Sample records for computational nuclear structure

  1. Computational nuclear quantum many-body problem: The UNEDF project

    NASA Astrophysics Data System (ADS)

    Bogner, S.; Bulgac, A.; Carlson, J.; Engel, J.; Fann, G.; Furnstahl, R. J.; Gandolfi, S.; Hagen, G.; Horoi, M.; Johnson, C.; Kortelainen, M.; Lusk, E.; Maris, P.; Nam, H.; Navratil, P.; Nazarewicz, W.; Ng, E.; Nobre, G. P. A.; Ormand, E.; Papenbrock, T.; Pei, J.; Pieper, S. C.; Quaglioni, S.; Roche, K. J.; Sarich, J.; Schunck, N.; Sosonkina, M.; Terasaki, J.; Thompson, I.; Vary, J. P.; Wild, S. M.

    2013-10-01

    The UNEDF project was a large-scale collaborative effort that applied high-performance computing to the nuclear quantum many-body problem. The primary focus of the project was on constructing, validating, and applying an optimized nuclear energy density functional, which entailed a wide range of pioneering developments in microscopic nuclear structure and reactions, algorithms, high-performance computing, and uncertainty quantification. UNEDF demonstrated that close associations among nuclear physicists, mathematicians, and computer scientists can lead to novel physics outcomes built on algorithmic innovations and computational developments. This review showcases a wide range of UNEDF science results to illustrate this interplay.

  2. Nuclear Computational Low Energy Initiative (NUCLEI)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Reddy, Sanjay K.

    This is the final report for University of Washington for the NUCLEI SciDAC-3. The NUCLEI -project, as defined by the scope of work, will develop, implement and run codes for large-scale computations of many topics in low-energy nuclear physics. Physics to be studied include the properties of nuclei and nuclear decays, nuclear structure and reactions, and the properties of nuclear matter. The computational techniques to be used include Quantum Monte Carlo, Configuration Interaction, Coupled Cluster, and Density Functional methods. The research program will emphasize areas of high interest to current and possible future DOE nuclear physics facilities, including ATLAS andmore » FRIB (nuclear structure and reactions, and nuclear astrophysics), TJNAF (neutron distributions in nuclei, few body systems, and electroweak processes), NIF (thermonuclear reactions), MAJORANA and FNPB (neutrino-less double-beta decay and physics beyond the Standard Model), and LANSCE (fission studies).« less

  3. Vibrational Properties of Hydrogen-Bonded Systems Using the Multireference Generalization to the "On-the-Fly" Electronic Structure within Quantum Wavepacket ab Initio Molecular Dynamics (QWAIMD).

    PubMed

    Li, Junjie; Li, Xiaohu; Iyengar, Srinivasan S

    2014-06-10

    We discuss a multiconfigurational treatment of the "on-the-fly" electronic structure within the quantum wavepacket ab initio molecular dynamics (QWAIMD) method for coupled treatment of quantum nuclear effects with electronic structural effects. Here, multiple single-particle electronic density matrices are simultaneously propagated with a quantum nuclear wavepacket and other classical nuclear degrees of freedom. The multiple density matrices are coupled through a nonorthogonal configuration interaction (NOCI) procedure to construct the instantaneous potential surface. An adaptive-mesh-guided set of basis functions composed of Gaussian primitives are used to simplify the electronic structure calculations. Specifically, with the replacement of the atom-centered basis functions positioned on the centers of the quantum-mechanically treated nuclei by a mesh-guided band of basis functions, the two-electron integrals used to compute the electronic structure potential surface become independent of the quantum nuclear variable and hence reusable along the entire Cartesian grid representing the quantum nuclear coordinates. This reduces the computational complexity involved in obtaining a potential surface and facilitates the interpretation of the individual density matrices as representative diabatic states. The parametric nuclear position dependence of the diabatic states is evaluated at the initial time-step using a Shannon-entropy-based sampling function that depends on an approximation to the quantum nuclear wavepacket and the potential surface. This development is meant as a precursor to an on-the-fly fully multireference electronic structure procedure embedded, on-the-fly, within a quantum nuclear dynamics formalism. We benchmark the current development by computing structural, dynamic, and spectroscopic features for a series of bihalide hydrogen-bonded systems: FHF(-), ClHCl(-), BrHBr(-), and BrHCl(-). We find that the donor-acceptor structural features are in good agreement with experiments. Spectroscopic features are computed using a unified velocity/flux autocorrelation function and include vibrational fundamentals and combination bands. These agree well with experiments and other theories.

  4. Nuclear Physics Laboratory 1979 annual report

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Adelberger, E.G.

    1979-07-01

    Research progress is reported in the following areas: astrophysics and cosmology, fundamental symmetries, nuclear structure, radiative capture, medium energy physics, heavy ion reactions, research by users and visitors, accelerator and ion source development, instrumentation and experimental techniques, and computers and computing. Publications are listed. (WHK)

  5. Structure, spectra and antioxidant action of ascorbic acid studied by density functional theory, Raman spectroscopic and nuclear magnetic resonance techniques.

    PubMed

    Singh, Gurpreet; Mohanty, B P; Saini, G S S

    2016-02-15

    Structure, vibrational and nuclear magnetic resonance spectra, and antioxidant action of ascorbic acid towards hydroxyl radicals have been studied computationally and in vitro by ultraviolet-visible, nuclear magnetic resonance and vibrational spectroscopic techniques. Time dependant density functional theory calculations have been employed to specify various electronic transitions in ultraviolet-visible spectra. Observed chemical shifts and vibrational bands in nuclear magnetic resonance and vibrational spectra, respectively have been assigned with the help of calculations. Changes in the structure of ascorbic acid in aqueous phase have been examined computationally and experimentally by recording Raman spectra in aqueous medium. Theoretical calculations of the interaction between ascorbic acid molecule and hydroxyl radical predicted the formation of dehydroascorbic acid as first product, which has been confirmed by comparing its simulated spectra with the corresponding spectra of ascorbic acid in presence of hydrogen peroxide. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. Structural integrity of materials in nuclear service: a bibliography

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Heddleson, F.A.

    This report contains 679 abstracts from the Nuclear Safety Information Center (NSIC) computer file dated 1973 through 1976 covering material properties with respect to structural integrity. All materials important to the nuclear industry (except concrete) are covered for mechanical properties, chemical properties, corrosion, fracture or failure, radiation damage, creep, cracking, and swelling. Keyword, author, and permuted-title indexes are included for the convenience of the user.

  7. Accelerating Full Configuration Interaction Calculations for Nuclear Structure

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yang, Chao; Sternberg, Philip; Maris, Pieter

    2008-04-14

    One of the emerging computational approaches in nuclear physics is the full configuration interaction (FCI) method for solving the many-body nuclear Hamiltonian in a sufficiently large single-particle basis space to obtain exact answers - either directly or by extrapolation. The lowest eigenvalues and correspondingeigenvectors for very large, sparse and unstructured nuclear Hamiltonian matrices are obtained and used to evaluate additional experimental quantities. These matrices pose a significant challenge to the design and implementation of efficient and scalable algorithms for obtaining solutions on massively parallel computer systems. In this paper, we describe the computational strategies employed in a state-of-the-art FCI codemore » MFDn (Many Fermion Dynamics - nuclear) as well as techniques we recently developed to enhance the computational efficiency of MFDn. We will demonstrate the current capability of MFDn and report the latest performance improvement we have achieved. We will also outline our future research directions.« less

  8. Computation of statistical secondary structure of nucleic acids.

    PubMed Central

    Yamamoto, K; Kitamura, Y; Yoshikura, H

    1984-01-01

    This paper presents a computer analysis of statistical secondary structure of nucleic acids. For a given single stranded nucleic acid, we generated "structure map" which included all the annealing structures in the sequence. The map was transformed into "energy map" by rough approximation; here, the energy level of every pairing structure consisting of more than 2 successive nucleic acid pairs was calculated. By using the "energy map", the probability of occurrence of each annealed structure was computed, i.e., the structure was computed statistically. The basis of computation was the 8-queen problem in the chess game. The validity of our computer programme was checked by computing tRNA structure which has been well established. Successful application of this programme to small nuclear RNAs of various origins is demonstrated. PMID:6198622

  9. Structural integrity of a confinement vessel for testing nuclear fuels for space propulsion

    NASA Astrophysics Data System (ADS)

    Bergmann, V. L.

    Nuclear propulsion systems for rockets could significantly reduce the travel time to distant destinations in space. However, long before such a concept can become reality, a significant effort must be invested in analysis and ground testing to guide the development of nuclear fuels. Any testing in support of development of nuclear fuels for space propulsion must be safely contained to prevent the release of radioactive materials. This paper describes analyses performed to assess the structural integrity of a test confinement vessel. The confinement structure, a stainless steel pressure vessel with bolted flanges, was designed for operating static pressures in accordance with the ASME Boiler and Pressure Vessel Code. In addition to the static operating pressures, the confinement barrier must withstand static overpressures from off-normal conditions without releasing radioactive material. Results from axisymmetric finite element analyses are used to evaluate the response of the confinement structure under design and accident conditions. For the static design conditions, the stresses computed from the ASME code are compared with the stresses computed by the finite element method.

  10. Energy and Technology Review

    NASA Astrophysics Data System (ADS)

    Poggio, Andrew J.

    1988-10-01

    This issue of Energy and Technology Review contains: Neutron Penumbral Imaging of Laser-Fusion Targets--using our new penumbral-imaging diagnostic, we have obtained the first images that can be used to measure directly the deuterium-tritium burn region in laser-driven fusion targets; Computed Tomography for Nondestructive Evaluation--various computed tomography systems and computational techniques are used in nondestructive evaluation; Three-Dimensional Image Analysis for Studying Nuclear Chromatin Structure--we have developed an optic-electronic system for acquiring cross-sectional views of cell nuclei, and computer codes to analyze these images and reconstruct the three-dimensional structures they represent; Imaging in the Nuclear Test Program--advanced techniques produce images of unprecedented detail and resolution from Nevada Test Site data; and Computational X-Ray Holography--visible-light experiments and numerically simulated holograms test our ideas about an X-ray microscope for biological research.

  11. Response of basic structural elements and B-52 structural components to simulated nuclear overpressure. Volume II-program data (basic structural elements). Final report, 1 June 1977-30 September 1979

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Syring, R.P.; Grubb, R.L.

    1979-09-30

    This document reports on the following: (1) experimental determination of the response of 16 basic structural elements and 7 B-52 components to simulated nuclear overpressure environments (utilizing Sandia Corporation's Thunderpipe Shock Tube), (2) analysis of these test specimens utilizing the NOVA-2 computer program, and (3) correlation of test and analysis results.

  12. Response of basic structural elements and B-52 structural components to simulated nuclear overpressure. Volume I-program description and results (basic structural elements). Final report, 1 June 1977-30 September 1979

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Syring, R.P.; Grubb, R.L.

    1979-09-30

    This document reports on the following: (1) experimental determination of the response of 16 basic structural elements and 7 B-52 components to simulated nuclear overpressure environments (utilizing Sandia Corporation's Thunderpipe Shock Tube), (2) analysis of these test specimens utilizing the NOVA-2 computer program, and (3) correlation of test and analysis results.

  13. Nuclear data and related services

    NASA Astrophysics Data System (ADS)

    Tuli, J. K.

    1985-10-01

    National Nuclear Data Center (NNDC) maintains a number of data bases containing bibliographic information and evaluated as well as experimental nuclear properties. An evaluated computer file maintained by the NNDC, called the Evaluated Nuclear Structure Data File (ENSDF), contains nuclear structure information for all known nuclides. The ENSDF is the source for the journal Nuclear Data Sheets which is produced and edited by NNDC. The Evaluated Nuclear Data File (ENDF), on the other hand is designed for storage and retrieval of such evaluated nuclear data as are used in neutronic, photonic, and decay heat calculations in a large variety of applications. Some of the publications from these data bases are the Nuclear Wallet Cards, Radioactivity Handbook, and books on neutron cross sections and resonance parameters. In addition, the NNDC maintains three bibliographic files: NSR - for nuclear structure and decay data related references, CINDA - a bibliographic file for neutron induced reactions, and CPBIB for charged particle reactions. Selected retrievals from evaluated data and bibliographic files are possible on-line or on request from NNDC.

  14. Neutron radiation damage studies in the structural materials of a 500 MWe fast breeder reactor using DPA cross-sections from ENDF / B-VII.1

    NASA Astrophysics Data System (ADS)

    Saha, Uttiyoarnab; Devan, K.; Bachchan, Abhitab; Pandikumar, G.; Ganesan, S.

    2018-04-01

    The radiation damage in the structural materials of a 500 MWe Indian prototype fast breeder reactor (PFBR) is re-assessed by computing the neutron displacement per atom (dpa) cross-sections from the recent nuclear data library evaluated by the USA, ENDF / B-VII.1, wherein revisions were taken place in the new evaluations of basic nuclear data because of using the state-of-the-art neutron cross-section experiments, nuclear model-based predictions and modern data evaluation techniques. An indigenous computer code, computation of radiation damage (CRaD), is developed at our centre to compute primary-knock-on atom (PKA) spectra and displacement cross-sections of materials both in point-wise and any chosen group structure from the evaluated nuclear data libraries. The new radiation damage model, athermal recombination-corrected displacement per atom (arc-dpa), developed based on molecular dynamics simulations is also incorporated in our study. This work is the result of our earlier initiatives to overcome some of the limitations experienced while using codes like RECOIL, SPECTER and NJOY 2016, to estimate radiation damage. Agreement of CRaD results with other codes and ASTM standard for Fe dpa cross-section is found good. The present estimate of total dpa in D-9 steel of PFBR necessitates renormalisation of experimental correlations of dpa and radiation damage to ensure consistency of damage prediction with ENDF / B-VII.1 library.

  15. The ENSDF Java Package

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sonzogni, A.A.

    2005-05-24

    A package of computer codes has been developed to process and display nuclear structure and decay data stored in the ENSDF (Evaluated Nuclear Structure Data File) library. The codes were written in an object-oriented fashion using the java language. This allows for an easy implementation across multiple platforms as well as deployment on web pages. The structure of the different java classes that make up the package is discussed as well as several different implementations.

  16. Contributions to the NUCLEI SciDAC-3 Project

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bogner, Scott; Nazarewicz, Witek

    This is the Final Report for Michigan State University for the NUCLEI SciDAC-3 project. The NUCLEI project, as defined by the scope of work, has developed, implemented and run codes for large-scale computations of many topics in low-energy nuclear physics. Physics studied included the properties of nuclei and nuclear decays, nuclear structure and reactions, and the properties of nuclear matter. The computational techniques used included Configuration Interaction, Coupled Cluster, and Density Functional methods. The research program emphasized areas of high interest to current and possible future DOE nuclear physics facilities, including ATLAS at ANL and FRIB at MSU (nuclear structuremore » and reactions, and nuclear astrophysics), TJNAF (neutron distributions in nuclei, few body systems, and electroweak processes), NIF (thermonuclear reactions), MAJORANA and FNPB (neutrinoless double-beta decay and physics beyond the Standard Model), and LANSCE (fission studies).« less

  17. Possible 6-qubit NMR quantum computer device material; simulator of the NMR line width

    NASA Astrophysics Data System (ADS)

    Hashi, K.; Kitazawa, H.; Shimizu, T.; Goto, A.; Eguchi, S.; Ohki, S.

    2002-12-01

    For an NMR quantum computer, splitting of an NMR spectrum must be larger than a line width. In order to find a best device material for a solid-state NMR quantum computer, we have made a simulation program to calculate the NMR line width due to the nuclear dipole field by the 2nd moment method. The program utilizes the lattice information prepared by commercial software to draw a crystal structure. By applying this program, we can estimate the NMR line width due to the nuclear dipole field without measurements and find a candidate material for a 6-qubit solid-state NMR quantum computer device.

  18. Particle tracking acceleration via signed distance fields in direct-accelerated geometry Monte Carlo

    DOE PAGES

    Shriwise, Patrick C.; Davis, Andrew; Jacobson, Lucas J.; ...

    2017-08-26

    Computer-aided design (CAD)-based Monte Carlo radiation transport is of value to the nuclear engineering community for its ability to conduct transport on high-fidelity models of nuclear systems, but it is more computationally expensive than native geometry representations. This work describes the adaptation of a rendering data structure, the signed distance field, as a geometric query tool for accelerating CAD-based transport in the direct-accelerated geometry Monte Carlo toolkit. Demonstrations of its effectiveness are shown for several problems. The beginnings of a predictive model for the data structure's utilization based on various problem parameters is also introduced.

  19. Equation of state of dense nuclear matter and neutron star structure from nuclear chiral interactions

    NASA Astrophysics Data System (ADS)

    Bombaci, Ignazio; Logoteta, Domenico

    2018-02-01

    Aims: We report a new microscopic equation of state (EOS) of dense symmetric nuclear matter, pure neutron matter, and asymmetric and β-stable nuclear matter at zero temperature using recent realistic two-body and three-body nuclear interactions derived in the framework of chiral perturbation theory (ChPT) and including the Δ(1232) isobar intermediate state. This EOS is provided in tabular form and in parametrized form ready for use in numerical general relativity simulations of binary neutron star merging. Here we use our new EOS for β-stable nuclear matter to compute various structural properties of non-rotating neutron stars. Methods: The EOS is derived using the Brueckner-Bethe-Goldstone quantum many-body theory in the Brueckner-Hartree-Fock approximation. Neutron star properties are next computed solving numerically the Tolman-Oppenheimer-Volkov structure equations. Results: Our EOS models are able to reproduce the empirical saturation point of symmetric nuclear matter, the symmetry energy Esym, and its slope parameter L at the empirical saturation density n0. In addition, our EOS models are compatible with experimental data from collisions between heavy nuclei at energies ranging from a few tens of MeV up to several hundreds of MeV per nucleon. These experiments provide a selective test for constraining the nuclear EOS up to 4n0. Our EOS models are consistent with present measured neutron star masses and particularly with the mass M = 2.01 ± 0.04 M⊙ of the neutron stars in PSR J0348+0432.

  20. Quantum wavepacket ab initio molecular dynamics: an approach for computing dynamically averaged vibrational spectra including critical nuclear quantum effects.

    PubMed

    Sumner, Isaiah; Iyengar, Srinivasan S

    2007-10-18

    We have introduced a computational methodology to study vibrational spectroscopy in clusters inclusive of critical nuclear quantum effects. This approach is based on the recently developed quantum wavepacket ab initio molecular dynamics method that combines quantum wavepacket dynamics with ab initio molecular dynamics. The computational efficiency of the dynamical procedure is drastically improved (by several orders of magnitude) through the utilization of wavelet-based techniques combined with the previously introduced time-dependent deterministic sampling procedure measure to achieve stable, picosecond length, quantum-classical dynamics of electrons and nuclei in clusters. The dynamical information is employed to construct a novel cumulative flux/velocity correlation function, where the wavepacket flux from the quantized particle is combined with classical nuclear velocities to obtain the vibrational density of states. The approach is demonstrated by computing the vibrational density of states of [Cl-H-Cl]-, inclusive of critical quantum nuclear effects, and our results are in good agreement with experiment. A general hierarchical procedure is also provided, based on electronic structure harmonic frequencies, classical ab initio molecular dynamics, computation of nuclear quantum-mechanical eigenstates, and employing quantum wavepacket ab initio dynamics to understand vibrational spectroscopy in hydrogen-bonded clusters that display large degrees of anharmonicities.

  1. NASTRAN Analysis Comparison to Shock Tube Tests Used to Simulate Nuclear Overpressures

    NASA Technical Reports Server (NTRS)

    Wheless, T. K.

    1985-01-01

    This report presents a study of the effectiveness of the NASTRAN computer code for predicting structural response to nuclear blast overpressures. NASTRAN's effectiveness is determined by comparing results against shock tube tests used to simulate nuclear overpressures. Seven panels of various configurations are compared in this study. Panel deflections are the criteria used to measure NASTRAN's effectiveness. This study is a result of needed improvements in the survivability/vulnerability analyses subjected to nuclear blast.

  2. Recent advances in computational actinoid chemistry.

    PubMed

    Wang, Dongqi; van Gunsteren, Wilfred F; Chai, Zhifang

    2012-09-07

    We briefly review advances in computational actinoid (An) chemistry during the past ten years in regard to two issues: the geometrical and electronic structures, and reactions. The former addresses the An-O, An-C, and M-An (M is a metal atom including An) bonds in the actinoid molecular systems, including actinoid oxo and oxide species, actinoid-carbenoid, dinuclear and diatomic systems, and the latter the hydration and ligand exchange, the disproportionation, the oxidation, the reduction of uranyl, hydroamination, and the photolysis of uranium azide. Concerning their relevance to the electronic structures and reactions of actinoids and their importance in the development of an advanced nuclear fuel cycle, we also mentioned the work on actinoid carbides and nitrides, which have been proposed to be candidates of the next generation of nuclear fuel, and the oxidation of PuO(x), which is important to understand the speciation of actinoids in the environment, followed by a brief discussion on the urgent need for a heavier involvement of computational actinoid chemistry in developing advanced reprocessing protocols of spent nuclear fuel. The paper is concluded with an outlook.

  3. Nuclear transmutation in steels

    NASA Astrophysics Data System (ADS)

    Belozerova, A. R.; Shimanskii, G. A.; Belozerov, S. V.

    2009-05-01

    The investigations of the effects of nuclear transmutation in steels that are widely used in nuclear power and research reactors and in steels that are planned for the application in thermonuclear fusion plants, which are employed under the conditions of a prolonged action of neutron irradiation with different spectra, made it possible to study the effects of changes in the isotopic and chemical composition on the tendency of changes in the structural stability of these steels. For the computations of nuclear transmutation in steels, we used a program complex we have previously developed on the basis of algorithms for constructing branched block-type diagrams of nuclide transformations and for locally and globally optimizing these diagrams with the purpose of minimizing systematic errors in the calculation of nuclear transmutation. The dependences obtained were applied onto a Schaeffler diagram for steels used for structural elements of reactors. For the irradiation in fission reactors, we observed only a weak influence of the effects of nuclear transmutation in steels on their structural stability. On the contrary, in the case of irradiation with fusion neutrons, a strong influence of the effects of nuclear transmutation in steels on their structural stability has been noted.

  4. Simulation of ceramic materials relevant for nuclear waste management: Case of La1-xEuxPO4 solid solution

    NASA Astrophysics Data System (ADS)

    Kowalski, Piotr M.; Ji, Yaqi; Li, Yan; Arinicheva, Yulia; Beridze, George; Neumeier, Stefan; Bukaemskiy, Andrey; Bosbach, Dirk

    2017-02-01

    Using powerful computational resources and state-of-the-art methods of computational chemistry we contribute to the research on novel nuclear waste forms by providing atomic scale description of processes that govern the structural incorporation and the interactions of radionuclides in host materials. Here we present various results of combined computational and experimental studies on La1-xEuxPO4 monazite-type solid solution. We discuss the performance of DFT + U method with the Hubbard U parameter value derived ab initio, and the derivation of various structural, thermodynamic and radiation-damage related properties. We show a correlation between the cation displacement probabilities and the solubility data, indicating that the binding of cations is the driving factor behind both processes. The combined atomistic modeling and experimental studies result in a superior characterization of the investigated material.

  5. An introduction to using the FORTRAN programs provided with Computational Nuclear Physics 1 Nuclear Structure

    NASA Technical Reports Server (NTRS)

    Boytos, Matthew A.; Norbury, John W.

    1992-01-01

    The authors of this paper have provided a set of ready-to-run FORTRAN programs that should be useful in the field of theoretical nuclear physics. The purpose of this document is to provide a simple synopsis of the programs and their use. A separate section is devoted to each program set and includes: abstract; files; compiling, linking, and running; obtaining results; and a tutorial.

  6. Automatic Estimation of the Radiological Inventory for the Dismantling of Nuclear Facilities

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Garcia-Bermejo, R.; Felipe, A.; Gutierrez, S.

    The estimation of the radiological inventory of Nuclear Facilities to be dismantled is a process that included information related with the physical inventory of all the plant and radiological survey. Estimation of the radiological inventory for all the components and civil structure of the plant could be obtained with mathematical models with statistical approach. A computer application has been developed in order to obtain the radiological inventory in an automatic way. Results: A computer application that is able to estimate the radiological inventory from the radiological measurements or the characterization program has been developed. In this computer applications has beenmore » included the statistical functions needed for the estimation of the central tendency and variability, e.g. mean, median, variance, confidence intervals, variance coefficients, etc. This computer application is a necessary tool in order to be able to estimate the radiological inventory of a nuclear facility and it is a powerful tool for decision taken in future sampling surveys.« less

  7. Advances and trends in structural and solid mechanics; Proceedings of the Symposium, Washington, DC, October 4-7, 1982

    NASA Technical Reports Server (NTRS)

    Noor, A. K. (Editor); Housner, J. M.

    1983-01-01

    The mechanics of materials and material characterization are considered, taking into account micromechanics, the behavior of steel structures at elevated temperatures, and an anisotropic plasticity model for inelastic multiaxial cyclic deformation. Other topics explored are related to advances and trends in finite element technology, classical analytical techniques and their computer implementation, interactive computing and computational strategies for nonlinear problems, advances and trends in numerical analysis, database management systems and CAD/CAM, space structures and vehicle crashworthiness, beams, plates and fibrous composite structures, design-oriented analysis, artificial intelligence and optimization, contact problems, random waves, and lifetime prediction. Earthquake-resistant structures and other advanced structural applications are also discussed, giving attention to cumulative damage in steel structures subjected to earthquake ground motions, and a mixed domain analysis of nuclear containment structures using impulse functions.

  8. Processing And Display Of Medical Three Dimensional Arrays Of Numerical Data Using Octree Encoding

    NASA Astrophysics Data System (ADS)

    Amans, Jean-Louis; Darier, Pierre

    1986-05-01

    imaging modalities such as X-Ray computerized Tomography (CT), Nuclear Medecine and Nuclear Magnetic Resonance can produce three-dimensional (3-D) arrays of numerical data of medical object internal structures. The analysis of 3-D data by synthetic generation of realistic images is an important area of computer graphics and imaging.

  9. Thermal-neutron capture gamma-rays. Volume 2

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tuli, J.K.

    1997-05-01

    The energy and photon intensity of gamma rays as seen in thermal-neutron capture are presented ordered by Z, A of target nuclei. All gamma-rays with intensity of {ge}2% of the strongest transition are included. The strongest transition is indicated in each case. Where the target nuclide mass number is indicated as nat the natural target was used. The gamma energies given are in keV. The gamma intensities given are relative to 100 for the strongest transition. All data for A > 44 are taken from Evaluated Nuclear Structure Data File (4/97), a computer file of evaluated nuclear structure data maintainedmore » by the National Nuclear Data Center, Brookhaven National Laboratory, on behalf of the Nuclear Structure and Decay and Decay Data network, coordinated by the International Atomic Energy Agency, Vienna. These data are published in Nuclear Data Sheets, Academic Press, San Diego, CA. The data for A {le} 44 is taken from ``Prompt Gamma Rays from Thermal-Neutron Capture,`` M.A. Lone, R.A. Leavitt, D.A. Harrison, Atomic Data and Nuclear Data Tables 26, 511 (1981).« less

  10. NERVA dynamic analysis methodology, SPRVIB

    NASA Technical Reports Server (NTRS)

    Vronay, D. F.

    1972-01-01

    The general dynamic computer code called SPRVIB (Spring Vib) developed in support of the NERVA (nuclear engine for rocket vehicle application) program is described. Using normal mode techniques, the program computes kinematical responses of a structure caused by various combinations of harmonic and elliptic forcing functions or base excitations. Provision is made for a graphical type of force or base excitation input to the structure. A description of the required input format and a listing of the program are presented, along with several examples illustrating the use of the program. SPRVIB is written in FORTRAN 4 computer language for use on the CDC 6600 or the IBM 360/75 computers.

  11. Theoretical modeling of multiprotein complexes by iSPOT: Integration of small-angle X-ray scattering, hydroxyl radical footprinting, and computational docking.

    PubMed

    Huang, Wei; Ravikumar, Krishnakumar M; Parisien, Marc; Yang, Sichun

    2016-12-01

    Structural determination of protein-protein complexes such as multidomain nuclear receptors has been challenging for high-resolution structural techniques. Here, we present a combined use of multiple biophysical methods, termed iSPOT, an integration of shape information from small-angle X-ray scattering (SAXS), protection factors probed by hydroxyl radical footprinting, and a large series of computationally docked conformations from rigid-body or molecular dynamics (MD) simulations. Specifically tested on two model systems, the power of iSPOT is demonstrated to accurately predict the structures of a large protein-protein complex (TGFβ-FKBP12) and a multidomain nuclear receptor homodimer (HNF-4α), based on the structures of individual components of the complexes. Although neither SAXS nor footprinting alone can yield an unambiguous picture for each complex, the combination of both, seamlessly integrated in iSPOT, narrows down the best-fit structures that are about 3.2Å and 4.2Å in RMSD from their corresponding crystal structures, respectively. Furthermore, this proof-of-principle study based on the data synthetically derived from available crystal structures shows that the iSPOT-using either rigid-body or MD-based flexible docking-is capable of overcoming the shortcomings of standalone computational methods, especially for HNF-4α. By taking advantage of the integration of SAXS-based shape information and footprinting-based protection/accessibility as well as computational docking, this iSPOT platform is set to be a powerful approach towards accurate integrated modeling of many challenging multiprotein complexes. Copyright © 2016 Elsevier Inc. All rights reserved.

  12. A comparative approach for the investigation of biological information processing: An examination of the structure and function of computer hard drives and DNA

    PubMed Central

    2010-01-01

    Background The robust storage, updating and utilization of information are necessary for the maintenance and perpetuation of dynamic systems. These systems can exist as constructs of metal-oxide semiconductors and silicon, as in a digital computer, or in the "wetware" of organic compounds, proteins and nucleic acids that make up biological organisms. We propose that there are essential functional properties of centralized information-processing systems; for digital computers these properties reside in the computer's hard drive, and for eukaryotic cells they are manifest in the DNA and associated structures. Methods Presented herein is a descriptive framework that compares DNA and its associated proteins and sub-nuclear structure with the structure and function of the computer hard drive. We identify four essential properties of information for a centralized storage and processing system: (1) orthogonal uniqueness, (2) low level formatting, (3) high level formatting and (4) translation of stored to usable form. The corresponding aspects of the DNA complex and a computer hard drive are categorized using this classification. This is intended to demonstrate a functional equivalence between the components of the two systems, and thus the systems themselves. Results Both the DNA complex and the computer hard drive contain components that fulfill the essential properties of a centralized information storage and processing system. The functional equivalence of these components provides insight into both the design process of engineered systems and the evolved solutions addressing similar system requirements. However, there are points where the comparison breaks down, particularly when there are externally imposed information-organizing structures on the computer hard drive. A specific example of this is the imposition of the File Allocation Table (FAT) during high level formatting of the computer hard drive and the subsequent loading of an operating system (OS). Biological systems do not have an external source for a map of their stored information or for an operational instruction set; rather, they must contain an organizational template conserved within their intra-nuclear architecture that "manipulates" the laws of chemistry and physics into a highly robust instruction set. We propose that the epigenetic structure of the intra-nuclear environment and the non-coding RNA may play the roles of a Biological File Allocation Table (BFAT) and biological operating system (Bio-OS) in eukaryotic cells. Conclusions The comparison of functional and structural characteristics of the DNA complex and the computer hard drive leads to a new descriptive paradigm that identifies the DNA as a dynamic storage system of biological information. This system is embodied in an autonomous operating system that inductively follows organizational structures, data hierarchy and executable operations that are well understood in the computer science industry. Characterizing the "DNA hard drive" in this fashion can lead to insights arising from discrepancies in the descriptive framework, particularly with respect to positing the role of epigenetic processes in an information-processing context. Further expansions arising from this comparison include the view of cells as parallel computing machines and a new approach towards characterizing cellular control systems. PMID:20092652

  13. A comparative approach for the investigation of biological information processing: an examination of the structure and function of computer hard drives and DNA.

    PubMed

    D'Onofrio, David J; An, Gary

    2010-01-21

    The robust storage, updating and utilization of information are necessary for the maintenance and perpetuation of dynamic systems. These systems can exist as constructs of metal-oxide semiconductors and silicon, as in a digital computer, or in the "wetware" of organic compounds, proteins and nucleic acids that make up biological organisms. We propose that there are essential functional properties of centralized information-processing systems; for digital computers these properties reside in the computer's hard drive, and for eukaryotic cells they are manifest in the DNA and associated structures. Presented herein is a descriptive framework that compares DNA and its associated proteins and sub-nuclear structure with the structure and function of the computer hard drive. We identify four essential properties of information for a centralized storage and processing system: (1) orthogonal uniqueness, (2) low level formatting, (3) high level formatting and (4) translation of stored to usable form. The corresponding aspects of the DNA complex and a computer hard drive are categorized using this classification. This is intended to demonstrate a functional equivalence between the components of the two systems, and thus the systems themselves. Both the DNA complex and the computer hard drive contain components that fulfill the essential properties of a centralized information storage and processing system. The functional equivalence of these components provides insight into both the design process of engineered systems and the evolved solutions addressing similar system requirements. However, there are points where the comparison breaks down, particularly when there are externally imposed information-organizing structures on the computer hard drive. A specific example of this is the imposition of the File Allocation Table (FAT) during high level formatting of the computer hard drive and the subsequent loading of an operating system (OS). Biological systems do not have an external source for a map of their stored information or for an operational instruction set; rather, they must contain an organizational template conserved within their intra-nuclear architecture that "manipulates" the laws of chemistry and physics into a highly robust instruction set. We propose that the epigenetic structure of the intra-nuclear environment and the non-coding RNA may play the roles of a Biological File Allocation Table (BFAT) and biological operating system (Bio-OS) in eukaryotic cells. The comparison of functional and structural characteristics of the DNA complex and the computer hard drive leads to a new descriptive paradigm that identifies the DNA as a dynamic storage system of biological information. This system is embodied in an autonomous operating system that inductively follows organizational structures, data hierarchy and executable operations that are well understood in the computer science industry. Characterizing the "DNA hard drive" in this fashion can lead to insights arising from discrepancies in the descriptive framework, particularly with respect to positing the role of epigenetic processes in an information-processing context. Further expansions arising from this comparison include the view of cells as parallel computing machines and a new approach towards characterizing cellular control systems.

  14. Methods and benefits of experimental seismic evaluation of nuclear power plants. Final report

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Not Available

    1979-07-01

    This study reviews experimental techniques, instrumentation requirements, safety considerations, and benefits of performing vibration tests on nuclear power plant containments and internal components. The emphasis is on testing to improve seismic structural models. Techniques for identification of resonant frequencies, damping, and mode shapes, are discussed. The benefits of testing with regard to increased damping and more accurate computer models are oulined. A test plan, schedule and budget are presented for a typical PWR nuclear power plant.

  15. Is nuclear matter a quantum crystal?

    NASA Technical Reports Server (NTRS)

    Canuto, V.; Chitre, S. M.

    1973-01-01

    A possible alternative to the ordinary gas-like computation for nuclear matter is investigated under the assumption that the nucleons are arranged in a lattice. BCC, FCC and HCP structures are investigated. Only HCP shows a minimum in the energy vs. density curve with a modest binding energy of -1.5 MeV. The very low density limit is investigated and sensible results are obtained only if the tensor force decreases with the density. A study of the elastic properties indicates that the previous structures are mechanically unstable against shearing stresses.

  16. Accelerating nuclear configuration interaction calculations through a preconditioned block iterative eigensolver

    NASA Astrophysics Data System (ADS)

    Shao, Meiyue; Aktulga, H. Metin; Yang, Chao; Ng, Esmond G.; Maris, Pieter; Vary, James P.

    2018-01-01

    We describe a number of recently developed techniques for improving the performance of large-scale nuclear configuration interaction calculations on high performance parallel computers. We show the benefit of using a preconditioned block iterative method to replace the Lanczos algorithm that has traditionally been used to perform this type of computation. The rapid convergence of the block iterative method is achieved by a proper choice of starting guesses of the eigenvectors and the construction of an effective preconditioner. These acceleration techniques take advantage of special structure of the nuclear configuration interaction problem which we discuss in detail. The use of a block method also allows us to improve the concurrency of the computation, and take advantage of the memory hierarchy of modern microprocessors to increase the arithmetic intensity of the computation relative to data movement. We also discuss the implementation details that are critical to achieving high performance on massively parallel multi-core supercomputers, and demonstrate that the new block iterative solver is two to three times faster than the Lanczos based algorithm for problems of moderate sizes on a Cray XC30 system.

  17. SINGER: A Computer Code for General Analysis of Two-Dimensional Reinforced Concrete Structures. Volume 1. Solution Process

    DTIC Science & Technology

    1975-05-01

    Conference on Earthquake Engineering, Santiago de Chile, 13-18 January 1969, Vol. I , Session B2, Chilean Association oil Seismology and Earth- quake...Nuclear Agency May 1975 DISTRIBUTED BY: KJ National Technical Information Service U. S. DEPARTMENT OF COMMERCE ^804J AFWL-TR-74-228, Vol. I ...CM o / i ’•fu.r ) V V AFWL-TR- 74-228 Vol. I SINGER: A COMPUTER CODE FOR GENERAL ANALYSIS OF TWO-DIMENSIONAL CONCRETE STRUCTURES Volum« I

  18. An optimal transportation approach for nuclear structure-based pathology.

    PubMed

    Wang, Wei; Ozolek, John A; Slepčev, Dejan; Lee, Ann B; Chen, Cheng; Rohde, Gustavo K

    2011-03-01

    Nuclear morphology and structure as visualized from histopathology microscopy images can yield important diagnostic clues in some benign and malignant tissue lesions. Precise quantitative information about nuclear structure and morphology, however, is currently not available for many diagnostic challenges. This is due, in part, to the lack of methods to quantify these differences from image data. We describe a method to characterize and contrast the distribution of nuclear structure in different tissue classes (normal, benign, cancer, etc.). The approach is based on quantifying chromatin morphology in different groups of cells using the optimal transportation (Kantorovich-Wasserstein) metric in combination with the Fisher discriminant analysis and multidimensional scaling techniques. We show that the optimal transportation metric is able to measure relevant biological information as it enables automatic determination of the class (e.g., normal versus cancer) of a set of nuclei. We show that the classification accuracies obtained using this metric are, on average, as good or better than those obtained utilizing a set of previously described numerical features. We apply our methods to two diagnostic challenges for surgical pathology: one in the liver and one in the thyroid. Results automatically computed using this technique show potentially biologically relevant differences in nuclear structure in liver and thyroid cancers.

  19. An optimal transportation approach for nuclear structure-based pathology

    PubMed Central

    Wang, Wei; Ozolek, John A.; Slepčev, Dejan; Lee, Ann B.; Chen, Cheng; Rohde, Gustavo K.

    2012-01-01

    Nuclear morphology and structure as visualized from histopathology microscopy images can yield important diagnostic clues in some benign and malignant tissue lesions. Precise quantitative information about nuclear structure and morphology, however, is currently not available for many diagnostic challenges. This is due, in part, to the lack of methods to quantify these differences from image data. We describe a method to characterize and contrast the distribution of nuclear structure in different tissue classes (normal, benign, cancer, etc.). The approach is based on quantifying chromatin morphology in different groups of cells using the optimal transportation (Kantorovich-Wasserstein) metric in combination with the Fisher discriminant analysis and multidimensional scaling techniques. We show that the optimal transportation metric is able to measure relevant biological information as it enables automatic determination of the class (e.g. normal vs. cancer) of a set of nuclei. We show that the classification accuracies obtained using this metric are, on average, as good or better than those obtained utilizing a set of previously described numerical features. We apply our methods to two diagnostic challenges for surgical pathology: one in the liver and one in the thyroid. Results automatically computed using this technique show potentially biologically relevant differences in nuclear structure in liver and thyroid cancers. PMID:20977984

  20. Adiabatic quantum computing with spin qubits hosted by molecules.

    PubMed

    Yamamoto, Satoru; Nakazawa, Shigeaki; Sugisaki, Kenji; Sato, Kazunobu; Toyota, Kazuo; Shiomi, Daisuke; Takui, Takeji

    2015-01-28

    A molecular spin quantum computer (MSQC) requires electron spin qubits, which pulse-based electron spin/magnetic resonance (ESR/MR) techniques can afford to manipulate for implementing quantum gate operations in open shell molecular entities. Importantly, nuclear spins, which are topologically connected, particularly in organic molecular spin systems, are client qubits, while electron spins play a role of bus qubits. Here, we introduce the implementation for an adiabatic quantum algorithm, suggesting the possible utilization of molecular spins with optimized spin structures for MSQCs. We exemplify the utilization of an adiabatic factorization problem of 21, compared with the corresponding nuclear magnetic resonance (NMR) case. Two molecular spins are selected: one is a molecular spin composed of three exchange-coupled electrons as electron-only qubits and the other an electron-bus qubit with two client nuclear spin qubits. Their electronic spin structures are well characterized in terms of the quantum mechanical behaviour in the spin Hamiltonian. The implementation of adiabatic quantum computing/computation (AQC) has, for the first time, been achieved by establishing ESR/MR pulse sequences for effective spin Hamiltonians in a fully controlled manner of spin manipulation. The conquered pulse sequences have been compared with the NMR experiments and shown much faster CPU times corresponding to the interaction strength between the spins. Significant differences are shown in rotational operations and pulse intervals for ESR/MR operations. As a result, we suggest the advantages and possible utilization of the time-evolution based AQC approach for molecular spin quantum computers and molecular spin quantum simulators underlain by sophisticated ESR/MR pulsed spin technology.

  1. Recent developments in structural proteomics for protein structure determination.

    PubMed

    Liu, Hsuan-Liang; Hsu, Jyh-Ping

    2005-05-01

    The major challenges in structural proteomics include identifying all the proteins on the genome-wide scale, determining their structure-function relationships, and outlining the precise three-dimensional structures of the proteins. Protein structures are typically determined by experimental approaches such as X-ray crystallography or nuclear magnetic resonance (NMR) spectroscopy. However, the knowledge of three-dimensional space by these techniques is still limited. Thus, computational methods such as comparative and de novo approaches and molecular dynamic simulations are intensively used as alternative tools to predict the three-dimensional structures and dynamic behavior of proteins. This review summarizes recent developments in structural proteomics for protein structure determination; including instrumental methods such as X-ray crystallography and NMR spectroscopy, and computational methods such as comparative and de novo structure prediction and molecular dynamics simulations.

  2. Nuclear Physics Exascale Requirements Review: An Office of Science review sponsored jointly by Advanced Scientific Computing Research and Nuclear Physics, June 15 - 17, 2016, Gaithersburg, Maryland

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Carlson, Joseph; Savage, Martin J.; Gerber, Richard

    Imagine being able to predict — with unprecedented accuracy and precision — the structure of the proton and neutron, and the forces between them, directly from the dynamics of quarks and gluons, and then using this information in calculations of the structure and reactions of atomic nuclei and of the properties of dense neutron stars (NSs). Also imagine discovering new and exotic states of matter, and new laws of nature, by being able to collect more experimental data than we dream possible today, analyzing it in real time to feed back into an experiment, and curating the data with fullmore » tracking capabilities and with fully distributed data mining capabilities. Making this vision a reality would improve basic scientific understanding, enabling us to precisely calculate, for example, the spectrum of gravity waves emitted during NS coalescence, and would have important societal applications in nuclear energy research, stockpile stewardship, and other areas. This review presents the components and characteristics of the exascale computing ecosystems necessary to realize this vision.« less

  3. The fourth age of quantum chemistry: molecules in motion.

    PubMed

    Császár, Attila G; Fábri, Csaba; Szidarovszky, Tamás; Mátyus, Edit; Furtenbacher, Tibor; Czakó, Gábor

    2012-01-21

    Developments during the last two decades in nuclear motion theory made it possible to obtain variational solutions to the time-independent, nuclear-motion Schrödinger equation of polyatomic systems as "exact" as the potential energy surface (PES) is. Nuclear motion theory thus reached a level whereby this branch of quantum chemistry started to catch up with the well developed and widely applied other branch, electronic structure theory. It seems to be fair to declare that we are now in the fourth age of quantum chemistry, where the first three ages are principally defined by developments in electronic structure techniques (G. Richards, Nature, 1979, 278, 507). In the fourth age we are able to incorporate into our quantum chemical treatment the motion of nuclei in an exact fashion and, for example, go beyond equilibrium molecular properties and compute accurate, temperature-dependent, effective properties, thus closing the gap between measurements and electronic structure computations. In this Perspective three fundamental algorithms for the variational solution of the time-independent nuclear-motion Schrödinger equation employing exact kinetic energy operators are presented: one based on tailor-made Hamiltonians, one on the Eckart-Watson Hamiltonian, and one on a general internal-coordinate Hamiltonian. It is argued that the most useful and most widely applicable procedure is the third one, based on a Hamiltonian containing a kinetic energy operator written in terms of internal coordinates and an arbitrary embedding of the body-fixed frame of the molecule. This Hamiltonian makes it feasible to treat the nuclear motions of arbitrary quantum systems, irrespective of whether they exhibit a single well-defined minimum or not, and of arbitrary reduced-dimensional models. As a result, molecular spectroscopy, an important field for the application of nuclear motion theory, has almost black-box-type tools at its disposal. Variational nuclear motion computations, based on an exact kinetic energy operator and an arbitrary PES, can now be performed for about 9 active vibrational degrees of freedom relatively straightforwardly. Simulations of high-resolution spectra allow the understanding of complete rotational-vibrational spectra up to and beyond the first dissociation limits. Variational results obtained for H(2)O, H, NH(3), CH(4), and H(2)CCO are used to demonstrate the power of the variational techniques for the description of vibrational and rotational excitations. Some qualitative features of the results are also discussed.

  4. Computed tomography: Will the slices reveal the truth

    PubMed Central

    Haridas, Harish; Mohan, Abarajithan; Papisetti, Sravanthi; Ealla, Kranti K. R.

    2016-01-01

    With the advances in the field of imaging sciences, new methods have been developed in dental radiology. These include digital radiography, density analyzing methods, cone beam computed tomography (CBCT), magnetic resonance imaging, ultrasound, and nuclear imaging techniques, which provide high-resolution detailed images of oral structures. The current review aims to critically elaborate the use of CBCT in endodontics. PMID:27652253

  5. Mims electron-nuclear double resonance in LiYF4:Ce3+ crystal

    NASA Astrophysics Data System (ADS)

    Gafurov, M.; Mamin, G.; Kurkin, I.; Orlinskii, S.

    2018-05-01

    We report the observation of the pulsed electron-nuclear double resonance (ENDOR) spectra from 19F and 7Li nuclei on impurity Ce3+ ions in LiYF4 crystal. The resolved structure from the nearby and remote nuclei in spectra is observed. The outcome shows that LiYF4:Ce3+ system can be exploited as a convenient matrix for performing spin manipulations and adjusting quantum computation protocols while ENDOR technique is usable for the investigation of electron-nuclear interaction with all the nuclei of the system.

  6. The hyperfine structure in the rotational spectra of D{sub 2}{sup 17}O and HD{sup 17}O: Confirmation of the absolute nuclear magnetic shielding scale for oxygen

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Puzzarini, Cristina, E-mail: cristina.puzzarini@unibo.it; Cazzoli, Gabriele; Harding, Michael E.

    2015-03-28

    Guided by theoretical predictions, the hyperfine structures of the rotational spectra of mono- and bideuterated-water containing {sup 17}O have been experimentally investigated. To reach sub-Doppler resolution, required to resolve the hyperfine structure due to deuterium quadrupole coupling as well as to spin-rotation (SR) and dipolar spin-spin couplings, the Lamb-dip technique has been employed. The experimental investigation and in particular, the spectral analysis have been supported by high-level quantum-chemical computations employing coupled-cluster techniques and, for the first time, a complete experimental determination of the hyperfine parameters involved was possible. The experimentally determined {sup 17}O spin-rotation constants of D{sub 2}{sup 17}O andmore » HD{sup 17}O were used to derive the paramagnetic part of the corresponding nuclear magnetic shielding constants. Together with the computed diamagnetic contributions as well as the vibrational and temperature corrections, the latter constants have been employed to confirm the oxygen nuclear magnetic shielding scale, recently established on the basis of spin-rotation data for H{sub 2}{sup 17}O [Puzzarini et al., J. Chem. Phys. 131, 234304 (2009)].« less

  7. Designing a new structure for storing nuclear data: Progress of the Working Party for Evaluation Cooperation subgroup #38

    DOE PAGES

    Mattoon, C. M.; Beck, B. R.

    2015-12-24

    An international effort is underway to design a new structure for storing and using nuclear reaction data, with the goal of eventually replacing the current standard, ENDF-6. This effort, organized by the Working Party for Evaluation Cooperation, was initiated in 2012 and has resulted in a list of requirements and specifications for how the proposed new structure shall perform. The new structure will take advantage of new developments in computational tools, using a nested hierarchy to store data. Here, the structure can be stored in text form (such as an XML file) for human readability and data sharing, or itmore » can be stored in binary to optimize data access. In this paper, we present the progress towards completing the requirements, specifications and implementation of the new structure.« less

  8. Designing a new structure for storing nuclear data: Progress of the Working Party for Evaluation Cooperation subgroup #38

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mattoon, C. M.; Beck, B. R.

    An international effort is underway to design a new structure for storing and using nuclear reaction data, with the goal of eventually replacing the current standard, ENDF-6. This effort, organized by the Working Party for Evaluation Cooperation, was initiated in 2012 and has resulted in a list of requirements and specifications for how the proposed new structure shall perform. The new structure will take advantage of new developments in computational tools, using a nested hierarchy to store data. Here, the structure can be stored in text form (such as an XML file) for human readability and data sharing, or itmore » can be stored in binary to optimize data access. In this paper, we present the progress towards completing the requirements, specifications and implementation of the new structure.« less

  9. Chiral discrimination in NMR spectroscopy: computation of the relevant molecular pseudoscalars

    NASA Astrophysics Data System (ADS)

    Buckingham, A. David; Lazzeretti, Paolo; Pelloni, Stefano

    2015-07-01

    Nuclear magnetic resonance (NMR) is normally blind to chirality but it has been predicted that precessing nuclear spins in a strong magnetic field induce a rotating electric polarisation that is of opposite sign for enantiomers. The polarisation is determined by two pseudoscalars, ? and ?. The former arises from the distortion of the electronic structure by the nuclear magnetic moment in the presence of the strong magnetic field and is equivalent to the linear effect of an electric field on the nuclear shielding tensor. ? determines the temperature-dependent partial orientation of the permanent electric dipole moment of the molecule by the antisymmetric part of the nuclear shielding tensor. Computations of these two contributions are reported for the nuclei in the chiral molecules N-methyloxaziridine, 2-methyloxirane, 1,3-dimethylallene, 1-fluoroethanol, 2-fluoroazirine, 1,2-M-dioxin, 1,2-M-dithiin, 1,2-M-diselenin and 1,2-M-ditellurin. For strongly dipolar molecules, ? is typically two to three orders of magnitude greater than ?, raising hopes for the detection of chirality in NMR spectroscopy. This paper is dedicated to the memory of Prof. Nicholas Handy, F.R.S.

  10. Cloud Quantum Computing of an Atomic Nucleus

    NASA Astrophysics Data System (ADS)

    Dumitrescu, E. F.; McCaskey, A. J.; Hagen, G.; Jansen, G. R.; Morris, T. D.; Papenbrock, T.; Pooser, R. C.; Dean, D. J.; Lougovski, P.

    2018-05-01

    We report a quantum simulation of the deuteron binding energy on quantum processors accessed via cloud servers. We use a Hamiltonian from pionless effective field theory at leading order. We design a low-depth version of the unitary coupled-cluster ansatz, use the variational quantum eigensolver algorithm, and compute the binding energy to within a few percent. Our work is the first step towards scalable nuclear structure computations on a quantum processor via the cloud, and it sheds light on how to map scientific computing applications onto nascent quantum devices.

  11. Cloud Quantum Computing of an Atomic Nucleus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dumitrescu, Eugene F.; McCaskey, Alex J.; Hagen, Gaute

    Here, we report a quantum simulation of the deuteron binding energy on quantum processors accessed via cloud servers. We use a Hamiltonian from pionless effective field theory at leading order. We design a low-depth version of the unitary coupled-cluster ansatz, use the variational quantum eigensolver algorithm, and compute the binding energy to within a few percent. Our work is the first step towards scalable nuclear structure computations on a quantum processor via the cloud, and it sheds light on how to map scientific computing applications onto nascent quantum devices.

  12. Cloud Quantum Computing of an Atomic Nucleus.

    PubMed

    Dumitrescu, E F; McCaskey, A J; Hagen, G; Jansen, G R; Morris, T D; Papenbrock, T; Pooser, R C; Dean, D J; Lougovski, P

    2018-05-25

    We report a quantum simulation of the deuteron binding energy on quantum processors accessed via cloud servers. We use a Hamiltonian from pionless effective field theory at leading order. We design a low-depth version of the unitary coupled-cluster ansatz, use the variational quantum eigensolver algorithm, and compute the binding energy to within a few percent. Our work is the first step towards scalable nuclear structure computations on a quantum processor via the cloud, and it sheds light on how to map scientific computing applications onto nascent quantum devices.

  13. Cloud Quantum Computing of an Atomic Nucleus

    DOE PAGES

    Dumitrescu, Eugene F.; McCaskey, Alex J.; Hagen, Gaute; ...

    2018-05-23

    Here, we report a quantum simulation of the deuteron binding energy on quantum processors accessed via cloud servers. We use a Hamiltonian from pionless effective field theory at leading order. We design a low-depth version of the unitary coupled-cluster ansatz, use the variational quantum eigensolver algorithm, and compute the binding energy to within a few percent. Our work is the first step towards scalable nuclear structure computations on a quantum processor via the cloud, and it sheds light on how to map scientific computing applications onto nascent quantum devices.

  14. Enhancement of DFT-calculations at petascale: Nuclear Magnetic Resonance, Hybrid Density Functional Theory and Car-Parrinello calculations

    NASA Astrophysics Data System (ADS)

    Varini, Nicola; Ceresoli, Davide; Martin-Samos, Layla; Girotto, Ivan; Cavazzoni, Carlo

    2013-08-01

    One of the most promising techniques used for studying the electronic properties of materials is based on Density Functional Theory (DFT) approach and its extensions. DFT has been widely applied in traditional solid state physics problems where periodicity and symmetry play a crucial role in reducing the computational workload. With growing compute power capability and the development of improved DFT methods, the range of potential applications is now including other scientific areas such as Chemistry and Biology. However, cross disciplinary combinations of traditional Solid-State Physics, Chemistry and Biology drastically improve the system complexity while reducing the degree of periodicity and symmetry. Large simulation cells containing of hundreds or even thousands of atoms are needed to model these kind of physical systems. The treatment of those systems still remains a computational challenge even with modern supercomputers. In this paper we describe our work to improve the scalability of Quantum ESPRESSO (Giannozzi et al., 2009 [3]) for treating very large cells and huge numbers of electrons. To this end we have introduced an extra level of parallelism, over electronic bands, in three kernels for solving computationally expensive problems: the Sternheimer equation solver (Nuclear Magnetic Resonance, package QE-GIPAW), the Fock operator builder (electronic ground-state, package PWscf) and most of the Car-Parrinello routines (Car-Parrinello dynamics, package CP). Final benchmarks show our success in computing the Nuclear Magnetic Response (NMR) chemical shift of a large biological assembly, the electronic structure of defected amorphous silica with hybrid exchange-correlation functionals and the equilibrium atomic structure of height Porphyrins anchored to a Carbon Nanotube, on many thousands of CPU cores.

  15. 229Thorium-doped calcium fluoride for nuclear laser spectroscopy.

    PubMed

    Dessovic, P; Mohn, P; Jackson, R A; Winkler, G; Schreitl, M; Kazakov, G; Schumm, T

    2014-03-12

    The (229)thorium isotope presents an extremely low-energy isomer state of the nucleus which is expected around 7.8 eV, in the vacuum ultraviolet (VUV) regime. This unique system may bridge between atomic and nuclear physics, enabling coherent manipulation and precision spectroscopy of nuclear quantum states using laser light. It has been proposed to implant (229)thorium into VUV transparent crystal matrices to facilitate laser spectroscopy and possibly realize a solid-state nuclear clock. In this work, we validate the feasibility of this approach by computer modelling of thorium doping into calcium fluoride single crystals. Using atomistic modelling and full electronic structure calculations, we find a persistent large band gap and no additional electronic levels emerging in the middle of the gap due to the presence of the dopant, which should allow direct optical interrogation of the nuclear transition.Based on the electronic structure, we estimate the thorium nuclear quantum levels within the solid-state environment. Precision laser spectroscopy of these levels will allow the study of a broad range of crystal field effects, transferring Mössbauer spectroscopy into the optical regime.

  16. Accelerating nuclear configuration interaction calculations through a preconditioned block iterative eigensolver

    DOE PAGES

    Shao, Meiyue; Aktulga, H.  Metin; Yang, Chao; ...

    2017-09-14

    In this paper, we describe a number of recently developed techniques for improving the performance of large-scale nuclear configuration interaction calculations on high performance parallel computers. We show the benefit of using a preconditioned block iterative method to replace the Lanczos algorithm that has traditionally been used to perform this type of computation. The rapid convergence of the block iterative method is achieved by a proper choice of starting guesses of the eigenvectors and the construction of an effective preconditioner. These acceleration techniques take advantage of special structure of the nuclear configuration interaction problem which we discuss in detail. Themore » use of a block method also allows us to improve the concurrency of the computation, and take advantage of the memory hierarchy of modern microprocessors to increase the arithmetic intensity of the computation relative to data movement. Finally, we also discuss the implementation details that are critical to achieving high performance on massively parallel multi-core supercomputers, and demonstrate that the new block iterative solver is two to three times faster than the Lanczos based algorithm for problems of moderate sizes on a Cray XC30 system.« less

  17. Accelerating nuclear configuration interaction calculations through a preconditioned block iterative eigensolver

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shao, Meiyue; Aktulga, H.  Metin; Yang, Chao

    In this paper, we describe a number of recently developed techniques for improving the performance of large-scale nuclear configuration interaction calculations on high performance parallel computers. We show the benefit of using a preconditioned block iterative method to replace the Lanczos algorithm that has traditionally been used to perform this type of computation. The rapid convergence of the block iterative method is achieved by a proper choice of starting guesses of the eigenvectors and the construction of an effective preconditioner. These acceleration techniques take advantage of special structure of the nuclear configuration interaction problem which we discuss in detail. Themore » use of a block method also allows us to improve the concurrency of the computation, and take advantage of the memory hierarchy of modern microprocessors to increase the arithmetic intensity of the computation relative to data movement. Finally, we also discuss the implementation details that are critical to achieving high performance on massively parallel multi-core supercomputers, and demonstrate that the new block iterative solver is two to three times faster than the Lanczos based algorithm for problems of moderate sizes on a Cray XC30 system.« less

  18. Neuroanatomy of cranial computed tomography

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kretschmann, H.J.; Weinrich, W.

    1985-01-01

    Based on the fundamental structures visualized by means of computed tomography, the authors present the functional systems which are relevant in neurology by means of axial cross-sections. All drawings were prepared from original preparations by means of a new technique which is similar to the grey values of X-ray CT and nuclear magnetic resonance tomography. A detailed description is given of the topics of neurofunctional lesions.

  19. On the crystal structure of the vaterite polymorph of CaCO3: a calcium-43 solid-state NMR and computational assessment.

    PubMed

    Burgess, Kevin M N; Bryce, David L

    2015-02-01

    The vaterite polymorph of CaCO3 has puzzled crystallographers for decades in part due to difficulties in obtaining single crystals. The multiple proposed structures for the vaterite polymorph of CaCO3 are assessed using a combined (43)Ca solid-state nuclear magnetic resonance (SSNMR) spectroscopic and computational approach. A combination of improved experimental and computational methods, along with a calibrated chemical shift scale and (43)Ca nuclear quadrupole moment, allow for improved insights relative to our earlier work (Bryce et al., J. Am. Chem. Soc. 2008, 130, 9282). Here, we synthesize a (43)Ca isotopically-enriched sample of vaterite and perform high-resolution quadrupolar SSNMR experiments including magic-angle spinning (MAS), double-rotation (DOR), and multiple-quantum (MQ) MAS experiments at magnetic field strengths of 9.4 and 21.1T. We identify one crystallographically unique Ca(2+) site in vaterite with a slight distribution in both chemical shifts and quadrupolar parameters. Both the experimental (43)Ca electric field gradient tensor and the isotropic chemical shift for vaterite are compared to those calculated with the gauge-including projector-augmented-wave (GIPAW) DFT method in an attempt to identify the model that best represents the crystal structure of vaterite. Simulations of (43)Ca DOR and MAS NMR spectra based on the NMR parameters computed for a total of 18 structural models for vaterite allow us to distinguish between these models. Among these 18, the P3221 and C2 structures provide simulated spectra and diffractograms in best agreement with all experimental data. Copyright © 2014 Elsevier Inc. All rights reserved.

  20. Axial deformed solution of the Skyrme-Hartree-Fock-Bogolyubov equations using the transformed harmonic oscillator Basis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Perez, R. Navarro; Schunck, N.; Lasseri, R.

    2017-03-09

    HFBTHO is a physics computer code that is used to model the structure of the nucleus. It is an implementation of the nuclear energy Density Functional Theory (DFT), where the energy of the nucleus is obtained by integration over space of some phenomenological energy density, which is itself a functional of the neutron and proton densities. In HFBTHO, the energy density derives either from the zero-range Dkyrme or the finite-range Gogny effective two-body interaction between nucleons. Nuclear superfluidity is treated at the Hartree-Fock-Bogoliubov (HFB) approximation, and axial-symmetry of the nuclear shape is assumed. This version is the 3rd release ofmore » the program; the two previous versions were published in Computer Physics Communications [1,2]. The previous version was released at LLNL under GPL 3 Open Source License and was given release code LLNL-CODE-573953.« less

  1. Toward a structure determination method for biomineral-associated protein using combined solid- state NMR and computational structure prediction.

    PubMed

    Masica, David L; Ash, Jason T; Ndao, Moise; Drobny, Gary P; Gray, Jeffrey J

    2010-12-08

    Protein-biomineral interactions are paramount to materials production in biology, including the mineral phase of hard tissue. Unfortunately, the structure of biomineral-associated proteins cannot be determined by X-ray crystallography or solution nuclear magnetic resonance (NMR). Here we report a method for determining the structure of biomineral-associated proteins. The method combines solid-state NMR (ssNMR) and ssNMR-biased computational structure prediction. In addition, the algorithm is able to identify lattice geometries most compatible with ssNMR constraints, representing a quantitative, novel method for investigating crystal-face binding specificity. We use this method to determine most of the structure of human salivary statherin interacting with the mineral phase of tooth enamel. Computation and experiment converge on an ensemble of related structures and identify preferential binding at three crystal surfaces. The work represents a significant advance toward determining structure of biomineral-adsorbed protein using experimentally biased structure prediction. This method is generally applicable to proteins that can be chemically synthesized. Copyright © 2010 Elsevier Ltd. All rights reserved.

  2. Dynamics starting at a conical intersection: Application to the photochemistry of pyrrole

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sellner, Bernhard; Barbatti, Mario; Lischka, Hans

    The photochemical ring opening process in pyrrole has been investigated by performing classical on-the-fly dynamics using the multiconfiguration self-consistent field method for the computation of energies and energy gradients. As starting point for the dynamics the conical intersection corresponding to the ring-puckered ring-opened structure, determined previously [Barbatti et al., J. Chem. Phys. 125, 164323 (2006)], has been chosen. Two sets of initial conditions for the nuclear velocities were constructed: (i) nuclear velocities in the branching (g,h) plane of the conical intersection and (ii) statistical distribution for all atoms. Both sets of initial conditions show very similar results. Reactive trajectories aremore » only found in a very limited sector in the (g,h) plane and reaction products are very similar. Within the simulation time of 1 ps, ring opening of pyrrole to the biradical NH=CH-CH-CH=CH chain followed by ring closure to a substituted cyclopropene structure (NH=CH-C{sub 3}H{sub 3}) is observed. The computed structural data correlate well with the experimentally observed dissociation products.« less

  3. Molecular Dynamics-based Simulations of Bulk/Interfacial Structures and Diffusion Behaviors in Nuclear Waste Glasses

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Du, Jincheng; Rimsza, Jessica; Deng, Lu

    This NEUP Project aimed to generate accurate atomic structural models of nuclear waste glasses by using large-scale molecular dynamics-based computer simulations and to use these models to investigate self-diffusion behaviors, interfacial structures, and hydrated gel structures formed during dissolution of these glasses. The goal was to obtain realistic and accurate short and medium range structures of these complex oxide glasses, to provide a mechanistic understanding of the dissolution behaviors, and to generate reliable information with predictive power in designing nuclear waste glasses for long-term geological storage. Looking back of the research accomplishments of this project, most of the scientific goalsmore » initially proposed have been achieved through intensive research in the three and a half year period of the project. This project has also generated a wealth of scientific data and vibrant discussions with various groups through collaborations within and outside of this project. Throughout the project one book chapter and 14 peer reviewed journal publications have been generated (including one under review) and 16 presentations (including 8 invited talks) have been made to disseminate the results of this project in national and international conference. Furthermore, this project has trained several outstanding graduate students and young researchers for future workforce in nuclear related field, especially on nuclear waste immobilization. One postdoc and four PhD students have been fully or partially supported through the project with intensive training in the field material science and engineering with expertise on glass science and nuclear waste disposal« less

  4. 78 FR 47804 - Verification, Validation, Reviews, and Audits for Digital Computer Software Used in Safety...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-08-06

    ..., ``Configuration Management Plans for Digital Computer Software used in Safety Systems of Nuclear Power Plants... Digital Computer Software Used in Safety Systems of Nuclear Power Plants AGENCY: Nuclear Regulatory..., Reviews, and Audits for Digital Computer Software Used in Safety Systems of Nuclear Power Plants.'' This...

  5. Errors in the Calculation of 27Al Nuclear Magnetic Resonance Chemical Shifts

    PubMed Central

    Wang, Xianlong; Wang, Chengfei; Zhao, Hui

    2012-01-01

    Computational chemistry is an important tool for signal assignment of 27Al nuclear magnetic resonance spectra in order to elucidate the species of aluminum(III) in aqueous solutions. The accuracy of the popular theoretical models for computing the 27Al chemical shifts was evaluated by comparing the calculated and experimental chemical shifts in more than one hundred aluminum(III) complexes. In order to differentiate the error due to the chemical shielding tensor calculation from that due to the inadequacy of the molecular geometry prediction, single-crystal X-ray diffraction determined structures were used to build the isolated molecule models for calculating the chemical shifts. The results were compared with those obtained using the calculated geometries at the B3LYP/6-31G(d) level. The isotropic chemical shielding constants computed at different levels have strong linear correlations even though the absolute values differ in tens of ppm. The root-mean-square difference between the experimental chemical shifts and the calculated values is approximately 5 ppm for the calculations based on the X-ray structures, but more than 10 ppm for the calculations based on the computed geometries. The result indicates that the popular theoretical models are adequate in calculating the chemical shifts while an accurate molecular geometry is more critical. PMID:23203134

  6. Nuclear spin noise in the central spin model

    NASA Astrophysics Data System (ADS)

    Fröhling, Nina; Anders, Frithjof B.; Glazov, Mikhail

    2018-05-01

    We study theoretically the fluctuations of the nuclear spins in quantum dots employing the central spin model which accounts for the hyperfine interaction of the nuclei with the electron spin. These fluctuations are calculated both with an analytical approach using homogeneous hyperfine couplings (box model) and with a numerical simulation using a distribution of hyperfine coupling constants. The approaches are in good agreement. The box model serves as a benchmark with low computational cost that explains the basic features of the nuclear spin noise well. We also demonstrate that the nuclear spin noise spectra comprise a two-peak structure centered at the nuclear Zeeman frequency in high magnetic fields with the shape of the spectrum controlled by the distribution of the hyperfine constants. This allows for direct access to this distribution function through nuclear spin noise spectroscopy.

