivity and coefficient of thermal expansion, and mechanical properties data including tensile, compressive and flexural strengths will be obtained using the established test methods covered in D-7219 and ASTM C 781-02 "Standard Practice for Testing Graphite and Boronated Graphite Components for High-Temperature Gas-Cooled Nuclear Reactors". Various factors known to effect the properties of graphites will be investigated. These include specimen size, spatial location within a graphite billet, specimen orientation (ag and wg) within a billet, and billet-to-billet variations. The current status of the materials characterization program is reported herein. To date billets of the four graphite grades have been procured, and detailed cut up plans for obtaining the various specimens have been prepared. Particular attention has been given to the traceability of each specimen to its spatial location and orientation within a billet.« less

Porogen-based solid freeform fabrication of polycaprolactone-calcium phosphate scaffolds for tissue engineering.

PubMed

Mondrinos, Mark J; Dembzynski, Robert; Lu, Lin; Byrapogu, Venkata K C; Wootton, David M; Lelkes, Peter I; Zhou, Jack

2006-09-01

Drop on demand printing (DDP) is a solid freeform fabrication (SFF) technique capable of generating microscale physical features required for tissue engineering scaffolds. Here, we report results toward the development of a reproducible manufacturing process for tissue engineering scaffolds based on injectable porogens fabricated by DDP. Thermoplastic porogens were designed using Pro/Engineer and fabricated with a commercially available DDP machine. Scaffolds composed of either pure polycaprolactone (PCL) or homogeneous composites of PCL and calcium phosphate (CaP, 10% or 20% w/w) were subsequently fabricated by injection molding of molten polymer-ceramic composites, followed by porogen dissolution with ethanol. Scaffold pore sizes, as small as 200 microm, were attainable using the indirect (porogen-based) method. Scaffold structure and porosity were analyzed by scanning electron microscopy (SEM) and microcomputed tomography, respectively. We characterized the compressive strength of 90:10 and 80:20 PCL-CaP composite materials (19.5+/-1.4 and 24.8+/-1.3 Mpa, respectively) according to ASTM standards, as well as pure PCL scaffolds (2.77+/-0.26 MPa) fabricated using our process. Human embryonic palatal mesenchymal (HEPM) cells attached and proliferated on all scaffolds, as evidenced by fluorescent nuclear staining with Hoechst 33258 and the Alamar Blue assay, with increased proliferation observed on 80:20 PCL-CaP scaffolds. SEM revealed multilayer assembly of HEPM cells on 80:20 PCL-CaP composite, but not pure PCL, scaffolds. In summary, we have developed an SFF-based injection molding process for the fabrication of PCL and PCL-CaP scaffolds that display in vitro cytocompatibility and suitable mechanical properties for hard tissue repair.

Mold with improved core for metal casting operation

DOEpatents

Gritzner, Verne B.; Hackett, Donald W.

1977-01-01

The present invention is directed to a mold containing an improved core for use in casting hollow, metallic articles. The core is formed of, or covered with, a layer of cellular material which possesses sufficient strength to maintain its structural integrity during casting, but will crush to alleviate the internal stresses that build up if the normal contraction during solidification and cooling is restricted.

Ultrasonically-assisted Polymer Molding: An Evaluation

NASA Astrophysics Data System (ADS)

Moles, Matthew; Roy, Anish; Silberschmidt, Vadim

Energy reduction in extrusion and injection molding processes can be achieved by the introduction of ultrasonic energy. Polymer flow can be enhanced on application of ultrasonic vibration, which can reduce the thermal and pressure input requirements to produce the same molding; higher productivity may also be achieved. In this paper, a design of an ultrasound-assisted injection mold machine is explored. An extrusion-die design was augmented with a commercial 1.5 kW ultrasonic transducer and sonotrode designed to resonate close to 20 kHz with up to 100 μm vibration amplitude. The design was evaluated with modal and thermal analysis using finite-element analysis software. The use of numerical techniques, including computational fluid dynamics, fluid-structure interaction and coupled Lagrangian-Eulerian method, to predict the effect of ultrasound on polymer flow was considered. A sonotrode design utilizing ceramic to enhance thermal isolation was also explored.

In-situ Crystallization of Highly Volatile Commercial Mold Flux Using an Isolated Observation System in the Confocal Laser Scanning Microscope

NASA Astrophysics Data System (ADS)

Park, Jun-Yong; Ryu, Jae Wook; Sohn, Il

2014-08-01

The in situ crystallization behavior of highly volatile commercial mold fluxes for medium carbon steels was investigated using the confocal laser scanning microscope (CLSM) equipped with an optimized isolated observation system. The highly volatile compounds of the mold flux were suppressed during heating allowing direct observation in the CLSM. Cooling rates of 25, 50, 100, 400, and 800 K/min were incorporated and continuous cooling transformation (CCT) diagrams of 4 different commercial mold fluxes for medium carbon steels were developed. Identification of the crystalline phase was conducted with XRD and SEM-EDS analysis. A cuspidine crystalline was observed in all samples at various cooling rates. With higher basicity, CaF2, and NaF, the crystallization of the fluxes was enhanced according to the CCT diagram. As the slag structure becomes depolymerized, the diffusion rate of the cathodic ions seems to increase.

Porous carbonaceous electrode structure and method for secondary electrochemical cell

DOEpatents

Kaun, Thomas D.

1977-03-08

Positive and negative electrodes are provided as rigid, porous carbonaceous matrices with particulate active material fixedly embedded. Active material such as metal chalcogenides, solid alloys of alkali metal or alkaline earth metals along with other metals and their oxides in particulate form are blended with a thermosetting resin and a solid volatile to form a paste mixture. Various electrically conductive powders or current collector structures can be blended or embedded into the paste mixture which can be molded to the desired electrode shape. The molded paste is heated to a temperature at which the volatile transforms into vapor to impart porosity as the resin begins to cure into a rigid solid structure.

Three-Dimensional-Moldable Nanofiber-Reinforced Transparent Composites with a Hierarchically Self-Assembled "Reverse" Nacre-like Architecture.

PubMed

Biswas, Subir K; Sano, Hironari; Shams, Md Iftekhar; Yano, Hiroyuki

2017-09-06

Achieving a structural hierarchy and a uniform nanofiller dispersion simultaneously remains highly challenging for obtaining a robust polymer nanocomposite of immiscible components. In this study, a remarkably facile Pickering emulsification approach is developed to fabricate hierarchical composites of immiscible acrylic polymer and native cellulose nanofibers by taking advantage of the dual role of the nanofibers as both emulsion stabilizer and polymer reinforcement. The composites feature a unique "reverse" nacre-like microstructure reinforced with a well-dispersed two-tier hierarchical nanofiber network, leading to a synergistic high strength, modulus, and toughness (20, 50, and 53 times that of neat polymer, respectively), high optical transparency (89%), high flexibility, and a drastically low thermal expansion (13 ppm K -1 , 1/15th of the neat polymer). The nanocomposites have a three-dimensional-shape moldability, also their surface can be patterned with micro/nanoscale features with high fidelity by in situ compression molding, making them attractive as the substrate for flexible displays, smart contact lens devices, and photovoltaics. The Pickering emulsification approach should be broadly applicable for the fabrication of novel functional materials of various immiscible components.

Fabrication of complex nanoscale structures on various substrates

NASA Astrophysics Data System (ADS)

Han, Kang-Soo; Hong, Sung-Hoon; Lee, Heon

2007-09-01

Polymer based complex nanoscale structures were fabricated and transferred to various substrates using reverse nanoimprint lithography. To facilitate the fabrication and transference of the large area of the nanostructured layer to the substrates, a water-soluble polyvinyl alcohol mold was used. After generation and transference of the nanostructured layer, the polyvinyl alcohol mold was removed by dissolving in water. A residue-free, UV-curable, glue layer was formulated and used to bond the nanostructured layer onto the substrates. As a result, nanometer scale patterned polymer layers were bonded to various substrates and three-dimensional nanostructures were also fabricated by stacking of the layers.

A cryogenic thermal source for detector array characterization

NASA Astrophysics Data System (ADS)

Chuss, David T.; Rostem, Karwan; Wollack, Edward J.; Berman, Leah; Colazo, Felipe; DeGeorge, Martin; Helson, Kyle; Sagliocca, Marco

2017-10-01

We describe the design, fabrication, and validation of a cryogenically compatible quasioptical thermal source for characterization of detector arrays. The source is constructed using a graphite-loaded epoxy mixture that is molded into a tiled pyramidal structure. The mold is fabricated using a hardened steel template produced via a wire electron discharge machining process. The absorptive mixture is bonded to a copper backplate enabling thermalization of the entire structure and measurement of the source temperature. Measurements indicate that the reflectance of the source is <0.001 across a spectral band extending from 75 to 330 GHz.

Enteridinines A and B from slime mold Enteridium lycoperdon.

PubMed

Rezanka, Tomás; Dvoráková, Radmila; Hanus, Lumír O; Dembitsky, Valery M

2004-02-01

Two novel deoxysugar esters, named enteridinines A and B, were isolated from the slime mold Enteridium lycoperdon. Their structures, including the absolute configurations of the hydroxyl and methyl groups, were determined by means of extensive spectroscopic data such as UV, IR, MS, 1D and 2D NMR spectra. Enteridinines A and B have unique structures containing 1,7-dioxaspiro[5.5]undecanes with an O-beta-D-mycarosyl-(1-->4)-beta-D-olivosyl and an O-beta-L-olivomycosyl-(1-->4)-beta-D-amicetosyl-(1-->4)-beta-L-digitoxosyl unit, respectively, and showed growth inhibitory activities against Gram positive bacteria.

A Cryogenic Thermal Source for Detector Array Characterization

NASA Technical Reports Server (NTRS)

Chuss, David T.; Rostem, Karwan; Wollack, Edward J.; Berman, Leah; Colazo, Felipe; DeGeorge, Martin; Helson, Kyle; Sagliocca, Marco

2017-01-01

We describe the design, fabrication, and validation of a cryogenically compatible quasioptical thermal source for characterization of detector arrays. The source is constructed using a graphite-loaded epoxy mixture that is molded into a tiled pyramidal structure. The mold is fabricated using a hardened steel template produced via a wire electron discharge machining process. The absorptive mixture is bonded to a copper backplate enabling thermalization of the entire structure and measurement of the source temperature. Measurements indicate that the reflectance of the source is less than 0.001 across a spectral band extending from 75 to 330 gigahertz.

