The role of fragment-based and computational methods in polypharmacology.

PubMed

Bottegoni, Giovanni; Favia, Angelo D; Recanatini, Maurizio; Cavalli, Andrea

2012-01-01

Polypharmacology-based strategies are gaining increased attention as a novel approach to obtaining potentially innovative medicines for multifactorial diseases. However, some within the pharmaceutical community have resisted these strategies because they can be resource-hungry in the early stages of the drug discovery process. Here, we report on fragment-based and computational methods that might accelerate and optimize the discovery of multitarget drugs. In particular, we illustrate that fragment-based approaches can be particularly suited for polypharmacology, owing to the inherent promiscuous nature of fragments. In parallel, we explain how computer-assisted protocols can provide invaluable insights into how to unveil compounds theoretically able to bind to more than one protein. Furthermore, several pragmatic aspects related to the use of these approaches are covered, thus offering the reader practical insights on multitarget-oriented drug discovery projects. Copyright © 2011 Elsevier Ltd. All rights reserved.

Ligand deconstruction: Why some fragment binding positions are conserved and others are not.

PubMed

Kozakov, Dima; Hall, David R; Jehle, Stefan; Jehle, Sefan; Luo, Lingqi; Ochiana, Stefan O; Jones, Elizabeth V; Pollastri, Michael; Allen, Karen N; Whitty, Adrian; Vajda, Sandor

2015-05-19

Fragment-based drug discovery (FBDD) relies on the premise that the fragment binding mode will be conserved on subsequent expansion to a larger ligand. However, no general condition has been established to explain when fragment binding modes will be conserved. We show that a remarkably simple condition can be developed in terms of how fragments coincide with binding energy hot spots--regions of the protein where interactions with a ligand contribute substantial binding free energy--the locations of which can easily be determined computationally. Because a substantial fraction of the free energy of ligand binding comes from interacting with the residues in the energetically most important hot spot, a ligand moiety that sufficiently overlaps with this region will retain its location even when other parts of the ligand are removed. This hypothesis is supported by eight case studies. The condition helps identify whether a protein is suitable for FBDD, predicts the size of fragments required for screening, and determines whether a fragment hit can be extended into a higher affinity ligand. Our results show that ligand binding sites can usefully be thought of in terms of an anchor site, which is the top-ranked hot spot and dominates the free energy of binding, surrounded by a number of weaker satellite sites that confer improved affinity and selectivity for a particular ligand and that it is the intrinsic binding potential of the protein surface that determines whether it can serve as a robust binding site for a suitably optimized ligand.

Ligand deconstruction: Why some fragment binding positions are conserved and others are not

PubMed Central

Kozakov, Dima; Hall, David R.; Jehle, Stefan; Luo, Lingqi; Ochiana, Stefan O.; Jones, Elizabeth V.; Pollastri, Michael; Allen, Karen N.; Whitty, Adrian; Vajda, Sandor

2015-01-01

Fragment-based drug discovery (FBDD) relies on the premise that the fragment binding mode will be conserved on subsequent expansion to a larger ligand. However, no general condition has been established to explain when fragment binding modes will be conserved. We show that a remarkably simple condition can be developed in terms of how fragments coincide with binding energy hot spots—regions of the protein where interactions with a ligand contribute substantial binding free energy—the locations of which can easily be determined computationally. Because a substantial fraction of the free energy of ligand binding comes from interacting with the residues in the energetically most important hot spot, a ligand moiety that sufficiently overlaps with this region will retain its location even when other parts of the ligand are removed. This hypothesis is supported by eight case studies. The condition helps identify whether a protein is suitable for FBDD, predicts the size of fragments required for screening, and determines whether a fragment hit can be extended into a higher affinity ligand. Our results show that ligand binding sites can usefully be thought of in terms of an anchor site, which is the top-ranked hot spot and dominates the free energy of binding, surrounded by a number of weaker satellite sites that confer improved affinity and selectivity for a particular ligand and that it is the intrinsic binding potential of the protein surface that determines whether it can serve as a robust binding site for a suitably optimized ligand. PMID:25918377

Structure solution of DNA-binding proteins and complexes with ARCIMBOLDO libraries

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pröpper, Kevin; Instituto de Biologia Molecular de Barcelona; Meindl, Kathrin

2014-06-01

The structure solution of DNA-binding protein structures and complexes based on the combination of location of DNA-binding protein motif fragments with density modification in a multi-solution frame is described. Protein–DNA interactions play a major role in all aspects of genetic activity within an organism, such as transcription, packaging, rearrangement, replication and repair. The molecular detail of protein–DNA interactions can be best visualized through crystallography, and structures emphasizing insight into the principles of binding and base-sequence recognition are essential to understanding the subtleties of the underlying mechanisms. An increasing number of high-quality DNA-binding protein structure determinations have been witnessed despite themore » fact that the crystallographic particularities of nucleic acids tend to pose specific challenges to methods primarily developed for proteins. Crystallographic structure solution of protein–DNA complexes therefore remains a challenging area that is in need of optimized experimental and computational methods. The potential of the structure-solution program ARCIMBOLDO for the solution of protein–DNA complexes has therefore been assessed. The method is based on the combination of locating small, very accurate fragments using the program Phaser and density modification with the program SHELXE. Whereas for typical proteins main-chain α-helices provide the ideal, almost ubiquitous, small fragments to start searches, in the case of DNA complexes the binding motifs and DNA double helix constitute suitable search fragments. The aim of this work is to provide an effective library of search fragments as well as to determine the optimal ARCIMBOLDO strategy for the solution of this class of structures.« less

Missing Fragments: Detecting Cooperative Binding in Fragment-Based Drug Design

PubMed Central

2012-01-01

The aim of fragment-based drug design (FBDD) is to identify molecular fragments that bind to alternate subsites within a given binding pocket leading to cooperative binding when linked. In this study, the binding of fragments to human phenylethanolamine N-methyltransferase is used to illustrate how (a) current protocols may fail to detect fragments that bind cooperatively, (b) theoretical approaches can be used to validate potential hits, and (c) apparent false positives obtained when screening against cocktails of fragments may in fact indicate promising leads. PMID:24900472

Hot spot analysis for driving the development of hits into leads in fragment based drug discovery

PubMed Central

Hall, David R.; Ngan, Chi Ho; Zerbe, Brandon S.; Kozakov, Dima; Vajda, Sandor

2011-01-01

Fragment based drug design (FBDD) starts with finding fragment-sized compounds that are highly ligand efficient and can serve as a core moiety for developing high affinity leads. Although the core-bound structure of a protein facilitates the construction of leads, effective design is far from straightforward. We show that protein mapping, a computational method developed to find binding hot spots and implemented as the FTMap server, provides information that complements the fragment screening results and can drive the evolution of core fragments into larger leads with a minimal loss or, in some cases, even a gain in ligand efficiency. The method places small molecular probes, the size of organic solvents, on a dense grid around the protein, and identifies the hot spots as consensus clusters formed by clusters of several probes. The hot spots are ranked based on the number of probe clusters, which predicts the binding propensity of the subsites and hence their importance for drug design. Accordingly, with a single exception the main hot spot identified by FTMap binds the core compound found by fragment screening. The most useful information is provided by the neighboring secondary hot spots, indicating the regions where the core can be extended to increase its affinity. To quantify this information, we calculate the density of probes from mapping, which describes the binding propensity at each point, and show that the change in the correlation between a ligand position and the probe density upon extending or repositioning the core moiety predicts the expected change in ligand efficiency. PMID:22145575

Characterization of the Artemisinin Binding Site for Translationally Controlled Tumor Protein (TCTP) by Bioorthogonal Click Chemistry.

PubMed

Li, Weichao; Zhou, Yiqing; Tang, Guanghui; Xiao, Youli

2016-12-21

Despite the fact that multiple artemisinin-alkylated proteins in Plasmodium falciparum have been identified in recent studies, the alkylation mechanism and accurate binding site of artemisinin-protein interaction have remained elusive. Here, we report the chemical-probe-based enrichment of the artemisinin-binding peptide and characterization of the artemisinin-binding site of P. falciparum translationally controlled tumor protein (TCTP). A peptide fragment within the N-terminal region of TCTP was enriched and found to be alkylated by an artemisinin-derived probe. MS2 fragments showed that artemisinin could alkylate multiple amino acids from Phe12 to Tyr22 of TCTP, which was supported by labeling experiments upon site-directed mutagenesis and computational modeling studies. Taken together, the "capture-and-release" strategy affords consolidated advantages previously unavailable in artemisinin-protein binding site studies, and our results deepened the understanding of the mechanism of protein alkylation via heme-activated artemisinin.

In silico fragment-based drug discovery: setup and validation of a fragment-to-lead computational protocol using S4MPLE.

PubMed

Hoffer, Laurent; Renaud, Jean-Paul; Horvath, Dragos

2013-04-22

This paper describes the use and validation of S4MPLE in Fragment-Based Drug Design (FBDD)--a strategy to build drug-like ligands starting from small compounds called fragments. S4MPLE is a conformational sampling tool based on a hybrid genetic algorithm that is able to simulate one (conformer enumeration) or more molecules (docking). The goal of the current paper is to show that due to the judicious design of genetic operators, S4MPLE may be used without any specific adaptation as an in silico FBDD tool. Such fragment-to-lead evolution involves either growing of one or linking of several fragment-like binder(s). The native ability to specifically "dock" a substructure that is covalently anchored to its target (here, some prepositioned fragment formally part of the binding site) enables it to act like dedicated de novo builders and differentiates it from most classical docking tools, which may only cope with non-covalent interactions. Besides, S4MPLE may address growing/linking scenarios involving protein site flexibility, and it might also suggest "growth" moves by bridging the ligand to the site via water-mediated interactions if H2O molecules are simply appended to the input files. Therefore, the only development overhead required to build a virtual fragment→ligand growing/linking strategy based on S4MPLE were two chemoinformatics programs meant to provide a minimalistic management of the linker library. The first creates a duplicate-free library by fragmenting a compound database, whereas the second builds new compounds, attaching chemically compatible linkers to the starting fragments. S4MPLE is subsequently used to probe the optimal placement of the linkers within the binding site, with initial restraints on atoms from initial fragments, followed by an optimization of all kept poses after restraint removal. Ranking is mainly based on two criteria: force-field potential energy and RMSD shifts of the original fragment moieties. This strategy was applied to several examples from the FBDD literature with good results over several monitored criteria: ability to generate the optimized ligand (or close analogs), good ranking of analogs among decoy compounds, and accurate predictions of expected binding modes of reference ligands. Simulations included "classical" covalent growing/linking, more challenging ones involving binding site conformational changes, and growth with optional recognition of putatively favorable water-mediated interactions.

Fragment-based lead generation: identification of seed fragments by a highly efficient fragment screening technology

NASA Astrophysics Data System (ADS)

Neumann, Lars; Ritscher, Allegra; Müller, Gerhard; Hafenbradl, Doris

2009-08-01

For the detection of the precise and unambiguous binding of fragments to a specific binding site on the target protein, we have developed a novel reporter displacement binding assay technology. The application of this technology for the fragment screening as well as the fragment evolution process with a specific modelling based design strategy is demonstrated for inhibitors of the protein kinase p38alpha. In a fragment screening approach seed fragments were identified which were then used to build compounds from the deep-pocket towards the hinge binding area of the protein kinase p38alpha based on a modelling approach. BIRB796 was used as a blueprint for the alignment of the fragments. The fragment evolution of these deep-pocket binding fragments towards the fully optimized inhibitor BIRB796 included the modulation of the residence time as well as the affinity. The goal of our study was to evaluate the robustness and efficiency of our novel fragment screening technology at high fragment concentrations, compare the screening data with biochemical activity data and to demonstrate the evolution of the hit fragments with fast kinetics, into slow kinetic inhibitors in an in silico approach.

Increasing Chemical Space Coverage by Combining Empirical and Computational Fragment Screens

PubMed Central

2015-01-01

Most libraries for fragment-based drug discovery are restricted to 1,000–10,000 compounds, but over 500,000 fragments are commercially available and potentially accessible by virtual screening. Whether this larger set would increase chemotype coverage, and whether a computational screen can pragmatically prioritize them, is debated. To investigate this question, a 1281-fragment library was screened by nuclear magnetic resonance (NMR) against AmpC β-lactamase, and hits were confirmed by surface plasmon resonance (SPR). Nine hits with novel chemotypes were confirmed biochemically with KI values from 0.2 to low mM. We also computationally docked 290,000 purchasable fragments with chemotypes unrepresented in the empirical library, finding 10 that had KI values from 0.03 to low mM. Though less novel than those discovered by NMR, the docking-derived fragments filled chemotype holes from the empirical library. Crystal structures of nine of the fragments in complex with AmpC β-lactamase revealed new binding sites and explained the relatively high affinity of the docking-derived fragments. The existence of chemotype holes is likely a general feature of fragment libraries, as calculation suggests that to represent the fragment substructures of even known biogenic molecules would demand a library of minimally over 32,000 fragments. Combining computational and empirical fragment screens enables the discovery of unexpected chemotypes, here by the NMR screen, while capturing chemotypes missing from the empirical library and tailored to the target, with little extra cost in resources. PMID:24807704

The importance of hydration thermodynamics in fragment-to-lead optimization.

PubMed

Ichihara, Osamu; Shimada, Yuzo; Yoshidome, Daisuke

2014-12-01

Using a computational approach to assess changes in solvation thermodynamics upon ligand binding, we investigated the effects of water molecules on the binding energetics of over 20 fragment hits and their corresponding optimized lead compounds. Binding activity and X-ray crystallographic data of published fragment-to-lead optimization studies from various therapeutically relevant targets were studied. The analysis reveals a distinct difference between the thermodynamic profile of water molecules displaced by fragment hits and those displaced by the corresponding optimized lead compounds. Specifically, fragment hits tend to displace water molecules with notably unfavorable excess entropies-configurationally constrained water molecules-relative to those displaced by the newly added moieties of the lead compound during the course of fragment-to-lead optimization. Herein we describe the details of this analysis with the goal of providing practical guidelines for exploiting thermodynamic signatures of binding site water molecules in the context of fragment-to-lead optimization. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Combining fragment homology modeling with molecular dynamics aims at prediction of Ca2+ binding sites in CaBPs

NASA Astrophysics Data System (ADS)

Pang, ChunLi; Cao, TianGuang; Li, JunWei; Jia, MengWen; Zhang, SuHua; Ren, ShuXi; An, HaiLong; Zhan, Yong

2013-08-01

The family of calcium-binding proteins (CaBPs) consists of dozens of members and contributes to all aspects of the cell's function, from homeostasis to learning and memory. However, the Ca2+-binding mechanism is still unclear for most of CaBPs. To identify the Ca2+-binding sites of CaBPs, this study presented a computational approach which combined the fragment homology modeling with molecular dynamics simulation. For validation, we performed a two-step strategy as follows: first, the approach is used to identify the Ca2+-binding sites of CaBPs, which have the EF-hand Ca2+-binding site and the detailed binding mechanism. To accomplish this, eighteen crystal structures of CaBPs with 49 Ca2+-binding sites are selected to be analyzed including calmodulin. The computational method identified 43 from 49 Ca2+-binding sites. Second, we performed the approach to large-conductance Ca2+-activated K+ (BK) channels which don't have clear Ca2+-binding mechanism. The simulated results are consistent with the experimental data. The computational approach may shed some light on the identification of Ca2+-binding sites in CaBPs.

Towards novel therapeutics for HIV through fragment-based screening and drug design.

PubMed

Tiefendbrunn, Theresa; Stout, C David

2014-01-01

Fragment-based drug discovery has been applied with varying levels of success to a number of proteins involved in the HIV (Human Immunodeficiency Virus) life cycle. Fragment-based approaches have led to the discovery of novel binding sites within protease, reverse transcriptase, integrase, and gp41. Novel compounds that bind to known pockets within CCR5 have also been identified via fragment screening, and a fragment-based approach to target the TAR-Tat interaction was explored. In the context of HIV-1 reverse transcriptase (RT), fragment-based approaches have yielded fragment hits with mid-μM activity in an in vitro activity assay, as well as fragment hits that are active against drug-resistant variants of RT. Fragment-based drug discovery is a powerful method to elucidate novel binding sites within proteins, and the method has had significant success in the context of HIV proteins.

Fragment-based screen against HIV protease.

PubMed

Perryman, Alexander L; Zhang, Qing; Soutter, Holly H; Rosenfeld, Robin; McRee, Duncan E; Olson, Arthur J; Elder, John E; Stout, C David

2010-03-01

We have employed a fragment-based screen against wild-type (NL4-3) HIV protease (PR) using the Active Sight fragment library and X-ray crystallography. The experiments reveal two new binding sites for small molecules. PR was co-crystallized with fragments, or crystals were soaked in fragment solutions, using five crystal forms, and 378 data sets were collected to 2.3-1.3 A resolution. Fragment binding induces a distinct conformation and specific crystal form of TL-3 inhibited PR during co-crystallization. One fragment, 2-methylcyclohexanol, binds in the 'exo site' adjacent to the Gly(16)Gly(17)Gln(18)loop where the amide of Gly(17)is a specific hydrogen bond donor, and hydrophobic contacts occur with the side chains of Lys(14)and Leu(63). Another fragment, indole-6-carboxylic acid, binds on the 'outside/top of the flap' via hydrophobic contacts with Trp(42), Pro(44), Met(46), and Lys(55), a hydrogen bond with Val(56), and a salt-bridge with Arg(57). 2-acetyl-benzothiophene also binds at this site. This study is the first fragment-based crystallographic screen against HIV PR, and the first time that fragments were screened against an inhibitor-bound drug target to search for compounds that both bind to novel sites and stabilize the inhibited conformation of the target.

Fragment-Based Screen against HIV Protease

PubMed Central

Perryman, A. L.; Zhang, Q.; Soutter, H. H.; Rosenfeld, R.; McRee, D. E.; Olson, A. J.; Elder, J. E.; Stout, C. D.

2009-01-01

We have employed a fragment-based screen against wild-type (NL4-3) HIV protease (PR) using the Active Sight fragment library and X-ray crystallography. The experiments reveal two new binding sites for small molecules. PR was co-crystallized with fragments, or crystals were soaked in fragment solutions, using five crystal forms, and 378 data sets were collected to 2.3-1.3 Å resolution. Fragment binding induces a distinct conformation and specific crystal form of TL-3 inhibited PR during co-crystallization. One fragment, 2-methylcyclohexanol, binds in the ‘exo site’ adjacent to the Gly16Gly17Gln18 loop where the amide of Gly17 is a specific hydrogen bond donor, and hydrophobic contacts occur with the side chains of Lys14 and Leu63. Another fragment, indole-6-carboxylic acid, binds on the ‘outside/top of the flap’ via hydrophobic contacts with Trp42, Pro44, Met46, and Lys55, a hydrogen bond with Val56, and a salt-bridge with Arg57. 2-acetyl-benzothiophene also binds at this site. This study is the first fragment-based crystallographic screen against HIV PR, and the first time that fragments were screened against an inhibitor-bound drug target to search for compounds that both bind to novel sites and stabilize the inhibited conformation of the target. PMID:20659109

The multiple roles of computational chemistry in fragment-based drug design

NASA Astrophysics Data System (ADS)

Law, Richard; Barker, Oliver; Barker, John J.; Hesterkamp, Thomas; Godemann, Robert; Andersen, Ole; Fryatt, Tara; Courtney, Steve; Hallett, Dave; Whittaker, Mark

2009-08-01

Fragment-based drug discovery (FBDD) represents a change in strategy from the screening of molecules with higher molecular weights and physical properties more akin to fully drug-like compounds, to the screening of smaller, less complex molecules. This is because it has been recognised that fragment hit molecules can be efficiently grown and optimised into leads, particularly after the binding mode to the target protein has been first determined by 3D structural elucidation, e.g. by NMR or X-ray crystallography. Several studies have shown that medicinal chemistry optimisation of an already drug-like hit or lead compound can result in a final compound with too high molecular weight and lipophilicity. The evolution of a lower molecular weight fragment hit therefore represents an attractive alternative approach to optimisation as it allows better control of compound properties. Computational chemistry can play an important role both prior to a fragment screen, in producing a target focussed fragment library, and post-screening in the evolution of a drug-like molecule from a fragment hit, both with and without the available fragment-target co-complex structure. We will review many of the current developments in the area and illustrate with some recent examples from successful FBDD discovery projects that we have conducted.

Computational fragment-based screening using RosettaLigand: the SAMPL3 challenge

NASA Astrophysics Data System (ADS)

Kumar, Ashutosh; Zhang, Kam Y. J.

2012-05-01

SAMPL3 fragment based virtual screening challenge provides a valuable opportunity for researchers to test their programs, methods and screening protocols in a blind testing environment. We participated in SAMPL3 challenge and evaluated our virtual fragment screening protocol, which involves RosettaLigand as the core component by screening a 500 fragments Maybridge library against bovine pancreatic trypsin. Our study reaffirmed that the real test for any virtual screening approach would be in a blind testing environment. The analyses presented in this paper also showed that virtual screening performance can be improved, if a set of known active compounds is available and parameters and methods that yield better enrichment are selected. Our study also highlighted that to achieve accurate orientation and conformation of ligands within a binding site, selecting an appropriate method to calculate partial charges is important. Another finding is that using multiple receptor ensembles in docking does not always yield better enrichment than individual receptors. On the basis of our results and retrospective analyses from SAMPL3 fragment screening challenge we anticipate that chances of success in a fragment screening process could be increased significantly with careful selection of receptor structures, protein flexibility, sufficient conformational sampling within binding pocket and accurate assignment of ligand and protein partial charges.

Nexus Between Protein–Ligand Affinity Rank-Ordering, Biophysical Approaches, and Drug Discovery

PubMed Central

2013-01-01

The confluence of computational and biophysical methods to accurately rank-order the binding affinities of small molecules and determine structures of macromolecular complexes is a potentially transformative advance in the work flow of drug discovery. This viewpoint explores the impact that advanced computational methods may have on the efficacy of small molecule drug discovery and optimization, particularly with respect to emerging fragment-based methods. PMID:24900579

Fast and Efficient Fragment-Based Lead Generation by Fully Automated Processing and Analysis of Ligand-Observed NMR Binding Data.

PubMed

Peng, Chen; Frommlet, Alexandra; Perez, Manuel; Cobas, Carlos; Blechschmidt, Anke; Dominguez, Santiago; Lingel, Andreas

2016-04-14

NMR binding assays are routinely applied in hit finding and validation during early stages of drug discovery, particularly for fragment-based lead generation. To this end, compound libraries are screened by ligand-observed NMR experiments such as STD, T1ρ, and CPMG to identify molecules interacting with a target. The analysis of a high number of complex spectra is performed largely manually and therefore represents a limiting step in hit generation campaigns. Here we report a novel integrated computational procedure that processes and analyzes ligand-observed proton and fluorine NMR binding data in a fully automated fashion. A performance evaluation comparing automated and manual analysis results on (19)F- and (1)H-detected data sets shows that the program delivers robust, high-confidence hit lists in a fraction of the time needed for manual analysis and greatly facilitates visual inspection of the associated NMR spectra. These features enable considerably higher throughput, the assessment of larger libraries, and shorter turn-around times.

Scrutinizing MHC-I binding peptides and their limits of variation.

PubMed

Koch, Christian P; Perna, Anna M; Pillong, Max; Todoroff, Nickolay K; Wrede, Paul; Folkers, Gerd; Hiss, Jan A; Schneider, Gisbert

2013-01-01

Designed peptides that bind to major histocompatibility protein I (MHC-I) allomorphs bear the promise of representing epitopes that stimulate a desired immune response. A rigorous bioinformatical exploration of sequence patterns hidden in peptides that bind to the mouse MHC-I allomorph H-2K(b) is presented. We exemplify and validate these motif findings by systematically dissecting the epitope SIINFEKL and analyzing the resulting fragments for their binding potential to H-2K(b) in a thermal denaturation assay. The results demonstrate that only fragments exclusively retaining the carboxy- or amino-terminus of the reference peptide exhibit significant binding potential, with the N-terminal pentapeptide SIINF as shortest ligand. This study demonstrates that sophisticated machine-learning algorithms excel at extracting fine-grained patterns from peptide sequence data and predicting MHC-I binding peptides, thereby considerably extending existing linear prediction models and providing a fresh view on the computer-based molecular design of future synthetic vaccines. The server for prediction is available at http://modlab-cadd.ethz.ch (SLiDER tool, MHC-I version 2012).

Relationship between Hot Spot Residues and Ligand Binding Hot Spots in Protein-Protein Interfaces

PubMed Central

Zerbe, Brandon S.; Hall, David R.

2013-01-01

In the context of protein-protein interactions, the term “hot spot” refers to a residue or cluster of residues that makes a major contribution to the binding free energy, as determined by alanine scanning mutagenesis. In contrast, in pharmaceutical research a hot spot is a site on a target protein that has high propensity for ligand binding and hence is potentially important for drug discovery. Here we examine the relationship between these two hot spot concepts by comparing alanine scanning data for a set of 15 proteins with results from mapping the protein surfaces for sites that can bind fragment-sized small molecules. We find the two types of hot spots are largely complementary; the residues protruding into hot spot regions identified by computational mapping or experimental fragment screening are almost always themselves hot spot residues as defined by alanine scanning experiments. Conversely, a residue that is found by alanine scanning to contribute little to binding rarely interacts with hot spot regions on the partner protein identified by fragment mapping. In spite of the strong correlation between the two hot spot concepts, they fundamentally differ, however. In particular, while identification of a hot spot by alanine scanning establishes the potential to generate substantial interaction energy with a binding partner, there are additional topological requirements to be a hot spot for small molecule binding. Hence, only a minority of hot spots identified by alanine scanning represent sites that are potentially useful for small inhibitor binding, and it is this subset that is identified by experimental or computational fragment screening. PMID:22770357

Relationship between hot spot residues and ligand binding hot spots in protein-protein interfaces.

PubMed

Zerbe, Brandon S; Hall, David R; Vajda, Sandor; Whitty, Adrian; Kozakov, Dima

2012-08-27

In the context of protein-protein interactions, the term "hot spot" refers to a residue or cluster of residues that makes a major contribution to the binding free energy, as determined by alanine scanning mutagenesis. In contrast, in pharmaceutical research, a hot spot is a site on a target protein that has high propensity for ligand binding and hence is potentially important for drug discovery. Here we examine the relationship between these two hot spot concepts by comparing alanine scanning data for a set of 15 proteins with results from mapping the protein surfaces for sites that can bind fragment-sized small molecules. We find the two types of hot spots are largely complementary; the residues protruding into hot spot regions identified by computational mapping or experimental fragment screening are almost always themselves hot spot residues as defined by alanine scanning experiments. Conversely, a residue that is found by alanine scanning to contribute little to binding rarely interacts with hot spot regions on the partner protein identified by fragment mapping. In spite of the strong correlation between the two hot spot concepts, they fundamentally differ, however. In particular, while identification of a hot spot by alanine scanning establishes the potential to generate substantial interaction energy with a binding partner, there are additional topological requirements to be a hot spot for small molecule binding. Hence, only a minority of hot spots identified by alanine scanning represent sites that are potentially useful for small inhibitor binding, and it is this subset that is identified by experimental or computational fragment screening.

Novel approach of fragment-based lead discovery applied to renin inhibitors.

PubMed

Tawada, Michiko; Suzuki, Shinkichi; Imaeda, Yasuhiro; Oki, Hideyuki; Snell, Gyorgy; Behnke, Craig A; Kondo, Mitsuyo; Tarui, Naoki; Tanaka, Toshimasa; Kuroita, Takanobu; Tomimoto, Masaki

2016-11-15

A novel approach was conducted for fragment-based lead discovery and applied to renin inhibitors. The biochemical screening of a fragment library against renin provided the hit fragment which showed a characteristic interaction pattern with the target protein. The hit fragment bound only to the S1, S3, and S3 SP (S3 subpocket) sites without any interactions with the catalytic aspartate residues (Asp32 and Asp215 (pepsin numbering)). Prior to making chemical modifications to the hit fragment, we first identified its essential binding sites by utilizing the hit fragment's substructures. Second, we created a new and smaller scaffold, which better occupied the identified essential S3 and S3 SP sites, by utilizing library synthesis with high-throughput chemistry. We then revisited the S1 site and efficiently explored a good building block attaching to the scaffold with library synthesis. In the library syntheses, the binding modes of each pivotal compound were determined and confirmed by X-ray crystallography and the library was strategically designed by structure-based computational approach not only to obtain a more active compound but also to obtain informative Structure Activity Relationship (SAR). As a result, we obtained a lead compound offering synthetic accessibility as well as the improved in vitro ADMET profiles. The fragments and compounds possessing a characteristic interaction pattern provided new structural insights into renin's active site and the potential to create a new generation of renin inhibitors. In addition, we demonstrated our FBDD strategy integrating highly sensitive biochemical assay, X-ray crystallography, and high-throughput synthesis and in silico library design aimed at fragment morphing at the initial stage was effective to elucidate a pocket profile and a promising lead compound. Copyright © 2016 Elsevier Ltd. All rights reserved.

BcL-xL Conformational Changes upon Fragment Binding Revealed by NMR

PubMed Central

Aguirre, Clémentine; ten Brink, Tim; Walker, Olivier; Guillière, Florence; Davesne, Dany; Krimm, Isabelle

2013-01-01

Protein-protein interactions represent difficult but increasingly important targets for the design of therapeutic compounds able to interfere with biological processes. Recently, fragment-based strategies have been proposed as attractive approaches for the elaboration of protein-protein surface inhibitors from fragment-like molecules. One major challenge in targeting protein-protein interactions is related to the structural adaptation of the protein surface upon molecular recognition. Methods capable of identifying subtle conformational changes of proteins upon fragment binding are therefore required at the early steps of the drug design process. In this report we present a fast NMR method able to probe subtle conformational changes upon fragment binding. The approach relies on the comparison of experimental fragment-induced Chemical Shift Perturbation (CSP) of amine protons to CSP simulated for a set of docked fragment poses, considering the ring-current effect from fragment binding. We illustrate the method by the retrospective analysis of the complex between the anti-apoptotic Bcl-xL protein and the fragment 4′-fluoro-[1,1′-biphenyl]-4-carboxylic acid that was previously shown to bind one of the Bcl-xL hot spots. The CSP-based approach shows that the protein undergoes a subtle conformational rearrangement upon interaction, for residues located in helices 2, 3 and the very beginning of 5. Our observations are corroborated by residual dipolar coupling measurements performed on the free and fragment-bound forms of the Bcl-xL protein. These NMR-based results are in total agreement with previous molecular dynamic calculations that evidenced a high flexibility of Bcl-xL around the binding site. Here we show that CSP of protein amine protons are useful and reliable structural probes. Therefore, we propose to use CSP simulation to assess protein conformational changes upon ligand binding in the fragment-based drug design approach. PMID:23717610

Bioisostere Identification by Determining the Amino Acid Binding Preferences of Common Chemical Fragments.

PubMed

Sato, Tomohiro; Hashimoto, Noriaki; Honma, Teruki

2017-12-26

To assist in the structural optimization of hit/lead compounds during drug discovery, various computational approaches to identify potentially useful bioisosteric conversions have been reported. Here, the preference of chemical fragments to hydrogen bonds with specific amino acid residues was used to identify potential bioisosteric conversions. We first compiled a data set of chemical fragments frequently occurring in complex structures contained in the Protein Data Bank. We then used a computational approach to determine the amino acids to which these chemical fragments most frequently hydrogen bonded. The results of the frequency analysis were used to hierarchically cluster chemical fragments according to their amino acid preferences. The Euclid distance between amino acid preferences of chemical fragments for hydrogen bonding was then compared to MMP information in the ChEMBL database. To demonstrate the applicability of the approach for compound optimization, the similarity of amino acid preferences was used to identify known bioisosteric conversions of the epidermal growth factor receptor inhibitor gefitinib. The amino acid preference distance successfully detected bioisosteric fragments corresponding to the morpholine ring in gefitinib with a higher ROC score compared to those based on topological similarity of substituents and frequency of MMP in the ChEMBL database.

Identifying Interactions that Determine Fragment Binding at Protein Hotspots.

PubMed

Radoux, Chris J; Olsson, Tjelvar S G; Pitt, Will R; Groom, Colin R; Blundell, Tom L

2016-05-12

Locating a ligand-binding site is an important first step in structure-guided drug discovery, but current methods do little to suggest which interactions within a pocket are the most important for binding. Here we illustrate a method that samples atomic hotspots with simple molecular probes to produce fragment hotspot maps. These maps specifically highlight fragment-binding sites and their corresponding pharmacophores. For ligand-bound structures, they provide an intuitive visual guide within the binding site, directing medicinal chemists where to grow the molecule and alerting them to suboptimal interactions within the original hit. The fragment hotspot map calculation is validated using experimental binding positions of 21 fragments and subsequent lead molecules. The ligands are found in high scoring areas of the fragment hotspot maps, with fragment atoms having a median percentage rank of 97%. Protein kinase B and pantothenate synthetase are examined in detail. In each case, the fragment hotspot maps are able to rationalize a Free-Wilson analysis of SAR data from a fragment-based drug design project.

Immobilization of Fab' fragments onto substrate surfaces: A survey of methods and applications.

PubMed

Crivianu-Gaita, Victor; Thompson, Michael

2015-08-15

Antibody immobilization onto surfaces has widespread applications in many different fields. It is desirable to bind antibodies such that their fragment-antigen-binding (Fab) units are oriented away from the surface in order to maximize analyte binding. The immobilization of only Fab' fragments yields benefits over the more traditional whole antibody immobilization technique. Bound Fab' fragments display higher surface densities, yielding a higher binding capacity for the analyte. The nucleophilic sulfide of the Fab' fragments allows for specific orientations to be achieved. For biosensors, this indicates a higher sensitivity and lower detection limit for a target analyte. The last thirty years have shown tremendous progress in the immobilization of Fab' fragments onto gold, Si-based, polysaccharide-based, plastic-based, magnetic, and inorganic surfaces. This review will show the current scope of Fab' immobilization techniques available and illustrate methods employed to minimize non-specific adsorption of undesirables. Furthermore, a variety of examples will be given to show the versatility of immobilized Fab' fragments in different applications and future directions of the field will be addressed, especially regarding biosensors. Copyright © 2015 Elsevier B.V. All rights reserved.

Creating Novel Activated Factor XI Inhibitors through Fragment Based Lead Generation and Structure Aided Drug Design

PubMed Central

Fjellström, Ola; Akkaya, Sibel; Beisel, Hans-Georg; Eriksson, Per-Olof; Erixon, Karl; Gustafsson, David; Jurva, Ulrik; Kang, Daiwu; Karis, David; Knecht, Wolfgang; Nerme, Viveca; Nilsson, Ingemar; Olsson, Thomas; Redzic, Alma; Roth, Robert; Sandmark, Jenny; Tigerström, Anna; Öster, Linda

2015-01-01

Activated factor XI (FXIa) inhibitors are anticipated to combine anticoagulant and profibrinolytic effects with a low bleeding risk. This motivated a structure aided fragment based lead generation campaign to create novel FXIa inhibitor leads. A virtual screen, based on docking experiments, was performed to generate a FXIa targeted fragment library for an NMR screen that resulted in the identification of fragments binding in the FXIa S1 binding pocket. The neutral 6-chloro-3,4-dihydro-1H-quinolin-2-one and the weakly basic quinolin-2-amine structures are novel FXIa P1 fragments. The expansion of these fragments towards the FXIa prime side binding sites was aided by solving the X-ray structures of reported FXIa inhibitors that we found to bind in the S1-S1’-S2’ FXIa binding pockets. Combining the X-ray structure information from the identified S1 binding 6-chloro-3,4-dihydro-1H-quinolin-2-one fragment and the S1-S1’-S2’ binding reference compounds enabled structure guided linking and expansion work to achieve one of the most potent and selective FXIa inhibitors reported to date, compound 13, with a FXIa IC50 of 1.0 nM. The hydrophilicity and large polar surface area of the potent S1-S1’-S2’ binding FXIa inhibitors compromised permeability. Initial work to expand the 6-chloro-3,4-dihydro-1H-quinolin-2-one fragment towards the prime side to yield molecules with less hydrophilicity shows promise to afford potent, selective and orally bioavailable compounds. PMID:25629509

Peptide docking of HIV-1 p24 with single chain fragment variable (scFv) by CDOCKER algorithm

NASA Astrophysics Data System (ADS)

Karim, Hana Atiqah Abdul; Tayapiwatana, Chatchai; Nimmanpipug, Piyarat; Zain, Sharifuddin M.; Rahman, Noorsaadah Abdul; Lee, Vannajan Sanghiran

2014-10-01

In search for the important residues that might have involve in the binding interaction between the p24 caspid protein of HIV-1 fragment (MET68 - PRO90) with the single chain fragment variable (scFv) of FAB23.5, modern computational chemistry approach has been conducted and applied. The p24 fragment was initially taken out from the 1AFV protein molecule consisting of both light (VL) and heavy (VH) chains of FAB23.5 as well as the HIV-1 caspid protein. From there, the p24 (antigen) fragment was made to dock back into the protein pocket receptor (antibody) by using the CDOCKER algorithm to conduct the molecular docking process. The score calculated from the CDOCKER gave 15 possible docked poses with various docked ligand's positions, the interaction energy as well as the binding energy. The best docked pose that imitates the original antigen's position was determined and further processed to the In Situ minimization to obtain the residues interaction energy as well as to observe the hydrogen bonds interaction in the protein-peptide complex. Based on the results demonstrated, the specific residues in the complex that have shown immense lower interaction energies in the 5Å vicinity region from the peptide are from the heavy chain (VH:TYR105) and light chain (VL: ASN31, TYR32, and GLU97). Those residues play vital roles in the binding mechanism of Antibody-Antigen (Ab-Ag) complex of p24 with FAB23.5.

Cryptic binding sites on proteins: definition, detection, and druggability.

PubMed

Vajda, Sandor; Beglov, Dmitri; Wakefield, Amanda E; Egbert, Megan; Whitty, Adrian

2018-05-22

Many proteins in their unbound structures lack surface pockets appropriately sized for drug binding. Hence, a variety of experimental and computational tools have been developed for the identification of cryptic sites that are not evident in the unbound protein but form upon ligand binding, and can provide tractable drug target sites. The goal of this review is to discuss the definition, detection, and druggability of such sites, and their potential value for drug discovery. Novel methods based on molecular dynamics simulations are particularly promising and yield a large number of transient pockets, but it has been shown that only a minority of such sites are generally capable of binding ligands with substantial affinity. Based on recent studies, current methodology can be improved by combining molecular dynamics with fragment docking and machine learning approaches. Copyright © 2018 Elsevier Ltd. All rights reserved.

Generating "fragment-based virtual library" using pocket similarity search of ligand-receptor complexes.

PubMed

Khashan, Raed S

2015-01-01

As the number of available ligand-receptor complexes is increasing, researchers are becoming more dedicated to mine these complexes to aid in the drug design and development process. We present free software which is developed as a tool for performing similarity search across ligand-receptor complexes for identifying binding pockets which are similar to that of a target receptor. The search is based on 3D-geometric and chemical similarity of the atoms forming the binding pocket. For each match identified, the ligand's fragment(s) corresponding to that binding pocket are extracted, thus forming a virtual library of fragments (FragVLib) that is useful for structure-based drug design. The program provides a very useful tool to explore available databases.

Studying the Chemistry of Cationized Triacylglycerols Using Electrospray Ionization Mass Spectrometry and Density Functional Theory Computations

NASA Astrophysics Data System (ADS)

Grossert, J. Stuart; Herrera, Lisandra Cubero; Ramaley, Louis; Melanson, Jeremy E.

2014-08-01

Analysis of triacylglycerols (TAGs), found as complex mixtures in living organisms, is typically accomplished using liquid chromatography, often coupled to mass spectrometry. TAGs, weak bases not protonated using electrospray ionization, are usually ionized by adduct formation with a cation, including those present in the solvent (e.g., Na+). There are relatively few reports on the binding of TAGs with cations or on the mechanisms by which cationized TAGs fragment. This work examines binding efficiencies, determined by mass spectrometry and computations, for the complexation of TAGs to a range of cations (Na+, Li+, K+, Ag+, NH4 +). While most cations bind to oxygen, Ag+ binding to unsaturation in the acid side chains is significant. The importance of dimer formation, [2TAG + M]+ was demonstrated using several different types of mass spectrometers. From breakdown curves, it became apparent that two or three acid side chains must be attached to glycerol for strong cationization. Possible mechanisms for fragmentation of lithiated TAGs were modeled by computations on tripropionylglycerol. Viable pathways were found for losses of neutral acids and lithium salts of acids from different positions on the glycerol moiety. Novel lactone structures were proposed for the loss of a neutral acid from one position of the glycerol moiety. These were studied further using triple-stage mass spectrometry (MS3). These lactones can account for all the major product ions in the MS3 spectra in both this work and the literature, which should allow for new insights into the challenging analytical methods needed for naturally occurring TAGs.

Binding Modes of Ligands Using Enhanced Sampling (BLUES): Rapid Decorrelation of Ligand Binding Modes via Nonequilibrium Candidate Monte Carlo.

PubMed

Gill, Samuel C; Lim, Nathan M; Grinaway, Patrick B; Rustenburg, Ariën S; Fass, Josh; Ross, Gregory A; Chodera, John D; Mobley, David L

2018-05-31

Accurately predicting protein-ligand binding affinities and binding modes is a major goal in computational chemistry, but even the prediction of ligand binding modes in proteins poses major challenges. Here, we focus on solving the binding mode prediction problem for rigid fragments. That is, we focus on computing the dominant placement, conformation, and orientations of a relatively rigid, fragment-like ligand in a receptor, and the populations of the multiple binding modes which may be relevant. This problem is important in its own right, but is even more timely given the recent success of alchemical free energy calculations. Alchemical calculations are increasingly used to predict binding free energies of ligands to receptors. However, the accuracy of these calculations is dependent on proper sampling of the relevant ligand binding modes. Unfortunately, ligand binding modes may often be uncertain, hard to predict, and/or slow to interconvert on simulation time scales, so proper sampling with current techniques can require prohibitively long simulations. We need new methods which dramatically improve sampling of ligand binding modes. Here, we develop and apply a nonequilibrium candidate Monte Carlo (NCMC) method to improve sampling of ligand binding modes. In this technique, the ligand is rotated and subsequently allowed to relax in its new position through alchemical perturbation before accepting or rejecting the rotation and relaxation as a nonequilibrium Monte Carlo move. When applied to a T4 lysozyme model binding system, this NCMC method shows over 2 orders of magnitude improvement in binding mode sampling efficiency compared to a brute force molecular dynamics simulation. This is a first step toward applying this methodology to pharmaceutically relevant binding of fragments and, eventually, drug-like molecules. We are making this approach available via our new Binding modes of ligands using enhanced sampling (BLUES) package which is freely available on GitHub.

Dissecting fragment-based lead discovery at the von Hippel-Lindau protein:hypoxia inducible factor 1α protein-protein interface.

PubMed

Van Molle, Inge; Thomann, Andreas; Buckley, Dennis L; So, Ernest C; Lang, Steffen; Crews, Craig M; Ciulli, Alessio

2012-10-26

Fragment screening is widely used to identify attractive starting points for drug design. However, its potential and limitations to assess the tractability of often challenging protein:protein interfaces have been underexplored. Here, we address this question by means of a systematic deconstruction of lead-like inhibitors of the pVHL:HIF-1α interaction into their component fragments. Using biophysical techniques commonly employed for screening, we could only detect binding of fragments that violate the Rule of Three, are more complex than those typically screened against classical druggable targets, and occupy two adjacent binding subsites at the interface rather than just one. Analyses based on ligand and group lipophilicity efficiency of anchored fragments were applied to dissect the individual subsites and probe for binding hot spots. The implications of our findings for targeting protein interfaces by fragment-based approaches are discussed. Copyright © 2012 Elsevier Ltd. All rights reserved.

A novel in silico approach to drug discovery via computational intelligence.

PubMed

Hecht, David; Fogel, Gary B

2009-04-01

A computational intelligence drug discovery platform is introduced as an innovative technology designed to accelerate high-throughput drug screening for generalized protein-targeted drug discovery. This technology results in collections of novel small molecule compounds that bind to protein targets as well as details on predicted binding modes and molecular interactions. The approach was tested on dihydrofolate reductase (DHFR) for novel antimalarial drug discovery; however, the methods developed can be applied broadly in early stage drug discovery and development. For this purpose, an initial fragment library was defined, and an automated fragment assembly algorithm was generated. These were combined with a computational intelligence screening tool for prescreening of compounds relative to DHFR inhibition. The entire method was assayed relative to spaces of known DHFR inhibitors and with chemical feasibility in mind, leading to experimental validation in future studies.

Fragment-based drug discovery and its application to challenging drug targets.

PubMed

Price, Amanda J; Howard, Steven; Cons, Benjamin D

2017-11-08

Fragment-based drug discovery (FBDD) is a technique for identifying low molecular weight chemical starting points for drug discovery. Since its inception 20 years ago, FBDD has grown in popularity to the point where it is now an established technique in industry and academia. The approach involves the biophysical screening of proteins against collections of low molecular weight compounds (fragments). Although fragments bind to proteins with relatively low affinity, they form efficient, high quality binding interactions with the protein architecture as they have to overcome a significant entropy barrier to bind. Of the biophysical methods available for fragment screening, X-ray protein crystallography is one of the most sensitive and least prone to false positives. It also provides detailed structural information of the protein-fragment complex at the atomic level. Fragment-based screening using X-ray crystallography is therefore an efficient method for identifying binding hotspots on proteins, which can then be exploited by chemists and biologists for the discovery of new drugs. The use of FBDD is illustrated here with a recently published case study of a drug discovery programme targeting the challenging protein-protein interaction Kelch-like ECH-associated protein 1:nuclear factor erythroid 2-related factor 2. © 2017 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

Fragment growing and linking lead to novel nanomolar lactate dehydrogenase inhibitors.

PubMed

Kohlmann, Anna; Zech, Stephan G; Li, Feng; Zhou, Tianjun; Squillace, Rachel M; Commodore, Lois; Greenfield, Matthew T; Lu, Xiaohui; Miller, David P; Huang, Wei-Sheng; Qi, Jiwei; Thomas, R Mathew; Wang, Yihan; Zhang, Sen; Dodd, Rory; Liu, Shuangying; Xu, Rongsong; Xu, Yongjin; Miret, Juan J; Rivera, Victor; Clackson, Tim; Shakespeare, William C; Zhu, Xiaotian; Dalgarno, David C

2013-02-14

Lactate dehydrogenase A (LDH-A) catalyzes the interconversion of lactate and pyruvate in the glycolysis pathway. Cancer cells rely heavily on glycolysis instead of oxidative phosphorylation to generate ATP, a phenomenon known as the Warburg effect. The inhibition of LDH-A by small molecules is therefore of interest for potential cancer treatments. We describe the identification and optimization of LDH-A inhibitors by fragment-based drug discovery. We applied ligand based NMR screening to identify low affinity fragments binding to LDH-A. The dissociation constants (K(d)) and enzyme inhibition (IC(50)) of fragment hits were measured by surface plasmon resonance (SPR) and enzyme assays, respectively. The binding modes of selected fragments were investigated by X-ray crystallography. Fragment growing and linking, followed by chemical optimization, resulted in nanomolar LDH-A inhibitors that demonstrated stoichiometric binding to LDH-A. Selected molecules inhibited lactate production in cells, suggesting target-specific inhibition in cancer cell lines.

Fragment-Linking Approach Using (19)F NMR Spectroscopy To Obtain Highly Potent and Selective Inhibitors of β-Secretase.

PubMed

Jordan, John B; Whittington, Douglas A; Bartberger, Michael D; Sickmier, E Allen; Chen, Kui; Cheng, Yuan; Judd, Ted

2016-04-28

Fragment-based drug discovery (FBDD) has become a widely used tool in small-molecule drug discovery efforts. One of the most commonly used biophysical methods in detecting weak binding of fragments is nuclear magnetic resonance (NMR) spectroscopy. In particular, FBDD performed with (19)F NMR-based methods has been shown to provide several advantages over (1)H NMR using traditional magnetization-transfer and/or two-dimensional methods. Here, we demonstrate the utility and power of (19)F-based fragment screening by detailing the identification of a second-site fragment through (19)F NMR screening that binds to a specific pocket of the aspartic acid protease, β-secretase (BACE-1). The identification of this second-site fragment allowed the undertaking of a fragment-linking approach, which ultimately yielded a molecule exhibiting a more than 360-fold increase in potency while maintaining reasonable ligand efficiency and gaining much improved selectivity over cathepsin-D (CatD). X-ray crystallographic studies of the molecules demonstrated that the linked fragments exhibited binding modes consistent with those predicted from the targeted screening approach, through-space NMR data, and molecular modeling.

Fragment-based drug discovery using rational design.

PubMed

Jhoti, H

2007-01-01

Fragment-based drug discovery (FBDD) is established as an alternative approach to high-throughput screening for generating novel small molecule drug candidates. In FBDD, relatively small libraries of low molecular weight compounds (or fragments) are screened using sensitive biophysical techniques to detect their binding to the target protein. A lower absolute affinity of binding is expected from fragments, compared to much higher molecular weight hits detected by high-throughput screening, due to their reduced size and complexity. Through the use of iterative cycles of medicinal chemistry, ideally guided by three-dimensional structural data, it is often then relatively straightforward to optimize these weak binding fragment hits into potent and selective lead compounds. As with most other lead discovery methods there are two key components of FBDD; the detection technology and the compound library. In this review I outline the two main approaches used for detecting the binding of low affinity fragments and also some of the key principles that are used to generate a fragment library. In addition, I describe an example of how FBDD has led to the generation of a drug candidate that is now being tested in clinical trials for the treatment of cancer.

Binding thermodynamics discriminates fragments from druglike compounds: a thermodynamic description of fragment-based drug discovery.

PubMed

Williams, Glyn; Ferenczy, György G; Ulander, Johan; Keserű, György M

2017-04-01

Small is beautiful - reducing the size and complexity of chemical starting points for drug design allows better sampling of chemical space, reveals the most energetically important interactions within protein-binding sites and can lead to improvements in the physicochemical properties of the final drug. The impact of fragment-based drug discovery (FBDD) on recent drug discovery projects and our improved knowledge of the structural and thermodynamic details of ligand binding has prompted us to explore the relationships between ligand-binding thermodynamics and FBDD. Information on binding thermodynamics can give insights into the contributions to protein-ligand interactions and could therefore be used to prioritise compounds with a high degree of specificity in forming key interactions. Copyright © 2016 Elsevier Ltd. All rights reserved.

Assessment of Dengue virus helicase and methyltransferase as targets for fragment-based drug discovery.

PubMed

Coutard, Bruno; Decroly, Etienne; Li, Changqing; Sharff, Andrew; Lescar, Julien; Bricogne, Gérard; Barral, Karine

2014-06-01

Seasonal and pandemic flaviviruses continue to be leading global health concerns. With the view to help drug discovery against Dengue virus (DENV), a fragment-based experimental approach was applied to identify small molecule ligands targeting two main components of the flavivirus replication complex: the NS3 helicase (Hel) and the NS5 mRNA methyltransferase (MTase) domains. A library of 500 drug-like fragments was first screened by thermal-shift assay (TSA) leading to the identification of 36 and 32 fragment hits binding Hel and MTase from DENV, respectively. In a second stage, we set up a fragment-based X-ray crystallographic screening (FBS-X) in order to provide both validated fragment hits and structural binding information. No fragment hit was confirmed for DENV Hel. In contrast, a total of seven fragments were identified as DENV MTase binders and structures of MTase-fragment hit complexes were solved at resolution at least 2.0Å or better. All fragment hits identified contain either a five- or six-membered aromatic ring or both, and three novel binding sites were located on the MTase. To further characterize the fragment hits identified by TSA and FBS-X, we performed enzymatic assays to assess their inhibition effect on the N7- and 2'-O-MTase enzymatic activities: five of these fragment hits inhibit at least one of the two activities with IC50 ranging from 180μM to 9mM. This work validates the FBS-X strategy for identifying new anti-flaviviral hits targeting MTase, while Hel might not be an amenable target for fragment-based drug discovery (FBDD). This approach proved to be a fast and efficient screening method for FBDD target validation and discovery of starting hits for the development of higher affinity molecules that bind to novel allosteric sites. Copyright © 2014 Elsevier B.V. All rights reserved.

Targeting lysine specific demethylase 4A (KDM4A) tandem TUDOR domain - A fragment based approach.

PubMed

Upadhyay, Anup K; Judge, Russell A; Li, Leiming; Pithawalla, Ron; Simanis, Justin; Bodelle, Pierre M; Marin, Violeta L; Henry, Rodger F; Petros, Andrew M; Sun, Chaohong

2018-06-01

The tandem TUDOR domains present in the non-catalytic C-terminal half of the KDM4A, 4B and 4C enzymes play important roles in regulating their chromatin localizations and substrate specificities. They achieve this regulatory role by binding to different tri-methylated lysine residues on histone H3 (H3-K4me3, H3-K23me3) and histone H4 (H4-K20me3) depending upon the specific chromatin environment. In this work, we have used a 2D-NMR based fragment screening approach to identify a novel fragment (1a), which binds to the KDM4A-TUDOR domain and shows modest competition with H3-K4me3 binding in biochemical as well as in vitro cell based assays. A co-crystal structure of KDM4A TUDOR domain in complex with 1a shows that the fragment binds stereo-specifically to the methyl lysine binding pocket forming a network of strong hydrogen bonds and hydrophobic interactions. We anticipate that the fragment 1a can be further developed into a novel allosteric inhibitor of the KDM4 family of enzymes through targeting their C-terminal tandem TUDOR domain. Copyright © 2018 Elsevier Ltd. All rights reserved.

Advances in fragment-based drug discovery platforms.

PubMed

Orita, Masaya; Warizaya, Masaichi; Amano, Yasushi; Ohno, Kazuki; Niimi, Tatsuya

2009-11-01

Fragment-based drug discovery (FBDD) has been established as a powerful alternative and complement to traditional high-throughput screening techniques for identifying drug leads. At present, this technique is widely used among academic groups as well as small biotech and large pharmaceutical companies. In recent years, > 10 new compounds developed with FBDD have entered clinical development, and more and more attention in the drug discovery field is being focused on this technique. Under the FBDD approach, a fragment library of relatively small compounds (molecular mass = 100 - 300 Da) is screened by various methods and the identified fragment hits which normally weakly bind to the target are used as starting points to generate more potent drug leads. Because FBDD is still a relatively new drug discovery technology, further developments and optimizations in screening platforms and fragment exploitation can be expected. This review summarizes recent advances in FBDD platforms and discusses the factors important for the successful application of this technique. Under the FBDD approach, both identifying the starting fragment hit to be developed and generating the drug lead from that starting fragment hit are important. Integration of various techniques, such as computational technology, X-ray crystallography, NMR, surface plasmon resonance, isothermal titration calorimetry, mass spectrometry and high-concentration screening, must be applied in a situation-appropriate manner.

AlphaSpace: Fragment-Centric Topographical Mapping To Target Protein–Protein Interaction Interfaces

PubMed Central

2016-01-01

Inhibition of protein–protein interactions (PPIs) is emerging as a promising therapeutic strategy despite the difficulty in targeting such interfaces with drug-like small molecules. PPIs generally feature large and flat binding surfaces as compared to typical drug targets. These features pose a challenge for structural characterization of the surface using geometry-based pocket-detection methods. An attractive mapping strategy—that builds on the principles of fragment-based drug discovery (FBDD)—is to detect the fragment-centric modularity at the protein surface and then characterize the large PPI interface as a set of localized, fragment-targetable interaction regions. Here, we introduce AlphaSpace, a computational analysis tool designed for fragment-centric topographical mapping (FCTM) of PPI interfaces. Our approach uses the alpha sphere construct, a geometric feature of a protein’s Voronoi diagram, to map out concave interaction space at the protein surface. We introduce two new features—alpha-atom and alpha-space—and the concept of the alpha-atom/alpha-space pair to rank pockets for fragment-targetability and to facilitate the evaluation of pocket/fragment complementarity. The resulting high-resolution interfacial map of targetable pocket space can be used to guide the rational design and optimization of small molecule or biomimetic PPI inhibitors. PMID:26225450

A fragment-based approach applied to a highly flexible target: Insights and challenges towards the inhibition of HSP70 isoforms

NASA Astrophysics Data System (ADS)

Jones, Alan M.; Westwood, Isaac M.; Osborne, James D.; Matthews, Thomas P.; Cheeseman, Matthew D.; Rowlands, Martin G.; Jeganathan, Fiona; Burke, Rosemary; Lee, Diane; Kadi, Nadia; Liu, Manjuan; Richards, Meirion; McAndrew, Craig; Yahya, Norhakim; Dobson, Sarah E.; Jones, Keith; Workman, Paul; Collins, Ian; van Montfort, Rob L. M.

2016-10-01

The heat shock protein 70s (HSP70s) are molecular chaperones implicated in many cancers and of significant interest as targets for novel cancer therapies. Several HSP70 inhibitors have been reported, but because the majority have poor physicochemical properties and for many the exact mode of action is poorly understood, more detailed mechanistic and structural insight into ligand-binding to HSP70s is urgently needed. Here we describe the first comprehensive fragment-based inhibitor exploration of an HSP70 enzyme, which yielded an amino-quinazoline fragment that was elaborated to a novel ATP binding site ligand with different physicochemical properties to known adenosine-based HSP70 inhibitors. Crystal structures of amino-quinazoline ligands bound to the different conformational states of the HSP70 nucleotide binding domain highlighted the challenges of a fragment-based approach when applied to this particular flexible enzyme class with an ATP-binding site that changes shape and size during its catalytic cycle. In these studies we showed that Ser275 is a key residue in the selective binding of ATP. Additionally, the structural data revealed a potential functional role for the ATP ribose moiety in priming the protein for the formation of the ATP-bound pre-hydrolysis complex by influencing the conformation of one of the phosphate binding loops.

Molecularly Imprinted Polymers with DNA Aptamer Fragments as Macromonomers.

PubMed

Zhang, Zijie; Liu, Juewen

2016-03-01

Molecularly imprinted polymers (MIPs) are produced in the presence of a template molecule. After removing the template, the cavity can selectively rebind the template. MIPs are attractive functional materials with a low cost and high stability, but traditional MIPs often suffer from low binding affinity. This study employs DNA aptamer fragments as macromonomers to improve MIPs. The DNA aptamer for adenosine was first split into two halves, fluorescently labeled, and copolymerized into MIPs. With a fluorescence quenching assay, the importance of imprinting was confirmed. Further studies were carried out using isothermal titration calorimetry (ITC). Compared to the mixture of the free aptamer fragments, their MIPs doubled the binding affinity. Each free aptamer fragment alone cannot bind adenosine, whereas MIPs containing each fragment are effective binders. We further shortened one of the aptamer fragments, and the DNA length was pushed to as short as six nucleotides, yielding MIPs with a dissociation constant of 27 μM adenosine. This study provides a new method for preparing functional MIP materials by combining high-affinity biopolymer fragments with low-cost synthetic monomers, allowing higher binding affinity and providing a method for signaling binding based on DNA chemistry.

A Fragment-Based Ligand Screen Against Part of a Large Protein Machine: The ND1 Domains of the AAA+ ATPase p97/VCP.

PubMed

Chimenti, Michael S; Bulfer, Stacie L; Neitz, R Jeffrey; Renslo, Adam R; Jacobson, Matthew P; James, Thomas L; Arkin, Michelle R; Kelly, Mark J S

2015-07-01

The ubiquitous AAA+ ATPase p97 functions as a dynamic molecular machine driving several cellular processes. It is essential in regulating protein homeostasis, and it represents a potential drug target for cancer, particularly when there is a greater reliance on the endoplasmic reticulum-associated protein degradation pathway and ubiquitin-proteasome pathway to degrade an overabundance of secreted proteins. Here, we report a case study for using fragment-based ligand design approaches against this large and dynamic hexamer, which has multiple potential binding sites for small molecules. A screen of a fragment library was conducted by surface plasmon resonance (SPR) and followed up by nuclear magnetic resonance (NMR), two complementary biophysical techniques. Virtual screening was also carried out to examine possible binding sites for the experimental hits and evaluate the potential utility of fragment docking for this target. Out of this effort, 13 fragments were discovered that showed reversible binding with affinities between 140 µM and 1 mM, binding stoichiometries of 1:1 or 2:1, and good ligand efficiencies. Structural data for fragment-protein interactions were obtained with residue-specific [U-(2)H] (13)CH3-methyl-labeling NMR strategies, and these data were compared to poses from docking. The combination of virtual screening, SPR, and NMR enabled us to find and validate a number of interesting fragment hits and allowed us to gain an understanding of the structural nature of fragment binding. © 2015 Society for Laboratory Automation and Screening.

Homo-trimerization is essential for the transcription factor function of Myrf for oligodendrocyte differentiation.

PubMed

Kim, Dongkyeong; Choi, Jin-Ok; Fan, Chuandong; Shearer, Randall S; Sharif, Mohamed; Busch, Patrick; Park, Yungki

2017-05-19

Myrf is a key transcription factor for oligodendrocyte differentiation and central nervous system myelination. We and others have previously shown that Myrf is generated as a membrane protein in the endoplasmic reticulum (ER), and that it undergoes auto-processing to release its N-terminal fragment from the ER, which enters the nucleus to work as a transcription factor. These previous studies allow a glimpse into the unusual complexity behind the biogenesis and function of the transcription factor domain of Myrf. Here, we report that Myrf N-terminal fragments assemble into stable homo-trimers before ER release. Consequently, Myrf N-terminal fragments are released from the ER only as homo-trimers. Our re-analysis of a previous genetic screening result in Caenorhabditis elegans shows that homo-trimerization is essential for the biological functions of Myrf N-terminal fragment, and that the region adjacent to the DNA-binding domain is pivotal to its homo-trimerization. Further, our computational analysis uncovered a novel homo-trimeric DNA motif that mediates the homo-trimeric DNA binding of Myrf N-terminal fragments. Importantly, we found that homo-trimerization defines the DNA binding specificity of Myrf N-terminal fragments. In sum, our study elucidates the molecular mechanism governing the biogenesis and function of Myrf N-terminal fragments and its physiological significance. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

SPR-based fragment screening with neurotensin receptor 1 generates novel small molecule ligands

PubMed Central

Huber, Sylwia; Casagrande, Fabio; Hug, Melanie N.; Wang, Lisha; Heine, Philipp; Kummer, Lutz; Plückthun, Andreas; Hennig, Michael

2017-01-01

The neurotensin receptor 1 represents an important drug target involved in various diseases of the central nervous system. So far, the full exploitation of potential therapeutic activities has been compromised by the lack of compounds with favorable physicochemical and pharmacokinetic properties which efficiently penetrate the blood-brain barrier. Recent progress in the generation of stabilized variants of solubilized neurotensin receptor 1 and its subsequent purification and successful structure determination presents a solid starting point to apply the approach of fragment-based screening to extend the chemical space of known neurotensin receptor 1 ligands. In this report, surface plasmon resonance was used as primary method to screen 6369 compounds. Thereby 44 hits were identified and confirmed in competition as well as dose-response experiments. Furthermore, 4 out of 8 selected hits were validated using nuclear magnetic resonance spectroscopy as orthogonal biophysical method. Computational analysis of the compound structures, taking the known crystal structure of the endogenous peptide agonist into consideration, gave insight into the potential fragment-binding location and interactions and inspires chemistry efforts for further exploration of the fragments. PMID:28510609

Computational Fragment-Based Drug Design: Current Trends, Strategies, and Applications.

PubMed

Bian, Yuemin; Xie, Xiang-Qun Sean

2018-04-09

Fragment-based drug design (FBDD) has become an effective methodology for drug development for decades. Successful applications of this strategy brought both opportunities and challenges to the field of Pharmaceutical Science. Recent progress in the computational fragment-based drug design provide an additional approach for future research in a time- and labor-efficient manner. Combining multiple in silico methodologies, computational FBDD possesses flexibilities on fragment library selection, protein model generation, and fragments/compounds docking mode prediction. These characteristics provide computational FBDD superiority in designing novel and potential compounds for a certain target. The purpose of this review is to discuss the latest advances, ranging from commonly used strategies to novel concepts and technologies in computational fragment-based drug design. Particularly, in this review, specifications and advantages are compared between experimental and computational FBDD, and additionally, limitations and future prospective are discussed and emphasized.

Generation of Polar Semi-Saturated Bicyclic Pyrazoles for Fragment-Based Drug Discovery Campaigns.

PubMed

Luise, Nicola; Wyatt, Paul

2018-05-07

Synthesising polar semi-saturated bicyclic heterocycles can lead to better starting points for fragment-based drug discovery (FBDD) programs. This communication highlights the application of diverse chemistry to construct bicyclic systems from a common intermediate, where pyrazole, a privileged heteroaromatic able to bind effectively to biological targets, is fused to diverse saturated counterparts. The generated fragments can be further developed either after confirmation of their binding pose or early in the process, as their synthetic intermediates. Essential quality control (QC) for selection of small molecules to add to a fragment library is discussed. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Lessons from hot spot analysis for fragment-based drug discovery

PubMed Central

Hall, David R.; Vajda, Sandor

2015-01-01

Analysis of binding energy hot spots at protein surfaces can provide crucial insights into the prospects for successful application of fragment-based drug discovery (FBDD), and whether a fragment hit can be advanced into a high affinity, druglike ligand. The key factor is the strength of the top ranking hot spot, and how well a given fragment complements it. We show that published data are sufficient to provide a sophisticated and quantitative understanding of how hot spots derive from protein three-dimensional structure, and how their strength, number and spatial arrangement govern the potential for a surface site to bind to fragment-sized and larger ligands. This improved understanding provides important guidance for the effective application of FBDD in drug discovery. PMID:26538314

Solution NMR Spectroscopy in Target-Based Drug Discovery.

PubMed

Li, Yan; Kang, Congbao

2017-08-23

Solution NMR spectroscopy is a powerful tool to study protein structures and dynamics under physiological conditions. This technique is particularly useful in target-based drug discovery projects as it provides protein-ligand binding information in solution. Accumulated studies have shown that NMR will play more and more important roles in multiple steps of the drug discovery process. In a fragment-based drug discovery process, ligand-observed and protein-observed NMR spectroscopy can be applied to screen fragments with low binding affinities. The screened fragments can be further optimized into drug-like molecules. In combination with other biophysical techniques, NMR will guide structure-based drug discovery. In this review, we describe the possible roles of NMR spectroscopy in drug discovery. We also illustrate the challenges encountered in the drug discovery process. We include several examples demonstrating the roles of NMR in target-based drug discoveries such as hit identification, ranking ligand binding affinities, and mapping the ligand binding site. We also speculate the possible roles of NMR in target engagement based on recent processes in in-cell NMR spectroscopy.

Discovery of Potent Myeloid Cell Leukemia 1 (Mcl-1) Inhibitors Using Fragment-Based Methods and Structure-Based Design

DOE Office of Scientific and Technical Information (OSTI.GOV)

Friberg, Anders; Vigil, Dominico; Zhao, Bin

2012-12-17

Myeloid cell leukemia 1 (Mcl-1), a member of the Bcl-2 family of proteins, is overexpressed and amplified in various cancers and promotes the aberrant survival of tumor cells that otherwise would undergo apoptosis. Here we describe the discovery of potent and selective Mcl-1 inhibitors using fragment-based methods and structure-based design. NMR-based screening of a large fragment library identified two chemically distinct hit series that bind to different sites on Mcl-1. Members of the two fragment classes were merged together to produce lead compounds that bind to Mcl-1 with a dissociation constant of <100 nM with selectivity for Mcl-1 over Bcl-xLmore » and Bcl-2. Structures of merged compounds when complexed to Mcl-1 were obtained by X-ray crystallography and provide detailed information about the molecular recognition of small-molecule ligands binding Mcl-1. The compounds represent starting points for the discovery of clinically useful Mcl-1 inhibitors for the treatment of a wide variety of cancers.« less

Fragment-based protein-protein interaction antagonists of a viral dimeric protease

PubMed Central

Gable, Jonathan E.; Lee, Gregory M.; Acker, Timothy M.; Hulce, Kaitlin R.; Gonzalez, Eric R.; Schweigler, Patrick; Melkko, Samu; Farady, Christopher J.; Craik, Charles S.

2016-01-01

Fragment-based drug discovery has shown promise as an approach for challenging targets such as protein-protein interfaces. We developed and applied an activity-based fragment screen against dimeric Kaposi’s sarcoma-associated herpesvirus protease (KSHV Pr) using an optimized fluorogenic substrate. Dose response determination was performed as a confirmation screen and NMR spectroscopy was used to map fragment inhibitor binding to KSHV Pr. Kinetic assays demonstrated that several initial hits also inhibit human cytomegalovirus protease (HCMV Pr). Binding of these hits to HCMV Pr was also confirmed via NMR spectroscopy. Despite the use of a target-agnostic fragment library, more than 80% of confirmed hits disrupted dimerization and bound to a previously reported pocket at the dimer interface of KSHV Pr, not to the active site. One class of fragments, an aminothiazole scaffold, was further explored using commercially available analogs. These compounds demonstrated greater than 100-fold improvement of inhibition. This study illustrates the power of fragment-based screening for these challenging enzymatic targets and provides an example of the potential druggability of pockets at protein-protein interfaces. PMID:26822284

Small Molecule Regulation of Protein Conformation by Binding in the Flap of HIV Protease

PubMed Central

Tiefenbrunn, Theresa; Forli, Stefano; Baksh, Michael M.; Chang, Max W.; Happer, Meaghan; Lin, Ying-Chuan; Perryman, Alexander L.; Rhee, Jin-Kyu; Torbett, Bruce E.; Olson, Arthur J.; Elder, John H.; Finn, M. G.; Stout, C. David

2013-01-01

The fragment indole-6-carboxylic acid (1F1), previously identified as a flap site binder in a fragment-based screen against HIV protease (PR), has been co-crystallized with pepstatin-inhibited PR and with apo-PR. Another fragment, 3-indolepropionic acid (1F1-N), predicted by AutoDock calculations and confirmed in a novel ‘inhibition of nucleation’ crystallization assay, exploits the same interactions in the flap site in two crystal structures. Both 1F1 and 1F1-N bind to the closed form of apo-PR and to pepstatin:PR. In solution, 1F1 and 1F1-N raise the Tm of apo-PR by 3.5–5 °C as assayed by differential scanning fluorimetry (DSF), and show equivalent low-micromolar binding constants to both apo-PR and pepstatin:PR, assayed by backscattering interferometry (BSI). The observed signal intensities in BSI are greater for each fragment upon binding to apo-PR than to pepstatin-bound PR, consistent with greater conformational change in the former binding event. Together, these data indicate that fragment binding in the flap site favors a closed conformation of HIV PR. PMID:23540839

Native State Mass Spectrometry, Surface Plasmon Resonance, and X-ray Crystallography Correlate Strongly as a Fragment Screening Combination.

PubMed

Woods, Lucy A; Dolezal, Olan; Ren, Bin; Ryan, John H; Peat, Thomas S; Poulsen, Sally-Ann

2016-03-10

Fragment-based drug discovery (FBDD) is contingent on the development of analytical methods to identify weak protein-fragment noncovalent interactions. Herein we have combined an underutilized fragment screening method, native state mass spectrometry, together with two proven and popular fragment screening methods, surface plasmon resonance and X-ray crystallography, in a fragment screening campaign against human carbonic anhydrase II (CA II). In an initial fragment screen against a 720-member fragment library (the "CSIRO Fragment Library") seven CA II binding fragments, including a selection of nonclassical CA II binding chemotypes, were identified. A further 70 compounds that comprised the initial hit chemotypes were subsequently sourced from the full CSIRO compound collection and screened. The fragment results were extremely well correlated across the three methods. Our findings demonstrate that there is a tremendous opportunity to apply native state mass spectrometry as a complementary fragment screening method to accelerate drug discovery.

Native Mass Spectrometry in Fragment-Based Drug Discovery.

PubMed

Pedro, Liliana; Quinn, Ronald J

2016-07-28

The advent of native mass spectrometry (MS) in 1990 led to the development of new mass spectrometry instrumentation and methodologies for the analysis of noncovalent protein-ligand complexes. Native MS has matured to become a fast, simple, highly sensitive and automatable technique with well-established utility for fragment-based drug discovery (FBDD). Native MS has the capability to directly detect weak ligand binding to proteins, to determine stoichiometry, relative or absolute binding affinities and specificities. Native MS can be used to delineate ligand-binding sites, to elucidate mechanisms of cooperativity and to study the thermodynamics of binding. This review highlights key attributes of native MS for FBDD campaigns.

Lessons from Hot Spot Analysis for Fragment-Based Drug Discovery.

PubMed

Hall, David R; Kozakov, Dima; Whitty, Adrian; Vajda, Sandor

2015-11-01

Analysis of binding energy hot spots at protein surfaces can provide crucial insights into the prospects for successful application of fragment-based drug discovery (FBDD), and whether a fragment hit can be advanced into a high-affinity, drug-like ligand. The key factor is the strength of the top ranking hot spot, and how well a given fragment complements it. We show that published data are sufficient to provide a sophisticated and quantitative understanding of how hot spots derive from a protein 3D structure, and how their strength, number, and spatial arrangement govern the potential for a surface site to bind to fragment-sized and larger ligands. This improved understanding provides important guidance for the effective application of FBDD in drug discovery. Copyright © 2015 Elsevier Ltd. All rights reserved.

In silico fragment-based drug design.

PubMed

Konteatis, Zenon D

2010-11-01

In silico fragment-based drug design (FBDD) is a relatively new approach inspired by the success of the biophysical fragment-based drug discovery field. Here, we review the progress made by this approach in the last decade and showcase how it complements and expands the capabilities of biophysical FBDD and structure-based drug design to generate diverse, efficient drug candidates. Advancements in several areas of research that have enabled the development of in silico FBDD and some applications in drug discovery projects are reviewed. The reader is introduced to various computational methods that are used for in silico FBDD, the fragment library composition for this technique, special applications used to identify binding sites on the surface of proteins and how to assess the druggability of these sites. In addition, the reader will gain insight into the proper application of this approach from examples of successful programs. In silico FBDD captures a much larger chemical space than high-throughput screening and biophysical FBDD increasing the probability of developing more diverse, patentable and efficient molecules that can become oral drugs. The application of in silico FBDD holds great promise for historically challenging targets such as protein-protein interactions. Future advances in force fields, scoring functions and automated methods for determining synthetic accessibility will all aid in delivering more successes with in silico FBDD.

Combining H/D exchange mass spectroscopy and computational docking reveals extended DNA-binding surface on uracil-DNA glycosylase

PubMed Central

Roberts, Victoria A.; Pique, Michael E.; Hsu, Simon; Li, Sheng; Slupphaug, Geir; Rambo, Robert P.; Jamison, Jonathan W.; Liu, Tong; Lee, Jun H.; Tainer, John A.; Ten Eyck, Lynn F.; Woods, Virgil L.

2012-01-01

X-ray crystallography provides excellent structural data on protein–DNA interfaces, but crystallographic complexes typically contain only small fragments of large DNA molecules. We present a new approach that can use longer DNA substrates and reveal new protein–DNA interactions even in extensively studied systems. Our approach combines rigid-body computational docking with hydrogen/deuterium exchange mass spectrometry (DXMS). DXMS identifies solvent-exposed protein surfaces; docking is used to create a 3-dimensional model of the protein–DNA interaction. We investigated the enzyme uracil-DNA glycosylase (UNG), which detects and cleaves uracil from DNA. UNG was incubated with a 30 bp DNA fragment containing a single uracil, giving the complex with the abasic DNA product. Compared with free UNG, the UNG–DNA complex showed increased solvent protection at the UNG active site and at two regions outside the active site: residues 210–220 and 251–264. Computational docking also identified these two DNA-binding surfaces, but neither shows DNA contact in UNG–DNA crystallographic structures. Our results can be explained by separation of the two DNA strands on one side of the active site. These non-sequence-specific DNA-binding surfaces may aid local uracil search, contribute to binding the abasic DNA product and help present the DNA product to APE-1, the next enzyme on the DNA-repair pathway. PMID:22492624

A Ligand-observed Mass Spectrometry Approach Integrated into the Fragment Based Lead Discovery Pipeline

PubMed Central

Chen, Xin; Qin, Shanshan; Chen, Shuai; Li, Jinlong; Li, Lixin; Wang, Zhongling; Wang, Quan; Lin, Jianping; Yang, Cheng; Shui, Wenqing

2015-01-01

In fragment-based lead discovery (FBLD), a cascade combining multiple orthogonal technologies is required for reliable detection and characterization of fragment binding to the target. Given the limitations of the mainstream screening techniques, we presented a ligand-observed mass spectrometry approach to expand the toolkits and increase the flexibility of building a FBLD pipeline especially for tough targets. In this study, this approach was integrated into a FBLD program targeting the HCV RNA polymerase NS5B. Our ligand-observed mass spectrometry analysis resulted in the discovery of 10 hits from a 384-member fragment library through two independent screens of complex cocktails and a follow-up validation assay. Moreover, this MS-based approach enabled quantitative measurement of weak binding affinities of fragments which was in general consistent with SPR analysis. Five out of the ten hits were then successfully translated to X-ray structures of fragment-bound complexes to lay a foundation for structure-based inhibitor design. With distinctive strengths in terms of high capacity and speed, minimal method development, easy sample preparation, low material consumption and quantitative capability, this MS-based assay is anticipated to be a valuable addition to the repertoire of current fragment screening techniques. PMID:25666181

Comprehensive Experimental and Computational Analysis of Binding Energy Hot Spots at the NF-κB Essential Modulator (NEMO)/IKKβ Protein-Protein Interface

PubMed Central

Golden, Mary S.; Cote, Shaun M.; Sayeg, Marianna; Zerbe, Brandon S.; Villar, Elizabeth A.; Beglov, Dmitri; Sazinsky, Stephen L.; Georgiadis, Rosina M.; Vajda, Sandor; Kozakov, Dima; Whitty, Adrian

2013-01-01

We report a comprehensive analysis of binding energy hot spots at the protein-protein interaction (PPI) interface between NF-κB Essential Modulator (NEMO) and IκB kinase subunit β (IKKβ), an interaction that is critical for NF-κB pathway signaling, using experimental alanine scanning mutagenesis and also the FTMap method for computational fragment screening. The experimental results confirm that the previously identified NBD region of IKKβ contains the highest concentration of hot spot residues, the strongest of which are W739, W741 and L742 (ΔΔG = 4.3, 3.5 and 3.2 kcal/mol, respectively). The region occupied by these residues defines a potentially druggable binding site on NEMO that extends for ~16 Å to additionally include the regions that bind IKKβ L737 and F734. NBD residues D738 and S740 are also important for binding but do not make direct contact with NEMO, instead likely acting to stabilize the active conformation of surrounding residues. We additionally found two previously unknown hot spot regions centered on IKKβ residues L708/V709 and L719/I723. The computational approach successfully identified all three hot spot regions on IKKβ. Moreover, the method was able to accurately quantify the energetic importance of all hot spots residues involving direct contact with NEMO. Our results provide new information to guide the discovery of small molecule inhibitors that target the NEMO/IKKβ interaction. They additionally clarify the structural and energetic complementarity between “pocket-forming” and “pocket occupying” hot spot residues, and further validate computational fragment mapping as a method for identifying hot spots at PPI interfaces. PMID:23506214

Screening a fragment cocktail library using ultrafiltration

PubMed Central

Shibata, Sayaka; Zhang, Zhongsheng; Korotkov, Konstantin V.; Delarosa, Jaclyn; Napuli, Alberto; Kelley, Angela M.; Mueller, Natasha; Ross, Jennifer; Zucker, Frank H.; Buckner, Frederick S.; Merritt, Ethan A.; Verlinde, Christophe L. M. J.; Van Voorhis, Wesley C.; Hol, Wim G. J.; Fan, Erkang

2011-01-01

Ultrafiltration provides a generic method to discover ligands for protein drug targets with millimolar to micromolar Kd, the typical range of fragment-based drug discovery. This method was tailored to a 96-well format, and cocktails of fragment-sized molecules, with molecular masses between 150 and 300 Da, were screened against medical structural genomics target proteins. The validity of the method was confirmed through competitive binding assays in the presence of ligands known to bind the target proteins. PMID:21750879

NMR screening in fragment-based drug design: a practical guide.