  7. The table of isotopes-8th edition and beyond

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Firestone, R.B.

    A new edition of the Table of Isotopes has been published this year by John Wiley and Sons, Inc. This edition is the eighth in a series started by Glenn T. Seaborg in 1940. The two-volume, 3168-page, cloth-bound edition is twice the size of the previous edition published in 1978. It contains nuclear structure and decay data, based mainly on the Evaluated Nuclear Structure Data File (ENSDF), for >3100 isotopes and isomers. Approximately 24000 references are cited, and the appendices have been updated and extended. The book is packaged with an interactive CD-ROM that contains the Table of Isotopes inmore » Adobe Acrobat Portable Document Format for convenient viewing on personal computer (PC) and UNIX workstations. The CD-ROM version contains a chart of the nuclides graphical index and separate indices organized for radioisotope users and nuclear structure physicists. More than 100000 hypertext links are provided to move the user quickly through related information free from the limitations of page size. Complete references with keyword abstracts are provided. The CD-ROM also contains the Table of Super-deformed Nuclear Bands and Fission Isomers; Tables of Atoms, Atomic Nuclei, and Subatomic Particles by Ivan P. Selinov; the ENSDF and nuclear structure reference (NSR) databases; the ENSDF manual by Jagdish K. Tuli; and Abode Acrobat Reader software.« less

  8. Systems and methods for dismantling a nuclear reactor

    DOEpatents

    Heim, Robert R; Adams, Scott Ryan; Cole, Matthew Denver; Kirby, William E; Linnebur, Paul Damon

    2014-10-28

    Systems and methods for dismantling a nuclear reactor are described. In one aspect the system includes a remotely controlled heavy manipulator ("manipulator") operatively coupled to a support structure, and a control station in a non-contaminated portion of a workspace. The support structure provides the manipulator with top down access into a bioshield of a nuclear reactor. At least one computing device in the control station provides remote control to perform operations including: (a) dismantling, using the manipulator, a graphite moderator, concrete walls, and a ceiling of the bioshield, the manipulator being provided with automated access to all internal portions of the bioshield; (b) loading, using the manipulator, contaminated graphite blocks from the graphite core and other components from the bioshield into one or more waste containers; and (c) dispersing, using the manipulator, dust suppression and contamination fixing spray to contaminated matter.

  9. The fundamentals behind solving for unknown molecular structures using computer-assisted structure elucidation: a free software package at the undergraduate and graduate levels.

    PubMed

    Moser, Arvin; Pautler, Brent G

    2016-05-15

    The successful elucidation of an unknown compound's molecular structure often requires an analyst with profound knowledge and experience of advanced spectroscopic techniques, such as Nuclear Magnetic Resonance (NMR) spectroscopy and mass spectrometry. The implementation of Computer-Assisted Structure Elucidation (CASE) software in solving for unknown structures, such as isolated natural products and/or reaction impurities, can serve both as elucidation and teaching tools. As such, the introduction of CASE software with 112 exercises to train students in conjunction with the traditional pen and paper approach will strengthen their overall understanding of solving unknowns and explore of various structural end points to determine the validity of the results quickly. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  10. Protein Structure Determination by Assembling Super-Secondary Structure Motifs Using Pseudocontact Shifts.

    PubMed

    Pilla, Kala Bharath; Otting, Gottfried; Huber, Thomas

    2017-03-07

    Computational and nuclear magnetic resonance hybrid approaches provide efficient tools for 3D structure determination of small proteins, but currently available algorithms struggle to perform with larger proteins. Here we demonstrate a new computational algorithm that assembles the 3D structure of a protein from its constituent super-secondary structural motifs (Smotifs) with the help of pseudocontact shift (PCS) restraints for backbone amide protons, where the PCSs are produced from different metal centers. The algorithm, DINGO-PCS (3D assembly of Individual Smotifs to Near-native Geometry as Orchestrated by PCSs), employs the PCSs to recognize, orient, and assemble the constituent Smotifs of the target protein without any other experimental data or computational force fields. Using a universal Smotif database, the DINGO-PCS algorithm exhaustively enumerates any given Smotif. We benchmarked the program against ten different protein targets ranging from 100 to 220 residues with different topologies. For nine of these targets, the method was able to identify near-native Smotifs. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Spectral implementation of some quantum algorithms by one- and two-dimensional nuclear magnetic resonance

    NASA Astrophysics Data System (ADS)

    Das, Ranabir; Kumar, Anil

    2004-10-01

    Quantum information processing has been effectively demonstrated on a small number of qubits by nuclear magnetic resonance. An important subroutine in any computing is the readout of the output. "Spectral implementation" originally suggested by Z. L. Madi, R. Bruschweiler, and R. R. Ernst [J. Chem. Phys. 109, 10603 (1999)], provides an elegant method of readout with the use of an extra "observer" qubit. At the end of computation, detection of the observer qubit provides the output via the multiplet structure of its spectrum. In spectral implementation by two-dimensional experiment the observer qubit retains the memory of input state during computation, thereby providing correlated information on input and output, in the same spectrum. Spectral implementation of Grover's search algorithm, approximate quantum counting, a modified version of Berstein-Vazirani problem, and Hogg's algorithm are demonstrated here in three- and four-qubit systems.

  12. A computer-aided diagnosis system of nuclear cataract.

    PubMed

    Li, Huiqi; Lim, Joo Hwee; Liu, Jiang; Mitchell, Paul; Tan, Ava Grace; Wang, Jie Jin; Wong, Tien Yin

    2010-07-01

    Cataracts are the leading cause of blindness worldwide, and nuclear cataract is the most common form of cataract. An algorithm for automatic diagnosis of nuclear cataract is investigated in this paper. Nuclear cataract is graded according to the severity of opacity using slit lamp lens images. Anatomical structure in the lens image is detected using a modified active shape model. On the basis of the anatomical landmark, local features are extracted according to clinical grading protocol. Support vector machine regression is employed for grade prediction. This is the first time that the nucleus region can be detected automatically in slit lamp images. The system is validated using clinical images and clinical ground truth on >5000 images. The success rate of structure detection is 95% and the average grading difference is 0.36 on a 5.0 scale. The automatic diagnosis system can improve the grading objectivity and potentially be used in clinics and population studies to save the workload of ophthalmologists.

  13. Leadership Class Configuration Interaction Code - Status and Opportunities

    NASA Astrophysics Data System (ADS)

    Vary, James

    2011-10-01

    With support from SciDAC-UNEDF (www.unedf.org) nuclear theorists have developed and are continuously improving a Leadership Class Configuration Interaction Code (LCCI) for forefront nuclear structure calculations. The aim of this project is to make state-of-the-art nuclear structure tools available to the entire community of researchers including graduate students. The project includes codes such as NuShellX, MFDn and BIGSTICK that run a range of computers from laptops to leadership class supercomputers. Codes, scripts, test cases and documentation have been assembled, are under continuous development and are scheduled for release to the entire research community in November 2011. A covering script that accesses the appropriate code and supporting files is under development. In addition, a Data Base Management System (DBMS) that records key information from large production runs and archived results of those runs has been developed (http://nuclear.physics.iastate.edu/info/) and will be released. Following an outline of the project, the code structure, capabilities, the DBMS and current efforts, I will suggest a path forward that would benefit greatly from a significant partnership between researchers who use the codes, code developers and the National Nuclear Data efforts. This research is supported in part by DOE under grant DE-FG02-87ER40371 and grant DE-FC02-09ER41582 (SciDAC-UNEDF).

  14. Linearized Alternating Direction Method of Multipliers for Constrained Nonconvex Regularized Optimization

    DTIC Science & Technology

    2016-11-22

    structure of the graph, we replace the ℓ1- norm by the nonconvex Capped -ℓ1 norm , and obtain the Generalized Capped -ℓ1 regularized logistic regression...X. M. Yuan. Linearized augmented lagrangian and alternating direction methods for nuclear norm minimization. Mathematics of Computation, 82(281):301...better approximations of ℓ0- norm theoretically and computationally beyond ℓ1- norm , for example, the compressive sensing (Xiao et al., 2011). The

  15. 2011 Release of the Evaluated Nuclear Data Library (ENDL2011.0)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Brown, D. A.; Beck, B.; Descalles, M. A.

    LLNL’s Computational Nuclear Physics Group and Nuclear Theory and Modeling Group have collaborated to produce the last of three major releases of LLNL’s evaluated nuclear database, ENDL2011. ENDL2011 is designed to support LLNL’s current and future nuclear data needs by providing the best nuclear data available to our programmatic customers. This library contains many new evaluations for radiochemical diagnostics, structural materials, and thermonuclear reactions. We have made an effort to eliminate all holes in reaction networks, allowing in-line isotopic creation and depletion calculations. We have striven to keep ENDL2011 at the leading edge of nuclear data library development by reviewingmore » and incorporating new evaluations as they are made available to the nuclear data community. Finally, this release is our most highly tested release as we have strengthened our already rigorous testing regime by adding tests against IPPE Activation Ratio Measurements, many more new critical assemblies and a more complete set of classified testing (to be detailed separately).« less

  16. The Advanced Software Development and Commercialization Project

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gallopoulos, E.; Canfield, T.R.; Minkoff, M.

    1990-09-01

    This is the first of a series of reports pertaining to progress in the Advanced Software Development and Commercialization Project, a joint collaborative effort between the Center for Supercomputing Research and Development of the University of Illinois and the Computing and Telecommunications Division of Argonne National Laboratory. The purpose of this work is to apply techniques of parallel computing that were pioneered by University of Illinois researchers to mature computational fluid dynamics (CFD) and structural dynamics (SD) computer codes developed at Argonne. The collaboration in this project will bring this unique combination of expertise to bear, for the first time,more » on industrially important problems. By so doing, it will expose the strengths and weaknesses of existing techniques for parallelizing programs and will identify those problems that need to be solved in order to enable wide spread production use of parallel computers. Secondly, the increased efficiency of the CFD and SD codes themselves will enable the simulation of larger, more accurate engineering models that involve fluid and structural dynamics. In order to realize the above two goals, we are considering two production codes that have been developed at ANL and are widely used by both industry and Universities. These are COMMIX and WHAMS-3D. The first is a computational fluid dynamics code that is used for both nuclear reactor design and safety and as a design tool for the casting industry. The second is a three-dimensional structural dynamics code used in nuclear reactor safety as well as crashworthiness studies. These codes are currently available for both sequential and vector computers only. Our main goal is to port and optimize these two codes on shared memory multiprocessors. In so doing, we shall establish a process that can be followed in optimizing other sequential or vector engineering codes for parallel processors.« less

  17. Ground-state energies and charge radii of medium-mass nuclei in the unitary-model-operator approach

    NASA Astrophysics Data System (ADS)

    Miyagi, Takayuki; Abe, Takashi; Okamoto, Ryoji; Otsuka, Takaharu

    2014-09-01

    In nuclear structure theory, one of the most fundamental problems is to understand the nuclear structure based on nuclear forces. This attempt has been enabled due to the progress of the computational power and nuclear many-body approaches. However, it is difficult to apply the first-principle methods to medium-mass region, because calculations demand the huge model space as increasing the number of nucleons. The unitary-model-operator approach (UMOA) is one of the methods which can be applied to medium-mass nuclei. The essential point of the UMOA is to construct the effective Hamiltonian which does not induce the two-particle-two-hole excitations. A many-body problem is reduced to the two-body subsystem problem in an entire many-body system with the two-body effective interaction and one-body potential determined self-consistently. In this presentation, we will report the numerical results of ground-state energies and charge radii of 16O, 40Ca, and 56Ni in the UMOA, and discuss the saturation property by comparing our results with those in the other many-body methods and also experimental data. In nuclear structure theory, one of the most fundamental problems is to understand the nuclear structure based on nuclear forces. This attempt has been enabled due to the progress of the computational power and nuclear many-body approaches. However, it is difficult to apply the first-principle methods to medium-mass region, because calculations demand the huge model space as increasing the number of nucleons. The unitary-model-operator approach (UMOA) is one of the methods which can be applied to medium-mass nuclei. The essential point of the UMOA is to construct the effective Hamiltonian which does not induce the two-particle-two-hole excitations. A many-body problem is reduced to the two-body subsystem problem in an entire many-body system with the two-body effective interaction and one-body potential determined self-consistently. In this presentation, we will report the numerical results of ground-state energies and charge radii of 16O, 40Ca, and 56Ni in the UMOA, and discuss the saturation property by comparing our results with those in the other many-body methods and also experimental data. The part of numerical calculation has been done on the NEC SX8R at RCNP, Osaka University. This work was supported in part by MEXT SPIRE and JICFuS. It was also supported in part by the Program in part for Leading Graduate Schools, MEXT, Japan.

  18. NVR-BIP: Nuclear Vector Replacement using Binary Integer Programming for NMR Structure-Based Assignments.

    PubMed

    Apaydin, Mehmet Serkan; Çatay, Bülent; Patrick, Nicholas; Donald, Bruce R

    2011-05-01

    Nuclear magnetic resonance (NMR) spectroscopy is an important experimental technique that allows one to study protein structure and dynamics in solution. An important bottleneck in NMR protein structure determination is the assignment of NMR peaks to the corresponding nuclei. Structure-based assignment (SBA) aims to solve this problem with the help of a template protein which is homologous to the target and has applications in the study of structure-activity relationship, protein-protein and protein-ligand interactions. We formulate SBA as a linear assignment problem with additional nuclear overhauser effect constraints, which can be solved within nuclear vector replacement's (NVR) framework (Langmead, C., Yan, A., Lilien, R., Wang, L. and Donald, B. (2003) A Polynomial-Time Nuclear Vector Replacement Algorithm for Automated NMR Resonance Assignments. Proc. the 7th Annual Int. Conf. Research in Computational Molecular Biology (RECOMB) , Berlin, Germany, April 10-13, pp. 176-187. ACM Press, New York, NY. J. Comp. Bio. , (2004), 11, pp. 277-298; Langmead, C. and Donald, B. (2004) An expectation/maximization nuclear vector replacement algorithm for automated NMR resonance assignments. J. Biomol. NMR , 29, 111-138). Our approach uses NVR's scoring function and data types and also gives the option of using CH and NH residual dipolar coupling (RDCs), instead of NH RDCs which NVR requires. We test our technique on NVR's data set as well as on four new proteins. Our results are comparable to NVR's assignment accuracy on NVR's test set, but higher on novel proteins. Our approach allows partial assignments. It is also complete and can return the optimum as well as near-optimum assignments. Furthermore, it allows us to analyze the information content of each data type and is easily extendable to accept new forms of input data, such as additional RDCs.

  19. Interdisciplinary Team-Teaching Experience for a Computer and Nuclear Energy Course for Electrical and Computer Engineering Students

    ERIC Educational Resources Information Center

    Kim, Charles; Jackson, Deborah; Keiller, Peter

    2016-01-01

    A new, interdisciplinary, team-taught course has been designed to educate students in Electrical and Computer Engineering (ECE) so that they can respond to global and urgent issues concerning computer control systems in nuclear power plants. This paper discusses our experience and assessment of the interdisciplinary computer and nuclear energy…

  20. Energy Structure and Energy Security under Climate Mitigation Scenarios in China

    PubMed Central

    Matsumoto, Ken’ichi

    2015-01-01

    This study investigates how energy structure and energy security in China will change in the future under climate mitigation policy scenarios using Representative Concentration Pathways in a computable general equilibrium model. The findings suggest that to reduce greenhouse gas emissions, China needs to shift its energy structure from fossil fuel dominance to renewables and nuclear. The lower the allowable emissions, the larger the shifts required. Among fossil fuels, coal use particularly must significantly decrease. Such structural shifts will improve energy self-sufficiency, thus enhancing energy security. Under the policy scenarios, energy-source diversity as measured by the Herfindahl Index improves until 2050, after which diversity declines because of high dependence on a specific energy source (nuclear and biomass). Overall, however, it is revealed that energy security improves along with progress in climate mitigation. These improvements will also contribute to the economy by reducing energy procurement risks. PMID:26660094

  1. Spent nuclear fuel assembly inspection using neutron computed tomography

    NASA Astrophysics Data System (ADS)

    Pope, Chad Lee

    The research presented here focuses on spent nuclear fuel assembly inspection using neutron computed tomography. Experimental measurements involving neutron beam transmission through a spent nuclear fuel assembly serve as benchmark measurements for an MCNP simulation model. Comparison of measured results to simulation results shows good agreement. Generation of tomography images from MCNP tally results was accomplished using adapted versions of built in MATLAB algorithms. Multiple fuel assembly models were examined to provide a broad set of conclusions. Tomography images revealing assembly geometric information including the fuel element lattice structure and missing elements can be obtained using high energy neutrons. A projection difference technique was developed which reveals the substitution of unirradiated fuel elements for irradiated fuel elements, using high energy neutrons. More subtle material differences such as altering the burnup of individual elements can be identified with lower energy neutrons provided the scattered neutron contribution to the image is limited. The research results show that neutron computed tomography can be used to inspect spent nuclear fuel assemblies for the purpose of identifying anomalies such as missing elements or substituted elements. The ability to identify anomalies in spent fuel assemblies can be used to deter diversion of material by increasing the risk of early detection as well as improve reprocessing facility operations by confirming the spent fuel configuration is as expected or allowing segregation if anomalies are detected.

  2. Marketing and commercialization of computational research services.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Toevs, J. W.

    Physical and computational scientists and mathematicians in Russia's nuclear cities are turning their work toward generating profits from Western markets. Successful ventures require an understanding of the marketing of contract research as well as Western expectations regarding contract execution, quality, and performance. This paper will address fundamentals in business structure, marketing, and contract performance for organizations engaging in the marketing and commercialization of research services. Considerable emphasis will be placed on developing adequate communication within the organization.

  3. QRAP: A numerical code for projected (Q)uasiparticle (RA)ndom (P)hase approximation

    NASA Astrophysics Data System (ADS)

    Samana, A. R.; Krmpotić, F.; Bertulani, C. A.

    2010-06-01

    A computer code for quasiparticle random phase approximation - QRPA and projected quasiparticle random phase approximation - PQRPA models of nuclear structure is explained in details. The residual interaction is approximated by a simple δ-force. An important application of the code consists in evaluating nuclear matrix elements involved in neutrino-nucleus reactions. As an example, cross sections for 56Fe and 12C are calculated and the code output is explained. The application to other nuclei and the description of other nuclear and weak decay processes are also discussed. Program summaryTitle of program: QRAP ( Quasiparticle RAndom Phase approximation) Computers: The code has been created on a PC, but also runs on UNIX or LINUX machines Operating systems: WINDOWS or UNIX Program language used: Fortran-77 Memory required to execute with typical data: 16 Mbytes of RAM memory and 2 MB of hard disk space No. of lines in distributed program, including test data, etc.: ˜ 8000 No. of bytes in distributed program, including test data, etc.: ˜ 256 kB Distribution format: tar.gz Nature of physical problem: The program calculates neutrino- and antineutrino-nucleus cross sections as a function of the incident neutrino energy, and muon capture rates, using the QRPA or PQRPA as nuclear structure models. Method of solution: The QRPA, or PQRPA, equations are solved in a self-consistent way for even-even nuclei. The nuclear matrix elements for the neutrino-nucleus interaction are treated as the beta inverse reaction of odd-odd nuclei as function of the transfer momentum. Typical running time: ≈ 5 min on a 3 GHz processor for Data set 1.

  4. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tan, Lizhen; Yang, Ying; Tyburska-Puschel, Beata

    The mission of the Nuclear Energy Enabling Technologies (NEET) program is to develop crosscutting technologies for nuclear energy applications. Advanced structural materials with superior performance at elevated temperatures are always desired for nuclear reactors, which can improve reactor economics, safety margins, and design flexibility. They benefit not only new reactors, including advanced light water reactors (LWRs) and fast reactors such as sodium-cooled fast reactor (SFR) that is primarily designed for management of high-level wastes, but also life extension of the existing fleet when component exchange is needed. Developing and utilizing the modern materials science tools (experimental, theoretical, and computational tools)more » is an important path to more efficient alloy development and process optimization. Ferritic-martensitic (FM) steels are important structural materials for nuclear reactors due to their advantages over other applicable materials like austenitic stainless steels, notably their resistance to void swelling, low thermal expansion coefficients, and higher thermal conductivity. However, traditional FM steels exhibit a noticeable yield strength reduction at elevated temperatures above ~500°C, which limits their applications in advanced nuclear reactors which target operating temperatures at 650°C or higher. Although oxide-dispersion-strengthened (ODS) ferritic steels have shown excellent high-temperature performance, their extremely high cost, limited size and fabricability of products, as well as the great difficulty with welding and joining, have limited or precluded their commercial applications. Zirconium has shown many benefits to Fe-base alloys such as grain refinement, improved phase stability, and reduced radiation-induced segregation. The ultimate goal of this project is, with the aid of computational modeling tools, to accelerate the development of a new generation of Zr-bearing ferritic alloys to be fabricated using conventional steelmaking practices, which have excellent radiation resistance and enhanced high-temperature creep performance greater than Grade 91.« less

  5. Unified equation of state for neutron stars on a microscopic basis

    NASA Astrophysics Data System (ADS)

    Sharma, B. K.; Centelles, M.; Viñas, X.; Baldo, M.; Burgio, G. F.

    2015-12-01

    We derive a new equation of state (EoS) for neutron stars (NS) from the outer crust to the core based on modern microscopic calculations using the Argonne v18 potential plus three-body forces computed with the Urbana model. To deal with the inhomogeneous structures of matter in the NS crust, we use a recent nuclear energy density functional that is directly based on the same microscopic calculations, and which is able to reproduce the ground-state properties of nuclei along the periodic table. The EoS of the outer crust requires the masses of neutron-rich nuclei, which are obtained through Hartree-Fock-Bogoliubov calculations with the new functional when they are unknown experimentally. To compute the inner crust, Thomas-Fermi calculations in Wigner-Seitz cells are performed with the same functional. Existence of nuclear pasta is predicted in a range of average baryon densities between ≃0.067 fm-3 and ≃0.0825 fm-3, where the transition to the core takes place. The NS core is computed from the new nuclear EoS assuming non-exotic constituents (core of npeμ matter). In each region of the star, we discuss the comparison of the new EoS with previous EoSs for the complete NS structure, widely used in astrophysical calculations. The new microscopically derived EoS fulfills at the same time a NS maximum mass of 2 M⊙ with a radius of 10 km, and a 1.5 M⊙ NS with a radius of 11.6 km.

  6. Durability and shielding performance of borated Ceramicrete coatings in beta and gamma radiation fields

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wagh, Arun S.; Sayenko, S. Yu.; Dovbnya, A. N.

    2015-07-01

    Ceramicrete™, a chemically bonded phosphate ceramic, was developed for nuclear waste immobilization and nuclear radiation shielding. Ceramicrete products are fabricated by an acid–base reaction between magnesium oxide and mono potassium phosphate. Fillers are used to impart desired properties to the product. Ceramicrete’s tailored compositions have resulted in several commercial structural products, including corrosion- and fire-protection coatings. Their borated version, called Borobond™, has been studied for its neutron shielding capabilities and is being used in structures built for storage of nuclear materials. This investigation assesses the durability and shielding performance of borated Ceramicrete coatings when exposed to gamma and beta radiationsmore » to predict the composition needed for optimal shielding performance in a realistic nuclear radiation field. Investigations were conducted using experimental data coupled with predictive Monte Carlo computer model. The results show that it is possible to produce products for simultaneous shielding of all three types of nuclear radiations, viz., neutrons, gamma-, and beta-rays. Additionally, because sprayable Ceramicrete coatings exhibit excellent corrosionand fire-protection characteristics on steel, this research also establishes an opportunity to produce thick coatings to enhance the shielding performance of corrosion and fire protection coatings for use in high radiation environment in nuclear industry.« less

  7. An Informal Overview of the Unitary Group Approach

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sonnad, V.; Escher, J.; Kruse, M.

    The Unitary Groups Approach (UGA) is an elegant and conceptually unified approach to quantum structure calculations. It has been widely used in molecular structure calculations, and holds the promise of a single computational approach to structure calculations in a variety of different fields. We explore the possibility of extending the UGA to computations in atomic and nuclear structure as a simpler alternative to traditional Racah algebra-based approaches. We provide a simple introduction to the basic UGA and consider some of the issues in using the UGA with spin-dependent, multi-body Hamiltonians requiring multi-shell bases adapted to additional symmetries. While the UGAmore » is perfectly capable of dealing with such problems, it is seen that the complexity rises dramatically, and the UGA is not at this time, a simpler alternative to Racah algebra-based approaches.« less

  8. Methodology, status, and plans for development and assessment of the RELAP5 code

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Johnson, G.W.; Riemke, R.A.

    1997-07-01

    RELAP/MOD3 is a computer code used for the simulation of transients and accidents in light-water nuclear power plants. The objective of the program to develop and maintain RELAP5 was and is to provide the U.S. Nuclear Regulatory Commission with an independent tool for assessing reactor safety. This paper describes code requirements, models, solution scheme, language and structure, user interface validation, and documentation. The paper also describes the current and near term development program and provides an assessment of the code`s strengths and limitations.

  9. Computational study: Reduction of iron corrosion in lead coolant of fast nuclear reactor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Arkundato, Artoto; Su'ud, Zaki; Abdullah, Mikrajuddin

    2012-06-20

    In this paper we report molecular dynamics simulation results of iron (cladding) corrosion in interaction with lead coolant of fast nuclear reactor. The goal of this work is to study effect of oxygen injection to the coolant to reduce iron corrosion. By evaluating diffusion coefficients, radial distribution functions, mean-square displacement curves and observation of crystal structure of iron before and after oxygen injection, we concluded that a significant reduction of corrosion can be achieved by issuing about 2% of oxygen atoms into lead coolant.

  10. How does ytterbium chloride interact with DMPC bilayers? A computational and experimental study.

    PubMed

    Gonzalez, Miguel A; Barriga, Hanna M G; Richens, Joanna L; Law, Robert V; O'Shea, Paul; Bresme, Fernando

    2017-03-29

    Lanthanide salts have been studied for many years, primarily in Nuclear Magnetic Resonance (NMR) experiments of mixed lipid-protein systems and more recently to study lipid flip-flop in model membrane systems. It is well recognised that lanthanide salts can influence the behaviour of both lipid and protein systems, however a full molecular level description of lipid-lanthanide interactions is still outstanding. Here we present a study of lanthanide-bilayer interactions, using molecular dynamics computer simulations, fluorescence electrostatic potential experiments and nuclear magnetic resonance. Computer simulations reveal the microscopic structure of DMPC lipid bilayers in the presence of Yb 3+ , and a surprising ability of the membranes to adsorb significant concentrations of Yb 3+ without disrupting the overall membrane structure. At concentrations commonly used in NMR experiments, Yb 3+ ions bind strongly to 5 lipids, inducing a small decrease of the area per lipid and a slight increase of the ordering of the aliphatic chains and the bilayer thickness. The area compressibility modulus increases by a factor of two, with respect to the free-salt case, showing that Yb 3+ ions make the bilayer more rigid. These modifications of the bilayer properties should be taken into account in the interpretation of NMR experiments.

  11. Parvovirus Induced Alterations in Nuclear Architecture and Dynamics

    PubMed Central

    Ihalainen, Teemu O.; Niskanen, Einari A.; Jylhävä, Juulia; Paloheimo, Outi; Dross, Nicolas; Smolander, Hanna; Langowski, Jörg; Timonen, Jussi; Vihinen-Ranta, Maija

    2009-01-01

    The nucleus of interphase eukaryotic cell is a highly compartmentalized structure containing the three-dimensional network of chromatin and numerous proteinaceous subcompartments. DNA viruses induce profound changes in the intranuclear structures of their host cells. We are applying a combination of confocal imaging including photobleaching microscopy and computational methods to analyze the modifications of nuclear architecture and dynamics in parvovirus infected cells. Upon canine parvovirus infection, expansion of the viral replication compartment is accompanied by chromatin marginalization to the vicinity of the nuclear membrane. Dextran microinjection and fluorescence recovery after photobleaching (FRAP) studies revealed the homogeneity of this compartment. Markedly, in spite of increase in viral DNA content of the nucleus, a significant increase in the protein mobility was observed in infected compared to non-infected cells. Moreover, analyzis of the dynamics of photoactivable capsid protein demonstrated rapid intranuclear dynamics of viral capsids. Finally, quantitative FRAP and cellular modelling were used to determine the duration of viral genome replication. Altogether, our findings indicate that parvoviruses modify the nuclear structure and dynamics extensively. Intranuclear crowding of viral components leads to enlargement of the interchromosomal domain and to chromatin marginalization via depletion attraction. In conclusion, parvoviruses provide a useful model system for understanding the mechanisms of virus-induced intranuclear modifications. PMID:19536327

  12. Seismic risk management solution for nuclear power plants

    DOE PAGES

    Coleman, Justin; Sabharwall, Piyush

    2014-12-01

    Nuclear power plants should safely operate during normal operations and maintain core-cooling capabilities during off-normal events, including external hazards (such as flooding and earthquakes). Management of external hazards to expectable levels of risk is critical to maintaining nuclear facility and nuclear power plant safety. Seismic risk is determined by convolving the seismic hazard with seismic fragilities (capacity of systems, structures, and components). Seismic isolation (SI) is one protective measure showing promise to minimize seismic risk. Current SI designs (used in commercial industry) reduce horizontal earthquake loads and protect critical infrastructure from the potentially destructive effects of large earthquakes. The benefitmore » of SI application in the nuclear industry is being recognized and SI systems have been proposed in American Society of Civil Engineer Standard 4, ASCE-4, to be released in the winter of 2014, for light water reactors facilities using commercially available technology. The intent of ASCE-4 is to provide criteria for seismic analysis of safety related nuclear structures such that the responses to design basis seismic events, computed in accordance with this standard, will have a small likelihood of being exceeded. The U.S. nuclear industry has not implemented SI to date; a seismic isolation gap analysis meeting was convened on August 19, 2014, to determine progress on implementing SI in the U.S. nuclear industry. The meeting focused on the systems and components that could benefit from SI. As a result, this article highlights the gaps identified at this meeting.« less

  13. Response surface method in geotechnical/structural analysis, phase 1

    NASA Astrophysics Data System (ADS)

    Wong, F. S.

    1981-02-01

    In the response surface approach, an approximating function is fit to a long running computer code based on a limited number of code calculations. The approximating function, called the response surface, is then used to replace the code in subsequent repetitive computations required in a statistical analysis. The procedure of the response surface development and feasibility of the method are shown using a sample problem in slop stability which is based on data from centrifuge experiments of model soil slopes and involves five random soil parameters. It is shown that a response surface can be constructed based on as few as four code calculations and that the response surface is computationally extremely efficient compared to the code calculation. Potential applications of this research include probabilistic analysis of dynamic, complex, nonlinear soil/structure systems such as slope stability, liquefaction, and nuclear reactor safety.

  14. MOOSE: A parallel computational framework for coupled systems of nonlinear equations.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Derek Gaston; Chris Newman; Glen Hansen

    Systems of coupled, nonlinear partial differential equations (PDEs) often arise in simulation of nuclear processes. MOOSE: Multiphysics Object Oriented Simulation Environment, a parallel computational framework targeted at the solution of such systems, is presented. As opposed to traditional data-flow oriented computational frameworks, MOOSE is instead founded on the mathematical principle of Jacobian-free Newton-Krylov (JFNK) solution methods. Utilizing the mathematical structure present in JFNK, physics expressions are modularized into `Kernels,'' allowing for rapid production of new simulation tools. In addition, systems are solved implicitly and fully coupled, employing physics based preconditioning, which provides great flexibility even with large variance in timemore » scales. A summary of the mathematics, an overview of the structure of MOOSE, and several representative solutions from applications built on the framework are presented.« less

  15. The use of the SRIM code for calculation of radiation damage induced by neutrons

    NASA Astrophysics Data System (ADS)

    Mohammadi, A.; Hamidi, S.; Asadabad, Mohsen Asadi

    2017-12-01

    Materials subjected to neutron irradiation will being evolve to structural changes by the displacement cascades initiated by nuclear reaction. This study discusses a methodology to compute primary knock-on atoms or PKAs information that lead to radiation damage. A program AMTRACK has been developed for assessing of the PKAs information. This software determines the specifications of recoil atoms (using PTRAC card of MCNPX code) and also the kinematics of interactions. The deterministic method was used for verification of the results of (MCNPX+AMTRACK). The SRIM (formely TRIM) code is capable to compute neutron radiation damage. The PKAs information was extracted by AMTRACK program, which can be used as an input of SRIM codes for systematic analysis of primary radiation damage. Then the Bushehr Nuclear Power Plant (BNPP) radiation damage on reactor pressure vessel is calculated.

  16. 77 FR 50723 - Verification, Validation, Reviews, and Audits for Digital Computer Software Used in Safety...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-08-22

    ... Digital Computer Software Used in Safety Systems of Nuclear Power Plants AGENCY: Nuclear Regulatory..., ``Verification, Validation, Reviews, and Audits for Digital Computer Software used in Safety Systems of Nuclear... NRC regulations promoting the development of, and compliance with, software verification and...

  17. A Stochastic Model of Space Radiation Transport as a Tool in the Development of Time-Dependent Risk Assessment

    NASA Technical Reports Server (NTRS)

    Kim, Myung-Hee Y.; Nounu, Hatem N.; Ponomarev, Artem L.; Cucinotta, Francis A.

    2011-01-01

    A new computer model, the GCR Event-based Risk Model code (GERMcode), was developed to describe biophysical events from high-energy protons and heavy ions that have been studied at the NASA Space Radiation Laboratory (NSRL) [1] for the purpose of simulating space radiation biological effects. In the GERMcode, the biophysical description of the passage of heavy ions in tissue and shielding materials is made with a stochastic approach that includes both ion track structure and nuclear interactions. The GERMcode accounts for the major nuclear interaction processes of importance for describing heavy ion beams, including nuclear fragmentation, elastic scattering, and knockout-cascade processes by using the quantum multiple scattering fragmentation (QMSFRG) model [2]. The QMSFRG model has been shown to be in excellent agreement with available experimental data for nuclear fragmentation cross sections

  18. SPY: A new scission point model based on microscopic ingredients to predict fission fragments properties

    NASA Astrophysics Data System (ADS)

    Lemaître, J.-F.; Dubray, N.; Hilaire, S.; Panebianco, S.; Sida, J.-L.

    2013-12-01

    Our purpose is to determine fission fragments characteristics in a framework of a scission point model named SPY for Scission Point Yields. This approach can be considered as a theoretical laboratory to study fission mechanism since it gives access to the correlation between the fragments properties and their nuclear structure, such as shell correction, pairing, collective degrees of freedom, odd-even effects. Which ones are dominant in final state? What is the impact of compound nucleus structure? The SPY model consists in a statistical description of the fission process at the scission point where fragments are completely formed and well separated with fixed properties. The most important property of the model relies on the nuclear structure of the fragments which is derived from full quantum microscopic calculations. This approach allows computing the fission final state of extremely exotic nuclei which are inaccessible by most of the fission model available on the market.

  19. Microphysics in the Gamma-Ray Burst Central Engine

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Janiuk, Agnieszka, E-mail: agnes@cft.edu.pl

    We calculate the structure and evolution of a gamma-ray burst central engine where an accreting torus has formed around the newly born black hole. We study the general relativistic, MHD models and we self-consistently incorporate the nuclear equation of state. The latter accounts for the degeneracy of relativistic electrons, protons, and neutrons, and is used in the dynamical simulation, instead of a standard polytropic γ -law. The EOS provides the conditions for the nuclear pressure in the function of density and temperature, which evolve with time according to the conservative MHD scheme. We analyze the structure of the torus andmore » outflowing winds, and compute the neutrino flux emitted through the nuclear reaction balance in the dense and hot matter. We also estimate the rate of transfer of the black-hole rotational energy to the bipolar jets. Finally, we elaborate on the nucleosynthesis of heavy elements in the accretion flow and the wind, through computations of the thermonuclear reaction network. We discuss the possible signatures of the radioactive element decay in the accretion flow. We suggest that further detailed modeling of the accretion flow in the GRB engine, together with its microphysics, may be a valuable tool to constrain the black-hole mass and spin. It can be complementary to the gravitational wave analysis if the waves are detected with an electromagnetic counterpart.« less

  20. Inorganic nanotubes and fullerenes . Structure and properties of hypothetical phosphorus fullerenes

    NASA Astrophysics Data System (ADS)

    Seifert, G.; Heine, T.; Fowler, P. W.

    The possibility of stable non-carbon fullerenes is discussed for the case of phosphorus fullerene-like cage structures. On the basis of Density Functional Tight Binding calculations it is shown that many such cages correspond to metastable structures, but with increasing nuclearity become less stable with respect to separate molecular P4 units. Stability rules, known for carbon fullerenes, such as the ``isolated pentagon rule'', do not reflect the different electronic and steric requirements of the phosphorus atom. The computational results tend to rule out phosphorus fullerenes.

  1. Analysis of the transient response of nuclear spins in GaAs with/without nuclear magnetic resonance

    NASA Astrophysics Data System (ADS)

    Rasly, Mahmoud; Lin, Zhichao; Yamamoto, Masafumi; Uemura, Tetsuya

    2016-05-01

    As an alternative to studying the steady-state responses of nuclear spins in solid state systems, working within a transient-state framework can reveal interesting phenomena. The response of nuclear spins in GaAs to a changing magnetic field was analyzed based on the time evolution of nuclear spin temperature. Simulation results well reproduced our experimental results for the transient oblique Hanle signals observed in an all-electrical spin injection device. The analysis showed that the so called dynamic nuclear polarization can be treated as a cooling tool for the nuclear spins: It works as a provider to exchange spin angular momentum between polarized electron spins and nuclear spins through the hyperfine interaction, leading to an increase in the nuclear polarization. In addition, a time-delay of the nuclear spin temperature with a fast sweep of the external magnetic field produces a possible transient state for the nuclear spin polarization. On the other hand, the nuclear magnetic resonance acts as a heating tool for a nuclear spin system. This causes the nuclear spin temperature to jump to infinity: i.e., the average nuclear spins along with the nuclear field vanish at resonant fields of 75As, 69Ga and 71Ga, showing an interesting step-dip structure in the oblique Hanle signals. These analyses provide a quantitative understanding of nuclear spin dynamics in semiconductors for application in future computation processing.

  2. [Morphological and functional characteristics of lymphocytes of mothers of children with Down syndrome].

    PubMed

    Novikov, V D; Valova, T A; Iasakova, N T; Belan, I B

    2000-01-01

    Nuclear chromatine of peripheral blood lymphocytes was studied in 13 women with children suffering from Down's syndrome using optic structural computer analysis. In 12 cases significant increase of nuclear roundness coefficient was determined. Deformation coefficient was determined for heterochromatine structures in 8 cases. Integral optic density of nuclear chromatine was significantly decreased in 12 women. This indicates the reduction of felgen-positive material due to deficiency of its compact fraction (in 11 cases). The activity of lymphocyte cytoplasmic lactate, alpha-glycerophosphate and succinate dehydrogenases (SDG) was studied morphocytochemically in 5 women who had children with the disease. High activity of mitochondrial SDG was determined in all cases which probably indicates disorders in lymphocyte energy state. This is one of the reasons for retention of risk pregnancy. Further research in this area may serve as a base for complete cytoanalysis in order to distinguish risk groups among women including primagravida for consequent determination of embryonal karyotype.

  3. 77 FR 50722 - Software Unit Testing for Digital Computer Software Used in Safety Systems of Nuclear Power Plants

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-08-22

    ... NUCLEAR REGULATORY COMMISSION [NRC-2012-0195] Software Unit Testing for Digital Computer Software...) is issuing for public comment draft regulatory guide (DG), DG-1208, ``Software Unit Testing for Digital Computer Software used in Safety Systems of Nuclear Power Plants.'' The DG-1208 is proposed...

  4. 78 FR 47011 - Software Unit Testing for Digital Computer Software Used in Safety Systems of Nuclear Power Plants

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-08-02

    ... NUCLEAR REGULATORY COMMISSION [NRC-2012-0195] Software Unit Testing for Digital Computer Software... revised regulatory guide (RG), revision 1 of RG 1.171, ``Software Unit Testing for Digital Computer Software Used in Safety Systems of Nuclear Power Plants.'' This RG endorses American National Standards...

  5. SARS: Safeguards Accounting and Reporting Software

    NASA Astrophysics Data System (ADS)

    Mohammedi, B.; Saadi, S.; Ait-Mohamed, S.

    In order to satisfy the requirements of the SSAC (State System for Accounting and Control of nuclear materials), for recording and reporting objectives; this computer program comes to bridge the gape between nuclear facilities operators and national inspection verifying records and delivering reports. The SARS maintains and generates at-facility safeguards accounting records and generates International Atomic Energy Agency (IAEA) safeguards reports based on accounting data input by the user at any nuclear facility. A database structure is built and BORLAND DELPHI programming language has been used. The software is designed to be user-friendly, to make extensive and flexible management of menus and graphs. SARS functions include basic physical inventory tacking, transaction histories and reporting. Access controls are made by different passwords.

  6. A computer program for calculation of approximate embryo/fetus radiation dose in nuclear medicine applications.

    PubMed

    Bayram, Tuncay; Sönmez, Bircan

    2012-04-01

    In this study, we aimed to make a computer program that calculates approximate radiation dose received by embryo/fetus in nuclear medicine applications. Radiation dose values per MBq-1 received by embryo/fetus in nuclear medicine applications were gathered from literature for various stages of pregnancy. These values were embedded in the computer code, which was written in Fortran 90 program language. The computer program called nmfdose covers almost all radiopharmaceuticals used in nuclear medicine applications. Approximate radiation dose received by embryo/fetus can be calculated easily at a few steps using this computer program. Although there are some constraints on using the program for some special cases, nmfdose is useful and it provides practical solution for calculation of approximate dose to embryo/fetus in nuclear medicine applications. None declared.

  7. Quick reproduction of blast-wave flow-field properties of nuclear, TNT, and ANFO explosions

    NASA Astrophysics Data System (ADS)

    Groth, C. P. T.

    1986-04-01

    In many instances, extensive blast-wave flow-field properties are required in gasdynamics research studies of blast-wave loading and structure response, and in evaluating the effects of explosions on their environment. This report provides a very useful computer code, which can be used in conjunction with the DNA Nuclear Blast Standard subroutines and code, to quickly reconstruct complete and fairly accurate blast-wave data for almost any free-air (spherical) and surface-burst (hemispherical) nuclear, trinitrotoluene (TNT), or ammonium nitrate-fuel oil (ANFO) explosion. This code is capable of computing all of the main flow properties as functions of radius and time, as well as providing additional information regarding air viscosity, reflected shock-wave properties, and the initial decay of the flow properties just behind the shock front. Both spatial and temporal distributions of the major blast-wave flow properties are also made readily available. Finally, provisions are also included in the code to provide additional information regarding the peak or shock-front flow properties over a range of radii, for a specific explosion of interest.

  8. Computational prediction of CTCF/cohesin-based intra-TAD loops that insulate chromatin contacts and gene expression in mouse liver

    PubMed Central

    2018-01-01

    CTCF and cohesin are key drivers of 3D-nuclear organization, anchoring the megabase-scale Topologically Associating Domains (TADs) that segment the genome. Here, we present and validate a computational method to predict cohesin-and-CTCF binding sites that form intra-TAD DNA loops. The intra-TAD loop anchors identified are structurally indistinguishable from TAD anchors regarding binding partners, sequence conservation, and resistance to cohesin knockdown; further, the intra-TAD loops retain key functional features of TADs, including chromatin contact insulation, blockage of repressive histone mark spread, and ubiquity across tissues. We propose that intra-TAD loops form by the same loop extrusion mechanism as the larger TAD loops, and that their shorter length enables finer regulatory control in restricting enhancer-promoter interactions, which enables selective, high-level expression of gene targets of super-enhancers and genes located within repressive nuclear compartments. These findings elucidate the role of intra-TAD cohesin-and-CTCF binding in nuclear organization associated with widespread insulation of distal enhancer activity. PMID:29757144

  9. Computational prediction of CTCF/cohesin-based intra-TAD loops that insulate chromatin contacts and gene expression in mouse liver.

    PubMed

    Matthews, Bryan J; Waxman, David J

    2018-05-14

    CTCF and cohesin are key drivers of 3D-nuclear organization, anchoring the megabase-scale Topologically Associating Domains (TADs) that segment the genome. Here, we present and validate a computational method to predict cohesin-and-CTCF binding sites that form intra-TAD DNA loops. The intra-TAD loop anchors identified are structurally indistinguishable from TAD anchors regarding binding partners, sequence conservation, and resistance to cohesin knockdown; further, the intra-TAD loops retain key functional features of TADs, including chromatin contact insulation, blockage of repressive histone mark spread, and ubiquity across tissues. We propose that intra-TAD loops form by the same loop extrusion mechanism as the larger TAD loops, and that their shorter length enables finer regulatory control in restricting enhancer-promoter interactions, which enables selective, high-level expression of gene targets of super-enhancers and genes located within repressive nuclear compartments. These findings elucidate the role of intra-TAD cohesin-and-CTCF binding in nuclear organization associated with widespread insulation of distal enhancer activity. © 2018, Matthews et al.

  10. Tensor of effective susceptibility in random magnetic composites: Application to two-dimensional and three-dimensional cases

    NASA Astrophysics Data System (ADS)

    Posnansky, Oleg P.

    2018-05-01

    The measuring of dynamic magnetic susceptibility by nuclear magnetic resonance is used for revealing information about the internal structure of various magnetoactive composites. The response of such material on the applied external static and time-varying magnetic fields encodes intrinsic dynamic correlations and depends on links between macroscopic effective susceptibility and structure on the microscopic scale. In the current work we carried out computational analysis of the frequency dependent dynamic magnetic susceptibility and demonstrated its dependence on the microscopic architectural elements while also considering Euclidean dimensionality. The proposed numerical method is efficient in the simulation of nuclear magnetic resonance experiments in two- and three-dimensional random magnetic media by choosing and modeling the influence of the concentration of components and internal hierarchical characteristics of physical parameters.

  11. Optimization of Cooling Water Flow Rate in Nuclear and Thermal Power Plants Based on a Mathematical Model of Cooling Systems{sup 1}

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Murav’ev, V. P., E-mail: murval1@mail.ru; Kochetkov, A. V.; Glazova, E. G.

    A mathematical model and algorithms are proposed for automatic calculation of the optimum flow rate of cooling water in nuclear and thermal power plants with cooling systems of arbitrary complexity. An unlimited number of configuration and design variants are assumed with the possibility of obtaining a result for any computational time interval, from monthly to hourly. The structural solutions corresponding to an optimum cooling water flow rate can be used for subsequent engineering-economic evaluation of the best cooling system variant. The computerized mathematical model and algorithms make it possible to determine the availability and degree of structural changes for themore » cooling system in all stages of the life cycle of a plant.« less

  12. 78 FR 47014 - Configuration Management Plans for Digital Computer Software Used in Safety Systems of Nuclear...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-08-02

    ... Software Used in Safety Systems of Nuclear Power Plants AGENCY: Nuclear Regulatory Commission. ACTION... Computer Software Used in Safety Systems of Nuclear Power Plants.'' This RG endorses, with clarifications... Electrical and Electronic Engineers (IEEE) Standard 828-2005, ``IEEE Standard for Software Configuration...

  13. NNSA Administrator Addresses the Next Generation of Nuclear Security Professionals: Part 2

    ScienceCinema

    Thomas D'Agostino

    2017-12-09

    Administrator Thomas DAgostino of the National Nuclear Security Administration addressed the next generation of nuclear security professionals during the opening session of todays 2009 Department of Energy (DOE) Computational Science Graduate Fellowship Annual Conference. Administrator DAgostino discussed NNSAs role in implementing President Obamas nuclear security agenda and encouraged the computing science fellows to consider careers in nuclear security.

  14. NNSA Administrator Addresses the Next Generation of Nuclear Security Professionals: Part 1

    ScienceCinema

    Thomas D'Agostino

    2017-12-09

    Administrator Thomas DAgostino of the National Nuclear Security Administration addressed the next generation of nuclear security professionals during the opening session of todays 2009 Department of Energy (DOE) Computational Science Graduate Fellowship Annual Conference. Administrator DAgostino discussed NNSAs role in implementing President Obamas nuclear security agenda and encouraged the computing science fellows to consider careers in nuclear security.

  15. APORT: a program for the area-based apportionment of county variables to cells of a polar grid. [Airborne pollutant transport models

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fields, D.E.; Little, C.A.

    1978-11-01

    The APORT computer code was developed to apportion variables tabulated for polygon-structured civil districts onto cells of a polar grid. The apportionment is based on fractional overlap between the polygon and the grid cells. Centering the origin of the polar system at a pollutant source site yields results that are very useful for assessing and interpreting the effects of airborne pollutant dissemination. The APOPLT graphics code, which uses the same data set as APORT, provides a convenient visual display of the polygon structure and the extent of the polar grid. The APORT/APOPLT methodology was verified by application to county summariesmore » of cattle population for counties surrounding the Oyster Creek, New Jersey, nuclear power plant. These numerical results, which were obtained using approximately 2-min computer time on an IBM System 360/91 computer, compare favorably to results of manual computations in both speed and accuracy.« less

  16. Physical and Mechanical Metallurgy of Zirconium Alloys for Nuclear Applications: A Multi-Scale Computational Study

    NASA Astrophysics Data System (ADS)

    Glazoff, Michael Vasily

    In the post-Fukushima world, thermal and structural stability of materials under extreme conditions is an important issue for the safety of nuclear reactors. Because the nuclear industry will continue using zirconium (Zr) cladding for the foreseeable future, it becomes critical to gain a fundamental understanding of several interconnected problems. First, what are the thermodynamic and kinetic factors affecting oxidation and hydrogen pick-up by these materials at normal, off-normal conditions, and in long-term storage? Secondly, what protective coatings could be used in order to gain valuable time at off-normal conditions (temperature exceeds ~1200°C (2200°F)? Thirdly, the kinetics of the coating's oxidation must be understood. Lastly, one needs automated inspection algorithms allowing identifying cladding's defects. This work attempts to explore the problem from a computational perspective, utilizing first principles atomistic simulations, computational thermodynamics, plasticity theory, and morphological algorithms of image processing for defect identification. It consists of the four parts dealing with these four problem areas preceded by the introduction. In the 1st part, computational thermodynamics and ab initio calculations were used to shed light upon the different stages of zircaloy oxidation and hydrogen pickup, and microstructure optimization to increase thermal stability. The 2 nd part describes the kinetic theory of oxidation of the several materials considered to be perspective coatings for Zr alloys: SiC and ZrSiO4. The 3rd part deals with understanding the respective roles of the two different plasticity mechanisms in Zr nuclear alloys: twinning (at low T) and crystallographic slip (higher T's). For that goal, an advanced plasticity model was proposed. In the 4th part projectional algorithms for defect identification in zircaloy coatings are described. Conclusions and recommendations are presented in the 5th part. This integrative approach's value is in developing multi-faceted understanding of complex processes taking place in nuclear fuel rods. It helped identify several problems pertaining to the safe operations with nuclear fuel: limits of temperature that should be strictly obeyed in storage to retard zircaloy hydriding; understanding the benefits and limitations of coatings; developing in-depth understanding of Zr plasticity; developing original algorithms for defect identification in SiC-braided zircaloy. The obtained results will be useful for the nuclear industry.

  17. Study of the extra-ionic electron distributions in semi-metallic structures by nuclear quadrupole resonance techniques

    NASA Technical Reports Server (NTRS)

    Murty, A. N.

    1976-01-01

    A straightforward self-consistent method was developed to estimate solid state electrostatic potentials, fields and field gradients in ionic solids. The method is a direct practical application of basic electrostatics to solid state and also helps in the understanding of the principles of crystal structure. The necessary mathematical equations, derived from first principles, were presented and the systematic computational procedure developed to arrive at the solid state electrostatic field gradients values was given.

  18. Multiphysics Modeling of a Single Channel in a Nuclear Thermal Propulsion Grooved Ring Fuel Element

    NASA Technical Reports Server (NTRS)

    Kim, Tony; Emrich, William J., Jr.; Barkett, Laura A.; Mathias, Adam D.; Cassibry, Jason T.

    2013-01-01

    In the past, fuel rods have been used in nuclear propulsion applications. A new fuel element concept that reduces weight and increases efficiency uses a stack of grooved discs. Each fuel element is a flat disc with a hole on the interior and grooves across the top. Many grooved ring fuel elements for use in nuclear thermal propulsion systems have been modeled, and a single flow channel for each design has been analyzed. For increased efficiency, a fuel element with a higher surface-area-to-volume ratio is ideal. When grooves are shallower, i.e., they have a lower surface area, the results show that the exit temperature is higher. By coupling the physics of turbulence with those of heat transfer, the effects on the cooler gas flowing through the grooves of the thermally excited solid can be predicted. Parametric studies were done to show how a pressure drop across the axial length of the channels will affect the exit temperatures of the gas. Geometric optimization was done to show the behaviors that result from the manipulation of various parameters. Temperature profiles of the solid and gas showed that more structural optimization is needed to produce the desired results. Keywords: Nuclear Thermal Propulsion, Fuel Element, Heat Transfer, Computational Fluid Dynamics, Coupled Physics Computations, Finite Element Analysis

  19. Comprehensive computational design of ordered peptide macrocycles

    PubMed Central

    Hosseinzadeh, Parisa; Bhardwaj, Gaurav; Mulligan, Vikram Khipple; Shortridge, Matthew D.; Craven, Timothy W.; Pardo-Avila, Fátima; Rettie, Stephen A.; Kim, David E.; Silva, Daniel-Adriano; Ibrahim, Yehia M.; Webb, Ian K.; Cort, John R.; Adkins, Joshua N.; Varani, Gabriele; Baker, David

    2018-01-01

    Mixed-chirality peptide macrocycles such as cyclosporine are among the most potent therapeutics identified to date, but there is currently no way to systematically search the structural space spanned by such compounds. Natural proteins do not provide a useful guide: Peptide macrocycles lack regular secondary structures and hydrophobic cores, and can contain local structures not accessible with L-amino acids. Here, we enumerate the stable structures that can be adopted by macrocyclic peptides composed of L- and D-amino acids by near-exhaustive backbone sampling followed by sequence design and energy landscape calculations. We identify more than 200 designs predicted to fold into single stable structures, many times more than the number of currently available unbound peptide macrocycle structures. Nuclear magnetic resonance structures of 9 of 12 designed 7- to 10-residue macrocycles, and three 11- to 14-residue bicyclic designs, are close to the computational models. Our results provide a nearly complete coverage of the rich space of structures possible for short peptide macrocycles and vastly increase the available starting scaffolds for both rational drug design and library selection methods. PMID:29242347

  20. Evaluation of ilmenite serpentine concrete and ordinary concrete as nuclear reactor shielding

    NASA Astrophysics Data System (ADS)

    Abulfaraj, Waleed H.; Kamal, Salah M.

    1994-07-01

    The present study involves adapting a formal decision methodology to the selection of alternative nuclear reactor concretes shielding. Multiattribute utility theory is selected to accommodate decision makers' preferences. Multiattribute utility theory (MAU) is here employed to evaluate two appropriate nuclear reactor shielding concretes in terms of effectiveness to determine the optimal choice in order to meet the radiation protection regulations. These concretes are Ordinary concrete (O.C.) and Ilmenite Serpentile concrete (I.S.C.). These are normal weight concrete and heavy heat resistive concrete, respectively. The effectiveness objective of the nuclear reactor shielding is defined and structured into definite attributes and subattributes to evaluate the best alternative. Factors affecting the decision are dose received by reactor's workers, the material properties as well as cost of concrete shield. A computer program is employed to assist in performing utility analysis. Based upon data, the result shows the superiority of Ordinary concrete over Ilmenite Serpentine concrete.

  1. Computing the cross sections of nuclear reactions with nuclear clusters emission for proton energies between 30 MeV and 2.6 GeV

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Korovin, Yu. A.; Maksimushkina, A. V., E-mail: AVMaksimushkina@mephi.ru; Frolova, T. A.

    2016-12-15

    The cross sections of nuclear reactions involving emission of clusters of light nuclei in proton collisions with a heavy-metal target are computed for incident-proton energies between 30 MeV and 2.6 GeV. The calculation relies on the ALICE/ASH and CASCADE/INPE computer codes. The parameters determining the pre-equilibrium cluster emission are varied in the computation.

  2. Scoring nuclear pleomorphism using a visual BoF modulated by a graph structure

    NASA Astrophysics Data System (ADS)

    Moncayo-Martínez, Ricardo; Romo-Bucheli, David; Arias, Viviana; Romero, Eduardo

    2017-11-01

    Nuclear pleomorphism has been recognized as a key histological criterium in breast cancer grading systems (such as Bloom Richardson and Nothingham grading systems). However, the nuclear pleomorphism assessment is subjective and presents high inter-reader variability. Automatic algorithms might facilitate quantitative estimation of nuclear variations in shape and size. Nevertheless, the automatic segmentation of the nuclei is difficult and still and open research problem. This paper presents a method using a bag of multi-scale visual features, modulated by a graph structure, to grade nuclei in breast cancer microscopical fields. This strategy constructs hematoxylin-eosin image patches, each containing a nucleus that is represented by a set of visual words in the BoF. The contribution of each visual word is computed by examining the visual words in an associated graph built when projecting the multi-dimensional BoF to a bi-dimensional plane where local relationships are conserved. The methodology was evaluated using 14 breast cancer cases of the Cancer Genome Atlas database. From these cases, a set of 134 microscopical fields was extracted, and under a leave-one-out validation scheme, an average F-score of 0.68 was obtained.

  3. The Impact of the Nuclear Equation of State in Core Collapse Supernovae

    NASA Astrophysics Data System (ADS)

    Baird, M. L.; Lentz, E. J.; Hix, W. R.; Mezzacappa, A.; Messer, O. E. B.; Liebendoerfer, M.; TeraScale Supernova Initiative Collaboration

    2005-12-01

    One of the key ingredients to the core collapse supernova mechanism is the physics of matter at or near nuclear density. Included in simulations as part of the Equation of State (EOS), nuclear repulsion experienced at high densities are responsible for the bounce shock, which initially causes the outer envelope of the supernova to expand, as well as determining the structure of the newly formed proto-neutron star. Recent years have seen renewed interest in this fundamental piece of supernova physics, resulting in several promising candidate EOS parameterizations. We will present the impact of these variations in the nuclear EOS using spherically symmetric, Newtonian and General Relativistic neutrino transport simulations of stellar core collapse and bounce. This work is supported in part by SciDAC grants to the TeraScale Supernovae Initiative from the DOE Office of Science High Energy, Nuclear, and Advanced Scientific Computing Research Programs. Oak Ridge National Laboratory is managed by UT-Battelle, LLC, for U.S. Department of Energy under contract DEAC05-00OR22725

  4. 78 FR 47805 - Test Documentation for Digital Computer Software Used in Safety Systems of Nuclear Power Plants

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-08-06

    ... Documents Access and Management System (ADAMS): You may access publicly available documents online in the... Management Plans for Digital Computer Software used in Safety Systems of Nuclear Power Plants,'' issued for... Used in Safety Systems of Nuclear Power Plants AGENCY: Nuclear Regulatory Commission. ACTION: Revision...

  5. Analysis of the transient response of nuclear spins in GaAs with/without nuclear magnetic resonance

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rasly, Mahmoud; Lin, Zhichao; Yamamoto, Masafumi

    As an alternative to studying the steady-state responses of nuclear spins in solid state systems, working within a transient-state framework can reveal interesting phenomena. The response of nuclear spins in GaAs to a changing magnetic field was analyzed based on the time evolution of nuclear spin temperature. Simulation results well reproduced our experimental results for the transient oblique Hanle signals observed in an all-electrical spin injection device. The analysis showed that the so called dynamic nuclear polarization can be treated as a cooling tool for the nuclear spins: It works as a provider to exchange spin angular momentum between polarizedmore » electron spins and nuclear spins through the hyperfine interaction, leading to an increase in the nuclear polarization. In addition, a time-delay of the nuclear spin temperature with a fast sweep of the external magnetic field produces a possible transient state for the nuclear spin polarization. On the other hand, the nuclear magnetic resonance acts as a heating tool for a nuclear spin system. This causes the nuclear spin temperature to jump to infinity: i.e., the average nuclear spins along with the nuclear field vanish at resonant fields of {sup 75}As, {sup 69}Ga and {sup 71}Ga, showing an interesting step-dip structure in the oblique Hanle signals. These analyses provide a quantitative understanding of nuclear spin dynamics in semiconductors for application in future computation processing.« less

  6. Equations of state for crystalline zirconium iodide: The role of dispersion

    NASA Astrophysics Data System (ADS)

    Rossi, Matthew L.; Taylor, Christopher D.

    2013-02-01

    We present the first-principle equations of state of several zirconium iodides, ZrI2, ZrI3, and ZrI4, computed using density functional theory methods that apply various methods for introducing the dispersion correction. Iodides formed due to reaction of molecular or atomic iodine with zirconium and zircaloys are of particular interest due to their application to the cladding material used in the fabrication of nuclear fuel rods. Stress corrosion cracking (SCC), associated with fission product chemistry with the clad material, is a major concern in the life cycle of nuclear fuels, as many of the observed rod failures have occurred due to pellet-cladding chemical interactions (PCCI) [A. Atrens, G. Dannhäuser, G. Bäro, Stress-corrosion-cracking of zircaloy-4 cladding tubes, Journal of Nuclear Materials 126 (1984) 91-102; P. Rudling, R. Adamson, B. Cox, F. Garzarolli, A. Strasser, High burn-up fuel issues, Nuclear Engineering and Technology 40 (2008) 1-8]. A proper understanding of the physical properties of the corrosion products is, therefore, required for the development of a comprehensive SCC model. In this particular work, we emphasize that, while existing modeling techniques include methods to compute crystal structures and associated properties, it is important to capture intermolecular forces not traditionally included, such as van der Waals (dispersion) correction. Furthermore, crystal structures with stoichiometries favoring a high I:Zr ratio are found to be particularly sensitive, such that traditional density functional theory approaches that do not incorporate dispersion incorrectly predict significantly larger volumes of the lattice. This latter point is related to the diffuse nature of the iodide electron cloud.

  7. Crystal structure of importin-α3 bound to the nuclear localization signal of Ran-binding protein 3.

    PubMed

    Koyama, Masako; Matsuura, Yoshiyuki

    2017-09-23

    Ran-binding protein 3 (RanBP3) is a primarily nuclear Ran-binding protein that functions as an accessory factor in the Ran GTPase system. RanBP3 associates with Ran-specific nucleotide exchange factor RCC1 and enhances its catalytic activity towards Ran. RanBP3 also promotes CRM1-mediated nuclear export as well as CRM1-independent nuclear export of β-catenin, Smad2, and Smad3. Nuclear import of RanBP3 is dependent on the nuclear import adaptor protein importin-α and, RanBP3 is imported more efficiently by importin-α3 than by other members of the importin-α family. Protein kinase signaling pathways control nucleocytoplasmic transport through phosphorylation of RanBP3 at Ser58, immediately C-terminal to the nuclear localization signal (NLS) in the N-terminal region of RanBP3. Here we report the crystal structure of human importin-α3 bound to an N-terminal fragment of human RanBP3 containing the NLS sequence that is necessary and sufficient for nuclear import. The structure reveals that RanBP3 binds to importin-α3 residues that are strictly conserved in all seven isoforms of human importin-α at the major NLS-binding site, indicating that the region of importin-α outside the NLS-binding site, possibly the autoinhibotory importin-β1-binding domain, may be the key determinant for the preferential binding of RanBP3 to importin-α3. Computational docking simulation indicates that phosphorylation of RanBP3 at Ser58 could potentially stabilize the association of RanBP3 with importin-α through interactions between the phosphate moiety of phospho-Ser58 of RanBP3 and a cluster of basic residues (Arg96 and Lys97 in importin-α3) on armadillo repeat 1 of importin-α. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. Nuclear physics: quantitative single-cell approaches to nuclear organization and gene expression.

    PubMed

    Lionnet, T; Wu, B; Grünwald, D; Singer, R H; Larson, D R

    2010-01-01

    The internal workings of the nucleus remain a mystery. A list of component parts exists, and in many cases their functional roles are known for events such as transcription, RNA processing, or nuclear export. Some of these components exhibit structural features in the nucleus, regions of concentration or bodies that have given rise to the concept of functional compartmentalization--that there are underlying organizational principles to be described. In contrast, a picture is emerging in which transcription appears to drive the assembly of the functional components required for gene expression, drawing from pools of excess factors. Unifying this seemingly dual nature requires a more rigorous approach, one in which components are tracked in time and space and correlated with onset of specific nuclear functions. In this chapter, we anticipate tools that will address these questions and provide the missing kinetics of nuclear function. These tools are based on analyzing the fluctuations inherent in the weak signals of endogenous nuclear processes and determining values for them. In this way, it will be possible eventually to provide a computational model describing the functional relationships of essential components.

  9. Transport Of Passive Scalars In A Turbulent Channel Flow

    NASA Technical Reports Server (NTRS)

    Kim, John; Moin, Parviz

    1990-01-01

    Computer simulation of transport of passive scalars in turbulent channel flow described in report. Shows flow structures and statistical properties. As used here, "passive scalars" means scalar quantities like fluctuations in temperature or concentrations of contaminants that do not disturb flow appreciably. Examples include transport of heat in heat exchangers, gas turbines, and nuclear reactors and dispersal of pollution in atmosphere.

  10. Structural studies of RNA-protein complexes: A hybrid approach involving hydrodynamics, scattering, and computational methods.

    PubMed

    Patel, Trushar R; Chojnowski, Grzegorz; Astha; Koul, Amit; McKenna, Sean A; Bujnicki, Janusz M

    2017-04-15

    The diverse functional cellular roles played by ribonucleic acids (RNA) have emphasized the need to develop rapid and accurate methodologies to elucidate the relationship between the structure and function of RNA. Structural biology tools such as X-ray crystallography and Nuclear Magnetic Resonance are highly useful methods to obtain atomic-level resolution models of macromolecules. However, both methods have sample, time, and technical limitations that prevent their application to a number of macromolecules of interest. An emerging alternative to high-resolution structural techniques is to employ a hybrid approach that combines low-resolution shape information about macromolecules and their complexes from experimental hydrodynamic (e.g. analytical ultracentrifugation) and solution scattering measurements (e.g., solution X-ray or neutron scattering), with computational modeling to obtain atomic-level models. While promising, scattering methods rely on aggregation-free, monodispersed preparations and therefore the careful development of a quality control pipeline is fundamental to an unbiased and reliable structural determination. This review article describes hydrodynamic techniques that are highly valuable for homogeneity studies, scattering techniques useful to study the low-resolution shape, and strategies for computational modeling to obtain high-resolution 3D structural models of RNAs, proteins, and RNA-protein complexes. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

  11. Current and anticipated uses of the thermal hydraulics codes at the NRC

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Caruso, R.