3D customized and flexible tactile sensor using a piezoelectric nanofiber mat and sandwich-molded elastomer sheets

NASA Astrophysics Data System (ADS)

Bit Lee, Han; Kim, Young Won; Yoon, Jonghun; Lee, Nak Kyu; Park, Suk-Hee

2017-04-01

We developed a skin-conformal flexible sensor in which three-dimensional (3D) free-form elastomeric sheets were harmoniously integrated with a piezoelectric nanofiber mat. The elastomeric sheets were produced by polydimethylsiloxane (PDMS) molding via using a 3D printed mold assembly, which was adaptively designed from 3D scanned skin surface geometry. The mold assembly, fabricated using a multi-material 3D printer, was composed of a pair of upper/lower mold parts and an interconnecting hinge, with material properties are characterized by different flexibilities. As a result of appropriate deformabilites of the upper mold part and hinge, the skin-conformal PDMS structures were successfully sandwich molded and demolded with good repeatability. An electrospun poly(vinylidene fluoride trifluoroethylene) nanofiber mat was prepared as the piezoelectric active layer and integrated with the 3D elastomeric parts. We confirmed that the highly responsive sensing performances of the 3D integrated sensor were identical to those of a flat sensor in terms of sensitivity and the linearity of the input-output relationship. The close 3D conformal skin contact of the flexible sensor enabled discernable perception of various scales of physical stimuli, such as tactile force and even minute skin deformation caused by the tester’s pulse. Collectively from the 3D scanning design to the practical application, our achievements can potentially meet the needs of tailored human interfaces in the field of wearable devices and human-like robots.

Molding compound trends in a denser packaging world: Qualification tests and reliability concerns

NASA Astrophysics Data System (ADS)

Nguyen, L. T.; Lo, R. H. Y.; Chen, A. S.; Belani, J. G.

1993-12-01

Molding compound development has traditionally been driven by the memory market, then subsequent applications filter down to other IC technologies such as logic, analog, and ASIC. However, this strategy has changed lately with the introduction of thin packages such as PQFP & TSOP. Rather than targeting a compound for a family of IC such as DRAM or SRAM, compound development efforts are now focused at specific classes of packages. The configurations of these thin packages impose new functional requirements that need to be revisited to provide the optimized combination of properties. The evolution of qualification tests mirrors the advances in epoxy and compounding technologies. From the first standard novolac-based epoxies of the 1970s to the latest 3(sup rd)-generation ultra-low stress materials, longer test times at increasingly harsher environments were achieved. This paper benchmarks the current reliability tests used by the electronic industry, examines those tests that affect and are affected by the molding compounds, discusses the relevance of accelerated testing, and addresses the major reliability issues facing current molding compound development efforts. Six compound-related reliability concerns were selected: moldability, package stresses, package cracking, halogen-induced intermetallic growth at bond pads, moisture-induced corrosion, and interfacial delamination. Causes of each failure type are surveyed and remedies are recommended. Accelerated tests are designed to apply to a limited quantity of devices, bias, or environmental conditions larger than usual ratings, to intensify failure mechanisms that would occur under normal operating conditions. The observed behavior is then extrapolated from the lot to the entire population. Emphasis is on compressing the time necessary to obtain reliability data. This approach has two main drawbacks. With increasingly complex devices, even accelerated tests are expensive. And with new technologies, it becomes difficult to ascertain that the applied stress 1) induces the failure phenomenon linked with usual field conditions, and 2) does not create any new ones. Technology evolution and reliability testing are interdependent. Devices get larger with increasingly smaller features and more complex geometries. Molding compounds have evolved considerably over the past decade to provide ultra-low stress levels and moldability for thin packages.

Population structure of the NPGS Senegalese sorghum collection and its evaluation to identify new disease resistant genes.

PubMed

Cuevas, Hugo E; Prom, Louis K; Rosa-Valentin, Giseiry

2018-01-01

Sorghum germplasm from West and Central Africa is cultivated in rainy and high humidity regions and is an important source of resistance genes to fungal diseases. Mold and anthracnose are two important biotic constraints to sorghum production in wet areas worldwide. Here, 158 National Plant Germplasm System (NPGS) accessions from Senegal were evaluated for agronomic traits, anthracnose, and grain mold resistance at two locations, and genetically characterized according to 20 simple sequence repeat markers. A total of 221 alleles were amplified with an average of 11 alleles per locus. Each accession had a unique genetic profile (i.e., no duplicates), and the average genetic distance between accessions was 0.42. Population structure and cluster analysis separated the collection into four populations with pairwise FST values >0.15. Three of the populations were composed of Guinea-race sorghum germplasm, and one included multiple races. Anthracnose resistant accessions were present at high frequency and evenly distributed among the three Guinea-race populations. Fourteen accessions showed resistance to grain mold, and eight were resistant to both diseases. These results indicated that the NPGS of Senegal is a genetically diverse collection with a high frequency of disease resistant accessions. Nevertheless, its population structure suggests the presence of few sources of resistance to both grain mold and anthracnose, which are fixed in the germplasm. The phenotypic and genotypic information for these accessions provides a valuable resource for its correct use to broaden the genetic base of breeding programs.

Investigation of Thermal and Electrical Properties for Conductive Polymer Composites

NASA Astrophysics Data System (ADS)

Juwhari, Hassan K.; Abuobaid, Ahmad; Zihlif, Awwad M.; Elimat, Ziad M.

2017-10-01

This study addresses the effects of temperature ranging from 300 K to 400 K on thermal ( κ) and electrical ( σ) conductivities, and Lorenz number ( L) for different conductive polymeric composites (CPCs), as tailoring the ratios between both conductivities of the composites can be influential in the design optimization of certain thermo-electronic devices. Both κ and σ were found to have either a linear or a nonlinear (2nd and 3rd degree polynomial function) increasing behavior with increased temperatures, depending on the conduction mechanism occurring in the composite systems studied. Temperature-dependent behavior of L tends to show decreasing trends above 300 K, where at 300 K the highest and the lowest values were found to be 3 × 103 W Ω/K2 for CPCs containing iron particles and 3 × 10-2 W Ω/K2 for CPCs-containing carbon fibers respectively. Overall, temperature-dependent behavior of κ/ σ and L can be controlled by heterogeneous structures produced via mechanical-molding-compression. These structures are mainly responsible for energy-transfer processes or transport properties that take place by electrons and phonons in the CPCs' bulks. Hence, the outcome is considered significant in the development process of high performing materials for the thermo-electronic industry.

High Temperature Structural Foam

NASA Technical Reports Server (NTRS)

Weiser, Erik S.; Baillif, Faye F.; Grimsley, Brian W.; Marchello, Joseph M.

1997-01-01

The Aerospace Industry is experiencing growing demand for high performance polymer foam. The X-33 program needs structural foam insulation capable of retaining its strength over a wide range of environmental conditions. The High Speed Research Program has a need for low density core splice and potting materials. This paper reviews the state of the art in foam materials and describes experimental work to fabricate low density, high shear strength foam which can withstand temperatures from -220 C to 220 C. Commercially available polymer foams exhibit a wide range of physical properties. Some with densities as low as 0.066 g/cc are capable of co-curing at temperatures as high as 182 C. Rohacell foams can be resin transfer molded at temperatures up to 180 C. They have moduli of elasticity of 0.19 MPa, tensile strengths of 3.7 Mpa and compressive strengths of 3.6 MPa. The Rohacell foams cannot withstand liquid hydrogen temperatures, however Imi-Tech markets Solimide (trademark) foams which withstand temperatures from -250 C to 200 C, but they do not have the required structural integrity. The research activity at NASA Langley Research Center focuses on using chemical blowing agents to produce polyimide thermoplastic foams capable of meeting the above performance requirements. The combination of blowing agents that decompose at the minimum melt viscosity temperature together with plasticizers to lower the viscosity has been used to produce foams by both extrusion and oven heating. The foams produced exhibit good environmental stability while maintaining structural properties.

Economical processing of fiber-reinforced components with thermal expansion molding

NASA Technical Reports Server (NTRS)

Schneider, K.

1979-01-01

The concept of economical fabrication of fiber-reinforced structural components is illustrated with an example of a typical control surface (aileron). The concept provides for fabricating struts, ribs, and a cover plate as an integral structure in a hardening device and then joining the closure cover plate mechanically. Fabrication of the integral structure is achieved by the 'thermal expansion molding' technique. The hardening pressure is produced by silicone rubber cores which expand under the influence of temperature. Test results are presented for several rubber materials as well as for various structural pieces. The technique is demonstrated extensively for an aileron, consisting of five ribs, struts, and a cover plate. Economically, for a large scale technical production of an aileron, cost savings of twenty-five percent can be realized compared to those for a sheet metal structure.

Winding Pack Height Management During Fabrication of the ITER CS Module

NASA Astrophysics Data System (ADS)

Martovetsky, Nicolai N.; Irick, David K.; Reed, Richard P.; Haefelfinger, Rolf; Salazar, Erica

The Central Solenoid (CS) stack consists of six modules, 2.1 m tall each [1]. In order to verify good impregnation, we performed a vacuum pressure impregnation (VPI) test of a full cross section of the CS module (CSM), 40 conductors tall and 14 conductors wide [2]. It was discovered that after preparation of the full cross section stack until completion of the VPI, the stack shrunk in height by 20-25 mm. Our study of the literature and discussions with the leading experts in VPI did not reveal obvious reasons for this change of height, so we launched a study to address this issue. We assembled two 12x1 (tall by wide) arrays and several 7x1 arrays in order to study characteristics of the dry winding pack under compressive force and effects of different fabrication steps. Then we impregnated these arrays in different conditions under compressive force and studied change of height as a result of compression, impregnation, gelling and curing of the stack of insulated conductors. We showed that by controlling the application of the compressive force, before closing the mold and during impregnation, one can reduce the height uncertainty. Most of the height reduction takes place while the glass is dry under the dead weight and the applied compressive force. Reduction of height during injection of the resin and during gelling, curing and cooling of the coil is noticeable, reproducible and relatively small. The paper presents results of our studies and recommendations for assembly and VPI of tall windings.

Polycephalin B and C: Unusual Tetramic Acids from Plasmodia of the Slime Mold Physarum polycephalum (Myxomycetes).

PubMed

Nowak, Alexander; Steffan, Bert

1998-12-04

Illumination results in increased formation of metabolites 1 and 2 in the plasmodia of the slime mold Physarum polycephalum. This was determined from HPLC studies undertaken in the search for the photoactive substances involved in the "blue-light phenomenon". The isolation and structure elucidation of 1 and 2 is described. © 1998 WILEY-VCH Verlag GmbH, Weinheim, Fed. Rep. of Germany.