PubMed

Kim, Hai-Young; Wyss, Daniel F

2015-01-01

Fragment-based drug design (FBDD) comprises both fragment-based screening (FBS) to find hits and elaboration of these hits to lead compounds. Typical fragment hits have lower molecular weight (<300-350 Da) and lower initial potency but higher ligand efficiency when compared to those from high-throughput screening. NMR spectroscopy has been widely used for FBDD since it identifies and localizes the binding site of weakly interacting hits on the target protein. Here we describe ligand-based NMR methods for hit identification from fragment libraries and for functional cross-validation of primary hits.

Definition of IgG- and albumin-binding regions of streptococcal protein G.

PubMed

Akerström, B; Nielsen, E; Björck, L

1987-10-05

Protein G, the immunoglobin G-binding surface protein of group C and G streptococci, also binds serum albumin. The albumin-binding site on protein G is distinct from the immunoglobulin G-binding site. By mild acid hydrolysis of the papain-liberated protein G fragment (35 kDa), a 28-kDa fragment was produced which retained full immunoglobulin G-binding activity (determined by Scatchard plotting) but had lost all albumin-binding capacity. A protein G (65 kDa), isolated after cloning and expression of the protein G gene in Escherichia coli, had comparable affinity to immunoglobulin G (5-10 X 10(10)M-1), but much higher affinity to albumin than the 35- and 28-kDa protein G fragments (31, 2.6, and 0 X 10(9)M-1, respectively). The amino-terminal amino acid sequences of the 65-, 35-, and 28-kDa fragments allowed us to exactly locate the three fragments in an overall sequence map of protein G, based on the partial gene sequences published by Guss et al. (Guss, B., Eliasson, M., Olsson, A., Uhlen, M., Frej, A.-K., Jörnvall, H., Flock, J.-I., and Lindberg, M. (1986) EMBO J. 5, 1567-1575) and Fahnestock et al. (Fahnestock, S. R., Alexander, P., Nagle, J., and Filpula, D. (1986) J. Bacteriol. 167, 870-880). In this map could then be deduced the location of three homologous albumin-binding regions and three homologous immunoglobulin G-binding regions.

The ways and means of fragment-based drug design.

PubMed

Doak, Bradley C; Norton, Raymond S; Scanlon, Martin J

2016-11-01

Fragment-based drug design (FBDD) has emerged as a mainstream approach for the rapid and efficient identification of building blocks that can be used to develop high-affinity ligands against protein targets. One of the strengths of FBDD is the relative ease and low cost of the primary screen to identify fragments that bind. However, the fragments that emerge from primary screens often have low affinities, with K D values in the high μM to mM range, and a significant challenge for FBDD is to develop the initial fragments into more potent ligands. Successful fragment elaboration often requires co-structures of the fragments bound to their target proteins, as well as a range of biophysical and biochemical assays to track potency and efficacy. These challenges have led to the development of specific chemical strategies for the elaboration of weakly-binding fragments into more potent "hits" and lead compounds. In this article we review different approaches that have been employed to meet these challenges and describe some of the strategies that have resulted in several fragment-derived compounds entering clinical trials. Copyright © 2016 Elsevier Inc. All rights reserved.

Identification of DNA primase inhibitors via a combined fragment-based and virtual screening

NASA Astrophysics Data System (ADS)

Ilic, Stefan; Akabayov, Sabine R.; Arthanari, Haribabu; Wagner, Gerhard; Richardson, Charles C.; Akabayov, Barak

2016-11-01

The structural differences between bacterial and human primases render the former an excellent target for drug design. Here we describe a technique for selecting small molecule inhibitors of the activity of T7 DNA primase, an ideal model for bacterial primases due to their common structural and functional features. Using NMR screening, fragment molecules that bind T7 primase were identified and then exploited in virtual filtration to select larger molecules from the ZINC database. The molecules were docked to the primase active site using the available primase crystal structure and ranked based on their predicted binding energies to identify the best candidates for functional and structural investigations. Biochemical assays revealed that some of the molecules inhibit T7 primase-dependent DNA replication. The binding mechanism was delineated via NMR spectroscopy. Our approach, which combines fragment based and virtual screening, is rapid and cost effective and can be applied to other targets.

Fragment-Based Protein-Protein Interaction Antagonists of a Viral Dimeric Protease.

PubMed

Gable, Jonathan E; Lee, Gregory M; Acker, Timothy M; Hulce, Kaitlin R; Gonzalez, Eric R; Schweigler, Patrick; Melkko, Samu; Farady, Christopher J; Craik, Charles S

2016-04-19

Fragment-based drug discovery has shown promise as an approach for challenging targets such as protein-protein interfaces. We developed and applied an activity-based fragment screen against dimeric Kaposi's sarcoma-associated herpesvirus protease (KSHV Pr) using an optimized fluorogenic substrate. Dose-response determination was performed as a confirmation screen, and NMR spectroscopy was used to map fragment inhibitor binding to KSHV Pr. Kinetic assays demonstrated that several initial hits also inhibit human cytomegalovirus protease (HCMV Pr). Binding of these hits to HCMV Pr was also confirmed by NMR spectroscopy. Despite the use of a target-agnostic fragment library, more than 80 % of confirmed hits disrupted dimerization and bound to a previously reported pocket at the dimer interface of KSHV Pr, not to the active site. One class of fragments, an aminothiazole scaffold, was further explored using commercially available analogues. These compounds demonstrated greater than 100-fold improvement of inhibition. This study illustrates the power of fragment-based screening for these challenging enzymatic targets and provides an example of the potential druggability of pockets at protein-protein interfaces. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Evaluation of designed ligands by a multiple screening method: Application to glycogen phosphorylase inhibitors constructed with a variety of approaches

NASA Astrophysics Data System (ADS)

So, Sung-Sau; Karplus, Martin

2001-07-01

Glycogen phosphorylase (GP) is an important enzyme that regulates blood glucose level and a key therapeutic target for the treatment of type II diabetes. In this study, a number of potential GP inhibitors are designed with a variety of computational approaches. They include the applications of MCSS, LUDI and CoMFA to identify additional fragments that can be attached to existing lead molecules; the use of 2D and 3D similarity-based QSAR models (HQSAR and SMGNN) and of the LUDI program to identify novel molecules that may bind to the glucose binding site. The designed ligands are evaluated by a multiple screening method, which is a combination of commercial and in-house ligand-receptor binding affinity prediction programs used in a previous study (So and Karplus, J. Comp.-Aid. Mol. Des., 13 (1999), 243-258). Each method is used at an appropriate point in the screening, as determined by both the accuracy of the calculations and the computational cost. A comparison of the strengths and weaknesses of the ligand design approaches is made.

Global structure–activity relationship model for nonmutagenic carcinogens using virtual ligand-protein interactions as model descriptors

PubMed Central

Cunningham, Albert R.; Trent, John O.

2012-01-01

Structure–activity relationship (SAR) models are powerful tools to investigate the mechanisms of action of chemical carcinogens and to predict the potential carcinogenicity of untested compounds. We describe the use of a traditional fragment-based SAR approach along with a new virtual ligand-protein interaction-based approach for modeling of nonmutagenic carcinogens. The ligand-based SAR models used descriptors derived from computationally calculated ligand-binding affinities for learning set agents to 5495 proteins. Two learning sets were developed. One set was from the Carcinogenic Potency Database, where chemicals tested for rat carcinogenesis along with Salmonella mutagenicity data were provided. The second was from Malacarne et al. who developed a learning set of nonalerting compounds based on rodent cancer bioassay data and Ashby’s structural alerts. When the rat cancer models were categorized based on mutagenicity, the traditional fragment model outperformed the ligand-based model. However, when the learning sets were composed solely of nonmutagenic or nonalerting carcinogens and noncarcinogens, the fragment model demonstrated a concordance of near 50%, whereas the ligand-based models demonstrated a concordance of 71% for nonmutagenic carcinogens and 74% for nonalerting carcinogens. Overall, these findings suggest that expert system analysis of virtual chemical protein interactions may be useful for developing predictive SAR models for nonmutagenic carcinogens. Moreover, a more practical approach for developing SAR models for carcinogenesis may include fragment-based models for chemicals testing positive for mutagenicity and ligand-based models for chemicals devoid of DNA reactivity. PMID:22678118

Global structure-activity relationship model for nonmutagenic carcinogens using virtual ligand-protein interactions as model descriptors.

PubMed

Cunningham, Albert R; Carrasquer, C Alex; Qamar, Shahid; Maguire, Jon M; Cunningham, Suzanne L; Trent, John O

2012-10-01

Structure-activity relationship (SAR) models are powerful tools to investigate the mechanisms of action of chemical carcinogens and to predict the potential carcinogenicity of untested compounds. We describe the use of a traditional fragment-based SAR approach along with a new virtual ligand-protein interaction-based approach for modeling of nonmutagenic carcinogens. The ligand-based SAR models used descriptors derived from computationally calculated ligand-binding affinities for learning set agents to 5495 proteins. Two learning sets were developed. One set was from the Carcinogenic Potency Database, where chemicals tested for rat carcinogenesis along with Salmonella mutagenicity data were provided. The second was from Malacarne et al. who developed a learning set of nonalerting compounds based on rodent cancer bioassay data and Ashby's structural alerts. When the rat cancer models were categorized based on mutagenicity, the traditional fragment model outperformed the ligand-based model. However, when the learning sets were composed solely of nonmutagenic or nonalerting carcinogens and noncarcinogens, the fragment model demonstrated a concordance of near 50%, whereas the ligand-based models demonstrated a concordance of 71% for nonmutagenic carcinogens and 74% for nonalerting carcinogens. Overall, these findings suggest that expert system analysis of virtual chemical protein interactions may be useful for developing predictive SAR models for nonmutagenic carcinogens. Moreover, a more practical approach for developing SAR models for carcinogenesis may include fragment-based models for chemicals testing positive for mutagenicity and ligand-based models for chemicals devoid of DNA reactivity.

Fragment informatics and computational fragment-based drug design: an overview and update.

PubMed

Sheng, Chunquan; Zhang, Wannian

2013-05-01

Fragment-based drug design (FBDD) is a promising approach for the discovery and optimization of lead compounds. Despite its successes, FBDD also faces some internal limitations and challenges. FBDD requires a high quality of target protein and good solubility of fragments. Biophysical techniques for fragment screening necessitate expensive detection equipment and the strategies for evolving fragment hits to leads remain to be improved. Regardless, FBDD is necessary for investigating larger chemical space and can be applied to challenging biological targets. In this scenario, cheminformatics and computational chemistry can be used as alternative approaches that can significantly improve the efficiency and success rate of lead discovery and optimization. Cheminformatics and computational tools assist FBDD in a very flexible manner. Computational FBDD can be used independently or in parallel with experimental FBDD for efficiently generating and optimizing leads. Computational FBDD can also be integrated into each step of experimental FBDD and help to play a synergistic role by maximizing its performance. This review will provide critical analysis of the complementarity between computational and experimental FBDD and highlight recent advances in new algorithms and successful examples of their applications. In particular, fragment-based cheminformatics tools, high-throughput fragment docking, and fragment-based de novo drug design will provide the focus of this review. We will also discuss the advantages and limitations of different methods and the trends in new developments that should inspire future research. © 2012 Wiley Periodicals, Inc.

Identification of N-ethylmethylamine as a novel scaffold for inhibitors of soluble epoxide hydrolase by crystallographic fragment screening.

PubMed

Amano, Yasushi; Tanabe, Eiki; Yamaguchi, Tomohiko

2015-05-15

Soluble epoxide hydrolase (sEH) is a potential target for the treatment of inflammation and hypertension. X-ray crystallographic fragment screening was used to identify fragment hits and their binding modes. Eight fragment hits were identified via soaking of sEH crystals with fragment cocktails, and the co-crystal structures of these hits were determined via individual soaking. Based on the binding mode, N-ethylmethylamine was identified as a promising scaffold that forms hydrogen bonds with the catalytic residues of sEH, Asp335, Tyr383, and Tyr466. Compounds containing this scaffold were selected from an in-house chemical library and assayed. Although the starting fragment had a weak inhibitory activity (IC50: 800μM), we identified potent inhibitors including 2-({[2-(adamantan-1-yl)ethyl]amino}methyl)phenol exhibiting the highest inhibitory activity (IC50: 0.51μM). This corresponded to a more than 1500-fold increase in inhibitory activity compared to the starting fragment. Co-crystal structures of the hit compounds demonstrate that the binding of N-ethylmethylamine to catalytic residues is similar to that of the starting fragment. We therefore consider crystallographic fragment screening to be appropriate for the identification of weak but promising fragment hits. Copyright © 2015 Elsevier Ltd. All rights reserved.

Experiences in fragment-based drug discovery.

PubMed

Murray, Christopher W; Verdonk, Marcel L; Rees, David C

2012-05-01

Fragment-based drug discovery (FBDD) has become established in both industry and academia as an alternative approach to high-throughput screening for the generation of chemical leads for drug targets. In FBDD, specialised detection methods are used to identify small chemical compounds (fragments) that bind to the drug target, and structural biology is usually employed to establish their binding mode and to facilitate their optimisation. In this article, we present three recent and successful case histories in FBDD. We then re-examine the key concepts and challenges of FBDD with particular emphasis on recent literature and our own experience from a substantial number of FBDD applications. Our opinion is that careful application of FBDD is living up to its promise of delivering high quality leads with good physical properties and that in future many drug molecules will be derived from fragment-based approaches. Copyright © 2012 Elsevier Ltd. All rights reserved.

Computational redesign of a protein-protein interface for high affinity and binding specificity using modular architecture and naturally occurring template fragments.

PubMed

Potapov, V; Reichmann, D; Abramovich, R; Filchtinski, D; Zohar, N; Ben Halevy, D; Edelman, M; Sobolev, V; Schreiber, G

2008-12-05

A new method is presented for the redesign of protein-protein interfaces, resulting in specificity of the designed pair while maintaining high affinity. The design is based on modular interface architecture and was carried out on the interaction between TEM1 beta-lactamase and its inhibitor protein, beta-lactamase inhibitor protein. The interface between these two proteins is composed of several mostly independent modules. We previously showed that it is possible to delete a complete module without affecting the overall structure of the interface. Here, we replace a complete module with structure fragments taken from nonrelated proteins. Nature-optimized fragments were chosen from 10(7) starting templates found in the Protein Data Bank. A procedure was then developed to identify sets of interacting template residues with a backbone arrangement mimicking the original module. This generated a final list of 361 putative replacement modules that were ranked using a novel scoring function based on grouped atom-atom contact surface areas. The top-ranked designed complex exhibited an affinity of at least the wild-type level and a mode of binding that was remarkably specific despite the absence of negative design in the procedure. In retrospect, the combined application of three factors led to the success of the design approach: utilizing the modular construction of the interface, capitalizing on native rather than artificial templates, and ranking with an accurate atom-atom contact surface scoring function.

A fragment-based approach leading to the discovery of a novel binding site and the selective CK2 inhibitor CAM4066.

PubMed

De Fusco, Claudia; Brear, Paul; Iegre, Jessica; Georgiou, Kathy Hadje; Sore, Hannah F; Hyvönen, Marko; Spring, David R

2017-07-01

Recently we reported the discovery of a potent and selective CK2α inhibitor CAM4066. This compound inhibits CK2 activity by exploiting a pocket located outside the ATP binding site (αD pocket). Here we describe in detail the journey that led to the discovery of CAM4066 using the challenging fragment linking strategy. Specifically, we aimed to develop inhibitors by linking a high-affinity fragment anchored in the αD site to a weakly binding warhead fragment occupying the ATP site. Moreover, we describe the remarkable impact that molecular modelling had on the development of this novel chemical tool. The work described herein shows potential for the development of a novel class of CK2 inhibitors. Copyright © 2017. Published by Elsevier Ltd.

Leveraging structure determination with fragment screening for infectious disease drug targets: MECP synthase from Burkholderia pseudomallei

DOE Office of Scientific and Technical Information (OSTI.GOV)

Begley, Darren W.; Hartley, Robert C.; Davies, Douglas R.

As part of the Seattle Structural Genomics Center for Infectious Disease, we seek to enhance structural genomics with ligand-bound structure data which can serve as a blueprint for structure-based drug design. We have adapted fragment-based screening methods to our structural genomics pipeline to generate multiple ligand-bound structures of high priority drug targets from pathogenic organisms. In this study, we report fragment screening methods and structure determination results for 2C-methyl-D-erythritol-2,4-cyclo-diphosphate (MECP) synthase from Burkholderia pseudomallei, the gram-negative bacterium which causes melioidosis. Screening by nuclear magnetic resonance spectroscopy as well as crystal soaking followed by X-ray diffraction led to the identification ofmore » several small molecules which bind this enzyme in a critical metabolic pathway. A series of complex structures obtained with screening hits reveal distinct binding pockets and a range of small molecules which form complexes with the target. Additional soaks with these compounds further demonstrate a subset of fragments to only bind the protein when present in specific combinations. This ensemble of fragment-bound complexes illuminates several characteristics of MECP synthase, including a previously unknown binding surface external to the catalytic active site. These ligand-bound structures now serve to guide medicinal chemists and structural biologists in rational design of novel inhibitors for this enzyme.« less

Fragment-Based Optimization of Small Molecule CXCL12 Inhibitors for Antagonizing the CXCL12/CXCR4 Interaction

PubMed Central

Ziarek, Joshua J.; Liu, Yan; Smith, Emmanuel; Zhang, Guolin; Peterson, Francis C.; Chen, Jun; Yu, Yongping; Chen, Yu; Volkman, Brian F.; Li, Rongshi

2013-01-01

The chemokine CXCL12 and its G protein-coupled receptor (GPCR) CXCR4 are high-priority clinical targets because of their involvement in metastatic cancers (also implicated in autoimmune disease and cardiovascular disease). Because chemokines interact with two distinct sites to bind and activate their receptors, both the GPCRs and chemokines are potential targets for small molecule inhibition. A number of chemokines have been validated as targets for drug development, but virtually all drug discovery efforts focus on the GPCRs. However, all CXCR4 receptor antagonists with the exception of MSX-122 have failed in clinical trials due to unmanageable toxicities, emphasizing the need for alternative strategies to interfere with CXCL12/CXCR4-guided metastatic homing. Although targeting the relatively featureless surface of CXCL12 was presumed to be challenging, focusing efforts at the sulfotyrosine (sY) binding pockets proved successful for procuring initial hits. Using a hybrid structure-based in silico/NMR screening strategy, we recently identified a ligand that occludes the receptor recognition site. From this initial hit, we designed a small fragment library containing only nine tetrazole derivatives using a fragment-based and bioisostere approach to target the sY binding sites of CXCL12. Compound binding modes and affinities were studied by 2D NMR spectroscopy, X-ray crystallography, molecular docking and cell-based functional assays. Our results demonstrate that the sY binding sites are conducive to the development of high affinity inhibitors with better ligand efficiency (LE) than typical protein-protein interaction inhibitors (LE ≤ 0.24). Our novel tetrazole-based fragment 18 was identified to bind the sY21 site with a Kd of 24 μM (LE = 0.30). Optimization of 18 yielded compound 25 which specifically inhibits CXCL12-induced migration with an improvement in potency over the initial hit 9. The fragment from this library that exhibited the highest affinity and ligand efficiency (11: Kd = 13 μM, LE = 0.33) may serve as a starting point for development of inhibitors targeting the sY12 site. PMID:23368099

Does aluminium bind to histidine? An NMR investigation of amyloid β12 and amyloid β16 fragments.

PubMed

Narayan, Priya; Krishnarjuna, Bankala; Vishwanathan, Vinaya; Jagadeesh Kumar, Dasappa; Babu, Sudhir; Ramanathan, Krishna Venkatachala; Easwaran, Kalpathy Ramaier Katchap; Nagendra, Holenarasipur Gundurao; Raghothama, Srinivasarao

2013-07-01

Aluminium and zinc are known to be the major triggering agents for aggregation of amyloid peptides leading to plaque formation in Alzheimer's disease. While zinc binding to histidine in Aβ (amyloid β) fragments has been implicated as responsible for aggregation, not much information is available on the interaction of aluminium with histidine. In the NMR study of the N-terminal Aβ fragments, DAEFRHDSGYEV (Aβ12) and DAEFRHDSGYEVHHQK (Aβ16) presented here, the interactions of the fragments with aluminium have been investigated. Significant chemical shifts were observed for few residues near the C-terminus when aluminium chloride was titrated with Aβ12 and Aβ16 peptides. Surprisingly, it is nonhistidine residues which seem to be involved in aluminium binding. Based on NMR constrained structure obtained by molecular modelling, aluminium-binding pockets in Aβ12 were around charged residues such as Asp, Glu. The results are discussed in terms of native structure propagation, and the relevance of histidine residues in the sequences for metal-binding interactions. We expect that the study of such short amyloid peptide fragments will not only provide clues for plaque formation in aggregated conditions but also facilitate design of potential drugs for these targets. © 2013 John Wiley & Sons A/S.

The FTMap family of web servers for determining and characterizing ligand binding hot spots of proteins

PubMed Central

Kozakov, Dima; Grove, Laurie E.; Hall, David R.; Bohnuud, Tanggis; Mottarella, Scott; Luo, Lingqi; Xia, Bing; Beglov, Dmitri; Vajda, Sandor

2016-01-01

FTMap is a computational mapping server that identifies binding hot spots of macromolecules, i.e., regions of the surface with major contributions to the ligand binding free energy. To use FTMap, users submit a protein, DNA, or RNA structure in PDB format. FTMap samples billions of positions of small organic molecules used as probes and scores the probe poses using a detailed energy expression. Regions that bind clusters of multiple probe types identify the binding hot spots, in good agreement with experimental data. FTMap serves as basis for other servers, namely FTSite to predict ligand binding sites, FTFlex to account for side chain flexibility, FTMap/param to parameterize additional probes, and FTDyn to map ensembles of protein structures. Applications include determining druggability of proteins, identifying ligand moieties that are most important for binding, finding the most bound-like conformation in ensembles of unliganded protein structures, and providing input for fragment based drug design. FTMap is more accurate than classical mapping methods such as GRID and MCSS, and is much faster than the more recent approaches to protein mapping based on mixed molecular dynamics. Using 16 probe molecules, the FTMap server finds the hot spots of an average size protein in less than an hour. Since FTFlex performs mapping for all low energy conformers of side chains in the binding site, its completion time is proportionately longer. PMID:25855957

NMR-based platform for fragment-based lead discovery used in screening BRD4-targeted compounds

PubMed Central

Yu, Jun-lan; Chen, Tian-tian; Zhou, Chen; Lian, Fu-lin; Tang, Xu-long; Wen, Yi; Shen, Jing-kang; Xu, Ye-chun; Xiong, Bing; Zhang, Nai-xia

2016-01-01

Aim: Fragment-based lead discovery (FBLD) is a complementary approach in drug research and development. In this study, we established an NMR-based FBLD platform that was used to screen novel scaffolds targeting human bromodomain of BRD4, and investigated the binding interactions between hit compounds and the target protein. Methods: 1D NMR techniques were primarily used to generate the fragment library and to screen compounds. The inhibitory activity of hits on the first bromodomain of BRD4 [BRD4(I)] was examined using fluorescence anisotropy binding assay. 2D NMR and X-ray crystallography were applied to characterize the binding interactions between hit compounds and the target protein. Results: An NMR-based fragment library containing 539 compounds was established, which were clustered into 56 groups (8–10 compounds in each group). Eight hits with new scaffolds were found to inhibit BRD4(I). Four out of the 8 hits (compounds 1, 2, 8 and 9) had IC50 values of 100–260 μmol/L, demonstrating their potential for further BRD4-targeted hit-to-lead optimization. Analysis of the binding interactions revealed that compounds 1 and 2 shared a common quinazolin core structure and bound to BRD4(I) in a non-acetylated lysine mimetic mode. Conclusion: An NMR-based platform for FBLD was established and used in discovery of BRD4-targeted compounds. Four potential hit-to-lead optimization candidates have been found, two of them bound to BRD4(I) in a non-acetylated lysine mimetic mode, being selective BRD4(I) inhibitors. PMID:27238211

Crystallographic Fragment Based Drug Discovery: Use of a Brominated Fragment Library Targeting HIV Protease

PubMed Central

Tiefenbrunn, Theresa; Forli, Stefano; Happer, Meaghan; Gonzalez, Ana; Tsai, Yingssu; Soltis, Michael; Elder, John H.; Olson, Arthur J.; Stout, C. David

2013-01-01

A library of 68 brominated fragments was screened against a new crystal form of inhibited HIV-1 protease in order to probe surface sites in soaking experiments. Often fragments are weak binders with partial occupancy, resulting in weak, difficult-to-fit electron density. The use of a brominated fragment library addresses this challenge, as bromine can be located unequivocally via anomalous scattering. Data collection was carried out in an automated fashion using AutoDrug at SSRL. Novel hits were identified in the known surface sites: 3-bromo-2,6-dimethoxybenzoic acid (Br6) in the flap site, and 1-bromo-2-naphthoic acid (Br27) in the exosite, expanding the chemistry of known fragments for development of higher affinity potential allosteric inhibitors. At the same time, mapping the binding sites of a number of weaker binding Br-fragments provides further insight into the nature of these surface pockets. PMID:23998903

[Cloning, expression and identification of functional fragment rC3B of human complement C3 in E. Coli].

PubMed

Gan, Hui; Zhou, Yong; Sun, Ping; Zhu, Xiao-Xia; Wang, Quan-Li; Zhan, Lin-Sheng

2007-08-01

This study was purposed to verify the binding part of human complement C3 to complement receptor III (CRIII) in monocytes, the peptide rC3B, including the binding-site, was expressed, purified and identified. rC3B, the binding part of human complement C3 to CRIII, was selected by computer-aided modeling and summarizing researches published. Then, rC3B gene fragment was amplified by PCR, and cloned into prokaryotic vector pQE30a. The fusion protein rC3B was expressed in E.coli M15 and purified by Ni(2+)-chelating affinity chromatography. The activity of rC3B was identified by Western blot and adherence assay with monocytes. The results showed that rC3B fragment was obtained, and a prokaryotic expression vector pQE30-rC3B was constructed. rC3B was efficiently expressed and purified. In Western blot, the target protein showed the activity of binding with C3 antibody, while the purified protein showed the activity of adherence with monocytes. It is concluded that the recombinant C3B was obtained and identified, and this study lay the basis for the further functional analysis of C3.

Design and synthesis of dihydroisoquinolones for fragment-based drug discovery (FBDD).

PubMed

Palmer, Nick; Peakman, Torren M; Norton, David; Rees, David C

2016-02-07

This study describes general synthesis aspects of fragments for FBDD, as illustrated by the dihydroisoquinolones 1-3. Previous Rh(III) methodology is extended to incorporate amines, heteroatoms (N and S), and substituents (halogen, ester) as potential binding groups and/or synthetic growth points for fragment-to-lead elaboration.

Fragment screening using capillary electrophoresis (CEfrag) for hit identification of heat shock protein 90 ATPase inhibitors.

PubMed

Austin, Carol; Pettit, Simon N; Magnolo, Sharon K; Sanvoisin, Jonathan; Chen, Wenjie; Wood, Stephen P; Freeman, Lauren D; Pengelly, Reuben J; Hughes, Dallas E

2012-08-01

CEfrag is a new fragment screening technology based on affinity capillary electrophoresis (ACE). Here we report on the development of a mobility shift competition assay using full-length human heat shock protein 90α (Hsp90α), radicicol as the competitor probe ligand, and successful screening of the Selcia fragment library. The CEfrag assay was able to detect weaker affinity (IC(50) >500 µM) fragments than were detected by a fluorescence polarization competition assay using FITC-labeled geldanamycin. The binding site of selected fragments was determined by co-crystallization with recombinant Hsp90α N-terminal domain and X-ray analysis. The results of this study confirm that CEfrag is a sensitive microscale technique enabling detection of fragments binding to the biological target in near-physiological solution.

Fragment-based modelling of single stranded RNA bound to RNA recognition motif containing proteins

PubMed Central

de Beauchene, Isaure Chauvot; de Vries, Sjoerd J.; Zacharias, Martin

2016-01-01

Abstract Protein-RNA complexes are important for many biological processes. However, structural modeling of such complexes is hampered by the high flexibility of RNA. Particularly challenging is the docking of single-stranded RNA (ssRNA). We have developed a fragment-based approach to model the structure of ssRNA bound to a protein, based on only the protein structure, the RNA sequence and conserved contacts. The conformational diversity of each RNA fragment is sampled by an exhaustive library of trinucleotides extracted from all known experimental protein–RNA complexes. The method was applied to ssRNA with up to 12 nucleotides which bind to dimers of the RNA recognition motifs (RRMs), a highly abundant eukaryotic RNA-binding domain. The fragment based docking allows a precise de novo atomic modeling of protein-bound ssRNA chains. On a benchmark of seven experimental ssRNA–RRM complexes, near-native models (with a mean heavy-atom deviation of <3 Å from experiment) were generated for six out of seven bound RNA chains, and even more precise models (deviation < 2 Å) were obtained for five out of seven cases, a significant improvement compared to the state of the art. The method is not restricted to RRMs but was also successfully applied to Pumilio RNA binding proteins. PMID:27131381

Proteins with similar architecture exhibit similar large-scale dynamic behavior.

PubMed Central

Keskin, O; Jernigan, R L; Bahar, I

2000-01-01

We have investigated the similarities and differences in the computed dynamic fluctuations exhibited by six members of a protein fold family with a coarse-grained Gaussian network model. Specifically, we consider the cofactor binding fragment of CysB; the lysine/arginine/ornithine-binding protein (LAO); the enzyme porphobilinogen deaminase (PBGD); the ribose-binding protein (RBP); the N-terminal lobe of ovotransferrin in apo-form (apo-OVOT); and the leucine/isoleucine/valine-binding protein (LIVBP). All have domains that resemble a Rossmann fold, but there are also some significant differences. Results indicate that similar global dynamic behavior is preserved for the members of a fold family, and that differences usually occur in regions only where specific function is localized. The present work is a computational demonstration that the scaffold of a protein fold may be utilized for diverse purposes. LAO requires a bound ligand before it conforms to the large-scale fluctuation behavior of the three other members of the family, CysB, PBGD, and RBP, all of which contain a substrate (cofactor) at the active site cleft. The dynamics of the ligand-free enzymes LIVBP and apo-OVOT, on the other hand, concur with that of unliganded LAO. The present results suggest that it is possible to construct structure alignments based on dynamic fluctuation behavior. PMID:10733987

Evaluation of a focused virtual library of heterobifunctional ligands for Clostridium difficile toxins.

PubMed

Sanhueza, Carlos A; Cartmell, Jonathan; El-Hawiet, Amr; Szpacenko, Adam; Kitova, Elena N; Daneshfar, Rambod; Klassen, John S; Lang, Dean E; Eugenio, Luiz; Ng, Kenneth K-S; Kitov, Pavel I; Bundle, David R

2015-01-07

A focused library of virtual heterobifunctional ligands was generated in silico and a set of ligands with recombined fragments was synthesized and evaluated for binding to Clostridium difficile toxins. The position of the trisaccharide fragment was used as a reference for filtering docked poses during virtual screening to match the trisaccharide ligand in a crystal structure. The peptoid, a diversity fragment probing the protein surface area adjacent to a known binding site, was generated by a multi-component Ugi reaction. Our approach combines modular fragment-based design with in silico screening of synthetically feasible compounds and lays the groundwork for future efforts in development of composite bifunctional ligands for large clostridial toxins.

Genetically Encoded Fragment-Based Discovery of Glycopeptide Ligands for Carbohydrate-Binding Proteins

DOE PAGES

Ng, Simon; Lin, Edith; Kitov, Pavel I.; ...

2015-04-10

Here we describe an approach to accelerate the search for competitive inhibitors for carbohydrate-recognition domains (CRDs). Genetically encoded fragment-based-discovery (GE-FBD) uses selection of phagedisplayed glycopeptides to dock a glycan fragment at the CRD and guide selection of Synergistic peptide motifs adjacent to the CRD. Starting from concanavalin A (ConA), a mannose (Man)-binding protein, as a bait, we narrowed a library of 10 8 glycopeptides to 86 leads that share a consensus motif, Man-WYD. Validation of synthetic leads yielded Man-WYDLF that exhibited 40 50-fold enhancement in affinity over methyl α-D-mannopyranoside (MeMan). Lectin array Suggested specificity: Man-WYD derivative bound only to 3more » out of 17 proteins-ConA, LcH, and PSA-that bind to Man. An X-ray structure of ConA.:Man-WYD proved that the trimannoside core and Man-WYD exhibit identical CRD docking; but their extra-CRD binding modes are significantly. different. Still, they have comparable affinity and selectivity for various Man-binding proteins. The intriguing observation provides new insight into functional mimicry :of carbohydrates by peptide ligands. GE-FBD may provide an alternative to rapidly search for competitive inhibitors for lectins.« less

Genetically Encoded Fragment-Based Discovery of Glycopeptide Ligands for Carbohydrate-Binding Proteins

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ng, Simon; Lin, Edith; Kitov, Pavel I.

Here we describe an approach to accelerate the search for competitive inhibitors for carbohydrate-recognition domains (CRDs). Genetically encoded fragment-based-discovery (GE-FBD) uses selection of phagedisplayed glycopeptides to dock a glycan fragment at the CRD and guide selection of Synergistic peptide motifs adjacent to the CRD. Starting from concanavalin A (ConA), a mannose (Man)-binding protein, as a bait, we narrowed a library of 10 8 glycopeptides to 86 leads that share a consensus motif, Man-WYD. Validation of synthetic leads yielded Man-WYDLF that exhibited 40 50-fold enhancement in affinity over methyl α-D-mannopyranoside (MeMan). Lectin array Suggested specificity: Man-WYD derivative bound only to 3more » out of 17 proteins-ConA, LcH, and PSA-that bind to Man. An X-ray structure of ConA.:Man-WYD proved that the trimannoside core and Man-WYD exhibit identical CRD docking; but their extra-CRD binding modes are significantly. different. Still, they have comparable affinity and selectivity for various Man-binding proteins. The intriguing observation provides new insight into functional mimicry :of carbohydrates by peptide ligands. GE-FBD may provide an alternative to rapidly search for competitive inhibitors for lectins.« less

Biosensor-based small molecule fragment screening with biolayer interferometry

NASA Astrophysics Data System (ADS)

Wartchow, Charles A.; Podlaski, Frank; Li, Shirley; Rowan, Karen; Zhang, Xiaolei; Mark, David; Huang, Kuo-Sen

2011-07-01

Biosensor-based fragment screening is a valuable tool in the drug discovery process. This method is advantageous over many biochemical methods because primary hits can be distinguished from non-specific or non-ideal interactions by examining binding profiles and responses, resulting in reduced false-positive rates. Biolayer interferometry (BLI), a technique that measures changes in an interference pattern generated from visible light reflected from an optical layer and a biolayer containing proteins of interest, is a relatively new method for monitoring small molecule interactions. The BLI format is based on a disposable sensor that is immersed in 96-well or 384-well plates. BLI has been validated for small molecule detection and fragment screening with model systems and well-characterized targets where affinity constants and binding profiles are generally similar to those obtained with surface plasmon resonsance (SPR). Screens with challenging targets involved in protein-protein interactions including BCL-2, JNK1, and eIF4E were performed with a fragment library of 6,500 compounds, and hit rates were compared for these targets. For eIF4E, a protein containing a PPI site and a nucleotide binding site, results from a BLI fragment screen were compared to results obtained in biochemical HTS screens. Overlapping hits were observed for the PPI site, and hits unique to the BLI screen were identified. Hit assessments with SPR and BLI are described.

In silico design of fragment-based drug targeting host processing α-glucosidase i for dengue fever

NASA Astrophysics Data System (ADS)

Toepak, E. P.; Tambunan, U. S. F.

2017-02-01

Dengue is a major health problem in the tropical and sub-tropical regions. The development of antiviral that targeting dengue’s host enzyme can be more effective and efficient treatment than the viral enzyme. Host enzyme processing α-glucosidase I has an important role in the maturation process of dengue virus envelope glycoprotein. The inhibition of processing α-glucosidase I can become a promising target for dengue fever treatment. The antiviral approach using in silico fragment-based drug design can generate drug candidates with high binding affinity. In this research, 198.621 compounds were obtained from ZINC15 Biogenic Database. These compounds were screened to find the favorable fragments according to Rules of Three and pharmacological properties. The screening fragments were docked into the active site of processing α-glucosidase I. The potential fragment candidates from the molecular docking simulation were linked with castanospermine (CAST) to generate ligands with a better binding affinity. The Analysis of ligand - enzyme interaction showed ligands with code LRS 22, 28, and 47 have the better binding free energy than the standard ligand. Ligand LRS 28 (N-2-4-methyl-5-((1S,3S,6S,7R,8R,8aR)-1,6,7,8-tetrahydroxyoctahydroindolizin-3-yl) pentyl) indolin-1-yl) propionamide) itself among the other ligands has the lowest binding free energy. Pharmacological properties prediction also showed the ligands LRS 22, 28, and 47 can be promising as the dengue fever drug candidates.

Validation of tautomeric and protomeric binding modes by free energy calculations. A case study for the structure based optimization of D-amino acid oxidase inhibitors.

PubMed

Orgován, Zoltán; Ferenczy, György G; Steinbrecher, Thomas; Szilágyi, Bence; Bajusz, Dávid; Keserű, György M

2018-02-01

Optimization of fragment size D-amino acid oxidase (DAAO) inhibitors was investigated using a combination of computational and experimental methods. Retrospective free energy perturbation (FEP) calculations were performed for benzo[d]isoxazole derivatives, a series of known inhibitors with two potential binding modes derived from X-ray structures of other DAAO inhibitors. The good agreement between experimental and computed binding free energies in only one of the hypothesized binding modes strongly support this bioactive conformation. Then, a series of 1-H-indazol-3-ol derivatives formerly not described as DAAO inhibitors was investigated. Binding geometries could be reliably identified by structural similarity to benzo[d]isoxazole and other well characterized series and FEP calculations were performed for several tautomers of the deprotonated and protonated compounds since all these forms are potentially present owing to the experimental pKa values of representative compounds in the series. Deprotonated compounds are proposed to be the most important bound species owing to the significantly better agreement between their calculated and measured affinities compared to the protonated forms. FEP calculations were also used for the prediction of the affinities of compounds not previously tested as DAAO inhibitors and for a comparative structure-activity relationship study of the benzo[d]isoxazole and indazole series. Selected indazole derivatives were synthesized and their measured binding affinity towards DAAO was in good agreement with FEP predictions.

Validation of tautomeric and protomeric binding modes by free energy calculations. A case study for the structure based optimization of d-amino acid oxidase inhibitors

NASA Astrophysics Data System (ADS)

Orgován, Zoltán; Ferenczy, György G.; Steinbrecher, Thomas; Szilágyi, Bence; Bajusz, Dávid; Keserű, György M.

2018-02-01

Optimization of fragment size d-amino acid oxidase (DAAO) inhibitors was investigated using a combination of computational and experimental methods. Retrospective free energy perturbation (FEP) calculations were performed for benzo[d]isoxazole derivatives, a series of known inhibitors with two potential binding modes derived from X-ray structures of other DAAO inhibitors. The good agreement between experimental and computed binding free energies in only one of the hypothesized binding modes strongly support this bioactive conformation. Then, a series of 1-H-indazol-3-ol derivatives formerly not described as DAAO inhibitors was investigated. Binding geometries could be reliably identified by structural similarity to benzo[d]isoxazole and other well characterized series and FEP calculations were performed for several tautomers of the deprotonated and protonated compounds since all these forms are potentially present owing to the experimental pKa values of representative compounds in the series. Deprotonated compounds are proposed to be the most important bound species owing to the significantly better agreement between their calculated and measured affinities compared to the protonated forms. FEP calculations were also used for the prediction of the affinities of compounds not previously tested as DAAO inhibitors and for a comparative structure-activity relationship study of the benzo[d]isoxazole and indazole series. Selected indazole derivatives were synthesized and their measured binding affinity towards DAAO was in good agreement with FEP predictions.

Structural Plasticity and Conformational Transitions of HIV Envelope Glycoprotein gp120

PubMed Central

Korkut, Anil; Hendrickson, Wayne A.

2012-01-01

HIV envelope glycoproteins undergo large-scale conformational changes as they interact with cellular receptors to cause the fusion of viral and cellular membranes that permits viral entry to infect targeted cells. Conformational dynamics in HIV gp120 are also important in masking conserved receptor epitopes from being detected for effective neutralization by the human immune system. Crystal structures of HIV gp120 and its complexes with receptors and antibody fragments provide high-resolution pictures of selected conformational states accessible to gp120. Here we describe systematic computational analyses of HIV gp120 plasticity in such complexes with CD4 binding fragments, CD4 mimetic proteins, and various antibody fragments. We used three computational approaches: an isotropic elastic network analysis of conformational plasticity, a full atomic normal mode analysis, and simulation of conformational transitions with our coarse-grained virtual atom molecular mechanics (VAMM) potential function. We observe collective sub-domain motions about hinge points that coordinate those motions, correlated local fluctuations at the interfacial cavity formed when gp120 binds to CD4, and concerted changes in structural elements that form at the CD4 interface during large-scale conformational transitions to the CD4-bound state from the deformed states of gp120 in certain antibody complexes. PMID:23300605

Plasminogen fragments K 1-3 and K 5 bind to different sites in fibrin fragment DD.

PubMed

Grinenko, T V; Kapustianenko, L G; Yatsenko, T A; Yusova, O I; Rybachuk, V N

2016-01-01

Specific plasminogen-binding sites of fibrin molecule are located in Аα148-160 regions of C-terminal domains. Plasminogen interaction with these sites initiates the activation process of proenzyme and subsequent fibrin lysis. In this study we investigated the binding of plasminogen fragments K 1-3 and K 5 with fibrin fragment DD and their effect on Glu-plasminogen interaction with DD. It was shown that the level of Glu-plasminogen binding to fibrin fragment DD is decreased by 50-60% in the presence of K 1-3 and K 5. Fragments K 1-3 and K 5 have high affinity to fibrin fragment DD (Kd is 0.02 for K 1-3 and 0.054 μМ for K 5). K 5 interaction is independent and K 1-3 is partly dependent on C-terminal lysine residues. K 1-3 interacts with complex of fragment DD-immobilized K 5 as well as K 5 with complex of fragment DD-immobilized K 1-3. The plasminogen fragments do not displace each other from binding sites located in fibrin fragment DD, but can compete for the interaction. The results indicate that fibrin fragment DD contains different binding sites for plasminogen kringle fragments K 1-3 and K 5, which can be located close to each other. The role of amino acid residues of fibrin molecule Аα148-160 region in interaction with fragments K 1-3 and K 5 is discussed.

Adaptive frozen orbital treatment for the fragment molecular orbital method combined with density-functional tight-binding

NASA Astrophysics Data System (ADS)

Nishimoto, Yoshio; Fedorov, Dmitri G.

2018-02-01

The exactly analytic gradient is derived and implemented for the fragment molecular orbital (FMO) method combined with density-functional tight-binding (DFTB) using adaptive frozen orbitals. The response contributions which arise from freezing detached molecular orbitals on the border between fragments are computed by solving Z-vector equations. The accuracy of the energy, its gradient, and optimized structures is verified on a set of representative inorganic materials and polypeptides. FMO-DFTB is applied to optimize the structure of a silicon nano-wire, and the results are compared to those of density functional theory and experiment. FMO accelerates the DFTB calculation of a boron nitride nano-ring with 7872 atoms by a factor of 406. Molecular dynamics simulations using FMO-DFTB applied to a 10.7 μm chain of boron nitride nano-rings, consisting of about 1.2 × 106 atoms, reveal the rippling and twisting of nano-rings at room temperature.

Molecular-Simulation-Driven Fragment Screening for the Discovery of New CXCL12 Inhibitors.

PubMed

Martinez-Rosell, Gerard; Harvey, Matt J; De Fabritiis, Gianni

2018-03-26

Fragment-based drug discovery (FBDD) has become a mainstream approach in drug design because it allows the reduction of the chemical space and screening libraries while identifying fragments with high protein-ligand efficiency interactions that can later be grown into drug-like leads. In this work, we leverage high-throughput molecular dynamics (MD) simulations to screen a library of 129 fragments for a total of 5.85 ms against the CXCL12 monomer, a chemokine involved in inflammation and diseases such as cancer. Our in silico binding assay was able to recover binding poses, affinities, and kinetics for the selected library and was able to predict 8 mM-affinity fragments with ligand efficiencies higher than 0.3. All of the fragment hits present a similar chemical structure, with a hydrophobic core and a positively charged group, and bind to either sY7 or H1S68 pockets, where they share pharmacophoric properties with experimentally resolved natural binders. This work presents a large-scale screening assay using an exclusive combination of thousands of short MD adaptive simulations analyzed with a Markov state model (MSM) framework.

Affinity of hemoglobin for the cytoplasmic fragment of human erythrocyte membrane band 3. Equilibrium measurements at physiological pH using matrix-bound proteins: the effects of ionic strength, deoxygenation and of 2,3-diphosphoglycerate.

PubMed

Chétrite, G; Cassoly, R

1985-10-05

The cytoplasmic fragment of band 3 protein isolated from the human erythrocyte membrane was linked to a CNBr-activated Sepharose matrix in an attempt to measure, in batch experiments, its equilibrium binding constant with oxy- and deoxyhemoglobin at physiological pH and ionic strength values and in the presence or the absence of 2,3-diphosphoglycerate. All the experiments were done at pH 7.2, and equilibrium constants were computed on the basis of one hemoglobin tetramer bound per monomer of fragment. In 10 mM-phosphate buffer, a dissociation constant KD = 2 X 10(-4)M was measured for oxyhemoglobin and was shown to increase to 8 X 10(-4)M in the presence of 50 mM-NaCl. Association could not be demonstrated at higher salt concentrations. Diphosphoglycerate-stripped deoxyhemoglobin was shown to associate more strongly with the cytoplasmic fragment of band 3. In 10 mM-bis-Tris (pH 7.2) and in the presence of 120 mM-NaCl, a dissociation constant KD = 4 X 10(-4)M was measured. Upon addition of increasing amounts of 2,3-diphosphoglycerate, the complex formed between deoxyhemoglobin and the cytoplasmic fragment of band 3 was dissociated. On the reasonable assumption that the hemoglobin binding site present on band 3 fragment was not modified upon linking the protein to the Sepharose matrix, the results indicated that diphosphoglycerate-stripped deoxyhemoglobin or partially liganded hemoglobin tetramers in the T state could bind band 3 inside the intact human red blood cell.

Specific binding of (/sup 3/H-Tyr8)physalaemin to rat submaxillary gland substance P receptor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bahouth, S.W.; Lazaro, D.M.; Brundish, D.E.

1985-01-01

(/sup 3/H)Physalaemin ((/sup 3/H)PHY) binds to a single class of noninteracting sites on rat submaxillary gland membranes suspended in high ionic strength media with a KD of 2.7 nM, a Bmax of 240 fmol/mg of protein, and low nonspecific binding. The relative potencies of substance P (SP) and its fragments in competing with (/sup 3/H)PHY correlate with their relative salivation potencies. This indicates that (/sup 3/H)PHY interacts with a physiologically relevant SP receptor. In low ionic strength media, the KD of (/sup 3/H)PHY does not change, but SP and some of its fragments are more potent than PHY in competingmore » with (/sup 3/H) PHY. Computer-assisted analysis of (/sup 3/H)PHY and (/sup 3/H)SP binding in high and low ionic strength media demonstrated that both peptides are equipotent in high ionic strength but that the affinity of SP increases by 70-fold in low ionic strength. The SP fragments that contain a basic residue in positions 1 and/or 3 also display an increased affinity in low ionic strength. These findings document that (/sup 3/H)PHY binding in high ionic strength (mu . 0.6) accurately reflects the pharmacological potencies of agonists on the SP-P receptor. The binding of (/sup 3/H)PHY, like that of (/sup 3/H)SP, increases by the addition of divalent cations (Mg2+ greater than Ca2+ greater than Mn2+). Guanine nucleotides decrease (/sup 3/H)PHY binding by decreasing the Bmax to the same level (160 fmol/mg of protein), in the presence or absence of Mg2+.« less

Crystallographic fragment-based drug discovery: use of a brominated fragment library targeting HIV protease.

PubMed

Tiefenbrunn, Theresa; Forli, Stefano; Happer, Meaghan; Gonzalez, Ana; Tsai, Yingssu; Soltis, Michael; Elder, John H; Olson, Arthur J; Stout, Charles D

2014-02-01

A library of 68 brominated fragments was screened against a new crystal form of inhibited HIV-1 protease in order to probe surface sites in soaking experiments. Often, fragments are weak binders with partial occupancy, resulting in weak, difficult-to-fit electron density. The use of a brominated fragment library addresses this challenge, as bromine can be located unequivocally via anomalous scattering. Data collection was carried out in an automated fashion using AutoDrug at SSRL. Novel hits were identified in the known surface sites: 3-bromo-2,6-dimethoxybenzoic acid (Br6) in the flap site and 1-bromo-2-naphthoic acid (Br27) in the exosite, expanding the chemistry of known fragments for development of higher affinity potential allosteric inhibitors. At the same time, mapping the binding sites of a number of weaker binding Br-fragments provides further insight into the nature of these surface pockets. © 2013 John Wiley & Sons A/S.

Inhibition of ligand exchange kinetics via active-site trapping with an antibody fragment.

PubMed

Oyen, David; Steyaert, Jan; Barlow, John N

2014-04-01

We describe the first example of an inhibitory antibody fragment (nanobody ca1697) that binds simultaneously to an enzyme (the enzyme dihydrofolate reductase from Escherichia coli) and its bound substrate (folate). Binding of the antibody to the substrate causes a 20-fold reduction in the rate of folate exchange kinetics. This work opens up the prospect of designing new types of antibody-based inhibitors of enzymes and receptors through suitable design of immunogens.

p65 fragments, homologous to the C2 region of protein kinase C, bind to the intracellular receptors for protein kinase C.

PubMed

Mochly-Rosen, D; Miller, K G; Scheller, R H; Khaner, H; Lopez, J; Smith, B L

1992-09-08

Receptors for activated protein kinase C (RACKs) have been isolated from the particulate cell fraction of heart and brain. We previously demonstrated that binding of protein kinase C (PKC) to RACKs requires PKC activators and is via a site on PKC that is distinct from the substrate binding site. Here, we examine the possibility that the C2 region in the regulatory domain of PKC is involved in binding of PKC to RACKs. The synaptic vesicle-specific p65 protein contains two regions homologous to the C2 region of PKC. We found that three p65 fragments, containing either one or two of these PKC C2 homologous regions, bound to highly purified RACKs. Binding of the p65 fragments and PKC to RACKs was mutually exclusive; preincubation of RACKs with the p65 fragments inhibited PKC binding, and preincubation of RACKs with PKC inhibited binding of the p65 fragments. Preincubation of the p65 fragments with a peptide resembling the PKC binding site on RACKs also inhibited p65 binding to RACKs, suggesting that PKC and p65 bind to the same or nearby regions on RACKs. Since the only homologous region between PKC and the p65 fragments is the C2 region, these results suggest that the C2 region on PKC contains at least part of the RACK binding site.

Identification of dengue viral RNA-dependent RNA polymerase inhibitor using computational fragment-based approaches and molecular dynamics study.

PubMed

Anusuya, Shanmugam; Velmurugan, Devadasan; Gromiha, M Michael

2016-07-01

Dengue is a major public health concern in tropical and subtropical countries of the world. There are no specific drugs available to treat dengue. Even though several candidates targeted both viral and host proteins to overcome dengue infection, they have not yet entered into the later stages of clinical trials. In order to design a drug for dengue fever, newly emerged fragment-based drug designing technique was applied. RNA-dependent RNA polymerase, which is essential for dengue viral replication is chosen as a drug target for dengue drug discovery. A cascade of methods, fragment screening, fragment growing, and fragment linking revealed the compound [2-(4-carbamoylpiperidin-1-yl)-2-oxoethyl]8-(1,3-benzothiazol-2-yl)naphthalene-1-carboxylate as a potent dengue viral polymerase inhibitor. Both strain energy and binding free energy calculations predicted that this could be a better inhibitor than the existing ones. Molecular dynamics simulation studies showed that the dengue polymerase-lead complex is stable and their interactions are consistent throughout the simulation. The hydrogen-bonded interactions formed by the residues Arg792, Thr794, Ser796, and Asn405 are the primary contributors for the stability and the rigidity of the polymerase-lead complex. This might keep the polymerase in closed conformation and thus inhibits viral replication. Hence, this might be a promising lead molecule for dengue drug designing. Further optimization of this lead molecule would result in a potent drug for dengue.

Probing conformational states of glutaryl-CoA dehydrogenase by fragment screening

DOE Office of Scientific and Technical Information (OSTI.GOV)

Begley, Darren W.; Davies, Douglas R.; Hartley, Robert C.

Glutaric acidemia type 1 is an inherited metabolic disorder which can cause macrocephaly, muscular rigidity, spastic paralysis and other progressive movement disorders in humans. The defects in glutaryl-CoA dehydrogenase (GCDH) associated with this disease are thought to increase holoenzyme instability and reduce cofactor binding. Here, the first structural analysis of a GCDH enzyme in the absence of the cofactor flavin adenine dinucleotide (FAD) is reported. The apo structure of GCDH from Burkholderia pseudomallei reveals a loss of secondary structure and increased disorder in the FAD-binding pocket relative to the ternary complex of the highly homologous human GCDH. After conducting amore » fragment-based screen, four small molecules were identified which bind to GCDH from B. pseudomallei. Complex structures were determined for these fragments, which cause backbone and side-chain perturbations to key active-site residues. Structural insights from this investigation highlight differences from apo GCDH and the utility of small-molecular fragments as chemical probes for capturing alternative conformational states of preformed protein crystals.« less

Understanding Cryptic Pocket Formation in Protein Targets by Enhanced Sampling Simulations.

PubMed

Oleinikovas, Vladimiras; Saladino, Giorgio; Cossins, Benjamin P; Gervasio, Francesco L

2016-11-02

Cryptic pockets, that is, sites on protein targets that only become apparent when drugs bind, provide a promising alternative to classical binding sites for drug development. Here, we investigate the nature and dynamical properties of cryptic sites in four pharmacologically relevant targets, while comparing the efficacy of various simulation-based approaches in discovering them. We find that the studied cryptic sites do not correspond to local minima in the computed conformational free energy landscape of the unliganded proteins. They thus promptly close in all of the molecular dynamics simulations performed, irrespective of the force-field used. Temperature-based enhanced sampling approaches, such as Parallel Tempering, do not improve the situation, as the entropic term does not help in the opening of the sites. The use of fragment probes helps, as in long simulations occasionally it leads to the opening and binding to the cryptic sites. Our observed mechanism of cryptic site formation is suggestive of an interplay between two classical mechanisms: induced-fit and conformational selection. Employing this insight, we developed a novel Hamiltonian Replica Exchange-based method "SWISH" (Sampling Water Interfaces through Scaled Hamiltonians), which combined with probes resulted in a promising general approach for cryptic site discovery. We also addressed the issue of "false-positives" and propose a simple approach to distinguish them from druggable cryptic pockets. Our simulations, whose cumulative sampling time was more than 200 μs, help in clarifying the molecular mechanism of pocket formation, providing a solid basis for the choice of an efficient computational method.

Template-based de novo design for type II kinase inhibitors and its extented application to acetylcholinesterase inhibitors.

PubMed

Su, Bo-Han; Huang, Yi-Syuan; Chang, Chia-Yun; Tu, Yi-Shu; Tseng, Yufeng J

2013-10-31

There is a compelling need to discover type II inhibitors targeting the unique DFG-out inactive kinase conformation since they are likely to possess greater potency and selectivity relative to traditional type I inhibitors. Using a known inhibitor, such as a currently available and approved drug or inhibitor, as a template to design new drugs via computational de novo design is helpful when working with known ligand-receptor interactions. This study proposes a new template-based de novo design protocol to discover new inhibitors that preserve and also optimize the binding interactions of the type II kinase template. First, sorafenib (Nexavar) and nilotinib (Tasigna), two type II inhibitors with different ligand-receptor interactions, were selected as the template compounds. The five-step protocol can reassemble each drug from a large fragment library. Our procedure demonstrates that the selected template compounds can be successfully reassembled while the key ligand-receptor interactions are preserved. Furthermore, to demonstrate that the algorithm is able to construct more potent compounds, we considered kinase inhibitors and other protein dataset, acetylcholinesterase (AChE) inhibitors. The de novo optimization was initiated using a template compound possessing a less than optimal activity from a series of aminoisoquinoline and TAK-285 inhibiting type II kinases, and E2020 derivatives inhibiting AChE respectively. Three compounds with greater potency than the template compound were discovered that were also included in the original congeneric series. This template-based lead optimization protocol with the fragment library can help to design compounds with preferred binding interactions of known inhibitors automatically and further optimize the compounds in the binding pockets.

Mass spectrometry for fragment screening.

PubMed

Chan, Daniel Shiu-Hin; Whitehouse, Andrew J; Coyne, Anthony G; Abell, Chris

2017-11-08

Fragment-based approaches in chemical biology and drug discovery have been widely adopted worldwide in both academia and industry. Fragment hits tend to interact weakly with their targets, necessitating the use of sensitive biophysical techniques to detect their binding. Common fragment screening techniques include differential scanning fluorimetry (DSF) and ligand-observed NMR. Validation and characterization of hits is usually performed using a combination of protein-observed NMR, isothermal titration calorimetry (ITC) and X-ray crystallography. In this context, MS is a relatively underutilized technique in fragment screening for drug discovery. MS-based techniques have the advantage of high sensitivity, low sample consumption and being label-free. This review highlights recent examples of the emerging use of MS-based techniques in fragment screening. © 2017 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

Cytidine derivatives as IspF inhibitors of Burkolderia pseudomallei

PubMed Central

Zhang, Zheng; Jakkaraju, Sriram; Blain, Joy; Gogol, Kenneth; Zhao, Lei; Hartley, Robert C.; Karlsson, Courtney A.; Staker, Bart L.; Stewart, Lance J.; Myler, Peter J.; Clare, Michael; Begley, Darren W.; Horn, James R.; Hagen, Timothy J

2013-01-01

Published biological data suggest that the methyl erythritol phosphate (MEP) pathway, a non-mevalonate isoprenoid biosynthetic pathway, is essential for certain bacteria and other infectious disease organisms. One highly conserved enzyme in the MEP pathway is 2C-methyl-D-erythritol 2,4-cyclodiphosphate synthase (IspF). Fragment-bound complexes of IspF from Burkholderia pseudomallei were used to design and synthesize a series of molecules linking the cytidine moiety to different zinc pocket fragment binders. Testing by surface plasmon resonance (SPR) found one molecule in the series to possess binding affinity equal to that of cytidine diphosphate, despite lacking any metal-coordinating phosphate groups. Close inspection of the SPR data suggest different binding stoichiometries between IspF and test compounds. Crystallographic analysis shows important variations between the binding mode of one synthesized compound and the pose of the bound fragment from which it was designed. The binding modes of these molecules add to our structural knowledge base for IspF and suggest future refinements in this compound series. PMID:24157367

Fragment screening of cyclin G-associated kinase by weak affinity chromatography.

PubMed

Meiby, Elinor; Knapp, Stefan; Elkins, Jonathan M; Ohlson, Sten

2012-11-01

Fragment-based drug discovery (FBDD) has become a new strategy for drug discovery where lead compounds are evolved from small molecules. These fragments form low affinity interactions (dissociation constant (K(D)) = mM - μM) with protein targets, which require fragment screening methods of sufficient sensitivity. Weak affinity chromatography (WAC) is a promising new technology for fragment screening based on selective retention of fragments by a drug target. Kinases are a major pharmaceutical target, and FBDD has been successfully applied to several of these targets. In this work, we have demonstrated the potential to use WAC in combination with mass spectrometry (MS) detection for fragment screening of a kinase target-cyclin G-associated kinase (GAK). One hundred seventy fragments were selected for WAC screening by virtual screening of a commercial fragment library against the ATP-binding site of five different proteins. GAK protein was immobilized on a capillary HPLC column, and compound binding was characterized by frontal affinity chromatography. Compounds were screened in sets of 13 or 14, in combination with MS detection for enhanced throughput. Seventy-eight fragments (46 %) with K(D) < 200 μM were detected, including a few highly efficient GAK binders (K(D) of 2 μM; ligand efficiency = 0.51). Of special interest is that chiral screening by WAC may be possible, as two stereoisomeric fragments, which both contained one chiral center, demonstrated twin peaks. This ability, in combination with the robustness, sensitivity, and simplicity of WAC makes it a new method for fragment screening of considerable potential.

Discovery of Potent Non-Nucleoside Inhibitors of Dengue Viral RNA-Dependent RNA Polymerase from a Fragment Hit Using Structure-Based Drug Design.

PubMed

Yokokawa, Fumiaki; Nilar, Shahul; Noble, Christian G; Lim, Siew Pheng; Rao, Ranga; Tania, Stefani; Wang, Gang; Lee, Gladys; Hunziker, Jürg; Karuna, Ratna; Manjunatha, Ujjini; Shi, Pei-Yong; Smith, Paul W

2016-04-28

The discovery and optimization of non-nucleoside dengue viral RNA-dependent-RNA polymerase (RdRp) inhibitors are described. An X-ray-based fragment screen of Novartis' fragment collection resulted in the identification of a biphenyl acetic acid fragment 3, which bound in the palm subdomain of RdRp. Subsequent optimization of the fragment hit 3, relying on structure-based design, resulted in a >1000-fold improvement in potency in vitro and acquired antidengue activity against all four serotypes with low micromolar EC50 in cell-based assays. The lead candidate 27 interacts with a novel binding pocket in the palm subdomain of the RdRp and exerts a promising activity against all clinically relevant dengue serotypes.

The rise of fragment-based drug discovery.

PubMed

Murray, Christopher W; Rees, David C

2009-06-01

The search for new drugs is plagued by high attrition rates at all stages in research and development. Chemists have an opportunity to tackle this problem because attrition can be traced back, in part, to the quality of the chemical leads. Fragment-based drug discovery (FBDD) is a new approach, increasingly used in the pharmaceutical industry, for reducing attrition and providing leads for previously intractable biological targets. FBDD identifies low-molecular-weight ligands (∼150 Da) that bind to biologically important macromolecules. The three-dimensional experimental binding mode of these fragments is determined using X-ray crystallography or NMR spectroscopy, and is used to facilitate their optimization into potent molecules with drug-like properties. Compared with high-throughput-screening, the fragment approach requires fewer compounds to be screened, and, despite the lower initial potency of the screening hits, offers more efficient and fruitful optimization campaigns. Here, we review the rise of FBDD, including its application to discovering clinical candidates against targets for which other chemistry approaches have struggled.

Insights into the Impact of Linker Flexibility and Fragment Ionization on the Design of CK2 Allosteric Inhibitors: Comparative Molecular Dynamics Simulation Studies.

PubMed

Zhou, Yue; Zhang, Na; Qi, Xiaoqian; Tang, Shan; Sun, Guohui; Zhao, Lijiao; Zhong, Rugang; Peng, Yongzhen

2018-01-01

Protein kinase is a novel therapeutic target for human diseases. The off-target and side effects of ATP-competitive inhibitors preclude them from the clinically relevant drugs. The compounds targeting the druggable allosteric sites outside the highly conversed ATP binding pocket have been identified as promising alternatives to overcome current barriers of ATP-competitive inhibitors. By simultaneously interacting with the αD region (new allosteric site) and sub-ATP binding pocket, the attractive compound CAM4066 was named as allosteric inhibitor of CK2α. It has been demonstrated that the rigid linker and non-ionizable substituted fragment resulted in significant decreased inhibitory activities of compounds. The molecular dynamics simulations and energy analysis revealed that the appropriate coupling between the linker and pharmacophore fragments were essential for binding of CAM4066 with CK2α. The lower flexible linker of compound 21 lost the capability of coupling fragments A and B to αD region and positive area, respectively, whereas the methyl benzoate of fragment B induced the re-orientated Pre-CAM4066 with the inappropriate polar interactions. Most importantly, the match between the optimized linker and pharmacophore fragments is the challenging work of fragment-linking based drug design. These results provide rational clues to further structural modification and development of highly potent allosteric inhibitors of CK2.

Insights into the Impact of Linker Flexibility and Fragment Ionization on the Design of CK2 Allosteric Inhibitors: Comparative Molecular Dynamics Simulation Studies

PubMed Central

Zhou, Yue; Zhang, Na; Qi, Xiaoqian; Tang, Shan; Zhao, Lijiao; Zhong, Rugang; Peng, Yongzhen

2018-01-01

Protein kinase is a novel therapeutic target for human diseases. The off-target and side effects of ATP-competitive inhibitors preclude them from the clinically relevant drugs. The compounds targeting the druggable allosteric sites outside the highly conversed ATP binding pocket have been identified as promising alternatives to overcome current barriers of ATP-competitive inhibitors. By simultaneously interacting with the αD region (new allosteric site) and sub-ATP binding pocket, the attractive compound CAM4066 was named as allosteric inhibitor of CK2α. It has been demonstrated that the rigid linker and non-ionizable substituted fragment resulted in significant decreased inhibitory activities of compounds. The molecular dynamics simulations and energy analysis revealed that the appropriate coupling between the linker and pharmacophore fragments were essential for binding of CAM4066 with CK2α. The lower flexible linker of compound 21 lost the capability of coupling fragments A and B to αD region and positive area, respectively, whereas the methyl benzoate of fragment B induced the re-orientated Pre-CAM4066 with the inappropriate polar interactions. Most importantly, the match between the optimized linker and pharmacophore fragments is the challenging work of fragment-linking based drug design. These results provide rational clues to further structural modification and development of highly potent allosteric inhibitors of CK2. PMID:29301250

"Plug-and-Play" potentials: Investigating quantum effects in (H2)2-Li+-benzene

NASA Astrophysics Data System (ADS)

D'Arcy, Jordan H.; Kolmann, Stephen J.; Jordan, Meredith J. T.

2015-08-01

Quantum and anharmonic effects are investigated in (H2)2-Li+-benzene, a model for hydrogen adsorption in metal-organic frameworks and carbon-based materials, using rigid-body diffusion Monte Carlo (RBDMC) simulations. The potential-energy surface (PES) is calculated as a modified Shepard interpolation of M05-2X/6-311+G(2df,p) electronic structure data. The RBDMC simulations yield zero-point energies (ZPE) and probability density histograms that describe the ground-state nuclear wavefunction. Binding a second H2 molecule to the H2-Li+-benzene complex increases the ZPE of the system by 5.6 kJ mol-1 to 17.6 kJ mol-1. This ZPE is 42% of the total electronic binding energy of (H2)2-Li+-benzene and cannot be neglected. Our best estimate of the 0 K binding enthalpy of the second H2 to H2-Li+-benzene is 7.7 kJ mol-1, compared to 12.4 kJ mol-1 for the first H2 molecule. Anharmonicity is found to be even more important when a second (and subsequent) H2 molecule is adsorbed; use of harmonic ZPEs results in significant error in the 0 K binding enthalpy. Probability density histograms reveal that the two H2 molecules are found at larger distance from the Li+ ion and are more confined in the θ coordinate than in H2-Li+-benzene. They also show that both H2 molecules are delocalized in the azimuthal coordinate, ϕ. That is, adding a second H2 molecule is insufficient to localize the wavefunction in ϕ. Two fragment-based (H2)2-Li+-benzene PESs are developed. These use a modified Shepard interpolation for the Li+-benzene and H2-Li+-benzene fragments, and either modified Shepard interpolation or a cubic spline to model the H2-H2 interaction. Because of the neglect of three-body H2, H2, Li+ terms, both fragment PESs lead to overbinding of the second H2 molecule by 1.5 kJ mol-1. Probability density histograms, however, indicate that the wavefunctions for the two H2 molecules are effectively identical on the "full" and fragment PESs. This suggests that the 1.5 kJ mol-1 error is systematic over the regions of configuration space explored by our simulations. Notwithstanding this, modified Shepard interpolation of the weak H2-H2 interaction is problematic and we obtain more accurate results, at considerably lower computational cost, using a cubic spline interpolation. Indeed, the ZPE of the fragment-with-spline PES is identical, within error, to the ZPE of the full PES. This fragmentation scheme therefore provides an accurate and inexpensive method to study higher hydrogen loading in this and similar systems.

"Plug-and-Play" potentials: Investigating quantum effects in (H2)2-Li(+)-benzene.

PubMed

D'Arcy, Jordan H; Kolmann, Stephen J; Jordan, Meredith J T

2015-08-21

Quantum and anharmonic effects are investigated in (H2)2-Li(+)-benzene, a model for hydrogen adsorption in metal-organic frameworks and carbon-based materials, using rigid-body diffusion Monte Carlo (RBDMC) simulations. The potential-energy surface (PES) is calculated as a modified Shepard interpolation of M05-2X/6-311+G(2df,p) electronic structure data. The RBDMC simulations yield zero-point energies (ZPE) and probability density histograms that describe the ground-state nuclear wavefunction. Binding a second H2 molecule to the H2-Li(+)-benzene complex increases the ZPE of the system by 5.6 kJ mol(-1) to 17.6 kJ mol(-1). This ZPE is 42% of the total electronic binding energy of (H2)2-Li(+)-benzene and cannot be neglected. Our best estimate of the 0 K binding enthalpy of the second H2 to H2-Li(+)-benzene is 7.7 kJ mol(-1), compared to 12.4 kJ mol(-1) for the first H2 molecule. Anharmonicity is found to be even more important when a second (and subsequent) H2 molecule is adsorbed; use of harmonic ZPEs results in significant error in the 0 K binding enthalpy. Probability density histograms reveal that the two H2 molecules are found at larger distance from the Li(+) ion and are more confined in the θ coordinate than in H2-Li(+)-benzene. They also show that both H2 molecules are delocalized in the azimuthal coordinate, ϕ. That is, adding a second H2 molecule is insufficient to localize the wavefunction in ϕ. Two fragment-based (H2)2-Li(+)-benzene PESs are developed. These use a modified Shepard interpolation for the Li(+)-benzene and H2-Li(+)-benzene fragments, and either modified Shepard interpolation or a cubic spline to model the H2-H2 interaction. Because of the neglect of three-body H2, H2, Li(+) terms, both fragment PESs lead to overbinding of the second H2 molecule by 1.5 kJ mol(-1). Probability density histograms, however, indicate that the wavefunctions for the two H2 molecules are effectively identical on the "full" and fragment PESs. This suggests that the 1.5 kJ mol(-1) error is systematic over the regions of configuration space explored by our simulations. Notwithstanding this, modified Shepard interpolation of the weak H2-H2 interaction is problematic and we obtain more accurate results, at considerably lower computational cost, using a cubic spline interpolation. Indeed, the ZPE of the fragment-with-spline PES is identical, within error, to the ZPE of the full PES. This fragmentation scheme therefore provides an accurate and inexpensive method to study higher hydrogen loading in this and similar systems.

Computational Modeling Approach in Probing the Effects of Cytosine Methylation on the Transcription Factor Binding to DNA.

PubMed

Tenayuca, John; Cousins, Kimberley; Yang, Shumei; Zhang, Lubo

2017-01-01

Cytosine methylation at CpG dinucleotides is a chief mechanism in epigenetic modification of gene expression patterns. Previous studies demonstrated that increased CpG methylation of Sp1 sites at -268 and -346 of protein kinase C ε promoter repressed the gene expression. The present study investigated the impact of CpG methylation on the Sp1 binding via molecular modeling and electrophoretic mobility shift assay. Each of the Sp1 sites contain two CpGs. Methylation of either CpG lowered the binding affinity of Sp1, whereas methylation of both CpGs produced a greater decrease in the binding affinity. Computation of van der Waals (VDW) energy of Sp1 in complex with the Sp1 sites demonstrated increased VDW values from one to two sites of CpG methylation. Molecular modeling indicated that single CpG methylation caused underwinding of the DNA fragment, with the phosphate groups at C1, C4 and C5 reoriented from their original positions. Methylation of both CpGs pinched the minor groove and increased the helical twist concomitant with a shallow, hydrophobic major groove. Additionally, double methylation eliminated hydrogen bonds on recognition helix residues located at positions -1 and 1, which were essential for interaction with O6/N7 of G-bases. Bonding from linker residues Arg565, Lys595 and Lys596 were also reduced. Methylation of single or both CpGs significantly affected hydrogen bonding from all three Sp1 DNA binding domains, demonstrating that the consequences of cytosine modification extend beyond the neighboring nucleotides. The results indicate that cytosine methylation causes subtle structural alterations in Sp1 binding sites consequently resulting in inhibition of side chain interactions critical for specific base recognition and reduction of the binding affinity of Sp1. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Computational medicinal chemistry in fragment-based drug discovery: what, how and when.

PubMed

Rabal, Obdulia; Urbano-Cuadrado, Manuel; Oyarzabal, Julen

2011-01-01

The use of fragment-based drug discovery (FBDD) has increased in the last decade due to the encouraging results obtained to date. In this scenario, computational approaches, together with experimental information, play an important role to guide and speed up the process. By default, FBDD is generally considered as a constructive approach. However, such additive behavior is not always present, therefore, simple fragment maturation will not always deliver the expected results. In this review, computational approaches utilized in FBDD are reported together with real case studies, where applicability domains are exemplified, in order to analyze them, and then, maximize their performance and reliability. Thus, a proper use of these computational tools can minimize misleading conclusions, keeping the credit on FBDD strategy, as well as achieve higher impact in the drug-discovery process. FBDD goes one step beyond a simple constructive approach. A broad set of computational tools: docking, R group quantitative structure-activity relationship, fragmentation tools, fragments management tools, patents analysis and fragment-hopping, for example, can be utilized in FBDD, providing a clear positive impact if they are utilized in the proper scenario - what, how and when. An initial assessment of additive/non-additive behavior is a critical point to define the most convenient approach for fragments elaboration.

Fragment-Based Drug Discovery Using NMR Spectroscopy

PubMed Central

Harner, Mary J.; Frank, Andreas O.; Fesik, Stephen W.

2013-01-01

Nuclear magnetic resonance (NMR) spectroscopy has evolved into a powerful tool for fragment-based drug discovery over the last two decades. While NMR has been traditionally used to elucidate the three-dimensional structures and dynamics of biomacromolecules and their interactions, it can also be a very valuable tool for the reliable identification of small molecules that bind to proteins and for hit-to-lead optimization. Here, we describe the use of NMR spectroscopy as a method for fragment-based drug discovery and how to most effectively utilize this approach for discovering novel therapeutics based on our experience. PMID:23686385

Computer Model Of Fragmentation Of Atomic Nuclei

NASA Technical Reports Server (NTRS)

Wilson, John W.; Townsend, Lawrence W.; Tripathi, Ram K.; Norbury, John W.; KHAN FERDOUS; Badavi, Francis F.

1995-01-01

High Charge and Energy Semiempirical Nuclear Fragmentation Model (HZEFRG1) computer program developed to be computationally efficient, user-friendly, physics-based program for generating data bases on fragmentation of atomic nuclei. Data bases generated used in calculations pertaining to such radiation-transport applications as shielding against radiation in outer space, radiation dosimetry in outer space, cancer therapy in laboratories with beams of heavy ions, and simulation studies for designing detectors for experiments in nuclear physics. Provides cross sections for production of individual elements and isotopes in breakups of high-energy heavy ions by combined nuclear and Coulomb fields of interacting nuclei. Written in ANSI FORTRAN 77.

Identification of sequence-structure RNA binding motifs for SELEX-derived aptamers.

PubMed

Hoinka, Jan; Zotenko, Elena; Friedman, Adam; Sauna, Zuben E; Przytycka, Teresa M

2012-06-15

Systematic Evolution of Ligands by EXponential Enrichment (SELEX) represents a state-of-the-art technology to isolate single-stranded (ribo)nucleic acid fragments, named aptamers, which bind to a molecule (or molecules) of interest via specific structural regions induced by their sequence-dependent fold. This powerful method has applications in designing protein inhibitors, molecular detection systems, therapeutic drugs and antibody replacement among others. However, full understanding and consequently optimal utilization of the process has lagged behind its wide application due to the lack of dedicated computational approaches. At the same time, the combination of SELEX with novel sequencing technologies is beginning to provide the data that will allow the examination of a variety of properties of the selection process. To close this gap we developed, Aptamotif, a computational method for the identification of sequence-structure motifs in SELEX-derived aptamers. To increase the chances of identifying functional motifs, Aptamotif uses an ensemble-based approach. We validated the method using two published aptamer datasets containing experimentally determined motifs of increasing complexity. We were able to recreate the author's findings to a high degree, thus proving the capability of our approach to identify binding motifs in SELEX data. Additionally, using our new experimental dataset, we illustrate the application of Aptamotif to elucidate several properties of the selection process.

Virtual screening filters for the design of type II p38 MAP kinase inhibitors: a fragment based library generation approach.

PubMed

Badrinarayan, Preethi; Sastry, G Narahari

2012-04-01

In this work, we introduce the development and application of a three-step scoring and filtering procedure for the design of type II p38 MAP kinase leads using allosteric fragments extracted from virtual screening hits. The design of the virtual screening filters is based on a thorough evaluation of docking methods, DFG-loop conformation, binding interactions and chemotype specificity of the 138 p38 MAP kinase inhibitors from Protein Data Bank bound to DFG-in and DFG-out conformations using Glide, GOLD and CDOCKER. A 40 ns molecular dynamics simulation with the apo, type I with DFG-in and type II with DFG-out forms was carried out to delineate the effects of structural variations on inhibitor binding. The designed docking-score and sub-structure filters were first tested on a dataset of 249 potent p38 MAP kinase inhibitors from seven diverse series and 18,842 kinase inhibitors from PDB, to gauge their capacity to discriminate between kinase and non-kinase inhibitors and likewise to selectively filter-in target-specific inhibitors. The designed filters were then applied in the virtual screening of a database of ten million (10⁷) compounds resulting in the identification of 100 hits. Based on their binding modes, 98 allosteric fragments were extracted from the hits and a fragment library was generated. New type II p38 MAP kinase leads were designed by tailoring the existing type I ATP site binders with allosteric fragments using a common urea linker. Target specific virtual screening filters can thus be easily developed for other kinases based on this strategy to retrieve target selective compounds. Copyright © 2012 Elsevier Inc. All rights reserved.

Neutralisation and binding of VHS virus by monovalent antibody fragments.

PubMed

Cupit, P M; Lorenzen, N; Strachan, G; Kemp, G J; Secombes, C J; Cunningham, C

2001-12-04

We have previously reported the cloning and characterisation of the heavy and light chain variable domain genes encoding three monoclonal antibodies (Mabs) that bind viral haemorrhagic septicaemia virus (VHSV). Two of these antibodies, 3F1H10 and 3F1A2 both neutralised the virus though 3F1A2 appeared to recognise a broader range of virus isolates. The variable domains of these two antibodies differ by only four residues (Lorenzen et al., 2000a. Fish Shellfish Immunol. 10, 129-142). To further study the mechanism of neutralisation, Fab fragments as well as a series of recombinant bacterial single chain antibody (scAb) fragments were generated from the three anti-VHSV Mabs and their variable domain genes, respectively. Fabs and scAbs derived from the neutralising Mabs were both able to neutralise the VHSV type 1 isolate DK-F1. In addition, a series of scAb fragments were produced using the 3F1H10 variable heavy (VH) chain and variable light (Vkappa) chain domains but containing, either alone or in dual combination, each of the four different residues present in 3F1A2. The dissociation constants of Mabs 3F1H10 and 3F1A2 and their respective Fab and scAb fragments were measured by BIAcore analysis and found to correlate with the capacity of each molecule to neutralise DK-F1. These investigations, together with computer assisted molecular analysis of the theoretical influence of each mutation on antigen binding, led to the identification of a single mutation at position 35a in the VH domain as having the most marked impact on viral neutralisation.