    1997-07-01

    The focus of Thermal-Hydraulic computer code usage in nuclear regulatory organizations has undergone a considerable shift since the codes were originally conceived. Less work is being done in the area of {open_quotes}Design Basis Accidents,{close_quotes}, and much more emphasis is being placed on analysis of operational events, probabalistic risk/safety assessment, and maintenance practices. All of these areas need support from Thermal-Hydraulic computer codes to model the behavior of plant fluid systems, and they all need the ability to perform large numbers of analyses quickly. It is therefore important for the T/H codes of the future to be able to support thesemore » needs, by providing robust, easy-to-use, tools that produce easy-to understand results for a wider community of nuclear professionals. These tools need to take advantage of the great advances that have occurred recently in computer software, by providing users with graphical user interfaces for both input and output. In addition, reduced costs of computer memory and other hardware have removed the need for excessively complex data structures and numerical schemes, which make the codes more difficult and expensive to modify, maintain, and debug, and which increase problem run-times. Future versions of the T/H codes should also be structured in a modular fashion, to allow for the easy incorporation of new correlations, models, or features, and to simplify maintenance and testing. Finally, it is important that future T/H code developers work closely with the code user community, to ensure that the code meet the needs of those users.« less

  12. Computer Security for Commercial Nuclear Power Plants - Literature Review for Korea Hydro Nuclear Power Central Research Institute

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Duran, Felicia Angelica; Waymire, Russell L.

    2013-10-01

    Sandia National Laboratories (SNL) is providing training and consultation activities on security planning and design for the Korea Hydro and Nuclear Power Central Research Institute (KHNPCRI). As part of this effort, SNL performed a literature review on computer security requirements, guidance and best practices that are applicable to an advanced nuclear power plant. This report documents the review of reports generated by SNL and other organizations [U.S. Nuclear Regulatory Commission, Nuclear Energy Institute, and International Atomic Energy Agency] related to protection of information technology resources, primarily digital controls and computer resources and their data networks. Copies of the key documentsmore » have also been provided to KHNP-CRI.« less

  13. Rail Shock and Vibration Pre-Test Modeling of a Used Nuclear Fuel Assembly

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ross, Steven B.; Klymyshyn, Nicholas A.; Jensen, Philip J.

    The U.S. Department of Energy Office of Nuclear Energy (DOE-NE), Office of Fuel Cycle Technology, has established the Used Fuel Disposition Campaign (UFDC) to conduct the research and development activities related to storage, transportation, and disposal of used nuclear fuel (UNF) and high-level radioactive waste (HLW). The mission of the UFDC is to identify alternatives and conduct scientific research and technology development to enable storage, transportation and disposal of used nuclear fuel and HLW generated by existing and future nuclear fuel cycles. The Storage and Transportation staff within the UFDC is responsible for addressing issues regarding the long-term or extendedmore » storage (ES) of UNF and its subsequent transportation. Available information is not sufficient to determine the ability of ES UNF, including high-burnup fuel, to withstand shock and vibration forces that could occur when the UNF is shipped by rail from nuclear power plant sites to a storage or disposal facility. There are three major gaps in the available information – 1) the forces that UNF assemblies would be subjected to when transported by rail, 2) the mechanical characteristics of fuel rod cladding, which is an essential structure for controlling the geometry of the UNF, a safety related feature, and 3) modeling methodologies to evaluate multiple possible degradation or damage mechanisms over the UNF lifetime. In order to address the first gap, options for tests to determine the physical response of surrogate UNF assemblies subjected to shock and vibration forces that are expected to be experienced during normal conditions of transportation (NCT) by rail must be identified and evaluated. The objective of the rail shock and vibration tests is to obtain data that will help researchers understand the mechanical loads that ES UNF assemblies would be subjected to under normal conditions of transportation and to fortify the computer modeling that will be necessary to evaluate the impact those loads may have on the integrity of the UNF assembly. The shock and vibration testing along with computer modeling is a vital part of research to achieve closure of a gap in information related to the ability of ES UNF to maintain its safety function when subjected to NCT. In support of this effort, preliminary structural dynamics modeling is presented herein. The modeling investigates the rigidity of a hypothetical cask and cradle structure by comparing it to a monolithic concrete mass. The concrete mass represents a practical option for achieving the necessary cask and cradle mass on a flatbed railcar, but this comparative modeling study investigates whether or not the dynamic loads transmitted through a monolithic concrete configuration are adequately representative of a realistic cask and cradle system. This modeling highlights the need for rail testing by reporting the phenomenon of structural transmissibility. As shown herein, this structural transmissibility can cause an amplification of shock and vibration loads through the structure, which could potentially lead to accelerated mechanical degradation of UNF under NCT.« less

  14. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kornreich, Drew E; Vaidya, Rajendra U; Ammerman, Curtt N

    Integrated Computational Materials Engineering (ICME) is a novel overarching approach to bridge length and time scales in computational materials science and engineering. This approach integrates all elements of multi-scale modeling (including various empirical and science-based models) with materials informatics to provide users the opportunity to tailor material selections based on stringent application needs. Typically, materials engineering has focused on structural requirements (stress, strain, modulus, fracture toughness etc.) while multi-scale modeling has been science focused (mechanical threshold strength model, grain-size models, solid-solution strengthening models etc.). Materials informatics (mechanical property inventories) on the other hand, is extensively data focused. All of thesemore » elements are combined within the framework of ICME to create architecture for the development, selection and design new composite materials for challenging environments. We propose development of the foundations for applying ICME to composite materials development for nuclear and high-radiation environments (including nuclear-fusion energy reactors, nuclear-fission reactors, and accelerators). We expect to combine all elements of current material models (including thermo-mechanical and finite-element models) into the ICME framework. This will be accomplished through the use of a various mathematical modeling constructs. These constructs will allow the integration of constituent models, which in tum would allow us to use the adaptive strengths of using a combinatorial scheme (fabrication and computational) for creating new composite materials. A sample problem where these concepts are used is provided in this summary.« less

  15. Advanced mathematical on-line analysis in nuclear experiments. Usage of parallel computing CUDA routines in standard root analysis

    NASA Astrophysics Data System (ADS)

    Grzeszczuk, A.; Kowalski, S.

    2015-04-01

    Compute Unified Device Architecture (CUDA) is a parallel computing platform developed by Nvidia for increase speed of graphics by usage of parallel mode for processes calculation. The success of this solution has opened technology General-Purpose Graphic Processor Units (GPGPUs) for applications not coupled with graphics. The GPGPUs system can be applying as effective tool for reducing huge number of data for pulse shape analysis measures, by on-line recalculation or by very quick system of compression. The simplified structure of CUDA system and model of programming based on example Nvidia GForce GTX580 card are presented by our poster contribution in stand-alone version and as ROOT application.

  16. Proceedings of the 2013 International Conference on Mathematics and Computational Methods Applied to Nuclear Science and Engineering - M and C 2013

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    NONE

    2013-07-01

    The Mathematics and Computation Division of the American Nuclear (ANS) and the Idaho Section of the ANS hosted the 2013 International Conference on Mathematics and Computational Methods Applied to Nuclear Science and Engineering (M and C 2013). This proceedings contains over 250 full papers with topics ranging from reactor physics; radiation transport; materials science; nuclear fuels; core performance and optimization; reactor systems and safety; fluid dynamics; medical applications; analytical and numerical methods; algorithms for advanced architectures; and validation verification, and uncertainty quantification.

  17. Operate a Nuclear Power Plant.

    ERIC Educational Resources Information Center

    Frimpter, Bonnie J.; And Others

    1983-01-01

    Describes classroom use of a computer program originally published in Creative Computing magazine. "The Nuclear Power Plant" (runs on Apple II with 48K memory) simulates the operating of a nuclear generating station, requiring students to make decisions as they assume the task of managing the plant. (JN)

  18. Applications of NMR and computational methodologies to study protein dynamics.

    PubMed

    Narayanan, Chitra; Bafna, Khushboo; Roux, Louise D; Agarwal, Pratul K; Doucet, Nicolas

    2017-08-15

    Overwhelming evidence now illustrates the defining role of atomic-scale protein flexibility in biological events such as allostery, cell signaling, and enzyme catalysis. Over the years, spin relaxation nuclear magnetic resonance (NMR) has provided significant insights on the structural motions occurring on multiple time frames over the course of a protein life span. The present review article aims to illustrate to the broader community how this technique continues to shape many areas of protein science and engineering, in addition to being an indispensable tool for studying atomic-scale motions and functional characterization. Continuing developments in underlying NMR technology alongside software and hardware developments for complementary computational approaches now enable methodologies to routinely provide spatial directionality and structural representations traditionally harder to achieve solely using NMR spectroscopy. In addition to its well-established role in structural elucidation, we present recent examples that illustrate the combined power of selective isotope labeling, relaxation dispersion experiments, chemical shift analyses, and computational approaches for the characterization of conformational sub-states in proteins and enzymes. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Vorinostat differentially alters 3D nuclear structure of cancer and non-cancerous esophageal cells.

    PubMed

    Nandakumar, Vivek; Hansen, Nanna; Glenn, Honor L; Han, Jessica H; Helland, Stephanie; Hernandez, Kathryn; Senechal, Patti; Johnson, Roger H; Bussey, Kimberly J; Meldrum, Deirdre R

    2016-08-09

    The histone deacetylase (HDAC) inhibitor vorinostat has received significant attention in recent years as an 'epigenetic' drug used to treat solid tumors. However, its mechanisms of action are not entirely understood, particularly with regard to its interaction with the aberrations in 3D nuclear structure that accompany neoplastic progression. We investigated the impact of vorinostat on human esophageal epithelial cell lines derived from normal, metaplastic (pre-cancerous), and malignant tissue. Using a combination of novel optical computed tomography (CT)-based quantitative 3D absorption microscopy and conventional confocal fluorescence microscopy, we show that subjecting malignant cells to vorinostat preferentially alters their 3D nuclear architecture relative to non-cancerous cells. Optical CT (cell CT) imaging of fixed single cells showed that drug-treated cancer cells exhibit significant alterations in nuclear morphometry. Confocal microscopy revealed that vorinostat caused changes in the distribution of H3K9ac-marked euchromatin and H3K9me3-marked constitutive heterochromatin. Additionally, 3D immuno-FISH showed that drug-induced expression of the DNA repair gene MGMT was accompanied by spatial relocation toward the center of the nucleus in the nuclei of metaplastic but not in non-neoplastic cells. Our data suggest that vorinostat's differential modulation of 3D nuclear architecture in normal and abnormal cells could play a functional role in its anti-cancer action.

  20. Nuclear Reactor Physics

    NASA Astrophysics Data System (ADS)

    Stacey, Weston M.

    2001-02-01

    An authoritative textbook and up-to-date professional's guide to basic and advanced principles and practices Nuclear reactors now account for a significant portion of the electrical power generated worldwide. At the same time, the past few decades have seen an ever-increasing number of industrial, medical, military, and research applications for nuclear reactors. Nuclear reactor physics is the core discipline of nuclear engineering, and as the first comprehensive textbook and reference on basic and advanced nuclear reactor physics to appear in a quarter century, this book fills a large gap in the professional literature. Nuclear Reactor Physics is a textbook for students new to the subject, for others who need a basic understanding of how nuclear reactors work, as well as for those who are, or wish to become, specialists in nuclear reactor physics and reactor physics computations. It is also a valuable resource for engineers responsible for the operation of nuclear reactors. Dr. Weston Stacey begins with clear presentations of the basic physical principles, nuclear data, and computational methodology needed to understand both the static and dynamic behaviors of nuclear reactors. This is followed by in-depth discussions of advanced concepts, including extensive treatment of neutron transport computational methods. As an aid to comprehension and quick mastery of computational skills, he provides numerous examples illustrating step-by-step procedures for performing the calculations described and chapter-end problems. Nuclear Reactor Physics is a useful textbook and working reference. It is an excellent self-teaching guide for research scientists, engineers, and technicians involved in industrial, research, and military applications of nuclear reactors, as well as government regulators who wish to increase their understanding of nuclear reactors.

  1. Structure and stability of hexa-aqua V(III) cations in vanadium redox flow battery electrolytes.

    PubMed

    Vijayakumar, M; Li, Liyu; Nie, Zimin; Yang, Zhenguo; Hu, JianZhi

    2012-08-07

    The vanadium(III) cation structure in mixed acid based electrolyte solution from vanadium redox flow batteries is studied by (17)O and (35/37)Cl nuclear magnetic resonance (NMR) spectroscopy, electronic spectroscopy and density functional theory (DFT) based computational modelling. Both computational and experimental results reveal that the V(III) species can complex with counter anions (sulfate/chlorine) depending on the composition of its solvation sphere. By analyzing the powder precipitate it was found that the formation of sulfate complexed V(III) species is the crucial process in the precipitation reaction. The precipitation occurs through nucleation of neutral species formed through deprotonation and ion-pair formation process. However, the powder precipitate shows a multiphase nature which warrants multiple reaction pathways for precipitation reaction.

  2. Crashworthiness: Planes, trains, and automobiles

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Logan, R.W.; Tokarz, F.J.; Whirley, R.G.

    A powerful DYNA3D computer code simulates the dynamic effects of stress traveling through structures. It is the most advanced modeling tool available to study crashworthiness problems and to analyze impacts. Now used by some 1000 companies, government research laboratories, and universities in the U.S. and abroad, DYNA3D is also a preeminent example of successful technology transfer. The initial interest in such a code was to simulate the structural response of weapons systems. The need was to model not the explosive or nuclear events themselves but rather the impacts of weapons systems with the ground, tracking the stress waves as theymore » move through the object. This type of computer simulation augmented or, in certain cases, reduced the need for expensive and time-consuming crash testing.« less

  3. Designer drugs: the evolving science of drug discovery.

    PubMed

    Wanke, L A; DuBose, R F

    1998-07-01

    Drug discovery and design are fundamental to drug development. Until recently, most drugs were discovered through random screening or developed through molecular modification. New technologies are revolutionizing this phase of drug development. Rational drug design, using powerful computers and computational chemistry and employing X-ray crystallography, nuclear magnetic resonance spectroscopy, and three-dimensional quantitative structure activity relationship analysis, is creating highly specific, biologically active molecules by virtual reality modeling. Sophisticated screening technologies are eliminating all but the most active lead compounds. These new technologies promise more efficacious, safe, and cost-effective medications, while minimizing drug development time and maximizing profits.

  4. Solution-state structure and affinities of cyclodextrin: Fentanyl complexes by nuclear magnetic resonance spectroscopy and molecular dynamics simulation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mayer, Brian P.; Kennedy, Daniel J.; Lau, Edmond Y.

    Cyclodextrins (CDs) are investigated for their ability to form inclusion complexes with the analgesic fentanyl and three similar molecules: acetylfentanyl, thiofentanyl, and acetylthiofentanyl. Stoichiometry, binding strength, and complex structure are revealed through nuclear magnetic resonance (NMR) techniques and discussed in terms of molecular dynamics (MD) simulations. It was found that β-cyclodextrin is generally capable of forming the strongest complexes with the fentanyl panel. Two-dimensional NMR data and computational chemical calculations are used to derive solution-state structures of the complexes. Binding of the fentanyls to the CDs occurs at the amide phenyl ring, leaving the majority of the molecule solvated bymore » water, an observation common to all four fentanyls. This finding suggests a universal binding behavior, as the vast majority of previously synthesized fentanyl analogues contain this structural moiety. Furthermore, this baseline study serves as the most complete work on CD:fentanyl complexes to date and provides the insights into strategies for producing future generations of designer cyclodextrins capable of stronger and more selective complexation of fentanyl and its analogues.« less

  5. Solution-state structure and affinities of cyclodextrin: Fentanyl complexes by nuclear magnetic resonance spectroscopy and molecular dynamics simulation

    DOE PAGES

    Mayer, Brian P.; Kennedy, Daniel J.; Lau, Edmond Y.; ...

    2016-02-04

    Cyclodextrins (CDs) are investigated for their ability to form inclusion complexes with the analgesic fentanyl and three similar molecules: acetylfentanyl, thiofentanyl, and acetylthiofentanyl. Stoichiometry, binding strength, and complex structure are revealed through nuclear magnetic resonance (NMR) techniques and discussed in terms of molecular dynamics (MD) simulations. It was found that β-cyclodextrin is generally capable of forming the strongest complexes with the fentanyl panel. Two-dimensional NMR data and computational chemical calculations are used to derive solution-state structures of the complexes. Binding of the fentanyls to the CDs occurs at the amide phenyl ring, leaving the majority of the molecule solvated bymore » water, an observation common to all four fentanyls. This finding suggests a universal binding behavior, as the vast majority of previously synthesized fentanyl analogues contain this structural moiety. Furthermore, this baseline study serves as the most complete work on CD:fentanyl complexes to date and provides the insights into strategies for producing future generations of designer cyclodextrins capable of stronger and more selective complexation of fentanyl and its analogues.« less

  6. Nuclear Science Symposium, 31st and Symposium on Nuclear Power Systems, 16th, Orlando, FL, October 31-November 2, 1984, Proceedings

    NASA Technical Reports Server (NTRS)

    Biggerstaff, J. A. (Editor)

    1985-01-01

    Topics related to physics instrumentation are discussed, taking into account cryostat and electronic development associated with multidetector spectrometer systems, the influence of materials and counting-rate effects on He-3 neutron spectrometry, a data acquisition system for time-resolved muscle experiments, and a sensitive null detector for precise measurements of integral linearity. Other subjects explored are concerned with space instrumentation, computer applications, detectors, instrumentation for high energy physics, instrumentation for nuclear medicine, environmental monitoring and health physics instrumentation, nuclear safeguards and reactor instrumentation, and a 1984 symposium on nuclear power systems. Attention is given to the application of multiprocessors to scientific problems, a large-scale computer facility for computational aerodynamics, a single-board 32-bit computer for the Fastbus, the integration of detector arrays and readout electronics on a single chip, and three-dimensional Monte Carlo simulation of the electron avalanche in a proportional counter.

  7. 16th International Conference on Nuclear Structure: NS2016

    DOE PAGES

    Galindo-Uribarri, Alfredo

    2016-10-28

    Every two years the Nuclear Structure (NS) conference series brings together researchers from an international community of experimental and theoretical nuclear physicists to present and discuss their latest results in nuclear structure. This biennial conference covered the latest results on experimental and theoretical research into the structure of nuclei at the extremes of isospin, excitation energy, mass, and angular momentum. Topics included many of the most exciting areas of modern nuclear structure research such as transitional behavior, nuclear structure and its evolution across the nuclear landscape, shell structure, collectivity, nuclear structure with radioactive beams, and macroscopic and microscopic approaches tomore » nuclear structure.« less

  8. 16th International Conference on Nuclear Structure: NS2016

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Galindo-Uribarri, Alfredo

    Every two years the Nuclear Structure (NS) conference series brings together researchers from an international community of experimental and theoretical nuclear physicists to present and discuss their latest results in nuclear structure. This biennial conference covered the latest results on experimental and theoretical research into the structure of nuclei at the extremes of isospin, excitation energy, mass, and angular momentum. Topics included many of the most exciting areas of modern nuclear structure research such as transitional behavior, nuclear structure and its evolution across the nuclear landscape, shell structure, collectivity, nuclear structure with radioactive beams, and macroscopic and microscopic approaches tomore » nuclear structure.« less

  9. A new algorithm to handle finite nuclear mass effects in electronic calculations: the ISOTOPE program.

    PubMed

    Gonçalves, Cristina P; Mohallem, José R

    2004-11-15

    We report the development of a simple algorithm to modify quantum chemistry codes based on the LCAO procedure, to account for the isotope problem in electronic structure calculations. No extra computations are required compared to standard Born-Oppenheimer calculations. An upgrade of the Gamess package called ISOTOPE is presented, and its applicability is demonstrated in some examples.

  10. Coordination characteristics of uranyl BBP complexes: Insights from an electronic structure analysis

    DOE PAGES

    Pemmaraju, Chaitanya Das; Copping, Roy; Smiles, Danil E.; ...

    2017-03-21

    Here, organic ligand complexes of lanthanide/actinide ions have been studied extensively for applications in nuclear fuel storage and recycling. Several complexes of 2,6-bis(2-benzimidazyl)pyridine (H2BBP) featuring the uranyl moiety have been reported recently, and the present study investigates the coordination characteristics of these complexes using density functional theory-based electronic structure analysis. In particular, with the aid of several computational models, the nonplanar equatorial coordination about uranyl, observed in some of the compounds, is studied and its origin traced to steric effects.

  11. Economic Analysis of Complex Nuclear Fuel Cycles with NE-COST

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ganda, Francesco; Dixon, Brent; Hoffman, Edward

    The purpose of this work is to present a new methodology, and associated computational tools, developed within the U.S. Department of Energy (U.S. DOE) Fuel Cycle Option Campaign to quantify the economic performance of complex nuclear fuel cycles. The levelized electricity cost at the busbar is generally chosen to quantify and compare the economic performance of different baseload generating technologies, including of nuclear: it is the cost of electricity which renders the risk-adjusted discounted net present value of the investment cash flow equal to zero. The work presented here is focused on the calculation of the levelized cost of electricitymore » of fuel cycles at mass balance equilibrium, which is termed LCAE (Levelized Cost of Electricity at Equilibrium). To alleviate the computational issues associated with the calculation of the LCAE for complex fuel cycles, a novel approach has been developed, which has been called the “island approach” because of its logical structure: a generic complex fuel cycle is subdivided into subsets of fuel cycle facilities, called islands, each containing one and only one type of reactor or blanket and an arbitrary number of fuel cycle facilities. A nuclear economic software tool, NE-COST, written in the commercial programming software MATLAB®, has been developed to calculate the LCAE of complex fuel cycles with the “island” computational approach. NE-COST has also been developed with the capability to handle uncertainty: the input parameters (both unit costs and fuel cycle characteristics) can have uncertainty distributions associated with them, and the output can be computed in terms of probability density functions of the LCAE. In this paper NE-COST will be used to quantify, as examples, the economic performance of (1) current Light Water Reactors (LWR) once-through systems; (2) continuous plutonium recycling in Fast Reactors (FR) with driver and blanket; (3) Recycling of plutonium bred in FR into LWR. For each fuel cycle, the contributions to the total LCAE of the main cost components will be identified.« less

  12. Fracture Analysis of Vessels. Oak Ridge FAVOR, v06.1, Computer Code: Theory and Implementation of Algorithms, Methods, and Correlations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Williams, P. T.; Dickson, T. L.; Yin, S.

    The current regulations to insure that nuclear reactor pressure vessels (RPVs) maintain their structural integrity when subjected to transients such as pressurized thermal shock (PTS) events were derived from computational models developed in the early-to-mid 1980s. Since that time, advancements and refinements in relevant technologies that impact RPV integrity assessment have led to an effort by the NRC to re-evaluate its PTS regulations. Updated computational methodologies have been developed through interactions between experts in the relevant disciplines of thermal hydraulics, probabilistic risk assessment, materials embrittlement, fracture mechanics, and inspection (flaw characterization). Contributors to the development of these methodologies include themore » NRC staff, their contractors, and representatives from the nuclear industry. These updated methodologies have been integrated into the Fracture Analysis of Vessels -- Oak Ridge (FAVOR, v06.1) computer code developed for the NRC by the Heavy Section Steel Technology (HSST) program at Oak Ridge National Laboratory (ORNL). The FAVOR, v04.1, code represents the baseline NRC-selected applications tool for re-assessing the current PTS regulations. This report is intended to document the technical bases for the assumptions, algorithms, methods, and correlations employed in the development of the FAVOR, v06.1, code.« less

  13. Cryptic genetic diversity, population structure, and gene flow in the Mojave rattlesnake (Crotalus scutulatus).

    PubMed

    Schield, Drew R; Adams, Richard H; Card, Daren C; Corbin, Andrew B; Jezkova, Tereza; Hales, Nicole R; Meik, Jesse M; Perry, Blair W; Spencer, Carol L; Smith, Lydia L; García, Gustavo Campillo; Bouzid, Nassima M; Strickland, Jason L; Parkinson, Christopher L; Borja, Miguel; Castañeda-Gaytán, Gamaliel; Bryson, Robert W; Flores-Villela, Oscar A; Mackessy, Stephen P; Castoe, Todd A

    2018-06-15

    The Mojave rattlesnake (Crotalus scutulatus) inhabits deserts and arid grasslands of the western United States and Mexico. Despite considerable interest in its highly toxic venom and the recognition of two subspecies, no molecular studies have characterized range-wide genetic diversity and population structure or tested species limits within C. scutulatus. We used mitochondrial DNA and thousands of nuclear loci from double-digest restriction site associated DNA sequencing to infer population genetic structure throughout the range of C. scutulatus, and to evaluate divergence times and gene flow between populations. We find strong support for several divergent mitochondrial and nuclear clades of C. scutulatus, including splits coincident with two major phylogeographic barriers: the Continental Divide and the elevational increase associated with the Central Mexican Plateau. We apply Bayesian clustering, phylogenetic inference, and coalescent-based species delimitation to our nuclear genetic data to test hypotheses of population structure. We also performed demographic analyses to test hypotheses relating to population divergence and gene flow. Collectively, our results support the existence of four distinct lineages within C. scutulatus, and genetically defined populations do not correspond with currently recognized subspecies ranges. Finally, we use approximate Bayesian computation to test hypotheses of divergence among multiple rattlesnake species groups distributed across the Continental Divide, and find evidence for co-divergence at this boundary during the mid-Pleistocene. Copyright © 2018 Elsevier Inc. All rights reserved.

  14. 78 FR 47015 - Software Requirement Specifications for Digital Computer Software Used in Safety Systems of...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-08-02

    ... NUCLEAR REGULATORY COMMISSION [NRC-2012-0195] Software Requirement Specifications for Digital Computer Software Used in Safety Systems of Nuclear Power Plants AGENCY: Nuclear Regulatory Commission... issuing a revised regulatory guide (RG), revision 1 of RG 1.172, ``Software Requirement Specifications for...

  15. Technology Roadmap Instrumentation, Control, and Human-Machine Interface to Support DOE Advanced Nuclear Energy Programs

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Donald D Dudenhoeffer; Burce P Hallbert

    Instrumentation, Controls, and Human-Machine Interface (ICHMI) technologies are essential to ensuring delivery and effective operation of optimized advanced Generation IV (Gen IV) nuclear energy systems. In 1996, the Watts Bar I nuclear power plant in Tennessee was the last U.S. nuclear power plant to go on line. It was, in fact, built based on pre-1990 technology. Since this last U.S. nuclear power plant was designed, there have been major advances in the field of ICHMI systems. Computer technology employed in other industries has advanced dramatically, and computing systems are now replaced every few years as they become functionally obsolete. Functionalmore » obsolescence occurs when newer, more functional technology replaces or supersedes an existing technology, even though an existing technology may well be in working order.Although ICHMI architectures are comprised of much of the same technology, they have not been updated nearly as often in the nuclear power industry. For example, some newer Personal Digital Assistants (PDAs) or handheld computers may, in fact, have more functionality than the 1996 computer control system at the Watts Bar I plant. This illustrates the need to transition and upgrade current nuclear power plant ICHMI technologies.« less

  16. A solid reactor core thermal model for nuclear thermal rockets

    NASA Astrophysics Data System (ADS)

    Rider, William J.; Cappiello, Michael W.; Liles, Dennis R.

    1991-01-01

    A Helium/Hydrogen Cooled Reactor Analysis (HERA) computer code has been developed. HERA has the ability to model arbitrary geometries in three dimensions, which allows the user to easily analyze reactor cores constructed of prismatic graphite elements. The code accounts for heat generation in the fuel, control rods, and other structures; conduction and radiation across gaps; convection to the coolant; and a variety of boundary conditions. The numerical solution scheme has been optimized for vector computers, making long transient analyses economical. Time integration is either explicit or implicit, which allows the use of the model to accurately calculate both short- or long-term transients with an efficient use of computer time. Both the basic spatial and temporal integration schemes have been benchmarked against analytical solutions.

  17. Application of desktop computers in nuclear engineering education

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Graves, H.W. Jr.

    1990-01-01

    Utilization of desktop computers in the academic environment is based on the same objectives as in the industrial environment - increased quality and efficiency. Desktop computers can be extremely useful teaching tools in two general areas: classroom demonstrations and homework assignments. Although differences in emphasis exist, tutorial programs share many characteristics with interactive software developed for the industrial environment. In the Reactor Design and Fuel Management course at the University of Maryland, several interactive tutorial programs provided by Energy analysis Software Service have been utilized. These programs have been designed to be sufficiently structured to permit an orderly, disciplined solutionmore » to the problem being solved, and yet be flexible enough to accommodate most problem solution options.« less

  18. Fragment-Based Electronic Structure Approach for Computing Nuclear Magnetic Resonance Chemical Shifts in Molecular Crystals.

    PubMed

    Hartman, Joshua D; Beran, Gregory J O

    2014-11-11

    First-principles chemical shielding tensor predictions play a critical role in studying molecular crystal structures using nuclear magnetic resonance. Fragment-based electronic structure methods have dramatically improved the ability to model molecular crystal structures and energetics using high-level electronic structure methods. Here, a many-body expansion fragment approach is applied to the calculation of chemical shielding tensors in molecular crystals. First, the impact of truncating the many-body expansion at different orders and the role of electrostatic embedding are examined on a series of molecular clusters extracted from molecular crystals. Second, the ability of these techniques to assign three polymorphic forms of the drug sulfanilamide to the corresponding experimental (13)C spectra is assessed. This challenging example requires discriminating among spectra whose (13)C chemical shifts differ by only a few parts per million (ppm) across the different polymorphs. Fragment-based PBE0/6-311+G(2d,p) level chemical shielding predictions correctly assign these three polymorphs and reproduce the sulfanilamide experimental (13)C chemical shifts with 1 ppm accuracy. The results demonstrate that fragment approaches are competitive with the widely used gauge-invariant projector augmented wave (GIPAW) periodic density functional theory calculations.

  19. 77 FR 50726 - Software Requirement Specifications for Digital Computer Software and Complex Electronics Used in...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-08-22

    ... Computer Software and Complex Electronics Used in Safety Systems of Nuclear Power Plants AGENCY: Nuclear...-1209, ``Software Requirement Specifications for Digital Computer Software and Complex Electronics used... Electronics Engineers (ANSI/IEEE) Standard 830-1998, ``IEEE Recommended Practice for Software Requirements...

  20. Tensor Fermi liquid parameters in nuclear matter from chiral effective field theory

    NASA Astrophysics Data System (ADS)

    Holt, J. W.; Kaiser, N.; Whitehead, T. R.

    2018-05-01

    We compute from chiral two- and three-body forces the complete quasiparticle interaction in symmetric nuclear matter up to twice nuclear matter saturation density. Second-order perturbative contributions that account for Pauli blocking and medium polarization are included, allowing for an exploration of the full set of central and noncentral operator structures permitted by symmetries and the long-wavelength limit. At the Hartree-Fock level, the next-to-next-to-leading order three-nucleon force contributes to all noncentral interactions, and their strengths grow approximately linearly with the nucleon density up to that of saturated nuclear matter. Three-body forces are shown to enhance the already strong proton-neutron effective tensor interaction, while the corresponding like-particle tensor force remains small. We also find a large isovector cross-vector interaction but small center-of-mass tensor interactions in the isoscalar and isovector channels. The convergence of the expansion of the noncentral quasiparticle interaction in Landau parameters and Legendre polynomials is studied in detail.

  1. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vins, M.

    This contribution overviews neutron spectrum measurement, which was done on training reactor VR-1 Sparrow with a new nuclear fuel. Former nuclear fuel IRT-3M was changed for current nuclear fuel IRT-4M with lower enrichment of 235U (enrichment was reduced from former 36% to 20%) in terms of Reduced Enrichment for Research and Test Reactors (RERTR) Program. Neutron spectrum measurement was obtained by irradiation of activation foils at the end of pipe of rabit system and consecutive deconvolution of obtained saturated activities. Deconvolution was performed by computer iterative code SAND-II with 620 groups' structure. All gamma measurements were performed on Canberra HPGe.more » Activation foils were chosen according physical and nuclear parameters from the set of certificated foils. The Resulting differential flux at the end of pipe of rabit system agreed well with typical spectrum of light water reactor. Measurement of neutron spectrum has brought better knowledge about new reactor core C1 and improved methodology of activation measurement. (author)« less

  2. Knowledge management: Role of the the Radiation Safety Information Computational Center (RSICC)

    NASA Astrophysics Data System (ADS)

    Valentine, Timothy

    2017-09-01

    The Radiation Safety Information Computational Center (RSICC) at Oak Ridge National Laboratory (ORNL) is an information analysis center that collects, archives, evaluates, synthesizes and distributes information, data and codes that are used in various nuclear technology applications. RSICC retains more than 2,000 software packages that have been provided by code developers from various federal and international agencies. RSICC's customers (scientists, engineers, and students from around the world) obtain access to such computing codes (source and/or executable versions) and processed nuclear data files to promote on-going research, to ensure nuclear and radiological safety, and to advance nuclear technology. The role of such information analysis centers is critical for supporting and sustaining nuclear education and training programs both domestically and internationally, as the majority of RSICC's customers are students attending U.S. universities. Additionally, RSICC operates a secure CLOUD computing system to provide access to sensitive export-controlled modeling and simulation (M&S) tools that support both domestic and international activities. This presentation will provide a general review of RSICC's activities, services, and systems that support knowledge management and education and training in the nuclear field.

  3. Toward Microscopic Equations of State for Core-Collapse Supernovae from Chiral Effective Field Theory

    NASA Astrophysics Data System (ADS)

    Aboona, Bassam; Holt, Jeremy

    2017-09-01

    Chiral effective field theory provides a modern framework for understanding the structure and dynamics of nuclear many-body systems. Recent works have had much success in applying the theory to describe the ground- and excited-state properties of light and medium-mass atomic nuclei when combined with ab initio numerical techniques. Our aim is to extend the application of chiral effective field theory to describe the nuclear equation of state required for supercomputer simulations of core-collapse supernovae. Given the large range of densities, temperatures, and proton fractions probed during stellar core collapse, microscopic calculations of the equation of state require large computational resources on the order of one million CPU hours. We investigate the use of graphics processing units (GPUs) to significantly reduce the computational cost of these calculations, which will enable a more accurate and precise description of this important input to numerical astrophysical simulations. Cyclotron Institute at Texas A&M, NSF Grant: PHY 1659847, DOE Grant: DE-FG02-93ER40773.

  4. Boundary-to-Marker Evidence-Controlled Segmentation and MDL-Based Contour Inference for Overlapping Nuclei.

    PubMed

    Song, Jie; Xiao, Liang; Lian, Zhichao

    2017-03-01

    This paper presents a novel method for automated morphology delineation and analysis of cell nuclei in histopathology images. Combining the initial segmentation information and concavity measurement, the proposed method first segments clusters of nuclei into individual pieces, avoiding segmentation errors introduced by the scale-constrained Laplacian-of-Gaussian filtering. After that a nuclear boundary-to-marker evidence computing is introduced to delineate individual objects after the refined segmentation process. The obtained evidence set is then modeled by the periodic B-splines with the minimum description length principle, which achieves a practical compromise between the complexity of the nuclear structure and its coverage of the fluorescence signal to avoid the underfitting and overfitting results. The algorithm is computationally efficient and has been tested on the synthetic database as well as 45 real histopathology images. By comparing the proposed method with several state-of-the-art methods, experimental results show the superior recognition performance of our method and indicate the potential applications of analyzing the intrinsic features of nuclei morphology.

  5. Selectivity in Ligand Binding to Uranyl Compounds: A Synthetic, Structural, Thermodynamic and Computational Study

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Arnold, John

    The uranyl cation (UO 2 2+) is the most abundant form of uranium on the planet. It is estimated that 4.5 billion tons of uranium in this form exist in sea water. The ability to bind and extract the uranyl cation from aqueous solution while separating it from other elements would provide a limitless source of nuclear fuel. A large body of research concerns the selective recognition and extraction of uranyl. A stable molecule, the cation has a linear O=U=O geometry. The short U-O bonds (1.78 Å) arise from the combination of uranium 5f/6d and oxygen 2p orbitals. Due tomore » the oxygen moieties being multiply bonded, these sites were not thought to be basic enough for Lewis acidic coordination to be a viable approach to sequestration. We believe that the goal of developing a practical system for uranium separation from seawater will not be attained without new insights into our existing fundamental knowledge of actinide chemistry. We posit that detailed studies of the kinetic and thermodynamic factors that influence interactions between f-elements and ligands with a range of donor atoms is essential to any major advance in this important area. The goal of this research is thus to broaden the coordination chemistry of the uranyl ion by studying new ligand systems via synthetic, structural, thermodynamic and computational methods. We anticipate that this fundamental science will find use beyond actinide separation technologies in areas such as nuclear waste remediation and nuclear materials.« less

  6. 77 FR 50720 - Test Documentation for Digital Computer Software Used in Safety Systems of Nuclear Power Plants

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-08-22

    ... NUCLEAR REGULATORY COMMISSION [NRC-2012-0195] Test Documentation for Digital Computer Software...) is issuing for public comment draft regulatory guide (DG), DG-1207, ``Test Documentation for Digital... practices for test documentation for software and computer systems as described in the Institute of...

  7. Spectral Regularization Algorithms for Learning Large Incomplete Matrices.

    PubMed

    Mazumder, Rahul; Hastie, Trevor; Tibshirani, Robert

    2010-03-01

    We use convex relaxation techniques to provide a sequence of regularized low-rank solutions for large-scale matrix completion problems. Using the nuclear norm as a regularizer, we provide a simple and very efficient convex algorithm for minimizing the reconstruction error subject to a bound on the nuclear norm. Our algorithm Soft-Impute iteratively replaces the missing elements with those obtained from a soft-thresholded SVD. With warm starts this allows us to efficiently compute an entire regularization path of solutions on a grid of values of the regularization parameter. The computationally intensive part of our algorithm is in computing a low-rank SVD of a dense matrix. Exploiting the problem structure, we show that the task can be performed with a complexity linear in the matrix dimensions. Our semidefinite-programming algorithm is readily scalable to large matrices: for example it can obtain a rank-80 approximation of a 10(6) × 10(6) incomplete matrix with 10(5) observed entries in 2.5 hours, and can fit a rank 40 approximation to the full Netflix training set in 6.6 hours. Our methods show very good performance both in training and test error when compared to other competitive state-of-the art techniques.

  8. Spectral Regularization Algorithms for Learning Large Incomplete Matrices

    PubMed Central

    Mazumder, Rahul; Hastie, Trevor; Tibshirani, Robert

    2010-01-01

    We use convex relaxation techniques to provide a sequence of regularized low-rank solutions for large-scale matrix completion problems. Using the nuclear norm as a regularizer, we provide a simple and very efficient convex algorithm for minimizing the reconstruction error subject to a bound on the nuclear norm. Our algorithm Soft-Impute iteratively replaces the missing elements with those obtained from a soft-thresholded SVD. With warm starts this allows us to efficiently compute an entire regularization path of solutions on a grid of values of the regularization parameter. The computationally intensive part of our algorithm is in computing a low-rank SVD of a dense matrix. Exploiting the problem structure, we show that the task can be performed with a complexity linear in the matrix dimensions. Our semidefinite-programming algorithm is readily scalable to large matrices: for example it can obtain a rank-80 approximation of a 106 × 106 incomplete matrix with 105 observed entries in 2.5 hours, and can fit a rank 40 approximation to the full Netflix training set in 6.6 hours. Our methods show very good performance both in training and test error when compared to other competitive state-of-the art techniques. PMID:21552465

  9. Multicomponent Density Functional Theory: Impact of Nuclear Quantum Effects on Proton Affinities and Geometries.

    PubMed

    Brorsen, Kurt R; Yang, Yang; Hammes-Schiffer, Sharon

    2017-08-03

    Nuclear quantum effects such as zero point energy play a critical role in computational chemistry and often are included as energetic corrections following geometry optimizations. The nuclear-electronic orbital (NEO) multicomponent density functional theory (DFT) method treats select nuclei, typically protons, quantum mechanically on the same level as the electrons. Electron-proton correlation is highly significant, and inadequate treatments lead to highly overlocalized nuclear densities. A recently developed electron-proton correlation functional, epc17, has been shown to provide accurate nuclear densities for molecular systems. Herein, the NEO-DFT/epc17 method is used to compute the proton affinities for a set of molecules and to examine the role of nuclear quantum effects on the equilibrium geometry of FHF - . The agreement of the computed results with experimental and benchmark values demonstrates the promise of this approach for including nuclear quantum effects in calculations of proton affinities, pK a 's, optimized geometries, and reaction paths.

  10. Life sciences and environmental sciences

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Not Available

    1992-02-01

    The DOE laboratories play a unique role in bringing multidisciplinary talents -- in biology, physics, chemistry, computer sciences, and engineering -- to bear on major problems in the life and environmental sciences. Specifically, the laboratories utilize these talents to fulfill OHER's mission of exploring and mitigating the health and environmental effects of energy use, and of developing health and medical applications of nuclear energy-related phenomena. At Lawrence Berkeley Laboratory (LBL) support of this mission is evident across the spectrum of OHER-sponsored research, especially in the broad areas of genomics, structural biology, basic cell and molecular biology, carcinogenesis, energy and environment,more » applications to biotechnology, and molecular, nuclear and radiation medicine. These research areas are briefly described.« less

  11. Numerical Nuclear Second Derivatives on a Computing Grid: Enabling and Accelerating Frequency Calculations on Complex Molecular Systems.

    PubMed

    Yang, Tzuhsiung; Berry, John F

    2018-06-04

    The computation of nuclear second derivatives of energy, or the nuclear Hessian, is an essential routine in quantum chemical investigations of ground and transition states, thermodynamic calculations, and molecular vibrations. Analytic nuclear Hessian computations require the resolution of costly coupled-perturbed self-consistent field (CP-SCF) equations, while numerical differentiation of analytic first derivatives has an unfavorable 6 N ( N = number of atoms) prefactor. Herein, we present a new method in which grid computing is used to accelerate and/or enable the evaluation of the nuclear Hessian via numerical differentiation: NUMFREQ@Grid. Nuclear Hessians were successfully evaluated by NUMFREQ@Grid at the DFT level as well as using RIJCOSX-ZORA-MP2 or RIJCOSX-ZORA-B2PLYP for a set of linear polyacenes with systematically increasing size. For the larger members of this group, NUMFREQ@Grid was found to outperform the wall clock time of analytic Hessian evaluation; at the MP2 or B2LYP levels, these Hessians cannot even be evaluated analytically. We also evaluated a 156-atom catalytically relevant open-shell transition metal complex and found that NUMFREQ@Grid is faster (7.7 times shorter wall clock time) and less demanding (4.4 times less memory requirement) than an analytic Hessian. Capitalizing on the capabilities of parallel grid computing, NUMFREQ@Grid can outperform analytic methods in terms of wall time, memory requirements, and treatable system size. The NUMFREQ@Grid method presented herein demonstrates how grid computing can be used to facilitate embarrassingly parallel computational procedures and is a pioneer for future implementations.

  12. A Pipeline Software Architecture for NMR Spectrum Data Translation

    PubMed Central

    Ellis, Heidi J.C.; Weatherby, Gerard; Nowling, Ronald J.; Vyas, Jay; Fenwick, Matthew; Gryk, Michael R.

    2012-01-01

    The problem of formatting data so that it conforms to the required input for scientific data processing tools pervades scientific computing. The CONNecticut Joint University Research Group (CONNJUR) has developed a data translation tool based on a pipeline architecture that partially solves this problem. The CONNJUR Spectrum Translator supports data format translation for experiments that use Nuclear Magnetic Resonance to determine the structure of large protein molecules. PMID:24634607

  13. Progress Towards a Rad-Hydro Code for Modern Computing Architectures LA-UR-10-02825

    NASA Astrophysics Data System (ADS)

    Wohlbier, J. G.; Lowrie, R. B.; Bergen, B.; Calef, M.

    2010-11-01

    We are entering an era of high performance computing where data movement is the overwhelming bottleneck to scalable performance, as opposed to the speed of floating-point operations per processor. All multi-core hardware paradigms, whether heterogeneous or homogeneous, be it the Cell processor, GPGPU, or multi-core x86, share this common trait. In multi-physics applications such as inertial confinement fusion or astrophysics, one may be solving multi-material hydrodynamics with tabular equation of state data lookups, radiation transport, nuclear reactions, and charged particle transport in a single time cycle. The algorithms are intensely data dependent, e.g., EOS, opacity, nuclear data, and multi-core hardware memory restrictions are forcing code developers to rethink code and algorithm design. For the past two years LANL has been funding a small effort referred to as Multi-Physics on Multi-Core to explore ideas for code design as pertaining to inertial confinement fusion and astrophysics applications. The near term goals of this project are to have a multi-material radiation hydrodynamics capability, with tabular equation of state lookups, on cartesian and curvilinear block structured meshes. In the longer term we plan to add fully implicit multi-group radiation diffusion and material heat conduction, and block structured AMR. We will report on our progress to date.

  14. MOOSE: A PARALLEL COMPUTATIONAL FRAMEWORK FOR COUPLED SYSTEMS OF NONLINEAR EQUATIONS.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    G. Hansen; C. Newman; D. Gaston

    Systems of coupled, nonlinear partial di?erential equations often arise in sim- ulation of nuclear processes. MOOSE: Multiphysics Ob ject Oriented Simulation Environment, a parallel computational framework targeted at solving these systems is presented. As opposed to traditional data / ?ow oriented com- putational frameworks, MOOSE is instead founded on mathematics based on Jacobian-free Newton Krylov (JFNK). Utilizing the mathematical structure present in JFNK, physics are modularized into “Kernels” allowing for rapid production of new simulation tools. In addition, systems are solved fully cou- pled and fully implicit employing physics based preconditioning allowing for a large amount of ?exibility even withmore » large variance in time scales. Background on the mathematics, an inspection of the structure of MOOSE and several rep- resentative solutions from applications built on the framework are presented.« less

  15. X-ray-induced acoustic computed tomography of concrete infrastructure

    NASA Astrophysics Data System (ADS)

    Tang, Shanshan; Ramseyer, Chris; Samant, Pratik; Xiang, Liangzhong

    2018-02-01

    X-ray-induced Acoustic Computed Tomography (XACT) takes advantage of both X-ray absorption contrast and high ultrasonic resolution in a single imaging modality by making use of the thermoacoustic effect. In XACT, X-ray absorption by defects and other structures in concrete create thermally induced pressure jumps that launch ultrasonic waves, which are then received by acoustic detectors to form images. In this research, XACT imaging was used to non-destructively test and identify defects in concrete. For concrete structures, we conclude that XACT imaging allows multiscale imaging at depths ranging from centimeters to meters, with spatial resolutions from sub-millimeter to centimeters. XACT imaging also holds promise for single-side testing of concrete infrastructure and provides an optimal solution for nondestructive inspection of existing bridges, pavement, nuclear power plants, and other concrete infrastructure.

  16. Extreme Scale Computing to Secure the Nation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Brown, D L; McGraw, J R; Johnson, J R

    2009-11-10

    Since the dawn of modern electronic computing in the mid 1940's, U.S. national security programs have been dominant users of every new generation of high-performance computer. Indeed, the first general-purpose electronic computer, ENIAC (the Electronic Numerical Integrator and Computer), was used to calculate the expected explosive yield of early thermonuclear weapons designs. Even the U. S. numerical weather prediction program, another early application for high-performance computing, was initially funded jointly by sponsors that included the U.S. Air Force and Navy, agencies interested in accurate weather predictions to support U.S. military operations. For the decades of the cold war, national securitymore » requirements continued to drive the development of high performance computing (HPC), including advancement of the computing hardware and development of sophisticated simulation codes to support weapons and military aircraft design, numerical weather prediction as well as data-intensive applications such as cryptography and cybersecurity U.S. national security concerns continue to drive the development of high-performance computers and software in the U.S. and in fact, events following the end of the cold war have driven an increase in the growth rate of computer performance at the high-end of the market. This mainly derives from our nation's observance of a moratorium on underground nuclear testing beginning in 1992, followed by our voluntary adherence to the Comprehensive Test Ban Treaty (CTBT) beginning in 1995. The CTBT prohibits further underground nuclear tests, which in the past had been a key component of the nation's science-based program for assuring the reliability, performance and safety of U.S. nuclear weapons. In response to this change, the U.S. Department of Energy (DOE) initiated the Science-Based Stockpile Stewardship (SBSS) program in response to the Fiscal Year 1994 National Defense Authorization Act, which requires, 'in the absence of nuclear testing, a progam to: (1) Support a focused, multifaceted program to increase the understanding of the enduring stockpile; (2) Predict, detect, and evaluate potential problems of the aging of the stockpile; (3) Refurbish and re-manufacture weapons and components, as required; and (4) Maintain the science and engineering institutions needed to support the nation's nuclear deterrent, now and in the future'. This program continues to fulfill its national security mission by adding significant new capabilities for producing scientific results through large-scale computational simulation coupled with careful experimentation, including sub-critical nuclear experiments permitted under the CTBT. To develop the computational science and the computational horsepower needed to support its mission, SBSS initiated the Accelerated Strategic Computing Initiative, later renamed the Advanced Simulation & Computing (ASC) program (sidebar: 'History of ASC Computing Program Computing Capability'). The modern 3D computational simulation capability of the ASC program supports the assessment and certification of the current nuclear stockpile through calibration with past underground test (UGT) data. While an impressive accomplishment, continued evolution of national security mission requirements will demand computing resources at a significantly greater scale than we have today. In particular, continued observance and potential Senate confirmation of the Comprehensive Test Ban Treaty (CTBT) together with the U.S administration's promise for a significant reduction in the size of the stockpile and the inexorable aging and consequent refurbishment of the stockpile all demand increasing refinement of our computational simulation capabilities. Assessment of the present and future stockpile with increased confidence of the safety and reliability without reliance upon calibration with past or future test data is a long-term goal of the ASC program. This will be accomplished through significant increases in the scientific bases that underlie the computational tools. Computer codes must be developed that replace phenomenology with increased levels of scientific understanding together with an accompanying quantification of uncertainty. These advanced codes will place significantly higher demands on the computing infrastructure than do the current 3D ASC codes. This article discusses not only the need for a future computing capability at the exascale for the SBSS program, but also considers high performance computing requirements for broader national security questions. For example, the increasing concern over potential nuclear terrorist threats demands a capability to assess threats and potential disablement technologies as well as a rapid forensic capability for determining a nuclear weapons design from post-detonation evidence (nuclear counterterrorism).« less

  17. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Thayer, K.J.

    The past year has seen several of the Physics Division`s new research projects reach major milestones with first successful experiments and results: the atomic physics station in the Basic Energy Sciences Research Center at the Argonne Advanced Photon Source was used in first high-energy, high-brilliance x-ray studies in atomic and molecular physics; the Short Orbit Spectrometer in Hall C at the Thomas Jefferson National Accelerator (TJNAF) Facility that the Argonne medium energy nuclear physics group was responsible for, was used extensively in the first round of experiments at TJNAF; at ATLAS, several new beams of radioactive isotopes were developed andmore » used in studies of nuclear physics and nuclear astrophysics; the new ECR ion source at ATLAS was completed and first commissioning tests indicate excellent performance characteristics; Quantum Monte Carlo calculations of mass-8 nuclei were performed for the first time with realistic nucleon-nucleon interactions using state-of-the-art computers, including Argonne`s massively parallel IBM SP. At the same time other future projects are well under way: preparations for the move of Gammasphere to ATLAS in September 1997 have progressed as planned. These new efforts are imbedded in, or flowing from, the vibrant ongoing research program described in some detail in this report: nuclear structure and reactions with heavy ions; measurements of reactions of astrophysical interest; studies of nucleon and sub-nucleon structures using leptonic probes at intermediate and high energies; atomic and molecular structure with high-energy x-rays. The experimental efforts are being complemented with efforts in theory, from QCD to nucleon-meson systems to structure and reactions of nuclei. Finally, the operation of ATLAS as a national users facility has achieved a new milestone, with 5,800 hours beam on target for experiments during the past fiscal year.« less

  18. NMR studies of protein-nucleic acid interactions.

    PubMed

    Varani, Gabriele; Chen, Yu; Leeper, Thomas C

    2004-01-01

    Protein-DNA and protein-RNA complexes play key functional roles in every living organism. Therefore, the elucidation of their structure and dynamics is an important goal of structural and molecular biology. Nuclear magnetic resonance (NMR) studies of protein and nucleic acid complexes have common features with studies of protein-protein complexes: the interaction surfaces between the molecules must be carefully delineated, the relative orientation of the two species needs to be accurately and precisely determined, and close intermolecular contacts defined by nuclear Overhauser effects (NOEs) must be obtained. However, differences in NMR properties (e.g., chemical shifts) and biosynthetic pathways for sample productions generate important differences. Chemical shift differences between the protein and nucleic acid resonances can aid the NMR structure determination process; however, the relatively limited dispersion of the RNA ribose resonances makes the process of assigning intermolecular NOEs more difficult. The analysis of the resulting structures requires computational tools unique to nucleic acid interactions. This chapter summarizes the most important elements of the structure determination by NMR of protein-nucleic acid complexes and their analysis. The main emphasis is on recent developments (e.g., residual dipolar couplings and new Web-based analysis tools) that have facilitated NMR studies of these complexes and expanded the type of biological problems to which NMR techniques of structural elucidation can now be applied.

  19. On-line computer system for use with low- energy nuclear physics experiments is reported

    NASA Technical Reports Server (NTRS)

    Gemmell, D. S.

    1969-01-01

    Computer program handles data from low-energy nuclear physics experiments which utilize the ND-160 pulse-height analyzer and the PHYLIS computing system. The program allows experimenters to choose from about 50 different basic data-handling functions and to prescribe the order in which these functions will be performed.

  20. 76 FR 40943 - Notice of Issuance of Regulatory Guide

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-07-12

    ..., Revision 3, ``Criteria for Use of Computers in Safety Systems of Nuclear Power Plants.'' FOR FURTHER..., ``Criteria for Use of Computers in Safety Systems of Nuclear Power Plants,'' was issued with a temporary... Fuel Reprocessing Plants,'' to 10 CFR part 50 with regard to the use of computers in safety systems of...

  1. Quantification of the Spatial Organization of the Nuclear Lamina as a Tool for Cell Classification

    PubMed Central

    Righolt, Christiaan H.; Zatreanu, Diana A.; Raz, Vered

    2013-01-01

    The nuclear lamina is the structural scaffold of the nuclear envelope that plays multiple regulatory roles in chromatin organization and gene expression as well as a structural role in nuclear stability. The lamina proteins, also referred to as lamins, determine nuclear lamina organization and define the nuclear shape and the structural integrity of the cell nucleus. In addition, lamins are connected with both nuclear and cytoplasmic structures forming a dynamic cellular structure whose shape changes upon external and internal signals. When bound to the nuclear lamina, the lamins are mobile, have an impact on the nuclear envelop structure, and may induce changes in their regulatory functions. Changes in the nuclear lamina shape cause changes in cellular functions. A quantitative description of these structural changes could provide an unbiased description of changes in cellular function. In this review, we describe how changes in the nuclear lamina can be measured from three-dimensional images of lamins at the nuclear envelope, and we discuss how structural changes of the nuclear lamina can be used for cell classification. PMID:27335676

  2. Quantification of the Spatial Organization of the Nuclear Lamina as a Tool for Cell Classification.

    PubMed

    Righolt, Christiaan H; Zatreanu, Diana A; Raz, Vered

    2013-01-01

    The nuclear lamina is the structural scaffold of the nuclear envelope that plays multiple regulatory roles in chromatin organization and gene expression as well as a structural role in nuclear stability. The lamina proteins, also referred to as lamins, determine nuclear lamina organization and define the nuclear shape and the structural integrity of the cell nucleus. In addition, lamins are connected with both nuclear and cytoplasmic structures forming a dynamic cellular structure whose shape changes upon external and internal signals. When bound to the nuclear lamina, the lamins are mobile, have an impact on the nuclear envelop structure, and may induce changes in their regulatory functions. Changes in the nuclear lamina shape cause changes in cellular functions. A quantitative description of these structural changes could provide an unbiased description of changes in cellular function. In this review, we describe how changes in the nuclear lamina can be measured from three-dimensional images of lamins at the nuclear envelope, and we discuss how structural changes of the nuclear lamina can be used for cell classification.

  3. Computer program for afterheat temperature distribution for mobile nuclear power plant

    NASA Technical Reports Server (NTRS)

    Parker, W. G.; Vanbibber, L. E.

    1972-01-01

    ESATA computer program was developed to analyze thermal safety aspects of post-impacted mobile nuclear power plants. Program is written in FORTRAN 4 and designed for IBM 7094/7044 direct coupled system.

  4. Peroxide Activation for Electrophilic Reactivity by the Binuclear Non-heme Iron Enzyme AurF

    DOE PAGES

    Park, Kiyoung; Li, Ning; Kwak, Yeonju; ...

    2017-05-01

    Binuclear non-heme iron enzymes activate O 2 for diverse chemistries that include oxygenation of organic substrates and hydrogen atom abstraction. This process often involves the formation of peroxo-bridged biferric intermediates, only some of which can perform electrophilic reactions. To elucidate the geometric and electronic structural requirements to activate peroxo reactivity, the active peroxo intermediate in 4-aminobenzoate N-oxygenase (AurF) has been characterized spectroscopically and computationally. A magnetic circular dichroism study of reduced AurF shows that its electronic and geometric structures are poised to react rapidly with O 2. Nuclear resonance vibrational spectroscopic definition of the peroxo intermediate formed in this reactionmore » shows that the active intermediate has a protonated peroxo bridge. Density functional theory computations on the structure established here show that the protonation activates peroxide for electrophilic/single-electron-transfer reactivity. As a result, this activation of peroxide by protonation is likely also relevant to the reactive peroxo intermediates in other binuclear non-heme iron enzymes.« less

  5. Predicting Real-Valued Protein Residue Fluctuation Using FlexPred.

    PubMed

    Peterson, Lenna; Jamroz, Michal; Kolinski, Andrzej; Kihara, Daisuke

    2017-01-01

    The conventional view of a protein structure as static provides only a limited picture. There is increasing evidence that protein dynamics are often vital to protein function including interaction with partners such as other proteins, nucleic acids, and small molecules. Considering flexibility is also important in applications such as computational protein docking and protein design. While residue flexibility is partially indicated by experimental measures such as the B-factor from X-ray crystallography and ensemble fluctuation from nuclear magnetic resonance (NMR) spectroscopy as well as computational molecular dynamics (MD) simulation, these techniques are resource-intensive. In this chapter, we describe the web server and stand-alone version of FlexPred, which rapidly predicts absolute per-residue fluctuation from a three-dimensional protein structure. On a set of 592 nonredundant structures, comparing the fluctuations predicted by FlexPred to the observed fluctuations in MD simulations showed an average correlation coefficient of 0.669 and an average root mean square error of 1.07 Å. FlexPred is available at http://kiharalab.org/flexPred/ .

  6. Peroxide Activation for Electrophilic Reactivity by the Binuclear Non-heme Iron Enzyme AurF

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Park, Kiyoung; Li, Ning; Kwak, Yeonju

    Binuclear non-heme iron enzymes activate O 2 for diverse chemistries that include oxygenation of organic substrates and hydrogen atom abstraction. This process often involves the formation of peroxo-bridged biferric intermediates, only some of which can perform electrophilic reactions. To elucidate the geometric and electronic structural requirements to activate peroxo reactivity, the active peroxo intermediate in 4-aminobenzoate N-oxygenase (AurF) has been characterized spectroscopically and computationally. A magnetic circular dichroism study of reduced AurF shows that its electronic and geometric structures are poised to react rapidly with O 2. Nuclear resonance vibrational spectroscopic definition of the peroxo intermediate formed in this reactionmore » shows that the active intermediate has a protonated peroxo bridge. Density functional theory computations on the structure established here show that the protonation activates peroxide for electrophilic/single-electron-transfer reactivity. As a result, this activation of peroxide by protonation is likely also relevant to the reactive peroxo intermediates in other binuclear non-heme iron enzymes.« less

  7. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schaeffel, J.A.; Mullinix, B.R.; Ranson, W.F.

    An experimental technique to simulate and evaluate the effects of high concentrations of x-rays resulting from a nuclear detonation on missile structures is presented. Data from 34 tests are included to demonstrate the technique. The effects of variations in the foil thickness, capacitor voltage, and plate thickness on the total impulse and maximum strain in the structure were determined. The experimental technique utilizes a high energy capacitor discharge unit to explode an aluminum foil on the surface of the structure. The structural response is evaluated by optical methods using the grid slope deflection method. The fringe patterns were recorded usingmore » a high-speed framing camera. The data were digitized using an optical comparator with an x-y table. The analysis was performed on a CDC 6600 computer.« less

  8. National Nuclear Data Center

    Science.gov Websites

    reaction data Sigma Retrieval & Plotting Nuclear structure & decay Data Nuclear Science References Experimental Unevaluated Nuclear Data List Evaluated Nuclear Structure Data File NNDC databases Ground and isomeric states properties Nuclear structure & decay data journal Nuclear reaction model code Tools and

  9. Lattice QCD Calculations in Nuclear Physics towards the Exascale

    NASA Astrophysics Data System (ADS)

    Joo, Balint

    2017-01-01

    The combination of algorithmic advances and new highly parallel computing architectures are enabling lattice QCD calculations to tackle ever more complex problems in nuclear physics. In this talk I will review some computational challenges that are encountered in large scale cold nuclear physics campaigns such as those in hadron spectroscopy calculations. I will discuss progress in addressing these with algorithmic improvements such as multi-grid solvers and software for recent hardware architectures such as GPUs and Intel Xeon Phi, Knights Landing. Finally, I will highlight some current topics for research and development as we head towards the Exascale era This material is funded by the U.S. Department of Energy, Office Of Science, Offices of Nuclear Physics, High Energy Physics and Advanced Scientific Computing Research, as well as the Office of Nuclear Physics under contract DE-AC05-06OR23177.

  10. NMRDSP: an accurate prediction of protein shape strings from NMR chemical shifts and sequence data.

    PubMed

    Mao, Wusong; Cong, Peisheng; Wang, Zhiheng; Lu, Longjian; Zhu, Zhongliang; Li, Tonghua

    2013-01-01

    Shape string is structural sequence and is an extremely important structure representation of protein backbone conformations. Nuclear magnetic resonance chemical shifts give a strong correlation with the local protein structure, and are exploited to predict protein structures in conjunction with computational approaches. Here we demonstrate a novel approach, NMRDSP, which can accurately predict the protein shape string based on nuclear magnetic resonance chemical shifts and structural profiles obtained from sequence data. The NMRDSP uses six chemical shifts (HA, H, N, CA, CB and C) and eight elements of structure profiles as features, a non-redundant set (1,003 entries) as the training set, and a conditional random field as a classification algorithm. For an independent testing set (203 entries), we achieved an accuracy of 75.8% for S8 (the eight states accuracy) and 87.8% for S3 (the three states accuracy). This is higher than only using chemical shifts or sequence data, and confirms that the chemical shift and the structure profile are significant features for shape string prediction and their combination prominently improves the accuracy of the predictor. We have constructed the NMRDSP web server and believe it could be employed to provide a solid platform to predict other protein structures and functions. The NMRDSP web server is freely available at http://cal.tongji.edu.cn/NMRDSP/index.jsp.

  11. Work-a-day world of NPRDS: what makes it tick

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Not Available

    The Nuclear Plant Reliability Data System (NPRDS) is a computer-based data bank of reliability information on safety-related nuclear-power-plant systems and components. Until January 1982, the system was administered by the American Nuclear Society 58.20 Subcommittee. The data base was maintained by Southwest Research Institute in San Antonio, Texas. In October 1982, it was decided that the Institute of Nuclear Power Operations (INPO) would maintain the data base on its own computer. The transition is currently in progress.

  12. Modular structural elements in the replication origin region of Tetrahymena rDNA.

    PubMed Central

    Du, C; Sanzgiri, R P; Shaiu, W L; Choi, J K; Hou, Z; Benbow, R M; Dobbs, D L

    1995-01-01

    Computer analyses of the DNA replication origin region in the amplified rRNA genes of Tetrahymena thermophila identified a potential initiation zone in the 5'NTS [Dobbs, Shaiu and Benbow (1994), Nucleic Acids Res. 22, 2479-2489]. This region consists of a putative DNA unwinding element (DUE) aligned with predicted bent DNA segments, nuclear matrix or scaffold associated region (MAR/SAR) consensus sequences, and other common modular sequence elements previously shown to be clustered in eukaryotic chromosomal origin regions. In this study, two mung bean nuclease-hypersensitive sites in super-coiled plasmid DNA were localized within the major DUE-like element predicted by thermodynamic analyses. Three restriction fragments of the 5'NTS region predicted to contain bent DNA segments exhibited anomalous migration characteristic of bent DNA during electrophoresis on polyacrylamide gels. Restriction fragments containing the 5'NTS region bound Tetrahymena nuclear matrices in an in vitro binding assay, consistent with an association of the replication origin region with the nuclear matrix in vivo. The direct demonstration in a protozoan origin region of elements previously identified in Drosophila, chick and mammalian origin regions suggests that clusters of modular structural elements may be a conserved feature of eukaryotic chromosomal origins of replication. Images PMID:7784181

  13. Design of structurally distinct proteins using strategies inspired by evolution

    DOE PAGES

    Jacobs, T. M.; Williams, B.; Williams, T.; ...

    2016-05-06

    Natural recombination combines pieces of preexisting proteins to create new tertiary structures and functions. In this paper, we describe a computational protocol, called SEWING, which is inspired by this process and builds new proteins from connected or disconnected pieces of existing structures. Helical proteins designed with SEWING contain structural features absent from other de novo designed proteins and, in some cases, remain folded at more than 100°C. High-resolution structures of the designed proteins CA01 and DA05R1 were solved by x-ray crystallography (2.2 angstrom resolution) and nuclear magnetic resonance, respectively, and there was excellent agreement with the design models. Finally, thismore » method provides a new strategy to rapidly create large numbers of diverse and designable protein scaffolds.« less

  14. Nuclear quantum fluctuations in ice I(h).

    PubMed

    Moreira, Pedro Augusto Franco Pinheiro; de Koning, Maurice

    2015-10-14

    We discuss the role of nuclear quantum fluctuations in ice Ih, focusing on the hydrogen-bond (HB) structure and the molecular dipole-moment distribution. For this purpose we carry out DFT-based first-principles molecular dynamics and path-integral molecular dynamics simulations at T = 100 K. We analyze the HB structure in terms of a set of parameters previously employed to characterize molecular structures in the liquid phase and compute the molecular dipole moments using the maximally-localized Wannier functions. The results show that the protons experience very large digressions driven by quantum fluctuations, accompanied by major rearrangements in the electronic density. As a result of these protonic quantum fluctuations the molecular dipole-moment distribution is substantially broadened as well as shifted to a larger mean value when compared to the results obtained when such fluctuations are neglected. In terms of dielectric constants, the reconciliation between the greater mean dipole moment and experimental indications that the dielectric constant of H2O ice is lower than that of D2O ice would indicate that the topology of the HB network is sensitive to protonic quantum fluctuations.

  15. A computational NMR study on zigzag aluminum nitride nanotubes

    NASA Astrophysics Data System (ADS)

    Bodaghi, Ali; Mirzaei, Mahmoud; Seif, Ahmad; Giahi, Masoud

    2008-12-01

    A computational nuclear magnetic resonance (NMR) study is performed to investigate the electronic structure properties of the single-walled zigzag aluminum nitride nanotubes (AlNNTs). The chemical-shielding (CS) tensors are calculated at the sites of Al-27 and N-15 nuclei in three structural forms of AlNNT including H-saturated, Al-terminated, and N-terminated ones. The structural forms are firstly optimized and then the calculated CS tensors in the optimized structures are converted to chemical-shielding isotropic (CSI) and chemical-shielding anisotropic (CSA) parameters. The calculated parameters reveal that various Al-27 and N-15 nuclei are divided into some layers with equivalent electrostatic properties; furthermore, Al and N can act as Lewis base and acid, respectively. In the Al-terminated and N-terminated forms of AlNNT, in which one mouth of the nanotube is terminated by aluminum and nitrogen nuclei, respectively, just the CS tensors of the nearest nuclei to the mouth of the nanotube are significantly changed due to removal of saturating hydrogen atoms. Density functional theory (DFT) calculations are performed using GAUSSIAN 98 package of program.