Solid Lubricated Rolling Element Bearings

DTIC Science & Technology

1979-02-15

lubricant into uneven patches of varnish . This varnish , along with the file-like action of the exposed ball carbides on the relatively softer races, can...its structure. Fluorine , one of the most reactive elements, reacts with graphite without combustion from about 790’F to 1022°F, forming a grey-colored...to allow for molding and machining after molding. 0 Method 2 (Hughes) Impregnating these dense weaves with a Thermid 600 polyimide varnish

Colloidal isopressing: A new shaping method for ceramic suspensions

NASA Astrophysics Data System (ADS)

Yu, Benjamin Christopher

Colloidal Isopressing is a new processing method for shaping compacts from particulate suspensions. The study of interparticle interactions within a suspension, and their effect on the overall slurry behavior, has led to the prior discovery of a plastic-to-brittle transition in powder compacts formed by pressure filtration. Colloidal Isopressing utilizes this pressure dependent behavior for slurries with a short-range repulsive potential to rapidly transform plastic consolidated bodies into more complex shapes. The first results are presented for aqueous alumina suspensions where electrostatic double layer repulsion is compressed to short interparticle separations by the addition of ammonium chloride. Consolidation at low pressures produces a high relative density slurry that is plastic and can be extruded into a rubber mold. The application of an hydrostatic pressure forces a small amount of liquid into a porous portion of the mold and pushes particles together into a rigid network. As the pressure is released, the newly formed powder compact will partially separate from the lower modulus rubber mold. The body can then be ejected from the mold, dried, and densified to produce the final ceramic component. Colloidal Isopressing has been successfully modeled as a special case of consolidation via pressure filtration. Theoretical analyses have accurately predicted the time required for the rapid transformation from plastic slurry to elastic powder compact. The effects of slurry composition on processing were studied. The electrolyte concentration, powder particle size, slurry pH, and polymer concentration were shown to alter the flow behavior of filter pressed and liquefied compacts. As the free volume of liquid decreased and/or the relative attraction between particles increased, the concentrated slurry became more difficult to process. Finally, drying of compacts formed by Colloidal Isopressing did not result in any shrinkage during drying, thus allowing for very rapid heating rates to be used. In fact, the drying, burnout, and densification could be combined into one step, with final densities approaching the theoretical limit.

Premature melt solidification during mold filling and its influence on the as-cast structure

NASA Astrophysics Data System (ADS)

Wu, M.; Ahmadein, M.; Ludwig, A.

2018-03-01

Premature melt solidification is the solidification of a melt during mold filling. In this study, a numerical model is used to analyze the influence of the pouring process on the premature solidification. The numerical model considers three phases, namely, air, melt, and equiaxed crystals. The crystals are assumed to have originated from the heterogeneous nucleation in the undercooled melt resulting from the first contact of the melt with the cold mold during pouring. The transport of the crystals by the melt flow, in accordance with the socalled "big bang" theory, is considered. The crystals are assumed globular in morphology and capable of growing according to the local constitutional undercooling. These crystals can also be remelted by mixing with the superheated melt. As the modeling results, the evolutionary trends of the number density of the crystals and the volume fraction of the solid crystals in the melt during pouring are presented. The calculated number density of the crystals and the volume fraction of the solid crystals in the melt at the end of pouring are used as the initial conditions for the subsequent solidification simulation of the evolution of the as-cast structure. A five-phase volume-average model for mixed columnar-equiaxed solidification is used for the solidification simulation. An improved agreement between the simulation and experimental results is achieved by considering the effect of premature melt solidification during mold filling. Finally, the influences of pouring parameters, namely, pouring temperature, initial mold temperature, and pouring rate, on the premature melt solidification are discussed.

Aluminum-based one- and two-dimensional micro fin array structures: high-throughput fabrication and heat transfer testing

NASA Astrophysics Data System (ADS)

Primeaux, Philip A.; Zhang, Bin; Zhang, Xiaoman; Miller, Jacob; Meng, W. J.; KC, Pratik; Moore, Arden L.

2017-02-01

Microscale fin array structures were replicated onto surfaces of aluminum 1100 and aluminum 6061 alloy (Al1100/Al6061) sheet metals through room-temperature instrumented roll molding. Aluminum-based micro fin arrays were replicated at room temperature, and the fabrication process is one with high throughput and low cost. One-dimensional (1D) micro fin arrays were made through one-pass rolling, while two-dimensional (2D) micro fin arrays were made by sequential 90° cross rolling with the same roller sleeve. For roll molding of 1D micro fins, fin heights greater than 600 µm were achieved and were shown to be proportional to the normal load force per feature width. At a given normal load force, the fin height was further shown to scale inversely with the hardness of the sheet metal. For sequential 90° cross rolling, morphologies of roll molded 2D micro fin arrays were examined, which provided clues to understand how plastic deformation occurred under cross rolling conditions. A series of pool boiling experiments on low profile Al micro fin array structures were performed within Novec 7100, a widely used commercial dielectric coolant. Results for both horizontal and vertical surface orientations show that roll molded Al micro fin arrays can increase heat flux at fixed surface temperature as compared to un-patterned Al sheet. The present results further suggest that many factors beyond just increased surface area can influence heat transfer performance, including surface finish and the important multiphase transport mechanisms in and around the fin geometry. These factors must also be considered when designing and optimizing micro fin array structures for heat transfer applications.

Liquid crystal polyester-carbon fiber composites

NASA Technical Reports Server (NTRS)

Chung, T. S.

1984-01-01

Liquid crystal polymers (LCP) have been developed as a thermoplastic matrix for high performance composites. A successful melt impregnation method has been developed which results in the production of continuous carbon fiber (CF) reinforced LCP prepreg tape. Subsequent layup and molding of prepreg into laminates has yielded composites of good quality. Tensile and flexural properties of LCP/CF composites are comparable to those of epoxy/CF composites. The LCP/CF composites have better impact resistance than the latter, although epoxy/CF composites possess superior compression and shear strength. The LCP/CF composites have good property retention until 200 F (67 % of room temperature value). Above 200 F, mechanical properties decrease significantly. Experimental results indicate that the poor compression and shear strength may be due to the poor interfacial adhesion between the matrix and carbon fiber as adequate toughness of the LCP matrix. Low mechanical property retention at high temperatures may be attributable to the low beta-transition temperature (around 80 C) of the LCP matrix material.

Preparation of a porous conductive scaffold from aniline pentamer-modified polyurethane/PCL blend for cardiac tissue engineering.

PubMed

Baheiraei, Nafiseh; Yeganeh, Hamid; Ai, Jafar; Gharibi, Reza; Ebrahimi-Barough, Somayeh; Azami, Mahmoud; Vahdat, Sadaf; Baharvand, Hossein

2015-10-01

A novel biodegradable electroactive polyurethane containing aniline pentamer (AP) was blended with polycaprolactone (PCL). The prepared blend (PB) and PCL were further fabricated in to scaffolds using a mixture of poly(ethylene glycol) and salt particles in a double porogen particulate leaching and compression molding methodology. Scaffolds held open and interconnected pores having pore size ranging from several μm to 150 µm. PB scaffolds had compression modulus and strength of 4.1 and 1.3 MPa, respectively. The conductivity of the scaffold was measured as 10(-5) ± 0.09 S .cm(-1) and preserved for at least 100 h post fabrication. Scaffolds supported neonatal cardiomyocytes adhesion and growth with PB showing more extensive effect on the expression of the cardiac genes involved in muscle contraction and relaxation (troponin-T) and cytoskeleton alignment (actinin-4). Our results highlight the potential of incorporation of AP as an electroactive moiety for induction of cardiomyocyte proliferation and repair of damaged heart tissue. © 2015 Wiley Periodicals, Inc.

Strength and fatigue properties of three-step sintered dense nanocrystal hydroxyapatite bioceramics

NASA Astrophysics Data System (ADS)

Guo, Wen-Guang; Qiu, Zhi-Ye; Cui, Han; Wang, Chang-Ming; Zhang, Xiao-Jun; Lee, In-Seop; Dong, Yu-Qi; Cui, Fu-Zhai

2013-06-01

Dense hydroxyapatite (HA) ceramic is a promising material for hard tissue repair due to its unique physical properties and biologic properties. However, the brittleness and low compressive strength of traditional HA ceramics limited their applications, because previous sintering methods produced HA ceramics with crystal sizes greater than nanometer range. In this study, nano-sized HA powder was employed to fabricate dense nanocrystal HA ceramic by high pressure molding, and followed by a three-step sintering process. The phase composition, microstructure, crystal dimension and crystal shape of the sintered ceramic were examined by X-ray diffraction (XRD) and scanning electron microscopy (SEM). Mechanical properties of the HA ceramic were tested, and cytocompatibility was evaluated. The phase of the sintered ceramic was pure HA, and the crystal size was about 200 nm. The compressive strength and elastic modulus of the HA ceramic were comparable to human cortical bone, especially the good fatigue strength overcame brittleness of traditional sintered HA ceramics. Cell attachment experiment also demonstrated that the ceramics had a good cytocompatibility.

Mechanical properties of as-cast and heat-treated ZA-27 alloy/short glass fiber composites

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sharma, S.C.; Girish, B.M.; Satish, B.M.

1998-02-01

This paper reports on the mechanical properties of as-cast and heat-treated ZA-27 alloy composites reinforced with glass fibers from 1 to 5 wt%. The composites were fabricated using the Compocasting method, in which short glass fibers were introduced into the vortex created in the molten alloy through an impeller rotated at 500 rpm. The molten mass was thoroughly stirred and poured into permanent molds and squeezed under pressure. The specimens were heat treated at 320 C for 1, 2, 3, and 4 h. The tests on the as-cast composites revealed that as the glass content in the composites was increased,more » the ultimate tensile strength (UTS), compressive strength, and hardness of the composite increased, while the ductility and impact strength were decreased. Heat treatment was found to improve significantly the ductility, compressive strength, and impact strength, while the hardness and UTS were reduced. This paper discusses the behavior of these composites.« less

Performance of Subscale Docking Seals Under Simulated Temperature Conditions

NASA Technical Reports Server (NTRS)

Smith, Ian M.; Daniels, Christopher C.

2008-01-01

A universal docking system is being developed by the National Aeronautics and Space Administration (NASA) to support future space exploration missions to low Earth orbit (LEO), to the moon, and to Mars. The candidate docking seals for the system are a composite design consisting of elastomer seal bulbs molded into the front and rear sides of a metal ring. The test specimens were subscale seals with two different elastomer cross-sections and a 12-in. outside diameter. The seal assemblies were mated in elastomer seal-on-metal plate and elastomer seal-on-elastomer seal configurations. The seals were manufactured from S0383-70 silicone elastomer compound. Nominal and off-nominal joint configurations were examined. Both the compression load required to mate the seals and the leak rate observed were recorded while the assemblies were subjected to representative docking system operating temperatures of -58, 73, and 122 F (-50, 23, and 50 C). Both the loads required to fully compress the seals and their leak rates were directly proportional to the test temperature.

