Computer-Assisted Experiments with a Laser Diode

ERIC Educational Resources Information Center

Kraftmakher, Yaakov

2011-01-01

A laser diode from an inexpensive laser pen (laser pointer) is used in simple experiments. The radiant output power and efficiency of the laser are measured, and polarization of the light beam is shown. The "h/e" ratio is available from the threshold of spontaneous emission. The lasing threshold is found using several methods. With a…

A technical innovation for improving identification of the trackers by the LED cameras in navigation-assisted total knee arthroplasty.

PubMed

Darmanis, Spyridon; Toms, Andrew; Durman, Robert; Moore, Donna; Eyres, Keith

2007-07-01

To reduce the operating time in computer-assisted navigated total knee replacement (TKR), by improving communication between the infrared camera and the trackers placed on the patient. The innovation involves placing a routinely used laser pointer on top of the camera, so that the infrared cameras focus precisely on the trackers located on the knee to be operated on. A prospective randomized study was performed involving 40 patients divided into two groups, A and B. Both groups underwent navigated TKR, but for group B patients a laser pointer was used to improve the targeting capabilities of the cameras. Without the laser pointer, the camera had to move a mean 9.2 times in order to identify the trackers. With the introduction of the laser pointer, this was reduced to 0.9 times. Accordingly, the additional mean time required without the laser pointer was 11.6 minutes. Time delays are a major problem in computer-assisted surgery, and our technical suggestion can contribute towards reducing the delays associated with this particular application.

Cosmetic and aesthetic skin photosurgery using a computer-assisted CO2 laser-scanning system

NASA Astrophysics Data System (ADS)

Dutu, Doru C. A.; Dumitras, Dan C.; Nedelcu, Ioan; Ghetie, Sergiu D.

1997-12-01

Since the first application of CO2 laser in skin photosurgery, various techniques such as laser pulsing, beam scanning and computer-assisted laser pulse generator have been introduced for the purpose of reducing tissue carbonization and thermal necrosis. Using a quite simple XY optical scanner equipped with two galvanometric driven mirrors and an appropriate software to process the scanning data and control the interaction time and energy density in the scanned area, we have obtained a device which can improve CO2 laser application in cosmetic and aesthetic surgery. The opto-mechanical CO2 laser scanner based on two total reflecting flat mirrors placed at 90 degree(s) in respect to the XY scanning directions and independently driven through a magnetic field provides a linear movement of the incident laser beam in the operating field. A DA converter supplied with scanning data by the software enables a scanning with linearity better than 1% for a maximum angular deviation of 20 degree(s). Because the scanning quality of the laser beam in the operating field is given not only by the displacement function of the two mirrors, but also by the beam characteristics in the focal plane and the cross distribution in the laser beam, the surgeon can control through software either the scanning field dimensions or the distance between two consecutive points of the vertically and/or horizontally sweep line. The development of computer-assisted surgical scanning techniques will help control the surgical laser, to create either a reproducible incision with a controlled depth or a controlled incision pattern with minimal incision width, a long desired facility for plastic surgery, neurosurgery, ENT and dentistry.

High Tech: A Place in Our Lives and in Our Schools.

ERIC Educational Resources Information Center

Roach, John V.

1986-01-01

Discusses various aspects of high technology: computers in cars, computer-assisted design and manufacturing, computers in telephones, video recorders, laser technology, home computers, job training, computer education, and the challenge to the technology teacher. (CT)

FRAX(®) Clinical Task Force of the 2010 Joint International Society for Clinical Densitometry & International Osteoporosis Foundation Position Development Conference.

PubMed

McCloskey, Eugene V; Binkley, Neil

2011-01-01

The World Health Organization fracture risk assessment tool, FRAX(®), is an advance in clinical care that can assist in clinical decision-making. However, with increasing clinical utilization, numerous questions have arisen regarding how to best estimate fracture risk in an individual patient. Recognizing the need to assist clinicians in optimal use of FRAX(®), the International Osteoporosis Foundation (IOF) in conjunction with the International Society for Clinical Densitometry (ISCD) assembled an international panel of experts that ultimately developed joint Official Positions of the ISCD and IOF advising clinicians regarding FRAX(®) usage. As part of the process, the charge of the FRAX(®) Clinical Task Force was to review and synthesize data surrounding a number of recognized clinical risk factors including rheumatoid arthritis, smoking, alcohol, prior fracture, falls, bone turnover markers and glucocorticoid use. This synthesis was presented to the expert panel and constitutes the data on which the subsequent Official Positions are predicated. A summary of the Clinical Task Force composition and charge is presented here. Copyright © 2011. Published by Elsevier Inc.

Pulsed laser ablation of IC packages for device failure analyses

NASA Astrophysics Data System (ADS)

Hong, Ming Hui; Mai, ZhiHong; Chen, G. X.; Thiam, Thomas; Song, Wen D.; Lu, Yongfeng; Soh, Chye E.; Chong, Tow Chong

2002-06-01

Pulsed laser ablation of mold compounds for IC packaging in air and with steam assistance is investigated. It is applied to decap IC packages and expose computer CPU dies for the device failure analyses. Compared with chemical decapping, the laser ablation has advantages of being fast speed, non- contact and dry processing. Laser ablation with the steam assistance results in higher ablation rate and wider ablated crater with much smoother surface morphology. It implies that the steam assisted laser ablation can achieve a faster and better quality laser processing. Audible acoustic wave and plasma optical signal diagnostics are also carried out to have a better understanding of the mechanisms behind. Light wavelength and laser fluence applied in the decapping are two important parameters. The 532 nm Nd:YAG laser decapping at a low laser fluence can achieve a large decapping area with a fine ablation profile. IC packages decapped by the laser ablation show good quality for the device failure analyses.

Other notable protein blotting methods: a brief review.

PubMed

Kurien, Biji T; Scofield, R Hal

2015-01-01

Proteins have been transferred from the gel to the membrane by a variety of methods. These include vacuum blotting, centrifuge blotting, electroblotting of proteins to Teflon tape and membranes for N- and C-terminal sequence analysis, multiple tissue blotting, a two-step transfer of low- and high-molecular-weight proteins, acid electroblotting onto activated glass, membrane-array method for the detection of human intestinal bacteria in fecal samples, protein microarray using a new black cellulose nitrate support, electrotransfer using square wave alternating voltage for enhanced protein recovery, polyethylene glycol-mediated significant enhancement of the immunoblotting transfer, parallel protein chemical processing before and during western blot and the molecular scanner concept, electronic western blot of matrix-assisted laser desorption/ionization mass spectrometric-identified polypeptides from parallel processed gel-separated proteins, semidry electroblotting of peptides and proteins from acid-urea polyacrylamide gels, transfer of silver-stained proteins from polyacrylamide gels to polyvinylidene difluoride (PVDF) membranes, and the display of K(+) channel proteins on a solid nitrocellulose support for assaying toxin binding. The quantification of proteins bound to PVDF membranes by elution of CBB, clarification of immunoblots on PVDF for transmission densitometry, gold coating of nonconductive membranes before matrix-assisted laser desorption/ionization tandem mass spectrometric analysis to prevent charging effect for analysis of peptides from PVDF membranes, and a simple method for coating native polysaccharides onto nitrocellulose are some of the methods involving either the manipulation of membranes with transferred proteins or just a passive transfer of antigens to membranes. All these methods are briefly reviewed in this chapter.

Bone Densitometry (Bone Density Scan)

MedlinePlus

... News Physician Resources Professions Site Index A-Z Bone Densitometry (DEXA) Bone densitometry, also called dual-energy ... limitations of DEXA Bone Densitometry? What is a Bone Density Scan (DEXA)? Bone density scanning, also called ...

Inhibition of Breast Cancer-lnduced Bone Pain, Metastasis, and Osteolysis in Nude Mice by LOVAZA and DHA Fatty Acids

DTIC Science & Technology

2012-10-01

ASIC3, TGAGAGCCACCAGCTTACCT/ACATGTCCTCAAGGGAGTGG (30 cycles); mouse TRPV1 , GTGACCCTCTTGGTGGAGAA/ CTTCAGTGTGGGGTGGAGTT (30 cycles), mouse GAPDH...densitometry assisted by the image analysis software MetaMorph Image ( xx). Sizes are as follows: ASIC1a 506bp, ASCI1b 563bp, ASCI3 245pb, TRPV1

Lifetime fluorescence spectroscopy for in situ investigation of osteogenic differentiation

NASA Astrophysics Data System (ADS)

Marcu, Laura; Elbarbary, Amir; Zuk, Patricia; De Ugarte, Daniel A.; Benhaim, Prosper; Kurt, Hamza; Hedrick, Marc H.; Ashjian, Peter

2003-07-01

Time-Resolved Laser-Induced Fluorescence Spectroscopy (TR-LIFS) represents a potential tool for the in-situ characterization of bioengineered tissues. In this study, we evaluate the application of TR-LIFS to non-intrusive monitoring of matrix composition during osteogenetic differentiation. Human adipose-derived stem cells, harvested from 3 patients, were induced in osteogenic media for 3, 5, and 7 weeks. Samples were subsequently collected and probed for time-resolved fluorescence emission with a pulsed nitrogen laser. Fluorescence parameters, derived from both spectral- and time-domain, were used for sample characterization. The samples were further analyzed using Western blot analysis and computer-based densitometry. A significant change in the fluorescence parameters was detected for samples beyond 3 weeks of osteogenic differentiation. The spectroscopic observations: 1) show increase of collagen I when contrasted against the time-resolved fluorescence spectra of commercially available collagens; and 2) are in agreement with Western blot analysis that demonstrated significant increase in collagen I content between 3- vs. 5-weeks and 3- vs. 7-weeks and no changes for collagens III, IV, and V. Our results suggest that TR-LIFS can be used as a non-invasive means for the detection of specific collagens in maturing connective tissues.

Variation in sensitivity, absorption and density of the central rod distribution with eccentricity.

PubMed

Tornow, R P; Stilling, R

1998-01-01

To assess the human rod photopigment distribution and sensitivity with high spatial resolution within the central +/-15 degrees and to compare the results of pigment absorption, sensitivity and rod density distribution (number of rods per square degree). Rod photopigment density distribution was measured with imaging densitometry using a modified Rodenstock scanning laser ophthalmoscope. Dark-adapted sensitivity profiles were measured with green stimuli (17' arc diameter, 1 degrees spacing) using a T ubingen manual perimeter. Sensitivity profiles were plotted on a linear scale and rod photopigment optical density distribution profiles were converted to absorption profiles of the rod photopigment layer. Both the absorption profile of the rod photopigment and the linear sensitivity profile for green stimuli show a minimum at the foveal center and increase steeply with eccentricity. The variation with eccentricity corresponds to the rod density distribution. Rod photopigment absorption profiles, retinal sensitivity profiles, and the rod density distribution are linearly related within the central +/-15 degrees. This is in agreement with theoretical considerations. Both methods, imaging retinal densitometry using a scanning laser ophthalmoscope and dark-adapted perimetry with small green stimuli, are useful for assessing the central rod distribution and sensitivity. However, at present, both methods have limitations. Suggestions for improving the reliability of both methods are given.

Accommodating brightness and exposure levels in densitometry of stained polyacrylamide electrophoresis gels

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tan, Han Yen; Ng, Tuck Wah; Liew, Oi Wah

2010-03-20

Flatbed scanner densitometers can be operated under various illumination and recording exposure levels. In this work, we show that optical density measurement accuracy, sensitivity, and stability of stained polyacrylamide electrophoresis gel densitometry are crucially dependent on these two factors (brightness and exposure level), notwithstanding that the source is monochromatic, spatially uniform, and the measurements are made using an accurately calibrated step wedge in tandem. We further outline a method to accommodate the intensity deviations over a range of illumination and exposure levels in order to maintain sensitivity and repeatability in the computed optical densities. Comparisons were also made with resultsmore » from a commercial densitometer.« less

Hardware Considerations for Computer Based Education in the 1980's.

ERIC Educational Resources Information Center

Hirschbuhl, John J.

1980-01-01

In the future, computers will be needed to sift through the vast proliferation of available information. Among new developments in computer technology are the videodisc microcomputers and holography. Predictions for future developments include laser libraries for the visually handicapped and Computer Assisted Dialogue. (JN)

Comparative microstructural analysis of bone osteotomies after cutting by computer-assisted robot-guided laser osteotome and piezoelectric osteotome: an in vivo animal study.

PubMed

Augello, Marcello; Deibel, Waldemar; Nuss, Katja; Cattin, Philippe; Jürgens, Philipp

2018-04-13

Most industrial laser applications utilize computer and robot assistance, for guidance, safety, repeatability, and precision. In contrast, medical applications using laser systems are mostly conducted manually. The advantages can be effective only when the system is coupled to a robotic guidance, as operating by hand does not reach the required accuracy. We currently developed the first laser osteotome which offers preoperative planning based on CT data, robot guidance, and a precise execution of the laser cuts. In an animal trial, our system was used to create a grid pattern of the same depth on the inner layer of parietal bone in 12 adult sheep. The same bone cuts were done with piezoelectric osteotome on the contralateral side. The micro-CT and histological analysis showed more new mineralized bone in the laser group compared to the piezoelectric group. As well, a cutting pattern with especially a constant osteotomy depth in the laser group was demonstrated. The here presented autonomous osteotomy tool shows not only an advantage in early bone healing stage but additionally sharp bone cuts with a very high accuracy and freely selectable design cuts.

Systems to Detect Bacterial Contamination of Banked Blood in a Rapid, Non-Invasive Low Technology Manner. Phase 1.

DTIC Science & Technology

1994-08-25

Department of the Army position, policy or decision unless so designated by other documentation. 94-30800 IIV III !111 IiI I ’ I foron Appr •vedREPORT...copyrighted material is quoted, permission has been obtained to use such material. Where material from documents designated for limited distribution is...Laser Scanning Densitometry for quantitation of the color changes. (6) Narrative: a. Eperimental Methods: 1. Bacteria: Ten bacterial species

Mechanical and Thermal Properties of Dental Composites Cured with CAD/CAM Assisted Solid-State Laser

PubMed Central

De Santis, Roberto; Gloria, Antonio; Maietta, Saverio; Martorelli, Massimo; De Luca, Alessandro; Spagnuolo, Gianrico; Riccitiello, Francesco; Rengo, Sandro

2018-01-01

Over the last three decades, it has been frequently reported that the properties of dental restorative composites cured with argon laser are similar or superior to those achieved with conventional halogen and light emitting diode (LED) curing units. Whereas laser curing is not dependent on the distance between the curing unit and the material, such distance represents a drawback for conventional curing units. However, a widespread clinical application of this kind of laser remains difficult due to cost, heavy weight, and bulky size. Recently, with regard to the radiation in the blue region of the spectrum, powerful solid-state lasers have been commercialized. In the current research, CAD (computer-aided design)/CAM (computer-aided manufacturing) assisted solid-state lasers were employed for curing of different dental restorative composites consisting of micro- and nanoparticle-reinforced materials based on acrylic resins. Commercial LED curing units were used as a control. Temperature rise during the photopolymerisation process and bending properties were measured. By providing similar light energy dose, no significant difference in temperature rise was observed when the two light sources provided similar intensity. In addition, after 7 days since curing, bending properties of composites cured with laser and LED were similar. The results suggested that this kind of laser would be suitable for curing dental composites, and the curing process does not suffer from the tip-to-tooth distance. PMID:29584683

Computer-assisted surgical planning and automation of laser delivery systems

NASA Astrophysics Data System (ADS)

Zamorano, Lucia J.; Dujovny, Manuel; Dong, Ada; Kadi, A. Majeed

1991-05-01

This paper describes a 'real time' surgical treatment planning interactive workstation, utilizing multimodality imaging (computer tomography, magnetic resonance imaging, digital angiography) that has been developed to provide the neurosurgeon with two-dimensional multiplanar and three-dimensional 'display' of a patient's lesion.

Laser-assisted cartilage reshaping: in vitro and in vivo animal studies

NASA Astrophysics Data System (ADS)

Wang, Zhi; Pankratov, Michail M.; Perrault, Donald F., Jr.; Shapshay, Stanley M.

1995-05-01

Correction of cartilaginous defects in the head and neck area remains a challenge for the surgeon. This study investigated a new technique for laser-assisted cartilage reshaping. The pulsed 1.44 micrometers Nd:YAG laser was used in vitro and in vivo experiments to irradiate cartilage to change it's shape without carbonization or vaporization of tissue. Two watts of average power in non contact manner was used to irradiate and reshape the cartilage. The extracted reshaped cartilage specimens underwent testing of elastic force with a computer assisted measurement system that recorded the changes in elastic force in the specimens from 1 hr to 11 days post-irradiation. An animal model of defective tracheal cartilage (collapsed tracheal wall) was created, allowed to heal for 6 weeks and then corrected endoscopically with the laser-assisted technique. The results of the in vitro and in vivo investigations demonstrated that it was possible to alter the cartilage and that cartilage would retain its new shape. The clinical significance of the technique is evident and warrants further animal studies and clinical trials.

Robust Computer-Assisted Laser Treatment Using Real-Time Retinal Tracking

DTIC Science & Technology

2001-10-25

Abstract- We propose a new computerized system to accurately guide laser shots to the diseased areas within the retina based on predetermined...image registration I. INTRODUCTION Diabetic retinopathy resulting from long term diabetes mellitus is one of the common diseases that lead to choroidal...have a strong impact on the effectiveness of such procedures. In this work, we propose a new computerized treatment planning system for laser treatment

Corneal densitometry and its correlation with age, pachymetry, corneal curvature, and refraction.

PubMed

Garzón, Nuria; Poyales, Francisco; Illarramendi, Igor; Mendicute, Javier; Jáñez, Óscar; Caro, Pedro; López, Alfredo; Argüeso, Francisco

2017-12-01

To determine normative corneal densitometry values in relation to age, sex, refractive error, corneal thickness, and keratometry, measured using the Oculus Pentacam system. Three hundred and thirty-eight healthy subjects (185 men; 153 women) with no corneal disease underwent an exhaustive ocular examination. Corneal densitometry was expressed in standardized grayscale units (GSU). The mean corneal densitometry over the total area was 16.46 ± 1.85 GSU. The Pearson correlation coefficient for total densitometry was r = 0.542 (p < 0.001). Statistically significant differences were found between men and women for the total area (p = 0.006), with readings of 16.22 ± 1.54 GSU and 16.60 ± 1.83 GSU, respectively. When the cornea was divided into layers of different depths, a significant correlation was found for all layers and age: r = 0.447 (p < 0.001), r = 0.563 (p < 0.001), and r = 0.520 (p < 0.001) for the anterior, central, and posterior layers, respectively. However, when the cornea was divided into concentric annuli starting from the center of the cornea, densitometry was strongly correlated only with age in the 6-10-mm annulus (p < 0.001). Neither mean keratometry nor spherical equivalent was correlated with corneal densitometry in any zone of the cornea (p > 0.05). This is the first report of normative corneal densitometry values in relation to keratometry, corneal thickness, and spherical equivalent measured with the latest Oculus Pentacam software. Corneal densitometry increases with age, but corneal keratometry and refractive parameters do not affect light scattering in the human cornea.

Time dynamics of burst-train filamentation assisted femtosecond laser machining in glasses.

PubMed

Esser, Dagmar; Rezaei, Saeid; Li, Jianzhao; Herman, Peter R; Gottmann, Jens

2011-12-05

Bursts of femtosecond laser pulses with a repetition rate of f = 38.5MHz were created using a purpose-built optical resonator. Single Ti:Sapphire laser pulses, trapped inside a resonator and released into controllable burst profiles by computer generated trigger delays to a fast Pockels cell switch, drove filamentation-assisted laser machining of high aspect ratio holes deep into transparent glasses. The time dynamics of the hole formation and ablation plume physics on 2-ns to 400-ms time scales were examined in time-resolved side-view images recorded with an intensified-CCD camera during the laser machining process. Transient effects of photoluminescence and ablation plume emissions confirm the build-up of heat accumulation effects during the burst train, the formation of laser-generated filaments and plume-shielding effects inside the deeply etched vias. The small time interval between the pulses in the present burst train enabled a more gentle modification in the laser interaction volume that mitigated shock-induced microcracks compared with single pulses.

Laser Fluence Recognition Using Computationally Intelligent Pulsed Photoacoustics Within the Trace Gases Analysis

NASA Astrophysics Data System (ADS)

Lukić, M.; Ćojbašić, Ž.; Rabasović, M. D.; Markushev, D. D.; Todorović, D. M.

2017-11-01

In this paper, the possibilities of computational intelligence applications for trace gas monitoring are discussed. For this, pulsed infrared photoacoustics is used to investigate SF6-Ar mixtures in a multiphoton regime, assisted by artificial neural networks. Feedforward multilayer perceptron networks are applied in order to recognize both the spatial characteristics of the laser beam and the values of laser fluence Φ from the given photoacoustic signal and prevent changes. Neural networks are trained in an offline batch training regime to simultaneously estimate four parameters from theoretical or experimental photoacoustic signals: the laser beam spatial profile R(r), vibrational-to-translational relaxation time τ _{V-T} , distance from the laser beam to the absorption molecules in the photoacoustic cell r* and laser fluence Φ . The results presented in this paper show that neural networks can estimate an unknown laser beam spatial profile and the parameters of photoacoustic signals in real time and with high precision. Real-time operation, high accuracy and the possibility of application for higher intensities of radiation for a wide range of laser fluencies are factors that classify the computational intelligence approach as efficient and powerful for the in situ measurement of atmospheric pollutants.

Position statement: introduction, methods, and participants. The Writing Group for the International Society for Clinical Densitometry (ISCD) Position Development Conference.

PubMed

2004-01-01

Following publication of the proceedings from the first Position Development Conference (PDC) of the International Society for Clinical Densitometry (ISCD), members of the ISCD Scientific Advisory Committee (SAC) addressed additional topics of interest in the field of bone densitometry. These topics were addressed at a subsequent PDC, which was held in Cincinnati, Ohio, July 25-27, 2003. Five topics were chosen for discussion: (1) the diagnosis of osteoporosis in men, premenopausal women, and children; (2) technical standardization for dual-energy X-ray absorptiometry (DXA); (3) indications for bone densitometry; (4) reporting of bone density results; and (5) nomenclature and decimal places for bone densitometry. This report describes the methodology used for the development, presentation, and finalization of PDC positions. These positions are discussed in the following papers.

Clinical value of bone densitometry.

PubMed

Sartoris, D J

1994-07-01

The purpose of this article is to provide insight into the long-standing controversy over the clinical value of noninvasive measurement of bone mass. Results of recent studies have increasingly supported the judicious use of bone densitometry as a clinical tool [1]. These reports contradict editorials on the limitations of bone densitometry that have appeared in a variety of subspecialty publications [2,3]. The importance of bone mass measurement is underscored by the lack of success in predicting bone density from various combinations of anthropometric and historical variables. Growing evidence suggests that densitometry is a useful tool for determining which women near menopause are at risk for osteoporosis and, therefore, are candidates for estrogen-replacement therapy. This article summarizes current concepts on the subject and attempts to prove that bone densitometry is a beneficial and indicated procedure for selected patients.

Cost-effectiveness of bone densitometry among Caucasian women and men without a prior fracture according to age and body weight.

PubMed

Schousboe, J T; Gourlay, M; Fink, H A; Taylor, B C; Orwoll, E S; Barrett-Connor, E; Melton, L J; Cummings, S R; Ensrud, K E

2013-01-01

We used a microsimulation model to estimate the threshold body weights at which screening bone densitometry is cost-effective. Among women aged 55-65 years and men aged 55-75 years without a prior fracture, body weight can be used to identify those for whom bone densitometry is cost-effective. Bone densitometry may be more cost-effective for those with lower body weight since the prevalence of osteoporosis is higher for those with low body weight. Our purpose was to estimate weight thresholds below which bone densitometry is cost-effective for women and men without a prior clinical fracture at ages 55, 60, 65, 75, and 80 years. We used a microsimulation model to estimate the costs and health benefits of bone densitometry and 5 years of fracture prevention therapy for those without prior fracture but with femoral neck osteoporosis (T-score ≤ -2.5) and a 10-year hip fracture risk of ≥3%. Threshold pre-test probabilities of low BMD warranting drug therapy at which bone densitometry is cost-effective were calculated. Corresponding body weight thresholds were estimated using data from the Study of Osteoporotic Fractures (SOF), the Osteoporotic Fractures in Men (MrOS) study, and the National Health and Nutrition Examination Survey (NHANES) for 2005-2006. Assuming a willingness to pay of $75,000 per quality adjusted life year (QALY) and drug cost of $500/year, body weight thresholds below which bone densitometry is cost-effective for those without a prior fracture were 74, 90, and 100 kg, respectively, for women aged 55, 65, and 80 years; and were 67, 101, and 108 kg, respectively, for men aged 55, 75, and 80 years. For women aged 55-65 years and men aged 55-75 years without a prior fracture, body weight can be used to select those for whom bone densitometry is cost-effective.

Clinical applicability of robot-guided contact-free laser osteotomy in cranio-maxillo-facial surgery: in-vitro simulation and in-vivo surgery in minipig mandibles.

PubMed

Baek, K-W; Deibel, W; Marinov, D; Griessen, M; Bruno, A; Zeilhofer, H-F; Cattin, Ph; Juergens, Ph

2015-12-01

Laser was being used in medicine soon after its invention. However, it has been possible to excise hard tissue with lasers only recently, and the Er:YAG laser is now established in the treatment of damaged teeth. Recently experimental studies have investigated its use in bone surgery, where its major advantages are freedom of cutting geometry and precision. However, these advantages become apparent only when the system is used with robotic guidance. The main challenge is ergonomic integration of the laser and the robot, otherwise the surgeon's space in the operating theatre is obstructed during the procedure. Here we present our first experiences with an integrated, miniaturised laser system guided by a surgical robot. An Er:YAG laser source and the corresponding optical system were integrated into a composite casing that was mounted on a surgical robotic arm. The robot-guided laser system was connected to a computer-assisted preoperative planning and intraoperative navigation system, and the laser osteotome was used in an operating theatre to create defects of different shapes in the mandibles of 6 minipigs. Similar defects were created on the opposite side with a piezoelectric (PZE) osteotome and a conventional drill guided by a surgeon. The performance was analysed from the points of view of the workflow, ergonomics, ease of use, and safety features. The integrated robot-guided laser osteotome can be ergonomically used in the operating theatre. The computer-assisted and robot-guided laser osteotome is likely to be suitable for clinical use for ostectomies that require considerable accuracy and individual shape. Copyright © 2015 The British Association of Oral and Maxillofacial Surgeons. Published by Elsevier Ltd. All rights reserved.

Desktop Manufacturing Technologies.

ERIC Educational Resources Information Center

Snyder, Mark

1991-01-01

Desktop manufacturing is the use of data from a computer-assisted design system to construct actual models of an object. Emerging processes are stereolithography, laser sintering, ballistic particle manufacturing, laminated object manufacturing, and photochemical machining. (SK)

Towards computer-assisted TTTS: Laser ablation detection for workflow segmentation from fetoscopic video.

PubMed

Vasconcelos, Francisco; Brandão, Patrick; Vercauteren, Tom; Ourselin, Sebastien; Deprest, Jan; Peebles, Donald; Stoyanov, Danail

2018-06-27

Intrauterine foetal surgery is the treatment option for several congenital malformations. For twin-to-twin transfusion syndrome (TTTS), interventions involve the use of laser fibre to ablate vessels in a shared placenta. The procedure presents a number of challenges for the surgeon, and computer-assisted technologies can potentially be a significant support. Vision-based sensing is the primary source of information from the intrauterine environment, and hence, vision approaches present an appealing approach for extracting higher level information from the surgical site. In this paper, we propose a framework to detect one of the key steps during TTTS interventions-ablation. We adopt a deep learning approach, specifically the ResNet101 architecture, for classification of different surgical actions performed during laser ablation therapy. We perform a two-fold cross-validation using almost 50 k frames from five different TTTS ablation procedures. Our results show that deep learning methods are a promising approach for ablation detection. To our knowledge, this is the first attempt at automating photocoagulation detection using video and our technique can be an important component of a larger assistive framework for enhanced foetal therapies. The current implementation does not include semantic segmentation or localisation of the ablation site, and this would be a natural extension in future work.

Evaluation of laser cutting process with auxiliary gas pressure by soft computing approach

NASA Astrophysics Data System (ADS)

Lazov, Lyubomir; Nikolić, Vlastimir; Jovic, Srdjan; Milovančević, Miloš; Deneva, Heristina; Teirumenieka, Erika; Arsic, Nebojsa

2018-06-01

Evaluation of the optimal laser cutting parameters is very important for the high cut quality. This is highly nonlinear process with different parameters which is the main challenge in the optimization process. Data mining methodology is one of most versatile method which can be used laser cutting process optimization. Support vector regression (SVR) procedure is implemented since it is a versatile and robust technique for very nonlinear data regression. The goal in this study was to determine the optimal laser cutting parameters to ensure robust condition for minimization of average surface roughness. Three cutting parameters, the cutting speed, the laser power, and the assist gas pressure, were used in the investigation. As a laser type TruLaser 1030 technological system was used. Nitrogen as an assisted gas was used in the laser cutting process. As the data mining method, support vector regression procedure was used. Data mining prediction accuracy was very high according the coefficient (R2) of determination and root mean square error (RMSE): R2 = 0.9975 and RMSE = 0.0337. Therefore the data mining approach could be used effectively for determination of the optimal conditions of the laser cutting process.

A field-to-desktop toolchain for X-ray CT densitometry enables tree ring analysis

PubMed Central

De Mil, Tom; Vannoppen, Astrid; Beeckman, Hans; Van Acker, Joris; Van den Bulcke, Jan

2016-01-01

Background and Aims Disentangling tree growth requires more than ring width data only. Densitometry is considered a valuable proxy, yet laborious wood sample preparation and lack of dedicated software limit the widespread use of density profiling for tree ring analysis. An X-ray computed tomography-based toolchain of tree increment cores is presented, which results in profile data sets suitable for visual exploration as well as density-based pattern matching. Methods Two temperate (Quercus petraea, Fagus sylvatica) and one tropical species (Terminalia superba) were used for density profiling using an X-ray computed tomography facility with custom-made sample holders and dedicated processing software. Key Results Density-based pattern matching is developed and able to detect anomalies in ring series that can be corrected via interactive software. Conclusions A digital workflow allows generation of structure-corrected profiles of large sets of cores in a short time span that provide sufficient intra-annual density information for tree ring analysis. Furthermore, visual exploration of such data sets is of high value. The dated profiles can be used for high-resolution chronologies and also offer opportunities for fast screening of lesser studied tropical tree species. PMID:27107414

Estimation of the laser cutting operating cost by support vector regression methodology

NASA Astrophysics Data System (ADS)

Jović, Srđan; Radović, Aleksandar; Šarkoćević, Živče; Petković, Dalibor; Alizamir, Meysam

2016-09-01

Laser cutting is a popular manufacturing process utilized to cut various types of materials economically. The operating cost is affected by laser power, cutting speed, assist gas pressure, nozzle diameter and focus point position as well as the workpiece material. In this article, the process factors investigated were: laser power, cutting speed, air pressure and focal point position. The aim of this work is to relate the operating cost to the process parameters mentioned above. CO2 laser cutting of stainless steel of medical grade AISI316L has been investigated. The main goal was to analyze the operating cost through the laser power, cutting speed, air pressure, focal point position and material thickness. Since the laser operating cost is a complex, non-linear task, soft computing optimization algorithms can be used. Intelligent soft computing scheme support vector regression (SVR) was implemented. The performance of the proposed estimator was confirmed with the simulation results. The SVR results are then compared with artificial neural network and genetic programing. According to the results, a greater improvement in estimation accuracy can be achieved through the SVR compared to other soft computing methodologies. The new optimization methods benefit from the soft computing capabilities of global optimization and multiobjective optimization rather than choosing a starting point by trial and error and combining multiple criteria into a single criterion.

Collection of wood quality data by X-ray densitometry: a case study with three southern pines

Treesearch

Thomas L. Eberhardt; Lisa J. Samuelson

2015-01-01

X-ray densitometry is a technique often used in tree growth and wood quality studies to incrementally measure density (specific gravity) along a radial strip of wood. Protocols for this technique vary between laboratories because of differences in species, equipment, tree age, and other factors. Here, the application of X-ray densitometry is discussed in terms of a...

Laser direct writing of micro- and nano-scale medical devices

PubMed Central

Gittard, Shaun D; Narayan, Roger J

2010-01-01

Laser-based direct writing of materials has undergone significant development in recent years. The ability to modify a variety of materials at small length scales and using short production times provides laser direct writing with unique capabilities for fabrication of medical devices. In many laser-based rapid prototyping methods, microscale and submicroscale structuring of materials is controlled by computer-generated models. Various laser-based direct write methods, including selective laser sintering/melting, laser machining, matrix-assisted pulsed-laser evaporation direct write, stereolithography and two-photon polymerization, are described. Their use in fabrication of microstructured and nanostructured medical devices is discussed. Laser direct writing may be used for processing a wide variety of advanced medical devices, including patient-specific prostheses, drug delivery devices, biosensors, stents and tissue-engineering scaffolds. PMID:20420557

Laser-assisted heating of a plasmonic nanofluid in a microchannel

NASA Astrophysics Data System (ADS)

Walsh, Timothy

The work presented in this study analyses the theoretical modeling and experimentation of laser-assisted heating of plasmonic nanofluids (PNFs) in a microchannel for accurate, efficient, and ultra-fast heating of a microdroplet. Suspended plasmonic nanoparticles exhibit strong light absorption and scattering upon the excitation of localized surface plasmons (LSPs), resulting in intense and rapid photothermal heating. Several multi-stepped computational models were utilized to theoretically characterize and verify the laser-assisted heating behavior of gold nanoshells (GNS) and gold nanorod (GNR) plasmonic nanofluid droplets in a microchannel. From the experimental investigation, a full range of controllable steady-state temperatures, room temperature to 100°C, are confirmed to be achievable for the 780-nm-tuned plasmonic nanofluid. Droplet fluid heating is verified to occur as a result of LSP excitation, in time scales of milliseconds, and to be repeatable over many cycles. Additionally, the significance and effects of parameters in the process, such as nanoparticle structure, volumetric concentration, microchannel depth, and laser power density are established. The obtained results in this research may be integrated into other existing microfluidic technologies and biological techniques, such as the polymerase chain reaction, where accurate and ultra-fast heating of microdroplets in a microchannel can greatly improve efficiency.

Trace metal analysis by laser ablation-inductively coupled plasmamass spectrometry and x-ray K-edge densitometry of forensic samples

DOE Office of Scientific and Technical Information (OSTI.GOV)

Berry, Jonna Elizabeth

This dissertation describes a variety of studies on the determination of trace elements in samples with forensic importance. Laser ablation-inductively coupled plasma-mass spectrometry (LA-ICP-MS) was used to determine the trace element composition of numerous lipstick samples. Lipstick samples were determined to be homogeneous. Most lipstick samples of similar colors were readily distinguishable at a 95% confidence interval based on trace element composition. Numerous strands of a multi-strand speaker cable were analyzed by LA-ICP-MS. The strands in this study are spatially heterogeneous in trace element composition. In actual forensic applications, the possibility of spatial heterogeneity must be considered, especially in casesmore » where only small samples (e.g., copper wire fragments after an explosion) are available. The effects of many unpredictable variables, such as weather, temperature, and human activity, on the retention of gunshot residue (GSR) around projectile wounds were assessed with LAICP- MS. Skin samples around gunshot and stab wounds and larvae feeding in and around the wounds on decomposing pig carcasses were analyzed for elements consistent with GSR (Sb, Pb, Ba, and Cu). These elements were detected at higher levels in skin and larvae samples around the gunshot wounds compared to the stab wounds for an extended period of time throughout decomposition in both a winter and summer study. After decomposition, radiographic images of the pig bones containing possible damage from bullets revealed metallic particles embedded within a number of bones. Metallic particles within the bones were analyzed with x-ray, K-edge densitometry and determined to contain lead, indicating that bullet residue can be retained throughout decomposition and detected within bones containing projectile trauma.« less

Orbital Reconstruction: Patient-Specific Orbital Floor Reconstruction Using a Mirroring Technique and a Customized Titanium Mesh.

PubMed

Tarsitano, Achille; Badiali, Giovanni; Pizzigallo, Angelo; Marchetti, Claudio

2016-10-01

Enophthalmos is a severe complication of primary reconstruction of orbital floor fractures. The goal of secondary reconstruction procedures is to restore symmetrical globe positions to recover function and aesthetics. The authors propose a new method of orbital floor reconstruction using a mirroring technique and a customized titanium mesh, printed using a direct metal laser-sintering method. This reconstructive protocol involves 4 steps: mirroring of the healthy orbit at the affected site, virtual design of a patient-specific orbital floor mesh, CAM procedures for direct laser-sintering of the customized titanium mesh, and surgical insertion of the device. Using a computed tomography data set, the normal, uninjured side of the craniofacial skeleton was reflected onto the contralateral injured side, and a reconstructive orbital floor mesh was designed virtually on the mirrored orbital bone surface. The solid-to-layer files of the mesh were then manufactured using direct metal laser sintering, which resolves the shaping and bending biases inherent in the indirect method. An intraoperative navigation system ensured accuracy of the entire procedure. Clinical outcomes were assessed using 3dMD photogrammetry and computed tomography data in 7 treated patients. The technique described here appears to be a viable method to correct complex orbital floor defects needing delayed reconstruction. This study represents the first step in the development of a wider experimental protocol for orbital floor reconstruction using computer-assisted design-computer-assisted manufacturing technology.

The Physics of Physical Examinations.

ERIC Educational Resources Information Center

Patterson, James D.

1989-01-01

Discussed are several topics on medical imaging including x-rays and Computer Assisted Tomography (CAT) scans, magnetic resonance imaging, fiber optics endoscopy, nuclear medicine and bone scans, positron-emission tomography, and ultrasound. The concepts of radiation dosage, electrocardiograms, and laser therapy are included. (YP)

Electrophoretic mobility patterns of collagen following laser welding

NASA Astrophysics Data System (ADS)

Bass, Lawrence S.; Moazami, Nader; Pocsidio, Joanne O.; Oz, Mehmet C.; LoGerfo, Paul; Treat, Michael R.

1991-06-01

Clinical application of laser vascular anastomosis in inhibited by a lack of understanding of its mechanism. Whether tissue fusion results from covalent or non-covalent bonding of collagen and other structural proteins is unknown. We compared electrophoretic mobility of collagen in laser treated and untreated specimens of rat tail tendon (>90% type I collagen) and rabbit aorta. Welding was performed, using tissue shrinkage as the clinical endpoint, using the 808 nm diode laser (power density 14 watts/cm2) and topical indocyanine green dye (max absorption 805 nm). Collagen was extracted with 8 M urea (denaturing), 0.5 M acetic acid (non-denaturing) and acetic acid/pepsin (cleaves non- helical protein). Mobility patterns on gel electrophoresis (SDS-PAGE) after urea or acetic acid extraction were identical in the lasered and control tendon and vessel (confirmed by optical densitometry), revealing no evidence of formation of novel covalent bonds. Alpha and beta band intensity was diminished in pepsin incubated lasered specimens compared with controls (optical density ratio 0.00 +/- 9 tendon, 0.65 +/- 0.12 aorta), indicating the presence of denatured collagen. With the laser parameters used, collagen is denatured without formation of covalent bonds, suggesting that non-covalent interaction between denatured collagen molecules may be responsible for the weld. Based on this mechanism, welding parameters can be chosen which produce collagen denaturation without cell death.

Direct-to-consumer marketing of osteoporosis drugs and bone densitometry.

PubMed

Hollon, Matthew F; Larson, Eric B; Koepsell, Thomas D; Downer, Ann E

2003-01-01

To determine whether there is an association between a woman's exposure to direct-to-consumer (DTC) advertisements for 2 osteoporosis drugs and presentation for bone densitometry. A matched case-control study was conducted between October and December 1998 at an academic primary care clinic in Seattle, WA. Seventeen women from the study population (aged >/=18 y, seen in the previous 2 y at the academic primary care clinic) presented for bone densitometry. All 51 women completed a self-administered questionnaire. Women familiar with 1 of 2 osteoporosis drugs due to exposure to advertisements had 9 times the odds of densitometry (unadjusted OR 9.3, 95% CI 1.0 to 86). Multivariate analysis, including confounders such as education level and whether a woman had previously had 3 screening tests (mammography, Pap smear, serum cholesterol), revealed a significant and strong association between exposure to advertisements and densitometry (adjusted OR 29, 95% CI 1.6 to 511). DTC marketing may increase health services utilization. Further independent evaluation of DTC marketing based on available observational evidence is feasible and warranted.

A field-to-desktop toolchain for X-ray CT densitometry enables tree ring analysis.

PubMed

De Mil, Tom; Vannoppen, Astrid; Beeckman, Hans; Van Acker, Joris; Van den Bulcke, Jan

2016-06-01

Disentangling tree growth requires more than ring width data only. Densitometry is considered a valuable proxy, yet laborious wood sample preparation and lack of dedicated software limit the widespread use of density profiling for tree ring analysis. An X-ray computed tomography-based toolchain of tree increment cores is presented, which results in profile data sets suitable for visual exploration as well as density-based pattern matching. Two temperate (Quercus petraea, Fagus sylvatica) and one tropical species (Terminalia superba) were used for density profiling using an X-ray computed tomography facility with custom-made sample holders and dedicated processing software. Density-based pattern matching is developed and able to detect anomalies in ring series that can be corrected via interactive software. A digital workflow allows generation of structure-corrected profiles of large sets of cores in a short time span that provide sufficient intra-annual density information for tree ring analysis. Furthermore, visual exploration of such data sets is of high value. The dated profiles can be used for high-resolution chronologies and also offer opportunities for fast screening of lesser studied tropical tree species. © The Author 2016. Published by Oxford University Press on behalf of the Annals of Botany Company. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Digital video technology, today and tomorrow

NASA Astrophysics Data System (ADS)

Liberman, J.