  16. Extending Strong Scaling of Quantum Monte Carlo to the Exascale

    NASA Astrophysics Data System (ADS)

    Shulenburger, Luke; Baczewski, Andrew; Luo, Ye; Romero, Nichols; Kent, Paul

    Quantum Monte Carlo is one of the most accurate and most computationally expensive methods for solving the electronic structure problem. In spite of its significant computational expense, its massively parallel nature is ideally suited to petascale computers which have enabled a wide range of applications to relatively large molecular and extended systems. Exascale capabilities have the potential to enable the application of QMC to significantly larger systems, capturing much of the complexity of real materials such as defects and impurities. However, both memory and computational demands will require significant changes to current algorithms to realize this possibility. This talk will detail both the causes of the problem and potential solutions. Sandia National Laboratories is a multi-mission laboratory managed and operated by Sandia Corp, a wholly owned subsidiary of Lockheed Martin Corp, for the US Department of Energys National Nuclear Security Administration under contract DE-AC04-94AL85000.

  17. Situation awareness and trust in computer-based procedures in nuclear power plant operations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Throneburg, E. B.; Jones, J. M.

    2006-07-01

    Situation awareness and trust are two issues that need to be addressed in the design of computer-based procedures for nuclear power plants. Situation awareness, in relation to computer-based procedures, concerns the operators' knowledge of the plant's state while following the procedures. Trust concerns the amount of faith that the operators put into the automated procedures, which can affect situation awareness. This paper first discusses the advantages and disadvantages of computer-based procedures. It then discusses the known aspects of situation awareness and trust as applied to computer-based procedures in nuclear power plants. An outline of a proposed experiment is then presentedmore » that includes methods of measuring situation awareness and trust so that these aspects can be analyzed for further study. (authors)« less

  18. SIRT-FILTER v1.0.0

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    PELT, DANIEL

    2017-04-21

    Small Python package to compute tomographic reconstructions using a reconstruction method published in: Pelt, D.M., & De Andrade, V. (2017). Improved tomographic reconstruction of large-scale real-world data by filter optimization. Advanced Structural and Chemical Imaging 2: 17; and Pelt, D. M., & Batenburg, K. J. (2015). Accurately approximating algebraic tomographic reconstruction by filtered backprojection. In Proceedings of The 13th International Meeting on Fully Three-Dimensional Image Reconstruction in Radiology and Nuclear Medicine (pp. 158-161).

  19. Sensitivity of ab Initio vs Empirical Methods in Computing Structural Effects on NMR Chemical Shifts for the Example of Peptides.

    PubMed

    Sumowski, Chris Vanessa; Hanni, Matti; Schweizer, Sabine; Ochsenfeld, Christian

    2014-01-14

    The structural sensitivity of NMR chemical shifts as computed by quantum chemical methods is compared to a variety of empirical approaches for the example of a prototypical peptide, the 38-residue kaliotoxin KTX comprising 573 atoms. Despite the simplicity of empirical chemical shift prediction programs, the agreement with experimental results is rather good, underlining their usefulness. However, we show in our present work that they are highly insensitive to structural changes, which renders their use for validating predicted structures questionable. In contrast, quantum chemical methods show the expected high sensitivity to structural and electronic changes. This appears to be independent of the quantum chemical approach or the inclusion of solvent effects. For the latter, explicit solvent simulations with increasing number of snapshots were performed for two conformers of an eight amino acid sequence. In conclusion, the empirical approaches neither provide the expected magnitude nor the patterns of NMR chemical shifts determined by the clearly more costly ab initio methods upon structural changes. This restricts the use of empirical prediction programs in studies where peptide and protein structures are utilized for the NMR chemical shift evaluation such as in NMR refinement processes, structural model verifications, or calculations of NMR nuclear spin relaxation rates.

  20. Perturbation approach for nuclear magnetic resonance solid-state quantum computation

    DOE PAGES

    Berman, G. P.; Kamenev, D. I.; Tsifrinovich, V. I.

    2003-01-01

    A dynmore » amics of a nuclear-spin quantum computer with a large number ( L = 1000 ) of qubits is considered using a perturbation approach. Small parameters are introduced and used to compute the error in an implementation of an entanglement between remote qubits, using a sequence of radio-frequency pulses. The error is computed up to the different orders of the perturbation theory and tested using exact numerical solution.« less

  1. Packing microstructure and local density variations of experimental and computational pebble beds

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Auwerda, G. J.; Kloosterman, J. L.; Lathouwers, D.

    2012-07-01

    In pebble bed type nuclear reactors the fuel is contained in graphite pebbles, which form a randomly stacked bed with a non-uniform packing density. These variations can influence local coolant flow and power density and are a possible cause of hotspots. To analyse local density variations computational methods are needed that can generate randomly stacked pebble beds with a realistic packing structure on a pebble-to-pebble level. We first compare various properties of the local packing structure of a computed bed with those of an image made using computer aided X-ray tomography, looking at properties in the bulk of the bedmore » and near the wall separately. Especially for the bulk of the bed, properties of the computed bed show good comparison with the scanned bed and with literature, giving confidence our method generates beds with realistic packing microstructure. Results also show the packing structure is different near the wall than in the bulk of the bed, with pebbles near the wall forming ordered layers similar to hexagonal close packing. Next, variations in the local packing density are investigated by comparing probability density functions of the packing fraction of small clusters of pebbles throughout the bed. Especially near the wall large variations in local packing fractions exists, with a higher probability for both clusters of pebbles with low (<0.6) and high (>0.65) packing fraction, which could significantly affect flow rates and, together with higher power densities, could result in hotspots. (authors)« less

  2. Evaluation of the Retrieval of Nuclear Science Document References Using the Universal Decimal Classification as the Indexing Language for a Computer-Based System

    ERIC Educational Resources Information Center

    Atherton, Pauline; And Others

    A single issue of Nuclear Science Abstracts, containing about 2,300 abstracts, was indexed by Universal Decimal Classification (UDC) using the Special Subject Edition of UDC for Nuclear Science and Technology. The descriptive cataloging and UDC-indexing records formed a computer-stored data base. A systematic random sample of 500 additional…

  3. High-Performance Computational Analysis of Glioblastoma Pathology Images with Database Support Identifies Molecular and Survival Correlates.

    PubMed

    Kong, Jun; Wang, Fusheng; Teodoro, George; Cooper, Lee; Moreno, Carlos S; Kurc, Tahsin; Pan, Tony; Saltz, Joel; Brat, Daniel

    2013-12-01

    In this paper, we present a novel framework for microscopic image analysis of nuclei, data management, and high performance computation to support translational research involving nuclear morphometry features, molecular data, and clinical outcomes. Our image analysis pipeline consists of nuclei segmentation and feature computation facilitated by high performance computing with coordinated execution in multi-core CPUs and Graphical Processor Units (GPUs). All data derived from image analysis are managed in a spatial relational database supporting highly efficient scientific queries. We applied our image analysis workflow to 159 glioblastomas (GBM) from The Cancer Genome Atlas dataset. With integrative studies, we found statistics of four specific nuclear features were significantly associated with patient survival. Additionally, we correlated nuclear features with molecular data and found interesting results that support pathologic domain knowledge. We found that Proneural subtype GBMs had the smallest mean of nuclear Eccentricity and the largest mean of nuclear Extent, and MinorAxisLength. We also found gene expressions of stem cell marker MYC and cell proliferation maker MKI67 were correlated with nuclear features. To complement and inform pathologists of relevant diagnostic features, we queried the most representative nuclear instances from each patient population based on genetic and transcriptional classes. Our results demonstrate that specific nuclear features carry prognostic significance and associations with transcriptional and genetic classes, highlighting the potential of high throughput pathology image analysis as a complementary approach to human-based review and translational research.

  4. The development of regulatory expectations for computer-based safety systems for the UK nuclear programme

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hughes, P. J.; Westwood, R.N; Mark, R. T.

    2006-07-01

    The Nuclear Installations Inspectorate (NII) of the UK's Health and Safety Executive (HSE) has completed a review of their Safety Assessment Principles (SAPs) for Nuclear Installations recently. During the period of the SAPs review in 2004-2005 the designers of future UK naval reactor plant were optioneering the control and protection systems that might be implemented. Because there was insufficient regulatory guidance available in the naval sector to support this activity the Defence Nuclear Safety Regulator (DNSR) invited the NII to collaborate with the production of a guidance document that provides clarity of regulatory expectations for the production of safety casesmore » for computer based safety systems. A key part of producing regulatory expectations was identifying the relevant extant standards and sector guidance that reflect good practice. The three principal sources of such good practice were: IAEA Safety Guide NS-G-1.1 (Software for Computer Based Systems Important to Safety in Nuclear Power Plants), European Commission consensus document (Common Position of European Nuclear Regulators for the Licensing of Safety Critical Software for Nuclear Reactors) and IEC nuclear sector standards such as IEC60880. A common understanding has been achieved between the NII and DNSR and regulatory guidance developed which will be used by both NII and DNSR in the assessment of computer-based safety systems and in the further development of more detailed joint technical assessment guidance for both regulatory organisations. (authors)« less

  5. Running SW4 On New Commodity Technology Systems (CTS-1) Platform

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rodgers, Arthur J.; Petersson, N. Anders; Pitarka, Arben

    We have recently been running earthquake ground motion simulations with SW4 on the new capacity computing systems, called the Commodity Technology Systems - 1 (CTS-1) at Lawrence Livermore National Laboratory (LLNL). SW4 is a fourth order time domain finite difference code developed by LLNL and distributed by the Computational Infrastructure for Geodynamics (CIG). SW4 simulates seismic wave propagation in complex three-dimensional Earth models including anelasticity and surface topography. We are modeling near-fault earthquake strong ground motions for the purposes of evaluating the response of engineered structures, such as nuclear power plants and other critical infrastructure. Engineering analysis of structures requiresmore » the inclusion of high frequencies which can cause damage, but are often difficult to include in simulations because of the need for large memory to model fine grid spacing on large domains.« less

  6. Natural chemical shielding analysis of nuclear magnetic resonance shielding tensors from gauge-including atomic orbital calculations

    NASA Astrophysics Data System (ADS)

    Bohmann, Jonathan A.; Weinhold, Frank; Farrar, Thomas C.

    1997-07-01

    Nuclear magnetic shielding tensors computed by the gauge including atomic orbital (GIAO) method in the Hartree-Fock self-consistent-field (HF-SCF) framework are partitioned into magnetic contributions from chemical bonds and lone pairs by means of natural chemical shielding (NCS) analysis, an extension of natural bond orbital (NBO) analysis. NCS analysis complements the description provided by alternative localized orbital methods by directly calculating chemical shieldings due to delocalized features in the electronic structure, such as bond conjugation and hyperconjugation. Examples of NCS tensor decomposition are reported for CH4, CO, and H2CO, for which a graphical mnemonic due to Cornwell is used to illustrate the effect of hyperconjugative delocalization on the carbon shielding.

  7. Digital computer operation of a nuclear reactor

    DOEpatents

    Colley, R.W.

    1982-06-29

    A method is described for the safe operation of a complex system such as a nuclear reactor using a digital computer. The computer is supplied with a data base containing a list of the safe state of the reactor and a list of operating instructions for achieving a safe state when the actual state of the reactor does not correspond to a listed safe state, the computer selects operating instructions to return the reactor to a safe state.

  8. The Next Frontier in Computing

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sarrao, John

    2016-11-16

    Exascale computing refers to computing systems capable of at least one exaflop or a billion calculations per second (1018). That is 50 times faster than the most powerful supercomputers being used today and represents a thousand-fold increase over the first petascale computer that came into operation in 2008. How we use these large-scale simulation resources is the key to solving some of today’s most pressing problems, including clean energy production, nuclear reactor lifetime extension and nuclear stockpile aging.

  9. Digital computer operation of a nuclear reactor

    DOEpatents

    Colley, Robert W.

    1984-01-01

    A method is described for the safe operation of a complex system such as a nuclear reactor using a digital computer. The computer is supplied with a data base containing a list of the safe state of the reactor and a list of operating instructions for achieving a safe state when the actual state of the reactor does not correspond to a listed safe state, the computer selects operating instructions to return the reactor to a safe state.

  10. Amorphous chalcogenides as random octahedrally bonded solids: I. Implications for the first sharp diffraction peak, photodarkening, and Boson peak

    NASA Astrophysics Data System (ADS)

    Lukyanov, Alexey; Lubchenko, Vassiliy

    2017-09-01

    We develop a computationally efficient algorithm for generating high-quality structures for amorphous materials exhibiting distorted octahedral coordination. The computationally costly step of equilibrating the simulated melt is relegated to a much more efficient procedure, viz., generation of a random close-packed structure, which is subsequently used to generate parent structures for octahedrally bonded amorphous solids. The sites of the so-obtained lattice are populated by atoms and vacancies according to the desired stoichiometry while allowing one to control the number of homo-nuclear and hetero-nuclear bonds and, hence, effects of the mixing entropy. The resulting parent structure is geometrically optimized using quantum-chemical force fields; by varying the extent of geometric optimization of the parent structure, one can partially control the degree of octahedrality in local coordination and the strength of secondary bonding. The present methodology is applied to the archetypal chalcogenide alloys AsxSe1-x. We find that local coordination in these alloys interpolates between octahedral and tetrahedral bonding but in a non-obvious way; it exhibits bonding motifs that are not characteristic of either extreme. We consistently recover the first sharp diffraction peak (FSDP) in our structures and argue that the corresponding mid-range order stems from the charge density wave formed by regions housing covalent and weak, secondary interactions. The number of secondary interactions is determined by a delicate interplay between octahedrality and tetrahedrality in the covalent bonding; many of these interactions are homonuclear. The present results are consistent with the experimentally observed dependence of the FSDP on arsenic content, pressure, and temperature and its correlation with photodarkening and the Boson peak. They also suggest that the position of the FSDP can be used to infer the effective particle size relevant for the configurational equilibration in covalently bonded glassy liquids, where the identification of the effective rigid molecular unit is ambiguous.

  11. Coupled-channel calculation for cross section of fusion and barrier distribution of {}^{16,17,18}O + {}^{16}O reactions

    NASA Astrophysics Data System (ADS)

    Fereidonnejad, R.; Sadeghi, H.; Ghambari, M.

    2018-03-01

    In this work, the effect of multi-phonon excitation on heavy-ion fusion reactions has been studied and fusion barrier distributions of energy intervals near and below the Coulomb barrier have been studied for 16,17,18O + 16O reactions. The structure and deformation of nuclear projectiles have been studied. Given the adaptation of computations to experimental data, our calculations predict the behavior of reactions in intervals of energy in which experimental measurements are not available. In addition the S-factor for these reactions has been calculated. The results showed that the structure and deformation of a nuclear projectile are important factors. The S-factor, obtained in the coupled-channel calculations for the {}^{16}O + {}^{16}O, {}^{17}O +{}^{16}O and {}^{18}O +{}^{16}O reactions, showed good agreement with the experimental data and had a maximum value at an energy near 5, 4.5 and 4 MeV, respectively.

  12. Path-integral simulation of solids.

    PubMed

    Herrero, C P; Ramírez, R

    2014-06-11

    The path-integral formulation of the statistical mechanics of quantum many-body systems is described, with the purpose of introducing practical techniques for the simulation of solids. Monte Carlo and molecular dynamics methods for distinguishable quantum particles are presented, with particular attention to the isothermal-isobaric ensemble. Applications of these computational techniques to different types of solids are reviewed, including noble-gas solids (helium and heavier elements), group-IV materials (diamond and elemental semiconductors), and molecular solids (with emphasis on hydrogen and ice). Structural, vibrational, and thermodynamic properties of these materials are discussed. Applications also include point defects in solids (structure and diffusion), as well as nuclear quantum effects in solid surfaces and adsorbates. Different phenomena are discussed, as solid-to-solid and orientational phase transitions, rates of quantum processes, classical-to-quantum crossover, and various finite-temperature anharmonic effects (thermal expansion, isotopic effects, electron-phonon interactions). Nuclear quantum effects are most remarkable in the presence of light atoms, so that especial emphasis is laid on solids containing hydrogen as a constituent element or as an impurity.

  13. Anharmonic and Quantum Fluctuations in Molecular Crystals from Ab Initio Simulations

    NASA Astrophysics Data System (ADS)

    Rossi, Mariana; Gasparotto, Piero; Ceriotti, Michele

    Molecular crystals often exist in multiple competing polymorphs which are challenging to be predicted computationally, but show significantly different physicochemical properties. This challenge is not due only to the combinatorial search space, but also to the complex interplay of subtle effects determine the relative stability of different structures. Here we estimate all contributions to the free energies of these systems with density-functional theory, including the oft-neglected anharmonic contributions and nuclear quantum effects, by using a series of different flavors of thermodynamic integration. As an example, for the two most stable forms of paracetamol we find that anharmonic contributions, different descriptions of van der Waals interactions, and nuclear quantum effects all matter to quantitatively determine the stability of different phases. Our studies indicate that anharmonic free energies could play an important role for molecular crystals composed by large molecules and opens the way for a systematic inclusion of these effects in order to obtain a predictive screening of structures.

  14. Computational carbohydrate chemistry: what theoretical methods can tell us

    PubMed Central

    Woods, Robert J.

    2014-01-01

    Computational methods have had a long history of application to carbohydrate systems and their development in this regard is discussed. The conformational analysis of carbohydrates differs in several ways from that of other biomolecules. Many glycans appear to exhibit numerous conformations coexisting in solution at room temperature and a conformational analysis of a carbohydrate must address both spatial and temporal properties. When solution nuclear magnetic resonance data are used for comparison, the simulation must give rise to ensemble-averaged properties. In contrast, when comparing to experimental data obtained from crystal structures a simulation of a crystal lattice, rather than of an isolated molecule, is appropriate. Molecular dynamics simulations are well suited for such condensed phase modeling. Interactions between carbohydrates and other biological macromolecules are also amenable to computational approaches. Having obtained a three-dimensional structure of the receptor protein, it is possible to model with accuracy the conformation of the carbohydrate in the complex. An example of the application of free energy perturbation simulations to the prediction of carbohydrate-protein binding energies is presented. PMID:9579797

  15. Stable Isotopes, Quantum Computing and Consciousness

    NASA Astrophysics Data System (ADS)

    Berezin, Alexander A.

    2000-10-01

    Recent proposals of quantum computing/computers (QC) based on nuclear spins suggest that consciousness (CON) activity may be related (assisted) to subset of C13 atoms incorporated randomly, or quasirandomly, in neural structures. Consider two DNA chains. Even if they are completely identical chemically (same sequence of codons), patterns of 12C and 13C isotopes in them are different (possible origin of personal individuality). Perhaps it is subsystem of nuclear spins of 13C "sublattice" which forms dynamical system capable of QC and on which CON is "spanned". Some issues related to this hypothesis are: (1) existence of CON-driven positional correlations among C13 atoms, (2) motion (hopping) of C13 via enhanced neutron tunneling, cf. quantum "anti Zeno-effect", (3) possible optimization of concentration of QC-active C13 atoms above their standard isotopic abundance, (4) characteristic time-scales for operation of C13-based QC (perrhaps, broad range of scales), (5) reflection of QC dynamics of C13 on CON, (6) possibility that C13-based QC operates "above" level of "regular" CON (perhaps, Jungian sub/super-CON), (7) isotopicity as connector to universal Library of Patterns ("Platonic World"), (8) self-stabilization of coherence in C13 (sub)system. Some of this questions are, in principle, experimentally addressable through shifting of isotopic abundances.

  16. Advanced Simulation & Computing FY15 Implementation Plan Volume 2, Rev. 0.5

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McCoy, Michel; Archer, Bill; Matzen, M. Keith

    2014-09-16

    The Stockpile Stewardship Program (SSP) is a single, highly integrated technical program for maintaining the surety and reliability of the U.S. nuclear stockpile. The SSP uses nuclear test data, computational modeling and simulation, and experimental facilities to advance understanding of nuclear weapons. It includes stockpile surveillance, experimental research, development and engineering programs, and an appropriately scaled production capability to support stockpile requirements. This integrated national program requires the continued use of experimental facilities and programs, and the computational enhancements to support these programs. The Advanced Simulation and Computing Program (ASC) is a cornerstone of the SSP, providing simulation capabilities andmore » computational resources that support annual stockpile assessment and certification, study advanced nuclear weapons design and manufacturing processes, analyze accident scenarios and weapons aging, and provide the tools to enable stockpile Life Extension Programs (LEPs) and the resolution of Significant Finding Investigations (SFIs). This requires a balance of resource, including technical staff, hardware, simulation software, and computer science solutions. As the program approaches the end of its second decade, ASC is intently focused on increasing predictive capabilities in a three-dimensional (3D) simulation environment while maintaining support to the SSP. The program continues to improve its unique tools for solving progressively more difficult stockpile problems (sufficient resolution, dimensionality, and scientific details), quantify critical margins and uncertainties, and resolve increasingly difficult analyses needed for the SSP. Where possible, the program also enables the use of high-performance simulation and computing tools to address broader national security needs, such as foreign nuclear weapon assessments and counternuclear terrorism.« less

  17. Thermomechanical analysis of fast-burst reactors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Miller, J.D.

    1994-08-01

    Fast-burst reactors are designed to provide intense, short-duration pulses of neutrons. The fission reaction also produces extreme time-dependent heating of the nuclear fuel. An existing transient-dynamic finite element code was modified specifically to compute the time-dependent stresses and displacements due to thermal shock loads of reactors. Thermomechanical analysis was then applied to determine structural feasibility of various concepts for an EDNA-type reactor and to optimize the mechanical design of the new SPR III-M reactor.

  18. Chemistry Division: Annual progress report for period ending March 31, 1987

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Not Available

    1987-08-01

    This report is divided into the following sections: coal chemistry; aqueous chemistry at high temperatures and pressures; geochemistry of crustal processes to high temperatures and pressures; chemistry of advanced inorganic materials; structure and dynamics of advanced polymeric materials; chemistry of transuranium elements and compounds; separations chemistry; reactions and catalysis in molten salts; surface science related to heterogeneous catalysis; electron spectroscopy; chemistry related to nuclear waste disposal; computational modeling of security document printing; and special topics. (DLC)

  19. Laboratory directed research and development program FY 1997

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    NONE

    1998-03-01

    This report compiles the annual reports of Laboratory Directed Research and Development projects supported by the Berkeley Lab. Projects are arranged under the following topical sections: (1) Accelerator and fusion research division; (2) Chemical sciences division; (3) Computing Sciences; (4) Earth sciences division; (5) Environmental energy technologies division; (6) life sciences division; (7) Materials sciences division; (8) Nuclear science division; (9) Physics division; (10) Structural biology division; and (11) Cross-divisional. A total of 66 projects are summarized.

  20. Fire and the Related Effects of Nuclear Explosions. 1982 Asilomar Conference,

    DTIC Science & Technology

    1982-11-01

    SRT International 333 Ravenswood Ave. Menlo Park, CA 94025 F2A Work Unit 2563F II. CONTROLLING OFFICE NAME AND AOoReSS US. REPORT OATS Federal...and Scope: 1. Define the events and modules to be used in the Urban Fire Demonstration Model along with appropriate data elements, control and data...1) a specific control structure to sequence and organize the various computational V- 9 elements of an interactive simulation, and (2) emphasis

  1. New Features in the Computational Infrastructure for Nuclear Astrophysics

    NASA Astrophysics Data System (ADS)

    Smith, M. S.; Lingerfelt, E. J.; Scott, J. P.; Hix, W. R.; Nesaraja, C. D.; Koura, H.; Roberts, L. F.

    2006-04-01

    The Computational Infrastructure for Nuclear Astrophysics is a suite of computer codes online at nucastrodata.org that streamlines the incorporation of recent nuclear physics results into astrophysical simulations. The freely-available, cross- platform suite enables users to upload cross sections and s-factors, convert them into reaction rates, parameterize the rates, store the rates in customizable libraries, setup and run custom post-processing element synthesis calculations, and visualize the results. New features include the ability for users to comment on rates or libraries using an email-type interface, a nuclear mass model evaluator, enhanced techniques for rate parameterization, better treatment of rate inverses, and creation and exporting of custom animations of simulation results. We also have online animations of r- process, rp-process, and neutrino-p process element synthesis occurring in stellar explosions.

  2. Shock-driven fluid-structure interaction for civil design

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wood, Stephen L; Deiterding, Ralf

    The multiphysics fluid-structure interaction simulation of shock-loaded structures requires the dynamic coupling of a shock-capturing flow solver to a solid mechanics solver for large deformations. The Virtual Test Facility combines a Cartesian embedded boundary approach with dynamic mesh adaptation in a generic software framework of flow solvers using hydrodynamic finite volume upwind schemes that are coupled to various explicit finite element solid dynamics solvers (Deiterding et al., 2006). This paper gives a brief overview of the computational approach and presents first simulations that utilize the general purpose solid dynamics code DYNA3D for complex 3D structures of interest in civil engineering.more » Results from simulations of a reinforced column, highway bridge, multistory building, and nuclear reactor building are presented.« less

  3. Conference on Real-Time Computer Applications in Nuclear, Particle and Plasma Physics, 6th, Williamsburg, VA, May 15-19, 1989, Proceedings

    NASA Technical Reports Server (NTRS)

    Pordes, Ruth (Editor)

    1989-01-01

    Papers on real-time computer applications in nuclear, particle, and plasma physics are presented, covering topics such as expert systems tactics in testing FASTBUS segment interconnect modules, trigger control in a high energy physcis experiment, the FASTBUS read-out system for the Aleph time projection chamber, a multiprocessor data acquisition systems, DAQ software architecture for Aleph, a VME multiprocessor system for plasma control at the JT-60 upgrade, and a multiasking, multisinked, multiprocessor data acquisition front end. Other topics include real-time data reduction using a microVAX processor, a transputer based coprocessor for VEDAS, simulation of a macropipelined multi-CPU event processor for use in FASTBUS, a distributed VME control system for the LISA superconducting Linac, a distributed system for laboratory process automation, and a distributed system for laboratory process automation. Additional topics include a structure macro assembler for the event handler, a data acquisition and control system for Thomson scattering on ATF, remote procedure execution software for distributed systems, and a PC-based graphic display real-time particle beam uniformity.

  4. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ivanov, Sergei D., E-mail: sergei.ivanov@unirostock.de; Grant, Ian M.; Marx, Dominik

    With the goal of computing quantum free energy landscapes of reactive (bio)chemical systems in multi-dimensional space, we combine the metadynamics technique for sampling potential energy surfaces with the ab initio path integral approach to treating nuclear quantum motion. This unified method is applied to the double proton transfer process in the formic acid dimer (FAD), in order to study the nuclear quantum effects at finite temperatures without imposing a one-dimensional reaction coordinate or reducing the dimensionality. Importantly, the ab initio path integral metadynamics technique allows one to treat the hydrogen bonds and concomitant proton transfers in FAD strictly independently andmore » thus provides direct access to the much discussed issue of whether the double proton transfer proceeds via a stepwise or concerted mechanism. The quantum free energy landscape we compute for this H-bonded molecular complex reveals that the two protons move in a concerted fashion from initial to product state, yet world-line analysis of the quantum correlations demonstrates that the protons are as quantum-uncorrelated at the transition state as they are when close to the equilibrium structure.« less

  5. Integrative Structure Determination of Protein Assemblies by Satisfaction of Spatial Restraints

    NASA Astrophysics Data System (ADS)

    Alber, Frank; Chait, Brian T.; Rout, Michael P.; Sali, Andrej

    To understand the cell, we need to determine the structures of macromolecular assemblies, many of which consist of tens to hundreds of components. A great variety of experimental data can be used to characterize the assemblies at several levels of resolution, from atomic structures to component configurations. To maximize completeness, resolution, accuracy, precision and efficiency of the structure determination, a computational approach is needed that can use spatial information from a variety of experimental methods. We propose such an approach, defined by its three main components: a hierarchical representation of the assembly, a scoring function consisting of spatial restraints derived from experimental data, and an optimization method that generates structures consistent with the data. We illustrate the approach by determining the configuration of the 456 proteins in the nuclear pore complex from Baker's yeast.

  6. Tomography reconstruction methods for damage diagnosis of wood structure in construction field

    NASA Astrophysics Data System (ADS)

    Qiu, Qiwen; Lau, Denvid

    2018-03-01

    The structural integrity of wood building element plays a critical role in the public safety, which requires effective methods for diagnosis of internal damage inside the wood body. Conventionally, the non-destructive testing (NDT) methods such as X-ray computed tomography, thermography, radar imaging reconstruction method, ultrasonic tomography, nuclear magnetic imaging techniques, and sonic tomography have been used to obtain the information about the internal structure of wood. In this paper, the applications, advantages and disadvantages of these traditional tomography methods are reviewed. Additionally, the present article gives an overview of recently developed tomography approach that relies on the use of mechanical and electromagnetic waves for assessing the structural integrity of wood buildings. This developed tomography reconstruction method is believed to provide a more accurate, reliable, and comprehensive assessment of wood structural integrity

  7. Computational Model for Oxygen Transport and Consumption in Human Vitreous

    PubMed Central

    Filas, Benjamen A.; Shui, Ying-Bo; Beebe, David C.

    2013-01-01

    Purpose. Previous studies that measured liquefaction and oxygen content in human vitreous suggested that exposure of the lens to excess oxygen causes nuclear cataracts. Here, we developed a computational model that reproduced available experimental oxygen distributions for intact and degraded human vitreous in physiologic and environmentally perturbed conditions. After validation, the model was used to estimate how age-related changes in vitreous physiology and structure alter oxygen levels at the lens. Methods. A finite-element model for oxygen transport and consumption in the human vitreous was created. Major inputs included ascorbate-mediated oxygen consumption in the vitreous, consumption at the posterior lens surface, and inflow from the retinal vasculature. Concentration-dependent relations were determined from experimental human data or estimated from animal studies, with the impact of all assumptions explored via parameter studies. Results. The model reproduced experimental data in humans, including oxygen partial pressure (Po2) gradients (≈15 mm Hg) across the anterior-posterior extent of the vitreous body, higher oxygen levels at the pars plana relative to the vitreous core, increases in Po2 near the lens after cataract surgery, and equilibration in the vitreous chamber following vitrectomy. Loss of the antioxidative capacity of ascorbate increases oxygen levels 3-fold at the lens surface. Homogeneous vitreous degeneration (liquefaction), but not partial posterior vitreous detachment, greatly increases oxygen exposure to the lens. Conclusions. Ascorbate content and the structure of the vitreous gel are critical determinants of lens oxygen exposure. Minimally invasive surgery and restoration of vitreous structure warrant further attention as strategies for preventing nuclear cataracts. PMID:24008409

  8. Computational model for oxygen transport and consumption in human vitreous.

    PubMed

    Filas, Benjamen A; Shui, Ying-Bo; Beebe, David C

    2013-10-15

    Previous studies that measured liquefaction and oxygen content in human vitreous suggested that exposure of the lens to excess oxygen causes nuclear cataracts. Here, we developed a computational model that reproduced available experimental oxygen distributions for intact and degraded human vitreous in physiologic and environmentally perturbed conditions. After validation, the model was used to estimate how age-related changes in vitreous physiology and structure alter oxygen levels at the lens. A finite-element model for oxygen transport and consumption in the human vitreous was created. Major inputs included ascorbate-mediated oxygen consumption in the vitreous, consumption at the posterior lens surface, and inflow from the retinal vasculature. Concentration-dependent relations were determined from experimental human data or estimated from animal studies, with the impact of all assumptions explored via parameter studies. The model reproduced experimental data in humans, including oxygen partial pressure (Po2) gradients (≈15 mm Hg) across the anterior-posterior extent of the vitreous body, higher oxygen levels at the pars plana relative to the vitreous core, increases in Po2 near the lens after cataract surgery, and equilibration in the vitreous chamber following vitrectomy. Loss of the antioxidative capacity of ascorbate increases oxygen levels 3-fold at the lens surface. Homogeneous vitreous degeneration (liquefaction), but not partial posterior vitreous detachment, greatly increases oxygen exposure to the lens. Ascorbate content and the structure of the vitreous gel are critical determinants of lens oxygen exposure. Minimally invasive surgery and restoration of vitreous structure warrant further attention as strategies for preventing nuclear cataracts.

  9. The Next Frontier in Computing

    ScienceCinema

    Sarrao, John

    2018-06-13

    Exascale computing refers to computing systems capable of at least one exaflop or a billion calculations per second (1018). That is 50 times faster than the most powerful supercomputers being used today and represents a thousand-fold increase over the first petascale computer that came into operation in 2008. How we use these large-scale simulation resources is the key to solving some of today’s most pressing problems, including clean energy production, nuclear reactor lifetime extension and nuclear stockpile aging.

  10. Constraining nuclear data via cosmological observations: Neutrino energy transport and big bang nucleosynthesis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Paris, Mark W.; Fuller, George M.; Grohs, Evan Bradley

    Here, we introduce a new computational capability that moves toward a self-consistent calculation of neutrino transport and nuclear reactions for big bang nucleosynthesis (BBN). Such a self-consistent approach is needed to be able to extract detailed information about nuclear reactions and physics beyond the standard model from precision cosmological observations of primordial nuclides and the cosmic microwave background radiation. We also calculate the evolution of the early universe through the epochs of weak decoupling, weak freeze-out and big bang nucleosynthesis (BBN) by simultaneously coupling a full strong, electromagnetic, and weak nuclear reaction network with a multi-energy group Boltzmann neutrino energymore » transport scheme. The modular structure of our approach allows the dissection of the relative contributions of each process responsible for evolving the dynamics of the early universe. Such an approach allows a detailed account of the evolution of the active neutrino energy distribution functions alongside and self-consistently with the nuclear reactions and entropy/heat generation and flow between the neutrino and photon/electron/positron/baryon plasma components. Our calculations reveal nonlinear feedback in the time evolution of neutrino distribution functions and plasma thermodynamic conditions. We discuss the time development of neutrino spectral distortions and concomitant entropy production and extraction from the plasma. These effects result in changes in the computed values of the BBN deuterium and helium-4 yields that are on the order of a half-percent relative to a baseline standard BBN calculation with no neutrino transport. This is an order of magnitude larger effect than in previous estimates. For particular implementations of quantum corrections in plasma thermodynamics, our calculations show a 0.4% increase in deuterium and a 0.6% decrease in 4He over our baseline. The magnitude of these changes are on the order of uncertainties in the nuclear physics for the case of deuterium and are potentially significant for the error budget of helium in upcoming cosmological observations.« less

  11. Constraining nuclear data via cosmological observations: Neutrino energy transport and big bang nucleosynthesis

    NASA Astrophysics Data System (ADS)

    Paris, Mark; Fuller, George; Grohs, Evan; Kishimoto, Chad; Vlasenko, Alexey

    2017-09-01

    We introduce a new computational capability that moves toward a self-consistent calculation of neutrino transport and nuclear reactions for big bang nucleosynthesis (BBN). Such a self-consistent approach is needed to be able to extract detailed information about nuclear reactions and physics beyond the standard model from precision cosmological observations of primordial nuclides and the cosmic microwave background radiation. We calculate the evolution of the early universe through the epochs of weak decoupling, weak freeze-out and big bang nucleosynthesis (BBN) by simultaneously coupling a full strong, electromagnetic, and weak nuclear reaction network with a multi-energy group Boltzmann neutrino energy transport scheme. The modular structure of our approach allows the dissection of the relative contributions of each process responsible for evolving the dynamics of the early universe. Such an approach allows a detailed account of the evolution of the active neutrino energy distribution functions alongside and self-consistently with the nuclear reactions and entropy/heat generation and 'ow between the neutrino and photon/electron/positron/baryon plasma components. Our calculations reveal nonlinear feedback in the time evolution of neutrino distribution functions and plasma thermodynamic conditions. We discuss the time development of neutrino spectral distortions and concomitant entropy production and extraction from the plasma. These e↑ects result in changes in the computed values of the BBN deuterium and helium-4 yields that are on the order of a half-percent relative to a baseline standard BBN calculation with no neutrino transport. This is an order of magnitude larger e↑ect than in previous estimates. For particular implementations of quantum corrections in plasma thermodynamics, our calculations show a 0.4% increase in deuterium and a 0.6% decrease in 4He over our baseline. The magnitude of these changes are on the order of uncertainties in the nuclear physics for the case of deuterium and are potentially signi↓cant for the error budget of helium in upcoming cosmological observations.

  12. Constraining nuclear data via cosmological observations: Neutrino energy transport and big bang nucleosynthesis

    DOE PAGES

    Paris, Mark W.; Fuller, George M.; Grohs, Evan Bradley; ...

    2017-09-13

    Here, we introduce a new computational capability that moves toward a self-consistent calculation of neutrino transport and nuclear reactions for big bang nucleosynthesis (BBN). Such a self-consistent approach is needed to be able to extract detailed information about nuclear reactions and physics beyond the standard model from precision cosmological observations of primordial nuclides and the cosmic microwave background radiation. We also calculate the evolution of the early universe through the epochs of weak decoupling, weak freeze-out and big bang nucleosynthesis (BBN) by simultaneously coupling a full strong, electromagnetic, and weak nuclear reaction network with a multi-energy group Boltzmann neutrino energymore » transport scheme. The modular structure of our approach allows the dissection of the relative contributions of each process responsible for evolving the dynamics of the early universe. Such an approach allows a detailed account of the evolution of the active neutrino energy distribution functions alongside and self-consistently with the nuclear reactions and entropy/heat generation and flow between the neutrino and photon/electron/positron/baryon plasma components. Our calculations reveal nonlinear feedback in the time evolution of neutrino distribution functions and plasma thermodynamic conditions. We discuss the time development of neutrino spectral distortions and concomitant entropy production and extraction from the plasma. These effects result in changes in the computed values of the BBN deuterium and helium-4 yields that are on the order of a half-percent relative to a baseline standard BBN calculation with no neutrino transport. This is an order of magnitude larger effect than in previous estimates. For particular implementations of quantum corrections in plasma thermodynamics, our calculations show a 0.4% increase in deuterium and a 0.6% decrease in 4He over our baseline. The magnitude of these changes are on the order of uncertainties in the nuclear physics for the case of deuterium and are potentially significant for the error budget of helium in upcoming cosmological observations.« less

  13. Genetic Diversity and Domestication Footprints of Chinese Cherry [Cerasus pseudocerasus (Lindl.) G.Don] as Revealed by Nuclear Microsatellites

    PubMed Central

    Zhang, Jing; Chen, Tao; Wang, Yan; Chen, Qing; Sun, Bo; Luo, Ya; Zhang, Yong; Tang, Haoru; Wang, Xiaorong

    2018-01-01

    Chinese cherry [Cerasus pseudocerasus (Lindl.) G.Don] is a commercially important fruit crop in China, but its structure patterns and domestication history remain imprecise. To address these questions, we estimated the genetic structure and domestication history of Chinese cherry using 19 nuclear microsatellite markers and 650 representative accessions (including 118 Cerasus relatives) selected throughout their natural eco-geographical distributions. Our structure analyses detected no genetic contribution from Cerasus relatives to the evolution history of Chinese cherry. A separate genetic structure was detected in wild Chinese cherries and rough geographical structures were observed in cultivated Chinese cherries. One wild (wild Chinese cherry, WC) and two cultivated (cultivated Chinese cherry, CC1 and CC2) genetic clusters were defined. Our approximate Bayesian computation analyses supported an independent domestication history with two domestication events for CC1 and CC2, happening about 3900 and 2200 years ago, respectively. Moderate loss of genetic diversity, over 1000-year domestication bottlenecks and divergent domestication in fruit traits were also detected in cultivated Chinese cherries, which is highly correlated to long-term clonal propagation and different domestication trends and preferences. Our study is the first to comprehensively and systematically investigate the structure patterns and domestication history for Chinese cherry, providing important references for revealing the evolution and domestication history of perennial woody fruit trees. PMID:29535750

  14. Accuracy and Precision of Radioactivity Quantification in Nuclear Medicine Images

    PubMed Central

    Frey, Eric C.; Humm, John L.; Ljungberg, Michael

    2012-01-01

    The ability to reliably quantify activity in nuclear medicine has a number of increasingly important applications. Dosimetry for targeted therapy treatment planning or for approval of new imaging agents requires accurate estimation of the activity in organs, tumors, or voxels at several imaging time points. Another important application is the use of quantitative metrics derived from images, such as the standard uptake value commonly used in positron emission tomography (PET), to diagnose and follow treatment of tumors. These measures require quantification of organ or tumor activities in nuclear medicine images. However, there are a number of physical, patient, and technical factors that limit the quantitative reliability of nuclear medicine images. There have been a large number of improvements in instrumentation, including the development of hybrid single-photon emission computed tomography/computed tomography and PET/computed tomography systems, and reconstruction methods, including the use of statistical iterative reconstruction methods, which have substantially improved the ability to obtain reliable quantitative information from planar, single-photon emission computed tomography, and PET images. PMID:22475429

  15. ASC FY17 Implementation Plan, Rev. 1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hamilton, P. G.

    The Stockpile Stewardship Program (SSP) is an integrated technical program for maintaining the safety, surety, and reliability of the U.S. nuclear stockpile. The SSP uses nuclear test data, computational modeling and simulation, and experimental facilities to advance understanding of nuclear weapons. It includes stockpile surveillance, experimental research, development and engineering programs, and an appropriately scaled production capability to support stockpile requirements. This integrated national program requires the continued use of experimental facilities and programs, and the computational capabilities to support these programs. The Advanced Simulation and Computing Program (ASC) is a cornerstone of the SSP, providing simulation capabilities and computationalmore » resources that support annual stockpile assessment and certification, study advanced nuclear weapons design and manufacturing processes, analyze accident scenarios and weapons aging, and provide the tools to enable stockpile Life Extension Programs (LEPs) and the resolution of Significant Finding Investigations (SFIs). This requires a balance of resources, including technical staff, hardware, simulation software, and computer science solutions.« less

  16. Computational analysis of EBNA1 ``druggability'' suggests novel insights for Epstein-Barr virus inhibitor design

    NASA Astrophysics Data System (ADS)

    Gianti, Eleonora; Messick, Troy E.; Lieberman, Paul M.; Zauhar, Randy J.

    2016-04-01

    The Epstein-Barr Nuclear Antigen 1 (EBNA1) is a critical protein encoded by the Epstein-Barr Virus (EBV). During latent infection, EBNA1 is essential for DNA replication and transcription initiation of viral and cellular genes and is necessary to immortalize primary B-lymphocytes. Nonetheless, the concept of EBNA1 as drug target is novel. Two EBNA1 crystal structures are publicly available and the first small-molecule EBNA1 inhibitors were recently discovered. However, no systematic studies have been reported on the structural details of EBNA1 "druggable" binding sites. We conducted computational identification and structural characterization of EBNA1 binding pockets, likely to accommodate ligand molecules (i.e. "druggable" binding sites). Then, we validated our predictions by docking against a set of compounds previously tested in vitro for EBNA1 inhibition (PubChem AID-2381). Finally, we supported assessments of pocket druggability by performing induced fit docking and molecular dynamics simulations paired with binding affinity predictions by Molecular Mechanics Generalized Born Surface Area calculations for a number of hits belonging to druggable binding sites. Our results establish EBNA1 as a target for drug discovery, and provide the computational evidence that active AID-2381 hits disrupt EBNA1:DNA binding upon interacting at individual sites. Lastly, structural properties of top scoring hits are proposed to support the rational design of the next generation of EBNA1 inhibitors.

  17. Nuclear Data Networks

    Science.gov Websites

    calibrations. NSDD The international network of Nuclear Structure and Decay Data evaluators Group of and updating of nuclear structure data contained in Evaluated Nuclear Structure Data File (ENSDF

  18. Game Imaging Meets Nuclear Reality

    ScienceCinema

    Michel, Kelly; Watkins, Adam

    2018-01-16

    At Los Alamos National Laboratory, a team of artists and animators, nuclear engineers and computer scientists is teaming to provide 3-D models of nuclear facilities to train IAEA safeguards inspectors and others who need fast familiarity with specific nuclear sites.

  19. Digital Image Correlation of Concrete Slab at University of Tennessee, Knoxville

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mahadevan, Sankaran; Agarwal, Vivek; Pham, Binh T.

    Assessment and management of aging concrete structures in nuclear power plants require a more systematic approach than simple reliance on existing code margins of safety. Some degradation mechanisms of concrete manifest themselves via swelling or by other shape deformation of the concrete. Specifically, degradation of concrete structure damaged by ASR is viewed as one of the dominant factors impacting the structural integrity of aging nuclear power plants. Structural health monitoring of concrete structures aims to understand the current health condition of a structure based on heterogeneous measurements to produce high-confidence actionable information regarding structural integrity that supports operational and maintenancemore » decisions. Number of nondestructive examination techniques (i.e., thermography, digital image correlation, mechanical deformation measurements, nonlinear impact resonance (DIC) acoustic spectroscopy, and vibro-acoustic modulation) is used to detect the damage caused by ASR. DIC techniques have been increasing in popularity, especially in micro- and nano-scale mechanical testing applications due to its relative ease of implementation and use. Advances in computer technology and digital cameras help this method moving forward. To ensure the best outcome of the DIC system, important factors in the experiment are identified. They include standoff distance, speckle size, speckle pattern, and durable paint. These optimal experimental options are selected basing on a thorough investigation. The resulting DIC deformation map indicates that this technique can be used to generate data related to degradation assessment of concrete structure damaged by the impact of ASR.« less

  20. Revisiting the Electronic Structure of FeS Monomers Using ab Initio Ligand Field Theory and the Angular Overlap Model.

    PubMed

    Chilkuri, Vijay Gopal; DeBeer, Serena; Neese, Frank

    2017-09-05

    Iron-sulfur (FeS) proteins are universally found in nature with actives sites ranging in complexity from simple monomers to multinuclear sites from two up to eight iron atoms. These sites include mononuclear (rubredoxins), dinuclear (ferredoxins and Rieske proteins), trinuclear (e.g., hydrogenases), and tetranuclear (various ferredoxins and high-potential iron-sulfur proteins). The electronic structure of the higher-nuclearity clusters is inherently extremely complex. Hence, it is reasonable to take a bottom-up approach in which clusters of increasing nuclearity are analyzed in terms of the properties of their lower nuclearity constituents. In the present study, the first step is taken by an in-depth analysis of mononuclear FeS systems. Two different FeS molecules with phenylthiolate and methylthiolate as ligands are studied in their oxidized and reduced forms using modern wave function-based ab initio methods. The ab initio electronic spectra and wave function are presented and analyzed in detail. The very intricate electronic structure-geometry relationship in these systems is analyzed using ab initio ligand field theory (AILFT) in conjunction with the angular overlap model (AOM) parametrization scheme. The simple AOM model is used to explain the effect of geometric variations on the electronic structure. Through a comparison of the ab initio computed UV-vis absorption spectra and the available experimental spectra, the low-energy part of the many-particle spectrum is carefully analyzed. We show ab initio calculated magnetic circular dichroism spectra and present a comparison with the experimental spectrum. Finally, AILFT parameters and the ab initio spectra are compared with those obtained experimentally to understand the effect of the increased covalency of the thiolate ligands on the electronic structure of FeS monomers.

  1. A computer system to analyze showers in nuclear emulsions: Center Director's discretionary fund report

    NASA Technical Reports Server (NTRS)

    Meegan, C. A.; Fountain, W. F.; Berry, F. A., Jr.

    1987-01-01

    A system to rapidly digitize data from showers in nuclear emulsions is described. A TV camera views the emulsions though a microscope. The TV output is superimposed on the monitor of a minicomputer. The operator uses the computer's graphics capability to mark the positions of particle tracks. The coordinates of each track are stored on a disk. The computer then predicts the coordinates of each track through successive layers of emulsion. The operator, guided by the predictions, thus tracks and stores the development of the shower. The system provides a significant improvement over purely manual methods of recording shower development in nuclear emulsion stacks.

  2. Computer Model Of Fragmentation Of Atomic Nuclei

    NASA Technical Reports Server (NTRS)

    Wilson, John W.; Townsend, Lawrence W.; Tripathi, Ram K.; Norbury, John W.; KHAN FERDOUS; Badavi, Francis F.

    1995-01-01

    High Charge and Energy Semiempirical Nuclear Fragmentation Model (HZEFRG1) computer program developed to be computationally efficient, user-friendly, physics-based program for generating data bases on fragmentation of atomic nuclei. Data bases generated used in calculations pertaining to such radiation-transport applications as shielding against radiation in outer space, radiation dosimetry in outer space, cancer therapy in laboratories with beams of heavy ions, and simulation studies for designing detectors for experiments in nuclear physics. Provides cross sections for production of individual elements and isotopes in breakups of high-energy heavy ions by combined nuclear and Coulomb fields of interacting nuclei. Written in ANSI FORTRAN 77.

  3. Performance assessment of KORAT-3D on the ANL IBM-SP computer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Alexeyev, A.V.; Zvenigorodskaya, O.A.; Shagaliev, R.M.

    1999-09-01

    The TENAR code is currently being developed at the Russian Federal Nuclear Center (VNIIEF) as a coupled dynamics code for the simulation of transients in VVER and RBMK systems and other nuclear systems. The neutronic module in this code system is KORAT-3D. This module is also one of the most computationally intensive components of the code system. A parallel version of KORAT-3D has been implemented to achieve the goal of obtaining transient solutions in reasonable computational time, particularly for RBMK calculations that involve the application of >100,000 nodes. An evaluation of the KORAT-3D code performance was recently undertaken on themore » Argonne National Laboratory (ANL) IBM ScalablePower (SP) parallel computer located in the Mathematics and Computer Science Division of ANL. At the time of the study, the ANL IBM-SP computer had 80 processors. This study was conducted under the auspices of a technical staff exchange program sponsored by the International Nuclear Safety Center (INSC).« less

  4. Integrative Structure–Function Mapping of the Nucleoporin Nup133 Suggests a Conserved Mechanism for Membrane Anchoring of the Nuclear Pore Complex

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim, Seung Joong; Fernandez-Martinez, Javier; Sampathkumar, Parthasarathy

    2014-08-19

    The nuclear pore complex (NPC) is the sole passageway for the transport of macromolecules across the nuclear envelope. Nup133, a major component in the essential Y-shaped Nup84 complex, is a large scaffold protein of the NPC's outer ring structure. Here, we describe an integrative modeling approach that produces atomic models for multiple states of Saccharomyces cerevisiae (Sc) Nup133, based on the crystal structures of the sequence segments and their homologs, including the related Vanderwaltozyma polyspora (Vp) Nup133 residues 55 to 502 (VpNup133 55–502) determined in this study, small angle X-ray scattering profiles for 18 constructs of ScNup133 and one constructmore » of VpNup133, and 23 negative-stain electron microscopy class averages of ScNup1332–1157. Using our integrative approach, we then computed a multi-state structural model of the full-length ScNup133 and validated it with mutational studies and 45 chemical cross-links determined via mass spectrometry. Finally, the model of ScNup133 allowed us to annotate a potential ArfGAP1 lipid packing sensor (ALPS) motif in Sc and VpNup133 and discuss its potential significance in the context of the whole NPC; we suggest that ALPS motifs are scattered throughout the NPC's scaffold in all eukaryotes and play a major role in the assembly and membrane anchoring of the NPC in the nuclear envelope. Our results are consistent with a common evolutionary origin of Nup133 with membrane coating complexes (the protocoatomer hypothesis); the presence of the ALPS motifs in coatomer-like nucleoporins suggests an ancestral mechanism for membrane recognition present in early membrane coating complexes.« less

  5. Integrative Structure–Function Mapping of the Nucleoporin Nup133 Suggests a Conserved Mechanism for Membrane Anchoring of the Nuclear Pore Complex*

    PubMed Central

    Kim, Seung Joong; Fernandez-Martinez, Javier; Sampathkumar, Parthasarathy; Martel, Anne; Matsui, Tsutomu; Tsuruta, Hiro; Weiss, Thomas M.; Shi, Yi; Markina-Inarrairaegui, Ane; Bonanno, Jeffery B.; Sauder, J. Michael; Burley, Stephen K.; Chait, Brian T.; Almo, Steven C.; Rout, Michael P.; Sali, Andrej

    2014-01-01

    The nuclear pore complex (NPC) is the sole passageway for the transport of macromolecules across the nuclear envelope. Nup133, a major component in the essential Y-shaped Nup84 complex, is a large scaffold protein of the NPC's outer ring structure. Here, we describe an integrative modeling approach that produces atomic models for multiple states of Saccharomyces cerevisiae (Sc) Nup133, based on the crystal structures of the sequence segments and their homologs, including the related Vanderwaltozyma polyspora (Vp) Nup133 residues 55 to 502 (VpNup13355–502) determined in this study, small angle X-ray scattering profiles for 18 constructs of ScNup133 and one construct of VpNup133, and 23 negative-stain electron microscopy class averages of ScNup1332–1157. Using our integrative approach, we then computed a multi-state structural model of the full-length ScNup133 and validated it with mutational studies and 45 chemical cross-links determined via mass spectrometry. Finally, the model of ScNup133 allowed us to annotate a potential ArfGAP1 lipid packing sensor (ALPS) motif in Sc and VpNup133 and discuss its potential significance in the context of the whole NPC; we suggest that ALPS motifs are scattered throughout the NPC's scaffold in all eukaryotes and play a major role in the assembly and membrane anchoring of the NPC in the nuclear envelope. Our results are consistent with a common evolutionary origin of Nup133 with membrane coating complexes (the protocoatomer hypothesis); the presence of the ALPS motifs in coatomer-like nucleoporins suggests an ancestral mechanism for membrane recognition present in early membrane coating complexes. PMID:25139911

  6. Computational Pathology to Discriminate Benign from Malignant Intraductal Proliferations of the Breast

    PubMed Central

    Oh, Eun-Yeong; Lerwill, Melinda F.; Brachtel, Elena F.; Jones, Nicholas C.; Knoblauch, Nicholas W.; Montaser-Kouhsari, Laleh; Johnson, Nicole B.; Rao, Luigi K. F.; Faulkner-Jones, Beverly; Wilbur, David C.; Schnitt, Stuart J.; Beck, Andrew H.

    2014-01-01

    The categorization of intraductal proliferative lesions of the breast based on routine light microscopic examination of histopathologic sections is in many cases challenging, even for experienced pathologists. The development of computational tools to aid pathologists in the characterization of these lesions would have great diagnostic and clinical value. As a first step to address this issue, we evaluated the ability of computational image analysis to accurately classify DCIS and UDH and to stratify nuclear grade within DCIS. Using 116 breast biopsies diagnosed as DCIS or UDH from the Massachusetts General Hospital (MGH), we developed a computational method to extract 392 features corresponding to the mean and standard deviation in nuclear size and shape, intensity, and texture across 8 color channels. We used L1-regularized logistic regression to build classification models to discriminate DCIS from UDH. The top-performing model contained 22 active features and achieved an AUC of 0.95 in cross-validation on the MGH data-set. We applied this model to an external validation set of 51 breast biopsies diagnosed as DCIS or UDH from the Beth Israel Deaconess Medical Center, and the model achieved an AUC of 0.86. The top-performing model contained active features from all color-spaces and from the three classes of features (morphology, intensity, and texture), suggesting the value of each for prediction. We built models to stratify grade within DCIS and obtained strong performance for stratifying low nuclear grade vs. high nuclear grade DCIS (AUC = 0.98 in cross-validation) with only moderate performance for discriminating low nuclear grade vs. intermediate nuclear grade and intermediate nuclear grade vs. high nuclear grade DCIS (AUC = 0.83 and 0.69, respectively). These data show that computational pathology models can robustly discriminate benign from malignant intraductal proliferative lesions of the breast and may aid pathologists in the diagnosis and classification of these lesions. PMID:25490766

  7. APOLLO: a general code for transport, slowing-down and thermalization calculations in heterogeneous media

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kavenoky, A.

    1973-01-01

    From national topical meeting on mathematical models and computational techniques for analysis of nuclear systems; Ann Arbor, Michigan, USA (8 Apr 1973). In mathematical models and computational techniques for analysis of nuclear systems. APOLLO calculates the space-and-energy-dependent flux for a one dimensional medium, in the multigroup approximation of the transport equation. For a one dimensional medium, refined collision probabilities have been developed for the resolution of the integral form of the transport equation; these collision probabilities increase accuracy and save computing time. The interaction between a few cells can also be treated by the multicell option of APOLLO. The diffusionmore » coefficient and the material buckling can be computed in the various B and P approximations with a linearly anisotropic scattering law, even in the thermal range of the spectrum. Eventually this coefficient is corrected for streaming by use of Benoist's theory. The self-shielding of the heavy isotopes is treated by a new and accurate technique which preserves the reaction rates of the fundamental fine structure flux. APOLLO can perform a depletion calculation for one cell, a group of cells or a complete reactor. The results of an APOLLO calculation are the space-and-energy-dependent flux, the material buckling or any reaction rate; these results can also be macroscopic cross sections used as input data for a 2D or 3D depletion and diffusion code in reactor geometry. 10 references. (auth)« less

  8. Combined Mitochondrial and Nuclear Markers Revealed a Deep Vicariant History for Leopoldamys neilli, a Cave-Dwelling Rodent of Thailand

    PubMed Central

    Latinne, Alice; Waengsothorn, Surachit; Rojanadilok, Prateep; Eiamampai, Krairat; Sribuarod, Kriangsak; Michaux, Johan R.

    2012-01-01

    Background Historical biogeography and evolutionary processes of cave taxa have been widely studied in temperate regions. However, Southeast Asian cave ecosystems remain largely unexplored despite their high scientific interest. Here we studied the phylogeography of Leopoldamys neilli, a cave-dwelling murine rodent living in limestone karsts of Thailand, and compared the molecular signature of mitochondrial and nuclear markers. Methodology/Principal Findings We used a large sampling (n = 225) from 28 localities in Thailand and a combination of mitochondrial and nuclear markers with various evolutionary rates (two intronic regions and 12 microsatellites). The evolutionary history of L. neilli and the relative role of vicariance and dispersal were investigated using ancestral range reconstruction analysis and Approximate Bayesian computation (ABC). Both mitochondrial and nuclear markers support a large-scale population structure of four main groups (west, centre, north and northeast) and a strong finer structure within each of these groups. A deep genealogical divergence among geographically close lineages is observed and denotes a high population fragmentation. Our findings suggest that the current phylogeographic pattern of this species results from the fragmentation of a widespread ancestral population and that vicariance has played a significant role in the evolutionary history of L. neilli. These deep vicariant events that occurred during Plio-Pleistocene are related to the formation of the Central Plain of Thailand. Consequently, the western, central, northern and northeastern groups of populations were historically isolated and should be considered as four distinct Evolutionarily Significant Units (ESUs). Conclusions/Significance Our study confirms the benefit of using several independent genetic markers to obtain a comprehensive and reliable picture of L. neilli evolutionary history at different levels of resolution. The complex genetic structure of Leopoldamys neilli is supported by congruent mitochondrial and nuclear markers and has been influenced by the geological history of Thailand during Plio-Pleistocene. PMID:23118888

  9. Computation of Thermodynamic Equilibria Pertinent to Nuclear Materials in Multi-Physics Codes

    NASA Astrophysics Data System (ADS)

    Piro, Markus Hans Alexander

    Nuclear energy plays a vital role in supporting electrical needs and fulfilling commitments to reduce greenhouse gas emissions. Research is a continuing necessity to improve the predictive capabilities of fuel behaviour in order to reduce costs and to meet increasingly stringent safety requirements by the regulator. Moreover, a renewed interest in nuclear energy has given rise to a "nuclear renaissance" and the necessity to design the next generation of reactors. In support of this goal, significant research efforts have been dedicated to the advancement of numerical modelling and computational tools in simulating various physical and chemical phenomena associated with nuclear fuel behaviour. This undertaking in effect is collecting the experience and observations of a past generation of nuclear engineers and scientists in a meaningful way for future design purposes. There is an increasing desire to integrate thermodynamic computations directly into multi-physics nuclear fuel performance and safety codes. A new equilibrium thermodynamic solver is being developed with this matter as a primary objective. This solver is intended to provide thermodynamic material properties and boundary conditions for continuum transport calculations. There are several concerns with the use of existing commercial thermodynamic codes: computational performance; limited capabilities in handling large multi-component systems of interest to the nuclear industry; convenient incorporation into other codes with quality assurance considerations; and, licensing entanglements associated with code distribution. The development of this software in this research is aimed at addressing all of these concerns. The approach taken in this work exploits fundamental principles of equilibrium thermodynamics to simplify the numerical optimization equations. In brief, the chemical potentials of all species and phases in the system are constrained by estimates of the chemical potentials of the system components at each iterative step, and the objective is to minimize the residuals of the mass balance equations. Several numerical advantages are achieved through this simplification. In particular, computational expense is reduced and the rate of convergence is enhanced. Furthermore, the software has demonstrated the ability to solve systems involving as many as 118 component elements. An early version of the code has already been integrated into the Advanced Multi-Physics (AMP) code under development by the Oak Ridge National Laboratory, Los Alamos National Laboratory, Idaho National Laboratory and Argonne National Laboratory. Keywords: Engineering, Nuclear -- 0552, Engineering, Material Science -- 0794, Chemistry, Mathematics -- 0405, Computer Science -- 0984

  10. DOE Office of Scientific and Technical Information (OSTI.GOV)

    McCoy, Michel; Archer, Bill; Hendrickson, Bruce

    The Stockpile Stewardship Program (SSP) is an integrated technical program for maintaining the safety, surety, and reliability of the U.S. nuclear stockpile. The SSP uses nuclear test data, computational modeling and simulation, and experimental facilities to advance understanding of nuclear weapons. It includes stockpile surveillance, experimental research, development and engineering programs, and an appropriately scaled production capability to support stockpile requirements. This integrated national program requires the continued use of experimental facilities and programs, and the computational capabilities to support these programs. The Advanced Simulation and Computing Program (ASC) is a cornerstone of the SSP, providing simulation capabilities and computationalmore » resources that support annual stockpile assessment and certification, study advanced nuclear weapons design and manufacturing processes, analyze accident scenarios and weapons aging, and provide the tools to enable stockpile Life Extension Programs (LEPs) and the resolution of Significant Finding Investigations (SFIs). This requires a balance of resource, including technical staff, hardware, simulation software, and computer science solutions. ASC is now focused on increasing predictive capabilities in a three-dimensional (3D) simulation environment while maintaining support to the SSP. The program continues to improve its unique tools for solving progressively more difficult stockpile problems (sufficient resolution, dimensionality, and scientific details), and quantifying critical margins and uncertainties. Resolving each issue requires increasingly difficult analyses because the aging process has progressively moved the stockpile further away from the original test base. Where possible, the program also enables the use of high performance computing (HPC) and simulation tools to address broader national security needs, such as foreign nuclear weapon assessments and counter nuclear terrorism.« less

  11. Reactivity effects in VVER-1000 of the third unit of the kalinin nuclear power plant at physical start-up. Computations in ShIPR intellectual code system with library of two-group cross sections generated by UNK code

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zizin, M. N.; Zimin, V. G.; Zizina, S. N., E-mail: zizin@adis.vver.kiae.ru

    2010-12-15

    The ShIPR intellectual code system for mathematical simulation of nuclear reactors includes a set of computing modules implementing the preparation of macro cross sections on the basis of the two-group library of neutron-physics cross sections obtained for the SKETCH-N nodal code. This library is created by using the UNK code for 3D diffusion computation of first VVER-1000 fuel loadings. Computation of neutron fields in the ShIPR system is performed using the DP3 code in the two-group diffusion approximation in 3D triangular geometry. The efficiency of all groups of control rods for the first fuel loading of the third unit ofmore » the Kalinin Nuclear Power Plant is computed. The temperature, barometric, and density effects of reactivity as well as the reactivity coefficient due to the concentration of boric acid in the reactor were computed additionally. Results of computations are compared with the experiment.« less

  12. Reactivity effects in VVER-1000 of the third unit of the kalinin nuclear power plant at physical start-up. Computations in ShIPR intellectual code system with library of two-group cross sections generated by UNK code

    NASA Astrophysics Data System (ADS)

    Zizin, M. N.; Zimin, V. G.; Zizina, S. N.; Kryakvin, L. V.; Pitilimov, V. A.; Tereshonok, V. A.

    2010-12-01

    The ShIPR intellectual code system for mathematical simulation of nuclear reactors includes a set of computing modules implementing the preparation of macro cross sections on the basis of the two-group library of neutron-physics cross sections obtained for the SKETCH-N nodal code. This library is created by using the UNK code for 3D diffusion computation of first VVER-1000 fuel loadings. Computation of neutron fields in the ShIPR system is performed using the DP3 code in the two-group diffusion approximation in 3D triangular geometry. The efficiency of all groups of control rods for the first fuel loading of the third unit of the Kalinin Nuclear Power Plant is computed. The temperature, barometric, and density effects of reactivity as well as the reactivity coefficient due to the concentration of boric acid in the reactor were computed additionally. Results of computations are compared with the experiment.

  13. Solving The Longstanding Problem Of Low-Energy Nuclear Reactions At the Highest Microscopic Level - Final Report

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Quaglioni, S.

    2016-09-22

    A 2011 DOE-NP Early Career Award (ECA) under Field Work Proposal (FWP) SCW1158 supported the project “Solving the Long-Standing Problem of Low-Energy Nuclear Reactions at the Highest Microscopic Level” in the five-year period from June 15, 2011 to June 14, 2016. This project, led by PI S. Quaglioni, aimed at developing a comprehensive and computationally efficient framework to arrive at a unified description of structural properties and reactions of light nuclei in terms of constituent protons and neutrons interacting through nucleon-nucleon (NN) and three-nucleon (3N) forces. Specifically, the project had three main goals: 1) arriving at the accurate predictions formore » fusion reactions that power stars and Earth-based fusion facilities; 2) realizing a comprehensive description of clustering and continuum effects in exotic nuclei, including light Borromean systems; and 3) achieving fundamental understanding of the role of the 3N force in nuclear reactions and nuclei at the drip line.« less

  14. Radioactive decay data tables: A handbook of decay data for application to radiation dosimetry and radiological assessments

    NASA Astrophysics Data System (ADS)

    Kocher, D. C.; Smith, J. S.

    Decay data are presented for approximately 500 radionuclides including those occurring naturally in the environment, those of potential importance in routine or accidental releases from the nuclear fuel cycle, those of current interest in nuclear medicine and fusion reactor technology, and some of those of interest to Committee 2 of the International Commission on Radiological Protection for the estimation of annual limits on intake via inhalation and ingestion for occupationally exposed individuals. Physical processes involved in radioactive decay which produce the different types of radiation observed, methods used to prepare the decay data sets for each radionuclide in the format of the computerized evaluated nuclear structure data file, the tables of radioactive decay data, and the computer code MEDLIST used to produce the tables are described. Applications of the data to problems of interest in radiation dosimetry and radiological assessments are considered as well as the calculations of the activity of a daughter radionuclide relative to the activity of its parent in a radioactive decay chain.

  15. Damage tolerance of nuclear graphite at elevated temperatures

    DOE PAGES

    Liu, Dong; Gludovatz, Bernd; Barnard, Harold S.; ...

    2017-06-30

    Nuclear-grade graphite is a critically important high-temperature structural material for current and potentially next generation of fission reactors worldwide. It is imperative to understand its damage-tolerant behaviour and to discern the mechanisms of damage evolution under in-service conditions. Here we perform in situ mechanical testing with synchrotron X-ray computed micro-tomography at temperatures between ambient and 1,000 °C on a nuclear-grade Gilsocarbon graphite. We find that both the strength and fracture toughness of this graphite are improved at elevated temperature. Whereas this behaviour is consistent with observations of the closure of microcracks formed parallel to the covalent-sp 2-bonded graphene layers atmore » higher temperatures, which accommodate the more than tenfold larger thermal expansion perpendicular to these layers, we attribute the elevation in strength and toughness primarily to changes in the residual stress state at 800–1,000 °C, specifically to the reduction in significant levels of residual tensile stresses in the graphite that are ‘frozen-in’ following processing.« less

  16. Damage tolerance of nuclear graphite at elevated temperatures

    PubMed Central

    Liu, Dong; Gludovatz, Bernd; Barnard, Harold S.; Kuball, Martin; Ritchie, Robert O.