Improved Thermoplastic/Iron-Particle Transformer Cores

NASA Technical Reports Server (NTRS)

Wincheski, Russell A.; Bryant, Robert G.; Namkung, Min

2004-01-01

A method of fabricating improved transformer cores from composites of thermoplastic matrices and iron-particles has been invented. Relative to commercially available laminated-iron-alloy transformer cores, the cores fabricated by this method weigh less and are less expensive. Relative to prior polymer-matrix/ iron-particle composite-material transformer cores, the cores fabricated by this method can be made mechanically stronger and more magnetically permeable. In addition, whereas some prior cores have exhibited significant eddy-current losses, the cores fabricated by this method exhibit very small eddy-current losses. The cores made by this method can be expected to be attractive for use in diverse applications, including high-signal-to-noise transformers, stepping motors, and high-frequency ignition coils. The present method is a product of an experimental study of the relationships among fabrication conditions, final densities of iron particles, and mechanical and electromagnetic properties of fabricated cores. Among the fabrication conditions investigated were molding pressures (83, 104, and 131 MPa), and molding temperatures (250, 300, and 350 C). Each block of core material was made by uniaxial-compression molding, at the applicable pressure/temperature combination, of a mixture of 2 weight percent of LaRC (or equivalent high-temperature soluble thermoplastic adhesive) with 98 weight percent of approximately spherical iron particles having diameters in the micron range. Each molded block was cut into square cross-section rods that were used as core specimens in mechanical and electromagnetic tests. Some of the core specimens were annealed at 900 C and cooled slowly before testing. For comparison, a low-carbon-steel core was also tested. The results of the tests showed that density, hardness, and rupture strength generally increased with molding pressure and temperature, though the correlation was rather weak. The weakness of the correlation was attributed to the pores in the specimens. The maximum relative permeabilities of cores made without annealing ranged from 30 to 110, while those of cores made with annealing ranged from 900 to 1,400. However, the greater permeabilities of the annealed specimens were not associated with noticeably greater densities. The major practical result of the investigation was the discovery of an optimum distribution of iron-particle sizes: It was found that eddy-current losses in the molded cores were minimized by using 100 mesh (corresponding to particles with diameters less than or equal to 100 m) iron particles. The effect of optimization of particle sizes on eddy-current losses is depicted in the figure.

RNACompress: Grammar-based compression and informational complexity measurement of RNA secondary structure.

PubMed

Liu, Qi; Yang, Yu; Chen, Chun; Bu, Jiajun; Zhang, Yin; Ye, Xiuzi

2008-03-31

With the rapid emergence of RNA databases and newly identified non-coding RNAs, an efficient compression algorithm for RNA sequence and structural information is needed for the storage and analysis of such data. Although several algorithms for compressing DNA sequences have been proposed, none of them are suitable for the compression of RNA sequences with their secondary structures simultaneously. This kind of compression not only facilitates the maintenance of RNA data, but also supplies a novel way to measure the informational complexity of RNA structural data, raising the possibility of studying the relationship between the functional activities of RNA structures and their complexities, as well as various structural properties of RNA based on compression. RNACompress employs an efficient grammar-based model to compress RNA sequences and their secondary structures. The main goals of this algorithm are two fold: (1) present a robust and effective way for RNA structural data compression; (2) design a suitable model to represent RNA secondary structure as well as derive the informational complexity of the structural data based on compression. Our extensive tests have shown that RNACompress achieves a universally better compression ratio compared with other sequence-specific or common text-specific compression algorithms, such as Gencompress, winrar and gzip. Moreover, a test of the activities of distinct GTP-binding RNAs (aptamers) compared with their structural complexity shows that our defined informational complexity can be used to describe how complexity varies with activity. These results lead to an objective means of comparing the functional properties of heteropolymers from the information perspective. A universal algorithm for the compression of RNA secondary structure as well as the evaluation of its informational complexity is discussed in this paper. We have developed RNACompress, as a useful tool for academic users. Extensive tests have shown that RNACompress is a universally efficient algorithm for the compression of RNA sequences with their secondary structures. RNACompress also serves as a good measurement of the informational complexity of RNA secondary structure, which can be used to study the functional activities of RNA molecules.

RNACompress: Grammar-based compression and informational complexity measurement of RNA secondary structure

PubMed Central

Liu, Qi; Yang, Yu; Chen, Chun; Bu, Jiajun; Zhang, Yin; Ye, Xiuzi

2008-01-01

Background With the rapid emergence of RNA databases and newly identified non-coding RNAs, an efficient compression algorithm for RNA sequence and structural information is needed for the storage and analysis of such data. Although several algorithms for compressing DNA sequences have been proposed, none of them are suitable for the compression of RNA sequences with their secondary structures simultaneously. This kind of compression not only facilitates the maintenance of RNA data, but also supplies a novel way to measure the informational complexity of RNA structural data, raising the possibility of studying the relationship between the functional activities of RNA structures and their complexities, as well as various structural properties of RNA based on compression. Results RNACompress employs an efficient grammar-based model to compress RNA sequences and their secondary structures. The main goals of this algorithm are two fold: (1) present a robust and effective way for RNA structural data compression; (2) design a suitable model to represent RNA secondary structure as well as derive the informational complexity of the structural data based on compression. Our extensive tests have shown that RNACompress achieves a universally better compression ratio compared with other sequence-specific or common text-specific compression algorithms, such as Gencompress, winrar and gzip. Moreover, a test of the activities of distinct GTP-binding RNAs (aptamers) compared with their structural complexity shows that our defined informational complexity can be used to describe how complexity varies with activity. These results lead to an objective means of comparing the functional properties of heteropolymers from the information perspective. Conclusion A universal algorithm for the compression of RNA secondary structure as well as the evaluation of its informational complexity is discussed in this paper. We have developed RNACompress, as a useful tool for academic users. Extensive tests have shown that RNACompress is a universally efficient algorithm for the compression of RNA sequences with their secondary structures. RNACompress also serves as a good measurement of the informational complexity of RNA secondary structure, which can be used to study the functional activities of RNA molecules. PMID:18373878

Aluminum integral foams with tailored density profile by adapted blowing agents

NASA Astrophysics Data System (ADS)

Hartmann, Johannes; Fiegl, Tobias; Körner, Carolin

2014-05-01

The goal of the present work is the variation of the structure of aluminum integral foams regarding the thickness of the integral solid skin as well as the density profile. A modified die casting process, namely integral foam molding, is used in which an aluminum melt and blowing agent particles (magnesium hydride MgH2) are injected in a permanent steel mold. The high solidification rates at the cooled walls of the mold lead to the formation of a solid skin. In the inner region, hydrogen is released by thermal decomposition of MgH2 particles. Thus, the pore formation takes place parallel to the continuing solidification of the melt. The thickness of the solid skin and the density profile of the core strongly depend on the interplay between solidification velocity and kinetics of hydrogen release. By varying the melt and blowing agent properties, the structure of integral foams can be systematically changed to meet the requirements of the desired field of application of the produced component.

An injection molding process for manufacturing highly porous and interconnected biodegradable polymer matrices for use as tissue engineering scaffolds.

PubMed

Kramschuster, Adam; Turng, Lih-Sheng

2010-02-01

In this research, injection molding was combined with a novel material combination, supercritical fluid processing, and particulate leaching techniques to produce highly porous and interconnected structures that have the potential to act as scaffolds for tissue engineering applications. The foamed structures, molded with polylactide (PLA) and polyvinyl alcohol (PVOH) with salt as the particulate, were processed without the aid of organic solvents, which can be detrimental to tissue growth. The pore size in the scaffolds is controlled by salt particulates and interconnectivity is achieved by the co-continuous blending morphology of biodegradable PLA matrix with water-soluble PVOH. Carbon dioxide (CO(2)) at the supercritical state is used to serve as a plasticizer, thereby imparting moldability of blends even with an ultra high salt particulate content, and allows the use of low processing temperatures, which are desirable for temperature-sensitive biodegradable polymers. Interconnected pores of approximately 200 microm in diameter and porosities of approximately 75% are reported and discussed.

Fabrication of a high aspect ratio thick silicon wafer mold and electroplating using flipchip bonding for MEMS applications

NASA Astrophysics Data System (ADS)

Kim, Bong-Hwan; Kim, Jong-Bok

2009-06-01

We have developed a microfabrication process for high aspect ratio thick silicon wafer molds and electroplating using flipchip bonding with THB 151N negative photoresist (JSR micro). This fabrication technique includes large area and high thickness silicon wafer mold electroplating. The process consists of silicon deep reactive ion etching (RIE) of the silicon wafer mold, photoresist bonding between the silicon mold and the substrate, nickel electroplating and a silicon removal process. High thickness silicon wafer molds were made by deep RIE and flipchip bonding. In addition, nickel electroplating was developed. Dry film resist (ORDYL MP112, TOK) and thick negative-tone photoresist (THB 151N, JSR micro) were used as bonding materials. In order to measure the bonding strength, the surface energy was calculated using a blade test. The surface energy of the bonding wafers was found to be 0.36-25.49 J m-2 at 60-180 °C for the dry film resist and 0.4-1.9 J m-2 for THB 151N in the same temperature range. Even though ORDYL MP112 has a better value of surface energy than THB 151N, it has a critical disadvantage when it comes to removing residue after electroplating. The proposed process can be applied to high aspect ratio MEMS structures, such as air gap inductors or vertical MEMS probe tips.

Modeling growth of three bakery product spoilage molds as a function of water activity, temperature and pH.

PubMed

Dagnas, Stéphane; Onno, Bernard; Membré, Jeanne-Marie

2014-09-01

The objective of this study was to quantify the effect of water activity, pH and storage temperature on the growth of Eurotium repens, Aspergillus niger and Penicillium corylophilum, isolated from spoiled bakery products. Moreover, the behaviors of these three mold species were compared to assess whether a general modeling framework may be set and re-used in future research on bakery spoilage molds. The mold growth was modeled by building two distinct Gamma-type secondary models: one on the lag time for growth and another one on the radial growth rate. A set of 428 experimental growth curves was generated. The effect of temperature (15-35 °C), water activity (0.80-0.98) and pH (3-7) was assessed. Results showed that it was not possible to apply the same set of secondary model equations to the three mold species given that the growth rate varied significantly with the factors pH and water activity. In contrast, the temperature effect on both growth rate and lag time of the three mold species was described by the same equation. The equation structure and model parameter values of the Gamma models were also compared per mold species to assess whether a relationship between lag time and growth rate existed. There was no correlation between the two growth responses for E. repens, but a slight one for A. niger and P. corylophilum. These findings will help in determining bakery product shelf-life and guiding future work in the predictive mycology field. Copyright © 2014 Elsevier B.V. All rights reserved.

A catalyst-free, temperature controlled gelation system for in-mold fabrication of microgels.