1994-10-01

Digital video is probably computing's fastest moving technology today. Just three years ago, the zenith of digital video technology on the PC was the successful marriage of digital text and graphics with analog audio and video by means of expensive analog laser disc players and video overlay boards. The state of the art involves two different approaches to fully digital video on computers: hardware-assisted and software-only solutions.

Automated Laser Cutting In Three Dimensions

NASA Technical Reports Server (NTRS)

Bird, Lisa T.; Yvanovich, Mark A.; Angell, Terry R.; Bishop, Patricia J.; Dai, Weimin; Dobbs, Robert D.; He, Mingli; Minardi, Antonio; Shelton, Bret A.

1995-01-01

Computer-controlled machine-tool system uses laser beam assisted by directed flow of air to cut refractory materials into complex three-dimensional shapes. Velocity, position, and angle of cut varied. In original application, materials in question were thermally insulating thick blankets and tiles used on space shuttle. System shapes tile to concave or convex contours and cuts beveled edges on blanket, without cutting through outer layer of quartz fabric part of blanket. For safety, system entirely enclosed to prevent escape of laser energy. No dust generated during cutting operation - all material vaporized; larger solid chips dislodged from workpiece easily removed later.

Area densitometry using rotating Scheimpflug photography for posterior capsule opacification and surface light scattering analyses.

PubMed

Minami, Keiichiro; Honbo, Masato; Mori, Yosai; Kataoka, Yasushi; Miyata, Kazunori

2015-11-01

To compare area densitometry analysis using rotating Scheimpflug photography in quantifications of posterior capsule opacification (PCO) and surface light scattering with previous anterior-segment analyzer measurement. Miyata Eye Hospital, Miyazaki, Japan. Prospective observational case series. Scheimpflug images of eyes with foldable intraocular lenses (IOLs) were obtained using rotating and fixed Scheimpflug photography. Area densitometry on the posterior and anterior surfaces was conducted for PCO and surface light scattering analyses, respectively, with an identical area size. Correlation between two measurements was analyzed using linear regression. The study included 105 eyes of 74 patients who received IOLs 1 to 18 years (mean, 4.9 ± 4.5 years) postoperatively. In the PCO analysis on the posterior IOL surface, there was a significant correlation between the two measurements (P < .001, R(2) = 0.60). In the surface light scattering analysis, a significant and higher correlation was obtained (P < .001, R(2) = 0.91) until the fixed Scheimpflug photography exhibited saturation due to intensive scatterings. Area densitometry combined with a rotating Scheimpflug photography was exchangeable to previously established densitometry measurement, and allowed successive evaluation in longer-term observations. Copyright © 2015 ASCRS and ESCRS. Published by Elsevier Inc. All rights reserved.

Is Breast Densitometry a Measure of Breast Cancer Risk

DTIC Science & Technology

2001-09-01

preparing the same or similar computer software, or (c) used by a party other than the Government, except that the Government may release or disclose...compositional density. This increases the accuracy, dynamic range and precision of the measurement. This is the principal difference between...vivo whole body %FAT. By subtracting two x-ray images acquired at different x-ray energies, one component (say soft tissue) of a two component model (say

An Outdoor Navigation Platform with a 3D Scanner and Gyro-assisted Odometry

NASA Astrophysics Data System (ADS)

Yoshida, Tomoaki; Irie, Kiyoshi; Koyanagi, Eiji; Tomono, Masahiro

This paper proposes a light-weight navigation platform that consists of gyro-assisted odometry, a 3D laser scanner and map-based localization for human-scale robots. The gyro-assisted odometry provides highly accurate positioning only by dead-reckoning. The 3D laser scanner has a wide field of view and uniform measuring-point distribution. The map-based localization is robust and computationally inexpensive by utilizing a particle filter on a 2D grid map generated by projecting 3D points on to the ground. The system uses small and low-cost sensors, and can be applied to a variety of mobile robots in human-scale environments. Outdoor navigation experiments were conducted at the Tsukuba Challenge held in 2009 and 2010, which is an open proving ground for human-scale robots. Our robot successfully navigated the assigned 1-km courses in a fully autonomous mode multiple times.

Comparison and validation of methods to quantify Cry1Ab toxin from Bacillus thuringiensis for standardization of insect bioassays.

PubMed

Crespo, André L B; Spencer, Terence A; Nekl, Emily; Pusztai-Carey, Marianne; Moar, William J; Siegfried, Blair D

2008-01-01

Standardization of toxin preparations derived from Bacillus thuringiensis (Berliner) used in laboratory bioassays is critical for accurately assessing possible changes in the susceptibility of field populations of target pests. Different methods were evaluated to quantify Cry1Ab, the toxin expressed by 80% of the commercially available transgenic maize that targets the European corn borer, Ostrinia nubilalis (Hübner). We compared three methods of quantification on three different toxin preparations from independent sources: enzyme-linked immunosorbent assay (ELISA), sodium dodecyl sulfate-polyacrylamide gel electrophoresis and densitometry (SDS-PAGE/densitometry), and the Bradford assay for total protein. The results were compared to those obtained by immunoblot analysis and with the results of toxin bioassays against susceptible laboratory colonies of O. nubilalis. The Bradford method resulted in statistically higher estimates than either ELISA or SDS-PAGE/densitometry but also provided the lowest coefficients of variation (CVs) for estimates of the Cry1Ab concentration (from 2.4 to 5.4%). The CV of estimates obtained by ELISA ranged from 12.8 to 26.5%, whereas the CV of estimates obtained by SDS-PAGE/densitometry ranged from 0.2 to 15.4%. We standardized toxin concentration by using SDS-PAGE/densitometry, which is the only method specific for the 65-kDa Cry1Ab protein and is not confounded by impurities detected by ELISA and Bradford assay for total protein. Bioassays with standardized Cry1Ab preparations based on SDS-PAGE/densitometry showed no significant differences in LC(50) values, although there were significant differences in growth inhibition for two of the three Cry1Ab preparations. However, the variation in larval weight caused by toxin source was only 4% of the total variation, and we conclude that standardization of Cry1Ab production and quantification by SDS-PAGE/densitometry may improve data consistency in monitoring efforts to identify changes in insect susceptibility to Cry1Ab.

Stone formation from nonabsorbable clip migration into the collecting system after robot-assisted partial nephrectomy.

PubMed

Lee, Ziho; Reilly, Christopher E; Moore, Blake W; Mydlo, Jack H; Lee, David I; Eun, Daniel D

2014-01-01

We describe a case in which a Weck Hem-o-lok clip (Teleflex, Research Triangle Park, USA) migrated into the collecting system and acted as a nidus for stone formation in a patient after robot-assisted partial nephrectomy. The patient presented 2 years postoperatively with left-sided renal colic. Abdominal computed tomography scan showed a 10 millimeter renal calculus in the left middle pole. After using laser lithotripsy to fragment the overlying renal stone, a Weck Hem-o-lok clip was found to be embedded in the collecting system. A laser fiber through a flexible ureteroscope was used to successfully dislodge the clip from the renal parenchyma, and a stone basket was used to extract the clip.

21 CFR 884.6200 - Assisted reproduction laser system.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Assisted reproduction laser system. 884.6200... Assisted reproduction laser system. (a) Identification. The assisted reproduction laser system is a device that images, targets, and controls the power and pulse duration of a laser beam used to ablate a small...

21 CFR 884.6200 - Assisted reproduction laser system.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Assisted reproduction laser system. 884.6200... Assisted reproduction laser system. (a) Identification. The assisted reproduction laser system is a device that images, targets, and controls the power and pulse duration of a laser beam used to ablate a small...

21 CFR 884.6200 - Assisted reproduction laser system.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Assisted reproduction laser system. 884.6200... Assisted reproduction laser system. (a) Identification. The assisted reproduction laser system is a device that images, targets, and controls the power and pulse duration of a laser beam used to ablate a small...

21 CFR 884.6200 - Assisted reproduction laser system.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Assisted reproduction laser system. 884.6200... Assisted reproduction laser system. (a) Identification. The assisted reproduction laser system is a device that images, targets, and controls the power and pulse duration of a laser beam used to ablate a small...

21 CFR 884.6200 - Assisted reproduction laser system.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Assisted reproduction laser system. 884.6200... Assisted reproduction laser system. (a) Identification. The assisted reproduction laser system is a device that images, targets, and controls the power and pulse duration of a laser beam used to ablate a small...

An investigation on co-axial water-jet assisted fiber laser cutting of metal sheets

NASA Astrophysics Data System (ADS)

Madhukar, Yuvraj K.; Mullick, Suvradip; Nath, Ashish K.

2016-02-01

Water assisted laser cutting has received significant attention in recent times with assurance of many advantages than conventional gas assisted laser cutting. A comparative study between co-axial water-jet and gas-jet assisted laser cutting of thin sheets of mild steel (MS) and titanium (Ti) by fiber laser is presented. Fiber laser (1.07 μm wavelength) was utilised because of its low absorption in water. The cut quality was evaluated in terms of average kerf, projected dross height, heat affected zone (HAZ) and cut surface roughness. It was observed that a broad range process parameter could produce consistent cut quality in MS. However, oxygen assisted cutting could produce better quality only with optimised parameters at high laser power and high cutting speed. In Ti cutting the water-jet assisted laser cutting performed better over the entire range of process parameters compared with gas assisted cutting. The specific energy, defined as the amount of laser energy required to remove unit volume of material was found more in case of water-jet assisted laser cutting process. It is mainly due to various losses associated with water assisted laser processing such as absorption of laser energy in water and scattering at the interaction zone.

Hybrid tracking and control system for computer-aided retinal surgery

NASA Astrophysics Data System (ADS)

Ferguson, R. D.; Wright, Cameron H. G.; Rylander, Henry G., III; Welch, Ashley J.; Barrett, Steven F.

1996-05-01

We describe initial experimental results of a new hybrid digital and analog design for retinal tracking and laser beam control. Initial results demonstrate tracking rates which exceed the equivalent of 50 degrees per second in the eye, with automatic lesion pattern creation and robust loss of lock detection. Robotically assisted laser surgery to treat conditions such as diabetic retinopathy, macular degeneration, and retinal tears can now be realized under clinical conditions with requisite safety using standard video hardware and inexpensive optical components.

Medical education as a science: the quality of evidence for computer-assisted instruction.

PubMed

Letterie, Gerard S

2003-03-01

A marked increase in the number of computer programs for computer-assisted instruction in the medical sciences has occurred over the past 10 years. The quality of both the programs and the literature that describe these programs has varied considerably. The purposes of this study were to evaluate the published literature that described computer-assisted instruction in medical education and to assess the quality of evidence for its implementation, with particular emphasis on obstetrics and gynecology. Reports published between 1988 and 2000 on computer-assisted instruction in medical education were identified through a search of MEDLINE and Educational Resource Identification Center and a review of the bibliographies of the articles that were identified. Studies were selected if they included a description of computer-assisted instruction in medical education, regardless of the type of computer program. Data were extracted with a content analysis of 210 reports. The reports were categorized according to study design (comparative, prospective, descriptive, review, or editorial), type of computer-assisted instruction, medical specialty, and measures of effectiveness. Computer-assisted instruction programs included online technologies, CD-ROMs, video laser disks, multimedia work stations, virtual reality, and simulation testing. Studies were identified in all medical specialties, with a preponderance in internal medicine, general surgery, radiology, obstetrics and gynecology, pediatrics, and pathology. Ninety-six percent of the articles described a favorable impact of computer-assisted instruction in medical education, regardless of the quality of the evidence. Of the 210 reports that were identified, 60% were noncomparative, descriptive reports of new techniques in computer-assisted instruction, and 15% and 14% were reviews and editorials, respectively, of existing technology. Eleven percent of studies were comparative and included some form of assessment of the effectiveness of the computer program. These assessments included pre- and posttesting and questionnaires to score program quality, perceptions of the medical students and/or residents regarding the program, and impact on learning. In one half of these comparative studies, computer-assisted instruction was compared with traditional modes of teaching, such as text and lectures. Six studies compared performance before and after the computer-assisted instruction. Improvements were shown in 5 of the studies. In the remainder of the studies, computer-assisted instruction appeared to result in similar test performance. Despite study design or outcome, most articles described enthusiastic endorsement of the programs by the participants, including medical students, residents, and practicing physicians. Only 1 study included cost analysis. Thirteen of the articles were in obstetrics and gynecology. Computer-assisted instruction has assumed to have an increasing role in medical education. In spite of enthusiastic endorsement and continued improvements in software, few studies of good design clearly demonstrate improvement in medical education over traditional modalities. There are no comparative studies in obstetrics and gynecology that demonstrate a clear-cut advantage. Future studies of computer-assisted instruction that include comparisons and cost assessments to gauge their effectiveness over traditional methods may better define their precise role.

[SOPHOCLE (Ophthalmologic Simulator of Laser PHOtocoagulation): contribution to virtual reality].

PubMed

Rouland, J F; Dubois, P; Chaillou, C; Meseuree, P; Karpf, S; Godin, S; Duquenoy, F

1995-01-01

This study was undertaken to teach laser retinal photocoagulation in different disorders using a "virtual eye". Most ophthalmologists routinely use laser photocoagulator. Both indications and laser effects are well-known. However, in various diseases (diabetic retinopathy, age-related-macular degeneration, myopia...) complications rate increase or at least does not decrease. The main reasons are: - ignorance of risk factors, - misuse of the instrument. We developed a new automated device stimulating a real laser photocoagulator. Only slit-lamp exists. The three-mirror lens, the fundus and the retinal photocoagulation impacts are "virtual". The aim of the simulator is to help practitioners to recognize various pathologies almost as in real conditions and to be familiar with different technics of photocoagulation. By using computer assisted learning, a constant evaluation determines the level and the progress of practitioners.

Assessment of Corneal Backward Light Scattering in Diabetic Patients.

PubMed

Özyol, Pelin; Özyol, Erhan

2016-10-03

To analyze corneal backward light scattering differences in patients with type 2 diabetes mellitus. We enrolled 43 eyes from 43 diabetic patients and 40 eyes from 40 healthy controls. Corneal backward light scattering was evaluated using densitometry measurements from different corneal layers and zones obtained using Scheimpflug tomography (PentacamHR). When densitometry values were divided by depth, anterior layer of diabetic corneas displayed significantly higher corneal backward light scattering values than controls (32.05, 95% confidence intervals [CI], 31.02-33.08 vs. 29.18, 95% CI, 27.60-30.76, P=0.024). Corneal densitometry measurements were also significantly higher in diabetic eyes compared with control eyes, when considered by concentric zones of total cornea in the 0 to 2 mm (21.65, 95% CI, 20.28-23.01 vs. 18.87 95% CI, 18.49-19.25, P=0.020), and anterior layer in the 0 to 2 mm (27.3, 95% CI, 25.04-29.56 vs. 22.31, 95% CI, 20.57-24.05, P<0.001), 2 to 6 mm (26.2, 95% CI, 24.99-27.41 vs. 22.4, 95% CI, 20.18-24.62, P<0.001) and 6 to 10 mm (32.19, 95% CI, 29.98-34.40 vs. 27.2, 95% CI, 25.39-29.01, P=0.022). There was excellent positive correlation between anterior total corneal densitometry measurements and duration of diabetes (r=0.802, P<0.001), although no significant correlation was observed with anterior total corneal densitometry measurements and hemoglobin A1c levels (r=0.080, P=0.621) in diabetic eyes. Backward light scattering values from the anterior layer of the cornea is greater in diabetic eyes than in controls. Anterior total corneal densitometry measurements show positive correlation with the duration of diabetes.

Pre-Ionization Controlled Laser Plasma Formation for Ignition Applications

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shneider, Mikhail

The presented research explored new physics and ignition schemes based on laser induced plasmas that are fundamentally distinct from past laser ignition research focused on single laser pulses. Specifically, we consider the use of multiple laser pulses where the first pulse provides pre-ionization allowing controlled absorption of the second pulse. In this way, we can form tailored laser plasmas in terms of their ionization fraction, gas temperature (e.g. to achieve elevated temperature of ~2000 K ideally suited for an ignition source), reduced energy loss to shock waves and radiation, and large kernel size (e.g. length ~1-10 cm). The proposed researchmore » included both experimental and modeling efforts, at Colorado State University, Princeton University and University of Tennessee, towards the basic science of the new laser plasma approach with emphasis on tailoring the plasmas to practical propulsion systems. Experimental results (CSU) show that the UV beam produces a pre-ionized volume which assists in breakdown of the NIR beam, leading to reduction in NIR breakdown threshold by factor of >2. Numerical modeling is performed to examine the ionization and breakdown of both beams. The main theoretical and computational parts of the work were done at Princeton University. The modeled breakdown threshold of the NIR, including assist by pre-ionization, is in reasonable agreement with the experimental results.« less

The Use of Laser Guidance Reduces Fluoroscopy Time for C-Arm Cone-Beam Computed Tomography-Guided Biopsies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kroes, Maarten W., E-mail: Maarten.Kroes@radboudumc.nl; Strijen, Marco J. L. van, E-mail: m.van.strijen@antoniusziekenhuis.nl; Braak, Sicco J., E-mail: sjbraak@gmail.com

2016-09-15

PurposeWhen using laser guidance for cone-beam computed tomography (CBCT)-guided needle interventions, planned needle paths are visualized to the operator without the need to switch between entry- and progress-view during needle placement. The current study assesses the effect of laser guidance during CBCT-guided biopsies on fluoroscopy and procedure times.Materials and MethodsProspective data from 15 CBCT-guided biopsies of 8–65 mm thoracic and abdominal lesions assisted by a ceiling-mounted laser guidance technique were compared to retrospective data of 36 performed CBCT-guided biopsies of lesions >20 mm using the freehand technique. Fluoroscopy time, procedure time, and number of CBCT-scans were recorded. All data are presented asmore » median (ranges).ResultsFor biopsies using the freehand technique, more fluoroscopy time was necessary to guide the needle onto the target, 165 s (83–333 s) compared to 87 s (44–190 s) for laser guidance (p < 0.001). Procedure times were shorter for freehand-guided biopsies, 24 min versus 30 min for laser guidance (p < 0.001).ConclusionThe use of laser guidance during CBCT-guided biopsies significantly reduces fluoroscopy time.« less

Optothermal response of a single silicon nanotip

NASA Astrophysics Data System (ADS)

Vella, A.; Shinde, D.; Houard, J.; Silaeva, E.; Arnoldi, L.; Blum, I.; Rigutti, L.; Pertreux, E.; Maioli, P.; Crut, A.; Del Fatti, N.

2018-02-01

The optical properties and thermal dynamics of conical single silicon nanotips are experimentally and theoretically investigated. The spectral and spatial dependencies of their optical extinction are quantitatively measured by spatial modulation spectroscopy (SMS). A nonuniform optical extinction along the tip axis and an enhanced near-infrared absorption, as compared to bulk crystalline silicon, are evidenced. This information is a key input for computing the thermal response of single silicon nanotips under ultrafast laser illumination, which is investigated by laser assisted atom probe tomography (La-APT) used as a highly sensitive temperature probe. A combination of these two experimental techniques and comparison with modeling also permits us to elucidate the impact of thermal effects on the laser assisted field evaporation process. Extension of this coupled approach opens up future perspectives for the quantitative study of the optical and thermal properties of a wide class of individual nano-objects, in particular elongated ones such as nanotubes, nanowires, and nanocones, which constitute promising nanosources for electron and/or ion emission.

Comparison of gamma densitometry and electrical capacitance measurements applied to hold-up prediction of oil–water flow patterns in horizontal and slightly inclined pipes

NASA Astrophysics Data System (ADS)

Perera, Kshanthi; Kumara, W. A. S.; Hansen, Fredrik; Mylvaganam, Saba; Time, Rune W.

2018-06-01

Measurement techniques are vital for the control and operation of multiphase oil–water flow in pipes. The development of such techniques depends on laboratory experiments involving flow visualization, liquid fraction (‘hold-up’), phase slip and pressure drop measurements. They provide valuable information by revealing the physics, spatial and temporal structures of complex multiphase flow phenomena. This paper presents the hold-up measurement of oil–water flow in pipelines using gamma densitometry and electrical capacitance tomography (ECT) sensors. The experiments were carried out with different pipe inclinations from  ‑5° to  +6° for selected mixture velocities (0.2–1.5 m s‑1), and at selected watercuts (0.05–0.95). Mineral oil (Exxsol D60) and water were used as test fluids. Nine flow patterns were identified including a new pattern called stratified wavy and mixed interface flow. As a third direct method, visual observations and high-speed videos were used for the flow regime and interface identification. ECT and gamma densitometry hold-up measurements show similar trends for changes in pipeline inclinations. Changing the pipe inclination affected the flow mostly at lower mixture velocities and caused a change of flow patterns, allowing the highest change of hold-up. ECT hold-up measurements overpredict the gamma densitometry measurements at higher input water cuts and underpredict at intermediate water cuts. Gamma hold-up results showed good agreement with the literature results, having a maximum deviation of 6%, while it was as high as 22% for ECT in comparison to gamma densitometry. Uncertainty analysis of the measurement techniques was carried out with single-phase oil flow. This shows that the measurement error associated with gamma densitometry is approximately 3.2%, which includes 1.3% statistical error and 2.9% error identified as electromagnetically induced noise in electronics. Thus, gamma densitometry can predict hold-up with a higher accuracy in comparison to ECT when applied to oil–water systems at minimized electromagnetic noise.

Beam transport program for FEL project

NASA Astrophysics Data System (ADS)

Sugimoto, Masayoshi; Takao, Masaru

1992-07-01

A beam transport program is developed to design the beam transport line of the free electron laser system at JAERI and to assist the beam diagnosis. The program traces a beam matrix through the elements in the beam transport line and the accelerators. The graphical user interface is employed to access the parameters and to represent the results. The basic computational method is based on the LANL-TRACE program and it is rewritten for personal computers in Pascal.

Qualitative identification of rigid gas permeable contact lens materials by densitometry.

PubMed

Arce, C G; Schuman, P D; Schuman, W P

1999-10-01

We describe a practical method to qualitatively identify polymethylmethacrylate (PMMA) and rigid gas permeable (RGP) contact lens materials. By progressive dilution of a saturated saline solution made with distilled or tap water and sodium chloride, we recorded comparative densitometry of rigid contact lens materials using a small hydrometer or by liquid displacement. The method was sensitive enough to separate the polymethylmethacrylate, all silicon-methacrylates, and all but two fluorine-containing silicon-methacrylates. The hydrometer had a precision of three decimals rounded to the nearest 0.005. There was only one RGP product that could have been confused with the PMMA material. Most silicon-methacrylates had lower densities than fluorine containing silicon-methacrylates. Only four of 25 products under 1.117 gm/cm3 contained fluorine. Densitometry with a hydrometer is an effective non-destructive method to identify RGP materials and to verify their quality. The method is easier when lens blanks are tested, but in spite of differences in shape, size, and weight, densitometry may also be used with new or used contact lenses. Its simplicity and low cost makes densitometry feasible for any contact lens laboratory or clinic to use on a routine basis. Only silicon-methacrylates had an inverse relationship between density and oxygen permeability. As the silicon content of the contact lens increases, the Dk increases and the density decreases.

Middle Ear Mechanics of Cartilage Tympanoplasty Evaluated by Laser Holography and Vibrometry

PubMed Central

Aarnisalo, Antti A.; Cheng, Jeffrey T.; Ravicz, Michael E.; Hulli, Nesim; Harrington, Ellery J.; Hernandez-Montes, Maria S.; Furlong, Cosme; Merchant, Saumil N.; Rosowski, John J.

2010-01-01

Goals To assess the effects of thickness and position of cartilage used to reconstruct the tympanic membrane (TM) using a novel technique, time-averaged laser holography. Background Cartilage is commonly used in TM reconstruction to prevent formation of retraction pockets. The thickness, position, and shape of the cartilage graft may adversely affect TM motion and hearing. We sought to systematically investigate these parameters in an experimental setting. Methods Computer-assisted optoelectronic laser holography was used in 4 human cadaveric temporal bones to study sound-induced TM motion for 500 Hz to 8 kHz. Stapes velocity was measured with a laser Doppler vibrometer. Baseline (control) measurements were made with the TM intact. Measurements were repeated after a 0.5- or 1.0-mm-thick oval piece of conchal cartilage was placed on the medial TM surface in the posterior-superior quadrant. The cartilage was rotated so that it was either in contact with the bony tympanic rim and manubrium or not. Results At frequencies less than 4 kHz, the cartilage graft had only minor effects on the overall TM fringe patterns. The different conditions had no effects on stapes velocity. Greater than 4 kHz, TM motion was reduced over the grafted TM, both with 0.5- and 1.0-mm-thick grafts. No significant differences in stapes velocity were seen with the 2 different thicknesses of cartilage compared with control. Conclusion Computer-assisted optoelectronic laser holography is a promising technique to investigate middle ear mechanics after tympanoplasty. Such positioning may prevent postoperative TM retraction. These findings and conclusions apply to cartilage placed in the posterior-superior TM quadrant. PMID:19779389

Simulations of Laboratory Astrophysics Experiments using the CRASH code

NASA Astrophysics Data System (ADS)

Trantham, Matthew; Kuranz, Carolyn; Fein, Jeff; Wan, Willow; Young, Rachel; Keiter, Paul; Drake, R. Paul

2015-11-01

Computer simulations can assist in the design and analysis of laboratory astrophysics experiments. The Center for Radiative Shock Hydrodynamics (CRASH) at the University of Michigan developed a code that has been used to design and analyze high-energy-density experiments on OMEGA, NIF, and other large laser facilities. This Eulerian code uses block-adaptive mesh refinement (AMR) with implicit multigroup radiation transport, electron heat conduction and laser ray tracing. This poster will demonstrate some of the experiments the CRASH code has helped design or analyze including: Kelvin-Helmholtz, Rayleigh-Taylor, magnetized flows, jets, and laser-produced plasmas. This work is funded by the following grants: DEFC52-08NA28616, DE-NA0001840, and DE-NA0002032.

Rhabdomyolysis After Cosmetic Laser-Assisted Liposuction.

PubMed

Shin, Jin-yong; Chang, Hak

2015-08-01

A 34-year-old-female patient visited our emergency room for symptoms of disturbance of urination and shortness of breath. She was diagnosed with rhabdomyolysis with acute kidney injury after laser-assisted liposuction and required hemodialysis. Although laser-assisted liposuction is a well-used procedure, it can cause local complications, such as burns and skin irregularities, as well as systemic complications, such as infection, fever, and emboli. However, laser-assisted, liposuction-induced rhabdomyolysis has not been reported. Repetitive exercises, trauma, and crush injury are the major causes of rhabdomyolysis. In this study, a unique case of rhabdomyolysis that developed after laser-assisted liposuction is reported.

The Writing Notebook: Creative Word Processing in the Classroom--November/December 1986, January/February 1987, and April/May 1987.

ERIC Educational Resources Information Center

Franklin, Sharon, Ed.; Madian, Jon, Ed.

1986-01-01

Produced using a Macintosh Plus and LaserWriter Printer, these journals present articles relating to word processing in the classroom. Articles and their authors for the November/December 1986 issue include: "Computer Assisted Instruction: Western Europe" (Owen and Irene Thomas); "FrEd Writing" (B. Fleury); "Writing Up a…

Progress in Development of Methods in Bone Densitometry

NASA Technical Reports Server (NTRS)

Whedon, G. D.; Neumann, William F.; Jenkins, Dale W.

1966-01-01

The effects of weightlessness and decreased activity on the astronaut's musculoskeletal system during prolonged space flight, missions are of concern to NASA. This problem was anticipated from the knowledge that human subjects lose significant quantities of calcium from the skeleton during periods of bedrest, immobilization, and water immersion. An accurate method of measurement of the changes in mineral content of the skeleton is required not only in the space program but also in the biological, medical, and dental fields for mineral metabolism studies and for studying various pathological conditions of the skeleton and teeth. This method is a difficult one requiring the coordinated efforts of physiologists, biophysicists, radiologists, and clinicians. The densitometry methods reported in this conference which have been used or are being developed include X-ray, beta excited X-rays, radioisotopes, sonic vibration, and neutron activation analysis Studies in the Gemini, Biosatellite, and Apollo flights use the X-ray bone densitometry method which requires making X-rays before and after the flights. An in-flight method of bone densitometry would be valuable, and use of radioisotope sources has been suggested. Many advances in bone densitometry have been made in the last five years, and the urgency of the requirement makes this working conference timely and valuable. In such a rapidly developing field with investigators working independently in a variety of scientific disciplines, a working conference is of great value in exchanging information and ideas, critically evaluating approaches and methods, and pointing out new research pathways.

Effect of hydrogen concentration in conventional and IAD coatings on the absorption and laser-induced damage at 10.6 μm

NASA Astrophysics Data System (ADS)

Rahe, Manfred; Ristau, Detlev; Schmidt, Holger

1993-06-01

In this paper, data of single layers of YbF3, BaF2, YF3, and NaF and multilayer coatings produced by conventional thermal evaporation (boat, e-beam) and ion assisted deposition (IAD) are compared. Hydrogen concentration depth profiling was performed using nuclear reaction analysis based on the reaction 1H(15N, (alpha) (gamma) )12C. Absorption was measured with the aid of a laser calorimeter and a cw CO2 laser. A computer-controlled test facility with a TEA CO2 laser was used for determining the 1-on-1 damage thresholds of the coatings. The results point out that the absorption and damage behavior of coatings for the CO2 laser wavelength are related to the total amount of species containing hydrogen. Most of the IAD coatings exhibit a lower hydrogen contamination than conventional thin films.

Complications of femtosecond-assisted laser in-situ keratomileusis flaps.

PubMed

Shah, Deepika N; Melki, Samir

2014-01-01

Femtosecond-assisted laser in-situ keratomileusis flaps have revolutionized refractive surgery since their introduction. Although these lasers are exceedingly safe, complications still do occur. This review focuses specifically on examining the literature and evidence for flap complications during femtosecond-assisted laser in-situ keratomileusis as well as their management.

Wood densitometry in 17th and 18th century Dutch, German, Austrian and French violins, compared to classical Cremonese and modern violins.

PubMed

Stoel, Berend C; Borman, Terry M; de Jongh, Ronald

2012-01-01

Classical violins produced by makers such as Antonio Stradivari and Guarneri del Gesu have long been considered the epitome of the luthier's art and the expressive tool of choice for the most celebrated violinists. It has been speculated these makers had access to wood that was unique in some way and that this was responsible for their acclaimed tonal characteristics. In an attempt to discern whether the above conjecture is true, we analyzed 17 modern and classical Dutch, German, Austrian and French violins by wood densitometry using computed tomography and correlated these results with our previous study of modern and Cremonese violins; in all studying 30 instruments of the violin family. In order to make this comparison possible we developed methods to cross calibrate results from different CT manufacturers using calibration wood pieces. We found no significant differences in median densities between modern and classical violins, or between classical violins from different origins. These results suggest that it is unlikely classical Cremonese makers had access to wood with significantly different wood density characteristics than that available to contemporaneous or modern makers.

Automation of film densitometry for application in personal monitoring.

PubMed

Taheri, M; Movafeghi, A; Rastkhah, N

2011-03-01

In this research work, a semi-automatic densitometry system has been developed for large-scale monitoring services by use of film badge dosemeters. The system consists of a charge-coupled device (CCD)-based scanner that can scan optical densities (ODs) up to 4.2, a computer vision algorithm to improve the quality of digitised films and an analyser program to calculate the necessary information, e.g. the mean OD of region of interest and radiation doses. For calibration of the system, two reference films were used. The Microtek scanner International Color Consortium (ICC) profiler is applied for determining the colour attributes of the scanner accurately and a reference of the density step tablet, Bundesanstalt für Materialforschung und-prüfung (BAM) is used for calibrating the automatic conversion of gray-level values to OD values in the range of 0.2-4.0 OD. The system contributes to achieve more objectives and reliable results. So by applying this system, we can digitise a set of 20 films at once and calculate their relative doses less than about 4 min, and meanwhile it causes to avoid disadvantages of manual process and to enhance the accuracy of dosimetry.

Laser assisted processing; Proceedings of the Meeting, Hamburg, Federal Republic of Germany, Sept. 19, 20, 1988

NASA Astrophysics Data System (ADS)

Laude, Lucien D.; Rauscher, Gerhard

The use of lasers in industrial material processing is discussed in reviews and reports. Sections are devoted to high-precision laser machining, deposition methods, ablation and polymers, and synthesis and oxidation. Particular attention is given to laser cutting of steel sheets, laser micromachining of material surfaces, process control in laser soldering, laser-induced CVD of doped Si stripes on SOS and their characterization by piezoresistivity measurements, laser CVD of Pt spots on glass, laser deposition of GaAs, UV-laser photoablation of polymers, ArF excimer-laser ablation of HgCdTe semiconductor, pulsed laser synthesis of Ti silicides and nitrides, the kinetics of laser-assisted oxidation of metallic films, and excimer-laser-assisted etching of solids for microelectronics.

Interpretation and use of FRAX in clinical practice - position paper of the International Osteoporosis Foundation and the International Society for Clinical Densitometry

USDA-ARS?s Scientific Manuscript database

The International Osteoporosis Foundation (IOF) and the International Society for Clinical Densitometry (ISCD) appointed a joint Task Force to develop resource documents in order to make recommendations on how to improve FRAX and better inform clinicians who use FRAX. The Task Force met in November...

Pulmonary Emphysema in Cystic Fibrosis Detected by Densitometry on Chest Multidetector Computed Tomography

PubMed Central

Wielpütz, Mark O.; Weinheimer, Oliver; Eichinger, Monika; Wiebel, Matthias; Biederer, Jürgen; Kauczor, Hans-Ulrich; Heußel, Claus P.

2013-01-01

Background Histopathological studies on lung specimens from patients with cystic fibrosis (CF) and recent results from a mouse model indicate that emphysema may contribute to CF lung disease. However, little is known about the relevance of emphysema in patients with CF. In the present study, we used computationally generated density masks based on multidetector computed tomography (MDCT) of the chest for non-invasive characterization and quantification of emphysema in CF. Methods Volumetric MDCT scans were acquired in parallel to pulmonary function testing in 41 patients with CF (median age 20.1 years; range 7-66 years) and 21 non-CF controls (median age 30.4 years; range 4-68 years), and subjected to dedicated software. The lung was segmented, low attenuation volumes below a threshold of -950 Hounsfield units were assigned to emphysema volume (EV), and the emphysema index was computed (EI). Results were correlated with forced expiratory volume in 1 s percent predicted (FEV1%), residual volume (RV), and RV/total lung capacity (RV/TLC). Results We show that EV was increased in CF (457±530 ml) compared to non-CF controls (78±90 ml) (P<0.01). EI was also increased in CF (7.7±7.5%) compared to the control group (1.2±1.4%) (P<0.05). EI correlated inversely with FEV1% (rs=-0.66), and directly with RV (rs=0.69) and RV/TLC (rs=0.47) in patients with CF (P<0.007), but not in non-CF controls. Emphysema in CF was detected from early adolescence (~13 years) and increased with age (rs=0.67, P<0.001). Conclusions Our results indicate that early onset emphysema detected by densitometry on chest MDCT is a characteristic pathology that contributes to airflow limitation and may serve as a novel endpoint for monitoring lung disease in CF. PMID:23991177

Multifunctional optical correlator for picosecond ultraviolet laser pulse measurement

DOE PAGES

Rakhman, Abdurahim; Wang, Yang; Garcia, Frances; ...

2014-01-01

A compact optical correlator system that measures both the autocorrelation between two infrared (IR) lights and the cross-correlation between an IR and an ultraviolet (UV) light using a single nonlinear optical crystal has been designed and experimentally demonstrated. The rapid scanning of optical delay line, switching between auto and cross-correlations, crystal angle tuning, and data acquisition and processing are all computer controlled. Pulse widths of an IR light from a mode-locked laser are measured by the correlator and the results are compared with a direct measurement using a high-speed photodetector system. The correlator has been used to study the parametermore » dependence of the pulse width of a macropulse UV laser designed for laser-assisted hydrogen ion (H-) beam stripping for the Spallation Neutron Source at Oak Ridge National Laboratory.« less

Comparison of carbon dioxide laser-assisted versus stapler-assisted endoscopic cricopharyngeal myotomy.

PubMed

Pollei, Taylor R; Hinni, Michael L; Hayden, Richard E; Lott, David G; Mors, Matthew B

2013-09-01

We directly compared endoscopic carbon dioxide (CO2) laser and stapler treatment methods for both cricopharyngeal hypertrophy (CPH) and Zenker's diverticulum (ZD). We performed a single-institution retrospective chart review of 153 patients who underwent either CO2 laser-assisted or stapler-assisted endoscopic cricopharyngeal myotomy (CPM). Isolated CPH was more likely to be treated with the CO2 laser than by stapler techniques. The ZD pouch size decreased significantly after surgery in both laser (p = 0.04) and stapler (p = 0.008) groups. The average duration of the procedure for CPM was longer for the laser than for the stapler (p = 0.01). Both techniques were successful when used in revision procedures. The overall complication rates were not statistically significantly different. Laser surgery trended toward a higher rate of major complications (2.4% versus 0%). Symptomatic recurrence was more likely after stapler surgery (p = 0.002). The rates of revision surgery were similar in the two groups (3.3% for laser and 4.3% for stapler). In the treatment of isolated CPH or ZD, stapler-assisted endoscopic surgery results in a shorter operative time, whereas laser-assisted CPM results in a decreased incidence of symptomatic recurrence.

Hair and bare skin discrimination for laser-assisted hair removal systems.

PubMed

Cayir, Sercan; Yetik, Imam Samil

2017-07-01

Laser-assisted hair removal devices aim to remove body hair permanently. In most cases, these devices irradiate the whole area of the skin with a homogenous power density. Thus, a significant portion of the skin, where hair is not present, is burnt unnecessarily causing health risks. Therefore, methods that can distinguish hair regions automatically would be very helpful avoiding these unnecessary applications of laser. This study proposes a new system of algorithms to detect hair regions with the help of a digital camera. Unlike previous limited number of studies, our methods are very fast allowing for real-time application. Proposed methods are based on certain features derived from histograms of hair and skin regions. We compare our algorithm with competing methods in terms of localization performance and computation time and show that a much faster real-time accurate localization of hair regions is possible with the proposed method. Our results show that the algorithm we have developed is extremely fast (around 45 milliseconds) allowing for real-time application with high accuracy hair localization ( 96.48 %).

Laser assisted zona hatching does not lead to immediate impairment in human embryo quality and metabolism.

PubMed

Uppangala, Shubhashree; D'Souza, Fiona; Pudakalakatti, Shivanand; Atreya, Hanudatta S; Raval, Keyur; Kalthur, Guruprasad; Adiga, Satish Kumar

2016-12-01

Laser assisted zona hatching (LAH) is a routinely used therapeutic intervention in assisted reproductive technology for patients with poor prognosis. However, results are not conclusive in demonstrating the benefits of zona hatching in improving the pregnancy rate. Recent observations on LAH induced genetic instability in animal embryos prompted us to look into the effects of laser assisted zona hatching on the human preimplantation embryo quality and metabolic uptake using high resolution nuclear magnetic resonance (NMR) technology. This experimental prospective study included fifty embryos from twenty-five patients undergoing intra cytoplasmic sperm injection. Embryo quality assessment followed by profiling of spent media for the non-invasive evaluation of metabolites was performed using NMR spectroscopy 24 hours after laser treatment and compared with that of non-treated sibling embryos. Both cell number and embryo quality on day 3 of development did not vary significantly between the two groups at 24 hours post laser treatment interval. Time lapse monitoring of the embryos for 24 hours did not reveal blastomere fragmentation adjacent to the point of laser treatment. Similarly, principal component analysis of metabolites did not demonstrate any variation across the groups. These results suggest that laser assisted zona hatching does not affect human preimplantation embryo morphology and metabolism at least until 24 hours post laser assisted zona hatching. However, studies are required to elucidate laser induced metabolic and developmental changes at extended time periods. AH: assisted hatching; ART: assisted reproductive technology; DNA: deoxy-ribo nucleic acid; LAH: laser assisted hatching; MHz: megahertz; NMR: nuclear magnetic resonance; PCA: principal component analysis; PGD: preimplantation genetic diagnosis; TLM: time lapse monitoring.

Assessment of indigenous Nepalese soybean as a potential germplasm resource for improvement of protein in North American cultivars.