Kinetics of anti-carcinoembryonic antigen antibody internalization: effects of affinity, bivalency, and stability

PubMed Central

Schmidt, Michael M.; Thurber, Greg M.

2010-01-01

Theoretical analyses suggest that the cellular internalization and catabolism of bound antibodies contribute significantly to poor penetration into tumors. Here we quantitatively assess the internalization of antibodies and antibody fragments against the commonly targeted antigen carcinoembryonic antigen (CEA). Although CEA is often referred to as a non-internalizing or shed antigen, anti-CEA antibodies and antibody fragments are shown to be slowly endocytosed by LS174T cells with a half-time of 10–16 h, a time scale consistent with the metabolic turnover rate of CEA in the absence of antibody. Anti-CEA single chain variable fragments (scFvs) with significant differences in affinity, stability against protease digestion, and valency exhibit similar uptake rates of bound antibody. In contrast, one anti-CEA IgG exhibits unique binding and trafficking properties with twice as many molecules bound per cell at saturation and significantly faster cellular internalization after binding. The internalization rates measured herein can be used in simple computational models to predict the microdistribution of these antibodies in tumor spheroids. PMID:18408925

Computational exploration of zinc binding groups for HDAC inhibition.

PubMed

Chen, Kai; Xu, Liping; Wiest, Olaf

2013-05-17

Histone deacetylases (HDACs) have emerged as important drug targets in epigenetics. The most common HDAC inhibitors use hydroxamic acids as zinc binding groups despite unfavorable pharmacokinetic properties. A two-stage protocol of M05-2X calculations of a library of 48 fragments in a small model active site, followed by QM/MM hybrid calculations of the full enzyme with selected binders, is used to prospectively select potential bidentate zinc binders. The energetics and interaction patterns of several zinc binders not previously used for the inhibition of HDACs are discussed.

Site-specific fab fragment biotinylation at the conserved nucleotide binding site for enhanced Ebola detection.

PubMed

Mustafaoglu, Nur; Alves, Nathan J; Bilgicer, Basar

2015-07-01

The nucleotide binding site (NBS) is a highly conserved region between the variable light and heavy chains at the Fab domains of all antibodies, and a small molecule that we identified, indole-3-butyric acid (IBA), binds specifically to this site. Fab fragment, with its small size and simple production methods compared to intact antibody, is good candidate for use in miniaturized diagnostic devices and targeted therapeutic applications. However, commonly used modification techniques are not well suited for Fab fragments as they are often more delicate than intact antibodies. Fab fragments are of particular interest for sensor surface functionalization but immobilization results in damage to the antigen binding site and greatly reduced activity due to their truncated size that allows only a small area that can bind to surfaces without impeding antigen binding. In this study, we describe an NBS-UV photocrosslinking functionalization method (UV-NBS(Biotin) in which a Fab fragment is site-specifically biotinylated with an IBA-EG11-Biotin linker via UV energy exposure (1 J/cm(2)) without affecting its antigen binding activity. This study demonstrates successful immobilization of biotinylated Ebola detecting Fab fragment (KZ52 Fab fragment) via the UV-NBS(Biotin) method yielding 1031-fold and 2-fold better antigen detection sensitivity compared to commonly used immobilization methods: direct physical adsorption and NHS-Biotin functionalization, respectively. Utilization of the UV-NBS(Biotin) method for site-specific conjugation to Fab fragment represents a proof of concept use of Fab fragment for various diagnostic and therapeutic applications with numerous fluorescent probes, affinity molecules and peptides. © 2015 Wiley Periodicals, Inc.

Methylation of zebularine: a quantum mechanical study incorporating interactive 3D pdf graphs.

PubMed

Selvam, Lalitha; Vasilyev, Vladislav; Wang, Feng

2009-08-20

Methylation of a cytidine deaminase inhibitor, 1-(beta-D-ribofuranosyl)-2-pyrimidone (i.e., zebularine (zeb)), which produces 1-(beta-D-ribofuranosyl)-5-methyl-2-pyrimidinone (d5), has been investigated using density functional theory models. The optimized structures of zeb and d5 and the valence orbitals primarily responsible for the methylation in d5 are presented using state-of-the-art interactive (on a computer or online) three-dimensional (3D) graphics in a portable document format (pdf) file, 3D-PDF (http://www.web3d.org/x3d/vrml/ ). The facility to embed 3D molecular structures into pdf documents has been developed jointly at Swinburne University of Technology and the National Computational Infrastructure, the Australian National University. The methyl fragment in the base moiety shows little effect on the sugar puckering but apparently affects anisotropic properties, such as condensed Fukui functions. Binding energy spectra, both valence space and core space, are noticeably affected; in particular, in the outer-valence space (e.g., IP < 20 eV). The methyl fragment delocalizes and diffuses into almost all valence space, but orbitals 8 (57a, IP = 12.57 eV), 18 (47a, IP = 14.70 eV), and 37 (28a, IP = 22.15 eV) are identified as fingerprint for the methyl fragment. In the inner shell, however, the impact of the methyl can be localized and identified by chemical shift. A small, global, red shift is found for the O-K, N-K and sugar C-K spectra, whereas the base C-K spectrum exhibits apparent methyl-related changes.

STD-NMR experiments identify a structural motif with novel second-site activity against West Nile virus NS2B-NS3 protease.

PubMed

Schöne, Tobias; Grimm, Lena Lisbeth; Sakai, Naoki; Zhang, Linlin; Hilgenfeld, Rolf; Peters, Thomas

2017-10-01

West Nile virus (WNV) belongs to the genus Flavivirus of the family Flaviviridae. This mosquito-borne virus that is highly pathogenic to humans has been evolving into a global threat during the past two decades. Despite many efforts, neither antiviral drugs nor vaccines are available. The viral protease NS2B-NS3 pro is essential for viral replication, and therefore it is considered a prime drug target. However, success in the development of specific NS2B-NS3 pro inhibitors had been moderate so far. In the search for new structural motifs with binding affinity for NS2B-NS3 pro , we have screened a fragment library, the Maybridge Ro5 library, employing saturation transfer difference (STD) NMR experiments as readout. About 30% of 429 fragments showed binding to NS2B-NS3 pro . Subsequent STD-NMR competition experiments using the known active site fragment A as reporter ligand yielded 14 competitively binding fragments, and 22 fragments not competing with A. In a fluorophore-based protease assay, all of these fragments showed inhibition in the micromolar range. Interestingly, 10 of these 22 fragments showed a notable increase of STD intensities in the presence of compound A suggesting cooperative binding. The most promising non-competitive inhibitors 1 and 2 (IC 50 ∼ 500 μM) share a structural motif that may guide the development of novel second-site (potentially allosteric) inhibitors of NS2B-NS3 pro . To identify the matching protein binding site, chemical shift perturbation studies employing 1 H, 15 N-TROSY-HSQC experiments with uniformly 2 H, 15 N-labeled protease were performed in the presence of 1, and in the concomitant absence or presence of A. The data suggest that 1 interacts with Met 52* of NS2B, identifying a secondary site adjacent to the binding site of A. Therefore, our study paves the way for the synthesis of novel bidentate NS2B-NS3 pro inhibitors. Copyright © 2017 Elsevier B.V. All rights reserved.

Tracing neuronal circuits in transgenic animals by transneuronal control of transcription (TRACT)

PubMed Central

Huang, Ting-hao; Niesman, Peter; Arasu, Deepshika; Lee, Donghyung; De La Cruz, Aubrie L; Callejas, Antuca; Hong, Elizabeth J

2017-01-01

Understanding the computations that take place in brain circuits requires identifying how neurons in those circuits are connected to one another. We describe a technique called TRACT (TRAnsneuronal Control of Transcription) based on ligand-induced intramembrane proteolysis to reveal monosynaptic connections arising from genetically labeled neurons of interest. In this strategy, neurons expressing an artificial ligand (‘donor’ neurons) bind to and activate a genetically-engineered artificial receptor on their synaptic partners (‘receiver’ neurons). Upon ligand-receptor binding at synapses the receptor is cleaved in its transmembrane domain and releases a protein fragment that activates transcription in the synaptic partners. Using TRACT in Drosophila we have confirmed the connectivity between olfactory receptor neurons and their postsynaptic targets, and have discovered potential new connections between neurons in the circadian circuit. Our results demonstrate that the TRACT method can be used to investigate the connectivity of neuronal circuits in the brain. PMID:29231171

Computational discovery of picomolar Q(o) site inhibitors of cytochrome bc1 complex.

PubMed

Hao, Ge-Fei; Wang, Fu; Li, Hui; Zhu, Xiao-Lei; Yang, Wen-Chao; Huang, Li-Shar; Wu, Jia-Wei; Berry, Edward A; Yang, Guang-Fu

2012-07-11

A critical challenge to the fragment-based drug discovery (FBDD) is its low-throughput nature due to the necessity of biophysical method-based fragment screening. Herein, a method of pharmacophore-linked fragment virtual screening (PFVS) was successfully developed. Its application yielded the first picomolar-range Q(o) site inhibitors of the cytochrome bc(1) complex, an important membrane protein for drug and fungicide discovery. Compared with the original hit compound 4 (K(i) = 881.80 nM, porcine bc(1)), the most potent compound 4f displayed 20 507-fold improved binding affinity (K(i) = 43.00 pM). Compound 4f was proved to be a noncompetitive inhibitor with respect to the substrate cytochrome c, but a competitive inhibitor with respect to the substrate ubiquinol. Additionally, we determined the crystal structure of compound 4e (K(i) = 83.00 pM) bound to the chicken bc(1) at 2.70 Å resolution, providing a molecular basis for understanding its ultrapotency. To our knowledge, this study is the first application of the FBDD method in the discovery of picomolar inhibitors of a membrane protein. This work demonstrates that the novel PFVS approach is a high-throughput drug discovery method, independent of biophysical screening techniques.

sc-PDB-Frag: a database of protein-ligand interaction patterns for Bioisosteric replacements.

PubMed

Desaphy, Jérémy; Rognan, Didier

2014-07-28

Bioisosteric replacement plays an important role in medicinal chemistry by keeping the biological activity of a molecule while changing either its core scaffold or substituents, thereby facilitating lead optimization and patenting. Bioisosteres are classically chosen in order to keep the main pharmacophoric moieties of the substructure to replace. However, notably when changing a scaffold, no attention is usually paid as whether all atoms of the reference scaffold are equally important for binding to the desired target. We herewith propose a novel database for bioisosteric replacement (scPDBFrag), capitalizing on our recently published structure-based approach to scaffold hopping, focusing on interaction pattern graphs. Protein-bound ligands are first fragmented and the interaction of the corresponding fragments with their protein environment computed-on-the-fly. Using an in-house developed graph alignment tool, interaction patterns graphs can be compared, aligned, and sorted by decreasing similarity to any reference. In the herein presented sc-PDB-Frag database ( http://bioinfo-pharma.u-strasbg.fr/scPDBFrag ), fragments, interaction patterns, alignments, and pairwise similarity scores have been extracted from the sc-PDB database of 8077 druggable protein-ligand complexes and further stored in a relational database. We herewith present the database, its Web implementation, and procedures for identifying true bioisosteric replacements based on conserved interaction patterns.

Partial filling affinity capillary electrophoresis as a useful tool for fragment-based drug discovery: A proof of concept on thrombin.

PubMed

Farcaş, E; Bouckaert, C; Servais, A-C; Hanson, J; Pochet, L; Fillet, M

2017-09-01

With the emergence of more challenging targets, a relatively new approach, fragment-based drug discovery (FBDD), proved its efficacy and gained increasing importance in the pharmaceutical industry. FBDD identifies low molecular-weight (MW) ligands (fragments) that bind to biologically important macromolecules, then a structure-guided fragment growing or merging approach is performed, contributing to the quality of the lead. However, to select the appropriate fragment to be evolved, sensitive analytical screening methods must be used to measure the affinity in the μM or even mM range. In this particular context, we developed a robust and selective partial filling affinity CE (ACE) method for the direct binding screening of a small fragment library in order to identify new thrombin inhibitors. To demonstrate the accuracy of our assay, the complex dissociation constants of three known thrombin inhibitors, namely benzamidine, p-aminobenzamidine and nafamostat were determined and found to be in good concordance with the previously reported values. Finally, the screening of a small library was performed and demonstrated the high discriminatory power of our method towards weak binders compared to classical spectrophotometric activity assay, proving the interest of our method in the context of FBDD. Copyright © 2017 Elsevier B.V. All rights reserved.

Optimization of a binding fragment targeting the "enlarged methionine pocket" leads to potent Trypanosoma brucei methionyl-tRNA synthetase inhibitors.

PubMed

Huang, Wenlin; Zhang, Zhongsheng; Ranade, Ranae M; Gillespie, J Robert; Barros-Álvarez, Ximena; Creason, Sharon A; Shibata, Sayaka; Verlinde, Christophe L M J; Hol, Wim G J; Buckner, Frederick S; Fan, Erkang

2017-06-15

Potent inhibitors of Trypanosoma brucei methionyl-tRNA synthetase were previously designed using a structure-guided approach. Compounds 1 and 2 were the most active compounds in the cyclic and linear linker series, respectively. To further improve cellular potency, SAR investigation of a binding fragment targeting the "enlarged methionine pocket" (EMP) was performed. The optimization led to the identification of a 6,8-dichloro-tetrahydroquinoline ring as a favorable fragment to bind the EMP. Replacement of 3,5-dichloro-benzyl group (the EMP binding fragment) of inhibitor 2 using this tetrahydroquinoline fragment resulted in compound 13, that exhibited an EC 50 of 4nM. Copyright © 2017 Elsevier Ltd. All rights reserved.

Fragment-based drug design.

PubMed

Feyfant, Eric; Cross, Jason B; Paris, Kevin; Tsao, Désirée H H

2011-01-01

Fragment-based drug design (FBDD), which is comprised of both fragment screening and the use of fragment hits to design leads, began more than 15 years ago and has been steadily gaining in popularity and utility. Its origin lies on the fact that the coverage of chemical space and the binding efficiency of hits are directly related to the size of the compounds screened. Nevertheless, FBDD still faces challenges, among them developing fragment screening libraries that ensure optimal coverage of chemical space, physical properties and chemical tractability. Fragment screening also requires sensitive assays, often biophysical in nature, to detect weak binders. In this chapter we will introduce the technologies used to address these challenges and outline the experimental advantages that make FBDD one of the most popular new hit-to-lead process.

A fragment-based approach to the SAMPL3 Challenge

NASA Astrophysics Data System (ADS)

Kulp, John L.; Blumenthal, Seth N.; Wang, Qiang; Bryan, Richard L.; Guarnieri, Frank

2012-05-01

The success of molecular fragment-based design depends critically on the ability to make predictions of binding poses and of affinity ranking for compounds assembled by linking fragments. The SAMPL3 Challenge provides a unique opportunity to evaluate the performance of a state-of-the-art fragment-based design methodology with respect to these requirements. In this article, we present results derived from linking fragments to predict affinity and pose in the SAMPL3 Challenge. The goal is to demonstrate how incorporating different aspects of modeling protein-ligand interactions impact the accuracy of the predictions, including protein dielectric models, charged versus neutral ligands, ΔΔGs solvation energies, and induced conformational stress. The core method is based on annealing of chemical potential in a Grand Canonical Monte Carlo (GC/MC) simulation. By imposing an initially very high chemical potential and then automatically running a sequence of simulations at successively decreasing chemical potentials, the GC/MC simulation efficiently discovers statistical distributions of bound fragment locations and orientations not found reliably without the annealing. This method accounts for configurational entropy, the role of bound water molecules, and results in a prediction of all the locations on the protein that have any affinity for the fragment. Disregarding any of these factors in affinity-rank prediction leads to significantly worse correlation with experimentally-determined free energies of binding. We relate three important conclusions from this challenge as applied to GC/MC: (1) modeling neutral ligands—regardless of the charged state in the active site—produced better affinity ranking than using charged ligands, although, in both cases, the poses were almost exactly overlaid; (2) simulating explicit water molecules in the GC/MC gave better affinity and pose predictions; and (3) applying a ΔΔGs solvation correction further improved the ranking of the neutral ligands. Using the GC/MC method under a variety of parameters in the blinded SAMPL3 Challenge provided important insights to the relevant parameters and boundaries in predicting binding affinities using simulated annealing of chemical potential calculations.

SHOP: a method for structure-based fragment and scaffold hopping.

PubMed

Fontaine, Fabien; Cross, Simon; Plasencia, Guillem; Pastor, Manuel; Zamora, Ismael

2009-03-01

A new method for fragment and scaffold replacement is presented that generates new families of compounds with biological activity, using GRID molecular interaction fields (MIFs) and the crystal structure of the targets. In contrast to virtual screening strategies, this methodology aims only to replace a fragment of the original molecule, maintaining the other structural elements that are known or suspected to have a critical role in ligand binding. First, we report a validation of the method, recovering up to 95% of the original fragments searched among the top-five proposed solutions, using 164 fragment queries from 11 diverse targets. Second, six key customizable parameters are investigated, concluding that filtering the receptor MIF using the co-crystallized ligand atom type has the greatest impact on the ranking of the proposed solutions. Finally, 11 examples using more realistic scenarios have been performed; diverse chemotypes are returned, including some that are similar to compounds that are known to bind to similar targets.

A combination of 19F NMR and surface plasmon resonance for site-specific hit selection and validation of fragment molecules that bind to the ATP-binding site of a kinase.

PubMed

Nagatoishi, Satoru; Yamaguchi, Sou; Katoh, Etsuko; Kajita, Keita; Yokotagawa, Takane; Kanai, Satoru; Furuya, Toshio; Tsumoto, Kouhei

2018-05-01

19 F NMR has recently emerged as an efficient, sensitive tool for analyzing protein binding to small molecules, and surface plasmon resonance (SPR) is also a popular tool for this purpose. Herein a combination of 19 F NMR and SPR was used to find novel binders to the ATP-binding pocket of MAP kinase extracellular regulated kinase 2 (ERK2) by fragment screening with an original fluorinated-fragment library. The 19 F NMR screening yielded a high primary hit rate of binders to the ERK2 ATP-binding pocket compared with the rate for the SPR screening. Hit compounds were evaluated and categorized according to their ability to bind to different binding sites in the ATP-binding pocket. The binding manner was characterized by using isothermal titration calorimetry and docking simulation. Combining 19 F NMR with other biophysical methods allows the identification of multiple types of hit compounds, thereby increasing opportunities for drug design using preferred fragments. Copyright © 2018 Elsevier Ltd. All rights reserved.

Utilizing Fibronectin Integrin-Binding Specificity to Control Cellular Responses

PubMed Central

Bachman, Haylee; Nicosia, John; Dysart, Marilyn; Barker, Thomas H.

2015-01-01

Significance: Cells communicate with the extracellular matrix (ECM) protein fibronectin (Fn) through integrin receptors on the cell surface. Controlling integrin–Fn interactions offers a promising approach to directing cell behavior, such as adhesion, migration, and differentiation, as well as coordinated tissue behaviors such as morphogenesis and wound healing. Recent Advances: Several different groups have developed recombinant fragments of Fn that can control epithelial to mesenchymal transition, sequester growth factors, and promote bone and wound healing. It is thought that these physiological responses are, in part, due to specific integrin engagement. Furthermore, it has been postulated that the integrin-binding domain of Fn is a mechanically sensitive switch that drives binding of one integrin heterodimer over another. Critical Issues: Although computational simulations have predicted the mechano-switch hypothesis and recent evidence supports the existence of varying strain states of Fn in vivo, experimental evidence of the Fn integrin switch is still lacking. Future Directions: Evidence of the integrin mechano-switch will enable the development of new Fn-based peptides in tissue engineering and wound healing, as well as deepen our understanding of ECM pathologies, such as fibrosis. PMID:26244106

Tissue Specific and Hormonal Regulation of Gene Expression

DTIC Science & Technology

1997-08-01

interference assays were performed. These assays identify DNA bases that, when modified, interfere with the binding of the nuclear factor to the hCRH promoter...thymidine residues. The DNA bases that when modified affected the binding of the protein are noted with arrows, and their location in the hCRH...indicated. B. Methylation interference. The fragments were partially methylated using dimethyl sulfate. The DNA bases that when modified affected the

DOE Office of Scientific and Technical Information (OSTI.GOV)

D’Arcy, Jordan H.; Kolmann, Stephen J.; Jordan, Meredith J. T.

Quantum and anharmonic effects are investigated in (H{sub 2}){sub 2}–Li{sup +}–benzene, a model for hydrogen adsorption in metal-organic frameworks and carbon-based materials, using rigid-body diffusion Monte Carlo (RBDMC) simulations. The potential-energy surface (PES) is calculated as a modified Shepard interpolation of M05-2X/6-311+G(2df,p) electronic structure data. The RBDMC simulations yield zero-point energies (ZPE) and probability density histograms that describe the ground-state nuclear wavefunction. Binding a second H{sub 2} molecule to the H{sub 2}–Li{sup +}–benzene complex increases the ZPE of the system by 5.6 kJ mol{sup −1} to 17.6 kJ mol{sup −1}. This ZPE is 42% of the total electronic binding energymore » of (H{sub 2}){sub 2}–Li{sup +}–benzene and cannot be neglected. Our best estimate of the 0 K binding enthalpy of the second H{sub 2} to H{sub 2}–Li{sup +}–benzene is 7.7 kJ mol{sup −1}, compared to 12.4 kJ mol{sup −1} for the first H{sub 2} molecule. Anharmonicity is found to be even more important when a second (and subsequent) H{sub 2} molecule is adsorbed; use of harmonic ZPEs results in significant error in the 0 K binding enthalpy. Probability density histograms reveal that the two H{sub 2} molecules are found at larger distance from the Li{sup +} ion and are more confined in the θ coordinate than in H{sub 2}–Li{sup +}–benzene. They also show that both H{sub 2} molecules are delocalized in the azimuthal coordinate, ϕ. That is, adding a second H{sub 2} molecule is insufficient to localize the wavefunction in ϕ. Two fragment-based (H{sub 2}){sub 2}–Li{sup +}–benzene PESs are developed. These use a modified Shepard interpolation for the Li{sup +}–benzene and H{sub 2}–Li{sup +}–benzene fragments, and either modified Shepard interpolation or a cubic spline to model the H{sub 2}–H{sub 2} interaction. Because of the neglect of three-body H{sub 2}, H{sub 2}, Li{sup +} terms, both fragment PESs lead to overbinding of the second H{sub 2} molecule by 1.5 kJ mol{sup −1}. Probability density histograms, however, indicate that the wavefunctions for the two H{sub 2} molecules are effectively identical on the “full” and fragment PESs. This suggests that the 1.5 kJ mol{sup −1} error is systematic over the regions of configuration space explored by our simulations. Notwithstanding this, modified Shepard interpolation of the weak H{sub 2}–H{sub 2} interaction is problematic and we obtain more accurate results, at considerably lower computational cost, using a cubic spline interpolation. Indeed, the ZPE of the fragment-with-spline PES is identical, within error, to the ZPE of the full PES. This fragmentation scheme therefore provides an accurate and inexpensive method to study higher hydrogen loading in this and similar systems.« less

DNA Length Modulates the Affinity of Fragments of Genomic DNA for the Nuclear Matrix In Vitro.

PubMed

García-Vilchis, David; Aranda-Anzaldo, Armando

2017-12-01

Classical observations have shown that during the interphase the chromosomal DNA of metazoans is organized in supercoiled loops attached to a compartment known as the nuclear matrix (NM). Fragments of chromosomal DNA able to bind the isolated NM in vitro are known as matrix associated/attachment/addressed regions or MARs. No specific consensus sequence or motif has been found that may constitute a universal, defining feature of MARs. On the other hand, high-salt resistant DNA-NM interactions in situ define true DNA loop anchorage regions or LARs, that might correspond to a subset of the potential MARs but are not necessarily identical to MARs characterized in vitro, since there are several examples of MARs able to bind the NM in vitro but which are not actually bound to the NM in situ. In the present work we assayed the capacity of two LARs, as well as of shorter fragments within such LARs, for binding to the NM in vitro. Paradoxically the isolated (≈2 kb) LARs cannot bind to the NM in vitro while their shorter (≈300 pb) sub-fragments and other non-related but equally short DNA fragments, bind to the NM in a high-salt resistant fashion. Our results suggest that the ability of a given DNA fragment for binding to the NM in vitro primarily depends on the length of the fragment, suggesting that binding to the NM is modulated by the local topology of the DNA fragment in suspension that it is known to depend on the DNA length. J. Cell. Biochem. 118: 4487-4497, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Computer-Aided Drug Design (CADD): Methodological Aspects and Practical Applications in Cancer Research

NASA Astrophysics Data System (ADS)

Gianti, Eleonora

Computer-Aided Drug Design (CADD) has deservedly gained increasing popularity in modern drug discovery (Schneider, G.; Fechner, U. 2005), whether applied to academic basic research or the pharmaceutical industry pipeline. In this work, after reviewing theoretical advancements in CADD, we integrated novel and stateof- the-art methods to assist in the design of small-molecule inhibitors of current cancer drug targets, specifically: Androgen Receptor (AR), a nuclear hormone receptor required for carcinogenesis of Prostate Cancer (PCa); Signal Transducer and Activator of Transcription 5 (STAT5), implicated in PCa progression; and Epstein-Barr Nuclear Antigen-1 (EBNA1), essential to the Epstein Barr Virus (EBV) during latent infections. Androgen Receptor. With the aim of generating binding mode hypotheses for a class (Handratta, V.D. et al. 2005) of dual AR/CYP17 inhibitors (CYP17 is a key enzyme for androgens biosynthesis and therefore implicated in PCa development), we successfully implemented a receptor-based computational strategy based on flexible receptor docking (Gianti, E.; Zauhar, R.J. 2012). Then, with the ultimate goal of identifying novel AR binders, we performed Virtual Screening (VS) by Fragment-Based Shape Signatures, an improved version of the original method developed in our Laboratory (Zauhar, R.J. et al. 2003), and we used the results to fully assess the high-level performance of this innovative tool in computational chemistry. STAT5. The SRC Homology 2 (SH2) domain of STAT5 is responsible for phospho-peptide recognition and activation. As a keystone of Structure-Based Drug Design (SBDD), we characterized key residues responsible for binding. We also generated a model of STAT5 receptor bound to a phospho-peptide ligand, which was validated by docking publicly known STAT5 inhibitors. Then, we performed Shape Signatures- and docking-based VS of the ZINC database (zinc.docking.org), followed by Molecular Mechanics Generalized Born Surface Area (MMGBSA) simulations, paired with Principal Component Analysis (PCA) of top-scoring hits to identify novel lead molecules likely to be active against STAT5. EBNA1 is the only viral protein consistently expressed in the many EBV-associated tumors, and is required for viral genome maintenance during latent infection. To immediately assist SBDD, we computationally identified "druggable" binding sites of EBNA1, and our predictions were later confirmed by experimental evidence (The Wistar Institute proprietary data).

Fragment-based virtual screening approach and molecular dynamics simulation studies for identification of BACE1 inhibitor leads.

PubMed

Manoharan, Prabu; Ghoshal, Nanda

2018-05-01

Traditional structure-based virtual screening method to identify drug-like small molecules for BACE1 is so far unsuccessful. Location of BACE1, poor Blood Brain Barrier permeability and P-glycoprotein (Pgp) susceptibility of the inhibitors make it even more difficult. Fragment-based drug design method is suitable for efficient optimization of initial hit molecules for target like BACE1. We have developed a fragment-based virtual screening approach to identify/optimize the fragment molecules as a starting point. This method combines the shape, electrostatic, and pharmacophoric features of known fragment molecules, bound to protein conjugate crystal structure, and aims to identify both chemically and energetically feasible small fragment ligands that bind to BACE1 active site. The two top-ranked fragment hits were subjected for a 53 ns MD simulation. Principle component analysis and free energy landscape analysis reveal that the new ligands show the characteristic features of established BACE1 inhibitors. The potent method employed in this study may serve for the development of potential lead molecules for BACE1-directed Alzheimer's disease therapeutics.

Proteome-wide Identification of Novel Ceramide-binding Proteins by Yeast Surface cDNA Display and Deep Sequencing.

PubMed

Bidlingmaier, Scott; Ha, Kevin; Lee, Nam-Kyung; Su, Yang; Liu, Bin

2016-04-01

Although the bioactive sphingolipid ceramide is an important cell signaling molecule, relatively few direct ceramide-interacting proteins are known. We used an approach combining yeast surface cDNA display and deep sequencing technology to identify novel proteins binding directly to ceramide. We identified 234 candidate ceramide-binding protein fragments and validated binding for 20. Most (17) bound selectively to ceramide, although a few (3) bound to other lipids as well. Several novel ceramide-binding domains were discovered, including the EF-hand calcium-binding motif, the heat shock chaperonin-binding motif STI1, the SCP2 sterol-binding domain, and the tetratricopeptide repeat region motif. Interestingly, four of the verified ceramide-binding proteins (HPCA, HPCAL1, NCS1, and VSNL1) and an additional three candidate ceramide-binding proteins (NCALD, HPCAL4, and KCNIP3) belong to the neuronal calcium sensor family of EF hand-containing proteins. We used mutagenesis to map the ceramide-binding site in HPCA and to create a mutant HPCA that does not bind to ceramide. We demonstrated selective binding to ceramide by mammalian cell-produced wild type but not mutant HPCA. Intriguingly, we also identified a fragment from prostaglandin D2synthase that binds preferentially to ceramide 1-phosphate. The wide variety of proteins and domains capable of binding to ceramide suggests that many of the signaling functions of ceramide may be regulated by direct binding to these proteins. Based on the deep sequencing data, we estimate that our yeast surface cDNA display library covers ∼60% of the human proteome and our selection/deep sequencing protocol can identify target-interacting protein fragments that are present at extremely low frequency in the starting library. Thus, the yeast surface cDNA display/deep sequencing approach is a rapid, comprehensive, and flexible method for the analysis of protein-ligand interactions, particularly for the study of non-protein ligands. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Identification of sequence–structure RNA binding motifs for SELEX-derived aptamers

PubMed Central

Hoinka, Jan; Zotenko, Elena; Friedman, Adam; Sauna, Zuben E.; Przytycka, Teresa M.

2012-01-01

Motivation: Systematic Evolution of Ligands by EXponential Enrichment (SELEX) represents a state-of-the-art technology to isolate single-stranded (ribo)nucleic acid fragments, named aptamers, which bind to a molecule (or molecules) of interest via specific structural regions induced by their sequence-dependent fold. This powerful method has applications in designing protein inhibitors, molecular detection systems, therapeutic drugs and antibody replacement among others. However, full understanding and consequently optimal utilization of the process has lagged behind its wide application due to the lack of dedicated computational approaches. At the same time, the combination of SELEX with novel sequencing technologies is beginning to provide the data that will allow the examination of a variety of properties of the selection process. Results: To close this gap we developed, Aptamotif, a computational method for the identification of sequence–structure motifs in SELEX-derived aptamers. To increase the chances of identifying functional motifs, Aptamotif uses an ensemble-based approach. We validated the method using two published aptamer datasets containing experimentally determined motifs of increasing complexity. We were able to recreate the author's findings to a high degree, thus proving the capability of our approach to identify binding motifs in SELEX data. Additionally, using our new experimental dataset, we illustrate the application of Aptamotif to elucidate several properties of the selection process. Contact: przytyck@ncbi.nlm.nih.gov, Zuben.Sauna@fda.hhs.gov PMID:22689764

Evidence for glucocorticoid receptor binding to a site(s) in a remote region of the 5' flanking sequences of the human proopiomelanocortin gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tully, D.B.; Hillman, D.; Herbert, E.

1986-05-01

Glucocorticoids negatively regulate expression of the human proopiomelanocortin (POMC) gene. It has been postulated that this effect may be modulated by a direct interaction of the glucocorticoid receptor (GR) with DNA in the vicinity of the POMC promoter. In order to investigate interactions of GR with POMC DNA, DNA-cellulose competitive binding assays have been performed using isolated fragments of cloned POMC DNA to compete with calf thymus DNA-cellulose for binding of triamcinolone acetonide affinity-labelled GR prepared from HeLa S/sub 3/ cells. In these assays, two fragments isolated from the 5' flanking sequences of POMC DNA (Fragment 3,-1765 to -677 andmore » Fragment 4, -676 to +125 with respect to the mRNA cap site) have competed favorably, with Fragment 3 consistently competing more strongly than Fragment 4. Additional studies have been conducted utilizing a newly developed South-western Blot procedure in which specific /sup 32/P-labelled DNA fragments are allowed to bind to dexamethasone mesylate labelled GR immobilized on nitrocellulose filters. Results from these studies have also shown preferential binding by POMC DNA fragments 3 and 4. DNA footprinting and gene transfer experiments are now being conducted to further characterize the nature of GR interaction with POMC DNA.« less

Fragment-Based Screening of a Natural Product Library against 62 Potential Malaria Drug Targets Employing Native Mass Spectrometry

PubMed Central

2018-01-01

Natural products are well known for their biological relevance, high degree of three-dimensionality, and access to areas of largely unexplored chemical space. To shape our understanding of the interaction between natural products and protein targets in the postgenomic era, we have used native mass spectrometry to investigate 62 potential protein targets for malaria using a natural-product-based fragment library. We reveal here 96 low-molecular-weight natural products identified as binding partners of 32 of the putative malarial targets. Seventy-nine (79) fragments have direct growth inhibition on Plasmodium falciparum at concentrations that are promising for the development of fragment hits against these protein targets. This adds a fragment library to the published HTS active libraries in the public domain. PMID:29436819

Fragment-Based Screening of a Natural Product Library against 62 Potential Malaria Drug Targets Employing Native Mass Spectrometry.

PubMed

Vu, Hoan; Pedro, Liliana; Mak, Tin; McCormick, Brendan; Rowley, Jessica; Liu, Miaomiao; Di Capua, Angela; Williams-Noonan, Billy; Pham, Ngoc B; Pouwer, Rebecca; Nguyen, Bao; Andrews, Katherine T; Skinner-Adams, Tina; Kim, Jessica; Hol, Wim G J; Hui, Raymond; Crowther, Gregory J; Van Voorhis, Wesley C; Quinn, Ronald J

2018-04-13

Natural products are well known for their biological relevance, high degree of three-dimensionality, and access to areas of largely unexplored chemical space. To shape our understanding of the interaction between natural products and protein targets in the postgenomic era, we have used native mass spectrometry to investigate 62 potential protein targets for malaria using a natural-product-based fragment library. We reveal here 96 low-molecular-weight natural products identified as binding partners of 32 of the putative malarial targets. Seventy-nine (79) fragments have direct growth inhibition on Plasmodium falciparum at concentrations that are promising for the development of fragment hits against these protein targets. This adds a fragment library to the published HTS active libraries in the public domain.

Effective Fragment Potential Method for H-Bonding: How To Obtain Parameters for Nonrigid Fragments.

PubMed

Dubinets, Nikita; Slipchenko, Lyudmila V

2017-07-20

Accuracy of the effective fragment potential (EFP) method was explored for describing intermolecular interaction energies in three dimers with strong H-bonded interactions, formic acid, formamide, and formamidine dimers, which are a part of HBC6 database of noncovalent interactions. Monomer geometries in these dimers change significantly as a function of intermonomer separation. Several EFP schemes were considered, in which fragment parameters were prepared for a fragment in its gas-phase geometry or recomputed for each unique fragment geometry. Additionally, a scheme in which gas-phase fragment parameters are shifted according to relaxed fragment geometries is introduced and tested. EFP data are compared against the coupled cluster with single, double, and perturbative triple excitations (CCSD(T)) method in a complete basis set (CBS) and the symmetry adapted perturbation theory (SAPT). All considered EFP schemes provide a good agreement with CCSD(T)/CBS for binding energies at equilibrium separations, with discrepancies not exceeding 2 kcal/mol. However, only the schemes that utilize relaxed fragment geometries remain qualitatively correct at shorter than equilibrium intermolecular distances. The EFP scheme with shifted parameters behaves quantitatively similar to the scheme in which parameters are recomputed for each monomer geometry and thus is recommended as a computationally efficient approach for large-scale EFP simulations of flexible systems.

Fragment Linking and Optimization of Inhibitors of the Aspartic Protease Endothiapepsin: Fragment-Based Drug Design Facilitated by Dynamic Combinatorial Chemistry.

PubMed

Mondal, Milon; Radeva, Nedyalka; Fanlo-Virgós, Hugo; Otto, Sijbren; Klebe, Gerhard; Hirsch, Anna K H

2016-08-01

Fragment-based drug design (FBDD) affords active compounds for biological targets. While there are numerous reports on FBDD by fragment growing/optimization, fragment linking has rarely been reported. Dynamic combinatorial chemistry (DCC) has become a powerful hit-identification strategy for biological targets. We report the synergistic combination of fragment linking and DCC to identify inhibitors of the aspartic protease endothiapepsin. Based on X-ray crystal structures of endothiapepsin in complex with fragments, we designed a library of bis-acylhydrazones and used DCC to identify potent inhibitors. The most potent inhibitor exhibits an IC50 value of 54 nm, which represents a 240-fold improvement in potency compared to the parent hits. Subsequent X-ray crystallography validated the predicted binding mode, thus demonstrating the efficiency of the combination of fragment linking and DCC as a hit-identification strategy. This approach could be applied to a range of biological targets, and holds the potential to facilitate hit-to-lead optimization. © 2016 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.

Fragment library screening identifies hits that bind to the non-catalytic surface of Pseudomonas aeruginosa DsbA1

PubMed Central

Headey, Stephen J.; Vazirani, Mansha; Shouldice, Stephen R.; Coinçon, Mathieu; Tay, Stephanie; Morton, Craig J.; Simpson, Jamie S.; Martin, Jennifer L.

2017-01-01

At a time when the antibiotic drug discovery pipeline has stalled, antibiotic resistance is accelerating with catastrophic implications for our ability to treat bacterial infections. Globally we face the prospect of a future when common infections can once again kill. Anti-virulence approaches that target the capacity of the bacterium to cause disease rather than the growth or survival of the bacterium itself offer a tantalizing prospect of novel antimicrobials. They may also reduce the propensity to induce resistance by removing the strong selection pressure imparted by bactericidal or bacteriostatic agents. In the human pathogen Pseudomonas aeruginosa, disulfide bond protein A (PaDsbA1) plays a central role in the oxidative folding of virulence factors and is therefore an attractive target for the development of new anti-virulence antimicrobials. Using a fragment-based approach we have identified small molecules that bind to PaDsbA1. The fragment hits show selective binding to PaDsbA1 over the DsbA protein from Escherichia coli, suggesting that developing species-specific narrow-spectrum inhibitors of DsbA enzymes may be feasible. Structures of a co-complex of PaDsbA1 with the highest affinity fragment identified in the screen reveal that the fragment binds on the non-catalytic surface of the protein at a domain interface. This biophysical and structural data represent a starting point in the development of higher affinity compounds, which will be assessed for their potential as selective PaDsbA1 inhibitors. PMID:28346540

Translation of Polioviral mRNA Is Inhibited by Cleavage of Polypyrimidine Tract-Binding Proteins Executed by Polioviral 3Cpro

PubMed Central

Back, Sung Hoon; Kim, Yoon Ki; Kim, Woo Jae; Cho, Sungchan; Oh, Hoe Rang; Kim, Jung-Eun; Jang, Sung Key

2002-01-01

The translation of polioviral mRNA occurs through an internal ribosomal entry site (IRES). Several RNA-binding proteins, such as polypyrimidine tract-binding protein (PTB) and poly(rC)-binding protein (PCBP), are required for the poliovirus IRES-dependent translation. Here we report that a poliovirus protein, 3Cpro (and/or 3CDpro), cleaves PTB isoforms (PTB1, PTB2, and PTB4). Three 3Cpro target sites (one major target site and two minor target sites) exist in PTBs. PTB fragments generated by poliovirus infection are redistributed to the cytoplasm from the nucleus, where most of the intact PTBs are localized. Moreover, these PTB fragments inhibit polioviral IRES-dependent translation in a cell-based assay system. We speculate that the proteolytic cleavage of PTBs may contribute to the molecular switching from translation to replication of polioviral RNA. PMID:11836431

Fragment-Based, Structure-Enabled Discovery of Novel Pyridones and Pyridone Macrocycles as Potent Bromodomain and Extra-Terminal Domain (BET) Family Bromodomain Inhibitors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Le; Pratt, John K.; Soltwedel, Todd

Members of the BET family of bromodomain containing proteins have been identified as potential targets for blocking proliferation in a variety of cancer cell lines. A two-dimensional NMR fragment screen for binders to the bromodomains of BRD4 identified a phenylpyridazinone fragment with a weak binding affinity (1, Ki = 160 μM). SAR investigation of fragment 1, aided by X-ray structure-based design, enabled the synthesis of potent pyridone and macrocyclic pyridone inhibitors exhibiting single digit nanomolar potency in both biochemical and cell based assays. Advanced analogs in these series exhibited high oral exposures in rodent PK studies and demonstrated significant tumormore » growth inhibition efficacy in mouse flank xenograft models.« less

Intrinsic Conformational Preferences and Interactions in α-Synuclein Fibrils: Insights from Molecular Dynamics Simulations.

PubMed

Ilie, Ioana M; Nayar, Divya; den Otter, Wouter K; van der Vegt, Nico F A; Briels, Wim J

2018-06-12

Amyloid formation by the intrinsically disordered α-synuclein protein is the hallmark of Parkinson's disease. We present atomistic Molecular Dynamics simulations of the core of α-synuclein using enhanced sampling techniques to describe the conformational and binding free energy landscapes of fragments implicated in fibril stabilization. The theoretical framework is derived to combine the free energy profiles of the fragments into the reaction free energy of a protein binding to a fibril. Our study shows that individual fragments in solution have a propensity toward attaining non-β conformations, indicating that in a fibril β-strands are stabilized by interactions with other strands. We show that most dimers of hydrogen-bonded fragments are unstable in solution, while hydrogen bonding stabilizes the collective binding of five fragments to the end of a fibril. Hydrophobic effects make further contributions to the stability of fibrils. This study is the first of its kind where structural and binding preferences of the five major fragments of the hydrophobic core of α-synuclein have been investigated. This approach improves sampling of intrinsically disordered proteins, provides information on the binding mechanism between the core sequences of α-synuclein, and enables the parametrization of coarse grained models.

Fragment Linking and Optimization of Inhibitors of the Aspartic Protease Endothiapepsin: Fragment‐Based Drug Design Facilitated by Dynamic Combinatorial Chemistry

PubMed Central

Mondal, Milon; Radeva, Nedyalka; Fanlo‐Virgós, Hugo; Otto, Sijbren; Klebe, Gerhard

2016-01-01

Abstract Fragment‐based drug design (FBDD) affords active compounds for biological targets. While there are numerous reports on FBDD by fragment growing/optimization, fragment linking has rarely been reported. Dynamic combinatorial chemistry (DCC) has become a powerful hit‐identification strategy for biological targets. We report the synergistic combination of fragment linking and DCC to identify inhibitors of the aspartic protease endothiapepsin. Based on X‐ray crystal structures of endothiapepsin in complex with fragments, we designed a library of bis‐acylhydrazones and used DCC to identify potent inhibitors. The most potent inhibitor exhibits an IC50 value of 54 nm, which represents a 240‐fold improvement in potency compared to the parent hits. Subsequent X‐ray crystallography validated the predicted binding mode, thus demonstrating the efficiency of the combination of fragment linking and DCC as a hit‐identification strategy. This approach could be applied to a range of biological targets, and holds the potential to facilitate hit‐to‐lead optimization. PMID:27400756

Promiscuous 2-aminothiazoles (PrATs): a frequent hitting scaffold.

PubMed

Devine, Shane M; Mulcair, Mark D; Debono, Cael O; Leung, Eleanor W W; Nissink, J Willem M; Lim, San Sui; Chandrashekaran, Indu R; Vazirani, Mansha; Mohanty, Biswaranjan; Simpson, Jamie S; Baell, Jonathan B; Scammells, Peter J; Norton, Raymond S; Scanlon, Martin J

2015-02-12

We have identified a class of molecules, known as 2-aminothiazoles (2-ATs), as frequent-hitting fragments in biophysical binding assays. This was exemplified by 4-phenylthiazol-2-amine being identified as a hit in 14/14 screens against a diverse range of protein targets, suggesting that this scaffold is a poor starting point for fragment-based drug discovery. This prompted us to analyze this scaffold in the context of an academic fragment library used for fragment-based drug discovery (FBDD) and two larger compound libraries used for high-throughput screening (HTS). This analysis revealed that such "promiscuous 2-aminothiazoles" (PrATs) behaved as frequent hitters under both FBDD and HTS settings, although the problem was more pronounced in the fragment-based studies. As 2-ATs are present in known drugs, they cannot necessarily be deemed undesirable, but the combination of their promiscuity and difficulties associated with optimizing them into a lead compound makes them, in our opinion, poor scaffolds for fragment libraries.

A fluorescent aptasensor for sensitive analysis oxytetracycline based on silver nanoclusters.

PubMed

Hosseini, Morteza; Mehrabi, Fatemeh; Ganjali, Mohammad Reza; Norouzi, Parviz

2016-11-01

A fluorescent aptasensor for detection of oxytetracycline (OTC) was presented based on fluorescence quenching of DNA aptamer-templated silver nanoclusters (AgNCs). The specific DNA scaffolds with two different nucleotides fragments were used: one was enriched with a cytosine sequence fragment (C12) that could produce DNA-AgNCs via a chemical reduction method, and another was the OTC aptamer fragment that could selectively bind to the OTC antibiotic. Thus, the as-prepared AgNCs could exhibit quenched fluorescence after binding to the target OTC. The fluorescence ratio of the DNA-AgNCs was quenched in a linearly proportional manner to the concentration of the target in the range of 0.5 nM to 100 nM with a detection limit of 0.1 nM. This proposed nanobiosensor was demonstrated to be sensitive, selective, and simple, introducing a viable alternative for rapid determination of toxin OTC in honey and water samples. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

Deciphering the Arginine-Binding Preferences at the Substrate-Binding Groove of Ser/Thr Kinases by Computational Surface Mapping

PubMed Central

Ben-Shimon, Avraham; Niv, Masha Y.

2011-01-01

Protein kinases are key signaling enzymes that catalyze the transfer of γ-phosphate from an ATP molecule to a phospho-accepting residue in the substrate. Unraveling the molecular features that govern the preference of kinases for particular residues flanking the phosphoacceptor is important for understanding kinase specificities toward their substrates and for designing substrate-like peptidic inhibitors. We applied ANCHORSmap, a new fragment-based computational approach for mapping amino acid side chains on protein surfaces, to predict and characterize the preference of kinases toward Arginine binding. We focus on positions P−2 and P−5, commonly occupied by Arginine (Arg) in substrates of basophilic Ser/Thr kinases. The method accurately identified all the P−2/P−5 Arg binding sites previously determined by X-ray crystallography and produced Arg preferences that corresponded to those experimentally found by peptide arrays. The predicted Arg-binding positions and their associated pockets were analyzed in terms of shape, physicochemical properties, amino acid composition, and in-silico mutagenesis, providing structural rationalization for previously unexplained trends in kinase preferences toward Arg moieties. This methodology sheds light on several kinases that were described in the literature as having non-trivial preferences for Arg, and provides some surprising departures from the prevailing views regarding residues that determine kinase specificity toward Arg. In particular, we found that the preference for a P−5 Arg is not necessarily governed by the 170/230 acidic pair, as was previously assumed, but by several different pairs of acidic residues, selected from positions 133, 169, and 230 (PKA numbering). The acidic residue at position 230 serves as a pivotal element in recognizing Arg from both the P−2 and P−5 positions. PMID:22125489

Modulation of [3H]DAGO binding by substance P (SP) and SP fragments in the mouse brain and spinal cord via MU1 interactions.

PubMed

Krumins, S A; Kim, D C; Seybold, V S; Larson, A A

1989-01-01

Binding of [3H]DAGO to fresh, frozen or beta-funaltrexamine (beta-FNA) pretreated membranes of mouse brain and spinal cord was extensively studied using substance P (SP) or SP fragments as potential competitors and/or modulators. The objective was to determine whether SP exerts its analgesic effect by interacting with mu opioid receptors. The affinity of DAGO was reduced and binding capacity was increased in the presence of SP or the N-terminal SP fragments SP(1-9) and SP(1-4) but not the C-terminal SP fragment SP(5-11). Because sub-nanomolar concentrations of SP or N-terminal SP fragments displaced [3H] DAGO binding to a minor but detectable degree, it is suggested that SP interacts with mu 1 sites through its N-terminus portion. The effect of SP on DAGO binding was less in the spinal cord compared to the rest of the brain. Modulation of DAGO binding by SP was enhanced in the brain after pretreatment of membranes with the narcotic antagonist beta-FNA. These results suggest a novel mechanism for the analgesic action of SP.

Synthesis and binding affinity of neuropeptide Y at opiate receptors.

PubMed

Kiddle, James J; McCreery, Heather J; Soles, Sonia

2003-03-24

Neuropeptide Y and several metabolic fragments were synthesized and evaluated for binding affinity at non-selective opiate receptors. Neuropeptide Y and several C-terminal fragments were shown to bind to non-selective opiate receptors with an affinity similar to that of Leu-enkephalin.

Detection of Listeria monocytogenes with short peptide fragments from class IIa bacteriocins as recognition elements.

PubMed

Azmi, Sarfuddin; Jiang, Keren; Stiles, Michael; Thundat, Thomas; Kaur, Kamaljit

2015-03-09

We employed a direct peptide-bacteria binding assay to screen peptide fragments for high and specific binding to Listeria monocytogenes. Peptides were screened from a peptide array library synthesized on cellulose membrane. Twenty four peptide fragments (each a 14-mer) were derived from three potent anti-listerial peptides, Leucocin A, Pediocin PA1, and Curvacin A, that belong to class IIa bacteriocins. Fragment Leu10 (GEAFSAGVHRLANG), derived from the C-terminal region of Leucocin A, displayed the highest binding among all of the library fragments toward several pathogenic Gram-positive bacteria, including L. monocytogenes, Enterococcus faecalis, and Staphylococcus aureus. The specific binding of Leu10 to L. monocytogenes was further validated using microcantilever (MCL) experiments. Microcantilevers coated with gold were functionalized with peptides by chemical conjugation using a cysteamine linker to yield a peptide density of ∼4.8×10(-3) μmol/cm2 for different peptide fragments. Leu10 (14-mer) functionalized MCL was able to detect Listeria with same sensitivity as that of Leucocin A (37-mer) functionalized MCL, validating the use of short peptide fragments in bacterial detection platforms. Fragment Leu10 folded into a helical conformation in solution, like that of native Leucocin A, suggesting that both Leu10 and Leucocin A may employ a similar mechanism for binding target bacteria. The results show that peptide-conjugated microcantilevers can function as highly sensitive platforms for Listeria detection and hold potential to be developed as biosensors for pathogenic bacteria.

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

Exchanging the minimal cell binding fragments of tetanus neurotoxin in botulinum neurotoxin A and B impacts their toxicity at the neuromuscular junction and central neurons.

PubMed

Höltje, Markus; Schulze, Sebastian; Strotmeier, Jasmin; Mahrhold, Stefan; Richter, Karin; Binz, Thomas; Bigalke, Hans; Ahnert-Hilger, Gudrun; Rummel, Andreas

2013-12-01

The modular four domain structure of clostridial neurotoxins supports the idea to reassemble individual domains from tetanus and botulinum neurotoxins to generate novel molecules with altered pharmacological properties. To treat disorders of the central nervous system drug transporter molecules based on catalytically inactive clostridial neurotoxins circumventing the passage of the blood-brain-barrier are desired. Such molecules can be produced based on the highly effective botulinum neurotoxin serotype A incorporating the retrograde axonal sorting property of tetanus neurotoxin which is supposed to be encoded within its C-terminal cell binding domain HC. The corresponding exchange of the tetanus neurotoxin HC-fragment in botulinum neurotoxin A yielded the novel hybrid molecule AATT which displayed decreased potency at the neuromuscular junction like tetanus neurotoxin but exerted equal activity in cortical neurons compared to botulinum neurotoxin A wild-type. Minimizing the tetanus neurotoxin cell binding domain to its N- or C-terminal half drastically reduced the potencies of AATA and AAAT in cortical neurons indicating that the structural motif mediating sorting of tetanus neurotoxin is predominantly encoded within the entire HC-fragment. However, the reciprocal exchange resulted in TTAA which showed a similar potency as tetanus neurotoxin at the neuromuscular junction indicating that the tetanus neurotoxin portion prevents a high potency as observed for botulinum neurotoxins. In conclusion, clostridial neurotoxin based inactivated drug transporter for targeting central neurons should contain the cell binding domain of tetanus neurotoxin to exert its tropism for the central nervous system. Copyright © 2013 Elsevier Ltd. All rights reserved.

Essential motions and energetic contributions of individual residues in a peptide bound to an SH3 domain.

PubMed Central

Kolafa, J; Perram, J W; Bywater, R P

2000-01-01

We have studied protein-ligand interactions by molecular dynamics simulations using software designed to exploit parallel computing architectures. The trajectories were analyzed to extract the essential motions and to estimate the individual contributions of fragments of the ligand to overall binding enthalpy. Two forms of the bound ligand are compared, one with the termini blocked by covalent derivatization, and one in the underivatized, zwitterionic form. The ends of the peptide tend to bind more loosely in the capped form. We can observe significant motions in the bound ligand and distinguish between motions of the peptide backbone and of the side chains. This could be useful in designing ligands, which fit optimally to the binding protein. We show that it is possible to determine the different contributions of each residue in a peptide to the enthalpy of binding. Proline is a major net contributor to binding enthalpy, in keeping with the known propensity for this family of proteins to bind proline-rich peptides. PMID:10919999

Structures of endothiapepsin-fragment complexes from crystallographic fragment screening using a novel, diverse and affordable 96-compound fragment library.

PubMed

Huschmann, Franziska U; Linnik, Janina; Sparta, Karine; Ühlein, Monika; Wang, Xiaojie; Metz, Alexander; Schiebel, Johannes; Heine, Andreas; Klebe, Gerhard; Weiss, Manfred S; Mueller, Uwe

2016-05-01

Crystallographic screening of the binding of small organic compounds (termed fragments) to proteins is increasingly important for medicinal chemistry-oriented drug discovery. To enable such experiments in a widespread manner, an affordable 96-compound library has been assembled for fragment screening in both academia and industry. The library is selected from already existing protein-ligand structures and is characterized by a broad ligand diversity, including buffer ingredients, carbohydrates, nucleotides, amino acids, peptide-like fragments and various drug-like organic compounds. When applied to the model protease endothiapepsin in a crystallographic screening experiment, a hit rate of nearly 10% was obtained. In comparison to other fragment libraries and considering that no pre-screening was performed, this hit rate is remarkably high. This demonstrates the general suitability of the selected compounds for an initial fragment-screening campaign. The library composition, experimental considerations and time requirements for a complete crystallographic fragment-screening campaign are discussed as well as the nine fully refined obtained endothiapepsin-fragment structures. While most of the fragments bind close to the catalytic centre of endothiapepsin in poses that have been observed previously, two fragments address new sites on the protein surface. ITC measurements show that the fragments bind to endothiapepsin with millimolar affinity.

Structures of endothiapepsin–fragment complexes from crystallographic fragment screening using a novel, diverse and affordable 96-compound fragment library

PubMed Central

Huschmann, Franziska U.; Linnik, Janina; Sparta, Karine; Ühlein, Monika; Wang, Xiaojie; Metz, Alexander; Schiebel, Johannes; Heine, Andreas; Klebe, Gerhard; Weiss, Manfred S.; Mueller, Uwe

2016-01-01

Crystallographic screening of the binding of small organic compounds (termed fragments) to proteins is increasingly important for medicinal chemistry-oriented drug discovery. To enable such experiments in a widespread manner, an affordable 96-compound library has been assembled for fragment screening in both academia and industry. The library is selected from already existing protein–ligand structures and is characterized by a broad ligand diversity, including buffer ingredients, carbohydrates, nucleotides, amino acids, peptide-like fragments and various drug-like organic compounds. When applied to the model protease endothiapepsin in a crystallographic screening experiment, a hit rate of nearly 10% was obtained. In comparison to other fragment libraries and considering that no pre-screening was performed, this hit rate is remarkably high. This demonstrates the general suitability of the selected compounds for an initial fragment-screening campaign. The library composition, experimental considerations and time requirements for a complete crystallographic fragment-screening campaign are discussed as well as the nine fully refined obtained endothiapepsin–fragment structures. While most of the fragments bind close to the catalytic centre of endothiapepsin in poses that have been observed previously, two fragments address new sites on the protein surface. ITC measurements show that the fragments bind to endothiapepsin with millimolar affinity. PMID:27139825

Application of Fragment Based Drug Discovery to Membrane Proteins: Biophysical Identification of Ligands of the Integral Membrane Enzyme DsbB

PubMed Central

Früh, Virginie; Zhou, Yunpeng; Chen, Dan; Loch, Caroline; Eiso, AB; Grinkova, Yelena N.; Verheij, Herman; Sligar, Stephen G; Bushweller, John H.; Siegal, Gregg

2014-01-01

Summary Membrane proteins are important pharmaceutical targets, but they pose significant challenges for fragment based drug discovery approaches. Here we present the first successful use of biophysical methods to screen for fragment ligands to an integral membrane protein. The E. coli inner membrane protein DsbB was solubilized in detergent micelles and lipid bilayer nanodiscs. The solubilized protein was immobilized with retention of functionality and used to screen 1,071 drug fragments for binding using Target Immobilized NMR Screening. Biochemical and biophysical validation of the 8 most potent hits revealed an IC50 range of 7 to 200 μM. The ability to insert a broad array of membrane proteins into nanodiscs, combined with the efficiency of TINS, demonstrates the feasibility of finding fragments targeting membrane proteins. PMID:20797617

Antibody engineering of a cytotoxic monoclonal antibody 84 against human embryonic stem cells: Investigating the effects of multivalency on cytotoxicity.

PubMed

Klement, Maximilian; Zheng, Jiyun; Liu, Chengcheng; Tan, Heng-Liang; Wong, Victor Vai Tak; Choo, Andre Boon-Hwa; Lee, Dong-Yup; Ow, Dave Siak-Wei

2017-02-10

Antibody fragments have shown targeted specificity to their antigens, but only modest tissue retention times in vivo and in vitro. Multimerization has been used as a protein engineering tool to increase the number of binding units and thereby enhance the efficacy and retention time of antibody fragments. In this work, we explored the effects of valency using a series of self-assembling polypeptides based on the GCN4 leucine zipper multimerization domain fused to a single-chain variable fragment via an antibody upper hinge sequence. Four engineered antibody fragments with a valency from one to four antigen-binding units of a cytotoxic monoclonal antibody 84 against human embryonic stem cells (hESC) were constructed. We hypothesized that higher cytotoxicity would be observed for fragments with increased valency. Flow cytometry analysis revealed that the trimeric and tetrameric engineered antibody fragments resulted in the highest degree of cytotoxicity to the undifferentiated hESC, while the engineered antibody fragments were observed to have improved tissue penetration into cell clusters. Thus, a trade off was made for the trimeric versus tetrameric fragment due to improved tissue penetration. These results have direct implications for antibody-mediated removal of undifferentiated hESC during regenerative medicine and cell therapy. Copyright © 2016 The Author(s). Published by Elsevier B.V. All rights reserved.

Structural insights into binding of inhibitors to soluble epoxide hydrolase gained by fragment screening and X-ray crystallography.

PubMed

Amano, Yasushi; Yamaguchi, Tomohiko; Tanabe, Eiki

2014-04-15

Soluble epoxide hydrolase (sEH) is a component of the arachidonic acid cascade and is a candidate target for therapies for hypertension or inflammation. Although many sEH inhibitors are available, their scaffolds are not structurally diverse, and knowledge of their specific interactions with sEH is limited. To obtain detailed structural information about protein-ligand interactions, we conducted fragment screening of sEH, analyzed the fragments using high-throughput X-ray crystallography, and determined 126 fragment-bound structures at high resolution. Aminothiazole and benzimidazole derivatives were identified as novel scaffolds that bind to the catalytic triad of sEH with good ligand efficiency. We further identified fragment hits that bound to subpockets of sEH called the short and long branches. The water molecule conserved in the structure plays an important role in binding to the long branch, whereas Asp496 and the main chain of Phe497 form hydrogen bonds with fragment hits in the short branch. Fragment hits and their crystal structures provide structural insights into ligand binding to sEH that will facilitate the discovery of novel and potent inhibitors of sEH. Copyright © 2014 Elsevier Ltd. All rights reserved.

Dynamic undocking and the quasi-bound state as tools for drug discovery

NASA Astrophysics Data System (ADS)

Ruiz-Carmona, Sergio; Schmidtke, Peter; Luque, F. Javier; Baker, Lisa; Matassova, Natalia; Davis, Ben; Roughley, Stephen; Murray, James; Hubbard, Rod; Barril, Xavier

2017-03-01

There is a pressing need for new technologies that improve the efficacy and efficiency of drug discovery. Structure-based methods have contributed towards this goal but they focus on predicting the binding affinity of protein-ligand complexes, which is notoriously difficult. We adopt an alternative approach that evaluates structural, rather than thermodynamic, stability. As bioactive molecules present a static binding mode, we devised dynamic undocking (DUck), a fast computational method to calculate the work necessary to reach a quasi-bound state at which the ligand has just broken the most important native contact with the receptor. This non-equilibrium property is surprisingly effective in virtual screening because true ligands form more-resilient interactions than decoys. Notably, DUck is orthogonal to docking and other 'thermodynamic' methods. We demonstrate the potential of the docking-undocking combination in a fragment screening against the molecular chaperone and oncology target Hsp90, for which we obtain novel chemotypes and a hit rate that approaches 40%.

NMR characterization of weak interactions between RhoGDI2 and fragment screening hits.

PubMed

Liu, Jiuyang; Gao, Jia; Li, Fudong; Ma, Rongsheng; Wei, Qingtao; Wang, Aidong; Wu, Jihui; Ruan, Ke

2017-01-01

The delineation of intrinsically weak interactions between novel targets and fragment screening hits has long limited the pace of hit-to-lead evolution. Rho guanine-nucleotide dissociation inhibitor 2 (RhoGDI2) is a novel target that lacks any chemical probes for the treatment of tumor metastasis. Protein-observed and ligand-observed NMR spectroscopy was used to characterize the weak interactions between RhoGDI2 and fragment screening hits. We identified three hits of RhoGDI2 using streamlined NMR fragment-based screening. The binding site residues were assigned using non-uniformly sampled C α - and H α -based three dimensional NMR spectra. The molecular docking to the proposed geranylgeranyl binding pocket of RhoGDI2 was guided by NMR restraints of chemical shift perturbations and ligand-observed transferred paramagnetic relaxation enhancement. We further validated the weak RhoGDI2-hit interactions using mutagenesis and structure-affinity analysis. Weak interactions between RhoGDI2 and fragment screening hits were delineated using an integrated NMR approach. Binders to RhoGDI2 as a potential anti-cancer target have been first reported, and their weak interactions were depicted using NMR spectroscopy. Our work highlights the powerfulness and the versatility of the integrative NMR techniques to provide valuable structural insight into the intrinsically weak interactions between RhoGDI2 and the fragment screening hits, which could hardly be conceived using other biochemical techniques. Copyright © 2016 Elsevier B.V. All rights reserved.

Customizing Monoclonal Antibodies for the Treatment of Methamphetamine Abuse: Current and Future Applications

PubMed Central

Peterson, Eric C.; Gentry, W. Brooks

2015-01-01

Monoclonal antibody-based medications designed to bind (+)-methamphetamine (METH) with high affinity are among the newest approaches to the treatment of METH abuse, and the associated medical complications. The potential clinical indications for these medications include treatment of overdose, reduction of drug dependence, and protection of vulnerable populations from METH-related complications. Research designed to discover and conduct preclinical and clinical testing of these antibodies suggest a scientific vision for how intact mAb (singular and plural) or small antigen binding fragments of mAb could be engineered to optimize the proteins for specific therapeutic applications. In this review we discuss keys to success in this development process including choosing predictors of specificity, efficacy, duration of action, and safety of the medications in disease models of acute and chronic drug abuse. We consider important aspects of METH-like hapten design and how hapten structural features influence specificity and affinity, with an example of a high-resolution x-ray crystal structure of a high affinity antibody to demonstrate this structural relationship. Additionally, several prototype anti-METH mAb forms such as antigen binding fragments (Fab) and single chain variable fragments (scFv) are under development. Unique, customizable aspects of these fragments are presented with specific possible clinical indications. Finally, we discuss clinical trial progress of the first in kind anti-METH mAb, for which the METH is the disease target instead of vulnerable central nervous system networks of receptors, binding sites and neuronal connections. PMID:24484976

Customizing monoclonal antibodies for the treatment of methamphetamine abuse: current and future applications.

PubMed

Peterson, Eric C; Gentry, W Brooks; Owens, S Michael

2014-01-01

Monoclonal antibody-based medications designed to bind (+)-methamphetamine (METH) with high affinity are among the newest approaches to the treatment of METH abuse and the associated medical complications. The potential clinical indications for these medications include treatment of overdose, reduction of drug dependence, and protection of vulnerable populations from METH-related complications. Research designed to discover and conduct preclinical and clinical testing of these antibodies suggests a scientific vision for how intact monoclonal antibody (mAb) (singular and plural) or small antigen-binding fragments of mAb could be engineered to optimize the proteins for specific therapeutic applications. In this review, we discuss keys to success in this development process including choosing predictors of specificity, efficacy, duration of action, and safety of the medications in disease models of acute and chronic drug abuse. We consider important aspects of METH-like hapten design and how hapten structural features influence specificity and affinity, with an example of a high-resolution X-ray crystal structure of a high-affinity antibody to demonstrate this structural relationship. Additionally, several prototype anti-METH mAb forms such as antigen-binding fragments and single-chain variable fragments are under development. Unique, customizable aspects of these fragments are presented with specific possible clinical indications. Finally, we discuss clinical trial progress of the first in kind anti-METH mAb, for which METH is the disease target instead of vulnerable central nervous system networks of receptors, binding sites, and neuronal connections. © 2014 Elsevier Inc. All rights reserved.

Potassium Binding Adjacent to Cationic Transition-Metal Fragments: Unusual Heterobimetallic Adducts of a Calix[4]arene-Based Thione Ligand.

PubMed

Patchett, Ruth; Knighton, Richard C; Mattock, James D; Vargas, Alfredo; Chaplin, Adrian B

2017-11-20

The synthesis of cationic rhodium and iridium complexes of a bis(imidazole-2-thione)-functionalized calix[4]arene ligand and their surprising capacity for potassium binding are described. In both cases, uptake of the alkali metal into the calix[4]arene cavity occurs despite adverse electrostatic interactions associated with close proximity to the transition-metal fragment [Rh + ···K + = 3.715(1) Å; Ir + ···K + = 3.690(1) Å]. The formation and constituent bonding of these unusual heterobimetallic adducts have been interrogated through extensive solution and solid-state characterization, examination of the host-guest chemistry of the ligand and its upper-rim unfunctionalized calix[4]arene analogue, and use of density functional theory based energy decomposition analysis.

Fragment-based identification of determinants of conformational and spectroscopic change at the ricin active site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Carra,J.; McHugh, C.; Mulligan, S.

2007-01-01

We found that amide ligands can bind weakly but specifically to the ricin active site, producing significant shifts in positions of the critical active site residues Arg180 and Tyr80. These results indicate that fragment-based drug discovery methods are capable of identifying minimal bonding determinants of active-site side-chain rearrangements and the mechanistic origins of spectroscopic shifts. Our results suggest that tryptophan fluorescence provides a sensitive probe for the geometric relationship of arginine-tryptophan pairs, which often have significant roles in protein function. Using the unusual characteristics of the RTA system, we measured the still controversial thermodynamic changes of site-specific urea binding tomore » a protein, results that are relevant to understanding the physical mechanisms of protein denaturation.« less

Global Analysis of Transcription Factor-Binding Sites in Yeast Using ChIP-Seq

PubMed Central

Lefrançois, Philippe; Gallagher, Jennifer E. G.; Snyder, Michael

2016-01-01

Transcription factors influence gene expression through their ability to bind DNA at specific regulatory elements. Specific DNA-protein interactions can be isolated through the chromatin immunoprecipitation (ChIP) procedure, in which DNA fragments bound by the protein of interest are recovered. ChIP is followed by high-throughput DNA sequencing (Seq) to determine the genomic provenance of ChIP DNA fragments and their relative abundance in the sample. This chapter describes a ChIP-Seq strategy adapted for budding yeast to enable the genome-wide characterization of binding sites of transcription factors (TFs) and other DNA-binding proteins in an efficient and cost-effective way. Yeast strains with epitope-tagged TFs are most commonly used for ChIP-Seq, along with their matching untagged control strains. The initial step of ChIP involves the cross-linking of DNA and proteins. Next, yeast cells are lysed and sonicated to shear chromatin into smaller fragments. An antibody against an epitope-tagged TF is used to pull down chromatin complexes containing DNA and the TF of interest. DNA is then purified and proteins degraded. Specific barcoded adapters for multiplex DNA sequencing are ligated to ChIP DNA. Short DNA sequence reads (28–36 base pairs) are parsed according to the barcode and aligned against the yeast reference genome, thus generating a nucleotide-resolution map of transcription factor-binding sites and their occupancy. PMID:25213249

Aggregation landscapes of Huntingtin exon 1 protein fragments and the critical repeat length for the onset of Huntington’s disease

PubMed Central

Chen, Mingchen; Wolynes, Peter G.

2017-01-01

Huntington’s disease (HD) is a neurodegenerative disease caused by an abnormal expansion in the polyglutamine (polyQ) track of the Huntingtin (HTT) protein. The severity of the disease depends on the polyQ repeat length, arising only in patients with proteins having 36 repeats or more. Previous studies have shown that the aggregation of N-terminal fragments (encoded by HTT exon 1) underlies the disease pathology in mouse models and that the HTT exon 1 gene product can self-assemble into amyloid structures. Here, we provide detailed structural mechanisms for aggregation of several protein fragments encoded by HTT exon 1 by using the associative memory, water-mediated, structure and energy model (AWSEM) to construct their free energy landscapes. We find that the addition of the N-terminal 17-residue sequence (NT17) facilitates polyQ aggregation by encouraging the formation of prefibrillar oligomers, whereas adding the C-terminal polyproline sequence (P10) inhibits aggregation. The combination of both terminal additions in HTT exon 1 fragment leads to a complex aggregation mechanism with a basic core that resembles that found for the aggregation of pure polyQ repeats using AWSEM. At the extrapolated physiological concentration, although the grand canonical free energy profiles are uphill for HTT exon 1 fragments having 20 or 30 glutamines, the aggregation landscape for fragments with 40 repeats has become downhill. This computational prediction agrees with the critical length found for the onset of HD and suggests potential therapies based on blocking early binding events involving the terminal additions to the polyQ repeats. PMID:28400517

Identification of a New Zinc Binding Chemotype by Fragment Screening.

PubMed

Chrysanthopoulos, Panagiotis K; Mujumdar, Prashant; Woods, Lucy A; Dolezal, Olan; Ren, Bin; Peat, Thomas S; Poulsen, Sally-Ann

2017-09-14

The discovery of a new zinc binding chemotype from screening a nonbiased fragment library is reported. Using the orthogonal fragment screening methods of native state mass spectrometry and surface plasmon resonance a 3-unsubstituted 2,4-oxazolidinedione fragment was found to have low micromolar binding affinity to the zinc metalloenzyme carbonic anhydrase II (CA II). This affinity approached that of fragment sized primary benzenesulfonamides, the classical zinc binding group found in most CA II inhibitors. Protein X-ray crystallography established that 3-unsubstituted 2,4-oxazolidinediones bound to CA II via an interaction of the acidic ring nitrogen with the CA II active site zinc, as well as two hydrogen bonds between the oxazolidinedione ring oxygen and the CA II protein backbone. Furthermore, 3-unsubstituted 2,4-oxazolidinediones appear to be a viable starting point for the development of an alternative class of CA inhibitor, wherein the medicinal chemistry pedigree of primary sulfonamides has dominated for several decades.

Contributions of computational chemistry and biophysical techniques to fragment-based drug discovery.

PubMed

Gozalbes, Rafael; Carbajo, Rodrigo J; Pineda-Lucena, Antonio

2010-01-01

In the last decade, fragment-based drug discovery (FBDD) has evolved from a novel approach in the search of new hits to a valuable alternative to the high-throughput screening (HTS) campaigns of many pharmaceutical companies. The increasing relevance of FBDD in the drug discovery universe has been concomitant with an implementation of the biophysical techniques used for the detection of weak inhibitors, e.g. NMR, X-ray crystallography or surface plasmon resonance (SPR). At the same time, computational approaches have also been progressively incorporated into the FBDD process and nowadays several computational tools are available. These stretch from the filtering of huge chemical databases in order to build fragment-focused libraries comprising compounds with adequate physicochemical properties, to more evolved models based on different in silico methods such as docking, pharmacophore modelling, QSAR and virtual screening. In this paper we will review the parallel evolution and complementarities of biophysical techniques and computational methods, providing some representative examples of drug discovery success stories by using FBDD.

The successful merger of theoretical thermochemistry with fragment-based methods in quantum chemistry.

PubMed

Ramabhadran, Raghunath O; Raghavachari, Krishnan

2014-12-16

CONSPECTUS: Quantum chemistry and electronic structure theory have proven to be essential tools to the experimental chemist, in terms of both a priori predictions that pave the way for designing new experiments and rationalizing experimental observations a posteriori. Translating the well-established success of electronic structure theory in obtaining the structures and energies of small chemical systems to increasingly larger molecules is an exciting and ongoing central theme of research in quantum chemistry. However, the prohibitive computational scaling of highly accurate ab initio electronic structure methods poses a fundamental challenge to this research endeavor. This scenario necessitates an indirect fragment-based approach wherein a large molecule is divided into small fragments and is subsequently reassembled to compute its energy accurately. In our quest to further reduce the computational expense associated with the fragment-based methods and overall enhance the applicability of electronic structure methods to large molecules, we realized that the broad ideas involved in a different area, theoretical thermochemistry, are transferable to the area of fragment-based methods. This Account focuses on the effective merger of these two disparate frontiers in quantum chemistry and how new concepts inspired by theoretical thermochemistry significantly reduce the total number of electronic structure calculations needed to be performed as part of a fragment-based method without any appreciable loss of accuracy. Throughout, the generalized connectivity based hierarchy (CBH), which we developed to solve a long-standing problem in theoretical thermochemistry, serves as the linchpin in this merger. The accuracy of our method is based on two strong foundations: (a) the apt utilization of systematic and sophisticated error-canceling schemes via CBH that result in an optimal cutting scheme at any given level of fragmentation and (b) the use of a less expensive second layer of electronic structure method to recover all the missing long-range interactions in the parent large molecule. Overall, the work featured here dramatically decreases the computational expense and empowers the execution of very accurate ab initio calculations (gold-standard CCSD(T)) on large molecules and thereby facilitates sophisticated electronic structure applications to a wide range of important chemical problems.

Oriented Immobilization of Fab Fragments by Site-Specific Biotinylation at the Conserved Nucleotide Binding Site for Enhanced Antigen Detection.

PubMed

Mustafaoglu, Nur; Alves, Nathan J; Bilgicer, Basar

2015-09-08

Oriented immobilization of antibodies and antibody fragments has become increasingly important as a result of the efforts to reduce the size of diagnostic and sensor devices to miniaturized dimensions for improved accessibility to the end-user. Reduced dimensions of sensor devices necessitate the immobilized antibodies to conserve their antigen binding activity for proper operation. Fab fragments are becoming more commonly used in small-scaled diagnostic devices due to their small size and ease of manufacture. In this study, we used the previously described UV-NBS(Biotin) method to functionalize Fab fragments with IBA-EG11-Biotin linker utilizing UV energy to initiate a photo-cross-linking reaction between the nucleotide binding site (NBS) on the Fab fragment and IBA-Biotin molecule. Our results demonstrate that immobilization of biotinylated Fab fragments via UV-NBS(Biotin) method generated the highest level of immobilized Fab on surfaces when compared to other typical immobilization methods while preserving antigen binding activity. UV-NBS(Biotin) method provided 432-fold, 114-fold, and 29-fold improved antigen detection sensitivity than physical adsorption, NHS-Biotin, and ε-NH3(+), methods, respectively. Additionally, the limit of detection (LOD) for PSA utilizing Fab fragments immobilized via UV-NBS(Biotin) method was significantly lower than that of the other immobilization methods, with an LOD of 0.4 pM PSA. In summary, site-specific biotinylation of Fab fragments without structural damage or loss in antigen binding activity provides a wide range of application potential for UV-NBS immobilization technique across numerous diagnostic devices and nanotechnologies.

Prediction of cyclin-dependent kinase 2 inhibitor potency using the fragment molecular orbital method

PubMed Central

2011-01-01

Background The reliable and robust estimation of ligand binding affinity continues to be a challenge in drug design. Many current methods rely on molecular mechanics (MM) calculations which do not fully explain complex molecular interactions. Full quantum mechanical (QM) computation of the electronic state of protein-ligand complexes has recently become possible by the latest advances in the development of linear-scaling QM methods such as the ab initio fragment molecular orbital (FMO) method. This approximate molecular orbital method is sufficiently fast that it can be incorporated into the development cycle during structure-based drug design for the reliable estimation of ligand binding affinity. Additionally, the FMO method can be combined with approximations for entropy and solvation to make it applicable for binding affinity prediction for a broad range of target and chemotypes. Results We applied this method to examine the binding affinity for a series of published cyclin-dependent kinase 2 (CDK2) inhibitors. We calculated the binding affinity for 28 CDK2 inhibitors using the ab initio FMO method based on a number of X-ray crystal structures. The sum of the pair interaction energies (PIE) was calculated and used to explain the gas-phase enthalpic contribution to binding. The correlation of the ligand potencies to the protein-ligand interaction energies gained from FMO was examined and was seen to give a good correlation which outperformed three MM force field based scoring functions used to appoximate the free energy of binding. Although the FMO calculation allows for the enthalpic component of binding interactions to be understood at the quantum level, as it is an in vacuo single point calculation, the entropic component and solvation terms are neglected. For this reason a more accurate and predictive estimate for binding free energy was desired. Therefore, additional terms used to describe the protein-ligand interactions were then calculated to improve the correlation of the FMO derived values to experimental free energies of binding. These terms were used to account for the polar and non-polar solvation of the molecule estimated by the Poisson-Boltzmann equation and the solvent accessible surface area (SASA), respectively, as well as a correction term for ligand entropy. A quantitative structure-activity relationship (QSAR) model obtained by Partial Least Squares projection to latent structures (PLS) analysis of the ligand potencies and the calculated terms showed a strong correlation (r2 = 0.939, q2 = 0.896) for the 14 molecule test set which had a Pearson rank order correlation of 0.97. A training set of a further 14 molecules was well predicted (r2 = 0.842), and could be used to obtain meaningful estimations of the binding free energy. Conclusions Our results show that binding energies calculated with the FMO method correlate well with published data. Analysis of the terms used to derive the FMO energies adds greater understanding to the binding interactions than can be gained by MM methods. Combining this information with additional terms and creating a scaled model to describe the data results in more accurate predictions of ligand potencies than the absolute values obtained by FMO alone. PMID:21219630

Elucidation of the binding mechanism of renin using a wide array of computational techniques and biological assays.