PubMed

Krüger, Andreas J D; Köhler, Jens; Cichosz, Stefan; Rose, Jonas C; Gehlen, David B; Haraszti, Tamás; Möller, Martin; De Laporte, Laura

2018-06-19

Anisometric microgels are prepared via thermal crosslinking using an in-mold polymerization technique. Star-shaped poly(ethylene oxide-stat-propylene oxide) polymers, end-modified with amine and epoxy groups, form hydrogels, of which the mechanical properties and gelation rate can be adjusted by the temperature, duration of heating, and polymer concentration. Depending on the microgel stiffness, the rod-shaped microgels self-assemble into ordered or disordered structures.

Composite Materials and Sandwich Structures - A Primer

DTIC Science & Technology

2010-05-01

cooling through a temperature range characteristic of the plastic. In the softened stage the plastic can be formed in a desired shape by molding or...which components are placed in a mold , and the composite is built up and worked by hand. Hybrid- A composite laminate comprised of laminae of two or...ply orientation is symmetrical about the laminate mid- plane. Thermoplastic - A plastic that can be repeatedly softened by heating, and hardened by

Method for forming pyrrone molding powders and products of said method

NASA Technical Reports Server (NTRS)

Hughes, C. T.; Mchenry, R. J. (Inventor)

1972-01-01

The formation of pyrrone resins of the ladder or semiladder structure is described. The technique involves initial formation of fully cyclized prepolymers having an average degree of polymerization of about 1.5, one with acidic terminal groups, another with amine terminal groups. Thereafter the prepolymers are intimately admixed on a 1:1 stoichiometric basis. The resulting powder mixture is molded at elevated pressures and temperatures to form a fully cyclized resin.

Spinoff From a Moon Suit

NASA Technical Reports Server (NTRS)

1991-01-01

Al Gross transferred expertise obtained as an ILC engineer for NASA's Apollo program to the manufacture of athletic shoes. Gross substituted DuPont's Hytrel plastic for foam materials in the shoe's midsole, eliminating cushioning loss caused by body weight. An external pressurized shell applied from space suit technology was incorporated into the shoe. Stiffness and cushioning properties of the midsole were "tuned" by varying material thickness and styling lines. A stress free "blow molding" process adapted from NASA space suit design was also utilized. The resulting compression chamber midsole performed well in tests. It allows AVIA to re-configure for specific sports and is a "first step" toward a durable, foamless, non-fatiguing midsole.

Processing and Characterization of Cellulose Nanocrystals/Polylactic Acid Nanocomposite Films

PubMed Central

Sullivan, Erin M.; Moon, Robert J.; Kalaitzidou, Kyriaki

2015-01-01

The focus of this study is to examine the effect of cellulose nanocrystals (CNC) on the properties of polylactic acid (PLA) films. The films are fabricated via melt compounding and melt fiber spinning followed by compression molding. Film fracture morphology, thermal properties, crystallization behavior, thermo-mechanical behavior, and mechanical behavior were determined as a function of CNC content using scanning electron microscopy, differential scanning calorimetry, X-ray diffraction, dynamic mechanical analysis, and tensile testing. Film crystallinity increases with increasing CNC content indicating CNC act as nucleating agents, promoting crystallization. Furthermore, the addition of CNC increased the film storage modulus and slightly broadened the glass transition region. PMID:28793701

Assessment of relative flammability and thermochemical properties of some thermoplastic materials

NASA Technical Reports Server (NTRS)

Kourtides, D. A.; Parker, J. A.

1977-01-01

Thermomechanical properties, flammability, oxygen index, relative toxicity of pyrolysis effluents, and char yields were studied for 12 advanced polymers which are candidates for use in aircraft interiors as decorative films, compression- and injection-molded parts and thermoplastic parts. Polymers sampled included polyphenylene sulfide, 9,9 bis (4-hydroxyphenol) fluorene polycarbonate-poly (dimethylsiloxane), polyether sulfone, polyvinyl fluoride and polyvinylidene fluoride. Availability of these samples, whether in commercial form or in test quantities, is specified. An estimate of relative fire resistance for the materials was obtained; the five polymers listed above were found to be the most fire resistant of the 12 sampled.

Flexural creep behaviour of jute polypropylene composites

NASA Astrophysics Data System (ADS)

Chandekar, Harichandra; Chaudhari, Vikas

2016-09-01

Present study is about the flexural creep behaviour of jute fabric reinforced polypropylene (Jute-PP) composites. The PP sheet and alkali treated jute fabric is stacked alternately and hot pressed in compression molding machine to get Jute-PP composite laminate. The flexural creep study is carried out on dynamic mechanical analyzer. The creep behaviour of the composite is modeled using four-parameter Burgers model. Short-term accelerated creep testing is conducted which is later used to predict long term creep behaviour. The feasibility of the construction of a master curve using the time-temperature superposition (TTS) principle to predict long term creep behavior of unreinforced PP and Jute-PP composite is investigated.

Enhanced wear performance of ultra high molecular weight polyethylene crosslinked by organosilane.

PubMed

Tang, C Y; Xie, X L; Wu, X C; Li, R K Y; Mai, Y W

2002-11-01

Ultra high molecular weight polyethylene (UHMWPE) crosslinked by organosilane was thermal compression molded. The organosilane used was the tri-ethyloxyl vinyl silane. Its gelation, melting behavior, crystallinity, mechanical and wear-resisting properties were systematically investigated. The results showed that the gel ratio of UHMWPE increases with the incorporation of organosilane. At a low content of organosilane, the melting point and crystallinity of the crosslinked UHMWPE increase, and hence the mechanical and wear-resisting properties are improved. However, at a high content of organosilane, these performances of the crosslinked UHMWPE become worse. At 0.4 phr silane, the wear resistance of crosslinked UHMWPE reaches its optimum value.

Polypropionate lactones of deoxysugars glycosides from slime mold Lycogala epidendrum.

PubMed

Rezanka, Tomás; Dvoráková, Radmila

2003-08-01

Two novel polypropionate lactone glycosides (1 and 2, i.e. lycogalinosides A and B) were isolated from the slime mold Lycogala epidendrum. Their structures, including the absolute configurations of the hydroxyl and methyls groups, were determined by means of extensive spectroscopic data such as mass, IR, UV, and 1D and 2D NMR spectra and chemical degradation followed by spectroscopic and chromatographic analysis. Compounds 1 and 2 are unique in structure containing a 2-deoxy-alpha-L-fucopyranosyl-(1-4)-6-deoxy-beta-D-gulopyranosyl unit and a beta-D-olivopyranosyl-(1-4)-beta-D-fucopyranosyl unit, respectively, and showed growth inhibitory activities against Gram-positive bacteria.

Fabrication of cylindrical superhydrophobic microchannels by replicating lotus leaf structures on internal walls

NASA Astrophysics Data System (ADS)

Das, Ajit; Bhaumik, Soubhik Kumar

2018-04-01

Cylindrical superhydrophobic microchannels are fabricated by replicating lotus leaf structures on internal walls. The fabrication process comprises of three steps: the creation of a cylindrical mold of a glass rod (125 µm) with polystyrene films bearing negative imprints of lotus leaf (superhydrophobic) structures; casting polydimethylsiloxane (PDMS, Sylgard 184) over the mold; and solvent-assisted pulling off of the glass rod to leave a positive replica on the inner wall of the PDMS cast. The last crucial step is achieved through selective dissolution of the intermediate negative replica layer in the cylindrical mold without any swelling effect. The high fidelity of the replication process is confirmed through scanning electron microscope (SEM) imaging. The attained superhydrophobicity is assessed by comparing the dynamics of the advancing meniscus in the fabricated microchannels with that over a similarly fabricated smooth microchannel. Contact angle studies of the meniscus reveal a lower capillary effect and drag force experienced by the superhydrophobic microchannel compared to smooth ones. Studies based on velocity lead to a prediction of a drag reduction of 35%. A new avenue is thus opened up for microfabrication and flow analysis of closed superhydrophobic (SH) conduits in lab on chip and microfluidic applications.

Mold-Based Application of Laser-Induced Periodic Surface Structures (LIPSS) on Biomaterials for Nanoscale Patterning.

PubMed

Hendrikson, Wim; Masman-Bakker, Wendy; van Bochove, Bas; Skolski, Johann; Eichstädt, Justus; Koopman, Bart; van Blitterswijk, Clemens; Grijpma, Dirk; Römer, Gert-Willem; Moroni, Lorenzo; Rouwkema, Jeroen

2016-01-01

Laser-induced periodic surface structures (LIPSS) are highly regular, but at the same time contain a certain level of disorder. The application of LIPSS is a promising method to functionalize biomaterials. However, the absorption of laser energy of most polymer biomaterials is insufficient for the direct application of LIPSS. Here, we report the application of LIPSS to relevant biomaterials using a two-step approach. First, LIPSS are fabricated on a stainless steel surface. Then, the structures are replicated onto biomaterials using the steel as a mold. Results show that LIPSS can be transferred successfully using this approach, and that human mesenchymal stromal cells respond to the transferred structures. With this approach, the range of biomaterials that can be supplied with LIPSS increases dramatically. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Occupational exposure to styrene in the fibreglass reinforced plastic industry: comparison between two different manufacturing processes.

PubMed

Tranfo, Giovanna; Gherardi, Monica; Paci, E; Gatto, Mariapia; Gordiani, A; Caporossi, Lidia; Capanna, Silvia; Sisto, Renata; Papaleo, B; Fiumalbi, Carla; Garofani, Patrizia

2012-01-01

Styrene is used in manufacturing fiberglass reinforced plastics: and occupational exposure was related to neurotoxicology and genotoxicity. The sum of the metabolites mandelic and phenylglyoxylic acids is the ACGIH biomarker for occupational exposure with a BEI of 400 mg/g of creatinine in end shift urine corresponding to a airborne styrene concentration of 85 mg/m3. There are two main molding processes, open and closed, the last more effective at controlling worker's styrene exposure. To compare the open molding process to the compression of fiber reinforced resin foils, a kind of closed molding, monitoring the styrene exposure of workers in two production sites (A and B). Environmental Monitoring was carried out by Radiello samplers and Biological Monitoring by means of the determination of MA and PGA with HPLC/MS/MS in 10 workers at Site A and 14 at Site B. The median values for styrene exposure resulted 31.1 mg/m3 for Site A and 24.4 mg/m for Site B, while the medians for the sum of the two metabolites in the end shift urine were 86.7 e 33.8 mg/g creatinine respectively. There is a significant linear correlation between personal styrene exposure and the excretion of styrene metabolites (R = 0.74). As expected the exposure markers of the workers of the two production sites resulted higher in the open process. The analytical results of both environmental and biological monitoring were all below the occupational exposure limits, confirming the efficacy of the protective devices.

Phenotypic responses to microbial volatiles render a mold fungus more susceptible to insect damage.