PubMed

Krishnan, Hari B; Natarajan, Savithiry S; Mahmoud, Ahmed A; Bennett, John O; Krishnan, Ammulu Hari; Prasad, Braj Nandan

2006-07-26

Soybeans contain approximately 40% protein and 20% oil and represents an important source of protein in animal rations and human diets. Attempts are being made to increase further the overall protein content of soybeans by utilization of exotic germplasms. In this study, soybean cultivars from Nepal have been characterized and their potential as a germplasm resource for improvement of the protein content and quality of North American cultivars assessed. Soybean cultivars 'Sathia', 'Seti', 'Kavre', and 'Soida Chiny', indigenous to various regions of Nepal, contained 42-45% protein, which is significantly higher in comparison to that of the North American cultivar 'Williams 82' (39%). Fractionation of seed protein by high-resolution two-dimensional gel electrophoresis revealed differences in the protein profiles of these cultivars. Various isoelectric forms of glycinin and beta-conglycinin were identified by comparing the matrix-assisted laser desorption ionization time-of-flight mass fingerprinting data against the National Center for Biotechnology Information nonredundant database. Nepalese cultivar Sathia was distinct, lacking some isoelectric forms of acidic and basic glycinin subunits while expressing other unique forms. The contribution of these unique protein spots present in either Sathia or Williams 82 to the total protein content was quantified using scanning laser densitometry. Distinct restriction fragment length polymorphisms (RFLP) for group 1 glycinin genes were observed among the tested Nepalese genotypes, indicating sequence variation among the cultivars. Conversely, evaluation of RFLP for the genes encoding group 2 glycinins, beta-conglycinin, and Bowman-Birk proteinase inhibitors indicated a high degree of conservation in these genes. Determination of amino acid composition, a reflection of protein quality, indicated that the arginine content of the Nepalese soybeans ranged from 7.7 to 8.1%, which was 5-10% higher than the 7.4% expressed in Williams 82. Additionally, Karve and Seti contained significantly more cysteine than Williams 82. Nepalese high-protein soybeans having a desirable amino acid composition hold potential to increase the protein quality and diversity of North American cultivars.

Photofragmentation of Gas-Phase Lanthanide Cyclopentadienyl Complexes: Experimental and Time-Dependent Excited-State Molecular Dynamics

PubMed Central

2015-01-01

Unimolecular gas-phase laser-photodissociation reaction mechanisms of open-shell lanthanide cyclopentadienyl complexes, Ln(Cp)3 and Ln(TMCp)3, are analyzed from experimental and computational perspectives. The most probable pathways for the photoreactions are inferred from photoionization time-of-flight mass spectrometry (PI-TOF-MS), which provides the sequence of reaction intermediates and the distribution of final products. Time-dependent excited-state molecular dynamics (TDESMD) calculations provide insight into the electronic mechanisms for the individual steps of the laser-driven photoreactions for Ln(Cp)3. Computational analysis correctly predicts several key reaction products as well as the observed branching between two reaction pathways: (1) ligand ejection and (2) ligand cracking. Simulations support our previous assertion that both reaction pathways are initiated via a ligand-to-metal charge-transfer (LMCT) process. For the more complex chemistry of the tetramethylcyclopentadienyl complexes Ln(TMCp)3, TMESMD is less tractable, but computational geometry optimization reveals the structures of intermediates deduced from PI-TOF-MS, including several classic “tuck-in” structures and products of Cp ring expansion. The results have important implications for metal–organic catalysis and laser-assisted metal–organic chemical vapor deposition (LCVD) of insulators with high dielectric constants. PMID:24910492

Modelling and characterization of photothermal effects assisted with gold nanorods in ex vivo samples and in a murine model

NASA Astrophysics Data System (ADS)

Lamela Rivera, Horacio; Rodríguez Jara, Félix; Cunningham, Vincent

2011-03-01

We discuss in this article the implementation of a laser-tissue interaction and bioheat-transfer 2-D finite-element model for Photothermal Therapy assisted with Gold Nanorods. We have selected Gold Nanorods as absorbing nanostructures in order to improve the efficiency of using compact diode lasers because of their high opto-thermal conversion efficiency at 808 and 850 nm. The goal is to model the distribution of the optical energy among the tissue including the skin absorption effects and the tissue thermal response, with and without the presence of Gold Nanorods. The heat generation due to the optical energy absorption and the thermal propagation will be computationally modeled and optimized. The model has been evaluated and compared with experimental ex-vivo data in fresh chicken muscle samples and in-vivo BALB/c mice animal model.

Nanofabrication with Pulsed Lasers

PubMed Central

2010-01-01

An overview of pulsed laser-assisted methods for nanofabrication, which are currently developed in our Institute (LP3), is presented. The methods compass a variety of possibilities for material nanostructuring offered by laser–matter interactions and imply either the nanostructuring of the laser-illuminated surface itself, as in cases of direct laser ablation or laser plasma-assisted treatment of semiconductors to form light-absorbing and light-emitting nano-architectures, as well as periodic nanoarrays, or laser-assisted production of nanoclusters and their controlled growth in gaseous or liquid medium to form nanostructured films or colloidal nanoparticles. Nanomaterials synthesized by laser-assisted methods have a variety of unique properties, not reproducible by any other route, and are of importance for photovoltaics, optoelectronics, biological sensing, imaging and therapeutics. PMID:20672069

Automated brain computed tomographic densitometry of early ischemic changes in acute stroke

PubMed Central

Stoel, Berend C.; Marquering, Henk A.; Staring, Marius; Beenen, Ludo F.; Slump, Cornelis H.; Roos, Yvo B.; Majoie, Charles B.

2015-01-01

Abstract. The Alberta Stroke Program Early CT score (ASPECTS) scoring method is frequently used for quantifying early ischemic changes (EICs) in patients with acute ischemic stroke in clinical studies. Varying interobserver agreement has been reported, however, with limited agreement. Therefore, our goal was to develop and evaluate an automated brain densitometric method. It divides CT scans of the brain into ASPECTS regions using atlas-based segmentation. EICs are quantified by comparing the brain density between contralateral sides. This method was optimized and validated using CT data from 10 and 63 patients, respectively. The automated method was validated against manual ASPECTS, stroke severity at baseline and clinical outcome after 7 to 10 days (NIH Stroke Scale, NIHSS) and 3 months (modified Rankin Scale). Manual and automated ASPECTS showed similar and statistically significant correlations with baseline NIHSS (R=−0.399 and −0.277, respectively) and with follow-up mRS (R=−0.256 and −0.272), except for the follow-up NIHSS. Agreement between automated and consensus ASPECTS reading was similar to the interobserver agreement of manual ASPECTS (differences <1 point in 73% of cases). The automated ASPECTS method could, therefore, be used as a supplementary tool to assist manual scoring. PMID:26158082

Body composition of adult cystic fibrosis patients and control subjects as determined by densitometry, bioelectrical impedance, total-body electrical conductivity, skinfold measurements, and deuterium oxide dilution

DOE Office of Scientific and Technical Information (OSTI.GOV)

Newby, M.J.; Keim, N.L.; Brown, D.L.

1990-08-01

This study contrasts body compositions (by six methods) of eight cystic fibrosis (CF) subjects with those of eight control subjects matched for age, height, and sex. CF subjects weighed 84% as much as control subjects. Densitometry and two bioelectrical impedance-analysis methods suggested that reduced CF weights were due to less lean tissue (10.7, 9.5, and 10.4 kg). Total-body electrical conductivity (TOBEC) and skinfold-thickness measurements indicated that CF subjects were leaner than control subjects and had less fat (5.4 and 3.6 kg) and less lean (5.2 and 7 kg) tissue. D2O dilution showed a pattern similar to TOBEC (8.3 kg lessmore » lean, 2.7 kg less fat tissue). Densitometry estimates of fat (mass and percent) were not correlated (r less than 0.74, p greater than 0.05) with any other method for CF subjects but were correlated with all other methods for control subjects. CF subjects contained less fat and lean tissue than did control subjects. Densitometry by underwater weighing is unsuitable for assessing body composition of CF patients.« less

Development of a water-jet assisted laser paint removal process

NASA Astrophysics Data System (ADS)

Madhukar, Yuvraj K.; Mullick, Suvradip; Nath, Ashish K.

2013-12-01

The laser paint removal process usually leaves behind traces of combustion product i.e. ashes on the surface. An additional post-processing such as light-brushing or wiping by some mechanical means is required to remove the residual ash. In order to strip out the paint completely from the surface in a single step, a water-jet assisted laser paint removal process has been investigated. The 1.07 μm wavelength of Yb-fiber laser radiation has low absorption in water; therefore a high power fiber laser was used in the experiment. The laser beam was delivered on the paint-surface along with a water jet to remove the paint and residual ashes effectively. The specific energy, defined as the laser energy required removing a unit volume of paint was found to be marginally more than that for the gas-jet assisted laser paint removal process. However, complete paint removal was achieved with the water-jet assist only. The relatively higher specific energy in case of water-jet assist is mainly due to the scattering of laser beam in the turbulent flow of water-jet.

Femtosecond-laser assisted cell reprogramming

NASA Astrophysics Data System (ADS)

Breunig, Hans Georg; Uchugonova, Aisada; Batista, Ana; König, Karsten

2017-02-01

Femtosecond-laser pulses can assist to transfect cells by creating transient holes in the cell membrane, thus making them temporarily permeable for extraneous genetic material. This procedure offers the advantage of being completely "virus free" since no viruses are used for the delivery and integration of gene factors into the host genome and, thereby, avoiding serious side effects which so far prevent clinical application. Unfortunately, focusing of the laser radiation onto individual cell membranes is quite elaborate and time consuming. Regarding these obstacles, we briefly review two optical setups for fast, efficient and high throughput laser-assisted cell transfection based on femtosecond laser pulse excitation. The first setup aims at assisting the transfection of adherent cells. It comprises of a modified laser-scanning microscope with beamshaping optics as well as home-made software to automate the detection, targeting and laser-irradiation process. The second setup aims at laser-assisted transfection of non-adherent cells in suspension which move in a continuous flow through the laser focus region. The setup allows to address a large number of cells, however, with much lower transfection efficiency than the individual-cell targeting approach.

[Three-dimensional tooth model reconstruction based on fusion of dental computed tomography images and laser-scanned images].

PubMed

Zhang, Dongxia; Gan, Yangzhou; Xiong, Jing; Xia, Zeyang

2017-02-01

Complete three-dimensional(3D) tooth model provides essential information to assist orthodontists for diagnosis and treatment planning. Currently, 3D tooth model is mainly obtained by segmentation and reconstruction from dental computed tomography(CT) images. However, the accuracy of 3D tooth model reconstructed from dental CT images is low and not applicable for invisalign design. And another serious problem also occurs, i.e. frequentative dental CT scan during different intervals of orthodontic treatment often leads to radiation to the patients. Hence, this paper proposed a method to reconstruct tooth model based on fusion of dental CT images and laser-scanned images. A complete3 D tooth model was reconstructed with the registration and fusion between the root reconstructed from dental CT images and the crown reconstructed from laser-scanned images. The crown of the complete 3D tooth model reconstructed with the proposed method has higher accuracy. Moreover, in order to reconstruct complete 3D tooth model of each orthodontic treatment interval, only one pre-treatment CT scan is needed and in the orthodontic treatment process only the laser-scan is required. Therefore, radiation to the patients can be reduced significantly.

[Evaluation of free radical quantity in the anterior chamber following femtosecond laser-assisted capsulotomy].

PubMed

Tóth, Gábor; Sándor, Gábor László; Kleiner, Dénes; Szentmáry, Nóra; Kiss, Huba J; Blázovics, Anna; Nagy, Zoltán Zsolt

2016-11-01

Femtosecond laser is a revolutionary, innovative treatment method used in cataract surgery. To evaluate free radical quantity in the anterior chamber of the eye, during femtosecond laser assisted capsulotomy, in a porcine eye model. Seventy fresh porcine eyes were collected within 2 hours post mortem, were transported at 4 ºC and treated within 7 hours. Thirty-five eyes were used as control and 35 as femtosecond laser assisted capsulotomy group. A simple luminol-dependent chemiluminescence method was used to measure the total scavenger capacity in the aqueous humour, as an indicator of free radical production. The emitted photons were expressed in relative light unit %. The relative light unit % was lower in the control group (median 1%, interquartile range [0.4-3%]) than in the femtosecond laser assisted capsulotomy group (median 4.4%, interquartile range [1.5%-21%]) (p = 0.01). Femtosecond laser assisted capsulotomy decreases the antioxidant defense of the anterior chamber, which refers to a significant free radical production during femtosecond laser assisted capsulotomy. Orv. Hetil., 2016, 157(47), 1880-1883.

Validation of Long Bone Mechanical Properties from Densitometry

NASA Technical Reports Server (NTRS)

Whalen, R.; Katz, B.; Cleek, T.; Hargens, Alan R. (Technical Monitor)

1995-01-01

The objective of this study was to assess whether cross-sectional areal properties, calculated from densitometry, correlate to the true flexural properties. Right and left male embalmed tibiae were used in the study. Prior to scanning, the proximal end of each tibia was potted in a fixture with registration pins, flushed thoroughly with water under pressure to remove trapped air, and then placed in a constant thickness water bath attached to a precision indexer. Two sets of three scans of the entire tibia were taken with an Hologic QDR 1000/W densitometer at rotations of 0, 45, and 90 degrees about the tibia long axis. An aluminum step phantom and a bone step phantom, machined from bovine cortical bone, were also in the bath and scanned separately. Pixel attenuation data from the two sets of scans were averaged to reduce noise. Pixel data from the high energy beam were then converted to equivalent thicknesses using calibration equations. Cross-sectional areal properties (centroid, principal area moments and principal angle) along the length were computed from the three registered scans using methods developed in our laboratory. Flexural rigidities. Four strain gages were bonded around the circumference of each of 5 cross-sections encompassing the entire diaphysis. A known transverse load was then applied to the distal end and the bone was rotated 360 degrees in eight increments of 45 degrees each. Strains from the eight orientations were analyzed along with the known applied bending moments at each section to compute section centroids, curvatures, principal flexural rigidities and principal angle. Reference axes between the two methods were maintained within +/- 0.5 degrees using an electronic inclinometer. Principal angles (flexural - areal) differed by -2.0 +/- 4.0 degrees, and 1.0 +/- 2.5 degrees for the right and left tibia, respectively. Section principal flexural rigidities were highly correlated to principal areal moments (right: r(sup 2)= 0.997; left: r(sup 2)= 0.978) indicating a nearly constant effective flexural modulus. Right and left tibia exhibited a very high degree of symmetry when comparing either flexural or areal properties. To our knowledge this is the first study to validate the use of densitometry (DXA) to predict three dimensional structural properties of long bones. Our initial results support the conclusion that bone mineral and its distribution are the primary determinants of flexural modulus and rigidity.

IR-laser assisted additive freeform optics manufacturing.

PubMed

Hong, Zhihan; Liang, Rongguang

2017-08-02

Computer-controlled additive manufacturing (AM) processes, also known as three-dimensional (3D) printing, create 3D objects by the successive adding of a material or materials. While there have been tremendous developments in AM, the 3D printing of optics is lagging due to the limits in materials and tight requirements for optical applicaitons. We propose a new precision additive freeform optics manufacturing (AFOM) method using an pulsed infrared (IR) laser. Compared to ultraviolet (UV) curable materials, thermally curable optical silicones have a number of advantages, such as strong UV stability, non-yellowing, and high transmission, making it particularly suitable for optical applications. Pulsed IR laser radiation offers a distinct advantage in processing optical silicones, as the high peak intensity achieved in the focal region allows for curing the material quickly, while the brief duration of the laser-material interaction creates a negligible heat-affected zone.

Model of depositing layer on cylindrical surface produced by induction-assisted laser cladding process

NASA Astrophysics Data System (ADS)

Kotlan, Václav; Hamar, Roman; Pánek, David; Doležel, Ivo

2017-12-01

A model of hybrid cladding on a cylindrical surface is built and numerically solved. Heating of both substrate and the powder material to be deposited on its surface is realized by laser beam and preheating inductor. The task represents a hard-coupled electromagnetic-thermal problem with time-varying geometry. Two specific algorithms are developed to incorporate this effect into the model, driven by local distribution of temperature and its gradients. The algorithms are implemented into the COMSOL Multiphysics 5.2 code that is used for numerical computations of the task. The methodology is illustrated with a typical example whose results are discussed.

Dependence of Long Bone Flexural Properties on Bone Mineral Distribution

NASA Technical Reports Server (NTRS)

Katz, BethAnn; Cleek, Tammy M.; Whalen, Robert T.; Connolly, James P. (Technical Monitor)

1995-01-01

The objective of this study is to assess whether a non-invasive determination of long bone cross-sectional areal properties using bone densitometry accurately estimates true long bone flexural properties. In this study, section properties of two pairs of human female embalmed tibiae were compared using two methods: special analysis of bone densitometry data, and experimental determination of flexural regidities from bone surface strain measurements during controlled loading.

A comparison of free autologous breast reconstruction with and without the use of laser-assisted indocyanine green angiography: a cost-effectiveness analysis.

PubMed

Chatterjee, Abhishek; Krishnan, Naveen M; Van Vliet, Michael M; Powell, Stephen G; Rosen, Joseph M; Ridgway, Emily B

2013-05-01

Laser-assisted indocyanine green angiography is a U.S. Food and Drug Administration-approved technology used to assess tissue viability and perfusion. Its use in plastic and reconstructive surgery to assess flap perfusion in autologous breast reconstruction is relatively new. There have been no previous studies evaluating the cost-effectiveness of this new technology compared with the current practice of clinical judgment in evaluating tissue perfusion and viability in free autologous breast reconstruction in patients who have undergone mastectomy. A comprehensive literature review was performed to identify the complication rate of the most common complications with and without laser-assisted indocyanine green angiography in free autologous breast reconstruction after mastectomy. These probabilities were combined with Medicare Current Procedural Terminology provider reimbursement codes (cost) and utility estimates for common complications from a survey of 10 plastic surgeons to fit into a decision model to evaluate the cost-effectiveness of laser-assisted indocyanine green angiography. The decision model revealed a baseline cost difference of $773.66 and a 0.22 difference in the quality-adjusted life-years, yielding an incremental cost-utility ratio of $3516.64 per quality-adjusted life year favoring laser-assisted indocyanine green angiography. Sensitivity analysis showed that using laser-assisted indocyanine green angiography was more cost-effective when the complication rate without using laser-assisted indocyanine green angiography (clinical judgment alone) was 4 percent or higher. The authors' study demonstrates that laser-assisted indocyanine green angiography is a cost-effective technology under the most stringent acceptable thresholds when used in immediate free autologous breast reconstruction.

Social determinants of bone densitometry uptake for osteoporosis risk in patients aged 50yr and older: a systematic review.

PubMed

Brennan, Sharon L; Wluka, Anita E; Gould, Haslinda; Nicholson, Geoffrey C; Leslie, William D; Ebeling, Peter R; Oldenburg, Brian; Kotowicz, Mark A; Pasco, Julie A

2012-01-01

The World Health Organization identifies that osteoporosis is one of the leading health problems in the Western world. An increased risk of fragility fracture is observed in more socially disadvantaged individuals in most Western countries. Dual-energy X-ray absorptiometry (DXA) is currently the procedure of choice to diagnose osteoporosis and assess fracture risk. We systematically reviewed the literature regarding social determinants of DXA utilization for osteoporosis detection in patients aged 50yr and older using a computer-aided search of MEDLINE, EMBASE, CINAHL, and PsychINFO from January 1994 to December 2010. Five cross-sectional studies, incorporating 16 separate analyses, were identified for inclusion in this review. The best evidence analysis identified limited evidence for a positive association between either income or education with DXA utilization; furthermore, the best evidence analysis found no evidence for an association between either marital status or working status and DXA utilization. Further research is required to identify whether a relationship exists and elucidate reasons for disparities in DXA utilization between different social groups, such as choice and referral processes, as a necessary precursor in identifying modifiable determinants and appropriate strategies to promote preventive screening to identify fracture risk. Copyright © 2012 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Relationship between CT densitometry with a slice thickness of 0.5 mm and audiometry in otosclerosis.

PubMed

Kawase, Setsuko; Naganawa, Shinji; Sone, Michihiko; Ikeda, Mitsuru; Ishigaki, Takeo

2006-06-01

The appropriate cutoff Hounsfield unit (HU) value for the diagnosis of otosclerosis was determined and the correlation between the bone conduction threshold and the findings of computed tomography (CT) densitometry investigated. CT images, 0.5-mm thick, were evaluated in 24 ears with otosclerosis and 19 control ears. Eight regions of interest were set around the otic capsule. The mean HU values in the area anterior to the oval window (A-OW) and anterior to the internal auditory canal (A-IAC) were significantly lower in otosclerosis than in controls. Based on receiver operating characteristic (ROC) analysis, the cutoff HU value in A-OW was determined to be 2,187.3 HU. The mean HU value in retrofenestral otosclerosis was significantly lower in the area A-OW, A-IAC and around the cochlea than in controls. Based on ROC analysis, the cutoff HU value in the latter was determined to be 2,045 HU. A statistically significant correlation was found between the density of the area A-OW and the hearing level at 500 and 1,000 Hz, and between the density of the area around the cochlea and the hearing level at most frequencies. These results suggest the semi-automated diagnosis of otosclerosis may be possible.

Linear Calibration of Radiographic Mineral Density Using Video-Digitizing Methods

NASA Technical Reports Server (NTRS)

Martin, R. Bruce; Papamichos, Thomas; Dannucci, Greg A.

1990-01-01

Radiographic images can provide quantitative as well as qualitative information if they are subjected to densitometric analysis. Using modem video-digitizing techniques, such densitometry can be readily accomplished using relatively inexpensive computer systems. However, such analyses are made more difficult by the fact that the density values read from the radiograph have a complex, nonlinear relationship to bone mineral content. This article derives the relationship between these variables from the nature of the intermediate physical processes, and presents a simple mathematical method for obtaining a linear calibration function using a step wedge or other standard.

Linear Calibration of Radiographic Mineral Density Using Video-Digitizing Methods

NASA Technical Reports Server (NTRS)

Martin, R. Bruce; Papamichos, Thomas; Dannucci, Greg A.

1990-01-01

Radiographic images can provide quantitative as well as qualitative information if they are subjected to densitometric analysis. Using modern video-digitizing techniques, such densitometry can be readily accomplished using relatively inexpensive computer systems. However, such analyses are made more difficult by the fact that the density values read from the radiograph have a complex, nonlinear relationship to bone mineral content. This article derives the relationship between these variables from the nature of the intermediate physical processes, and presents a simple mathematical method for obtaining a linear calibration function using a step wedge or other standard.

Official Positions for FRAX® clinical regarding falls and frailty: can falls and frailty be used in FRAX®? From Joint Official Positions Development Conference of the International Society for Clinical Densitometry and International Osteoporosis Foundation on FRAX®.

PubMed

Masud, Tahir; Binkley, Neil; Boonen, Steven; Hannan, Marian T

2011-01-01

Risk factors for fracture can be purely skeletal, e.g., bone mass, microarchitecture or geometry, or a combination of bone and falls risk related factors such as age and functional status. The remit of this Task Force was to review the evidence and consider if falls should be incorporated into the FRAX® model or, alternatively, to provide guidance to assist clinicians in clinical decision-making for patients with a falls history. It is clear that falls are a risk factor for fracture. Fracture probability may be underestimated by FRAX® in individuals with a history of frequent falls. The substantial evidence that various interventions are effective in reducing falls risk was reviewed. Targeting falls risk reduction strategies towards frail older people at high risk for indoor falls is appropriate. This Task Force believes that further fracture reduction requires measures to reduce falls risk in addition to bone directed therapy. Clinicians should recognize that patients with frequent falls are at higher fracture risk than currently estimated by FRAX® and include this in decision-making. However, quantitative adjustment of the FRAX® estimated risk based on falls history is not currently possible. In the long term, incorporation of falls as a risk factor in the FRAX® model would be ideal. Copyright © 2011 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Complications from laser-assisted liposuction performed by noncore practitioners.

PubMed

Blum, Craig A; Sasser, Charles G S; Kaplan, Jonathan L

2013-10-01

Liposuction is one of the most commonly performed aesthetic surgery procedures in the United States, and most plastic surgeons perform suction-assisted, ultrasound-assisted, or power-assisted liposuction. The past decade has seen a growing interest in laser-assisted liposuction (LAL) and the proposed advantages of traditional liposuction methods. However, it is performed by a minority of plastic surgeons. In fact, many LAL providers are not trained in aesthetic practice, and many offer LAL as their only body-contouring procedure. When only one method of body contouring is available to a provider, it may lead to inappropriate patient selection with associated poor outcomes. This report discusses the use of laser liposuction in body contouring and the demographics of those performing liposuction, including LAL. Complications from laser-assisted liposuction performed by noncore practitioners are illustrated.

Laser assisted drug delivery: a review of an evolving technology.

PubMed

Sklar, Lindsay R; Burnett, Christopher T; Waibel, Jill S; Moy, Ronald L; Ozog, David M

2014-04-01

Topically applied drugs have a relatively low cutaneous bioavailability. This article reviews the existing applications of laser assisted drug delivery, a means by which the permeation of topically applied agents can be enhanced into the skin. The existing literature suggests that lasers are a safe and effective means of enhancing the delivery of topically applied agents through the skin. The types of lasers most commonly studied in regards to drug delivery are the carbon dioxide (CO2 ) and erbium:yttrium-aluminum-garnet (Er:YAG) lasers. Both conventional ablative and fractional ablative modalities have been utilized and are summarized herein. The majority of the existing studies on laser assisted drug delivery have been performed on animal models and additional human studies are needed. Laser assisted drug delivery is an evolving technology with potentially broad clinical applications. Multiple studies demonstrate that laser pretreatment of the skin can increase the permeability and depth of penetration of topically applied drug molecules for both local cutaneous and systemic applications. © 2014 Wiley Periodicals, Inc.

Marginal Accuracy and Internal Fit of 3-D Printing Laser-Sintered Co-Cr Alloy Copings.

PubMed

Kim, Myung-Joo; Choi, Yun-Jung; Kim, Seong-Kyun; Heo, Seong-Joo; Koak, Jai-Young

2017-01-23

Laser sintered technology has been introduced for clinical use and can be utilized more widely, accompanied by the digitalization of dentistry and the development of direct oral scanning devices. This study was performed with the aim of comparing the marginal accuracy and internal fit of Co-Cr alloy copings fabricated by casting, CAD/CAM (Computer-aided design/Computer-assisted manufacture) milled, and 3-D laser sintered techniques. A total of 36 Co-Cr alloy crown-copings were fabricated from an implant abutment. The marginal and internal fit were evaluated by measuring the weight of the silicone material, the vertical marginal discrepancy using a microscope, and the internal gap in the sectioned specimens. The data were statistically analyzed by One-way ANOVA (analysis of variance), a Scheffe's test, and Pearson's correlation at the significance level of p = 0.05, using statistics software. The silicone weight was significantly low in the casting group. The 3-D laser sintered group showed the highest vertical discrepancy, and marginal-, occlusal-, and average- internal gaps ( p < 0.05). The CAD/CAM milled group revealed a significantly high axial internal gap. There are moderate correlations between the vertical marginal discrepancy and the internal gap variables ( r = 0.654), except for the silicone weight. In this study, the 3-D laser sintered group achieved clinically acceptable marginal accuracy and internal fit.

Marginal Accuracy and Internal Fit of 3-D Printing Laser-Sintered Co-Cr Alloy Copings

PubMed Central

Kim, Myung-Joo; Choi, Yun-Jung; Kim, Seong-Kyun; Heo, Seong-Joo; Koak, Jai-Young

2017-01-01

Laser sintered technology has been introduced for clinical use and can be utilized more widely, accompanied by the digitalization of dentistry and the development of direct oral scanning devices. This study was performed with the aim of comparing the marginal accuracy and internal fit of Co-Cr alloy copings fabricated by casting, CAD/CAM (Computer-aided design/Computer-assisted manufacture) milled, and 3-D laser sintered techniques. A total of 36 Co-Cr alloy crown-copings were fabricated from an implant abutment. The marginal and internal fit were evaluated by measuring the weight of the silicone material, the vertical marginal discrepancy using a microscope, and the internal gap in the sectioned specimens. The data were statistically analyzed by One-way ANOVA (analysis of variance), a Scheffe’s test, and Pearson’s correlation at the significance level of p = 0.05, using statistics software. The silicone weight was significantly low in the casting group. The 3-D laser sintered group showed the highest vertical discrepancy, and marginal-, occlusal-, and average- internal gaps (p < 0.05). The CAD/CAM milled group revealed a significantly high axial internal gap. There are moderate correlations between the vertical marginal discrepancy and the internal gap variables (r = 0.654), except for the silicone weight. In this study, the 3-D laser sintered group achieved clinically acceptable marginal accuracy and internal fit. PMID:28772451

Technology development of the Space Transportation System mission and terrestrial applications of satellite technology

NASA Technical Reports Server (NTRS)

1981-01-01

The Space Transportation System (STS) is discussed, including the launch processing system, the thermal protection subsystem, meteorological research, sound supression water system, rotating service structure, improved hypergol or removal systems, fiber optics research, precision positioning, remote controlled solid rocket booster nozzle plugs, ground operations for Centaur orbital transfer vehicle, parachute drying, STS hazardous waste disposal and recycle, toxic waste technology and control concepts, fast analytical densitometry study, shuttle inventory management system, operational intercommunications system improvement, and protective garment ensemble. Terrestrial applications are also covered, including LANDSAT applications to water resources, satellite freeze forecast system, application of ground penetrating radar to soil survey, turtle tracking, evaluating computer drawn ground cover maps, sparkless load pulsar, and coupling a microcomputer and computing integrator with a gas chromatograph.

Femtosecond laser-assisted cataract surgery in anterior lenticonus due to Alport syndrome.

PubMed

Barnes, Alexander C; Roth, Allen S

2017-06-01

We describe a case of bilateral anterior lenticonus in a patient with Alport syndrome treated with femtosecond laser-assisted cataract surgery (FLACS). FLACS was performed without complication, and a desirable postoperative visual acuity was achieved. Femtosecond laser-assisted cataract surgery is an effective approach for managing patients with anterior lenticonus secondary to Alport syndrome.

Laser-assisted solar cell metallization processing

NASA Technical Reports Server (NTRS)

Dutta, S.

1984-01-01

Laser assisted processing techniques utilized to produce the fine line, thin metal grid structures that are required to fabricate high efficiency solar cells are investigated. The tasks comprising these investigations are summarized. Metal deposition experiments are carried out utilizing laser assisted pyrolysis of a variety of metal bearing polymer films and metalloorganic inks spun onto silicon substrates. Laser decomposition of spun on silver neodecanoate ink yields very promising results. Solar cell comb metallization patterns are written using this technique.

Selection of the most influential factors on the water-jet assisted underwater laser process by adaptive neuro-fuzzy technique

NASA Astrophysics Data System (ADS)

Nikolić, Vlastimir; Petković, Dalibor; Lazov, Lyubomir; Milovančević, Miloš

2016-07-01

Water-jet assisted underwater laser cutting has shown some advantages as it produces much less turbulence, gas bubble and aerosols, resulting in a more gentle process. However, this process has relatively low efficiency due to different losses in water. It is important to determine which parameters are the most important for the process. In this investigation was analyzed the water-jet assisted underwater laser cutting parameters forecasting based on the different parameters. The method of ANFIS (adaptive neuro fuzzy inference system) was applied to the data in order to select the most influential factors for water-jet assisted underwater laser cutting parameters forecasting. Three inputs are considered: laser power, cutting speed and water-jet speed. The ANFIS process for variable selection was also implemented in order to detect the predominant factors affecting the forecasting of the water-jet assisted underwater laser cutting parameters. According to the results the combination of laser power cutting speed forms the most influential combination foe the prediction of water-jet assisted underwater laser cutting parameters. The best prediction was observed for the bottom kerf-width (R2 = 0.9653). The worst prediction was observed for dross area per unit length (R2 = 0.6804). According to the results, a greater improvement in estimation accuracy can be achieved by removing the unnecessary parameter.

A brief review of other notable protein blotting methods.

PubMed

Kurien, Biji T; Scofield, R Hal

2009-01-01

A plethora of methods have been used for transferring proteins from the gel to the membrane. These include centrifuge blotting, electroblotting of proteins to Teflon tape and membranes for N- and C-terminal sequence analysis, multiple tissue blotting, a two-step transfer of low and high molecular weight proteins, blotting of Coomassie Brilliant Blue (CBB)-stained proteins from polyacrylamide gels to transparencies, acid electroblotting onto activated glass, membrane-array method for the detection of human intestinal bacteria in fecal samples, protein microarray using a new black cellulose nitrate support, electrotransfer using square wave alternating voltage for enhanced protein recovery, polyethylene glycol-mediated significant enhancement of the immunoblotting transfer, parallel protein chemical processing before and during western blot and the molecular scanner concept, electronic western blot of matrix-assisted laser desorption/ionization (MALDI) mass spectrometry-identified polypeptides from parallel processed gel-separated proteins, semidry electroblotting of peptides and proteins from acid-urea polyacrylamide gels, transfer of silver-stained proteins from polyacrylamide gels to polyvinylidene difluoride (PVDF) membranes, and the display of K(+) channel proteins on a solid nitrocellulose support for assaying toxin binding. The quantification of proteins bound to PVDF membranes by elution of CBB, clarification of immunoblots on PVDF for transmission densitometry, gold coating of nonconductive membranes before MALDI tandem mass spectrometric analysis to prevent charging effect for analysis of peptides from PVDF membranes, and a simple method for coating native polysaccharides onto nitrocellulose are some of the methods involving either the manipulation of membranes with transferred proteins or just a passive transfer of antigens to membranes. All these methods are briefly reviewed in this chapter.

Laser-assisted focused He + ion beam induced etching with and without XeF 2 gas assist

DOE PAGES

Stanford, Michael G.; Mahady, Kyle; Lewis, Brett B.; ...

2016-10-04

Focused helium ion (He +) milling has been demonstrated as a high-resolution nanopatterning technique; however, it can be limited by its low sputter yield as well as the introduction of undesired subsurface damage. Here, we introduce pulsed laser- and gas-assisted processes to enhance the material removal rate and patterning fidelity. A pulsed laser-assisted He+ milling process is shown to enable high-resolution milling of titanium while reducing subsurface damage in situ. Gas-assisted focused ion beam induced etching (FIBIE) of Ti is also demonstrated in which the XeF 2 precursor provides a chemical assist for enhanced material removal rate. In conclusion, amore » pulsed laser-assisted and gas-assisted FIBIE process is shown to increase the etch yield by ~9× relative to the pure He+ sputtering process. These He + induced nanopatterning techniques improve material removal rate, in comparison to standard He + sputtering, while simultaneously decreasing subsurface damage, thus extending the applicability of the He + probe as a nanopattering tool.« less

Laser-assisted focused He + ion beam induced etching with and without XeF 2 gas assist

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stanford, Michael G.; Mahady, Kyle; Lewis, Brett B.

Focused helium ion (He +) milling has been demonstrated as a high-resolution nanopatterning technique; however, it can be limited by its low sputter yield as well as the introduction of undesired subsurface damage. Here, we introduce pulsed laser- and gas-assisted processes to enhance the material removal rate and patterning fidelity. A pulsed laser-assisted He+ milling process is shown to enable high-resolution milling of titanium while reducing subsurface damage in situ. Gas-assisted focused ion beam induced etching (FIBIE) of Ti is also demonstrated in which the XeF 2 precursor provides a chemical assist for enhanced material removal rate. In conclusion, amore » pulsed laser-assisted and gas-assisted FIBIE process is shown to increase the etch yield by ~9× relative to the pure He+ sputtering process. These He + induced nanopatterning techniques improve material removal rate, in comparison to standard He + sputtering, while simultaneously decreasing subsurface damage, thus extending the applicability of the He + probe as a nanopattering tool.« less

Irradiation control parameters for computer-assisted laser photocoagulation of the retina

NASA Astrophysics Data System (ADS)

Naess, Espen; Molvik, Torstein; Barrett, Steven F.; Wright, Cameron H. G.; de Graaf, Peter W.

2001-06-01

A system for robotically assisted retinal surgery has been developed to rapidly and safely place lesions on the retina for photocoagulation therapy. This system provides real- time, motion stabilized lesion placement for typical irradiation times of 100 ms. The system consists of three main subsystems: a global, digital-based tracking subsystem; a fast, local analog tracking subsystem; and a confocal reflectance subsystem to control lesion parameters dynamically. We have reported on these subsystems in previous SPIE presentations. This paper concentrates on the development of the second hybrid system prototype. Considerable progress has been made toward reducing the footprint of the optical system, simplifying the user interface, fully characterizing the analog tracking system and using measurable lesion reflectance growth parameters to develop a noninvasive method to infer lesion depth. This method will allow dynamic control of laser dosimetry to provide similar lesions across the non-uniform retinal surface. These system improvements and progress toward a clinically significant system are covered in detail within this paper.

Quantitative data standardization of X-ray based densitometry methods

NASA Astrophysics Data System (ADS)

Sergunova, K. A.; Petraikin, A. V.; Petrjajkin, F. A.; Akhmad, K. S.; Semenov, D. S.; Potrakhov, N. N.

2018-02-01

In the present work is proposed the design of special liquid phantom for assessing the accuracy of quantitative densitometric data. Also are represented the dependencies between the measured bone mineral density values and the given values for different X-ray based densitometry techniques. Shown linear graphs make it possible to introduce correction factors to increase the accuracy of BMD measurement by QCT, DXA and DECT methods, and to use them for standardization and comparison of measurements.

Advanced imaging of the macrostructure and microstructure of bone

NASA Technical Reports Server (NTRS)

Genant, H. K.; Gordon, C.; Jiang, Y.; Link, T. M.; Hans, D.; Majumdar, S.; Lang, T. F.

2000-01-01

Noninvasive and/or nondestructive techniques are capable of providing more macro- or microstructural information about bone than standard bone densitometry. Although the latter provides important information about osteoporotic fracture risk, numerous studies indicate that bone strength is only partially explained by bone mineral density. Quantitative assessment of macro- and microstructural features may improve our ability to estimate bone strength. The methods available for quantitatively assessing macrostructure include (besides conventional radiographs) quantitative computed tomography (QCT) and volumetric quantitative computed tomography (vQCT). Methods for assessing microstructure of trabecular bone noninvasively and/or nondestructively include high-resolution computed tomography (hrCT), micro-computed tomography (muCT), high-resolution magnetic resonance (hrMR), and micromagnetic resonance (muMR). vQCT, hrCT and hrMR are generally applicable in vivo; muCT and muMR are principally applicable in vitro. Although considerable progress has been made in the noninvasive and/or nondestructive imaging of the macro- and microstructure of bone, considerable challenges and dilemmas remain. From a technical perspective, the balance between spatial resolution versus sampling size, or between signal-to-noise versus radiation dose or acquisition time, needs further consideration, as do the trade-offs between the complexity and expense of equipment and the availability and accessibility of the methods. The relative merits of in vitro imaging and its ultrahigh resolution but invasiveness versus those of in vivo imaging and its modest resolution but noninvasiveness also deserve careful attention. From a clinical perspective, the challenges for bone imaging include balancing the relative advantages of simple bone densitometry against the more complex architectural features of bone or, similarly, the deeper research requirements against the broader clinical needs. The considerable potential biological differences between the peripheral appendicular skeleton and the central axial skeleton have to be addressed further. Finally, the relative merits of these sophisticated imaging techniques have to be weighed with respect to their applications as diagnostic procedures requiring high accuracy or reliability on one hand and their monitoring applications requiring high precision or reproducibility on the other. Copyright 2000 S. Karger AG, Basel.

Convergence of anatomy, technology, and therapeutics: a review of laser-assisted drug delivers.

PubMed

Brauer, Jeremy A; Krakowski, Andrew C; Bloom, Bradley S; Nguyen, Tuyet A; Geronemus, Roy G

2014-12-01

This is a very exciting time in cutaneous laser surgery with an ever-expanding therapeutic armamentarium and an increased sophistication of available technology. These recent trends have allowed for both a rapid development of interest and exploration of laser-assisted drug delivery and its potential applications. We review the current literature on anatomy, technology, and therapeutics as it relates to laser-assisted drug delivery. The focus of our review is on two areas of interest that have received much attention to date - photodynamic therapy in the treatment of actinic keratoses and nonmelanoma skin cancers as well as the treatment of scarring. We will also discuss potential complications of existing modalities used independently and in laser-assisted drug delivery and conclude with future indications for this burgeoning therapeutic methodology.

Direct-to-digital holography and holovision

DOEpatents

Thomas, Clarence E.; Baylor, Larry R.; Hanson, Gregory R.; Rasmussen, David A.; Voelkl, Edgar; Castracane, James; Simkulet, Michelle; Clow, Lawrence

2000-01-01

Systems and methods for direct-to-digital holography are described. An apparatus includes a laser; a beamsplitter optically coupled to the laser; a reference beam mirror optically coupled to the beamsplitter; an object optically coupled to the beamsplitter, a focusing lens optically coupled to both the reference beam mirror and the object; and a digital recorder optically coupled to the focusing lens. A reference beam is incident upon the reference beam mirror at a non-normal angle, and the reference beam and an object beam are focused by the focusing lens at a focal plane of the digital recorder to form an image. The systems and methods provide advantages in that computer assisted holographic measurements can be made.

Virtual mask digital electron beam lithography

DOEpatents

Baylor, L.R.; Thomas, C.E.; Voelkl, E.; Moore, J.A.; Simpson, M.L.; Paulus, M.J.

1999-04-06

Systems and methods for direct-to-digital holography are described. An apparatus includes a laser; a beamsplitter optically coupled to the laser; a reference beam mirror optically coupled to the beamsplitter; an object optically coupled to the beamsplitter, a focusing lens optically coupled to both the reference beam mirror and the object; and a digital recorder optically coupled to the focusing lens. A reference beam is incident upon the reference beam mirror at a non-normal angle, and the reference beam and an object beam are focused by the focusing lens at a focal plane of the digital recorder to form an image. The systems and methods provide advantages in that computer assisted holographic measurements can be made. 5 figs.