PubMed

Tzoupis, Haralambos; Leonis, Georgios; Avramopoulos, Aggelos; Reis, Heribert; Czyżnikowska, Żaneta; Zerva, Sofia; Vergadou, Niki; Peristeras, Loukas D; Papavasileiou, Konstantinos D; Alexis, Michael N; Mavromoustakos, Thomas; Papadopoulos, Manthos G

2015-11-01

We investigate the binding mechanism in renin complexes, involving three drugs (remikiren, zankiren and enalkiren) and one lead compound, which was selected after screening the ZINC database. For this purpose, we used ab initio methods (the effective fragment potential, the variational perturbation theory, the energy decomposition analysis, the atoms-in-molecules), docking, molecular dynamics, and the MM-PBSA method. A biological assay for the lead compound has been performed to validate the theoretical findings. Importantly, binding free energy calculations for the three drug complexes are within 3 kcal/mol of the experimental values, thus further justifying our computational protocol, which has been validated through previous studies on 11 drug-protein systems. The main elements of the discovered mechanism are: (i) minor changes are induced to renin upon drug binding, (ii) the three drugs form an extensive network of hydrogen bonds with renin, whilst the lead compound presented diminished interactions, (iii) ligand binding in all complexes is driven by favorable van der Waals interactions and the nonpolar contribution to solvation, while the lead compound is associated with diminished van der Waals interactions compared to the drug-bound forms of renin, and (iv) the environment (H2O/Na(+)) has a small effect on the renin-remikiren interaction. Copyright © 2015 Elsevier Inc. All rights reserved.

Site-Specific Photoconjugation of Beta-Lactamase Fragments to Monoclonal Antibodies Enables Sensitive Analyte Detection via Split-Enzyme Complementation.

PubMed

Yu, Feifan; Alesand, Veronica; Nygren, Per-Åke

2018-02-27

Protein fragment complementation assays (PCA) rely on a proximity-driven reconstitution of a split reporter protein activity, typically via interaction between bait and prey units separately fused to the reporter protein halves. The PCA principle can also be formatted for use in immunossays for analyte detection, e.g., via the use of small immunoglobulin binding proteins (IgBp) as fusion partners to split-reporter protein fragments for conversion of pairs of antibodies into split-protein half-probes. However, the non-covalent binding between IgBp and antibodies is not ideal for development of robust assays. Here, the authors describe how split-enzyme reporter halves can be both site-specifically and covalently photoconjugated at antibody Fc-parts for use in homogeneous dual-antibody in vitro immunoassays based on analyte-dependent split-enzyme fragment complementation. The half-probes consist of parts of a beta-lactamase split-protein reporter fused to an immunoglobulin Fc binding domain equipped with a unique cysteine residue at which a photoactivable maleimide benzophenone group (MBP) is attached. Using such antibody conjugates the authors obtain an analyte-driven complementation of the reporter enzyme fragments monitored via conversion of a chromogenic substrate. Results from detection of human interferon-gamma and the extracellular domain of HER2 is shown. The described principles for site-specific conjugation of proteins to antibodies should be broadly applicable. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Metabolite identification through multiple kernel learning on fragmentation trees.

PubMed

Shen, Huibin; Dührkop, Kai; Böcker, Sebastian; Rousu, Juho

2014-06-15

Metabolite identification from tandem mass spectrometric data is a key task in metabolomics. Various computational methods have been proposed for the identification of metabolites from tandem mass spectra. Fragmentation tree methods explore the space of possible ways in which the metabolite can fragment, and base the metabolite identification on scoring of these fragmentation trees. Machine learning methods have been used to map mass spectra to molecular fingerprints; predicted fingerprints, in turn, can be used to score candidate molecular structures. Here, we combine fragmentation tree computations with kernel-based machine learning to predict molecular fingerprints and identify molecular structures. We introduce a family of kernels capturing the similarity of fragmentation trees, and combine these kernels using recently proposed multiple kernel learning approaches. Experiments on two large reference datasets show that the new methods significantly improve molecular fingerprint prediction accuracy. These improvements result in better metabolite identification, doubling the number of metabolites ranked at the top position of the candidates list. © The Author 2014. Published by Oxford University Press.

Structural comparisons of two allelic variants of human placental alkaline phosphatase.

PubMed

Millán, J L; Stigbrand, T; Jörnvall, H

1985-01-01

A simple immunosorbent purification scheme based on monoclonal antibodies has been devised for human placental alkaline phosphatase. The two most common allelic variants, S and F, have similar amino acid compositions with identical N-terminal amino acid sequences through the first 13 residues. Both variants have identical lectin binding properties towards concanavalin A, lentil-lectin, wheat germ agglutinin, phytohemagglutinin and soybean agglutinin, and identical carbohydrate contents as revealed by methylation analysis. CNBr fragments of the variants demonstrate identical high performance liquid chromatography patterns. The carbohydrate containing fragment is different from the 32P-labeled active site fragment and the N-terminal fragment.

[Fragment-based drug discovery: concept and aim].

PubMed

Tanaka, Daisuke

2010-03-01

Fragment-Based Drug Discovery (FBDD) has been recognized as a newly emerging lead discovery methodology that involves biophysical fragment screening and chemistry-driven fragment-to-lead stages. Although fragments, defined as structurally simple and small compounds (typically <300 Da), have not been employed in conventional high-throughput screening (HTS), the recent significant progress in the biophysical screening methods enables fragment screening at a practical level. The intention of FBDD primarily turns our attention to weakly but specifically binding fragments (hit fragments) as the starting point of medicinal chemistry. Hit fragments are then promoted to more potent lead compounds through linking or merging with another hit fragment and/or attaching functional groups. Another positive aspect of FBDD is ligand efficiency. Ligand efficiency is a useful guide in screening hit selection and hit-to-lead phases to achieve lead-likeness. Owing to these features, a number of successful applications of FBDD to "undruggable targets" (where HTS and other lead identification methods failed to identify useful lead compounds) have been reported. As a result, FBDD is now expected to complement more conventional methodologies. This review, as an introduction of the following articles, will summarize the fundamental concepts of FBDD and will discuss its advantages over other conventional drug discovery approaches.

Structure-Based Identification of Inhibitory Fragments Targeting the p300/CBP-Associated Factor Bromodomain

PubMed Central

2016-01-01

The P300/CBP-associated factor plays a central role in retroviral infection and cancer development, and the C-terminal bromodomain provides an opportunity for selective targeting. Here, we report several new classes of acetyl-lysine mimetic ligands ranging from mM to low micromolar affinity that were identified using fragment screening approaches. The binding modes of the most attractive fragments were determined using high resolution crystal structures providing chemical starting points and structural models for the development of potent and selective PCAF inhibitors. PMID:26731131

Determinants of Curvature-Sensing Behavior for MARCKS-Fragment Peptides.

PubMed

de Jesus, Armando J; White, Ormacinda R; Flynn, Aaron D; Yin, Hang

2016-05-10

It is increasingly recognized that membrane curvature plays an important role in various cellular activities such as signaling and trafficking, as well as key issues involving health and disease development. Thus, curvature-sensing peptides are essential to the study and detection of highly curved bilayer structures. The effector domain of myristoylated alanine-rich C-kinase substrate (MARCKS-ED) has been demonstrated to have curvature-sensing ability. Research of the MARCKS-ED has further revealed that its Lys and Phe residues play an essential role in how MARCKS-ED detects and binds to curved bilayers. MARCKS-ED has the added property of being a lower-molecular-weight curvature sensor, which offers advantages in production. With that in mind, this work investigates peptide-sequence-related factors that influence curvature sensing and explores whether peptide fragments of even shorter length can function as curvature sensors. Using both experimental and computational methods, we studied the curvature-sensing capabilities of seven fragments of MARCKS-ED. Two of the longer fragments were designed from approximately the two halves of the full-length peptide whereas the five shorter fragments were taken from the central stretch of MARCKS-ED. Fully atomistic molecular dynamics simulations show that the fragments that remain bound to the bilayer exhibit interactions with the bilayer similar to that of the full-length MARCKS-ED peptide. Fluorescence enhancement and anisotropy assays, meanwhile, reveal that five of the MARCKS fragments possess the ability to sense membrane curvature. Based on the sequences of the curvature-sensing fragments, it appears that the ability to sense curvature involves a balance between the numbers of positively charged residues and hydrophobic anchoring residues. Together, these findings help crystallize our understanding of the molecular mechanisms underpinning the curvature-sensing behaviors of peptides, which will prove useful in the design of future curvature sensors. Copyright © 2016 Biophysical Society. Published by Elsevier Inc. All rights reserved.

The Prion Protein N1 and N2 Cleavage Fragments Bind to Phosphatidylserine and Phosphatidic Acid; Relevance to Stress-Protection Responses.

PubMed

Haigh, Cathryn L; Tumpach, Carolin; Drew, Simon C; Collins, Steven J

2015-01-01

Internal cleavage of the cellular prion protein generates two well characterised N-terminal fragments, N1 and N2. These fragments have been shown to bind to anionic phospholipids at low pH. We sought to investigate binding with other lipid moieties and queried how such interactions could be relevant to the cellular functions of these fragments. Both N1 and N2 bound phosphatidylserine (PS), as previously reported, and a further interaction with phosphatidic acid (PA) was also identified. The specificity of this interaction required the N-terminus, especially the proline motif within the basic amino acids at the N-terminus, together with the copper-binding region (unrelated to copper saturation). Previously, the fragments have been shown to be protective against cellular stresses. In the current study, serum deprivation was used to induce changes in the cellular lipid environment, including externalisation of plasma membrane PS and increased cellular levels of PA. When copper-saturated, N2 could reverse these changes, but N1 could not, suggesting that direct binding of N2 to cellular lipids may be part of the mechanism by which this peptide signals its protective response.

The Prion Protein N1 and N2 Cleavage Fragments Bind to Phosphatidylserine and Phosphatidic Acid; Relevance to Stress-Protection Responses

PubMed Central

Haigh, Cathryn L.; Tumpach, Carolin; Drew, Simon C.; Collins, Steven J.

2015-01-01

Internal cleavage of the cellular prion protein generates two well characterised N-terminal fragments, N1 and N2. These fragments have been shown to bind to anionic phospholipids at low pH. We sought to investigate binding with other lipid moieties and queried how such interactions could be relevant to the cellular functions of these fragments. Both N1 and N2 bound phosphatidylserine (PS), as previously reported, and a further interaction with phosphatidic acid (PA) was also identified. The specificity of this interaction required the N-terminus, especially the proline motif within the basic amino acids at the N-terminus, together with the copper-binding region (unrelated to copper saturation). Previously, the fragments have been shown to be protective against cellular stresses. In the current study, serum deprivation was used to induce changes in the cellular lipid environment, including externalisation of plasma membrane PS and increased cellular levels of PA. When copper-saturated, N2 could reverse these changes, but N1 could not, suggesting that direct binding of N2 to cellular lipids may be part of the mechanism by which this peptide signals its protective response. PMID:26252007

Isolation and characterization of target sequences of the chicken CdxA homeobox gene.

PubMed Central

Margalit, Y; Yarus, S; Shapira, E; Gruenbaum, Y; Fainsod, A

1993-01-01

The DNA binding specificity of the chicken homeodomain protein CDXA was studied. Using a CDXA-glutathione-S-transferase fusion protein, DNA fragments containing the binding site for this protein were isolated. The sources of DNA were oligonucleotides with random sequence and chicken genomic DNA. The DNA fragments isolated were sequenced and tested in DNA binding assays. Sequencing revealed that most DNA fragments are AT rich which is a common feature of homeodomain binding sites. By electrophoretic mobility shift assays it was shown that the different target sequences isolated bind to the CDXA protein with different affinities. The specific sequences bound by the CDXA protein in the genomic fragments isolated, were determined by DNase I footprinting. From the footprinted sequences, the CDXA consensus binding site was determined. The CDXA protein binds the consensus sequence A, A/T, T, A/T, A, T, A/G. The CAUDAL binding site in the ftz promoter is also included in this consensus sequence. When tested, some of the genomic target sequences were capable of enhancing the transcriptional activity of reporter plasmids when introduced into CDXA expressing cells. This study determined the DNA sequence specificity of the CDXA protein and it also shows that this protein can further activate transcription in cells in culture. Images PMID:7909943

Elucidation of the Binding Mode of the Carboxyterminal Region of Peptide YY to the Human Y2 Receptor.

PubMed

Xu, Bo; Vasile, Silvana; Østergaard, Søren; Paulsson, Johan F; Pruner, Jasna; Åqvist, Johan; Wulff, Birgitte S; Gutiérrez-de-Terán, Hugo; Larhammar, Dan

2018-04-01

Understanding the agonist-receptor interactions in the neuropeptide Y (NPY)/peptide YY (PYY) signaling system is fundamental for the design of novel modulators of appetite regulation. We report here the results of a multidisciplinary approach to elucidate the binding mode of the native peptide agonist PYY to the human Y 2 receptor, based on computational modeling, peptide chemistry and in vitro pharmacological analyses. The preserved binding orientation proposed for full-length PYY and five analogs, truncated at the amino terminus, explains our pharmacological results where truncations of the N-terminal proline helix showed little effect on peptide affinity. This was followed by receptor mutagenesis to investigate the roles of several receptor positions suggested by the modeling. As a complement, PYY-(3-36) analogs were synthesized with modifications at different positions in the common PYY/NPY C-terminal fragment ( 32 TRQRY 36 -amide). The results were assessed and interpreted by molecular dynamics and Free Energy Perturbation (FEP) simulations of selected mutants, providing a detailed map of the interactions of the PYY/NPY C-terminal fragment with the transmembrane cavity of the Y 2 receptor. The amidated C-terminus would be stabilized by polar interactions with Gln288 6.55 and Tyr219 5.39 , while Gln130 3.32 contributes to interactions with Q 34 in the peptide and T 32 is close to the tip of TM7 in the receptor. This leaves the core, α -helix of the peptide exposed to make potential interactions with the extracellular loops. This model agrees with most experimental data available for the Y 2 system and can be used as a basis for optimization of Y 2 receptor agonists. Copyright © 2018 by The Author(s).

Biofragments: An Approach towards Predicting Protein Function Using Biologically Related Fragments and its Application to Mycobacterium tuberculosis CYP126

PubMed Central

Hudson, Sean A; Mashalidis, Ellene H; Bender, Andreas; McLean, Kirsty J; Munro, Andrew W; Abell, Chris

2014-01-01

We present a novel fragment-based approach that tackles some of the challenges for chemical biology of predicting protein function. The general approach, which we have termed biofragments, comprises two key stages. First, a biologically relevant fragment library (biofragment library) can be designed and constructed from known sets of substrate-like ligands for a protein class of interest. Second, the library can be screened for binding to a novel putative ligand-binding protein from the same or similar class, and the characterization of hits provides insight into the basis of ligand recognition, selectivity, and function at the substrate level. As a proof-of-concept, we applied the biofragments approach to the functionally uncharacterized Mycobacterium tuberculosis (Mtb) cytochrome P450 isoform, CYP126. This led to the development of a tailored CYP biofragment library with notable 3D characteristics and a significantly higher screening hit rate (14 %) than standard drug-like fragment libraries screened previously against Mtb CYP121 and 125 (4 % and 1 %, respectively). Biofragment hits were identified that make both substrate-like type-I and inhibitor-like type-II interactions with CYP126. A chemical-fingerprint-based substrate model was built from the hits and used to search a virtual TB metabolome, which led to the discovery that CYP126 has a strong preference for the recognition of aromatics and substrate-like type-I binding of chlorophenol moieties within the active site near the heme. Future catalytic analyses will be focused on assessing CYP126 for potential substrate oxidative dehalogenation. PMID:24677424

Fragment-based approaches to anti-HIV drug discovery: state of the art and future opportunities.

PubMed

Huang, Boshi; Kang, Dongwei; Zhan, Peng; Liu, Xinyong

2015-12-01

The search for additional drugs to treat HIV infection is a continuing effort due to the emergence and spread of HIV strains resistant to nearly all current drugs. The recent literature reveals that fragment-based drug design/discovery (FBDD) has become an effective alternative to conventional high-throughput screening strategies for drug discovery. In this critical review, the authors describe the state of the art in FBDD strategies for the discovery of anti-HIV drug-like compounds. The article focuses on fragment screening techniques, direct fragment-based design and early hit-to-lead progress. Rapid progress in biophysical detection and in silico techniques has greatly aided the application of FBDD to discover candidate agents directed at a variety of anti-HIV targets. Growing evidence suggests that structural insights on key proteins in the HIV life cycle can be applied in the early phase of drug discovery campaigns, providing valuable information on the binding modes and efficiently prompting fragment hit-to-lead progression. The combination of structural insights with improved methodologies for FBDD, including the privileged fragment-based reconstruction approach, fragment hybridization based on crystallographic overlays, fragment growth exploiting dynamic combinatorial chemistry, and high-speed fragment assembly via diversity-oriented synthesis followed by in situ screening, offers the possibility of more efficient and rapid discovery of novel drugs for HIV-1 prevention or treatment. Though the use of FBDD in anti-HIV drug discovery is still in its infancy, it is anticipated that anti-HIV agents developed via fragment-based strategies will be introduced into the clinic in the future.

Self-consistent field for fragmented quantum mechanical model of large molecular systems.

PubMed

Jin, Yingdi; Su, Neil Qiang; Xu, Xin; Hu, Hao

2016-01-30

Fragment-based linear scaling quantum chemistry methods are a promising tool for the accurate simulation of chemical and biomolecular systems. Because of the coupled inter-fragment electrostatic interactions, a dual-layer iterative scheme is often employed to compute the fragment electronic structure and the total energy. In the dual-layer scheme, the self-consistent field (SCF) of the electronic structure of a fragment must be solved first, then followed by the updating of the inter-fragment electrostatic interactions. The two steps are sequentially carried out and repeated; as such a significant total number of fragment SCF iterations is required to converge the total energy and becomes the computational bottleneck in many fragment quantum chemistry methods. To reduce the number of fragment SCF iterations and speed up the convergence of the total energy, we develop here a new SCF scheme in which the inter-fragment interactions can be updated concurrently without converging the fragment electronic structure. By constructing the global, block-wise Fock matrix and density matrix, we prove that the commutation between the two global matrices guarantees the commutation of the corresponding matrices in each fragment. Therefore, many highly efficient numerical techniques such as the direct inversion of the iterative subspace method can be employed to converge simultaneously the electronic structure of all fragments, reducing significantly the computational cost. Numerical examples for water clusters of different sizes suggest that the method shall be very useful in improving the scalability of fragment quantum chemistry methods. © 2015 Wiley Periodicals, Inc.

Fragment-Based Discovery of Pyrimido[1,2-b]indazole PDE10A Inhibitors.

PubMed

Chino, Ayaka; Seo, Ryushi; Amano, Yasushi; Namatame, Ichiji; Hamaguchi, Wataru; Honbou, Kazuya; Mihara, Takuma; Yamazaki, Mayako; Tomishima, Masaki; Masuda, Naoyuki

2018-01-01

In this study, we report the identification of potent pyrimidoindazoles as phosphodiesterase10A (PDE10A) inhibitors by using the method of fragment-based drug discovery (FBDD). The pyrazolopyridine derivative 2 was found to be a fragment hit compound which could occupy a part of the binding site of PDE10A enzyme by using the method of the X-ray co-crystal structure analysis. On the basis of the crystal structure of compound 2 and PDE10A protein, a number of compounds were synthesized and evaluated, by means of structure-activity relationship (SAR) studies, which culminated in the discovery of a novel pyrimidoindazole derivative 13 having good physicochemical properties.

Target immobilization as a strategy for NMR-based fragment screening: comparison of TINS, STD, and SPR for fragment hit identification.

PubMed

Kobayashi, Masakazu; Retra, Kim; Figaroa, Francis; Hollander, Johan G; Ab, Eiso; Heetebrij, Robert J; Irth, Hubertus; Siegal, Gregg

2010-09-01

Fragment-based drug discovery (FBDD) has become a widely accepted tool that is complementary to high-throughput screening (HTS) in developing small-molecule inhibitors of pharmaceutical targets. Because a fragment campaign can only be as successful as the hit matter found, it is critical that the first stage of the process be optimized. Here the authors compare the 3 most commonly used methods for hit discovery in FBDD: high concentration screening (HCS), solution ligand-observed nuclear magnetic resonance (NMR), and surface plasmon resonance (SPR). They selected the commonly used saturation transfer difference (STD) NMR spectroscopy and the proprietary target immobilized NMR screening (TINS) as representative of the array of possible NMR methods. Using a target typical of FBDD campaigns, the authors find that HCS and TINS are the most sensitive to weak interactions. They also find a good correlation between TINS and STD for tighter binding ligands, but the ability of STD to detect ligands with affinity weaker than 1 mM K(D) is limited. Similarly, they find that SPR detection is most suited to ligands that bind with K(D) better than 1 mM. However, the good correlation between SPR and potency in a bioassay makes this a good method for hit validation and characterization studies.

Pairwise additivity of energy components in protein-ligand binding: The HIV II protease-Indinavir case

NASA Astrophysics Data System (ADS)

Ucisik, Melek N.; Dashti, Danial S.; Faver, John C.; Merz, Kenneth M.

2011-08-01

An energy expansion (binding energy decomposition into n-body interaction terms for n ≥ 2) to express the receptor-ligand binding energy for the fragmented HIV II protease-Indinavir system is described to address the role of cooperativity in ligand binding. The outcome of this energy expansion is compared to the total receptor-ligand binding energy at the Hartree-Fock, density functional theory, and semiempirical levels of theory. We find that the sum of the pairwise interaction energies approximates the total binding energy to ˜82% for HF and to >95% for both the M06-L density functional and PM6-DH2 semiempirical method. The contribution of the three-body interactions amounts to 18.7%, 3.8%, and 1.4% for HF, M06-L, and PM6-DH2, respectively. We find that the expansion can be safely truncated after n = 3. That is, the contribution of the interactions involving more than three parties to the total binding energy of Indinavir to the HIV II protease receptor is negligible. Overall, we find that the two-body terms represent a good approximation to the total binding energy of the system, which points to pairwise additivity in the present case. This basic principle of pairwise additivity is utilized in fragment-based drug design approaches and our results support its continued use. The present results can also aid in the validation of non-bonded terms contained within common force fields and in the correction of systematic errors in physics-based score functions.

TINS, target immobilized NMR screening: an efficient and sensitive method for ligand discovery.

PubMed

Vanwetswinkel, Sophie; Heetebrij, Robert J; van Duynhoven, John; Hollander, Johan G; Filippov, Dmitri V; Hajduk, Philip J; Siegal, Gregg

2005-02-01

We propose a ligand screening method, called TINS (target immobilized NMR screening), which reduces the amount of target required for the fragment-based approach to drug discovery. Binding is detected by comparing 1D NMR spectra of compound mixtures in the presence of a target immobilized on a solid support to a control sample. The method has been validated by the detection of a variety of ligands for protein and nucleic acid targets (K(D) from 60 to 5000 muM). The ligand binding capacity of a protein was undiminished after 2000 different compounds had been applied, indicating the potential to apply the assay for screening typical fragment libraries. TINS can be used in competition mode, allowing rapid characterization of the ligand binding site. TINS may allow screening of targets that are difficult to produce or that are insoluble, such as membrane proteins.

Identification of potential glutaminyl cyclase inhibitors from lead-like libraries by in silico and in vitro fragment-based screening.

PubMed

Szaszkó, Mária; Hajdú, István; Flachner, Beáta; Dobi, Krisztina; Magyar, Csaba; Simon, István; Lőrincz, Zsolt; Kapui, Zoltán; Pázmány, Tamás; Cseh, Sándor; Dormán, György

2017-02-01

A glutaminyl cyclase (QC) fragment library was in silico selected by disconnection of the structure of known QC inhibitors and by lead-like 2D virtual screening of the same set. The resulting fragment library (204 compounds) was acquired from commercial suppliers and pre-screened by differential scanning fluorimetry followed by functional in vitro assays. In this way, 10 fragment hits were identified ([Formula: see text]5 % hit rate, best inhibitory activity: 16 [Formula: see text]). The in vitro hits were then docked to the active site of QC, and the best scoring compounds were analyzed for binding interactions. Two fragments bound to different regions in a complementary manner, and thus, linking those fragments offered a rational strategy to generate novel QC inhibitors. Based on the structure of the virtual linked fragment, a 77-membered QC target focused library was selected from vendor databases and docked to the active site of QC. A PubChem search confirmed that the best scoring analogues are novel, potential QC inhibitors.

Free energy calculations of glycosaminoglycan-protein interactions.

PubMed

Gandhi, Neha S; Mancera, Ricardo L

2009-10-01

Glycosaminoglycans (GAGs) are complex highly charged linear polysaccharides that have a variety of roles in biological processes. We report the first use of molecular dynamics (MD) free energy calculations using the MM/PBSA method to investigate the binding of GAGs to protein molecules, namely the platelet endothelial cell adhesion molecule 1 (PECAM-1) and annexin A2. Calculations of the free energy of the binding of heparin fragments of different sizes reveal the existence of a region of low GAG-binding affinity in domains 5-6 of PECAM-1 and a region of high affinity in domains 2-3, consistent with experimental data and ligand-protein docking studies. A conformational hinge movement between domains 2 and 3 was observed, which allows the binding of heparin fragments of increasing size (pentasaccharides to octasaccharides) with an increasingly higher binding affinity. Similar simulations of the binding of a heparin fragment to annexin A2 reveal the optimization of electrostatic and hydrogen bonding interactions with the protein and protein-bound calcium ions. In general, these free energy calculations reveal that the binding of heparin to protein surfaces is dominated by strong electrostatic interactions for longer fragments, with equally important contributions from van der Waals interactions and vibrational entropy changes, against a large unfavorable desolvation penalty due to the high charge density of these molecules.

Carboxyl‐terminal Heparin‐binding Fragments of Platelet Factor 4 Retain the Blocking Effect on the Receptor Binding of Basic Fibroblast Growth Factor

PubMed Central

Waki, Michinori; Ohno, Motonori; Kuwano, Michihiko; Sakata, Toshiie

1993-01-01

Platelet factor 4 (PF‐4) blocks the binding of basic fibroblast growth factor (bFGF) to its receptor. In the present study, we constructed carboxyl‐terminal fragments, which represent the heparin‐binding region of the PF‐4 molecule, and examined whether these synthetic peptides retain the blocking effects on the receptor binding of bFGF. Synthetic peptides inhibited the receptor binding of bFGF. Furthermore, they inhibited the migration and tube formation of bovine capillary endothelial cells in culture (these phenomena are dependent on endogenous bFGF). PMID:8320164

The localization of a vitamin K-induced modification in an N-terminal fragment of human prothrombin

PubMed Central

Skotland, Tore; Holm, Turid; Østerud, Bjarne; Flengsrud, Ragnar; Prydz, Hans

1974-01-01

1. The N-terminal fragment (PF-I) split off from prothrombin during coagulation was purified to homogeneity from human serum. 2. The apparent molecular weight is 27000±2000 in sodium dodecyl sulphate–polyacrylamide-gel electrophoresis, whereas a value of about 19600 is obtained by calculation based on amino acid and carbohydrate analyses. The N-terminal sequence is an Ala-Asx bond. The fragment contains about 16% carbohydrate, binds phospholipids in the presence of Ca2+ and is adsorbed to BaSO4. The pKa of its BaSO4-binding group(s) is 3.1–3.5. 3. By CNBr cleavage of fragment PF-I two peptides (C-1 and C-2) were obtained with molecular weights of about 5900 (C-2) and 12400 (C-1) on the basis of amino acid and carbohydrate analyses. Only the smaller (N-terminal) peptide is adsorbed to BaSO4 and, since the ability of the whole protein to bind to BaSO4 is known to be absent in samples obtained from patients treated with vitamin K antagonists, this peptide probably contains the site of a modification to the structure of the protein which occurs during biosynthesis and depends on vitamin K. This peptide does not contain hexosamine or sialic acid. ImagesFig. 2. PMID:4219283

The alpha-fetoprotein third domain receptor binding fragment: in search of scavenger and associated receptor targets.

PubMed

Mizejewski, G J

2015-01-01

Recent studies have demonstrated that the carboxyterminal third domain of alpha-fetoprotein (AFP-CD) binds with various ligands and receptors. Reports within the last decade have established that AFP-CD contains a large fragment of amino acids that interact with several different receptor types. Using computer software specifically designed to identify protein-to-protein interaction at amino acid sequence docking sites, the computer searches identified several types of scavenger-associated receptors and their amino acid sequence locations on the AFP-CD polypeptide chain. The scavenger receptors (SRs) identified were CD36, CD163, Stabilin, SSC5D, SRB1 and SREC; the SR-associated receptors included the mannose, low-density lipoprotein receptors, the asialoglycoprotein receptor, and the receptor for advanced glycation endproducts (RAGE). Interestingly, some SR interaction sites were localized on the AFP-derived Growth Inhibitory Peptide (GIP) segment at amino acids #480-500. Following the detection studies, a structural subdomain analysis of both the receptor and the AFP-CD revealed the presence of epidermal growth factor (EGF) repeats, extracellular matrix-like protein regions, amino acid-rich motifs and dimerization subdomains. For the first time, it was reported that EGF-like sequence repeats were identified on each of the three domains of AFP. Thereafter, the localization of receptors on specific cell types were reviewed and their functions were discussed.

The DINGO dataset: a comprehensive set of data for the SAMPL challenge

NASA Astrophysics Data System (ADS)

Newman, Janet; Dolezal, Olan; Fazio, Vincent; Caradoc-Davies, Tom; Peat, Thomas S.

2012-05-01

Part of the latest SAMPL challenge was to predict how a small fragment library of 500 commercially available compounds would bind to a protein target. In order to assess the modellers' work, a reasonably comprehensive set of data was collected using a number of techniques. These included surface plasmon resonance, isothermal titration calorimetry, protein crystallization and protein crystallography. Using these techniques we could determine the kinetics of fragment binding, the energy of binding, how this affects the ability of the target to crystallize, and when the fragment did bind, the pose or orientation of binding. Both the final data set and all of the raw images have been made available to the community for scrutiny and further work. This overview sets out to give the parameters of the experiments done and what might be done differently for future studies.

Fragmentation cross sections and binding energies of neutron-rich nuclei

NASA Astrophysics Data System (ADS)

Tsang, M. B.; Lynch, W. G.; Friedman, W. A.; Mocko, M.; Sun, Z. Y.; Aoi, N.; Cook, J. M.; Delaunay, F.; Famiano, M. A.; Hui, H.; Imai, N.; Iwasaki, H.; Motobayashi, T.; Niikura, M.; Onishi, T.; Rogers, A. M.; Sakurai, H.; Suzuki, H.; Takeshita, E.; Takeuchi, S.; Wallace, M. S.

2007-10-01

An exponential dependence of the fragmentation cross section on the average binding energy is observed and reproduced with a statistical model. The observed functional dependence is robust and allows the extraction of binding energies from measured cross sections. From the systematics of Cu isotope cross sections, the binding energies of Cu76,77,78,79 have been extracted. They are 636.94±0.4,647.1±0.4,651.6±0.4, and 657.8±0.5 MeV, respectively. Specifically, the uncertainty of the binding energy of Cu75 is reduced from 980 keV, as listed in the 2003 mass table of Audi, Wapstra, and Thibault to 400 keV. The predicted cross sections of two near drip-line nuclei, Na39 and Mg40 from the fragmentation of Ca48 are discussed.

A New Class of Allosteric HIV-1 Integrase Inhibitors Identified by Crystallographic Fragment Screening of the Catalytic Core Domain.

PubMed

Patel, Disha; Antwi, Janet; Koneru, Pratibha C; Serrao, Erik; Forli, Stefano; Kessl, Jacques J; Feng, Lei; Deng, Nanjie; Levy, Ronald M; Fuchs, James R; Olson, Arthur J; Engelman, Alan N; Bauman, Joseph D; Kvaratskhelia, Mamuka; Arnold, Eddy

2016-11-04

HIV-1 integrase (IN) is essential for virus replication and represents an important multifunctional therapeutic target. Recently discovered quinoline-based allosteric IN inhibitors (ALLINIs) potently impair HIV-1 replication and are currently in clinical trials. ALLINIs exhibit a multimodal mechanism of action by inducing aberrant IN multimerization during virion morphogenesis and by competing with IN for binding to its cognate cellular cofactor LEDGF/p75 during early steps of HIV-1 infection. However, quinoline-based ALLINIs impose a low genetic barrier for the evolution of resistant phenotypes, which highlights a need for discovery of second-generation inhibitors. Using crystallographic screening of a library of 971 fragments against the HIV-1 IN catalytic core domain (CCD) followed by a fragment expansion approach, we have identified thiophenecarboxylic acid derivatives that bind at the CCD-CCD dimer interface at the principal lens epithelium-derived growth factor (LEDGF)/p75 binding pocket. The most active derivative (5) inhibited LEDGF/p75-dependent HIV-1 IN activity in vitro with an IC 50 of 72 μm and impaired HIV-1 infection of T cells at an EC 50 of 36 μm The identified lead compound, with a relatively small molecular weight (221 Da), provides an optimal building block for developing a new class of inhibitors. Furthermore, although structurally distinct thiophenecarboxylic acid derivatives target a similar pocket at the IN dimer interface as the quinoline-based ALLINIs, the lead compound, 5, inhibited IN mutants that confer resistance to quinoline-based compounds. Collectively, our findings provide a plausible path for structure-based development of second-generation ALLINIs. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Fragment virtual screening based on Bayesian categorization for discovering novel VEGFR-2 scaffolds.

PubMed

Zhang, Yanmin; Jiao, Yu; Xiong, Xiao; Liu, Haichun; Ran, Ting; Xu, Jinxing; Lu, Shuai; Xu, Anyang; Pan, Jing; Qiao, Xin; Shi, Zhihao; Lu, Tao; Chen, Yadong

2015-11-01

The discovery of novel scaffolds against a specific target has long been one of the most significant but challengeable goals in discovering lead compounds. A scaffold that binds in important regions of the active pocket is more favorable as a starting point because scaffolds generally possess greater optimization possibilities. However, due to the lack of sufficient chemical space diversity of the databases and the ineffectiveness of the screening methods, it still remains a great challenge to discover novel active scaffolds. Since the strengths and weaknesses of both fragment-based drug design and traditional virtual screening (VS), we proposed a fragment VS concept based on Bayesian categorization for the discovery of novel scaffolds. This work investigated the proposal through an application on VEGFR-2 target. Firstly, scaffold and structural diversity of chemical space for 10 compound databases were explicitly evaluated. Simultaneously, a robust Bayesian classification model was constructed for screening not only compound databases but also their corresponding fragment databases. Although analysis of the scaffold diversity demonstrated a very unevenly distribution of scaffolds over molecules, results showed that our Bayesian model behaved better in screening fragments than molecules. Through a literature retrospective research, several generated fragments with relatively high Bayesian scores indeed exhibit VEGFR-2 biological activity, which strongly proved the effectiveness of fragment VS based on Bayesian categorization models. This investigation of Bayesian-based fragment VS can further emphasize the necessity for enrichment of compound databases employed in lead discovery by amplifying the diversity of databases with novel structures.

Fragment-based design of kinase inhibitors: a practical guide.

PubMed

Erickson, Jon A

2015-01-01

Fragment-based drug design has become an important strategy for drug design and development over the last decade. It has been used with particular success in the development of kinase inhibitors, which are one of the most widely explored classes of drug targets today. The application of fragment-based methods to discovering and optimizing kinase inhibitors can be a complicated and daunting task; however, a general process has emerged that has been highly fruitful. Here a practical outline of the fragment process used in kinase inhibitor design and development is laid out with specific examples. A guide to the overall process from initial discovery through fragment screening, including the difficulties in detection, to the computational methods available for use in optimization of the discovered fragments is reported.

The E. coli 16S rRNA binding site of ribosomal protein S15: higher-order structure in the absence and in the presence of the protein.

PubMed Central

Mougel, M; Philippe, C; Ebel, J P; Ehresmann, B; Ehresmann, C

1988-01-01

We have investigated in detail the secondary and tertiary structures of E. coli 16S rRNA binding site of protein S15 using a variety of enzymatic and chemical probes. RNase T1 and nuclease S1 were used to probe unpaired nucleotides and RNase V1 to monitor base-paired or stacked nucleotides. Bases were probed with dimethylsulfate (at A(N-1), C(N-3) and G(N-7)), with 1-cyclohexyl-3 (2-(1-methylmorpholino)-ethyl)-carboiimide-p- toluenesulfonate (at U(N-3) and G(N-1)) and with diethylpyrocarbonate (at A(N-7)). The RNA region corresponding to nucleotides 652 to 753 was tested within: (1) the complete 16S rRNA molecule; (2) a 16S rRNA fragment corresponding to nucleotides 578 to 756 obtained by transcription in vitro; (3) the S15-16S rRNA complex; (4) the S15-fragment complex. Cleavage and modification sites were detected by primer extension with reverse transcriptase. Our results show that: (1) The synthetized fragment folds into the same overall secondary structure as in the complete 16S rRNA, with the exception of the large asymmetrical internal loop (nucleotides 673-676/714-733) which is fully accessible in the fragment while it appears conformationally heterogeneous in the 16S rRNA; (2) the reactivity patterns of the S15-16S rRNA and S15-fragment complexes are identical; (3) the protein protects defined RNA regions, located in the large interior loop and in the 3'-end strand of helix [655-672]-[734-751]; (4) the protein also causes enhanced chemical reactivity and enzyme accessibility interpreted as resulting from a local conformational rearrangement, induced by S15 binding. Images PMID:2453025

A Maltose-Binding Protein Fusion Construct Yields a Robust Crystallography Platform for MCL1

PubMed Central

Clifton, Matthew C.; Dranow, David M.; Leed, Alison; Fulroth, Ben; Fairman, James W.; Abendroth, Jan; Atkins, Kateri A.; Wallace, Ellen; Fan, Dazhong; Xu, Guoping; Ni, Z. J.; Daniels, Doug; Van Drie, John; Wei, Guo; Burgin, Alex B.; Golub, Todd R.; Hubbard, Brian K.; Serrano-Wu, Michael H.

2015-01-01

Crystallization of a maltose-binding protein MCL1 fusion has yielded a robust crystallography platform that generated the first apo MCL1 crystal structure, as well as five ligand-bound structures. The ability to obtain fragment-bound structures advances structure-based drug design efforts that, despite considerable effort, had previously been intractable by crystallography. In the ligand-independent crystal form we identify inhibitor binding modes not observed in earlier crystallographic systems. This MBP-MCL1 construct dramatically improves the structural understanding of well-validated MCL1 ligands, and will likely catalyze the structure-based optimization of high affinity MCL1 inhibitors. PMID:25909780

Ribosomal Binding Site Switching: An Effective Strategy for High-Throughput Cloning Constructions

PubMed Central

Li, Yunlong; Zhang, Yong; Lu, Pei; Rayner, Simon; Chen, Shiyun

2012-01-01

Direct cloning of PCR fragments by TA cloning or blunt end ligation are two simple methods which would greatly benefit high-throughput (HTP) cloning constructions if the efficiency can be improved. In this study, we have developed a ribosomal binding site (RBS) switching strategy for direct cloning of PCR fragments. RBS is an A/G rich region upstream of the translational start codon and is essential for gene expression. Change from A/G to T/C in the RBS blocks its activity and thereby abolishes gene expression. Based on this property, we introduced an inactive RBS upstream of a selectable marker gene, and designed a fragment insertion site within this inactive RBS. Forward and reverse insertions of specifically tailed fragments will respectively form an active and inactive RBS, thus all background from vector self-ligation and fragment reverse insertions will be eliminated due to the non-expression of the marker gene. The effectiveness of our strategy for TA cloning and blunt end ligation are confirmed. Application of this strategy to gene over-expression, a bacterial two-hybrid system, a bacterial one-hybrid system, and promoter bank construction are also verified. The advantages of this simple procedure, together with its low cost and high efficiency, makes our strategy extremely useful in HTP cloning constructions. PMID:23185557

Fragmentation cross sections and binding energies of neutron-rich nuclei

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tsang, M. B.; Lynch, W. G.; Mocko, M.

An exponential dependence of the fragmentation cross section on the average binding energy is observed and reproduced with a statistical model. The observed functional dependence is robust and allows the extraction of binding energies from measured cross sections. From the systematics of Cu isotope cross sections, the binding energies of {sup 76,77,78,79}Cu have been extracted. They are 636.94{+-}0.4,647.1{+-}0.4,651.6{+-}0.4, and 657.8{+-}0.5 MeV, respectively. Specifically, the uncertainty of the binding energy of {sup 75}Cu is reduced from 980 keV, as listed in the 2003 mass table of Audi, Wapstra, and Thibault to 400 keV. The predicted cross sections of two near drip-linemore » nuclei, {sup 39}Na and {sup 40}Mg from the fragmentation of {sup 48}Ca are discussed.« less

Binding of various ovotransferrin fragments to chick-embryo red cells.

PubMed Central

Oratore, A; D'Andrea, G; Moreton, K; Williams, J

1989-01-01

1. The ability of N- and C-terminal half-molecule fragments of hen ovotransferrin to interact with chick red blood cells (CERBC) has been studied under conditions that allow binding of the transferrin to transferrin receptors to take place, but not the delivery of iron to the cell. Two kinds of half-molecule fragments were used: (a) those which can associate with one another to give a dimer resembling native transferrin and (b) those which cannot associate in this way because they lack a few amino acid residues from their C-terminal ends. 2. Neither N nor C half-molecules alone can bind to the CERBC, but, when both are present, tight binding occurs. 3. Whether or not the half-molecules can associate with one another makes little difference to receptor binding. 4. Given that one of the half-molecules is iron-saturated, the presence or absence of iron in the contralateral half-molecule again makes little difference to receptor binding. PMID:2920021

Interaction energies for the purine inhibitor roscovitine with cyclin-dependent kinase 2: correlated ab initio quantum-chemical, DFT and empirical calculations.

PubMed

Dobes, Petr; Otyepka, Michal; Strnad, Miroslav; Hobza, Pavel

2006-05-24

The interaction between roscovitine and cyclin-dependent kinase 2 (cdk2) was investigated by performing correlated ab initio quantum-chemical calculations. The whole protein was fragmented into smaller systems consisting of one or a few amino acids, and the interaction energies of these fragments with roscovitine were determined by using the MP2 method with the extended aug-cc-pVDZ basis set. For selected complexes, the complete basis set limit MP2 interaction energies, as well as the coupled-cluster corrections with inclusion of single, double and noninteractive triples contributions [CCSD(T)], were also evaluated. The energies of interaction between roscovitine and small fragments and between roscovitine and substantial sections of protein (722 atoms) were also computed by using density-functional tight-binding methods covering dispersion energy (DFTB-D) and the Cornell empirical potential. Total stabilisation energy originates predominantly from dispersion energy and methods that do not account for the dispersion energy cannot, therefore, be recommended for the study of protein-inhibitor interactions. The Cornell empirical potential describes reasonably well the interaction between roscovitine and protein; therefore, this method can be applied in future thermodynamic calculations. A limited number of amino acid residues contribute significantly to the binding of roscovitine and cdk2, whereas a rather large number of amino acids make a negligible contribution.

Structural modification of P-glycoprotein induced by OH radicals: Insights from atomistic simulations

NASA Astrophysics Data System (ADS)

Khosravian, N.; Kamaraj, B.; Neyts, E. C.; Bogaerts, A.

2016-02-01

This study reports on the possible effects of OH radical impact on the transmembrane domain 6 of P-glycoprotein, TM6, which plays a crucial role in drug binding in human cells. For the first time, we employ molecular dynamics (MD) simulations based on the self-consistent charge density functional tight binding (SCC-DFTB) method to elucidate the potential sites of fragmentation and mutation in this domain upon impact of OH radicals, and to obtain fundamental information about the underlying reaction mechanisms. Furthermore, we apply non-reactive MD simulations to investigate the long-term effect of this mutation, with possible implications for drug binding. Our simulations indicate that the interaction of OH radicals with TM6 might lead to the breaking of C-C and C-N peptide bonds, which eventually cause fragmentation of TM6. Moreover, according to our simulations, the OH radicals can yield mutation in the aromatic ring of phenylalanine in TM6, which in turn affects its structure. As TM6 plays an important role in the binding of a range of cytotoxic drugs with P-glycoprotein, any changes in its structure are likely to affect the response of the tumor cell in chemotherapy. This is crucial for cancer therapies based on reactive oxygen species, such as plasma treatment.

Structure-based engineering to restore high affinity binding of an isoform-selective anti-TGFβ1 antibody

PubMed Central

Honey, Denise M.; Best, Annie; Qiu, Huawei

2018-01-01

ABSTRACT Metelimumab (CAT192) is a human IgG4 monoclonal antibody developed as a TGFβ1-specific antagonist. It was tested in clinical trials for the treatment of scleroderma but later terminated due to lack of efficacy. Subsequent characterization of CAT192 indicated that its TGFβ1 binding affinity was reduced by ∼50-fold upon conversion from the parental single-chain variable fragment (scFv) to IgG4. We hypothesized this result was due to decreased conformational flexibility of the IgG that could be altered via engineering. Therefore, we designed insertion mutants in the elbow region and screened for binding and potency. Our results indicated that increasing the elbow region linker length in each chain successfully restored the isoform-specific and high affinity binding of CAT192 to TGFβ1. The crystal structure of the high binding affinity mutant displays large conformational rearrangements of the variable domains compared to the wild-type antigen-binding fragment (Fab) and the low binding affinity mutants. Insertion of two glycines in both the heavy and light chain elbow regions provided sufficient flexibility for the variable domains to extend further apart than the wild-type Fab, and allow the CDR3s to make additional interactions not seen in the wild-type Fab structure. These interactions coupled with the dramatic conformational changes provide a possible explanation of how the scFv and elbow-engineered Fabs bind TGFβ1 with high affinity. This study demonstrates the benefits of re-examining both structure and function when converting scFv to IgG molecules, and highlights the potential of structure-based engineering to produce fully functional antibodies. PMID:29333938

Recombinant human antibody fragment against tetanus toxoid produced by phage display.

PubMed

Neelakantam, B; Sridevi, N V; Shukra, A M; Sugumar, P; Samuel, S; Rajendra, L

2014-03-01

Phage display technology is a powerful in vitro method for the identification of specific monoclonal antibodies (antibody fragments) to an antigenic target and allows the rapid generation and selection of high affinity, fully human antibodies directed toward any disease target appropriate for antibody therapy. In the present study, we exploited the phage display technology for the selection of an antigen binding fragment (Fabs) toward tetanus toxoid using human naïve phage antibody library constructed from peripheral blood lymphocytes of naïve human donors. The phages displaying Fab were subjected to three rounds of bio-panning with tetanus toxoid as antigen on a solid phase. The high affinity antibody fragments were expressed in HB2151 strain of Escherichia coli and purified by immobilized metal affinity chromatography. The binding activity and specificity of the antibody fragment was established by its reactivity toward tetanus toxoid and non-reactivity toward other related toxins as determined by enzyme-linked immunosorbent assay and immunoblot analysis. The selected Fab fragment forming the antigen-binding complexes with the toxoid in flocculation assay indicates that the Fab may have a potential neutralizing ability toward antigen.

Targeting Ligandable Pockets on Plant Homeodomain (PHD) Zinc Finger Domains by a Fragment-Based Approach

PubMed Central

2018-01-01

Plant homeodomain (PHD) zinc fingers are histone reader domains that are often associated with human diseases. Despite this, they constitute a poorly targeted class of readers, suggesting low ligandability. Here, we describe a successful fragment-based campaign targeting PHD fingers from the proteins BAZ2A and BAZ2B as model systems. We validated a pool of in silico fragments both biophysically and structurally and solved the first crystal structures of PHD zinc fingers in complex with fragments bound to an anchoring pocket at the histone binding site. The best-validated hits were found to displace a histone H3 tail peptide in competition assays. This work identifies new chemical scaffolds that provide suitable starting points for future ligand optimization using structure-guided approaches. The demonstrated ligandability of the PHD reader domains could pave the way for the development of chemical probes to drug this family of epigenetic readers. PMID:29529862

Targeting Ligandable Pockets on Plant Homeodomain (PHD) Zinc Finger Domains by a Fragment-Based Approach.

PubMed

Amato, Anastasia; Lucas, Xavier; Bortoluzzi, Alessio; Wright, David; Ciulli, Alessio

2018-04-20

Plant homeodomain (PHD) zinc fingers are histone reader domains that are often associated with human diseases. Despite this, they constitute a poorly targeted class of readers, suggesting low ligandability. Here, we describe a successful fragment-based campaign targeting PHD fingers from the proteins BAZ2A and BAZ2B as model systems. We validated a pool of in silico fragments both biophysically and structurally and solved the first crystal structures of PHD zinc fingers in complex with fragments bound to an anchoring pocket at the histone binding site. The best-validated hits were found to displace a histone H3 tail peptide in competition assays. This work identifies new chemical scaffolds that provide suitable starting points for future ligand optimization using structure-guided approaches. The demonstrated ligandability of the PHD reader domains could pave the way for the development of chemical probes to drug this family of epigenetic readers.

Bacterial production and structure-functional validation of a recombinant antigen-binding fragment (Fab) of an anti-cancer therapeutic antibody targeting epidermal growth factor receptor.

PubMed

Kim, Ji-Hun; Sim, Dae-Won; Park, Dongsun; Jung, Tai-Geun; Lee, Seonghwan; Oh, Taeheun; Ha, Jong-Ryul; Seok, Seung-Hyeon; Seo, Min-Duk; Kang, Ho Chul; Kim, Young Pil; Won, Hyung-Sik

2016-12-01

Fragment engineering of monoclonal antibodies (mAbs) has emerged as an excellent paradigm to develop highly efficient therapeutic and/or diagnostic agents. Engineered mAb fragments can be economically produced in bacterial systems using recombinant DNA technologies. In this work, we established recombinant production in Escherichia coli for monovalent antigen-binding fragment (Fab) adopted from a clinically used anticancer mAB drug cetuximab targeting epidermal growth factor receptor (EGFR). Recombinant DNA constructs were designed to express both polypeptide chains comprising Fab in a single vector and to secrete them to bacterial periplasmic space for efficient folding. Particularly, a C-terminal engineering to confer an interchain disulfide bond appeared to be able to enhance its heterodimeric integrity and EGFR-binding activity. Conformational relevance of the purified final product was validated by mass spectrometry and crystal structure at 1.9 Å resolution. Finally, our recombinant cetuximab-Fab was found to have strong binding affinity to EGFR overexpressed in human squamous carcinoma model (A431) cells. Its binding ability was comparable to that of cetuximab. Its EGFR-binding affinity was estimated at approximately 0.7 nM of Kd in vitro, which was quite stronger than the binding affinity of natural ligand EGF. Hence, the results validate that our construction could serve as an efficient platform to produce a recombinant cetuximab-Fab with a retained antigen-binding functionality.

Structure and DNA-binding of meiosis-specific protein Hop2

NASA Astrophysics Data System (ADS)

Zhou, Donghua; Moktan, Hem; Pezza, Roberto

2014-03-01

Here we report structure elucidation of the DNA binding domain of homologous pairing protein 2 (Hop2), which is important to gene diversity when sperms and eggs are produced. Together with another protein Mnd1, Hop2 enhances the strand invasion activity of recombinase Dmc1 by over 30 times, facilitating proper synapsis of homologous chromosomes. However, the structural and biochemical bases for the function of Hop2 and Mnd1 have not been well understood. As a first step toward such understanding, we recently solved the structure for the N-terminus of Hop2 (1-84) using solution NMR. This fragment shows a typical winged-head conformation with recognized DNA binding activity. DNA interacting sites were then investigated by chemical shift perturbations in a titration experiment. Information of these sites was used to guide protein-DNA docking with MD simulation, revealing that helix 3 is stably lodged in the DNA major groove and that wing 1 (connecting strands 2 and 3) transiently comes in contact with the minor groove in nanosecond time scale. Mutagenesis analysis further confirmed the DNA binding sites in this fragment of the protein.

Biochemical analyses indicate that binding and cleavage specificities define the ordered processing of human Okazaki fragments by Dna2 and FEN1.

PubMed

Gloor, Jason W; Balakrishnan, Lata; Campbell, Judith L; Bambara, Robert A

2012-08-01

In eukaryotic Okazaki fragment processing, the RNA primer is displaced into a single-stranded flap prior to removal. Evidence suggests that some flaps become long before they are cleaved, and that this cleavage involves the sequential action of two nucleases. Strand displacement characteristics of the polymerase show that a short gap precedes the flap during synthesis. Using biochemical techniques, binding and cleavage assays presented here indicate that when the flap is ∼ 30 nt long the nuclease Dna2 can bind with high affinity to the flap and downstream double strand and begin cleavage. When the polymerase idles or dissociates the Dna2 can reorient for additional contacts with the upstream primer region, allowing the nuclease to remain stably bound as the flap is further shortened. The DNA can then equilibrate to a double flap that can bind Dna2 and flap endonuclease (FEN1) simultaneously. When Dna2 shortens the flap even more, FEN1 can displace the Dna2 and cleave at the flap base to make a nick for ligation.

An assay that may predict the development of IgG enhancing allergen-specific IgE binding during birch immunotherapy

PubMed Central

Selb, R.; Eckl-Dorna, J.; Vrtala, S.; Valenta, R.; Niederberger, V.

2017-01-01

Background It has been shown that birch pollen immunotherapy can induce IgG antibodies which enhance IgE binding to Bet v 1. We aimed to develop a serological assay to predict the development of antibodies which enhance IgE binding to Bet v 1 during immunotherapy. Methods In 18 patients treated by Bet v 1-fragment-specific immunotherapy, the effects of IgG antibodies specific for the fragments on the binding of IgE antibodies to Bet v 1 were measured by ELISA. Blocking and possible enhancing effects on IgE binding were compared with skin sensitivity to Bet v 1 after treatment. Results We found that fragment-specific IgG enhanced IgE binding to Bet v 1 in two patients who also showed an increase of skin sensitivity to Bet v 1. Conclusion Our results indicate that it may be possible to develop serological tests which predict the induction of unfavourable IgG antibodies enhancing the binding of IgE to Bet v 1 during immunotherapy. PMID:23998344

Proteome-wide covalent ligand discovery in native biological systems

PubMed Central

Backus, Keriann M.; Correia, Bruno E.; Lum, Kenneth M.; Forli, Stefano; Horning, Benjamin D.; González-Páez, Gonzalo E.; Chatterjee, Sandip; Lanning, Bryan R.; Teijaro, John R.; Olson, Arthur J.; Wolan, Dennis W.; Cravatt, Benjamin F.

2016-01-01

Small molecules are powerful tools for investigating protein function and can serve as leads for new therapeutics. Most human proteins, however, lack small-molecule ligands, and entire protein classes are considered “undruggable” 1,2. Fragment-based ligand discovery (FBLD) can identify small-molecule probes for proteins that have proven difficult to target using high-throughput screening of complex compound libraries 1,3. Although reversibly binding ligands are commonly pursued, covalent fragments provide an alternative route to small-molecule probes 4–10, including those that can access regions of proteins that are difficult to access through binding affinity alone 5,10,11. In this manuscript, we report a quantitative analysis of cysteine-reactive small-molecule fragments screened against thousands of proteins. Covalent ligands were identified for >700 cysteines found in both druggable proteins and proteins deficient in chemical probes, including transcription factors, adaptor/scaffolding proteins, and uncharacterized proteins. Among the atypical ligand-protein interactions discovered were compounds that react preferentially with pro- (inactive) caspases. We used these ligands to distinguish extrinsic apoptosis pathways in human cell lines versus primary human T-cells, showing that the former is largely mediated by caspase-8 while the latter depends on both caspase-8 and −10. Fragment-based covalent ligand discovery provides a greatly expanded portrait of the ligandable proteome and furnishes compounds that can illuminate protein functions in native biological systems. PMID:27309814

Decarboxylation of bovine prothrombin fragment 1 and prothrombin.

PubMed

Tuhy, P M; Bloom, J W; Mann, K G

1979-12-25

Bovine prothrombin fragment 1 and prothrombin undergo decarboxylation of their gamma-carboxyglutamic acid residues when the lyophilized proteins are heated in vacuo at 110 degrees C for several hours. The fully decarboxylated fragment 1 product has lost its barium-binding ability as well as the calcium-binding function which causes fluorescence quenching in the presence of 2 mM Ca2+. There is no sign of secondary structure alteration in solution upon analysis by fluorescence emission and circular dichroic spectroscopy. A family of partially decarboxylated fragment 1 species generated by heating for shorter periods shows that the initial decrease in calcium-binding ability occurs almost twice as rapidly as the loss of gamma-carboxyglutamic acid. This is consistent with the idea that differential functions can be ascribed to the 10 gamma-carboxyglutamic acid residues in fragment 1, including both high- and low-affinity metal ion binding sites. Prothrombin itself also undergoes total decarboxylation without any apparent alteration in secondary structure. However, in this case the latent thrombin activity is progressively diminished during the heating process in terms of both clotting activity and hydrolysis of the amide substrate H-D-Phe-Pip-Arg-pNA. The present results indicate that in vitro decarboxylation of gamma-carboxyglutamic acid in dried proteins is useful for analyzing the detailed calcium-binding proteins of vitamin K dependent coagulation factors.

DAMGO binding to mouse brain membranes: influence of salts, guanine nucleotides, substance P, and substance P fragments.

PubMed

Krumins, S A; Kim, D C; Igwe, O J; Larson, A A

1993-01-01

Substance P (SP) appears to mediate many processes of the central nervous system, including pain. This report deals with modulation of opioid binding in the mouse brain by SP and SP fragments, as well as by salts and guanine nucleotides. Binding studies of the selective mu opioid receptor agonist [D-Ala2, MePhe4,Gly(ol)5]enkephalin (DAMGO) to mouse brain membrane preparations demonstrated that guanine nucleotide modulation of DAMGO binding affinity was modified by SP. However, SP had little or no influence on inhibition of DAMGO binding induced by salts, such as MgCl2, CaCl2, or NaCl. By replacing GTP with GppNHp, SP (0.1 nM) produced multiple affinity forms of the DAMGO receptor, while at a higher concentration (10 nM), SP lost its influence on DAMGO binding. Furthermore, 0.1 nM SP changed DAMGO binding parameters in a medium containing NaCl, CaCl2, and GppNHp such that the high- and low-affinity conformations of the receptor converted to a single site following the addition of SP to the incubation medium. While the C-terminal SP fragment SP(5-11) was without effect, the N-terminal SP fragments SP(1-9) and SP(1-7) appeared to imitate SP in modifying GppNHp-modulated DAMGO binding. These results suggest that SP functions as a modulator of opioid binding at the mu receptor and it appears that the N-terminus of SP plays a role in the modulatory process.

A Fragment-Based Method of Creating Small-Molecule Libraries to Target the Aggregation of Intrinsically Disordered Proteins.

PubMed

Joshi, Priyanka; Chia, Sean; Habchi, Johnny; Knowles, Tuomas P J; Dobson, Christopher M; Vendruscolo, Michele

2016-03-14

The aggregation process of intrinsically disordered proteins (IDPs) has been associated with a wide range of neurodegenerative disorders, including Alzheimer's and Parkinson's diseases. Currently, however, no drug in clinical use targets IDP aggregation. To facilitate drug discovery programs in this important and challenging area, we describe a fragment-based approach of generating small-molecule libraries that target specific IDPs. The method is based on the use of molecular fragments extracted from compounds reported in the literature to inhibit of the aggregation of IDPs. These fragments are used to screen existing large generic libraries of small molecules to form smaller libraries specific for given IDPs. We illustrate this approach by describing three distinct small-molecule libraries to target, Aβ, tau, and α-synuclein, which are three IDPs implicated in Alzheimer's and Parkinson's diseases. The strategy described here offers novel opportunities for the identification of effective molecular scaffolds for drug discovery for neurodegenerative disorders and to provide insights into the mechanism of small-molecule binding to IDPs.

Dissecting Orthosteric Contacts for a Reverse-Fragment-Based Ligand Design.

PubMed

Chandramohan, Arun; Tulsian, Nikhil K; Anand, Ganesh S

2017-08-01

Orthosteric sites on proteins are formed typically from noncontiguous interacting sites in three-dimensional space where the composite binding interaction of a biological ligand is mediated by multiple synergistic interactions of its constituent functional groups. Through these multiple interactions, ligands stabilize both the ligand binding site and the local secondary structure. However, relative energetic contributions of the individual contacts in these protein-ligand interactions are difficult to resolve. Deconvolution of the contributions of these various functional groups in natural inhibitors/ligand would greatly aid in iterative fragment-based drug discovery (FBDD). In this study, we describe an approach of progressive unfolding of a target protein using a gradient of denaturant urea to reveal the individual energetic contributions of various ligand-functional groups to the affinity of the entire ligand. Through calibrated unfolding of two protein-ligand systems: cAMP-bound regulatory subunit of Protein Kinase A (RIα) and IBMX-bound phosphodiesterase8 (PDE8), monitored by amide hydrogen-deuterium exchange mass spectrometry, we show progressive disruption of individual orthosteric contacts in the ligand binding sites, allowing us to rank the energetic contributions of these individual interactions. In the two cAMP-binding sites of RIα, exocyclic phosphate oxygens of cAMP were identified to mediate stronger interactions than ribose 2'-OH in both the RIα-cAMP binding interfaces. Further, we have also ranked the relative contributions of the different functional groups of IBMX based on their interactions with the orthosteric residues of PDE8. This strategy for deconstruction of individual binding sites and identification of the strongest functional group interaction in enzyme orthosteric sites offers a rational starting point for FBDD.

Regulation of Cre recombinase by ligand-induced complementation of inactive fragments.

PubMed

Jullien, Nicolas; Sampieri, François; Enjalbert, Alain; Herman, Jean-Paul

2003-11-01

Cre recombinase is extensively used to engineer the genome of experimental animals. However, its usefulness is still limited by the lack of an efficient temporal control over its activity. To overcome this, we have developed DiCre, a regulatable fragment complementation system for Cre. The enzyme was split into two moieties that were fused to FKBP12 (FK506-binding protein) and FRB (binding domain of the FKBP12-rapamycin-associated protein), respectively. These can be efficiently heterodimerized by rapamycin. Several variants, based on splitting Cre at different sites and using different linker peptides, were tested in an indicator cell line. The fusion proteins, taken separately, had no recombinase activity. Stable transformants, co-expressing complementing fragments based on splitting Cre between Asn59 and Asn60, displayed low background activity affecting 0.05-0.4% of the cells. Rapamycin induced a rapid recombination, reaching 100% by 48-72 h, with an EC50 of 0.02 nM. Thus, ligand-induced dimerization can efficiently regulate Cre, and should be useful to achieve a tight temporal control of its activity, such as in the case of the creation of conditional knock-out animals.

Transforming fragments into candidates: small becomes big in medicinal chemistry.

PubMed

de Kloe, Gerdien E; Bailey, David; Leurs, Rob; de Esch, Iwan J P

2009-07-01

Fragment-based drug discovery (FBDD) represents a logical and efficient approach to lead discovery and optimisation. It can draw on structural, biophysical and biochemical data, incorporating a wide range of inputs, from precise mode-of-binding information on specific fragments to wider ranging pharmacophoric screening surveys using traditional HTS approaches. It is truly an enabling technology for the imaginative medicinal chemist. In this review, we analyse a representative set of 23 published FBDD studies that describe how low molecular weight fragments are being identified and efficiently transformed into higher molecular weight drug candidates. FBDD is now becoming warmly endorsed by industry as well as academia and the focus on small interacting molecules is making a big scientific impact.

Developments in SPR Fragment Screening.

PubMed

Chavanieu, Alain; Pugnière, Martine

2016-01-01

Fragment-based approaches have played an increasing role alongside high-throughput screening in drug discovery for 15 years. The label-free biosensor technology based on surface plasmon resonance (SPR) is now sensitive and informative enough to serve during primary screens and validation steps. In this review, the authors discuss the role of SPR in fragment screening. After a brief description of the underlying principles of the technique and main device developments, they evaluate the advantages and adaptations of SPR for fragment-based drug discovery. SPR can also be applied to challenging targets such as membrane receptors and enzymes. The high-level of immobilization of the protein target and its stability are key points for a relevant screening that can be optimized using oriented immobilized proteins and regenerable sensors. Furthermore, to decrease the rate of false negatives, a selectivity test may be performed in parallel on the main target bearing the binding site mutated or blocked with a low-off-rate ligand. Fragment-based drug design, integrated in a rational workflow led by SPR, will thus have a predominant role for the next wave of drug discovery which could be greatly enhanced by new improvements in SPR devices.

Investigation of copper(II) binding to the protein precursor of Non-Amyloid-Beta Component of Alzheimer Disease Amyloid Plaque

NASA Astrophysics Data System (ADS)

Rose, Francis; Hodak, Miroslav; Bernholc, Jerry

2007-03-01

The Non-Amyloid-Beta Component Precursor (NACP) is a natively unfolded synaptic protein that is implicated in Alzheimers and Parkinsons diseases. Its aggregation into fibrillar structures is accelerated by the binding of copper(II). Experimental studies suggest that the dominant copper binding site is located at the histidine residue in NACP. Based on this evidence we assembled a model fragment of the binding site and used DFT to analyze the conformational details of the most probable binding motifs. We investigated the overall conformational effects with classical MD by constraining the copper binding site to the most energetically favorable geometry obtained from the DFT calculations. These results are compared and contrasted with those of the unbound NACP.

Binding of endostatin to endothelial heparan sulphate shows a differential requirement for specific sulphates.

PubMed

Blackhall, Fiona H; Merry, Catherine L R; Lyon, Malcolm; Jayson, Gordon C; Folkman, Judah; Javaherian, Kashi; Gallagher, John T

2003-10-01

Endostatin is a naturally occurring proteolytic fragment of the C-terminal domain of collagen XVIII. It inhibits angiogenesis by a mechanism that appears to involve binding to HS (heparan sulphate). We have examined the molecular interaction between endostatin and HS from micro- and macrovessel endothelial cells. Two discrete panels of oligosaccharides were prepared from metabolically radiolabelled HS, using digestion with either heparinase I or III, and then examined for their endostatin affinity using a sensitive filter-binding assay. Two types of endostatin-binding regions were identified: one comprising sulphated domains of five or more disaccharides in length, enriched in 6-O-sulphate groups, and the other contained long heparinase I-resistant fragments. In the latter case, evidence from the present study suggests that the binding region encompasses a sulphated domain fragment and a transition zone of intermediate sulphation. The contribution to binding of specific O-sulphate groups was determined using selectively desulphated HS species, namely HS from Hs2st-/- mutant cells, and by comparing the compositions of endostatin-binding and non-binding oligosaccharides. The results indicate that 6-O-sulphates play a dominant role in site selectivity and 2-O-sulphates are not strictly essential.

Binding of endostatin to endothelial heparan sulphate shows a differential requirement for specific sulphates.

PubMed Central

Blackhall, Fiona H; Merry, Catherine L R; Lyon, Malcolm; Jayson, Gordon C; Folkman, Judah; Javaherian, Kashi; Gallagher, John T

2003-01-01

Endostatin is a naturally occurring proteolytic fragment of the C-terminal domain of collagen XVIII. It inhibits angiogenesis by a mechanism that appears to involve binding to HS (heparan sulphate). We have examined the molecular interaction between endostatin and HS from micro- and macrovessel endothelial cells. Two discrete panels of oligosaccharides were prepared from metabolically radiolabelled HS, using digestion with either heparinase I or III, and then examined for their endostatin affinity using a sensitive filter-binding assay. Two types of endostatin-binding regions were identified: one comprising sulphated domains of five or more disaccharides in length, enriched in 6-O-sulphate groups, and the other contained long heparinase I-resistant fragments. In the latter case, evidence from the present study suggests that the binding region encompasses a sulphated domain fragment and a transition zone of intermediate sulphation. The contribution to binding of specific O-sulphate groups was determined using selectively desulphated HS species, namely HS from Hs2st-/- mutant cells, and by comparing the compositions of endostatin-binding and non-binding oligosaccharides. The results indicate that 6-O-sulphates play a dominant role in site selectivity and 2-O-sulphates are not strictly essential. PMID:12812520

Analytic second derivative of the energy for density-functional tight-binding combined with the fragment molecular orbital method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nakata, Hiroya, E-mail: hiroya.nakata.gt@kyocera.jp; Nishimoto, Yoshio; Fedorov, Dmitri G.

2016-07-28

The analytic second derivative of the energy is developed for the fragment molecular orbital (FMO) method combined with density-functional tight-binding (DFTB), enabling simulations of infrared and Raman spectra of large molecular systems. The accuracy of the method is established in comparison to full DFTB without fragmentation for a set of representative systems. The performance of the FMO-DFTB Hessian is discussed for molecular systems containing up to 10 041 atoms. The method is applied to the study of the binding of α-cyclodextrin to polyethylene glycol, and the calculated IR spectrum of an epoxy amine oligomer reproduces experiment reasonably well.

Predicting the relative binding affinity of mineralocorticoid receptor antagonists by density functional methods

NASA Astrophysics Data System (ADS)

Roos, Katarina; Hogner, Anders; Ogg, Derek; Packer, Martin J.; Hansson, Eva; Granberg, Kenneth L.; Evertsson, Emma; Nordqvist, Anneli

2015-12-01

In drug discovery, prediction of binding affinity ahead of synthesis to aid compound prioritization is still hampered by the low throughput of the more accurate methods and the lack of general pertinence of one method that fits all systems. Here we show the applicability of a method based on density functional theory using core fragments and a protein model with only the first shell residues surrounding the core, to predict relative binding affinity of a matched series of mineralocorticoid receptor (MR) antagonists. Antagonists of MR are used for treatment of chronic heart failure and hypertension. Marketed MR antagonists, spironolactone and eplerenone, are also believed to be highly efficacious in treatment of chronic kidney disease in diabetes patients, but is contra-indicated due to the increased risk for hyperkalemia. These findings and a significant unmet medical need among patients with chronic kidney disease continues to stimulate efforts in the discovery of new MR antagonist with maintained efficacy but low or no risk for hyperkalemia. Applied on a matched series of MR antagonists the quantum mechanical based method gave an R2 = 0.76 for the experimental lipophilic ligand efficiency versus relative predicted binding affinity calculated with the M06-2X functional in gas phase and an R2 = 0.64 for experimental binding affinity versus relative predicted binding affinity calculated with the M06-2X functional including an implicit solvation model. The quantum mechanical approach using core fragments was compared to free energy perturbation calculations using the full sized compound structures.

The 'retro-design' concept for novel kinase inhibitors.

PubMed

Müller, Gerhard; Sennhenn, Peter C; Woodcock, Timothy; Neumann, Lars

2010-07-01

Protein kinases are among the most attractive therapeutic targets for a broad range of diseases. This feature review highlights and classifies the main design principles employed to generate active and selective kinase inhibitors. In particular, emphasis is focused on a fragment-based lead-generation approach, which constitutes a novel design method for developing type II kinase inhibitors with distinct binding kinetic attributes. This 'retro-design' strategy relies on a customized fragment library, and contrasts the traditional approach used in the design of type II inhibitors.

Epitope mapping: the first step in developing epitope-based vaccines.

PubMed

Gershoni, Jonathan M; Roitburd-Berman, Anna; Siman-Tov, Dror D; Tarnovitski Freund, Natalia; Weiss, Yael

2007-01-01

Antibodies are an effective line of defense in preventing infectious diseases. Highly potent neutralizing antibodies can intercept a virus before it attaches to its target cell and, thus, inactivate it. This ability is based on the antibodies' specific recognition of epitopes, the sites of the antigen to which antibodies bind. Thus, understanding the antibody/epitope interaction provides a basis for the rational design of preventive vaccines. It is assumed that immunization with the precise epitope, corresponding to an effective neutralizing antibody, would elicit the generation of similarly potent antibodies in the vaccinee. Such a vaccine would be a 'B-cell epitope-based vaccine', the implementation of which requires the ability to backtrack from a desired antibody to its corresponding epitope. In this article we discuss a range of methods that enable epitope discovery based on a specific antibody. Such a reversed immunological approach is the first step in the rational design of an epitope-based vaccine. Undoubtedly, the gold standard for epitope definition is x-ray analyses of crystals of antigen:antibody complexes. This method provides atomic resolution of the epitope; however, it is not readily applicable to many antigens and antibodies, and requires a very high degree of sophistication and expertise. Most other methods rely on the ability to monitor the binding of the antibody to antigen fragments or mutated variations. In mutagenesis of the antigen, loss of binding due to point modification of an amino acid residue is often considered an indication of an epitope component. In addition, computational combinatorial methods for epitope mapping are also useful. These methods rely on the ability of the antibody of interest to affinity isolate specific short peptides from combinatorial phage display peptide libraries. The peptides are then regarded as leads for the definition of the epitope corresponding to the antibody used to screen the peptide library. For epitope mapping, computational algorithms have been developed, such as Mapitope, which has recently been found to be effective in mapping conformational discontinuous epitopes. The pros and cons of various approaches towards epitope mapping are also discussed.

Multiple ligand simultaneous docking: orchestrated dancing of ligands in binding sites of protein.

PubMed

Li, Huameng; Li, Chenglong

2010-07-30

Present docking methodologies simulate only one single ligand at a time during docking process. In reality, the molecular recognition process always involves multiple molecular species. Typical protein-ligand interactions are, for example, substrate and cofactor in catalytic cycle; metal ion coordination together with ligand(s); and ligand binding with water molecules. To simulate the real molecular binding processes, we propose a novel multiple ligand simultaneous docking (MLSD) strategy, which can deal with all the above processes, vastly improving docking sampling and binding free energy scoring. The work also compares two search strategies: Lamarckian genetic algorithm and particle swarm optimization, which have respective advantages depending on the specific systems. The methodology proves robust through systematic testing against several diverse model systems: E. coli purine nucleoside phosphorylase (PNP) complex with two substrates, SHP2NSH2 complex with two peptides and Bcl-xL complex with ABT-737 fragments. In all cases, the final correct docking poses and relative binding free energies were obtained. In PNP case, the simulations also capture the binding intermediates and reveal the binding dynamics during the recognition processes, which are consistent with the proposed enzymatic mechanism. In the other two cases, conventional single-ligand docking fails due to energetic and dynamic coupling among ligands, whereas MLSD results in the correct binding modes. These three cases also represent potential applications in the areas of exploring enzymatic mechanism, interpreting noisy X-ray crystallographic maps, and aiding fragment-based drug design, respectively. 2010 Wiley Periodicals, Inc.

Computational Analysis of the Interaction Energies between Amino Acid Residues of the Measles Virus Hemagglutinin and Its Receptors.

PubMed

Xu, Fengqi; Tanaka, Shigenori; Watanabe, Hirofumi; Shimane, Yasuhiro; Iwasawa, Misako; Ohishi, Kazue; Maruyama, Tadashi

2018-05-03

Measles virus (MV) causes an acute and highly devastating contagious disease in humans. Employing the crystal structures of three human receptors, signaling lymphocyte-activation molecule (SLAM), CD46, and Nectin-4, in complex with the measles virus hemagglutinin (MVH), we elucidated computationally the details of binding energies between the amino acid residues of MVH and those of the receptors with an ab initio fragment molecular orbital (FMO) method. The calculated inter-fragment interaction energies (IFIEs) revealed a number of significantly interacting amino acid residues of MVH that played essential roles in binding to the receptors. As predicted from previously reported experiments, some important amino-acid residues of MVH were shown to be common but others were specific to interactions with the three receptors. Particularly, some of the (non-polar) hydrophobic residues of MVH were found to be attractively interacting with multiple receptors, thus indicating the importance of the hydrophobic pocket for intermolecular interactions (especially in the case of Nectin-4). In contrast, the electrostatic interactions tended to be used for specific molecular recognition. Furthermore, we carried out FMO calculations for in silico experiments of amino acid mutations, finding reasonable agreements with virological experiments concerning the substitution effect of residues. Thus, the present study demonstrates that the electron-correlated FMO method is a powerful tool to search exhaustively for amino acid residues that contribute to interactions with receptor molecules. It is also applicable for designing inhibitors of MVH and engineered MVs for cancer therapy.

Biologically active protein fragments containing specific binding regions of serum albumin or related proteins

NASA Technical Reports Server (NTRS)

Carter, Daniel C. (Inventor)

1998-01-01

In accordance with the present invention, biologically active protein fragments can be constructed which contain only those specific portions of the serum albumin family of proteins such as regions known as subdomains IIA and IIIA which are primarily responsible for the binding properties of the serum albumins. The artificial serums that can be prepared from these biologically active protein fragments are advantageous in that they can be produced much more easily than serums containing the whole albumin, yet still retain all or most of the original binding potential of the full albumin proteins. In addition, since the protein fragment serums of the present invention can be made from non-natural sources using conventional recombinant DNA techniques, they are far safer than serums containing natural albumin because they do not carry the potentially harmful viruses and other contaminants that will be found in the natural substances.

Searching for protein binding sites from Molecular Dynamics simulations and paramagnetic fragment-based NMR studies.

PubMed

Bernini, Andrea; Henrici De Angelis, Lucia; Morandi, Edoardo; Spiga, Ottavia; Santucci, Annalisa; Assfalg, Michael; Molinari, Henriette; Pillozzi, Serena; Arcangeli, Annarosa; Niccolai, Neri

2014-03-01

Hotspot delineation on protein surfaces represents a fundamental step for targeting protein-protein interfaces. Disruptors of protein-protein interactions can be designed provided that the sterical features of binding pockets, including the transient ones, can be defined. Molecular Dynamics, MD, simulations have been used as a reliable framework for identifying transient pocket openings on the protein surface. Accessible surface area and intramolecular H-bond involvement of protein backbone amides are proposed as descriptors for characterizing binding pocket occurrence and evolution along MD trajectories. TEMPOL induced paramagnetic perturbations on (1)H-(15)N HSQC signals of protein backbone amides have been analyzed as a fragment-based search for surface hotspots, in order to validate MD predicted pockets. This procedure has been applied to CXCL12, a small chemokine responsible for tumor progression and proliferation. From combined analysis of MD data and paramagnetic profiles, two CXCL12 sites suitable for the binding of small molecules were identified. One of these sites is the already well characterized CXCL12 region involved in the binding to CXCR4 receptor. The other one is a transient pocket predicted by Molecular Dynamics simulations, which could not be observed from static analysis of CXCL12 PDB structures. The present results indicate how TEMPOL, instrumental in identifying this transient pocket, can be a powerful tool to delineate minor conformations which can be highly relevant in dynamic discovery of antitumoral drugs. Copyright © 2013 Elsevier B.V. All rights reserved.

Identification and therapeutic potential of a vitronectin binding region of meningococcal msf.

PubMed

Hill, Darryl J; Griffiths, Natalie J; Borodina, Elena; Andreae, Clio A; Sessions, Richard B; Virji, Mumtaz

2015-01-01

The human pathogen Neisseria meningitides (Nm) attains serum resistance via a number of mechanisms, one of which involves binding to the host complement regulator protein vitronectin. We have shown previously that the Meningococcal surface fibril (Msf), a trimeric autotransporter, binds to the activated form of vitronectin (aVn) to increase Nm survival in human serum. In this study, we aimed to identify the aVn-binding region of Msf to assess its potential as an antigen which can elicit antibodies that block aVn binding and/or possess bactericidal properties. Using several recombinant Msf fragments spanning its surface-exposed region, the smallest aVn-binding recombinants were found to span residues 1-86 and 39-124. The use of further deletion constructs and overlapping recombinant Msf fragments suggested that a region of Msf comprising residues 39-82 may be primarily important for aVn binding and that other regions may also be involved but to a lesser extent. Molecular modelling implicated K66 and K68, conserved in all available Msf sequences, to be involved in the interaction. Recombinant fragments which bound to aVn were able to reduce the survival advantage conveyed by aVn-interaction in serum bactericidal assays. Antibodies raised against one such fragment inhibited aVn binding to Msf. In addition, the antibodies enhanced specific killing of Msf-expressing Nm in a dose-dependent manner. Overall, this study identifies an aVn-binding region of Msf, an adhesin known to impart serum resistance properties to the pathogen; and shows that this region of Msf can elicit antibodies with dual properties which reduce pathogen survival within the host and thus has potential as a vaccine antigen.