PubMed

Caballero Ortiz, Silvia; Trienens, Monika; Pfohl, Katharina; Karlovsky, Petr; Holighaus, Gerrit; Rohlfs, Marko

2018-04-01

In decomposer systems, fungi show diverse phenotypic responses to volatile organic compounds of microbial origin (volatiles). The mechanisms underlying such responses and their consequences for the performance and ecological success of fungi in a multitrophic community context have rarely been tested explicitly. We used a laboratory-based approach in which we investigated a tripartite yeast-mold-insect model decomposer system to understand the possible influence of yeast-borne volatiles on the ability of a chemically defended mold fungus to resist insect damage. The volatile-exposed mold phenotype (1) did not exhibit protein kinase A-dependent morphological differentiation, (2) was more susceptible to insect foraging activity, and (3) had reduced insecticidal properties. Additionally, the volatile-exposed phenotype was strongly impaired in secondary metabolite formation and unable to activate "chemical defense" genes upon insect damage. These results suggest that volatiles can be ecologically important factors that affect the chemical-based combative abilities of fungi against insect antagonists and, consequently, the structure and dynamics of decomposer communities.

In-line characterization of nanostructured mass-produced polymer components using scatterometry

NASA Astrophysics Data System (ADS)

Skovlund Madsen, Jonas; Højlund Thamdrup, Lasse; Czolkos, Ilja; Hansen, Poul Erik; Johansson, Alicia; Garnaes, Jørgen; Nygård, Jesper; Hannibal Madsen, Morten

2017-08-01

Scatterometry is used as an in-line metrology solution for injection molded nanostructures to evaluate the pattern replication fidelity. The method is used to give direct feedback to an operator when testing new molding parameters and for continuous quality control. A compact scatterometer has been built and tested at a fabrication facility. The scatterometry measurements, including data analysis and handling of the samples, are much faster than the injection molding cycle time, and thus, characterization does not slow down the production rate. Fabrication and characterization of 160 plastic parts with line gratings are presented here, and the optimal molding temperatures for replication of nanostructures are found for two polymers. Scatterometry results are compared to state of the art metrology solutions: atomic force and scanning electron microscopy. It is demonstrated that the scatterometer can determine the structural parameters of the samples with an accuracy of a few nanometers in less than a second, thereby enabling in-line characterization.

Biogenic silver nanoparticles based on trichoderma harzianum: synthesis, characterization, toxicity evaluation and biological activity

NASA Astrophysics Data System (ADS)

Guilger, Mariana; Pasquoto-Stigliani, Tatiane; Bilesky-Jose, Natália; Grillo, Renato; Abhilash, P. C.; Fraceto, Leonardo Fernandes; Lima, Renata De

2017-03-01

White mold is an agricultural disease caused by the fungus Sclerotinia sclerotiorum, which affects important crops. There are different ways of controlling this organism, but none provides inhibition of its resistance structures (sclerotia). Nanotechnology offers promising applications in agricultural area. Here, silver nanoparticles were biogenically synthesized using the fungus Trichoderma harzianum and characterized. Cytotoxicity and genotoxicity were evaluated, and the nanoparticles were initially tested against white mold sclerotia. Their effects on soybean were also investigated with no effects observed. The nanoparticles showed potential against S. sclerotiorum, inhibiting sclerotia germination and mycelial growth. Nanoparticle characterization data indicated spherical morphology, satisfactory polydispersity and size distribution. Cytotoxicity and genotoxicity assays showed that the nanoparticles caused both the effects, although, the most toxic concentrations were above those applied for white mold control. Given the potential of the nanoparticles against S. sclerotiorum, we conclude that this study presents a first step for a new alternative in white mold control.

Plastic masters-rigid templates for soft lithography.

PubMed

Desai, Salil P; Freeman, Dennis M; Voldman, Joel

2009-06-07

We demonstrate a simple process for the fabrication of rigid plastic master molds for soft lithography directly from (poly)dimethysiloxane devices. Plastics masters (PMs) provide a cost-effective alternative to silicon-based masters and can be easily replicated without the need for cleanroom facilities. We have successfully demonstrated the use of plastics micromolding to generate both single and dual-layer plastic structures, and have characterized the fidelity of the molding process. Using the PM fabrication technique, world-to-chip connections can be integrated directly into the master enabling devices with robust, well-aligned fluidic ports directly after molding. PMs provide an easy technique for the fabrication of microfluidic devices and a simple route for the scaling-up of fabrication of robust masters for soft lithography.

Structural Reorganization of CNC in Injection-Molded CNC/PBAT Materials under Thermal Annealing.

PubMed

Mariano, Marcos; El Kissi, Nadia; Dufresne, Alain

2016-10-04

Composite materials were prepared by extrusion and injection molding from polybutyrate adipate terephthalate (PBAT) and high aspect ratio cellulose nanocrystals (CNCs) extracted from capim dourado fibers. Three CNC contents were used, corresponding to 0.5, 1, and 2 times the theoretical percolation threshold. Small-amplitude oscillary shear (SAOS) experiments show that as the CNC content increases, a more elastic behavior is observed but no percolating network can form within the polymeric matrix as a result of the high shear rates involved during the injection-molding process. Annealing of the samples at 170 °C was performed, and the possible reorganization of the nanofiller was investigated. This reorganization was further elucidated using 2D-SAOS and creep experiments.

Polyimide molding powder, coating, adhesive, and matrix resin

NASA Technical Reports Server (NTRS)

St.clair, Terry L. (Inventor); Progar, Donald J. (Inventor)

1992-01-01

The invention is a polyimide prepared from 3,4'-oxydianiline (3,4'-ODA) and 4,4'-oxydiphthalic anhydride (ODPA), in 2-methoxyethyl ether (diglyme). The polymer was prepared in ultra high molecular weight and in a controlled molecular weight form which has a 2.5 percent offset in stoichiometry (excess diamine) with a 5.0 percent level of phthalic anhydride as an endcap. This controlled molecular weight form allows for greatly improved processing of the polymer for moldings, adhesive bonding, and composite fabrication. The higher molecular weight version affords tougher films and coatings. The overall polymer structure groups in the dianhydride, the diamine, and a metal linkage in the diamine affords adequate flow properties for making this polymer useful as a molding powder, adhesive, and matrix resin.

Effects of Light Curing Method and Exposure Time on Mechanical Properties of Resin Based Dental Materials

PubMed Central

Alpöz, A. Riza; Ertuḡrul, Fahinur; Cogulu, Dilsah; Ak, Asli Topaloḡlu; Tanoḡlu, Metin; Kaya, Elçin

2008-01-01

Objectives The aim of this study was to investigate microhardness and compressive strength of composite resin (Tetric-Ceram, Ivoclar Vivadent), compomer (Compoglass, Ivoclar, Vivadent), and resin modified glass ionomer cement (Fuji II LC, GC Corp) polymerized using halogen light (Optilux 501, Demetron, Kerr) and LED (Bluephase C5, Ivoclar Vivadent) for different curing times. Methods Samples were placed in disc shaped plastic molds with uniform size of 5 mm diameter and 2 mm in thickness for surface microhardness test and placed in a diameter of 4 mm and a length of 2 mm teflon cylinders for compressive strength test. For each subgroup, 20 samples for microhardness (n=180) and 5 samples for compressive strength were prepared (n=45). In group 1, samples were polymerized using halogen light source for 40 seconds; in group 2 and 3 samples were polymerized using LED light source for 20 seconds and 40 seconds respectively. All data were analyzed by two way analysis of ANOVA and Tukey’s post-hoc tests. Results Same exposure time of 40 seconds with a low intensity LED was found similar or more efficient than a high intensity halogen light unit (P>.05), however application of LED for 20 seconds was found less efficient than 40 seconds curing time (P=.03). Conclusions It is important to increase the light curing time and use appropriate light curing devices to polymerize resin composite in deep cavities to maximize the hardness and compressive strength of restorative materials. PMID:19212507

Processing, thermal and mechanical behaviour of PEI/MWCNT/carbon fiber nanostructured laminate

NASA Astrophysics Data System (ADS)

Santos, L. F. P.; Ribeiro, B.; Hein, L. R. O.; Botelho, E. C.; Costa, M. L.

2017-11-01

In this work, nanostructured composites of polyetherimide (PEI) with addition of functionalized multiwall carbon nanotube (MWCNT) were processed via solution mixing. After processing, these nanocomposites were evaluated by thermogravimetry (TGA), dynamic-mechanical analysis (DMA), scanning electron microscopy (SEM) and atomic force microscopy (AFM). Subsequently, the nanocomposite was processed with carbon fibers by using hot compression molding. In order to evaluate interlaminar fracture strength, the processed laminates were mechanically evaluated by interlaminar shear strength (ILSS) and compression shear test (CST). Also, the Weibull distribution was employed to help in the statistical treatment of the data obtained from the mechanical tests. With regards to the fracture of the specimens, optical microscopy was used for the evaluation of the material. The addition of 1 wt% of MWCNT in the polymer matrix increased both thermal stability and viscoelastic behavior of the material. These improvements positively impacted the mechanical properties, generating a 16% and 58% increase in the short-beam strength and apparent interlaminar shear, respectively. In addition, it can be verified from morphological analysis of the fracture a change in the failure mode of the laminate by the incorporation of MWCNT. This behavior can be proven from CST test where there was no presence of the shear force by compression.

The algorithm of verification of welding process for plastic pipes

NASA Astrophysics Data System (ADS)

Rzasinski, R.

2017-08-01

The study analyzes the process of butt welding of PE pipes in terms of proper selection of connector parameters. The process was oriented to the elements performed as a series of types of pipes. Polymeric materials commonly referred to as polymers or plastics, synthetic materials are produced from oil products in the polyreaction compounds of low molecular weight, called monomers. During the polyreactions monomers combine to build a macromolecule material monomer named with the prefix poly polypropylene, polyethylene or polyurethane, creating particles in solid state on the order of 0,2 to 0,4 mm. Finished products from polymers of virtually any shape and size are obtained by compression molding, injection molding, extrusion, laminating, centrifugal casting, etc. Weld can only be a thermoplastic that softens at an elevated temperature, and thus can be connected via a clamp. Depending on the source and method of supplying heat include the following welding processes: welding contact, radiant welding, friction welding, dielectric welding, ultrasonic welding. The analysis will be welding contact. In connection with the development of new generation of polyethylene, and the production of pipes with increasing dimensions (diameter, wall thickness) is important to select the correct process.

Synthesis and characterization of a Hyaluronan-polyethylene copolymer for biomedical applications.