    2017-01-01

    Nuclear-grade graphite is a critically important high-temperature structural material for current and potentially next generation of fission reactors worldwide. It is imperative to understand its damage-tolerant behaviour and to discern the mechanisms of damage evolution under in-service conditions. Here we perform in situ mechanical testing with synchrotron X-ray computed micro-tomography at temperatures between ambient and 1,000 °C on a nuclear-grade Gilsocarbon graphite. We find that both the strength and fracture toughness of this graphite are improved at elevated temperature. Whereas this behaviour is consistent with observations of the closure of microcracks formed parallel to the covalent-sp2-bonded graphene layers at higher temperatures, which accommodate the more than tenfold larger thermal expansion perpendicular to these layers, we attribute the elevation in strength and toughness primarily to changes in the residual stress state at 800–1,000 °C, specifically to the reduction in significant levels of residual tensile stresses in the graphite that are ‘frozen-in’ following processing. PMID:28665405

  17. Information flow and protein dynamics: the interplay between nuclear magnetic resonance spectroscopy and molecular dynamics simulations

    PubMed Central

    Pastor, Nina; Amero, Carlos

    2015-01-01

    Proteins participate in information pathways in cells, both as links in the chain of signals, and as the ultimate effectors. Upon ligand binding, proteins undergo conformation and motion changes, which can be sensed by the following link in the chain of information. Nuclear magnetic resonance (NMR) spectroscopy and molecular dynamics (MD) simulations represent powerful tools for examining the time-dependent function of biological molecules. The recent advances in NMR and the availability of faster computers have opened the door to more detailed analyses of structure, dynamics, and interactions. Here we briefly describe the recent applications that allow NMR spectroscopy and MD simulations to offer unique insight into the basic motions that underlie information transfer within and between cells. PMID:25999971

  18. 77 FR 50724 - Developing Software Life Cycle Processes for Digital Computer Software Used in Safety Systems of...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-08-22

    ... NUCLEAR REGULATORY COMMISSION [NRC-2012-0195] Developing Software Life Cycle Processes for Digital... Software Life Cycle Processes for Digital Computer Software used in Safety Systems of Nuclear Power Plants... clarifications, the enhanced consensus practices for developing software life-cycle processes for digital...

  19. The experimental nuclear reaction data (EXFOR): Extended computer database and Web retrieval system

    DOE PAGES

    Zerkin, V. V.; Pritychenko, B.

    2018-02-04

    The EXchange FORmat (EXFOR) experimental nuclear reaction database and the associated Web interface provide access to the wealth of low- and intermediate-energy nuclear reaction physics data. This resource is based on numerical data sets and bibliographical information of ~22,000 experiments since the beginning of nuclear science. The principles of the computer database organization, its extended contents and Web applications development are described. New capabilities for the data sets uploads, renormalization, covariance matrix, and inverse reaction calculations are presented in this paper. The EXFOR database, updated monthly, provides an essential support for nuclear data evaluation, application development, and research activities. Finally,more » it is publicly available at the websites of the International Atomic Energy Agency Nuclear Data Section, http://www-nds.iaea.org/exfor, the U.S. National Nuclear Data Center, http://www.nndc.bnl.gov/exfor, and the mirror sites in China, India and Russian Federation.« less

  20. The experimental nuclear reaction data (EXFOR): Extended computer database and Web retrieval system

    NASA Astrophysics Data System (ADS)

    Zerkin, V. V.; Pritychenko, B.

    2018-04-01

    The EXchange FORmat (EXFOR) experimental nuclear reaction database and the associated Web interface provide access to the wealth of low- and intermediate-energy nuclear reaction physics data. This resource is based on numerical data sets and bibliographical information of ∼22,000 experiments since the beginning of nuclear science. The principles of the computer database organization, its extended contents and Web applications development are described. New capabilities for the data sets uploads, renormalization, covariance matrix, and inverse reaction calculations are presented. The EXFOR database, updated monthly, provides an essential support for nuclear data evaluation, application development, and research activities. It is publicly available at the websites of the International Atomic Energy Agency Nuclear Data Section, http://www-nds.iaea.org/exfor, the U.S. National Nuclear Data Center, http://www.nndc.bnl.gov/exfor, and the mirror sites in China, India and Russian Federation.

  1. The experimental nuclear reaction data (EXFOR): Extended computer database and Web retrieval system

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zerkin, V. V.; Pritychenko, B.

    The EXchange FORmat (EXFOR) experimental nuclear reaction database and the associated Web interface provide access to the wealth of low- and intermediate-energy nuclear reaction physics data. This resource is based on numerical data sets and bibliographical information of ~22,000 experiments since the beginning of nuclear science. The principles of the computer database organization, its extended contents and Web applications development are described. New capabilities for the data sets uploads, renormalization, covariance matrix, and inverse reaction calculations are presented in this paper. The EXFOR database, updated monthly, provides an essential support for nuclear data evaluation, application development, and research activities. Finally,more » it is publicly available at the websites of the International Atomic Energy Agency Nuclear Data Section, http://www-nds.iaea.org/exfor, the U.S. National Nuclear Data Center, http://www.nndc.bnl.gov/exfor, and the mirror sites in China, India and Russian Federation.« less

  2. The new 3-(tert-butyl)-1-(2-nitrophenyl)-1H-pyrazol-5-amine: Experimental and computational studies

    NASA Astrophysics Data System (ADS)

    Cuenú, Fernando; Muñoz-Patiño, Natalia; Torres, John Eduard; Abonia, Rodrigo; Toscano, Rubén A.; Cobo, J.

    2017-11-01

    The molecular and supramolecular structure of the title compound, 3-(tertbutyl)-1-(2-nitrophenyl)-1H-pyrazol-5-amine (2NPz) from the single crystal X-ray diffraction (SC-XRD) and spectroscopic data analysis is reported. The computational analysis of the structure, geometry optimization, vibrational frequencies, nuclear magnetic resonance and UV-Vis is also described and compared with experimental data. Satisfactory theoretical aspects were made for the molecule using density functional theory (DFT), with B3LYP and B3PW91 functionals, and Hartree-Fock (HF), with 6-311++G(d,p) basis set, using GAUSSIAN 09 program package without any constraint on the geometry. With VEDA 4 software, vibrational frequencies were assigned in terms of the potential energy distribution while, with the GaussSum software, the percentage contribution of the frontier orbitals at each transition of the electronic absorption spectrum was established. The obtained results indicated that optimized geometry could well reflect the molecular structural parameters from SC-XRD. Theoretical data obtained for the vibrational analysis and NMR spectra are consistent with experimental data.

  3. Distribution of thermal neutrons in a temperature gradient

    NASA Astrophysics Data System (ADS)

    Molinari, V. G.; Pollachini, L.

    A method to determine the spatial distribution of the thermal spectrum of neutrons in heterogeneous systems is presented. The method is based on diffusion concepts and has a simple mathematical structure which increases computing efficiency. The application of this theory to the neutron thermal diffusion induced by a temperature gradient, as found in nuclear reactors, is described. After introducing approximations, a nonlinear equation system representing the neutron temperature is given. Values of the equation parameters and its dependence on geometrical factors and media characteristics are discussed.

  4. Documentation of probabilistic fracture mechanics codes used for reactor pressure vessels subjected to pressurized thermal shock loading: Parts 1 and 2. Final report

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Balkey, K.; Witt, F.J.; Bishop, B.A.

    1995-06-01

    Significant attention has been focused on the issue of reactor vessel pressurized thermal shock (PTS) for many years. Pressurized thermal shock transient events are characterized by a rapid cooldown at potentially high pressure levels that could lead to a reactor vessel integrity concern for some pressurized water reactors. As a result of regulatory and industry efforts in the early 1980`s, a probabilistic risk assessment methodology has been established to address this concern. Probabilistic fracture mechanics analyses are performed as part of this methodology to determine conditional probability of significant flaw extension for given pressurized thermal shock events. While recent industrymore » efforts are underway to benchmark probabilistic fracture mechanics computer codes that are currently used by the nuclear industry, Part I of this report describes the comparison of two independent computer codes used at the time of the development of the original U.S. Nuclear Regulatory Commission (NRC) pressurized thermal shock rule. The work that was originally performed in 1982 and 1983 to compare the U.S. NRC - VISA and Westinghouse (W) - PFM computer codes has been documented and is provided in Part I of this report. Part II of this report describes the results of more recent industry efforts to benchmark PFM computer codes used by the nuclear industry. This study was conducted as part of the USNRC-EPRI Coordinated Research Program for reviewing the technical basis for pressurized thermal shock (PTS) analyses of the reactor pressure vessel. The work focused on the probabilistic fracture mechanics (PFM) analysis codes and methods used to perform the PTS calculations. An in-depth review of the methodologies was performed to verify the accuracy and adequacy of the various different codes. The review was structured around a series of benchmark sample problems to provide a specific context for discussion and examination of the fracture mechanics methodology.« less

  5. Wind Farm LES Simulations Using an Overset Methodology

    NASA Astrophysics Data System (ADS)

    Ananthan, Shreyas; Yellapantula, Shashank

    2017-11-01

    Accurate simulation of wind farm wakes under realistic atmospheric inflow conditions and complex terrain requires modeling a wide range of length and time scales. The computational domain can span several kilometers while requiring mesh resolutions in O(10-6) to adequately resolve the boundary layer on the blade surface. Overset mesh methodology offers an attractive option to address the disparate range of length scales; it allows embedding body-confirming meshes around turbine geomtries within nested wake capturing meshes of varying resolutions necessary to accurately model the inflow turbulence and the resulting wake structures. Dynamic overset hole-cutting algorithms permit relative mesh motion that allow this nested mesh structure to track unsteady inflow direction changes, turbine control changes (yaw and pitch), and wake propagation. An LES model with overset mesh for localized mesh refinement is used to analyze wind farm wakes and performance and compared with local mesh refinements using non-conformal (hanging node) unstructured meshes. Turbine structures will be modeled using both actuator line approaches and fully-resolved structures to test the efficacy of overset methods for wind farm applications. Exascale Computing Project (ECP), Project Number: 17-SC-20-SC, a collaborative effort of two DOE organizations - the Office of Science and the National Nuclear Security Administration.

  6. Neutron Deep Penetration Calculations in Light Water with Monte Carlo TRIPOLI-4® Variance Reduction Techniques

    NASA Astrophysics Data System (ADS)

    Lee, Yi-Kang

    2017-09-01

    Nuclear decommissioning takes place in several stages due to the radioactivity in the reactor structure materials. A good estimation of the neutron activation products distributed in the reactor structure materials impacts obviously on the decommissioning planning and the low-level radioactive waste management. Continuous energy Monte-Carlo radiation transport code TRIPOLI-4 has been applied on radiation protection and shielding analyses. To enhance the TRIPOLI-4 application in nuclear decommissioning activities, both experimental and computational benchmarks are being performed. To calculate the neutron activation of the shielding and structure materials of nuclear facilities, the knowledge of 3D neutron flux map and energy spectra must be first investigated. To perform this type of neutron deep penetration calculations with the Monte Carlo transport code, variance reduction techniques are necessary in order to reduce the uncertainty of the neutron activation estimation. In this study, variance reduction options of the TRIPOLI-4 code were used on the NAIADE 1 light water shielding benchmark. This benchmark document is available from the OECD/NEA SINBAD shielding benchmark database. From this benchmark database, a simplified NAIADE 1 water shielding model was first proposed in this work in order to make the code validation easier. Determination of the fission neutron transport was performed in light water for penetration up to 50 cm for fast neutrons and up to about 180 cm for thermal neutrons. Measurement and calculation results were benchmarked. Variance reduction options and their performance were discussed and compared.

  7. Theoretical Investigations of Well-Defined Graphene Nanostructures: Catalysis, Spectroscopy, and Development of Novel Fragment-Based Models

    NASA Astrophysics Data System (ADS)

    Noffke, Benjamin W.

    Carbon materials have the potential to replace some precious metals in renewable energy applications. These materials are particularly attractive because of the elemental abundance and relatively low nuclear mass of carbon, implying economically feasible and lightweight materials. Targeted design of carbon materials is hindered by the lack of fundamental understanding that is required to tailor their properties for the desired application. However, most available synthetic methods to create carbon materials involve harsh conditions that limit the control of the resulting structure. Without a well-defined structure, the system is too complex and fundamental studies cannot be definitive. This work seeks to gain fundamental understanding through the development and application of efficient computational models for these systems, in conjunction with experiments performed on soluble, well-defined graphene nanostructures prepared by our group using a bottom-up synthetic approach. Theory is used to determine mechanistic details for well-defined carbon systems in applications of catalysis and electrochemical transformations. The resulting computational models do well to explain previous observations of carbon materials and provide suggestions for future directions. However, as the system size of the nanostructures gets larger, the computational cost can become prohibitive. To reduce the computational scaling of quantum chemical calculations, a new fragmentation scheme has been developed that addresses the challenges of fragmenting conjugated molecules. By selecting fragments that retain important structural characteristics in graphene, a more efficient method is achieved. The new method paves the way for an automated, systematic fragmentation scheme of graphene molecules.

  8. Improving Predictions with Reliable Extrapolation Schemes and Better Understanding of Factorization

    NASA Astrophysics Data System (ADS)

    More, Sushant N.

    New insights into the inter-nucleon interactions, developments in many-body technology, and the surge in computational capabilities has led to phenomenal progress in low-energy nuclear physics in the past few years. Nonetheless, many calculations still lack a robust uncertainty quantification which is essential for making reliable predictions. In this work we investigate two distinct sources of uncertainty and develop ways to account for them. Harmonic oscillator basis expansions are widely used in ab-initio nuclear structure calculations. Finite computational resources usually require that the basis be truncated before observables are fully converged, necessitating reliable extrapolation schemes. It has been demonstrated recently that errors introduced from basis truncation can be taken into account by focusing on the infrared and ultraviolet cutoffs induced by a truncated basis. We show that a finite oscillator basis effectively imposes a hard-wall boundary condition in coordinate space. We accurately determine the position of the hard-wall as a function of oscillator space parameters, derive infrared extrapolation formulas for the energy and other observables, and discuss the extension of this approach to higher angular momentum and to other localized bases. We exploit the duality of the harmonic oscillator to account for the errors introduced by a finite ultraviolet cutoff. Nucleon knockout reactions have been widely used to study and understand nuclear properties. Such an analysis implicitly assumes that the effects of the probe can be separated from the physics of the target nucleus. This factorization between nuclear structure and reaction components depends on the renormalization scale and scheme, and has not been well understood. But it is potentially critical for interpreting experiments and for extracting process-independent nuclear properties. We use a class of unitary transformations called the similarity renormalization group (SRG) transformations to systematically study the scale dependence of factorization for the simplest knockout process of deuteron electrodisintegration. We find that the extent of scale dependence depends strongly on kinematics, but in a systematic way. We find a relatively weak scale dependence at the quasi-free kinematics that gets progressively stronger as one moves away from the quasi-free region. Based on examination of the relevant overlap matrix elements, we are able to qualitatively explain and even predict the nature of scale dependence based on the kinematics under consideration.

  9. Integrative, Dynamic Structural Biology at Atomic Resolution—It’s About Time

    PubMed Central

    van den Bedem, Henry; Fraser, James S.

    2015-01-01

    Biomolecules adopt a dynamic ensemble of conformations, each with the potential to interact with binding partners or perform the chemical reactions required for a multitude of cellular functions. Recent advances in X-ray crystallography, Nuclear Magnetic Resonance (NMR) spectroscopy, and other techniques are helping us realize the dream of seeing—in atomic detail—how different parts of biomolecules exchange between functional sub-states using concerted motions. Integrative structural biology has advanced our understanding of the formation of large macromolecular complexes and how their components interact in assemblies by leveraging data from many low-resolution methods. Here, we review the growing opportunities for integrative, dynamic structural biology at the atomic scale, contending there is increasing synergistic potential between X-ray crystallography, NMR, and computer simulations to reveal a structural basis for protein conformational dynamics at high resolution. PMID:25825836

  10. Modeling of fracture of protective concrete structures under impact loads

    NASA Astrophysics Data System (ADS)

    Radchenko, P. A.; Batuev, S. P.; Radchenko, A. V.; Plevkov, V. S.

    2015-10-01

    This paper presents results of numerical simulation of interaction between a Boeing 747-400 aircraft and the protective shell of a nuclear power plant. The shell is presented as a complex multilayered cellular structure consisting of layers of concrete and fiber concrete bonded with steel trusses. Numerical simulation was performed three-dimensionally using the original algorithm and software taking into account algorithms for building grids of complex geometric objects and parallel computations. Dynamics of the stress-strain state and fracture of the structure were studied. Destruction is described using a two-stage model that allows taking into account anisotropy of elastic and strength properties of concrete and fiber concrete. It is shown that wave processes initiate destruction of the cellular shell structure; cells start to destruct in an unloading wave originating after the compression wave arrival at free cell surfaces.

  11. BigData and computing challenges in high energy and nuclear physics

    NASA Astrophysics Data System (ADS)

    Klimentov, A.; Grigorieva, M.; Kiryanov, A.; Zarochentsev, A.

    2017-06-01

    In this contribution we discuss the various aspects of the computing resource needs experiments in High Energy and Nuclear Physics, in particular at the Large Hadron Collider. This will evolve in the future when moving from LHC to HL-LHC in ten years from now, when the already exascale levels of data we are processing could increase by a further order of magnitude. The distributed computing environment has been a great success and the inclusion of new super-computing facilities, cloud computing and volunteering computing for the future is a big challenge, which we are successfully mastering with a considerable contribution from many super-computing centres around the world, academic and commercial cloud providers. We also discuss R&D computing projects started recently in National Research Center ``Kurchatov Institute''

  12. Microdosimetric study for nanosecond pulsed electric fields on a cell circuit model with nucleus.

    PubMed

    Denzi, Agnese; Merla, Caterina; Camilleri, Paola; Paffi, Alessandra; d'Inzeo, Guglielmo; Apollonio, Francesca; Liberti, Micaela

    2013-10-01

    Recently, scientific interest in electric pulses, always more intense and shorter and able to induce biological effects on both plasma and nuclear membranes, has greatly increased. Hence, microdosimetric models that include internal organelles like the nucleus have assumed increasing importance. In this work, a circuit model of the cell including the nucleus is proposed, which accounts for the dielectric dispersion of all cell compartments. The setup of the dielectric model of the nucleus is of fundamental importance in determining the transmembrane potential (TMP) induced on the nuclear membrane; here, this is demonstrated by comparing results for three different sets of nuclear dielectric properties present in the literature. The results have been compared, even including or disregarding the dielectric dispersion of the nucleus. The main differences have been found when using pulses shorter than 10 ns. This is due to the fact that the high spectral components of the shortest pulses are differently taken into account by the nuclear membrane transfer functions computed with and without nuclear dielectric dispersion. The shortest pulses are also the most effective in porating the intracellular structures, as confirmed by the time courses of the TMP calculated across the plasma and nuclear membranes. We show how dispersive nucleus models are unavoidable when dealing with pulses shorter than 10 ns because of the large spectral contents arriving above 100 MHz, i.e., over the typical relaxation frequencies of the dipolar mechanism of the molecules constituting the nuclear membrane and the subcellular cell compartments.

  13. Efficacy of the SU(3) scheme for ab initio large-scale calculations beyond the lightest nuclei

    DOE PAGES

    Dytrych, T.; Maris, P.; Launey, K. D.; ...

    2016-06-22

    We report on the computational characteristics of ab initio nuclear structure calculations in a symmetry-adapted no-core shell model (SA-NCSM) framework. We examine the computational complexity of the current implementation of the SA-NCSM approach, dubbed LSU3shell, by analyzing ab initio results for 6Li and 12C in large harmonic oscillator model spaces and SU3-selected subspaces. We demonstrate LSU3shell’s strong-scaling properties achieved with highly-parallel methods for computing the many-body matrix elements. Results compare favorably with complete model space calculations and significant memory savings are achieved in physically important applications. In particular, a well-chosen symmetry-adapted basis affords memory savings in calculations of states withmore » a fixed total angular momentum in large model spaces while exactly preserving translational invariance.« less

  14. Efficacy of the SU(3) scheme for ab initio large-scale calculations beyond the lightest nuclei

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dytrych, T.; Maris, Pieter; Launey, K. D.

    2016-06-09

    We report on the computational characteristics of ab initio nuclear structure calculations in a symmetry-adapted no-core shell model (SA-NCSM) framework. We examine the computational complexity of the current implementation of the SA-NCSM approach, dubbed LSU3shell, by analyzing ab initio results for 6Li and 12C in large harmonic oscillator model spaces and SU(3)-selected subspaces. We demonstrate LSU3shell's strong-scaling properties achieved with highly-parallel methods for computing the many-body matrix elements. Results compare favorably with complete model space calculations and signi cant memory savings are achieved in physically important applications. In particular, a well-chosen symmetry-adapted basis a ords memory savings in calculations ofmore » states with a fixed total angular momentum in large model spaces while exactly preserving translational invariance.« less

  15. Lecture Notes on Criticality Safety Validation Using MCNP & Whisper

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Brown, Forrest B.; Rising, Michael Evan; Alwin, Jennifer Louise

    Training classes for nuclear criticality safety, MCNP documentation. The need for, and problems surrounding, validation of computer codes and data area considered first. Then some background for MCNP & Whisper is given--best practices for Monte Carlo criticality calculations, neutron spectra, S(α,β) thermal neutron scattering data, nuclear data sensitivities, covariance data, and correlation coefficients. Whisper is computational software designed to assist the nuclear criticality safety analyst with validation studies with the Monte Carlo radiation transport package MCNP. Whisper's methodology (benchmark selection – C k's, weights; extreme value theory – bias, bias uncertainty; MOS for nuclear data uncertainty – GLLS) and usagemore » are discussed.« less

  16. Complex-energy approach to sum rules within nuclear density functional theory

    DOE PAGES

    Hinohara, Nobuo; Kortelainen, Markus; Nazarewicz, Witold; ...

    2015-04-27

    The linear response of the nucleus to an external field contains unique information about the effective interaction, correlations governing the behavior of the many-body system, and properties of its excited states. To characterize the response, it is useful to use its energy-weighted moments, or sum rules. By comparing computed sum rules with experimental values, the information content of the response can be utilized in the optimization process of the nuclear Hamiltonian or nuclear energy density functional (EDF). But the additional information comes at a price: compared to the ground state, computation of excited states is more demanding. To establish anmore » efficient framework to compute energy-weighted sum rules of the response that is adaptable to the optimization of the nuclear EDF and large-scale surveys of collective strength, we have developed a new technique within the complex-energy finite-amplitude method (FAM) based on the quasiparticle random- phase approximation. The proposed sum-rule technique based on the complex-energy FAM is a tool of choice when optimizing effective interactions or energy functionals. The method is very efficient and well-adaptable to parallel computing. As a result, the FAM formulation is especially useful when standard theorems based on commutation relations involving the nuclear Hamiltonian and external field cannot be used.« less

  17. Computer modeling and simulators as part of university training for NPP operating personnel

    NASA Astrophysics Data System (ADS)

    Volman, M.

    2017-01-01

    This paper considers aspects of a program for training future nuclear power plant personnel developed by the NPP Department of Ivanovo State Power Engineering University. Computer modeling is used for numerical experiments on the kinetics of nuclear reactors in Mathcad. Simulation modeling is carried out on the computer and full-scale simulator of water-cooled power reactor for the simulation of neutron-physical reactor measurements and the start-up - shutdown process.

  18. Role for Tyrosine Phosphorylation of A-kinase Anchoring Protein 8 (AKAP8) in Its Dissociation from Chromatin and the Nuclear Matrix.

    PubMed

    Kubota, Sho; Morii, Mariko; Yuki, Ryuzaburo; Yamaguchi, Noritaka; Yamaguchi, Hiromi; Aoyama, Kazumasa; Kuga, Takahisa; Tomonaga, Takeshi; Yamaguchi, Naoto

    2015-04-24

    Protein-tyrosine phosphorylation regulates a wide variety of cellular processes at the plasma membrane. Recently, we showed that nuclear tyrosine kinases induce global nuclear structure changes, which we called chromatin structural changes. However, the mechanisms are not fully understood. In this study we identify protein kinase A anchoring protein 8 (AKAP8/AKAP95), which associates with chromatin and the nuclear matrix, as a nuclear tyrosine-phosphorylated protein. Tyrosine phosphorylation of AKAP8 is induced by several tyrosine kinases, such as Src, Fyn, and c-Abl but not Syk. Nucleus-targeted Lyn and c-Src strongly dissociate AKAP8 from chromatin and the nuclear matrix in a kinase activity-dependent manner. The levels of tyrosine phosphorylation of AKAP8 are decreased by substitution of multiple tyrosine residues on AKAP8 into phenylalanine. Importantly, the phenylalanine mutations of AKAP8 inhibit its dissociation from nuclear structures, suggesting that the association/dissociation of AKAP8 with/from nuclear structures is regulated by its tyrosine phosphorylation. Furthermore, the phenylalanine mutations of AKAP8 suppress the levels of nuclear tyrosine kinase-induced chromatin structural changes. In contrast, AKAP8 knockdown increases the levels of chromatin structural changes. Intriguingly, stimulation with hydrogen peroxide induces chromatin structural changes accompanied by the dissociation of AKAP8 from nuclear structures. These results suggest that AKAP8 is involved in the regulation of chromatin structural changes through nuclear tyrosine phosphorylation. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  19. 1985 Nuclear Science Symposium, 32nd, and 1985 Symposium on Nuclear Power Systems, 17th, San Francisco, CA, October 23-25, 1985, Proceedings

    NASA Technical Reports Server (NTRS)

    1986-01-01

    The present conference ranges over topics in high energy physics instrumentation, detectors, nuclear medical applications, health physics and environmental monitoring, reactor instrumentation, nuclear spacecraft instrumentation, the 'Fastbus' data acquisition system, circuits and systems for nuclear research facilities, and the development status of nuclear power systems. Specific attention is given to CCD high precision detectors, a drift chamber preamplifier, a Cerenkov ring imaging detector, novel scintillation glasses and scintillating fibers, a modular multidrift vertex detector, radial wire drift chambers, liquid argon polarimeters, a multianode photomultiplier, the reliability of planar silicon detectors, the design and manufacture of wedge and strip anodes, ultrafast triode photodetectors, photomultiplier tubes, a barium fluoride plastic scintillator, a fine grained neutron hodoscope, the stability of low leakage silicon photodiodes for crystal calorimeters, and X-ray proportional counters. Also considered are positron emission tomography, single photon emission computed tomography, nuclear magnetic resonance imaging, Geiger-Muller detectors, nuclear plant safeguards, a 32-bit Fastbus computer, an advanced light water reactor, and nuclear plant maintenance.

  20. Co-ordination of the International Network of Nuclear Structure and Decay Data Evaluators; Summary Report of an IAEA Technical Meeting

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Abriola, D.; Tuli, J.

    The IAEA Nuclear Data Section convened the 18th meeting of the International Network of Nuclear Structure and Decay Data Evaluators at the IAEA Headquarters, Vienna, 23 to 27 March 2009. This meeting was attended by 22 scientists from 14 Member States, plus IAEA staff, concerned with the compilation, evaluation and dissemination of nuclear structure and decay data. A summary of the meeting, recommendations/conclusions, data centre reports, and various proposals considered, modified and agreed by the participants are contained within this document. The International Network of Nuclear Structure and Decay Data (NSDD) Evaluators holds biennial meetings under the auspices of themore » IAEA, and consists of evaluation groups and data service centres in several countries. This network has the objective of providing up-to-date nuclear structure and decay data for all known nuclides by evaluating all existing experimental data. Data resulting from this international evaluation collaboration is included in the Evaluated Nuclear Structure Data File (ENSDF) and published in the journals Nuclear Physics A and Nuclear Data Sheets (NDS).« less

  1. Multiscale integral analysis of a HT leakage in a fusion nuclear power plant

    NASA Astrophysics Data System (ADS)

    Velarde, M.; Fradera, J.; Perlado, J. M.; Zamora, I.; Martínez-Saban, E.; Colomer, C.; Briani, P.

    2016-05-01

    The present work presents an example of the application of an integral methodology based on a multiscale analysis that covers the whole tritium cycle within a nuclear fusion power plant, from a micro scale, analyzing key components where tritium is leaked through permeation, to a macro scale, considering its atmospheric transport. A leakage from the Nuclear Power Plants, (NPP) primary to the secondary side of a heat exchanger (HEX) is considered for the present example. Both primary and secondary loop coolants are assumed to be He. Leakage is placed inside the HEX, leaking tritium in elementary tritium (HT) form to the secondary loop where it permeates through the piping structural material to the exterior. The Heating Ventilation and Air Conditioning (HVAC) system removes the leaked tritium towards the NPP exhaust. The HEX is modelled with system codes and coupled to Computational Fluid Dynamic (CFD) to account for tritium dispersion inside the nuclear power plants buildings and in site environment. Finally, tritium dispersion is calculated with an atmospheric transport code and a dosimetry analysis is carried out. Results show how the implemented methodology is capable of assessing the impact of tritium from the microscale to the atmospheric scale including the dosimetric aspect.

  2. Quantum fluctuations of a fullerene cage modulate its internal magnetic environment.

    PubMed

    Kawatsu, Tsutomu; Tachikawa, Masanori

    2018-01-17

    To investigate the effect of quantum fluctuations on the magnetic environment inside a C 60 fullerene cage, we have calculated the nuclear magnetic shielding constant of protons in H 2 @C 60 and HD@C 60 systems by on-the-fly ab initio path integral simulation, including both thermal and nuclear quantum effects. The most dominant upfield from an isolated hydrogen molecule occurs due to the diamagnetic current of the C 60 cage, which is partly cancelled by the paramagnetic current, where the paramagnetic contribution is enlarged by the zero-point vibrational fluctuation of the C 60 carbon backbone structure via a widely distributed HOMO-LUMO gap. This quantum modulation mechanism of the nuclear magnetic shielding constant is newly proposed. Because this quantum effect is independent of the difference between H 2 and HD, the H 2 /HD isotope shift occurs in spite of the C 60 cage. The nuclear magnetic constants computed for H 2 @C 60 and HD@C 60 are 32.047 and 32.081 ppm, respectively, which are in reasonable agreement with the corresponding values of 32.19 and 32.23 ppm estimated from the experimental values of the chemical shifts.

  3. Emergent properties of nuclei from ab initio coupled-cluster calculations

    NASA Astrophysics Data System (ADS)

    Hagen, G.; Hjorth-Jensen, M.; Jansen, G. R.; Papenbrock, T.

    2016-06-01

    Emergent properties such as nuclear saturation and deformation, and the effects on shell structure due to the proximity of the scattering continuum and particle decay channels are fascinating phenomena in atomic nuclei. In recent years, ab initio approaches to nuclei have taken the first steps towards tackling the computational challenge of describing these phenomena from Hamiltonians with microscopic degrees of freedom. This endeavor is now possible due to ideas from effective field theories, novel optimization strategies for nuclear interactions, ab initio methods exhibiting a soft scaling with mass number, and ever-increasing computational power. This paper reviews some of the recent accomplishments. We also present new results. The recently optimized chiral interaction NNLO{}{{sat}} is shown to provide an accurate description of both charge radii and binding energies in selected light- and medium-mass nuclei up to 56Ni. We derive an efficient scheme for including continuum effects in coupled-cluster computations of nuclei based on chiral nucleon-nucleon and three-nucleon forces, and present new results for unbound states in the neutron-rich isotopes of oxygen and calcium. The coupling to the continuum impacts the energies of the {J}π =1/{2}-,3/{2}-,7/{2}-,3/{2}+ states in {}{17,23,25}O, and—contrary to naive shell-model expectations—the level ordering of the {J}π =3/{2}+,5/{2}+,9/{2}+ states in {}{53,55,61}Ca. ).

  4. Structural Model of the Bilitranslocase Transmembrane Domain Supported by NMR and FRET Data.

    PubMed

    Roy Choudhury, Amrita; Sikorska, Emilia; van den Boom, Johannes; Bayer, Peter; Popenda, Łukasz; Szutkowski, Kosma; Jurga, Stefan; Bonomi, Massimiliano; Sali, Andrej; Zhukov, Igor; Passamonti, Sabina; Novič, Marjana

    2015-01-01

    We present a 3D model of the four transmembrane (TM) helical regions of bilitranslocase (BTL), a structurally uncharacterized protein that transports organic anions across the cell membrane. The model was computed by considering helix-helix interactions as primary constraints, using Monte Carlo simulations. The interactions between the TM2 and TM3 segments have been confirmed by Förster resonance energy transfer (FRET) spectroscopy and nuclear magnetic resonance (NMR) spectroscopy, increasing our confidence in the model. Several insights into the BTL transport mechanism were obtained by analyzing the model. For example, the observed cis-trans Leu-Pro peptide bond isomerization in the TM3 fragment may indicate a key conformational change during anion transport by BTL. Our structural model of BTL may facilitate further studies, including drug discovery.

  5. Experimental shielding evaluation of the radiation protection provided by the structurally significant components of residential structures.

    PubMed

    Dickson, E D; Hamby, D M

    2014-03-01

    The human health and environmental effects following a postulated accidental release of radioactive material to the environment have been a public and regulatory concern since the early development of nuclear technology. These postulated releases have been researched extensively to better understand the potential risks for accident mitigation and emergency planning purposes. The objective of this investigation is to provide an updated technical basis for contemporary building shielding factors for the US housing stock. Building shielding factors quantify the protection from ionising radiation provided by a certain building type. Much of the current data used to determine the quality of shielding around nuclear facilities and urban environments is based on simplistic point-kernel calculations for 1950s era suburbia and is no longer applicable to the densely populated urban environments realised today. To analyse a building's radiation shielding properties, the ideal approach would be to subject a variety of building types to various radioactive sources and measure the radiation levels in and around the building. While this is not entirely practicable, this research analyses the shielding effectiveness of ten structurally significant US housing-stock models (walls and roofs) important for shielding against ionising radiation. The experimental data are used to benchmark computational models to calculate the shielding effectiveness of various building configurations under investigation from two types of realistic environmental source terms. Various combinations of these ten shielding models can be used to develop full-scale computational housing-unit models for building shielding factor calculations representing 69.6 million housing units (61.3%) in the United States. Results produced in this investigation provide a comparison between theory and experiment behind building shielding factor methodology.

  6. Machine learning of molecular electronic properties in chemical compound space

    NASA Astrophysics Data System (ADS)

    Montavon, Grégoire; Rupp, Matthias; Gobre, Vivekanand; Vazquez-Mayagoitia, Alvaro; Hansen, Katja; Tkatchenko, Alexandre; Müller, Klaus-Robert; Anatole von Lilienfeld, O.

    2013-09-01

    The combination of modern scientific computing with electronic structure theory can lead to an unprecedented amount of data amenable to intelligent data analysis for the identification of meaningful, novel and predictive structure-property relationships. Such relationships enable high-throughput screening for relevant properties in an exponentially growing pool of virtual compounds that are synthetically accessible. Here, we present a machine learning model, trained on a database of ab initio calculation results for thousands of organic molecules, that simultaneously predicts multiple electronic ground- and excited-state properties. The properties include atomization energy, polarizability, frontier orbital eigenvalues, ionization potential, electron affinity and excitation energies. The machine learning model is based on a deep multi-task artificial neural network, exploiting the underlying correlations between various molecular properties. The input is identical to ab initio methods, i.e. nuclear charges and Cartesian coordinates of all atoms. For small organic molecules, the accuracy of such a ‘quantum machine’ is similar, and sometimes superior, to modern quantum-chemical methods—at negligible computational cost.

  7. SAFSIM theory manual: A computer program for the engineering simulation of flow systems

    NASA Astrophysics Data System (ADS)

    Dobranich, Dean

    1993-12-01

    SAFSIM (System Analysis Flow SIMulator) is a FORTRAN computer program for simulating the integrated performance of complex flow systems. SAFSIM provides sufficient versatility to allow the engineering simulation of almost any system, from a backyard sprinkler system to a clustered nuclear reactor propulsion system. In addition to versatility, speed and robustness are primary SAFSIM development goals. SAFSIM contains three basic physics modules: (1) a fluid mechanics module with flow network capability; (2) a structure heat transfer module with multiple convection and radiation exchange surface capability; and (3) a point reactor dynamics module with reactivity feedback and decay heat capability. Any or all of the physics modules can be implemented, as the problem dictates. SAFSIM can be used for compressible and incompressible, single-phase, multicomponent flow systems. Both the fluid mechanics and structure heat transfer modules employ a one-dimensional finite element modeling approach. This document contains a description of the theory incorporated in SAFSIM, including the governing equations, the numerical methods, and the overall system solution strategies.

  8. Magnetic contributions in Bekenstein type models

    NASA Astrophysics Data System (ADS)

    Kraiselburd, Lucila; Castillo, Florencia L.; Mosquera, Mercedes E.; Vucetich, Héctor

    2018-02-01

    In this work, we analyze the spatial and time variation of the fine structure constant (α ) upon the theoretical framework developed by Bekenstein (Phys. Rev. D 66, 123514 (2002), 10.1103/PhysRevD.66.123514). We have computed the field ψ related to α at first order of the weak-field approximation and have also improved the estimation of the nuclear magnetic energy and, therefore, their contributions to the source term in the equation of motion of ψ . We obtained that the results are similar to the ones published in L. Kraiselburd and H. Vucetich, Int. J. Mod. Phys. E 20, 101 (2011) which were computed using the zero order of the approximation, showing that one can neglect the first order contribution to the variation of the fine structure constant. Through the comparison between our theoretical results and the observational data of the Eötvös-type experiments or the time variation of α over the cosmological time scale, we set constraints on the free parameter of the Bekenstein model, namely the Bekenstein length.

  9. Neutron Transmission of Single-crystal Sapphire Filters

    NASA Astrophysics Data System (ADS)

    Adib, M.; Kilany, M.; Habib, N.; Fathallah, M.

    2005-05-01

    An additive formula is given that permits the calculation of the nuclear capture, thermal diffuse and Bragg scattering cross-sections as a function of sapphire temperature and crystal parameters. We have developed a computer program that allows calculations of the thermal neutron transmission for the sapphire rhombohedral structure and its equivalent trigonal structure. The calculated total cross-section values and effective attenuation coefficient for single-crystalline sapphire at different temperatures are compared with measured values. Overall agreement is indicated between the formula and experimental data. We discuss the use of sapphire single crystal as a thermal neutron filter in terms of the optimum cystal thickness, mosaic spread, temperature, cutting plane and tuning for efficient transmission of thermal-reactor neutrons.

  10. 76 FR 60939 - Metal Fatigue Analysis Performed by Computer Software

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-09-30

    ... Nuclear Power Plants,'' Revision 2, issued December 2010, which recommends that the effects of the reactor... design control in accordance with Appendix B, ``Quality Assurance Criteria for Nuclear Power Plants and... Nuclear Power Plants.'' Intent The U.S. Nuclear Regulatory Commission (NRC) is issuing this regulatory...

  11. Nuclear-Recoil Differential Cross Sections for the Two Photon Double Ionization of Helium

    NASA Astrophysics Data System (ADS)

    Abdel Naby, Shahin; Ciappina, M. F.; Lee, T. G.; Pindzola, M. S.; Colgan, J.

    2013-05-01

    In support of the reaction microscope measurements at the free-electron laser facility at Hamburg (FLASH), we use the time-dependent close-coupling method (TDCC) to calculate fully differential nuclear-recoil cross sections for the two-photon double ionization of He at photon energy of 44 eV. The total cross section for the double ionization is in good agreement with previous calculations. The nuclear-recoil distribution is in good agreement with the experimental measurements. In contrast to the single-photon double ionization, maximum nuclear recoil triple differential cross section is obtained at small nuclear momenta. This work was supported in part by grants from NSF and US DoE. Computational work was carried out at NERSC in Oakland, California and the National Institute for Computational Sciences in Knoxville, Tennessee.

  12. Comprehensive Digital Imaging Network Project At Georgetown University Hospital

    NASA Astrophysics Data System (ADS)

    Mun, Seong K.; Stauffer, Douglas; Zeman, Robert; Benson, Harold; Wang, Paul; Allman, Robert

    1987-10-01

    The radiology practice is going through rapid changes due to the introduction of state-of-the-art computed based technologies. For the last twenty years we have witnessed the introduction of many new medical diagnostic imaging systems such as x-ray computed tomo-graphy, digital subtraction angiography (DSA), computerized nuclear medicine, single pho-ton emission computed tomography (SPECT), positron emission tomography (PET) and more re-cently, computerized digital radiography and nuclear magnetic resonance imaging (MRI). Other than the imaging systems, there has been a steady introduction of computed based information systems for radiology departments and hospitals.

  13. i-PI: A Python interface for ab initio path integral molecular dynamics simulations

    NASA Astrophysics Data System (ADS)

    Ceriotti, Michele; More, Joshua; Manolopoulos, David E.

    2014-03-01

    Recent developments in path integral methodology have significantly reduced the computational expense of including quantum mechanical effects in the nuclear motion in ab initio molecular dynamics simulations. However, the implementation of these developments requires a considerable programming effort, which has hindered their adoption. Here we describe i-PI, an interface written in Python that has been designed to minimise the effort required to bring state-of-the-art path integral techniques to an electronic structure program. While it is best suited to first principles calculations and path integral molecular dynamics, i-PI can also be used to perform classical molecular dynamics simulations, and can just as easily be interfaced with an empirical forcefield code. To give just one example of the many potential applications of the interface, we use it in conjunction with the CP2K electronic structure package to showcase the importance of nuclear quantum effects in high-pressure water. Catalogue identifier: AERN_v1_0 Program summary URL: http://cpc.cs.qub.ac.uk/summaries/AERN_v1_0.html Program obtainable from: CPC Program Library, Queen’s University, Belfast, N. Ireland Licensing provisions: GNU General Public License, version 3 No. of lines in distributed program, including test data, etc.: 138626 No. of bytes in distributed program, including test data, etc.: 3128618 Distribution format: tar.gz Programming language: Python. Computer: Multiple architectures. Operating system: Linux, Mac OSX, Windows. RAM: Less than 256 Mb Classification: 7.7. External routines: NumPy Nature of problem: Bringing the latest developments in the modelling of nuclear quantum effects with path integral molecular dynamics to ab initio electronic structure programs with minimal implementational effort. Solution method: State-of-the-art path integral molecular dynamics techniques are implemented in a Python interface. Any electronic structure code can be patched to receive the atomic coordinates from the Python interface, and to return the forces and energy that are used to integrate the equations of motion. Restrictions: This code only deals with distinguishable particles. It does not include fermonic or bosonic exchanges between equivalent nuclei, which can become important at very low temperatures. Running time: Depends dramatically on the nature of the simulation being performed. A few minutes for short tests with empirical force fields, up to several weeks for production calculations with ab initio forces. The examples provided with the code run in less than an hour.

  14. Studying the Effects of Nuclear Weapons Using a Slide-Rule Computer

    ERIC Educational Resources Information Center

    Shastri, Ananda

    2007-01-01

    This paper describes the construction of a slide-rule computer that allows one to quickly determine magnitudes of several effects that result from the detonation of a nuclear device. Suggestions for exercises are also included that allow high school and college-level physics students to explore scenarios involving these effects. It is hoped that…

  15. SINE_scan: an efficient tool to discover short interspersed nuclear elements (SINEs) in large-scale genomic datasets.

    PubMed

    Mao, Hongliang; Wang, Hao

    2017-03-01

    Short Interspersed Nuclear Elements (SINEs) are transposable elements (TEs) that amplify through a copy-and-paste mode via RNA intermediates. The computational identification of new SINEs are challenging because of their weak structural signals and rapid diversification in sequences. Here we report SINE_Scan, a highly efficient program to predict SINE elements in genomic DNA sequences. SINE_Scan integrates hallmark of SINE transposition, copy number and structural signals to identify a SINE element. SINE_Scan outperforms the previously published de novo SINE discovery program. It shows high sensitivity and specificity in 19 plant and animal genome assemblies, of which sizes vary from 120 Mb to 3.5 Gb. It identifies numerous new families and substantially increases the estimation of the abundance of SINEs in these genomes. The code of SINE_Scan is freely available at http://github.com/maohlzj/SINE_Scan , implemented in PERL and supported on Linux. wangh8@fudan.edu.cn. Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press.

  16. SINE_scan: an efficient tool to discover short interspersed nuclear elements (SINEs) in large-scale genomic datasets

    PubMed Central

    Mao, Hongliang

    2017-01-01

    Abstract Motivation: Short Interspersed Nuclear Elements (SINEs) are transposable elements (TEs) that amplify through a copy-and-paste mode via RNA intermediates. The computational identification of new SINEs are challenging because of their weak structural signals and rapid diversification in sequences. Results: Here we report SINE_Scan, a highly efficient program to predict SINE elements in genomic DNA sequences. SINE_Scan integrates hallmark of SINE transposition, copy number and structural signals to identify a SINE element. SINE_Scan outperforms the previously published de novo SINE discovery program. It shows high sensitivity and specificity in 19 plant and animal genome assemblies, of which sizes vary from 120 Mb to 3.5 Gb. It identifies numerous new families and substantially increases the estimation of the abundance of SINEs in these genomes. Availability and Implementation: The code of SINE_Scan is freely available at http://github.com/maohlzj/SINE_Scan, implemented in PERL and supported on Linux. Contact: wangh8@fudan.edu.cn Supplementary information: Supplementary data are available at Bioinformatics online. PMID:28062442

  17. Impact of steam explosion on the wheat straw lignin structure studied by solution-state nuclear magnetic resonance and density functional methods.

    PubMed

    Heikkinen, Harri; Elder, Thomas; Maaheimo, Hannu; Rovio, Stella; Rahikainen, Jenni; Kruus, Kristiina; Tamminen, Tarja

    2014-10-29

    Chemical changes of lignin induced by the steam explosion (SE) process were elucidated. Wheat straw was studied as the raw material, and lignins were isolated by the enzymatic mild acidolysis lignin (EMAL) procedure before and after the SE treatment for analyses mainly by two-dimensional (2D) [heteronuclear single-quantum coherence (HSQC) and heteronuclear multiple-bond correlation (HMBC)] and (31)P nuclear magnetic resonance (NMR). The β-O-4 structures were found to be homolytically cleaved, followed by recoupling to β-5 linkages. The homolytic cleavage/recoupling reactions were also studied by computational methods, which verified their thermodynamic feasibility. The presence of the tricin bound to wheat straw lignin was confirmed, and it was shown to participate in lignin reactions during the SE treatment. The preferred homolytic β-O-4 cleavage reaction was calculated to follow bond dissociation energies: G-O-G (guaiacyl) (69.7 kcal/mol) > G-O-S (syringyl) (68.4 kcal/mol) > G-O-T (tricin) (67.0 kcal/mol).

  18. Computer programs of information processing of nuclear physical methods as a demonstration material in studying nuclear physics and numerical methods

    NASA Astrophysics Data System (ADS)

    Bateev, A. B.; Filippov, V. P.

    2017-01-01

    The principle possibility of using computer program Univem MS for Mössbauer spectra fitting as a demonstration material at studying such disciplines as atomic and nuclear physics and numerical methods by students is shown in the article. This program is associated with nuclear-physical parameters such as isomer (or chemical) shift of nuclear energy level, interaction of nuclear quadrupole moment with electric field and of magnetic moment with surrounded magnetic field. The basic processing algorithm in such programs is the Least Square Method. The deviation of values of experimental points on spectra from the value of theoretical dependence is defined on concrete examples. This value is characterized in numerical methods as mean square deviation. The shape of theoretical lines in the program is defined by Gaussian and Lorentzian distributions. The visualization of the studied material on atomic and nuclear physics can be improved by similar programs of the Mössbauer spectroscopy, X-ray Fluorescence Analyzer or X-ray diffraction analysis.

  19. Radiochemical data collected on events from which radioactivity escaped beyond the borders of the Nevada test range complex. [NONE

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hicks, H.G.

    1981-02-12

    This report identifies all nuclear events in Nevada that are known to have sent radioactivity beyond the borders of the test range complex. There have been 177 such tests, representing seven different types: nuclear detonations in the atmosphere, nuclear excavation events, nuclear safety events, underground nuclear events that inadvertently seeped or vented to the atmosphere, dispersion of plutonium and/or uranium by chemical high explosives, nuclear rocket engine tests, and nuclear ramjet engine tests. The source term for each of these events is given, together with the data base from which it was derived (except where the data are classified). Themore » computer programs used for organizing and processing the data base and calculating radionuclide production are described and included, together with the input and output data and details of the calculations. This is the basic formation needed to make computer modeling studies of the fallout from any of these 177 events.« less

  20. Crystallographic and Computational Analyses of AUUCU Repeating RNA That Causes Spinocerebellar Ataxia Type 10 (SCA10).

    PubMed

    Park, HaJeung; González, Àlex L; Yildirim, Ilyas; Tran, Tuan; Lohman, Jeremy R; Fang, Pengfei; Guo, Min; Disney, Matthew D

    2015-06-23

    Spinocerebellar ataxia type 10 (SCA10) is caused by a pentanucleotide repeat expansion of r(AUUCU) within intron 9 of the ATXN10 pre-mRNA. The RNA causes disease by a gain-of-function mechanism in which it inactivates proteins involved in RNA biogenesis. Spectroscopic studies showed that r(AUUCU) repeats form a hairpin structure; however, there were no high-resolution structural models prior to this work. Herein, we report the first crystal structure of model r(AUUCU) repeats refined to 2.8 Å and analysis of the structure via molecular dynamics simulations. The r(AUUCU) tracts adopt an overall A-form geometry in which 3 × 3 nucleotide (5')UCU(3')/(3')UCU(5') internal loops are closed by AU pairs. Helical parameters of the refined structure as well as the corresponding electron density map on the crystallographic model reflect dynamic features of the internal loop. The computational analyses captured dynamic motion of the loop closing pairs, which can form single-stranded conformations with relatively low energies. Overall, the results presented here suggest the possibility for r(AUUCU) repeats to form metastable A-from structures, which can rearrange into single-stranded conformations and attract proteins such as heterogeneous nuclear ribonucleoprotein K (hnRNP K). The information presented here may aid in the rational design of therapeutics targeting this RNA.

  1. Crystallographic and Computational Analyses of AUUCU Repeating RNA That Causes Spinocerebellar Ataxia Type 10 (SCA10)

    PubMed Central

    Park, HaJeung; González, Àlex L.; Yildirim, Ilyas; Tran, Tuan; Lohman, Jeremy R.; Fang, Pengfei; Guo, Min; Disney, Matthew D.

    2016-01-01

    Spinocerebellar ataxia type 10 (SCA10) is caused by a pentanucleotide repeat expansion of r(AUUCU) within intron 9 of the ATXN10 pre-mRNA. The RNA causes disease by a gain-of-function mechanism in which it inactivates proteins involved in RNA biogenesis. Spectroscopic studies showed that r(AUUCU) repeats form a hairpin structure; however, there were no high-resolution structural models prior to this work. Herein, we report the first crystal structure of model r(AUUCU) repeats refined to 2.8 Å and analysis of the structure via molecular dynamics simulations. The r(AUUCU) tracts adopt an overall A-form geometry in which 3 × 3 nucleotide 5′UCU3′/3′UCU5′ internal loops are closed by AU pairs. Helical parameters of the refined structure as well as the corresponding electron density map on the crystallographic model reflect dynamic features of the internal loop. The computational analyses captured dynamic motion of the loop closing pairs, which can form single-stranded conformations with relatively low energies. Overall, the results presented here suggest the possibility for r(AUUCU) repeats to form metastable A-from structures, which can rearrange into single-stranded conformations and attract proteins such as heterogeneous nuclear ribonucleoprotein K (hnRNP K). The information presented here may aid in the rational design of therapeutics targeting this RNA. PMID:26039897

  2. Quantum free energy landscapes from ab initio path integral metadynamics: Double proton transfer in the formic acid dimer is concerted but not correlated.

    PubMed

    Ivanov, Sergei D; Grant, Ian M; Marx, Dominik

    2015-09-28

    With the goal of computing quantum free energy landscapes of reactive (bio)chemical systems in multi-dimensional space, we combine the metadynamics technique for sampling potential energy surfaces with the ab initio path integral approach to treating nuclear quantum motion. This unified method is applied to the double proton transfer process in the formic acid dimer (FAD), in order to study the nuclear quantum effects at finite temperatures without imposing a one-dimensional reaction coordinate or reducing the dimensionality. Importantly, the ab initio path integral metadynamics technique allows one to treat the hydrogen bonds and concomitant proton transfers in FAD strictly independently and thus provides direct access to the much discussed issue of whether the double proton transfer proceeds via a stepwise or concerted mechanism. The quantum free energy landscape we compute for this H-bonded molecular complex reveals that the two protons move in a concerted fashion from initial to product state, yet world-line analysis of the quantum correlations demonstrates that the protons are as quantum-uncorrelated at the transition state as they are when close to the equilibrium structure.

  3. Review of cardiovascular imaging in The Journal of Nuclear Cardiology in 2014: Part 1 of 2: Positron emission tomography, computed tomography, and neuronal imaging.

    PubMed

    AlJaroudi, Wael A; Hage, Fadi G

    2015-06-01

    The year 2014 has been an exciting year for the cardiovascular imaging community with significant advances in the realm of nuclear and multimodality cardiac imaging. In this new feature of the Journal of Nuclear Cardiology, we will summarize some of the breakthroughs that were published in the Journal in 2014 in 2 sister articles. This first article will concentrate on publications dealing with cardiac positron emission tomography (PET), computed tomography (CT), and neuronal imaging.

  4. Free Energy and Heat Capacity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kurata, Masaki; Devanathan, Ramaswami

    2015-10-13

    Free energy and heat capacity of actinide elements and compounds are important properties for the evaluation of the safety and reliable performance of nuclear fuel. They are essential inputs for models that describe complex phenomena that govern the behaviour of actinide compounds during nuclear fuel fabrication and irradiation. This chapter introduces various experimental methods to measure free energy and heat capacity to serve as inputs for models and to validate computer simulations. This is followed by a discussion of computer simulation of these properties, and recent simulations of thermophysical properties of nuclear fuel are briefly reviewed.

  5. Axially deformed solution of the Skyrme-Hartree-Fock-Bogolyubov equations using the transformed harmonic oscillator basis (III) HFBTHO (v3.00): A new version of the program

    NASA Astrophysics Data System (ADS)

    Perez, R. Navarro; Schunck, N.; Lasseri, R.-D.; Zhang, C.; Sarich, J.

    2017-11-01

    We describe the new version 3.00 of the code HFBTHO that solves the nuclear Hartree-Fock (HF) or Hartree-Fock-Bogolyubov (HFB) problem by using the cylindrical transformed deformed harmonic oscillator basis. In the new version, we have implemented the following features: (i) the full Gogny force in both particle-hole and particle-particle channels, (ii) the calculation of the nuclear collective inertia at the perturbative cranking approximation, (iii) the calculation of fission fragment charge, mass and deformations based on the determination of the neck, (iv) the regularization of zero-range pairing forces, (v) the calculation of localization functions, (vi) a MPI interface for large-scale mass table calculations. Program Files doi:http://dx.doi.org/10.17632/c5g2f92by3.1 Licensing provisions: GPL v3 Programming language: FORTRAN-95 Journal reference of previous version: M.V. Stoitsov, N. Schunck, M. Kortelainen, N. Michel, H. Nam, E. Olsen, J. Sarich, and S. Wild, Comput. Phys. Commun. 184 (2013). Does the new version supersede the previous one: Yes Summary of revisions: 1. the Gogny force in both particle-hole and particle-particle channels was implemented; 2. the nuclear collective inertia at the perturbative cranking approximation was implemented; 3. fission fragment charge, mass and deformations were implemented based on the determination of the position of the neck between nascent fragments; 4. the regularization method of zero-range pairing forces was implemented; 5. the localization functions of the HFB solution were implemented; 6. a MPI interface for large-scale mass table calculations was implemented. Nature of problem:HFBTHO is a physics computer code that is used to model the structure of the nucleus. It is an implementation of the energy density functional (EDF) approach to atomic nuclei, where the energy of the nucleus is obtained by integration over space of some phenomenological energy density, which is itself a functional of the neutron and proton intrinsic densities. In the present version of HFBTHO, the energy density derives either from the zero-range Skyrme or the finite-range Gogny effective two-body interaction between nucleons. Nuclear super-fluidity is treated at the Hartree-Fock-Bogolyubov (HFB) approximation. Constraints on the nuclear shape allows probing the potential energy surface of the nucleus as needed e.g., for the description of shape isomers or fission. The implementation of a local scale transformation of the single-particle basis in which the HFB solutions are expanded provide a tool to properly compute the structure of weakly-bound nuclei. Solution method: The program uses the axial Transformed Harmonic Oscillator (THO) single-particle basis to expand quasiparticle wave functions. It iteratively diagonalizes the Hartree-Fock-Bogolyubov Hamiltonian based on generalized Skyrme-like energy densities and zero-range pairing interactions or the finite-range Gogny force until a self-consistent solution is found. A previous version of the program was presented in M.V. Stoitsov, N. Schunck, M. Kortelainen, N. Michel, H. Nam, E. Olsen, J. Sarich, and S. Wild, Comput. Phys. Commun. 184 (2013) 1592-1604 with much of the formalism presented in the original paper M.V. Stoitsov, J. Dobaczewski, W. Nazarewicz, P. Ring, Comput. Phys. Commun. 167 (2005) 43-63. Additional comments: The user must have access to (i) the LAPACK subroutines DSYEEVR, DSYEVD, DSYTRF and DSYTRI, and their dependencies, which compute eigenvalues and eigenfunctions of real symmetric matrices, (ii) the LAPACK subroutines DGETRI and DGETRF, which invert arbitrary real matrices, and (iii) the BLAS routines DCOPY, DSCAL, DGEMM and DGEMV for double-precision linear algebra (or provide another set of subroutines that can perform such tasks). The BLAS and LAPACK subroutines can be obtained from the Netlib Repository at the University of Tennessee, Knoxville: http://netlib2.cs.utk.edu/.

  6. Belief Structures of Students For and Against the Nuclear Freeze.

    ERIC Educational Resources Information Center

    Tankard, James W., Jr.

    An investigation of college students' belief structures underlying their support or non-support of a nuclear freeze revealed a three-dimensional structure for beliefs in the areas of nuclear weapons and national defense. A questionnaire containing 25 belief statements concerning national defense and nuclear weapons and 4 media use questions was…

  7. Nuclear Data Sheets page at the NNDC

    Science.gov Websites

    Data Sheets is a journal primarily devoted to the publication of evaluated nuclear structure and decay ; neutron, proton, alpha, cluster and cluster emission; fission. Nuclear structure and decay data are basis. The ENSDF database is the source for the nuclear structure and decay articles, which deal with a

  8. Bayesian Peak Picking for NMR Spectra

    PubMed Central

    Cheng, Yichen; Gao, Xin; Liang, Faming

    2013-01-01

    Protein structure determination is a very important topic in structural genomics, which helps people to understand varieties of biological functions such as protein-protein interactions, protein–DNA interactions and so on. Nowadays, nuclear magnetic resonance (NMR) has often been used to determine the three-dimensional structures of protein in vivo. This study aims to automate the peak picking step, the most important and tricky step in NMR structure determination. We propose to model the NMR spectrum by a mixture of bivariate Gaussian densities and use the stochastic approximation Monte Carlo algorithm as the computational tool to solve the problem. Under the Bayesian framework, the peak picking problem is casted as a variable selection problem. The proposed method can automatically distinguish true peaks from false ones without preprocessing the data. To the best of our knowledge, this is the first effort in the literature that tackles the peak picking problem for NMR spectrum data using Bayesian method. PMID:24184964

  9. Modeling of fracture of protective concrete structures under impact loads

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Radchenko, P. A., E-mail: radchenko@live.ru; Batuev, S. P.; Radchenko, A. V.

    This paper presents results of numerical simulation of interaction between a Boeing 747-400 aircraft and the protective shell of a nuclear power plant. The shell is presented as a complex multilayered cellular structure consisting of layers of concrete and fiber concrete bonded with steel trusses. Numerical simulation was performed three-dimensionally using the original algorithm and software taking into account algorithms for building grids of complex geometric objects and parallel computations. Dynamics of the stress-strain state and fracture of the structure were studied. Destruction is described using a two-stage model that allows taking into account anisotropy of elastic and strength propertiesmore » of concrete and fiber concrete. It is shown that wave processes initiate destruction of the cellular shell structure; cells start to destruct in an unloading wave originating after the compression wave arrival at free cell surfaces.« less

  10. EPRI Guide to Managing Nuclear Utility Protective Clothing Programs. PCEVAL User`s Manual, A computer code for evaluating the economics of nuclear plant protective clothing programs: Final report

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kelly, J.J.; Kelly, D.M.

    1993-10-01

    The Electric Power Research Institute (EPRI) commissioned a radioactive waste related project (RP2414-34) in 1989 to produce a guide for developing and managing nuclear plant protective clothing programs. Every nuclear facility must coordinate some type of protective clothing program for its radiation workers to ensure proper and safe protection for the wearer and to maintain control over the spread of contamination. Yet, every nuclear facility has developed its own unique program for managing such clothing. Accordingly, a need existed for a reference guide to assist with standardizing protective clothing programs and in controlling the potentially escalating economics of such programs.more » The initial Guide to Managing Nuclear Utility Protective Clothing Programs, NP-7309, was published in May 1991. Since that time, a number of utilities have reviewed and/or used the report to enhance their protective clothing programs. Some of these utilities requested that a computer program be developed to assist utilities in evaluating the economics of protective clothing programs consistent with the guidance in NP-7309. The PCEVAL computer code responds to that industry need. This report, the PCEVAL User`s Manual, provides detailed instruction on use of the software.« less

  11. Genetic structure and demographic history of the endangered tree species Dysoxylum malabaricum (Meliaceae) in Western Ghats, India: implications for conservation in a biodiversity hotspot.

    PubMed

    Bodare, Sofia; Tsuda, Yoshiaki; Ravikanth, Gudasalamani; Uma Shaanker, Ramanan; Lascoux, Martin

    2013-09-01

    The impact of fragmentation by human activities on genetic diversity of forest trees is an important concern in forest conservation, especially in tropical forests. Dysoxylum malabaricum (white cedar) is an economically important tree species, endemic to the Western Ghats, India, one of the world's eight most important biodiversity hotspots. As D. malabaricum is under pressure of disturbance and fragmentation together with overharvesting, conservation efforts are required in this species. In this study, range-wide genetic structure of twelve D. malabaricum populations was evaluated to assess the impact of human activities on genetic diversity and infer the species' evolutionary history, using both nuclear and chloroplast (cp) DNA simple sequence repeats (SSR). As genetic diversity and population structure did not differ among seedling, juvenile and adult age classes, reproductive success among the old-growth trees and long distance seed dispersal by hornbills were suggested to contribute to maintain genetic diversity. The fixation index (F IS) was significantly correlated with latitude, with a higher level of inbreeding in the northern populations, possibly reflecting a more severe ecosystem disturbance in those populations. Both nuclear and cpSSRs revealed northern and southern genetic groups with some discordance of their distributions; however, they did not correlate with any of the two geographic gaps known as genetic barriers to animals. Approximate Bayesian computation-based inference from nuclear SSRs suggested that population divergence occurred before the last glacial maximum. Finally we discussed the implications of these results, in particular the presence of a clear pattern of historical genetic subdivision, on conservation policies.

  12. Genetic structure and demographic history of the endangered tree species Dysoxylum malabaricum (Meliaceae) in Western Ghats, India: implications for conservation in a biodiversity hotspot

    PubMed Central

    Bodare, Sofia; Tsuda, Yoshiaki; Ravikanth, Gudasalamani; Uma Shaanker, Ramanan; Lascoux, Martin

    2013-01-01

    The impact of fragmentation by human activities on genetic diversity of forest trees is an important concern in forest conservation, especially in tropical forests. Dysoxylum malabaricum (white cedar) is an economically important tree species, endemic to the Western Ghats, India, one of the world's eight most important biodiversity hotspots. As D. malabaricum is under pressure of disturbance and fragmentation together with overharvesting, conservation efforts are required in this species. In this study, range-wide genetic structure of twelve D. malabaricum populations was evaluated to assess the impact of human activities on genetic diversity and infer the species’ evolutionary history, using both nuclear and chloroplast (cp) DNA simple sequence repeats (SSR). As genetic diversity and population structure did not differ among seedling, juvenile and adult age classes, reproductive success among the old-growth trees and long distance seed dispersal by hornbills were suggested to contribute to maintain genetic diversity. The fixation index (FIS) was significantly correlated with latitude, with a higher level of inbreeding in the northern populations, possibly reflecting a more severe ecosystem disturbance in those populations. Both nuclear and cpSSRs revealed northern and southern genetic groups with some discordance of their distributions; however, they did not correlate with any of the two geographic gaps known as genetic barriers to animals. Approximate Bayesian computation-based inference from nuclear SSRs suggested that population divergence occurred before the last glacial maximum. Finally we discussed the implications of these results, in particular the presence of a clear pattern of historical genetic subdivision, on conservation policies. PMID:24223264

  13. Assessment of current atomic scale modelling methods for the investigation of nuclear fuels under irradiation: Example of uranium dioxide

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bertolus, Marjorie; Krack, Matthias; Freyss, Michel

    Multiscale approaches are developed to build more physically based kinetic and mechanical mesoscale models to enhance the predictive capability of fuel performance codes and increase the efficiency of the development of the safer and more innovative nuclear materials needed in the future. Atomic scale methods, and in particular electronic structure and empirical potential methods, form the basis of this multiscale approach. It is therefore essential to know the accuracy of the results computed at this scale if we want to feed them into higher scale models. We focus here on the assessment of the description of interatomic interactions in uraniummore » dioxide using on the one hand electronic structure methods, in particular in the density functional theory (DFT) framework and on the other hand empirical potential methods. These two types of methods are complementary, the former enabling to get results from a minimal amount of input data and further insight into the electronic and magnetic properties, while the latter are irreplaceable for studies where a large number of atoms needs to be considered. We consider basic properties as well as specific ones, which are important for the description of nuclear fuel under irradiation. These are especially energies, which are the main data passed to higher scale models. We limit ourselves to uranium dioxide.« less

  14. Détermination assistée par ordinateur de la structure des molécules organiques

    NASA Astrophysics Data System (ADS)

    Nuzillard, J.-M.

    1998-02-01

    Nuclear Magnetic Resonance spectroscopy offers the unique possibility of accessing proximity relationships between atoms by means of chemical shift correlation experiments. Structure determination of small molecules has become thus much simpler. Computer programs can use directly correlation information for structure analysis. The use and operation mechanism of such a program, LSD (Logic for Structure Determination) are presented. The example compound is gibberellic acid, a natural product. La spectroscopie de Résonance Magnétique Nucléaire offre un moyen unique de déterminer des relations de proximité entre atomes par le biais des expériences de corrélation. L'analyse structurale de petites molécules organiques s'en trouve extrêmement facilitée. Des programmes informatiques peuvent utiliser directement les informations de corrélation pour déduire des structures. Le fonctionnement et l'usage d'un tel programme, LSD (Logic for Structure Determination), sont détaillés sur un exemple, l'acide gibberellique.