Virtual mask digital electron beam lithography

DOEpatents

Baylor, Larry R.; Thomas, Clarence E.; Voelkl, Edgar; Moore, James A.; Simpson, Michael L.; Paulus, Michael J.

1999-01-01

Systems and methods for direct-to-digital holography are described. An apparatus includes a laser; a beamsplitter optically coupled to the laser; a reference beam mirror optically coupled to the beamsplitter; an object optically coupled to the beamsplitter, a focusing lens optically coupled to both the reference beam mirror and the object; and a digital recorder optically coupled to the focusing lens. A reference beam is incident upon the reference beam mirror at a non-normal angle, and the reference beam and an object beam are focused by the focusing lens at a focal plane of the digital recorder to form an image. The systems and methods provide advantages in that computer assisted holographic measurements can be made.

Transcanalicular laser-assisted dacryocystorhinostomy.

PubMed

Rosen, N; Barak, A; Rosner, M

1997-09-01

Current techniques of laser-assisted dacryocystorhinostomy are mostly endonasal. In this report, the authors describe their technique of laser-assisted dacryocystorhinostomy performed through the canaliculi and the surgical results they achieved. Fourteen patients with nasolacrimal duct obstruction underwent transcanalicular laser-assisted dacryocystorhinostomy. The bony ostium was perforated using a fiber optic-transmitting, giant-pulse Nd:YAG laser, with an energy of 0.5 to 4 J per pulse. The total energy used to create an ostium was 18 to 34 J. A silicone tube was inserted through the canaliculi and the ostium into the nasal cavity and kept in place for 5 to 7 months. Patients were observed for 18 to 22 months. Nine of the 14 patients (64%) reported the disappearance of epiphora following surgery. In 3 patients, no relief of epiphora was obtained. In 1 patient the operation was not completed because of severe nasal bleeding. In another, tearing began 12 months after surgery (6 months after tube removal). Transcanalicular laser-assisted dacryocystorhinostomy is a potentially useful method for performing dacryocystorhinostomy. Technical modifications and improvements are needed to increase the success rate.

The effectiveness and safety of combining laser-assisted liposuction and abdominoplasty.

PubMed

Aboelatta, Yasser Abdallah; Abdelaal, Mohammed Mahmoud; Bersy, Nada Abdelsatar

2014-02-01

Lipoabdominoplasty is nearly a daily aesthetic procedure. Despite the emergence of laser-assisted liposuction, to date, it has not been clearly evaluated combined with abdominoplasty. This prospective study aimed to evaluate the effectiveness and safety of laser-assisted liposuction relative to traditional liposuction combined with high-lateral-tension abdominoplasty. This study investigated 36 consecutive female patients who underwent high-lateral-tension abdominoplasty combined with liposuction of the upper central abdomen and both flanks. The patients were divided into three equal groups based on the technique used for liposuction. Group 1 underwent conventional liposuction with abdominoplasty. Group 2 underwent a mixture of conventional and laser-assisted liposuction with abdominoplasty. Group 3 underwent laser-assisted liposuction with abdominoplasty. The patients in groups 2 and 3 had a better aesthetic outcome than those in group 1 with regard to abdominal contour and skin tightness. No major complications were observed in groups 1 and 2. The patients in group 3 had a higher incidence of complications (3 seromas, 3 central necroses and dehiscence), and one patient underwent secondary sutures. Laser-assisted liposuction combined with abdominoplasty in the lateral abdomen seems to be a safe technique with good aesthetic outcomes. Although the combined use of laser-assisted liposuction in the lateral and central abdomen can achieve relatively better aesthetic results, it is associated with significant complications, and its use cannot be supported. Proper laser parameters in the central abdominal area still need further study. This journal requires that authors assign a level of evidence to each article. For a full description of these Evidence-Based Medicine ratings, please refer to the Table of Contents or the online Instructions to Authors www.springer.com/00266 .

Laser-modified Coulomb scattering states of an electron in the parabolic quasi-Sturmian-Floquet approach

NASA Astrophysics Data System (ADS)

Zaytsev, A. S.; Zaytsev, S. A.; Ancarani, L. U.; Kouzakov, K. A.

2018-04-01

Electron scattering states in combined Coulomb and laser fields are investigated with a nonperturbative approach based on the Hermitian Floquet theory. Taking into account the Coulomb-specific asymptotic behavior of the electron wave functions at large distances, a Lippmann-Schwinger-Floquet equation is derived in the Kramers-Henneberger frame. Such a scattering-state equation is solved numerically employing a set of parabolic quasi-Sturmian functions which have the great advantage of possessing, by construction, adequately chosen incoming or outgoing Coulomb asymptotic behaviors. Our quasi-Sturmian-Floquet approach is tested with a calculation of triple differential cross sections for a laser-assisted (e ,2 e ) process on atomic hydrogen within a first-order Born treatment of the projectile-atom interaction. Convergence with respect to the number of Floquet-Fourier expansion terms is numerically demonstrated. The illustration shows that the developed method is very efficient for the computation of light-dressed states of an electron moving in a Coulomb potential in the presence of laser radiation.

Investigation of the formation mechanism and morphology of the features created in the interior of cornea by femtosecond laser pulses

NASA Astrophysics Data System (ADS)

Guo, Yizang; Vukelic, Sinisa

2015-03-01

Laser assisted corneal surgeries often rely on the nonlinear absorption effect of ultrafast lasers to induce features in the interior of the cornea without affecting the surface. In particular, corneal flap formation in femtosecond assisted Laser- Assisted in situ Keratomileusis (LASIK) is based on the bubble creation. This study focuses on the interaction between the tissue and the femtosecond laser. Interior of cornea is treated with tightly focused femtosecond laser pulses. Due to the nature of the process, heating of the tissue within and around the focal volume is practically instantaneous. The affected region is subject to thermoelastic stress that arises with the steep temperature elevation. To predict the size of the region subject to the morphological changes due to the laser treatment, the temperature field is calculated. Cavitation bubble initiation and expansion process, which acts as precursor to the stress induced tissue trauma, is studied as well. Theoretical findings are compared against experimental results. High-speed camera is utilized to assess the laser treatment process, showing the temporal development of the cavitation bubbles. The results obtained in this study facilitate a better understanding of the effects of femtosecond laser assisted corneal surgeries and help in choosing optimal laser parameters.

A study comparing three different laser-assisted hatching techniques.

PubMed

Ma, B; Wang, Y; Zhang, H; Zhang, X

2014-01-01

Laser-assisted hatching (LAH) is recognized as a useful technology to improve clinical pregnancy rates and implantation rates. This study reports the differences between a new LAH method and two conventional LAH techniques. The authors studied 151 patients with repeated implantation failure, who were divided into three groups. In group 1, the zona pellucida (ZP) was opened using LAH (n = 52). In group 2, laser-assisted thinning was performed to dissolve the outer layer of the ZP (n = 49). In group 3, laser-assisted thinning was performed to dissolve the inner layer of the ZP (n = 50). The clinical pregnancy rates and implantation rates among the groups were compared. The results demonstrate that there are significant differences in the clinical pregnancy rates and implantation rates between group 3 and the other two groups. Performing laser-assisted thinning to dissolve the inner layer of the ZP markedly increases the pregnancy rates and implantation rates of patients with repeated implantation failure.

Design of catalytic monoliths for closed-cycle carbon dioxide lasers

NASA Technical Reports Server (NTRS)

Herz, R. K.; Guinn, K.; Goldblum, S.; Noskowski, E.

1989-01-01

Pulsed carbon dioxide (CO2) lasers have many applications in aeronautics, space research, weather monitoring and other areas. Full exploitation of the potential of these lasers in hampered by the dissociation of CO2 that occurs during laser operation. The development of closed-cycle CO2 lasers requires active CO-O2 recombination (CO oxidation) catalyst and design methods for implementation of catalysts in CO2 laser systems. A monolith catalyst section model and associated design computer program, LASCAT, are presented to assist in the design of a monolith catalyst section of a closed cycle CO2 laser system. Using LASCAT,the designer is able to specify a number of system parameters and determine the monolith section performance. Trade-offs between the catalyst activity, catalyst dimensions, monolith dimensions, pressure drop, O2 conversion, and other variables can be explored and adjusted to meet system design specifications. An introduction describes a typical closed-cycle CO2 system, and indicates some advantages of a closed cycle laser system over an open cycle system and some advantages of monolith support over other types of supports. The development and use of a monolith catalyst model is presented. The results of a design study and a discussion of general design rules are given.

A comparative study of internal laser-assisted and conventional liposuction: a look at the influence of drugs and major surgery on laboratory postoperative values

PubMed Central

Przylipiak, Andrzej Feliks; Galicka, Elżbieta; Donejko, Magdalena; Niczyporuk, Marek; Przylipiak, Jerzy

2013-01-01

Background Liposuction is a type of aesthetic surgery that has been performed on humans for decades. There is not much literature addressing the subject matter of pre- and post-surgery blood parameters, although this information is rather interesting. Documentation on patients who received laser-assisted liposuction treatment is particularly scarce. Until now, there has been no literature showing values of platelets, lymphocytes, and neutrophils after liposuction. Purpose The aim of the work is to analyze and interpret values of platelets, lymphocytes and neutrophils in patient blood before and after liposuction, a surgery in which an extraordinarily large amount of potent drugs are used. Moreover, the aim is to compare values changes in patients of conventional and laser-assisted liposuction. Material and methods We evaluated standard blood samples in patients prior to and after liposuction. This paper covers the number of platelets, lymphocytes, and neutrophils. A total of 54 patients were examined. Moreover, we compared the change in postoperative values in laser-assisted liposuction patients with the change of values in conventional liposuction patients. A paired two-sided Student’s t-test was used for statistical evaluation. P < 0.005 was acknowledged to be statistically significant. Results Values of platelets were raised both in conventional and in laser-assisted liposuction patients, but this difference was statistically non-significant and levels of platelets were still normal and within the range of blood levels in healthy patients. Values of neutrophils rose by up to 79.49% ± 7.74% standard deviation (SD) and values of lymphocytes dropped by up to 12.68% ± 5.61% SD. The before/after variances of conventional tumescent local anesthesia liposuction and variations in laser-assisted liposuction were similar for all measured parameters; they also showed no statistically significant differences between before and after surgery. The mean value of total operation time without laser-assistance was 3 hours 42 minutes (±57 minutes SD, range 2 hours 50 minutes to 5 hours 10 minutes). Surgeries with laser-assistance were on average 16 minutes shorter with a mean duration of 3 hours 26 minutes (±45 minutes SD, range 2 hours 40 minutes to 4 hours 10 minutes). The difference was not statistically significant (P < 0.06). The mean value of aspirate volume for liposuctions performed without laser support was 2,618 mL (±633.7 SD, range 700 mL to 3,500 mL). Mean aspirate volume for liposuctions with laser assistance was increased by up to 61 mL (2,677 mL ± 499.5 SD, range 1,800 mL to 3,500 mL). The difference was not statistically significant (P < 0.71). Conclusion We conclude that conventional liposuction and laser-assisted liposuction have a similar influence on platelets, lymphocytes, and neutrophils in patients. Moreover, laser-assisted liposuction seems to be less time consuming than conventional liposuction. PMID:24143076

A comparative study of internal laser-assisted and conventional liposuction: a look at the influence of drugs and major surgery on laboratory postoperative values.

PubMed

Przylipiak, Andrzej Feliks; Galicka, Elżbieta; Donejko, Magdalena; Niczyporuk, Marek; Przylipiak, Jerzy

2013-01-01

Liposuction is a type of aesthetic surgery that has been performed on humans for decades. There is not much literature addressing the subject matter of pre- and post-surgery blood parameters, although this information is rather interesting. Documentation on patients who received laser-assisted liposuction treatment is particularly scarce. Until now, there has been no literature showing values of platelets, lymphocytes, and neutrophils after liposuction. The aim of the work is to analyze and interpret values of platelets, lymphocytes and neutrophils in patient blood before and after liposuction, a surgery in which an extraordinarily large amount of potent drugs are used. Moreover, the aim is to compare values changes in patients of conventional and laser-assisted liposuction. We evaluated standard blood samples in patients prior to and after liposuction. This paper covers the number of platelets, lymphocytes, and neutrophils. A total of 54 patients were examined. Moreover, we compared the change in postoperative values in laser-assisted liposuction patients with the change of values in conventional liposuction patients. A paired two-sided Student's t-test was used for statistical evaluation. P < 0.005 was acknowledged to be statistically significant. Values of platelets were raised both in conventional and in laser-assisted liposuction patients, but this difference was statistically non-significant and levels of platelets were still normal and within the range of blood levels in healthy patients. Values of neutrophils rose by up to 79.49% ± 7.74% standard deviation (SD) and values of lymphocytes dropped by up to 12.68% ± 5.61% SD. The before/after variances of conventional tumescent local anesthesia liposuction and variations in laser-assisted liposuction were similar for all measured parameters; they also showed no statistically significant differences between before and after surgery. The mean value of total operation time without laser-assistance was 3 hours 42 minutes (± 57 minutes SD, range 2 hours 50 minutes to 5 hours 10 minutes). Surgeries with laser-assistance were on average 16 minutes shorter with a mean duration of 3 hours 26 minutes (± 45 minutes SD, range 2 hours 40 minutes to 4 hours 10 minutes). The difference was not statistically significant (P < 0.06). The mean value of aspirate volume for liposuctions performed without laser support was 2,618 mL (± 633.7 SD, range 700 mL to 3,500 mL). Mean aspirate volume for liposuctions with laser assistance was increased by up to 61 mL (2,677 mL ± 499.5 SD, range 1,800 mL to 3,500 mL). The difference was not statistically significant (P < 0.71). We conclude that conventional liposuction and laser-assisted liposuction have a similar influence on platelets, lymphocytes, and neutrophils in patients. Moreover, laser-assisted liposuction seems to be less time consuming than conventional liposuction.

Prospective study on laser-assisted laparascopic partial nephrectomy

NASA Astrophysics Data System (ADS)

Sroka, Ronald; Hennig, Georg; Zilinberg, Katja; Khoder, Wael Y.

2012-02-01

Introduction: Developments in laparoscopic partial nephrectomy (LPN) opened a demand for surgical tools compatible with laparoscopic manipulations to make laser assisted technique safe, feasible and reproducible. Warm ischemia and bleeding during laparoscopic partial nephrectomy place technical constraints on surgeons. Therefore it was the aim to develop a safe and effective laser assisted partial nephrectomy technique without need for ischemia. Patients and methods: A diode laser emitting light at 1318nm in cw mode was coupled into a bare fibre (core diameter 600 μm) thus able to transfer up to 100W to the tissue. After dry lab experience, a total of 10 patients suffering from kidney malformations underwent laparoscopic/retroperitoneoscopic partial nephrectomy. Clinically, postoperative renal function and serum c-reactive protein (CRP) were monitored. Laser induced coagulation depth and effects on resection margins were evaluated. Demographic, clinical and follow-up data are presented. Using a commercial available fibre guidance instrument for lanringeal intervention, the demands on an innovative laser fibre guidance instrument for the laser assisted laparoscopic partial nephrectomy (LLPN) are summarized. Results: Overall, all laparascopic intervention were succesfull and could be performed without conversion to open surgery. Mean operative time and mean blood loss were comparable to conventional open and laparascopic approaches. Laser assisted resection of the kidney tissue took max 15min. After extirpation of the tumours all patients showed clinical favourable outcome during follow up period. Tumour sizes were measured to be up 5cm in diameter. The depth of the coagulation on the removed tissue ranged between <1 to 2mm without effect on histopathological evaluation of tumours or resection margin. As the surface of the remaining kidney surface was laser assisted coagulated after removal. The sealing of the surface was induced by a slightly larger coagulation margin, but could not measured so far. Based on this experiences a simple and easy to use instrument described serving also for suction and rinsing. Conclusion: This prospective in-vivo feasibility study shows that laser assisted partial nephrectomy seems to be a safe and promising medical technique which could be provided either during open surgery as well as laparascopically. This application showed good haemostasis and minimal parenchymal damage. Further investigations and development are needed for on-line detection of the remain coagulation margin. An optimised treatment equipment will support the applicability of laser assisted laparoscopic partial nephrectomy.

Laser assisted deposition

NASA Technical Reports Server (NTRS)

Dutta, S.

1983-01-01

Applications of laser-based processing techniques to solar cell metallization are discussed. Laser-assisted thermal or photolytic maskless deposition from organometallic vapors or solutions may provide a viable alternative to photovoltaic metallization systems currently in use. High power, defocused excimer lasers may be used in conjunction with masks as an alternative to direct laser writing to provide higher throughput. Repeated pulsing with excimer lasers may eliminate the need for secondary plating techniques for metal film buildup. A comparison between the thermal and photochemical deposition processes is made.

Surface texture and hardness of dental alloys processed by alternative technologies

NASA Astrophysics Data System (ADS)

Porojan, Liliana; Savencu, Cristina E.; Topală, Florin I.; Porojan, Sorin D.

2017-08-01

Technological developments have led to the implementation of novel digitalized manufacturing methods for the production of metallic structures in prosthetic dentistry. These technologies can be classified as based on subtractive manufacturing, assisted by computer-aided design/computer-aided manufacturing (CAD/CAM) systems, or on additive manufacturing (AM), such as the recently developed laser-based methods. The aim of the study was to assess the surface texture and hardness of metallic structures for dental restorations obtained by alternative technologies: conventional casting (CST), computerized milling (MIL), AM power bed fusion methods, respective selective laser melting (SLM) and selective laser sintering (SLS). For the experimental analyses metallic specimens made of Co-Cr dental alloys were prepared as indicated by the manufacturers. The specimen structure at the macro level was observed by an optical microscope and micro-hardness was measured in all substrates. Metallic frameworks obtained by AM are characterized by increased hardness, depending also on the surface processing. The formation of microstructural defects can be better controlled and avoided during SLM and MIL process. Application of power bed fusion techniques, like SLS and SLM, is currently a challenge in dental alloys processing.

A Preliminary Report on the CO2 Laser for Lumbar Fusion: Safety, Efficacy and Technical Considerations.

PubMed

Villavicencio, Alan T; Burneikiene, Sigita; Babuska, Jason M; Nelson, Ewell L; Mason, Alexander; Rajpal, Sharad

2015-04-01

The purpose of this study was to evaluate potential technical advantages of the CO2 laser technology in mini-open transforaminal lumbar interbody fusion (TLIF) surgeries and report our preliminary clinical data on the safety and clinical outcomes. There is currently no literature discussing the recently redeveloped CO2 laser technology application for lumbar fusion. Safety and clinical outcomes were compared between two groups: 24 patients that underwent CO2 laser-assisted one-level TLIF surgeries and 30 patients that underwent standard one-level TLIF surgeries without the laser. There were no neural thermal injuries or other intraoperative laser-related complications encountered in this cohort of patients. At a mean follow-up of 17.4 months, significantly reduced lower back pain scores (P=0.013) were reported in the laser-assisted patient group compared to a standard fusion patient group. Lower extremity radicular pain intensity scores were similar in both groups. Laser-assisted TLIF surgeries showed a tendency (P = 0.07) of shorter operative times that was not statistically significant. Based on this preliminary clinical report, the safety of the CO2 laser device for lumbar fusion surgeries was assessed. There were no neural thermal injuries or other intraoperative laser-related complications encountered in this cohort of patients. Further investigation of CO2 laser-assisted lumbar fusion procedures is warranted in order to evaluate its effect on clinical outcomes.

Simulations of Laboratory Astrophysics Experiments using the CRASH code

NASA Astrophysics Data System (ADS)

Trantham, Matthew; Kuranz, Carolyn; Manuel, Mario; Keiter, Paul; Drake, R. P.

2014-10-01

Computer simulations can assist in the design and analysis of laboratory astrophysics experiments. The Center for Radiative Shock Hydrodynamics (CRASH) at the University of Michigan developed a code that has been used to design and analyze high-energy-density experiments on OMEGA, NIF, and other large laser facilities. This Eulerian code uses block-adaptive mesh refinement (AMR) with implicit multigroup radiation transport, electron heat conduction and laser ray tracing. This poster/talk will demonstrate some of the experiments the CRASH code has helped design or analyze including: Kelvin-Helmholtz, Rayleigh-Taylor, imploding bubbles, and interacting jet experiments. This work is funded by the Predictive Sciences Academic Alliances Program in NNSA-ASC via Grant DEFC52-08NA28616, by the NNSA-DS and SC-OFES Joint Program in High-Energy-Density Laboratory Plasmas, Grant Number DE-NA0001840, and by the National Laser User Facility Program, Grant Number DE-NA0000850.

Video-assisted thoracoscopic surgery for pulmonary nodules after computed tomography-guided marking with a spiral wire.

PubMed

Eichfeld, Uwe; Dietrich, Arne; Ott, Rudolph; Kloeppel, Rainer

2005-01-01

Peripheral pulmonary nodules are preferably removed by minimally invasive techniques, such as video-assisted thoracoscopic (VATS) surgery. These nodules should be marked preoperatively for better intraoperative detection and removal. Twenty-two cases with a single pulmonary nodule requiring surgical removal for histologic examination were included in a prospective study. Guided by computed tomography, nodules were marked preoperatively using a laser marker system and fixed with a spiral wire. The marked nodules were removed by VATS surgery immediately after the marking. The marking wire was placed in all 22 patients without any complications. The marked nodule was completely removed by VATS surgery in 19 patients. Conversion to thoracotomy was necessary in 3 patients, twice because of thoracoscopy-related problems and once because of a marking failure. The average times for the marking procedure and operation were 24 minutes and 32 minutes, respectively. This new method of computed tomography-guided nodule marking with a spiral wire and subsequent VATS surgery is very efficient in terms of localization and stable fixation of subpleural pulmonary nodules.

A Medical Manipulator System with Lasers in Photodynamic Therapy of Port Wine Stains

PubMed Central

Wang, Xingtao; Tian, Chunlai; Duan, Xingguang; Gu, Ying; Huang, Naiyan

2014-01-01

Port wine stains (PWS) are a congenital malformation and dilation of the superficial dermal capillary. Photodynamic therapy (PDT) with lasers is an effective treatment of PWS with good results. However, because the laser density is uneven and nonuniform, the treatment is carried out manually by a doctor thus providing little accuracy. Additionally, since the treatment of a single lesion can take between 30 and 60 minutes, the doctor can become fatigued after only a few applications. To assist the medical staff with this treatment method, a medical manipulator system (MMS) was built to operate the lasers. The manipulator holds the laser fiber and, using a combination of active and passive joints, the fiber can be operated automatically. In addition to the control input from the doctor over a human-computer interface, information from a binocular vision system is used to guide and supervise the operation. Clinical results are compared in nonparametric values between treatments with and without the use of the MMS. The MMS, which can significantly reduce the workload of doctors and improve the uniformity of laser irradiation, was safely and helpfully applied in PDT treatment of PWS with good therapeutic results. PMID:25302297

Pulsed excimer laser processing for cost-effective solar cells

NASA Technical Reports Server (NTRS)

Wong, David C.

1985-01-01

The application of excimer laser in the fabrication of photovoltaic devices was investigated extensively. Processes included junction formation, laser assisted chemical vapor deposition metallization, and laser assisted chemical vapor deposition surface passivation. Results demonstrated that implementation of junction formation by laser annealing in production is feasible because of excellent control in junction depth and quality. Both metallization and surface passivation, however, were found impractical to be considered for manufacturing at this stage.

The study on force, surface integrity, tool life and chip on laser assisted machining of inconel 718 using Nd:YAG laser source.

PubMed

Venkatesan, K

2017-07-01

Inconel 718, a high-temperature alloy, is a promising material for high-performance aerospace gas turbine engines components. However, the machining of the alloy is difficult owing to immense shear strength, rapid work hardening rate during turning, and less thermal conductivity. Hence, like ceramics and composites, the machining of this alloy is considered as difficult-to-turn materials. Laser assisted turning method has become a promising solution in recent years to lessen cutting stress when materials that are considered difficult-to-turn, such as Inconel 718 is employed. This study investigated the influence of input variables of laser assisted machining on the machinability aspect of the Inconel 718. The comparison of machining characteristics has been carried out to analyze the process benefits with the variation of laser machining variables. The laser assisted machining variables are cutting speeds of 60-150 m/min, feed rates of 0.05-0.125 mm/rev with a laser power between 1200 W and 1300 W. The various output characteristics such as force, roughness, tool life and geometrical characteristic of chip are investigated and compared with conventional machining without application of laser power. From experimental results, at a laser power of 1200 W, laser assisted turning outperforms conventional machining by 2.10 times lessening in cutting force, 46% reduction in surface roughness as well as 66% improvement in tool life when compared that of conventional machining. Compared to conventional machining, with the application of laser, the cutting speed of carbide tool has increased to a cutting condition of 150 m/min, 0.125 mm/rev. Microstructural analysis shows that no damage of the subsurface of the workpiece.

CO2-laser-assisted processing of glass fiber-reinforced thermoplastic composites

NASA Astrophysics Data System (ADS)

Brecher, Christian; Emonts, Michael; Schares, Richard Ludwig; Stimpfl, Joffrey

2013-02-01

To fully exploit the potential of fiber-reinforced thermoplastic composites (FRTC) and to achieve a broad industrial application, automated manufacturing systems are crucial. Investigations at Fraunhofer IPT have proven that the use of laser system technology in processing FRTC allows to achieve high throughput, quality, flexibility, reproducibility and out-of-autoclave processing simultaneously. As 90% of the FRP in Europe1 are glass fiber-reinforced a high impact can be achieved by introducing laser-assisted processing with all its benefits to glass fiber-reinforced thermoplastics (GFRTC). Fraunhofer IPT has developed the diode laser-assisted tape placement (laying and winding) to process carbon fiber-reinforced thermoplastic composites (CFRTC) for years. However, this technology cannot be transferred unchanged to process milky transparent GFRTC prepregs (preimpregnated fibers). Due to the short wavelength (approx. 980 nm) and therefore high transmission less than 20% of the diode laser energy is absorbed as heat into non-colored GFRTC prepregs. Hence, the use of a different wave length, e.g. CO2-laser (10.6 μm) with more than 90% laser absorption, is required to allow the full potential of laser-assisted processing of GFRTC. Also the absorption of CO2-laser radiation at the surface compared to volume absorption of diode laser radiation is beneficial for the interlaminar joining of GFRTC. Fraunhofer IPT is currently developing and investigating the CO2-laser-assisted tape placement including new system, beam guiding, process and monitoring technology to enable a resource and energy efficient mass production of GFRP composites, e.g. pipes, tanks, masts. The successful processing of non-colored glass fiber-reinforced Polypropylene (PP) and Polyphenylene Sulfide (PPS) has already been proven.

A new concept in laser-assisted chemistry - The electronic-field representation

NASA Technical Reports Server (NTRS)

George, T. F.; Zimmerman, I. H.; Yuan, J.-M.; Laing, J. R.; Devries, P. L.

1977-01-01

Electronic-field representation is proposed as a technique for laser-assisted chemistry. Specifically, it is shown that several field-assisted chemical processes can be described in terms of mixed matter-field quantum states and their associated energies. The technique may be used to analyze the effects exerted by an intense laser on both bound and unbound molecular systems, and to investigate other field-induced effects including multiphoton processes, emission, and photodissociation.

Joint Official Positions of the International Society for Clinical Densitometry and International Osteoporosis Foundation on FRAX(®). Executive Summary of the 2010 Position Development Conference on Interpretation and use of FRAX® in clinical practice.

PubMed

Hans, Didier B; Kanis, John A; Baim, Sanford; Bilezikian, John P; Binkley, Neil; Cauley, Jane A; Compston, Juliet E; Cooper, Cyrus; Dawson-Hughes, Bess; El-Hajj Fuleihan, Ghada; Leslie, William D; Lewiecki, E Michael; Luckey, Marjorie M; McCloskey, Eugene V; Papapoulos, Socrates E; Poiana, Catalina; Rizzoli, René

2011-01-01

The International Society for Clinical Densitometry (ISCD) and the International Osteoporosis Foundation (IOF) convened the FRAX(®) Position Development Conference (PDC) in Bucharest, Romania, on November 14, 2010, following a two-day joint meeting of the ISCD and IOF on the "Interpretation and Use of FRAX(®) in Clinical Practice." These three days of critical discussion and debate, led by a panel of international experts from the ISCD, IOF and dedicated task forces, have clarified a number of important issues pertaining to the interpretation and implementation of FRAX(®) in clinical practice. The Official Positions resulting from the PDC are intended to enhance the quality and clinical utility of fracture risk assessment worldwide. Since the field of skeletal assessment is still evolving rapidly, some clinically important issues addressed at the PDCs are not associated with robust medical evidence. Accordingly, some Official Positions are based largely on expert opinion. Despite limitations inherent in such a process, the ISCD and IOF believe it is important to provide clinicians and technologists with the best distillation of current knowledge in the discipline of bone densitometry and provide an important focus for the scientific community to consider. This report describes the methodology and results of the ISCD-IOF PDC dedicated to FRAX(®). Copyright © 2011 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Selective Destruction of Protein Function by Chromophore-Assisted Laser Inactivation

NASA Astrophysics Data System (ADS)

Jay, Daniel G.

1988-08-01

Chromophore-assisted laser inactivation of protein function has been achieved. After a protein binds a specific ligand or antibody conjugated with malachite green (C.I. 42000), it is selectively inactivated by laser irradiation at a wavelength of light absorbed by the dye but not significantly absorbed by cellular components. Ligand-bound proteins in solution and on the surfaces of cells can be denatured without other proteins in the same samples being affected. Chromophore-assisted laser inactivation can be used to study cell surface phenomena by inactivating the functions of single proteins on living cells, a molecular extension of cellular laser ablation. It has an advantage over genetics and the use of specific inhibitors in that the protein function of a single cell within the organism can be inactivated by focusing the laser beam.

Ar+ and CuBr laser-assisted chemical bleaching of teeth: estimation of whiteness degree

NASA Astrophysics Data System (ADS)

Dimitrov, S.; Todorovska, Roumyana; Gizbrecht, Alexander I.; Raychev, L.; Petrov, Lyubomir P.

2003-11-01

In this work the results of adaptation of impartial methods for color determination aimed at developing of techniques for estimation of human teeth whiteness degree, sufficiently handy for common use in clinical practice are presented. For approbation and by the way of illustration of the techniques, standards of teeth colors were used as well as model and naturally discolored human teeth treated by two bleaching chemical compositions activated by three light sources each: Ar+ and CuBr lasers, and a standard halogen photopolymerization lamp. Typical reflection and fluorescence spectra of some samples are presented; the samples colors were estimated by a standard computer processing in RGB and B coordinates. The results of the applied spectral and colorimetric techniques are in a good agreement with those of the standard computer processing of the corresponding digital photographs and complies with the visually estimated degree of the teeth whiteness judged according to the standard reference scale commonly used in the aesthetic dentistry.

Computational fluid dynamics assisted characterization of parafoveal hemodynamics in normal and diabetic eyes using adaptive optics scanning laser ophthalmoscopy.

PubMed

Lu, Yang; Bernabeu, Miguel O; Lammer, Jan; Cai, Charles C; Jones, Martin L; Franco, Claudio A; Aiello, Lloyd Paul; Sun, Jennifer K

2016-12-01

Diabetic retinopathy (DR) is the leading cause of visual loss in working-age adults worldwide. Previous studies have found hemodynamic changes in the diabetic eyes, which precede clinically evident pathological alterations of the retinal microvasculature. There is a pressing need for new methods to allow greater understanding of these early hemodynamic changes that occur in DR. In this study, we propose a noninvasive method for the assessment of hemodynamics around the fovea (a region of the eye of paramount importance for vision). The proposed methodology combines adaptive optics scanning laser ophthalmoscopy and computational fluid dynamics modeling. We compare results obtained with this technique with in vivo measurements of blood flow based on blood cell aggregation tracking. Our results suggest that parafoveal hemodynamics, such as capillary velocity, wall shear stress, and capillary perfusion pressure can be noninvasively and reliably characterized with this method in both healthy and diabetic retinopathy patients.

Computational fluid dynamics assisted characterization of parafoveal hemodynamics in normal and diabetic eyes using adaptive optics scanning laser ophthalmoscopy

PubMed Central

Lu, Yang; Bernabeu, Miguel O.; Lammer, Jan; Cai, Charles C.; Jones, Martin L.; Franco, Claudio A.; Aiello, Lloyd Paul; Sun, Jennifer K.

2016-01-01

Diabetic retinopathy (DR) is the leading cause of visual loss in working-age adults worldwide. Previous studies have found hemodynamic changes in the diabetic eyes, which precede clinically evident pathological alterations of the retinal microvasculature. There is a pressing need for new methods to allow greater understanding of these early hemodynamic changes that occur in DR. In this study, we propose a noninvasive method for the assessment of hemodynamics around the fovea (a region of the eye of paramount importance for vision). The proposed methodology combines adaptive optics scanning laser ophthalmoscopy and computational fluid dynamics modeling. We compare results obtained with this technique with in vivo measurements of blood flow based on blood cell aggregation tracking. Our results suggest that parafoveal hemodynamics, such as capillary velocity, wall shear stress, and capillary perfusion pressure can be noninvasively and reliably characterized with this method in both healthy and diabetic retinopathy patients. PMID:28078170

Standard guidelines of care: laser and IPL hair reduction.

PubMed

Buddhadev, Rajesh M

2008-01-01

Laser-assisted hair removal, Laser hair removal, Laser and light-assisted hair removal, Laser and light-assisted, long-term hair reduction, IPL photodepilation, LHE photodepilation; all these are acceptable synonyms. Laser (Ruby, Nd Yag, Alexandrite, Diode), intense pulse light, light and heat energy system are the different light-/Laser-based systems used for hair removal; each have its advantages and disadvantages. The word "LONG-TERM HAIR REDUCTION" should be used rather than permanent hair removal. Patient counseling is essential about the need for multiple sessions. PHYSICIANS' QUALIFICATIONS: Laser hair removal may be practiced by any dermatologist, who has received adequate background training during postgraduation or later at a centre that provides education and training in Lasers or in focused workshops providing such training. The dermatologist should have adequate knowledge of the machines, the parameters and aftercare. The physician may allow the actual procedure to be performed under his/her direct supervision by a trained nurse assistant/junior doctor. However, the final responsibility for the procedure would lie with the physician. The procedure may be performed in the physician's minor procedure room. Investigations to rule out any underlying cause for hair growth are important; concurrent drug therapy may be needed. Laser parameters vary with area, type of hair, and the machine used. Full knowledge about the machine and cooling system is important. Future maintenance treatments may be needed.

Laser and optical system for laser assisted hydrogen ion beam stripping at SNS

DOE PAGES

Liu, Y.; Rakhman, A.; Menshov, A.; ...

2016-12-01

A high-efficiency laser assisted hydrogen ion (H-) beam stripping was recently successfully carried out in the Spallation Neutron Source (SNS) accelerator. The experiment was not only an important step toward foil-less H- stripping for charge exchange injection, it also set up a first example of using megawatt ultraviolet (UV) laser source in an operational high power proton accelerator facility. This study reports in detail the design, installation, and commissioning result of a macro-pulsed multi-megawatt UV laser system and laser beam transport line for the laser stripping experiment.

Laser and optical system for laser assisted hydrogen ion beam stripping at SNS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Y.; Rakhman, A.; Menshov, A.

A high-efficiency laser assisted hydrogen ion (H-) beam stripping was recently successfully carried out in the Spallation Neutron Source (SNS) accelerator. The experiment was not only an important step toward foil-less H- stripping for charge exchange injection, it also set up a first example of using megawatt ultraviolet (UV) laser source in an operational high power proton accelerator facility. This study reports in detail the design, installation, and commissioning result of a macro-pulsed multi-megawatt UV laser system and laser beam transport line for the laser stripping experiment.

Endobronchial Forceps-Assisted and Excimer Laser-Assisted Inferior Vena Cava Filter Removal: The Data, Where We Are, and How It Is Done.

PubMed

Chen, James X; Montgomery, Jennifer; McLennan, Gordon; Stavropoulos, S William

2018-06-01

The recognition of inferior vena cava filter related complications has motivated increased attentiveness in clinical follow-up of patients with inferior vena cava filters and has led to development of multiple approaches for retrieving filters that are challenging or impossible to remove using conventional techniques. Endobronchial forceps and excimer lasers are tools for designed to aid in complex inferior vena cava filter removals. This article discusses endobronchial forceps-assisted and excimer laser-assisted inferior vena cava filter retrievals. Copyright © 2018 Elsevier Inc. All rights reserved.

Iterations of computer- and template assisted mandibular or maxillary reconstruction with free flaps containing the lateral scapular border--Evolution of a biplanar plug-on cutting guide.

PubMed

Cornelius, Carl-Peter; Giessler, Goetz Andreas; Wilde, Frank; Metzger, Marc Christian; Mast, Gerson; Probst, Florian Andreas

2016-03-01

Computer-assisted planning and intraoperative implementation using templates have become appreciated modalities in craniofacial reconstruction with fibula and DCIA flaps due to saving in operation time, improved accuracy of osteotomies and easy insetting. Up to now, a similar development for flaps from the subscapular vascular system, namely the lateral scapular border and tip, has not been addressed in the literature. A cohort of 12 patients who underwent mandibular (n = 10) or maxillary (n = 2) reconstruction with free flaps containing the lateral scapular border and tip using computer-assisted planning, stereolithography (STL) models and selective laser sintered (SLS) templates for bone contouring and sub-segmentation osteotomies was reviewed focussing on iterations in the design of computer generated tools and templates. The technical evolution migrated from hybrid STL models over SLS templates for cut out as well as sub-segmentation with a uniplanar framework to plug-on tandem template assemblies providing a biplanar access for the in toto cut out from the posterior aspect in succession with contouring into sub-segments from the medial side. The latest design version is the proof of concept that virtual planning of bone flaps from the lateral scapular border can be successfully transferred into surgery by appropriate templates. Copyright © 2015 European Association for Cranio-Maxillo-Facial Surgery. Published by Elsevier Ltd. All rights reserved.

Computed Tomography-Assisted Thoracoscopic Surgery: A Novel, Innovative Approach in Patients With Deep Intrapulmonary Lesions of Unknown Malignant Status.

PubMed

Kostrzewa, Michael; Kara, Kerim; Rathmann, Nils; Tsagogiorgas, Charalambos; Henzler, Thomas; Schoenberg, Stefan O; Hohenberger, Peter; Diehl, Steffen J; Roessner, Eric D

2017-06-01

Minimally invasive resection of small, deep intrapulmonary lesions can be challenging due to the difficulty of localizing them during video-assisted thoracoscopic surgery (VATS). We report our preliminary results evaluating the feasibility of an image-guided, minimally invasive, 1-stop-shop approach for the resection of small, deep intrapulmonary lesions in a hybrid operating room (OR). Fifteen patients (5 men, 10 women; mean age, 63 years) with a total of 16 solitary, deep intrapulmonary nodules of unknown malignant status were identified for intraoperative wire marking. Patients were placed on the operating table for resection by VATS. A marking wire was placed within the lesion under 3D laser and fluoroscopic guidance using a cone beam computed tomography system. Then, wedge resection by VATS was performed in the same setting without repositioning the patient. Complete resection with adequate safety margins was confirmed for all lesions. Marking wire placement facilitated resection in 15 of 16 lesions. Eleven lesions proved to be malignant, either primary or secondary; 5 were benign. Mean lesion size was 7.7 mm; mean distance to the pleural surface was 15.1 mm (mean lesion depth-diameter ratio, 2.2). Mean procedural time for marking wire placement was 35 minutes; mean VATS duration was 36 minutes. Computed tomography-assisted thoracoscopic surgery is a new, safe, and effective procedure for minimally invasive resection of small, deeply localized intrapulmonary lesions. The benefits of computed tomography-assisted thoracoscopic surgery are 1. One-stop-shop procedure, 2. Lower risk for the patient (no patient relocation, no marking wire loss), and 3. No need to coordinate scheduling between the CT room and OR.

Micro-domain controlled anisotropic laser ceramics assisted by rare-earth trivalent

NASA Astrophysics Data System (ADS)

Sato, Yoichi; Akiyama, Jun; Taira, Takunori

2012-01-01

Principles that enable to synthesize anisotropic laser ceramics have been established. Anisotropic laser ceramics contain micro domains made of anisotropic crystals, and we have invented the novel alignment technology of micro domain structure in laser ceramics assisted by rare-earth trivalent. Our novel process is essentially superior to the traditional electromagnetic processing from the viewpoint of mass production. We discussed the significance of anisotropic laser ceramics, and we also show the result of evaluations to our orientation controlled RE:FAP ceramics.

Laser-assisted drug delivery in dermatology: from animal models to clinical practice.

PubMed

Ali, Faisal R; Al-Niaimi, Firas

2016-02-01

Topical medicaments are the mainstay of the dermatologists' therapeutic arsenal. Laser-assisted drug delivery enhances the ability of topically applied medicaments to penetrate the skin. We discuss the mechanisms of laser-assisted drug delivery and animal models that have informed clinical practice. We review clinical studies that have employed laser-assisted drug delivery for a range of indications to date including non-melanoma skin cancer, vitiligo, scarring, vaccination, local anaesthesia, analgesia, viral warts, infantile haemangiomas and cosmetic uses. Studies thus far suggest that laser pre-treatment improves transepidermal absorption of topical agents and allows for a much deeper penetration of drugs than is possible with topical medicaments alone. This may allow more efficacious action of current treatments, such that conventional duration of treatment can be shortened or lower concentrations of active agents be used, potentially obviating side effects of treatment. The prospect of using laser technologies to facilitate transdermal vaccination and as an adjunct for inflammatory dermatoses and cosmetic indications remains in its infancy. As larger trials are published, involving greater numbers of patients and utilising various laser and topical medicament parameters, we will enhance our understanding of this nascent modality of treatment delivery.