PubMed

Oldinski, Rachael A; Cranson, Cody N; James, Susan P

2010-08-01

Hyaluronan (HA)-based biomaterials are of interest for bone and cartilage tissue engineering because HA plays an important role in orthopedic tissue development, function, and repair. The goal of this project was to develop a biomaterial that incorporated the constituents of both a hydrogel and a hydrophobic polymer for biomedical applications. A series of amphiphilic graft copolymers consisting of HA, a glycosaminoglycan, and high-density polyethylene (HDPE), that is, HA-co-HDPE, were fabricated. The chemical characteristics, physical and viscoelastic properties, and cytocompatibility of novel HA-co-HDPE materials were characterized via Fourier Transform infrared (FTIR) spectroscopy, solid state nuclear magnetic resonance (ssNMR) spectroscopy, differential scanning calorimetry (DSC), dynamic shear testing, and an in vitro human osteoblast cell study. The esterification reaction between HA and functionalized HDPE resulted in semicrystalline, insoluble powder. The dynamic shear properties of HA-co-HDPE concentrated solutions were more like natural proteoglycans than the HA control. HA-co-HDPE was successfully compression molded into disks that swelled upon hydration. Osteoblasts were viable and expressed the osteoblast phenotype after 7 days of culture on HA-co-HDPE materials. These HA-co-HDPE materials may have several biomaterial applications in saline suspension or molded form, including orthopedic tissue repair.

Preparation of artificial kidney stones of reproducible size, shape, and mass by precision injection molding.

PubMed

Carey, Robert I; Kyle, Christopher C; Carey, Donna L; Leveillee, Raymond J

2008-01-01

To prepare artificial kidney stones of defined shape, size, mass, and material composition via precision injection molding of Ultracal 30 cement slurries into an inexpensive biodegradable mold. A calcium alginate and silica-based mold was used to prepare casts of varying shapes in a reproducible manner. Ultracal 30 cement slurries mixed 1:1 with water were injected into these casts and allowed to harden. The artificial stones were recovered and their physical properties determined. Ex-vivo and in-vivo responses to holmium laser lithotripsy were examined. Spheres, half spheres, cylinders, cubes, tapered conical structures, and flat angulated structures were prepared with high precision without post-molding manipulations. Large spheres of average mass 0.661 g (+/- 0.037), small spheres of average mass 0.046 g (+/- 0.0026), and hexagons of average mass 0.752 g (+/- 0.0180) were found to have densities (1610-1687 kg/m(3)) within the expected range for Ultracal 30 cement stones. Ex-vivo holmium laser lithotripsy of small spheres in saline showed uniformly reproducible efficiencies of comminution. Implantation of a tapered conical stone into the ureter of a porcine model demonstrated stone comminution in vivo consistent with that seen in the ex-vivo models. We present an environmentally safe, technically simple procedure for the formation of artificial kidney stones of predetermined size and shape. The technique does not require the use of hazardous solvents or postprocedural processing of the stones. These stones are intended for use in standardized experiments of lithotripsy efficiency in which the shape of the stone as well as the mass can be predetermined and precisely controlled.

Semi-contact-writing of polymer molds for prototyping PDMS chips with low surface roughness, sharp edges and locally varying channel heights

NASA Astrophysics Data System (ADS)

Gutzweiler, Ludwig; Stumpf, Fabian; Tanguy, Laurent; Roth, Guenter; Koltay, Peter; Zengerle, Roland; Riegger, Lutz

2016-04-01

Microfluidic systems fabricated in polydimethylsiloxane (PDMS) enable a broad variety of applications and are widespread in the field of Lab-on-a-Chip. Here we demonstrate semi-contact-writing, a novel method for fabrication of polymer based molds for casting microfluidic PDMS chips in a highly flexible, time and cost-efficient manner. The method is related to direct-writing of an aqueous polymer solution on a planar glass substrate and substitutes conventional, time- and cost-consuming UV-lithography. This technique facilitates on-demand prototyping in a low-cost manner and is therefore ideally suited for rapid chip layout iterations. No cleanroom facilities and less expertise are required. Fabrication time from scratch to ready-to-use PDMS-chip is less than 5 h. This polymer writing method enables structure widths down to 140 μm and controllable structure heights ranging from 5.5 μm for writing single layers up to 98 μm by stacking. As a unique property, freely selectable height variations across a substrate can be achieved by application of local stacking. Furthermore, the molds exhibit low surface roughness (R a   =  24 nm, R RMS  =  28 nm) and high fidelity edge sharpness. We validated the method by fabrication of molds to cast PDMS chips for droplet based flow-through PCR with single-cell sensitivity.

Development of porous lamellar poly(L-lactic acid) scaffolds by conventional injection molding process.

PubMed

Ghosh, Satyabrata; Viana, Júlio C; Reis, Rui L; Mano, João F

2008-07-01

A novel fabrication technique is proposed for the preparation of unidirectionally oriented, porous scaffolds by selective polymer leaching from lamellar structures created by conventional injection molding. The proof of the concept is implemented using a 50/50 wt.% poly(L-lactic acid)/poly(ethylene oxide) (PLLA/PEO) blend. With this composition, the PLLA and PEO blend is biphasic, containing a homogeneous PLLA/PEO phase and a PEO-rich phase. The two phases were structured using injection molding into well-defined alternating layers of homogeneous PLLA/PEO phase and PEO-rich phase. Leaching of water-soluble PEO from the PEO-rich phase produces macropores, and leaching of phase-separated PEO from the initially homogeneous PLLA/PEO phase produces micropores in the lamellae. Thus, scaffolds with a macroporous lamellar architecture with microporous walls can be produced. The lamellae are continuous along the flow direction, and a continuous lamellar thickness of less than 1 microm could be achieved. Porosities of 57-74% and pore sizes of around 50-100 microm can be obtained using this process. The tensile elastic moduli of the porous constructs were between 580 and 800 MPa. We propose that this organic-solvent-free method of preparing lamellar scaffolds with good mechanical properties, and the reproducibility associated with the injection molding technique, holds promise for a wide range of guided tissue engineering applications.

Analysis of the Mechanical Behavior and Surface Rugosity of Different Dental Die Materials.

PubMed

Niekawa, Ciro T; Kreve, Simone; A'vila, Gisseli Bertozzi; Godoy, Gilmar Gil; Eduardo Vieira da Silva, J R; Dias, Sergio Candido

2017-01-01

This work evaluated the mechanical and surface behavior of different die materials. The studied materials are polyurethane resin Exakto-Form (Bredent), Gypsum type IV, Fuji Rock EP (Gc), and Durone (Dentsply). Two metallic matrices molded in polyvinyl siloxane provided 30 cylindrical test specimens for the diametral compression test and 30 hemispherical test specimens for the surface rugosity test. The cylindrical test specimens were submitted to tests of diametral compression strength using a DL2000 universal assay machine, with a load cell of 2000 Kgf and constant speed of 1 mm/min connected to the software. Kruskal-Wallis and Dunn's nonparametric tests were used to analyze the results. The hemispheres were submitted to the surface rugosity assay using a SJ201-P rugosimeter with a sensitivity of 300 μm, speed of 0.5 mm/s, and cut-off of 0.8 mm, and the readings were taken on the convex surface of the test specimens and metallic matrix. Results were analyzed using with Fisher's least significant differences test (LSD) and Dunnett's test. Kruskal-Wallis test showed significant difference between die materials for diametral compression strength ( P = 0.002). Dunn's test showed significantly higher values for modified polyurethane resin (Exakto-Form). The gypsum type IV, which did not significantly differ regarding diametral compression strength, showed 34.0% (Durone) and 42.7% (Fuji Rock) lower values in comparison to Exakto-Form. Within the parameters adopted in this study, it is possible to conclude that Exakto-Form polyurethane resin showed higher resistance to compression and was closer to the metallic matrix rugosity, and, along with the gypsum type IV Durone, showed better reproducibility of details relative to the Fuji Rock.

Replication fidelity improvement of PMMA microlens array based on weight evaluation and optimization

NASA Astrophysics Data System (ADS)

Jiang, Bing-yan; Shen, Long-jiang; Peng, Hua-jiang; Yin, Xiang-lin

2007-12-01

High replication fidelity is a prerequisite of high quality plastic microlens array in injection molding. But, there's not an economical and practical method to evaluate and improve the replication fidelity until now. Based on part weight evaluation and optimization, this paper presents a new method of replication fidelity improvement. Firstly, a simplified analysis model of PMMA micro columns arrays (5×16) with 200μm diameter was set up. And then, Flow (3D) module of Moldflow MPI6.0 based on Navier-Stokes equations was used to calculate the weight of the micro columns arrays in injection molding. The effects of processing parameters (melt temperature, mold temperature, injection time, packing pressure and packing time) on the part weight were investigated in the simulations. The simulation results showed that the mold temperature and the injection time have important effects on the filling of micro columns; the optimal mold temperature and injection time for better replication fidelity could be determined by the curves of mold temperature vs part weight and injection time vs part weight. At last, the effects of processing parameters on part weight of micro columns array were studied experimentally. The experimental results showed that the increase of melt temperature and mold temperature can make the packing pressure transfer to micro cavity more effectively through runner system, and increase the part weight. From the observation results of the image measuring apparatus, it was discovered that the higher the part weight, the better the filling of the microstructures. In conclusion, part weight can be used to evaluate the replication fidelity of micro-feature structured parts primarily; which is an economical and practical method to improve the replication fidelity of microlens arrays based on weight evaluation and optimization.

Indirect three-dimensional printing of synthetic polymer scaffold based on thermal molding process.

PubMed

Park, Jeong Hun; Jung, Jin Woo; Kang, Hyun-Wook; Cho, Dong-Woo

2014-06-01

One of the major issues in tissue engineering has been the development of three-dimensional (3D) scaffolds, which serve as a structural template for cell growth and extracellular matrix formation. In scaffold-based tissue engineering, 3D printing (3DP) technology has been successfully applied for the fabrication of complex 3D scaffolds by using both direct and indirect techniques. In principle, direct 3DP techniques rely on the straightforward utilization of the final scaffold materials during the actual scaffold fabrication process. In contrast, indirect 3DP techniques use a negative mold based on a scaffold design, to which the desired biomaterial is cast and then sacrificed to obtain the final scaffold. Such indirect 3DP techniques generally impose a solvent-based process for scaffold fabrication, resulting in a considerable increase in the fabrication time and poor mechanical properties. In addition, the internal architecture of the resulting scaffold is affected by the properties of the biomaterial solution. In this study, we propose an advanced indirect 3DP technique using projection-based micro-stereolithography and an injection molding system (IMS) in order to address these challenges. The scaffold was fabricated by a thermal molding process using IMS to overcome the limitation of the solvent-based molding process in indirect 3DP techniques. The results indicate that the thermal molding process using an IMS has achieved a substantial reduction in scaffold fabrication time and has also provided the scaffold with higher mechanical modulus and strength. In addition, cell adhesion and proliferation studies have indicated no significant difference in cell activity between the scaffolds prepared by solvent-based and thermal molding processes.