Identification and Therapeutic Potential of a Vitronectin Binding Region of Meningococcal Msf

PubMed Central

Hill, Darryl J.; Griffiths, Natalie J.; Borodina, Elena; Andreae, Clio A.; Sessions, Richard B.; Virji, Mumtaz

2015-01-01

The human pathogen Neisseria meningitides (Nm) attains serum resistance via a number of mechanisms, one of which involves binding to the host complement regulator protein vitronectin. We have shown previously that the Meningococcal surface fibril (Msf), a trimeric autotransporter, binds to the activated form of vitronectin (aVn) to increase Nm survival in human serum. In this study, we aimed to identify the aVn-binding region of Msf to assess its potential as an antigen which can elicit antibodies that block aVn binding and/or possess bactericidal properties. Using several recombinant Msf fragments spanning its surface-exposed region, the smallest aVn-binding recombinants were found to span residues 1-86 and 39-124. The use of further deletion constructs and overlapping recombinant Msf fragments suggested that a region of Msf comprising residues 39-82 may be primarily important for aVn binding and that other regions may also be involved but to a lesser extent. Molecular modelling implicated K66 and K68, conserved in all available Msf sequences, to be involved in the interaction. Recombinant fragments which bound to aVn were able to reduce the survival advantage conveyed by aVn-interaction in serum bactericidal assays. Antibodies raised against one such fragment inhibited aVn binding to Msf. In addition, the antibodies enhanced specific killing of Msf-expressing Nm in a dose-dependent manner. Overall, this study identifies an aVn-binding region of Msf, an adhesin known to impart serum resistance properties to the pathogen; and shows that this region of Msf can elicit antibodies with dual properties which reduce pathogen survival within the host and thus has potential as a vaccine antigen. PMID:25826209

A collagen-binding EGFR antibody fragment targeting tumors with a collagen-rich extracellular matrix.

PubMed

Liang, Hui; Li, Xiaoran; Wang, Bin; Chen, Bing; Zhao, Yannan; Sun, Jie; Zhuang, Yan; Shi, Jiajia; Shen, He; Zhang, Zhijun; Dai, Jianwu

2016-02-17

Many tumors over-express collagen, which constitutes the physical scaffold of tumor microenvironment. Collagen has been considered to be a target for cancer therapy. The collagen-binding domain (CBD) is a short peptide, which could bind to collagen and achieve the sustained release of CBD-fused proteins in collagen scaffold. Here, a collagen-binding EGFR antibody fragment was designed and expressed for targeting the collagen-rich extracellular matrix in tumors. The antibody fragment (Fab) of cetuximab was fused with CBD (CBD-Fab) and expressed in Pichia pastoris. CBD-Fab maintained antigen binding and anti-tumor activity of cetuximab and obtained a collagen-binding ability in vitro. The results also showed CBD-Fab was mainly enriched in tumors and had longer retention time in tumors in A431 s.c. xenografts. Furthermore, CBD-Fab showed a similar therapeutic efficacy as cetuximab in A431 xenografts. Although CBD-Fab hasn't showed better therapeutic effects than cetuximab, its smaller molecular and special target may be applicable as antibody-drug conjugates (ADC) or immunotoxins.

A collagen-binding EGFR antibody fragment targeting tumors with a collagen-rich extracellular matrix

PubMed Central

Liang, Hui; Li, Xiaoran; Wang, Bin; Chen, Bing; Zhao, Yannan; Sun, Jie; Zhuang, Yan; Shi, Jiajia; Shen, He; Zhang, Zhijun; Dai, Jianwu

2016-01-01

Many tumors over-express collagen, which constitutes the physical scaffold of tumor microenvironment. Collagen has been considered to be a target for cancer therapy. The collagen-binding domain (CBD) is a short peptide, which could bind to collagen and achieve the sustained release of CBD-fused proteins in collagen scaffold. Here, a collagen-binding EGFR antibody fragment was designed and expressed for targeting the collagen-rich extracellular matrix in tumors. The antibody fragment (Fab) of cetuximab was fused with CBD (CBD-Fab) and expressed in Pichia pastoris. CBD-Fab maintained antigen binding and anti-tumor activity of cetuximab and obtained a collagen-binding ability in vitro. The results also showed CBD-Fab was mainly enriched in tumors and had longer retention time in tumors in A431 s.c. xenografts. Furthermore, CBD-Fab showed a similar therapeutic efficacy as cetuximab in A431 xenografts. Although CBD-Fab hasn’t showed better therapeutic effects than cetuximab, its smaller molecular and special target may be applicable as antibody–drug conjugates (ADC) or immunotoxins. PMID:26883295

Recombinant human antibody fragment against tetanus toxoid produced by phage display

PubMed Central

Neelakantam, B.; Sridevi, N. V.; Shukra, A. M.; Sugumar, P.; Samuel, S.

2014-01-01

Phage display technology is a powerful in vitro method for the identification of specific monoclonal antibodies (antibody fragments) to an antigenic target and allows the rapid generation and selection of high affinity, fully human antibodies directed toward any disease target appropriate for antibody therapy. In the present study, we exploited the phage display technology for the selection of an antigen binding fragment (Fabs) toward tetanus toxoid using human naïve phage antibody library constructed from peripheral blood lymphocytes of naïve human donors. The phages displaying Fab were subjected to three rounds of bio-panning with tetanus toxoid as antigen on a solid phase. The high affinity antibody fragments were expressed in HB2151 strain of Escherichia coli and purified by immobilized metal affinity chromatography. The binding activity and specificity of the antibody fragment was established by its reactivity toward tetanus toxoid and non-reactivity toward other related toxins as determined by enzyme-linked immunosorbent assay and immunoblot analysis. The selected Fab fragment forming the antigen-binding complexes with the toxoid in flocculation assay indicates that the Fab may have a potential neutralizing ability toward antigen. PMID:24678405

Analysis of correlated domain motions in IgG light chain reveals possible mechanisms of immunological signal transduction.

PubMed

Król, Marcin; Roterman, Irena; Piekarska, Barbara; Konieczny, Leszek; Rybarska, Janina; Stopa, Barbara; Spólnik, Paweł

2005-05-15

It was shown experimentally that binding of a micelle composed of Congo red molecules to immunological complexes leads to the enhanced stability of the latter, and simultaneously prevents binding of a complement molecule (C1q). The dye binds in a cavity created by the removal of N-terminal polypeptide chain, as observed experimentally in a model system-immunoglobulin G (IgG) light chain dimer. Molecular Dynamics (MD) simulations of three forms of IgG light chain dimer, with and without the dye, were performed to investigate the role of N-terminal fragment and self-assembled ligand in coupling between V and C domains. Root-mean-square distance (RMSD) time profiles show that removal of N-terminal fragment leads to destabilization of V domain. A micelle composed of four self-assembled dye molecules stabilizes and fixes the domain. Analysis of root-mean-square fluctuation (RMSF) values and dynamic cross-correlation matrices (DCCM) reveals that removal of N-terminal fragment results in complete decoupling between V and C domains. Binding of self-assembled Congo red molecules improves the coupling, albeit slightly. The disruption of a small beta-sheet composed of N- and C-terminal fragments of the domain (NC sheet) is the most likely reason for the decoupling. Self-assembled ligand, bound in the place originally occupied by N-terminal fragment, is not able to take over the function of the beta-sheet. Lack of correlation of motions between residues in V and C domains denotes that light chain-Congo red complexes have hampered ability to transmit conformational changes between domains. This is a likely explanation of the lack of complement binding by immunological complexes, which bind Congo red, and supports the idea that the NC sheet is the key structural fragment taking part in immunological signal transduction. Copyright 2005 Wiley-Liss, Inc.

Establish an automated flow injection ESI-MS method for the screening of fragment based libraries: Application to Hsp90.

PubMed

Riccardi Sirtori, Federico; Caronni, Dannica; Colombo, Maristella; Dalvit, Claudio; Paolucci, Mauro; Regazzoni, Luca; Visco, Carlo; Fogliatto, Gianpaolo

2015-08-30

ESI-MS is a well established technique for the study of biopolymers (nucleic acids, proteins) and their non covalent adducts, due to its capacity to detect ligand-target complexes in the gas phase and allows inference of ligand-target binding in solution. In this article we used this approach to investigate the interaction of ligands to the Heat Shock Protein 90 (Hsp90). This enzyme is a molecular chaperone involved in the folding and maturation of several proteins which has been subjected in the last years to intensive drug discovery efforts due to its key role in cancer. In particular, reference compounds, with a broad range of dissociation constants from 40pM to 100μM, were tested to assess the reliability of ESI-MS for the study of protein-ligand complexes. A good agreement was found between the values measured with a fluorescence polarization displacement assay and those determined by mass spectrometry. After this validation step we describe the setup of a medium throughput screening method, based on ESI-MS, suitable to explore interactions of therapeutic relevance biopolymers with chemical libraries. Our approach is based on an automated flow injection ESI-MS method (AFI-MS) and has been applied to screen the Nerviano Medical Sciences proprietary fragment library of about 2000 fragments against Hsp90. In order to discard false positive hits and to discriminate those of them interacting with the N-terminal ATP binding site, competition experiments were performed using a reference inhibitor. Gratifyingly, this group of hits matches with the ligands previously identified by NMR FAXS techniques and confirmed by X-ray co-crystallization experiments. These results support the use of AFI-MS for the screening of medium size libraries, including libraries of small molecules with low affinity typically used in fragment based drug discovery. AFI-MS is a valid alternative to other techniques with the additional opportunities to identify compounds interacting with unpredicted or allosteric sites, without the need of any binding probes. Copyright © 2015 Elsevier B.V. All rights reserved.

Production of a soluble single-chain variable fragment antibody against okadaic acid and exploration of its specific binding.

PubMed

He, Kuo; Zhang, Xiuyuan; Wang, Lixia; Du, Xinjun; Wei, Dong

2016-06-15

Okadaic acid is a lipophilic marine algal toxin commonly responsible for diarrhetic shellfish poisoning (DSP). Outbreaks of DSP have been increasing and are of worldwide public health concern; therefore, there is a growing demand for more rapid, reliable, and economical analytical methods for the detection of this toxin. In this study, anti-okadaic acid single-chain variable fragment (scFv) genes were prepared by cloning heavy and light chain genes from hybridoma cells, followed by fusion of the chains via a linker peptide. An scFv-pLIP6/GN recombinant plasmid was constructed and transformed into Escherichia coli for expression, and the target scFv was identified with IC-CLEIA (chemiluminescent enzyme immunoassay). The IC15 was 0.012 ± 0.02 μg/L, and the IC50 was 0.25 ± 0.03 μg/L. The three-dimensional structure of the scFv was simulated with computer modeling, and okadaic acid was docked to the scFv model to obtain a putative structure of the binding complex. Two predicted critical amino acids, Ser32 and Thr187, were then mutated to verify this theoretical model. Both mutants exhibited significant loss of binding activity. These results help us to understand this specific scFv-antigen binding mechanism and provide guidance for affinity maturation of the antibody in vitro. The high-affinity scFv developed here also has potential for okadaic acid toxin detection. Copyright © 2016. Published by Elsevier Inc.

Combining phage display with de novo protein sequencing for reverse engineering of monoclonal antibodies.

PubMed

Rickert, Keith W; Grinberg, Luba; Woods, Robert M; Wilson, Susan; Bowen, Michael A; Baca, Manuel

2016-01-01

The enormous diversity created by gene recombination and somatic hypermutation makes de novo protein sequencing of monoclonal antibodies a uniquely challenging problem. Modern mass spectrometry-based sequencing will rarely, if ever, provide a single unambiguous sequence for the variable domains. A more likely outcome is computation of an ensemble of highly similar sequences that can satisfy the experimental data. This outcome can result in the need for empirical testing of many candidate sequences, sometimes iteratively, to identity one which can replicate the activity of the parental antibody. Here we describe an improved approach to antibody protein sequencing by using phage display technology to generate a combinatorial library of sequences that satisfy the mass spectrometry data, and selecting for functional candidates that bind antigen. This approach was used to reverse engineer 2 commercially-obtained monoclonal antibodies against murine CD137. Proteomic data enabled us to assign the majority of the variable domain sequences, with the exception of 3-5% of the sequence located within or adjacent to complementarity-determining regions. To efficiently resolve the sequence in these regions, small phage-displayed libraries were generated and subjected to antigen binding selection. Following enrichment of antigen-binding clones, 2 clones were selected for each antibody and recombinantly expressed as antigen-binding fragments (Fabs). In both cases, the reverse-engineered Fabs exhibited identical antigen binding affinity, within error, as Fabs produced from the commercial IgGs. This combination of proteomic and protein engineering techniques provides a useful approach to simplifying the technically challenging process of reverse engineering monoclonal antibodies from protein material.

Combining phage display with de novo protein sequencing for reverse engineering of monoclonal antibodies

PubMed Central

Rickert, Keith W.; Grinberg, Luba; Woods, Robert M.; Wilson, Susan; Bowen, Michael A.; Baca, Manuel

2016-01-01

ABSTRACT The enormous diversity created by gene recombination and somatic hypermutation makes de novo protein sequencing of monoclonal antibodies a uniquely challenging problem. Modern mass spectrometry-based sequencing will rarely, if ever, provide a single unambiguous sequence for the variable domains. A more likely outcome is computation of an ensemble of highly similar sequences that can satisfy the experimental data. This outcome can result in the need for empirical testing of many candidate sequences, sometimes iteratively, to identity one which can replicate the activity of the parental antibody. Here we describe an improved approach to antibody protein sequencing by using phage display technology to generate a combinatorial library of sequences that satisfy the mass spectrometry data, and selecting for functional candidates that bind antigen. This approach was used to reverse engineer 2 commercially-obtained monoclonal antibodies against murine CD137. Proteomic data enabled us to assign the majority of the variable domain sequences, with the exception of 3–5% of the sequence located within or adjacent to complementarity-determining regions. To efficiently resolve the sequence in these regions, small phage-displayed libraries were generated and subjected to antigen binding selection. Following enrichment of antigen-binding clones, 2 clones were selected for each antibody and recombinantly expressed as antigen-binding fragments (Fabs). In both cases, the reverse-engineered Fabs exhibited identical antigen binding affinity, within error, as Fabs produced from the commercial IgGs. This combination of proteomic and protein engineering techniques provides a useful approach to simplifying the technically challenging process of reverse engineering monoclonal antibodies from protein material. PMID:26852694

Computational Study of Pseudo-Phosphorylation and Phosphorylation of the Microtubule Associated Protein Tau

NASA Astrophysics Data System (ADS)

Prokopovich, Dmitriy; Larini, Luca

This study focuses on the effect of pseudo-phosphorylation on the aggregation of protein tau, which is very often found interacting with microtubules in the neuron. Within the axon of the neuron, tau governs the assembly of microtubules that make up the cytoskeleton. This is important for stabilization of and transport across the microtubules. One of the indications of the Alzheimer's disease is the hyper-phosphorylation and aggregation of protein tau into neurofibrillary tangles that destroy the neurons. But even experts in the field do not know if hyper-phosphorylation directly causes the aggregation of tau. In some experiments, pseudo-phosphorylation mimics the effects of phosphorylation. It does so by mutating certain residues of the protein chain into charged residues. In this computational study, we will employ a fragment of tau called PHF43. This fragment belongs to the microtubule binding region and papers published by others have indicated that it readily aggregates. Replica exchange molecular dynamics simulations were performed on the pseudo-phosphorylated, phosphorylated, and dimerized PHF43. The program used to simulate and analyze PHF43 was AMBER14.

Fragment screening by SPR and advanced application to GPCRs.

PubMed

Shepherd, Claire A; Hopkins, Andrew L; Navratilova, Iva

2014-01-01

Surface plasmon resonance (SPR) is one of the primary biophysical methods for the screening of low molecular weight 'fragment' libraries, due to its low protein consumption and 'label-free' methodology. SPR biosensor interaction analysis is employed to both screen and confirm the binding of compounds in fragment screening experiments, as it provides accurate information on the affinity and kinetics of molecular interactions. The most advanced application of the use of SPR for fragment screening is against membrane protein drug targets, such G-protein coupled receptors (GPCRs). Biophysical GPCR assays using SPR have been validated with pharmacological measurements approximate to cell-based methods, yet provide the advantage of biophysical methods in their ability to measure the weak affinities of low molecular weight fragments. A number of SPR fragment screens against GPCRs have now been disclosed in the literature. SPR fragment screening is proving versatile to screen both thermostabilised GPCRs and solubilised wild type receptors. In this chapter, we discuss the state-of-the-art in GPCR fragment screening by SPR and the technical considerations in performing such experiments. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

Luciferase assay to study the activity of a cloned promoter DNA fragment.

PubMed

Solberg, Nina; Krauss, Stefan

2013-01-01

Luciferase based assays have become an invaluable tool for the analysis of cloned promoter DNA fragments, both for verifying the ability of a potential promoter fragment to drive the expression of a luciferase reporter gene in various cellular contexts, and for dissecting binding elements in the promoter. Here, we describe the use of the Dual-Luciferase(®) Reporter Assay System created by Promega (Promega Corporation, Wisconsin, USA) to study the cloned 6.7 kilobases (kb) mouse (m) Tcf3 promoter DNA fragment in mouse embryonic derived neural stem cells (NSC). In this system, the expression of the firefly luciferase driven by the cloned mTcf3 promoter DNA fragment (including transcription initiation sites) is correlated with a co-transfected control reporter expressing Renilla luciferase from the herpes simplex virus (HSV) thymidine kinase promoter. Using an internal control reporter allows to normalize the activity of the experimental reporter to the internal control, which minimizes experimental variability.

Dynamic aspects of antibody:oligosaccharide complexes characterized by molecular dynamics simulations and saturation transfer difference nuclear magnetic resonance.

PubMed

Theillet, François-Xavier; Frank, Martin; Vulliez-Le Normand, Brigitte; Simenel, Catherine; Hoos, Sylviane; Chaffotte, Alain; Bélot, Frédéric; Guerreiro, Catherine; Nato, Farida; Phalipon, Armelle; Mulard, Laurence A; Delepierre, Muriel

2011-12-01

Carbohydrates are likely to maintain significant conformational flexibility in antibody (Ab):carbohydrate complexes. As demonstrated herein for the protective monoclonal Ab (mAb) F22-4 recognizing the Shigella flexneri 2a O-antigen (O-Ag) and numerous synthetic oligosaccharide fragments thereof, the combination of molecular dynamics simulations and nuclear magnetic resonance saturation transfer difference experiments, supported by physicochemical analysis, allows us to determine the binding epitope and its various contributions to affinity without using any modified oligosaccharides. Moreover, the methods used provide insights into ligand flexibility in the complex, thus enabling a better understanding of the Ab affinities observed for a representative set of synthetic O-Ag fragments. Additionally, these complementary pieces of information give evidence to the ability of the studied mAb to recognize internal as well as terminal epitopes of its cognate polysaccharide antigen. Hence, we show that an appropriate combination of computational and experimental methods provides a basis to explore carbohydrate functional mimicry and receptor binding. The strategy may facilitate the design of either ligands or carbohydrate recognition domains, according to needed improvements of the natural carbohydrate:receptor properties. © The Author 2011. Published by Oxford University Press. All rights reserved.

Toxicity of hydrolyzed vicilins toward Callosobruchus maculatus and phytopathogenic fungi.

PubMed

Uchôa, Adriana Ferreira; de Miranda, Maria Raquel Alcântara; de Souza, Amanda Jardim; Gomes, Valdirene Moreira; Fernandes, Kátia Valevski Sales; Lemos, Francisco José Alves; Oliveira, Antonia Elenir Amancio; Xavier-Filho, José

2009-09-09

Studies have shown that vicilins (7S storage proteins) from seeds were able to bind to the surface of the Callosobruchus maculatus larval midgut and to the peritrophic matrices of the midguts of Diatraea saccharalis and Tenebrio molitor , inhibiting larval development. Vicilins were also shown to inhibit yeast growth and bind to yeast cells through the association with chitin-containing structures. The present work studies the association of peptides from vicilins of genotypes of Vigna unguiculata (susceptible and resistant to bruchid) with acetylated chitin and the toxicity of vicilin fragments and chitin-binding vicilin fragments to C. maculatus and phytopathogenic fungi. Hydrolysis of vicilins with alpha-chymotrypsin results in a complex mixture of fragments that were separated by chitin-affinity chromatography. Chitin-binding peptides from both genotypes were toxic to C. maculatus larvae, and alpha-chymotrypsin-hydrolyzed vicilins were deleterious to the above insect and to Fusarium oxysporum , Colletotrichum musae , and Saccharomyces cerevisiae fungi.

Characterization of the complex formed between a potent neutralizing ovine-derived polyclonal anti-TNFα Fab fragment and human TNFα

PubMed Central

Abbott, W. Mark; Snow, Melanie; Eckersley, Sonia; Renshaw, Jonathan; Davies, Gareth; Norman, Richard A.; Ceuppens, Peter; Slootstra, Jerry; Benschop, Joris J.; Hamuro, Yoshitomo; Lee, Jessica E.; Newham, Peter

2013-01-01

TNFα (tumour necrosis factor α) is an early mediator in the systemic inflammatory response to infection and is therefore a therapeutic target in sepsis. AZD9773 is an ovine-derived, polyclonal anti-TNFα Fab fragment derived from a pool of serum and currently being developed as a treatment for severe sepsis and septic shock. In the present study, we show that although AZD9773 has a modest affinity for TNFα in a binding assay, the Ki in a cell-based assay is approximately four orders of magnitude lower. We show using SEC (size exclusion chromatography) that the maximum size of the complex between AZD9773 and TNFα is consistent with approximately 12 Fabs binding to one TNFα trimer. A number of approaches were taken to map the epitopes recognized by AZD9773. These revealed that a number of different regions on TNFα are involved in binding to the polyclonal Fab. The data suggest that there are probably three epitopes per monomer that are responsible for most of the inhibition by AZD9773 and that all three can be occupied at the same time in the complex. We conclude that AZD9773 is clearly demonstrated to bind to multiple epitopes on TNFα and suggest that the polyclonal nature may account, at least in part, for the very high potency observed in cell-based assays. PMID:23863106

Crystal structure correlations with the intrinsic thermodynamics of human carbonic anhydrase inhibitor binding

PubMed Central

Smirnov, Alexey; Zubrienė, Asta; Manakova, Elena; Gražulis, Saulius

2018-01-01

The structure-thermodynamics correlation analysis was performed for a series of fluorine- and chlorine-substituted benzenesulfonamide inhibitors binding to several human carbonic anhydrase (CA) isoforms. The total of 24 crystal structures of 16 inhibitors bound to isoforms CA I, CA II, CA XII, and CA XIII provided the structural information of selective recognition between a compound and CA isoform. The binding thermodynamics of all structures was determined by the analysis of binding-linked protonation events, yielding the intrinsic parameters, i.e., the enthalpy, entropy, and Gibbs energy of binding. Inhibitor binding was compared within structurally similar pairs that differ by para- or meta-substituents enabling to obtain the contributing energies of ligand fragments. The pairs were divided into two groups. First, similar binders—the pairs that keep the same orientation of the benzene ring exhibited classical hydrophobic effect, a less exothermic enthalpy and a more favorable entropy upon addition of the hydrophobic fragments. Second, dissimilar binders—the pairs of binders that demonstrated altered positions of the benzene rings exhibited the non-classical hydrophobic effect, a more favorable enthalpy and variable entropy contribution. A deeper understanding of the energies contributing to the protein-ligand recognition should lead toward the eventual goal of rational drug design where chemical structures of ligands could be designed based on the target protein structure. PMID:29503769

Binding of Soluble Natural Ligands to a Soluble Human T-Cell Receptor Fragment Produced in Escherichia coli

NASA Astrophysics Data System (ADS)

Hilyard, Katherine L.; Reyburn, Hugh; Chung, Shan; Bell, John I.; Strominger, Jack L.

1994-09-01

An Escherichia coli expression system has been developed to produce milligram quantities of the variable domains of a human T-cell receptor from a cytotoxic T cell that recognizes the HLA-A2-influenza matrix peptide complex as a single polypeptide chain. The recombinant protein was purified by metal-chelate chromatography and then refolded in a redox buffer system. The refolded protein was shown to directly bind both Staphylococcus aureus enterotoxin B and the major histocompatibility complex protein-peptide complex using a BIAcore biosensor. Thus this preparation of a single-chain, variable-domain, T-cell receptor fragment can bind both of its natural ligands and some of it is therefore a functional fragment of the receptor molecule.

Structure-based affinity maturation of a chimeric anti-ricin antibody C4C13.

PubMed

Luo, Longlong; Luo, Qun; Guo, Leiming; Lv, Ming; Lin, Zhou; Geng, Jing; Li, Xinying; Li, Yan; Shen, Beifen; Qiao, Chunxia; Feng, Jiannan

2014-01-01

Ricin is a highly lethal toxin. Anti-ricin chimeric monoclonal antibody (mAb) C4C13 was prepared in our lab; however, its binding affinity was much weaker than that of the parent antibody 4C13. In this study, based on the computer-guided homology modeling and conformational optimization methods, the 3-D structure of C4C13 variable regions Fv was constructed and optimized. Using molecular docking and dynamics simulation methods, the 3-D complex structure of ricin and C4C13 Fv was obtained. Considering the orientation property, surface electrostatic distribution, residues chemical and physical character and intermolecular hydrogen bond, the binding mode and key residues were predicted. According to C4C13 Fv fragment and ricin complementary binding surface, electrostatic attraction periphery and van der Waals interaction interface, three mutants (i.e., M1 (N(H102)F, W(H103)Y); M2 (W(H103)Y) and M3 (R(L90)G)) were designed, in which M1 and M2 were predicted to possess higher antigen-binding activity than C4C13, while M3 was weaker. The relative affinity assays by ELISA showed that M1 and M2 mutations had higher affinity (9.6 and 18.3 nmol/L) than C4C13 (130 nmol/L) and M3 had weaker affinity (234.5 nmol/L) than C4C13. The results showed that the modeling complex structure of the antigen (ricin) and antibody (C4C13) is reasonable. Our work offered affinity maturated antibodies by site mutations, which were beneficial for valuable anti-ricin antibody design and preparation in future.

Efficient clustering aggregation based on data fragments.

PubMed

Wu, Ou; Hu, Weiming; Maybank, Stephen J; Zhu, Mingliang; Li, Bing

2012-06-01

Clustering aggregation, known as clustering ensembles, has emerged as a powerful technique for combining different clustering results to obtain a single better clustering. Existing clustering aggregation algorithms are applied directly to data points, in what is referred to as the point-based approach. The algorithms are inefficient if the number of data points is large. We define an efficient approach for clustering aggregation based on data fragments. In this fragment-based approach, a data fragment is any subset of the data that is not split by any of the clustering results. To establish the theoretical bases of the proposed approach, we prove that clustering aggregation can be performed directly on data fragments under two widely used goodness measures for clustering aggregation taken from the literature. Three new clustering aggregation algorithms are described. The experimental results obtained using several public data sets show that the new algorithms have lower computational complexity than three well-known existing point-based clustering aggregation algorithms (Agglomerative, Furthest, and LocalSearch); nevertheless, the new algorithms do not sacrifice the accuracy.

Fragment Screening and HIV Therapeutics

PubMed Central

Bauman, Joseph D.; Patel, Disha; Arnold, Eddy

2013-01-01

Fragment screening has proven to be a powerful alternative to traditional methods for drug discovery. Biophysical methods, such as X-ray crystallography, NMR spectroscopy, and surface plasmon resonance, are used to screen a diverse library of small molecule compounds. Although compounds identified via this approach have relatively weak affinity, they provide a good platform for lead development and are highly efficient binders with respect to their size. Fragment screening has been utilized for a wide-range of targets, including HIV-1 proteins. Here, we review the fragment screening studies targeting HIV-1 proteins using X-ray crystallography or surface plasmon resonance. These studies have successfully detected binding of novel fragments to either previously established or new sites on HIV-1 protease and reverse transcriptase. In addition, fragment screening against HIV-1 reverse transcriptase has been used as a tool to better understand the complex nature of ligand binding to a flexible target. PMID:21972022

Anti-fouling properties of Fab' fragments immobilized on silane-based adlayers

NASA Astrophysics Data System (ADS)

Crivianu-Gaita, Victor; Romaschin, Alexander; Thompson, Michael

2015-12-01

Biosensors require surfaces that are highly specific towards the target analyte and that are minimally fouling. However, surface tuning to minimize fouling is a difficult task. The last decade has seen an increase in the use of immobilized antigen-binding antibody fragments (Fab') in biosensors. One Fab' linker compound S-(11-trichlorosilyl-undecanyl)-benzothiosulfonate (TUBTS) and three spacers were used to create the silane-based adlayers. The ultra-high frequency electromagnetic piezoelectric acoustic sensor (EMPAS) was used to gauge the fouling properties of the various surfaces using bovine serum albumin (BSA), goat IgG, and mouse serum. X-ray photoelectron spectroscopy (XPS), contact angle, and atomic force microscopy (AFM) were employed to characterize the surfaces. It was discovered that immobilized oriented Fab' fragments reduced the fouling levels of surfaces up to 80% compared to the surfaces without fragments. An explanation for this phenomenon is that the antibody fragments increase the hydration of the surfaces and aid in the formation of an anti-fouling water barrier. The anti-fouling effect of the Fab' fragments is at its maximum when there is an even distribution of fragments across the surfaces. Finally, using Fab'-covered surfaces, a cancer biomarker was detected from serum, showing the applicability of this work to the field of biodetection.

Genetic study of the functional organization of the colicin E1 molecule.

PubMed Central

Suit, J L; Fan, M L; Kayalar, C; Luria, S E

1985-01-01

Colicin E1 fragments obtained by genetic manipulations of the ColE1 plasmid were tested for bactericidal activity, binding to bacterial cells, and reactions with a series of anticolicin monoclonal antibodies. Two of the fragments were also tested for ability to form channels in liposomal vesicles. The results are in agreement with studies from chemically and enzymatically derived colicin fragments, assigning the receptor binding activity to the central part of the molecule and the killing activity to a region near the carboxyl terminus. PMID:2579061

[Modification of retinal photoreceptor membranes and Ca ion binding].

PubMed

Korchagin, V P; Berman, A L; Shukoliukov, S A; Rychkova, M P; Etingof, R N

1978-10-01

Calcium binding by modified photoreceptor membranes of cattle retina has been studied. Ca2+-binding the membranes significantly changes after C-phospholipase treatment, displaying the initial growth (less than 65% of lipid phosphorus removed) with subsequent decrease (more than 65% of phosphorus removed). Liposomes of the photoreceptor membranes lipids were found to bind more calcium than do the native photoreceptor membranes. Proteolytic enzymes (papaine, pronase) splitting some rhodopsin fragments do not affect the ability of the membrane to bind Ca2+. The increase of light-induced Ca-binding is observed only after the outer segments preincubation under conditions providing for rhodopsin phosphorylation. This effect was observed also after the splitting of the rhodopsin fragment by papaine. It is concluded that calcium binding in the photoreceptor membranes is mainly due to the phosphate groups of phospholipids.

Concerted formation of macromolecular Suppressor–mutator transposition complexes

PubMed Central

Raina, Ramesh; Schläppi, Michael; Karunanandaa, Balasulojini; Elhofy, Adam; Fedoroff, Nina

1998-01-01

Transposition of the maize Suppressor–mutator (Spm) transposon requires two element-encoded proteins, TnpA and TnpD. Although there are multiple TnpA binding sites near each element end, binding of TnpA to DNA is not cooperative, and the binding affinity is not markedly affected by the number of binding sites per DNA fragment. However, intermolecular complexes form cooperatively between DNA fragments with three or more TnpA binding sites. TnpD, itself not a sequence-specific DNA-binding protein, binds to TnpA and stabilizes the TnpA–DNA complex. The high redundancy of TnpA binding sites at both element ends and the protein–protein interactions between DNA-bound TnpA complexes and between these and TnpD imply a concerted transition of the element from a linear to a protein crosslinked transposition complex within a very narrow protein concentration range. PMID:9671711

Fragment Based Optimization of Metabotropic Glutamate Receptor 2 (mGluR2) Positive Allosteric Modulators in the Absence of Structural Information.

PubMed

Szabó, György; Túrós, György I; Kolok, Sándor; Vastag, Mónika; Sánta, Zsuzsanna; Dékány, Miklós; Lévay, György I; Greiner, István; Natsumi, Minami; Tatsuya, Watanabe; Keserű, György M

2018-03-14

Metabotropic glutamate receptor 2 (mGluR2) positive allosteric modulators (PAMs) have been implicated as potential pharmacotherapy for psychiatric conditions. Screening our corporate compound deck, we identified a benzotriazole fragment (4) that was rapidly optimized to a potent and metabolically stable early lead (16). The highly lipophilic character of 16, together with its limited solubility, permeability, and high protein binding, however, did not allow reaching of the proof of concept in vivo. Since further attempts on the optimization of druglike properties were unsuccessful, the original hit 4 has been revisited and was optimized following the principles of fragment based drug discovery (FBDD). Lacking structural information on the receptor-ligand complex, we implemented a group efficiency (GE) based strategy and identified a new fragment like lead (60) with more balanced profile. Significant improvement achieved on the druglike properties nominated the compound for in vivo proof of concept studies that revealed the chemotype being a promising PAM lead targeting mGluR2 receptors.

Extending rule-based methods to model molecular geometry and 3D model resolution.

PubMed

Hoard, Brittany; Jacobson, Bruna; Manavi, Kasra; Tapia, Lydia

2016-08-01

Computational modeling is an important tool for the study of complex biochemical processes associated with cell signaling networks. However, it is challenging to simulate processes that involve hundreds of large molecules due to the high computational cost of such simulations. Rule-based modeling is a method that can be used to simulate these processes with reasonably low computational cost, but traditional rule-based modeling approaches do not include details of molecular geometry. The incorporation of geometry into biochemical models can more accurately capture details of these processes, and may lead to insights into how geometry affects the products that form. Furthermore, geometric rule-based modeling can be used to complement other computational methods that explicitly represent molecular geometry in order to quantify binding site accessibility and steric effects. We propose a novel implementation of rule-based modeling that encodes details of molecular geometry into the rules and binding rates. We demonstrate how rules are constructed according to the molecular curvature. We then perform a study of antigen-antibody aggregation using our proposed method. We simulate the binding of antibody complexes to binding regions of the shrimp allergen Pen a 1 using a previously developed 3D rigid-body Monte Carlo simulation, and we analyze the aggregate sizes. Then, using our novel approach, we optimize a rule-based model according to the geometry of the Pen a 1 molecule and the data from the Monte Carlo simulation. We use the distances between the binding regions of Pen a 1 to optimize the rules and binding rates. We perform this procedure for multiple conformations of Pen a 1 and analyze the impact of conformation and resolution on the optimal rule-based model. We find that the optimized rule-based models provide information about the average steric hindrance between binding regions and the probability that antibodies will bind to these regions. These optimized models quantify the variation in aggregate size that results from differences in molecular geometry and from model resolution.

Generation of single domain antibody fragments derived from camelids and generation of manifold constructs.

PubMed

Vincke, Cécile; Gutiérrez, Carlos; Wernery, Ulrich; Devoogdt, Nick; Hassanzadeh-Ghassabeh, Gholamreza; Muyldermans, Serge

2012-01-01

Immunizing a camelid (camels and llamas) with soluble, properly folded proteins raises an affinity-matured immune response in the unique camelid heavy-chain only antibodies (HCAbs). The peripheral blood lymphocytes of the immunized animal are used to clone the antigen-binding antibody fragment from the HCAbs in a phage display vector. A representative aliquot of the library of these antigen-binding fragments is used to retrieve single domain antigen-specific binders by successive rounds of panning. These single domain antibody fragments are cloned in tandem to generate manifold constructs (bivalent, biparatopic or bispecific constructs) to increase their functional affinity, to increase specificity, or to connect two independent antigen molecules.

Papain cleavage of the 38,000-dalton fragment inhibits the binding of 4, 4'-diisothiocyanostilbene-2, 2'-disulfonate to lys-539 on the 60,000-dalton fragment in human band 3.

PubMed

Yamaguchi, Takeo; Kojima, Hideaki; Kawaguchi, Shiori; Shimada, Maiko; Aso, Haruka

2017-08-01

Human band 3 is a 98-kDa transmembrane (TM) protein comprising 14 TM segments. Papain cleavages band 3 into 38- and 60-kDa fragments. Under vigorous conditions, the cleavage of the loop region between the TM 7 of gate domain and the TM 8 of core domain in the 38-kDa fragment produces 7- and 31-kDa fragments. Conformational changes of the TM 5 segment containing Lys-539 by cleavage of the 38-kDa fragment remain unclear. Pressure-induced haemolysis of erythrocytes was suppressed by binding of 4, 4'-diisothiocyanostilbene-2, 2'-disulfonate (DIDS) to Lys-539. Such effect of DIDS was not observed upon cleavage of the 38-kDa fragment, because of inhibition of DIDS binding to Lys-539. Using fluorescence of DIDS labelled to Lys-539, conformational changes of band 3 were examined. Fluorescence spectra demonstrated that the molecular motion of DIDS is more restricted upon digestion of the 38-kDa fragment. Interestingly, the quenching of DIDS fluorescence showed that Hg2+ is less accessible to DIDS upon digestion of the 38-kDa fragment. Taken together, we propose that the conformational changes of the TM 5 segment characterized by the sequestration and restricted motion of Lys-539 are induced by the cleavage of the loop region between the TM 7 and the TM 8. © The Authors 2017. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

Correlation between CD16a binding and immuno effector functionality of an antigen specific immunoglobulin Fc fragment (Fcab).

PubMed

Kainer, Manuela; Antes, Bernhard; Wiederkum, Susanne; Wozniak-Knopp, Gordana; Bauer, Anton; Rüker, Florian; Woisetschläger, Max

2012-10-15

Antigen binding immunoglobulin Fc fragments (Fcab) are generated by engineering loop regions in the CH3 domain of human IgG1 Fc. Variants of an Fcab specific for Her-2 were designed to display either enhanced (S239D:A330L:I332E) or diminished (L234A:L235A) binding affinities to the Fc receptor CD16a based on mutations described previously. The two mutant Fcab proteins demonstrated the expected modulation of CD16a binding. Interaction with recombinant or cell surface expressed Her-2 was unaffected in both mutants compared to the parental Fcab. Binding affinities for CD16a correlated with the ADCC-potencies of the Fcab variants. Additional studies indicated that the L234A:L235A variant Fcab had equivalent structural features as the unmodified Fcab since their DSC profiles were similar and antigen binding after re-folding upon partial heat denaturation had not changed. Introduction of the S239D:A330L:I332E mutations resulted in a significant reduction of the CH2 domain melting temperature, a moderate decrease of the thermal transition of the CH3 domain and lower antigen binding after thermal stress compared to the parental Fcab. We conclude that the known correlation between CD16a binding affinity and ADCC potency is also valid in Fcab proteins and that antigen specific Fcab molecules can be further engineered for fine tuning of immuno effector functions. Copyright © 2012 Elsevier Inc. All rights reserved.

Identification of second arginine-glycine-aspartic acid motif of ovine vitronectin as the complement C9 binding site and its implication in bacterial infection.

PubMed

Prasada, Rao T; Lakshmi, Prasanth T; Parvathy, R; Murugavel, S; Karuna, Devi; Paritosh, Joshi

2017-02-01

Vitronectin (Vn), a multifunctional protein of blood and extracellular matrix, interacts with complement C9. This interaction may modulate innate immunity. Details of Vn-C9 interactions are limited. Vn-C9 interactions were assessed by employing a goat homologous system and observing Vn binding to C9 in three different assays. Using recombinant fragments, C9 binding was mapped to the N-terminus of Vn. Site directed mutagenesis was performed to alter the second arginine glycine aspartic acid (RGD) sequence (RGD-2) of Vn. Changing R to G or D to A in RGD-2 caused significant decrease in Vn binding to C9 whereas changing of R to G in the first RGD motif (RGD-1) had no effect on Vn binding to C9. These results imply that the RGD-2 of goat Vn is involved in C9 binding. In a competitive binding assay, the presence of soluble RGD peptide inhibited Vn binding to C9 whereas heparin had no effect. Vn binding to C9 was also evaluated in terms of bacterial pathogenesis. Serum dependent inhibition of Escherichia coli growth was significantly reverted when Vn or its N-fragment were included in the assay. The C-fragment, which did not support C9 binding, also partly nullified serum-dependent inhibition of bacterial growth, probably through other serum component(s). © 2017 The Societies and John Wiley & Sons Australia, Ltd.

[Treatment of conmminuted patellar fractures with internal Ni-Ti patellar concentrator and tension bind wire fixation].

PubMed

Tan, Hong-lie; Qian, Chen; Zhao, Jin-kun; Shi, Yan; Zhou, Qi

2009-02-01

To study the clinical efficacy of the treatment of comminuted patellar fractures with internal NiTi-Patellar concentrator and tension bind wire fixation. From March 2004 to June 2007, 38 cases of fresh comminuted patellar fractures were treated with internal NiTi-Patellar concentrator and tension bind wire fixation. There were 25 males and 13 females,ranging from 21 to 64 years (mean 42.5 years). All were comminuted fractures with displacement, 16 cases were 3 fragments, 14 cases were 4 fragments, 8 cases were 5 fragments. There were other fractures in 8 cases. During followed-up, knee function and complications were evaluated. All patients were followed up for 8 to 24 months (mean 15 months) and obtained complete bone union. No case of implant was loosening and fragment displacement, traumatic arthritis occured in 2 cases. Under Lysholm & Gillquist score, the results were excellent in 17 cases, good in 19, fair in 2. Internal Ni-Ti-Patellar concentrator and tension bind wire fixation is one of the ideal methods for the treatment of comminuted patellar fracture, which could provide satisfied reduction, reliable fixation and good functional recovery.

Deciphering structure-activity relationships in a series of Tat/TAR inhibitors.

PubMed

Pascale, Lise; González, Alejandro López; Di Giorgio, Audrey; Gaysinski, Marc; Teixido Closa, Jordi; Tejedor, Roger Estrada; Azoulay, Stéphane; Patino, Nadia

2016-11-01

A series of pentameric "Polyamide Amino Acids" (PAAs) compounds derived from the same trimeric precursor have been synthesized and investigated as HIV TAR RNA ligands, in the absence and in the presence of a Tat fragment. All PAAs bind TAR with similar sub-micromolar affinities but their ability to compete efficiently with the Tat fragment strongly differs, IC50 ranging from 35 nM to >2 μM. While NMR and CD studies reveal that all PAA interact with TAR at the same site and induce globally the same RNA conformational change upon binding, a comparative thermodynamic study of PAA/TAR equilibria highlights distinct TAR binding modes for Tat competitor and non-competitor PAAs. This led us to suggest two distinct interaction modes that have been further validated by molecular modeling studies. While the binding of Tat competitor PAAs induces a contraction at the TAR bulge region, the binding of non-competitor ones widens it. This could account for the distinct PAA ability to compete with Tat fragment. Our work illustrates how comparative thermodynamic studies of a series of RNA ligands of same chemical family are of value for understanding their binding modes and for rationalizing structure-activity relationships.

Identification of the divergent calmodulin binding motif in yeast Ssb1/Hsp75 protein and in other HSP70 family members.

PubMed

Heinen, R C; Diniz-Mendes, L; Silva, J T; Paschoalin, V M F

2006-11-01

Yeast soluble proteins were fractionated by calmodulin-agarose affinity chromatography and the Ca2+/calmodulin-binding proteins were analyzed by SDS-PAGE. One prominent protein of 66 kDa was excised from the gel, digested with trypsin and the masses of the resultant fragments were determined by MALDI/MS. Twenty-one of 38 monoisotopic peptide masses obtained after tryptic digestion were matched to the heat shock protein Ssb1/Hsp75, covering 37% of its sequence. Computational analysis of the primary structure of Ssb1/Hsp75 identified a unique potential amphipathic alpha-helix in its N-terminal ATPase domain with features of target regions for Ca2+/calmodulin binding. This region, which shares 89% similarity to the experimentally determined calmodulin-binding domain from mouse, Hsc70, is conserved in near half of the 113 members of the HSP70 family investigated, from yeast to plant and animals. Based on the sequence of this region, phylogenetic analysis grouped the HSP70s in three distinct branches. Two of them comprise the non-calmodulin binding Hsp70s BIP/GR78, a subfamily of eukaryotic HSP70 localized in the endoplasmic reticulum, and DnaK, a subfamily of prokaryotic HSP70. A third heterogeneous group is formed by eukaryotic cytosolic HSP70s containing the new calmodulin-binding motif and other cytosolic HSP70s whose sequences do not conform to those conserved motif, indicating that not all eukaryotic cytosolic Hsp70s are target for calmodulin regulation. Furthermore, the calmodulin-binding domain found in eukaryotic HSP70s is also the target for binding of Bag-1 - an enhancer of ADP/ATP exchange activity of Hsp70s. A model in which calmodulin displaces Bag-1 and modulates Ssb1/Hsp75 chaperone activity is discussed.

A molecular model for cocaine binding by the immunotherapeutic human/mouse chimeric monoclonal antibody 2E2.

PubMed

Lape, Michael; Paula, Stefan; Ball, William J

2010-06-01

Immunotherapy by cocaine-binding monoclonal antibodies (mAbs) has emerged as a promising strategy for the treatment of cocaine addiction. The human (gamma1 heavy chain)/murine (lambda light chain) chimeric mAb 2E2 has excellent affinity and specificity for cocaine and recent animal studies have demonstrated 2E2's ability in vivo to reduce cocaine levels in the brain as well as alter cocaine self-administration behavior in rats. In this study, we used mAb 2E2 amino acid sequence information to create a homology model for the 3-D structure of its Fv fragment. Subsequent computational docking studies revealed the intermolecular interactions potentially responsible for mAb 2E2's cocaine binding properties. The driving force of cocaine binding was identified as a combination of hydrophobic interactions and a single hydrogen bond between a light chain tyrosine residue and a carbonyl oxygen atom of cocaine. The model also allowed for an in silico evaluation of single/double residue mutations in the heavy and light chain variable regions that might further enhance mAb 2E2's cocaine binding properties. Copyright (c) 2010 Elsevier Masson SAS. All rights reserved.

A Molecular Model for Cocaine Binding by the Immunotherapeutic Human/Mouse Chimeric Monoclonal Antibody 2E2

PubMed Central

Lape, Michael; Paula, Stefan; Ball, William J.

2010-01-01

Immunotherapy by cocaine-binding monoclonal antibodies (mAbs) has emerged as a promising strategy for the treatment of cocaine addiction. The human (γ1 heavy chain)/murine (λ light chain) chimeric mAb 2E2 has excellent affinity and specificity for cocaine and recent animal studies have demonstrated 2E2’s ability in vivo to reduce cocaine levels in the brain as well as alter cocaine self-administration behavior in rats. In this study, we used mAb 2E2 amino acid sequence information to create a homology model for the 3-D structure of its Fv fragment. Subsequent computational docking studies revealed the intermolecular interactions potentially responsible for mAb 2E2’s cocaine binding properties. The driving force of cocaine binding was identified as a combination of hydrophobic interactions and a single hydrogen bond between a light chain tyrosine residue and a carbonyl oxygen atom of cocaine. The model also allowed for an in silico evaluation of single/double residue mutations in the heavy and light chain variable regions that might further enhance mAb 2E2’s cocaine binding properties. PMID:20185210

Computational Assessment of Potassium and Magnesium Ion Binding to a Buried Pocket in GTPase-Associating Center RNA

PubMed Central

2016-01-01

An experimentally well-studied model of RNA tertiary structures is a 58mer rRNA fragment, known as GTPase-associating center (GAC) RNA, in which a highly negative pocket walled by phosphate oxygen atoms is stabilized by a chelated cation. Although such deep pockets with more than one direct phosphate to ion chelation site normally include magnesium, as shown in one GAC crystal structure, another GAC crystal structure and solution experiments suggest potassium at this site. Both crystal structures also depict two magnesium ions directly bound to the phosphate groups comprising this controversial pocket. Here, we used classical molecular dynamics simulations as well as umbrella sampling to investigate the possibility of binding of potassium versus magnesium inside the pocket and to better characterize the chelation of one of the binding magnesium ions outside the pocket. The results support the preference of the pocket to accommodate potassium rather than magnesium and suggest that one of the closely binding magnesium ions can only bind at high magnesium concentrations, such as might be present during crystallization. This work illustrates the complementary utility of molecular modeling approaches with atomic-level detail in resolving discrepancies between conflicting experimental results. PMID:27983843

Computational Assessment of Potassium and Magnesium Ion Binding to a Buried Pocket in GTPase-Associating Center RNA.

PubMed

Hayatshahi, Hamed S; Roe, Daniel R; Galindo-Murillo, Rodrigo; Hall, Kathleen B; Cheatham, Thomas E

2017-01-26

An experimentally well-studied model of RNA tertiary structures is a 58mer rRNA fragment, known as GTPase-associating center (GAC) RNA, in which a highly negative pocket walled by phosphate oxygen atoms is stabilized by a chelated cation. Although such deep pockets with more than one direct phosphate to ion chelation site normally include magnesium, as shown in one GAC crystal structure, another GAC crystal structure and solution experiments suggest potassium at this site. Both crystal structures also depict two magnesium ions directly bound to the phosphate groups comprising this controversial pocket. Here, we used classical molecular dynamics simulations as well as umbrella sampling to investigate the possibility of binding of potassium versus magnesium inside the pocket and to better characterize the chelation of one of the binding magnesium ions outside the pocket. The results support the preference of the pocket to accommodate potassium rather than magnesium and suggest that one of the closely binding magnesium ions can only bind at high magnesium concentrations, such as might be present during crystallization. This work illustrates the complementary utility of molecular modeling approaches with atomic-level detail in resolving discrepancies between conflicting experimental results.

RNA–protein binding kinetics in an automated microfluidic reactor

PubMed Central

Ridgeway, William K.; Seitaridou, Effrosyni; Phillips, Rob; Williamson, James R.

2009-01-01

Microfluidic chips can automate biochemical assays on the nanoliter scale, which is of considerable utility for RNA–protein binding reactions that would otherwise require large quantities of proteins. Unfortunately, complex reactions involving multiple reactants cannot be prepared in current microfluidic mixer designs, nor is investigation of long-time scale reactions possible. Here, a microfluidic ‘Riboreactor’ has been designed and constructed to facilitate the study of kinetics of RNA–protein complex formation over long time scales. With computer automation, the reactor can prepare binding reactions from any combination of eight reagents, and is optimized to monitor long reaction times. By integrating a two-photon microscope into the microfluidic platform, 5-nl reactions can be observed for longer than 1000 s with single-molecule sensitivity and negligible photobleaching. Using the Riboreactor, RNA–protein binding reactions with a fragment of the bacterial 30S ribosome were prepared in a fully automated fashion and binding rates were consistent with rates obtained from conventional assays. The microfluidic chip successfully combines automation, low sample consumption, ultra-sensitive fluorescence detection and a high degree of reproducibility. The chip should be able to probe complex reaction networks describing the assembly of large multicomponent RNPs such as the ribosome. PMID:19759214

A 1H NMR method for the analysis of antigen-antibody interactions: binding of a peptide fragment of lysozyme to anti-lysozyme monoclonal antibody.

PubMed

Ito, W; Nishimura, M; Sakato, N; Fujio, H; Arata, Y

1987-09-01

A proton nuclear magnetic resonance (NMR) study is reported of the molecular structural basis of antigen-antibody interactions. An immunologically reactive proteolytic fragment corresponding to one of the antigenic regions on hen egg-white lysozyme (HEL) was used in combination with a monoclonal antibody that recognizes this site. Using spin diffusion, we prepared an antibody in which the magnetization of the antigen binding site was saturated by non-specific nuclear Overhauser effect. Under these conditions the effect of the saturation of the antibody was observed to spread over the peptide fragment through the antigen binding site. On the basis of the results obtained for the intermolecular nuclear Overhauser effect, we discuss how the peptide fragment interacts with the antibody. The side chains of aromatic residues, Trp, Tyr, and His, and of ionic residues, especially Arg, Lys, and Glu, are suggested to be important in the antigen-antibody interaction.

Structure of the receptor-binding domain of human thrombopoietin determined by complexation with a neutralizing antibody fragment

PubMed Central

Feese, Michael D.; Tamada, Taro; Kato, Yoichi; Maeda, Yoshitake; Hirose, Masako; Matsukura, Yasuko; Shigematsu, Hideki; Muto, Takanori; Matsumoto, Atsushi; Watarai, Hiroshi; Ogami, Kinya; Tahara, Tomoyuki; Kato, Takashi; Miyazaki, Hiroshi; Kuroki, Ryota

2004-01-01

The cytokine thrombopoietin (TPO), the ligand for the hematopoietic receptor c-Mpl, acts as a primary regulator of megakaryocytopoiesis and platelet production. We have determined the crystal structure of the receptor-binding domain of human TPO (hTPO163) to a 2.5-Å resolution by complexation with a neutralizing Fab fragment. The backbone structure of hTPO163 has an antiparallel four-helix bundle fold. The neutralizing Fab mainly recognizes the C–D crossover loop containing the species invariant residue Q111. Titration calorimetric experiments show that hTPO163 interacts with soluble c-Mpl containing the extracellular cytokine receptor homology domains with 1:2 stoichiometry with the binding constants of 3.3 × 109 M–1 and 1.1 × 106 M–1. The presence of the neutralizing Fab did not inhibit binding of hTPO163 to soluble c-Mpl fragments, but the lower-affinity binding disappeared. Together with prior genetic data, these define the structure–function relationships in TPO and the activation scheme of c-Mpl. PMID:14769915

An Angular Overlap Model for Cu(II) Ion in the AMOEBA Polarizable Force Field

PubMed Central

Xiang, Jin Yu; Ponder, Jay W.

2014-01-01

An extensible polarizable force field for transition metal ion was developed based on AMOEBA and the angular overlap model (AOM) with consistent treatment of electrostatics for all atoms. Parameters were obtained by fitting molecular mechanics (MM) energies to various ab initio gas-phase calculations. The results of parameterization were presented for copper (II) ion ligated to water and model fragments of amino acid residues involved in the copper binding sites of type 1 copper proteins. Molecular dynamics (MD) simulations were performed on aqueous copper (II) ion at various temperatures, as well as plastocyanin (1AG6) and azurin (1DYZ). Results demonstrated that the AMOEBA-AOM significantly improves the accuracy of classical MM in a number of test cases when compared to ab initio calculations. The Jahn-Teller distortion for hexa-aqua copper (II) complex was handled automatically without specifically designating axial and in-plane ligands. Analyses of MD trajectories resulted in a 6-coordination first solvation shell for aqueous copper (II) ion and a 1.8ns average residence time of water molecules. The ensemble average geometries of 1AG6 and 1DYZ copper binding sites were in general agreement with X-ray and previous computational studies. PMID:25045338

Virtual screening with AutoDock Vina and the common pharmacophore engine of a low diversity library of fragments and hits against the three allosteric sites of HIV integrase: participation in the SAMPL4 protein-ligand binding challenge

NASA Astrophysics Data System (ADS)

Perryman, Alexander L.; Santiago, Daniel N.; Forli, Stefano; Santos-Martins, Diogo; Olson, Arthur J.

2014-04-01

To rigorously assess the tools and protocols that can be used to understand and predict macromolecular recognition, and to gain more structural insight into three newly discovered allosteric binding sites on a critical drug target involved in the treatment of HIV infections, the Olson and Levy labs collaborated on the SAMPL4 challenge. This computational blind challenge involved predicting protein-ligand binding against the three allosteric sites of HIV integrase (IN), a viral enzyme for which two drugs (that target the active site) have been approved by the FDA. Positive control cross-docking experiments were utilized to select 13 receptor models out of an initial ensemble of 41 different crystal structures of HIV IN. These 13 models of the targets were selected using our new "Rank Difference Ratio" metric. The first stage of SAMPL4 involved using virtual screens to identify 62 active, allosteric IN inhibitors out of a set of 321 compounds. The second stage involved predicting the binding site(s) and crystallographic binding mode(s) for 57 of these inhibitors. Our team submitted four entries for the first stage that utilized: (1) AutoDock Vina (AD Vina) plus visual inspection; (2) a new common pharmacophore engine; (3) BEDAM replica exchange free energy simulations, and a Consensus approach that combined the predictions of all three strategies. Even with the SAMPL4's very challenging compound library that displayed a significantly lower amount of structural diversity than most libraries that are conventionally employed in prospective virtual screens, these approaches produced hit rates of 24, 25, 34, and 27 %, respectively, on a set with 19 % declared binders. Our only entry for the second stage challenge was based on the results of AD Vina plus visual inspection, and it ranked third place overall according to several different metrics provided by the SAMPL4 organizers. The successful results displayed by these approaches highlight the utility of the computational structure-based drug discovery tools and strategies that are being developed to advance the goals of the newly created, multi-institution, NIH-funded center called the "HIV Interaction and Viral Evolution Center".

Virtual screening with AutoDock Vina and the common pharmacophore engine of a low diversity library of fragments and hits against the three allosteric sites of HIV integrase: participation in the SAMPL4 protein-ligand binding challenge.

PubMed

Perryman, Alexander L; Santiago, Daniel N; Forli, Stefano; Martins, Diogo Santos; Olson, Arthur J

2014-04-01

To rigorously assess the tools and protocols that can be used to understand and predict macromolecular recognition, and to gain more structural insight into three newly discovered allosteric binding sites on a critical drug target involved in the treatment of HIV infections, the Olson and Levy labs collaborated on the SAMPL4 challenge. This computational blind challenge involved predicting protein-ligand binding against the three allosteric sites of HIV integrase (IN), a viral enzyme for which two drugs (that target the active site) have been approved by the FDA. Positive control cross-docking experiments were utilized to select 13 receptor models out of an initial ensemble of 41 different crystal structures of HIV IN. These 13 models of the targets were selected using our new "Rank Difference Ratio" metric. The first stage of SAMPL4 involved using virtual screens to identify 62 active, allosteric IN inhibitors out of a set of 321 compounds. The second stage involved predicting the binding site(s) and crystallographic binding mode(s) for 57 of these inhibitors. Our team submitted four entries for the first stage that utilized: (1) AutoDock Vina (AD Vina) plus visual inspection; (2) a new common pharmacophore engine; (3) BEDAM replica exchange free energy simulations, and a Consensus approach that combined the predictions of all three strategies. Even with the SAMPL4's very challenging compound library that displayed a significantly lower amount of structural diversity than most libraries that are conventionally employed in prospective virtual screens, these approaches produced hit rates of 24, 25, 34, and 27 %, respectively, on a set with 19 % declared binders. Our only entry for the second stage challenge was based on the results of AD Vina plus visual inspection, and it ranked third place overall according to several different metrics provided by the SAMPL4 organizers. The successful results displayed by these approaches highlight the utility of the computational structure-based drug discovery tools and strategies that are being developed to advance the goals of the newly created, multi-institution, NIH-funded center called the "HIV Interaction and Viral Evolution Center".

The cis conformation of proline leads to weaker binding of a p53 peptide to MDM2 compared to trans.

PubMed

Zhan, Yingqian Ada; Ytreberg, F Marty

2015-06-01

The cis and trans conformations of the Xaa-Pro (Xaa: any amino acid) peptide bond are thermodynamically stable while other peptide bonds strongly prefer trans. The effect of proline cis-trans isomerization on protein binding has not been thoroughly investigated. In this study, computer simulations were used to calculate the absolute binding affinity for a p53 peptide (residues 17-29) to MDM2 for both cis and trans isomers of the p53 proline in position 27. Results show that the cis isomer of p53(17-29) binds more weakly to MDM2 than the trans isomer, and that this is primarily due to the difference in the free energy cost associated with the loss of conformational entropy of p53(17-29) when it binds to MDM2. The population of cis p53(17-29) was estimated to be 0.8% of the total population in the bound state. The stronger binding of trans p53(17-29) to MDM2 compared to cis may leave a minimal level of p53 available to respond to cellular stress. This study demonstrates that it is feasible to estimate the absolute binding affinity for an intrinsically disordered protein fragment binding to an ordered protein that are in good agreement with experimental results. Copyright © 2015 Elsevier Inc. All rights reserved.

Sedimentation properties in density gradients correspond with levels of sperm DNA fragmentation, chromatin compaction and binding affinity to hyaluronic acid.

PubMed

Torabi, Forough; Binduraihem, Adel; Miller, David

2017-03-01

Mature spermatozoa bind hyaluronic acid in the extracellular matrix via hyaladherins. Immature spermatozoa may be unable to interact because they do not express the appropriate hyaladherins on their surface. Fresh human semen samples were fractionated using differential density gradient centrifugation (DDGC) and the ability of these fractions to bind hyaluronic acid was evaluated. The presence of sperm hyaladherins was also assessed. CD44 was located mainly on the acrosome and equatorial segment and became more restricted to the equatorial segment in capacitated spermatozoa. Hyaluronic acid-TRITC (hyaluronic acid conjugated with tetramethylrhodamine isothiocyanante), a generic hyaluronic-acid-binding reagent, labelled the membrane and the neck region, particularly after capacitation. Sperm populations obtained after DDGC or after interaction with hyaluronic acid were assessed for DNA fragmentation and chromatin maturity. Strong relationships between both measures and sperm sedimentation and hyaluronic-acid-binding profiles were revealed. Capacitation enhanced hyaluronic acid binding of both DDGC-pelleted sperm and sperm washed free of seminal fluid. In conclusion, hyaladherins were detected on human sperm and a higher capacity for sperm hyaluronic-acid-binding was shown to correspond with their DDGC sedimentation profiles and with lower levels of DNA fragmentation and better chromatin maturity. Capacitation induced changes in the distribution and presence of hyaladherins may enhance hyaluronic-acid-binding. Copyright © 2016 Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved.

Average Cross-Sectional Area of DebriSat Fragments Using Volumetrically Constructed 3D Representations

NASA Technical Reports Server (NTRS)

Scruggs, T.; Moraguez, M.; Patankar, K.; Fitz-Coy, N.; Liou, J.-C.; Sorge, M.; Huynh, T.

2016-01-01

Debris fragments from the hypervelocity impact testing of DebriSat are being collected and characterized for use in updating existing satellite breakup models. One of the key parameters utilized in these models is the ballistic coefficient of the fragment which is directly related to its area-to-mass ratio. However, since the attitude of fragments varies during their orbital lifetime, it is customary to use the average cross-sectional area in the calculation of the area-to-mass ratio. The average cross-sectional area is defined as the average of the projected surface areas perpendicular to the direction of motion and has been shown to be equal to one-fourth of the total surface area of a convex object. Unfortunately, numerous fragments obtained from the DebriSat experiment show significant concavity (i.e., shadowing) and thus we have explored alternate methods for computing the average cross-sectional area of the fragments. An imaging system based on the volumetric reconstruction of a 3D object from multiple 2D photographs of the object was developed for use in determining the size characteristic (i.e., characteristics length) of the DebriSat fragments. For each fragment, the imaging system generates N number of images from varied azimuth and elevation angles and processes them using a space-carving algorithm to construct a 3D point cloud of the fragment. This paper describes two approaches for calculating the average cross-sectional area of debris fragments based on the 3D imager. Approach A utilizes the constructed 3D object to generate equally distributed cross-sectional area projections and then averages them to determine the average cross-sectional area. Approach B utilizes a weighted average of the area of the 2D photographs to directly compute the average cross-sectional area. A comparison of the accuracy and computational needs of each approach is described as well as preliminary results of an analysis to determine the "optimal" number of images needed for the 3D imager to accurately measure the average cross sectional area of objects with known dimensions.

Protocols Utilizing Constant pH Molecular Dynamics to Compute pH-Dependent Binding Free Energies

PubMed Central

2015-01-01

In protein–ligand binding, the electrostatic environments of the two binding partners may vary significantly in bound and unbound states, which may lead to protonation changes upon binding. In cases where ligand binding results in a net uptake or release of protons, the free energy of binding is pH-dependent. Nevertheless, conventional free energy calculations and molecular docking protocols typically do not rigorously account for changes in protonation that may occur upon ligand binding. To address these shortcomings, we present a simple methodology based on Wyman’s binding polynomial formalism to account for the pH dependence of binding free energies and demonstrate its use on cucurbit[7]uril (CB[7]) host–guest systems. Using constant pH molecular dynamics and a reference binding free energy that is taken either from experiment or from thermodynamic integration computations, the pH-dependent binding free energy is determined. This computational protocol accurately captures the large pKa shifts observed experimentally upon CB[7]:guest association and reproduces experimental binding free energies at different levels of pH. We show that incorrect assignment of fixed protonation states in free energy computations can give errors of >2 kcal/mol in these host–guest systems. Use of the methods presented here avoids such errors, thus suggesting their utility in computing proton-linked binding free energies for protein–ligand complexes. PMID:25134690

An N-terminal fragment of substance P, substance P(1-7), down-regulates neurokinin-1 binding in the mouse spinal cord.

PubMed

Yukhananov RYu; Larson, A A

1994-08-29

Injected intrathecally, substance P (SP) down-regulates neurokinin-1 (NK-1) binding in the spinal cord and desensitizes rats to the behavioral effect of SP. N-terminal fragments of SP, such as SP(1-7), induce antinociception and play a role in desensitization to SP in mice. The goal of this study was to assess the abilities of N- and C-terminal fragments of SP to down-regulate NK-1 binding. Binding of [3H]SP to mouse spinal cord membranes was inhibited by SP, CP-96,345, and to a lesser extent by SP(5-11), but not SP(1-7), consistent with these binding sites being NK-1 receptors. Injection of SP(5-11) intrathecally did not affect the affinity (Kd) or concentration (Bmax) of [3H]SP binding. However, injection of 1 nmol of SP(1-7) decreased the Bmax of [3H]SP binding in the spinal cord at 6 h after its injection just as this dose of SP decreased the Bmax at 24 h. These data suggest that the N-terminus of SP is responsible for down-regulation of NK-1 binding. As SP(5-11) did not down-regulate NK-1 binding, activation of NK-1 sites does not appear necessary or sufficient for down-regulation of SP binding. In contrast, SP(1-7), in spite of its inability to interact with NK-1 sites, did down-regulate SP binding, suggesting an indirect mechanism dissociated from NK-1 receptors.

Structure-guided fragment-based in silico drug design of dengue protease inhibitors.

PubMed

Knehans, Tim; Schüller, Andreas; Doan, Danny N; Nacro, Kassoum; Hill, Jeffrey; Güntert, Peter; Madhusudhan, M S; Weil, Tanja; Vasudevan, Subhash G

2011-03-01

An in silico fragment-based drug design approach was devised and applied towards the identification of small molecule inhibitors of the dengue virus (DENV) NS2B-NS3 protease. Currently, no DENV protease co-crystal structure with bound inhibitor and fully formed substrate binding site is available. Therefore a homology model of DENV NS2B-NS3 protease was generated employing a multiple template spatial restraints method and used for structure-based design. A library of molecular fragments was derived from the ZINC screening database with help of the retrosynthetic combinatorial analysis procedure (RECAP). 150,000 molecular fragments were docked to the DENV protease homology model and the docking poses were rescored using a target-specific scoring function. High scoring fragments were assembled to small molecule candidates by an implicit linking cascade. The cascade included substructure searching and structural filters focusing on interactions with the S1 and S2 pockets of the protease. The chemical space adjacent to the promising candidates was further explored by neighborhood searching. A total of 23 compounds were tested experimentally and two compounds were discovered to inhibit dengue protease (IC(50) = 7.7 μM and 37.9 μM, respectively) and the related West Nile virus protease (IC(50) = 6.3 μM and 39.0 μM, respectively). This study demonstrates the successful application of a structure-guided fragment-based in silico drug design approach for dengue protease inhibitors providing straightforward hit generation using a combination of homology modeling, fragment docking, chemical similarity and structural filters.

Structure-guided fragment-based in silico drug design of dengue protease inhibitors

NASA Astrophysics Data System (ADS)

Knehans, Tim; Schüller, Andreas; Doan, Danny N.; Nacro, Kassoum; Hill, Jeffrey; Güntert, Peter; Madhusudhan, M. S.; Weil, Tanja; Vasudevan, Subhash G.

2011-03-01

An in silico fragment-based drug design approach was devised and applied towards the identification of small molecule inhibitors of the dengue virus (DENV) NS2B-NS3 protease. Currently, no DENV protease co-crystal structure with bound inhibitor and fully formed substrate binding site is available. Therefore a homology model of DENV NS2B-NS3 protease was generated employing a multiple template spatial restraints method and used for structure-based design. A library of molecular fragments was derived from the ZINC screening database with help of the retrosynthetic combinatorial analysis procedure (RECAP). 150,000 molecular fragments were docked to the DENV protease homology model and the docking poses were rescored using a target-specific scoring function. High scoring fragments were assembled to small molecule candidates by an implicit linking cascade. The cascade included substructure searching and structural filters focusing on interactions with the S1 and S2 pockets of the protease. The chemical space adjacent to the promising candidates was further explored by neighborhood searching. A total of 23 compounds were tested experimentally and two compounds were discovered to inhibit dengue protease (IC50 = 7.7 μM and 37.9 μM, respectively) and the related West Nile virus protease (IC50 = 6.3 μM and 39.0 μM, respectively). This study demonstrates the successful application of a structure-guided fragment-based in silico drug design approach for dengue protease inhibitors providing straightforward hit generation using a combination of homology modeling, fragment docking, chemical similarity and structural filters.

A glass fiber/diethylaminoethyl double filter binding assay that measures apoptotic internucleosomal DNA fragmentation.

PubMed

Erusalimsky, J D; John, J; Hong, Y; Moore, M

1996-11-15

A filter binding assay that measures internucleosomal DNA fragmentation associated with apoptosis is described. The assay is based on a novel principle that consists of using simultaneously two kinds of glass fiber filters to harvest [3H]thymidine-prelabeled cells following their incubation with inducers of apoptosis. One filter, which is neutral, traps intact chromatin and high-molecular-weight DNA. The other filter, which is positively charged with DEAE active groups, traps low-molecular-weight DNA fragments. DNA fragmentation is quantified by measuring the radioactivity retained by each of the filters. The assay was evaluated with the histiocytic lymphoma cell line U937 and the topoisomerase inhibitors camptothecin, etoposide, and doxorubicin. These agents caused a dose-dependent decrease of radioactivity in the neutral filter and a parallel increase of radioactivity in the DEAE filter. Irradiation-induced single strand breaks and topoisomerase-mediated primary DNA damage were not detected by this method. Consistent with the detection of internucleosomal DNA fragmentation, the effects measured by this assay were prevented by the endonuclease inhibitor zinc acetate and by the metabolic inhibitor sodium azide. Results obtained using this assay were validated by observation of DNA ladders on agarose gels and by morphologic examination of apoptotic features. Evaluation of the assay in a mock screen demonstrated that the introduction of the DEAE filter increases the assay sensitivity and eliminates false positives. Thus, this assay may be used in high-throughput screening approaches to discover novel modulators of apoptosis.

Development of a homogeneous immunoassay system using protein A fusion fragmented Renilla luciferase.

PubMed

Mie, Masayasu; Thuy, Ngo Phan Bich; Kobatake, Eiry

2012-03-07

A homogeneous immunoassay system was developed using fragmented Renilla luciferase (Rluc). The B domain of protein A was fused to two Rluc fragments. When complexes between an antibody and fragmented Rluc fusion proteins bind to target molecules, the Rluc fragments come into close proximity and the luminescence activity of fragmented Rluc is restored by complementation. As proof-of-principle, this fragmented Rluc system was used to detect E. coli homogeneously using an anti-E. coli antibody.

Evaluation of an Inverse Molecular Design Algorithm in a Model Binding Site

PubMed Central

Huggins, David J.; Altman, Michael D.; Tidor, Bruce

2008-01-01

Computational molecular design is a useful tool in modern drug discovery. Virtual screening is an approach that docks and then scores individual members of compound libraries. In contrast to this forward approach, inverse approaches construct compounds from fragments, such that the computed affinity, or a combination of relevant properties, is optimized. We have recently developed a new inverse approach to drug design based on the dead-end elimination and A* algorithms employing a physical potential function. This approach has been applied to combinatorially constructed libraries of small-molecule ligands to design high-affinity HIV-1 protease inhibitors [M. D. Altman et al. J. Am. Chem. Soc. 130: 6099–6013, 2008]. Here we have evaluated the new method using the well studied W191G mutant of cytochrome c peroxidase. This mutant possesses a charged binding pocket and has been used to evaluate other design approaches. The results show that overall the new inverse approach does an excellent job of separating binders from non-binders. For a few individual cases, scoring inaccuracies led to false positives. The majority of these involve erroneous solvation energy estimation for charged amines, anilinium ions and phenols, which has been observed previously for a variety of scoring algorithms. Interestingly, although inverse approaches are generally expected to identify some but not all binders in a library, due to limited conformational searching, these results show excellent coverage of the known binders while still showing strong discrimination of the non-binders. PMID:18831031

Evaluation of an inverse molecular design algorithm in a model binding site.

PubMed

Huggins, David J; Altman, Michael D; Tidor, Bruce

2009-04-01

Computational molecular design is a useful tool in modern drug discovery. Virtual screening is an approach that docks and then scores individual members of compound libraries. In contrast to this forward approach, inverse approaches construct compounds from fragments, such that the computed affinity, or a combination of relevant properties, is optimized. We have recently developed a new inverse approach to drug design based on the dead-end elimination and A* algorithms employing a physical potential function. This approach has been applied to combinatorially constructed libraries of small-molecule ligands to design high-affinity HIV-1 protease inhibitors (Altman et al., J Am Chem Soc 2008;130:6099-6013). Here we have evaluated the new method using the well-studied W191G mutant of cytochrome c peroxidase. This mutant possesses a charged binding pocket and has been used to evaluate other design approaches. The results show that overall the new inverse approach does an excellent job of separating binders from nonbinders. For a few individual cases, scoring inaccuracies led to false positives. The majority of these involve erroneous solvation energy estimation for charged amines, anilinium ions, and phenols, which has been observed previously for a variety of scoring algorithms. Interestingly, although inverse approaches are generally expected to identify some but not all binders in a library, due to limited conformational searching, these results show excellent coverage of the known binders while still showing strong discrimination of the nonbinders. (c) 2008 Wiley-Liss, Inc.

Structural models of antibody variable fragments: A method for investigating binding mechanisms

NASA Astrophysics Data System (ADS)

Petit, Samuel; Brard, Frédéric; Coquerel, Gérard; Perez, Guy; Tron, François

1998-03-01

The value of comparative molecular modeling for elucidating structure-function relationships was demonstrated by analyzing six anti-nucleosome autoantibody variable fragments. Structural models were built using the automated procedure developed in the COMPOSER software, subsequently minimized with the AMBER force field, and validated according to several standard geometric and chemical criteria. Canonical class assignment from Chothia and Lesk's [Chottin and Lesk, J. Mol. Biol., 196 (1987) 901; Chothia et al., Nature, 342 (1989) 877] work was used as a supplementary validation tool for five of the six hypervariable loops. The analysis, based on the hypothesis that antigen binding could occur through electrostatic interactions, reveals a diversity of possible binding mechanisms of anti-nucleosome or anti-histone antibodies to their cognate antigen. These results lead us to postulate that anti-nucleosome autoantibodies could have different origins. Since both anti-DNA and anti-nculeosome autoantibodies are produced during the course of systemic lupus erythematosus, a non-organ specific autoimmune disease, a comparative structural and electrostatic analysis of the two populations of autoantibodies may constitute a way to elucidate their origin and the role of the antigen in tolerance breakdown. The present study illustrates some interests, advantages and limits of a methodology based on the use of comparative modeling and analysis of molecular surface properties.

Specific labeling of the thyroxine binding site in thyroxine-binding globulin: determination of the amino acid composition of a labeled peptide fragment isolated from a proteolytic digest of the derivatized protein.

PubMed

Tabachnick, M; Perret, V

1987-08-01

[125I] Thyroxine has been covalently bound to the thyroxine binding site in thyroxine-binding globulin by reaction with the bifunctional reagent, 1,5-difluoro-2,4-dinitrobenzene. An average of 0.47 mol of [125I] thyroxine was incorporated per mol protein; nonspecific binding amounted to 8%. A labeled peptide fragment was isolated from a proteolytic digest of the derivatized protein by HPLC and its amino acid composition was determined. Comparison with the amino acid sequence of thyroxine-binding globulin indicated partial correspondence of the labeled peptide with two possible regions in the protein. These regions also coincide with part of the barrel structure present in the closely homologous protein, alpha 1-antitrypsin.

Comparative study of thiophilic functionalised matrices for polyclonal F(ab')2 purification.

PubMed

Kumpalume, Peter; Slater, Nigel K H

2004-01-02

Thiophilic adsorbents have been developed using divinyl sulfone or epoxy activated Streamline quartz base matrix. Their capacity and selectivity for binding polyclonal F(ab')2 fragments generated by whole serum proteolysis was tested. Except for epoxy activated guanidine, all the adsorbents displayed high selectivity for F(ab')2 with dynamic binding capacities ranging from 3 to 10 mg/ml of adsorbent. Thiol immobilised ligands adsorbed more F(ab')2 and the recovery was equal to or more than that from amino immobilised ligands. All adsorbents showed good selectivity for IgG and the dynamic binding capacities were better than for F(ab')2.

Structural requirements for fibromodulin binding to collagen and the control of type I collagen fibrillogenesis--critical roles for disulphide bonding and the C-terminal region.

PubMed

Font, B; Eichenberger, D; Goldschmidt, D; Boutillon, M M; Hulmes, D J

1998-06-15

Fibromodulin belongs to the family of small, leucine-rich proteoglycans which have been reported to interact with collagens and to inhibit type I collagen fibrillogenesis. Decorin and fibromodulin exhibit a noticeable degree of sequence similarity. However, as previously reported [Font, B., Eichenberger, D., Rosenberg, L. M. & van der Rest, M. (1996) Matrix Biol. 15, 341-348] the domains of these molecules implicated in the interactions with type XII and type XIV collagens are different, these being the dermatan sulphate/chondroitin sulphate chain for decorin and the core protein for fibromodulin. At the present time the fibromodulin domains implicated in the interactions with fibrillar collagens remain unknown. In experiments reported here, we have sought to identify the structural requirements for fibromodulin interaction with collagen and for the control of type I collagen fibrillogenesis. Circular dichroism spectra and fibrillogenesis inhibition studies show that fibromodulin structure and its collagen fibrillogenesis control function are strictly dependent on the presence of intact disulphide bridge(s). In addition, we show that the binding of fibromodulin (or fibromodulin-derived fragments) to type I collagen is not necessarily correlated with fibrillogenesis inhibition. To isolate fibromodulin domains, the native proteoglycan was submitted to mild proteolysis. We have isolated an alpha-chymotrypsin-resistant fragment which contains the bulk of the N-terminal and central region of the molecule including the leucine-rich repeats 4 and 6 reported for decorin to be involved in type I collagen binding. This fragment does not bind to type I collagen. Using enzymes with different specificities, a number of large fragments of fibromodulin were obtained, suggesting a compact structure for this molecule which is relatively resistant to proteolysis. None of these N-glycosylated fragments were able to bind to type I collagen in co-sedimentation experiments. Taken together these results suggest that fibromodulin-type I collagen interactions leading to fibrillogenesis inhibition require more than one binding domain. One of these domains could be the C-terminal end of the molecule containing the disulphide loop which is absent in the chymotrypsin-resistant fragment.

Generating and Purifying Fab Fragments from Human and Mouse IgG Using the Bacterial Enzymes IdeS, SpeB and Kgp.

PubMed

Sjögren, Jonathan; Andersson, Linda; Mejàre, Malin; Olsson, Fredrik

2017-01-01

Fab fragments are valuable research tools in various areas of science including applications in imaging, binding studies, removal of Fc-mediated effector functions, mass spectrometry, infection biology, and many others. The enzymatic tools for the generation of Fab fragments have been discovered through basic research within the field of molecular bacterial pathogenesis. Today, these enzymes are widely applied as research tools and in this chapter, we describe methodologies based on bacterial enzymes to generate Fab fragments from both human and mouse IgG. For all human IgG subclasses, the IdeS enzyme from Streptococcus pyogenes has been applied to generate F(ab')2 fragments that subsequently can be reduced under mild conditions to generate a homogenous pool of Fab' fragments. The enzyme Kgp from Porphyromonas gingivalis has been applied to generate intact Fab fragments from human IgG1 and the Fab fragments can be purified using a CH1-specific affinity resin. The SpeB protease, also from S. pyogenes, is able to digest mouse IgGs and has been applied to digest antibodies and Fab fragments can be purified on light chain affinity resins. In this chapter, we describe methodologies that can be used to obtain Fab fragments from human and mouse IgG using bacterial proteases.