Improvement of laser keyhole formation with the assistance of arc plasma in the hybrid welding process of magnesium alloy

NASA Astrophysics Data System (ADS)

Liu, Liming; Hao, Xinfeng

2009-11-01

In the previous work, low-power laser/arc hybrid welding technique is used to weld magnesium alloy and high-quality weld joints are obtained. In order to make clear the interactions between low-power laser pulse and arc plasma, the effect of arc plasma on laser pulse is studied in this article. The result shows that the penetration of low-power laser welding with the assistance of TIG arc is more than two times deeper than that of laser welding alone and laser welding transforms from thermal-conduction mode to keyhole mode. The plasma behaviors and spectra during the welding process are studied, and the transition mechanism of laser-welding mode is analyzed in detail. It is also found that with the assistance of arc plasma, the threshold value of average power density to form keyhole welding for YAG laser is only 3.3×10 4 W/cm 2, and the average peak power density is 2.6×10 5 W/cm 2 in the present experiment. Moreover, the distribution of energy density during laser pulse is modulated to improve the formation and stability of laser keyholes.

Laser-assisted electrochemical micromachining of mould cavity on the stainless steel surface

NASA Astrophysics Data System (ADS)

Li, Xiaohai; Wang, Shuming; Wang, Dong; Tong, Han

2018-02-01

In order to fabricate the micro mould cavities with complex structures on 304 stainless steel, laser-assisted electrochemical micromachining (EMM) based on surface modification by fiber laser masking was studied,and a new device of laser-assisted EMM was developed. Laser marking on the surface of 304 stainless steel can first be realized by fiber laser heating scanning. Through analysis of X ray diffraction analysis (XRD), metal oxide layer with predefined pattern can be formed by laser marking, and phase transformation can also occur on the 304 stainless steel surface, which produce the laser masking layer with corrosion resistance. The stainless steel surface with laser masking layer is subsequently etched by EMM, the laser masking layer severs as the temporary protective layer without relying on lithography mask, the fabrication of formed electrodes is also avoided, so micro pattern cavities can fast be fabricated. The impacts on machining accuracy during EMM with laser masking were discussed to optimize machining parameters, such as machining voltage, electrolyte concentration, duty cycle of pulse power supply and electrode gap size, the typical mould cavities 23μm deep were fabricated under the optimized parameters.

Evaluation of piezocision and laser-assisted flapless corticotomy in the acceleration of canine retraction: a randomized controlled trial.

PubMed

Alfawal, Alaa M H; Hajeer, Mohammad Y; Ajaj, Mowaffak A; Hamadah, Omar; Brad, Bassel

2018-02-17

To evaluate the effectiveness of two minimally invasive surgical procedures in the acceleration of canine retraction: piezocision and laser-assisted flapless corticotomy (LAFC). Trial design: A single-centre randomized controlled trial with a compound design (two-arm parallel-group design and a split-mouth design for each arm). 36 Class II division I patients (12 males, 24 females; age range: 15 to 27 years) requiring first upper premolars extraction followed by canine retraction. piezocision group (PG; n = 18) and laser-assisted flapless corticotomy group (LG; n = 18). A split-mouth design was applied for each group where the flapless surgical intervention was randomly allocated to one side and the other side served as a control side. the rate of canine retraction (primary outcome), anchorage loss and canine rotation, which were assessed at 1, 2, 3 and 4 months following the onset of canine retraction. Also the duration of canine retraction was recorded. Random sequence: Computer-generated random numbers. Allocation concealment: sequentially numbered, opaque, sealed envelopes. Blinding: Single blinded (outcomes' assessor). Seventeen patients in each group were enrolled in the statistical analysis. The rate of canine retraction was significantly greater in the experimental side than in the control side in both groups by two-fold in the first month and 1.5-fold in the second month (p < 0.001). Also the overall canine retraction duration was significantly reduced in the experimental side as compared with control side in both groups about 25% (p ≤ 0.001). There were no significant differences between the experimental and the control sides regarding loss of anchorage and upper canine rotation in both groups (p > 0.05). There were no significant differences between the two flapless techniques regarding the studied variables during all evaluation times (p > 0.05). Piezocision and laser-assisted flapless corticotomy appeared to be effective treatment methods for accelerating canine retraction without any significant untoward effect on anchorage or canine rotation during rapid retraction. ClinicalTrials.gov (Identifier: NCT02606331 ).

Rapid and efficient proteolysis through laser-assisted immobilized enzyme reactors.

PubMed

Zhang, Peng; Gao, Mingxia; Zhu, Shaochun; Lei, Jie; Zhang, Xiangmin

2011-11-25

In this report, laser radiation (808nm) for the first time was employed to enhance the efficiency of proteolysis through immobilized enzyme reactor (IMER). IMER based monolithic support was prepared in the fused-silica capillary via a simple two-step procedure including acryloylation on trypsin surface and in situ aqueous polymerization/immobilization. The feasibility and high efficiency of the laser-assisted IMER were demonstrated by the digestion of bovine serum albumin (BSA), cytochrome c (Cyt-c) and β-casein. The digestion process was achieved in 60s. The peptides were identified by MALDI-TOF-MS, yielding the sequence coverage of 33% for BSA, 73% for Cyt-c and 22% for β-casein. The comparisons between the in-solution digestion and on IMER reaction with/without laser assistance were made. To further confirm its efficiency in proteome analysis, the laser-assisted IMER was also applied to the analysis of one fraction of human serum sample through two-dimensional (2-D) separation of strong anion exchange/reversed-phase liquid chromatography (SAX/RPLC). After a database search, 49 unique peptides corresponding to 5 proteins were identified. The results showed that the laser-assisted IMER provides a promising platform for the high-throughput protein identification. Copyright © 2011 Elsevier B.V. All rights reserved.

Thermo-mechanical mechanism of laser-assisted alteration and stabilization of micro pore structure in eye-sclera

NASA Astrophysics Data System (ADS)

Baum, Olga; Wachsmann-Hogiu, Sebastian; Sobol, Emil

2018-02-01

Thermo-mechanical effect of laser radiation is a basis of new method of normalization of intraocular pressure in glaucomatous eyes due to laser-assisted pore formation in eye sclera. Laser-induced creation of pores in sclera increases hydraulic permeability. Stability of laser-induced pore system is achieved via gas nano-bubbles arisen in the sclera under laser radiation as a result of temperature dependency of gas solubility. The stabilization of laser-induced gas and pore systems in the tissue is an important mechanism for a long lasting healing of glaucoma observed in clinical trials with one year follow-up.

ALR - Laser altimeter for the ASTER deep space mission. Simulated operation above a surface with crater

NASA Astrophysics Data System (ADS)

de Brum, A. G. V.; da Cruz, F. C.; Hetem, A., Jr.

2015-10-01

To assist in the investigation of the triple asteroid system 2001-SN263, the deep space mission ASTER will carry onboard a laser altimeter. The instrument was named ALR and its development is now in progress. In order to help in the instrument design, with a view to the creation of software to control the instrument, a package of computer programs was produced to simulate the operation of a pulsed laser altimeter with operating principle based on the measurement of the time of flight of the travelling pulse. This software Simulator was called ALR_Sim, and the results obtained with its use represent what should be expected as return signal when laser pulses are fired toward a target, reflect on it and return to be detected by the instrument. The program was successfully tested with regard to some of the most common situations expected. It constitutes now the main workbench dedicated to the creation and testing of control software to embark in the ALR. In addition, the Simulator constitutes also an important tool to assist the creation of software to be used on Earth, in the processing and analysis of the data received from the instrument. This work presents the results obtained in the special case which involves the modeling of a surface with crater, along with the simulation of the instrument operation above this type of terrain. This study points out that the comparison of the wave form obtained as return signal after reflection of the laser pulse on the surface of the crater with the expected return signal in the case of a flat and homogeneous surface is a useful method that can be applied for terrain details extraction.

Laser-Assisted Liposuction Using the Novel 1,444-nm Nd:YAG Laser for the Treatment of Gynecomastia: A Pilot Study.

PubMed

Yoo, Kwang Ho; Bae, Jung Min; Won, Chae Young; Chung, Yu Seok; Goo, Boncheol; Rho, Yong Kwan; Kim, Gyong Moon; Lee, Jongwon; Ahn, Byeong Heon; Kim, Beom Joon

2015-01-01

Laser-assisted liposuction (LAL) is currently widely used to reduce localized fat. A novel Nd:YAG laser that uses a wavelength of 1,444 nm, which is better absorbed by fat, has recently been introduced. In this study, we investigated the efficacy of 1,444-nm Nd:YAG LAL for the treatment of gynecomastia. Thirteen Korean male patients (20-28 years, mean age 23 years) diagnosed with gynecomastia were enrolled in this study. All patients were treated by LAL with 1,444-nm Nd:YAG laser (100 µs pulse width, 40 Hz frequency, 300 mJ pulse energy and 12 W power with continuous emission) after tumescent anesthetic infiltration and were then evaluated. Outcome was assessed using the following 4 methods: (1) clinical assessment with photographs obtained before and 12 weeks after LAL treatment, (2) comparison of pre- and postoperative patient chest circumferences, (3) computed tomography (CT) scans to evaluate changes in breast thickness and (4) a patient satisfaction survey at the end of the study. After 12 weeks, most patients (84.5%) showed an improvement greater than 50%. Mean chest circumference was significantly reduced from 109.6 ± 8.2 to 101.2 ± 4.4 cm 12 weeks after LAL (p < 0.001). CT scans showed a significant reduction in mean breast thickness from 22.7 ± 3.2 to 15.6 ± 2.4 mm (p = 0.016). Side effects (pain, edema, numbness and ecchymosis) were minimal and disappeared shortly after the first manifestation. Gynecomastia can be safely treated with 1,444-nm Nd:YAG LAL to reduce fatty tissue and total breast volume. © 2015 S. Karger AG, Basel.

Threshold Damage of In vivo Porcine Skin at 2000 nm Laser Irradiation

DTIC Science & Technology

2006-01-01

surgery. J Clin Laser Med Surg 1992; 10:211-216. 8. Shapshay SM, Rebeiz EE, Pankratov MM. Holmium: Yttrium Aluminium Garnet laser-assisted endoscopic...laser-assisted endoscopic sinus surgery: laboratory experience. Laryngoscope 1991 ; 101:142-149. 10. Min K, Leu H, Zweifel K. Quantitative determination...JTF. Choice of clip levels for beam width measurements using knife-edge techniques. IEEE J. Quantum Electron. 1991 ; 27:1098-1104 19. Finney DJ

Clinical assessment of diode laser-assisted endoscopic intrasphenoidal vidian neurectomy in the treatment of refractory rhinitis.

PubMed

Lai, Wen-Sen; Cheng, Sheng-Yao; Lin, Yuan-Yung; Yang, Pei-Lin; Lin, Hung-Che; Cheng, Li-Hsiang; Yang, Jinn-Moon; Lee, Jih-Chin

2017-12-01

For chronic rhinitis that is refractory to medical therapy, surgical intervention such as endoscopic vidian neurectomy (VN) can be used to control the intractable symptoms. Lasers can contribute to minimizing the invasiveness of ENT surgery. The aim of this retrospective study is to compare in patients who underwent diode laser-assisted versus traditional VN in terms of operative time, surgical field, quality of life, and postoperative complications. All patients had refractory rhinitis with a poor treatment response to a 6-month trial of corticosteroid nasal sprays and underwent endoscopic VN between November 2006 and September 2015. They were non-randomly allocated into either a cold instrument group or a diode laser-assisted group. Vidian nerve was excised with a 940-nm continuous wave diode laser through a 600-μm silica optical fiber, utilizing a contact mode with the power set at 5 W. A visual analog scale (VAS) was used to grade the severity of the rhinitis symptoms for quality of life assessment before the surgery and 6 months after. Of the 118 patients enrolled in the study, 75 patients underwent cold instrument VN and 43 patients underwent diode laser-assisted VN. Patients in the laser-assisted group had a significantly lower surgical field score and a lower postoperative bleeding rate than those in the cold instrument group. Changes in the VAS were significant in preoperative and postoperative nasal symptoms in each group. The application of diode lasers for vidian nerve transection showed a better surgical field and a lower incidence of postoperative hemorrhage. Recent advancements in laser application and endoscopic technique has made VN safer and more effective. We recommend this surgical approach as a reliable and effective treatment for patients with refractory rhinitis.

Effect of laser-assisted bleaching with Nd:YAG and diode lasers on shear bond strength of orthodontic brackets.

PubMed

Mirhashemi, Amirhossein; Emadian Razavi, Elham Sadat; Behboodi, Sara; Chiniforush, Nasim

2015-12-01

The aim of the present study was to assess the effect of laser-assisted bleaching with neodymium:yttrium-aluminum-garnet (Nd:YAG) and diode lasers on shear bond strength (SBS) of orthodontic brackets. One hundred and four extracted human premolars were randomly divided into four groups: group 1: No bleaching applied (control group); group 2: Teeth bleached with 40 % hydrogen peroxide; group 3: Teeth treated with 30 % hydrogen peroxide activated with Nd:YAG laser (1064 nm, 2.5 W, 25 Hz, pulse duration of 100 μs, 6 mm distance); and group 4: Teeth treated with 30 % hydrogen peroxide activated with diode laser (810 nm, 1 W, CW, 6 mm distance). Equal numbers of teeth in groups 2, 3, and 4 were bonded at start, 1 h, 24 h, and 1 week after bleaching. A universal testing machine measured the SBS of the samples 24 h after bonding. After bracket debonding, the amount of residual adhesive on the enamel surface was observed under a stereomicroscope to determine the adhesive remnant index (ARI) scores. The SBS in the unbleached group was significantly higher than that in the bleached groups bonded immediately and 1 h after laser-assisted bleaching (P < 0.05). In groups 3 and 4 at start and group 2 at start and 1 h after laser-assisted bleaching, the SBS was found to be significantly lower than that in the control group. Significant differences in the ARI scores existed among groups as well. The SBS of brackets seems to increase quickly within an hour after laser-assisted bleaching and 24 h after conventional bleaching. Thus, this protocol can be recommended if it is necessary to bond the brackets on the same day of bleaching.

Cracking the perfusion code?: Laser-assisted Indocyanine Green angiography and combined laser Doppler spectrophotometry for intraoperative evaluation of tissue perfusion in autologous breast reconstruction with DIEP or ms-TRAM flaps.

PubMed

Ludolph, Ingo; Arkudas, Andreas; Schmitz, Marweh; Boos, Anja M; Taeger, Christian D; Rother, Ulrich; Horch, Raymund E; Beier, Justus P

2016-10-01

The aim of this prospective study was to assess the correlation of flap perfusion analysis based on laser-assisted Indocyanine Green (ICG) angiography with combined laser Doppler spectrophotometry in autologous breast reconstruction using free DIEP/ms-TRAM flaps. Between February 2014 and July 2015, 35 free DIEP/ms-TRAM flaps were included in this study. Besides the clinical evaluation of flaps, intraoperative perfusion dynamics were assessed by means of laser-assisted ICG angiography and post-capillary oxygen saturation and relative haemoglobin content (rHb) using combined laser Doppler spectrophotometry. Correlation of the aforementioned parameters was analysed, as well as the impact on flap design and postoperative complications. Flap survival rate was 100%. There were no partial flap losses. In three cases, flap design was based on the angiography, contrary to clinical evaluation and spectrophotometry. The final decision on the inclusion of flap areas was based on the angiographic perfusion pattern. Angiography and spectrophotometry showed a correlation in most of the cases regarding tissue perfusion, post-capillary oxygen saturation and relative haemoglobin content. Laser-assisted ICG angiography is a useful tool for intraoperative evaluation of flap perfusion in autologous breast reconstruction with DIEP/ms-TRAM flaps, especially in decision making in cases where flap perfusion is not clearly assessable by clinical signs and exact determination of well-perfused flap margins is difficult to obtain. It provides an objective real-time analysis of flap perfusion, with high sensitivity for the detection of poorly perfused flap areas. Concerning the topographical mapping of well-perfused flap areas, laser-assisted angiography is superior to combined laser Doppler spectrophotometry. Copyright © 2016 British Association of Plastic, Reconstructive and Aesthetic Surgeons. Published by Elsevier Ltd. All rights reserved.

Laser-assisted simultaneous transfer and patterning of vertically aligned carbon nanotube arrays on polymer substrates for flexible devices.

PubMed

In, Jung Bin; Lee, Daeho; Fornasiero, Francesco; Noy, Aleksandr; Grigoropoulos, Costas P

2012-09-25

We demonstrate a laser-assisted dry transfer technique for assembling patterns of vertically aligned carbon nanotube arrays on a flexible polymeric substrate. A laser beam is applied to the interface of a nanotube array and a polycarbonate sheet in contact with one another. The absorbed laser heat promotes nanotube adhesion to the polymer in the irradiated regions and enables selective pattern transfer. A combination of the thermal transfer mechanism with rapid direct writing capability of focused laser beam irradiation allows us to achieve simultaneous material transfer and direct micropatterning in a single processing step. Furthermore, we demonstrate that malleability of the nanotube arrays transferred onto a flexible substrate enables post-transfer tailoring of electric conductance by collapsing the aligned nanotubes in different directions. This work suggests that the laser-assisted transfer technique provides an efficient route to using vertically aligned nanotubes as conductive elements in flexible device applications.

Charge Assisted Laser Desorption/Ionization Mass Spectrometry of Droplets

PubMed Central

Jorabchi, Kaveh; Westphall, Michael S.; Smith, Lloyd M.

2008-01-01

We propose and evaluate a new mechanism to account for analyte ion signal enhancement in ultraviolet-laser desorption mass spectrometry of droplets in the presence of corona ions. Our new insights are based on timing control of corona ion production, laser desorption, and peptide ion extraction achieved by a novel pulsed corona apparatus. We demonstrate that droplet charging rather than gas-phase ion-neutral reactions is the major contributor to analyte ion generation from an electrically isolated droplet. Implications of the new mechanism, termed charge assisted laser desorption/ionization (CALDI), are discussed and contrasted to those of the laser desorption atmospheric pressure chemical ionization method (LD-APCI). It is also demonstrated that analyte ion generation in CALDI occurs with external electric fields about one order of magnitude lower than those needed for atmospheric pressure matrix assisted laser desorption/ionization or electrospray ionization of droplets. PMID:18387311

Laser Assisted Free-Free Transition in Electron - Atom Collision

NASA Technical Reports Server (NTRS)

Sinha, C.; Bhatia, A. K.

2011-01-01

Free-free transition is studied for electron-Hydrogen atom system in ground state at very low incident energies in presence of an external homogeneous, monochromatic and linearly polarized laser field. The incident electron is considered to be dressed by the laser in a non perturbative manner by choosing the Volkov solutions in both the channels. The space part of the scattering wave function for the electron is solved numerically by taking into account the effect of electron exchange, short range as well as of the long range interactions. Laser assisted differential as well as elastic total cross sections are calculated for single photon absorption/emission in the soft photon limit, the laser intensity being much less than the atomic field intensity. A strong suppression is noted in the laser assisted cross sections as compared to the field free situations. Significant difference is noted in the singlet and the triplet cross sections.

Respiratory complications after diode-laser-assisted tonsillotomy.

PubMed

Fischer, Miloš; Horn, Iris-Susanne; Quante, Mirja; Merkenschlager, Andreas; Schnoor, Jörg; Kaisers, Udo X; Dietz, Andreas; Kluba, Karsten

2014-08-01

Children with certain risk factors, such as comorbidities or severe obstructive sleep apnea syndrome (OSAS) are known to require extended postoperative monitoring after adenotonsillectomy. However, there are no recommendations available for diode-laser-assisted tonsillotomy. A retrospective chart review of 96 children who underwent diode-laser-assisted tonsillotomy (07/2011-06/2013) was performed. Data for general and sleep apnea history, power of the applied diode-laser (λ = 940 nm), anesthesia parameters, the presence of postoperative respiratory complications and postoperative healing were evaluated. After initially uncomplicated diode-laser-assisted tonsillotomy, an adjustment of post-anesthesia care was necessary in 16 of 96 patients due to respiratory failure. Respiratory complications were more frequent in younger children (3.1 vs. 4.0 years, p = 0.049, 95 % CI -1.7952 to -0.0048) and in children who suffered from nocturnal apneas (OR = 5.00, p < 0.01, 95 % CI 1.4780-16.9152) or who suffered from relevant comorbidities (OR = 4.84, p < 0.01, 95 % CI 1.5202-15.4091). Moreover, a diode-laser power higher than 13 W could be identified as a risk factor for the occurrence of a postoperative oropharyngeal edema (OR = 3.45, p < 0.01, 95 % CI 1.3924-8.5602). Postoperative respiratory complications should not be underestimated in children with sleep-disordered breathing (SDB). Therefore, children with SDB, children with comorbidities or children younger than 3 years should be considered "at risk" and children with confirmed moderate to severe OSAS should be referred to a PICU following diode-laser-assisted tonsillotomy. We recommend a reduced diode-laser power (<13 W) to reduce oropharyngeal edema.

Optimized path planning for soft tissue resection via laser vaporization

NASA Astrophysics Data System (ADS)

Ross, Weston; Cornwell, Neil; Tucker, Matthew; Mann, Brian; Codd, Patrick

2018-02-01

Robotic and robotic-assisted surgeries are becoming more prevalent with the promise of improving surgical outcomes through increased precision, reduced operating times, and minimally invasive procedures. The handheld laser scalpel in neurosurgery has been shown to provide a more gentle approach to tissue manipulation on or near critical structures over classical tooling, though difficulties of control have prevented large scale adoption of the tool. This paper presents a novel approach to generating a cutting path for the volumetric resection of tissue using a computer-guided laser scalpel. A soft tissue ablation simulator is developed and used in conjunction with an optimization routine to select parameters which maximize the total resection of target tissue while minimizing the damage to surrounding tissue. The simulator predicts the ablative properties of tissue from an interrogation cut for tuning and simulates the removal of a tumorous tissue embedded on the surface of healthy tissue using a laser scalpel. We demonstrate the ability to control depth and smoothness of cut using genetic algorithms to optimize the ablation parameters and cutting path. The laser power level, cutting rate and spacing between cuts are optimized over multiple surface cuts to achieve the desired resection volumes.

Simultaneous Feulgen densitometry and autoradiographic grain counting with the Quantimet 720D image-analysis system. III. Improvements in Feulgen densitometry.

PubMed

Sklarew, R J

1983-10-01

A method has been developed for densitometric estimation of the Feulgen-stained DNA content of 3H-labeled nuclei in autoradiographs in conjunction with automated grain counting using a Quantimet Imaging System. Refinements in the methodology are reported which include 1) the incorporation of an Image-Editor Module into the Quantimet module configuration; 2) the optimization of incident illumination based upon evaluation of various light sources; 3) changes in the optical configuration which reduce glare and minimize the level of monitor shading correction; 4) the optimization of scanner sensitivity; and 5) the evaluation of cell-flattening and staining with respect to densitometry resolution and sensitivity. These refinements resulted in a CV of less than 6.4% in the G-1 and G-2 DNA peaks of rat kidney cells in autoradiographs compared to the previous CV of 10.5%, and a G-2 to G-1 ratio of 2.025. For a fixed field position the CV was 5.1% and the replication error less than 1.0%.

Current methods and advances in bone densitometry

NASA Technical Reports Server (NTRS)

Guglielmi, G.; Gluer, C. C.; Majumdar, S.; Blunt, B. A.; Genant, H. K.

1995-01-01

Bone mass is the primary, although not the only, determinant of fracture. Over the past few years a number of noninvasive techniques have been developed to more sensitively quantitate bone mass. These include single and dual photon absorptiometry (SPA and DPA), single and dual X-ray absorptiometry (SXA and DXA) and quantitative computed tomography (QCT). While differing in anatomic sites measured and in their estimates of precision, accuracy, and fracture discrimination, all of these methods provide clinically useful measurements of skeletal status. It is the intent of this review to discuss the pros and cons of these techniques and to present the new applications of ultrasound (US) and magnetic resonance (MRI) in the detection and management of osteoporosis.

Electron-hydrogen collisions in a laser field. (Reannouncement with new availability information)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Smith, P.H.; Flannery, M.R.

1991-12-31

The Floquet treatment has already been successfully employed (Chu, Potvliege and Shakeshaft) in calculations of laser-induced multiphoton ionizations, where it provides dressed states for an atom in a laser field. The (perturbative) dressing of target states can have important consequences in laser-assisted scattering was illustrated by Byron and Joachain. These dressed states are useful, not only for laser-induced phenomena, but also as a collisional basis set for laser-assisted collisions. In this role they are in fact very appealing, since the Floquet treatment naturally lends itself to a time-independent analysis, and hence are compatible with present field-free scattering theories. Despite themore » apparent applicability of this approach, work along these lines has only just recently appeared (Sharma and Mohan, Smith and Flannery, Burke et al). Byron and Joachain have illustrated that perturbative dressing of the target states can have important consequences in laser-assisted scattering. Floquet dressing however provides a more complete description (Smith and Flannery).« less

Nanomaterials as Assisted Matrix of Laser Desorption/Ionization Time-of-Flight Mass Spectrometry for the Analysis of Small Molecules.

PubMed

Lu, Minghua; Yang, Xueqing; Yang, Yixin; Qin, Peige; Wu, Xiuru; Cai, Zongwei

2017-04-21

Matrix-assisted laser desorption/ionization (MALDI), a soft ionization method, coupling with time-of-flight mass spectrometry (TOF MS) has become an indispensible tool for analyzing macromolecules, such as peptides, proteins, nucleic acids and polymers. However, the application of MALDI for the analysis of small molecules (<700 Da) has become the great challenge because of the interference from the conventional matrix in low mass region. To overcome this drawback, more attention has been paid to explore interference-free methods in the past decade. The technique of applying nanomaterials as matrix of laser desorption/ionization (LDI), also called nanomaterial-assisted laser desorption/ionization (nanomaterial-assisted LDI), has attracted considerable attention in the analysis of low-molecular weight compounds in TOF MS. This review mainly summarized the applications of different types of nanomaterials including carbon-based, metal-based and metal-organic frameworks as assisted matrices for LDI in the analysis of small biological molecules, environmental pollutants and other low-molecular weight compounds.

Nanomaterials as Assisted Matrix of Laser Desorption/Ionization Time-of-Flight Mass Spectrometry for the Analysis of Small Molecules

PubMed Central

Lu, Minghua; Yang, Xueqing; Yang, Yixin; Qin, Peige; Wu, Xiuru; Cai, Zongwei

2017-01-01

Matrix-assisted laser desorption/ionization (MALDI), a soft ionization method, coupling with time-of-flight mass spectrometry (TOF MS) has become an indispensible tool for analyzing macromolecules, such as peptides, proteins, nucleic acids and polymers. However, the application of MALDI for the analysis of small molecules (<700 Da) has become the great challenge because of the interference from the conventional matrix in low mass region. To overcome this drawback, more attention has been paid to explore interference-free methods in the past decade. The technique of applying nanomaterials as matrix of laser desorption/ionization (LDI), also called nanomaterial-assisted laser desorption/ionization (nanomaterial-assisted LDI), has attracted considerable attention in the analysis of low-molecular weight compounds in TOF MS. This review mainly summarized the applications of different types of nanomaterials including carbon-based, metal-based and metal-organic frameworks as assisted matrices for LDI in the analysis of small biological molecules, environmental pollutants and other low-molecular weight compounds. PMID:28430138

Computational fluid dynamics (CFD) assisted performance evaluation of the Twincer™ disposable high-dose dry powder inhaler.

PubMed

de Boer, Anne H; Hagedoorn, Paul; Woolhouse, Robert; Wynn, Ed

2012-09-01

To use computational fluid dynamics (CFD) for evaluating and understanding the performance of the high-dose disposable Twincer™ dry powder inhaler, as well as to learn the effect of design modifications on dose entrainment, powder dispersion and retention behaviour. Comparison of predicted flow and particle behaviour from CFD computations with experimental data obtained with cascade impactor and laser diffraction analysis. Inhaler resistance, flow split, particle trajectories and particle residence times can well be predicted with CFD for a multiple classifier based inhaler like the Twincer™. CFD computations showed that the flow split of the Twincer™ is independent of the pressure drop across the inhaler and that the total flow rate can be decreased without affecting the dispersion efficacy or retention behaviour. They also showed that classifier symmetry can be improved by reducing the resistance of one of the classifier bypass channels, which for the current concept does not contribute to the swirl in the classifier chamber. CFD is a highly valuable tool for development and optimisation of dry powder inhalers. CFD can assist adapting the inhaler design to specific physico-chemical properties of the drug formulation with respect to dispersion and retention behaviour. © 2012 The Authors. JPP © 2012 Royal Pharmaceutical Society.

Influencing Factors and Workpiece's Microstructure in Laser-Assisted Milling of Titanium

NASA Astrophysics Data System (ADS)

Wiedenmann, R.; Liebl, S.; Zaeh, M. F.

Today's lightweight components have to withstand increasing mechanical and thermal loads. Therefore, advanced materials substitute conventional materials like steel or aluminum alloys. Using these high-performance materials the associated costs become prohibitively high. This paper presents the newest fundamental investigations on the hybrid process 'laser-assisted milling' which is an innovative technique to process such materials. The focus is on the validation of a numerical database for a CAD/CAM process control unit which is calculated by using simulation. Prior to that, the influencing factors on a laser-assisted milling process are systematically investigated using Design of Experiments (DoE) to identify the main influencing parameters coming from the laser and the milling operation.

Thermal and molecular investigation of laser tissue welding

NASA Astrophysics Data System (ADS)

Small, Ward, IV

Despite the growing number of successful animal and human trials, the exact mechanisms of laser tissue welding remain unknown. Furthermore, the effects of laser heating on tissue on the molecular scale are not fully understood. To address these issues, a multi-front attack on both extrinsic (solder/patch mediated) and intrinsic (laser only) tissue welding was launched using two-color infrared thermometry, computer modeling, weld strength assessment, biochemical assays, and vibrational spectroscopy. The coupling of experimentally measured surface temperatures with the predictive numerical simulations provided insight into the sub surface dynamics of the laser tissue welding process. Quantification of the acute strength of the welds following the welding procedure enabled comparison among trials during an experiment, with previous experiments, and with other studies in the literature. The acute weld integrity also provided an indication of the probability of long-term success. Molecular effects induced in the tissue by laser irradiation were investigated by measuring the concentrations of specific collagen covalent crosslinks and measuring the infrared absorption spectra before and after the laser exposure. This investigation yielded results pertaining to both the methods and mechanisms of laser tissue welding. The combination of two-color infrared thermometry to obtain accurate surface temperatures free from emissivity bias and computer modeling illustrated the importance of including evaporation in the simulations, which effectively serves as an inherent cooling mechanism during laser irradiation. Moreover, the hydration state predicted by the model was useful in assessing the role of electrostatic versus covalent bonding in the fusion. These tools also helped elicit differences between dye- enhanced liquid solders and solid-matrix patches in laser-assisted tissue welding, demonstrating the significance of repeatable energy delivery. Surprisingly, covalent bonds between collagen molecules (crosslinks) were formed in tissue when exposed to the commonly used absorbing chromophore indocyanine green (ICG) prior to laser irradiation, which restored the crosslink concentrations to their native levels. Crosslinks were either created or destroyed during exposure to green laser light without any extrinsic materials or chromophores, which may impact the acute and long-term strength and stability of laser welded tissues. Infrared spectroscopy revealed changes in collagen conformation (molecular structure) induced by laser heating as a function of temperature, elucidating the dynamics of the denaturation process.

Translational medicine in the field of ablative fractional laser (AFXL)-assisted drug delivery: A critical review from basics to current clinical status.

PubMed

Haedersdal, Merete; Erlendsson, Andrés M; Paasch, Uwe; Anderson, R Rox

2016-05-01

Ablative fractional lasers enhance uptake of topical therapeutics and the concept of fractional laser-assisted drug delivery has now been taken into clinical practice. We systematically reviewed preclinical data and clinical evidence for fractional lasers to enhance drug uptake and improve clinical efficacy. We searched PubMed and Embase databases; 34 articles met the inclusion criteria. Studies were categorized into experimental preclinical studies and clinical trials, the latter graded according to level of evidence. All preclinical trials (n = 16) documented enhanced topical drug uptake into skin after ablative fractional laser treatment. Clinical evidence encompassed 18 studies, of which 9 were randomized controlled trials and 2 were controlled trials, examining neoplastic lesions, photodamaged skin, scars, onychomycosis, and topical anesthetics. The highest level of evidence was reached for actinic keratoses treated with methylaminolevulinate for photodynamic therapy (level IB, 5 randomized controlled trials), substantiating superior and long-lasting efficacy versus conventional photodynamic therapy. No adverse events were reported, but ablative fractional laser-assisted drug delivery implies risks of systemic drug absorption, especially when performed over large skin areas. Fractional laser-assisted drug delivery is beneficial in enhancing preclinical and clinical outcomes for certain skin conditions. Copyright © 2015 American Academy of Dermatology, Inc. Published by Elsevier Inc. All rights reserved.

Design and implementation of a system for laser assisted milling of advanced materials

NASA Astrophysics Data System (ADS)

Wu, Xuefeng; Feng, Gaocheng; Liu, Xianli

2016-09-01

Laser assisted machining is an effective method to machine advanced materials with the added benefits of longer tool life and increased material removal rates. While extensive studies have investigated the machining properties for laser assisted milling(LAML), few attempts have been made to extend LAML to machining parts with complex geometric features. A methodology for continuous path machining for LAML is developed by integration of a rotary and movable table into an ordinary milling machine with a laser beam system. The machining strategy and processing path are investigated to determine alignment of the machining path with the laser spot. In order to keep the material removal temperatures above the softening temperature of silicon nitride, the transformation is coordinated and the temperature interpolated, establishing a transient thermal model. The temperatures of the laser center and cutting zone are also carefully controlled to achieve optimal machining results and avoid thermal damage. These experiments indicate that the system results in no surface damage as well as good surface roughness, validating the application of this machining strategy and thermal model in the development of a new LAML system for continuous path processing of silicon nitride. The proposed approach can be easily applied in LAML system to achieve continuous processing and improve efficiency in laser assisted machining.

Abdominal Subcutaneous Mass After Laser-Assisted Lipolysis and Immediate Multiple Treatments with a Dual-Wavelength Laser, Vacuum and Massage Device.

PubMed

Gentileschi, Stefano; Servillo, Maria; D'Ettorre, Marco; Salgarello, Marzia

2016-04-01

Body contouring by means of minimally invasive procedures is a growing trend. Current approaches to body contouring often involve a combination of surgical techniques (eg, laser-assisted liposuction) and a series of noninvasive device-based treatments aimed at accelerating recovery and improving aesthetic outcomes. In this case study, we describe a 38-year-old woman who presented with an abdominal-wall mass that resembled a tumor when assessed with magnetic resonance imaging. Twenty-six months before presenting to our office, the patient had undergone laser lipolysis and a series of treatments with a device that delivered dual-wavelength laser energy and vacuum-assisted massage. To address the patient's concerns, we removed the mass and performed abdominal dermolipectomy. No postoperative complications occurred, and the patient was highly satisfied with the aesthetic outcome. The results of histologic studies indicated that the mass was pseudocystic and fluid-filled, surrounded by a fibrous capsule, and characterized as a foreign-body granuloma. Further analysis is warranted regarding the safety of laser lipolysis without aspiration combined with a device delivering dual-wavelength laser energy and vacuum-assisted massage. 5 Risk. © 2015 The American Society for Aesthetic Plastic Surgery, Inc. Reprints and permission: journals.permissions@oup.com.

Influence of instrument conditions on the evaporation behavior of uranium dioxide with UV laser-assisted atom probe tomography

DOE Office of Scientific and Technical Information (OSTI.GOV)

Valderrama, B.; Henderson, H.B.; Gan, J.

2015-04-01

Atom probe tomography (APT) provides the ability to detect subnanometer chemical variations spatially, with high accuracy. However, it is known that compositional accuracy can be affected by experimental conditions. A study of the effect of laser energy, specimen base temperature, and detection rate is performed on the evaporation behavior of uranium dioxide (UO 2). In laser-assisted mode, tip geometry and standing voltage also contribute to the evaporation behavior. In this investigation, it was determined that modifying the detection rate and temperature did not affect the evaporation behavior as significantly as laser energy. It was also determined that three laser evaporationmore » regimes are present in UO 2. Very low laser energy produces a behavior similar to DC-field evaporation, moderate laser energy produces the desired laser-assisted field evaporation characteristic and high laser energy induces thermal effects, negatively altering the evaporation behavior. The need for UO 2 to be analyzed under moderate laser energies to produce accurate stoichiometry distinguishes it from other oxides. The following experimental conditions providing the best combination of mass resolving power, accurate stoichiometry, and uniform evaporation behavior: 50 K, 10 pJ laser energy, a detection rate of 0.003 atoms per pulse, and a 100 kHz repetition rate.« less

Visualization of liquid-assisted hard tissue ablation with a pulsed CO2 laser

NASA Astrophysics Data System (ADS)

Li, X. W.; Chen, C. G.; Zhang, X. Z.; Zhan, Z. L.; Xie, S. S.

2015-01-01

To investigate the characteristics of liquid-mediated hard tissue ablation induced by a pulsed CO2 laser with a wavelength of 10.6 μm, a high speed camera was used to monitor the interaction between water, tissue and laser irradiation. The results showed that laser irradiation can directly impact on tissue through a vapor channel formed by the leading part of the laser pulse. The ablation debris plays a key role in liquid-assisted laser ablation, having the ability to keep the vapor channel open to extend actuation time. The runoff effect induced by vortex convection liquid flow can remove the tissue that obstructs the effect of the next laser pulse.

Fundamental study of hydrogen-attachment-induced peptide fragmentation occurring in the gas phase and during the matrix-assisted laser desorption/ionization process.

PubMed

Asakawa, Daiki; Takahashi, Hidenori; Iwamoto, Shinichi; Tanaka, Koichi

2018-05-09

Mass spectrometry with hydrogen-radical-mediated fragmentation techniques has been used for the sequencing of proteins/peptides. The two methods, matrix-assisted laser desorption/ionization in-source decay (MALDI-ISD) and hydrogen attachment/abstraction dissociation (HAD) are known as hydrogen-radical-mediated fragmentation techniques. MALDI-ISD occurs during laser induced desorption processes, whereas HAD utilizes the association of hydrogen with peptide ions in the gas phase. In this study, the general mechanisms of MALDI-ISD and HAD of peptides were investigated. We demonstrated the fragmentation of four model peptides and investigated the fragment formation pathways using density functional theory (DFT) calculations. The current experimental and computational joint study indicated that MALDI-ISD and HAD produce aminoketyl radical intermediates, which immediately undergo radical-induced cleavage at the N-Cα bond located on the C-terminal side of the radical site, leading to the c'/z˙ fragment pair. In the case of MALDI-ISD, the z˙ fragments undergo a subsequent reaction with the matrix to give z' and matrix adducts of the z fragments. In contrast, the c' and z˙ fragments react with hydrogen atoms during the HAD processes, and various fragment species, such as c˙, c', z˙ and z', were observed in the HAD-MS/MS mass spectra.

Flexible Carbon Dioxide Laser Fiber Versus Ultrasonic Scalpel in Robot-Assisted Laparoscopic Myomectomy.

PubMed

Choussein, Souzana; Srouji, Serene S; Farland, Leslie V; Gargiulo, Antonio R

2015-01-01

To compare the effectiveness and safety of a flexible carbon dioxide (CO2) laser fiber to the ultrasonic scalpel when employed through a robotic surgical system. Retrospective cohort study. Level II-2 evidence. Reproductive surgery practice at an academic hospital. Two hundred thirty-six women who had undergone robot-assisted laparoscopic myomectomy with either CO2 laser (n = 85) or the ultrasonic scalpel (n = 151). Robot-assisted laparoscopic myomectomy employing either a flexible CO2 laser fiber or a robotic ultrasonic scalpel as the primary energy tool. Perioperative outcomes (estimated blood loss, operative time, length of hospital stay) of patients undergoing robot-assisted myomectomy with a flexible laser fiber or ultrasonic scalpel. Estimated blood loss and operative time were comparable (p = .95 and p = .55, respectively) between the 2 groups after adjusting for all confounders, whereas length of hospital stay remained significantly different (p = .004). Odds ratio for complications was 0.35 (95% confidence interval 0.08-1.56; p = .17), which denotes no difference in the risk for complications between the 2 groups. Robot-assisted laparoscopic myomectomy with a flexible CO2 laser fiber is safe and has comparable operative outcomes to the ultrasonic scalpel. The small size and flexibility of this device allows robotic surgeons to employ safe focal energy without sacrificing operative ergonomics. Copyright © 2015 AAGL. Published by Elsevier Inc. All rights reserved.