Hybrid Deployable Foam Antennas and Reflectors

NASA Technical Reports Server (NTRS)

Rivellini, Tommaso; Willis, Paul; Hodges, Richard; Spitz, Suzanne

2006-01-01

Hybrid deployable radio antennas and reflectors of a proposed type would feature rigid narrower apertures plus wider adjoining apertures comprising reflective surfaces supported by open-cell polymeric foam structures (see figure). The open-cell foam structure of such an antenna would be compressed for compact stowage during transport. To initiate deployment of the antenna, the foam structure would simply be released from its stowage mechanical restraint. The elasticity of the foam would drive the expansion of the foam structure to its full size and shape. There are several alternatives for fabricating a reflective surface supported by a polymeric foam structure. One approach would be to coat the foam with a metal. Another approach would be to attach a metal film or a metal-coated polymeric membrane to the foam. Yet another approach would be to attach a metal mesh to the foam. The hybrid antenna design and deployment concept as proposed offers significant advantages over other concepts for deployable antennas: 1) In the unlikely event of failure to deploy, the rigid narrow portion of the antenna would still function, providing a minimum level of assured performance. In contrast, most other concepts for deploying a large antenna from compact stowage are of an "all or nothing" nature: the antenna is not useful at all until and unless it is fully deployed. 2) Stowage and deployment would not depend on complex mechanisms or actuators, nor would it involve the use of inflatable structures. Therefore, relative to antennas deployed by use of mechanisms, actuators, or inflation systems, this antenna could be lighter, cheaper, amenable to stowage in a smaller volume, and more reliable. An open-cell polymeric (e.g., polyurethane) foam offers several advantages for use as a compressible/expandable structural material to support a large antenna or reflector aperture. A few of these advantages are the following: 3) The open cellular structure is amenable to compression to a very small volume - typically to 1/20 of its full size in one dimension. 4) At a temperature above its glass-transition temperature (T(sub g)), the foam strongly damps vibrations. Even at a temperature below T(sub g), the damping should exceed that of other materials. 5) In its macroscopic mechanical properties, an open-cell foam is isotropic. This isotropy facilitates computational modeling of antenna structures. 6) Through chemical formulation, the T(sub g) of an open-cell polyurethane foam can be set at a desired value between about - 100 and about 0 C. Depending on the application, it may or may not be necessary to rigidify a foam structure after deployment. If rigidification is necessary, then the T(sub g) of the foam can be tailored to exceed the temperature of the deployment environment, in conjunction with providing a heater to elasticize the foam for deployment. Once deployed, the foam would become rigidified by cooling to below T(sub g). 7) Techniques for molding or machining polymeric foams (especially including open-cell polyurethane foams) to desired sizes and shapes are well developed.

A bioinspired study on the compressive resistance of helicoidal fibre structures

NASA Astrophysics Data System (ADS)

Tan, Ting; Ribbans, Brian

2017-10-01

Helicoidal fibre structures are widely observed in natural materials. In this paper, an integrated experimental and analytical approach was used to investigate the compressive resistance of helicoidal fibre structures. First, helicoidal fibre-reinforced composites were created using three-dimensionally printed helicoids and polymeric matrices, including plain, ring-reinforced and helix-reinforced helicoids. Then, load-displacement curves under monotonic compression tests were collected to measure the compressive strengths of helicoidal fibre composites. Fractographic characterization was performed using an X-ray microtomographer and scanning electron microscope, through which crack propagations in helicoidal structures were illustrated. Finally, mathematical modelling was performed to reveal the essential fibre architectures in the compressive resistance of helicoidal fibre structures. This work reveals that fibre-matrix ratios, helix pitch angles and interlayer rotary angles are critical to the compressive resistance of helicoidal structures.

Ozone decomposing filter

DOEpatents

Simandl, Ronald F.; Brown, John D.; Whinnery, Jr., LeRoy L.

1999-01-01

In an improved ozone decomposing air filter carbon fibers are held together with a carbonized binder in a perforated structure. The structure is made by combining rayon fibers with gelatin, forming the mixture in a mold, freeze-drying, and vacuum baking.

Molded transparent photopolymers and phase shift optics for fabricating three dimensional nanostructures

DOE PAGES

Jeon, Seokwoo; Shir, Daniel J.; Nam, Yun Suk; ...

2007-05-08

This paper introduces approaches that combine micro/nanomolding, or nanoimprinting, techniques with proximity optical phase mask lithographic methods to form three dimensional (3D) nanostructures in thick, transparent layers of photopolymers. The results demonstrate three strategies of this type, where molded relief structures in these photopolymers represent (i) fine (<1 μm) features that serve as the phase masks for their own exposure, (ii) coarse features (>1 μm) that are used with phase masks to provide access to large structure dimensions, and (iii) fine structures that are used together phase masks to achieve large, multilevel phase modulations. Several examples are provided, together withmore » optical modeling of the fabrication process and the transmission properties of certain of the fabricated structures. Lastly, these approaches provide capabilities in 3D fabrication that complement those of other techniques, with potential applications in photonics, microfluidics, drug delivery and other areas.« less

Shrink-induced superhydrophobic and antibacterial surfaces in consumer plastics.

PubMed

Freschauf, Lauren R; McLane, Jolie; Sharma, Himanshu; Khine, Michelle

2012-01-01

Structurally modified superhydrophobic surfaces have become particularly desirable as stable antibacterial surfaces. Because their self-cleaning and water resistant properties prohibit bacteria growth, structurally modified superhydrophobic surfaces obviate bacterial resistance common with chemical agents, and therefore a robust and stable means to prevent bacteria growth is possible. In this study, we present a rapid fabrication method for creating such superhydrophobic surfaces in consumer hard plastic materials with resulting antibacterial effects. To replace complex fabrication materials and techniques, the initial mold is made with commodity shrink-wrap film and is compatible with large plastic roll-to-roll manufacturing and scale-up techniques. This method involves a purely structural modification free of chemical additives leading to its inherent consistency over time and successive recasting from the same molds. Finally, antibacterial properties are demonstrated in polystyrene (PS), polycarbonate (PC), and polyethylene (PE) by demonstrating the prevention of gram-negative Escherichia coli (E. coli) bacteria growth on our structured plastic surfaces.

Electrolyzer assembly method and system

DOEpatents

Swala, Dana Ray; Bourgeois, Richard Scott; Paraszczak, Steven; Buckley, Donald Joseph

2017-05-23

The present techniques provide a novel electrolyzer and methods for welding components of such electrolyzers. The techniques may use conductors, such as resistance wires, placed in paths around the internal structural features and edges of the components. The conductors may be incorporated into the components during manufacture by injection molding, or other molding techniques, or may be tacked or otherwise applied to the surface of the components after manufacture. When current, a field or other excitation is applied to the conductors, the plastic surrounding the wire is melted. If this plastic is in direct contact with an adjoining component, a strong, hermetic seal may be formed between the two components, including the internal structural features.

Resin transfer molding of textile preforms for aircraft structural applications

NASA Technical Reports Server (NTRS)

Hasko, Gregory H.; Dexter, H. Benson; Weideman, Mark H.

1992-01-01

The NASA LaRC is conducting and supporting research to develop cost-effective fabrication methods that are applicable to primary composite aircraft structures. One of the most promising fabrication methods that has evolved is resin transfer molding (RTM) of dry textile material forms. RTM has been used for many years for secondary structures, but has received increased emphasis because it is an excellent method for applying resin to damage-tolerant textile preforms at low cost. Textile preforms based on processes such as weaving, braiding, knitting, stitching, and combinations of these have been shown to offer significant improvements in damage tolerance compared to laminated tape composites. The use of low-cost resins combined with textile preforms could provide a major breakthrough in achieving cost-effective composite aircraft structures. RTM uses resin in its lowest cost form, and storage and spoilage costs are minimal. Near net shape textile preforms are expected to be cost-effective because automated machines can be used to produce the preforms, post-cure operations such as machining and fastening are minimized, and material scrap rate may be reduced in comparison with traditional prepreg molding. The purpose of this paper is to discuss experimental and analytical techniques that are under development at NASA Langley to aid the engineer in developing RTM processes for airframe structural elements. Included are experimental techniques to characterize preform and resin behavior and analytical methods that were developed to predict resin flow and cure kinetics.

Method of manufacturing large dish reflectors for a solar concentrator apparatus

DOEpatents

Angel, Roger P [Tucson, AZ; Olbert, Blain H [Tucson, AZ

2011-12-27

A method of manufacturing monolithic glass reflectors for concentrating sunlight in a solar energy system is disclosed. The method of manufacturing allows large monolithic glass reflectors to be made from float glass in order to realize significant cost savings on the total system cost for a solar energy system. The method of manufacture includes steps of heating a sheet of float glass positioned over a concave mold until the sheet of glass sags and stretches to conform to the shape of the mold. The edges of the dish-shaped glass are rolled for structural stiffening around the periphery. The dish-shaped glass is then silvered to create a dish-shaped mirror that reflects solar radiation to a focus. The surface of the mold that contacts the float glass preferably has a grooved surface profile comprising a plurality of cusps and concave valleys. This grooved profile minimizes the contact area and marring of the specular glass surface, reduces parasitic heat transfer into the mold and increases mold lifetime. The disclosed method of manufacture is capable of high production rates sufficiently fast to accommodate the output of a conventional float glass production line so that monolithic glass reflectors can be produced as quickly as a float glass production can make sheets of float glass to be used in the process.

Fabrication of tissue engineered tympanic membrane patches using computer-aided design and injection molding.

PubMed

Hott, Morgan E; Megerian, Cliff A; Beane, Rich; Bonassar, Lawrence J

2004-07-01

The goal of the current study was to use computer-aided design and injection molding technologies to tissue engineer precisely shaped cartilage in the shape of butterfly tympanic membrane patches out of chondrocyte-seeded calcium alginate gels. Molds were designed on SolidWorks 2000 and built out of acrylonitrile butadiene styrene (ABS) using fused deposition modeling (FDM). Tympanic membrane patches were fabricated using bovine articular chondrocytes seeded at 50 x 10 cells/mL in 2% calcium alginate gels. Molded patches were cultured in vitro for up to 10 weeks and assessed biochemically, morphologically, and histologically. Unmolded patches demonstrated outstanding dimensional fidelity, with a volumetric precision of at least 3 microL, and maintained their shape well for up to 10 weeks of in vitro culture. Glycosaminoglycan and collagen content increased steadily over 10 weeks in culture, demonstrating continual deposition of new extracellular matrix consistent with new tissue development. The use of computer-aided design and injection molding technologies allows for the fabrication of very small, precisely shaped chondrocyte-seeded calcium alginate structures that faithfully maintain their shape during in vitro culture. In vitro fabrication of tympanic membrane patches with a precisely controlled geometry may have the potential to provide a minimally invasive alternative to traditional methods for the repair of chronic tympanic membrane perforations.