  15. Cloning retinoid and peroxisome proliferator-activated nuclear receptors of the Pacific oyster and in silico binding to environmental chemicals

    PubMed Central

    Vogeler, Susanne; Galloway, Tamara S.; Isupov, Michail

    2017-01-01

    Disruption of nuclear receptors, a transcription factor superfamily regulating gene expression in animals, is one proposed mechanism through which pollution causes effects in aquatic invertebrates. Environmental pollutants have the ability to interfere with the receptor’s functions through direct binding and inducing incorrect signals. Limited knowledge of invertebrate endocrinology and molecular regulatory mechanisms, however, impede the understanding of endocrine disruptive effects in many aquatic invertebrate species. Here, we isolated three nuclear receptors of the Pacific oyster, Crassostrea gigas: two isoforms of the retinoid X receptor, CgRXR-1 and CgRXR-2, a retinoic acid receptor ortholog CgRAR, and a peroxisome proliferator-activated receptor ortholog CgPPAR. Computer modelling of the receptors based on 3D crystal structures of human proteins was used to predict each receptor’s ability to bind to different ligands in silico. CgRXR showed high potential to bind and be activated by 9-cis retinoic acid and the organotin tributyltin (TBT). Computer modelling of CgRAR revealed six residues in the ligand binding domain, which prevent the successful interaction with natural and synthetic retinoid ligands. This supports an existing theory of loss of retinoid binding in molluscan RARs. Modelling of CgPPAR was less reliable due to high discrepancies in sequence to its human ortholog. Yet, there are suggestions of binding to TBT, but not to rosiglitazone. The effect of potential receptor ligands on early oyster development was assessed after 24h of chemical exposure. TBT oxide (0.2μg/l), all-trans retinoic acid (ATRA) (0.06 mg/L) and perfluorooctanoic acid (20 mg/L) showed high effects on development (>74% abnormal developed D-shelled larvae), while rosiglitazone (40 mg/L) showed no effect. The results are discussed in relation to a putative direct (TBT) disruption effect on nuclear receptors. The inability of direct binding of ATRA to CgRAR suggests either a disruptive effect through a pathway excluding nuclear receptors or an indirect interaction. Our findings provide valuable information on potential mechanisms of molluscan nuclear receptors and the effects of environmental pollution on aquatic invertebrates. PMID:28426724

  16. Toward a New Chemotherapy for Breast Cancer: Structural and Functional Mechanism of the Retinoid Receptors Addressed by a Novel Computer Approach

    DTIC Science & Technology

    2002-01-01

    the surface of the receptor. This pocket is the target for several known and unknown coactivator proteins, which bind the LBD through a conserved LxxLL...was and to Not se FLKAILN) and the LBDs of several receptors (TRo was used as an example in prisingly, the LBD of TR13 was also found to interact with...receptors. 541 ATTCCTTAAAGCCATTTTAAACTGAGGCATTAAGAAGAAATGCACTCACCATGAGCACCA The LBDs of several nuclear receptors were examined for FL. K. A • 1,...N

  17. Thermal Hydraulics Design and Analysis Methodology for a Solid-Core Nuclear Thermal Rocket Engine Thrust Chamber

    NASA Technical Reports Server (NTRS)

    Wang, Ten-See; Canabal, Francisco; Chen, Yen-Sen; Cheng, Gary; Ito, Yasushi

    2013-01-01

    Nuclear thermal propulsion is a leading candidate for in-space propulsion for human Mars missions. This chapter describes a thermal hydraulics design and analysis methodology developed at the NASA Marshall Space Flight Center, in support of the nuclear thermal propulsion development effort. The objective of this campaign is to bridge the design methods in the Rover/NERVA era, with a modern computational fluid dynamics and heat transfer methodology, to predict thermal, fluid, and hydrogen environments of a hypothetical solid-core, nuclear thermal engine the Small Engine, designed in the 1960s. The computational methodology is based on an unstructured-grid, pressure-based, all speeds, chemically reacting, computational fluid dynamics and heat transfer platform, while formulations of flow and heat transfer through porous and solid media were implemented to describe those of hydrogen flow channels inside the solid24 core. Design analyses of a single flow element and the entire solid-core thrust chamber of the Small Engine were performed and the results are presented herein

  18. An anisotropic thermomechanical damage model for concrete at transient elevated temperatures.

    PubMed

    Baker, Graham; de Borst, René

    2005-11-15

    The behaviour of concrete at elevated temperatures is important for an assessment of integrity (strength and durability) of structures exposed to a high-temperature environment, in applications such as fire exposure, smelting plants and nuclear installations. In modelling terms, a coupled thermomechanical analysis represents a generalization of the computational mechanics of fracture and damage. Here, we develop a fully coupled anisotropic thermomechanical damage model for concrete under high stress and transient temperature, with emphasis on the adherence of the model to the laws of thermodynamics. Specific analytical results are given, deduced from thermodynamics, of a novel interpretation on specific heat, evolution of entropy and the identification of the complete anisotropic, thermomechanical damage surface. The model is also shown to be stable in a computational sense, and to satisfy the laws of thermodynamics.

  19. Advanced imaging in COPD: insights into pulmonary pathophysiology

    PubMed Central

    Milne, Stephen

    2014-01-01

    Chronic obstructive pulmonary disease (COPD) involves a complex interaction of structural and functional abnormalities. The two have long been studied in isolation. However, advanced imaging techniques allow us to simultaneously assess pathological processes and their physiological consequences. This review gives a comprehensive account of the various advanced imaging modalities used to study COPD, including computed tomography (CT), magnetic resonance imaging (MRI), and the nuclear medicine techniques positron emission tomography (PET) and single-photon emission computed tomography (SPECT). Some more recent developments in imaging technology, including micro-CT, synchrotron imaging, optical coherence tomography (OCT) and electrical impedance tomography (EIT), are also described. The authors identify the pathophysiological insights gained from these techniques, and speculate on the future role of advanced imaging in both clinical and research settings. PMID:25478198

  20. Relaxation near Supermassive Black Holes Driven by Nuclear Spiral Arms: Anisotropic Hypervelocity Stars, S-stars, and Tidal Disruption Events

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hamers, Adrian S.; Perets, Hagai B., E-mail: hamers@ias.edu

    Nuclear spiral arms are small-scale transient spiral structures found in the centers of galaxies. Similarly to their galactic-scale counterparts, nuclear spiral arms can perturb the orbits of stars. In the case of the Galactic center (GC), these perturbations can affect the orbits of stars and binaries in a region extending to several hundred parsecs around the supermassive black hole (SMBH), causing diffusion in orbital energy and angular momentum. This diffusion process can drive stars and binaries to close approaches with the SMBH, disrupting single stars in tidal disruption events (TDEs), or disrupting binaries, leaving a star tightly bound to themore » SMBH and an unbound star escaping the galaxy, i.e., a hypervelocity star (HVS). Here, we consider diffusion by nuclear spiral arms in galactic nuclei, specifically the Milky Way GC. We determine nuclear-spiral-arm-driven diffusion rates using test-particle integrations and compute disruption rates. Our TDE rates are up to 20% higher compared to relaxation by single stars. For binaries, the enhancement is up to a factor of ∼100, and our rates are comparable to the observed numbers of HVSs and S-stars. Our scenario is complementary to relaxation driven by massive perturbers. In addition, our rates depend on the inclination of the binary with respect to the Galactic plane. Therefore, our scenario provides a novel potential source for the observed anisotropic distribution of HVSs. Nuclear spiral arms may also be important for accelerating the coalescence of binary SMBHs and for supplying nuclear star clusters with stars and gas.« less

  1. Nuclear Structure Aspects in Nuclear Astrophysics

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Smith, Michael Scott

    2006-12-01

    Nuclear Astrophysics as a broad and diverse field of study can be viewed as a magnifier of the impact of microscopic processes on the evolution of macroscopic events. One of the primary goals in Nuclear Astrophysics is the understanding of the nucleosynthesis processes that take place in the cosmos and the simulation of the correlated stellar and explosive burning scenarios. These simulations are strongly dependent on the input from Nuclear Physics which sets the time scale for all stellar dynamic processes--from giga-years of stellar evolution to milliseconds of stellar explosions--and provides the basis for most of the signatures that wemore » have for the interpretation of these events--from stellar luminosities, elemental and isotopic abundances to neutrino flux from distant supernovae. The Nuclear Physics input comes through nuclear structure, low energy reaction rates, nuclear masses, and decay rates. There is a common perception that low energy reaction rates are the most important component of the required nuclear physics input; however, in this article we take a broader approach and present an overview of the close correlation between various nuclear structure aspects and their impact on nuclear astrophysics. We discuss the interplay between the weak and the strong forces on stellar time scales due to the limitations they provide for the evolution of slow and rapid burning processes. The effects of shell structure in nuclei on stellar burning processes as well as the impact of clustering in nuclei is outlined. Furthermore we illustrate the effects of the various nuclear structure aspects on the major nucleosynthesis processes that have been identified in the last few decades. We summarize and provide a coherent overview of the impact of all aspects of nuclear structure on nuclear astrophysics.« less

  2. Quantum ring-polymer contraction method: Including nuclear quantum effects at no additional computational cost in comparison to ab initio molecular dynamics

    NASA Astrophysics Data System (ADS)

    John, Christopher; Spura, Thomas; Habershon, Scott; Kühne, Thomas D.

    2016-04-01

    We present a simple and accurate computational method which facilitates ab initio path-integral molecular dynamics simulations, where the quantum-mechanical nature of the nuclei is explicitly taken into account, at essentially no additional computational cost in comparison to the corresponding calculation using classical nuclei. The predictive power of the proposed quantum ring-polymer contraction method is demonstrated by computing various static and dynamic properties of liquid water at ambient conditions using density functional theory. This development will enable routine inclusion of nuclear quantum effects in ab initio molecular dynamics simulations of condensed-phase systems.

  3. Advanced Simulation and Computing Fiscal Year 2016 Implementation Plan, Version 0

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McCoy, M.; Archer, B.; Hendrickson, B.

    2015-08-27

    The Stockpile Stewardship Program (SSP) is an integrated technical program for maintaining the safety, surety, and reliability of the U.S. nuclear stockpile. The SSP uses nuclear test data, computational modeling and simulation, and experimental facilities to advance understanding of nuclear weapons. It includes stockpile surveillance, experimental research, development and engineering programs, and an appropriately scaled production capability to support stockpile requirements. This integrated national program requires the continued use of experimental facilities and programs, and the computational capabilities to support these programs. The purpose of this IP is to outline key work requirements to be performed and to control individualmore » work activities within the scope of work. Contractors may not deviate from this plan without a revised WA or subsequent IP.« less

  4. Hydration of nucleic acid fragments: comparison of theory and experiment for high-resolution crystal structures of RNA, DNA, and DNA-drug complexes.

    PubMed Central

    Hummer, G; García, A E; Soumpasis, D M

    1995-01-01

    A computationally efficient method to describe the organization of water around solvated biomolecules is presented. It is based on a statistical mechanical expression for the water-density distribution in terms of particle correlation functions. The method is applied to analyze the hydration of small nucleic acid molecules in the crystal environment, for which high-resolution x-ray crystal structures have been reported. Results for RNA [r(ApU).r(ApU)] and DNA [d(CpG).d(CpG) in Z form and with parallel strand orientation] and for DNA-drug complexes [d(CpG).d(CpG) with the drug proflavine intercalated] are described. A detailed comparison of theoretical and experimental data shows positional agreement for the experimentally observed water sites. The presented method can be used for refinement of the water structure in x-ray crystallography, hydration analysis of nuclear magnetic resonance structures, and theoretical modeling of biological macromolecules such as molecular docking studies. The speed of the computations allows hydration analyses of molecules of almost arbitrary size (tRNA, protein-nucleic acid complexes, etc.) in the crystal environment and in aqueous solution. Images FIGURE 1 FIGURE 2 FIGURE 5 FIGURE 6 FIGURE 9 FIGURE 12 FIGURE 13 PMID:7542034

  5. Visualizing the molecular sociology at the HeLa cell nuclear periphery.

    PubMed

    Mahamid, Julia; Pfeffer, Stefan; Schaffer, Miroslava; Villa, Elizabeth; Danev, Radostin; Cuellar, Luis Kuhn; Förster, Friedrich; Hyman, Anthony A; Plitzko, Jürgen M; Baumeister, Wolfgang

    2016-02-26

    The molecular organization of eukaryotic nuclear volumes remains largely unexplored. Here we combined recent developments in cryo-electron tomography (cryo-ET) to produce three-dimensional snapshots of the HeLa cell nuclear periphery. Subtomogram averaging and classification of ribosomes revealed the native structure and organization of the cytoplasmic translation machinery. Analysis of a large dynamic structure-the nuclear pore complex-revealed variations detectable at the level of individual complexes. Cryo-ET was used to visualize previously elusive structures, such as nucleosome chains and the filaments of the nuclear lamina, in situ. Elucidation of the lamina structure provides insight into its contribution to metazoan nuclear stiffness. Copyright © 2016, American Association for the Advancement of Science.

  6. The controversial nuclear matrix: a balanced point of view.

    PubMed

    Martelli, A M; Falcieri, E; Zweyer, M; Bortul, R; Tabellini, G; Cappellini, A; Cocco, L; Manzoli, L

    2002-10-01

    The nuclear matrix is defined as the residual framework after the removal of the nuclear envelope, chromatin, and soluble components by sequential extractions. According to several investigators the nuclear matrix provides the structural basis for intranuclear order. However, the existence itself and the nature of this structure is still uncertain. Although the techniques used for the visualization of the nuclear matrix have improved over the years, it is still unclear to what extent the isolated nuclear matrix corresponds to an in vivo existing structure. Therefore, considerable skepticism continues to surround the nuclear matrix fraction as an accurate representation of the situation in living cells. Here, we summarize the experimental evidence in favor of, or against, the presence of a diffuse nucleoskeleton as a facilitating organizational nonchromatin structure of the nucleus.

  7. SKYSINE-II procedure: calculation of the effects of structure design on neutron, primary gamma-ray and secondary gamma-ray dose rates in air

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lampley, C.M.

    1979-01-01

    An updated version of the SKYSHINE Monte Carlo procedure has been developed. The new computer code, SKYSHINE-II, provides a substantial increase in versatility in that the program possesses the ability to address three types of point-isotropic radiation sources: (1) primary gamma rays, (2) neutrons, and (3) secondary gamma rays. In addition, the emitted radiation may now be characterized by an energy emission spectrum product of a new energy-dependent atmospheric transmission data base developed by Radiation Research Associates, Inc. for each of the three source types described above. Most of the computational options present in the original program have been retainedmore » in the new version. Hence, the SKYSHINE-II computer code provides a versatile and viable tool for the analysis of the radiation environment in the vicinity of a building structure containing radiation sources, situated within the confines of a nuclear power plant. This report describes many of the calculational methods employed within the SKYSHINE-II program. A brief description of the new data base is included. Utilization instructions for the program are provided for operation of the SKYSHINE-II code on the Brookhaven National Laboratory Central Scientific Computing Facility. A listing of the source decks, block data routines, and the new atmospheric transmission data base are provided in the appendices of the report.« less

  8. Extremely low nucleotide polymorphism in Pinus krempfii Lecomte, a unique flat needle pine endemic to Vietnam

    PubMed Central

    Wang, Baosheng; Khalili Mahani, Marjan; Ng, Wei Lun; Kusumi, Junko; Phi, Hai Hong; Inomata, Nobuyuki; Wang, Xiao-Ru; Szmidt, Alfred E

    2014-01-01

    Pinus krempfii Lecomte is a morphologically and ecologically unique pine, endemic to Vietnam. It is regarded as vulnerable species with distribution limited to just two provinces: Khanh Hoa and Lam Dong. Although a few phylogenetic studies have included this species, almost nothing is known about its genetic features. In particular, there are no studies addressing the levels and patterns of genetic variation in natural populations of P. krempfii. In this study, we sampled 57 individuals from six natural populations of P. krempfii and analyzed their sequence variation in ten nuclear gene regions (approximately 9 kb) and 14 mitochondrial (mt) DNA regions (approximately 10 kb). We also analyzed variation at seven chloroplast (cp) microsatellite (SSR) loci. We found very low haplotype and nucleotide diversity at nuclear loci compared with other pine species. Furthermore, all investigated populations were monomorphic across all mitochondrial DNA (mtDNA) regions included in our study, which are polymorphic in other pine species. Population differentiation at nuclear loci was low (5.2%) but significant. However, structure analysis of nuclear loci did not detect genetically differentiated groups of populations. Approximate Bayesian computation (ABC) using nuclear sequence data and mismatch distribution analysis for cpSSR loci suggested recent expansion of the species. The implications of these findings for the management and conservation of P. krempfii genetic resources were discussed. PMID:25360263

  9. Permanent Disposal of Nuclear Waste in Salt

    NASA Astrophysics Data System (ADS)

    Hansen, F. D.

    2016-12-01

    Salt formations hold promise for eternal removal of nuclear waste from our biosphere. Germany and the United States have ample salt formations for this purpose, ranging from flat-bedded formations to geologically mature dome structures. Both nations are revisiting nuclear waste disposal options, accompanied by extensive collaboration on applied salt repository research, design, and operation. Salt formations provide isolation while geotechnical barriers reestablish impermeability after waste is placed in the geology. Between excavation and closure, physical, mechanical, thermal, chemical, and hydrological processes ensue. Salt response over a range of stress and temperature has been characterized for decades. Research practices employ refined test techniques and controls, which improve parameter assessment for features of the constitutive models. Extraordinary computational capabilities require exacting understanding of laboratory measurements and objective interpretation of modeling results. A repository for heat-generative nuclear waste provides an engineering challenge beyond common experience. Long-term evolution of the underground setting is precluded from direct observation or measurement. Therefore, analogues and modeling predictions are necessary to establish enduring safety functions. A strong case for granular salt reconsolidation and a focused research agenda support salt repository concepts that include safety-by-design. Sandia National Laboratories is a multi-program laboratory managed and operated by Sandia Corporation, a wholly owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energy's National Nuclear Security Administration under contract DE-AC04-94AL85000. Author: F. D. Hansen, Sandia National Laboratories

  10. Photonuclear reactions in astrophysical p-process: Theoretical calculations and experiment simulation based on ELI-NP

    NASA Astrophysics Data System (ADS)

    Xu, Yi; Luo, Wen; Balabanski, Dimiter; Goriely, Stephane; Matei, Catalin; Tesileanu, Ovidiu

    2017-09-01

    The astrophysical p-process is an important way of nucleosynthesis to produce the stable and proton-rich nuclei beyond Fe which can not be reached by the s- and r-processes. In the present study, the astrophysical reaction rates of (γ,n), (γ,p), and (γ,α) reactions are computed within the modern reaction code TALYS for about 3000 stable and proton-rich nuclei with 12 < Z < 110. The nuclear structure ingredients involved in the calculation are determined from experimental data whenever available and, if not, from global microscopic nuclear models. In particular, both of the Wood-Saxon potential and the double folding potential with density dependent M3Y (DDM3Y) effective interaction are used for the calculations. It is found that the photonuclear reaction rates are very sensitive to the nuclear potential, and the better determination of nuclear potential would be important to reduce the uncertainties of reaction rates. Meanwhile, the Extreme Light Infrastructure-Nuclear Physics (ELI-NP) facility is being developed, which will provide the great opportunity to experimentally study the photonuclear reactions in p-process. Simulations of the experimental setup for the measurements of the photonuclear reactions 96Ru(γ,p) and 96Ru(γ,α) are performed. It is shown that the experiments of photonuclear reactions in p-process based on ELI-NP are quite promising.

  11. Anharmonic and Quantum Fluctuations in Molecular Crystals: A First-Principles Study of the Stability of Paracetamol

    NASA Astrophysics Data System (ADS)

    Rossi, Mariana; Gasparotto, Piero; Ceriotti, Michele

    2016-09-01

    Molecular crystals often exist in multiple competing polymorphs, showing significantly different physicochemical properties. Computational crystal structure prediction is key to interpret and guide the search for the most stable or useful form, a real challenge due to the combinatorial search space, and the complex interplay of subtle effects that work together to determine the relative stability of different structures. Here we take a comprehensive approach based on different flavors of thermodynamic integration in order to estimate all contributions to the free energies of these systems with density-functional theory, including the oft-neglected anharmonic contributions and nuclear quantum effects. We take the two main stable forms of paracetamol as a paradigmatic example. We find that anharmonic contributions, different descriptions of van der Waals interactions, and nuclear quantum effects all matter to quantitatively determine the stability of different phases. Our analysis highlights the many challenges inherent in the development of a quantitative and predictive framework to model molecular crystals. However, it also indicates which of the components of the free energy can benefit from a cancellation of errors that can redeem the predictive power of approximate models, and suggests simple steps that could be taken to improve the reliability of ab initio crystal structure prediction.

  12. Microscopically based energy density functionals for nuclei using the density matrix expansion. II. Full optimization and validation

    NASA Astrophysics Data System (ADS)

    Navarro Pérez, R.; Schunck, N.; Dyhdalo, A.; Furnstahl, R. J.; Bogner, S. K.

    2018-05-01

    Background: Energy density functional methods provide a generic framework to compute properties of atomic nuclei starting from models of nuclear potentials and the rules of quantum mechanics. Until now, the overwhelming majority of functionals have been constructed either from empirical nuclear potentials such as the Skyrme or Gogny forces, or from systematic gradient-like expansions in the spirit of the density functional theory for atoms. Purpose: We seek to obtain a usable form of the nuclear energy density functional that is rooted in the modern theory of nuclear forces. We thus consider a functional obtained from the density matrix expansion of local nuclear potentials from chiral effective field theory. We propose a parametrization of this functional carefully calibrated and validated on selected ground-state properties that is suitable for large-scale calculations of nuclear properties. Methods: Our energy functional comprises two main components. The first component is a non-local functional of the density and corresponds to the direct part (Hartree term) of the expectation value of local chiral potentials on a Slater determinant. Contributions to the mean field and the energy of this term are computed by expanding the spatial, finite-range components of the chiral potential onto Gaussian functions. The second component is a local functional of the density and is obtained by applying the density matrix expansion to the exchange part (Fock term) of the expectation value of the local chiral potential. We apply the UNEDF2 optimization protocol to determine the coupling constants of this energy functional. Results: We obtain a set of microscopically constrained functionals for local chiral potentials from leading order up to next-to-next-to-leading order with and without three-body forces and contributions from Δ excitations. These functionals are validated on the calculation of nuclear and neutron matter, nuclear mass tables, single-particle shell structure in closed-shell nuclei, and the fission barrier of 240Pu. Quantitatively, they perform noticeably better than the more phenomenological Skyrme functionals. Conclusions: The inclusion of higher-order terms in the chiral perturbation expansion seems to produce a systematic improvement in predicting nuclear binding energies while the impact on other observables is not really significant. This result is especially promising since all the fits have been performed at the single-reference level of the energy density functional approach, where important collective correlations such as center-of-mass correction, rotational correction, or zero-point vibrational energies have not been taken into account yet.

  13. Fundamental Physics with Electroweak Probes of Nuclei

    NASA Astrophysics Data System (ADS)

    Pastore, Saori

    2018-02-01

    The past decade has witnessed tremendous progress in the theoretical and computational tools that produce our understanding of nuclei. A number of microscopic calculations of nuclear electroweak structure and reactions have successfully explained the available experimental data, yielding a complex picture of the way nuclei interact with electroweak probes. This achievement is of great interest from the pure nuclear-physics point of view. But it is of much broader interest too, because the level of accuracy and confidence reached by these calculations opens up the concrete possibility of using nuclei to address open questions in other sub-fields of physics, such as, understanding the fundamental properties of neutrinos, or the particle nature of dark matter. In this talk, I will review recent progress in microscopic calculations of electroweak properties of light nuclei, including electromagnetic moments, form factors and transitions in between lowlying nuclear states along with preliminary studies for single- and double-beta decay rates. I will illustrate the key dynamical features required to explain the available experimental data, and, if time permits, present a novel framework to calculate neutrino-nucleus cross sections for A > 12 nuclei.

  14. Elucidating the Higher Stability of Vanadium (V) Cations in Mixed Acid Based Redox Flow Battery Electrolytes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vijayakumar, M.; Wang, Wei; Nie, Zimin

    2013-11-01

    The Vanadium (V) cation structures in mixed acid based electrolyte solution were analysed by density functional theory (DFT) based computational modelling and 51V and 35Cl Nuclear Magnetic Resonance (NMR) spectroscopy. The Vanadium (V) cation exists as di-nuclear [V2O3Cl2.6H2O]2+ compound at higher vanadium concentrations (≥1.75M). In particular, at high temperatures (>295K) this di-nuclear compound undergoes ligand exchange process with nearby solvent chlorine molecule and forms chlorine bonded [V2O3Cl2.6H2O]2+ compound. This chlorine bonded [V2O3Cl2.6H2O]2+ compound might be resistant to the de-protonation reaction which is the initial step in the precipitation reaction in Vanadium based electrolyte solutions. The combined theoretical and experimental approachmore » reveals that formation of chlorine bonded [V2O3Cl2.6H2O]2+ compound might be central to the observed higher thermal stability of mixed acid based Vanadium (V) electrolyte solutions.« less

  15. SkyNet: Modular nuclear reaction network library

    NASA Astrophysics Data System (ADS)

    Lippuner, Jonas; Roberts, Luke F.

    2017-10-01

    The general-purpose nuclear reaction network SkyNet evolves the abundances of nuclear species under the influence of nuclear reactions. SkyNet can be used to compute the nucleosynthesis evolution in all astrophysical scenarios where nucleosynthesis occurs. Any list of isotopes can be evolved and SkyNet supports various different types of nuclear reactions. SkyNet is modular, permitting new or existing physics, such as nuclear reactions or equations of state, to be easily added or modified.

  16. Trinity to Trinity 1945-2015

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Moniz, Ernest; Carr, Alan; Bethe, Hans

    The Trinity Test of July 16, 1945 was the first full-scale, real-world test of a nuclear weapon; with the new Trinity supercomputer Los Alamos National Laboratory's goal is to do this virtually, in 3D. Trinity was the culmination of a fantastic effort of groundbreaking science and engineering by hundreds of men and women at Los Alamos and other Manhattan Project sites. It took them less than two years to change the world. The Laboratory is marking the 70th anniversary of the Trinity Test because it not only ushered in the Nuclear Age, but with it the origin of today’s advancedmore » supercomputing. We live in the Age of Supercomputers due in large part to nuclear weapons science here at Los Alamos. National security science, and nuclear weapons science in particular, at Los Alamos National Laboratory have provided a key motivation for the evolution of large-scale scientific computing. Beginning with the Manhattan Project there has been a constant stream of increasingly significant, complex problems in nuclear weapons science whose timely solutions demand larger and faster computers. The relationship between national security science at Los Alamos and the evolution of computing is one of interdependence.« less

  17. Trinity to Trinity 1945-2015

    ScienceCinema

    Moniz, Ernest; Carr, Alan; Bethe, Hans; Morrison, Phillip; Ramsay, Norman; Teller, Edward; Brixner, Berlyn; Archer, Bill; Agnew, Harold; Morrison, John

    2018-01-16

    The Trinity Test of July 16, 1945 was the first full-scale, real-world test of a nuclear weapon; with the new Trinity supercomputer Los Alamos National Laboratory's goal is to do this virtually, in 3D. Trinity was the culmination of a fantastic effort of groundbreaking science and engineering by hundreds of men and women at Los Alamos and other Manhattan Project sites. It took them less than two years to change the world. The Laboratory is marking the 70th anniversary of the Trinity Test because it not only ushered in the Nuclear Age, but with it the origin of today’s advanced supercomputing. We live in the Age of Supercomputers due in large part to nuclear weapons science here at Los Alamos. National security science, and nuclear weapons science in particular, at Los Alamos National Laboratory have provided a key motivation for the evolution of large-scale scientific computing. Beginning with the Manhattan Project there has been a constant stream of increasingly significant, complex problems in nuclear weapons science whose timely solutions demand larger and faster computers. The relationship between national security science at Los Alamos and the evolution of computing is one of interdependence.

  18. Multiphysics Thrust Chamber Modeling for Nuclear Thermal Propulsion

    NASA Technical Reports Server (NTRS)

    Wang, Ten-See; Cheng, Gary; Chen, Yen-Sen

    2006-01-01

    The objective of this effort is to develop an efficient and accurate thermo-fluid computational methodology to predict environments for a solid-core, nuclear thermal engine thrust chamber. The computational methodology is based on an unstructured-grid, pressure-based computational fluid dynamics formulation. A two-pronged approach is employed in this effort: A detailed thermo-fluid analysis on a multi-channel flow element for mid-section corrosion investigation; and a global modeling of the thrust chamber to understand the effect of heat transfer on thrust performance. Preliminary results on both aspects are presented.

  19. On the fly quantum dynamics of electronic and nuclear wave packets

    NASA Astrophysics Data System (ADS)

    Komarova, Ksenia G.; Remacle, F.; Levine, R. D.

    2018-05-01

    Multielectronic states quantum dynamics on a grid is described in a manner motivated by on the fly classical trajectory computations. Non stationary electronic states are prepared by a few cycle laser pulse. The nuclei respond and begin moving. We solve the time dependent Schrödinger equation for the electronic and nuclear dynamics for excitation from the ground electronic state. A satisfactory accuracy is possible using a localized description on a discrete grid. This enables computing on the fly for both the nuclear and electronic dynamics including non-adiabatic couplings. Attosecond dynamics in LiH is used as an example.

  20. Nuclear reactor descriptions for space power systems analysis

    NASA Technical Reports Server (NTRS)

    Mccauley, E. W.; Brown, N. J.

    1972-01-01

    For the small, high performance reactors required for space electric applications, adequate neutronic analysis is of crucial importance, but in terms of computational time consumed, nuclear calculations probably yield the least amount of detail for mission analysis study. It has been found possible, after generation of only a few designs of a reactor family in elaborate thermomechanical and nuclear detail to use simple curve fitting techniques to assure desired neutronic performance while still performing the thermomechanical analysis in explicit detail. The resulting speed-up in computation time permits a broad detailed examination of constraints by the mission analyst.

  1. Computer-generated formulas for three-center nuclear-attraction integrals (electrostatic potential) for Slater-type orbitals

    NASA Technical Reports Server (NTRS)

    Jones, H. W.

    1984-01-01

    The computer-assisted C-matrix, Loewdin-alpha-function, single-center expansion method in spherical harmonics has been applied to the three-center nuclear-attraction integral (potential due to the product of separated Slater-type orbitals). Exact formulas are produced for 13 terms of an infinite series that permits evaluation to ten decimal digits of an example using 1s orbitals.

  2. Atomic structure of nano voids in irradiated 3C-SiC

    NASA Astrophysics Data System (ADS)

    Lin, Yan-Ru; Chen, Liu-Gu; Hsieh, Cheng-Yo; Hu, Alice; Lo, Sheng-Chuan; Chen, Fu-Rong; Kai, Ji-Jung

    2018-01-01

    It is important to understand the atomic structure of defect clusters in SiC, a promising material for nuclear application. In this study, we have directly observed and identified nano voids in ion irradiated 3C-SiC at 800 °C, 20 dpa through ABF and HAADF STEM images. A quantitative method was used to analyze HAADF images in which atomic columns with a difference in the number of atoms could be identified and scattered intensities can be computed. Our result shows that these voids are composed of atomic vacancies in an octahedral arrangement. The density of the void was measured by STEM to be 9.2 × 1019m-3 and the size was ∼1.5 nm.

  3. Structure of Ni 78 from First-Principles Computations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hagen, Gaute; Univ. of Tennessee, Knoxville, TN; Jansen, Gustav R.

    Doubly magic nuclei have a simple structure and are the cornerstones for entire regions of the nuclear chart. Theoretical insights into the supposedly doubly magic 78Ni and its neighbors are challenging because of the extreme neutron-to-proton ratio and the proximity of the continuum. In this study, we predict the J π = 2more » $$+\\atop{1}$$ state in 78Ni from a correlation with the J π = 2$$+\\atop{1}$$ state in 48Ca using chiral nucleon-nucleon and three-nucleon interactions. Our results confirm that 78Ni is doubly magic, and the predicted low-lying states of 79,80Ni open the way for shell-model studies of many more rare isotopes.« less

  4. Structure of Ni 78 from First-Principles Computations

    DOE PAGES

    Hagen, Gaute; Univ. of Tennessee, Knoxville, TN; Jansen, Gustav R.; ...

    2016-10-17

    Doubly magic nuclei have a simple structure and are the cornerstones for entire regions of the nuclear chart. Theoretical insights into the supposedly doubly magic 78Ni and its neighbors are challenging because of the extreme neutron-to-proton ratio and the proximity of the continuum. In this study, we predict the J π = 2more » $$+\\atop{1}$$ state in 78Ni from a correlation with the J π = 2$$+\\atop{1}$$ state in 48Ca using chiral nucleon-nucleon and three-nucleon interactions. Our results confirm that 78Ni is doubly magic, and the predicted low-lying states of 79,80Ni open the way for shell-model studies of many more rare isotopes.« less

  5. Cloud prediction of protein structure and function with PredictProtein for Debian.

    PubMed

    Kaján, László; Yachdav, Guy; Vicedo, Esmeralda; Steinegger, Martin; Mirdita, Milot; Angermüller, Christof; Böhm, Ariane; Domke, Simon; Ertl, Julia; Mertes, Christian; Reisinger, Eva; Staniewski, Cedric; Rost, Burkhard

    2013-01-01

    We report the release of PredictProtein for the Debian operating system and derivatives, such as Ubuntu, Bio-Linux, and Cloud BioLinux. The PredictProtein suite is available as a standard set of open source Debian packages. The release covers the most popular prediction methods from the Rost Lab, including methods for the prediction of secondary structure and solvent accessibility (profphd), nuclear localization signals (predictnls), and intrinsically disordered regions (norsnet). We also present two case studies that successfully utilize PredictProtein packages for high performance computing in the cloud: the first analyzes protein disorder for whole organisms, and the second analyzes the effect of all possible single sequence variants in protein coding regions of the human genome.

  6. Cloud Prediction of Protein Structure and Function with PredictProtein for Debian

    PubMed Central

    Kaján, László; Yachdav, Guy; Vicedo, Esmeralda; Steinegger, Martin; Mirdita, Milot; Angermüller, Christof; Böhm, Ariane; Domke, Simon; Ertl, Julia; Mertes, Christian; Reisinger, Eva; Rost, Burkhard

    2013-01-01

    We report the release of PredictProtein for the Debian operating system and derivatives, such as Ubuntu, Bio-Linux, and Cloud BioLinux. The PredictProtein suite is available as a standard set of open source Debian packages. The release covers the most popular prediction methods from the Rost Lab, including methods for the prediction of secondary structure and solvent accessibility (profphd), nuclear localization signals (predictnls), and intrinsically disordered regions (norsnet). We also present two case studies that successfully utilize PredictProtein packages for high performance computing in the cloud: the first analyzes protein disorder for whole organisms, and the second analyzes the effect of all possible single sequence variants in protein coding regions of the human genome. PMID:23971032

  7. Standardized Procedure Content And Data Structure Based On Human Factors Requirements For Computer-Based Procedures

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bly, Aaron; Oxstrand, Johanna; Le Blanc, Katya L

    2015-02-01

    Most activities that involve human interaction with systems in a nuclear power plant are guided by procedures. Traditionally, the use of procedures has been a paper-based process that supports safe operation of the nuclear power industry. However, the nuclear industry is constantly trying to find ways to decrease the human error rate, especially the human errors associated with procedure use. Advances in digital technology make computer-based procedures (CBPs) a valid option that provides further enhancement of safety by improving human performance related to procedure use. The transition from paper-based procedures (PBPs) to CBPs creates a need for a computer-based proceduremore » system (CBPS). A CBPS needs to have the ability to perform logical operations in order to adjust to the inputs received from either users or real time data from plant status databases. Without the ability for logical operations the procedure is just an electronic copy of the paper-based procedure. In order to provide the CBPS with the information it needs to display the procedure steps to the user, special care is needed in the format used to deliver all data and instructions to create the steps. The procedure should be broken down into basic elements and formatted in a standard method for the CBPS. One way to build the underlying data architecture is to use an Extensible Markup Language (XML) schema, which utilizes basic elements to build each step in the smart procedure. The attributes of each step will determine the type of functionality that the system will generate for that step. The CBPS will provide the context for the step to deliver referential information, request a decision, or accept input from the user. The XML schema needs to provide all data necessary for the system to accurately perform each step without the need for the procedure writer to reprogram the CBPS. The research team at the Idaho National Laboratory has developed a prototype CBPS for field workers as well as the underlying data structure for such CBPS. The objective of the research effort is to develop guidance on how to design both the user interface and the underlying schema. This paper will describe the result and insights gained from the research activities conducted to date.« less

  8. Control and applications of cooperating disparate robotic manipulators relevant to nuclear waste management

    NASA Technical Reports Server (NTRS)

    Lew, Jae Young; Book, Wayne J.

    1991-01-01

    Remote handling in nuclear waste management requires a robotic system with precise motion as well as a large workspace. The concept of a small arm mounted on the end of a large arm may satisfy such needs. However, the performance of such a serial configuration lacks payload capacity which is a crucial factor for handling a massive object. Also, this configuration induces more flexibility on the structure. To overcome these problems, the topology of bracing the tip of the small arm (not the large arm) and having an end effector in the middle of the chain is proposed in this paper. Also, control of these cooperating disparate manipulators is accomplished in computer simulations. Thus, this robotic system can have the accuracy of the small arm, and at the same time, it can have the payload capacity and large workspace of the large arm.

  9. Systematics of intermediate-energy single-nucleon removal cross sections

    NASA Astrophysics Data System (ADS)

    Tostevin, J. A.; Gade, A.

    2014-11-01

    There is now a large and increasing body of experimental data and theoretical analyses for reactions that remove a single nucleon from an intermediate-energy beam of neutron- or proton-rich nuclei. In each such measurement, one obtains the inclusive cross section for the population of all bound final states of the mass A -1 reaction residue. These data, from different regions of the nuclear chart, and that involve weakly and strongly bound nucleons, are compared with theoretical expectations. These calculations include an approximate treatment of the reaction dynamics and shell-model descriptions of the projectile initial state, the bound final states of the residues, and the single-particle strengths computed from their overlap functions. The results are discussed in the light of recent data, more exclusive tests of the eikonal dynamical description, and calculations that take input from more microscopic nuclear structure models.

  10. Interpretation of time-domain electromagnetic soundings in the Calico Hills area, Nevada Test Site, Nye County, Nevada

    NASA Astrophysics Data System (ADS)

    Kauahikaua, J.

    A controlled source, time domain electromagnetic (TDEM) sounding survey was conducted in the Calico Hills area of the Nevada Test Site (NTS). The geoelectric structure was determined as an aid in the evaluation of the site for possible future storage of spent nuclear fuel or high level nuclear waste. The data were initially interpreted with a simple scheme that produces an apparent resistivity versus depth curve from the vertical magnetic field data. These curves are qualitatively interpreted much like standard Schlumberger resistivity sounding curves. Final interpretation made use of a layered earth Marquardt inversion computer program. The results combined with those from a set of Schlumberger soundings in the area show that there is a moderately resistive basement at a depth no greater than 800 meters. The basement resistivity is greater than 100 ohm meters.

  11. Advances in Nuclear Monitoring Technologies

    NASA Astrophysics Data System (ADS)

    Park, Brent

    2006-03-01

    Homeland security requires low-cost, large-area detectors for locating and identifying weapons-usable nuclear materials and monitors for radiological isotopes that are more robust than current systems. Recent advances in electronics materials and nanotechnology, specifically organic semiconductors and inorganic quantum dots, offer potential improvements. We provide an overview of the physical processes involved in radiation detection using these new materials in the design of new device structures. Examples include recent efforts on quantum dots, as well as more traditional radiation-detecting materials such as CdZnTe and high-pressure xenon. Detector improvements demand not only new materials but also enhanced data-analysis tools that reduce false alarms and thus increase the quality of decisions. Additional computing power on hand-held platforms should enable the application of advanced algorithms to radiation-detection problems in the field, reducing the need to transmit data and thus delay analysis.

  12. Emergent properties of nuclei from ab initio coupled-cluster calculations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hagen, G.; Hjorth-Jensen, M.; Jansen, G. R.

    Emergent properties such as nuclear saturation and deformation, and the effects on shell structure due to the proximity of the scattering continuum and particle decay channels are fascinating phenomena in atomic nuclei. In recent years, ab initio approaches to nuclei have taken the first steps towards tackling the computational challenge of describing these phenomena from Hamiltonians with microscopic degrees of freedom. Our endeavor is now possible due to ideas from effective field theories, novel optimization strategies for nuclear interactions, ab initio methods exhibiting a soft scaling with mass number, and ever-increasing computational power. We review some of the recent accomplishments. We also present new results. The recently optimized chiral interaction NNLOmore » $${}_{{\\rm{sat}}}$$ is shown to provide an accurate description of both charge radii and binding energies in selected light- and medium-mass nuclei up to 56Ni. We derive an efficient scheme for including continuum effects in coupled-cluster computations of nuclei based on chiral nucleon–nucleon and three-nucleon forces, and present new results for unbound states in the neutron-rich isotopes of oxygen and calcium. Finally, the coupling to the continuum impacts the energies of the $${J}^{\\pi }=1/{2}^{-},3/{2}^{-},7/{2}^{-},3/{2}^{+}$$ states in $${}^{\\mathrm{17,23,25}}$$O, and—contrary to naive shell-model expectations—the level ordering of the $${J}^{\\pi }=3/{2}^{+},5/{2}^{+},9/{2}^{+}$$ states in $${}^{\\mathrm{53,55,61}}$$Ca.« less

  13. Emergent properties of nuclei from ab initio coupled-cluster calculations

    DOE PAGES

    Hagen, G.; Hjorth-Jensen, M.; Jansen, G. R.; ...

    2016-05-17

    Emergent properties such as nuclear saturation and deformation, and the effects on shell structure due to the proximity of the scattering continuum and particle decay channels are fascinating phenomena in atomic nuclei. In recent years, ab initio approaches to nuclei have taken the first steps towards tackling the computational challenge of describing these phenomena from Hamiltonians with microscopic degrees of freedom. Our endeavor is now possible due to ideas from effective field theories, novel optimization strategies for nuclear interactions, ab initio methods exhibiting a soft scaling with mass number, and ever-increasing computational power. We review some of the recent accomplishments. We also present new results. The recently optimized chiral interaction NNLOmore » $${}_{{\\rm{sat}}}$$ is shown to provide an accurate description of both charge radii and binding energies in selected light- and medium-mass nuclei up to 56Ni. We derive an efficient scheme for including continuum effects in coupled-cluster computations of nuclei based on chiral nucleon–nucleon and three-nucleon forces, and present new results for unbound states in the neutron-rich isotopes of oxygen and calcium. Finally, the coupling to the continuum impacts the energies of the $${J}^{\\pi }=1/{2}^{-},3/{2}^{-},7/{2}^{-},3/{2}^{+}$$ states in $${}^{\\mathrm{17,23,25}}$$O, and—contrary to naive shell-model expectations—the level ordering of the $${J}^{\\pi }=3/{2}^{+},5/{2}^{+},9/{2}^{+}$$ states in $${}^{\\mathrm{53,55,61}}$$Ca.« less

  14. Potential energy surface, dipole moment surface and the intensity calculations for the 10 μm, 5 μm and 3 μm bands of ozone

    NASA Astrophysics Data System (ADS)

    Polyansky, Oleg L.; Zobov, Nikolai F.; Mizus, Irina I.; Kyuberis, Aleksandra A.; Lodi, Lorenzo; Tennyson, Jonathan

    2018-05-01

    Monitoring ozone concentrations in the Earth's atmosphere using spectroscopic methods is a major activity which undertaken both from the ground and from space. However there are long-running issues of consistency between measurements made at infrared (IR) and ultraviolet (UV) wavelengths. In addition, key O3 IR bands at 10 μm, 5 μm and 3 μm also yield results which differ by a few percent when used for retrievals. These problems stem from the underlying laboratory measurements of the line intensities. Here we use quantum chemical techniques, first principles electronic structure and variational nuclear-motion calculations, to address this problem. A new high-accuracy ab initio dipole moment surface (DMS) is computed. Several spectroscopically-determined potential energy surfaces (PESs) are constructed by fitting to empirical energy levels in the region below 7000 cm-1 starting from an ab initio PES. Nuclear motion calculations using these new surfaces allow the unambiguous determination of the intensities of 10 μm band transitions, and the computation of the intensities of 10 μm and 5 μm bands within their experimental error. A decrease in intensities within the 3 μm is predicted which appears consistent with atmospheric retrievals. The PES and DMS form a suitable starting point both for the computation of comprehensive ozone line lists and for future calculations of electronic transition intensities.

  15. CESAR5.3: Isotopic depletion for Research and Testing Reactor decommissioning

    NASA Astrophysics Data System (ADS)

    Ritter, Guillaume; Eschbach, Romain; Girieud, Richard; Soulard, Maxime

    2018-05-01

    CESAR stands in French for "simplified depletion applied to reprocessing". The current version is now number 5.3 as it started 30 years ago from a long lasting cooperation with ORANO, co-owner of the code with CEA. This computer code can characterize several types of nuclear fuel assemblies, from the most regular PWR power plants to the most unexpected gas cooled and graphite moderated old timer research facility. Each type of fuel can also include numerous ranges of compositions like UOX, MOX, LEU or HEU. Such versatility comes from a broad catalog of cross section libraries, each corresponding to a specific reactor and fuel matrix design. CESAR goes beyond fuel characterization and can also provide an evaluation of structural materials activation. The cross-sections libraries are generated using the most refined assembly or core level transport code calculation schemes (CEA APOLLO2 or ERANOS), based on the European JEFF3.1.1 nuclear data base. Each new CESAR self shielded cross section library benefits all most recent CEA recommendations as for deterministic physics options. Resulting cross sections are organized as a function of burn up and initial fuel enrichment which allows to condensate this costly process into a series of Legendre polynomials. The final outcome is a fast, accurate and compact CESAR cross section library. Each library is fully validated, against a stochastic transport code (CEA TRIPOLI 4) if needed and against a reference depletion code (CEA DARWIN). Using CESAR does not require any of the neutron physics expertise implemented into cross section libraries generation. It is based on top quality nuclear data (JEFF3.1.1 for ˜400 isotopes) and includes up to date Bateman equation solving algorithms. However, defining a CESAR computation case can be very straightforward. Most results are only 3 steps away from any beginner's ambition: Initial composition, in core depletion and pool decay scenario. On top of a simple utilization architecture, CESAR includes a portable Graphical User Interface which can be broadly deployed in R&D or industrial facilities. Aging facilities currently face decommissioning and dismantling issues. This way to the end of the nuclear fuel cycle requires a careful assessment of source terms in the fuel, core structures and all parts of a facility that must be disposed of with "industrial nuclear" constraints. In that perspective, several CESAR cross section libraries were constructed for early CEA Research and Testing Reactors (RTR's). The aim of this paper is to describe how CESAR operates and how it can be used to help these facilities care for waste disposal, nuclear materials transport or basic safety cases. The test case will be based on the PHEBUS Facility located at CEA - Cadarache.

  16. Protein Structure Prediction by Protein Threading

    NASA Astrophysics Data System (ADS)

    Xu, Ying; Liu, Zhijie; Cai, Liming; Xu, Dong

    The seminal work of Bowie, Lüthy, and Eisenberg (Bowie et al., 1991) on "the inverse protein folding problem" laid the foundation of protein structure prediction by protein threading. By using simple measures for fitness of different amino acid types to local structural environments defined in terms of solvent accessibility and protein secondary structure, the authors derived a simple and yet profoundly novel approach to assessing if a protein sequence fits well with a given protein structural fold. Their follow-up work (Elofsson et al., 1996; Fischer and Eisenberg, 1996; Fischer et al., 1996a,b) and the work by Jones, Taylor, and Thornton (Jones et al., 1992) on protein fold recognition led to the development of a new brand of powerful tools for protein structure prediction, which we now term "protein threading." These computational tools have played a key role in extending the utility of all the experimentally solved structures by X-ray crystallography and nuclear magnetic resonance (NMR), providing structural models and functional predictions for many of the proteins encoded in the hundreds of genomes that have been sequenced up to now.

  17. Industrial Productivity

    NASA Technical Reports Server (NTRS)

    1977-01-01

    NASTRAN is an offshoot of the computer-design technique used in construction of airplanes and spacecraft. [n this technique engineers create a mathematical model of the aeronautical or space vehicle and "fly" it on the ground by means of computer simulation. The technique enables them to study performance and structural behavior of a number of different designs before settling on the final configuration and proceeding with construction. From this base of aerospace experience, NASA-Goddard developed the NASTRAN general purpose computer program, which offers an exceptionally wide range of analytic capability with regard to structures. NASTRAN has been applied to autos, trucks, railroad cars, ships, nuclear power reactors, steam turbines, bridges, and office buildings. NASA-Langley provides program maintenance services regarded as vital by many NASTRAN users. NASTRAN is essentially a predictive tool. It takes an electronic look at a computerire$.dedgn and reports how the structure will react under a great many different conditions. It can, for example, note areas where high stress levels will occur-potential failure points that need strengthening. Conversely, it can identify over-designed areas where weight and material might be saved safely. NASTRAN can tell how pipes stand up under strong fluid flow, how metals are affected by high temperatures, how a building will fare in an earthquake or how powerful winds will cause a bridge to oscillate. NASTRAN analysis is quick and inexpensive. It minimizes trial-and-error in the design process and makes possible better, safe, lighter structures affording large-scale savings in development time and materials. Some examples of the broad utility NASTRAN is finding among industrial firms are shown on these pages.

  18. Evaluation of Spacecraft Shielding Effectiveness for Radiation Protection

    NASA Technical Reports Server (NTRS)

    Cucinotta, Francis A.; Wilson, John W.

    1999-01-01

    The potential for serious health risks from solar particle events (SPE) and galactic cosmic rays (GCR) is a critical issue in the NASA strategic plan for the Human Exploration and Development of Space (HEDS). The excess cost to protect against the GCR and SPE due to current uncertainties in radiation transmission properties and cancer biology could be exceedingly large based on the excess launch costs to shield against uncertainties. The development of advanced shielding concepts is an important risk mitigation area with the potential to significantly reduce risk below conventional mission designs. A key issue in spacecraft material selection is the understanding of nuclear reactions on the transmission properties of materials. High-energy nuclear particles undergo nuclear reactions in passing through materials and tissue altering their composition and producing new radiation types. Spacecraft and planetary habitat designers can utilize radiation transport codes to identify optimal materials for lowering exposures and to optimize spacecraft design to reduce astronaut exposures. To reach these objectives will require providing design engineers with accurate data bases and computationally efficient software for describing the transmission properties of space radiation in materials. Our program will reduce the uncertainty in the transmission properties of space radiation by improving the theoretical description of nuclear reactions and radiation transport, and provide accurate physical descriptions of the track structure of microscopic energy deposition.

  19. Numerical study on simultaneous emission and transmission tomography in the MRI framework

    NASA Astrophysics Data System (ADS)

    Gjesteby, Lars; Cong, Wenxiang; Wang, Ge

    2017-09-01

    Multi-modality imaging methods are instrumental for advanced diagnosis and therapy. Specifically, a hybrid system that combines computed tomography (CT), nuclear imaging, and magnetic resonance imaging (MRI) will be a Holy Grail of medical imaging, delivering complementary structural/morphological, functional, and molecular information for precision medicine. A novel imaging method was recently demonstrated that takes advantage of radiotracer polarization to combine MRI principles with nuclear imaging. This approach allows the concentration of a polarized Υ-ray emitting radioisotope to be imaged with MRI resolution potentially outperforming the standard nuclear imaging mode at a sensitivity significantly higher than that of MRI. In our work, we propose to acquire MRI-modulated nuclear data for simultaneous image reconstruction of both emission and transmission parameters, suggesting the potential for simultaneous CT-SPECT-MRI. The synchronized diverse datasets allow excellent spatiotemporal registration and unique insight into physiological and pathological features. Here we describe the methodology involving the system design with emphasis on the formulation for tomographic images, even when significant radiotracer signals are limited to a region of interest (ROI). Initial numerical results demonstrate the feasibility of our approach for reconstructing concentration and attenuation images through a head phantom with various radio-labeled ROIs. Additional considerations regarding the radioisotope characteristics are also discussed.

  20. Xenon NMR of liquid crystals confined to cylindrical nanocavities: a simulation study.

    PubMed

    Karjalainen, Jouni; Vaara, Juha; Straka, Michal; Lantto, Perttu

    2015-03-21

    Applications of liquid crystals (LCs), such as smart windows and the ubiquitous display devices, are based on controlling the orientational and translational order in a small volume of LC medium. Hence, understanding the effects of confinement to the liquid crystal phase behaviour is essential. The NMR shielding of (129)Xe atoms dissolved in LCs constitutes a very sensitive probe to the details of LC environment. Linking the experimental results to microscopic phenomena calls for molecular simulations. In this work, the NMR shielding of atomic (129)Xe dissolved in a uniaxial thermotropic LC confined to nanosized cylindrical cavities is computed from coarse-grained (CG) isobaric Monte Carlo (MC) simulations with a quantum-chemically (QC) pre-parameterised pairwise-additive model for the Xe nuclear shielding tensor. We report the results for the (129)Xe nuclear shielding and its connection to the structure and order of the LC appropriate to two different cavity sizes, as well as a comparison to the results of bulk (non-confined) simulations. We find that the confinement changes the LC phase structure dramatically and gives rise to the coexistence of varying degrees of LC order, which is reflected in the Xe shielding. Furthermore, we qualitatively reproduce the behaviour of the mean (129)Xe chemical shift with respect to temperature for atomic Xe dissolved in LC confined to controlled-pore glass materials. In the small-radius cavity the nematic - paranematic phase transition is revealed only by the anisotropic component of the (129)Xe nuclear shielding. In the larger cavity, the nematic - paranematic - isotropic transition is clearly seen in the Xe shielding. The simulated (129)Xe NMR shielding is insensitive to the smectic-A - nematic transition, since in the smectic-A phase, the Xe atoms largely occupy the imperfect layer structure near the cavity walls. The direct contribution of the cavity wall to (129)Xe nuclear shielding is dependent on the cavity size but independent of temperature. Our results show that the combination of CG simulations and a QC pre-parameterised (129)Xe NMR shielding allows efficient studies of the phase behaviour and structure of complex systems containing thousands of molecules, and brings us closer to the simulation of NMR experiments.

  1. Initial Assessment of X-Ray Computer Tomography image analysis for material defect microstructure

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kane, Joshua James; Windes, William Enoch

    2016-06-01

    The original development work leading to this report was focused on the non destructive three-dimensional (3-D) characterization of nuclear graphite as a means to better understand the nature of the inherent pore structure. The pore structure of graphite and its evolution under various environmental factors such as irradiation, mechanical stress, and oxidation plays an important role in their observed properties and characteristics. If we are to transition from an empirical understanding of graphite behavior to a truly predictive mechanistic understanding the pore structure must be well characterized and understood. As the pore structure within nuclear graphite is highly interconnected andmore » truly 3-D in nature, 3-D characterization techniques are critical. While 3-D characterization has been an excellent tool for graphite pore characterization, it is applicable to a broad number of materials systems over many length scales. Given the wide range of applications and the highly quantitative nature of the tool, it is quite surprising to discover how few materials researchers understand and how valuable of a tool 3-D image processing and analysis can be. Ultimately, this report is intended to encourage broader use of 3 D image processing and analysis in materials science and engineering applications, more specifically nuclear-related materials applications, by providing interested readers with enough familiarity to explore its vast potential in identifying microstructure changes. To encourage this broader use, the report is divided into two main sections. Section 2 provides an overview of some of the key principals and concepts needed to extract a wide variety of quantitative metrics from a 3-D representation of a material microstructure. The discussion includes a brief overview of segmentation methods, connective components, morphological operations, distance transforms, and skeletonization. Section 3 focuses on the application of concepts from Section 2 to relevant materials at Idaho National Laboratory. In this section, image analysis examples featuring nuclear graphite will be discussed in detail. Additionally, example analyses from Transient Reactor Test Facility low-enriched uranium conversion, Advanced Gas Reactor like compacts, and tristructural isotopic particles are shown to give a broader perspective of the applicability to relevant materials of interest.« less

  2. FOREWORD: Foreword

    NASA Astrophysics Data System (ADS)

    Covello, Aldo; Gargano, Angela

    2011-01-01

    The Tenth International Spring Seminar on Nuclear Physics was held in Vietri sul Mare from May 21 to May 25, 2010. This Seminar was the tenth in a series of topical meetings held every two or three years in the Naples area. The series began with the Sorrento meeting in 1986 and continued with the Capri meeting in 1988, the Ischia meeting in 1990, the Amalfi meeting in 1992, the Ravello meeting in 1995, the S. Agata meeting in 1998, the Maiori meeting in 2001, the Paestum meeting in 2004, and the Vico Equense meeting in 2007. For this tenth meeting we returned to Salerno Bay and met in the small town of Vietri. While the location of the Conference has never been the same, what remained invariant is the aim of these meetings, which is to discuss recent advances and new perspectives in nuclear structure experiments and theory in a pleasant and friendly atmosphere. It is by now well established that we have entered a new era in Nuclear Physics research with the advent of radioactive ion beam facilities. While nuclear structure studies are currently being performed in several laboratories where RIBs are available, the development of new facilities, which will provide high-intensity beams, is in progress or under discussion in Europe, Asia and North America. At this meeting we had a comprehensive overview of this fascinating field and of future scenarios thanks to the participation of leaders of the most important projects. The results that are becoming available for nuclei far from stability are highlighting new themes of research, such as the evolution of the shell structure when moving towards the particle drip lines, and stimulating a proficuous interplay between experiment and theory. On the other hand, new ideas and the development of more powerful computational tools promise a deeper understanding of the structure of nuclei in terms of the basic interactions between their constituents. As usual, the program of the meeting consisted of general talks and of more specialized seminars, the latter including most of the contributions submitted by participants. The speakers covered five main topics: i) Nuclear Structure far from Stability: New Advances and Perspectives; ii) From Nuclear Forces to Nuclear Structure; iii) Exploring Nuclear Shell Structure: Experiment and Theory; iv) New Aspects of Collective Nuclear Motion; and v) Special Topics. We received 63 manuscripts out of the 77 invited papers and contributions presented at the Seminar. All of these have been peer reviewed and are collected in this volume. We would like to thank all the anonymous colleagues who have acted as referees to assess the suitability of the various articles for publication in the Journal of Physics: Conference Series. We are confident that the high quality of both invited and contributed papers contained in these Proceedings will be appreciated by the nuclear physics community. As was the case for most of the previous Seminars, the Vietri Seminar also ended with a Round Table Discussion on the theme 'Trends and Perspectives in Nuclear Structure'. N Benczer-Koller, B A Brown, A Faessler, B Fornal, O Sorlin, and I Talmi kindly agreed to be on the panel and their remarks were essential in bringing about the active involvement of the audience. The Conference had about 100 participants from some 20 countries (please see PDF for list of participants). This is well in line with the tradition of these meetings, as is the fact that about 50% of the present participants attended one or more of the previous Seminars. We gratefully acknowledge the financial support of the Istituto Nazionale di Fisica Nucleare and the University of Naples Federico II who helped make the Seminar possible. We also acknowledge the support provided in various ways by the Dipartimento di Scienze Fisiche which acted as host to the Seminar. Aldo CovelloAngela GarganoEditors LOCAL ORGANIZING COMMITTEE A Covello (Chair)A Gargano (Co-Chair)L Coraggio (Scientific Secretary)F AndreozziN ItacoG La RanaN Lo Iudice A. Porrino INTERNATIONAL ADVISORY COMMITTEE J Äystö (Jyväskylä)D Morrissey (Michigan) A B Balantekin (Wisconsin)W Nazarewicz (Oak Ridge) B R Barrett (Tucson)P von Neumann-Cosel (Darmstadt) P G Bizzeti (Firenze)R Okamoto (Kyushu) Y Blumenfeld (CERN and IPN Orsay)A V Ramayya (Vanderbilt) J Dobaczewski (Warsaw)J Schiffer (Argonne) G Fiorentini (Ferrara)A C Shotter (Edinburgh) B Fornal (Kraków)Ch Stoyanov (Sofia) S Gales (GANIL)I Talmi (Rehovot) F Iachello (Yale)P van Duppen (Leuven) R Jolos (Dubna)A Vitturi (Padova) M Lattuada (Catania) SPONSORS OF THE SEMINAR Dipartimento di Scienze Fisiche, Università di Napoli "Federico II" Istituto Nazionale di Fisica NucleareUniversità di Napoli Federico II

  3. The nuclear matrix prepared by amine modification

    PubMed Central

    Wan, Katherine M.; Nickerson, Jeffrey A.; Krockmalnic, Gabriela; Penman, Sheldon

    1999-01-01

    The nucleus is spatially ordered by attachments to a nonchromatin nuclear structure, the nuclear matrix. The nuclear matrix and chromatin are intimately connected and integrated structures, and so a major technical challenge in nuclear matrix research has been to remove chromatin while retaining a native nuclear matrix. Most methods for removing chromatin require first a nuclease digestion and then a salt extraction to remove cut chromatin. We have hypothesized that cut chromatin is held in place by charge interactions involving nucleosomal amino groups. We have tested this hypothesis by chemically modifying amino groups after nuclease digestion. By using this protocol, chromatin could be effectively removed at physiological ionic strength. We compared the ultrastructure and composition of this nuclear matrix preparation with the traditional high-salt nuclear matrix and with the third nuclear matrix preparation that we have developed from which chromatin is removed after extensive crosslinking. All three matrix preparations reveal internal nuclear matrix structures that are built on a network of branched filaments of about 10 nm diameter. That such different chromatin-removal protocols reveal similar principles of nuclear matrix construction increases our confidence that we are observing important architectural elements of the native structure in the living cell. PMID:9927671

  4. Prosodic analysis by rule

    NASA Astrophysics Data System (ADS)

    Lindsay, D.

    1985-02-01

    Research on the automatic computer analysis of intonation using linguistic knowledge is described. The use of computer programs to analyze and classify fundamental frequency (FO) contours, and work on the psychophysics of British English intonation and on the phonetics of FO contours are described. Results suggest that FO can be conveniently tracked to represent intonation through time, which can be subsequently used by a computer program as the basis for analysis. Nuclear intonation, where the intonational nucleus is the region of auditory prominence, or information focus, found in all spoken sentences was studied. The main mechanism behind such prominence is the perception of an extensive FO movement on the nuclear syllable. A classification of the nuclear contour shape is a classification of the sentence type, often into categories that cannot be readily determined from only the segmental phonemes of the utterance.

  5. Computer codes for checking, plotting and processing of neutron cross-section covariance data and their application

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sartori, E.; Roussin, R.W.

    This paper presents a brief review of computer codes concerned with checking, plotting, processing and using of covariances of neutron cross-section data. It concentrates on those available from the computer code information centers of the United States and the OECD/Nuclear Energy Agency. Emphasis will be placed also on codes using covariances for specific applications such as uncertainty analysis, data adjustment and data consistency analysis. Recent evaluations contain neutron cross section covariance information for all isotopes of major importance for technological applications of nuclear energy. It is therefore important that the available software tools needed for taking advantage of this informationmore » are widely known as hey permit the determination of better safety margins and allow the optimization of more economic, I designs of nuclear energy systems.« less

  6. U.S. Nuclear Weapons Enterprise: A Strategic Past and Unknown Future

    DTIC Science & Technology

    2012-04-25

    are left to base their planning assumptions, weapons designs and capabilities on outdated models . The likelihood of a large-scale nuclear war has...conduct any testing on nuclear weapons and must rely on computer modeling . While this may provide sufficient confidence in the current nuclear...unlikely the world will be free of nuclear weapons. 24 APPENDIX A – Acronyms ACC – Air Combat Command ACM – Advanced cruise missle CSAF

  7. Computers in Engineering Teaching.

    ERIC Educational Resources Information Center

    Rushby, N. J.

    This bibliography cites 26 books, papers, and reports dealing with various uses of computers in engineering education; and describes several computer programs available for use in teaching aeronautical, chemical, civil, electrical and electronic, mechanical, and nuclear engineering. Each computer program entry is presented by name, author,…

  8. Calcium-43 chemical shift and electric field gradient tensor interplay: a sensitive probe of structure, polymorphism, and hydration.

    PubMed

    Widdifield, Cory M; Moudrakovski, Igor; Bryce, David L

    2014-07-14

    Calcium is the 5th most abundant element on earth, and is found in numerous biological tissues, proteins, materials, and increasingly in catalysts. However, due to a number of unfavourable nuclear properties, such as a low magnetogyric ratio, very low natural abundance, and its nuclear electric quadrupole moment, development of solid-state (43)Ca NMR has been constrained relative to similar nuclides. In this study, 12 commonly-available calcium compounds are analyzed via(43)Ca solid-state NMR and the information which may be obtained by the measurement of both the (43)Ca electric field gradient (EFG) and chemical shift tensors (the latter of which are extremely rare with only a handful of literature examples) is discussed. Combined with density functional theory (DFT) computations, this 'tensor interplay' is, for the first time for (43)Ca, illustrated to be diagnostic in distinguishing polymorphs (e.g., calcium formate), and the degree of hydration (e.g., CaCl2·2H2O and calcium tartrate tetrahydrate). For Ca(OH)2, we outline the first example of (1)H to (43)Ca cross-polarization on a sample at natural abundance in (43)Ca. Using prior knowledge of the relationship between the isotropic calcium chemical shift and the calcium quadrupolar coupling constant (CQ) with coordination number, we postulate the coordination number in a sample of calcium levulinate dihydrate, which does not have a known crystal structure. Natural samples of CaCO3 (aragonite polymorph) are used to show that the synthetic structure is present in nature. Gauge-including projector augmented-wave (GIPAW) DFT computations using accepted crystal structures for many of these systems generally result in calculated NMR tensor parameters which are in very good agreement with the experimental observations. This combination of (43)Ca NMR measurements with GIPAW DFT ultimately allows us to establish clear correlations between various solid-state (43)Ca NMR observables and selected structural parameters, such as unit cell dimensions and average Ca-O bond distances.

  9. Integrative structure and functional anatomy of a nuclear pore complex

    NASA Astrophysics Data System (ADS)

    Kim, Seung Joong; Fernandez-Martinez, Javier; Nudelman, Ilona; Shi, Yi; Zhang, Wenzhu; Raveh, Barak; Herricks, Thurston; Slaughter, Brian D.; Hogan, Joanna A.; Upla, Paula; Chemmama, Ilan E.; Pellarin, Riccardo; Echeverria, Ignacia; Shivaraju, Manjunatha; Chaudhury, Azraa S.; Wang, Junjie; Williams, Rosemary; Unruh, Jay R.; Greenberg, Charles H.; Jacobs, Erica Y.; Yu, Zhiheng; de La Cruz, M. Jason; Mironska, Roxana; Stokes, David L.; Aitchison, John D.; Jarrold, Martin F.; Gerton, Jennifer L.; Ludtke, Steven J.; Akey, Christopher W.; Chait, Brian T.; Sali, Andrej; Rout, Michael P.

    2018-03-01

    Nuclear pore complexes play central roles as gatekeepers of RNA and protein transport between the cytoplasm and nucleoplasm. However, their large size and dynamic nature have impeded a full structural and functional elucidation. Here we determined the structure of the entire 552-protein nuclear pore complex of the yeast Saccharomyces cerevisiae at sub-nanometre precision by satisfying a wide range of data relating to the molecular arrangement of its constituents. The nuclear pore complex incorporates sturdy diagonal columns and connector cables attached to these columns, imbuing the structure with strength and flexibility. These cables also tie together all other elements of the nuclear pore complex, including membrane-interacting regions, outer rings and RNA-processing platforms. Inwardly directed anchors create a high density of transport factor-docking Phe-Gly repeats in the central channel, organized into distinct functional units. This integrative structure enables us to rationalize the architecture, transport mechanism and evolutionary origins of the nuclear pore complex.