A compact, efficient, and lightweight laser head for CARLO®: integration, performance, and benefits

NASA Astrophysics Data System (ADS)

Deibel, Waldemar; Schneider, Adrian; Augello, Marcello; Bruno, Alfredo E.; Juergens, Philipp; Cattin, Philippe

2015-09-01

Ever since the first functional lasers were built about 50 years ago, researchers and doctors dream of a medical use for such systems. Today's technology is finally advanced enough to realize these ambitions in a variety of medical fields. There are well-established laser based systems in ophthalmology, dental applications, treatment of kidney stones, and many more. Using lasers presents more than just an alternative to conventional methods for osteotomies. It offers less tissue damage, faster healing times, comparable intervention duration and in consequence improves postoperative treatment of patients. However, there are a few factors that limit routine applications. These technical drawbacks include missing depth control and safe guiding of the laser beam. This paper presents the engineering and integration of a miniaturized laser head for a computer assisted and robot-guided laser osteotome (CARLO®), which can overcome the mentioned drawbacks. The CARLO® device ensures a safe and precise guidance of the laser beam. Such guidance also enables new opportunities and methods, e.g. free geometrical functional cuts, which have the potential to revolutionize bone surgery. The laser head is optimized for beam shaping, target conditioning, working distance, compactness and the integration of all other parts needed, e.g. CCD-cameras for monitoring and referencing, a visible laser for cut simulation, etc. The beam coming out of the laser system is conditioned in shape, energy properties and working distance with an optical arrangement to achieve the desired cutting performance. Here also parameters like optical losses, operating mode, optics materials and long-term stability have are taken into account.

Comparative analysis of ventricular assist devices (POLVAD and POLVAD_EXT) based on multiscale FEM model.

PubMed

Milenin, Andrzej; Kopernik, Magdalena

2011-01-01

The prosthesis - pulsatory ventricular assist device (VAD) - is made of polyurethane (PU) and biocompatible TiN deposited by pulsed laser deposition (PLD) method. The paper discusses the numerical modelling and computer-aided design of such an artificial organ. Two types of VADs: POLVAD and POLVAD_EXT are investigated. The main tasks and assumptions of the computer program developed are presented. The multiscale model of VAD based on finite element method (FEM) is introduced and the analysis of the stress-strain state in macroscale for the blood chamber in both versions of VAD is shown, as well as the verification of the results calculated by applying ABAQUS, a commercial FEM code. The FEM code developed is based on a new approach to the simulation of multilayer materials obtained by using PLD method. The model in microscale includes two components, i.e., model of initial stresses (residual stress) caused by the deposition process and simulation of active loadings observed in the blood chamber of POLVAD and POLVAD_EXT. The computed distributions of stresses and strains in macro- and microscales are helpful in defining precisely the regions of blood chamber, which can be defined as the failure-source areas.

All-femtosecond laser-assisted in situ keratomileusis

NASA Astrophysics Data System (ADS)

Gabryte, Egle; Danieliene, Egle; Vaiceliunaite, Agne; Ruksenas, Osvaldas; Vengris, Mikas; Danielius, Romualdas

2013-03-01

We present a femtosecond solid-state Yb:KGW laser system capable of performing the complete laser-assisted in situ keratomileusis (LASIK) ophthalmic procedure. The fundamental infrared radiation (IR) is used to create the corneal flap, and subsequently the corneal stromal ablation is performed using the ultraviolet (UV) pulses of the fifth harmonic. The heating of cornea, ablated surface quality, and healing outcomes of the surgeries performed using the femtosecond laser system are investigated by both ex vivo and in vivo experiments and compared to the results of conventional clinical ArF excimer laser application. The results of this research indicate the feasibility of clinical application of femtosecond UV lasers for LASIK procedure.

Characterization of diamond thin films and related materials

NASA Astrophysics Data System (ADS)

McKindra, Travis Kyle

Thin carbon films including sputtered deposited graphite and CO 2 laser-assisted combustion-flame deposited graphite and diamond thin films were characterized using optical and electron microscopy, X-ray diffraction and micro-Raman spectroscopy. Amorphous carbon thin films were deposited by DC magnetron sputtering using Ar/O2 gases. The film morphology changed with the oxygen content. The deposition rate decreased as the amount of oxygen increased due to oxygen reacting with the growing film. The use of oxygen in the working gas enhanced the crystalline nature of the films. Graphite was deposited on WC substrates by a CO2 laser-assisted O2/C2H2 combustion-flame method. Two distinct microstructural areas were observed; an inner core of dense material surrounded by an outer shell of lamellar-like material. The deposits were crystalline regardless of the laser power and deposition times of a few minutes. Diamond films were deposited by a CO2 laser-assisted O 2/C2H2/C2H4 combustion-flame method with the laser focused parallel to the substrate surface. The laser enhanced diamond growth was most pronounced when deposited with a 10.532 microm CO2 laser wavelength tuned to the CH2-wagging vibrational mode of the C2H4 molecule. Nucleation of diamond thin films deposited with and without using a CO 2 laser-assisted combustion-flame process was investigated. With no laser there was nucleation of a sub-layer of grains followed by irregular grain growth. An untuned laser wavelength yielded nucleation of a sub-layer then columnar grain growth. The 10.532 microm tuned laser wavelength caused growth of columnar grains.

Integrated cooling-vacuum-assisted 1540-nm erbium:glass laser is effective in treating mild-to-moderate acne vulgaris.

PubMed

Politi, Y; Levi, A; Enk, C D; Lapidoth, M

2015-12-01

Acne treatment by a mid-infrared laser may be unsatisfactory due to deeply situated acne-affected sebaceous glands which serve as its target. Skin manipulation by vacuum and contact cooling may improve laser-skin interaction, reduce pain sensation, and increase overall safety and efficacy. To evaluate the safety and efficacy of acne treatment using an integrated cooling-vacuum-assisted 1540-nm erbium:glass laser, a prospective interventional study was conducted. It included 12 patients (seven men and five women) suffering from mild-to-moderate acne vulgaris. The device utilizes a mid-infrared 1540-nm laser (Alma Lasers Ltd. Caesarea, Israel), which is integrated with combined cooling-vacuum-assisted technology. An acne lesion is initially manipulated upon contact by a vacuum-cooling-assisted tip, followed by three to four stacked laser pulses (500-600 mJ, 4 mm spot size, and frequency of 2 Hz). Patients underwent four to six treatment sessions with a 2-week interval and were followed-up 1 and 3 months after the last treatment. Clinical photographs were taken by high-resolution digital camera before and after treatment. Clinical evaluation was performed by two independent dermatologists, and results were graded on a scale of 0 (exacerbation) to 4 (76-100 % improvement). Patients' and physicians' satisfaction was also recorded. Pain perception and adverse effects were evaluated as well. All patients demonstrated a moderate to significant improvement (average score of 3.6 and 2.0 within 1 and 3 months, respectively, following last treatment session). No side effects, besides a transient erythema, were observed. Cooling-vacuum-assisted 1540-nm laser is safe and effective for the treatment of acne vulgaris.

Laser-assisted solar cell metallization processing

NASA Technical Reports Server (NTRS)

Dutta, S.

1984-01-01

Laser-assisted processing techniques utilized to produce the fine line, thin metal grid structures that are required to fabricate high efficiency solar cells are examined. Two basic techniques for metal deposition are investigated; (1) photochemical decomposition of liquid or gas phase organometallic compounds utilizing either a focused, CW ultraviolet laser (System 1) or a mask and ultraviolet flood illumination, such as that provided by a repetitively pulsed, defocused excimer laser (System 2), for pattern definition, and (2) thermal deposition of metals from organometallic solutions or vapors utilizing a focused, CW laser beam as a local heat source to draw the metallization pattern.

Laser assisted bioprinting using a femtosecond laser with and without a gold transductive layer: a parametric study

NASA Astrophysics Data System (ADS)

Desrus, H.; Chassagne, B.; Catros, S.; Artiges, C.; Devillard, R.; Petit, S.; Deloison, F.; Fricain, J. C.; Guillemot, F.; Kling, R.

2016-03-01

Experimental results of femtosecond Laser Assisted Bioprinting (LAB) are reported on. Two set-up, used to print different model bioinks and keratinocytes cells line HaCaT, were studied: first one was using a femtosecond laser with low pulse energy and an absorbing gold layer, whereas the second one used high pulse energy enabling the removal of the absorbing layer. Printed drop diameter and resulting height of the bioink jet are then quantified as a function of the LAB parameters such as laser energy, focus spot location or numerical aperture.

Changes in Astigmatism, Densitometry, and Aberrations After SMILE for Low to High Myopic Astigmatism: A 12-Month Prospective Study.

PubMed

Pedersen, Iben Bach; Ivarsen, Anders; Hjortdal, Jesper

2017-01-01

To evaluate 12-month changes in refraction, visual outcome, corneal densitometry, and postoperative aberrations after small incision lenticule extraction (SMILE) for myopic astigmatism. This 12-month prospective clinical trial comprised 101 eyes (101 patients) treated with SMILE for myopic astigmatism with cylinder of 0.75 to 4.00 diopters (D). The preoperative, 1-week, and 1-, 3-, 6-, 9-, and 12-month examinations included measurement of manifest refraction, uncorrected distance visual acuity (UDVA), and corrected (CDVA) distance visual acuity. Astigmatic error vector analysis was performed using Al-pin's method. Densitometry and aberrations were evaluated with Pentacam HR (Oculus Optikgeräte, Wetzlar, Germany). Preoperative spherical equivalent averaged -6.78 ± 1.90 D with 1.81 ± 1.00 D in cylinder correction. After 12 months, 74% and 93% of the eyes were within ±0.50 and ±1.00 D of the attempted refraction, respectively. The logMAR UDVA and CDVA averaged 0.03 ± 0.16 and -0.08 ± 0.09, respectively. Vector analysis showed a with-the-rule undercorrection at 12 months with a mean difference vector of 0.31 D @ 91°. There was a minor counterclockwise rotation of the axis, with an arithmetic angle of error of 0.34° ± 14°. An undercorrection of approximately 11% per diopter of attempted correction was seen at 12 months. Spherical aberrations, coma, and higher order aberrations remained stable during the postoperative period (P < .09). After 12 months, no increase in densitometry could be identified. Treatment of astigmatism with SMILE seems to be predictable and effective, but with an astigmatic undercorrection of approximately 11% and a small counterclockwise rotation of the axis. [J Refract Surg. 2017;33(1):11-17.]. Copyright 2017, SLACK Incorporated.

The usefulness of densitometry in predicting the composition and fragility of urolithiasis.

PubMed

Argüelles-Salido, Enrique; Lozano-Blasco, Jose Maria; Subira-Rios, Jorge; Bernardo-Villar, Pastora; Podio-Lora, Virtudes; Campoy-Martínez, Pedro; Vazquez-Albertino, Ricardo; Medina-Lopez, Rafael

2014-04-01

The choice of ideal treatment for a given lithiasis is a crucial factor for its success, minimizing the number of interventions and complications. Previous determination of stone composition and its fragility is desirable, to predict its behavior during extracorporeal shock wave lithotripsy and for evaluation of its appropriateness, or to set the indication for other techniques. To determine the role of densitometry in the prediction of composition and fragility of urinary lithiasis undergoing SWL. Experimental prospective, blinded, in vitro study using 193 urinary calculi of known composition : monohydrated calcium oxalate, mixed calcium oxalate, uric acid, and calcium carbonate, obtained from spontaneous passage or surgery. Densitometry and SWL were performed on them. We compare the mineral composition of the stone and mineral density of each composition group to check if they are characteristic of each type and correlate these parameters with the energy dose required to fragment them down to a given fragment size. Only 53 out of 193 stones showed valuable data. Calcium carbonate was the composition showing grater mineral content and density (1,24 gr and 0,47 gr/cm2), followed by mixed oxalate (0,51/0,26) and uric acid (0,52/ 0,15), finishing with the monohydrate calcium oxalate group (0,32/0,05).Only the comparison between calcium carbonate and monohydrated calcium oxalate showed statistically significant results (p<0,05). Correlation coefficients between mineral content (0,347) and density (0,424) and the energy used for stone fragmentation to a given fragment size were statistically significant (p<0,05) CONCLUSIONS: In our study, the use of densitometry to determine stone composition and lithiasic fragility did not show conclusive results due to the limited number of calculi tested. Nevertheless, there are signs that, with a different study design , more practically useful results could be achieved.

Collagen crosslinking for ectasia following PRK performed in excimer laser-assisted keratoplasty for keratoconus.

PubMed

Spadea, Leopoldo

2012-01-01

To report the results of corneal collagen crosslinking (CXL) in a patient with corneal ectasia developed after excimer laser-assisted lamellar keratoplasty for keratoconus and a secondary photorefractive keratectomy (PRK) for residual refractive error. A 33-year-old woman, who had originally been treated for keratoconus in the right eye by excimer laser-assisted lamellar keratoplasty, subsequently had her residual ametropia treated by topographically guided, transepithelial excimer laser PRK. Five years after PRK, the patient developed corneal ectasia showing concomitant visual changes of best spectacle-corrected visual acuity (BSCVA) reduced to 20/33 with a refraction of -6.00 +6.00 × 30. The minimum corneal thickness at the ectasia apex was 406 µm. A treatment of riboflavin-UVA-induced corneal CXL was performed on the right eye. Two years after the CXL treatment, the right eye improved to 20/20 BSCVA with a refraction of plano +1.00 × 50 while exhibiting a clear lamellar graft. Corneal CXL provided safe and effective management of ectasia developed after excimer laser-assisted lamellar keratoplasty and PRK.

Surface roughness analysis after laser assisted machining of hard to cut materials

NASA Astrophysics Data System (ADS)

Przestacki, D.; Jankowiak, M.

2014-03-01

Metal matrix composites and Si3N4 ceramics are very attractive materials for various industry applications due to extremely high hardness and abrasive wear resistance. However because of these features they are problematic for the conventional turning process. The machining on a classic lathe still requires special polycrystalline diamond (PCD) or cubic boron nitride (CBN) cutting inserts which are very expensive. In the paper an experimental surface roughness analysis of laser assisted machining (LAM) for two tapes of hard-to-cut materials was presented. In LAM, the surface of work piece is heated directly by a laser beam in order to facilitate, the decohesion of material. Surface analysis concentrates on the influence of laser assisted machining on the surface quality of the silicon nitride ceramic Si3N4 and metal matrix composite (MMC). The effect of the laser assisted machining was compared to the conventional machining. The machining parameters influence on surface roughness parameters was also investigated. The 3D surface topographies were measured using optical surface profiler. The analysis of power spectrum density (PSD) roughness profile were analyzed.

Laser-assisted treatment of dentinal hypersensitivity: a literature review

PubMed Central

Biagi, Roberto; Cossellu, Gianguido; Sarcina, Michele; Pizzamiglio, Ilaria Tina; Farronato, Giampietro

2015-01-01

Summary The purpose of this literature review was to evaluate the effectiveness of the laser-assisted treatment of dentinal hypersensitivity. A review with inclusion and exclusion criteria was performed from January 2009 to December 2014 with electronic data-bases: MedLine via PubMed, Science Direct and Cochrane Library. Research of paper magazines by hand was not considered. Forty-three articles were selected between literature reviews, in vitro studies, clinical trials, pilot and preliminary studies. The items were divided into laser-used groups for an accurate description, and then the reading of results into various typologies. Laser-assisted treatment reduces dentinal hypersensitivity-related pain, but also a psychosomatic component must be considered, so further studies and more suitable follow-ups are necessary. PMID:26941892

Use of the Femtosecond Lasers in Ophthalmology

NASA Astrophysics Data System (ADS)

Roszkowska, Anna M.; Urso, Mario; Signorino, Alberto; Aragona, Pasquale

2018-01-01

Femtosecond laser (FSL) is an infrared laser with a wavelength of 1053 nm. FS laser works producing photodisruption or photoionization of the optically transparent tissue such as cornea. Currently FS lasers have a wide range of applications in ophthalmic surgery. They are used above all in corneal surgery in refractive procedures and keratoplasty, and recently in cataract surgery. The use of the FSL in corneal refractive surgery includes LASIK flap creation, astigmatic keratotomy, Femtosecond Lenticule Extraction (FLEx), Small Incision Lenticule Extraction (SMILE) and channels creation for implantation of the intrastromal corneal rings. As to the corneal grafting, the FS lasers are used in laser-assisted anterior and posterior lamellar keratoplasty and customized trephination in the penetrating keratoplasty. FS Laser Assisted Cataract Surgery (FLACS) includes capsulorrhexis and nuclear fragmentation that enhance safety and efficacy of the procedure.

Liquid-assisted laser ablation of advanced ceramics and glass-ceramic materials

NASA Astrophysics Data System (ADS)

Garcia-Giron, A.; Sola, D.; Peña, J. I.

2016-02-01

In this work, results obtained by laser ablation of advanced ceramics and glass-ceramic materials assisted by liquids are reported. A Q-switched Nd:YAG laser at its fundamental wavelength of 1064 nm with pulse-width in the nanosecond range was used to machine the materials, which were immersed in water and ethylene glycol. Variation in geometrical parameters, morphology, and ablation yields were studied by using the same laser working conditions. It was observed that machined depth and removed volume depended on the thermal, optical, and mechanical features of the processed materials as well as on the properties of the surrounding medium in which the laser processing was carried out. Variation in ablation yields was studied in function of the liquid used to assist the laser process and related to refractive index and viscosity. Material features and working conditions were also related to the obtained results in order to correlate ablation parameters with respect to the hardness of the processed materials.

[Thirty years of laser-assisted microvascular anastomosis (LAMA): what are the clinical perspectives?].

PubMed

Leclère, F M; Duquennoy-Martinot, V; Schoofs, M; Buys, B; Mordon, S

2011-02-01

Since the first studies by Jain and Gorisch (1979), laser-assisted anastomoses have been steadily developed to a stage where clinical use is within reach. The laser-assisted vascular microanastomosis (LAMA) procedure is performed more quickly than conventional anastomosis, the surgically induced vessel damage is limited, and reduced bleeding after unclamping is observed. A Medline literature search, for the January 1979 to February 2010 period, was performed to review articles focusing on the LAMA technique. The search yielded a total of 354 publications, of which 87 were relevant: 82 were animal series and five clinical studies. Microsurgical techniques and principal characteristics of LAMA in patients are the focus of the analysis. This study discusses the technological innovations and new orientations in laser welding. The first two clinical series using the 1.9-μm diode laser appear promising. Technical innovation will most likely lead to greater ease of use of the laser handpiece in the operating room. Copyright © 2010 Elsevier Masson SAS. All rights reserved.

Magnetic-Field-Assisted Terahertz Quantum Cascade Laser Operating up to 225 K

NASA Technical Reports Server (NTRS)

Wade, A.; Fedorov, G.; Smirnov, D.; Kumar, S.; Williams, B. S.; Hu, Q.; Reno, J. L.

2008-01-01

Advances in semiconductor bandgap engineering have resulted in the recent development of the terahertz quantum cascade laser1. These compact optoelectronic devices now operate in the frequency range 1.2-5 THz, although cryogenic cooling is still required2.3. Further progress towards the realization of devices operating at higher temperatures and emitting at longer wavelengths (sub-terahertz quantum cascade lasers) is difficult because it requires maintaining a population inversion between closely spaced electronic sub-bands (1 THz approx. equals 4 meV). Here, we demonstrate a magnetic-field-assisted quantum cascade laser based on the resonant-phonon design. By applying appropriate electrical bias and strong magnetic fields above 16 T, it is possible to achieve laser emission from a single device over a wide range of frequencies (0.68-3.33 THz). Owing to the suppression of inter-landau-level non-radiative scattering, the device shows magnetic field assisted laser action at 1 THz at temperatures up to 215 K, and 3 THz lasing up to 225 K.

Laser Eye Surgery: MedlinePlus Health Topic

MedlinePlus

... types of laser eye surgery. LASIK - laser-assisted in situ keratomileusis - is one of the most common. Many ... Laser (National Institutes of Health) ClinicalTrials.gov: Laser In Situ Keratomileusis (LASIK) (National Institutes of Health) ClinicalTrials.gov: ...

The Integrated Radiation Mapper Assistant

DOE Office of Scientific and Technical Information (OSTI.GOV)

Carlton, R.E.; Tripp, L.R.

1995-03-01

The Integrated Radiation Mapper Assistant (IRMA) system combines state-of-the-art radiation sensors and microprocessor based analysis techniques to perform radiation surveys. Control of the survey function is from a control station located outside the radiation thus reducing time spent in radiation areas performing radiation surveys. The system consists of a directional radiation sensor, a laser range finder, two area radiation sensors, and a video camera mounted on a pan and tilt platform. THis sensor package is deployable on a remotely operated vehicle. The outputs of the system are radiation intensity maps identifying both radiation source intensities and radiation levels throughout themore » room being surveyed. After completion of the survey, the data can be removed from the control station computer for further analysis or archiving.« less

System technology for laser-assisted milling with tool integrated optics

NASA Astrophysics Data System (ADS)

Hermani, Jan-Patrick; Emonts, Michael; Brecher, Christian

2013-02-01

High strength metal alloys and ceramics offer a huge potential for increased efficiency (e. g. in engine components for aerospace or components for gas turbines). However, mass application is still hampered by cost- and time-consuming end-machining due to long processing times and high tool wear. Laser-induced heating shortly before machining can reduce the material strength and improve machinability significantly. The Fraunhofer IPT has developed and successfully realized a new approach for laser-assisted milling with spindle and tool integrated, co-rotating optics. The novel optical system inside the tool consists of one deflection prism to position the laser spot in front of the cutting insert and one focusing lens. Using a fiber laser with high beam quality the laser spot diameter can be precisely adjusted to the chip size. A high dynamic adaption of the laser power signal according to the engagement condition of the cutting tool was realized in order not to irradiate already machined work piece material. During the tool engagement the laser power is controlled in proportion to the current material removal rate, which has to be calculated continuously. The needed geometric values are generated by a CAD/CAM program and converted into a laser power signal by a real-time controller. The developed milling tool with integrated optics and the algorithm for laser power control enable a multi-axis laser-assisted machining of complex parts.

Metasurface-assisted orbital angular momentum carrying Bessel-Gaussian Laser: proposal and simulation.

PubMed

Zhou, Nan; Wang, Jian

2018-05-23

Bessel-Gaussian beams have distinct properties of suppressed diffraction divergence and self-reconstruction. In this paper, we propose and simulate metasurface-assisted orbital angular momentum (OAM) carrying Bessel-Gaussian laser. The laser can be regarded as a Fabry-Perot cavity formed by one partially transparent output plane mirror and the other metasurface-based reflector mirror. The gain medium of Nd:YVO 4 enables the lasing wavelength at 1064 nm with a 808 nm laser serving as the pump. The sub-wavelength structure of metasurface facilitates flexible spatial light manipulation. The compact metasurface-based reflector provides combined phase functions of an axicon and a spherical mirror. By appropriately selecting the size of output mirror and inserting mode-selection element in the laser cavity, different orders of OAM-carrying Bessel-Gaussian lasing modes are achievable. The lasing Bessel-Gaussian 0 , Bessel-Gaussian 01 + , Bessel-Gaussian 02 + and Bessel-Gaussian 03 + modes have high fidelities of ~0.889, ~0.889, ~0.881 and ~0.879, respectively. The metasurface fabrication tolerance and the dependence of threshold power and output lasing power on the length of gain medium, beam radius of pump and transmittance of output mirror are also discussed. The obtained results show successful implementation of metasurface-assisted OAM-carrying Bessel-Gaussian laser with favorable performance. The metasurface-assisted OAM-carrying Bessel-Gaussian laser may find wide OAM-enabled communication and non-communication applications.

Transcanalicular Diode Laser-assisted Dacryocystorhinostomy for the Treatment of Primary Acquired Nasolacrimal Duct Obstruction.

PubMed

Mor, Joel M; Guo, Yongwei; Koch, Konrad R; Heindl, Ludwig M

2017-10-13

Today's gold standard in the treatment of infrasaccal primary acquired nasolacrimal duct obstruction (PANDO) is external dacryocystorhinostomy (DCR), a relatively invasive procedure that can be performed after failure of recanalizing treatments. However, with progress in the field of diode laser technology, new approaches have emerged. Laser-assisted transcanalicular DCR with subsequent bicanalicular silicon intubation is a new option showing great promise as a viable minimally invasive procedure. Under permanent endoscopic visual control from the nasal cavity, a diode laser fiber is inserted into the lacrimal sac and laser energy is applied to create a bony ostium between the lacrimal sac and the nasal cavity. Since no skin incision needs to be made, advantages of this method comprise the sparing of the skin as well as the medial palpebral structures and the physiological palpebral-canalicular pump mechanism. The duration of surgery as well as reconvalescence is generally shorter than with external DCR. Complications include silicon tube prolapse, mild swelling and, rarely, canalicular infection and thermal injury. One-year functional success rates, defined as complete resolution of symptoms and ostium patency, are high, yet still range behind those of external DCR. However, secondary external DCR after failure of laser-assisted DCR can be performed without difficulty. Thus, laser-assisted transcanalicular DCR is a valid option that should be considered as a second-step procedure after failure of recanalization procedures and before external DCR.

Parameters in fractional laser assisted delivery of topical anesthetics: Role of laser type and laser settings.

PubMed

Meesters, Arne A; Nieboer, Marilin J; Kezic, Sanja; de Rie, Menno A; Wolkerstorfer, Albert

2018-05-07

Efficacy of topical anesthetics can be enhanced by pretreatment of the skin with ablative fractional lasers. However, little is known about the role of parameters such as laser modality and laser density settings in this technique. Aims of this study were to compare the efficacy of pretreatment with two different ablative fractional laser modalities, a CO 2 laser and an Er:YAG laser, and to assess the role of laser density in ablative fractional laser assisted topical anesthesia. In each of 15 healthy subjects, four 10 × 10 mm test regions on the back were randomized to pretreatment (70-75 μm ablation depth) with CO 2 laser at 5% density, CO 2 laser at 15% density, Er:YAG laser at 5% density or Er:YAG laser at 15% density. Articaine hydrochloride 40 mg/ml + epinephrine 10 μg/ml solution was applied under occlusion to all four test regions. After 15 minutes, a pass with the CO 2 laser (1,500 μm ablation depth) was administered as pain stimulus to each test region. A reference pain stimulus was given on unanesthetized skin. The main outcome parameter, pain, was scored on a 0-10 visual analogue scale (VAS) after each pain stimulus. Median VAS scores were 1.50 [CO 2 5%], 0.50 [CO 2 15%], 1.50 [Er:YAG 5%], 0.43 [Er:YAG 15%], and 4.50 [unanesthetized reference]. VAS scores for all pretreated test regions were significantly lower compared to the untreated reference region (P < 0.01). We found no significant difference in VAS scores between the CO 2 and the Er:YAG laser pretreated regions. However, VAS scores were significantly lower at 15% density compared to 5% density for both for the CO 2 laser (P < 0.05) and the Er:YAG laser (P < 0.01). Pretreatment with the CO 2 laser was considered slightly more painful than pretreatment with Er:YAG laser by the subjects. Fractional laser assisted topical anesthesia is effective even with very low energy settings and an occlusion time of only 15 minutes. Both the CO 2 laser and the Er:YAG laser can be used to assist topical anesthesia although the CO 2 laser pretreatment is experienced as more painful. In our study settings, using articaine/epinephrine solution and an occlusion time of 15 minutes, a density of 15% was more effective than 5%. Lasers Surg. Med. © 2018 Wiley Periodicals, Inc. © 2018 Wiley Periodicals, Inc.

CHARACTERIZATION OF CRYPTOSPORIDIUM PARVUM BY MATRIX-ASSISTED LASER DESORPTION -- IONIZATION TIME OF FLIGHT MASS SPECTROMETRY

EPA Science Inventory

Matrix assisted laser desorption/ionization (MALDI) mass spectrometry was used to investigate whole and freeze thawed Cryptosporidium parvum oocysts. Whole oocysts revealed some mass spectral features. Reproducible patterns of spectral markers and increased sensitivity were obtai...

Neutron Resonance Densitometry for Particle-like Debris of Melted Fuel

NASA Astrophysics Data System (ADS)

Harada, H.; Kitatani, F.; Koizumi, M.; Takamine, J.; Kureta, M.; Tsutiya, H.; Iimura, H.; Seya, M.; Becker, B.; Kopecky, S.; Schillebeeckx, P.

2014-04-01

Neutron Resonance Densitometry (NRD) is proposed for the quantification of nuclear materials in particle-like debris of melted fuel from the reactors of the Fukushima Daiichi nuclear power plant. The method is based on a combination of neutron resonance transmission analysis (NRTA) and neutron resonance capture analysis (NRCA). It uses the neutron time-of-flight (TOF) technique with a pulsed white neutron source and a neutron flight path as short as 5 m. The spectrometer for NRCA is made of LaBr3(Ce) detectors. The achievable uncertainty due to only counting statistics is less than 1 % to determine Pu and U isotopes.

Seasonal vegetation differences from ERTS imagery

NASA Technical Reports Server (NTRS)

Ashley, M. D.; Rea, J.

1975-01-01

Knowledge of the times when crop and forest vegetation experience seasonally related changes in development is important in understanding growth and yield relationships. This article describes how densitometry of earth resources technology satellite (ERTS-1) multispectral scanner (MSS) imagery can be used to identify such phenological events. Adjustments for instrument calibration, aperture size, gray-scale differences between overpasses, and normalization of changing solar elevation are considered in detail. Seasonal vegetation differences can be identified by densitometry of band 5 (0.6-0.7 microns) and band 7 (0.8-1.1 microns) MSS imagery. Band-to-band ratios of the densities depicted the changes more graphically than the individual band readings.

Comparison of instruments for dual-energy X-ray bone mineral densitometry.

PubMed

Vainio, P; Ahonen, E; Leinonen, K; Sievänen, H; Koski, E

1992-04-01

While bone mineral densitometry has become a common laboratory test, it is important to pay attention to the compatibility of the results from different instruments. In this study results from three commercially available bone densitometers are compared using both patient and phantom studies. Overall correlation between instruments was good but there were systematic discrepancies in the results. The three instruments provided bone mineral density (BMD) values that differed by as much as 13.5% due to differences as large as 6% in bone mineral content and as large as 7% in bone area. Thus, the BMD values obtained from different manufacturers' instruments are not directly comparable.

Chlorogenic acid content, essential oil compositions, and in vitro antioxidant activities of Chromolaena odorata leaves

PubMed Central

Pitakpawasutthi, Yamon; Thitikornpong, Worathat; Palanuvej, Chanida; Ruangrungsi, Nijsiri

2016-01-01

Chromolaena odorata (L.) R. M. King and H. Rob. is a Thai medicinal plant used for the treatment of wounds, rashes, diabetes, and insect repellent. The leaves of C. odorata were collected from 10 different sources throughout Thailand. The chemical constituents of essential oils were hydro-distilled from the leaves and were analyzed by gas chromatography-mass spectrometry. Chlorogenic acid contents were determined by thin-layer chromatography (TLC) - densitometry with winCATS software and TLC image analysis with ImageJ software. The TLC plate was developed in the mobile phase that consisted of ethyl acetate:water:formic acid (17:3:2). Antioxidant activities were examined by 1,1-diphenyl-2-picryl hydrazyl (DPPH) radical scavenging and β-carotene bleaching assays. C. odorata essential oil has shown the major components of pregeijerene, dauca-5, 8-diene, (E)-caryophyllene, β-pinene, and α-pinene. The chlorogenic acid content of C. odorata leaves was determined by TLC-densitometry and TLC image analysis. Results have shown that TLC-densitometry and TLC image analysis method were not statistically significantly different. DPPH radical scavenging and β-carotene bleaching assays of ethanolic extract of C. odorata leaves showed its antioxidant potential. PMID:27144150

Laser cladding assisted by friction stir processing for preparation of deformed crack-free Ni-Cr-Fe coating with nanostructure

NASA Astrophysics Data System (ADS)

Xie, Siyao; Li, Ruidi; Yuan, Tiechui; Chen, Chao; Zhou, Kechao; Song, Bo; Shi, Yusheng

2018-02-01

Although laser cladding has find its widespread application in surface hardening, this technology has been significantly limited by the solidification crack, which usually initiates along grain boundary due to the brittle precipitation in grain boundary and networks formation during the laser rapid melting/solidification process. This paper proposed a novel laser cladding technology assisted by friction stir processing (FSP) to eliminate the usual metallurgical defects by the thermomechanical coupling effect of FSP with the Ni-Cr-Fe as representative coating material. By the FSP assisted laser cladding, the crack in laser cladding Ni-Cr-Fe coating was eliminated and the coarse networks of laser cladding coating was transformed into dispersed nanoparticles. Moreover, the plastic layers with thicknesses 47-140 μm can be observed, with gradient grain refinement from substrate to the top surface in which grain size reached 300 nm and laser photocoagulation net second phase crushed in the layer. In addition, cracks closed in the plastic zone. The refinement of grain resulted the hardness increased to over 400 HV, much higher than the 300 HV of the laser cladding structure. After FSP, the friction coefficient decreased from 0.6167 to 0.5645 which promoted the wear resistance.

Single-stage CO2 laser assisted uvuloplasty for treatment of snoring and mild obstructive sleep apnoea.

PubMed

Herford, A S; Finn, R

2000-08-01

The purpose of this study was to describe a single-stage laser assisted uvuloplasty (uvulectomy) and to determine its effectiveness in treatment of snoring and mild obstructive sleep apnoea (OSA). All patients treated with laser assisted uvuloplasty in a 49-month period for snoring and/or mild OSA were studied. Frequency of snoring before and after surgery, loudness of snoring and postoperative discomfort were investigated. Patients were asked to evaluate change in daytime energy, sleep habits, missed days of work and also overall satisfaction following laser assisted uvuloplasty. Thirty patients underwent a single-stage laser assisted uvuloplasty. A preoperative diagnosis of OSA was established in 19 patients, the remaining 11 patients were treated for snoring. There were no complications and only one patient required an additional stage. A questionnaire was completed by 18 patients (10 patients diagnosed with sleep apnoea, and eight patients with snoring only). Preoperatively the frequency of snoring averaged 9.3 cm on a visual analogue scale. Postoperatively there were 12 patients with either none or very minimal snoring and six patients who had an average score of 3.2. Loudness of snoring also decreased from an average of 5.4 to 2.5 cm. Postoperative discomfort averaged 1.1 cm. Improvement in sleep was noted by 16 patients and improved daytime energy was noted by 17 patients. Eleven patients reported that they missed at least one day of work postoperatively with an average of 3 days missed. Patient satisfaction was reported by 17 patients with only one stating that he was unsatisfied with the procedure. Laser-assisted uvuloplasty (uvulectomy) is an effective surgical procedure for treatment of snoring and some types of OSA. A single-stage procedure appears to be effective and may further decrease the morbidity associated with this disease.

Mapping crystal defects with a digital scanning ultramicroscope

NASA Astrophysics Data System (ADS)

Springer, John M., Jr.; Silberman, Enrique; Kroes, Roger L.; Reiss, Don

1991-12-01

A computer controlled scanning ultramicroscope has been built to assist in the characterization of transparent crystals. The device measures the scattering of a focused He-Ne laser beam by crystalline defects. As an XYZ translation table moves the crystal under the ultramicroscope, the scattered light is measured by a photodetector whose output is digitized and recorded. From this data, contour maps or 3-D perspective plots of the scattering regions of the crystal can be generated to assist in finding patterns of defects which might be correlated with perturbations in the growth process. The verified resolution of the present instrument is about 1 micrometers , which is limited by the minimum step of the stepper-motor driven translation stages, optical diffraction effects, and the sensitivity of the detector at the laser light frequency. The instrument was used to build a database of defects patterns in commercial laboratory grown triglycine sulphate (TGS) crystals, and to map defects in a TGS crystal grown from aqueous solution during the flight of Spacelab 3. This crystal shows indications of a reduction both in the generation of defects at the seed-new growth interface and in their propagation into the new crystal.

Mapping crystal defects with a digital scanning ultramicroscope

NASA Astrophysics Data System (ADS)

Springer, J. M.; Silberman, E.; Kroes, Roger; Reiss, D.

A computer controlled scanning ultramicroscope has been built to assist in the characterization of transparent crystals. The device measures the scattering of a focused He-Ne laser beam by crystalline defects. As an XYZ translation table moves the crystal under the ultramicroscope, the scattered light is measured by a photodetector whose output is digitized and recorded. From this data, contour maps or three dimensional perspective plots of the scattering regions of the crystal can be generated to assist in finding patterns of defects which might be correlated with perturbations in the growth process. The verified resolution of the present instrument is about 1 micrometer, which is limited by the minimum step of the stepper-motor driven translation stages, optical diffraction effects and the sensitivity of the detector at the laser light frequency. The instrument was used to build a database of defects patterns in commercial laboratory grown triglycine sulphate (TGS) crystals, and to map defects in a TGS crystal grown from aqueous solution during the flight of Spacelab 3. This crystal shows indications of a reduction both in the generation of defects at the seed-new growth interface and in their propagation into the new crystal.

Mapping crystal defects with a digital scanning ultramicroscope

NASA Technical Reports Server (NTRS)

Springer, J. M.; Silberman, E.; Kroes, Roger; Reiss, D.

1991-01-01

A computer controlled scanning ultramicroscope has been built to assist in the characterization of transparent crystals. The device measures the scattering of a focused He-Ne laser beam by crystalline defects. As an XYZ translation table moves the crystal under the ultramicroscope, the scattered light is measured by a photodetector whose output is digitized and recorded. From this data, contour maps or three dimensional perspective plots of the scattering regions of the crystal can be generated to assist in finding patterns of defects which might be correlated with perturbations in the growth process. The verified resolution of the present instrument is about 1 micrometer, which is limited by the minimum step of the stepper-motor driven translation stages, optical diffraction effects and the sensitivity of the detector at the laser light frequency. The instrument was used to build a database of defects patterns in commercial laboratory grown triglycine sulphate (TGS) crystals, and to map defects in a TGS crystal grown from aqueous solution during the flight of Spacelab 3. This crystal shows indications of a reduction both in the generation of defects at the seed-new growth interface and in their propagation into the new crystal.

Optical pulse generation in a transistor laser via intra-cavity photon-assisted tunneling and excess base carrier redistribution

DOE Office of Scientific and Technical Information (OSTI.GOV)

Feng, M.; Iverson, E. W.; Wang, C. Y.

2015-11-02

For a direct-gap semiconductor (e.g., a p-n junction), photon-assisted tunneling is known to exhibit a high nonlinear absorption. In a transistor laser, as discussed here, the coherent photons generated at the quantum well interact with the collector junction field and “assist” electron tunneling from base to collector, thus resulting in the nonlinear modulation of the laser and the realization of optical pulse generation. 1 and 2 GHz optical pulses are demonstrated in the transistor laser using collector voltage control.

Liquid-Assisted Femtosecond Laser Precision-Machining of Silica.

PubMed

Cao, Xiao-Wen; Chen, Qi-Dai; Fan, Hua; Zhang, Lei; Juodkazis, Saulius; Sun, Hong-Bo

2018-04-28

We report a systematical study on the liquid assisted femtosecond laser machining of quartz plate in water and under different etching solutions. The ablation features in liquid showed a better structuring quality and improved resolution with 1/3~1/2 smaller features as compared with those made in air. It has been demonstrated that laser induced periodic structures are present to a lesser extent when laser processed in water solutions. The redistribution of oxygen revealed a strong surface modification, which is related to the etching selectivity of laser irradiated regions. Laser ablation in KOH and HF solution showed very different morphology, which relates to the evolution of laser induced plasma on the formation of micro/nano-features in liquid. This work extends laser precision fabrication of hard materials. The mechanism of strong absorption in the regions with permittivity (epsilon) near zero is discussed.

Room temperature operation of electro-optical bistability in the edge-emitting tunneling-collector transistor laser

NASA Astrophysics Data System (ADS)

Feng, M.; Holonyak, N.; Wang, C. Y.

2017-09-01

Optical bistable devices are fundamental to digital photonics as building blocks of switches, logic gates, and memories in future computer systems. Here, we demonstrate both optical and electrical bistability and capability for switching in a single transistor operated at room temperature. The electro-optical hysteresis is explained by the interaction of electron-hole (e-h) generation and recombination dynamics with the cavity photon modulation in different switching paths. The switch-UP and switch-DOWN threshold voltages are determined by the rate difference of photon generation at the base quantum-well and the photon absorption via intra-cavity photon-assisted tunneling controlled by the collector voltage. Thus, the transistor laser electro-optical bistable switching is programmable with base current and collector voltage, and the basis for high speed optical logic processors.

Characterisation of organometallic and coordination compounds by solvent-free matrix-assisted laser desorption/ionisation time-of-flight mass spectrometry.

PubMed

Wyatt, Mark F; Stein, Bridget K; Brenton, A Gareth

2008-01-01

Insoluble or low solubility organometallic and coordination compounds have been characterised by matrix-assisted laser desorption/ionisation time-of-flight mass spectrometry, with solvent-free sample preparation being the key step toward successful analysis.

LASIK eye surgery

MedlinePlus

... Assisted In Situ Keratomileusis; Laser vision correction; Nearsightedness - Lasik; Myopia - Lasik ... cornea (curvature) and the length of the eye. LASIK uses an excimer laser (an ultraviolet laser) to ...

Efficacy and perioperative timing of bromfenac in the management of ocular discomfort after femtosecond laser-assisted laser in situ keratomileusis.