Single-molecule imaging of DNA polymerase I (Klenow fragment) activity by atomic force microscopy

NASA Astrophysics Data System (ADS)

Chao, J.; Zhang, P.; Wang, Q.; Wu, N.; Zhang, F.; Hu, J.; Fan, C. H.; Li, B.

2016-03-01

We report a DNA origami-facilitated single-molecule platform that exploits atomic force microscopy to study DNA replication. We imaged several functional activities of the Klenow fragment of E. coli DNA polymerase I (KF) including binding, moving, and dissociation from the template DNA. Upon completion of these actions, a double-stranded DNA molecule was formed. Furthermore, the direction of KF activities was captured and then confirmed by shifting the KF binding sites on the template DNA.We report a DNA origami-facilitated single-molecule platform that exploits atomic force microscopy to study DNA replication. We imaged several functional activities of the Klenow fragment of E. coli DNA polymerase I (KF) including binding, moving, and dissociation from the template DNA. Upon completion of these actions, a double-stranded DNA molecule was formed. Furthermore, the direction of KF activities was captured and then confirmed by shifting the KF binding sites on the template DNA. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr06544e

A note on the self-similar solutions to the spontaneous fragmentation equation

NASA Astrophysics Data System (ADS)

Breschi, Giancarlo; Fontelos, Marco A.

2017-05-01

We provide a method to compute self-similar solutions for various fragmentation equations and use it to compute their asymptotic behaviours. Our procedure is applied to specific cases: (i) the case of mitosis, where fragmentation results into two identical fragments, (ii) fragmentation limited to the formation of sufficiently large fragments, and (iii) processes with fragmentation kernel presenting a power-like behaviour.

Heterotypic binding between neuronal membrane vesicles and glial cells is mediated by a specific cell adhesion molecule

PubMed Central

1984-01-01

By means of a multistage quantitative assay, we have identified a new kind of cell adhesion molecule (CAM) on neuronal cells of the chick embryo that is involved in their adhesion to glial cells. The assay used to identify the binding component (which we name neuron-glia CAM or Ng-CAM) was designed to distinguish between homotypic binding (e.g., neuron to neuron) and heterotypic binding (e.g., neuron to glia). This distinction was essential because a single neuron might simultaneously carry different CAMs separately mediating each of these interactions. The adhesion of neuronal cells to glial cells in vitro was previously found to be inhibited by Fab' fragments prepared from antisera against neuronal membranes but not by Fab' fragments against N-CAM, the neural cell adhesion molecule. This suggested that neuron-glia adhesion is mediated by specific cell surface molecules different from previously isolated CAMs . To verify that this was the case, neuronal membrane vesicles were labeled internally with 6-carboxyfluorescein and externally with 125I-labeled antibodies to N-CAM to block their homotypic binding. Labeled vesicles bound to glial cells but not to fibroblasts during a 30-min incubation period. The specific binding of the neuronal vesicles to glial cells was measured by fluorescence microscopy and gamma spectroscopy of the 125I label. Binding increased with increasing concentrations of both glial cells and neuronal vesicles. Fab' fragments prepared from anti-neuronal membrane sera that inhibited binding between neurons and glial cells were also found to inhibit neuronal vesicle binding to glial cells. The inhibitory activity of the Fab' fragments was depleted by preincubation with neuronal cells but not with glial cells. Trypsin treatment of neuronal membrane vesicles released material that neutralized Fab' fragment inhibition; after chromatography, neutralizing activity was enriched 50- fold. This fraction was injected into mice to produce monoclonal antibodies; an antibody was obtained that interacted with neurons, inhibited binding of neuronal membrane vesicles to glial cells, and recognized an Mr = 135,000 band in immunoblots of embryonic chick brain membranes. These results suggest that this molecule is present on the surfaces of neurons and that it directly or indirectly mediates adhesion between neurons and glial cells. Because the monoclonal antibody as well as the original polyspecific antibodies that were active in the assay did not bind to glial cells, we infer that neuron- glial interaction is heterophilic, i.e., it occurs between Ng-CAM on neurons and an as yet unidentified CAM present on glial cells. PMID:6725397

Analytic second derivative of the energy for density functional theory based on the three-body fragment molecular orbital method

NASA Astrophysics Data System (ADS)

Nakata, Hiroya; Fedorov, Dmitri G.; Zahariev, Federico; Schmidt, Michael W.; Kitaura, Kazuo; Gordon, Mark S.; Nakamura, Shinichiro

2015-03-01

Analytic second derivatives of the energy with respect to nuclear coordinates have been developed for spin restricted density functional theory (DFT) based on the fragment molecular orbital method (FMO). The derivations were carried out for the three-body expansion (FMO3), and the two-body expressions can be obtained by neglecting the three-body corrections. Also, the restricted Hartree-Fock (RHF) Hessian for FMO3 can be obtained by neglecting the density-functional related terms. In both the FMO-RHF and FMO-DFT Hessians, certain terms with small magnitudes are neglected for computational efficiency. The accuracy of the FMO-DFT Hessian in terms of the Gibbs free energy is evaluated for a set of polypeptides and water clusters and found to be within 1 kcal/mol of the corresponding full (non-fragmented) ab initio calculation. The FMO-DFT method is also applied to transition states in SN2 reactions and for the computation of the IR and Raman spectra of a small Trp-cage protein (PDB: 1L2Y). Some computational timing analysis is also presented.

Minimal Pharmacophoric Elements and Fragment Hopping, an Approach Directed at Molecular Diversity and Isozyme Selectivity. Design of Selective Neuronal Nitric Oxide Synthase Inhibitors

PubMed Central

Ji, Haitao; Stanton, Benjamin Z.; Igarashi, Jotaro; Li, Huiying; Martásek, Pavel; Roman, Linda J.; Poulos, Thomas L.; Silverman, Richard B.

2010-01-01

Fragment hopping, a new fragment-based approach for de novo inhibitor design focusing on ligand diversity and isozyme selectivity, is described. The core of this approach is the derivation of the minimal pharmacophoric element for each pharmacophore. Sites for both ligand binding and isozyme selectivity are considered in deriving the minimal pharmacophoric elements. Five general-purpose libraries are established: the basic fragment library, the bioisostere library, the rules for metabolic stability, the toxicophore library, and the side chain library. These libraries are employed to generate focused fragment libraries to match the minimal pharmacophoric elements for each pharmacophore and then to link the fragment to the desired molecule. This method was successfully applied to neuronal nitric oxide synthase (nNOS), which is implicated in stroke and neurodegenerative diseases. Starting with the nitroarginine-containing dipeptide inhibitors we developed previously, a small organic molecule with a totally different chemical structure was designed, which showed nanomolar nNOS inhibitory potency and more than 1000-fold nNOS selectivity. The crystallographic analysis confirms that the small organic molecule with a constrained conformation can exactly mimic the mode of action of the dipeptide nNOS inhibitors. Therefore, a new peptidomimetic strategy, referred to as fragment hopping, which creates small organic molecules that mimic the biological function of peptides by a pharmacophore-driven strategy for fragment-based de novo design, has been established as a new type of fragment-based inhibitor design. As an open system, the newly established approach efficiently incorporates the concept of early “ADME/Tox” considerations and provides a basic platform for medicinal chemistry-driven efforts. PMID:18321097

Calcium binding to an elastic portion of connectin/titin filaments.

PubMed

Tatsumi, R; Maeda, K; Hattori, A; Takahashi, K

2001-01-01

Alpha-connectin/titin-1 exists as an elastic filament that links a thick filament with the Z-disk, keeping thick filaments centered within the sarcomere during force generation. We have shown that the connectin filament has an affinity for calcium ions and its binding site(s) is restricted to the beta-connectin/titin-2 portion. We now report the localization and the characterization of calcium-binding sites on beta-connectin. Purified beta-connectin was digested by trypsin into 1700- and 400-kDa fragments. which were then subjected to fluorescence calcium-binding assays. The 400-kDa fragment possesses calcium-binding activity; the binding constant was 1.0 x 10(7) M(-1) and the molar ratio of bound calcium ions to the 400-kDa fragment reached a maximum of 12 at a free calcium ion concentration of approximately 1.0 microM. Antibodies against the 400-kDa fragment formed a sharp dense stripe at the boundary of the A and the I bands, indicating that the calcium-binding domain constitutes the N-terminal region of beta-connectin, that is, the elastic portion of connectin filaments. Furthermore, we estimated the N-terminal location of beta-connectin of various origins (n = 26). Myofibrils were treated with a solution containing 0.1 mM CaCl2 and 70 microM leupeptin to split connectin filaments into beta-connectin and a subfragment, and chain weights of these polypeptides were estimated according to their mobility in 2% polyacrylamide slab gels. The subfragment exhibited a similar chain weight of 1200+/-33 kDa (mean+/-SD), while alpha- and beta-connectins were variable in size according to their origin. These results suggest that the apparent length of the 1200-kDa subfragment portion is almost constant in all instances, about 0.34 microm at the slack condition, therefore that the C-terminus of the 1200-kDa subfragment, that is, the N-terminus of the calcium-binding domain, is at the N2 line region of parent filaments in situ. Because the secondary structure of the 400-kDa fragment was changed by the binding of calcium ions, connectin filaments could be expected to alter their elasticity during the contraction-relaxation cycle of skeletal muscle.

Characterization of a recombinant humanized anti-cocaine monoclonal antibody and its Fab fragment.

PubMed

Kirley, Terence L; Norman, Andrew B

2015-01-01

Variations of post-translational modifications are important for stability and in vivo behavior of therapeutic antibodies. A recombinant humanized anti-cocaine monoclonal antibody (h2E2) was characterized for heterogeneity of N-linked glycosylation and disulfide bonds. In addition, charge heterogeneity, which is partially due to the presence or absence of C-terminal lysine on the heavy chains, was examined. For cocaine overdose therapy, Fab fragments may be therapeutic, and thus, a simplified method of generation, purification, and characterization of the Fab fragment generated by Endoproteinase Lys-C digestion was devised. Both the intact h2E2 antibody and purified Fab fragments were analyzed for their affinities for cocaine and 2 of its metabolites, benzoylecgonine and cocaethylene, by fluorescence quenching of intrinsic antibody tyrosine and tryptophan fluorescence resulting from binding of these drugs. Binding constants obtained from fluorescence quenching measurements are in agreement with recently published radioligand and ELISA binding assays. The dissociation constants determined for the h2E2 monoclonal and its Fab fragment are approximately 1, 5, and 20 nM for cocaethylene, cocaine, and benzoylecgonine, respectively. Tryptophan fluorescence quenching (emission at 330 nm) was measured after either excitation of tyrosine and tryptophan (280 nm) or selective excitation of tryptophan alone (295 nm). More accurate binding constants are obtained using tryptophan selective excitation at 295 nm, likely due to interfering absorption of cocaine and metabolites at 280 nm. These quenching results are consistent with multiple tryptophan and tyrosine residues in or near the predicted binding location of cocaine in a previously published 3-D model of this antibody's variable region.

Discovery of small molecule inhibitors of ubiquitin-like poxvirus proteinase I7L using homology modeling and covalent docking approaches

NASA Astrophysics Data System (ADS)

Katritch, Vsevolod; Byrd, Chelsea M.; Tseitin, Vladimir; Dai, Dongcheng; Raush, Eugene; Totrov, Maxim; Abagyan, Ruben; Jordan, Robert; Hruby, Dennis E.

2007-10-01

Essential for viral replication and highly conserved among poxviridae, the vaccinia virus I7L ubiquitin-like proteinase (ULP) is an attractive target for development of smallpox antiviral drugs. At the same time, the I7L proteinase exemplifies several interesting challenges from the rational drug design perspective. In the absence of a published I7L X-ray structure, we have built a detailed 3D model of the I7L ligand binding site (S2-S2' pocket) based on exceptionally high structural conservation of this site in proteases of the ULP family. The accuracy and limitations of this model were assessed through comparative analysis of available X-ray structures of ULPs, as well as energy based conformational modeling. The 3D model of the I7L ligand binding site was used to perform covalent docking and VLS of a comprehensive library of about 230,000 available ketone and aldehyde compounds. Out of 456 predicted ligands, 97 inhibitors of I7L proteinase activity were confirmed in biochemical assays (˜20% overall hit rate). These experimental results both validate our I7L ligand binding model and provide initial leads for rational optimization of poxvirus I7L proteinase inhibitors. Thus, fragments predicted to bind in the prime portion of the active site can be combined with fragments on non-prime side to yield compounds with improved activity and specificity.

Fragment screening for drug leads by weak affinity chromatography (WAC-MS).

PubMed

Ohlson, Sten; Duong-Thi, Minh-Dao

2018-02-23

Fragment-based drug discovery is an important tool for design of small molecule hit-to-lead compounds against various biological targets. Several approved drugs have been derived from an initial fragment screen and many such candidates are in various stages of clinical trials. Finding fragment hits, that are suitable for optimisation by medicinal chemists, is still a challenge as the binding between the small fragment and its target is weak in the range of mM to µM of K d and irrelevant non-specific interactions are abundant in this area of transient interactions. Fortunately, there are methods that can study weak interactions quite efficiently of which NMR, surface plasmon resonance (SPR) and X-ray crystallography are the most prominent. Now, a new technology based on zonal affinity chromatography, weak affinity chromatography (WAC), has been introduced which has remedied many of the problems with other technologies. By combining WAC with mass spectrometry (WAC-MS), it is a powerful tool to identify binders quantitatively in terms of affinity and kinetics either from fragment libraries or from complex mixtures of biological extracts. As WAC-MS can be multiplexed by analysing mixtures of fragments (20-100 fragments) in one sample, this approach yields high throughput, where a whole library of e.g. >2000 fragments can be analysed quantitatively within a day. WAC-MS is easy to perform, where the robustness and quality of HPLC is fully utilized. This review will highlight the rationale behind the application of WAC-MS for fragment screening in drug discovery. Copyright © 2018 Elsevier Inc. All rights reserved.

Momentum distributions of isotopes produced by fragmentation of relativistic C-12 and O-16 projectiles

NASA Technical Reports Server (NTRS)

Greiner, D. E.; Lindstrom, P. J.; Heckman, H. H.; Cork, B.; Bieser, F. S.

1975-01-01

The fragment momentum distributions in the projectile rest frame are, typically, Gaussian shaped, narrow, consistent with isotropy, depend on fragment and projectile, and have no significant correlation with target mass or beam energy. The nuclear temperature is inferred from the momentum distributions of the fragments and is approximately equal to the projectile nuclear binding energy, indicative of small energy transfer between target and fragment.

Specific interactions between mycobacterial FtsZ protein and curcumin derivatives: Molecular docking and ab initio molecular simulations

NASA Astrophysics Data System (ADS)

Fujimori, Mitsuki; Sogawa, Haruki; Ota, Shintaro; Karpov, Pavel; Shulga, Sergey; Blume, Yaroslav; Kurita, Noriyuki

2018-01-01

Filamentous temperature-sensitive Z (FtsZ) protein plays essential role in bacteria cell division, and its inhibition prevents Mycobacteria reproduction. Here we adopted curcumin derivatives as candidates of novel inhibitors and investigated their specific interactions with FtsZ, using ab initio molecular simulations based on protein-ligand docking, classical molecular mechanics and ab initio fragment molecular orbital (FMO) calculations. Based on FMO calculations, we specified the most preferable site of curcumin binding to FtsZ and highlighted the key amino acid residues for curcumin binding at an electronic level. The result will be useful for proposing novel inhibitors against FtsZ based on curcumin derivatives.

Finite element model for brittle fracture and fragmentation

DOE PAGES

Li, Wei; Delaney, Tristan J.; Jiao, Xiangmin; ...

2016-06-01

A new computational model for brittle fracture and fragmentation has been developed based on finite element analysis of non-linear elasticity equations. The proposed model propagates the cracks by splitting the mesh nodes alongside the most over-strained edges based on the principal direction of strain tensor. To prevent elements from overlapping and folding under large deformations, robust geometrical constraints using the method of Lagrange multipliers have been incorporated. In conclusion, the model has been applied to 2D simulations of the formation and propagation of cracks in brittle materials, and the fracture and fragmentation of stretched and compressed materials.

Finite element model for brittle fracture and fragmentation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Wei; Delaney, Tristan J.; Jiao, Xiangmin

A new computational model for brittle fracture and fragmentation has been developed based on finite element analysis of non-linear elasticity equations. The proposed model propagates the cracks by splitting the mesh nodes alongside the most over-strained edges based on the principal direction of strain tensor. To prevent elements from overlapping and folding under large deformations, robust geometrical constraints using the method of Lagrange multipliers have been incorporated. In conclusion, the model has been applied to 2D simulations of the formation and propagation of cracks in brittle materials, and the fracture and fragmentation of stretched and compressed materials.

Advances in free-energy-based simulations of protein folding and ligand binding.

PubMed

Perez, Alberto; Morrone, Joseph A; Simmerling, Carlos; Dill, Ken A

2016-02-01

Free-energy-based simulations are increasingly providing the narratives about the structures, dynamics and biological mechanisms that constitute the fabric of protein science. Here, we review two recent successes. It is becoming practical: first, to fold small proteins with free-energy methods without knowing substructures and second, to compute ligand-protein binding affinities, not just their binding poses. Over the past 40 years, the timescales that can be simulated by atomistic MD are doubling every 1.3 years--which is faster than Moore's law. Thus, these advances are not simply due to the availability of faster computers. Force fields, solvation models and simulation methodology have kept pace with computing advancements, and are now quite good. At the tip of the spear recently are GPU-based computing, improved fast-solvation methods, continued advances in force fields, and conformational sampling methods that harness external information. Copyright © 2015 Elsevier Ltd. All rights reserved.

28-mer Fragment Derived from Enterocin CRL35 Displays an Unexpected Bactericidal Effect on Listeria Cells.

PubMed

Masias, Emilse; Sanches, Paulo R S; Dupuy, Fernando G; Acuna, Leonardo; Bellomio, Augusto; Cilli, Eduardo; Saavedra, Lucila; Minahk, Carlos

2015-01-01

Two shorter peptides derived from enterocin CRL35, a 43-mer bacteriocin, were synthesized i.e. the N-terminal fragment spanning from residues 1 to 15, and a 28-mer fragment that represents the C-terminal of enterocin CRL35, the residues 16 to 43. The separate peptides showed no activity when combined. On one hand, the 28-mer peptide displayed an unpredicted antimicrobial activity. On the other, 15- mer peptide had no consistent anti-Listeria effect. The dissociation constants calculated from experimental data indicated that all peptides could bind at similar extent to the sensitive cells. However, transmembrane electrical potential was not dissipated to the same level by the different peptides; whereas the full-length and the C-terminal 28-mer fragment induced almost full dissipation, 15-mer fragment produced only a slow and incomplete effect. Furthermore, a different interaction of each peptide with membranes was demonstrated based on studies carried out with liposomes, which led us to conclude that activity was related to structure rather than to net positive charges. These results open up the possibility of designing new peptides based on the 28-mer fragment with enhanced activity, which would represent a promising approach for combating Listeria and other pathogens.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ren, Xueguang, E-mail: xue.g.ren@ptb.de; Pflüger, Thomas; Weyland, Marvin

The ionization and fragmentation of methane induced by low-energy (E{sub 0} = 66 eV) electron-impact is investigated using a reaction microscope. The momentum vectors of all three charged final state particles, two outgoing electrons, and one fragment ion, are detected in coincidence. Compared to the earlier study [Xu et al., J. Chem. Phys. 138, 134307 (2013)], considerable improvements to the instrumental mass and energy resolutions have been achieved. The fragment products CH{sub 4}{sup +}, CH{sub 3}{sup +}, CH{sub 2}{sup +}, CH{sup +}, and C{sup +} are clearly resolved. The binding energy resolution of ΔE = 2.0 eV is a factormore » of three better than in the earlier measurements. The fragmentation channels are investigated by measuring the ion kinetic energy distributions and the binding energy spectra. While being mostly in consistence with existing photoionization studies the results show differences including missing fragmentation channels and previously unseen channels.« less

Computational biology of RNA interactions.

PubMed

Dieterich, Christoph; Stadler, Peter F

2013-01-01

The biodiversity of the RNA world has been underestimated for decades. RNA molecules are key building blocks, sensors, and regulators of modern cells. The biological function of RNA molecules cannot be separated from their ability to bind to and interact with a wide space of chemical species, including small molecules, nucleic acids, and proteins. Computational chemists, physicists, and biologists have developed a rich tool set for modeling and predicting RNA interactions. These interactions are to some extent determined by the binding conformation of the RNA molecule. RNA binding conformations are approximated with often acceptable accuracy by sequence and secondary structure motifs. Secondary structure ensembles of a given RNA molecule can be efficiently computed in many relevant situations by employing a standard energy model for base pair interactions and dynamic programming techniques. The case of bi-molecular RNA-RNA interactions can be seen as an extension of this approach. However, unbiased transcriptome-wide scans for local RNA-RNA interactions are computationally challenging yet become efficient if the binding motif/mode is known and other external information can be used to confine the search space. Computational methods are less developed for proteins and small molecules, which bind to RNA with very high specificity. Binding descriptors of proteins are usually determined by in vitro high-throughput assays (e.g., microarrays or sequencing). Intriguingly, recent experimental advances, which are mostly based on light-induced cross-linking of binding partners, render in vivo binding patterns accessible yet require new computational methods for careful data interpretation. The grand challenge is to model the in vivo situation where a complex interplay of RNA binders competes for the same target RNA molecule. Evidently, bioinformaticians are just catching up with the impressive pace of these developments. Copyright © 2012 John Wiley & Sons, Ltd.

Dynamics and molecular determinants of cytoplasmic lipid droplet clustering and dispersion.

PubMed

Orlicky, David J; Monks, Jenifer; Stefanski, Adrianne L; McManaman, James L

2013-01-01

Perilipin-1 (Plin1), a prominent cytoplasmic lipid droplet (CLD) binding phosphoprotein and key physiological regulator of triglyceride storage and lipolysis in adipocytes, is thought to regulate the fragmentation and dispersion of CLD that occurs in response to β-adrenergic activation of adenylate cyclase. Here we investigate the dynamics and molecular determinants of these processes using cell lines stably expressing recombinant forms of Plin1 and/or other members of the perilipin family. Plin1 and a C-terminal CLD-binding fragment of Plin1 (Plin1CT) induced formation of single dense CLD clusters near the microtubule organizing center, whereas neither an N-terminal CLD-binding fragment of Plin1, nor Plin2 or Plin3 induced clustering. Clustered CLD coated by Plin1, or Plin1CT, dispersed in response to isoproterenol, or other agents that activate adenylate cyclase, in a process inhibited by the protein kinase A inhibitor, H89, and blocked by microtubule disruption. Isoproterenol-stimulated phosphorylation of CLD-associated Plin1 on serine 492 preceded their dispersion, and live cell imaging showed that cluster dispersion involved initial fragmentation of tight clusters into multiple smaller clusters, which then fragmented into well-dispersed individual CLD. siRNA knockdown of the cortical actin binding protein, moesin, induced disaggregation of tight clusters into multiple smaller clusters, and inhibited the reaggregation of dispersed CLD into tight clusters. Together these data suggest that the clustering and dispersion processes involve a complex orchestration of phosphorylation-dependent, microtubule-dependent and independent, and microfilament dependent steps.

A binary plasmid system for shuffling combinatorial antibody libraries.

PubMed

Collet, T A; Roben, P; O'Kennedy, R; Barbas, C F; Burton, D R; Lerner, R A

1992-11-01

We have used a binary system of replicon-compatible plasmids to test the potential for promiscuous recombination of heavy and light chains within sets of human Fab fragments isolated from combinatorial antibody libraries. Antibody molecules showed a surprising amount of promiscuity in that a particular heavy chain could recombine with multiple light chains with retention of binding to a protein antigen. The degree to which a given heavy chain productively paired with any light chain to bind antigen varied from 43% to 100% and depended strongly on the heavy-chain sequence. Such productive crosses resulted in a set of Fab fragments of similar apparent binding constants, which seemed to differ mainly in the amount of active Fab fragment produced in the bacterial cell. The dominance of the heavy chain in the antibody-antigen interaction was further explored in a set of directed crosses, in which heavy and light chains derived from antigen-specific clones were crossed with nonrelated heavy and light chains. In these crosses, an Fab fragment retained antigen binding only if it contained a heavy chain from an antigen-specific clone. In no case did the light chain confer detectable affinity when paired with indifferent heavy chains. The surprising promiscuity of heavy chains has ramifications for the evaluation of the diversity of combinatorial libraries made against protein antigens and should allow the combination of one such promiscuous heavy chain with an engineered light chain to form an Fab fragment carrying synthetic cofactors to assist in antibody catalysis.

A binary plasmid system for shuffling combinatorial antibody libraries.

PubMed Central

Collet, T A; Roben, P; O'Kennedy, R; Barbas, C F; Burton, D R; Lerner, R A

1992-01-01

We have used a binary system of replicon-compatible plasmids to test the potential for promiscuous recombination of heavy and light chains within sets of human Fab fragments isolated from combinatorial antibody libraries. Antibody molecules showed a surprising amount of promiscuity in that a particular heavy chain could recombine with multiple light chains with retention of binding to a protein antigen. The degree to which a given heavy chain productively paired with any light chain to bind antigen varied from 43% to 100% and depended strongly on the heavy-chain sequence. Such productive crosses resulted in a set of Fab fragments of similar apparent binding constants, which seemed to differ mainly in the amount of active Fab fragment produced in the bacterial cell. The dominance of the heavy chain in the antibody-antigen interaction was further explored in a set of directed crosses, in which heavy and light chains derived from antigen-specific clones were crossed with nonrelated heavy and light chains. In these crosses, an Fab fragment retained antigen binding only if it contained a heavy chain from an antigen-specific clone. In no case did the light chain confer detectable affinity when paired with indifferent heavy chains. The surprising promiscuity of heavy chains has ramifications for the evaluation of the diversity of combinatorial libraries made against protein antigens and should allow the combination of one such promiscuous heavy chain with an engineered light chain to form an Fab fragment carrying synthetic cofactors to assist in antibody catalysis. Images PMID:1438192

Identification of epitopes within integrin β4 for binding of auto-antibodies in ocular cicatricial and mucous membrane pemphigoid: preliminary report.

PubMed

Rashid, Khwaja Aftab; Foster, C Stephen; Ahmed, A Razzaque

2013-11-19

To identify the epitopes on human β4 integrin to which the sera of patients with ocular cicatricial pemphigoid (OCP) and mucous membrane pemphigoid (MMP) without ocular involvement bind. Fragments of the intracellular domain of the β4 molecule were cloned, expressed, purified and peptides were synthesized. Antibodies to various fragments and peptides were produced in rabbits. Binding specificity was determined via Western blot and blocking experiments. Test sera and controls were injected into neonatal BALB/c mice for in vivo passive transfer. Sera from patients with OCP, MMP, and both OCP and MMP were bound to cloned fragments of IC3.0. Its subcloned fragments IC3.4 (1489 aa-1572 aa) and IC3.4.1 (1489 aa-1510 aa) were bound with the sera from patients with OCP only. Subcloned fragments IC3.6 (1573 aa-1822 aa) and IC3.6.1 (1689 aa-1702 aa) were bound with MMP sera only. No cross-reactivity in binding was observed. Immuno-affinity-purified sera from patients with OCP, MMP, and rabbit antibodies to IC3.0, IC3.4, IC3.4.1, IC3.6, and IC3.6.1, when injected in neonatal BALB/c mice, produced subepidermal blisters in their skin. These preliminary observations identified IC3.4.1 as the possible epitope for the binding of OCP auto-antibody and IC3.6.1 as the possible epitope for the binding of MMP auto-antibody without ocular disease. Antibodies specific to these peptides produced blisters when injected in mice. Still-unidentified epitopes may exist. These observations may enhance our understanding of the role of β4 integrin in the pathobiology of OCP and MMP. Early diagnosis may be possible if serologic tests with specificity and sensitivity can be developed.

Mutations in the C-terminal fragment of DnaK affecting peptide binding.

PubMed Central

Burkholder, W F; Zhao, X; Zhu, X; Hendrickson, W A; Gragerov, A; Gottesman, M E

1996-01-01

Escherichia coli DnaK acts as a molecular chaperone through its ATP-regulated binding and release of polypeptide substrates. Overexpressing a C-terminal fragment (CTF) of DnaK (Gly-384 to Lys-638) containing the polypeptide substrate binding domain is lethal in wild-type E. coli. This dominant-negative phenotype may result from the nonproductive binding of CTF to cellular polypeptide targets of DnaK. Mutations affecting DnaK substrate binding were identified by selecting noncytotoxic CTF mutants followed by in vitro screening. The clustering of such mutations in the three-dimensional structure of CTF suggests the model that loops L1,2 and L4,5 form a rigid core structure critical for interactions with substrate. Images Fig. 1 Fig. 2 Fig. 3 PMID:8855230

Stochastic weighted particle methods for population balance equations with coagulation, fragmentation and spatial inhomogeneity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Kok Foong; Patterson, Robert I.A.; Wagner, Wolfgang

2015-12-15

Graphical abstract: -- Highlights: •Problems concerning multi-compartment population balance equations are studied. •A class of fragmentation weight transfer functions is presented. •Three stochastic weighted algorithms are compared against the direct simulation algorithm. •The numerical errors of the stochastic solutions are assessed as a function of fragmentation rate. •The algorithms are applied to a multi-dimensional granulation model. -- Abstract: This paper introduces stochastic weighted particle algorithms for the solution of multi-compartment population balance equations. In particular, it presents a class of fragmentation weight transfer functions which are constructed such that the number of computational particles stays constant during fragmentation events. Themore » weight transfer functions are constructed based on systems of weighted computational particles and each of it leads to a stochastic particle algorithm for the numerical treatment of population balance equations. Besides fragmentation, the algorithms also consider physical processes such as coagulation and the exchange of mass with the surroundings. The numerical properties of the algorithms are compared to the direct simulation algorithm and an existing method for the fragmentation of weighted particles. It is found that the new algorithms show better numerical performance over the two existing methods especially for systems with significant amount of large particles and high fragmentation rates.« less

DHS Summer Student Project Report

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kawamoto, S

2005-08-19

Tetanus and botulinum neurotoxins are among the most potent toxins known to man (Montecucco et al. al., 1995). Produced by the Clostridium tetani and Clostridium botulinum bacteria, respectively, these toxins concentrate in presynaptic axons and inhibit the release of neurotransmitters leading to paralysis and possibly death. Due to the potency of this lethal class of neurotoxins, we have undertaken a project to develop high affinity ligands that specifically bind to these toxins. Such compounds can have significant implications in both the design of detection systems to monitor for the possible release of these neurotoxins into the public and also themore » design of possible therapeutics to treat individuals exposed to tetanus or botulinum neurotoxins. The Clostridial neurotoxins are synthesized as 150 kDa proteins that are post-translationally cleaved into N- and C-terminal fragments held together by a single disulfide bond. The tetanus C-terminal fragment (TetC) has been shown to bind specifically to gangliosides present on the neuronal membrane surface and facilitate endocytosis of the toxin (Morris et al., 1980). Once the toxin is internalized in a membrane-bound vesicle, the light chain (N-terminal fragment) translocates to the cytosol where it interferes with neurotransmitter release. Previous work has demonstrated that various small molecule and peptide-based compounds bind to TetC, albeit in different locations. Among these molecules are the anticancer agent doxorubicin (Dox) and the tripeptides WEY and YEW (Figure 1; Cosman et al. al., 2002). The crystal structure of botulinum toxin and Dox (PDB code: 1I1E) demonstrates that Dox binds in a surface groove of in C-terminal fragment that is conserved in both botulinum and tetanus toxins. Similarly, YEW has been shown to bind to a second binding site that is highly conserved and also relatively close to the binding site of Dox. Thus, in our quest to design and synthesize high affinity ligands, we proposed to link Dox and YEW (or WEY) in hopes of creating a bidentate ligand. In theory, such a ligand could have a binding affinity approaching the product of the two binding affinities of the individual ligands. For my internship project, I was charged with the task of creating libraries of compounds linking Dox and YEW (or WEY) with linkers of varying lengths (Figure 2a). In addition, I was to attach a fluorescein dye to the molecules (Figure 2b) so that they could be used to develop a fluorescence polarization (FP) binding assay. The FP assay will greatly increase the ease with which future ligands can be rapidly screened and binding affinities can be accurately determined. As a side project, I worked on optimizing the conditions necessary to employ the Huisgen 1,3-dipolar cycloaddition reaction to be able to optimize linker lengths and possibly compound solubility (Huisgen, 1984). This reaction, often termed ''click chemistry'', utilizes molecules terminally functionalized with either an acetylene moiety or an azide. In the presence of a copper(I) catalyst, the alkyne and azide undergo a step-wise cycloaddition reaction to link the two molecules together via the formation of a 1,4-disubstituted triazole ring (Figure 3; Rostovtsev et al., 2002). By varying the length of the tethers between the terminal acetylene or azide and their respective molecules, the overall length of the linker between the two molecules can be ''fine tuned'' by one carbon unit at a time. At the completion of my internship I had synthesized conjugates of Doxorubicin and N-acyl-WEY linked together by linkers having 0-2 polyethylene glycol (PEG) linkers. These compounds are currently being used in experiments that employ electrospray ionization mass spectrometry (ESI-MS) to determine whether they bind to TetC with higher affinity than either Dox or WEY alone. I also synthesized the fluorescein tagged versions of the same three molecules. It is expected that these molecules will be used in the near future to develop a fluorescence polarization-based competitive binding assay for TetC and possibly botulinum C-terminal fragment (BotC).« less

DFT-based molecular modeling and vibrational study of the La(III) complex of 3,3'-(benzylidene)bis(4-hydroxycoumarin).

PubMed

Mihaylov, Tzvetan; Trendafilova, Natasha; Georgieva, Ivelina

2008-05-01

Molecular modeling of the La(III) complex of 3,3'-(benzylidene)bis(4-hydroxycoumarin) (PhDC) was performed using density functional theory (DFT) methods at B3LYP/6-31G(d) and BP86/TZP levels. Both Stuttgart-Dresden effective core potential and ZORA approximation were applied to the La(III) center. The electron density distribution and the nucleophilic centers of the deprotonated ligand PhDC(2-) in a solvent environment were estimated on the basis of Hirshfeld atomic charges, electrostatic potential values at the nuclei, and Nalewajski-Mrozek bond orders. In accordance with the empirical formula La(PhDC)(OH)(H(2)O), a chain structure of the complex was simulated by means of two types of molecular fragment: (1) two La(III) cations bound to one PhDC(2-) ligand, and (2) two PhDC(2-) ligands bound to one La(III) cation. Different orientations of PhDC(2-), OH(-) and H(2)O ligands in the La(III) complexes were investigated using 20 possible [La(PhDC(2-))(2)(OH)(H(2)O)](2-) fragments. Energy calculations predicted that the prism-like structure based on "tail-head" cis-LML2 type binding and stabilized via HO...HOH intramolecular hydrogen bonds is the most probable structure for the La(III) complex. The calculated vibrational spectrum of the lowest energy La(III) model fragment is in very good agreement with the experimental IR spectrum of the complex, supporting the suggested ligand binding mode to La(III) in a chain structure, namely, every PhDC(2-) interacts with two La(III) cations through both carbonylic and both hydroxylic oxygens, and every La(III) cation binds four oxygen atoms of two different PhDC(2-).

Adaptations in Electronic Structure Calculations in Heterogeneous Environments

DOE Office of Scientific and Technical Information (OSTI.GOV)

Talamudupula, Sai

Modern quantum chemistry deals with electronic structure calculations of unprecedented complexity and accuracy. They demand full power of high-performance computing and must be in tune with the given architecture for superior e ciency. To make such applications resourceaware, it is desirable to enable their static and dynamic adaptations using some external software (middleware), which may monitor both system availability and application needs, rather than mix science with system-related calls inside the application. The present work investigates scienti c application interlinking with middleware based on the example of the computational chemistry package GAMESS and middleware NICAN. The existing synchronous model ismore » limited by the possible delays due to the middleware processing time under the sustainable runtime system conditions. Proposed asynchronous and hybrid models aim at overcoming this limitation. When linked with NICAN, the fragment molecular orbital (FMO) method is capable of adapting statically and dynamically its fragment scheduling policy based on the computing platform conditions. Signi cant execution time and throughput gains have been obtained due to such static adaptations when the compute nodes have very di erent core counts. Dynamic adaptations are based on the main memory availability at run time. NICAN prompts FMO to postpone scheduling certain fragments, if there is not enough memory for their immediate execution. Hence, FMO may be able to complete the calculations whereas without such adaptations it aborts.« less

Molecular dynamic simulation of Trastuzumab F(ab’)2 structure in corporation with HER2 as a theranostic agent of breast cancer

NASA Astrophysics Data System (ADS)

Hermanto, S.; Yusuf, M.; Mutalib, A.; Hudiyono, S.

2017-05-01

Trastuzumab as intact IgG are well researched for theranostic agent in HER2 overexpressed breast cancer. However, due to the relatively large of molecules it is slowly moved and weak penetration of the target cells. Fragmentation of trastzumab has been developed by pepsin cleavages to get the F(ab’)2 fragments. To observe the stability and accessibility of F(ab’)2 structure in corporation with HER2 (human epidermal growth factor receptor-2), the structure of antibody modeling had been developed with 1IGT as a template. Molecular dynamics (MD) of the F(ab’)2 structure simulation has been done in the aqueous phase with AMBER trajectories for 20 ns. Computational visualization by VMD (Visual Molecular Dynamics) were applied to identify binding site interaction details between trastuzumab F(ab’)2 and HER2 receptor. The results of MD simulations indicated that the fragmentation of trastuzumab F(ab’)2 did not change the structure and conformation of F(ab’)2 as a whole, especially in the CDR (Complementarity Determining Region) area. SASA (solvent accessibility surface area) analysis on lysine residues showed that formation of conjugate DOTA-F(ab’)2 predicted occur on outside of the CDR regions so its not interfered with binding affinity for the HER2 receptor. The molecular dynamic simulation of DOTA-F(ab’)2 with HER2 receptor in aqueous system generated ΔGbinding more highly (15.5066 kkal/mol) than positive control HER2-Fab (-45.1446 kkal/mol).

Lipid Microarray Biosensor for Biotoxin Detection.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Singh, Anup K.; Throckmorton, Daniel J.; Moran-Mirabal, Jose C.

2006-05-01

We present the use of micron-sized lipid domains, patterned onto planar substrates and within microfluidic channels, to assay the binding of bacterial toxins via total internal reflection fluorescence microscopy (TIRFM). The lipid domains were patterned using a polymer lift-off technique and consisted of ganglioside-populated DSPC:cholesterol supported lipid bilayers (SLBs). Lipid patterns were formed on the substrates by vesicle fusion followed by polymer lift-off, which revealed micron-sized SLBs containing either ganglioside GT1b or GM1. The ganglioside-populated SLB arrays were then exposed to either Cholera toxin subunit B (CTB) or Tetanus toxin fragment C (TTC). Binding was assayed on planar substrates bymore » TIRFM down to 1 nM concentration for CTB and 100 nM for TTC. Apparent binding constants extracted from three different models applied to the binding curves suggest that binding of a protein to a lipid-based receptor is strongly affected by the lipid composition of the SLB and by the substrate on which the bilayer is formed. Patterning of SLBs inside microfluidic channels also allowed the preparation of lipid domains with different compositions on a single device. Arrays within microfluidic channels were used to achieve segregation and selective binding from a binary mixture of the toxin fragments in one device. The binding and segregation within the microfluidic channels was assayed with epifluorescence as proof of concept. We propose that the method used for patterning the lipid microarrays on planar substrates and within microfluidic channels can be easily adapted to proteins or nucleic acids and can be used for biosensor applications and cell stimulation assays under different flow conditions. KEYWORDS. Microarray, ganglioside, polymer lift-off, cholera toxin, tetanus toxin, TIRFM, binding constant.4« less

Design of a multi-purpose fragment screening library using molecular complexity and orthogonal diversity metrics

NASA Astrophysics Data System (ADS)

Lau, Wan F.; Withka, Jane M.; Hepworth, David; Magee, Thomas V.; Du, Yuhua J.; Bakken, Gregory A.; Miller, Michael D.; Hendsch, Zachary S.; Thanabal, Venkataraman; Kolodziej, Steve A.; Xing, Li; Hu, Qiyue; Narasimhan, Lakshmi S.; Love, Robert; Charlton, Maura E.; Hughes, Samantha; van Hoorn, Willem P.; Mills, James E.

2011-07-01

Fragment Based Drug Discovery (FBDD) continues to advance as an efficient and alternative screening paradigm for the identification and optimization of novel chemical matter. To enable FBDD across a wide range of pharmaceutical targets, a fragment screening library is required to be chemically diverse and synthetically expandable to enable critical decision making for chemical follow-up and assessing new target druggability. In this manuscript, the Pfizer fragment library design strategy which utilized multiple and orthogonal metrics to incorporate structure, pharmacophore and pharmacological space diversity is described. Appropriate measures of molecular complexity were also employed to maximize the probability of detection of fragment hits using a variety of biophysical and biochemical screening methods. In addition, structural integrity, purity, solubility, fragment and analog availability as well as cost were important considerations in the selection process. Preliminary analysis of primary screening results for 13 targets using NMR Saturation Transfer Difference (STD) indicates the identification of uM-mM hits and the uniqueness of hits at weak binding affinities for these targets.

Design of a multi-purpose fragment screening library using molecular complexity and orthogonal diversity metrics.

PubMed

Lau, Wan F; Withka, Jane M; Hepworth, David; Magee, Thomas V; Du, Yuhua J; Bakken, Gregory A; Miller, Michael D; Hendsch, Zachary S; Thanabal, Venkataraman; Kolodziej, Steve A; Xing, Li; Hu, Qiyue; Narasimhan, Lakshmi S; Love, Robert; Charlton, Maura E; Hughes, Samantha; van Hoorn, Willem P; Mills, James E

2011-07-01

Fragment Based Drug Discovery (FBDD) continues to advance as an efficient and alternative screening paradigm for the identification and optimization of novel chemical matter. To enable FBDD across a wide range of pharmaceutical targets, a fragment screening library is required to be chemically diverse and synthetically expandable to enable critical decision making for chemical follow-up and assessing new target druggability. In this manuscript, the Pfizer fragment library design strategy which utilized multiple and orthogonal metrics to incorporate structure, pharmacophore and pharmacological space diversity is described. Appropriate measures of molecular complexity were also employed to maximize the probability of detection of fragment hits using a variety of biophysical and biochemical screening methods. In addition, structural integrity, purity, solubility, fragment and analog availability as well as cost were important considerations in the selection process. Preliminary analysis of primary screening results for 13 targets using NMR Saturation Transfer Difference (STD) indicates the identification of uM-mM hits and the uniqueness of hits at weak binding affinities for these targets.

Straightforward hit identification approach in fragment-based discovery of bromodomain-containing protein 4 (BRD4) inhibitors.

PubMed

Borysko, Petro; Moroz, Yurii S; Vasylchenko, Oleksandr V; Hurmach, Vasyl V; Starodubtseva, Anastasia; Stefanishena, Natalia; Nesteruk, Kateryna; Zozulya, Sergey; Kondratov, Ivan S; Grygorenko, Oleksandr O

2018-05-09

A combination approach of a fragment screening and "SAR by catalog" was used for the discovery of bromodomain-containing protein 4 (BRD4) inhibitors. Initial screening of 3695-fragment library against bromodomain 1 of BRD4 using thermal shift assay (TSA), followed by initial hit validation, resulted in 73 fragment hits, which were used to construct a follow-up library selected from available screening collection. Additionally, analogs of inactive fragments, as well as a set of randomly selected compounds were also prepared (3 × 3200 compounds in total). Screening of the resulting sets using TSA, followed by re-testing at several concentrations, counter-screen, and TR-FRET assay resulted in 18 confirmed hits. Compounds derived from the initial fragment set showed better hit rate as compared to the other two sets. Finally, building dose-response curves revealed three compounds with IC 50  = 1.9-7.4 μM. For these compounds, binding sites and conformations in the BRD4 (4UYD) have been determined by docking. Copyright © 2018 Elsevier Ltd. All rights reserved.

Reassembly of a bioluminescent protein Renilla luciferase directed through DNA hybridization.

PubMed

Cissell, Kyle A; Rahimi, Yasmeen; Shrestha, Suresh; Deo, Sapna K

2009-01-01

Reassembly of split reporter proteins, also referred to as protein complementation, is utilized in the detection of protein-protein or protein-nucleic acid interactions. In this strategy, a reporter protein is fragmented into two inactive polypeptides to which interacting/binding partners are fused. The interaction between fused partners leads to the formation of a reassembled, active reporter. In this Communication, we have presented a proof-of-concept for the detection of a target nucleic acid sequence based on the reassembly of the bioluminescent reporter Renilla luciferase (Rluc), which is driven by DNA hybridization. Although, reassembly of Rluc though protein interactions has been demonstrated by others, the Rluc reassembly through DNA hybridization has not been shown yet, which is the novelty of this work. It is well established that bioluminescence detection offers significant advantages due to the absence of any background signal. In our study, two rationally designed fragments of Rluc were conjugated to complementary oligonucleotide probes. Hybridization of the two probes with fused Rluc fragments resulted in the reassembly of the fragments, generating active Rluc, measurable by the intensity of light given off upon addition of coelenterazine. Our study also shows that the reassembly of Rluc can be inhibited by an oligonucleotide probe that competes to bind to the hybridized probe-Rluc fragment complex, indicating a potential strategy for the quantitative detection of target nucleic acid. We were able to achieve the reassembly of Rluc fused to oligonucleotide probes using femtomole amounts of the probe-fragment protein conjugate. This concentration is approximately 4 orders of magnitude less than that reported using green fluorescent protein (GFP) as the reporter. A DNA-driven Rluc reassembly study performed in a cellular matrix did not show any interference from the matrix.

Fragment Based Strategies for Discovery of Novel HIV-1 Reverse Transcriptase and Integrase Inhibitors.

PubMed

Latham, Catherine F; La, Jennifer; Tinetti, Ricky N; Chalmers, David K; Tachedjian, Gilda

2016-01-01

Human immunodeficiency virus (HIV) remains a global health problem. While combined antiretroviral therapy has been successful in controlling the virus in patients, HIV can develop resistance to drugs used for treatment, rendering available drugs less effective and limiting treatment options. Initiatives to find novel drugs for HIV treatment are ongoing, although traditional drug design approaches often focus on known binding sites for inhibition of established drug targets like reverse transcriptase and integrase. These approaches tend towards generating more inhibitors in the same drug classes already used in the clinic. Lack of diversity in antiretroviral drug classes can result in limited treatment options, as cross-resistance can emerge to a whole drug class in patients treated with only one drug from that class. A fresh approach in the search for new HIV-1 drugs is fragment-based drug discovery (FBDD), a validated strategy for drug discovery based on using smaller libraries of low molecular weight molecules (<300 Da) screened using primarily biophysical assays. FBDD is aimed at not only finding novel drug scaffolds, but also probing the target protein to find new, often allosteric, inhibitory binding sites. Several fragment-based strategies have been successful in identifying novel inhibitory sites or scaffolds for two proven drug targets for HIV-1, reverse transcriptase and integrase. While any FBDD-generated HIV-1 drugs have yet to enter the clinic, recent FBDD initiatives against these two well-characterised HIV-1 targets have reinvigorated antiretroviral drug discovery and the search for novel classes of HIV-1 drugs.

C-Terminus of Progranulin Interacts with the Beta-Propeller Region of Sortilin to Regulate Progranulin Trafficking

PubMed Central

Meng, Peter S.; Mao, Yuxin; Hu, Fenghua

2011-01-01

Progranulin haplo-insufficiency is a main cause of frontotemporal lobar degeneration (FTLD) with TDP-43 aggregates. Previous studies have shown that sortilin regulates progranulin trafficking and is a main determinant of progranulin level in the brain. In this study, we mapped the binding site between progranulin and sortilin. Progranulin binds to the beta-propeller region of sortilin through its C-terminal tail. The C-terminal progranulin fragment is fully sufficient for sortilin binding and progranulin C-terminal peptide displaces progranulin binding to sortilin. Deletion of the last 3 residues of progranulin (QLL) abolishes its binding to sortilin and also sortilin dependent regulation of progranulin trafficking. Since progranulin haplo-insufficiency results in FTLD, these results may provide important insights into future studies of progranulin trafficking and signaling and progranulin based therapy for FTLD. PMID:21698296

An accurate algorithm for the detection of DNA fragments from dilution pool sequencing experiments.

PubMed

Bansal, Vikas

2018-01-01

The short read lengths of current high-throughput sequencing technologies limit the ability to recover long-range haplotype information. Dilution pool methods for preparing DNA sequencing libraries from high molecular weight DNA fragments enable the recovery of long DNA fragments from short sequence reads. These approaches require computational methods for identifying the DNA fragments using aligned sequence reads and assembling the fragments into long haplotypes. Although a number of computational methods have been developed for haplotype assembly, the problem of identifying DNA fragments from dilution pool sequence data has not received much attention. We formulate the problem of detecting DNA fragments from dilution pool sequencing experiments as a genome segmentation problem and develop an algorithm that uses dynamic programming to optimize a likelihood function derived from a generative model for the sequence reads. This algorithm uses an iterative approach to automatically infer the mean background read depth and the number of fragments in each pool. Using simulated data, we demonstrate that our method, FragmentCut, has 25-30% greater sensitivity compared with an HMM based method for fragment detection and can also detect overlapping fragments. On a whole-genome human fosmid pool dataset, the haplotypes assembled using the fragments identified by FragmentCut had greater N50 length, 16.2% lower switch error rate and 35.8% lower mismatch error rate compared with two existing methods. We further demonstrate the greater accuracy of our method using two additional dilution pool datasets. FragmentCut is available from https://bansal-lab.github.io/software/FragmentCut. vibansal@ucsd.edu. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

Lead generation and examples opinion regarding how to follow up hits.

PubMed

Orita, Masaya; Ohno, Kazuki; Warizaya, Masaichi; Amano, Yasushi; Niimi, Tatsuya

2011-01-01

In fragment-based drug discovery (FBDD), not only identifying the starting fragment hit to be developed but also generating a drug lead from that starting fragment hit is important. Converting fragment hits to leads is generally similar to a high-throughput screening (HTS) hits-to-leads approach in that properties associated with activity for a target protein, such as selectivity against other targets and absorption, distribution, metabolism, excretion, and toxicity (ADME/Tox), and physicochemical properties should be taken into account. However, enhancing the potency of the fragment hit is a key requirement in FBDD, unlike HTS, because initial fragment hits are generally weak. This enhancement is presently achieved by adding additional chemical groups which bind to additional parts of the target protein or by joining or combining two or more hit fragments; however, strategies for effecting greater improvements in effective activity are needed. X-ray analysis is a key technology attractive for converting fragments to drug leads. This method makes it clear whether a fragment hit can act as an anchor and provides insight regarding introduction of functional groups to improve fragment activity. Data on follow-up chemical synthesis of fragment hits has allowed for the differentiation of four different strategies: fragment optimization, fragment linking, fragment self-assembly, and fragment evolution. Here, we discuss our opinion regarding how to follow up on fragment hits, with a focus on the importance of fragment hits as an anchor moiety to so-called hot spots in the target protein using crystallographic data. Copyright © 2011 Elsevier Inc. All rights reserved.

[Computational chemistry in structure-based drug design].

PubMed

Cao, Ran; Li, Wei; Sun, Han-Zi; Zhou, Yu; Huang, Niu

2013-07-01

Today, the understanding of the sequence and structure of biologically relevant targets is growing rapidly and researchers from many disciplines, physics and computational science in particular, are making significant contributions to modern biology and drug discovery. However, it remains challenging to rationally design small molecular ligands with desired biological characteristics based on the structural information of the drug targets, which demands more accurate calculation of ligand binding free-energy. With the rapid advances in computer power and extensive efforts in algorithm development, physics-based computational chemistry approaches have played more important roles in structure-based drug design. Here we reviewed the newly developed computational chemistry methods in structure-based drug design as well as the elegant applications, including binding-site druggability assessment, large scale virtual screening of chemical database, and lead compound optimization. Importantly, here we address the current bottlenecks and propose practical solutions.

Polyreactivity of natural antibodies: exchange by HL-fragments.

PubMed

Sedykh, M A; Buneva, V N; Nevinsky, G A

2013-12-01

The polyreactivity of binding (formation of antibody (AB) complexes not only with specific but also with foreign antigens) is a widespread phenomenon that in some cases can be caused by a conformational lability of the antigen-binding sites of antibodies (which increases upon treatment with various destabilizing agents) and leads to AB binding with very different antigens. Some ABs exist as dimers of the initial ABs and their idiotypes (or anti-idiotypes) capable of producing intramolecular cyclic complexes with features of polyreactants. Another mechanism of binding polyreactivity is an exchange in blood by halves of IgG4 molecules (HL-fragments) against various antigens. Also, for the first time catalytic polyfunctionality of human milk ABs has been detected, which is caused by an exchange by HL-fragments between molecules of λ- and κ-IgG (IgG1-IgG4) and also by λ- and κ-sIgA against different antigens with formation of very different chimeric antibodies. This review considers all possible pathways of formation of polyspecific immunoglobulins and their biological functions described in the literature, as well as mechanisms of binding polyreactivity and catalytic polyfunctionality of natural antibodies.

Discovery of novel STAT3 small molecule inhibitors via in silico site-directed fragment-based drug design.

PubMed

Yu, Wenying; Xiao, Hui; Lin, Jiayuh; Li, Chenglong

2013-06-13

Constitutive activation of signal transducer and activator of transcription 3 (STAT3) has been validated as an attractive therapeutic target for cancer therapy. To stop both STAT3 activation and dimerization, a viable strategy is to design inhibitors blocking its SH2 domain phosphotyrosine binding site that is responsible for both actions. A new fragment-based drug design (FBDD) strategy, in silico site-directed FBDD, was applied in this study. A designed novel compound, 5,8-dioxo-6-(pyridin-3-ylamino)-5,8-dihydronaphthalene-1-sulfonamide (LY5), was confirmed to bind to STAT3 SH2 by fluorescence polarization assay. In addition, four out of the five chosen compounds have IC50 values lower than 5 μM for the U2OS cancer cells. 8 (LY5) has an IC50 range in 0.5-1.4 μM in various cancer cell lines. 8 also suppresses tumor growth in an in vivo mouse model. This study has demonstrated the utility of this approach and could be used to other drug targets in general.

Electrostatic field of the large fragment of Escherichia coli DNA polymerase I.

PubMed

Warwicker, J; Ollis, D; Richards, F M; Steitz, T A

1985-12-05

The electrostatic field of the large fragment of Escherichia coli DNA polymerase I (Klenow fragment) has been calculated by the finite difference procedure on a 2 A grid. The potential field is substantially negative at physiological pH (reflecting the net negative charge at this pH). The largest regions of positive potential are in the deep crevice of the C-terminal domain, which is the proposed binding site for the DNA substrate. Within the crevice, the electrostatic potential has a partly helical form. If the DNA is positioned to fulfil stereochemical requirements, then the positive potential generally follows the major groove and (to a lesser extent) the negative potential is in the minor groove. Such an arrangement could stabilize DNA configurations related by screw symmetry. The histidine residues of the Klenow fragment give the positive field of the groove a sensitivity to relatively small pH changes around neutrality. We suggest that the histidine residues could change their ionization states in response to DNA binding, and that this effect could contribute to the protein-DNA binding energy.

Advances in phage display technology for drug discovery.

PubMed

Omidfar, Kobra; Daneshpour, Maryam

2015-06-01

Over the past decade, several library-based methods have been developed to discover ligands with strong binding affinities for their targets. These methods mimic the natural evolution for screening and identifying ligand-target interactions with specific functional properties. Phage display technology is a well-established method that has been applied to many technological challenges including novel drug discovery. This review describes the recent advances in the use of phage display technology for discovering novel bioactive compounds. Furthermore, it discusses the application of this technology to produce proteins and peptides as well as minimize the use of antibodies, such as antigen-binding fragment, single-chain fragment variable or single-domain antibody fragments like VHHs. Advances in screening, manufacturing and humanization technologies demonstrate that phage display derived products can play a significant role in the diagnosis and treatment of disease. The effects of this technology are inevitable in the development pipeline for bringing therapeutics into the market, and this number is expected to rise significantly in the future as new advances continue to take place in display methods. Furthermore, a widespread application of this methodology is predicted in different medical technological areas, including biosensing, monitoring, molecular imaging, gene therapy, vaccine development and nanotechnology.

Computational Study of Pseudo-phosphorylation of the Microtubule associated Protein Tau

NASA Astrophysics Data System (ADS)

Prokopovich, Dmitriy; Larini, Luca

This computational study focuses on the effect of pseudo-phosphorylation on the aggregation of the microtubule associated protein tau. In the axon of the neuron, tau regulates the assembly of microtubules in the cytoskeleton. This is important for both stabilization of and transport across the microtubules. One of the hallmarks of the Alzheimer's disease is that tau is hyper-phosphorylated and aggregates into neurofibrillary tangles that lay waste to the neurons. It is not known if hyper-phosphorylation directly causes the aggregation of tau into tangles. Experimentally, pseudo-phosphorylation mimics the effects of phosphorylation by mutating certain residues of the protein chain into charged residues. In this study, we will consider the fragment called PHF43 that belongs to the microtubule binding region and has been shown to readily aggregate.

MaPLE: A MapReduce Pipeline for Lattice-based Evaluation and Its Application to SNOMED CT

PubMed Central

Zhang, Guo-Qiang; Zhu, Wei; Sun, Mengmeng; Tao, Shiqiang; Bodenreider, Olivier; Cui, Licong

2015-01-01

Non-lattice fragments are often indicative of structural anomalies in ontological systems and, as such, represent possible areas of focus for subsequent quality assurance work. However, extracting the non-lattice fragments in large ontological systems is computationally expensive if not prohibitive, using a traditional sequential approach. In this paper we present a general MapReduce pipeline, called MaPLE (MapReduce Pipeline for Lattice-based Evaluation), for extracting non-lattice fragments in large partially ordered sets and demonstrate its applicability in ontology quality assurance. Using MaPLE in a 30-node Hadoop local cloud, we systematically extracted non-lattice fragments in 8 SNOMED CT versions from 2009 to 2014 (each containing over 300k concepts), with an average total computing time of less than 3 hours per version. With dramatically reduced time, MaPLE makes it feasible not only to perform exhaustive structural analysis of large ontological hierarchies, but also to systematically track structural changes between versions. Our change analysis showed that the average change rates on the non-lattice pairs are up to 38.6 times higher than the change rates of the background structure (concept nodes). This demonstrates that fragments around non-lattice pairs exhibit significantly higher rates of change in the process of ontological evolution. PMID:25705725

MaPLE: A MapReduce Pipeline for Lattice-based Evaluation and Its Application to SNOMED CT.

PubMed

Zhang, Guo-Qiang; Zhu, Wei; Sun, Mengmeng; Tao, Shiqiang; Bodenreider, Olivier; Cui, Licong

2014-10-01

Non-lattice fragments are often indicative of structural anomalies in ontological systems and, as such, represent possible areas of focus for subsequent quality assurance work. However, extracting the non-lattice fragments in large ontological systems is computationally expensive if not prohibitive, using a traditional sequential approach. In this paper we present a general MapReduce pipeline, called MaPLE (MapReduce Pipeline for Lattice-based Evaluation), for extracting non-lattice fragments in large partially ordered sets and demonstrate its applicability in ontology quality assurance. Using MaPLE in a 30-node Hadoop local cloud, we systematically extracted non-lattice fragments in 8 SNOMED CT versions from 2009 to 2014 (each containing over 300k concepts), with an average total computing time of less than 3 hours per version. With dramatically reduced time, MaPLE makes it feasible not only to perform exhaustive structural analysis of large ontological hierarchies, but also to systematically track structural changes between versions. Our change analysis showed that the average change rates on the non-lattice pairs are up to 38.6 times higher than the change rates of the background structure (concept nodes). This demonstrates that fragments around non-lattice pairs exhibit significantly higher rates of change in the process of ontological evolution.

Renormalized coupled cluster approaches in the cluster-in-molecule framework: predicting vertical electron binding energies of the anionic water clusters (H2O)(n)(-).

PubMed

Xu, Peng; Gordon, Mark S

2014-09-04

Anionic water clusters are generally considered to be extremely challenging to model using fragmentation approaches due to the diffuse nature of the excess electron distribution. The local correlation coupled cluster (CC) framework cluster-in-molecule (CIM) approach combined with the completely renormalized CR-CC(2,3) method [abbreviated CIM/CR-CC(2,3)] is shown to be a viable alternative for computing the vertical electron binding energies (VEBE). CIM/CR-CC(2,3) with the threshold parameter ζ set to 0.001, as a trade-off between accuracy and computational cost, demonstrates the reliability of predicting the VEBE, with an average percentage error of ∼15% compared to the full ab initio calculation at the same level of theory. The errors are predominantly from the electron correlation energy. The CIM/CR-CC(2,3) approach provides the ease of a black-box type calculation with few threshold parameters to manipulate. The cluster sizes that can be studied by high-level ab initio methods are significantly increased in comparison with full CC calculations. Therefore, the VEBE computed by the CIM/CR-CC(2,3) method can be used as benchmarks for testing model potential approaches in small-to-intermediate-sized water clusters.

Neutralizing activity and protective immunity to ricin toxin conferred by B subunit (RTB)-specific Fab fragments.

PubMed

Yermakova, Anastasiya; Mantis, Nicholas J

2013-09-01

SylH3 and 24B11 are murine monoclonal antibodies directed against different epitopes on ricin toxin's binding (RTB) subunit that have been shown to passively protect mice against ricin challenge. Here we report that Fab fragments of SylH3 and 24B11 neutralize ricin in a cell based assay, and in a mouse challenge model as effectively as their respective full length parental IgGs. These data demonstrate that immunity to ricin can occur independent of Fc-mediated clearance. Copyright © 2013 Elsevier Ltd. All rights reserved.

Molecular blueprint of allosteric binding sites in a homologue of the agonist-binding domain of the α7 nicotinic acetylcholine receptor

PubMed Central

Spurny, Radovan; Debaveye, Sarah; Farinha, Ana; Veys, Ken; Vos, Ann M.; Gossas, Thomas; Atack, John; Bertrand, Sonia; Bertrand, Daniel; Danielson, U. Helena; Tresadern, Gary; Ulens, Chris

2015-01-01

The α7 nicotinic acetylcholine receptor (nAChR) belongs to the family of pentameric ligand-gated ion channels and is involved in fast synaptic signaling. In this study, we take advantage of a recently identified chimera of the extracellular domain of the native α7 nicotinic acetylcholine receptor and acetylcholine binding protein, termed α7-AChBP. This chimeric receptor was used to conduct an innovative fragment-library screening in combination with X-ray crystallography to identify allosteric binding sites. One allosteric site is surface-exposed and is located near the N-terminal α-helix of the extracellular domain. Ligand binding at this site causes a conformational change of the α-helix as the fragment wedges between the α-helix and a loop homologous to the main immunogenic region of the muscle α1 subunit. A second site is located in the vestibule of the receptor, in a preexisting intrasubunit pocket opposite the agonist binding site and corresponds to a previously identified site involved in positive allosteric modulation of the bacterial homolog ELIC. A third site is located at a pocket right below the agonist binding site. Using electrophysiological recordings on the human α7 nAChR we demonstrate that the identified fragments, which bind at these sites, can modulate receptor activation. This work presents a structural framework for different allosteric binding sites in the α7 nAChR and paves the way for future development of novel allosteric modulators with therapeutic potential. PMID:25918415

Lead identification for the K-Ras protein: virtual screening and combinatorial fragment-based approaches

PubMed Central

Pathan, Akbar Ali Khan; Panthi, Bhavana; Khan, Zahid; Koppula, Purushotham Reddy; Alanazi, Mohammed Saud; Sachchidanand; Parine, Narasimha Reddy; Chourasia, Mukesh

2016-01-01

Objective Kirsten rat sarcoma (K-Ras) protein is a member of Ras family belonging to the small guanosine triphosphatases superfamily. The members of this family share a conserved structure and biochemical properties, acting as binary molecular switches. The guanosine triphosphate-bound active K-Ras interacts with a range of effectors, resulting in the stimulation of downstream signaling pathways regulating cell proliferation, differentiation, and apoptosis. Efforts to target K-Ras have been unsuccessful until now, placing it among high-value molecules against which developing a therapy would have an enormous impact. K-Ras transduces signals when it binds to guanosine triphosphate by directly binding to downstream effector proteins, but in case of guanosine diphosphate-bound conformation, these interactions get disrupted. Methods In the present study, we targeted the nucleotide-binding site in the “on” and “off” state conformations of the K-Ras protein to find out suitable lead compounds. A structure-based virtual screening approach has been used to screen compounds from different databases, followed by a combinatorial fragment-based approach to design the apposite lead for the K-Ras protein. Results Interestingly, the designed compounds exhibit a binding preference for the “off” state over “on” state conformation of K-Ras protein. Moreover, the designed compounds’ interactions are similar to guanosine diphosphate and, thus, could presumably act as a potential lead for K-Ras. The predicted drug-likeness properties of these compounds suggest that these compounds follow the Lipinski’s rule of five and have tolerable absorption, distribution, metabolism, excretion and toxicity values. Conclusion Thus, through the current study, we propose targeting only “off” state conformations as a promising strategy for the design of reversible inhibitors to pharmacologically inhibit distinct conformations of K-Ras protein. PMID:27217775

Acanthamoeba castellanii contains a ribosomal RNA enhancer binding protein which stimulates TIF-IB binding and transcription under stringent conditions.

PubMed

Yang, Q; Radebaugh, C A; Kubaska, W; Geiss, G K; Paule, M R

1995-11-11

The intergenic spacer (IGS) of Acanthamoeba castellanii rRNA genes contains repeated elements which are weak enhancers for transcription by RNA polymerase I. A protein, EBF, was identified and partially purified which binds to the enhancers and to several other sequences within the IGS, but not to other DNA fragments, including the rRNA core promoter. No consensus binding sequence could be discerned in these fragments and bound factor is in rapid equilibrium with unbound. EBF has functional characteristics similar to vertebrate upstream binding factors (UBF). Not only does it bind to the enhancer and other IGS elements, but it also stimulates binding of TIF-IB, the fundamental transcription initiation factor, to the core promoter and stimulates transcription from the promoter. Attempts to identify polypeptides with epitopes similar to rat or Xenopus laevis UBF suggest that structurally the protein from A.castellanii is not closely related to vertebrate UBF.

Acanthamoeba castellanii contains a ribosomal RNA enhancer binding protein which stimulates TIF-IB binding and transcription under stringent conditions.

PubMed Central

Yang, Q; Radebaugh, C A; Kubaska, W; Geiss, G K; Paule, M R

1995-01-01

The intergenic spacer (IGS) of Acanthamoeba castellanii rRNA genes contains repeated elements which are weak enhancers for transcription by RNA polymerase I. A protein, EBF, was identified and partially purified which binds to the enhancers and to several other sequences within the IGS, but not to other DNA fragments, including the rRNA core promoter. No consensus binding sequence could be discerned in these fragments and bound factor is in rapid equilibrium with unbound. EBF has functional characteristics similar to vertebrate upstream binding factors (UBF). Not only does it bind to the enhancer and other IGS elements, but it also stimulates binding of TIF-IB, the fundamental transcription initiation factor, to the core promoter and stimulates transcription from the promoter. Attempts to identify polypeptides with epitopes similar to rat or Xenopus laevis UBF suggest that structurally the protein from A.castellanii is not closely related to vertebrate UBF. Images PMID:7501455

Theoretical Investigations of Well-Defined Graphene Nanostructures: Catalysis, Spectroscopy, and Development of Novel Fragment-Based Models

NASA Astrophysics Data System (ADS)

Noffke, Benjamin W.

Carbon materials have the potential to replace some precious metals in renewable energy applications. These materials are particularly attractive because of the elemental abundance and relatively low nuclear mass of carbon, implying economically feasible and lightweight materials. Targeted design of carbon materials is hindered by the lack of fundamental understanding that is required to tailor their properties for the desired application. However, most available synthetic methods to create carbon materials involve harsh conditions that limit the control of the resulting structure. Without a well-defined structure, the system is too complex and fundamental studies cannot be definitive. This work seeks to gain fundamental understanding through the development and application of efficient computational models for these systems, in conjunction with experiments performed on soluble, well-defined graphene nanostructures prepared by our group using a bottom-up synthetic approach. Theory is used to determine mechanistic details for well-defined carbon systems in applications of catalysis and electrochemical transformations. The resulting computational models do well to explain previous observations of carbon materials and provide suggestions for future directions. However, as the system size of the nanostructures gets larger, the computational cost can become prohibitive. To reduce the computational scaling of quantum chemical calculations, a new fragmentation scheme has been developed that addresses the challenges of fragmenting conjugated molecules. By selecting fragments that retain important structural characteristics in graphene, a more efficient method is achieved. The new method paves the way for an automated, systematic fragmentation scheme of graphene molecules.

Computational redesign of bacterial biotin carboxylase inhibitors using structure-based virtual screening of combinatorial libraries.

PubMed

Brylinski, Michal; Waldrop, Grover L

2014-04-02

As the spread of antibiotic resistant bacteria steadily increases, there is an urgent need for new antibacterial agents. Because fatty acid synthesis is only used for membrane biogenesis in bacteria, the enzymes in this pathway are attractive targets for antibacterial agent development. Acetyl-CoA carboxylase catalyzes the committed and regulated step in fatty acid synthesis. In bacteria, the enzyme is composed of three distinct protein components: biotin carboxylase, biotin carboxyl carrier protein, and carboxyltransferase. Fragment-based screening revealed that amino-oxazole inhibits biotin carboxylase activity and also exhibits antibacterial activity against Gram-negative organisms. In this report, we redesigned previously identified lead inhibitors to expand the spectrum of bacteria sensitive to the amino-oxazole derivatives by including Gram-positive species. Using 9,411 small organic building blocks, we constructed a diverse combinatorial library of 1.2×10⁸ amino-oxazole derivatives. A subset of 9×10⁶ of these compounds were subjected to structure-based virtual screening against seven biotin carboxylase isoforms using similarity-based docking by eSimDock. Potentially broad-spectrum antibiotic candidates were selected based on the consensus ranking by several scoring functions including non-linear statistical models implemented in eSimDock and traditional molecular mechanics force fields. The analysis of binding poses of the top-ranked compounds docked to biotin carboxylase isoforms suggests that: (1) binding of the amino-oxazole anchor is stabilized by a network of hydrogen bonds to residues 201, 202 and 204; (2) halogenated aromatic moieties attached to the amino-oxazole scaffold enhance interactions with a hydrophobic pocket formed by residues 157, 169, 171 and 203; and (3) larger substituents reach deeper into the binding pocket to form additional hydrogen bonds with the side chains of residues 209 and 233. These structural insights into drug-biotin carboxylase interactions will be tested experimentally in in vitro and in vivo systems to increase the potency of amino-oxazole inhibitors towards both Gram-negative as well as Gram-positive species.

The feasibility of an efficient drug design method with high-performance computers.

PubMed

Yamashita, Takefumi; Ueda, Akihiko; Mitsui, Takashi; Tomonaga, Atsushi; Matsumoto, Shunji; Kodama, Tatsuhiko; Fujitani, Hideaki

2015-01-01

In this study, we propose a supercomputer-assisted drug design approach involving all-atom molecular dynamics (MD)-based binding free energy prediction after the traditional design/selection step. Because this prediction is more accurate than the empirical binding affinity scoring of the traditional approach, the compounds selected by the MD-based prediction should be better drug candidates. In this study, we discuss the applicability of the new approach using two examples. Although the MD-based binding free energy prediction has a huge computational cost, it is feasible with the latest 10 petaflop-scale computer. The supercomputer-assisted drug design approach also involves two important feedback procedures: The first feedback is generated from the MD-based binding free energy prediction step to the drug design step. While the experimental feedback usually provides binding affinities of tens of compounds at one time, the supercomputer allows us to simultaneously obtain the binding free energies of hundreds of compounds. Because the number of calculated binding free energies is sufficiently large, the compounds can be classified into different categories whose properties will aid in the design of the next generation of drug candidates. The second feedback, which occurs from the experiments to the MD simulations, is important to validate the simulation parameters. To demonstrate this, we compare the binding free energies calculated with various force fields to the experimental ones. The results indicate that the prediction will not be very successful, if we use an inaccurate force field. By improving/validating such simulation parameters, the next prediction can be made more accurate.

Yoink: An interaction-based partitioning API.

PubMed

Zheng, Min; Waller, Mark P

2018-05-15

Herein, we describe the implementation details of our interaction-based partitioning API (application programming interface) called Yoink for QM/MM modeling and fragment-based quantum chemistry studies. Interactions are detected by computing density descriptors such as reduced density gradient, density overlap regions indicator, and single exponential decay detector. Only molecules having an interaction with a user-definable QM core are added to the QM region of a hybrid QM/MM calculation. Moreover, a set of molecule pairs having density-based interactions within a molecular system can be computed in Yoink, and an interaction graph can then be constructed. Standard graph clustering methods can then be applied to construct fragments for further quantum chemical calculations. The Yoink API is licensed under Apache 2.0 and can be accessed via yoink.wallerlab.org. © 2018 Wiley Periodicals, Inc. © 2018 Wiley Periodicals, Inc.

Antimicrobial Effects of Helix D-derived Peptides of Human Antithrombin III*

PubMed Central

Papareddy, Praveen; Kalle, Martina; Bhongir, Ravi K. V.; Mörgelin, Matthias; Malmsten, Martin; Schmidtchen, Artur

2014-01-01

Antithrombin III (ATIII) is a key antiproteinase involved in blood coagulation. Previous investigations have shown that ATIII is degraded by Staphylococcus aureus V8 protease, leading to release of heparin binding fragments derived from its D helix. As heparin binding and antimicrobial activity of peptides frequently overlap, we here set out to explore possible antibacterial effects of intact and degraded ATIII. In contrast to intact ATIII, the results showed that extensive degradation of the molecule yielded fragments with antimicrobial activity. Correspondingly, the heparin-binding, helix d-derived, peptide FFFAKLNCRLYRKANKSSKLV (FFF21) of human ATIII, was found to be antimicrobial against particularly the Gram-negative bacteria Escherichia coli and Pseudomonas aeruginosa. Fluorescence microscopy and electron microscopy studies demonstrated that FFF21 binds to and permeabilizes bacterial membranes. Analogously, FFF21 was found to induce membrane leakage of model anionic liposomes. In vivo, FFF21 significantly reduced P. aeruginosa infection in mice. Additionally, FFF21 displayed anti-endotoxic effects in vitro. Taken together, our results suggest novel roles for ATIII-derived peptide fragments in host defense. PMID:25202017

Antimicrobial effects of helix D-derived peptides of human antithrombin III.

PubMed

Papareddy, Praveen; Kalle, Martina; Bhongir, Ravi K V; Mörgelin, Matthias; Malmsten, Martin; Schmidtchen, Artur

2014-10-24

Antithrombin III (ATIII) is a key antiproteinase involved in blood coagulation. Previous investigations have shown that ATIII is degraded by Staphylococcus aureus V8 protease, leading to release of heparin binding fragments derived from its D helix. As heparin binding and antimicrobial activity of peptides frequently overlap, we here set out to explore possible antibacterial effects of intact and degraded ATIII. In contrast to intact ATIII, the results showed that extensive degradation of the molecule yielded fragments with antimicrobial activity. Correspondingly, the heparin-binding, helix D-derived, peptide FFFAKLNCRLYRKANKSSKLV (FFF21) of human ATIII, was found to be antimicrobial against particularly the Gram-negative bacteria Escherichia coli and Pseudomonas aeruginosa. Fluorescence microscopy and electron microscopy studies demonstrated that FFF21 binds to and permeabilizes bacterial membranes. Analogously, FFF21 was found to induce membrane leakage of model anionic liposomes. In vivo, FFF21 significantly reduced P. aeruginosa infection in mice. Additionally, FFF21 displayed anti-endotoxic effects in vitro. Taken together, our results suggest novel roles for ATIII-derived peptide fragments in host defense. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

Dynamics and Molecular Determinants of Cytoplasmic Lipid Droplet Clustering and Dispersion

PubMed Central

Stefanski, Adrianne L.; McManaman, James L.

2013-01-01

Perilipin-1 (Plin1), a prominent cytoplasmic lipid droplet (CLD) binding phosphoprotein and key physiological regulator of triglyceride storage and lipolysis in adipocytes, is thought to regulate the fragmentation and dispersion of CLD that occurs in response to β-adrenergic activation of adenylate cyclase. Here we investigate the dynamics and molecular determinants of these processes using cell lines stably expressing recombinant forms of Plin1 and/or other members of the perilipin family. Plin1 and a C-terminal CLD-binding fragment of Plin1 (Plin1CT) induced formation of single dense CLD clusters near the microtubule organizing center, whereas neither an N-terminal CLD-binding fragment of Plin1, nor Plin2 or Plin3 induced clustering. Clustered CLD coated by Plin1, or Plin1CT, dispersed in response to isoproterenol, or other agents that activate adenylate cyclase, in a process inhibited by the protein kinase A inhibitor, H89, and blocked by microtubule disruption. Isoproterenol-stimulated phosphorylation of CLD-associated Plin1 on serine 492 preceded their dispersion, and live cell imaging showed that cluster dispersion involved initial fragmentation of tight clusters into multiple smaller clusters, which then fragmented into well-dispersed individual CLD. siRNA knockdown of the cortical actin binding protein, moesin, induced disaggregation of tight clusters into multiple smaller clusters, and inhibited the reaggregation of dispersed CLD into tight clusters. Together these data suggest that the clustering and dispersion processes involve a complex orchestration of phosphorylation-dependent, microtubule-dependent and independent, and microfilament dependent steps. PMID:23825572

The PRC2-binding long non-coding RNAs in human and mouse genomes are associated with predictive sequence features

NASA Astrophysics Data System (ADS)

Tu, Shiqi; Yuan, Guo-Cheng; Shao, Zhen

2017-01-01

Recently, long non-coding RNAs (lncRNAs) have emerged as an important class of molecules involved in many cellular processes. One of their primary functions is to shape epigenetic landscape through interactions with chromatin modifying proteins. However, mechanisms contributing to the specificity of such interactions remain poorly understood. Here we took the human and mouse lncRNAs that were experimentally determined to have physical interactions with Polycomb repressive complex 2 (PRC2), and systematically investigated the sequence features of these lncRNAs by developing a new computational pipeline for sequences composition analysis, in which each sequence is considered as a series of transitions between adjacent nucleotides. Through that, PRC2-binding lncRNAs were found to be associated with a set of distinctive and evolutionarily conserved sequence features, which can be utilized to distinguish them from the others with considerable accuracy. We further identified fragments of PRC2-binding lncRNAs that are enriched with these sequence features, and found they show strong PRC2-binding signals and are more highly conserved across species than the other parts, implying their functional importance.

Signatures of van der Waals binding: A coupling-constant scaling analysis

NASA Astrophysics Data System (ADS)

Jiao, Yang; Schröder, Elsebeth; Hyldgaard, Per

2018-02-01

The van der Waals (vdW) density functional (vdW-DF) method [Rep. Prog. Phys. 78, 066501 (2015), 10.1088/0034-4885/78/6/066501] describes dispersion or vdW binding by tracking the effects of an electrodynamic coupling among pairs of electrons and their associated exchange-correlation holes. This is done in a nonlocal-correlation energy term Ecnl, which permits density functional theory calculation in the Kohn-Sham scheme. However, to map the nature of vdW forces in a fully interacting materials system, it is necessary to also account for associated kinetic-correlation energy effects. Here, we present a coupling-constant scaling analysis, which permits us to compute the kinetic-correlation energy Tcnl that is specific to the vdW-DF account of nonlocal correlations. We thus provide a more complete spatially resolved analysis of the electrodynamical-coupling nature of nonlocal-correlation binding, including vdW attraction, in both covalently and noncovalently bonded systems. We find that kinetic-correlation energy effects play a significant role in the account of vdW or dispersion interactions among molecules. Furthermore, our mapping shows that the total nonlocal-correlation binding is concentrated to pockets in the sparse electron distribution located between the material fragments.