  10. Integrative structure and functional anatomy of a nuclear pore complex.

    PubMed

    Kim, Seung Joong; Fernandez-Martinez, Javier; Nudelman, Ilona; Shi, Yi; Zhang, Wenzhu; Raveh, Barak; Herricks, Thurston; Slaughter, Brian D; Hogan, Joanna A; Upla, Paula; Chemmama, Ilan E; Pellarin, Riccardo; Echeverria, Ignacia; Shivaraju, Manjunatha; Chaudhury, Azraa S; Wang, Junjie; Williams, Rosemary; Unruh, Jay R; Greenberg, Charles H; Jacobs, Erica Y; Yu, Zhiheng; de la Cruz, M Jason; Mironska, Roxana; Stokes, David L; Aitchison, John D; Jarrold, Martin F; Gerton, Jennifer L; Ludtke, Steven J; Akey, Christopher W; Chait, Brian T; Sali, Andrej; Rout, Michael P

    2018-03-22

    Nuclear pore complexes play central roles as gatekeepers of RNA and protein transport between the cytoplasm and nucleoplasm. However, their large size and dynamic nature have impeded a full structural and functional elucidation. Here we determined the structure of the entire 552-protein nuclear pore complex of the yeast Saccharomyces cerevisiae at sub-nanometre precision by satisfying a wide range of data relating to the molecular arrangement of its constituents. The nuclear pore complex incorporates sturdy diagonal columns and connector cables attached to these columns, imbuing the structure with strength and flexibility. These cables also tie together all other elements of the nuclear pore complex, including membrane-interacting regions, outer rings and RNA-processing platforms. Inwardly directed anchors create a high density of transport factor-docking Phe-Gly repeats in the central channel, organized into distinct functional units. This integrative structure enables us to rationalize the architecture, transport mechanism and evolutionary origins of the nuclear pore complex.

  11. Condensins exert force on chromatin-nuclear envelope tethers to mediate nucleoplasmic reticulum formation in Drosophila melanogaster.

    PubMed

    Bozler, Julianna; Nguyen, Huy Q; Rogers, Gregory C; Bosco, Giovanni

    2014-12-30

    Although the nuclear envelope is known primarily for its role as a boundary between the nucleus and cytoplasm in eukaryotes, it plays a vital and dynamic role in many cellular processes. Studies of nuclear structure have revealed tissue-specific changes in nuclear envelope architecture, suggesting that its three-dimensional structure contributes to its functionality. Despite the importance of the nuclear envelope, the factors that regulate and maintain nuclear envelope shape remain largely unexplored. The nuclear envelope makes extensive and dynamic interactions with the underlying chromatin. Given this inexorable link between chromatin and the nuclear envelope, it is possible that local and global chromatin organization reciprocally impact nuclear envelope form and function. In this study, we use Drosophila salivary glands to show that the three-dimensional structure of the nuclear envelope can be altered with condensin II-mediated chromatin condensation. Both naturally occurring and engineered chromatin-envelope interactions are sufficient to allow chromatin compaction forces to drive distortions of the nuclear envelope. Weakening of the nuclear lamina further enhanced envelope remodeling, suggesting that envelope structure is capable of counterbalancing chromatin compaction forces. Our experiments reveal that the nucleoplasmic reticulum is born of the nuclear envelope and remains dynamic in that they can be reabsorbed into the nuclear envelope. We propose a model where inner nuclear envelope-chromatin tethers allow interphase chromosome movements to change nuclear envelope morphology. Therefore, interphase chromatin compaction may be a normal mechanism that reorganizes nuclear architecture, while under pathological conditions, such as laminopathies, compaction forces may contribute to defects in nuclear morphology. Copyright © 2015 Bozler et al.

  12. Condensins Exert Force on Chromatin-Nuclear Envelope Tethers to Mediate Nucleoplasmic Reticulum Formation in Drosophila melanogaster

    PubMed Central

    Bozler, Julianna; Nguyen, Huy Q.; Rogers, Gregory C.; Bosco, Giovanni

    2014-01-01

    Although the nuclear envelope is known primarily for its role as a boundary between the nucleus and cytoplasm in eukaryotes, it plays a vital and dynamic role in many cellular processes. Studies of nuclear structure have revealed tissue-specific changes in nuclear envelope architecture, suggesting that its three-dimensional structure contributes to its functionality. Despite the importance of the nuclear envelope, the factors that regulate and maintain nuclear envelope shape remain largely unexplored. The nuclear envelope makes extensive and dynamic interactions with the underlying chromatin. Given this inexorable link between chromatin and the nuclear envelope, it is possible that local and global chromatin organization reciprocally impact nuclear envelope form and function. In this study, we use Drosophila salivary glands to show that the three-dimensional structure of the nuclear envelope can be altered with condensin II-mediated chromatin condensation. Both naturally occurring and engineered chromatin-envelope interactions are sufficient to allow chromatin compaction forces to drive distortions of the nuclear envelope. Weakening of the nuclear lamina further enhanced envelope remodeling, suggesting that envelope structure is capable of counterbalancing chromatin compaction forces. Our experiments reveal that the nucleoplasmic reticulum is born of the nuclear envelope and remains dynamic in that they can be reabsorbed into the nuclear envelope. We propose a model where inner nuclear envelope-chromatin tethers allow interphase chromosome movements to change nuclear envelope morphology. Therefore, interphase chromatin compaction may be a normal mechanism that reorganizes nuclear architecture, while under pathological conditions, such as laminopathies, compaction forces may contribute to defects in nuclear morphology. PMID:25552604

  13. Computational materials design of crystalline solids.

    PubMed

    Butler, Keith T; Frost, Jarvist M; Skelton, Jonathan M; Svane, Katrine L; Walsh, Aron

    2016-11-07

    The modelling of materials properties and processes from first principles is becoming sufficiently accurate as to facilitate the design and testing of new systems in silico. Computational materials science is both valuable and increasingly necessary for developing novel functional materials and composites that meet the requirements of next-generation technology. A range of simulation techniques are being developed and applied to problems related to materials for energy generation, storage and conversion including solar cells, nuclear reactors, batteries, fuel cells, and catalytic systems. Such techniques may combine crystal-structure prediction (global optimisation), data mining (materials informatics) and high-throughput screening with elements of machine learning. We explore the development process associated with computational materials design, from setting the requirements and descriptors to the development and testing of new materials. As a case study, we critically review progress in the fields of thermoelectrics and photovoltaics, including the simulation of lattice thermal conductivity and the search for Pb-free hybrid halide perovskites. Finally, a number of universal chemical-design principles are advanced.

  14. Tensor Factorization for Low-Rank Tensor Completion.

    PubMed

    Zhou, Pan; Lu, Canyi; Lin, Zhouchen; Zhang, Chao

    2018-03-01

    Recently, a tensor nuclear norm (TNN) based method was proposed to solve the tensor completion problem, which has achieved state-of-the-art performance on image and video inpainting tasks. However, it requires computing tensor singular value decomposition (t-SVD), which costs much computation and thus cannot efficiently handle tensor data, due to its natural large scale. Motivated by TNN, we propose a novel low-rank tensor factorization method for efficiently solving the 3-way tensor completion problem. Our method preserves the low-rank structure of a tensor by factorizing it into the product of two tensors of smaller sizes. In the optimization process, our method only needs to update two smaller tensors, which can be more efficiently conducted than computing t-SVD. Furthermore, we prove that the proposed alternating minimization algorithm can converge to a Karush-Kuhn-Tucker point. Experimental results on the synthetic data recovery, image and video inpainting tasks clearly demonstrate the superior performance and efficiency of our developed method over state-of-the-arts including the TNN and matricization methods.

  15. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vinnikov, B.; NRC Kurchatov Inst.

    According to Scientific and Technical Cooperation between the USA and Russia in the field of nuclear engineering the Idaho National Laboratory has transferred to the possession of the National Research Center ' Kurchatov Inst. ' the SAPHIRE software without any fee. With the help of the software Kurchatov Inst. developed a Pilot Living PSA- Model of Leningrad NPP Unit 1. Computations of core damage frequencies were carried out for additional Initiating Events. In the submitted paper such additional Initiating Events are fires in various compartments of the NPP. During the computations of each fire, structure of the PSA - Modelmore » was not changed, but Fault Trees for the appropriate systems, which are removed from service during the fire, were changed. It follows from the computations, that for ten fires Core Damaged Frequencies (CDF) are not changed. Other six fires will cause additional core damage. On the basis of the calculated results it is possible to determine a degree of importance of these fires and to establish sequence of performance of fire-prevention measures in various places of the NPP. (authors)« less

  16. COST FUNCTION STUDIES FOR POWER REACTORS

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Heestand, J.; Wos, L.T.

    1961-11-01

    A function to evaluate the cost of electricity produced by a nuclear power reactor was developed. The basic equation, revenue = capital charges + profit + operating expenses, was expanded in terms of various cost parameters to enable analysis of multiregion nuclear reactors with uranium and/or plutonium for fuel. A corresponding IBM 704 computer program, which will compute either the price of electricity or the value of plutonium, is presented in detail. (auth)

  17. Calibration-quality adiabatic potential energy surfaces for H3(+) and its isotopologues.

    PubMed

    Pavanello, Michele; Adamowicz, Ludwik; Alijah, Alexander; Zobov, Nikolai F; Mizus, Irina I; Polyansky, Oleg L; Tennyson, Jonathan; Szidarovszky, Tamás; Császár, Attila G

    2012-05-14

    Calibration-quality ab initio adiabatic potential energy surfaces (PES) have been determined for all isotopologues of the molecular ion H(3)(+). The underlying Born-Oppenheimer electronic structure computations used optimized explicitly correlated shifted Gaussian functions. The surfaces include diagonal Born-Oppenheimer corrections computed from the accurate electronic wave functions. A fit to the 41,655 ab initio points is presented which gives a standard deviation better than 0.1 cm(-1) when restricted to the points up to 6000 cm(-1) above the first dissociation asymptote. Nuclear motion calculations utilizing this PES, called GLH3P, and an exact kinetic energy operator given in orthogonal internal coordinates are presented. The ro-vibrational transition frequencies for H(3)(+), H(2)D(+), and HD(2)(+) are compared with high resolution measurements. The most sophisticated and complete procedure employed to compute ro-vibrational energy levels, which makes explicit allowance for the inclusion of non-adiabatic effects, reproduces all the known ro-vibrational levels of the H(3)(+) isotopologues considered to better than 0.2 cm(-1). This represents a significant (order-of-magnitude) improvement compared to previous studies of transitions in the visible. Careful treatment of linear geometries is important for high frequency transitions and leads to new assignments for some of the previously observed lines. Prospects for further investigations of non-adiabatic effects in the H(3)(+) isotopologues are discussed. In short, the paper presents (a) an extremely accurate global potential energy surface of H(3)(+) resulting from high accuracy ab initio computations and global fit, (b) very accurate nuclear motion calculations of all available experimental line data up to 16,000 cm(-1), and (c) results suggest that we can predict accurately the lines of H(3)(+) towards dissociation and thus facilitate their experimental observation.

  18. Calibration-quality adiabatic potential energy surfaces for H3+ and its isotopologues

    NASA Astrophysics Data System (ADS)

    Pavanello, Michele; Adamowicz, Ludwik; Alijah, Alexander; Zobov, Nikolai F.; Mizus, Irina I.; Polyansky, Oleg L.; Tennyson, Jonathan; Szidarovszky, Tamás; Császár, Attila G.

    2012-05-01

    Calibration-quality ab initio adiabatic potential energy surfaces (PES) have been determined for all isotopologues of the molecular ion H_3^+. The underlying Born-Oppenheimer electronic structure computations used optimized explicitly correlated shifted Gaussian functions. The surfaces include diagonal Born-Oppenheimer corrections computed from the accurate electronic wave functions. A fit to the 41 655 ab initio points is presented which gives a standard deviation better than 0.1 cm-1 when restricted to the points up to 6000 cm-1 above the first dissociation asymptote. Nuclear motion calculations utilizing this PES, called GLH3P, and an exact kinetic energy operator given in orthogonal internal coordinates are presented. The ro-vibrational transition frequencies for H_3^+, H2D+, and HD_2^+ are compared with high resolution measurements. The most sophisticated and complete procedure employed to compute ro-vibrational energy levels, which makes explicit allowance for the inclusion of non-adiabatic effects, reproduces all the known ro-vibrational levels of the H_3^+ isotopologues considered to better than 0.2 cm-1. This represents a significant (order-of-magnitude) improvement compared to previous studies of transitions in the visible. Careful treatment of linear geometries is important for high frequency transitions and leads to new assignments for some of the previously observed lines. Prospects for further investigations of non-adiabatic effects in the H_3^+ isotopologues are discussed. In short, the paper presents (a) an extremely accurate global potential energy surface of H_3^+ resulting from high accuracy ab initio computations and global fit, (b) very accurate nuclear motion calculations of all available experimental line data up to 16 000 cm-1, and (c) results suggest that we can predict accurately the lines of H_3^+ towards dissociation and thus facilitate their experimental observation.

  19. Report on the FY17 Development of Computer Program for ASME Section III, Division 5, Subsection HB, Subpart B Rules

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Swindeman, M. J.; Jetter, R. I.; Sham, T. -L.

    One of the objectives of the high temperature design methodology activities is to develop and validate both improvements and the basic features of ASME Boiler and Pressure Vessel Code, Section III, Rules for Construction of Nuclear Facility Components, Division 5, High Temperature Reactors, Subsection HB, Subpart B (HBB). The overall scope of this task is to develop a computer program to aid assessment procedures of components under specified loading conditions in accordance with the elevated temperature design requirements for Division 5 Class A components. There are many features and alternative paths of varying complexity in HBB. The initial focus ofmore » this computer program is a basic path through the various options for a single reference material, 316H stainless steel. However, the computer program is being structured for eventual incorporation all of the features and permitted materials of HBB. This report will first provide a description of the overall computer program, particular challenges in developing numerical procedures for the assessment, and an overall approach to computer program development. This is followed by a more comprehensive appendix, which is the draft computer program manual for the program development. The strain limits rules have been implemented in the computer program. The evaluation of creep-fatigue damage will be implemented in future work scope.« less

  20. Databases of Conformations and NMR Structures of Glycan Determinants.

    PubMed

    Sarkar, Anita; Drouillard, Sophie; Rivet, Alain; Perez, Serge

    2015-12-01

    The present study reports a comprehensive nuclear magnetic resonance (NMR) characterization and a systematic conformational sampling of the conformational preferences of 170 glycan moieties of glycosphingolipids as produced in large-scale quantities by bacterial fermentation. These glycans span across a variety of families including the blood group antigens (A, B and O), core structures (Types 1, 2 and 4), fucosylated oligosaccharides (core and lacto-series), sialylated oligosaccharides (Types 1 and 2), Lewis antigens, GPI-anchors and globosides. A complementary set of about 100 glycan determinants occurring in glycoproteins and glycosaminoglycans has also been structurally characterized using molecular mechanics-based computation. The experimental and computational data generated are organized in two relational databases that can be queried by the user through a user-friendly search engine. The NMR ((1)H and (13)C, COSY, TOCSY, HMQC, HMBC correlation) spectra and 3D structures are available for visualization and download in commonly used structure formats. Emphasis has been given to the use of a common nomenclature for the structural encoding of the carbohydrates and each glycan molecule is described by four different types of representations in order to cope with the different usages in chemistry and biology. These web-based databases were developed with non-proprietary software and are open access for the scientific community available at http://glyco3d.cermav.cnrs.fr. © The Author 2015. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  1. HZEFRG1 - SEMIEMPIRICAL NUCLEAR FRAGMENTATION MODEL

    NASA Technical Reports Server (NTRS)

    Townsend, L. W.

    1994-01-01

    The high charge and energy (HZE), Semiempirical Nuclear Fragmentation Model, HZEFRG1, was developed to provide a computationally efficient, user-friendly, physics-based program package for generating nuclear fragmentation databases. These databases can then be used in radiation transport applications such as space radiation shielding and dosimetry, cancer therapy with laboratory heavy ion beams, and simulation studies of detector design in nuclear physics experiments. The program provides individual element and isotope production cross sections for the breakup of high energy heavy ions by the combined nuclear and Coulomb fields of the interacting nuclei. The nuclear breakup contributions are estimated using an energy-dependent abrasion-ablation model of heavy ion fragmentation. The abrasion step involves removal of nucleons by direct knockout in the overlap region of the colliding nuclei. The abrasions are treated on a geometric basis and uniform spherical nuclear density distributions are assumed. Actual experimental nuclear radii obtained from tabulations of electron scattering data are incorporated. Nuclear transparency effects are included by using an energy-dependent, impact-parameter-dependent average transmission factor for the projectile and target nuclei, which accounts for the finite mean free path of nucleons in nuclear matter. The ablation step, as implemented by Bowman, Swiatecki, and Tsang (LBL report no. LBL-2908, July 1973), was treated as a single-nucleon emission for every 10 MeV of excitation energy. Fragmentation contributions from electromagnetic dissociation (EMD) processes, arising from the interacting Coulomb fields, are estimated by using the Weiszacker-Williams theory, extended to include electric dipole and electric quadrupole contributions to one-nucleon removal cross sections. HZEFRG1 consists of a main program, seven function subprograms, and thirteen subroutines. Each is fully commented and begins with a brief description of its functionality. The inputs, which are provided interactively by the user in response to on-screen questions, consist of the projectile kinetic energy in units of MeV/nucleon and the masses and charges of the projectile and target nuclei. With proper inputs, HZEFRG1 first calculates the EMD cross sections and then begins the calculations for nuclear fragmentation by searching through a specified number of isotopes for each charge number (Z) from Z=1 (hydrogen) to the charge of the incident fragmenting nucleus (Zp). After completing the nuclear fragmentation cross sections, HZEFRG1 sorts through the results and writes the sorted output to a file in descending order, based on the charge number of the fragmented nucleus. Details of the theory, extensive comparisons of its predictions with available experimental cross section data, and a complete description of the code implementing it are given in the program documentation. HZEFRG1 is written in ANSI FORTRAN 77 to be machine independent. It was originally developed on a DEC VAX series computer, and has been successfully implemented on a DECstation running RISC ULTRIX 4.3, a Sun4 series computer running SunOS 4.1, an HP 9000 series computer running HP-UX 8.0.1, a Cray Y-MP series computer running UNICOS, and IBM PC series computers running MS-DOS 3.3 and higher. HZEFRG1 requires 1Mb of RAM for execution. In addition, a FORTRAN 77 compiler is required to create an executable. A sample output run is included on the distribution medium for numerical comparison. The standard distribution medium for this program is a 3.5 inch 1.44Mb MS-DOS format diskette. Alternate distribution media and formats are available upon request. HZEFRG1 was completed in 1992.

  2. Synthesis of calculational methods for design and analysis of radiation shields for nuclear rocket systems

    NASA Technical Reports Server (NTRS)

    Capo, M. A.; Disney, R. K.; Jordan, T. A.; Soltesz, R. G.; Woodsum, H. C.

    1969-01-01

    Eight computer programs make up a nine volume synthesis containing two design methods for nuclear rocket radiation shields. The first design method is appropriate for parametric and preliminary studies, while the second accomplishes the verification of a final nuclear rocket reactor design.

  3. Establishment of a Photon Data Section of the BNL National Nuclear Data Center: A preliminary proposal

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hanson, A.L.; Pearlstein, S.

    1992-05-01

    It is proposed to establish a Photon Data Section (PDS) of the BNL National Nuclear Data Center (NNDC). This would be a total program encompassing both photon-atom and photon-nucleus interactions. By utilizing the existing NNDC data base management expertise and on-line access capabilities, the implementation of photon interaction data activities within the existing NNDC nuclear structure and nuclear-reaction activities can reestablish a viable photon interaction data program at minimum cost. By taking advantage of the on-line capabilities, the x-ray users' community will have access to a dynamic, state-of-the-art data base of interaction information. The proposed information base would include datamore » that presently are scattered throughout the literature usually in tabulated form. It is expected that the data bases would include at least the most precise data available in photoelectric cross sections, atomic form factors and incoherent scattering functions, anomalous scattering factors, oscillator strengths and oscillator densities, fluorescence yields, Auger electron yields, etc. It could also include information not presently available in tabulations or in existing data bases such as EXAFS (extended x-ray absorption fine structure) reference spectra, chemical bonding induced shifts in the photoelectric absorption edge, matrix corrections, x-ray Raman, and x-ray resonant Raman cross sections. The data base will also include the best estimates of the accuracy of the interaction data as it exists in the data base. It is proposed that the PDS would support computer programs written for calculating scattering cross sections for given solid angles, sample geometries, and polarization of incident x-rays, for calculating Compton profiles, and for analyzing data as in EXAFS and x-ray fluorescence.« less

  4. Establishment of a Photon Data Section of the BNL National Nuclear Data Center: A preliminary proposal

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hanson, A.L.; Pearlstein, S.

    1992-05-01

    It is proposed to establish a Photon Data Section (PDS) of the BNL National Nuclear Data Center (NNDC). This would be a total program encompassing both photon-atom and photon-nucleus interactions. By utilizing the existing NNDC data base management expertise and on-line access capabilities, the implementation of photon interaction data activities within the existing NNDC nuclear structure and nuclear-reaction activities can reestablish a viable photon interaction data program at minimum cost. By taking advantage of the on-line capabilities, the x-ray users` community will have access to a dynamic, state-of-the-art data base of interaction information. The proposed information base would include datamore » that presently are scattered throughout the literature usually in tabulated form. It is expected that the data bases would include at least the most precise data available in photoelectric cross sections, atomic form factors and incoherent scattering functions, anomalous scattering factors, oscillator strengths and oscillator densities, fluorescence yields, Auger electron yields, etc. It could also include information not presently available in tabulations or in existing data bases such as EXAFS (extended x-ray absorption fine structure) reference spectra, chemical bonding induced shifts in the photoelectric absorption edge, matrix corrections, x-ray Raman, and x-ray resonant Raman cross sections. The data base will also include the best estimates of the accuracy of the interaction data as it exists in the data base. It is proposed that the PDS would support computer programs written for calculating scattering cross sections for given solid angles, sample geometries, and polarization of incident x-rays, for calculating Compton profiles, and for analyzing data as in EXAFS and x-ray fluorescence.« less

  5. A scalable quantum computer with ions in an array of microtraps

    PubMed

    Cirac; Zoller

    2000-04-06

    Quantum computers require the storage of quantum information in a set of two-level systems (called qubits), the processing of this information using quantum gates and a means of final readout. So far, only a few systems have been identified as potentially viable quantum computer models--accurate quantum control of the coherent evolution is required in order to realize gate operations, while at the same time decoherence must be avoided. Examples include quantum optical systems (such as those utilizing trapped ions or neutral atoms, cavity quantum electrodynamics and nuclear magnetic resonance) and solid state systems (using nuclear spins, quantum dots and Josephson junctions). The most advanced candidates are the quantum optical and nuclear magnetic resonance systems, and we expect that they will allow quantum computing with about ten qubits within the next few years. This is still far from the numbers required for useful applications: for example, the factorization of a 200-digit number requires about 3,500 qubits, rising to 100,000 if error correction is implemented. Scalability of proposed quantum computer architectures to many qubits is thus of central importance. Here we propose a model for an ion trap quantum computer that combines scalability (a feature usually associated with solid state proposals) with the advantages of quantum optical systems (in particular, quantum control and long decoherence times).

  6. Nuclear matrix and structural and functional compartmentalization of the eucaryotic cell nucleus.

    PubMed

    Razin, S V; Borunova, V V; Iarovaia, O V; Vassetzky, Y S

    2014-07-01

    Becoming popular at the end of the 20th century, the concept of the nuclear matrix implies the existence of a nuclear skeleton that organizes functional elements in the cell nucleus. This review presents a critical analysis of the results obtained in the study of nuclear matrix in the light of current views on the organization of the cell nucleus. Numerous studies of nuclear matrix have failed to provide evidence of the existence of such a structure. Moreover, the existence of a filamentous structure that supports the nuclear compartmentalization appears to be unnecessary, since this function is performed by the folded genome itself.

  7. Evaluated nuclear structure data file

    NASA Astrophysics Data System (ADS)

    Tuli, J. K.

    1996-02-01

    The Evaluated Nuclear Structure Data File (ENSDF) contains the evaluated nuclear properties of all known nuclides, as derived both from nuclear reaction and radioactive decay measurements. All experimental data are evaluated to create the adopted properties for each nuclide. ENSDF, together with other numeric and bibliographic files, can be accessed on-line through the INTERNET or modem, and some of the databases are also available on the World Wide Web. The structure and the scope of ENSDF are presented along with the on-line access system of the National Nuclear Data Center at Brookhaven National Laboratory.

  8. Evaluated nuclear structure data file

    NASA Astrophysics Data System (ADS)

    Tuli, J. K.

    The Evaluated Nuclear Structure Data File (ENSDF) contains the evaluated nuclear properties of all known nuclides. These properties are derived both from nuclear reaction and radioactive decay measurements. All experimental data are evaluated to create the adopted properties for each nuclide. ENSDF, together with other numeric and biographic files, can be accessed on-line through the INTERNET or modem. Some of the databases are also available on the World Wide Web. The structure and the scope of ENSDF are presented along with the on-line access system of the National Nuclear Data Center at Brookhaven National Laboratory.

  9. PREFACE: International Conference on Computing in High Energy and Nuclear Physics (CHEP'07)

    NASA Astrophysics Data System (ADS)

    Sobie, Randall; Tafirout, Reda; Thomson, Jana

    2007-07-01

    The 2007 International Conference on Computing in High Energy and Nuclear Physics (CHEP) was held on 2-7 September 2007 in Victoria, British Columbia, Canada. CHEP is a major series of international conferences for physicists and computing professionals from the High Energy and Nuclear Physics community, Computer Science and Information Technology. The CHEP conference provides an international forum to exchange information on computing experience and needs for the community, and to review recent, ongoing, and future activities. The CHEP'07 conference had close to 500 attendees with a program that included plenary sessions of invited oral presentations, a number of parallel sessions comprising oral and poster presentations, and an industrial exhibition. Conference tracks covered topics in Online Computing, Event Processing, Software Components, Tools and Databases, Software Tools and Information Systems, Computing Facilities, Production Grids and Networking, Grid Middleware and Tools, Distributed Data Analysis and Information Management and Collaborative Tools. The conference included a successful whale-watching excursion involving over 200 participants and a banquet at the Royal British Columbia Museum. The next CHEP conference will be held in Prague in March 2009. We would like thank the sponsors of the conference and the staff at the TRIUMF Laboratory and the University of Victoria who made the CHEP'07 a success. Randall Sobie and Reda Tafirout CHEP'07 Conference Chairs

  10. BOLD VENTURE COMPUTATION SYSTEM for nuclear reactor core analysis, Version III

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vondy, D.R.; Fowler, T.B.; Cunningham, G.W. III.

    1981-06-01

    This report is a condensed documentation for VERSION III of the BOLD VENTURE COMPUTATION SYSTEM for nuclear reactor core analysis. An experienced analyst should be able to use this system routinely for solving problems by referring to this document. Individual reports must be referenced for details. This report covers basic input instructions and describes recent extensions to the modules as well as to the interface data file specifications. Some application considerations are discussed and an elaborate sample problem is used as an instruction aid. Instructions for creating the system on IBM computers are also given.

  11. Simulation of multi-photon emission isotopes using time-resolved SimSET multiple photon history generator

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chiang, Chih-Chieh; Lin, Hsin-Hon; Lin, Chang-Shiun

    Abstract-Multiple-photon emitters, such as In-111 or Se-75, have enormous potential in the field of nuclear medicine imaging. For example, Se-75 can be used to investigate the bile acid malabsorption and measure the bile acid pool loss. The simulation system for emission tomography (SimSET) is a well-known Monte Carlo simulation (MCS) code in nuclear medicine for its high computational efficiency. However, current SimSET cannot simulate these isotopes due to the lack of modeling of complex decay scheme and the time-dependent decay process. To extend the versatility of SimSET for simulation of those multi-photon emission isotopes, a time-resolved multiple photon history generatormore » based on SimSET codes is developed in present study. For developing the time-resolved SimSET (trSimSET) with radionuclide decay process, the new MCS model introduce new features, including decay time information and photon time-of-flight information, into this new code. The half-life of energy states were tabulated from the Evaluated Nuclear Structure Data File (ENSDF) database. The MCS results indicate that the overall percent difference is less than 8.5% for all simulation trials as compared to GATE. To sum up, we demonstrated that time-resolved SimSET multiple photon history generator can have comparable accuracy with GATE and keeping better computational efficiency. The new MCS code is very useful to study the multi-photon imaging of novel isotopes that needs the simulation of lifetime and the time-of-fight measurements. (authors)« less

  12. Ab initio molecular dynamics with nuclear quantum effects at classical cost: Ring polymer contraction for density functional theory.

    PubMed

    Marsalek, Ondrej; Markland, Thomas E

    2016-02-07

    Path integral molecular dynamics simulations, combined with an ab initio evaluation of interactions using electronic structure theory, incorporate the quantum mechanical nature of both the electrons and nuclei, which are essential to accurately describe systems containing light nuclei. However, path integral simulations have traditionally required a computational cost around two orders of magnitude greater than treating the nuclei classically, making them prohibitively costly for most applications. Here we show that the cost of path integral simulations can be dramatically reduced by extending our ring polymer contraction approach to ab initio molecular dynamics simulations. By using density functional tight binding as a reference system, we show that our ring polymer contraction scheme gives rapid and systematic convergence to the full path integral density functional theory result. We demonstrate the efficiency of this approach in ab initio simulations of liquid water and the reactive protonated and deprotonated water dimer systems. We find that the vast majority of the nuclear quantum effects are accurately captured using contraction to just the ring polymer centroid, which requires the same number of density functional theory calculations as a classical simulation. Combined with a multiple time step scheme using the same reference system, which allows the time step to be increased, this approach is as fast as a typical classical ab initio molecular dynamics simulation and 35× faster than a full path integral calculation, while still exactly including the quantum sampling of nuclei. This development thus offers a route to routinely include nuclear quantum effects in ab initio molecular dynamics simulations at negligible computational cost.

  13. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lyakh, Dmitry I.

    An efficient parallel tensor transpose algorithm is suggested for shared-memory computing units, namely, multicore CPU, Intel Xeon Phi, and NVidia GPU. The algorithm operates on dense tensors (multidimensional arrays) and is based on the optimization of cache utilization on x86 CPU and the use of shared memory on NVidia GPU. From the applied side, the ultimate goal is to minimize the overhead encountered in the transformation of tensor contractions into matrix multiplications in computer implementations of advanced methods of quantum many-body theory (e.g., in electronic structure theory and nuclear physics). A particular accent is made on higher-dimensional tensors that typicallymore » appear in the so-called multireference correlated methods of electronic structure theory. Depending on tensor dimensionality, the presented optimized algorithms can achieve an order of magnitude speedup on x86 CPUs and 2-3 times speedup on NVidia Tesla K20X GPU with respect to the na ve scattering algorithm (no memory access optimization). Furthermore, the tensor transpose routines developed in this work have been incorporated into a general-purpose tensor algebra library (TAL-SH).« less

  14. An efficient tensor transpose algorithm for multicore CPU, Intel Xeon Phi, and NVidia Tesla GPU

    NASA Astrophysics Data System (ADS)

    Lyakh, Dmitry I.

    2015-04-01

    An efficient parallel tensor transpose algorithm is suggested for shared-memory computing units, namely, multicore CPU, Intel Xeon Phi, and NVidia GPU. The algorithm operates on dense tensors (multidimensional arrays) and is based on the optimization of cache utilization on x86 CPU and the use of shared memory on NVidia GPU. From the applied side, the ultimate goal is to minimize the overhead encountered in the transformation of tensor contractions into matrix multiplications in computer implementations of advanced methods of quantum many-body theory (e.g., in electronic structure theory and nuclear physics). A particular accent is made on higher-dimensional tensors that typically appear in the so-called multireference correlated methods of electronic structure theory. Depending on tensor dimensionality, the presented optimized algorithms can achieve an order of magnitude speedup on x86 CPUs and 2-3 times speedup on NVidia Tesla K20X GPU with respect to the naïve scattering algorithm (no memory access optimization). The tensor transpose routines developed in this work have been incorporated into a general-purpose tensor algebra library (TAL-SH).

  15. NMR crystallography of zeolites: How far can we go without diffraction data?

    PubMed

    Brouwer, Darren H; Van Huizen, Jared

    2018-05-10

    Nuclear magnetic resonance (NMR) crystallography-an approach to structure determination that seeks to integrate solid-state NMR spectroscopy, diffraction, and computation methods-has emerged as an effective strategy to determine structures of difficult-to-characterize materials, including zeolites and related network materials. This paper explores how far it is possible to go in determining the structure of a zeolite framework from a minimal amount of input information derived only from solid-state NMR spectroscopy. It is shown that the framework structure of the fluoride-containing and tetramethylammonium-templated octadecasil clathrasil material can be solved from the 1D 29 Si NMR spectrum and a single 2D 29 Si NMR correlation spectrum alone, without the space group and unit cell parameters normally obtained from diffraction data. The resulting NMR-solved structure is in excellent agreement with the structures determined previously by diffraction methods. It is anticipated that NMR crystallography strategies like this will be useful for structure determination of other materials, which cannot be solved from diffraction methods alone. Copyright © 2018 John Wiley & Sons, Ltd.

  16. Generalized Nuclear Data: A New Structure (with Supporting Infrastructure) for Handling Nuclear Data

    NASA Astrophysics Data System (ADS)

    Mattoon, C. M.; Beck, B. R.; Patel, N. R.; Summers, N. C.; Hedstrom, G. W.; Brown, D. A.

    2012-12-01

    The Evaluated Nuclear Data File (ENDF) format was designed in the 1960s to accommodate neutron reaction data to support nuclear engineering applications in power, national security and criticality safety. Over the years, the scope of the format has been extended to handle many other kinds of data including charged particle, decay, atomic, photo-nuclear and thermal neutron scattering. Although ENDF has wide acceptance and support for many data types, its limited support for correlated particle emission, limited numeric precision, and general lack of extensibility mean that the nuclear data community cannot take advantage of many emerging opportunities. More generally, the ENDF format provides an unfriendly environment that makes it difficult for new data evaluators and users to create and access nuclear data. The Cross Section Evaluation Working Group (CSEWG) has begun the design of a new Generalized Nuclear Data (or 'GND') structure, meant to replace older formats with a hierarchy that mirrors the underlying physics, and is aligned with modern coding and database practices. In support of this new structure, Lawrence Livermore National Laboratory (LLNL) has updated its nuclear data/reactions management package Fudge to handle GND structured nuclear data. Fudge provides tools for converting both the latest ENDF format (ENDF-6) and the LLNL Evaluated Nuclear Data Library (ENDL) format to and from GND, as well as for visualizing, modifying and processing (i.e., converting evaluated nuclear data into a form more suitable to transport codes) GND structured nuclear data. GND defines the structure needed for storing nuclear data evaluations and the type of data that needs to be stored. But unlike ENDF and ENDL, GND does not define how the data are to be stored in a file. Currently, Fudge writes the structured GND data to a file using the eXtensible Markup Language (XML), as it is ASCII based and can be viewed with any text editor. XML is a meta-language, meaning that it has a primitive set of definitions for representing hierarchical data/text in a file. Other meta-languages, like HDF5 which stores the data in binary form, can also be used to store GND in a file. In this paper, we will present an overview of the new GND data structures along with associated tools in Fudge.

  17. Thermal hydraulic-severe accident code interfaces for SCDAP/RELAP5/MOD3.2

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Coryell, E.W.; Siefken, L.J.; Harvego, E.A.

    1997-07-01

    The SCDAP/RELAP5 computer code is designed to describe the overall reactor coolant system thermal-hydraulic response, core damage progression, and fission product release during severe accidents. The code is being developed at the Idaho National Engineering Laboratory under the primary sponsorship of the Office of Nuclear Regulatory Research of the U.S. Nuclear Regulatory Commission. The code is the result of merging the RELAP5, SCDAP, and COUPLE codes. The RELAP5 portion of the code calculates the overall reactor coolant system, thermal-hydraulics, and associated reactor system responses. The SCDAP portion of the code describes the response of the core and associated vessel structures.more » The COUPLE portion of the code describes response of lower plenum structures and debris and the failure of the lower head. The code uses a modular approach with the overall structure, input/output processing, and data structures following the pattern established for RELAP5. The code uses a building block approach to allow the code user to easily represent a wide variety of systems and conditions through a powerful input processor. The user can represent a wide variety of experiments or reactor designs by selecting fuel rods and other assembly structures from a range of representative core component models, and arrange them in a variety of patterns within the thermalhydraulic network. The COUPLE portion of the code uses two-dimensional representations of the lower plenum structures and debris beds. The flow of information between the different portions of the code occurs at each system level time step advancement. The RELAP5 portion of the code describes the fluid transport around the system. These fluid conditions are used as thermal and mass transport boundary conditions for the SCDAP and COUPLE structures and debris beds.« less

  18. A HISTORICAL PERSPECTIVE OF NUCLEAR THERMAL HYDRAULICS

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    D’Auria, F; Rohatgi, Upendra S.

    The nuclear thermal-hydraulics discipline was developed following the needs for nuclear power plants (NPPs) and, to a more limited extent, research reactors (RR) design and safety. As in all other fields where analytical methods are involved, nuclear thermal-hydraulics took benefit of the development of computers. Thermodynamics, rather than fluid dynamics, is at the basis of the development of nuclear thermal-hydraulics together with the experiments in complex two-phase situations, namely, geometry, high thermal density, and pressure.

  19. Expression of DNAJB12 or DNAJB14 Causes Coordinate Invasion of the Nucleus by Membranes Associated with a Novel Nuclear Pore Structure

    PubMed Central

    Goodwin, Edward C.; Motamedi, Nasim; Lipovsky, Alex; Fernández-Busnadiego, Rubén; DiMaio, Daniel

    2014-01-01

    DNAJB12 and DNAJB14 are transmembrane proteins in the endoplasmic reticulum (ER) that serve as co-chaperones for Hsc70/Hsp70 heat shock proteins. We demonstrate that over-expression of DNAJB12 or DNAJB14 causes the formation of elaborate membranous structures within cell nuclei, which we designate DJANGOS for DNAJ-associated nuclear globular structures. DJANGOS contain DNAJB12, DNAJB14, Hsc70 and markers of the ER lumen and ER and nuclear membranes. Strikingly, they are evenly distributed underneath the nuclear envelope and are of uniform size in any one nucleus. DJANGOS are composed primarily of single-walled membrane tubes and sheets that connect to the nuclear envelope via a unique configuration of membranes, in which the nuclear pore complex appears anchored exclusively to the outer nuclear membrane, allowing both the inner and outer nuclear membranes to flow past the circumference of the nuclear pore complex into the nucleus. DJANGOS break down rapidly during cell division and reform synchronously in the daughter cell nuclei, demonstrating that they are dynamic structures that undergo coordinate formation and dissolution. Genetic studies showed that the chaperone activity of DNAJ/Hsc70 is required for the formation of DJANGOS. Further analysis of these structures will provide insight into nuclear pore formation and function, activities of molecular chaperones, and mechanisms that maintain membrane identity. PMID:24732912

  20. Argonne Physics Division

    Science.gov Websites

    , nuclear structure and reaction research, nuclear theory, medium energy nuclear research and accelerator structure of baryonic matter in the universe - the matter that makes up stars, planets and human life itself

  1. Molecular and Structural Traits of Insulin Receptor Substrate 1/LC3 Nuclear Structures and Their Role in Autophagy Control and Tumor Cell Survival.

    PubMed

    Lassak, Adam; Dean, Mathew; Wyczechowska, Dorota; Wilk, Anna; Marrero, Luis; Trillo-Tinoco, Jimena; Boulares, A Hamid; Sarkaria, Jann N; Del Valle, Luis; Peruzzi, Francesca; Ochoa, Augusto; Reiss, Krzysztof

    2018-05-15

    Insulin receptor substrate 1 (IRS-1) is a common cytosolic adaptor molecule involved in signal transduction from insulin and insulin-like growth factor I (IGF-I) receptors. IRS-1 can also be found in the nucleus. We report here a new finding of unique IRS-1 nuclear structures, which we observed initially in glioblastoma biopsy specimens and glioblastoma xenografts. These nuclear structures can be reproduced in vitro by the ectopic expression of IRS-1 cDNA cloned in frame with the nuclear localization signal (NLS-IRS-1). In these structures, IRS-1 localizes at the periphery, while the center harbors a key autophagy protein, LC3. These new nuclear structures are highly dynamic, rapidly exchange IRS-1 molecules with the surrounding nucleoplasm, disassemble during mitosis, and require a growth stimulus for their reassembly and maintenance. In tumor cells engineered to express NLS-IRS-1, the IRS-1/LC3 nuclear structures repress autophagy induced by either amino acid starvation or rapamycin treatment. In this process, IRS-1 nuclear structures sequester LC3 inside the nucleus, possibly preventing its cytosolic translocation and the formation of new autophagosomes. This novel mechanism provides a quick and reversible way of inhibiting autophagy, which could counteract autophagy-induced cancer cell death under severe stress, including anticancer therapies. Copyright © 2018 American Society for Microbiology.

  2. The virtual digital nuclear power plant: A modern tool for supporting the lifecycle of VVER-based nuclear power units

    NASA Astrophysics Data System (ADS)

    Arkadov, G. V.; Zhukavin, A. P.; Kroshilin, A. E.; Parshikov, I. A.; Solov'ev, S. L.; Shishov, A. V.

    2014-10-01

    The article describes the "Virtual Digital VVER-Based Nuclear Power Plant" computerized system comprising a totality of verified initial data (sets of input data for a model intended for describing the behavior of nuclear power plant (NPP) systems in design and emergency modes of their operation) and a unified system of new-generation computation codes intended for carrying out coordinated computation of the variety of physical processes in the reactor core and NPP equipment. Experiments with the demonstration version of the "Virtual Digital VVER-Based NPP" computerized system has shown that it is in principle possible to set up a unified system of computation codes in a common software environment for carrying out interconnected calculations of various physical phenomena at NPPs constructed according to the standard AES-2006 project. With the full-scale version of the "Virtual Digital VVER-Based NPP" computerized system put in operation, the concerned engineering, design, construction, and operating organizations will have access to all necessary information relating to the NPP power unit project throughout its entire lifecycle. The domestically developed commercial-grade software product set to operate as an independently operating application to the project will bring about additional competitive advantages in the modern market of nuclear power technologies.

  3. An improved numerical method to compute neutron/gamma deexcitation cascades starting from a high spin state

    DOE PAGES

    Regnier, D.; Litaize, O.; Serot, O.

    2015-12-23

    Numerous nuclear processes involve the deexcitation of a compound nucleus through the emission of several neutrons, gamma-rays and/or conversion electrons. The characteristics of such a deexcitation are commonly derived from a total statistical framework often called “Hauser–Feshbach” method. In this work, we highlight a numerical limitation of this kind of method in the case of the deexcitation of a high spin initial state. To circumvent this issue, an improved technique called the Fluctuating Structure Properties (FSP) method is presented. Two FSP algorithms are derived and benchmarked on the calculation of the total radiative width for a thermal neutron capture onmore » 238U. We compare the standard method with these FSP algorithms for the prediction of particle multiplicities in the deexcitation of a high spin level of 143Ba. The gamma multiplicity turns out to be very sensitive to the numerical method. The bias between the two techniques can reach 1.5 γγ/cascade. Lastly, the uncertainty of these calculations coming from the lack of knowledge on nuclear structure is estimated via the FSP method.« less

  4. 10 CFR 727.2 - What are the definitions of the terms used in this part?

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... information. Computer means desktop computers, portable computers, computer networks (including the DOE network and local area networks at or controlled by DOE organizations), network devices, automated.... DOE means the Department of Energy, including the National Nuclear Security Administration. DOE...

  5. 10 CFR 727.2 - What are the definitions of the terms used in this part?

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... information. Computer means desktop computers, portable computers, computer networks (including the DOE network and local area networks at or controlled by DOE organizations), network devices, automated.... DOE means the Department of Energy, including the National Nuclear Security Administration. DOE...

  6. 10 CFR 727.2 - What are the definitions of the terms used in this part?

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... information. Computer means desktop computers, portable computers, computer networks (including the DOE network and local area networks at or controlled by DOE organizations), network devices, automated.... DOE means the Department of Energy, including the National Nuclear Security Administration. DOE...

  7. 10 CFR 727.2 - What are the definitions of the terms used in this part?

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... information. Computer means desktop computers, portable computers, computer networks (including the DOE network and local area networks at or controlled by DOE organizations), network devices, automated.... DOE means the Department of Energy, including the National Nuclear Security Administration. DOE...

  8. 10 CFR 727.2 - What are the definitions of the terms used in this part?

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... information. Computer means desktop computers, portable computers, computer networks (including the DOE network and local area networks at or controlled by DOE organizations), network devices, automated.... DOE means the Department of Energy, including the National Nuclear Security Administration. DOE...

  9. FOLD-EM: automated fold recognition in medium- and low-resolution (4-15 Å) electron density maps.

    PubMed

    Saha, Mitul; Morais, Marc C

    2012-12-15

    Owing to the size and complexity of large multi-component biological assemblies, the most tractable approach to determining their atomic structure is often to fit high-resolution radiographic or nuclear magnetic resonance structures of isolated components into lower resolution electron density maps of the larger assembly obtained using cryo-electron microscopy (cryo-EM). This hybrid approach to structure determination requires that an atomic resolution structure of each component, or a suitable homolog, is available. If neither is available, then the amount of structural information regarding that component is limited by the resolution of the cryo-EM map. However, even if a suitable homolog cannot be identified using sequence analysis, a search for structural homologs should still be performed because structural homology often persists throughout evolution even when sequence homology is undetectable, As macromolecules can often be described as a collection of independently folded domains, one way of searching for structural homologs would be to systematically fit representative domain structures from a protein domain database into the medium/low resolution cryo-EM map and return the best fits. Taken together, the best fitting non-overlapping structures would constitute a 'mosaic' backbone model of the assembly that could aid map interpretation and illuminate biological function. Using the computational principles of the Scale-Invariant Feature Transform (SIFT), we have developed FOLD-EM-a computational tool that can identify folded macromolecular domains in medium to low resolution (4-15 Å) electron density maps and return a model of the constituent polypeptides in a fully automated fashion. As a by-product, FOLD-EM can also do flexible multi-domain fitting that may provide insight into conformational changes that occur in macromolecular assemblies.

  10. Teaching macromolecular modeling.

    PubMed Central

    Harvey, S C; Tan, R K

    1992-01-01

    Training newcomers to the field of macromolecular modeling is as difficult as is training beginners in x-ray crystallography, nuclear magnetic resonance, or other methods in structural biology. In one or two lectures, the most that can be conveyed is a general sense of the relationship between modeling and other structural methods. If a full semester is available, then students can be taught how molecular structures are built, manipulated, refined, and analyzed on a computer. Here we describe a one-semester modeling course that combines lectures, discussions, and a laboratory using a commercial modeling package. In the laboratory, students carry out prescribed exercises that are coordinated to the lectures, and they complete a term project on a modeling problem of their choice. The goal is to give students an understanding of what kinds of problems can be attacked by molecular modeling methods and which problems are beyond the current capabilities of those methods. PMID:1489919

  11. Permutation methods for the structured exploratory data analysis (SEDA) of familial trait values.

    PubMed

    Karlin, S; Williams, P T

    1984-07-01

    A collection of functions that contrast familial trait values between and across generations is proposed for studying transmission effects and other collateral influences in nuclear families. Two classes of structured exploratory data analysis (SEDA) statistics are derived from ratios of these functions. SEDA-functionals are the empirical cumulative distributions of the ratio of the two contrasts computed within each family. SEDA-indices are formed by first averaging the numerator and denominator contrasts separately over the population and then forming their ratio. The significance of SEDA results are determined by a spectrum of permutation techniques that selectively shuffle the trait values across families. The process systematically alters certain family structure relationships while keeping other familial relationships intact. The methodology is applied to five data examples of plasma total cholesterol concentrations, reported height values, dermatoglyphic pattern intensity index scores, measurements of dopamine-beta-hydroxylase activity, and psychometric cognitive test results.

  12. Imaging Molecular Motion: Femtosecond X-Ray Scattering of an Electrocyclic Chemical Reaction

    NASA Astrophysics Data System (ADS)

    Minitti, M. P.; Budarz, J. M.; Kirrander, A.; Robinson, J. S.; Ratner, D.; Lane, T. J.; Zhu, D.; Glownia, J. M.; Kozina, M.; Lemke, H. T.; Sikorski, M.; Feng, Y.; Nelson, S.; Saita, K.; Stankus, B.; Northey, T.; Hastings, J. B.; Weber, P. M.

    2015-06-01

    Structural rearrangements within single molecules occur on ultrafast time scales. Many aspects of molecular dynamics, such as the energy flow through excited states, have been studied using spectroscopic techniques, yet the goal to watch molecules evolve their geometrical structure in real time remains challenging. By mapping nuclear motions using femtosecond x-ray pulses, we have created real-space representations of the evolving dynamics during a well-known chemical reaction and show a series of time-sorted structural snapshots produced by ultrafast time-resolved hard x-ray scattering. A computational analysis optimally matches the series of scattering patterns produced by the x rays to a multitude of potential reaction paths. In so doing, we have made a critical step toward the goal of viewing chemical reactions on femtosecond time scales, opening a new direction in studies of ultrafast chemical reactions in the gas phase.

  13. Imaging Molecular Motion: Femtosecond X-Ray Scattering of an Electrocyclic Chemical Reaction.

    PubMed

    Minitti, M P; Budarz, J M; Kirrander, A; Robinson, J S; Ratner, D; Lane, T J; Zhu, D; Glownia, J M; Kozina, M; Lemke, H T; Sikorski, M; Feng, Y; Nelson, S; Saita, K; Stankus, B; Northey, T; Hastings, J B; Weber, P M

    2015-06-26

    Structural rearrangements within single molecules occur on ultrafast time scales. Many aspects of molecular dynamics, such as the energy flow through excited states, have been studied using spectroscopic techniques, yet the goal to watch molecules evolve their geometrical structure in real time remains challenging. By mapping nuclear motions using femtosecond x-ray pulses, we have created real-space representations of the evolving dynamics during a well-known chemical reaction and show a series of time-sorted structural snapshots produced by ultrafast time-resolved hard x-ray scattering. A computational analysis optimally matches the series of scattering patterns produced by the x rays to a multitude of potential reaction paths. In so doing, we have made a critical step toward the goal of viewing chemical reactions on femtosecond time scales, opening a new direction in studies of ultrafast chemical reactions in the gas phase.

  14. Numerical simulation of deformation and fracture of space protective shell structures from concrete and fiber concrete under pulse loading

    NASA Astrophysics Data System (ADS)

    Radchenko, P. A.; Batuev, S. P.; Radchenko, A. V.; Plevkov, V. S.

    2015-11-01

    This paper presents results of numerical simulation of interaction between aircraft Boeing 747-400 and protective shell of nuclear power plant. The shell is presented as complex multilayered cellular structure comprising layers of concrete and fiber concrete bonded with steel trusses. Numerical simulation was held three-dimensionally using the author's algorithm and software taking into account algorithms for building grids of complex geometric objects and parallel computations. The dynamics of stress-strain state and fracture of structure were studied. Destruction is described using two-stage model that allows taking into account anisotropy of elastic and strength properties of concrete and fiber concrete. It is shown that wave processes initiate destruction of shell cellular structure—cells start to destruct in unloading wave, originating after output of compression wave to the free surfaces of cells.

  15. Exploring the Early Structure of a Rapidly Decompressed Particle Bed

    NASA Astrophysics Data System (ADS)

    Zunino, Heather; Adrian, R. J.; Clarke, Amanda; Johnson, Blair; Arizona State University Collaboration

    2017-11-01

    Rapid expansion of dense, pressurized beds of fine particles subjected to rapid reduction of the external pressure is studied in a vertical shock tube. A near-sonic expansion wave impinges on the particle bed-gas interface and rapidly unloads the particle bed. A high-speed video camera captures events occurring during bed expansion. The particle bed does not expand homogeneously, but breaks down into horizontal slabs and then transforms into a cellular-type structure. There are several key parameters that affect the particle bed evolution, including particle size and initial bed height. Analyses of this bed structure evolution from experiments with varying particle sizes and initial bed heights is presented. This work is supported by the U.S. Department of Energy, National Nuclear Security Administration, Advanced Simulation and Computing Program, as a Cooperative Agreement under the Predictive Science and Academic Alliance Program, under Contract No. DE-NA0002378.

  16. Crystal MD: The massively parallel molecular dynamics software for metal with BCC structure

    NASA Astrophysics Data System (ADS)

    Hu, Changjun; Bai, He; He, Xinfu; Zhang, Boyao; Nie, Ningming; Wang, Xianmeng; Ren, Yingwen

    2017-02-01

    Material irradiation effect is one of the most important keys to use nuclear power. However, the lack of high-throughput irradiation facility and knowledge of evolution process, lead to little understanding of the addressed issues. With the help of high-performance computing, we could make a further understanding of micro-level-material. In this paper, a new data structure is proposed for the massively parallel simulation of the evolution of metal materials under irradiation environment. Based on the proposed data structure, we developed the new molecular dynamics software named Crystal MD. The simulation with Crystal MD achieved over 90% parallel efficiency in test cases, and it takes more than 25% less memory on multi-core clusters than LAMMPS and IMD, which are two popular molecular dynamics simulation software. Using Crystal MD, a two trillion particles simulation has been performed on Tianhe-2 cluster.

  17. Analysis of Material Sample Heated by Impinging Hot Hydrogen Jet in a Non-Nuclear Tester

    NASA Technical Reports Server (NTRS)

    Wang, Ten-See; Foote, John; Litchford, Ron

    2006-01-01

    A computational conjugate heat transfer methodology was developed and anchored with data obtained from a hot-hydrogen jet heated, non-nuclear materials tester, as a first step towards developing an efficient and accurate multiphysics, thermo-fluid computational methodology to predict environments for hypothetical solid-core, nuclear thermal engine thrust chamber. The computational methodology is based on a multidimensional, finite-volume, turbulent, chemically reacting, thermally radiating, unstructured-grid, and pressure-based formulation. The multiphysics invoked in this study include hydrogen dissociation kinetics and thermodynamics, turbulent flow, convective and thermal radiative, and conjugate heat transfers. Predicted hot hydrogen jet and material surface temperatures were compared with those of measurement. Predicted solid temperatures were compared with those obtained with a standard heat transfer code. The interrogation of physics revealed that reactions of hydrogen dissociation and recombination are highly correlated with local temperature and are necessary for accurate prediction of the hot-hydrogen jet temperature.

  18. Novel computer-aided diagnosis of mesothelioma using nuclear structure of mesothelial cells in effusion cytology specimens

    NASA Astrophysics Data System (ADS)

    Tosun, Akif Burak; Yergiyev, Oleksandr; Kolouri, Soheil; Silverman, Jan F.; Rohde, Gustavo K.

    2014-03-01

    diagnostic standard is a pleural biopsy with subsequent histologic examination of the tissue demonstrating invasion by the tumor. The diagnostic tissue is obtained through thoracoscopy or open thoracotomy, both being highly invasive procedures. Thoracocenthesis, or removal of effusion fluid from the pleural space, is a far less invasive procedure that can provide material for cytological examination. However, it is insufficient to definitively confirm or exclude the diagnosis of malignant mesothelioma, since tissue invasion cannot be determined. In this study, we present a computerized method to detect and classify malignant mesothelioma based on the nuclear chromatin distribution from digital images of mesothelial cells in effusion cytology specimens. Our method aims at determining whether a set of nuclei belonging to a patient, obtained from effusion fluid images using image segmentation, is benign or malignant, and has a potential to eliminate the need for tissue biopsy. This method is performed by quantifying chromatin morphology of cells using the optimal transportation (Kantorovich-Wasserstein) metric in combination with the modified Fisher discriminant analysis, a k-nearest neighborhood classification, and a simple voting strategy. Our results show that we can classify the data of 10 different human cases with 100% accuracy after blind cross validation. We conclude that nuclear structure alone contains enough information to classify the malignant mesothelioma. We also conclude that the distribution of chromatin seems to be a discriminating feature between nuclei of benign and malignant mesothelioma cells.

  19. Probing the coordination environment of Ti(3+) ions coordinated to nitrogen-containing Lewis bases.

    PubMed

    Morra, E; Maurelli, S; Chiesa, M; Van Doorslaer, S

    2015-08-28

    Multi-frequency continuous-wave and pulsed EPR techniques are employed to investigate the coordination of nitrogen-containing ligands to Ti(3+)-chloro complexes. Frozen solutions of TiCl3 and TiCl3(Py)3 dissolved in nitrogen-containing solvents have been investigated together with the TiCl3(Py)3 solid-state complex. For these different systems, the hyperfine and nuclear quadrupole data of Ti(3+)-bound (14)N nuclei are reported and discussed in the light of DFT computations, allowing for a detailed description of the microscopic structure of these systems.

  20. The 4D nucleome project.

    PubMed

    Dekker, Job; Belmont, Andrew S; Guttman, Mitchell; Leshyk, Victor O; Lis, John T; Lomvardas, Stavros; Mirny, Leonid A; O'Shea, Clodagh C; Park, Peter J; Ren, Bing; Politz, Joan C Ritland; Shendure, Jay; Zhong, Sheng

    2017-09-13

    The 4D Nucleome Network aims to develop and apply approaches to map the structure and dynamics of the human and mouse genomes in space and time with the goal of gaining deeper mechanistic insights into how the nucleus is organized and functions. The project will develop and benchmark experimental and computational approaches for measuring genome conformation and nuclear organization, and investigate how these contribute to gene regulation and other genome functions. Validated experimental technologies will be combined with biophysical approaches to generate quantitative models of spatial genome organization in different biological states, both in cell populations and in single cells.

  1. The 4D Nucleome Project

    PubMed Central

    Dekker, Job; Belmont, Andrew S.; Guttman, Mitchell; Leshyk, Victor O.; Lis, John T.; Lomvardas, Stavros; Mirny, Leonid A.; O’Shea, Clodagh C.; Park, Peter J.; Ren, Bing; Ritland Politz, Joan C.; Shendure, Jay; Zhong, Sheng

    2017-01-01

    Preface The 4D Nucleome Network aims to develop and apply approaches to map the structure and dynamics of the human and mouse genomes in space and time with the goal of gaining deeper mechanistic understanding of how the nucleus is organized and functions. The project will develop and benchmark experimental and computational approaches for measuring genome conformation and nuclear organization, and investigate how these contribute to gene regulation and other genome functions. Validated experimental approaches will be combined with biophysical modeling to generate quantitative models of spatial genome organization in different biological states, both in cell populations and in single cells. PMID:28905911

  2. Dynamic Computer Model of a Stirling Space Nuclear Power System

    DTIC Science & Technology

    2006-05-04

    diagram of electric propulsion…………………………………. 17 Figure 2-1. General NEP structure……………………………………………………….20 Figure 2-2. Fission of uranium -235...Figure 2-1. General NEP structure. [20] 21 Figure 2-2. Fission of uranium -235. In a fast reactor, the average number of neutrons...that is modeled for this project is a 600 kW(t) fast fission reactor consisting of uranium nitride fuel and sodium potassium coolant. Its dynamic

  3. Proceedings of the American Power Conference. Volume 58-II

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McBride, A.E.

    1996-11-01

    This book is part 2 of the proceedings of the American Power Conference, Technology for Competition and Globalization, 1996. The topics of the papers include structural plant design; challenges of the global marketplace; thermal hydraulic methods for nuclear power plant safety and operation; decontamination and decommissioning; competitive operations and maintenance; fuel opportunities; cooling; competitive power pricing; operations; transformers; relays; plant controls; training to meet the competitive future; burning technologies; ash and byproducts utilization; advanced systems; computer tools for plant design; globalization of power; power system protection and power quality; life extension; grounding; and transmission line equipment.

  4. Exploration for fossil and nuclear fuels from orbital altitudes

    NASA Technical Reports Server (NTRS)

    Short, N. M.

    1975-01-01

    A review of satellite-based photographic (optical and infrared) and microwave exploration and large-area mapping of the earth's surface in the ERTS program. Synoptic cloud-free coverage of large areas has been achieved with planimetric vertical views of the earth's surface useful in compiling close-to-orthographic mosaics. Radar penetration of cloud cover and infrared penetration of forest cover have been successful to some extent. Geological applications include map editing (with corrections in scale and computer processing of images), landforms analysis, structural geology studies, lithological identification, and exploration for minerals and fuels. Limitations of the method are noted.

  5. Nuclear Heart Scan

    MedlinePlus

    ... into your blood and travels to your heart. Nuclear heart scans use single photon emission computed tomography (SPECT) or cardiac positron emission tomography (PET) to detect the energy from the tracer to make pictures of your ...

  6. Frequency- and Time-Domain Methods in Soil-Structure Interaction Analysis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bolisetti, Chandrakanth; Whittaker, Andrew S.; Coleman, Justin L.

    2015-06-01

    Soil-structure interaction (SSI) analysis in the nuclear industry is currently performed using linear codes that function in the frequency domain. There is a consensus that these frequency-domain codes give reasonably accurate results for low-intensity ground motions that result in almost linear response. For higher intensity ground motions, which may result in nonlinear response in the soil, structure or at the vicinity of the foundation, the adequacy of frequency-domain codes is unproven. Nonlinear analysis, which is only possible in the time domain, is theoretically more appropriate in such cases. These methods are available but are rarely used due to the largemore » computational requirements and a lack of experience with analysts and regulators. This paper presents an assessment of the linear frequency-domain code, SASSI, which is widely used in the nuclear industry, and the time-domain commercial finite-element code, LS-DYNA, for SSI analysis. The assessment involves benchmarking the SSI analysis procedure in LS-DYNA against SASSI for linearly elastic models. After affirming that SASSI and LS-DYNA result in almost identical responses for these models, they are used to perform nonlinear SSI analyses of two structures founded on soft soil. An examination of the results shows that, in spite of using identical material properties, the predictions of frequency- and time-domain codes are significantly different in the presence of nonlinear behavior such as gapping and sliding of the foundation.« less

  7. SOC-DS computer code provides tool for design evaluation of homogeneous two-material nuclear shield

    NASA Technical Reports Server (NTRS)

    Disney, R. K.; Ricks, L. O.

    1967-01-01

    SOC-DS Code /Shield Optimization Code-Direc Search/, selects a nuclear shield material of optimum volume, weight, or cost to meet the requirments of a given radiation dose rate or energy transmission constraint. It is applicable to evaluating neutron and gamma ray shields for all nuclear reactors.

  8. Advanced Simulation and Computing Fiscal Year 14 Implementation Plan, Rev. 0.5

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Meisner, Robert; McCoy, Michel; Archer, Bill

    2013-09-11

    The Stockpile Stewardship Program (SSP) is a single, highly integrated technical program for maintaining the surety and reliability of the U.S. nuclear stockpile. The SSP uses nuclear test data, computational modeling and simulation, and experimental facilities to advance understanding of nuclear weapons. It includes stockpile surveillance, experimental research, development and engineering programs, and an appropriately scaled production capability to support stockpile requirements. This integrated national program requires the continued use of experimental facilities and programs, and the computational enhancements to support these programs. The Advanced Simulation and Computing Program (ASC) is a cornerstone of the SSP, providing simulation capabilities andmore » computational resources that support annual stockpile assessment and certification, study advanced nuclear weapons design and manufacturing processes, analyze accident scenarios and weapons aging, and provide the tools to enable stockpile Life Extension Programs (LEPs) and the resolution of Significant Finding Investigations (SFIs). This requires a balanced resource, including technical staff, hardware, simulation software, and computer science solutions. In its first decade, the ASC strategy focused on demonstrating simulation capabilities of unprecedented scale in three spatial dimensions. In its second decade, ASC is now focused on increasing predictive capabilities in a three-dimensional (3D) simulation environment while maintaining support to the SSP. The program continues to improve its unique tools for solving progressively more difficult stockpile problems (sufficient resolution, dimensionality, and scientific details), quantify critical margins and uncertainties, and resolve increasingly difficult analyses needed for the SSP. Moreover, ASC’s business model is integrated and focused on requirements-driven products that address long-standing technical questions related to enhanced predictive capability in the simulation tools.« less

  9. Seventy Years of Computing in the Nuclear Weapons Program

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Archer, Billy Joe

    Los Alamos has continuously been on the forefront of scientific computing since it helped found the field. This talk will explore the rich history of computing in the Los Alamos weapons program. The current status of computing will be discussed, as will the expectations for the near future.

  10. Kaon Condensation and the Non-Uniform Nuclear Matter

    NASA Astrophysics Data System (ADS)

    Maruyama, Toshiki; Tatsumi, Toshitaka; Voskresensky, Dmitri N.; Tanigawa, Tomonori; Chiba, Satoshi

    2004-04-01

    Non-uniform structures of nuclear matter are studied in a wide density-range. Using the density functional theory with a relativistic mean-field model, we examine non-uniform structures at sub-nuclear densities (nuclear "pastas") and at high densities, where kaon condensate is expected. We try to give a unified view about the change of the matter structure as density increases, carefully taking into account the Coulomb screening effects from the viewpoint of first-order phase transition.

  11. Accelerating Innovation: How Nuclear Physics Benefits Us All

    DOE R&D Accomplishments Database

    2011-01-01

    Innovation has been accelerated by nuclear physics in the areas of improving our health; making the world safer; electricity, environment, archaeology; better computers; contributions to industry; and training the next generation of innovators.

  12. Nuclear sensor signal processing circuit

    DOEpatents

    Kallenbach, Gene A [Bosque Farms, NM; Noda, Frank T [Albuquerque, NM; Mitchell, Dean J [Tijeras, NM; Etzkin, Joshua L [Albuquerque, NM

    2007-02-20

    An apparatus and method are disclosed for a compact and temperature-insensitive nuclear sensor that can be calibrated with a non-hazardous radioactive sample. The nuclear sensor includes a gamma ray sensor that generates tail pulses from radioactive samples. An analog conditioning circuit conditions the tail-pulse signals from the gamma ray sensor, and a tail-pulse simulator circuit generates a plurality of simulated tail-pulse signals. A computer system processes the tail pulses from the gamma ray sensor and the simulated tail pulses from the tail-pulse simulator circuit. The nuclear sensor is calibrated under the control of the computer. The offset is adjusted using the simulated tail pulses. Since the offset is set to zero or near zero, the sensor gain can be adjusted with a non-hazardous radioactive source such as, for example, naturally occurring radiation and potassium chloride.

  13. Assessment of Titanium Aluminide Alloys for High-Temperature Nuclear Structural Applications

    NASA Astrophysics Data System (ADS)

    Zhu, Hanliang; Wei, Tao; Carr, David; Harrison, Robert; Edwards, Lyndon; Hoffelner, Wolfgang; Seo, Dongyi; Maruyama, Kouichi

    2012-12-01

    Titanium aluminide (TiAl) alloys exhibit high specific strength, low density, good oxidation, corrosion, and creep resistance at elevated temperatures, making them good candidate materials for aerospace and automotive applications. TiAl alloys also show excellent radiation resistance and low neutron activation, and they can be developed to have various microstructures, allowing different combinations of properties for various extreme environments. Hence, TiAl alloys may be used in advanced nuclear systems as high-temperature structural materials. Moreover, TiAl alloys are good materials to be used for fundamental studies on microstructural effects on irradiation behavior of advanced nuclear structural materials. This article reviews the microstructure, creep, radiation, and oxidation properties of TiAl alloys in comparison with other nuclear structural materials to assess the potential of TiAl alloys as candidate structural materials for future nuclear applications.