PubMed

Cleaveland, Nathan A; De Mann, Derek W; Carlson, Neil E; Keil, Michael L

2017-02-01

To evaluate the safety, efficacy, and appropriate perioperative timing of the use of topical bromfenac ophthalmic solution 0.07% after femtosecond laser-assisted laser in situ keratomileusis (LASIK). Keil LASIK Vision Center, Grand Rapids, Michigan, USA. Prospective case series. Ocular discomfort was assessed 1, 2, and 5 hours postoperatively and the following morning using the Ocular Comfort Grading Assessment in patients treated with topical bromfenac 0.07% or artificial tears just before, just after, or before and after femtosecond laser-assisted LASIK. Visual outcomes and complications were noted up to 24 hours. The study enrolled 64 patients (120 eyes). Patients who were treated with bromfenac 0.07% just before or before and after femtosecond laser-assisted LASIK showed the greatest statistically significant decrease in several discomfort scores within the first few hours in comparison with the control group. Two hours after surgery, the majority of patients who were treated before and after LASIK were sleeping comfortably. There were no significant differences in visual acuity; 1 day postoperatively, the uncorrected distance visual acuity was 20/20 in 106 eyes (89%) and 20/25 or better in 116 eyes (97%). At 3 months, all patients had binocular distance visual acuity of 20/20 or better and 86% of patients had 20/15 or better. Ocular discomfort after femtosecond laser-assisted LASIK was reduced with a single dose of topical bromfenac 0.07% given immediately before surgery or given just before and after surgery and was typically minimal in all groups the morning after surgery. Copyright © 2017 ASCRS and ESCRS. Published by Elsevier Inc. All rights reserved.

Treatment of oral soft tissues benign tumors using laser

NASA Astrophysics Data System (ADS)

Crisan, Bogdan; Baciut, Mihaela; Crisan, Liana; Bran, Simion; Rotar, Horatiu; Dinu, Cristian; Moldovan, Iuliu; Baciut, Grigore

2014-01-01

The present study aimed to assess the efficacy and indications of surgical laser therapy in the treatment of oral soft tissues benign tumors compared to classic surgery. A controlled clinical study was conducted in a group of 93 patients presenting various forms of oral soft tissues benign tumors. These patients were examined pre-and postoperatively and the oral benign tumors were measured linearly and photographed. The surgery of laser-assisted biopsy excision of oral benign tumors was carried out using a diode laser device of 980 nm. In patients who received surgical laser treatment, therapeutic doses of laser to biostimulate the operated area were administered on the first day after the surgery. The interventions of conventional excision of oral soft tissues benign tumors consisted in removing them using scalpel. In patients who have received therapeutic doses of laser for biostimulation of the operated area, a faster healing of wound surfaces and tumor bed was observed during the first days after surgery. Two weeks after the surgical treatment, good healing without scarring or discomfort in the area of excision was documented. Surgical treatment of oral soft tissues benign tumors with laser assisted postoperative therapy confirms the benefits of this surgical procedure. A faster healing process of the excision area due to laser biostimulation of low intensity has been observed in patients with surgical laser assisted treatment in the postoperative period.

Significance of the Resonance Condition for Controlling the Seam Position in Laser-assisted TIG Welding

NASA Astrophysics Data System (ADS)

Emde, B.; Huse, M.; Hermsdorf, J.; Kaierle, S.; Wesling, V.; Overmeyer, L.; Kozakov, R.; Uhrlandt, D.

As an energy-preserving variant of laser hybrid welding, laser-assisted arc welding uses laser powers of less than 1 kW. Recent studies have shown that the electrical conductivity of a TIG welding arc changes within the arc in case of a resonant interaction between laser radiation and argon atoms. This paper presents investigations on how to control the position of the arc root on the workpiece by means of the resonant interaction. Furthermore, the influence on the welding result is demonstrated. The welding tests were carried out on a cooled copper plate and steel samples with resonant and non-resonant laser radiation. Moreover, an analysis of the weld seam is presented.

Low-temperature diffusion assisted by femtosecond laser-induced modifications at Ni/SiC interface

NASA Astrophysics Data System (ADS)

Okada, Tatsuya; Tomita, Takuro; Ueki, Tomoyuki; Hashimoto, Takuya; Kawakami, Hiroki; Fuchikami, Yuki; Hisazawa, Hiromu; Tanaka, Yasuhiro

2018-01-01

We investigated low-temperature diffusion at the Ni/SiC interface with the assistance of femtosecond laser-induced modifications. Cross sections of the laser-irradiated lines of two different pulse energies — 0.84 and 0.60 J/cm2 in laser fluence — were compared before and after annealing at 673 K. At the laser fluence of 0.60 J/cm2, a single flat Ni-based particle was formed at the interface after annealing. The SiC crystal under the particle was defect-free. The present results suggest the potential application of femtosecond laser-induced modifications to the low-temperature fabrication of contacts at the interface without introducing crystal defects, e.g., dislocations and stacking faults, in SiC.

Stress assisted selective ablation of ITO thin film by picosecond laser

NASA Astrophysics Data System (ADS)

Farid, Nazar; Chan, Helios; Milne, David; Brunton, Adam; M. O'Connor, Gerard

2018-01-01

Fast selective pattering with high precession on 175 nm ITO thin film with IR ps lasers is investigated. Ablation parameters are optimized with detailed studies on the scribed depth, topography, and particle generation using AFM and SEM. A comparison of 10 and 150 ps laser revealed that the shorter pulse (10 ps) laser is more appropriate in selective and partial ablation; up to 20 nm resolution for controlled depth with multipulses having energy below the damage threshold is demonstrated. The experimental results are interpreted to involve stress assisted ablation mechanism for the 10 ps laser while thermal ablation along with intense melting occurs for 150 ps laser. The transition between these regimes is estimated to occur at approximately 30 ps.

A switchable and stable single-longitudinal-mode, dual-wavelength erbium-doped fiber laser assisted by Rayleigh backscattering in tapered fiber

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gu, Jian; Yang, Yanfu, E-mail: yangyanfu@hotmail.com; Zhang, Jianyu

We have proposed and demonstrated a novel switchable single-longitudinal-mode (SLM), dual-wavelength erbium-doped fiber laser (DWEDFL) assisted by Rayleigh backscattering (RBS) in a tapered fiber in a ring laser configuration. The RBS feedback in a tapered fiber is a key mechanism as linewidth narrowing for laser output. A compound laser cavity ensured that the EDFL operated in the SLM state and a saturable absorber (SA) is employed to form a gain grating for both filtering and improving wavelength stability. The fiber laser can output dual wavelengths simultaneously or operate at single wavelength in a switchable manner. Experiment results show that withmore » the proper SA, the peak power drift was improved from 1–2 dB to 0.31 dB and the optical signal to noise ratio was higher than 60 dB. Under the assistance of RBS feedback, the laser linewidths are compressed by around three times and the Lorentzian 3 dB linewidths of 445 Hz and 425 Hz are obtained at 1550 nm and 1554 nm, respectively.« less

Fractional erbium-doped yttrium aluminum garnet laser-assisted drug delivery of hydroquinone in the treatment of melasma

PubMed Central

Badawi, Ashraf M; Osman, Mai Abdelraouf

2018-01-01

Background Melasma is a difficult-to-treat hyperpigmentary disorder. Ablative fractional laser (AFL)-assisted delivery of topically applied drugs to varied targets in the skin has been an area of ongoing study and research. Objective The objective of this study was to evaluate the efficacy and safety of fractional erbium-doped yttrium aluminum garnet (Er:YAG) laser as an assisted drug delivery for enhancing topical hydroquinone (HQ) permeation into the skin of melasma patients. Patients and methods Thirty female patients with bilateral melasma were randomly treated in a split-face controlled manner with a fractional Er:YAG laser followed by 4% HQ cream on one side and 4% HQ cream alone on the other side. All patients received six laser sessions with a 2-week interval. The efficacy of treatments was determined through photographs, dermoscopic photomicrographs and Melasma Area Severity Index (MASI) score, all performed at baseline and at 12 weeks of starting therapy. The patient’s level of satisfaction was also recorded. Results Er:YAG laser + HQ showed significantly better results (p<0.005) with regard to decrease in the degree of pigmentation as assessed on the 4-point scale than HQ alone. There was a significant decrease in MASI scores on Er:YAG laser + HQ side vs HQ side. Minor reversible side effects were observed on both sides. Conclusion AFL-assisted delivery of HQ is a safe and effective method for the treatment of melasma. PMID:29379308

Inhibition of enamel demineralisation using "Nd-YAG and diode laser assisted fluoride therapy".

PubMed

Chand, B R; Kulkarni, S; Mishra, P

2016-02-01

This in vitro study was to evaluate the irradiation efficacy of the Diode laser and the Nd-YAG laser either un-assisted or assisted by acidulated phosphate fluoride (APF) treatment on enamel's acid resistance. Seventy-two enamel samples, obtained from 12 extracted human molars, were randomly assigned to 6 groups as follows: (1) Control (C); (2) Exposed to APF gel (F); (3) Diode laser (DL); (4) Irradiated with Diode laser through APF gel (DL/F); (5) Nd-YAG laser (NL) and (6) Irradiated with Nd-YAG laser through APF gel (NL/F). The specimens were individually demineralised in an acidified hydroxyethylcellulose system, and the acid resistance was evaluated by determining the calcium ion dissolution using atomic absorption spectrometry. The average concentration of the calcium ion determined in groups 1 to 6 was 901, 757, 736, 592, 497 and 416 parts per million micrograms/gram, respectively. The results showed that demineralisation in the NL/F group was significantly less than the other groups and the control group was significantly greater than the other groups (P < 0.001). The effect of Nd-YAG laser irradiation, used alone or in combination with APF, in decreasing the enamel demineralisation was greater than all the other groups.

Laser-assisted marking for toric intraocular lens alignment.

PubMed

Dick, H Burkhard; Schultz, Tim

2016-01-01

We describe a technique of 3-dimensional spectral-domain optical coherence tomography-controlled laser-assisted corneal marking for toric intraocular lens implantation. To facilitate accurate alignment, the technique creates 2 perpendicular intrastromal incisions (width 0.75 mm) using an image-guided femtosecond laser. This was performed in a case series comprising 10 eyes of 10 patients. No posterior corneal perforation or epithelial alterations occurred. The incisions were plainly visible under the operating microscope, and no optical phenomena were reported 6 weeks after surgery. Laser-assisted marking can be performed safely and has the potential to enable precise axis marking. Dr. Dick is a paid consultant to Abbott Medical Optics, Inc. Dr. Schultz has no financial or proprietary interest in any material or method mentioned. Copyright © 2016 ASCRS and ESCRS. Published by Elsevier Inc. All rights reserved.

Peripheral laser assisted angioplasty: results, complications and follow-up.

PubMed

Owen, E R; Moussa, S A; Lewis, J D; Wilkins, R A

1990-04-01

Detailed results including complications and ultimate outcome of 24 laser assisted angioplasties in 22 patients are presented. Despite the enthusiasm expressed in other published reports, we remain sceptical of the value of laser using a 1.5 mm 'hot-tip' probe for assisting angioplasty of peripheral occlusions. The tendency for this type of probe to damage the vessel wall and in so doing prohibit the use of subsequent balloon dilatation is a major problem. In this small series the long-term patency was not improved compared with conventional angioplasty. We have established the relative safety of this laser technique and further advances in probe design may lead to greater success in crossing long lesions. Long-term maintenance of patency in these diseased arteries will need further advances in technique and assessment preferably by a controlled trial.

Efficacious insect and disease control with laser-guided air-assisted sprayer

USDA-ARS?s Scientific Manuscript database

Efficacy of a newly developed air-assisted variable-rate sprayer was investigated for the control of arthropod pests and plant diseases in six commercial fields. The sprayer was integrated with a high-speed laser scanning sensor, a custom-designed signal processing program, an automatic flow control...

Direct analysis of triterpenes from high-salt fermented cucumbers using infrared matrix-assisted laser desorption electrospray ionization (IR-MALDESI)

USDA-ARS?s Scientific Manuscript database

High-salt samples present a challenge to mass spectrometry (MS) analysis, particularly when electrospray ionization (ESI) is used, requiring extensive sample preparation steps such as desalting, extraction, and purification. In this study, infrared matrix-assisted laser desorption electrospray ioniz...

MATRIX-ASSISTED LASER DESORPTION IONIZATION OF SIZE AND COMPOSITION SELECTED AEROSOL PARTICLES. (R823980)

EPA Science Inventory

Matrix-assisted laser desorption/ionization (MALDI) was performed on individual,
size-selected aerosol particles in the 2-8 mu m diameter range, Monodisperse aerosol droplets
containing matrix, analyte, and solvent were generated and entrained in a dry stream of air, The dr...

Detection of trace ink compounds in erased handwritings using electrospray-assisted laser desorption ionization mass spectrometry.

PubMed

Kao, Yi-Ying; Cheng, Sy-Chyi; Cheng, Chu-Nian; Shiea, Jentaie; Ho, Hsiu-O

2014-06-01

Writings made with erasable pens on paper surfaces can either be rubbed off with an eraser or rendered invisible by changing the temperature of the ink. However, trace ink compounds still remain in the paper fibers even after rubbing or rendering. The detection of these ink compounds from erased handwritings will be helpful in knowing the written history of the paper. In this study, electrospray-assisted laser desorption ionization/mass spectrometry was used to characterize trace ink compounds remaining in visible and invisible ink lines. The ink compounds were desorbed from the paper surface by irradiating the handwritings with a pulsed laser beam; the desorbed analytes were subsequently ionized in an electrospray plume and detected by a quadrupole time-of-flight mass spectrometry mass analyzer. Because of the high spatial resolution of the laser beam, electrospray-assisted laser desorption ionization/mass spectrometry analysis resulted in minimal damage to the sample documents. Copyright © 2014 John Wiley & Sons, Ltd.

Effect of metal surfaces on matrix-assisted laser desorption/ionization analyte peak intensities.

PubMed

Kancharla, Vidhyullatha; Bashir, Sajid; Liu, Jingbo L; Ramirez, Oscar M; Derrick, Peter J; Beran, Kyle A

2017-10-01

Different metal surfaces in the form of transmission electron microscope grids were examined as support surfaces in matrix-assisted laser desorption/ionization time-of-flight mass spectrometry with a view towards enhancement of peptide signal intensity. The observed enhancement between 5-fold and 20-fold relative to the normal stainless steel slide was investigated by applying the thermal desorption model for matrix-assisted laser desorption/ionization. A simple model evaluates the impact that the thermal properties of the metals have on the ion yield of the analyte. It was observed that there was not a direct, or strong, correlation between the thermal properties of the metals and the corresponding ion yield of the peptides. The effects of both fixed and variable laser irradiances versus ion yield were also examined for the respective metals studied. In all cases the use of transmission electron microscope grids required much lower laser irradiances in order to generate similar peak intensities as those observed with a stainless steel surface.

An experimental investigation of pulsed laser-assisted machining of AISI 52100 steel

NASA Astrophysics Data System (ADS)

Panjehpour, Afshin; Soleymani Yazdi, Mohammad R.; Shoja-Razavi, Reza

2014-11-01

Grinding and hard turning are widely used for machining of hardened bearing steel parts. Laser-assisted machining (LAM) has emerged as an efficient alternative to grinding and hard turning for hardened steel parts. In most cases, continuous-wave lasers were used as a heat source to cause localized heating prior to material removal by a cutting tool. In this study, an experimental investigation of pulsed laser-assisted machining of AISI 52100 bearing steel was conducted. The effects of process parameters (i.e., laser mean power, pulse frequency, pulse energy, cutting speed and feed rate) on state variables (i.e., material removal temperature, specific cutting energy, surface roughness, microstructure, tool wear and chip formation) were investigated. At laser mean power of 425 W with frequency of 120 Hz and cutting speed of 70 m/min, the benefit of LAM was shown by 25% decrease in specific cutting energy and 18% improvement in surface roughness, as compared to those of the conventional machining. It was shown that at constant laser power, the increase of laser pulse energy causes the rapid increase in tool wear rate. Pulsed laser allowed efficient control of surface temperature and heat penetration in material removal region. Examination of the machined subsurface microstructure and microhardness profiles showed no change under LAM and conventional machining. Continuous chips with more uniform plastic deformation were produced in LAM.

Information computer program for laser therapy and laser puncture

NASA Astrophysics Data System (ADS)

Badovets, Nadegda N.; Medvedev, Andrei V.

1995-03-01

An informative computer program containing laser therapy and puncture methods has been developed. It was used successfully in connection with the compact Russian medical laser apparatus HELIOS-O1M in laser treatment and the education process.

Boron nitride microfibers grown by plasma-assisted laser chemical vapor deposition without a metal catalyst

NASA Astrophysics Data System (ADS)

Komatsu, Shojiro; Kazami, Daisuke; Tanaka, Hironori; Shimizu, Yoshiki; Moriyoshi, Yusuke; Shiratani, Masaharu; Okada, Katsuyuki

2006-04-01

Boron nitride fibers were found to grow on polycrystalline nickel and Si (100) substrates by plasma-assisted laser chemical vapor deposition from B2H6+NH3 using an excimer laser at 193nm. Their diameter was typically a few hundreds of nanometers, while the length was a few tens of micrometers. They were stoichiometric or boron-rich BN in chemical composition. When the substrate was rotated during deposition, spiral fibers were found to grow. We conclude that they grew with the help of laser light by other than the vapor - liquid - solid mechanism.

Using bone densitometry to monitor therapy in treating osteoporosis: pros and cons.

PubMed

Deal, C L

2001-06-01

Measurement of bone density is crucial for evaluating fracture risk. Low bone mass is a powerful predictor of fracture and is necessary to assess the need for treatment. Dual energy x-ray absorptiometry is accurate and precise. Use of bone density for monitoring therapy is an important tool for evaluating response to therapy, but an understanding of the limitations of the procedure are important for the practicing physician. Precision error of the technology and what change in density is clinically significant (least significant change) are important concepts to interpret results and make appropriate treatment decisions. This article reviews the use of bone densitometry as a tool for monitoring treatment in patients with low bone mass.

Laser-assisted photothermal imprinting of nanocomposite

NASA Astrophysics Data System (ADS)

Lu, Y.; Shao, D. B.; Chen, S. C.

2004-08-01

We report on a laser-assisted photothermal imprinting method for directly patterning carbon nanofiber-reinforced polyethylene nanocomposite. A single laser pulse from a solid state Nd :YAG laser (10ns pluse, 532 and 355nm wavelengths) is used to melt/soften a thin skin layer of the polymer nanocomposite. Meanwhile, a fused quartz mold with micro sized surface relief structures is pressed against the surface of the composite. Successful pattern transfer is realized upon releasing the quartz mold. Although polyethylene is transparent to the laser beam, the carbon nanofibers in the high density polyethylene (HDPE) matrix absorb the laser energy and convert it into heat. Numerical heat conduction simulation shows the HDPE matrix is partially melted or softened, allowing for easier imprinting of the relief pattern of the quartz mold.

Laser-assisted subepithelial keratectomy versus epipolis laser in situ keratomileusis for myopia: a meta-analysis of clinical outcomes.

PubMed

Wen, Daizong; Huang, Jinhai; Li, Xuexi; Savini, Giacomo; Feng, Yifan; Lin, Qiaoya; Wang, Qinmei

2014-01-01

To identify possible differences between laser-assisted subepithelial keratectomy and epipolis laser in situ keratomileusis for myopia. Meta-analysis. Patients from previously reported comparative studies treated by laser-assisted subepithelial keratectomy versus epipolis laser in situ keratomileusis. A systematic literature retrieval was conducted in the MEDLINE, EMBASE and Cochrane Library, up to January 2013. The included studies were subject to a meta-analysis using a RevMan 5.1 version software. The differences in efficacy, predictability, safety, epithelial healing time, pain perception and corneal haze formation. A total of six studies involving 517 eyes were included. There were no statistically significant differences in the final proportion of eyes with uncorrected visual acuity of 6/6 or better (P = 0.43), mean postoperative uncorrected visual acuity (P = 0.53), final proportion of eyes with refraction within ± 0.50 D (P = 0.62) and ± 1.00 D (P = 0.16) of target, final proportion of eyes losing two or more lines of best spectacle-corrected visual acuity (P = 1.00), healing time of corneal epithelium (P = 0.58), final proportion of eyes with corneal haze grade 0.5 or higher (P = 0.26), and corneal haze levels (P = 0.36). There were no significant differences in efficacy, predictability, safety, epithelial healing time and corneal haze formation between laser-assisted subepithelial keratectomy and epipolis laser in situ keratomileusis, but the result was limited. Future more data are required to detect the potential differences between the two procedures. © 2013 Royal Australian and New Zealand College of Ophthalmologists.

[Evaluation of bone mineral density in children with sickle cell disease].

PubMed

Garrido Colino, C; Beléndez Bieler, C; Pérez Díaz, M; Cela de Julián, E

2015-04-01

To evaluate bone mineral density (BMD) in children with sickle cell disease (SCD) in the Community of Madrid. The BMD was estimated in 40 children with SCD, and with an age range between 3 and 16 years, using densitometry (DXA), as recommended by the International Society for Clinical Densitometry (ISCD). The mean age at the time of the study was 7.97±3.95 years, the mean value of the DXA expressed in Z -score was -0.91±1.46 with a range of minimum values - 5.30 and 2.30 maximum. More than half (57.5%) of all the children had normal BMD (Z>-1), 25% had low BMD (Z between -1 and -2), and 17.5% showed an abnormal Z -score values of osteoporosis (Z -score<-2). The Pearson linear correlation was statistically significant between Z -score value and the haemoglobin level (r=0.368, p=.019), finding no correlation with the levels of 25 (OH) vitamin D. Prospective studies are needed with a larger number of patients to understand the future implications of bone densitometry changes and associated risk factors. Copyright © 2013 Asociación Española de Pediatría. Published by Elsevier España, S.L.U. All rights reserved.

A systematic quality assurance study in bone densitometry devices

NASA Astrophysics Data System (ADS)

Tuncman, Duygu; Kovan, Hatice; Kovan, Bilal; Demir, Bayram; Turkmen, Cuneyt

2015-07-01

Osteoporosis is the most common metabolic bone disease and can result in devastating physical, psychosocial, and economic consequences. It occurs in women after menopause and affects most elderly. Dual-energy x-ray absorptiometry (DXA) is currently the most widely used method for the measurement of areal Bone Mineral Density (BMD) (g/cm2) .DXA is based on the variable absorption of X-ray by the different body components and uses high and low energy X-ray photons. There are two important values in the assessment of the DXA. These values are T-score and Z-score. The T-score is calculated by taking the difference between a patient's measured BMD with the mean BMD of the young normal population, matched for gender and ethnicity, and then by dividing the difference with the standard deviation (SD) of the BMD of the young normal population. T-score and also Z-score are directly depends on the Bone Mineral Density (BMD). BMD measurements should be made periodically in a patient life. But mostly, it is not possible with the same device. Therefore, in this study, for the quality assurance of bone densitometry devices, we evaluated the BMD results measured in the different Bone Densitometry (DXA) devices using a spine phantom.

DIFFERENTIATION OF AEROMONAS ISOLATES OBTAINED FROM DRINKING WATER DISTRIBUTION SYSTEM USING MATRIX-ASSISTED LASER DESCRIPTION/IONIZATION-MASS SPECTROMETRY (MALDI-MS)

EPA Science Inventory

The genus Aeromonas is one of several medically significant genera that have gained prominence due to their evolving taxonomy and controversial role in human diseases. In this study, matrix-assisted laser desorption/ionization-mass spectrometry (MALDI-MS) was used to analyze the...

THE USE OF MATRIX-ASSISTED LASER DESORPTION/IONIZATION-MASS SPECTROMETRY FOR THE IDENTIFICATION OF AEROMONAS ISOLATES OBTAINED FROM WATER DISTRIBUTION SYSTEMS

EPA Science Inventory

Matrix-assisted laser desorption/ionization-mass spectrometry (MALDI-MS) has long been established as a tool by which microorganisms can be characterized and identified. EPA is investigating the potential of using this technology as a way to rapidly identify Aeromonas species fo...

Identification of Bacteria Using Matrix-Assisted Laser Desorption Ionization Time-of-Flight Mass Spectrometry

ERIC Educational Resources Information Center

Kedney, Mollie G.; Strunk, Kevin B.; Giaquinto, Lisa M.; Wagner, Jennifer A.; Pollack, Sidney; Patton, Walter A.

2007-01-01

Matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS or simply MALDI) has become ubiquitous in the identification and analysis of biomacromolecules. As a technique that allows for the molecular weight determination of otherwise nonvolatile molecules, MALDI has had a profound impact in the molecular…

Thermal damage control of dye-assisted laser tissue welding: effect of dye concentration

NASA Astrophysics Data System (ADS)

Xie, Hua; Buckley, Lisa A.; Prahl, Scott A.; Shaffer, Brian S.; Gregory, Kenton W.

2001-05-01

Successful laser-assisted tissue welding was implemented to provide proper weld strength with minimized tissue thermal injury. We investigated and compared the weld strengths and morphologic changes in porcine small intestinal submucose (SIS) and porcine ureteral tissues with various concentration of indocyanine green (ICG) and with a solid albumin sheet. The study showed that the tissues were welded at lower ICG concentration (0.05 mM) with minimized tissue thermal damage using an 800-nm wavelength diode laser.

Second-wave hydrodissection for aspiration of cortical remains after femtosecond laser-assisted cataract surgery.

PubMed

Lake, Jonathan C; Boianovsky, Celso; de Faria Pacini, Thiago; Crema, Armando

2018-06-14

We describe the technique of second-wave hydrodissection (the first wave being the initial cortical cleaving hydrodissection) performed after the removal of the cataract nucleus in femtosecond laser-assisted cataract surgery. After femtosecond laser application, the cortex is typically found adhered to the anterior capsule. Under high magnification, a steady stream of a balanced salt solution is directed toward the anterior capsule using a hydrodissection cannula. Full cleavage of the remaining cortex is observed by noting the appearance of a dark inner circle by the capsulotomy edge once the balanced salt solution wave has separated the cortex from the capsule. Irrigation/aspiration (I/A) of the cortical remains after the second wave is faster than I/A without this step in femtosecond laser-assisted cataract surgery. Copyright © 2018 ASCRS and ESCRS. Published by Elsevier Inc. All rights reserved.

Drawing a different picture with pencil lead as matrix-assisted laser desorption/ionization matrix for fullerene derivatives.

PubMed

Nye, Leanne C; Hungerbühler, Hartmut; Drewello, Thomas

2018-02-01

Inspired by reports on the use of pencil lead as a matrix-assisted laser desorption/ionization matrix, paving the way towards matrix-free matrix-assisted laser desorption/ionization, the present investigation evaluates its usage with organic fullerene derivatives. Currently, this class of compounds is best analysed using the electron transfer matrix trans-2-[3-(4-tert-butylphenyl)-2-methyl-2-propenylidene] malononitrile (DCTB), which was employed as the standard here. The suitability of pencil lead was additionally compared to direct (i.e. no matrix) laser desorption/ionization-mass spectrometry. The use of (DCTB) was identified as the by far gentler method, producing spectra with abundant molecular ion signals and much reduced fragmentation. Analytically, pencil lead was found to be ineffective as a matrix, however, appears to be an extremely easy and inexpensive method for producing sodium and potassium adducts.

Comparison of Blood Loss in Laser Lipolysis vs Traditional Liposuction.

PubMed

Abdelaal, Mohammed Mahmoud; Aboelatta, Yasser Abdallah

2014-08-01

Laser-assisted liposuction has been associated with reduced blood loss. However, this clinical finding has not been evaluated objectively. In this study, the authors objectively estimated the blood loss volume associated with laser lipolysis vs traditional liposuction in various anatomic regions. In this prospective study, 56 patients underwent equal amounts of traditional and laser-assisted liposuction at 2 contralateral anatomic sites. Blood loss volumes were calculated from the lipoaspirates by measuring hemoglobin and red blood cell content. The data were analyzed statistically with repeated-measures analysis of variance and the Mann-Whitney U test. Laser lipolysis can reduce blood loss by more than 50% compared with traditional liposuction. Laser lipolysis resulted in significant reductions in mean blood loss volumes in the abdomen, flanks, back, and breast. The authors provide objective evidence that laser lipolysis significantly reduces blood loss compared with traditional liposuction. 3. © 2014 The American Society for Aesthetic Plastic Surgery, Inc.

Infrared photodissociation spectroscopy of protonated neurotransmitters in the gas phase

NASA Astrophysics Data System (ADS)

MacLeod, N. A.; Simons, J. P.

2007-03-01

Protonated neurotransmitters have been produced in the gas phase via a novel photochemical scheme: complexes of the species of interest, 1-phenylethylamine, 2-amino-1-phenylethanol and the diastereo-isomers, ephedrine and pseudoephedrine, with a suitable proton donor, phenol (or indole), are produced in a supersonic expansion and ionized by resonant two photon ionization of the donor. Efficient proton transfer generates the protonated neurotransmitters, complexed to a phenoxy radical. Absorption of infrared radiation, and subsequent evaporation of the phenoxy tag, coupled with time of flight mass spectrometry, provides vibrational spectra of the protonated (and also hydrated) complexes for comparison with the results of quantum chemical computation. Comparison with the conformational structures of the neutral neurotransmitters (established previously) reveals the effect of protonation on their structure. The photochemical proton transfer strategy allows spectra to be recorded from individual laser shots and their quality compares favourably with that obtained using electro-spray or matrix assisted laser desorption ion sources.

Safety, efficacy and efficiency of laser-assisted IVF in subfertile mutant mouse strains

PubMed Central

Li, Ming-Wen; Kinchen, Kristy L; Vallelunga, Jadine M; Young, Diana L; Wright, Kaleb D K; Gorano, Lisa N; Wasson, Katherine; Lloyd, K C Kent

2013-01-01

In the present report we studied the safety, efficacy and efficiency of using an infrared laser to facilitate IVF by assessing fertilization, development and birth rates after laser-zona drilling (LZD) in 30 subfertile genetically modified (GM) mouse lines. We determined that LZD increased the fertilization rate four to ten times that of regular IVF, thus facilitating the derivation of 26 of 30 (86.7%) GM mouse lines. Cryopreserved two-cell stage embryos derived by LZD-assisted IVF were recovered and developed to blastocysts in vitro at the same rate as frozen–thawed embryos derived by regular IVF. Surprisingly after surgical transfer to pseudopregnant recipients the birth rate of embryos derived by LZD-assisted IVF was significantly lower than that of embryos derived by regular IVF. However this result could be completely mitigated by the addition of 0.25 M sucrose to the culture medium during LZD which caused the oocyte to shrink in volume relative to the perivitelline space. By increasing the distance from the laser target site on the zona pellucida, we hypothesize that the hyperosmotic effect of sucrose reduced the potential for laser-induced cytotoxic thermal damage to the underlying oocytes. With appropriate preparation and cautious application, our results indicate that LZD-assisted IVF is a safe, efficacious and efficient assisted reproductive technology for deriving mutant mouse lines with male factor infertility and subfertility caused by sperm–zona penetration defects. PMID:23315689

Estimating Body Composition in Adolescent Sprint Athletes: Comparison of Different Methods in a 3 Years Longitudinal Design

PubMed Central

Aerenhouts, Dirk

2015-01-01

A recommended field method to assess body composition in adolescent sprint athletes is currently lacking. Existing methods developed for non-athletic adolescents were not longitudinally validated and do not take maturation status into account. This longitudinal study compared two field methods, i.e., a Bio Impedance Analysis (BIA) and a skinfold based equation, with underwater densitometry to track body fat percentage relative to years from age at peak height velocity in adolescent sprint athletes. In this study, adolescent sprint athletes (34 girls, 35 boys) were measured every 6 months during 3 years (age at start = 14.8 ± 1.5yrs in girls and 14.7 ± 1.9yrs in boys). Body fat percentage was estimated in 3 different ways: 1) using BIA with the TANITA TBF 410; 2) using a skinfold based equation; 3) using underwater densitometry which was considered as the reference method. Height for age since birth was used to estimate age at peak height velocity. Cross-sectional analyses were performed using repeated measures ANOVA and Pearson correlations between measurement methods at each occasion. Data were analyzed longitudinally using a multilevel cross-classified model with the PROC Mixed procedure. In boys, compared to underwater densitometry, the skinfold based formula revealed comparable values for body fatness during the study period whereas BIA showed a different pattern leading to an overestimation of body fatness starting from 4 years after age at peak height velocity. In girls, both the skinfold based formula and BIA overestimated body fatness across the whole range of years from peak height velocity. The skinfold based method appears to give an acceptable estimation of body composition during growth as compared to underwater densitometry in male adolescent sprinters. In girls, caution is warranted when interpreting estimations of body fatness by both BIA and a skinfold based formula since both methods tend to give an overestimation. PMID:26317426

Effect of chronic smoking on lens nucleus as assessed by Pentacam HR lens densitometry in young adults.

PubMed

Pekel, Gökhan; Cetin, Ebru Nevin; Acer, Semra; Yagci, Ramazan; Altintas, Seher; Ongun, Gülin Tugba

2014-06-01

To evaluate the effects of chronic tobacco smoking on lens nucleus by Pentacam HR lens densitometry (LD) in young adults. Prospective cross-sectional case series. Thirty subjects (23 M, 7 F) who were chronic cigarette smokers (≥10 cigarettes/day for at least 2 years) (group 1) and another 30 subjects (23 M, 7 F) who did not smoke (group 2), were included in this study. The patients were matched for age and sex between the groups. The exclusion criteria were any history of ocular surgery, any systemic disorders and any ocular diseases except for mild refractive disorders. Lens densitometry measurements were done with the Pentacam HR (Oculus, Wetzlar, Germany). The Schirmer test and pachymetry measurements were also performed. Mean age of the patients for both groups was 28.90 ± 8.20 years (range: 18-40 years). Mean lens densitometry (LD) measurements of Group 1 (chronic cigarette smoking group) were higher than those of Group 2 (control group) in all LD techniques; however only mean "peak" LD measurements showed a statistically significant difference between these two groups (Group 1: 8.67 ± 0.61, Group 2: 8.44 ± 0.70, p = 0.04). The mean Schirmer test value was 12.43 ± 5.60 mm in Group 1 and 13.00 ± 4.26 mm in Group 2 (p = 0.55). The mean central corneal thickness (CCT) value was 564.23 ± 34.61 µm in Group 1 and 550.47 ± 32.94 µm in Group 2 (p = 0.03). The Pentacam HR LD seems to be an important option for the evaluation of lens nucleus in young adults, because it gives objective and quantitative data. Although chronic smoking increases lens nucleus density in young adults, the effect is not statistically significant when compared with the control group.

Femtosecond Laser-Assisted Descemetorhexis: A Novel Technique in Descemet Membrane Endothelial Keratoplasty.

PubMed

Pilger, Daniel; von Sonnleithner, Christoph; Bertelmann, Eckart; Joussen, Antonia M; Torun, Necip

2016-10-01

To explore the feasibility of femtosecond laser-assisted descemetorhexis (DR) to facilitate Descemet membrane endothelial keratoplasty (DMEK) surgery. Six pseudophakic patients suffering from Fuchs' endothelial dystrophy underwent femtosecond laser-assisted DMEK surgery. DR was performed using the LenSx femtosecond laser, followed by manual removal of the Descemet membrane. Optical coherence tomography images were used to measure DR parameters. Patients were followed up for 1 month to examine best corrected visual acuity, endothelial cell loss, flap detachment, and structure of the anterior chamber of the eye. The diameter of the DR approximated the intended diameter closely [mean error of 34 μm (0.45%) and 54 μm (0.67%) in the x- and y-diameter, respectively] and did not require manual correction. The median visual acuity increased from 0.4 logMAR (range 0.6-0.4 logMAR) preoperative to 0.2 logMAR (range 0-0.4 logMAR) postoperative. The median endothelial cell loss was 22% (range 7%-34%). No clinically significant flap detachments were noted. All patients had clear corneas after surgery, and no side effects or damage to structures of the anterior chamber were noted. Femtosecond laser-assisted DR is a safe and precise method for facilitating DMEK surgery.

Electron-molecule scattering in a strong laser field: Two-center interference effects

NASA Astrophysics Data System (ADS)

Dakić, J.; Habibović, D.; Čerkić, A.; Busuladžić, M.; Milošević, D. B.

2017-10-01

Laser-assisted scattering of electrons on diatomic molecules is considered using the S -matrix theory within the second Born approximation. The first term of the expansion in powers of the scattering potential corresponds to the direct or single laser-assisted scattering of electrons on molecular targets, while the second term of this expansion corresponds to the laser-assisted rescattering or double scattering. The rescattered electrons may have considerably higher energies in the final state than those that scattered only once. For multicenter polyatomic molecules scattering and rescattering may happen at any center and in any order. All these cases contribute to the scattering amplitude and the interference of different contributions leads to an increase or a decrease of the differential cross section in particular electron energy regions. For diatomic molecules there are two such contributions for single scattering and four contributions for double scattering. Analyzing the spectra of the scattered electrons, we find two interesting effects. For certain molecular orientations, the plateaus in the electron energy spectrum, characteristic of laser-assisted electron-atom scattering, are replaced by a sequence of gradually declining maxima, caused by the two-center interference effects. The second effect is the appearance of symmetric U -shaped structures in the angle-resolved energy spectra, which are described very well by the analytical formulas we provide.

Effects of Short-term Preoperative Topical Ketorolac on Pupil Diameter in Eyes Undergoing Femtosecond Laser-Assisted Capsulotomy.

PubMed

Diakonis, Vasilios F; Kontadakis, Georgios A; Anagnostopoulos, Apostolos G; Yesilirmak, Nilufer; Waren, Daniel P; Cabot, Florence; Yoo, Sonia H; Donaldson, Kendall E

2017-04-01

To assess pupil diameter before and after femtosecond laser-assisted capsulotomy in patients who were pretreated with a short-term topical nonsteroidal anti-inflammatory drug (NSAID) (ketorolac) versus those without pretreatment. This prospective, randomized, observational case series included consecutive patients scheduled to undergo cataract extraction using the Catalys femtosecond laser platform (Abbott Medical Optics, Inc., Santa Ana, CA) to perform only capsulotomies. The same protocol for preoperative medical mydriasis was used for all patients, whereas pupil diameter was assessed using a surgical ruler immediately before and 3 minutes after femtosecond laser-assisted capsulotomy. The patients were divided into two groups: one received short-term topical ketorolac preoperatively and the other did not receive NSAID pretreatment (control). A total of 42 eyes of 42 patients (1 eye per patient) were included in the study. Mean pupillary miosis was 0.79 ± 1.08 and 1.57 ± 1.19 mm for the ketorolac and control groups, respectively. There was a statistically significant decrease in pupil diameter for both groups individually (P < .05). There was also a statistically significant difference between the two groups (P < .05) with the induced miosis in the eyes that did not receive topical NSAIDs prior to cataract extraction being twofold greater when compared with the miosis of the eyes that received ketorolac pretreatment. Short-term topical use of ketorolac prior to femtosecond laser-assisted cataract surgery seems to induce significantly less pupillary miosis in comparison to eyes that did not receive NSAID pretreatment. NSAID use is advised prior to femtosecond laser-assisted cataract surgery to minimize pupil miosis-related surgical difficulties or complications during cataract extraction. [J Refract Surg. 2017;33(4):230-234.]. Copyright 2017, SLACK Incorporated.

Whom should we SPY? A cost analysis of laser-assisted indocyanine green angiography in prevention of mastectomy skin flap necrosis during prosthesis-based breast reconstruction.

PubMed

Kanuri, Arjun; Liu, Allen S; Guo, Lifei

2014-04-01

Skin flap necrosis is the most common complication following prosthesis-based breast reconstruction. Many studies have reported on the efficacy of laser-assisted indocyanine green angiography (SPY Elite System) in detecting flap necrosis. A cost-effectiveness analysis of laser-assisted indocyanine green angiography is lacking. The authors performed a retrospective review of all consecutive immediate postmastectomy prosthesis-based reconstructions at the Brigham and Women's Hospital over a 7-year 10-month period. The rate of mastectomy skin flap necrosis and related implant loss was determined for the entire cohort and for the subgroups of patients at increased risk for developing this complication: smokers, obese patients, and patients with large breasts. Cost of treating implant loss and skin flap necrosis was calculated based on the average treatment courses and costs at the authors' institution. The cost of the SPY was obtained from LifeCell Corp. From January of 2004 through October of 2011, 79 of 710 prosthesis-based breast reconstructions (11.1 percent) developed mastectomy skin flap necrosis requiring excision and reclosure. Performing laser-assisted indocyanine green angiography on the entire cohort would result in an additional cost of $1537.30 per case of flap necrosis prevented. If laser-assisted indocyanine green angiography was performed on only these high-risk subgroups, the cost savings per case of flap necrosis prevented is $2098.80 for smokers, $5162.30 for patients with a body mass index greater than 30, and $1892.70 for patients with mastectomy weight greater than 800 g. Laser-assisted indocyanine green angiography is not cost-effective as a preventative measure for flap necrosis if used indiscriminately on all patients undergoing prosthesis-based breast reconstructions, but it is cost-effective for high-risk patients, such as smokers, obese patients, and patients with large breasts.

Time Average Holography Study of Human Tympanic Membrane with Altered Middle Ear Ossicular Chain

NASA Astrophysics Data System (ADS)

Cheng, Jeffrey T.; Ravicz, Michael E.; Rosowski, John J.; Hulli, Nesim; Hernandez-Montes, Maria S.; Furlong, Cosme

2009-02-01

Computer-assisted time average holographic interferometry was used to study the vibration of the human tympanic membrane (TM) in cadaveric temporal bones before and after alterations of the ossicular chain. Simultaneous laser Doppler vibrometer measurements of stapes velocity were performed to estimate the conductive hearing loss caused by ossicular alterations. The quantified TM motion described from holographic images was correlated with stapes velocity to define relations between TM motion and stapes velocity in various ossicular disorders. The results suggest that motions of the TM are relatively uncoupled from stapes motion at frequencies above 1000 Hz.