Nucleic acid is a novel ligand for innate, immune pattern recognition collectins surfactant proteins A and D and mannose-binding lectin.

PubMed

Palaniyar, Nades; Nadesalingam, Jeya; Clark, Howard; Shih, Michael J; Dodds, Alister W; Reid, Kenneth B M

2004-07-30

Collectins are a family of innate immune proteins that contain fibrillar collagen-like regions and globular carbohydrate recognition domains (CRDs). The CRDs of these proteins recognize various microbial surface-specific carbohydrate patterns, particularly hexoses. We hypothesized that collectins, such as pulmonary surfactant proteins (SPs) SP-A and SP-D and serum protein mannose-binding lectin, could recognize nucleic acids, pentose-based anionic phosphate polymers. Here we show that collectins bind DNA from a variety of origins, including bacteria, mice, and synthetic oligonucleotides. Pentoses, such as arabinose, ribose, and deoxyribose, inhibit the interaction between SP-D and mannan, one of the well-studied hexose ligands for SP-D, and biologically relevant d-forms of the pentoses are better competitors than the l-forms. In addition, DNA and RNA polymer-related compounds, such as nucleotide diphosphates and triphosphates, also inhibit the carbohydrate binding ability of SP-D, or approximately 60 kDa trimeric recombinant fragments of SP-D that are composed of the alpha-helical coiled-coil neck region and three CRDs (SP-D(n/CRD)) or SP-D(n/CRD) with eight GXY repeats (SPD(GXY)(8)(n/CRD)). Direct binding and competition studies suggest that collectins bind nucleic acid via their CRDs as well as by their collagen-like regions, and that SP-D binds DNA more effectively than do SP-A and mannose-binding lectin at physiological salt conditions. Furthermore, the SP-D(GXY)(8)(n/CRD) fragments co-localize with DNA, and the protein competes the interaction between propidium iodide, a DNA-binding dye, and apoptotic cells. In conclusion, we show that collectins are a new class of proteins that bind free DNA and the DNA present on apoptotic cells by both their globular CRDs and collagen-like regions. Collectins may therefore play an important role in decreasing the inflammation caused by DNA in lungs and other tissues.

Physics-Based Fragment Acceleration Modeling for Pressurized Tank Burst Risk Assessments

NASA Technical Reports Server (NTRS)

Manning, Ted A.; Lawrence, Scott L.

2014-01-01

As part of comprehensive efforts to develop physics-based risk assessment techniques for space systems at NASA, coupled computational fluid and rigid body dynamic simulations were carried out to investigate the flow mechanisms that accelerate tank fragments in bursting pressurized vessels. Simulations of several configurations were compared to analyses based on the industry-standard Baker explosion model, and were used to formulate an improved version of the model. The standard model, which neglects an external fluid, was found to agree best with simulation results only in configurations where the internal-to-external pressure ratio is very high and fragment curvature is small. The improved model introduces terms that accommodate an external fluid and better account for variations based on circumferential fragment count. Physics-based analysis was critical in increasing the model's range of applicability. The improved tank burst model can be used to produce more accurate risk assessments of space vehicle failure modes that involve high-speed debris, such as exploding propellant tanks and bursting rocket engines.

Alignment-independent comparison of binding sites based on DrugScore potential fields encoded by 3D Zernike descriptors.

PubMed

Nisius, Britta; Gohlke, Holger

2012-09-24

Analyzing protein binding sites provides detailed insights into the biological processes proteins are involved in, e.g., into drug-target interactions, and so is of crucial importance in drug discovery. Herein, we present novel alignment-independent binding site descriptors based on DrugScore potential fields. The potential fields are transformed to a set of information-rich descriptors using a series expansion in 3D Zernike polynomials. The resulting Zernike descriptors show a promising performance in detecting similarities among proteins with low pairwise sequence identities that bind identical ligands, as well as within subfamilies of one target class. Furthermore, the Zernike descriptors are robust against structural variations among protein binding sites. Finally, the Zernike descriptors show a high data compression power, and computing similarities between binding sites based on these descriptors is highly efficient. Consequently, the Zernike descriptors are a useful tool for computational binding site analysis, e.g., to predict the function of novel proteins, off-targets for drug candidates, or novel targets for known drugs.

Mass spectrometry of cis-diamminedichloroplatinum(II) adducts with the dinucleosidemonophosphates d(ApG), d(GpG) and d(TpC) in an ion trap.

PubMed

Hagemeister, Timo; Linscheid, Michael

2002-07-01

The detection and fragmentation behaviour of adducts of the chemotherapeutic cis-diamminedichloroplatinum(II) (cisplatin) with the dinucleosidemonophosphates d(ApG), d(GpG) and d(TpC) as model compounds for DNA adducts in an ion trap with electrospray ionization were studied. Mainly the monofunctional adduct, the bifunctional adduct and the bifunctional adduct with platinum bridging two dinucleosidemonophosphates were detected. In addition, several more complex adducts were seen resulting from reactions among these species. Adduct formation was low in the case of d(TpC). Fragmentation could be controlled strongly by varying the temperature of the transfer capillary; furthermore, tandem mass spectrometric (MS/MS) experiments on both the monofunctional and the bifunctional adducts were performed. For the adducts of d(ApG) and d(GpG) losses of NH(3) and HCl were the most dominant reactions, followed by the losses of one, then another two units of 98 amu from the sugar-phosphate backbone, whereas d(TpC)-Pt predominantly forms the dinucleosidemonophosphate. In the gas phase, the conversion of the monofunctional into the bifunctional adducts through binding to another site in the dinucleotide accompanied by loss of NH(3) or HCl could also be observed. The removal of a ligand from the coordination sphere of the square-planar platinum complexes appeared to be the crucial step for the induction of further fragmentation of the dinucleotide ligand. MS(n) experiments of the bifunctional adducts of d(ApG) and d(GpG) revealed different fragmentation pathways involving the loss of phosphoric acid, metaphosphoric acid, deoxyribose units (intact or dehydrated) and the nucleobases in different orders, leaving characteristic binding site-determining fragments. Fragmentation of these ions was also performed, mainly resulting in fragmentation of the bases. The study confirmed the remarkable stability of the platinum-guanine bond compared with other nucleobases. Copyright 2002 John Wiley & Sons, Ltd.

Genomic signal processing methods for computation of alignment-free distances from DNA sequences.

PubMed

Borrayo, Ernesto; Mendizabal-Ruiz, E Gerardo; Vélez-Pérez, Hugo; Romo-Vázquez, Rebeca; Mendizabal, Adriana P; Morales, J Alejandro

2014-01-01

Genomic signal processing (GSP) refers to the use of digital signal processing (DSP) tools for analyzing genomic data such as DNA sequences. A possible application of GSP that has not been fully explored is the computation of the distance between a pair of sequences. In this work we present GAFD, a novel GSP alignment-free distance computation method. We introduce a DNA sequence-to-signal mapping function based on the employment of doublet values, which increases the number of possible amplitude values for the generated signal. Additionally, we explore the use of three DSP distance metrics as descriptors for categorizing DNA signal fragments. Our results indicate the feasibility of employing GAFD for computing sequence distances and the use of descriptors for characterizing DNA fragments.

Genomic Signal Processing Methods for Computation of Alignment-Free Distances from DNA Sequences

PubMed Central

Borrayo, Ernesto; Mendizabal-Ruiz, E. Gerardo; Vélez-Pérez, Hugo; Romo-Vázquez, Rebeca; Mendizabal, Adriana P.; Morales, J. Alejandro

2014-01-01

Genomic signal processing (GSP) refers to the use of digital signal processing (DSP) tools for analyzing genomic data such as DNA sequences. A possible application of GSP that has not been fully explored is the computation of the distance between a pair of sequences. In this work we present GAFD, a novel GSP alignment-free distance computation method. We introduce a DNA sequence-to-signal mapping function based on the employment of doublet values, which increases the number of possible amplitude values for the generated signal. Additionally, we explore the use of three DSP distance metrics as descriptors for categorizing DNA signal fragments. Our results indicate the feasibility of employing GAFD for computing sequence distances and the use of descriptors for characterizing DNA fragments. PMID:25393409

Machine learning in computational docking.

PubMed

Khamis, Mohamed A; Gomaa, Walid; Ahmed, Walaa F

2015-03-01

The objective of this paper is to highlight the state-of-the-art machine learning (ML) techniques in computational docking. The use of smart computational methods in the life cycle of drug design is relatively a recent development that has gained much popularity and interest over the last few years. Central to this methodology is the notion of computational docking which is the process of predicting the best pose (orientation + conformation) of a small molecule (drug candidate) when bound to a target larger receptor molecule (protein) in order to form a stable complex molecule. In computational docking, a large number of binding poses are evaluated and ranked using a scoring function. The scoring function is a mathematical predictive model that produces a score that represents the binding free energy, and hence the stability, of the resulting complex molecule. Generally, such a function should produce a set of plausible ligands ranked according to their binding stability along with their binding poses. In more practical terms, an effective scoring function should produce promising drug candidates which can then be synthesized and physically screened using high throughput screening process. Therefore, the key to computer-aided drug design is the design of an efficient highly accurate scoring function (using ML techniques). The methods presented in this paper are specifically based on ML techniques. Despite many traditional techniques have been proposed, the performance was generally poor. Only in the last few years started the application of the ML technology in the design of scoring functions; and the results have been very promising. The ML-based techniques are based on various molecular features extracted from the abundance of protein-ligand information in the public molecular databases, e.g., protein data bank bind (PDBbind). In this paper, we present this paradigm shift elaborating on the main constituent elements of the ML approach to molecular docking along with the state-of-the-art research in this area. For instance, the best random forest (RF)-based scoring function on PDBbind v2007 achieves a Pearson correlation coefficient between the predicted and experimentally determined binding affinities of 0.803 while the best conventional scoring function achieves 0.644. The best RF-based ranking power ranks the ligands correctly based on their experimentally determined binding affinities with accuracy 62.5% and identifies the top binding ligand with accuracy 78.1%. We conclude with open questions and potential future research directions that can be pursued in smart computational docking; using molecular features of different nature (geometrical, energy terms, pharmacophore), advanced ML techniques (e.g., deep learning), combining more than one ML models. Copyright © 2015 Elsevier B.V. All rights reserved.

Successful generation of structural information for fragment-based drug discovery.

PubMed

Öster, Linda; Tapani, Sofia; Xue, Yafeng; Käck, Helena

2015-09-01

Fragment-based drug discovery relies upon structural information for efficient compound progression, yet it is often challenging to generate structures with bound fragments. A summary of recent literature reveals that a wide repertoire of experimental procedures is employed to generate ligand-bound crystal structures successfully. We share in-house experience from setting up and executing fragment crystallography in a project that resulted in 55 complex structures. The ligands span five orders of magnitude in affinity and the resulting structures are made available to be of use, for example, for development of computational methods. Analysis of the results revealed that ligand properties such as potency, ligand efficiency (LE) and, to some degree, clogP influence the success of complex structure generation. Copyright © 2015 Elsevier Ltd. All rights reserved.

Towards better modelling of drug-loading in solid lipid nanoparticles: Molecular dynamics, docking experiments and Gaussian Processes machine learning.

PubMed

Hathout, Rania M; Metwally, Abdelkader A

2016-11-01

This study represents one of the series applying computer-oriented processes and tools in digging for information, analysing data and finally extracting correlations and meaningful outcomes. In this context, binding energies could be used to model and predict the mass of loaded drugs in solid lipid nanoparticles after molecular docking of literature-gathered drugs using MOE® software package on molecularly simulated tripalmitin matrices using GROMACS®. Consequently, Gaussian processes as a supervised machine learning artificial intelligence technique were used to correlate the drugs' descriptors (e.g. M.W., xLogP, TPSA and fragment complexity) with their molecular docking binding energies. Lower percentage bias was obtained compared to previous studies which allows the accurate estimation of the loaded mass of any drug in the investigated solid lipid nanoparticles by just projecting its chemical structure to its main features (descriptors). Copyright © 2016 Elsevier B.V. All rights reserved.

Computer-aided structure-affinity relationships in a set of piperazine and 3,8-diazabicyclo[3.2.1]octane derivatives binding to the μ-opioid receptor

NASA Astrophysics Data System (ADS)

Barlocco, Daniela; Cignarella, Giorgio; Greco, Giovanni; Novellino, Ettore

1993-10-01

Molecular modeling studies were carried out on a set of piperazine and 3,8-diazabicyclo[3.2.1]octane derivatives with the aim to highlight the main factors modulating their affinity for the μ-opioid receptor. Structure-affinity relationships were developed with the aid of molecular mechanics and semiempirical quantum-mechanics methods. According to our proposed pharmacodynamic model, the binding to the μ-receptor is promoted by the following physico-chemical features: the presence of hydrocarbon fragments on the nitrogen ring frame capable of interacting with one of two hypothesized hydrophobic receptor pockets; a `correct' orientation of an N-propionyl side chain so as to avoid a sterically hindered region of the receptor; the possibility of accepting a hydrogen bond from a receptor site complementary to the morphine phenol oxygen.

Partial Gene Cloning and Enzyme Structure Modeling of Exolevanase Fragment from Bacillus subtilis

NASA Astrophysics Data System (ADS)

Azhar, M.; Natalia, D.; Syukur, S.; Andriani, N.; Jamsari, J.

2018-04-01

Inulin hydrolysis thermophilic and thermotolerant bacteria are potential sources of inulin hydrolysis enzymes. Partial gene that encodes inulin hydrolysis enzymes had been isolated from Bacillus subtilis using polymerase chain reaction (PCR) method with the DPE.slFandDPE.eR degenerative primers. The partial gene was cloned into pGEM-T Easy vector with E. coli as host cells and analyzed using BLASTx, CrustalW2, and Phyre2 programs. Size of thepartial gene had been found539 bp that encoded 179aminoacid residues of protein fragment. The sequences of protein fragment was more similar to exolevanase than exoinulinase. The protein fragment had conserved motif FSGS, and specific hits GH32 β-fructosidase. It had three residues of active site and five residues of substrate binding. The active site on the protein fragment were D (1-WLNDP-5), D (125-FRDPK-129) and E (177-WEC-179). Substrate binding on the protein fragment were ND (1-WLNDP-5), Q (18-FYQY-21), FS (60-FSGS-63) RD (125-FRDPK-129) and E (177-WEC-179).

Efficient heterologous expression and secretion in Aspergillus oryzae of a llama variable heavy-chain antibody fragment V(HH) against EGFR.

PubMed

Okazaki, Fumiyoshi; Aoki, Jun-ichi; Tabuchi, Soichiro; Tanaka, Tsutomu; Ogino, Chiaki; Kondo, Akihiko

2012-10-01

We have constructed a filamentous fungus Aspergillus oryzae that secretes a llama variable heavy-chain antibody fragment (V(HH)) that binds specifically to epidermal growth factor receptor (EGFR) in a culture medium. A major improvement in yield was achieved by fusing the V(HH) with a Taka-amylase A signal sequence (sTAA) and a segment of 28 amino acids from the N-terminal region of Rhizopus oryzae lipase (N28). The yields of secreted, immunologically active anti-EGFR V(HH) reached 73.8 mg/1 in a Sakaguchi flask. The V(HH) fragments were released from the sTAA or N28 proteins by an indigenous A. oryzae protease during cultivation. The purified recombinant V(HH) fragment was specifically recognized and could bind to the EGFR with a high affinity.

E-novo: an automated workflow for efficient structure-based lead optimization.

PubMed

Pearce, Bradley C; Langley, David R; Kang, Jia; Huang, Hongwei; Kulkarni, Amit

2009-07-01

An automated E-Novo protocol designed as a structure-based lead optimization tool was prepared through Pipeline Pilot with existing CHARMm components in Discovery Studio. A scaffold core having 3D binding coordinates of interest is generated from a ligand-bound protein structural model. Ligands of interest are generated from the scaffold using an R-group fragmentation/enumeration tool within E-Novo, with their cores aligned. The ligand side chains are conformationally sampled and are subjected to core-constrained protein docking, using a modified CHARMm-based CDOCKER method to generate top poses along with CDOCKER energies. In the final stage of E-Novo, a physics-based binding energy scoring function ranks the top ligand CDOCKER poses using a more accurate Molecular Mechanics-Generalized Born with Surface Area method. Correlation of the calculated ligand binding energies with experimental binding affinities were used to validate protocol performance. Inhibitors of Src tyrosine kinase, CDK2 kinase, beta-secretase, factor Xa, HIV protease, and thrombin were used to test the protocol using published ligand crystal structure data within reasonably defined binding sites. In-house Respiratory Syncytial Virus inhibitor data were used as a more challenging test set using a hand-built binding model. Least squares fits for all data sets suggested reasonable validation of the protocol within the context of observed ligand binding poses. The E-Novo protocol provides a convenient all-in-one structure-based design process for rapid assessment and scoring of lead optimization libraries.

Design of a fragment library that maximally represents available chemical space.

PubMed

Schulz, M N; Landström, J; Bright, K; Hubbard, R E

2011-07-01

Cheminformatics protocols have been developed and assessed that identify a small set of fragments which can represent the compounds in a chemical library for use in fragment-based ligand discovery. Six different methods have been implemented and tested on Input Libraries of compounds from three suppliers. The resulting Fragment Sets have been characterised on the basis of computed physico-chemical properties and their similarity to the Input Libraries. A method that iteratively identifies fragments with the maximum number of similar compounds in the Input Library (Nearest Neighbours) produces the most diverse library. This approach could increase the success of experimental ligand discovery projects, by providing fragments that can be progressed rapidly to larger compounds through access to available similar compounds (known as SAR by Catalog).

Is the isolated ligand binding domain a good model of the domain in the native receptor?

PubMed

Deming, Dustin; Cheng, Qing; Jayaraman, Vasanthi

2003-05-16

Numerous studies have used the atomic level structure of the isolated ligand binding domain of the glutamate receptor to elucidate the agonist-induced activation and desensitization processes in this group of proteins. However, no study has demonstrated the structural equivalence of the isolated ligand binding fragments and the protein in the native receptor. In this report, using visible absorption spectroscopy we show that the electronic environment of the antagonist 6-cyano-7-nitro-2,3-dihydroxyquinoxaline is identical for the isolated protein and the native glutamate receptors expressed in cells. Our results hence establish that the local structure of the ligand binding site is the same in the two proteins and validate the detailed structure-function relationships that have been developed based on a comparison of the structure of the isolated ligand binding domain and electrophysiological consequences in the native receptor.

Computational approach to analyze isolated ssDNA aptamers against angiotensin II.

PubMed

Heiat, Mohammad; Najafi, Ali; Ranjbar, Reza; Latifi, Ali Mohammad; Rasaee, Mohammad Javad

2016-07-20

Aptamers are oligonucleotides with highly structured molecules that can bind to their targets through specific 3-D conformation. Commonly, not all the nucleotides such as primer binding fixed region and some other sequences are vital for aptamers folding and interaction. Elimination of unnecessary regions needs trustworthy prediction tools to reduce experimental efforts and errors. Here we introduced a manipulated in-silico approach to predict the 3-D structure of aptamers and their target interactions. To design an approach for computational analysis of isolated ssDNA aptamers (FLC112, FLC125 and their truncated core region including CRC112 and CRC125), their secondary and tertiary structures were modeled by Mfold and RNA composer respectively. Output PDB files were modified from RNA to DNA in the discovery studio visualizer software. Using ZDOCK server, the aptamer-target interactions were predicted. Finally, the interaction scores were compared with the experimental results. In-silico interaction scores and the experimental outcomes were in the same descending arrangement of FLC112>CRC125>CRC112>FLC125 with similar intensity. The consistent results of innovative in-silico method with experimental outputs, affirmed that the present method may be a reliable approach. Also, it showed that the exact in-silico predictions can be utilized as a credible reference to find aptameric fragments binding potency. Copyright © 2016 Elsevier B.V. All rights reserved.

The transcription factor CCAAT-binding factor CBF/NF-Y regulates the proximal promoter activity in the human alpha 1(XI) collagen gene (COL11A1).

PubMed

Matsuo, Noritaka; Yu-Hua, Wang; Sumiyoshi, Hideaki; Sakata-Takatani, Keiko; Nagato, Hitoshi; Sakai, Kumiko; Sakurai, Mami; Yoshioka, Hidekatsu

2003-08-29

We have characterized the proximal promoter region of the human COL11A1 gene. Transient transfection assays indicate that the segment from -199 to +1 is necessary for the activation of basal transcription. Electrophoretic mobility shift assays (EMSAs) demonstrated that the ATTGG sequence, within the -147 to -121 fragment, is critical to bind nuclear proteins in the proximal COL11A1 promoter. We demonstrated that the CCAAT binding factor (CBF/NF-Y) bound to this region using an interference assay with consensus oligonucleotides and a supershift assay with specific antibodies in an EMSA. In a chromatin immunoprecipitation assay and EMSA using DNA-affinity-purified proteins, CBF/NF-Y proteins directly bound this region in vitro and in vivo. We also showed that four tandem copies of the CBF/NF-Y-binding fragment produced higher transcriptional activity than one or two copies, whereas the absence of a CBF/NF-Y-binding fragment suppressed the COL11A1 promoter activity. Furthermore, overexpression of a dominant-negative CBF-B/NF-YA subunit significantly inhibited promoter activity in both transient and stable cells. These results indicate that the CBF/NF-Y proteins regulate the transcription of COL11A1 by directly binding to the ATTGG sequence in the proximal promoter region.

Analytic second derivative of the energy for density functional theory based on the three-body fragment molecular orbital method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nakata, Hiroya, E-mail: nakata.h.ab@m.titech.ac.jp; RIKEN, Research Cluster for Innovation, Nakamura Lab, 2-1 Hirosawa, Wako, Saitama 351-0198; Japan Society for the Promotion of Science, Kojimachi Business Center Building, 5-3-1 Kojimachi, Chiyoda-ku, Tokyo 102-0083

2015-03-28

Analytic second derivatives of the energy with respect to nuclear coordinates have been developed for spin restricted density functional theory (DFT) based on the fragment molecular orbital method (FMO). The derivations were carried out for the three-body expansion (FMO3), and the two-body expressions can be obtained by neglecting the three-body corrections. Also, the restricted Hartree-Fock (RHF) Hessian for FMO3 can be obtained by neglecting the density-functional related terms. In both the FMO-RHF and FMO-DFT Hessians, certain terms with small magnitudes are neglected for computational efficiency. The accuracy of the FMO-DFT Hessian in terms of the Gibbs free energy is evaluatedmore » for a set of polypeptides and water clusters and found to be within 1 kcal/mol of the corresponding full (non-fragmented) ab initio calculation. The FMO-DFT method is also applied to transition states in S{sub N}2 reactions and for the computation of the IR and Raman spectra of a small Trp-cage protein (PDB: 1L2Y). Some computational timing analysis is also presented.« less

Raising an Antibody Specific to Breast Cancer Subpopulations Using Phage Display on Tissue Sections.

PubMed

Larsen, Simon Asbjørn; Meldgaard, Theresa; Fridriksdottir, Agla Jael Rubner; Lykkemark, Simon; Poulsen, Pi Camilla; Overgaard, Laura Falkensteen; Petersen, Helene Bundgaard; Petersen, Ole William; Kristensen, Peter

2016-01-01

Primary tumors display a great level of intra-tumor heterogeneity in breast cancer. The current lack of prognostic and predictive biomarkers limits accurate stratification and the ability to predict response to therapy. The aim of the present study was to select recombinant antibody fragments specific against breast cancer subpopulations, aiding the discovery of novel biomarkers. Recombinant antibody fragments were selected by phage display. A novel shadowstick technology enabled the direct selection using tissue sections of antibody fragments specific against small subpopulations of breast cancer cells. Selections were performed against a subpopulation of breast cancer cells expressing CD271+, as these previously have been indicated to be potential breast cancer stem cells. The selected antibody fragments were screened by phage ELISA on both breast cancer and myoepithelial cells. The antibody fragments were validated and evaluated by immunohistochemistry experiments. Our study revealed an antibody fragment, LH8, specific for breast cancer cells. Immunohistochemistry results indicate that this particular antibody fragment binds an antigen that exhibits differential expression in different breast cancer subpopulations. Further studies characterizing this antibody fragment, the subpopulation it binds and the cognate antigen may unearth novel biomarkers of clinical relevance. Copyright© 2016, International Institute of Anticancer Research (Dr. John G. Delinasios), All rights reserved.

Basophile: Accurate Fragment Charge State Prediction Improves Peptide Identification Rates

DOE PAGES

Wang, Dong; Dasari, Surendra; Chambers, Matthew C.; ...

2013-03-07

In shotgun proteomics, database search algorithms rely on fragmentation models to predict fragment ions that should be observed for a given peptide sequence. The most widely used strategy (Naive model) is oversimplified, cleaving all peptide bonds with equal probability to produce fragments of all charges below that of the precursor ion. More accurate models, based on fragmentation simulation, are too computationally intensive for on-the-fly use in database search algorithms. We have created an ordinal-regression-based model called Basophile that takes fragment size and basic residue distribution into account when determining the charge retention during CID/higher-energy collision induced dissociation (HCD) of chargedmore » peptides. This model improves the accuracy of predictions by reducing the number of unnecessary fragments that are routinely predicted for highly-charged precursors. Basophile increased the identification rates by 26% (on average) over the Naive model, when analyzing triply-charged precursors from ion trap data. Basophile achieves simplicity and speed by solving the prediction problem with an ordinal regression equation, which can be incorporated into any database search software for shotgun proteomic identification.« less

Fragment-Based Approaches to Enhance GTP Competitive KRAS G12C Inhibitors

DTIC Science & Technology

During the current period we completed work on a series of guanine nucleotide mimetics and published results. As part of this we developed and...reported a novel method of measuring small molecule binding to KRAS G12C active site. We also published 2 additional manuscripts about KRAS G12C directed

Combining transcription factor binding affinities with open-chromatin data for accurate gene expression prediction

PubMed Central

Schmidt, Florian; Gasparoni, Nina; Gasparoni, Gilles; Gianmoena, Kathrin; Cadenas, Cristina; Polansky, Julia K.; Ebert, Peter; Nordström, Karl; Barann, Matthias; Sinha, Anupam; Fröhler, Sebastian; Xiong, Jieyi; Dehghani Amirabad, Azim; Behjati Ardakani, Fatemeh; Hutter, Barbara; Zipprich, Gideon; Felder, Bärbel; Eils, Jürgen; Brors, Benedikt; Chen, Wei; Hengstler, Jan G.; Hamann, Alf; Lengauer, Thomas; Rosenstiel, Philip; Walter, Jörn; Schulz, Marcel H.

2017-01-01

The binding and contribution of transcription factors (TF) to cell specific gene expression is often deduced from open-chromatin measurements to avoid costly TF ChIP-seq assays. Thus, it is important to develop computational methods for accurate TF binding prediction in open-chromatin regions (OCRs). Here, we report a novel segmentation-based method, TEPIC, to predict TF binding by combining sets of OCRs with position weight matrices. TEPIC can be applied to various open-chromatin data, e.g. DNaseI-seq and NOMe-seq. Additionally, Histone-Marks (HMs) can be used to identify candidate TF binding sites. TEPIC computes TF affinities and uses open-chromatin/HM signal intensity as quantitative measures of TF binding strength. Using machine learning, we find low affinity binding sites to improve our ability to explain gene expression variability compared to the standard presence/absence classification of binding sites. Further, we show that both footprints and peaks capture essential TF binding events and lead to a good prediction performance. In our application, gene-based scores computed by TEPIC with one open-chromatin assay nearly reach the quality of several TF ChIP-seq data sets. Finally, these scores correctly predict known transcriptional regulators as illustrated by the application to novel DNaseI-seq and NOMe-seq data for primary human hepatocytes and CD4+ T-cells, respectively. PMID:27899623

Improving Protocols for Protein Mapping through Proper Comparison to Crystallography Data

PubMed Central

Lexa, Katrina W.; Carlson, Heather A.

2013-01-01

Computational approaches to fragment-based drug design (FBDD) can complement experiments and facilitate the identification of potential hot spots along the protein surface. However, the evaluation of computational methods for mapping binding sites frequently focuses upon the ability to reproduce crystallographic coordinates to within a low RMSD threshold. This dependency on the deposited coordinate data overlooks the original electron density from the experiment, thus techniques may be developed based upon subjective - or even erroneous - atomic coordinates. This can become a significant drawback in applications to systems where the location of hot spots is unknown. Based on comparison to crystallographic density, we previously showed that mixed-solvent molecular dynamics (MixMD) accurately identifies the active site for HEWL, with acetonitrile as an organic solvent. Here, we concentrated on the influence of protic solvent on simulation and refined the optimal MixMD approach for extrapolation of the method to systems without established sites. Our results establish an accurate approach for comparing simulations to experiment. We have outlined the most efficient strategy for MixMD, based on simulation length and number of runs. The development outlined here makes MixMD a robust method which should prove useful across a broad range of target structures. Lastly, our results with MixMD match experimental data so well that consistency between simulations and density may be a useful way to aid the identification of probes vs waters during the refinement of future MSCS crystallographic structures. PMID:23327200

A mechanism for negative gene regulation in Autographa californica multinucleocapsid nuclear polyhedrosis virus

USGS Publications Warehouse

Leisy, D.J.; Rasmussen, C.; Owusu, E.O.; Rohrmann, G.F.

1997-01-01

The Autographa californica multinucleocapsid nuclear polyhedrosis virus (AcMNPV) ie-1 gene product (IE-1) is thought to play a central role in stimulating early viral transcription. IE-1 has been demonstrated to activate several early viral gene promoters and to negatively regulate the promoters of two other AcMNPV regulatory genes, ie-0 and ie-2. Our results indicate that IE-1 negatively regulates the expression of certain genes by binding directly, or as part of a complex, to promoter regions containing a specific IE-1-binding motif (5'-ACBYGTAA-3') near their mRNA start sites. The IE-1 binding motif was also found within the palindromic sequences of AcMNPV homologous repeat (hr) regions that have been shown to bind IE-1. The role of this IE-1 binding motif in the regulation of the ie-2 and pe-38 promoters was examined by introducing mutations in these promoters in which the central 6 bp were replaced with Bg/II sites. GUS reporter constructs containing ie-2 and pe-38 promoter fragments with and without these specific mutations were cotransfected into Sf9 cells with various amounts of an ie-1-containing plasmid (ple-1). Comparisons of GUS expression produced by the mutant and wild-type constructs demonstrated that the IE-1 binding motif mediated a significant decrease in expression from the ie-2 and pe-38 promoters in response to increasing pIe-1 concentrations. Electrophoretic mobility shift assays with pIe-1-transfected cell extracts and supershift assays with IE-1- specific antiserum demonstrated that IE-1 binds to promoter fragments containing the IE-1 binding motif but does not bind to promoter fragments lacking this motif.

Nucleolin forms a specific complex with a fragment of the viral (minus) strand of minute virus of mice DNA.

PubMed Central

Barrijal, S; Perros, M; Gu, Z; Avalosse, B L; Belenguer, P; Amalric, F; Rommelaere, J

1992-01-01

Nucleolin, a major nucleolar protein, forms a specific complex with the genome (a single-stranded DNA molecule of minus polarity) of parvovirus MVMp in vitro. By means of South-western blotting experiments, we mapped the binding site to a 222-nucleotide motif within the non-structural transcription unit, referred to as NUBE (nucleolin-binding element). The specificity of the interaction was confirmed by competitive gel retardation assays. DNaseI and nuclease S1 probing showed that NUBE folds into a secondary structure, in agreement with a computer-assisted conformational prediction. The whole NUBE may be necessary for the interaction with nucleolin, as suggested by the failure of NUBE subfragments to bind the protein and by the nuclease footprinting experiments. The present work extends the previously reported ability of nucleolin to form a specific complex with ribosomal RNA, to a defined DNA substrate. Considering the tropism of MVMp DNA replication for host cell nucleoli, these data raise the possibility that nucleolin may contribute to the regulation of the parvoviral life-cycle. Images PMID:1408821

Coilin phosphorylation mediates interaction with SMN and SmB'.

PubMed

Toyota, Cory G; Davis, Misty D; Cosman, Angela M; Hebert, Michael D

2010-04-01

Cajal bodies (CBs) are subnuclear domains that participate in spliceosomal small nuclear ribonucleoprotein (snRNP) biogenesis and play a part in the assembly of the spliceosomal complex. The CB marker protein, coilin, interacts with survival of motor neuron (SMN) and Sm proteins. Several coilin phosphoresidues have been identified by mass spectrometric analysis. Phosphorylation of coilin affects its self-interaction and localization in the nucleus. We hypothesize that coilin phosphorylation also impacts its binding to SMN and Sm proteins. In vitro binding studies with a C-terminal fragment of coilin and corresponding phosphomimics show that SMN binds preferentially to dephosphorylated analogs and that SmB' binds preferentially to phosphomimetic constructs. Bacterially expressed full-length coilin binds more SMN and SmB' than does the C-terminal fragment. Co-immunoprecipitation and phosphatase experiments show that SMN also binds dephosphorylated coilin in vivo. These data show that phosphorylation of coilin influences interaction with its target proteins and, thus, may be significant in managing the flow of snRNPs through the CB.

Coilin phosphorylation mediates interaction with SMN and SmB′

PubMed Central

Toyota, Cory G.; Davis, Misty D.; Cosman, Angela M.; Hebert, Michael D.

2010-01-01

Cajal bodies (CBs) are subnuclear domains that participate in spliceosomal small nuclear ribonucleoprotein (snRNP) biogenesis and play a part in the assembly of the spliceosomal complex. The CB marker protein, coilin, interacts with survival of motor neuron (SMN) and Sm proteins. Several coilin phosphoresidues have been identified by mass spectrometric analysis. Phosphorylation of coilin affects its self-interaction and localization in the nucleus. We hypothesize that coilin phosphorylation also impacts its binding to SMN and Sm proteins. In vitro binding studies with a C-terminal fragment of coilin and corresponding phosphomimics show that SMN binds preferentially to dephosphorylated analogs and that SmB′ binds preferentially to phosphomimetic constructs. Bacterially expressed full-length coilin binds more SMN and SmB′ than does the C-terminal fragment. Co-immunoprecipitation and phosphatase experiments show that SMN also binds dephosphorylated coilin in vivo. These data show that phosphorylation of coilin influences interaction with its target proteins and, thus, may be significant in managing the flow of snRNPs through the CB. PMID:19997741

An endogenously produced fragment of cardiac myosin-binding protein C is pathogenic and can lead to heart failure.

PubMed

Razzaque, Md Abdur; Gupta, Manish; Osinska, Hanna; Gulick, James; Blaxall, Burns C; Robbins, Jeffrey

2013-08-16

A stable 40-kDa fragment is produced from cardiac myosin-binding protein C when the heart is stressed using a stimulus, such as ischemia-reperfusion injury. Elevated levels of the fragment can be detected in the diseased mouse and human heart, but its ability to interfere with normal cardiac function in the intact animal is unexplored. To understand the potential pathogenicity of the 40-kDa fragment in vivo and to investigate the molecular pathways that could be targeted for potential therapeutic intervention. We generated cardiac myocyte-specific transgenic mice using a Tet-Off inducible system to permit controlled expression of the 40-kDa fragment in cardiomyocytes. When expression of the 40-kDa protein is induced by crossing the responder animals with tetracycline transactivator mice under conditions in which substantial quantities approximating those observed in diseased hearts are reached, the double-transgenic mice subsequently experience development of sarcomere dysgenesis and altered cardiac geometry, and the heart fails between 12 and 17 weeks of age. The induced double-transgenic mice had development of cardiac hypertrophy with myofibrillar disarray and fibrosis, in addition to activation of pathogenic MEK-ERK pathways. Inhibition of MEK-ERK signaling was achieved by injection of the mitogen-activated protein kinase (MAPK)/ERK inhibitor U0126. The drug effectively improved cardiac function, normalized heart size, and increased probability of survival. These results suggest that the 40-kDa cardiac myosin-binding protein C fragment, which is produced at elevated levels during human cardiac disease, is a pathogenic fragment that is sufficient to cause hypertrophic cardiomyopathy and heart failure.

The amino-terminal matrix assembly domain of fibronectin stabilizes cell shape and prevents cell cycle progression.

PubMed

Christopher, R A; Judge, S R; Vincent, P A; Higgins, P J; McKeown-Longo, P J

1999-10-01

Adhesion to the extracellular matrix modulates the cellular response to growth factors and is critical for cell cycle progression. The present study was designed to address the relationship between fibronectin matrix assembly and cell shape or shape dependent cellular processes. The binding of fibronectin's amino-terminal matrix assembly domain to adherent cells represents the initial step in the assembly of exogenous fibronectin into the extracellular matrix. When added to monolayers of pulmonary artery endothelial cells, the 70 kDa fragment of fibronectin (which contains the matrix assembly domain) stabilized both the extracellular fibronectin matrix as well as the actin cytoskeleton against cytochalasin D-mediated structural reorganization. This activity appeared to require specific fibronectin sequences as fibronectin fragments containing the cell adhesion domain as well as purified vitronectin were ineffective inhibitors of cytochalasin D-induced cytoarchitectural restructuring. Such pronounced morphologic consequences associated with exposure to the 70 kDa fragment suggested that this region of the fibronectin molecule may affect specific growth traits known to be influenced by cell shape. To assess this possibility, the 70 kDa fragment was added to scrape-wounded monolayers of bovine microvessel endothelium and the effects on two shape-dependent processes (i.e. migration and proliferation) were measured as a function of time after injury and location from the wound. The addition of amino-terminal fragments of fibronectin to the monolayer significantly inhibited (by >50%) wound closure. Staining of wounded monolayers with BrdU, moreover, indicated that either the 70 kDa or 25 kDa amino-terminal fragments of fibronectin, but not the 40 kDa collagen binding fragment, also inhibited cell cycle progression. These results suggest that the binding of fibronectin's amino-terminal region to endothelial cell layers inhibits cell cycle progression by stabilizing cell shape.

Selection of single chain antibody fragments binding to the extracellular domain of 4-1BB receptor by phage display technology.

PubMed

Bagheri, Salman; Yousefi, Mehdi; Safaie Qamsari, Elmira; Riazi-Rad, Farhad; Abolhassani, Mohsen; Younesi, Vahid; Dorostkar, Ruhollah; Movassaghpour, Ali Akbar; Sharifzadeh, Zahra

2017-03-01

The 4-1BB is a surface glycoprotein that pertains to the tumor necrosis factor-receptor family. There is compelling evidence suggesting important roles for 4-1BB in the immune response, including cell activation and proliferation and also cytokine induction. Because of encouraging results of different agonistic monoclonal antibodies against 4-1BB in the treatment of cancer, infectious, and autoimmune diseases, 4-1BB has been suggested as an attractive target for immunotherapy. In this study, single chain variable fragment phage display libraries, Tomlinson I+J, were screened against specific synthetic oligopeptides (peptides I and II) designed from 4-1BB extracellular domain. Five rounds of panning led to selection of four 4-1BB specific single chain variable fragments (PI.12, PI.42, PII.16, and PII.29) which showed specific reaction to relevant peptides in phage enzyme-linked immunosorbent assay. The selected clones were successfully expressed in Escherichia coli Rosetta-gami 2, and their expression was confirmed by western blot analysis. Enzyme-linked immunosorbent assay experiments indicated that these antibodies were able to specifically recognize 4-1BB without any cross-reactivity with other antigens. Flow cytometry analysis demonstrated an acceptable specific binding of the single chain variable fragments to 4-1BB expressed on CCRF-CEM cells, while no binding was observed with an irrelevant antibody. Anti-4-1BB single chain variable fragments enhanced surface CD69 expression and interleukin-2 production in stimulated CCRF-CEM cells which confirmed the agonistic effect of the selected single chain variable fragments. The data from this study have provided a rationale for further experiments involving the biological functions of anti-4-1BB single chain variable fragments in future studies.

Synthesis and profiling of a 3-aminopyridin-2-one-based kinase targeted fragment library: Identification of 3-amino-5-(pyridin-4-yl)pyridin-2(1H)-one scaffold for monopolar spindle 1 (MPS1) and Aurora kinases inhibition.

PubMed

Fearon, Daren; Westwood, Isaac M; van Montfort, Rob L M; Bayliss, Richard; Jones, Keith; Bavetsias, Vassilios

2018-07-15

Screening a 3-aminopyridin-2-one based fragment library against a 26-kinase panel representative of the human kinome identified 3-amino-5-(1-methyl-1H-pyrazol-4-yl)pyridin-2(1H)-one (2) and 3-amino-5-(pyridin-4-yl)pyridin-2(1H)-one (3) as ligand efficient inhibitors of the mitotic kinase Monopolar Spindle 1 (MPS1) and the Aurora kinase family. These kinases are well recognised as attractive targets for therapeutic intervention for treating cancer. Elucidation of the binding mode of these fragments and their analogues has been carried out by X-ray crystallography. Structural studies have identified key interactions with a conserved lysine residue and have highlighted potential regions of MPS1 which could be targeted to improve activity and selectivity. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

Prediction of the binding affinities of peptides to class II MHC using a regularized thermodynamic model

PubMed Central

2010-01-01

Background The binding of peptide fragments of extracellular peptides to class II MHC is a crucial event in the adaptive immune response. Each MHC allotype generally binds a distinct subset of peptides and the enormous number of possible peptide epitopes prevents their complete experimental characterization. Computational methods can utilize the limited experimental data to predict the binding affinities of peptides to class II MHC. Results We have developed the Regularized Thermodynamic Average, or RTA, method for predicting the affinities of peptides binding to class II MHC. RTA accounts for all possible peptide binding conformations using a thermodynamic average and includes a parameter constraint for regularization to improve accuracy on novel data. RTA was shown to achieve higher accuracy, as measured by AUC, than SMM-align on the same data for all 17 MHC allotypes examined. RTA also gave the highest accuracy on all but three allotypes when compared with results from 9 different prediction methods applied to the same data. In addition, the method correctly predicted the peptide binding register of 17 out of 18 peptide-MHC complexes. Finally, we found that suboptimal peptide binding registers, which are often ignored in other prediction methods, made significant contributions of at least 50% of the total binding energy for approximately 20% of the peptides. Conclusions The RTA method accurately predicts peptide binding affinities to class II MHC and accounts for multiple peptide binding registers while reducing overfitting through regularization. The method has potential applications in vaccine design and in understanding autoimmune disorders. A web server implementing the RTA prediction method is available at http://bordnerlab.org/RTA/. PMID:20089173

One Question, Multiple Answers: Biochemical and Biophysical Screening Methods Retrieve Deviating Fragment Hit Lists.

PubMed

Schiebel, Johannes; Radeva, Nedyalka; Köster, Helene; Metz, Alexander; Krotzky, Timo; Kuhnert, Maren; Diederich, Wibke E; Heine, Andreas; Neumann, Lars; Atmanene, Cedric; Roecklin, Dominique; Vivat-Hannah, Valérie; Renaud, Jean-Paul; Meinecke, Robert; Schlinck, Nina; Sitte, Astrid; Popp, Franziska; Zeeb, Markus; Klebe, Gerhard

2015-09-01

Fragment-based lead discovery is gaining momentum in drug development. Typically, a hierarchical cascade of several screening techniques is consulted to identify fragment hits which are then analyzed by crystallography. Because crystal structures with bound fragments are essential for the subsequent hit-to-lead-to-drug optimization, the screening process should distinguish reliably between binders and non-binders. We therefore investigated whether different screening methods would reveal similar collections of putative binders. First we used a biochemical assay to identify fragments that bind to endothiapepsin, a surrogate for disease-relevant aspartic proteases. In a comprehensive screening approach, we then evaluated our 361-entry library by using a reporter-displacement assay, saturation-transfer difference NMR, native mass spectrometry, thermophoresis, and a thermal shift assay. While the combined results of these screening methods retrieve 10 of the 11 crystal structures originally predicted by the biochemical assay, the mutual overlap of individual hit lists is surprisingly low, highlighting that each technique operates on different biophysical principles and conditions. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Communication: Two-step explosion processes of highly charged fullerene cations C{sub 60}{sup q+} (q = 20–60)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yamazaki, Kaoru; Nakamura, Takashi; Kanno, Manabu

2014-09-28

To establish the fundamental understanding of the fragmentation dynamics of highly positive charged nano- and bio-materials, we carried out on-the-fly classical trajectory calculations on the fragmentation dynamics of C{sub 60}{sup q+} (q = 20–60). We used the UB3LYP/3-21G level of density functional theory and the self-consistent charge density-functional based tight-binding theory. For q ≥ 20, we found that a two-step explosion mechanism governs the fragmentation dynamics: C{sub 60}{sup q+} first ejects singly and multiply charged fast atomic cations C{sup z+} (z ≥ 1) via Coulomb explosions on a timescale of 10 fs to stabilize the remaining core cluster. Thermal evaporationsmore » of slow atomic and molecular fragments from the core cluster subsequently occur on a timescale of 100 fs to 1 ps. Increasing the charge q makes the fragments smaller. This two-step mechanism governs the fragmentation dynamics in the most likely case that the initial kinetic energy accumulated upon ionization to C{sub 60}{sup q+} by ion impact or X-ray free electron laser is larger than 100 eV.« less

Recombinant Immunotoxin Therapy of Solid Tumors: Challenges and Strategies.

PubMed

Shan, Liang; Liu, Yuanyi; Wang, Paul

2013-01-01

Immunotoxins are a group of protein-based therapeutics, basically comprising two functional moieties: one is the antibody or antibody Fv fragment that allows the immunotoxin to bind specifically to target cells; another is the plant or bacterial toxin that kills the cells upon internalization. Immunotoxins have several unique features which are superior to conventional chemotherapeutics, including high specificity, extraordinary potency, and no known drug resistance. Development of immunotoxins evolves with time and technology, but significant progress has been achieved in the past 20 years after introduction of recombinant DNA technique and generation of the first single-chain variable fragment of monoclonal antibodies. Since then, more than 1,000 recombinant immunotoxins have been generated against cancer. However, most success in immunotoxin therapy has been achieved against hematological malignancies, several issues persist to be significant barriers for effective therapy of human solid tumors. Further development of immunotoxins will largely focus on the improvement of penetration capability to solid tumor mass and elimination of immunogenicity occurred when given repeatedly to patients. Promising strategies may include construction of recombinant antibody fragments with higher binding affinity and stability, elimination of immunodominant T- and B-cell epitopes of toxins, modification of immunotoxins with macromolecules like poly(ethylene glycol) and liposomes, and generation of immunotoxins with humanized antibody fragments and human endogenous cytotoxic enzymes. In this paper, we briefly reviewed the evolution of immunotoxin development and then discussed the challenges of immunotoxin therapy for human solid tumors and the potential strategies we may seek to overcome the challenges.

Methyl-Cytosine-Driven Structural Changes Enhance Adduction Kinetics of an Exon 7 fragment of the p53 Gene

NASA Astrophysics Data System (ADS)

Malla, Spundana; Kadimisetty, Karteek; Fu, You-Jun; Choudhary, Dharamainder; Schenkman, John B.; Rusling, James F.

2017-01-01

Methylation of cytosine (C) at C-phosphate-guanine (CpG) sites enhances reactivity of DNA towards electrophiles. Mutations at CpG sites on the p53 tumor suppressor gene that can result from these adductions are in turn correlated with specific cancers. Here we describe the first restriction-enzyme-assisted LC-MS/MS sequencing study of the influence of methyl cytosines (MeC) on kinetics of p53 gene adduction by model metabolite benzo[a]pyrene-7,8-dihydrodiol-9,10-epoxide (BPDE), using methodology applicable to correlate gene damage sites for drug and pollutant metabolites with mutation sites. This method allows direct kinetic measurements by LC-MS/MS sequencing for oligonucleotides longer than 20 base pairs (bp). We used MeC and non-MeC (C) versions of a 32 bp exon 7 fragment of the p53 gene. Methylation of 19 cytosines increased the rate constant 3-fold for adduction on G at the major reactive CpG in codon 248 vs. the non-MeC fragment. Rate constants for non-CpG codons 244 and 243 were not influenced significantly by MeC. Conformational and hydrophobicity changes in the MeC-p53 exon 7 fragment revealed by CD spectra and molecular modeling increase the BPDE binding constant to G in codon 248 consistent with a pathway in which preceding reactant binding greatly facilitates the rate of covalent SN2 coupling.

Principles for computational design of binding antibodies

PubMed Central

Pszolla, M. Gabriele; Lapidoth, Gideon D.; Norn, Christoffer; Dym, Orly; Unger, Tamar; Albeck, Shira; Tyka, Michael D.; Fleishman, Sarel J.

2017-01-01

Natural proteins must both fold into a stable conformation and exert their molecular function. To date, computational design has successfully produced stable and atomically accurate proteins by using so-called “ideal” folds rich in regular secondary structures and almost devoid of loops and destabilizing elements, such as cavities. Molecular function, such as binding and catalysis, however, often demands nonideal features, including large and irregular loops and buried polar interaction networks, which have remained challenging for fold design. Through five design/experiment cycles, we learned principles for designing stable and functional antibody variable fragments (Fvs). Specifically, we (i) used sequence-design constraints derived from antibody multiple-sequence alignments, and (ii) during backbone design, maintained stabilizing interactions observed in natural antibodies between the framework and loops of complementarity-determining regions (CDRs) 1 and 2. Designed Fvs bound their ligands with midnanomolar affinities and were as stable as natural antibodies, despite having >30 mutations from mammalian antibody germlines. Furthermore, crystallographic analysis demonstrated atomic accuracy throughout the framework and in four of six CDRs in one design and atomic accuracy in the entire Fv in another. The principles we learned are general, and can be implemented to design other nonideal folds, generating stable, specific, and precise antibodies and enzymes. PMID:28973872

Selection and characterization of naturally occurring single-domain (IgNAR) antibody fragments from immunized sharks by phage display.

PubMed

Dooley, Helen; Flajnik, Martin F; Porter, Andrew J

2003-09-01

The novel immunoglobulin isotype novel antigen receptor (IgNAR) is found in cartilaginous fish and is composed of a heavy-chain homodimer that does not associate with light chains. The variable regions of IgNAR function as independent domains similar to those found in the heavy-chain immunoglobulins of Camelids. Here, we describe the successful cloning and generation of a phage-displayed, single-domain library based upon the variable domain of IgNAR. Selection of such a library generated from nurse sharks (Ginglymostoma cirratum) immunized with the model antigen hen egg-white lysozyme (HEL) enabled the successful isolation of intact antigen-specific binders matured in vivo. The selected variable domains were shown to be functionally expressed in Escherichia coli, extremely stable, and bind to antigen specifically with an affinity in the nanomolar range. This approach can therefore be considered as an alternative route for the isolation of minimal antigen-binding fragments with favorable characteristics.

Crystallization and preliminary X-ray diffraction studies of an RNA aptamer in complex with the human IgG Fc fragment

PubMed Central

Sugiyama, Shigeru; Nomura, Yusuke; Sakamoto, Taiichi; Kitatani, Tomoya; Kobayashi, Asako; Miyakawa, Shin; Takahashi, Yoshinori; Adachi, Hiroaki; Takano, Kazufumi; Murakami, Satoshi; Inoue, Tsuyoshi; Mori, Yusuke; Nakamura, Yoshikazu; Matsumura, Hiroyoshi

2008-01-01

Aptamers, which are folded DNA or RNA molecules, bind to target molecules with high affinity and specificity. An RNA aptamer specific for the Fc fragment of human immunoglobulin G (IgG) has recently been identified and it has been demonstrated that an optimized 24-nucleotide RNA aptamer binds to the Fc fragment of human IgG and not to other species. In order to clarify the structural basis of the high specificity of the RNA aptamer, it was crystallized in complex with the Fc fragment of human IgG1. Preliminary X-ray diffraction studies revealed that the crystals belonged to the orthorhombic space group P21212, with unit-cell parameters a = 83.7, b = 107.2, c = 79.0 Å. A data set has been collected to 2.2 Å resolution. PMID:18931441

A Saccharomyces cerevisiae mitochondrial DNA fragment activates Reg1p-dependent glucose-repressible transcription in the nucleus.

PubMed

Santangelo, G M; Tornow, J

1997-12-01

As part of an effort to identify random carbon-source-regulated promoters in the Saccharomyces cerevisiae genome, we discovered that a mitochondrial DNA fragment is capable of directing glucose-repressible expression of a reporter gene. This fragment (CR24) originated from the mitochondrial genome adjacent to a transcription initiation site. Mutational analyses identified a GC cluster within the fragment that is required for transcriptional induction. Repression of nuclear CR24-driven transcription required Reg1p, indicating that this mitochondrially derived promoter is a member of a large group of glucose-repressible nuclear promoters that are similarly regulated by Reg1p. In vivo and in vitro binding assays indicated the presence of factors, located within the nucleus and the mitochondria, that bind to the GC cluster. One or more of these factors may provide a regulatory link between the nucleus and mitochondria.

Characterization of the major cyanogen bromide fragment of alpha-A crystallin

NASA Technical Reports Server (NTRS)

Ifeanyi, F.; Takemoto, L.; Spooner, B. S. (Principal Investigator)

1991-01-01

Alpha crystallin from the bovine lens has been digested with cyanogen bromide, and the major fragment (CB-1) has been purified using reverse phase HPLC. Characterization of this fragment by Edman degradation and antisera to synthetic peptides indicates that it originates from alpha-A crystallin, but lacks the N-terminal methionine and the last 35 amino acids from the C-terminus of the molecule. The purified CB-1 fragment binds as well as native alpha crystallin to lens membrane, but is unable to self-assemble into the correct size of high molecular weight oligomeric complexes characteristic of the intact alpha-A chain. Together, these results demonstrate that the alpha-A chain is comprised of at least two functional domains, one of which is involved in binding of alpha-A crystallin to lens membrane, and another which is necessary for correct self-assembly of the molecule into high molecular weight oligomers.

Development of an immunoassay for determination of 2,4-dichlorophenoxyacetic acid (2,4-D) based upon the recombinant Fab fragment of 2,4-D specific antibody

NASA Astrophysics Data System (ADS)

Nguyen, Van C.; Nguyen, Thi D. T.; Dau, Hung A.; Tham, Thu N.; Quyen, Dinh T.; Bachmman, Till; Schmid, Rolf D.

2001-09-01

To develop an immunoassay and further an immunosensor for 2,4-D based upon recombinant antibody, the Fab fragments of 2,4-D specific antibody were expressed in E. coli. Western blotting analysis of the periplasmic cell fractions shown that under the non-reducing condition only a single protein band at a molecular mass of 45-kDa, corresponding to the whole Fab fragment was detected. Antigen binding activity for 2,4-D was found only in the extract of cells bearing the 2,4-D plasmid. An immunoassay based on the competitive reaction of 2,4-D and enzyme tracer with 2,4-D Fab fragments immobilized on micro titer plates via rabbit anti-mouse IgC was developed. Using this assay, 2,4-D could be detected at concentration range of 0.5 (mu) g/1 to 10(mu) g/1. The center point of the 2,4-D test was found at a concentration of 5 (mu) g/l. The assay was applied for detection of 2,4-D in spiked orange samples, resulting in recovery rate of 90 percent. The immunoassay could be applied to monitor human exposure to 2,4-D from contamination in fruit samples.

When fragments link: a bibliometric perspective on the development of fragment-based drug discovery.

PubMed

Romasanta, Angelo K S; van der Sijde, Peter; Hellsten, Iina; Hubbard, Roderick E; Keseru, Gyorgy M; van Muijlwijk-Koezen, Jacqueline; de Esch, Iwan J P

2018-05-05

Fragment-based drug discovery (FBDD) is a highly interdisciplinary field, rich in ideas integrated from pharmaceutical sciences, chemistry, biology, and physics, among others. To enrich our understanding of the development of the field, we used bibliometric techniques to analyze 3642 publications in FBDD, complementing accounts by key practitioners. Mapping its core papers, we found the transfer of knowledge from academia to industry. Co-authorship analysis showed that university-industry collaboration has grown over time. Moreover, we show how ideas from other scientific disciplines have been integrated into the FBDD paradigm. Keyword analysis showed that the field is organized into four interconnected practices: library design, fragment screening, computational methods, and optimization. This study highlights the importance of interactions among various individuals and institutions from diverse disciplines in newly emerging scientific fields. Copyright © 2018. Published by Elsevier Ltd.

Fragment-based 13C nuclear magnetic resonance chemical shift predictions in molecular crystals: An alternative to planewave methods

NASA Astrophysics Data System (ADS)

Hartman, Joshua D.; Monaco, Stephen; Schatschneider, Bohdan; Beran, Gregory J. O.

2015-09-01

We assess the quality of fragment-based ab initio isotropic 13C chemical shift predictions for a collection of 25 molecular crystals with eight different density functionals. We explore the relative performance of cluster, two-body fragment, combined cluster/fragment, and the planewave gauge-including projector augmented wave (GIPAW) models relative to experiment. When electrostatic embedding is employed to capture many-body polarization effects, the simple and computationally inexpensive two-body fragment model predicts both isotropic 13C chemical shifts and the chemical shielding tensors as well as both cluster models and the GIPAW approach. Unlike the GIPAW approach, hybrid density functionals can be used readily in a fragment model, and all four hybrid functionals tested here (PBE0, B3LYP, B3PW91, and B97-2) predict chemical shifts in noticeably better agreement with experiment than the four generalized gradient approximation (GGA) functionals considered (PBE, OPBE, BLYP, and BP86). A set of recommended linear regression parameters for mapping between calculated chemical shieldings and observed chemical shifts are provided based on these benchmark calculations. Statistical cross-validation procedures are used to demonstrate the robustness of these fits.

Fragment-based (13)C nuclear magnetic resonance chemical shift predictions in molecular crystals: An alternative to planewave methods.

PubMed

Hartman, Joshua D; Monaco, Stephen; Schatschneider, Bohdan; Beran, Gregory J O

2015-09-14

We assess the quality of fragment-based ab initio isotropic (13)C chemical shift predictions for a collection of 25 molecular crystals with eight different density functionals. We explore the relative performance of cluster, two-body fragment, combined cluster/fragment, and the planewave gauge-including projector augmented wave (GIPAW) models relative to experiment. When electrostatic embedding is employed to capture many-body polarization effects, the simple and computationally inexpensive two-body fragment model predicts both isotropic (13)C chemical shifts and the chemical shielding tensors as well as both cluster models and the GIPAW approach. Unlike the GIPAW approach, hybrid density functionals can be used readily in a fragment model, and all four hybrid functionals tested here (PBE0, B3LYP, B3PW91, and B97-2) predict chemical shifts in noticeably better agreement with experiment than the four generalized gradient approximation (GGA) functionals considered (PBE, OPBE, BLYP, and BP86). A set of recommended linear regression parameters for mapping between calculated chemical shieldings and observed chemical shifts are provided based on these benchmark calculations. Statistical cross-validation procedures are used to demonstrate the robustness of these fits.

Plasmid P1 replication: negative control by repeated DNA sequences.

PubMed Central

Chattoraj, D; Cordes, K; Abeles, A

1984-01-01

The incompatibility locus, incA, of the unit-copy plasmid P1 is contained within a fragment that is essentially a set of nine 19-base-pair repeats. One or more copies of the fragment destabilizes the plasmid when present in trans. Here we show that extra copies of incA interfere with plasmid DNA replication and that a deletion of most of incA increases plasmid copy number. Thus, incA is not essential for replication but is required for its control. When cloned in a high-copy-number vector, pieces of the incA fragment that each contain only three repeats destabilize P1 plasmids efficiently. This result makes it unlikely that incA specifies a regulatory product. Our in vivo results suggest that the repeating DNA sequence itself negatively controls replication by titrating a P1-determined protein, RepA, that is essential for replication. Consistent with this hypothesis is the observation that the RepA protein binds to the incA fragment in vitro. Images PMID:6387706

Identification and functional characterization of the soybean GmaPPO12 promoter conferring Phytophthora sojae induced expression.

PubMed

Chai, Chunyue; Lin, Yanling; Shen, Danyu; Wu, Yuren; Li, Hongjuan; Dou, Daolong

2013-01-01

Identification of pathogen-inducible promoters largely lags behind cloning of the genes for disease resistance. Here, we cloned the soybean GmaPPO12 gene and found that it was rapidly and strongly induced by Phytophthorasojae infection. Computational analysis revealed that its promoter contained many known cis-elements, including several defense related transcriptional factor-binding boxes. We showed that the promoter could mediate induction of GUS expression upon infection in both transient expression assays in Nicotianabenthamiana and stable transgenic soybean hairy roots. Importantly, we demonstrated that pathogen-induced expression of the GmaPPO12 promoter was higher than that of the soybean GmaPR1a promoter. A progressive 5' and 3' deletion analysis revealed two fragments that were essential for promoter activity. Thus, the cloned promoter could be used in transgenic plants to enhance resistance to phytophthora pathogens, and the identified fragment could serve as a candidate to produce synthetic pathogen-induced promoters.

A simple and robust approach to immobilization of antibody fragments.

PubMed

Ikonomova, Svetlana P; He, Ziming; Karlsson, Amy J

2016-08-01

Antibody fragments, such as the single-chain variable fragment (scFv), have much potential in research and diagnostics because of their antigen-binding ability similar to a full-sized antibody and their ease of production in microorganisms. Some applications of antibody fragments require immobilization on a surface, and we have established a simple immobilization method that is based on the biotin-streptavidin interaction and does not require a separate purification step. We genetically fused two biotinylation tags-the biotin carboxyl carrier protein (BCCP) or the AviTag minimal sequence-to six different scFvs (scFv13R4, scFvD10, scFv26-10, scFv3, scFv5, and scFv12) for site-specific biotinylation in vivo by endogenous biotin ligases produced by Escherichia coli. The biotinylated scFvs were immobilized onto streptavidin-coated plates directly from cell lysates, and immobilization was detected through enzyme-linked immunosorbent assays. All scFvs fusions were successfully immobilized, and scFvs biotinylated via the BCCP tag tended to immobilize better than those biotinylated via the AviTag, even when biotinylation efficiency was improved with the biotin ligase BirA. The ability of immobilized scFvs to bind antigens was confirmed using scFv13R4 and scFvD10 with their respective targets β-galactosidase and bacteriophage lambda head protein D (gpD). The immobilized scFv13R4 bound to β-galactosidase at the same level for both biotinylation tags when the surface was saturated with the scFv, and immobilized scFvs retained their functionality for at least 100days after immobilization. The simplicity and robustness of our method make it a promising approach for future applications that require antibody fragment immobilization. Copyright © 2016 Elsevier B.V. All rights reserved.

Theoretical Modeling of Hydrogen Bonding in omolecular Solutions: The Combination of Quantum Mechanics and Molecular Mechanics

NASA Astrophysics Data System (ADS)

Ma, Jing; Jiang, Nan; Li, Hui

Hydrogen bonding interaction takes an important position in solutions. The non-classic nature of hydrogen bonding requires the resource-demanding quantum mechanical (QM) calculations. The molecular mechanics (MM) method, with much lower computational load, is applicable to the large-sized system. The combination of QM and MM is an efficient way in the treatment of solution. Taking advantage of the low-cost energy-based fragmentation QM approach (in which the o-molecule is divided into several subsystems, and QM calculation is carried out on each subsystem that is embedded in the environment of background charges of distant parts), the fragmentation-based QM/MM and polarization models have been implemented for the modeling of o-molecule in aqueous solutions, respectively. Within the framework of the fragmentation-based QM/MM hybrid model, the solute is treated by the fragmentation QM calculation while the numerous solvent molecules are described by MM. In the polarization model, the polarizability is considered by allowing the partial charges and fragment-centered dipole moments to be variables, with values coming from the energy-based fragmentation QM calculations. Applications of these two methods to the solvated long oligomers and cyclic peptides have demonstrated that the hydrogen bonding interaction affects the dynamic change in chain conformations of backbone.

Macromolecular ab initio phasing enforcing secondary and tertiary structure.

PubMed

Millán, Claudia; Sammito, Massimo; Usón, Isabel

2015-01-01

Ab initio phasing of macromolecular structures, from the native intensities alone with no experimental phase information or previous particular structural knowledge, has been the object of a long quest, limited by two main barriers: structure size and resolution of the data. Current approaches to extend the scope of ab initio phasing include use of the Patterson function, density modification and data extrapolation. The authors' approach relies on the combination of locating model fragments such as polyalanine α-helices with the program PHASER and density modification with the program SHELXE. Given the difficulties in discriminating correct small substructures, many putative groups of fragments have to be tested in parallel; thus calculations are performed in a grid or supercomputer. The method has been named after the Italian painter Arcimboldo, who used to compose portraits out of fruit and vegetables. With ARCIMBOLDO, most collections of fragments remain a 'still-life', but some are correct enough for density modification and main-chain tracing to reveal the protein's true portrait. Beyond α-helices, other fragments can be exploited in an analogous way: libraries of helices with modelled side chains, β-strands, predictable fragments such as DNA-binding folds or fragments selected from distant homologues up to libraries of small local folds that are used to enforce nonspecific tertiary structure; thus restoring the ab initio nature of the method. Using these methods, a number of unknown macromolecules with a few thousand atoms and resolutions around 2 Å have been solved. In the 2014 release, use of the program has been simplified. The software mediates the use of massive computing to automate the grid access required in difficult cases but may also run on a single multicore workstation (http://chango.ibmb.csic.es/ARCIMBOLDO_LITE) to solve straightforward cases.

Application of the fragment molecular orbital method analysis to fragment-based drug discovery of BET (bromodomain and extra-terminal proteins) inhibitors.

PubMed

Ozawa, Motoyasu; Ozawa, Tomonaga; Ueda, Kazuyoshi

2017-06-01

The molecular interactions of inhibitors of bromodomains (BRDs) were investigated. BRDs are protein interaction modules that recognizing ε-N-acetyl-lysine (εAc-Lys) motifs found in histone tails and are promising protein-protein interaction (PPI) targets. First, we analyzed a peptide ligand containing εAc-Lys to evaluate native PPIs. We then analyzed tetrahydroquinazoline-6-yl-benzensulfonamide derivatives found by fragment-based drug design (FBDD) and examined their interactions with the protein compared with the peptide ligand in terms of the inter-fragment interaction energy. In addition, we analyzed benzodiazepine derivatives that are high-affinity ligands for BRDs and examined differences in the CH/π interactions of the amino acid residues. We further surveyed changes in the charges of the amino acid residues among individual ligands, performed pair interaction energy decomposition analysis and estimated the water profile within the ligand binding site. Thus, useful insights for drug design were provided. Through these analyses and considerations, we show that the FMO method is a useful drug design tool to evaluate the process of FBDD and to explore PPI inhibitors. Copyright © 2017 Elsevier Inc. All rights reserved.

Conformational changes in fragments D and double-D from human fibrin(ogen) upon binding the peptide ligand Gly-His-Arg-Pro-amide.

PubMed

Everse, S J; Spraggon, G; Veerapandian, L; Doolittle, R F

1999-03-09

The structure of fragment double-D from human fibrin has been solved in the presence and absence of the peptide ligands that simulate the two knobs exposed by the removal of fibrinopeptides A and B, respectively. All told, six crystal structures have been determined, three of which are reported here for the first time: namely, fragments D and double-D with the peptide GHRPam alone and double-D in the absence of any peptide ligand. Comparison of the structures has revealed a series of conformational changes that are brought about by the various knob-hole interactions. Of greatest interest is a moveable "flap" of two negatively charged amino acids (Glubeta397 and Aspbeta398) whose side chains are pinned back to the coiled coil with a calcium atom bridge until GHRPam occupies the beta-chain pocket. Additionally, in the absence of the peptide ligand GPRPam, GHRPam binds to the gamma-chain pocket, a new calcium-binding site being formed concomitantly.

Ultrafast Coulomb explosion of a diiodomethane molecule induced by an X-ray free-electron laser pulse.

PubMed

Takanashi, Tsukasa; Nakamura, Kosuke; Kukk, Edwin; Motomura, Koji; Fukuzawa, Hironobu; Nagaya, Kiyonobu; Wada, Shin-Ichi; Kumagai, Yoshiaki; Iablonskyi, Denys; Ito, Yuta; Sakakibara, Yuta; You, Daehyun; Nishiyama, Toshiyuki; Asa, Kazuki; Sato, Yuhiro; Umemoto, Takayuki; Kariyazono, Kango; Ochiai, Kohei; Kanno, Manabu; Yamazaki, Kaoru; Kooser, Kuno; Nicolas, Christophe; Miron, Catalin; Asavei, Theodor; Neagu, Liviu; Schöffler, Markus; Kastirke, Gregor; Liu, Xiao-Jing; Rudenko, Artem; Owada, Shigeki; Katayama, Tetsuo; Togashi, Tadashi; Tono, Kensuke; Yabashi, Makina; Kono, Hirohiko; Ueda, Kiyoshi

2017-08-02

Coulomb explosion of diiodomethane CH 2 I 2 molecules irradiated by ultrashort and intense X-ray pulses from SACLA, the Japanese X-ray free electron laser facility, was investigated by multi-ion coincidence measurements and self-consistent charge density-functional-based tight-binding (SCC-DFTB) simulations. The diiodomethane molecule, containing two heavy-atom X-ray absorbing sites, exhibits a rather different charge generation and nuclear motion dynamics compared to iodomethane CH 3 I with only a single heavy atom, as studied earlier. We focus on charge creation and distribution in CH 2 I 2 in comparison to CH 3 I. The release of kinetic energy into atomic ion fragments is also studied by comparing SCC-DFTB simulations with the experiment. Compared to earlier simulations, several key enhancements are made, such as the introduction of a bond axis recoil model, where vibrational energy generated during charge creation processes induces only bond stretching or shrinking. We also propose an analytical Coulomb energy partition model to extract the essential mechanism of Coulomb explosion of molecules from the computed and the experimentally measured kinetic energies of fragment atomic ions by partitioning each pair Coulomb interaction energy into two ions of the pair under the constraint of momentum conservation. Effective internuclear distances assigned to individual fragment ions at the critical moment of the Coulomb explosion are then estimated from the average kinetic energies of the ions. We demonstrate, with good agreement between the experiment and the SCC-DFTB simulation, how the more heavily charged iodine fragments and their interplay define the characteristic features of the Coulomb explosion of CH 2 I 2 . The present study also confirms earlier findings concerning the magnitude of bond elongation in the ultrashort X-ray pulse duration, showing that structural damage to all but C-H bonds does not develop to a noticeable degree in the pulse length of ∼10 fs.

Emergence of energy dependence in the fragmentation of heterogeneous materials

NASA Astrophysics Data System (ADS)

Pál, Gergő; Varga, Imre; Kun, Ferenc

2014-12-01

The most important characteristics of the fragmentation of heterogeneous solids is that the mass (size) distribution of pieces is described by a power law functional form. The exponent of the distribution displays a high degree of universality depending mainly on the dimensionality and on the brittle-ductile mechanical response of the system. Recently, experiments and computer simulations have reported an energy dependence of the exponent increasing with the imparted energy. These novel findings question the phase transition picture of fragmentation phenomena, and have also practical importance for industrial applications. Based on large scale computer simulations here we uncover a robust mechanism which leads to the emergence of energy dependence in fragmentation processes resolving controversial issues on the problem: studying the impact induced breakup of platelike objects with varying thickness in three dimensions we show that energy dependence occurs when a lower dimensional fragmenting object is embedded into a higher dimensional space. The reason is an underlying transition between two distinct fragmentation mechanisms controlled by the impact velocity at low plate thicknesses, while it is hindered for three-dimensional bulk systems. The mass distributions of the subsets of fragments dominated by the two cracking mechanisms proved to have an astonishing robustness at all plate thicknesses, which implies that the nonuniversality of the complete mass distribution is the consequence of blending the contributions of universal partial processes.

Haptic computer-assisted patient-specific preoperative planning for orthopedic fractures surgery.

PubMed

Kovler, I; Joskowicz, L; Weil, Y A; Khoury, A; Kronman, A; Mosheiff, R; Liebergall, M; Salavarrieta, J

2015-10-01

The aim of orthopedic trauma surgery is to restore the anatomy and function of displaced bone fragments to support osteosynthesis. For complex cases, including pelvic bone and multi-fragment femoral neck and distal radius fractures, preoperative planning with a CT scan is indicated. The planning consists of (1) fracture reduction-determining the locations and anatomical sites of origin of the fractured bone fragments and (2) fracture fixation-selecting and placing fixation screws and plates. The current bone fragment manipulation, hardware selection, and positioning processes based on 2D slices and a computer mouse are time-consuming and require a technician. We present a novel 3D haptic-based system for patient-specific preoperative planning of orthopedic fracture surgery based on CT scans. The system provides the surgeon with an interactive, intuitive, and comprehensive, planning tool that supports fracture reduction and fixation. Its unique features include: (1) two-hand haptic manipulation of 3D bone fragments and fixation hardware models; (2) 3D stereoscopic visualization and multiple viewing modes; (3) ligaments and pivot motion constraints to facilitate fracture reduction; (4) semiautomatic and automatic fracture reduction modes; and (5) interactive custom fixation plate creation to fit the bone morphology. We evaluate our system with two experimental studies: (1) accuracy and repeatability of manual fracture reduction and (2) accuracy of our automatic virtual bone fracture reduction method. The surgeons achieved a mean accuracy of less than 1 mm for the manual reduction and 1.8 mm (std [Formula: see text] 1.1 mm) for the automatic reduction. 3D haptic-based patient-specific preoperative planning of orthopedic fracture surgery from CT scans is useful and accurate and may have significant advantages for evaluating and planning complex fractures surgery.

Screening of a Novel Fragment Library with Functional Complexity against Mycobacterium tuberculosis InhA.

PubMed

Prati, Federica; Zuccotto, Fabio; Fletcher, Daniel; Convery, Maire A; Fernandez-Menendez, Raquel; Bates, Robert; Encinas, Lourdes; Zeng, Jingkun; Chung, Chun-Wa; De Dios Anton, Paco; Mendoza-Losana, Alfonso; Mackenzie, Claire; Green, Simon R; Huggett, Margaret; Barros, David; Wyatt, Paul G; Ray, Peter C

2018-04-06

Our findings reported herein provide support for the benefits of including functional group complexity (FGC) within fragments when screening against protein targets such as Mycobacterium tuberculosis InhA. We show that InhA fragment actives with FGC maintained their binding pose during elaboration. Furthermore, weak fragment hits with functional group handles also allowed for facile fragment elaboration to afford novel and potent InhA inhibitors with good ligand efficiency metrics for optimization. © 2018 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.

Fragment Screening of Soluble Epoxide Hydrolase for Lead Generation-Structure-Based Hit Evaluation and Chemistry Exploration.

PubMed

Xue, Yafeng; Olsson, Thomas; Johansson, Carina A; Öster, Linda; Beisel, Hans-Georg; Rohman, Mattias; Karis, David; Bäckström, Stefan

2016-03-04

Soluble epoxide hydrolase (sEH) is involved in the regulation of many biological processes by metabolizing the key bioactive lipid mediator, epoxyeicosatrienoic acids. For the development of sEH inhibitors with improved physicochemical properties, we performed both a fragment screening and a high-throughput screening aiming at an integrated hit evaluation and lead generation. Followed by a joint dose-response analysis to confirm the hits, the identified actives were then effectively triaged by a structure-based hit-classification approach to three prioritized series. Two distinct scaffolds were identified as tractable starting points for potential lead chemistry work. The oxoindoline series bind at the right-hand side of the active-site pocket with hydrogen bonds to the protein. The 2-phenylbenzimidazole-4-sulfonamide series bind at the central channel with significant induced fit, which has not been previously reported. On the basis of the encouraging initial results, we envision that a new lead series with improved properties could be generated if a vector is found that could merge the cyclohexyl functionality of the oxoindoline series with the trifluoromethyl moiety of the 2-phenylbenzimidazole-4-sulfonamide series. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Discovery of CREBBP Bromodomain Inhibitors by High-Throughput Docking and Hit Optimization Guided by Molecular Dynamics.

PubMed

Xu, Min; Unzue, Andrea; Dong, Jing; Spiliotopoulos, Dimitrios; Nevado, Cristina; Caflisch, Amedeo

2016-02-25

We have identified two chemotypes of CREBBP bromodomain ligands by fragment-based high-throughput docking. Only 17 molecules from the original library of two-million compounds were tested in vitro. Optimization of the two low-micromolar hits, the 4-acylpyrrole 1 and acylbenzene 9, was driven by molecular dynamics results which suggested improvement of the polar interactions with the Arg1173 side chain at the rim of the binding site. The synthesis of only two derivatives of 1 yielded the 4-acylpyrrole 6 which shows a single-digit micromolar affinity for the CREBBP bromodomain and a ligand efficiency of 0.34 kcal/mol per non-hydrogen atom. Optimization of the acylbenzene hit 9 resulted in a series of derivatives with nanomolar potencies, good ligand efficiency and selectivity (see Unzue, A.; Xu, M.; Dong, J.; Wiedmer, L.; Spiliotopoulos, D.; Caflisch, A.; Nevado, C.Fragment-Based Design of Selective Nanomolar Ligands of the CREBBP Bromodomain. J. Med. Chem. 2015, DOI: 10.1021/acs.jmedchem.5b00172). The in silico predicted binding mode of the acylbenzene derivative 10 was validated by solving the structure of the complex with the CREBBP bromodomain.

Using RSAT oligo-analysis and dyad-analysis tools to discover regulatory signals in nucleic sequences.

PubMed

Defrance, Matthieu; Janky, Rekin's; Sand, Olivier; van Helden, Jacques

2008-01-01

This protocol explains how to discover functional signals in genomic sequences by detecting over- or under-represented oligonucleotides (words) or spaced pairs thereof (dyads) with the Regulatory Sequence Analysis Tools (http://rsat.ulb.ac.be/rsat/). Two typical applications are presented: (i) predicting transcription factor-binding motifs in promoters of coregulated genes and (ii) discovering phylogenetic footprints in promoters of orthologous genes. The steps of this protocol include purging genomic sequences to discard redundant fragments, discovering over-represented patterns and assembling them to obtain degenerate motifs, scanning sequences and drawing feature maps. The main strength of the method is its statistical ground: the binomial significance provides an efficient control on the rate of false positives. In contrast with optimization-based pattern discovery algorithms, the method supports the detection of under- as well as over-represented motifs. Computation times vary from seconds (gene clusters) to minutes (whole genomes). The execution of the whole protocol should take approximately 1 h.

Simple extrapolation method to predict the electronic structure of conjugated polymers from calculations on oligomers

DOE PAGES

Larsen, Ross E.

2016-04-12

In this study, we introduce two simple tight-binding models, which we call fragment frontier orbital extrapolations (FFOE), to extrapolate important electronic properties to the polymer limit using electronic structure calculations on only a few small oligomers. In particular, we demonstrate by comparison to explicit density functional theory calculations that for long oligomers the energies of the highest occupied molecular orbital (HOMO), the lowest unoccupied molecular orbital (LUMO), and of the first electronic excited state are accurately described as a function of number of repeat units by a simple effective Hamiltonian parameterized from electronic structure calculations on monomers, dimers and, optionally,more » tetramers. For the alternating copolymer materials that currently comprise some of the most efficient polymer organic photovoltaic devices one can use these simple but rigorous models to extrapolate computed properties to the polymer limit based on calculations on a small number of low-molecular-weight oligomers.« less

Computational Study on New Natural Compound Inhibitors of Pyruvate Dehydrogenase Kinases

PubMed Central

Zhou, Xiaoli; Yu, Shanshan; Su, Jing; Sun, Liankun

2016-01-01

Pyruvate dehydrogenase kinases (PDKs) are key enzymes in glucose metabolism, negatively regulating pyruvate dehyrogenase complex (PDC) activity through phosphorylation. Inhibiting PDKs could upregulate PDC activity and drive cells into more aerobic metabolism. Therefore, PDKs are potential targets for metabolism related diseases, such as cancers and diabetes. In this study, a series of computer-aided virtual screening techniques were utilized to discover potential inhibitors of PDKs. Structure-based screening using Libdock was carried out following by ADME (adsorption, distribution, metabolism, excretion) and toxicity prediction. Molecular docking was used to analyze the binding mechanism between these compounds and PDKs. Molecular dynamic simulation was utilized to confirm the stability of potential compound binding. From the computational results, two novel natural coumarins compounds (ZINC12296427 and ZINC12389251) from the ZINC database were found binding to PDKs with favorable interaction energy and predicted to be non-toxic. Our study provide valuable information of PDK-coumarins binding mechanisms in PDK inhibitor-based drug discovery. PMID:26959013

Computational Study on New Natural Compound Inhibitors of Pyruvate Dehydrogenase Kinases.