  14. Supporting the future nuclear workforce with computer-based procedures

    DOE PAGES

    Oxstrand, Johanna; Le Blanc, Katya

    2016-05-01

    Here we see that computer-based tools have dramatically increased ease and efficiency of everyday tasks. Gone are the days of paging through a paper catalog, transcribing product numbers, and calculating totals. Today, a consumer can find a product online with a simple search engine, and then purchase it in a matter of a few clicks. Paper catalogs have their place, but it is hard to imagine life without on-line shopping sites. All tasks conducted in a nuclear power plant are guided by procedures, which helps ensure safe and reliable operation of the plants. One prominent goal of the nuclear industrymore » is to minimize the risk of human errors. To achieve this goal one has to ensure tasks are correctly and consistently executed. This is partly achieved by training and by a structured approach to task execution, which is provided by procedures and work instructions. Procedures are used in the nuclear industry to direct workers' actions in a proper sequence. The governing idea is to minimize the reliance on memory and choices made in the field. However, the procedure document may not contain sufficient information to successfully complete the task. Therefore, the worker might have to carry additional documents such as turnover sheets, operation experience, drawings, and other procedures to the work site. The nuclear industry is operated with paper procedures like paper catalogs of the past. A field worker may carry a large stack of documents needed to complete a task to the field. Even though the paper process has helped keep the industry safe for decades, there are limitations to using paper. Paper procedures are static (i.e., the content does not change after the document is printed), difficult to search, and rely heavily on the field worker’s situational awareness and ability to consistently meet the high expectation of human performance excellence. With computer-based procedures (CBPs) that stack of papers may be reduced to the size of a small tablet or even a smart phone. Instead of manually matching equipment identification numbers listed in the procedure with the number on the physical equipment the field worker can simply scan a barcode to ensure the correct valve is opened while simultaneously creating a record. Instead of navigating through a maze of cross-references, CBPs enable intelligent work path navigation which accounts for past decisions and observation, thereby enabling more efficient and safe task completion.« less

  15. Supporting the future nuclear workforce with computer-based procedures

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Oxstrand, Johanna; Le Blanc, Katya

    Here we see that computer-based tools have dramatically increased ease and efficiency of everyday tasks. Gone are the days of paging through a paper catalog, transcribing product numbers, and calculating totals. Today, a consumer can find a product online with a simple search engine, and then purchase it in a matter of a few clicks. Paper catalogs have their place, but it is hard to imagine life without on-line shopping sites. All tasks conducted in a nuclear power plant are guided by procedures, which helps ensure safe and reliable operation of the plants. One prominent goal of the nuclear industrymore » is to minimize the risk of human errors. To achieve this goal one has to ensure tasks are correctly and consistently executed. This is partly achieved by training and by a structured approach to task execution, which is provided by procedures and work instructions. Procedures are used in the nuclear industry to direct workers' actions in a proper sequence. The governing idea is to minimize the reliance on memory and choices made in the field. However, the procedure document may not contain sufficient information to successfully complete the task. Therefore, the worker might have to carry additional documents such as turnover sheets, operation experience, drawings, and other procedures to the work site. The nuclear industry is operated with paper procedures like paper catalogs of the past. A field worker may carry a large stack of documents needed to complete a task to the field. Even though the paper process has helped keep the industry safe for decades, there are limitations to using paper. Paper procedures are static (i.e., the content does not change after the document is printed), difficult to search, and rely heavily on the field worker’s situational awareness and ability to consistently meet the high expectation of human performance excellence. With computer-based procedures (CBPs) that stack of papers may be reduced to the size of a small tablet or even a smart phone. Instead of manually matching equipment identification numbers listed in the procedure with the number on the physical equipment the field worker can simply scan a barcode to ensure the correct valve is opened while simultaneously creating a record. Instead of navigating through a maze of cross-references, CBPs enable intelligent work path navigation which accounts for past decisions and observation, thereby enabling more efficient and safe task completion.« less

  16. On the existence of Rydberg nuclear molecules

    NASA Astrophysics Data System (ADS)

    Bertulani, C. A.; Frederico, T.; Hussein, M. S.

    2017-11-01

    Present nuclear detection techniques prevents us from determining if the analogue of a Rydberg molecule exists for the nuclear case. But nothing in nature disallows their existence. As in the atomic case, Rydberg nuclear molecules would be a laboratory for new aspects and applications of nuclear physics. We propose that Rydberg nuclear molecules, which represent the exotic, halo nuclei version, such as 11Be +11Be, of the well known quasimolecules observed in stable nuclei such as 12C +12C, might be common structures that could manifest their existence along the dripline. A study of possible candidates and the expected structure of such exotic clustering of two halo nuclei: the Rydberg nuclear molecules, is made on the basis of three different methods. It is shown that such cluster structures might be stable and unexpectedly common.

  17. Numerical simulation of NQR/NMR: Applications in quantum computing.

    PubMed

    Possa, Denimar; Gaudio, Anderson C; Freitas, Jair C C

    2011-04-01

    A numerical simulation program able to simulate nuclear quadrupole resonance (NQR) as well as nuclear magnetic resonance (NMR) experiments is presented, written using the Mathematica package, aiming especially applications in quantum computing. The program makes use of the interaction picture to compute the effect of the relevant nuclear spin interactions, without any assumption about the relative size of each interaction. This makes the program flexible and versatile, being useful in a wide range of experimental situations, going from NQR (at zero or under small applied magnetic field) to high-field NMR experiments. Some conditions specifically required for quantum computing applications are implemented in the program, such as the possibility of use of elliptically polarized radiofrequency and the inclusion of first- and second-order terms in the average Hamiltonian expansion. A number of examples dealing with simple NQR and quadrupole-perturbed NMR experiments are presented, along with the proposal of experiments to create quantum pseudopure states and logic gates using NQR. The program and the various application examples are freely available through the link http://www.profanderson.net/files/nmr_nqr.php. Copyright © 2011 Elsevier Inc. All rights reserved.

  18. Echocardiography in the Era of Multimodality Cardiovascular Imaging

    PubMed Central

    Shah, Benoy Nalin

    2013-01-01

    Echocardiography remains the most frequently performed cardiac imaging investigation and is an invaluable tool for detailed and accurate evaluation of cardiac structure and function. Echocardiography, nuclear cardiology, cardiac magnetic resonance imaging, and cardiovascular-computed tomography comprise the subspeciality of cardiovascular imaging, and these techniques are often used together for a multimodality, comprehensive assessment of a number of cardiac diseases. This paper provides the general cardiologist and physician with an overview of state-of-the-art modern echocardiography, summarising established indications as well as highlighting advances in stress echocardiography, three-dimensional echocardiography, deformation imaging, and contrast echocardiography. Strengths and limitations of echocardiography are discussed as well as the growing role of real-time three-dimensional echocardiography in the guidance of structural heart interventions in the cardiac catheter laboratory. PMID:23878804

  19. Nuclear Cartography: Patterns in Binding Energies and Subatomic Structure

    ERIC Educational Resources Information Center

    Simpson, E. C.; Shelley, M.

    2017-01-01

    Nuclear masses and binding energies are some of the first nuclear properties met in high school physics, and can be used to introduce radioactive decays, fusion, and fission. With relatively little extension, they can also illustrate fundamental concepts in nuclear physics, such as shell structure and pairing, and to discuss how the elements…

  20. NDEC: A NEA platform for nuclear data testing, verification and benchmarking

    NASA Astrophysics Data System (ADS)

    Díez, C. J.; Michel-Sendis, F.; Cabellos, O.; Bossant, M.; Soppera, N.

    2017-09-01

    The selection, testing, verification and benchmarking of evaluated nuclear data consists, in practice, in putting an evaluated file through a number of checking steps where different computational codes verify that the file and the data it contains complies with different requirements. These requirements range from format compliance to good performance in application cases, while at the same time physical constraints and the agreement with experimental data are verified. At NEA, the NDEC (Nuclear Data Evaluation Cycle) platform aims at providing, in a user friendly interface, a thorough diagnose of the quality of a submitted evaluated nuclear data file. Such diagnose is based on the results of different computational codes and routines which carry out the mentioned verifications, tests and checks. NDEC also searches synergies with other existing NEA tools and databases, such as JANIS, DICE or NDaST, including them into its working scheme. Hence, this paper presents NDEC, its current development status and its usage in the JEFF nuclear data project.

  1. Characterization of a 65 kDa NIF in the nuclear matrix of the monocot Allium cepa that interacts with nuclear spectrin-like proteins.

    PubMed

    Pérez-Munive, Clara; Blumenthal, Sonal S D; de la Espina, Susana Moreno Díaz

    2012-01-01

    Plant cells have a well organized nucleus and nuclear matrix, but lack orthologues of the main structural components of the metazoan nuclear matrix. Although data is limited, most plant nuclear structural proteins are coiled-coil proteins, such as the NIFs (nuclear intermediate filaments) in Pisum sativum that cross-react with anti-intermediate filament and anti-lamin antibodies, form filaments 6-12 nm in diameter in vitro, and may play the role of lamins. We have investigated the conservation and features of NIFs in a monocot species, Allium cepa, and compared them with onion lamin-like proteins. Polyclonal antisera against the pea 65 kDa NIF were used in 1D and 2D Western blots, ICM (imunofluorescence confocal microscopy) and IEM (immunoelectron microscopy). Their presence in the nuclear matrix was analysed by differential extraction of nuclei, and their association with structural spectrin-like proteins by co-immunoprecipitation and co-localization in ICM. NIF is a conserved structural component of the nucleus and its matrix in monocots with Mr and pI values similar to those of pea 65 kDa NIF, which localized to the nuclear envelope, perichromatin domains and foci, and to the nuclear matrix, interacting directly with structural nuclear spectrin-like proteins. Its similarities with some of the proteins described as onion lamin-like proteins suggest that they are highly related or perhaps the same proteins.

  2. Novel nuclear magnetic resonance techniques for studying biological molecules

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Laws, David Douglas

    2000-06-01

    Over the fifty-five year history of Nuclear Magnetic Resonance (NMR), considerable progress has been made in the development of techniques for studying the structure, function, and dynamics of biological molecules. The majority of this research has involved the development of multi-dimensional NMR experiments for studying molecules in solution, although in recent years a number of groups have begun to explore NMR methods for studying biological systems in the solid-state. Despite this new effort, a need still exists for the development of techniques that improve sensitivity, maximize information, and take advantage of all the NMR interactions available in biological molecules. Inmore » this dissertation, a variety of novel NMR techniques for studying biomolecules are discussed. A method for determining backbone (Φ/Ψ) dihedral angles by comparing experimentally determined 13C a, chemical-shift anisotropies with theoretical calculations is presented, along with a brief description of the theory behind chemical-shift computation in proteins and peptides. The utility of the Spin-Polarization Induced Nuclear Overhauser Effect (SPINOE) to selectively enhance NMR signals in solution is examined in a variety of systems, as are methods for extracting structural information from cross-relaxation rates that can be measured in SPINOE experiments. Techniques for the production of supercritical and liquid laser-polarized xenon are discussed, as well as the prospects for using optically pumped xenon as a polarizing solvent. In addition, a detailed study of the structure of PrP 89-143 is presented. PrP 89-143 is a 54 residue fragment of the prion proteins which, upon mutation and aggregation, can induce prion diseases in transgenic mice. Whereas the structure of the wild-type PrP 89-143 is a generally unstructured mixture of α-helical and β-sheet conformers in the solid state, the aggregates formed from the PrP 89-143 mutants appear to be mostly β-sheet.« less

  3. Novel QCD Phenomenology

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Brodsky, Stanley J.; /SLAC /Southern Denmark U., CP3-Origins

    2011-08-12

    I review a number of topics where conventional wisdom in hadron physics has been challenged. For example, hadrons can be produced at large transverse momentum directly within a hard higher-twist QCD subprocess, rather than from jet fragmentation. Such 'direct' processes can explain the deviations from perturbative QCD predictions in measurements of inclusive hadron cross sections at fixed x{sub T} = 2p{sub T}/{radical}s, as well as the 'baryon anomaly', the anomalously large proton-to-pion ratio seen in high centrality heavy ion collisions. Initial-state and final-state interactions of the struck quark, the soft-gluon rescattering associated with its Wilson line, lead to Bjorken-scaling single-spinmore » asymmetries, diffractive deep inelastic scattering, the breakdown of the Lam-Tung relation in Drell-Yan reactions, as well as nuclear shadowing and antishadowing. The Gribov-Glauber theory predicts that antishadowing of nuclear structure functions is not universal, but instead depends on the flavor quantum numbers of each quark and antiquark, thus explaining the anomalous nuclear dependence measured in deep-inelastic neutrino scattering. Since shadowing and antishadowing arise from the physics of leading-twist diffractive deep inelastic scattering, one cannot attribute such phenomena to the structure of the nucleus itself. It is thus important to distinguish 'static' structure functions, the probability distributions computed from the square of the target light-front wavefunctions, versus 'dynamical' structure functions which include the effects of the final-state rescattering of the struck quark. The importance of the J = 0 photon-quark QCD contact interaction in deeply virtual Compton scattering is also emphasized. The scheme-independent BLM method for setting the renormalization scale is discussed. Eliminating the renormalization scale ambiguity greatly improves the precision of QCD predictions and increases the sensitivity of searches for new physics at the LHC. Other novel features of QCD are discussed, including the consequences of confinement for quark and gluon condensates.« less

  4. Nuclear Pore-Like Structures in a Compartmentalized Bacterium

    PubMed Central

    Sagulenko, Evgeny; Green, Kathryn; Yee, Benjamin; Morgan, Garry; Leis, Andrew; Lee, Kuo-Chang; Butler, Margaret K.; Chia, Nicholas; Pham, Uyen Thi Phuong; Lindgreen, Stinus; Catchpole, Ryan; Poole, Anthony M.; Fuerst, John A.

    2017-01-01

    Planctomycetes are distinguished from other Bacteria by compartmentalization of cells via internal membranes, interpretation of which has been subject to recent debate regarding potential relations to Gram-negative cell structure. In our interpretation of the available data, the planctomycete Gemmata obscuriglobus contains a nuclear body compartment, and thus possesses a type of cell organization with parallels to the eukaryote nucleus. Here we show that pore-like structures occur in internal membranes of G.obscuriglobus and that they have elements structurally similar to eukaryote nuclear pores, including a basket, ring-spoke structure, and eight-fold rotational symmetry. Bioinformatic analysis of proteomic data reveals that some of the G. obscuriglobus proteins associated with pore-containing membranes possess structural domains found in eukaryote nuclear pore complexes. Moreover, immunogold labelling demonstrates localization of one such protein, containing a β-propeller domain, specifically to the G. obscuriglobus pore-like structures. Finding bacterial pores within internal cell membranes and with structural similarities to eukaryote nuclear pore complexes raises the dual possibilities of either hitherto undetected homology or stunning evolutionary convergence. PMID:28146565

  5. Strategic disruption of nuclear pores structure, integrity and barrier for nuclear apoptosis.

    PubMed

    Shahin, Victor

    2017-08-01

    Apoptosis is a programmed cell death playing key roles in physiology and pathophysiology of multi cellular organisms. Its nuclear manifestation requires transmission of the death signals across the nuclear pore complexes (NPCs). In strategic sequential steps apoptotic factors disrupt NPCs structure, integrity and barrier ultimately leading to nuclear breakdown. The present review reflects on these steps. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Promyelocytic Leukemia (Pml) Nuclear Bodies Are Protein Structures That Do Not Accumulate RNA

    PubMed Central

    Boisvert, François-Michel; Hendzel, Michael J.; Bazett-Jones, David P.

    2000-01-01

    The promyelocytic leukemia (PML) nuclear body (also referred to as ND10, POD, and Kr body) is involved in oncogenesis and viral infection. This subnuclear domain has been reported to be rich in RNA and a site of nascent RNA synthesis, implicating its direct involvement in the regulation of gene expression. We used an analytical transmission electron microscopic method to determine the structure and composition of PML nuclear bodies and the surrounding nucleoplasm. Electron spectroscopic imaging (ESI) demonstrates that the core of the PML nuclear body is a dense, protein-based structure, 250 nm in diameter, which does not contain detectable nucleic acid. Although PML nuclear bodies contain neither chromatin nor nascent RNA, newly synthesized RNA is associated with the periphery of the PML nuclear body, and is found within the chromatin-depleted region of the nucleoplasm immediately surrounding the core of the PML nuclear body. We further show that the RNA does not accumulate in the protein core of the structure. Our results dismiss the hypothesis that the PML nuclear body is a site of transcription, but support the model in which the PML nuclear body may contribute to the formation of a favorable nuclear environment for the expression of specific genes. PMID:10648561

  7. Inferring hidden causal relations between pathway members using reduced Google matrix of directed biological networks

    PubMed Central

    2018-01-01

    Signaling pathways represent parts of the global biological molecular network which connects them into a seamless whole through complex direct and indirect (hidden) crosstalk whose structure can change during development or in pathological conditions. We suggest a novel methodology, called Googlomics, for the structural analysis of directed biological networks using spectral analysis of their Google matrices, using parallels with quantum scattering theory, developed for nuclear and mesoscopic physics and quantum chaos. We introduce analytical “reduced Google matrix” method for the analysis of biological network structure. The method allows inferring hidden causal relations between the members of a signaling pathway or a functionally related group of genes. We investigate how the structure of hidden causal relations can be reprogrammed as a result of changes in the transcriptional network layer during cancerogenesis. The suggested Googlomics approach rigorously characterizes complex systemic changes in the wiring of large causal biological networks in a computationally efficient way. PMID:29370181

  8. Quantitative Characterization of Tissue Microstructure with Temporal Diffusion Spectroscopy

    PubMed Central

    Xu, Junzhong; Does, Mark D.; Gore, John C.

    2009-01-01

    The signals recorded by diffusion-weighted magnetic resonance imaging (DWI) are dependent on the micro-structural properties of biological tissues, so it is possible to obtain quantitative structural information non-invasively from such measurements. Oscillating gradient spin echo (OGSE) methods have the ability to probe the behavior of water diffusion over different time scales and the potential to detect variations in intracellular structure. To assist in the interpretation of OGSE data, analytical expressions have been derived for diffusion-weighted signals with OGSE methods for restricted diffusion in some typical structures, including parallel planes, cylinders and spheres, using the theory of temporal diffusion spectroscopy. These analytical predictions have been confirmed with computer simulations. These expressions suggest how OGSE signals from biological tissues should be analyzed to characterize tissue microstructure, including how to estimate cell nuclear sizes. This approach provides a model to interpret diffusion data obtained from OGSE measurements that can be used for applications such as monitoring tumor response to treatment in vivo. PMID:19616979

  9. Bayesian peak picking for NMR spectra.

    PubMed

    Cheng, Yichen; Gao, Xin; Liang, Faming

    2014-02-01

    Protein structure determination is a very important topic in structural genomics, which helps people to understand varieties of biological functions such as protein-protein interactions, protein-DNA interactions and so on. Nowadays, nuclear magnetic resonance (NMR) has often been used to determine the three-dimensional structures of protein in vivo. This study aims to automate the peak picking step, the most important and tricky step in NMR structure determination. We propose to model the NMR spectrum by a mixture of bivariate Gaussian densities and use the stochastic approximation Monte Carlo algorithm as the computational tool to solve the problem. Under the Bayesian framework, the peak picking problem is casted as a variable selection problem. The proposed method can automatically distinguish true peaks from false ones without preprocessing the data. To the best of our knowledge, this is the first effort in the literature that tackles the peak picking problem for NMR spectrum data using Bayesian method. Copyright © 2013. Production and hosting by Elsevier Ltd.

  10. Nuclear ``pasta'' structures in low-density nuclear matter and properties of the neutron-star crust

    NASA Astrophysics Data System (ADS)

    Okamoto, Minoru; Maruyama, Toshiki; Yabana, Kazuhiro; Tatsumi, Toshitaka

    2013-08-01

    In the neutron-star crust, nonuniform structure of nuclear matter—called the “pasta” structure—is expected. From recent studies of giant flares in magnetars, these structures might be related to some observables and physical quantities of the neutron-star crust. To investigate the above quantities, we numerically explore the pasta structure with a fully three-dimensional geometry and study the properties of low-density nuclear matter, based on the relativistic mean-field model and the Thomas-Fermi approximation. We observe typical pasta structures for fixed proton number fraction and two of them for cold catalyzed matter. We also discuss the crystalline configuration of “pasta.”

  11. Approximate methods in gamma-ray skyshine calculations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Faw, R.E.; Roseberry, M.L.; Shultis, J.K.

    1985-11-01

    Gamma-ray skyshine, an important component of the radiation field in the environment of a nuclear power plant, has recently been studied in relation to storage of spent fuel and nuclear waste. This paper reviews benchmark skyshine experiments and transport calculations against which computational procedures may be tested. The paper also addresses the applicability of simplified computational methods involving single-scattering approximations. One such method, suitable for microcomputer implementation, is described and results are compared with other work.

  12. Coupled-cluster computations of atomic nuclei

    NASA Astrophysics Data System (ADS)

    Hagen, G.; Papenbrock, T.; Hjorth-Jensen, M.; Dean, D. J.

    2014-09-01

    In the past decade, coupled-cluster theory has seen a renaissance in nuclear physics, with computations of neutron-rich and medium-mass nuclei. The method is efficient for nuclei with product-state references, and it describes many aspects of weakly bound and unbound nuclei. This report reviews the technical and conceptual developments of this method in nuclear physics, and the results of coupled-cluster calculations for nucleonic matter, and for exotic isotopes of helium, oxygen, calcium, and some of their neighbors.

  13. Nuclear Fuel Depletion Analysis Using Matlab Software

    NASA Astrophysics Data System (ADS)

    Faghihi, F.; Nematollahi, M. R.

    Coupled first order IVPs are frequently used in many parts of engineering and sciences. In this article, we presented a code including three computer programs which are joint with the Matlab software to solve and plot the solutions of the first order coupled stiff or non-stiff IVPs. Some engineering and scientific problems related to IVPs are given and fuel depletion (production of the 239Pu isotope) in a Pressurized Water Nuclear Reactor (PWR) are computed by the present code.

  14. Comparing Vibrationally Averaged Nuclear Shielding Constants by Quantum Diffusion Monte Carlo and Second-Order Perturbation Theory.

    PubMed

    Ng, Yee-Hong; Bettens, Ryan P A

    2016-03-03

    Using the method of modified Shepard's interpolation to construct potential energy surfaces of the H2O, O3, and HCOOH molecules, we compute vibrationally averaged isotropic nuclear shielding constants ⟨σ⟩ of the three molecules via quantum diffusion Monte Carlo (QDMC). The QDMC results are compared to that of second-order perturbation theory (PT), to see if second-order PT is adequate for obtaining accurate values of nuclear shielding constants of molecules with large amplitude motions. ⟨σ⟩ computed by the two approaches differ for the hydrogens and carbonyl oxygen of HCOOH, suggesting that for certain molecules such as HCOOH where big displacements away from equilibrium happen (internal OH rotation), ⟨σ⟩ of experimental quality may only be obtainable with the use of more sophisticated and accurate methods, such as quantum diffusion Monte Carlo. The approach of modified Shepard's interpolation is also extended to construct shielding constants σ surfaces of the three molecules. By using a σ surface with the equilibrium geometry as a single data point to compute isotropic nuclear shielding constants for each descendant in the QDMC ensemble representing the ground state wave function, we reproduce the results obtained through ab initio computed σ to within statistical noise. Development of such an approach could thereby alleviate the need for any future costly ab initio σ calculations.

  15. Nuclear Methods for Transmutation of Nuclear Waste: Problems, Perspextives, Cooperative Research - Proceedings of the International Workshop

    NASA Astrophysics Data System (ADS)

    Khankhasayev, Zhanat B.; Kurmanov, Hans; Plendl, Mikhail Kh.

    1996-12-01

    The Table of Contents for the full book PDF is as follows: * Preface * I. Review of Current Status of Nuclear Transmutation Projects * Accelerator-Driven Systems — Survey of the Research Programs in the World * The Los Alamos Accelerator-Driven Transmutation of Nuclear Waste Concept * Nuclear Waste Transmutation Program in the Czech Republic * Tentative Results of the ISTC Supported Study of the ADTT Plutonium Disposition * Recent Neutron Physics Investigations for the Back End of the Nuclear Fuel Cycle * Optimisation of Accelerator Systems for Transmutation of Nuclear Waste * Proton Linac of the Moscow Meson Factory for the ADTT Experiments * II. Computer Modeling of Nuclear Waste Transmutation Methods and Systems * Transmutation of Minor Actinides in Different Nuclear Facilities * Monte Carlo Modeling of Electro-nuclear Processes with Nonlinear Effects * Simulation of Hybrid Systems with a GEANT Based Program * Computer Study of 90Sr and 137Cs Transmutation by Proton Beam * Methods and Computer Codes for Burn-Up and Fast Transients Calculations in Subcritical Systems with External Sources * New Model of Calculation of Fission Product Yields for the ADTT Problem * Monte Carlo Simulation of Accelerator-Reactor Systems * III. Data Basis for Transmutation of Actinides and Fission Products * Nuclear Data in the Accelerator Driven Transmutation Problem * Nuclear Data to Study Radiation Damage, Activation, and Transmutation of Materials Irradiated by Particles of Intermediate and High Energies * Radium Institute Investigations on the Intermediate Energy Nuclear Data on Hybrid Nuclear Technologies * Nuclear Data Requirements in Intermediate Energy Range for Improvement of Calculations of ADTT Target Processes * IV. Experimental Studies and Projects * ADTT Experiments at the Los Alamos Neutron Science Center * Neutron Multiplicity Distributions for GeV Proton Induced Spallation Reactions on Thin and Thick Targets of Pb and U * Solid State Nuclear Track Detector and Radiochemical Studies on the Transmutation of Nuclei Using Relativistic Heavy Ions * Experimental and Theoretical Study of Radionuclide Production on the Electronuclear Plant Target and Construction Materials Irradiated by 1.5 GeV and 130 MeV Protons * Neutronics and Power Deposition Parameters of the Targets Proposed in the ISTC Project 17 * Multicycle Irradiation of Plutonium in Solid Fuel Heavy-Water Blanket of ADS * Compound Neutron Valve of Accelerator-Driven System Sectioned Blanket * Subcritical Channel-Type Reactor for Weapon Plutonium Utilization * Accelerator Driven Molten-Fluoride Reactor with Modular Heat Exchangers on PB-BI Eutectic * A New Conception of High Power Ion Linac for ADTT * Pions and Accelerator-Driven Transmutation of Nuclear Waste? * V. Problems and Perspectives * Accelerator-Driven Transmutation Technologies for Resolution of Long-Term Nuclear Waste Concerns * Closing the Nuclear Fuel-Cycle and Moving Toward a Sustainable Energy Development * Workshop Summary * List of Participants

  16. Small-molecule ligand docking into comparative models with Rosetta

    PubMed Central

    Combs, Steven A; DeLuca, Samuel L; DeLuca, Stephanie H; Lemmon, Gordon H; Nannemann, David P; Nguyen, Elizabeth D; Willis, Jordan R; Sheehan, Jonathan H; Meiler, Jens

    2017-01-01

    Structure-based drug design is frequently used to accelerate the development of small-molecule therapeutics. Although substantial progress has been made in X-ray crystallography and nuclear magnetic resonance (NMR) spectroscopy, the availability of high-resolution structures is limited owing to the frequent inability to crystallize or obtain sufficient NMR restraints for large or flexible proteins. Computational methods can be used to both predict unknown protein structures and model ligand interactions when experimental data are unavailable. This paper describes a comprehensive and detailed protocol using the Rosetta modeling suite to dock small-molecule ligands into comparative models. In the protocol presented here, we review the comparative modeling process, including sequence alignment, threading and loop building. Next, we cover docking a small-molecule ligand into the protein comparative model. In addition, we discuss criteria that can improve ligand docking into comparative models. Finally, and importantly, we present a strategy for assessing model quality. The entire protocol is presented on a single example selected solely for didactic purposes. The results are therefore not representative and do not replace benchmarks published elsewhere. We also provide an additional tutorial so that the user can gain hands-on experience in using Rosetta. The protocol should take 5–7 h, with additional time allocated for computer generation of models. PMID:23744289

  17. FUEL ELEMENT FOR A NUCLEAR REACTOR

    DOEpatents

    Davidson, J.K.

    1963-11-19

    A fuel element structure particularly useful in high temperature nuclear reactors is presented. Basically, the structure comprises two coaxial graphite sleeves integrally joined together by radial fins. Due to the high structural strength of graphite at high temperatures and the rigidity of this structure, nuclear fuel encased within the inner sleeve in contiguous relation therewith is supported and prevented from expanding radially at high temperatures. Thus, the necessity of relying on the usual cladding materials with relatively low temperature limitations for structural strength is removed. (AEC)

  18. Applications of a global nuclear-structure model to studies of the heaviest elements

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Moeller, P.; Nix, J.R.

    1993-10-01

    We present some new results on heavy-element nuclear-structure properties calculated on the basis of the finite-range droplet model and folded-Yukawa single-particle potential. Specifically, we discuss calculations of nuclear ground-state masses and microscopic corrections, {alpha}-decay properties, {beta}-decay properties, fission potential-energy surfaces, and spontaneous-fission half-lives. These results, obtained in a global nuclear-structure approach, are particularly reliable for describing the stability properties of the heaviest elements.

  19. Hadron Cancer Therapy: Role of Nuclear Reactions

    DOE R&D Accomplishments Database

    Chadwick, M. B.

    2000-06-20

    Recently it has become feasible to calculate energy deposition and particle transport in the body by proton and neutron radiotherapy beams, using Monte Carlo transport methods. A number of advances have made this possible, including dramatic increases in computer speeds, a better understanding of the microscopic nuclear reaction cross sections, and the development of methods to model the characteristics of the radiation emerging from the accelerator treatment unit. This paper describes the nuclear reaction mechanisms involved, and how the cross sections have been evaluated from theory and experiment, for use in computer simulations of radiation therapy. The simulations will allow the dose delivered to a tumor to be optimized, whilst minimizing the dos given to nearby organs at risk.

  20. Medical Imaging.

    ERIC Educational Resources Information Center

    Jaffe, C. Carl

    1982-01-01

    Describes principle imaging techniques, their applications, and their limitations in terms of diagnostic capability and possible adverse biological effects. Techniques include film radiography, computed tomography, nuclear medicine, positron emission tomography (PET), ultrasonography, nuclear magnetic resonance, and digital radiography. PET has…

  1. General Nuclear Medicine

    MedlinePlus

    ... The special camera and imaging techniques used in nuclear medicine include the gamma camera and single-photon emission-computed tomography (SPECT). The gamma camera, also called a scintillation camera, detects radioactive energy that is emitted from the patient's body and ...

  2. Probabilistic assessment of dynamic system performance. Part 3

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Belhadj, Mohamed

    1993-01-01

    Accurate prediction of dynamic system failure behavior can be important for the reliability and risk analyses of nuclear power plants, as well as for their backfitting to satisfy given constraints on overall system reliability, or optimization of system performance. Global analysis of dynamic systems through investigating the variations in the structure of the attractors of the system and the domains of attraction of these attractors as a function of the system parameters is also important for nuclear technology in order to understand the fault-tolerance as well as the safety margins of the system under consideration and to insure a safemore » operation of nuclear reactors. Such a global analysis would be particularly relevant to future reactors with inherent or passive safety features that are expected to rely on natural phenomena rather than active components to achieve and maintain safe shutdown. Conventionally, failure and global analysis of dynamic systems necessitate the utilization of different methodologies which have computational limitations on the system size that can be handled. Using a Chapman-Kolmogorov interpretation of system dynamics, a theoretical basis is developed that unifies these methodologies as special cases and which can be used for a comprehensive safety and reliability analysis of dynamic systems.« less

  3. Nuclear ground-state masses and deformations: FRDM(2012)

    DOE PAGES

    Moller, P.; Sierk, A. J.; Ichikawa, T.; ...

    2016-03-25

    Here, we tabulate the atomic mass excesses and binding energies, ground-state shell-plus-pairing corrections, ground-state microscopic corrections, and nuclear ground-state deformations of 9318 nuclei ranging from 16O to A=339. The calculations are based on the finite-range droplet macroscopic and the folded-Yukawa single-particle microscopic nuclear-structure models, which are completely specified. Relative to our FRDM(1992) mass table in Möller et al. (1995), the results are obtained in the same model, but with considerably improved treatment of deformation and fewer of the approximations that were necessary earlier, due to limitations in computer power. The more accurate execution of the model and the more extensivemore » and more accurate experimental mass data base now available allow us to determine one additional macroscopic-model parameter, the density-symmetry coefficient LL, which was not varied in the previous calculation, but set to zero. Because we now realize that the FRDM is inaccurate for some highly deformed shapes occurring in fission, because some effects are derived in terms of perturbations around a sphere, we only adjust its macroscopic parameters to ground-state masses.« less

  4. Experimental determination of torsion angles in the polypeptide backbone of the gramicidin A channel by solid state nuclear magnetic resonance.

    PubMed

    Teng, Q; Nicholson, L K; Cross, T A

    1991-04-05

    An analytical method for the determination of torsion angles from solid state 15N nuclear magnetic resonance (n.m.r.) spectroscopic data is demonstrated. Advantage is taken of the 15N-1H and 15N-13C dipolar interactions as well as the 15N chemical shift interaction in oriented samples. The membrane-bound channel conformation of gramicidin A has eluded an atomic resolution structure determination by more traditional approaches. Here, the torsion angles for the Ala3 site are determined by obtaining the n.m.r. data for both the Gly2-Ala3 and Ala3-Leu4 peptide linkages. Complete utilization of the orientational constraints derived from these orientation-dependent nuclear spin interactions in restricting the conformational space is most effectively achieved by utilizing spherical trigonometry. Two possible sets of torsion angles for the Ala3 site are obtained (phi, psi = -129 degrees, 153 degrees and -129 degrees, 122 degrees), both of which are consistent with a right-handed beta-helix. Other functional and computational evidence strongly supports the set for which the carbonyl oxygen atom of the Ala3-Leu4 linkage is rotated into the channel lumen.

  5. Two-level convolution formula for nuclear structure function

    NASA Astrophysics Data System (ADS)

    Ma, Boqiang

    1990-05-01

    A two-level convolution formula for the nuclear structure function is derived in considering the nucleus as a composite system of baryon-mesons which are also composite systems of quark-gluons again. The results show that the European Muon Colaboration effect can not be explained by the nuclear effects as nucleon Fermi motion and nuclear binding contributions.

  6. Maria Goeppert Mayer, the Nuclear Shell Structure, and Magic Numbers

    Science.gov Websites

    dropdown arrow Site Map A-Z Index Menu Synopsis Maria Goeppert-Mayer, the Nuclear Shell Model, and Magic explanation of how neutrons and protons within atomic nuclei are structured. Called the "nuclear shell American husband, chemical physicist Joseph Mayer. At Argonne, Goeppert-Mayer learned most of her nuclear

  7. Nuclear system that burns its own wastes shows promise

    NASA Technical Reports Server (NTRS)

    Atchison, K.

    1975-01-01

    A nuclear fission energy system, capable of eliminating a significant amount of its radioactive wastes by burning them, is described. A theoretical investigation of this system conducted by computer analysis, is based on use of gaseous fuel nuclear reactors. Gaseous core reactors using a uranium plasma fuel are studied along with development for space propulsion.

  8. Absolute nuclear material assay

    DOEpatents

    Prasad, Manoj K [Pleasanton, CA; Snyderman, Neal J [Berkeley, CA; Rowland, Mark S [Alamo, CA

    2012-05-15

    A method of absolute nuclear material assay of an unknown source comprising counting neutrons from the unknown source and providing an absolute nuclear material assay utilizing a model to optimally compare to the measured count distributions. In one embodiment, the step of providing an absolute nuclear material assay comprises utilizing a random sampling of analytically computed fission chain distributions to generate a continuous time-evolving sequence of event-counts by spreading the fission chain distribution in time.

  9. Absolute nuclear material assay

    DOEpatents

    Prasad, Manoj K [Pleasanton, CA; Snyderman, Neal J [Berkeley, CA; Rowland, Mark S [Alamo, CA

    2010-07-13

    A method of absolute nuclear material assay of an unknown source comprising counting neutrons from the unknown source and providing an absolute nuclear material assay utilizing a model to optimally compare to the measured count distributions. In one embodiment, the step of providing an absolute nuclear material assay comprises utilizing a random sampling of analytically computed fission chain distributions to generate a continuous time-evolving sequence of event-counts by spreading the fission chain distribution in time.

  10. Geologic uncertainty in a regulatory environment: An example from the potential Yucca Mountain nuclear waste repository site

    NASA Astrophysics Data System (ADS)

    Rautman, C. A.; Treadway, A. H.

    1991-11-01

    Regulatory geologists are concerned with predicting the performance of sites proposed for waste disposal or for remediation of existing pollution problems. Geologic modeling of these sites requires large-scale expansion of knowledge obtained from very limited sampling. This expansion induces considerable uncertainty into the geologic models of rock properties that are required for modeling the predicted performance of the site. One method for assessing this uncertainty is through nonparametric geostatistical simulation. Simulation can produce a series of equiprobable models of a rock property of interest. Each model honors measured values at sampled locations, and each can be constructed to emulate both the univariate histogram and the spatial covariance structure of the measured data. Computing a performance model for a number of geologic simulations allows evaluation of the effects of geologic uncertainty. A site may be judged acceptable if the number of failures to meet a particular performance criterion produced by these computations is sufficiently low. A site that produces too many failures may be either unacceptable or simply inadequately described. The simulation approach to addressing geologic uncertainty is being applied to the potential high-level nuclear waste repository site at Yucca Mountain, Nevada, U.S.A. Preliminary geologic models of unsaturated permeability have been created that reproduce observed statistical properties reasonably well. A spread of unsaturated groundwater travel times has been computed that reflects the variability of those geologic models. Regions within the simulated models exhibiting the greatest variability among multiple runs are candidates for obtaining the greatest reduction in uncertainty through additional site characterization.

  11. A New Look to Nuclear Data

    DOE PAGES

    McCutchan, E. A.; Brown, D. A.; Sonzogni, A. A.

    2017-03-30

    Databases of evaluated nuclear data form a cornerstone on which we build academic nuclear structure physics, reaction physics, astrophysics, and many applied nuclear technologies. In basic research, nuclear data are essential for selecting, designing and conducting experiments, and for the development and testing of theoretical models to understand the fundamental properties of atomic nuclei. Likewise, the applied fields of nuclear power, homeland security, stockpile stewardship and nuclear medicine, all have deep roots requiring evaluated nuclear data. Each of these fields requires rapid and easy access to up-to-date, comprehensive and reliable databases. The DOE-funded US Nuclear Data Program is a specificmore » and coordinated effort tasked to compile, evaluate and disseminate nuclear structure and reaction data such that it can be used by the world-wide nuclear physics community.« less

  12. A New Look to Nuclear Data

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McCutchan, E. A.; Brown, D. A.; Sonzogni, A. A.

    Databases of evaluated nuclear data form a cornerstone on which we build academic nuclear structure physics, reaction physics, astrophysics, and many applied nuclear technologies. In basic research, nuclear data are essential for selecting, designing and conducting experiments, and for the development and testing of theoretical models to understand the fundamental properties of atomic nuclei. Likewise, the applied fields of nuclear power, homeland security, stockpile stewardship and nuclear medicine, all have deep roots requiring evaluated nuclear data. Each of these fields requires rapid and easy access to up-to-date, comprehensive and reliable databases. The DOE-funded US Nuclear Data Program is a specificmore » and coordinated effort tasked to compile, evaluate and disseminate nuclear structure and reaction data such that it can be used by the world-wide nuclear physics community.« less

  13. 10 CFR 76.74 - Computation and extension of time.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 10 Energy 2 2011-01-01 2011-01-01 false Computation and extension of time. 76.74 Section 76.74 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) CERTIFICATION OF GASEOUS DIFFUSION PLANTS Certification § 76.74 Computation and extension of time. (a) In computing any period of time, the day of the act...

  14. 10 CFR 76.74 - Computation and extension of time.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 10 Energy 2 2012-01-01 2012-01-01 false Computation and extension of time. 76.74 Section 76.74 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) CERTIFICATION OF GASEOUS DIFFUSION PLANTS Certification § 76.74 Computation and extension of time. (a) In computing any period of time, the day of the act...

  15. 10 CFR 76.74 - Computation and extension of time.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 10 Energy 2 2013-01-01 2013-01-01 false Computation and extension of time. 76.74 Section 76.74 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) CERTIFICATION OF GASEOUS DIFFUSION PLANTS Certification § 76.74 Computation and extension of time. (a) In computing any period of time, the day of the act...

  16. 10 CFR 76.74 - Computation and extension of time.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 10 Energy 2 2010-01-01 2010-01-01 false Computation and extension of time. 76.74 Section 76.74 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) CERTIFICATION OF GASEOUS DIFFUSION PLANTS Certification § 76.74 Computation and extension of time. (a) In computing any period of time, the day of the act...

  17. 10 CFR 76.74 - Computation and extension of time.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 10 Energy 2 2014-01-01 2014-01-01 false Computation and extension of time. 76.74 Section 76.74 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) CERTIFICATION OF GASEOUS DIFFUSION PLANTS Certification § 76.74 Computation and extension of time. (a) In computing any period of time, the day of the act...

  18. Nuclear Science Symposium, 19th, and Nuclear Power Systems Symposium, 4th, Miami, Fla., December 6-8, 1972, Proceedings.

    NASA Technical Reports Server (NTRS)

    1973-01-01

    Major topics covered include radiation monitoring instrumentation, nuclear circuits and systems, biomedical applications of nuclear radiation in diagnosis and therapy, plasma research for fusion power, reactor control and instrumentation, nuclear power standards, and applications of digital computers in nuclear power plants. Systems and devices for space applications are described, including the Apollo alpha spectrometer, a position sensitive detection system for UV and X-ray photons, a 4500-volt electron multiplier bias supply for satellite use, spark chamber systems, proportional counters, and other devices. Individual items are announced in this issue.

  19. The QSE-Reduced Nuclear Reaction Network for Silicon Burning

    NASA Astrophysics Data System (ADS)

    Hix, W. Raphael; Parete-Koon, Suzanne T.; Freiburghaus, Christian; Thielemann, Friedrich-Karl

    2007-09-01

    Iron and neighboring nuclei are formed in massive stars shortly before core collapse and during their supernova outbursts, as well as during thermonuclear supernovae. Complete and incomplete silicon burning are responsible for the production of a wide range of nuclei with atomic mass numbers from 28 to 64. Because of the large number of nuclei involved, accurate modeling of silicon burning is computationally expensive. However, examination of the physics of silicon burning has revealed that the nuclear evolution is dominated by large groups of nuclei in mutual equilibrium. We present a new hybrid equilibrium-network scheme which takes advantage of this quasi-equilibrium in order to reduce the number of independent variables calculated. This allows accurate prediction of the nuclear abundance evolution, deleptonization, and energy generation at a greatly reduced computational cost when compared to a conventional nuclear reaction network. During silicon burning, the resultant QSE-reduced network is approximately an order of magnitude faster than the full network it replaces and requires the tracking of less than a third as many abundance variables, without significant loss of accuracy. These reductions in computational cost and the number of species evolved make QSE-reduced networks well suited for inclusion within hydrodynamic simulations, particularly in multidimensional applications.

  20. Accelerated development of Zr-containing new generation ferritic steels for advanced nuclear reactors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tan, Lizhen; Yang, Ying; Sridharan, K.

    2015-12-01

    The mission of the Nuclear Energy Enabling Technologies (NEET) program is to develop crosscutting technologies for nuclear energy applications. Advanced structural materials with superior performance at elevated temperatures are always desired for nuclear reactors, which can improve reactor economics, safety margins, and design flexibility. They benefit not only new reactors, including advanced light water reactors (LWRs) and fast reactors such as the sodium-cooled fast reactor (SFR) that is primarily designed for management of high-level wastes, but also life extension of the existing fleet when component exchange is needed. Developing and utilizing the modern materials science tools (experimental, theoretical, and computationalmore » tools) is an important path to more efficient alloy development and process optimization. The ultimate goal of this project is, with the aid of computational modeling tools, to accelerate the development of Zr-bearing ferritic alloys that can be fabricated using conventional steelmaking methods. The new alloys are expected to have superior high-temperature creep performance and excellent radiation resistance as compared to Grade 91. The designed alloys were fabricated using arc-melting and drop-casting, followed by hot rolling and conventional heat treatments. Comprehensive experimental studies have been conducted on the developed alloys to evaluate their hardness, tensile properties, creep resistance, Charpy impact toughness, and aging resistance, as well as resistance to proton and heavy ion (Fe 2+) irradiation.« less

  1. The Nuclear Energy Advanced Modeling and Simulation Enabling Computational Technologies FY09 Report

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Diachin, L F; Garaizar, F X; Henson, V E

    2009-10-12

    In this document we report on the status of the Nuclear Energy Advanced Modeling and Simulation (NEAMS) Enabling Computational Technologies (ECT) effort. In particular, we provide the context for ECT In the broader NEAMS program and describe the three pillars of the ECT effort, namely, (1) tools and libraries, (2) software quality assurance, and (3) computational facility (computers, storage, etc) needs. We report on our FY09 deliverables to determine the needs of the integrated performance and safety codes (IPSCs) in these three areas and lay out the general plan for software quality assurance to meet the requirements of DOE andmore » the DOE Advanced Fuel Cycle Initiative (AFCI). We conclude with a brief description of our interactions with the Idaho National Laboratory computer center to determine what is needed to expand their role as a NEAMS user facility.« less

  2. Evidence Theory Based Uncertainty Quantification in Radiological Risk due to Accidental Release of Radioactivity from a Nuclear Power Plant

    NASA Astrophysics Data System (ADS)

    Ingale, S. V.; Datta, D.

    2010-10-01

    Consequence of the accidental release of radioactivity from a nuclear power plant is assessed in terms of exposure or dose to the members of the public. Assessment of risk is routed through this dose computation. Dose computation basically depends on the basic dose assessment model and exposure pathways. One of the exposure pathways is the ingestion of contaminated food. The aim of the present paper is to compute the uncertainty associated with the risk to the members of the public due to the ingestion of contaminated food. The governing parameters of the ingestion dose assessment model being imprecise, we have approached evidence theory to compute the bound of the risk. The uncertainty is addressed by the belief and plausibility fuzzy measures.

  3. Simulation of Nuclear Reactor Kinetics by the Monte Carlo Method

    NASA Astrophysics Data System (ADS)

    Gomin, E. A.; Davidenko, V. D.; Zinchenko, A. S.; Kharchenko, I. K.

    2017-12-01

    The KIR computer code intended for calculations of nuclear reactor kinetics using the Monte Carlo method is described. The algorithm implemented in the code is described in detail. Some results of test calculations are given.

  4. A systematic and feasible method for computing nuclear contributions to electrical properties of polyatomic molecules

    NASA Astrophysics Data System (ADS)

    Luis, Josep M.; Duran, Miquel; Andrés, José L.

    1997-08-01

    An analytic method to evaluate nuclear contributions to electrical properties of polyatomic molecules is presented. Such contributions control changes induced by an electric field on equilibrium geometry (nuclear relaxation contribution) and vibrational motion (vibrational contribution) of a molecular system. Expressions to compute the nuclear contributions have been derived from a power series expansion of the potential energy. These contributions to the electrical properties are given in terms of energy derivatives with respect to normal coordinates, electric field intensity or both. Only one calculation of such derivatives at the field-free equilibrium geometry is required. To show the useful efficiency of the analytical evaluation of electrical properties (the so-called AEEP method), results for calculations on water and pyridine at the SCF/TZ2P and the MP2/TZ2P levels of theory are reported. The results obtained are compared with previous theoretical calculations and with experimental values.

  5. CBP for Field Workers – Results and Insights from Three Usability and Interface Design Evaluations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Oxstrand, Johanna Helene; Le Blanc, Katya Lee; Bly, Aaron Douglas

    2015-09-01

    Nearly all activities that involve human interaction with the systems in a nuclear power plant are guided by procedures. Even though the paper-based procedures (PBPs) currently used by industry have a demonstrated history of ensuring safety, improving procedure use could yield significant savings in increased efficiency as well as improved nuclear safety through human performance gains. The nuclear industry is constantly trying to find ways to decrease the human error rate, especially the human errors associated with procedure use. As a step toward the goal of improving procedure use and adherence, researchers in the Light-Water Reactor Sustainability (LWRS) Program, togethermore » with the nuclear industry, have been investigating the possibility and feasibility of replacing the current paper-based procedure process with a computer-based procedure (CBP) system. This report describes a field evaluation of new design concepts of a prototype computer-based procedure system.« less

  6. Molecular structure, vibrational spectral assignments (FT-IR and FT-RAMAN), NMR, NBO, HOMO-LUMO and NLO properties of O-methoxybenzaldehyde based on DFT calculations

    NASA Astrophysics Data System (ADS)

    Vennila, P.; Govindaraju, M.; Venkatesh, G.; Kamal, C.

    2016-05-01

    Fourier transform - Infra red (FT-IR) and Fourier transform - Raman (FT-Raman) spectroscopic techniques have been carried out to analyze O-methoxy benzaldehyde (OMB) molecule. The fundamental vibrational frequencies and intensity of vibrational bands were evaluated using density functional theory (DFT). The vibrational analysis of stable isomer of OMB has been carried out by FT-IR and FT-Raman in combination with theoretical method simultaneously. The first-order hyperpolarizability and the anisotropy polarizability invariant were computed by DFT method. The atomic charges, hardness, softness, ionization potential, electronegativity, HOMO-LUMO energies, and electrophilicity index have been calculated. The 13C and 1H Nuclear magnetic resonance (NMR) have also been obtained by GIAO method. Molecular electronic potential (MEP) has been calculated by the DFT calculation method. Electronic excitation energies, oscillator strength and excited states characteristics were computed by the closed-shell singlet calculation method.

  7. Development of Fuel Shuffling Module for PHISICS

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Allan Mabe; Andrea Alfonsi; Cristian Rabiti

    2013-06-01

    PHISICS (Parallel and Highly Innovative Simulation for the INL Code System) [4] code toolkit has been in development at the Idaho National Laboratory. This package is intended to provide a modern analysis tool for reactor physics investigation. It is designed with the mindset to maximize accuracy for a given availability of computational resources and to give state of the art tools to the modern nuclear engineer. This is obtained by implementing several different algorithms and meshing approaches among which the user will be able to choose, in order to optimize his computational resources and accuracy needs. The software is completelymore » modular in order to simplify the independent development of modules by different teams and future maintenance. The package is coupled with the thermo-hydraulic code RELAP5-3D [3]. In the following the structure of the different PHISICS modules is briefly recalled, focusing on the new shuffling module (SHUFFLE), object of this paper.« less

  8. Anharmonic Vibrational Spectroscopy on Metal Transition Complexes

    NASA Astrophysics Data System (ADS)

    Latouche, Camille; Bloino, Julien; Barone, Vincenzo

    2014-06-01

    Advances in hardware performance and the availability of efficient and reliable computational models have made possible the application of computational spectroscopy to ever larger molecular systems. The systematic interpretation of experimental data and the full characterization of complex molecules can then be facilitated. Focusing on vibrational spectroscopy, several approaches have been proposed to simulate spectra beyond the double harmonic approximation, so that more details become available. However, a routine use of such tools requires the preliminary definition of a valid protocol with the most appropriate combination of electronic structure and nuclear calculation models. Several benchmark of anharmonic calculations frequency have been realized on organic molecules. Nevertheless, benchmarks of organometallics or inorganic metal complexes at this level are strongly lacking despite the interest of these systems due to their strong emission and vibrational properties. Herein we report the benchmark study realized with anharmonic calculations on simple metal complexes, along with some pilot applications on systems of direct technological or biological interest.

  9. A Survey of Computational Intelligence Techniques in Protein Function Prediction

    PubMed Central

    Tiwari, Arvind Kumar; Srivastava, Rajeev

    2014-01-01

    During the past, there was a massive growth of knowledge of unknown proteins with the advancement of high throughput microarray technologies. Protein function prediction is the most challenging problem in bioinformatics. In the past, the homology based approaches were used to predict the protein function, but they failed when a new protein was different from the previous one. Therefore, to alleviate the problems associated with homology based traditional approaches, numerous computational intelligence techniques have been proposed in the recent past. This paper presents a state-of-the-art comprehensive review of various computational intelligence techniques for protein function predictions using sequence, structure, protein-protein interaction network, and gene expression data used in wide areas of applications such as prediction of DNA and RNA binding sites, subcellular localization, enzyme functions, signal peptides, catalytic residues, nuclear/G-protein coupled receptors, membrane proteins, and pathway analysis from gene expression datasets. This paper also summarizes the result obtained by many researchers to solve these problems by using computational intelligence techniques with appropriate datasets to improve the prediction performance. The summary shows that ensemble classifiers and integration of multiple heterogeneous data are useful for protein function prediction. PMID:25574395

  10. "Cloud" functions and templates of engineering calculations for nuclear power plants

    NASA Astrophysics Data System (ADS)

    Ochkov, V. F.; Orlov, K. A.; Ko, Chzho Ko

    2014-10-01

    The article deals with an important problem of setting up computer-aided design calculations of various circuit configurations and power equipment carried out using the templates and standard computer programs available in the Internet. Information about the developed Internet-based technology for carrying out such calculations using the templates accessible in the Mathcad Prime software package is given. The technology is considered taking as an example the solution of two problems relating to the field of nuclear power engineering.

  11. Diagnostic imaging of the lower genitourinary tract

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rifkin, M.D.

    1985-01-01

    Dr. Rifkin analyzes the relative merits of ultrasound, computed tomography, magnetic resonance imaging, nuclear medicine, and radiography. He correlates ultrasound findings with those of computed tomography, radiography, and nuclear medicine and assesses the potential benefits of magnetic resonance imaging as compared with ultrasound and other imaging modalities. Each imaging modality is discussed in terms of its role as the primary, secondary, or complementary study for diagnoses involving the urinary bladder and perivesical spaces, the prostate and seminal vesicles, the urethra and penis, and the scrotal sac.

  12. Evaluation of prompt gamma-ray data and nuclear structure of niobium-94 with statistical model calculations

    NASA Astrophysics Data System (ADS)

    Turkoglu, Danyal

    Precise knowledge of prompt gamma-ray intensities following neutron capture is critical for elemental and isotopic analyses, homeland security, modeling nuclear reactors, etc. A recently-developed database of prompt gamma-ray production cross sections and nuclear structure information in the form of a decay scheme, called the Evaluated Gamma-ray Activation File (EGAF), is under revision. Statistical model calculations are useful for checking the consistency of the decay scheme, providing insight on its completeness and accuracy. Furthermore, these statistical model calculations are necessary to estimate the contribution of continuum gamma-rays, which cannot be experimentally resolved due to the high density of excited states in medium- and heavy-mass nuclei. Decay-scheme improvements in EGAF lead to improvements to other databases (Evaluated Nuclear Structure Data File, Reference Input Parameter Library) that are ultimately used in nuclear-reaction models to generate the Evaluated Nuclear Data File (ENDF). Gamma-ray transitions following neutron capture in 93Nb have been studied at the cold-neutron beam facility at the Budapest Research Reactor. Measurements have been performed using a coaxial HPGe detector with Compton suppression. Partial gamma-ray production capture cross sections at a neutron velocity of 2200 m/s have been deduced relative to that of the 255.9-keV transition after cold-neutron capture by 93Nb. With the measurement of a niobium chloride target, this partial cross section was internally standardized to the cross section for the 1951-keV transition after cold-neutron capture by 35Cl. The resulting (0.1377 +/- 0.0018) barn (b) partial cross section produced a calibration factor that was 23% lower than previously measured for the EGAF database. The thermal-neutron cross sections were deduced for the 93Nb(n,gamma ) 94mNb and 93Nb(n,gamma) 94gNb reactions by summing the experimentally-measured partial gamma-ray production cross sections associated with the ground-state transitions below the 396-keV level and combining that summation with the contribution to the ground state from the quasi-continuum above 396 keV, determined with Monte Carlo statistical model calculations using the DICEBOX computer code. These values, sigmam and sigma 0, were (0.83 +/- 0.05) b and (1.16 +/- 0.11) b, respectively, and found to be in agreement with literature values. Comparison of the modeled population and experimental depopulation of individual levels confirmed tentative spin assignments and suggested changes where imbalances existed.

  13. The contribution of Medical Physics to Nuclear Medicine: looking back - a physicist's perspective.

    PubMed

    Hutton, Brian F

    2014-12-01

    This paper is the first in a series of invited perspectives by four pioneers of Nuclear Medicine imaging and physics. A medical physicist and a Nuclear Medicine clinical specialist each take a backward look and a forward look at the contributions of Medical Physics to Nuclear Medicine. Contributions of Medical Physics are presented from the early discovery of radioactivity, development of first imaging devices, computers and emission tomography to recent development of hybrid imaging. There is evidence of significant contribution of Medical Physics throughout the development of Nuclear Medicine.

  14. The Prospect of using Three-Dimensional Earth Models To Improve Nuclear Explosion Monitoring and Ground Motion Hazard Assessment

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zucca, J J; Walter, W R; Rodgers, A J

    2008-11-19

    The last ten years have brought rapid growth in the development and use of three-dimensional (3D) seismic models of Earth structure at crustal, regional and global scales. In order to explore the potential for 3D seismic models to contribute to important societal applications, Lawrence Livermore National Laboratory (LLNL) hosted a 'Workshop on Multi-Resolution 3D Earth Models to Predict Key Observables in Seismic Monitoring and Related Fields' on June 6 and 7, 2007 in Berkeley, California. The workshop brought together academic, government and industry leaders in the research programs developing 3D seismic models and methods for the nuclear explosion monitoring andmore » seismic ground motion hazard communities. The workshop was designed to assess the current state of work in 3D seismology and to discuss a path forward for determining if and how 3D Earth models and techniques can be used to achieve measurable increases in our capabilities for monitoring underground nuclear explosions and characterizing seismic ground motion hazards. This paper highlights some of the presentations, issues, and discussions at the workshop and proposes two specific paths by which to begin quantifying the potential contribution of progressively refined 3D seismic models in critical applied arenas. Seismic monitoring agencies are tasked with detection, location, and characterization of seismic activity in near real time. In the case of nuclear explosion monitoring or seismic hazard, decisions to further investigate a suspect event or to launch disaster relief efforts may rely heavily on real-time analysis and results. Because these are weighty decisions, monitoring agencies are regularly called upon to meticulously document and justify every aspect of their monitoring system. In order to meet this level of scrutiny and maintain operational robustness requirements, only mature technologies are considered for operational monitoring systems, and operational technology necessarily lags contemporary research. Current monitoring practice is to use relatively simple Earth models that generally afford analytical prediction of seismic observables (see Examples of Current Monitoring Practice below). Empirical relationships or corrections to predictions are often used to account for unmodeled phenomena, such as the generation of S-waves from explosions or the effect of 3-dimensional Earth structure on wave propagation. This approach produces fast and accurate predictions in areas where empirical observations are available. However, accuracy may diminish away from empirical data. Further, much of the physics is wrapped into an empirical relationship or correction, which limits the ability to fully understand the physical processes underlying the seismic observation. Every generation of seismology researchers works toward quantitative results, with leaders who are active at or near the forefront of what has been computationally possible. While recognizing that only a 3-dimensional model can capture the full physics of seismic wave generation and propagation in the Earth, computational seismology has, until recently, been limited to simplifying model parameterizations (e.g. 1D Earth models) that lead to efficient algorithms. What is different today is the fact that the largest and fastest machines are at last capable of evaluating the effects of generalized 3D Earth structure, at levels of detail that improve significantly over past efforts, with potentially wide application. Advances in numerical methods to compute travel times and complete seismograms for 3D models are enabling new ways to interpret available data. This includes algorithms such as the Fast Marching Method (Rawlison and Sambridge, 2004) for travel time calculations and full waveform methods such as the spectral element method (SEM; Komatitsch et al., 2002, Tromp et al., 2005), higher order Galerkin methods (Kaser and Dumbser, 2006; Dumbser and Kaser, 2006) and advances in more traditional Cartesian finite difference methods (e.g. Pitarka, 1999; Nilsson et al., 2007). The ability to compute seismic observables using a 3D model is only half of the challenge; models must be developed that accurately represent true Earth structure. Indeed, advances in seismic imaging have followed improvements in 3D computing capability (e.g. Tromp et al., 2005; Rawlinson and Urvoy, 2006). Advances in seismic imaging methods have been fueled in part by theoretical developments and the introduction of novel approaches for combining different seismological observables, both of which can increase the sensitivity of observations to Earth structure. Examples of such developments are finite-frequency sensitivity kernels for body-wave tomography (e.g. Marquering et al., 1998; Montelli et al., 2004) and joint inversion of receiver functions and surface wave group velocities (e.g. Julia et al., 2000).« less

  15. Modelling non-adiabatic effects in H{sub 3}{sup +}: Solution of the rovibrational Schrödinger equation with motion-dependent masses and mass surfaces

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mátyus, Edit, E-mail: matyus@chem.elte.hu; Szidarovszky, Tamás; Császár, Attila G., E-mail: csaszar@chem.elte.hu

    2014-10-21

    Introducing different rotational and vibrational masses in the nuclear-motion Hamiltonian is a simple phenomenological way to model rovibrational non-adiabaticity. It is shown on the example of the molecular ion H{sub 3}{sup +}, for which a global adiabatic potential energy surface accurate to better than 0.1 cm{sup −1} exists [M. Pavanello, L. Adamowicz, A. Alijah, N. F. Zobov, I. I. Mizus, O. L. Polyansky, J. Tennyson, T. Szidarovszky, A. G. Császár, M. Berg et al., Phys. Rev. Lett. 108, 023002 (2012)], that the motion-dependent mass concept yields much more accurate rovibrational energy levels but, unusually, the results are dependent upon themore » choice of the embedding of the molecule-fixed frame. Correct degeneracies and an improved agreement with experimental data are obtained if an Eckart embedding corresponding to a reference structure of D{sub 3h} point-group symmetry is employed. The vibrational mass of the proton in H{sub 3}{sup +} is optimized by minimizing the root-mean-square (rms) deviation between the computed and recent high-accuracy experimental transitions. The best vibrational mass obtained is larger than the nuclear mass of the proton by approximately one third of an electron mass, m{sub opt,p}{sup (v)}=m{sub nuc,p}+0.31224 m{sub e}. This optimized vibrational mass, along with a nuclear rotational mass, reduces the rms deviation of the experimental and computed rovibrational transitions by an order of magnitude. Finally, it is shown that an extension of the algorithm allowing the use of motion-dependent masses can deal with coordinate-dependent mass surfaces in the rovibrational Hamiltonian, as well.« less

  16. Modelling non-adiabatic effects in H_3^+: Solution of the rovibrational Schrödinger equation with motion-dependent masses and mass surfaces

    NASA Astrophysics Data System (ADS)

    Mátyus, Edit; Szidarovszky, Tamás; Császár, Attila G.

    2014-10-01

    Introducing different rotational and vibrational masses in the nuclear-motion Hamiltonian is a simple phenomenological way to model rovibrational non-adiabaticity. It is shown on the example of the molecular ion H_3^+, for which a global adiabatic potential energy surface accurate to better than 0.1 cm-1 exists [M. Pavanello, L. Adamowicz, A. Alijah, N. F. Zobov, I. I. Mizus, O. L. Polyansky, J. Tennyson, T. Szidarovszky, A. G. Császár, M. Berg et al., Phys. Rev. Lett. 108, 023002 (2012)], that the motion-dependent mass concept yields much more accurate rovibrational energy levels but, unusually, the results are dependent upon the choice of the embedding of the molecule-fixed frame. Correct degeneracies and an improved agreement with experimental data are obtained if an Eckart embedding corresponding to a reference structure of D3h point-group symmetry is employed. The vibrational mass of the proton in H_3^+ is optimized by minimizing the root-mean-square (rms) deviation between the computed and recent high-accuracy experimental transitions. The best vibrational mass obtained is larger than the nuclear mass of the proton by approximately one third of an electron mass, m^(v)_opt,p=m_nuc,p+0.31224 m_e. This optimized vibrational mass, along with a nuclear rotational mass, reduces the rms deviation of the experimental and computed rovibrational transitions by an order of magnitude. Finally, it is shown that an extension of the algorithm allowing the use of motion-dependent masses can deal with coordinate-dependent mass surfaces in the rovibrational Hamiltonian, as well.

  17. Ab initio molecular dynamics with nuclear quantum effects at classical cost: Ring polymer contraction for density functional theory

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Marsalek, Ondrej; Markland, Thomas E., E-mail: tmarkland@stanford.edu

    Path integral molecular dynamics simulations, combined with an ab initio evaluation of interactions using electronic structure theory, incorporate the quantum mechanical nature of both the electrons and nuclei, which are essential to accurately describe systems containing light nuclei. However, path integral simulations have traditionally required a computational cost around two orders of magnitude greater than treating the nuclei classically, making them prohibitively costly for most applications. Here we show that the cost of path integral simulations can be dramatically reduced by extending our ring polymer contraction approach to ab initio molecular dynamics simulations. By using density functional tight binding asmore » a reference system, we show that our ring polymer contraction scheme gives rapid and systematic convergence to the full path integral density functional theory result. We demonstrate the efficiency of this approach in ab initio simulations of liquid water and the reactive protonated and deprotonated water dimer systems. We find that the vast majority of the nuclear quantum effects are accurately captured using contraction to just the ring polymer centroid, which requires the same number of density functional theory calculations as a classical simulation. Combined with a multiple time step scheme using the same reference system, which allows the time step to be increased, this approach is as fast as a typical classical ab initio molecular dynamics simulation and 35× faster than a full path integral calculation, while still exactly including the quantum sampling of nuclei. This development thus offers a route to routinely include nuclear quantum effects in ab initio molecular dynamics simulations at negligible computational cost.« less

  18. Absolute nuclear material assay using count distribution (LAMBDA) space

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Prasad, Mano K.; Snyderman, Neal J.; Rowland, Mark S.

    A method of absolute nuclear material assay of an unknown source comprising counting neutrons from the unknown source and providing an absolute nuclear material assay utilizing a model to optimally compare to the measured count distributions. In one embodiment, the step of providing an absolute nuclear material assay comprises utilizing a random sampling of analytically computed fission chain distributions to generate a continuous time-evolving sequence of event-counts by spreading the fission chain distribution in time.

  19. Absolute nuclear material assay using count distribution (LAMBDA) space

    DOEpatents

    Prasad, Manoj K [Pleasanton, CA; Snyderman, Neal J [Berkeley, CA; Rowland, Mark S [Alamo, CA

    2012-06-05

    A method of absolute nuclear material assay of an unknown source comprising counting neutrons from the unknown source and providing an absolute nuclear material assay utilizing a model to optimally compare to the measured count distributions. In one embodiment, the step of providing an absolute nuclear material assay comprises utilizing a random sampling of analytically computed fission chain distributions to generate a continuous time-evolving sequence of event-counts by spreading the fission chain distribution in time.

  20. The CAD-score web server: contact area-based comparison of structures and interfaces of proteins, nucleic acids and their complexes.

    PubMed

    Olechnovič, Kliment; Venclovas, Ceslovas

    2014-07-01

    The Contact Area Difference score (CAD-score) web server provides a universal framework to compute and analyze discrepancies between different 3D structures of the same biological macromolecule or complex. The server accepts both single-subunit and multi-subunit structures and can handle all the major types of macromolecules (proteins, RNA, DNA and their complexes). It can perform numerical comparison of both structures and interfaces. In addition to entire structures and interfaces, the server can assess user-defined subsets. The CAD-score server performs both global and local numerical evaluations of structural differences between structures or interfaces. The results can be explored interactively using sortable tables of global scores, profiles of local errors, superimposed contact maps and 3D structure visualization. The web server could be used for tasks such as comparison of models with the native (reference) structure, comparison of X-ray structures of the same macromolecule obtained in different states (e.g. with and without a bound ligand), analysis of nuclear magnetic resonance (NMR) structural ensemble or structures obtained in the course of molecular dynamics simulation. The web server is freely accessible at: http://www.ibt.lt/bioinformatics/cad-score. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Top