PubMed

Zhou, Xiaoli; Yu, Shanshan; Su, Jing; Sun, Liankun

2016-03-04

Pyruvate dehydrogenase kinases (PDKs) are key enzymes in glucose metabolism, negatively regulating pyruvate dehyrogenase complex (PDC) activity through phosphorylation. Inhibiting PDKs could upregulate PDC activity and drive cells into more aerobic metabolism. Therefore, PDKs are potential targets for metabolism related diseases, such as cancers and diabetes. In this study, a series of computer-aided virtual screening techniques were utilized to discover potential inhibitors of PDKs. Structure-based screening using Libdock was carried out following by ADME (adsorption, distribution, metabolism, excretion) and toxicity prediction. Molecular docking was used to analyze the binding mechanism between these compounds and PDKs. Molecular dynamic simulation was utilized to confirm the stability of potential compound binding. From the computational results, two novel natural coumarins compounds (ZINC12296427 and ZINC12389251) from the ZINC database were found binding to PDKs with favorable interaction energy and predicted to be non-toxic. Our study provide valuable information of PDK-coumarins binding mechanisms in PDK inhibitor-based drug discovery.

Electrospray mass spectrometry of NeuAc oligomers associated with the C fragment of the tetanus toxin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Prieto, M C; Whittal, R M; Baldwin, M A

2005-04-03

The Clostridial neurotoxins, botulinum and tetanus, gain entry into neuronal cells by protein recognition involving cell specific binding sites. The sialic or N-acetylneuraminic acid (NeuAc) residues of gangliosides attached to the surface of motor neurons are the suspected recognition and interaction points with Clostridial neurotoxins, although not necessarily the only ones. We have used electrospray ionization mass spectrometry (ESIMS) to examine formation of complexes between the tetanus toxin C fragment, or targeting domain, and carbohydrates containing NeuAc groups to determine how NeuAc residues contribute to ganglioside binding. ESI-MS was used to rapidly and efficiently measure dissociation constants for a numbermore » of related NeuAc-containing carbohydrates and NeuAc oligomers, information that has helped identify the structural features of gangliosides that determine their binding to tetanus toxin. The strength of the interactions between the C fragment and (NeuAc){sub n}, are consistent with the topography of the targeting domain of tetanus toxin and the nature of its carbohydrate binding sites. The results suggest that the targeting domain of tetanus toxin contains two binding sites that can accommodate NeuAc (or a dimer). This study also shows that NeuAc must play an important role in ganglioside binding and molecular recognition, a process critical for normal cell function and one frequently exploited by toxins, bacteria and viruses to facilitate their entrance into cells.« less

Why Congo red binding is specific for amyloid proteins - model studies and a computer analysis approach.

PubMed

Roterman, I; KrUl, M; Nowak, M; Konieczny, L; Rybarska, J; Stopa, B; Piekarska, B; Zemanek, G

2001-01-01

The complexing of Congo red in two different ligand forms - unimolecular and supramolecular (seven molecules in a micelle) - with eight deca-peptides organized in a b-sheet was tested by computational analysis to identify its dye-binding preferences. Polyphenylananine and polylysine peptides were selected to represent the specific side chain interactions expected to ensure particularly the stabilization of the dye-protein complex. Polyalanine was used to verify the participation of non-specific backbone-derived interactions. The initial complexes for calculation were constructed by intercalating the dye between the peptides in the middle of the beta-sheet. The long axis of the dye molecule (in the case of unimolecular systems) or the long axis of the ribbon-like micelle (in the case of the supramolecular dye form) was oriented parallel to the peptide backbone. This positioning maximally reduced the exposure of the hydrophobic diphenyl (central dye fragment) to water. In general the complexes of supramolecular Congo red ligands appeared more stable than those formed by individual dye molecules. Specific interactions (electrostatic and/or ring stacking) dominated as binding forces in the case of the single molecule, while non-specific surface adsorption seemed decisive in complexing with the supramolecular ligand. Both the unimolecular and supramolecular versions of the dye ligand were found to be likely to form complexes of sufficient stability with peptides. The low stability of the protein and the gap accessible to penetration in the peptide sheet seem sufficient for supramolecular ligand binding, but the presence of positively charged or hydrophobic amino acids may strengthen binding significantly. The need for specific interaction makes single-molecule Congo red binding rather unusual as a general amyloid protein ligand. The structural feature of Congo red, which enables specific and common interaction with amyloid proteins, probably derives from the ribbon-like self-assembled form of the dye.

Combining transcription factor binding affinities with open-chromatin data for accurate gene expression prediction.

PubMed

Schmidt, Florian; Gasparoni, Nina; Gasparoni, Gilles; Gianmoena, Kathrin; Cadenas, Cristina; Polansky, Julia K; Ebert, Peter; Nordström, Karl; Barann, Matthias; Sinha, Anupam; Fröhler, Sebastian; Xiong, Jieyi; Dehghani Amirabad, Azim; Behjati Ardakani, Fatemeh; Hutter, Barbara; Zipprich, Gideon; Felder, Bärbel; Eils, Jürgen; Brors, Benedikt; Chen, Wei; Hengstler, Jan G; Hamann, Alf; Lengauer, Thomas; Rosenstiel, Philip; Walter, Jörn; Schulz, Marcel H

2017-01-09

The binding and contribution of transcription factors (TF) to cell specific gene expression is often deduced from open-chromatin measurements to avoid costly TF ChIP-seq assays. Thus, it is important to develop computational methods for accurate TF binding prediction in open-chromatin regions (OCRs). Here, we report a novel segmentation-based method, TEPIC, to predict TF binding by combining sets of OCRs with position weight matrices. TEPIC can be applied to various open-chromatin data, e.g. DNaseI-seq and NOMe-seq. Additionally, Histone-Marks (HMs) can be used to identify candidate TF binding sites. TEPIC computes TF affinities and uses open-chromatin/HM signal intensity as quantitative measures of TF binding strength. Using machine learning, we find low affinity binding sites to improve our ability to explain gene expression variability compared to the standard presence/absence classification of binding sites. Further, we show that both footprints and peaks capture essential TF binding events and lead to a good prediction performance. In our application, gene-based scores computed by TEPIC with one open-chromatin assay nearly reach the quality of several TF ChIP-seq data sets. Finally, these scores correctly predict known transcriptional regulators as illustrated by the application to novel DNaseI-seq and NOMe-seq data for primary human hepatocytes and CD4+ T-cells, respectively. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Characteristics of dihydroflavonol 4-reductase gene promoters from different leaf colored Malus crabapple cultivars

PubMed Central

Tian, Ji; Chen, Meng-chen; Zhang, Jie; Li, Ke-ting; Song, Ting-ting; Zhang, Xi; Yao, Yun-cong

2017-01-01

Anthocyanins are secondary metabolites in land plants that contribute to the colors of leaves and flowers, and are nutritionally valuable components of the human diet. The DFR gene plays an important role in the anthocyanin biosynthetic pathway. In this study, we investigated the regulation of DFR expression and in different Malus crabapple cultivars that show distinct patterns of leaf coloration, and how it influences leaf anthocyanin accumulation and coloration. Specifically, we studied the ever-red leaved cultivar ‘Royalty’, the ever-green leaved cultivar ‘Flame’ and the spring-red leaved cultivar ‘Radiant’. RT-PCR analysis showed that the expression of McDFR1 correlated with the expression of a MYB transcription factor, McMYB10, and with anthocyanin accumulation. We isolated five McDFR1 promoter fragments from the three cultivars and identified four different fragments (F1–4) that were present either in several cultivars, or only in one. Yeast one-hybrid and electrophoretic mobility shift assay analyses showed that McMYB10 could bind to all the McDFR1 promoters, except McDFR1-Ra2. The F1, F2 and F3 fragments did not affect McMYB10 binding to the McDFR1 promoters; however, we found evidence that the F4 fragment suppressed binding, and that the MYBGAHV amino-acid sequence maybe an important cis-element for McMYB10 protein binding. This information has potential value for strategies to modify plant color through genetic transformation. PMID:29263792

Mapping a Noncovalent Protein-Peptide Interface by Top-Down FTICR Mass Spectrometry Using Electron Capture Dissociation

NASA Astrophysics Data System (ADS)

Clarke, David J.; Murray, Euan; Hupp, Ted; Mackay, C. Logan; Langridge-Smith, Pat R. R.

2011-08-01

Noncovalent protein-ligand and protein-protein complexes are readily detected using electrospray ionization mass spectrometry (ESI MS). Furthermore, recent reports have demonstrated that careful use of electron capture dissociation (ECD) fragmentation allows covalent backbone bonds of protein complexes to be dissociated without disruption of noncovalent protein-ligand interactions. In this way the site of protein-ligand interfaces can be identified. To date, protein-ligand complexes, which have proven tractable to this technique, have been mediated by ionic electrostatic interactions, i.e., ion pair interactions or salt bridging. Here we extend this methodology by applying ECD to study a protein-peptide complex that contains no electrostatics interactions. We analyzed the complex between the 21 kDa p53-inhibitor protein anterior gradient-2 and its hexapeptide binding ligand (PTTIYY). ECD fragmentation of the 1:1 complex occurs with retention of protein-peptide binding and analysis of the resulting fragments allows the binding interface to be localized to a C-terminal region between residues 109 and 175. These finding are supported by a solution-phase competition assay, which implicates the region between residues 108 and 122 within AGR2 as the PTTIYY binding interface. Our study expands previous findings by demonstrating that top-down ECD mass spectrometry can be used to determine directly the sites of peptide-protein interfaces. This highlights the growing potential of using ECD and related top-down fragmentation techniques for interrogation of protein-protein interfaces.

Characteristics of dihydroflavonol 4-reductase gene promoters from different leaf colored Malus crabapple cultivars.

PubMed

Tian, Ji; Chen, Meng-Chen; Zhang, Jie; Li, Ke-Ting; Song, Ting-Ting; Zhang, Xi; Yao, Yun-Cong

2017-01-01

Anthocyanins are secondary metabolites in land plants that contribute to the colors of leaves and flowers, and are nutritionally valuable components of the human diet. The DFR gene plays an important role in the anthocyanin biosynthetic pathway. In this study, we investigated the regulation of DFR expression and in different Malus crabapple cultivars that show distinct patterns of leaf coloration, and how it influences leaf anthocyanin accumulation and coloration. Specifically, we studied the ever-red leaved cultivar 'Royalty', the ever-green leaved cultivar 'Flame' and the spring-red leaved cultivar 'Radiant'. RT-PCR analysis showed that the expression of McDFR1 correlated with the expression of a MYB transcription factor, McMYB10 , and with anthocyanin accumulation. We isolated five McDFR1 promoter fragments from the three cultivars and identified four different fragments (F1-4) that were present either in several cultivars, or only in one. Yeast one-hybrid and electrophoretic mobility shift assay analyses showed that McMYB10 could bind to all the McDFR1 promoters, except McDFR1-Ra2 . The F1, F2 and F3 fragments did not affect McMYB10 binding to the McDFR1 promoters; however, we found evidence that the F4 fragment suppressed binding, and that the MYBGAHV amino-acid sequence maybe an important cis -element for McMYB10 protein binding. This information has potential value for strategies to modify plant color through genetic transformation.

ATP Binding to p97/VCP D1 Domain Regulates Selective Recruitment of Adaptors to Its Proximal N-Domain

PubMed Central

Chia, Wei Sheng; Chia, Diana Xueqi; Rao, Feng; Bar Nun, Shoshana; Geifman Shochat, Susana

2012-01-01

p97/Valosin-containing protein (VCP) is a member of the AAA-ATPase family involved in many cellular processes including cell division, intracellular trafficking and extraction of misfolded proteins in endoplasmic reticulum-associated degradation (ERAD). It is a homohexamer with each subunit containing two tandem D1 and D2 ATPase domains and N- and C-terminal regions that function as adaptor protein binding domains. p97/VCP is directed to its many different functional pathways by associating with various adaptor proteins. The regulation of the recruitment of the adaptor proteins remains unclear. Two adaptor proteins, Ufd1/Npl4 and p47, which bind exclusively to the p97/VCP N-domain and direct p97/VCP to either ERAD-related processes or homotypic fusion of Golgi fragments, were studied here. Surface plasmon resonance biosensor-based assays allowed the study of binding kinetics in real time. In competition experiments, it was observed that in the presence of ATP, Ufd1/Npl4 was able to compete more effectively with p47 for binding to p97/VCP. By using non-hydrolysable ATP analogues and the hexameric truncated p97/N-D1 fragment, it was shown that binding rather than hydrolysis of ATP to the proximal D1 domain strengthened the Ufd1/Npl4 association with the N-domain, thus regulating the recruitment of either Ufd1/Npl4 or p47. This novel role of ATP and an assigned function to the D1 AAA-ATPase domain link the multiple functions of p97/VCP to the metabolic status of the cell. PMID:23226521

Specific binding of the Xanthomonas campestris pv. vesicatoria AraC-type transcriptional activator HrpX to plant-inducible promoter boxes.

PubMed

Koebnik, Ralf; Krüger, Antje; Thieme, Frank; Urban, Alexander; Bonas, Ulla

2006-11-01

The pathogenicity of the plant-pathogenic bacterium Xanthomonas campestris pv. vesicatoria depends on a type III secretion system which is encoded by the 23-kb hrp (hypersensitive response and pathogenicity) gene cluster. Expression of the hrp operons is strongly induced in planta and in a special minimal medium and depends on two regulatory proteins, HrpG and HrpX. In this study, DNA affinity enrichment was used to demonstrate that the AraC-type transcriptional activator HrpX binds to a conserved cis-regulatory element, the plant-inducible promoter (PIP) box (TTCGC-N(15)-TTCGC), present in the promoter regions of four hrp operons. No binding of HrpX was observed when DNA fragments lacking a PIP box were used. HrpX also bound to a DNA fragment containing an imperfect PIP box (TTCGC-N(8)-TTCGT). Dinucleotide replacements in each half-site of the PIP box strongly decreased binding of HrpX, while simultaneous dinucleotide replacements in both half-sites completely abolished binding. Based on the complete genome sequence of Xanthomonas campestris pv. vesicatoria, putative plant-inducible promoters consisting of a PIP box and a -10 promoter motif were identified in the promoter regions of almost all HrpX-activated genes. Bioinformatic analyses and reverse transcription-PCR experiments revealed novel HrpX-dependent genes, among them a NUDIX hydrolase gene and several genes with a predicted role in the degradation of the plant cell wall. We conclude that HrpX is the most downstream component of the hrp regulatory cascade, which is proposed to directly activate most genes of the hrpX regulon via binding to corresponding PIP boxes.

ATP binding to p97/VCP D1 domain regulates selective recruitment of adaptors to its proximal N-domain.

PubMed

Chia, Wei Sheng; Chia, Diana Xueqi; Rao, Feng; Bar Nun, Shoshana; Geifman Shochat, Susana

2012-01-01

p97/Valosin-containing protein (VCP) is a member of the AAA-ATPase family involved in many cellular processes including cell division, intracellular trafficking and extraction of misfolded proteins in endoplasmic reticulum-associated degradation (ERAD). It is a homohexamer with each subunit containing two tandem D1 and D2 ATPase domains and N- and C-terminal regions that function as adaptor protein binding domains. p97/VCP is directed to its many different functional pathways by associating with various adaptor proteins. The regulation of the recruitment of the adaptor proteins remains unclear. Two adaptor proteins, Ufd1/Npl4 and p47, which bind exclusively to the p97/VCP N-domain and direct p97/VCP to either ERAD-related processes or homotypic fusion of Golgi fragments, were studied here. Surface plasmon resonance biosensor-based assays allowed the study of binding kinetics in real time. In competition experiments, it was observed that in the presence of ATP, Ufd1/Npl4 was able to compete more effectively with p47 for binding to p97/VCP. By using non-hydrolysable ATP analogues and the hexameric truncated p97/N-D1 fragment, it was shown that binding rather than hydrolysis of ATP to the proximal D1 domain strengthened the Ufd1/Npl4 association with the N-domain, thus regulating the recruitment of either Ufd1/Npl4 or p47. This novel role of ATP and an assigned function to the D1 AAA-ATPase domain link the multiple functions of p97/VCP to the metabolic status of the cell.

RNA–protein binding interface in the telomerase ribonucleoprotein

PubMed Central

Bley, Christopher J.; Qi, Xiaodong; Rand, Dustin P.; Borges, Chad R.; Nelson, Randall W.; Chen, Julian J.-L.

2011-01-01

Telomerase is a specialized reverse transcriptase containing an intrinsic telomerase RNA (TR) which provides the template for telomeric DNA synthesis. Distinct from conventional reverse transcriptases, telomerase has evolved a unique TR-binding domain (TRBD) in the catalytic telomerase reverse transcriptase (TERT) protein, integral for ribonucleoprotein assembly. Two structural elements in the vertebrate TR, the pseudoknot and CR4/5, bind TERT independently and are essential for telomerase enzymatic activity. However, the details of the TR–TERT interaction have remained elusive. In this study, we employed a photoaffinity cross-linking approach to map the CR4/5-TRBD RNA–protein binding interface by identifying RNA and protein residues in close proximity. Photoreactive 5-iodouridines were incorporated into the medaka CR4/5 RNA fragment and UV cross-linked to the medaka TRBD protein fragment. The cross-linking RNA residues were identified by alkaline partial hydrolysis and cross-linked protein residues were identified by mass spectrometry. Three CR4/5 RNA residues (U182, U187, and U205) were found cross-linking to TRBD amino acids Tyr503, Phe355, and Trp477, respectively. This CR4/5 binding pocket is distinct and separate from the previously proposed T pocket in the Tetrahymena TRBD. Based on homologous structural models, our cross-linking data position the essential loop L6.1 adjacent to the TERT C-terminal extension domain. We thus propose that stem-loop 6.1 facilitates proper TERT folding by interacting with both TRBD and C-terminal extension. Revealing the telomerase CR4/5-TRBD binding interface with single-residue resolution provides important insights into telomerase ribonucleoprotein architecture and the function of the essential CR4/5 domain. PMID:22123986

Identification of transmembrane domain 6 & 7 residues that contribute to the binding pocket of the urotensin II receptor.

PubMed

Holleran, Brian J; Domazet, Ivana; Beaulieu, Marie-Eve; Yan, Li Ping; Guillemette, Gaétan; Lavigne, Pierre; Escher, Emanuel; Leduc, Richard

2009-04-15

Urotensin II (U-II), a cyclic undecapeptide, is the natural ligand of the urotensin II (UT) receptor, a G protein-coupled receptor. In the present study, we used the substituted-cysteine accessibility method to identify specific residues in transmembrane domains (TMDs) six and seven of the rat urotensin II receptor (rUT) that contribute to the formation of the binding pocket of the receptor. Each residue in the R256(6.32)-Q283(6.59) fragment of TMD6 and the A295(7.31)-T321(7.57) fragment of TMD7 was mutated, individually, to a cysteine. The resulting mutants were expressed in COS-7 cells, which were subsequently treated with the positively charged methanethiosulfonate-ethylammonium (MTSEA) or the negatively charged methanethiosulfonate-ethylsulfonate (MTSES) sulfhydryl-specific alkylating agents. MTSEA treatment resulted in a significant reduction in the binding of TMD6 mutants F268C(6.44) and W278C(6.54) and TMD7 mutants L298C(7.34), T302C(7.38), and T303C(7.39) to (125)I-U-II. MTSES treatment resulted in a significant reduction in the binding of two additional mutants, namely L282C(6.58) in TMD6 and Y300C(7.36) in TMD7. These results suggest that specific residues orient themselves within the water-accessible binding pocket of the rUT receptor. This approach, which allowed us to identify key determinants in TMD6 and TMD7 that contribute to the UT receptor binding pocket, enabled us to further refine our homology-based model of how U-II interacts with its cognate receptor.

A ‘resource allocator’ for transcription based on a highly fragmented T7 RNA polymerase

PubMed Central

Segall-Shapiro, Thomas H; Meyer, Adam J; Ellington, Andrew D; Sontag, Eduardo D; Voigt, Christopher A

2014-01-01

Synthetic genetic systems share resources with the host, including machinery for transcription and translation. Phage RNA polymerases (RNAPs) decouple transcription from the host and generate high expression. However, they can exhibit toxicity and lack accessory proteins (σ factors and activators) that enable switching between different promoters and modulation of activity. Here, we show that T7 RNAP (883 amino acids) can be divided into four fragments that have to be co-expressed to function. The DNA-binding loop is encoded in a C-terminal 285-aa ‘σ fragment’, and fragments with different specificity can direct the remaining 601-aa ‘core fragment’ to different promoters. Using these parts, we have built a resource allocator that sets the core fragment concentration, which is then shared by multiple σ fragments. Adjusting the concentration of the core fragment sets the maximum transcriptional capacity available to a synthetic system. Further, positive and negative regulation is implemented using a 67-aa N-terminal ‘α fragment’ and a null (inactivated) σ fragment, respectively. The α fragment can be fused to recombinant proteins to make promoters responsive to their levels. These parts provide a toolbox to allocate transcriptional resources via different schemes, which we demonstrate by building a system which adjusts promoter activity to compensate for the difference in copy number of two plasmids. PMID:25080493

Computational Approaches to the Chemical Equilibrium Constant in Protein-ligand Binding.

PubMed

Montalvo-Acosta, Joel José; Cecchini, Marco

2016-12-01

The physiological role played by protein-ligand recognition has motivated the development of several computational approaches to the ligand binding affinity. Some of them, termed rigorous, have a strong theoretical foundation but involve too much computation to be generally useful. Some others alleviate the computational burden by introducing strong approximations and/or empirical calibrations, which also limit their general use. Most importantly, there is no straightforward correlation between the predictive power and the level of approximation introduced. Here, we present a general framework for the quantitative interpretation of protein-ligand binding based on statistical mechanics. Within this framework, we re-derive self-consistently the fundamental equations of some popular approaches to the binding constant and pinpoint the inherent approximations. Our analysis represents a first step towards the development of variants with optimum accuracy/efficiency ratio for each stage of the drug discovery pipeline. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Monte Carlo simulation as a tool to predict blasting fragmentation based on the Kuz Ram model

NASA Astrophysics Data System (ADS)

Morin, Mario A.; Ficarazzo, Francesco

2006-04-01

Rock fragmentation is considered the most important aspect of production blasting because of its direct effects on the costs of drilling and blasting and on the economics of the subsequent operations of loading, hauling and crushing. Over the past three decades, significant progress has been made in the development of new technologies for blasting applications. These technologies include increasingly sophisticated computer models for blast design and blast performance prediction. Rock fragmentation depends on many variables such as rock mass properties, site geology, in situ fracturing and blasting parameters and as such has no complete theoretical solution for its prediction. However, empirical models for the estimation of size distribution of rock fragments have been developed. In this study, a blast fragmentation Monte Carlo-based simulator, based on the Kuz-Ram fragmentation model, has been developed to predict the entire fragmentation size distribution, taking into account intact and joints rock properties, the type and properties of explosives and the drilling pattern. Results produced by this simulator were quite favorable when compared with real fragmentation data obtained from a blast quarry. It is anticipated that the use of Monte Carlo simulation will increase our understanding of the effects of rock mass and explosive properties on the rock fragmentation by blasting, as well as increase our confidence in these empirical models. This understanding will translate into improvements in blasting operations, its corresponding costs and the overall economics of open pit mines and rock quarries.

Cloud Computing for Protein-Ligand Binding Site Comparison

PubMed Central

2013-01-01

The proteome-wide analysis of protein-ligand binding sites and their interactions with ligands is important in structure-based drug design and in understanding ligand cross reactivity and toxicity. The well-known and commonly used software, SMAP, has been designed for 3D ligand binding site comparison and similarity searching of a structural proteome. SMAP can also predict drug side effects and reassign existing drugs to new indications. However, the computing scale of SMAP is limited. We have developed a high availability, high performance system that expands the comparison scale of SMAP. This cloud computing service, called Cloud-PLBS, combines the SMAP and Hadoop frameworks and is deployed on a virtual cloud computing platform. To handle the vast amount of experimental data on protein-ligand binding site pairs, Cloud-PLBS exploits the MapReduce paradigm as a management and parallelizing tool. Cloud-PLBS provides a web portal and scalability through which biologists can address a wide range of computer-intensive questions in biology and drug discovery. PMID:23762824

Cloud computing for protein-ligand binding site comparison.

PubMed

Hung, Che-Lun; Hua, Guan-Jie

2013-01-01

The proteome-wide analysis of protein-ligand binding sites and their interactions with ligands is important in structure-based drug design and in understanding ligand cross reactivity and toxicity. The well-known and commonly used software, SMAP, has been designed for 3D ligand binding site comparison and similarity searching of a structural proteome. SMAP can also predict drug side effects and reassign existing drugs to new indications. However, the computing scale of SMAP is limited. We have developed a high availability, high performance system that expands the comparison scale of SMAP. This cloud computing service, called Cloud-PLBS, combines the SMAP and Hadoop frameworks and is deployed on a virtual cloud computing platform. To handle the vast amount of experimental data on protein-ligand binding site pairs, Cloud-PLBS exploits the MapReduce paradigm as a management and parallelizing tool. Cloud-PLBS provides a web portal and scalability through which biologists can address a wide range of computer-intensive questions in biology and drug discovery.

Binding stability of peptides on major histocompatibility complex class I proteins: role of entropy and dynamics.

PubMed

Gul, Ahmet; Erman, Burak

2018-01-16

Prediction of peptide binding on specific human leukocyte antigens (HLA) has long been studied with successful results. We herein describe the effects of entropy and dynamics by investigating the binding stabilities of 10 nanopeptides on various HLA Class I alleles using a theoretical model based on molecular dynamics simulations. The fluctuational entropies of the peptides are estimated over a temperature range of 310-460 K. The estimated entropies correlate well with experimental binding affinities of the peptides: peptides that have higher binding affinities have lower entropies compared to non-binders, which have significantly larger entropies. The computation of the entropies is based on a simple model that requires short molecular dynamics trajectories and allows for approximate but rapid determination. The paper draws attention to the long neglected dynamic aspects of peptide binding, and provides a fast computation scheme that allows for rapid scanning of large numbers of peptides on selected HLA antigens, which may be useful in defining the right peptides for personal immunotherapy.

Binding stability of peptides on major histocompatibility complex class I proteins: role of entropy and dynamics

NASA Astrophysics Data System (ADS)

Gul, Ahmet; Erman, Burak

2018-03-01

Prediction of peptide binding on specific human leukocyte antigens (HLA) has long been studied with successful results. We herein describe the effects of entropy and dynamics by investigating the binding stabilities of 10 nanopeptides on various HLA Class I alleles using a theoretical model based on molecular dynamics simulations. The fluctuational entropies of the peptides are estimated over a temperature range of 310-460 K. The estimated entropies correlate well with experimental binding affinities of the peptides: peptides that have higher binding affinities have lower entropies compared to non-binders, which have significantly larger entropies. The computation of the entropies is based on a simple model that requires short molecular dynamics trajectories and allows for approximate but rapid determination. The paper draws attention to the long neglected dynamic aspects of peptide binding, and provides a fast computation scheme that allows for rapid scanning of large numbers of peptides on selected HLA antigens, which may be useful in defining the right peptides for personal immunotherapy.

Analysis of a two-domain binding site for the urokinase-type plasminogen activator-plasminogen activator inhibitor-1 complex in low-density-lipoprotein-receptor-related protein.

PubMed

Andersen, O M; Petersen, H H; Jacobsen, C; Moestrup, S K; Etzerodt, M; Andreasen, P A; Thøgersen, H C

2001-07-01

The low-density-lipoprotein-receptor (LDLR)-related protein (LRP) is composed of several classes of domains, including complement-type repeats (CR), which occur in clusters that contain binding sites for a multitude of different ligands. Each approximately 40-residue CR domain contains three conserved disulphide linkages and an octahedral Ca(2+) cage. LRP is a scavenging receptor for ligands from extracellular fluids, e.g. alpha(2)-macroglobulin (alpha(2)M)-proteinase complexes, lipoprotein-containing particles and serine proteinase-inhibitor complexes, like the complex between urokinase-type plasminogen activator (uPA) and the plasminogen activator inhibitor-1 (PAI-1). In the present study we analysed the interaction of the uPA-PAI-1 complex with an ensemble of fragments representing a complete overlapping set of two-domain fragments accounting for the ligand-binding cluster II (CR3-CR10) of LRP. By ligand blotting, solid-state competition analysis and surface-plasmon-resonance analysis, we demonstrate binding to multiple CR domains, but show a preferential interaction between the uPA-PAI-1 complex and a two-domain fragment comprising CR domains 5 and 6 of LRP. We demonstrate that surface-exposed aspartic acid and tryptophan residues at identical positions in the two homologous domains, CR5 and CR6 (Asp(958,CR5), Asp(999,CR6), Trp(953,CR5) and Trp(994,CR6)), are critical for the binding of the complex as well as for the binding of the receptor-associated protein (RAP) - the folding chaperone/escort protein required for transport of LRP to the cell surface. Accordingly, the present work provides (1) an identification of a preferred binding site within LRP CR cluster II; (2) evidence that the uPA-PAI-1 binding site involves residues from two adjacent protein domains; and (3) direct evidence identifying specific residues as important for the binding of uPA-PAI-1 as well as for the binding of RAP.

Semi-empirical quantum evaluation of peptide - MHC class II binding

NASA Astrophysics Data System (ADS)

González, Ronald; Suárez, Carlos F.; Bohórquez, Hugo J.; Patarroyo, Manuel A.; Patarroyo, Manuel E.

2017-01-01

Peptide presentation by the major histocompatibility complex (MHC) is a key process for triggering a specific immune response. Studying peptide-MHC (pMHC) binding from a structural-based approach has potential for reducing the costs of investigation into vaccine development. This study involved using two semi-empirical quantum chemistry methods (PM7 and FMO-DFTB) for computing the binding energies of peptides bonded to HLA-DR1 and HLA-DR2. We found that key stabilising water molecules involved in the peptide binding mechanism were required for finding high correlation with IC50 experimental values. Our proposal is computationally non-intensive, and is a reliable alternative for studying pMHC binding interactions.

Structural and functional analysis of an essential nucleoporin heterotrimer on the cytoplasmic face of the nuclear pore complex

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yoshida, Kimihisa; Seo, Hyuk-Soo; Debler, Erik W.

2012-07-25

So far, only a few of the interactions between the {approx}30 nucleoporins comprising the modular structure of the nuclear pore complex have been defined at atomic resolution. Here we report the crystal structure, at 2.6 {angstrom} resolution, of a heterotrimeric complex, composed of fragments of three cytoplasmically oriented nucleoporins of yeast: Nup82, Nup116, and Nup159. Our data show that the Nup82 fragment, representing more than the N-terminal half of the molecule, folds into an extensively decorated, seven-bladed {beta}-propeller that forms the centerpiece of this heterotrimeric complex and anchors both a C-terminal fragment of Nup116 and the C-terminal tail of Nup159.more » Binding between Nup116 and Nup82 is mutually reinforced via two loops, one emanating from the Nup82 {beta}-propeller and the other one from the {beta}-sandwich fold of Nup116, each contacting binding pockets in their counterparts. The Nup82-Nup159 interaction occurs through an amphipathic {alpha}-helix of Nup159, which is cradled in a large hydrophobic groove that is generated from several large surface decorations of the Nup82 {beta}-propeller. Although Nup159 and Nup116 fragments bind to the Nup82 {beta}-propeller in close vicinity, there are no direct contacts between them, consistent with the noncooperative binding that was detected biochemically. Extensive mutagenesis delineated hot-spot residues for these interactions. We also showed that the Nup82 {beta}-propeller binds to other yeast Nup116 family members, Nup145N, Nup100 and to the mammalian homolog, Nup98. Notably, each of the three nucleoporins contains additional nuclear pore complex binding sites, distinct from those that were defined here in the heterotrimeric Nup82 {center_dot} Nup159 {center_dot} Nup116 complex.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhao Jincun; Wang Wei; Yuan Zhihong

The spike (S) protein of SARS coronavirus (SARS-CoV) is responsible for viral binding with ACE2 molecules. Its receptor-binding motif (S-RBM) is located between residues 424 and 494, which folds into 2 anti-parallel {beta}-sheets, {beta}5 and {beta}6. We have previously demonstrated that fragment 450-650 of the S protein (S450-650) is predominantly recognized by convalescent sera of SARS patients. The N-terminal 60 residues (450-510) of the S450-650 fragment covers the entire {beta}6 strand of S-RBM. In the present study, we demonstrate that patient sera predominantly recognized 2 linear epitopes outside the {beta}6 fragment, while the mouse antisera, induced by immunization of BALB/cmore » mice with recombinant S450-650, mainly recognized the {beta}6 strand-containing region. Unlike patient sera, however, the mouse antisera were unable to inhibit the infectivity of S protein-expressing (SARS-CoV-S) pseudovirus. Fusion protein between green fluorescence protein (GFP) and S450-650 (S450-650-GFP) was able to stain Vero E6 cells and deletion of the {beta}6 fragment rendered the fusion product (S511-650-GFP) unable to do so. Similarly, recombinant S450-650, but not S511-650, was able to block the infection of Vero E6 cells by the SARS-CoV-S pseudovirus. Co-precipitation experiments confirmed that S450-650 was able to specifically bind with ACE2 molecules in lysate of Vero E6 cells. However, the ability of S450-510, either alone or in fusion with GFP, to bind with ACE2 was significantly poorer compared with S450-650. Our data suggest a possibility that, although the {beta}6 strand alone is able to bind with ACE2 with relatively high affinity, residues outside the S-RBM could also assist the receptor binding of SARS-CoV-S protein.« less

Screening Mixtures of Small Molecules for Binding to Multiple Sites on the Surface Tetanus Toxin C Fragment by Bioaffinity NMR

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cosman, M; Zeller, L; Lightstone, F C

2002-01-01

The clostridial neurotoxins include the closely related tetanus (TeNT) and botulinum (BoNT) toxins. Botulinum toxin is used to treat severe muscle disorders and as a cosmetic wrinkle reducer. Large quantities of botulinum toxin have also been produced by terrorists for use as a biological weapon. Because there are no known antidotes for these toxins, they thus pose a potential threat to human health whether by an accidental overdose or by a hostile deployment. Thus, the discovery of high specificity and affinity compounds that can inhibit their binding to neural cells can be used as antidotes or in the design ofmore » chemical detectors. Using the crystal structure of the C fragment of the tetanus toxin (TetC), which is the cell recognition and cell surface binding domain, and the computational program DOCK, sets of small molecules have been predicted to bind to two different sites located on the surface of this protein. While Site-1 is common to the TeNT and BoNTs, Site-2 is unique to TeNT. Pairs of these molecules from each site can then be linked together synthetically to thereby increase the specificity and affinity for this toxin. Electrospray ionization mass spectroscopy was used to experimentally screen each compound for binding. Mixtures containing binders were further screened for activity under biologically relevant conditions using nuclear magnetic resonance (NMR) methods. The screening of mixtures of compounds offers increased efficiency and throughput as compared to testing single compounds and can also evaluate how possible structural changes induced by the binding of one ligand can influence the binding of the second ligand. In addition, competitive binding experiments with mixtures containing ligands predicted to bind the same site could identify the best binder for that site. NMR transfer nuclear Overhauser effect (trNOE) confirm that TetC binds doxorubicin but that this molecule is displaced by N-acetylneuraminic acid (sialic acid) in a mixture that also contains 3-sialyllactose (another predicted site 1 binder) and bisbenzimide 33342 (non-binder). A series of five predicted Site-2 binders were then screened sequentially in the presence of the Site-1 binder doxorubicin. These experiments showed that the compounds lavendustin A and naphthofluorescein-di-({beta}-D-galactopyranoside) binds along with doxorubicin to TetC. Further experiments indicate that doxorubicin and lavendustin are potential candidates to use in preparing a bidendate inhibitor specific for TetC. The simultaneous binding of two different predicted Site-2 ligands to TetC suggests that they may bind multiple sites. Another possibility is that the conformations of the binding sites are dynamic and can bind multiple diverse ligands at a single site depending on the pre-existing conformation of the protein, especially when doxorubicin is already bound.« less

The interaction of E. coli integration host factor and lambda cos DNA: multiple complex formation and protein-induced bending.

PubMed Central

Kosturko, L D; Daub, E; Murialdo, H

1989-01-01

The interaction of E. coli's integration Host Factor (IHF) with fragments of lambda DNA containing the cos site has been studied by gel-mobility retardation and electron microscopy. The cos fragment used in the mobility assays is 398 bp and spans a region from 48,298 to 194 on the lambda chromosome. Several different complexes of IHF with this fragment can be distinguished by their differential mobility on polyacrylamide gels. Relative band intensities indicate that the formation of a complex between IHF and this DNA fragment has an equilibrium binding constant of the same magnitude as DNA fragments containing lambda's attP site. Gel-mobility retardation and electron microscopy have been employed to show that IHF sharply bends DNA near cos and to map the bending site. The protein-induced bend is near an intrinsic bend due to DNA sequence. The position of the bend suggests that IHF's role in lambda DNA packaging may be the enhancement of terminase binding/cos cutting by manipulating DNA structure. Images PMID:2521383

'Unconventional' coordination chemistry by metal chelating fragments in a metalloprotein active site.

PubMed

Martin, David P; Blachly, Patrick G; Marts, Amy R; Woodruff, Tessa M; de Oliveira, César A F; McCammon, J Andrew; Tierney, David L; Cohen, Seth M

2014-04-09

The binding of three closely related chelators: 5-hydroxy-2-methyl-4H-pyran-4-thione (allothiomaltol, ATM), 3-hydroxy-2-methyl-4H-pyran-4-thione (thiomaltol, TM), and 3-hydroxy-4H-pyran-4-thione (thiopyromeconic acid, TPMA) to the active site of human carbonic anhydrase II (hCAII) has been investigated. Two of these ligands display a monodentate mode of coordination to the active site Zn(2+) ion in hCAII that is not recapitulated in model complexes of the enzyme active site. This unprecedented binding mode in the hCAII-thiomaltol complex has been characterized by both X-ray crystallography and X-ray spectroscopy. In addition, the steric restrictions of the active site force the ligands into a 'flattened' mode of coordination compared with inorganic model complexes. This change in geometry has been shown by density functional computations to significantly decrease the strength of the metal-ligand binding. Collectively, these data demonstrate that the mode of binding by small metal-binding groups can be significantly influenced by the protein active site. Diminishing the strength of the metal-ligand bond results in unconventional modes of metal coordination not found in typical coordination compounds or even carefully engineered active site models, and understanding these effects is critical to the rational design of inhibitors that target clinically relevant metalloproteins.

Designing a VAR2CSA-based vaccine to prevent placental malaria.

PubMed

Fried, Michal; Duffy, Patrick E

2015-12-22

Placental malaria (PM) due to Plasmodium falciparum is a major cause of maternal, fetal and infant mortality, but the mechanisms of pathogenesis and protective immunity are relatively well-understood for this condition, providing a path for vaccine development. P. falciparum parasites bind to chondroitin sulfate A (CSA) to sequester in the placenta, and women become resistant over 1-2 pregnancies as they acquire antibodies that block adhesion to CSA. The protein VAR2CSA, a member of the PfEMP1 variant surface antigen family, mediates parasite adhesion to CSA, and is the leading target for a vaccine to prevent PM. Obstacles to PM vaccine development include the large size (∼ 350 kD), high cysteine content, and sequence variation of VAR2CSA. A number of approaches have been taken to identify the combination of VAR2CSA domains and alleles that can induce broadly active antibodies that block adhesion of heterologous parasite isolates to CSA. This review summarizes these approaches, which have examined VAR2CSA fragments for binding activity, antigenicity with naturally acquired antibodies, and immunogenicity in animals for inducing anti-adhesion or surface-reactive antibodies. Two products are expected to enter human clinical studies in the near future based on N-terminal VAR2CSA fragments that have high binding affinity for CSA, and additional proteins preferentially expressed by placental parasites are also being examined for their potential contribution to a PM vaccine. Copyright © 2015. Published by Elsevier Ltd.

QuBiLS-MAS, open source multi-platform software for atom- and bond-based topological (2D) and chiral (2.5D) algebraic molecular descriptors computations.

PubMed

Valdés-Martiní, José R; Marrero-Ponce, Yovani; García-Jacas, César R; Martinez-Mayorga, Karina; Barigye, Stephen J; Vaz d'Almeida, Yasser Silveira; Pham-The, Hai; Pérez-Giménez, Facundo; Morell, Carlos A

2017-06-07

In previous reports, Marrero-Ponce et al. proposed algebraic formalisms for characterizing topological (2D) and chiral (2.5D) molecular features through atom- and bond-based ToMoCoMD-CARDD (acronym for Topological Molecular Computational Design-Computer Aided Rational Drug Design) molecular descriptors. These MDs codify molecular information based on the bilinear, quadratic and linear algebraic forms and the graph-theoretical electronic-density and edge-adjacency matrices in order to consider atom- and bond-based relations, respectively. These MDs have been successfully applied in the screening of chemical compounds of different therapeutic applications ranging from antimalarials, antibacterials, tyrosinase inhibitors and so on. To compute these MDs, a computational program with the same name was initially developed. However, this in house software barely offered the functionalities required in contemporary molecular modeling tasks, in addition to the inherent limitations that made its usability impractical. Therefore, the present manuscript introduces the QuBiLS-MAS (acronym for Quadratic, Bilinear and N-Linear mapS based on graph-theoretic electronic-density Matrices and Atomic weightingS) software designed to compute topological (0-2.5D) molecular descriptors based on bilinear, quadratic and linear algebraic forms for atom- and bond-based relations. The QuBiLS-MAS module was designed as standalone software, in which extensions and generalizations of the former ToMoCoMD-CARDD 2D-algebraic indices are implemented, considering the following aspects: (a) two new matrix normalization approaches based on double-stochastic and mutual probability formalisms; (b) topological constraints (cut-offs) to take into account particular inter-atomic relations; (c) six additional atomic properties to be used as weighting schemes in the calculation of the molecular vectors; (d) four new local-fragments to consider molecular regions of interest; (e) number of lone-pair electrons in chemical structure defined by diagonal coefficients in matrix representations; and (f) several aggregation operators (invariants) applied over atom/bond-level descriptors in order to compute global indices. This software permits the parallel computation of the indices, contains a batch processing module and data curation functionalities. This program was developed in Java v1.7 using the Chemistry Development Kit library (version 1.4.19). The QuBiLS-MAS software consists of two components: a desktop interface (GUI) and an API library allowing for the easy integration of the latter in chemoinformatics applications. The relevance of the novel extensions and generalizations implemented in this software is demonstrated through three studies. Firstly, a comparative Shannon's entropy based variability study for the proposed QuBiLS-MAS and the DRAGON indices demonstrates superior performance for the former. A principal component analysis reveals that the QuBiLS-MAS approach captures chemical information orthogonal to that codified by the DRAGON descriptors. Lastly, a QSAR study for the binding affinity to the corticosteroid-binding globulin using Cramer's steroid dataset is carried out. From these analyses, it is revealed that the QuBiLS-MAS approach for atom-pair relations yields similar-to-superior performance with regard to other QSAR methodologies reported in the literature. Therefore, the QuBiLS-MAS approach constitutes a useful tool for the diversity analysis of chemical compound datasets and high-throughput screening of structure-activity data.

PatchSurfers: Two methods for local molecular property-based binding ligand prediction.

PubMed

Shin, Woong-Hee; Bures, Mark Gregory; Kihara, Daisuke

2016-01-15

Protein function prediction is an active area of research in computational biology. Function prediction can help biologists make hypotheses for characterization of genes and help interpret biological assays, and thus is a productive area for collaboration between experimental and computational biologists. Among various function prediction methods, predicting binding ligand molecules for a target protein is an important class because ligand binding events for a protein are usually closely intertwined with the proteins' biological function, and also because predicted binding ligands can often be directly tested by biochemical assays. Binding ligand prediction methods can be classified into two types: those which are based on protein-protein (or pocket-pocket) comparison, and those that compare a target pocket directly to ligands. Recently, our group proposed two computational binding ligand prediction methods, Patch-Surfer, which is a pocket-pocket comparison method, and PL-PatchSurfer, which compares a pocket to ligand molecules. The two programs apply surface patch-based descriptions to calculate similarity or complementarity between molecules. A surface patch is characterized by physicochemical properties such as shape, hydrophobicity, and electrostatic potentials. These properties on the surface are represented using three-dimensional Zernike descriptors (3DZD), which are based on a series expansion of a 3 dimensional function. Utilizing 3DZD for describing the physicochemical properties has two main advantages: (1) rotational invariance and (2) fast comparison. Here, we introduce Patch-Surfer and PL-PatchSurfer with an emphasis on PL-PatchSurfer, which is more recently developed. Illustrative examples of PL-PatchSurfer performance on binding ligand prediction as well as virtual drug screening are also provided. Copyright © 2015 Elsevier Inc. All rights reserved.

Characterization and screening of IgG binding to the neonatal Fc receptor

PubMed Central

Neuber, Tobias; Frese, Katrin; Jaehrling, Jan; Jäger, Sebastian; Daubert, Daniela; Felderer, Karin; Linnemann, Mechthild; Höhne, Anne; Kaden, Stefan; Kölln, Johanna; Tiller, Thomas; Brocks, Bodo; Ostendorp, Ralf; Pabst, Stefan

2014-01-01

The neonatal Fc receptor (FcRn) protects immunoglobulin G (IgG) from degradation and increases the serum half-life of IgG, thereby contributing to a higher concentration of IgG in the serum. Because altered FcRn binding may result in a reduced or prolonged half-life of IgG molecules, it is advisable to characterize Fc receptor binding of therapeutic antibody lead candidates prior to the start of pre-clinical and clinical studies. In this study, we characterized the interactions between FcRn of different species (human, cynomolgus monkey, mouse and rat) and nine IgG molecules from different species and isotypes with common variable heavy (VH) and variable light chain (VL) domains. Binding was analyzed at acidic and neutral pH using surface plasmon resonance (SPR) and biolayer interferometry (BLI). Furthermore, we transferred the well-accepted, but low throughput SPR-based method for FcRn binding characterization to the BLI-based Octet platform to enable a higher sample throughput allowing the characterization of FcRn binding already during early drug discovery phase. We showed that the BLI-based approach is fit-for-purpose and capable of discriminating between IgG molecules with significant differences in FcRn binding affinities. Using this high-throughput approach we investigated FcRn binding of 36 IgG molecules that represented all VH/VL region combinations available in the fully human, recombinant antibody library Ylanthia®. Our results clearly showed normal FcRn binding profiles for all samples. Hence, the variations among the framework parts, complementarity-determining region (CDR) 1 and CDR2 of the fragment antigen binding (Fab) domain did not significantly change FcRn binding. PMID:24802048

Engineering Archeal Surrogate Systems for the Development of Protein-Protein Interaction Inhibitors against Human RAD51.

PubMed

Moschetti, Tommaso; Sharpe, Timothy; Fischer, Gerhard; Marsh, May E; Ng, Hong Kin; Morgan, Matthew; Scott, Duncan E; Blundell, Tom L; R Venkitaraman, Ashok; Skidmore, John; Abell, Chris; Hyvönen, Marko

2016-11-20

Protein-protein interactions (PPIs) are increasingly important targets for drug discovery. Efficient fragment-based drug discovery approaches to tackle PPIs are often stymied by difficulties in the production of stable, unliganded target proteins. Here, we report an approach that exploits protein engineering to "humanise" thermophilic archeal surrogate proteins as targets for small-molecule inhibitor discovery and to exemplify this approach in the development of inhibitors against the PPI between the recombinase RAD51 and tumour suppressor BRCA2. As human RAD51 has proved impossible to produce in a form that is compatible with the requirements of fragment-based drug discovery, we have developed a surrogate protein system using RadA from Pyrococcus furiosus. Using a monomerised RadA as our starting point, we have adopted two parallel and mutually instructive approaches to mimic the human enzyme: firstly by mutating RadA to increase sequence identity with RAD51 in the BRC repeat binding sites, and secondly by generating a chimeric archaeal human protein. Both approaches generate proteins that interact with a fourth BRC repeat with affinity and stoichiometry comparable to human RAD51. Stepwise humanisation has also allowed us to elucidate the determinants of RAD51 binding to BRC repeats and the contributions of key interacting residues to this interaction. These surrogate proteins have enabled the development of biochemical and biophysical assays in our ongoing fragment-based small-molecule inhibitor programme and they have allowed us to determine hundreds of liganded structures in support of our structure-guided design process, demonstrating the feasibility and advantages of using archeal surrogates to overcome difficulties in handling human proteins. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

Reduction of the Ganglioside Binding Activity of the Tetanus Toxin HC Fragment Destroys Immunogenicity: Implications for Development of Novel Tetanus Vaccines

PubMed Central

Qazi, Omar; Sesardic, Dorothea; Tierney, Robert; Söderbäck, Zahra; Crane, Dennis; Bolgiano, Barbara; Fairweather, Neil

2006-01-01

In this study, the immunogenicities of the nontoxic HC fragment of tetanus toxin and derivatives lacking ganglioside binding activity were compared with that of tetanus toxoid after subcutaneous immunization of mice. Wild-type HC (HCWT) protein and tetanus toxoid both elicited strong antibody responses against toxoid and HC antigens and provided complete protection against toxin challenge. Mutants of HC containing deletions essential for ganglioside binding elicited lower responses than HCWT. HCM115, containing two amino acid substitutions within the ganglioside binding site, provided reduced protection against tetanus toxin challenge compared with HCWT, consistent with lower anti-HC and anti-toxoid antibody titers. Circular-dichroism spectroscopy and intrinsic fluorescence spectroscopy showed minimal structural perturbation in HCM115. We conclude that the presence of the ganglioside binding site within HC may be essential for induction of a fully protective anti-tetanus response comparable to that induced by tetanus toxoid by subcutaneous injection. PMID:16861677

Digital Biological Converter

DTIC Science & Technology

2013-06-28

of cuts that each fragment should be cut into so the fragments are no greater than a specific length threshold. Additionally, vector sequences and...restriction sites are attached to each fragment while ensuring the restriction sites are unique to each sequence. The vector sequences serve as hooks...for assembly into vector for cloning purposes, and also as primer binding domains for PCR ampl ification. The restriction sites are added to

Kinetic analysis of a monoclonal therapeutic antibody and its single-chain homolog by surface plasmon resonance.

PubMed

Patel, Rekha; Andrien, Bruce A

2010-01-01

Monoclonal antibodies (mAbs) and antibody fragments have become an emerging class of therapeutics since 1986. Their versatility enables them to be engineered for optimal efficiency and decreased immunogenicity, and the path to market has been set by recent regulatory approvals. One of the initial criteria for success of any protein or antibody therapeutic is to understand its binding characteristics to the target antigen. Surface plasmon resonance (SPR) has been widely used and is an important tool for ligand-antigen binding characterization. In this work, the binding kinetics of a recombinant mAb and its single-chain antibody homolog, single-chain variable fragment (scFv), was analyzed by SPR. These two proteins target the same antigen. The binding kinetics of the mAb (bivalent antibody) and scFv (monovalent scFv) for this antigen was analyzed along with an assessment of the thermodynamics of the binding interactions. Alternative binding configurations were investigated to evaluate potential experimental bias because theoretically experimental binding configuration should have no impact on binding kinetics. Self-association binding kinetics in the proteins' respective formulation solutions and antigen epitope mapping were also evaluated. Functional characterization of monoclonal and single-chain antibodies has become just as important as structural characterization in the biotechnology field.

ADAM13 cleavage of cadherin-11 promotes CNC migration independently of the homophilic binding site.

PubMed

Abbruzzese, Genevieve; Becker, Sarah F; Kashef, Jubin; Alfandari, Dominique

2016-07-15

The cranial neural crest (CNC) is a highly motile population of cells that is responsible for forming the face and jaw in all vertebrates and perturbing their migration can lead to craniofacial birth defects. Cell motility requires a dynamic modification of cell-cell and cell-matrix adhesion. In the CNC, cleavage of the cell adhesion molecule cadherin-11 by ADAM13 is essential for cell migration. This cleavage generates a shed extracellular fragment of cadherin-11 (EC1-3) that possesses pro-migratory activity via an unknown mechanism. Cadherin-11 plays an important role in modulating contact inhibition of locomotion (CIL) in the CNC to regulate directional cell migration. Here, we show that while the integral cadherin-11 requires the homophilic binding site to promote CNC migration in vivo, the EC1-3 fragment does not. In addition, we show that increased ADAM13 activity or expression of the EC1-3 fragment increases CNC invasiveness in vitro and blocks the repulsive CIL response in colliding cells. This activity requires the presence of an intact homophilic binding site on the EC1-3 suggesting that the cleavage fragment may function as a competitive inhibitor of cadherin-11 adhesion in CIL but not to promote cell migration in vivo. Copyright © 2015. Published by Elsevier Inc.

ADAM13 cleavage of cadherin-11 promotes CNC migration independently of the homophilic binding site

PubMed Central

Kashef, Jubin; Alfandari, Dominique

2015-01-01

The cranial neural crest (CNC) is a highly motile population of cells that is responsible for forming the face and jaw in all vertebrates and perturbing their migration can lead to craniofacial birth defects. Cell motility requires a dynamic modification of cell–cell and cell-matrix adhesion. In the CNC, cleavage of the cell adhesion molecule cadherin-11 by ADAM13 is essential for cell migration. This cleavage generates a shed extracellular fragment of cadherin-11 (EC1-3) that possesses pro-migratory activity via an unknown mechanism. Cadherin-11 plays an important role in modulating contact inhibition of locomotion (CIL) in the CNC to regulate directional cell migration. Here, we show that while the integral cadherin-11 requires the homophilic binding site to promote CNC migration in vivo, the EC1-3 fragment does not. In addition, we show that increased ADAM13 activity or expression of the EC1-3 fragment increases CNC invasiveness in vitro and blocks the repulsive CIL response in colliding cells. This activity requires the presence of an intact homophilic binding site on the EC1-3 suggesting that the cleavage fragment may function as a competitive inhibitor of cadherin-11 adhesion in CIL but not to promote cell migration in vivo. PMID:26206614

Monovalent IgG4 molecules

PubMed Central

Wilkinson, Ian C.; Fowler, Susan B.; Machiesky, LeeAnn; Miller, Kenneth; Hayes, David B.; Adib, Morshed; Her, Cheng; Borrok, M. Jack; Tsui, Ping; Burrell, Matthew; Corkill, Dominic J.; Witt, Susanne; Lowe, David C.; Webster, Carl I.

2013-01-01

Antibodies have become the fastest growing class of biological therapeutics, in part due to their exquisite specificity and ability to modulate protein-protein interactions with a high biological potency. The relatively large size and bivalency of antibodies, however, limits their use as therapeutics in certain circumstances. Antibody fragments, such as single-chain variable fragments and antigen binding-fragments, have emerged as viable alternatives, but without further modifications these monovalent formats have reduced terminal serum half-lives because of their small size and lack of an Fc domain, which is required for FcRn-mediated recycling. Using rational engineering of the IgG4 Fc domain to disrupt key interactions at the CH3-CH3 interface, we identified a number of point mutations that abolish Fc dimerization and created half-antibodies, a novel monovalent antibody format that retains a monomeric Fc domain. Introduction of these mutations into an IgG1 framework also led to the creation of half-antibodies. These half-antibodies were shown to be soluble, thermodynamically stable and monomeric, characteristics that are favorable for use as therapeutic proteins. Despite significantly reduced FcRn binding in vitro, which suggests that avidity gains in a dimeric Fc are critical to optimal FcRn binding, this format demonstrated an increased terminal serum half-life compared with that expected for most alternative antibody fragments. PMID:23567207

Method for screening inhibitors of the toxicity of Bacillus anthracis

DOEpatents

Cirino, Nick M.; Jackson, Paul J.; Lehnert, Bruce E.

2001-01-01

The protective antigen (PA) of Bacillus anthracis is integral to the mechanism of anthrax poisoning. The cloning, expression and purification of a 32 kDa B. anthracis PA fragment (PA32) is described. This fragment has also been expressed as a fusion construct to stabilized green fluorescent protein (EGFP-PA32). Both proteins were capable of binding to specific cell surface receptors as determined by fluorescent microscopy and a flow cytometric assay. To confirm binding specificity in the flow cytometric assay, non-fluorescent PA83 or PA32 was used to competitively inhibit fluorescent EGFP-PA32 binding to cell receptors. This assay can be employed as a rapid screen for compounds which disrupts binding of PA to cells. Additionally, the high intracellular expression levels and ease of purification make this recombinant protein an attractive vaccine candidate or therapeutic treatment for anthrax poisoning.

Identification of a Novel Class of BRD4 Inhibitors by Computational Screening and Binding Simulations

PubMed Central

2017-01-01

Computational screening is a method to prioritize small-molecule compounds based on the structural and biochemical attributes built from ligand and target information. Previously, we have developed a scalable virtual screening workflow to identify novel multitarget kinase/bromodomain inhibitors. In the current study, we identified several novel N-[3-(2-oxo-pyrrolidinyl)phenyl]-benzenesulfonamide derivatives that scored highly in our ensemble docking protocol. We quantified the binding affinity of these compounds for BRD4(BD1) biochemically and generated cocrystal structures, which were deposited in the Protein Data Bank. As the docking poses obtained in the virtual screening pipeline did not align with the experimental cocrystal structures, we evaluated the predictions of their precise binding modes by performing molecular dynamics (MD) simulations. The MD simulations closely reproduced the experimentally observed protein–ligand cocrystal binding conformations and interactions for all compounds. These results suggest a computational workflow to generate experimental-quality protein–ligand binding models, overcoming limitations of docking results due to receptor flexibility and incomplete sampling, as a useful starting point for the structure-based lead optimization of novel BRD4(BD1) inhibitors. PMID:28884163

Fragment-Based Docking: Development of the CHARMMing Web User Interface as a Platform for Computer-Aided Drug Design

PubMed Central

2015-01-01

Web-based user interfaces to scientific applications are important tools that allow researchers to utilize a broad range of software packages with just an Internet connection and a browser.1 One such interface, CHARMMing (CHARMM interface and graphics), facilitates access to the powerful and widely used molecular software package CHARMM. CHARMMing incorporates tasks such as molecular structure analysis, dynamics, multiscale modeling, and other techniques commonly used by computational life scientists. We have extended CHARMMing’s capabilities to include a fragment-based docking protocol that allows users to perform molecular docking and virtual screening calculations either directly via the CHARMMing Web server or on computing resources using the self-contained job scripts generated via the Web interface. The docking protocol was evaluated by performing a series of “re-dockings” with direct comparison to top commercial docking software. Results of this evaluation showed that CHARMMing’s docking implementation is comparable to many widely used software packages and validates the use of the new CHARMM generalized force field for docking and virtual screening. PMID:25151852

Fragment-based docking: development of the CHARMMing Web user interface as a platform for computer-aided drug design.

PubMed

Pevzner, Yuri; Frugier, Emilie; Schalk, Vinushka; Caflisch, Amedeo; Woodcock, H Lee

2014-09-22

Web-based user interfaces to scientific applications are important tools that allow researchers to utilize a broad range of software packages with just an Internet connection and a browser. One such interface, CHARMMing (CHARMM interface and graphics), facilitates access to the powerful and widely used molecular software package CHARMM. CHARMMing incorporates tasks such as molecular structure analysis, dynamics, multiscale modeling, and other techniques commonly used by computational life scientists. We have extended CHARMMing's capabilities to include a fragment-based docking protocol that allows users to perform molecular docking and virtual screening calculations either directly via the CHARMMing Web server or on computing resources using the self-contained job scripts generated via the Web interface. The docking protocol was evaluated by performing a series of "re-dockings" with direct comparison to top commercial docking software. Results of this evaluation showed that CHARMMing's docking implementation is comparable to many widely used software packages and validates the use of the new CHARMM generalized force field for docking and virtual screening.

Diverse binding site structures revealed in homology models of polyreactive immunoglobulins

NASA Astrophysics Data System (ADS)

Ramsland, Paul A.; Guddat, Luke W.; Edmundson, Allen B.; Raison, Robert L.

1997-09-01

We describe here computer-assisted homology models of the combiningsite structure of three polyreactive immunoglobulins. Template-based modelsof Fv (VL-VH) fragments were derived forthe surface IgM expressed by the malignant CD5 positive B cells from threepatients with chronic lymphocytic leukaemia (CLL). The conserved frameworkregions were constructed using crystal coordinates taken from highlyhomologous human variable domain structures (Pot and Hil). Complementaritydetermining regions (CDRs) were predicted by grafting loops, taken fromknown immunoglobulin structures, onto the Fv framework models. The CDRtemplates were chosen, where possible, to be of the same length and of highresidue identity or similarity. LCDR1, 2 and 3 as well as HCDR1 and 2 forthe Fv were constructed using this strategy. For HCDR3 prediction, adatabase containing the Cartesian coordinates of 30 of these loops wascompiled from unliganded antibody X-ray crystallographic structures and anHCDR3 of the same length as that of the B CLL Fv was selected as a template.In one case (Yar), the resulting HCDR3 model gave unfavourable interactionswhen incorporated into the Fv model. This HCDR3 was therefore modelled usingan alternative strategy of construction of the loop stems, using apreviously described HCDR3 conformation (Pot), followed by chain closurewith a β-turn. The template models were subjected to positionalrefinement using energy minimisation and molecular dynamics simulations(X-PLOR). An electrostatic surface description (GRASP) did not reveal acommon structural feature within the binding sites of the three polyreactiveFv. Thus, polyreactive immunoglobulins may recognise similar and multipleantigens through a diverse array of binding site structures.

Cloning, expression, purification and preliminary crystallographic studies of the adenylate/uridylate-rich element-binding protein HuR complexed with its target RNA

PubMed Central

Iyaguchi, Daisuke; Yao, Min; Tanaka, Isao; Toyota, Eiko

2009-01-01

Adenylate/uridylate-rich elements (AREs), which are found in the 3′-untrans­lated region (UTR) of many mRNAs, influence the stability of cytoplasmic mRNA. HuR (human antigen R) binds to AREs and regulates various genes. In order to reveal the RNA-recognition mechanism of HuR protein, an RNA-binding region of human HuR containing two N-terminal RNA-recognition motif domains bound to an 11-­base RNA fragment has been crystallized. The crystals belonged to space group P212121, with unit-cell parameters a = 42.4, b = 44.9, c = 91.1 Å. X-­ray diffraction data were collected to 1.8 Å resolution. PMID:19255485

HZEFRG1 - SEMIEMPIRICAL NUCLEAR FRAGMENTATION MODEL

NASA Technical Reports Server (NTRS)

Townsend, L. W.

1994-01-01

The high charge and energy (HZE), Semiempirical Nuclear Fragmentation Model, HZEFRG1, was developed to provide a computationally efficient, user-friendly, physics-based program package for generating nuclear fragmentation databases. These databases can then be used in radiation transport applications such as space radiation shielding and dosimetry, cancer therapy with laboratory heavy ion beams, and simulation studies of detector design in nuclear physics experiments. The program provides individual element and isotope production cross sections for the breakup of high energy heavy ions by the combined nuclear and Coulomb fields of the interacting nuclei. The nuclear breakup contributions are estimated using an energy-dependent abrasion-ablation model of heavy ion fragmentation. The abrasion step involves removal of nucleons by direct knockout in the overlap region of the colliding nuclei. The abrasions are treated on a geometric basis and uniform spherical nuclear density distributions are assumed. Actual experimental nuclear radii obtained from tabulations of electron scattering data are incorporated. Nuclear transparency effects are included by using an energy-dependent, impact-parameter-dependent average transmission factor for the projectile and target nuclei, which accounts for the finite mean free path of nucleons in nuclear matter. The ablation step, as implemented by Bowman, Swiatecki, and Tsang (LBL report no. LBL-2908, July 1973), was treated as a single-nucleon emission for every 10 MeV of excitation energy. Fragmentation contributions from electromagnetic dissociation (EMD) processes, arising from the interacting Coulomb fields, are estimated by using the Weiszacker-Williams theory, extended to include electric dipole and electric quadrupole contributions to one-nucleon removal cross sections. HZEFRG1 consists of a main program, seven function subprograms, and thirteen subroutines. Each is fully commented and begins with a brief description of its functionality. The inputs, which are provided interactively by the user in response to on-screen questions, consist of the projectile kinetic energy in units of MeV/nucleon and the masses and charges of the projectile and target nuclei. With proper inputs, HZEFRG1 first calculates the EMD cross sections and then begins the calculations for nuclear fragmentation by searching through a specified number of isotopes for each charge number (Z) from Z=1 (hydrogen) to the charge of the incident fragmenting nucleus (Zp). After completing the nuclear fragmentation cross sections, HZEFRG1 sorts through the results and writes the sorted output to a file in descending order, based on the charge number of the fragmented nucleus. Details of the theory, extensive comparisons of its predictions with available experimental cross section data, and a complete description of the code implementing it are given in the program documentation. HZEFRG1 is written in ANSI FORTRAN 77 to be machine independent. It was originally developed on a DEC VAX series computer, and has been successfully implemented on a DECstation running RISC ULTRIX 4.3, a Sun4 series computer running SunOS 4.1, an HP 9000 series computer running HP-UX 8.0.1, a Cray Y-MP series computer running UNICOS, and IBM PC series computers running MS-DOS 3.3 and higher. HZEFRG1 requires 1Mb of RAM for execution. In addition, a FORTRAN 77 compiler is required to create an executable. A sample output run is included on the distribution medium for numerical comparison. The standard distribution medium for this program is a 3.5 inch 1.44Mb MS-DOS format diskette. Alternate distribution media and formats are available upon request. HZEFRG1 was completed in 1992.

Binding Direction-Based Two-Dimensional Flattened Contact Area Computing Algorithm for Protein-Protein Interactions.

PubMed

Kang, Beom Sik; Pugalendhi, GaneshKumar; Kim, Ku-Jin

2017-10-13

Interactions between protein molecules are essential for the assembly, function, and regulation of proteins. The contact region between two protein molecules in a protein complex is usually complementary in shape for both molecules and the area of the contact region can be used to estimate the binding strength between two molecules. Although the area is a value calculated from the three-dimensional surface, it cannot represent the three-dimensional shape of the surface. Therefore, we propose an original concept of two-dimensional contact area which provides further information such as the ruggedness of the contact region. We present a novel algorithm for calculating the binding direction between two molecules in a protein complex, and then suggest a method to compute the two-dimensional flattened area of the contact region between two molecules based on the binding direction.

Design of Bcl-2 and Bcl-xL Inhibitors with Subnanomolar Binding Affinities Based upon a New Scaffold

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhou, Haibin; Chen, Jianfang; Meagher, Jennifer L.

Employing a structure-based strategy, we have designed a new class of potent small-molecule inhibitors of the anti-apoptotic proteins Bcl-2 and Bcl-xL. An initial lead compound with a new scaffold was designed based upon the crystal structure of Bcl-xL and U.S. Food and Drug Administration (FDA) approved drugs and was found to have an affinity of 100 {micro}M for both Bcl-2 and Bcl-xL. Linking this weak lead to another weak-affinity fragment derived from Abbott's ABT-737 led to an improvement of the binding affinity by a factor of >10,000. Further optimization ultimately yielded compounds with subnanomolar binding affinities for both Bcl-2 andmore » Bcl-xL and potent cellular activity. The best compound (21) binds to Bcl-xL and Bcl-2 with K{sub i} < 1 nM, inhibits cell growth in the H146 and H1417 small-cell lung cancer cell lines with IC{sub 50} values of 60-90 nM, and induces robust cell death in the H146 cancer cell line at 30-100 nM.« less

DNA sequencing using fluorescence background electroblotting membrane

DOEpatents

Caldwell, Karin D.; Chu, Tun-Jen; Pitt, William G.

1992-01-01

A method for the multiplex sequencing on DNA is disclosed which comprises the electroblotting or specific base terminated DNA fragments, which have been resolved by gel electrophoresis, onto the surface of a neutral non-aromatic polymeric microporous membrane exhibiting low background fluorescence which has been surface modified to contain amino groups. Polypropylene membranes are preferably and the introduction of amino groups is accomplished by subjecting the membrane to radio or microwave frequency plasma discharge in the presence of an aminating agent, preferably ammonia. The membrane, containing physically adsorbed DNA fragments on its surface after the electroblotting, is then treated with crosslinking means such as UV radiation or a glutaraldehyde spray to chemically bind the DNA fragments to the membrane through said smino groups contained on the surface thereof. The DNA fragments chemically bound to the membrane are subjected to hybridization probing with a tagged probe specific to the sequence of the DNA fragments. The tagging may be by either fluorophores or radioisotopes. The tagged probes hybridized to said target DNA fragments are detected and read by laser induced fluorescence detection or autoradiograms. The use of aminated low fluorescent background membranes allows the use of fluorescent detection and reading even when the available amount of DNA to be sequenced is small. The DNA bound to the membrances may be reprobed numerous times.

DNA sequencing using fluorescence background electroblotting membrane

DOEpatents

Caldwell, K.D.; Chu, T.J.; Pitt, W.G.

1992-05-12

A method for the multiplex sequencing on DNA is disclosed which comprises the electroblotting or specific base terminated DNA fragments, which have been resolved by gel electrophoresis, onto the surface of a neutral non-aromatic polymeric microporous membrane exhibiting low background fluorescence which has been surface modified to contain amino groups. Polypropylene membranes are preferably and the introduction of amino groups is accomplished by subjecting the membrane to radio or microwave frequency plasma discharge in the presence of an aminating agent, preferably ammonia. The membrane, containing physically adsorbed DNA fragments on its surface after the electroblotting, is then treated with crosslinking means such as UV radiation or a glutaraldehyde spray to chemically bind the DNA fragments to the membrane through amino groups contained on the surface. The DNA fragments chemically bound to the membrane are subjected to hybridization probing with a tagged probe specific to the sequence of the DNA fragments. The tagging may be by either fluorophores or radioisotopes. The tagged probes hybridized to the target DNA fragments are detected and read by laser induced fluorescence detection or autoradiograms. The use of aminated low fluorescent background membranes allows the use of fluorescent detection and reading even when the available amount of DNA to be sequenced is small. The DNA bound to the membranes may be reprobed numerous times. No Drawings

Fragment-based {sup 13}C nuclear magnetic resonance chemical shift predictions in molecular crystals: An alternative to planewave methods

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hartman, Joshua D.; Beran, Gregory J. O., E-mail: gregory.beran@ucr.edu; Monaco, Stephen

2015-09-14

We assess the quality of fragment-based ab initio isotropic {sup 13}C chemical shift predictions for a collection of 25 molecular crystals with eight different density functionals. We explore the relative performance of cluster, two-body fragment, combined cluster/fragment, and the planewave gauge-including projector augmented wave (GIPAW) models relative to experiment. When electrostatic embedding is employed to capture many-body polarization effects, the simple and computationally inexpensive two-body fragment model predicts both isotropic {sup 13}C chemical shifts and the chemical shielding tensors as well as both cluster models and the GIPAW approach. Unlike the GIPAW approach, hybrid density functionals can be used readilymore » in a fragment model, and all four hybrid functionals tested here (PBE0, B3LYP, B3PW91, and B97-2) predict chemical shifts in noticeably better agreement with experiment than the four generalized gradient approximation (GGA) functionals considered (PBE, OPBE, BLYP, and BP86). A set of recommended linear regression parameters for mapping between calculated chemical shieldings and observed chemical shifts are provided based on these benchmark calculations. Statistical cross-validation procedures are used to demonstrate the robustness of these fits.« less

Rapid, High Affinity Binding by a Fluorescein Templated Copolymer Combining Covalent, Hydrophobic, and Acid–Base Noncovalent Crosslinks

PubMed Central

Timberman, Anthony; Yang, Rongfang; Papantones, Alex; Seitz, W. Rudolf

2018-01-01

A new type of biomimetic templated copolymer has been prepared by reverse addition fragmentation chain transfer polymerization (RAFT) in dioxane. The initial formulation includes the template fluorescein, N-isopropylacrylamide (NIPAM, 84 mol %), methacrylic acid (MAA, 5-mol %), 4-vinylpyridine (4-VP, 9 mmol %), and N,N′-methylenebis(acrylamide) (MBA, 2 mol %). PolyNIPAM is a thermosensitive polymer that comes out of aqueous solution above its lower critical solution temperature forming hydrophobic ‘crosslinks’. MAA and 4-VP interact in dioxane forming acid–base crosslinks. The excess 4-VP serves as a recognition monomer organizing around the template fluorescein to form a binding site that is held in place by the noncovalent and covalent crosslinks. The MBA is a covalent crosslinker. The RAFT agent in the resulting copolylmer was reduced to a thiol and attached to gold nanoparticles. The gold nanoparticle bound copolymer binds fluorescein completely in less than two seconds with an affinity constant greater than 108 M−1. A reference copolymer prepared with the same monomers by the same procedure binds fluorescein much more weakly. PMID:29693601

Amplitude spectrum distance: measuring the global shape divergence of protein fragments.

PubMed

Galiez, Clovis; Coste, François

2015-08-14

In structural bioinformatics, there is an increasing interest in identifying and understanding the evolution of local protein structures regarded as key structural or functional protein building blocks. A central need is then to compare these, possibly short, fragments by measuring efficiently and accurately their (dis)similarity. Progress towards this goal has given rise to scores enabling to assess the strong similarity of fragments. Yet, there is still a lack of more progressive scores, with meaningful intermediate values, for the comparison, retrieval or clustering of distantly related fragments. We introduce here the Amplitude Spectrum Distance (ASD), a novel way of comparing protein fragments based on the discrete Fourier transform of their C(α) distance matrix. Defined as the distance between their amplitude spectra, ASD can be computed efficiently and provides a parameter-free measure of the global shape dissimilarity of two fragments. ASD inherits from nice theoretical properties, making it tolerant to shifts, insertions, deletions, circular permutations or sequence reversals while satisfying the triangle inequality. The practical interest of ASD with respect to RMSD, RMSDd, BC and TM scores is illustrated through zinc finger retrieval experiments and concrete structure examples. The benefits of ASD are also illustrated by two additional clustering experiments: domain linkers fragments and complementarity-determining regions of antibodies. Taking advantage of the Fourier transform to compare fragments at a global shape level, ASD is an objective and progressive measure taking into account the whole fragments. Its practical computation time and its properties make ASD particularly relevant for applications requiring meaningful measures on distantly related protein fragments, such as similar fragments retrieval asking for high recalls as shown in the experiments, or for any application taking also advantage of triangle inequality, such as fragments clustering. ASD program and source code are freely available at: http://www.irisa.fr/dyliss/public/ASD/.

Computational analysis of protein-protein interfaces involving an alpha helix: insights for terphenyl-like molecules binding.

PubMed

Isvoran, Adriana; Craciun, Dana; Martiny, Virginie; Sperandio, Olivier; Miteva, Maria A

2013-06-14

Protein-Protein Interactions (PPIs) are key for many cellular processes. The characterization of PPI interfaces and the prediction of putative ligand binding sites and hot spot residues are essential to design efficient small-molecule modulators of PPI. Terphenyl and its derivatives are small organic molecules known to mimic one face of protein-binding alpha-helical peptides. In this work we focus on several PPIs mediated by alpha-helical peptides. We performed computational sequence- and structure-based analyses in order to evaluate several key physicochemical and surface properties of proteins known to interact with alpha-helical peptides and/or terphenyl and its derivatives. Sequence-based analysis revealed low sequence identity between some of the analyzed proteins binding alpha-helical peptides. Structure-based analysis was performed to calculate the volume, the fractal dimension roughness and the hydrophobicity of the binding regions. Besides the overall hydrophobic character of the binding pockets, some specificities were detected. We showed that the hydrophobicity is not uniformly distributed in different alpha-helix binding pockets that can help to identify key hydrophobic hot spots. The presence of hydrophobic cavities at the protein surface with a more complex shape than the entire protein surface seems to be an important property related to the ability of proteins to bind alpha-helical peptides and low molecular weight mimetics. Characterization of similarities and specificities of PPI binding sites can be helpful for further development of small molecules targeting alpha-helix binding proteins.

N- and C-terminal substance P fragments: differential effects on striatal [3H]substance P binding and NK1 receptor internalization.

PubMed

Michael-Titus, A T; Blackburn, D; Connolly, Y; Priestley, J V; Whelpton, R

1999-07-13

N- and C-terminal substance P (SP) fragments increase striatal dopamine outflow at nanomolar concentrations. This contrasts with their low affinity for NK1 receptors. To explore this discrepancy, we investigated the interaction of SP and SP fragments with NK1 sites in fresh striatal slices, the same model used in the functional studies on dopamine outflow. [3H]SP bound specifically to one site (Kd = 6.6 +/- 0.9 nM; Bmax = 12.6 +/- 0.7 fmol/mg protein). [3H]SP binding was displaced by SP (IC50 = 11.8 nM), but not by SP(1-7) or SP(5-11), up to 10 microM. In contrast, 10 nM SP(1-7) or SP(5-11) induced significant internalization of the NK1 receptor, similar to that induced by SP. We suggest that SP fragments have high affinity for an NK1 receptor conformer which is different from that labelled by [3H]SP.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pennington, Luke F.; Tarchevskaya, Svetlana; Brigger, Daniel

Omalizumab is a widely used therapeutic anti-IgE antibody. Here we report the crystal structure of the omalizumab–Fab in complex with an IgE-Fc fragment. This structure reveals the mechanism of omalizumab-mediated inhibition of IgE interactions with both high- and low-affinity IgE receptors, and explains why omalizumab selectively binds free IgE. The structure of the complex also provides mechanistic insight into a class of disruptive IgE inhibitors that accelerate the dissociation of the high-affinity IgE receptor from IgE. We use this structural data to generate a mutant IgE-Fc fragment that is resistant to omalizumab binding. Treatment with this omalizumab-resistant IgE-Fc fragment, inmore » combination with omalizumab, promotes the exchange of cell-bound full-length IgE with omalizumab-resistant IgE-Fc fragments on human basophils. Furthermore, this combination treatment also blocks basophil activation more efficiently than either agent alone, providing a novel approach to probe regulatory mechanisms underlying IgE hypersensitivity with implications for therapeutic interventions.« less

An (e, 2e+ ion) study of electron-impact ionization and fragmentation of tetrafluoromethane at low energies

NASA Astrophysics Data System (ADS)

Hossen, Khokon; Ren, Xueguang; Wang, Enliang; Kumar, S. V. K.; Dorn, Alexander

2018-03-01

We study ionization and fragmentation of tetrafluoromethane (CF4) molecule induced by electron impact at low energies ( E 0 = 38 and 67 eV). We use a reaction microscope combined with a pulsed photoemission electron beam for our experimental investigation. The momentum vectors of the two outgoing electrons (energies E 1, E 2) and one fragment ion are detected in triple coincidence (e, 2e+ ion). After dissociation, the fragment products observed are CF3 +, CF2 +, CF+, F+ and C+. For CF3 + and CF2 + channels, we measure the ionized orbitals binding energies, the kinetic energy (KE) of the charged fragments and the two-dimensional (2D) correlation map between binding energy (BE) and KE of the fragments. From the BE and KE spectra, we conclude which molecular orbitals contribute to particular fragmentation channels of CF4. We also measure the total ionization cross section for the formation of CF3 + and CF2 + ions as function of projectile energy. We compare our results with earlier experiments and calculations for electron-impact and photoionization. The major contribution to CF3 + formation originates from ionization of the 4t2 orbital while CF2 + is mainly formed after 3t2 orbital ionization. We also observe a weak contribution of the (4a1)-1 state for the channel CF3 +.