Laser-assisted corneal welding in cataract surgery: retrospective study.

PubMed

Menabuoni, Luca; Pini, Roberto; Rossi, Francesca; Lenzetti, Ivo; Yoo, Sonia H; Parel, Jean-Marie

2007-09-01

To evaluate the efficacy of laser welding to close corneal wounds in cataract surgery. Department of Ophthalmology, Hospital of Misericordia e Dolce, Prato, Italy. This retrospective nonrandomized interventional case series included 20 eyes of 20 patients. All eyes had cataract with visual acuity worse than 20/200. Ten patients had phacoemulsification surgery, and 10 had extracapsular cataract extraction (ECCE). Surgeries were followed by laser-assisted closure of the corneal wounds by diode laser welding of the stroma using a technique established in animal models. Preoperative and postoperative (1, 3, 7, 30, and 90 days) astigmatism, level of inflammation, Seidel testing, and endothelial cell counts were obtained. There were minor differences in preoperative and postoperative astigmatism except in 1 eye in the ECCE group. The Seidel test showed no wound leakage during the follow-up examinations, and endothelial cell loss was similar to that published for standard surgical cataract procedures. No collateral effects of the laser welding were detected, nor was postoperative inflammation. Astigmatism was slightly affected by the use of laser welding for corneal wound closure after phacoemulsification and ECCE. The laser-assisted corneal sealing procedure was rapid and safe and could serve as an alternative to corneal suturing, with significant potential applications for the closure of longer incisions, such as those used in penetrating keratoplasty.

Diode Laser Assisted Filament Winding of Thermoplastic Matrix Composites

PubMed Central

Quadrini, Fabrizio; Squeo, Erica Anna; Prosperi, Claudia

2010-01-01

A new consolidation method for the laser-assisted filament winding of thermoplastic prepregs is discussed: for the first time a diode laser is used, as well as long glass fiber reinforced polypropylene prepregs. A consolidation apparatus was built by means of a CNC motion table, a stepper motor and a simple tensioner. Preliminary tests were performed in a hoop winding configuration: only the winding speed was changed, and all the other process parameters (laser power, distance from the laser focus, consolidation force) were kept constant. Small wound rings with an internal diameter of 25 mm were produced and compression tests were carried out to evaluate the composite agglomeration in dependence of the winding speed. At lower winding speeds, a strong interpenetration of adjacent layers was observed.

Fiber laser with combined feedback of core and cladding modes assisted by an intracavity long-period grating.

PubMed

Sáez-Rodriguez, D; Cruz, J L; Díez, A; Andrés, M V

2011-05-15

We present a fiber laser made in a single piece of conventional doped-core fiber that operates by combined feedback of the fundamental core mode LP((0,1)) and the high-order cladding mode LP((0,10)). The laser is an all-fiber structure that uses two fiber Bragg gratings and a long-period grating to select the modes circulating in the cavity; the laser emits at the coupling wavelength between the core mode LP((0,1)) and the counterpropagating cladding mode LP((0,10)) in the Bragg gratings. This work demonstrates the feasibility of high-order mode fiber lasers assisted by long-period gratings. © 2011 Optical Society of America

Optically-Based Diagnostics for Gas-Phase Laser Development

DTIC Science & Technology

2010-08-01

Laser (COIL), Electric Oxygen Iodine Laser (EOIL), Diode-Pumped Alkali Laser (DPAL), and Exciplex Alkali Laser (XPAL). The papers at this Symposium... exciplex -assisted absorption and laser-induced fluorescence, and multi-photon excitation of infrared atomic alkali transitions.11,12 In this paper... EXCIPLEX LASER SYSTEMS Proper review and discussion of the DPAL and XPAL laser systems can be found elsewhere,11,12 and in the paper by Carroll and

Effects of laser-assisted lipolysis on nipple-areola complex.

PubMed

Sönmez Ergün, Selma; Kayan, Reşit Burak; Güleş, Mustafa Ekrem; Kuzu, İsmail Melih

2017-08-01

Gynecomastia, as a most common benign condition, represents itself as the enlargement of the male breast and also nipple-areola complex as the severity of the condition increases. With this study, we aimed to clarify the effects of 980-nm diode laser on nipple-areola complex (NAC). Although numerous open techniques have been described to correct gynecomastia, nowadays trends have shifted to minimally invasive techniques such as laser-assisted lipolysis (LAL). A total of 25 patients with bilateral gynecomastia treated with LAL by using a 980-nm diode laser. The resultant contour and reduced size of the complex were satisfactory. LAL leads to significant reduction of the size of NAC.

The Characterization of Laser Ablation Patterns and a New Definition of Resolution in Matrix Assisted Laser Desorption Ionization Imaging Mass Spectrometry (MALDI-IMS).

PubMed

O'Rourke, Matthew B; Raymond, Benjamin B A; Padula, Matthew P

2017-05-01

Matrix assisted laser desorption ionization imaging mass spectrometry (MALDI-IMS) is a technique that has seen a sharp rise in both use and development. Despite this rapid adoption, there have been few thorough investigations into the actual physical mechanisms that underlie the acquisition of IMS images. We therefore set out to characterize the effect of IMS laser ablation patterns on the surface of a sample. We also concluded that the governing factors that control spatial resolution have not been correctly defined and therefore propose a new definition of resolution. Graphical Abstract ᅟ.

Selective tuning of high-Q silicon photonic crystal nanocavities via laser-assisted local oxidation.

PubMed

Chen, Charlton J; Zheng, Jiangjun; Gu, Tingyi; McMillan, James F; Yu, Mingbin; Lo, Guo-Qiang; Kwong, Dim-Lee; Wong, Chee Wei

2011-06-20

We examine the cavity resonance tuning of high-Q silicon photonic crystal heterostructures by localized laser-assisted thermal oxidation using a 532 nm continuous wave laser focused to a 2.5 μm radius spot-size. The total shift is consistent with the parabolic rate law. A tuning range of up to 8.7 nm is achieved with ∼ 30 mW laser powers. Over this tuning range, the cavity Qs decreases from 3.2×10(5) to 1.2×10(5). Numerical simulations model the temperature distributions in the silicon photonic crystal membrane and the cavity resonance shift from oxidation.

Comparison of characteristics of femtosecond laser-assisted anterior capsulotomy versus manual continuous curvilinear capsulorrhexis: A meta-analysis of 5-year results.

PubMed

Ali, Muhammad Hassaan; Ullah, Samee; Javaid, Usman; Javaid, Mamoona; Jamal, Samreen; Butt, Nadeem Hafeez

2017-10-01

To perform a meta-analysis on the precision and safety of femtosecond laser-assisted anterior capsulotomy versus conventional manual continuous curvilinear capsulorrhexis. This meta-analysis was conducted from February 2010 to November 2014. Literature search on PubMed, Google Scholar, ExcerptaMedica database and Cochrane Library was done to identify randomised controlled trials and case-control studies. SPSS 20 was used for data analysis. Of the 10 articles included, there were 3(30%) randomised controlled trials and 7(70%) non-randomised controlled trials. The meta-analysis was based on a total of 2,882eyes. Of them, 1,498(51.97%) underwent femtosecond laser-assisted capsulotomy and 1,384(48.02%) underwent manual continuous curvilinear capsulorrhexis. The diameter of the capsulotomy and the rates of anterior capsule tear showed no statistical difference between the femtosecond laser group and the manual capsulorrhexis group (p=0.29 and p=0.68). In terms of circularity of capsulotomy, femtosecond laser group had a more significant advantage than the manual capsulorrhexis group (p<0.001). Femtosecond laser performed capsulotomy with more precision and higher reliability than the manual continuous curvilinear capsulorrhexis.

Tracker-assisted versus manual ablation zone centration in laser in situ keratomileusis for myopia and astigmatism.

PubMed

Pineros, Oscar E

2002-01-01

Eye tracker systems have been developed concomitantly with small scanning beams to theoretically reduce ablation zone decentration and for accurate registration of all the laser pulses on the cornea. The purpose of the study was to compare the tracker-assisted with the manual centration method. Twenty-five patients (48 eyes) with myopia and/or astigmatism had laser in situ keratomileusis (LASIK) between August 1998 and February 1999 with the Technolas 117C laser. Twenty patients (38 eyes, 80%) were available for follow-up at 3 months after surgery. Eyes were assigned randomly to one of two ablation zone centration methods: Group 1: Tracker-assisted (20 eyes), Group 2: Manual (18 eyes). Mean distance between the ablation zone center and the pupillary center in the tracker-assisted centration group was 0.55 +/- 0.30 mm (range, 0.10 to 1.4 mm), and in the manual centration group, 0.43 +/- 0.23 mm (range, 0.10 to 1.0 mm) (P = .177). There was no statistically significant difference in postoperative contrast sensitivity, glare, and Topographical Corneal Surface Regularity Index (SRI) between the two groups. We obtained good results with both centration methods. We did not find superiority of the tracker-assisted over manual regarding ablation zone centration, vision quality, or regularity of the ablation.

Depilatory laser: a potential causative factor for inguinal hyperhidrosis: report of three cases.

PubMed

Obeid, Grace; Helou, Josiane; Maatouk, Ismael; Moutran, Roy; Tomb, Roland

2013-10-01

Hyperhidrosis has recently been described as a novel adverse effect of laser-assisted hair removal in the axillary area. Inguinal Hyperhidrosis (IH) is a localized and, typically, a primary form of hyperhidrosis affecting the groin area in individuals before age 25. IH has been reported in the literature after traumas and as a dysfunction of the central sympathetic nervous system. To the best of our knowledge, IH has never been reported as secondary to laser-assisted hair removal. Herein, we report three cases of IH following depilatory laser of the inguinal zone. Three female patients with no relevant medical history presented with the complaint of excessive sweating in the inguinal area after undergoing full bikini depilatory laser sessions. Although never described before, depilatory laser seems to trigger the occurrence of hyperhidrosis in the inguinal zone.

Laser Applications: Implications for Vocational Education.

ERIC Educational Resources Information Center

Fraser, Jeannette L.

Recent and projected advances in and commercial applications of lasers and laser technology were examined in order to assist vocational planners in responding to skill needs that will be created by lasers in the next few years. Until recently, most laser applications were in research and development settings; however, in the last several years…

Microscope self-calibration based on micro laser line imaging and soft computing algorithms

NASA Astrophysics Data System (ADS)

Apolinar Muñoz Rodríguez, J.

2018-06-01

A technique to perform microscope self-calibration via micro laser line and soft computing algorithms is presented. In this technique, the microscope vision parameters are computed by means of soft computing algorithms based on laser line projection. To implement the self-calibration, a microscope vision system is constructed by means of a CCD camera and a 38 μm laser line. From this arrangement, the microscope vision parameters are represented via Bezier approximation networks, which are accomplished through the laser line position. In this procedure, a genetic algorithm determines the microscope vision parameters by means of laser line imaging. Also, the approximation networks compute the three-dimensional vision by means of the laser line position. Additionally, the soft computing algorithms re-calibrate the vision parameters when the microscope vision system is modified during the vision task. The proposed self-calibration improves accuracy of the traditional microscope calibration, which is accomplished via external references to the microscope system. The capability of the self-calibration based on soft computing algorithms is determined by means of the calibration accuracy and the micro-scale measurement error. This contribution is corroborated by an evaluation based on the accuracy of the traditional microscope calibration.

Laser surface modification of AZ31B Mg alloy for bio-wettability.

PubMed

Ho, Yee-Hsien; Vora, Hitesh D; Dahotre, Narendra B

2015-02-01

Magnesium alloys are the potential degradable materials for load-bearing implant application due to their comparable mechanical properties to human bone, excellent bioactivity, and in vivo non-toxicity. However, for a successful load-bearing implant, the surface of bio-implant must allow protein absorption and layer formation under physiological environment that can assist the cell/osteoblast growth. In this regard, surface wettability of bio-implant plays a key role to dictate the quantity of protein absorption. In light of this, the main objective of the present study was to produce favorable bio-wettability condition of AZ31B Mg alloy bio-implant surface via laser surface modification technique under various laser processing conditions. In the present efforts, the influence of laser surface modification on AZ31B Mg alloy surface on resultant bio-wettability was investigated via contact-angle measurements and the co-relationships among microstructure (grain size), surface roughness, surface energy, and surface chemical composition were established. In addition, the laser surface modification technique was simulated by computational (thermal) model to facilitate the prediction of temperature and its resultant cooling/solidification rates under various laser processing conditions for correlating with their corresponding composition and phase evolution. These predicted thermal properties were later used to correlate with the corresponding microstructure, chemical composition, and phase evolution via experimental analyses (X-ray diffractometer, scanning electron microscope, energy-dispersive spectroscopy). © The Author(s) 2014 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.

Characterization of Nanostructured Polymer Films

DTIC Science & Technology

2014-12-23

discovered that polymer films with exceptional thermal and kinetic stability could be formed by Matrix Assisted Pulsed Laser Evaporation ( MAPLE ) onto...thermal properties of amorphous polymer nanoglobules fabricated via Matrix-Assisted Pulsed Laser Deposition ( MAPLE ). We discovered that stability in... MAPLE , Glass Transition Temperature 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT 18. NUMBER OF PAGES 19a. NAME OF RESPONSIBLE PERSON

Publications and Presentations of the Ophthalmology Branch, U.S. Air Force School of Aerospace Medicine, 2006-2010

DTIC Science & Technology

2013-12-01

LASER ASSISTED IN SITU KERATOMILEUSIS ( LASIK ) EYES Aaron MT, Gooch JM, Harvey RR, Davis RE, and Tutt RC Abstract: Aviation, Space, and Environmental...AZ; 9-13 May 2010 10. EFFECT OF HIGH ALTITUDE ON LASER ASSISTED IN SITU KERATOMILEUSIS ( LASIK ) EYES Aaron MT, Gooch JM, Harvey RR, Davis RE, and

A novel robotic platform for laser-assisted transurethral surgery of the prostate.

PubMed

Russo, S; Dario, P; Menciassi, A

2015-02-01

Benign prostatic hyperplasia (BPH) is the most common pathology afflicting ageing men. The gold standard for the surgical treatment of BPH is transurethral resection of the prostate. The laser-assisted transurethral surgical treatment of BPH is recently emerging as a valid clinical alternative. Despite this, there are still some issues that hinder the outcome of laser surgery, e.g., distal dexterity is strongly reduced by the current endoscopic instrumentation and contact between laser and prostatic tissue cannot be monitored and optimized. This paper presents a novel robotic platform for laser-assisted transurethral surgery of BPH. The system, designed to be compatible with the traditional endoscopic instrumentation, is composed of a catheter-like robot provided with a fiber optic-based sensing system and a cable-driven actuation mechanism. The sensing system allows contact monitoring between the laser and the hypertrophic tissue. The actuation mechanism allows steering of the laser fiber inside the prostatic urethra of the patient, when contact must be reached. The design of the proposed robotic platform along with its preliminary testing and evaluation is presented in this paper. The actuation mechanism is tested in in vitro experiments to prove laser steering performances according to the clinical requirements. The sensing system is calibrated in experiments aimed to evaluate the capability of discriminating the contact forces, between the laser tip and the prostatic tissue, from the pulling forces exerted on the cables, during laser steering. These results have been validated demonstrating the robot's capability of detecting sub-Newton contact forces even in combination with actuation.

Feasibility of simultaneous computed tomographic colonography and fully automated bone mineral densitometry in a single examination.

PubMed

Summers, Ronald M; Baecher, Nicolai; Yao, Jianhua; Liu, Jiamin; Pickhardt, Perry J; Choi, J Richard; Hill, Suvimol

2011-01-01

To show the feasibility of calculating the bone mineral density (BMD) from computed tomographic colonography (CTC) scans using fully automated software. Automated BMD measurement software was developed that measures the BMD of the first and second lumbar vertebrae on computed tomography and calculates the mean of the 2 values to provide a per patient BMD estimate. The software was validated in a reference population of 17 consecutive women who underwent quantitative computed tomography and in a population of 475 women from a consecutive series of asymptomatic patients enrolled in a CTC screening trial conducted at 3 medical centers. The mean (SD) BMD was 133.6 (34.6) mg/mL (95% confidence interval, 130.5-136.7; n = 475). In women aged 42 to 60 years (n = 316) and 61 to 79 years (n = 159), the mean (SD) BMDs were 143.1 (33.5) and 114.7 (28.3) mg/mL, respectively (P < 0.0001). Fully automated BMD measurements were reproducible for a given patient with 95% limits of agreement of -9.79 to 8.46 mg/mL for the mean difference between paired assessments on supine and prone CTC. Osteoporosis screening can be performed simultaneously with screening for colorectal polyps.

Analysis of plasma characteristics and conductive mechanism of laser assisted pulsed arc welding

NASA Astrophysics Data System (ADS)

Liu, Shuangyu; Chen, Shixian; Wang, Qinghua; Li, Yanqing; Zhang, Hong; Ding, Hongtao

2017-05-01

This study aims to investigate the arc plasma shape and the spectral characteristics during the laser assisted pulsed arc welding process. The arc plasma shape was synchronously observed using a high speed camera, and the emission spectrum of plasma was obtained by spectrometer. The well-known Boltzmann plot method and Stark broadening were used to calculate the electron temperature and density respectively. The conductive mechanism of arc ignition in laser assisted arc hybrid welding was investigated, and it was found that the plasma current moved to the arc anode under the action of electric field. Thus, a significant parabolic channel was formed between the keyhole and the wire tip. This channel became the main method of energy transformation between the arc and the molten pool. The calculation results of plasma resistivity show that the laser plasma has low resistivity as the starting point of conductive channel formation. When the laser pulse duration increases, the intensity of the plasma radiation spectrum and the plasma electron density will increase, and the electron temperature will decrease.

Cost savings associated with the use of the Ho:YAG laser in knee arthroscopy: a comparative retrospective review of 140 conventional and laser-assisted procedures

NASA Astrophysics Data System (ADS)

Johnson, Michael D.

1994-09-01

The impact of using the 2.1 micrometers Ho:YAG laser in orthopaedic surgery has not been fully investigated, especially as to what affect it may have on an employee's return to work and normal activities. In this retrospective review of 140 patients who underwent arthroscopic surgery at our facility, there were found to be significant decreases in time on crutches and time off from work when laser-assisted knee arthroscopies were compared to procedures where conventional mechanical or motorized instruments were used. The patients who had laser-assisted knee arthroscopies discontinued use of crutches 5 days earlier than the conventional group and returned to work 10 days earlier than their counterparts who had undergone conventional arthroscopic surgery. The ability to return to work more quickly translates into significant cost savings for employers who otherwise would have to replace the worker with temporary help, pay overtime, or face lost productivity due to an employee's absence following arthroscopic knee surgery.

Analysis of the Laser Propelled Lightcraft Vehicle

NASA Technical Reports Server (NTRS)

Feikema, Douglas

2000-01-01

Advanced propulsion research and technology require launch and space flight technologies, which can drastically reduce mission costs. Laser propulsion is a concept in which energy of a thrust producing reaction mass is supplied via beamed energy from an off-board power source. A variety of laser/beamed energy concepts were theoretically and experimentally investigated since the early 1970's. During the 1980's the Strategic Defense Initiative (SDI) research lead to the invention of the Laser Lightcraft concept. Based upon the Laser Lightcraft concept, the U.S. Air Force and NASA have jointly set out to develop technologies required for launching small payloads into Low Earth Orbit (LEO) for a cost of $1.0M or $1000/lb to $ 100/lb. The near term objectives are to demonstrate technologies and capabilities essential for a future earth to orbit launch capability. Laser propulsion offers the advantages of both high thrust and good specific impulse, I(sub sp), in excess of 1000 s. Other advantages are the simplicity and reliability of the engine because of few moving parts, simpler propellant feed system, and high specific impulse. Major limitations of this approach are the laser power available, absorption and distortion of the pulsed laser beam through the atmosphere, and coupling laser power into thrust throughout the flight envelope, The objective of this paper is to assist efforts towards optimizing the performance of the laser engine. In order to accomplish this goal (1) defocusing of the primary optic was investigated using optical ray tracing and (2), time dependent calculations were conducted of the optically induced blast wave to predict pressure and temperature in the vicinity of the cowl. Defocusing of the primary parabolic reflector causes blurring and reduction in the intensity of the laser ignition site on the cowl. However, because of the caustic effect of ray-tracing optics the laser radiation still forms a well-defined ignition line on the cowl. The blast wave calculations show reasonable agreement with previously published calculations and recent detailed CFD computations.

Morphologic features and surgically induced astigmatism of femtosecond laser versus manual clear corneal incisions.

PubMed

Zhu, Sha; Qu, Naibin; Wang, Wei; Zhu, Yanan; Shentu, Xingchao; Chen, Peiqing; Xu, Wen; Yao, Ke

2017-11-01

To compare the morphologic features and surgically induced astigmatism (SIA) between laser and manual clear corneal incisions (CCIs) after femtosecond laser-assisted cataract surgery. Eye Center, 2nd Affiliated Hospital, Medical College of Zhejiang University, Hangzhou, China. Prospective case series. Patients had femtosecond laser-assisted cataract surgery with a CCI created with the laser or manually after random allocation. The corrected distance visual acuity, corneal topography, and anterior segment optical coherence tomography were assessed at the 1-day, 1-week, 1-month, and 3-month follow-ups. The laser CCI group comprised 45 eyes and the manual CCI group, 48 eyes. The SIA was significantly lower in the manual CCI group than the laser CCI group at all visits (P < .05). At the 1-day and 1-week follow-ups, the mean CCI thickness was significantly smaller in the manual CCI group (P < .05). In the laser CCI group, the perpendicular linear distance between the external wound opening and the corneal vertex central line was statistically shorter than in the manual CCI group (P < .05). At 3 months, the SIA was correlated with the perpendicular linear distance with a Pearson correlation coefficient of -0.341 (P = .001). Femtosecond laser-created CCIs for cataract surgery caused more SIA than manually created CCIs, which could have resulted from inaccurate or uncertain corneal incision positioning of the femtosecond machine. Manual creation of CCIs is recommended in femtosecond laser-assisted cataract surgery until the locating system for the femtosecond laser incision is updated. Copyright © 2017 ASCRS and ESCRS. Published by Elsevier Inc. All rights reserved.

Tailoring the electrode-electrolyte interface of Solid Oxide Fuel Cells (SOFC) by laser micro-patterning to improve their electrochemical performance

NASA Astrophysics Data System (ADS)

Cebollero, J. A.; Lahoz, R.; Laguna-Bercero, M. A.; Larrea, A.

2017-08-01

Cathode activation polarisation is one of the main contributions to the losses of a Solid Oxide Fuel Cell. To reduce this loss we use a pulsed laser to modify the surface of yttria stabilized zirconia (YSZ) electrolytes to make a corrugated micro-patterning in the mesoscale. The beam of the laser source, 5 ns pulse width and emitting at λ = 532 nm (green region), is computer-controlled to engrave the selected micro-pattern on the electrolyte surface. Several laser scanning procedures and geometries have been tested. Finally, we engrave a square array with 28 μm of lattice parameter and 7 μm in depth on YSZ plates. With these plates we prepare LSM-YSZ/YSZ/LSM-YSZ symmetrical cells (LSM: La1-xSrxMnO3) and determine their activation polarisation by Electrochemical Impedance Spectroscopy (EIS). To get good electrode-electrolyte contact after sintering it is necessary to use pressure-assisted sintering with low loads (about 5 kPa), which do not modify the electrode microstructure. The decrease in polarisation with respect to an unprocessed cell is about 30%. EIS analysis confirms that the reason for this decrease is an improvement in the activation processes at the electrode-electrolyte interface.

Laser physics and a review of laser applications in dentistry for children.

PubMed

Martens, L C

2011-04-01

The aim of this introduction to this special laser issue is to describe some basic laser physics and to delineate the potential of laser-assisted dentistry in children. A brief review of the available laser literature was performed within the scope of paediatric dentistry. Attention was paid to soft tissue surgery, caries prevention and diagnosis, cavity preparation, comfort of the patient, effect on bacteria, long term pulpal vitality, endodontics in primary teeth, dental traumatology and low level laser therapy. Although there is a lack of sufficient evidence taking into account the highest standards for evidence-based dentistry, it is clear that laser application in a number of different aetiologies for soft tissue surgery in children has proven to be successful. Lasers provide a refined diagnosis of caries combined with the appropriate preventive adhesive dentistry after cavity preparation. This will further lead to a new wave of micro-dentistry based on 'filling without drilling'. It has become clear from a review of the literature that specific laser applications in paediatric dentistry have gained increasing importance. It can be concluded that children should be considered as amongst the first patients for receiving laser-assisted dentistry.

Laser-assisted bremsstrahlung and electron-positron pair creation in relativistic laser fields

DOE Office of Scientific and Technical Information (OSTI.GOV)

Loetstedt, Erik

2009-07-25

An electron submitted to a relativistically strong laser field emits Compton harmonics at frequencies satisfying the nonlinear Compton formula. We investigate the scenario when in addition to the laser field, also a nuclear Coulomb field is present to accelerate the electron. In this case we may speak about laser-assisted bremsstrahlung, with radiation resulting from the combined effect of the Coulomb and laser field. The theoretical method employed is fully relativistic quantum electrodynamics, where in particular the laser-dressed Dirac-Volkov propagator requires proper treatment. Electron-positron pair creation is a physical process related to bremsstrahlung by a crossing symmetry of quantum electrodynamics. Wemore » consider pair creation in the combined fields of a laser, a nucleus and a high-frequency photon. We show that the total number of created pairs is not affected by the laser, provided the energy of the high-energy photon exceeds the pair creation threshold, but that the differential cross section is strongly enhanced in a particular direction, making a small angle with the laser beam. The physical picture is that the electron-positron pair is created by the high-energy photon, and subsequently accelerated by the laser field.« less

Comparison of fiber delivered CO2 laser and electrocautery in transoral robot assisted tongue base surgery.

PubMed

Karaman, Murat; Gün, Taylan; Temelkuran, Burak; Aynacı, Engin; Kaya, Cem; Tekin, Ahmet Mahmut

2017-05-01

To compare intra-operative and post-operative effectiveness of fiber delivered CO 2 laser to monopolar electrocautery in robot assisted tongue base surgery. Prospective non-randomized clinical study. Twenty moderate to severe obstructive sleep apnea (OSA) patients, non-compliant with Continuous Positive Airway Pressure (CPAP), underwent Transoral Robotic Surgery (TORS) using the Da Vinci surgical robot in our University Hospital. OSA was treated with monopolar electrocautery in 10 patients, and with flexible CO 2 laser fiber in another 10 patients. The following parameters in the two sets are analyzed: Intraoperative bleeding that required cauterization, robot operating time, need for tracheotomy, postoperative self-limiting bleeding, length of hospitalization, duration until start of oral intake, pre-operative and post-operative minimum arterial oxygen saturation, pre-operative and post-operative Epworth Sleepiness Scale score, postoperative airway complication and postoperative pain. Mean follow-up was 12 months. None of the patients required tracheotomy and there were no intraoperative complications related to the use of the robot or the CO 2 laser. The use of CO 2 laser in TORS-assisted tongue base surgery resulted in less intraoperative bleeding that required cauterization, shorter robot operating time, shorter length of hospitalization, shorter duration until start of oral intake and less postoperative pain, when compared to electrocautery. Postoperative apnea-hypopnea index scores showed better efficacy of CO 2 laser than electrocautery. Comparison of postoperative airway complication rates and Epworth sleepiness scale scores were found to be statistically insignificant between the two groups. The use of CO 2 laser in robot assisted tongue base surgery has various intraoperative and post-operative advantages when compared to monopolar electrocautery.

Comparison of camel tear proteins between summer and winter

PubMed Central

Chen, Ziyan; Shamsi, Farrukh A.; Li, Kaijun; Huang, Qiang; Al-Rajhi, Ali A.; Chaudhry, Imtiaz A.

2011-01-01

Purpose Proteins in the tear fluid have positive effects on maintaining the integrity and stabilization of the tear film, which is affected by several environmental factors. The aim of this study is to investigate seasonal variation of protein patterns in camel tears collected during the summer and winter season. Methods Tears from both eyes of 50 clinically normal camels (Camelus dromedarius) were collected in the summer (June – July) and in the winter (December – January) respectively. Pooled tear protein samples from two seasons were separated by SDS–PAGE and two-dimensional electrophoresis (2-DE). Protein spots of differential expression in two season gels were excised and subjected to in-gel digestion and identification by matrix assisted laser desorption/ionization-time of flight/time of flight-mass spectrum (MALDI-TOF/TOF-MS) analysis. Two differentially expressed proteins, lactoferrin (LF) and vitelline membrane outer layer protein 1 homolog (VMO1 homolog), were validated by western blotting. Results Thirteen well resolved bands were detected in SDS–PAGE gels of both summer and winter camel tears. By band densitometry, significantly higher intensities of band 6, 7, 11, and lower intensity of band 13 were observed in the summer group compared to the winter group. In 2-DE profiles of camel tears, four protein spots were found expressed differentially in two seasons. Further protein identification by MALDI-TOF/TOF-MS and confirmation by western blotting indicated that there was a significant decrease in LF (p=0.002) and an increase in VMO1 homolog (p=0.042) in tears in the summer compared to the winter. Conclusions The seasonal variation of camel tear fluids has been found in the composition of proteins, including LF and VMO1 homolog. This result will expand our knowledge of physiologic characteristics of tear fluids and establish a foundation for the mechanistic studies and clinical practices on ocular surface disorders. PMID:21293736

Laser-assisted hair removal for facial hirsutism in women: A review of evidence.

PubMed

Lee, Chun-Man

2018-06-01

Poly cystic ovarian syndrome (PCOS) has been described as the common diagnosis for hirsutism in women. Facial hirsutism is by far the most distressing symptom of hyperandrogenism in women with PCOS. A statistically significant improvement in psychological well-being has been reported in patients with PCOS allocated for laser-assisted hair removal. The theory of selective photothermolysis has revolutionized laser hair removal in that it is effective and safe, when operated by sufficiently trained and experienced professionals. Long-pulsed ruby (694 nm), long-pulsed alexandrite (755 nm), diode (800-980 nm), and long-pulsed Nd:YAG (1064 nm) are commercially available laser devices for hair removal most widely studied. This article will introduce the fundamentals and mechanism of action of lasers in hair removal, in a contemporary literature review looking at medium to long term efficacy and safety profiles of various laser hair removal modalities most widely commercially available to date.

Patient responses to Er:YAG laser when used for conservative dentistry.

PubMed

Fornaini, Carlo; Riceputi, David; Lupi-Pegurier, Laurence; Rocca, Jean Paul

2012-11-01

The utilization of laser technology in conservative dentistry offers several advantages compared with traditional instruments, but one of the still unsolved problems is the difficulty in describing and explaining these advantages to patients. The aims of this study were to verify the efficacy of the way patients are informed and to evaluate their satisfaction with laser-assisted treatment. Before treatment, 100 patients were given a brochure that explained the relevant laser-assisted dental procedures, and after dental treatment an 11-item questionnaire was administered to the patients to evaluate their satisfaction with the treatment. Statistical analysis showed high levels of satisfaction for all the questions, especially those regarding the choice between laser therapy and traditional instruments (100%), choosing laser in the future (89%), and recommending it to family and friends (84%). This study may be relevant when determining the overall satisfaction of patients with this new technology.

High efficiency laser-assisted H - charge exchange for microsecond duration beams

DOE PAGES

Cousineau, Sarah; Rakhman, Abdurahim; Kay, Martin; ...

2017-12-26

Laser-assisted stripping is a novel approach to H - charge exchange that overcomes long-standing limitations associated with the traditional, foil-based method of producing high-intensity, time-structured beams of protons. This paper reports on the first successful demonstration of the laser stripping technique for microsecond duration beams. The experiment represents a factor of 1000 increase in the stripped pulse duration compared with the previous proof-of-principle demonstration. The central theme of the experiment is the implementation of methods to reduce the required average laser power such that high efficiency stripping can be accomplished for microsecond duration beams using conventional laser technology. In conclusion,more » the experiment was performed on the Spallation Neutron Source 1 GeV H - beam using a 1 MW peak power UV laser and resulted in ~95% stripping efficiency.« less

High efficiency laser-assisted H - charge exchange for microsecond duration beams

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cousineau, Sarah; Rakhman, Abdurahim; Kay, Martin

Laser-assisted stripping is a novel approach to H - charge exchange that overcomes long-standing limitations associated with the traditional, foil-based method of producing high-intensity, time-structured beams of protons. This paper reports on the first successful demonstration of the laser stripping technique for microsecond duration beams. The experiment represents a factor of 1000 increase in the stripped pulse duration compared with the previous proof-of-principle demonstration. The central theme of the experiment is the implementation of methods to reduce the required average laser power such that high efficiency stripping can be accomplished for microsecond duration beams using conventional laser technology. In conclusion,more » the experiment was performed on the Spallation Neutron Source 1 GeV H - beam using a 1 MW peak power UV laser and resulted in ~95% stripping efficiency.« less

Ionization assisted self-guiding of femtosecond laser pulses

NASA Astrophysics Data System (ADS)

Morozov, A.; Goltsov, A.; Chen, Q.; Scully, M.; Suckewer, S.

2018-05-01

We propose a new mechanism for the self-guiding of ultra-intense sub-picosecond laser pulses in gaseous media. It can be realized via optical field ionization by a laser pulse as it propagates inside an expanding cylindrical shock wave launched into ambient gas by a decayed plasma filament. In experiments, the filament was created in a hydrogen jet by a low energy femtosecond laser pre-pulse line focused with axicon lens. We demonstrated ionization-assisted guiding in structures with diameter as small as 14 μm and up to 3.5 mm long. The intensity reached 5 × 1017 W/cm2 in a single mode propagating for more than 100 Rayleigh lengths.

Identification of Fatty Acids, Phospholipids, and Their Oxidation Products Using Matrix-Assisted Laser Desorption Ionization Mass Spectrometry and Electrospray Ionization Mass Spectrometry

ERIC Educational Resources Information Center

Harmon, Christopher W.; Mang, Stephen A.; Greaves, John; Finlayson-Pitts, Barbara J.

2010-01-01

Electrospray ionization mass spectrometry (ESI-MS) and matrix-assisted laser desorption ionization mass spectrometry (MALDI-MS) have found increasing application in the analysis of biological samples. Using these techniques to solve problems in analytical chemistry should be an essential component of the training of undergraduate chemists. We…

Attosecond polarization control in atomic RABBITT-like experiments assisted by a circularly polarized laser

NASA Astrophysics Data System (ADS)

Boll, D. I. R.; Fojón, O. A.

2017-12-01

We study theoretically the single ionization of noble gas atoms by the combined action of an attosecond pulse train with linear polarization and an assistant laser field with circular polarization. We employ a non-perturbative model that under certain approximations gives closed-form expressions for the angular distributions of photoelectrons. Interestingly, our model allow us to interpret these angular distributions as two-centre interferences where the orientation and the modulus of the separation vector between the virtual emitters is governed by the assistant laser field. Additionally, we show that such a configuration of light fields is similar to the polarization control technique, where both the attosecond pulse train and the assistant laser field have linear polarizations whose relative orientation may be controlled. Moreover, in order to compare our results with the available experimental data, we obtain analytical expressions for the cross sections integrated over the photoelectron emission angles. By means of these expressions, we define the ‘magic time’ as the delay for which the total cross sections for atomic targets exhibit the same functional form as the one of the monochromatic photoionization of diatomic molecular targets.

Nanoparticle assisted laser desorption/ionization mass spectrometry for small molecule analytes.

PubMed

Abdelhamid, Hani Nasser

2018-03-01

Nanoparticle assisted laser desorption/ionization mass spectrometry (NPs-ALDI-MS) shows remarkable characteristics and has a promising future in terms of real sample analysis. The incorporation of NPs can advance several methods including surface assisted LDI-MS, and surface enhanced LDI-MS. These methods have advanced the detection of many thermally labile and nonvolatile biomolecules. Nanoparticles circumvent the drawbacks of conventional organic matrices for the analysis of small molecules. In most cases, NPs offer a clear background without interfering peaks, absence of fragmentation of thermally labile molecules, and allow the ionization of species with weak noncovalent interactions. Furthermore, an enhancement in sensitivity and selectivity can be achieved. NPs enable straightforward analysis of target species in a complex sample. This review (with 239 refs.) covers the progress made in laser-based mass spectrometry in combination with the use of metallic NPs (such as AuNPs, AgNPs, PtNPs, and PdNPs), NPs consisting of oxides and chalcogenides, silicon-based NPs, carbon-based nanomaterials, quantum dots, and metal-organic frameworks. Graphical abstract An overview is given on nanomaterials for use in surface-assisted laser desorption/ionization mass spectrometry of small molecules.

Surface-assisted laser desorption ionization mass spectrometry techniques for application in forensics.

PubMed

Guinan, Taryn; Kirkbride, Paul; Pigou, Paul E; Ronci, Maurizio; Kobus, Hilton; Voelcker, Nicolas H

2015-01-01

Matrix-assisted laser desorption ionization (MALDI) mass spectrometry (MS) is an excellent analytical technique for the rapid and sensitive analysis of macromolecules (>700 Da), such as peptides, proteins, nucleic acids, and synthetic polymers. However, the detection of smaller organic molecules with masses below 700 Da using MALDI-MS is challenging due to the appearance of matrix adducts and matrix fragment peaks in the same spectral range. Recently, nanostructured substrates have been developed that facilitate matrix-free laser desorption ionization (LDI), contributing to an emerging analytical paradigm referred to as surface-assisted laser desorption ionization (SALDI) MS. Since SALDI enables the detection of small organic molecules, it is rapidly growing in popularity, including in the field of forensics. At the same time, SALDI also holds significant potential as a high throughput analytical tool in roadside, work place and athlete drug testing. In this review, we discuss recent advances in SALDI techniques such as desorption ionization on porous silicon (DIOS), nano-initiator mass spectrometry (NIMS) and nano assisted laser desorption ionization (NALDI™) and compare their strengths and weaknesses with particular focus on forensic applications. These include the detection of illicit drug molecules and their metabolites in biological matrices and small molecule detection from forensic samples including banknotes and fingerprints. Finally, the review highlights recent advances in mass spectrometry imaging (MSI) using SALDI techniques. © 2014 Wiley Periodicals, Inc.

Basic poly(propylene glycols) as reference compounds for internal mass calibration in positive-ion matrix-assisted laser desorption/ionization mass spectrometry.

PubMed

Gross, Jürgen H

2017-12-01

Basic poly(propylene glycols), commercially available under the trade name Jeffamine, are evaluated for their potential use as internal mass calibrants in matrix-assisted laser desorption/ionization-time-of-flight-mass spectrometry. Due to their basic amino endgroups Jeffamines are expected to deliver [M+H] + ions in higher yields than neutral poly(propylene glycols) or poly(ethylene glycols). Aiming at accurate mass measurements and molecular formula determinations by matrix-assisted laser desorption/ionization-time-of-flight-mass spectrometry, four Jeffamines (M-600, M-2005, D-400, D-230) were thus compared. As a result, Jeffamine M-2005 is introduced as a new mass calibrant for positive-ion matrix-assisted laser desorption/ionization-time-of-flight-mass spectrometry in the range of m/z 200-1200 and the reference mass list is provided. While Jeffamine M-2005 is compatible with α-cyano-4-hydroxycinnamic acid, 2,5-dihydroxybenzoic acid, and 2-[(2 E)-3-(4- tert-butylphenyl)-2-methylprop-2-enylidene]malonitrile matrix, its use in combination with 2-[(2 E)-3-(4- tert-butylphenyl)-2-methylprop-2-enylidene]malonitrile provides best results due to low laser fluence requirements. Applications to PEG 300, PEG 600, the ionic liquid trihexyl(tetradecyl)-phosphonium tris(pentafluoroethyl)-trifluorophosphate, and [60]fullerene demonstrate mass accuracies of 2-5 ppm.

High speed three-dimensional laser scanner with real time processing

NASA Technical Reports Server (NTRS)

Lavelle, Joseph P. (Inventor); Schuet, Stefan R. (Inventor)

2008-01-01

A laser scanner computes a range from a laser line to an imaging sensor. The laser line illuminates a detail within an area covered by the imaging sensor, the area having a first dimension and a second dimension. The detail has a dimension perpendicular to the area. A traverse moves a laser emitter coupled to the imaging sensor, at a height above the area. The laser emitter is positioned at an offset along the scan direction with respect to the imaging sensor, and is oriented at a depression angle with respect to the area. The laser emitter projects the laser line along the second dimension of the area at a position where a image frame is acquired. The imaging sensor is sensitive to laser reflections from the detail produced by the laser line. The imaging sensor images the laser reflections from the detail to generate the image frame. A computer having a pipeline structure is connected to the imaging sensor for reception of the image frame, and for computing the range to the detail using height, depression angle and/or offset. The computer displays the range to the area and detail thereon covered by the image frame.

Reconfigurable Computing As an Enabling Technology for Single-Photon-Counting Laser Altimetry

NASA Technical Reports Server (NTRS)

Powell, Wesley; Hicks, Edward; Pinchinat, Maxime; Dabney, Philip; McGarry, Jan; Murray, Paul

2003-01-01

Single-photon-counting laser altimetry is a new measurement technique offering significant advantages in vertical resolution, reducing instrument size, mass, and power, and reducing laser complexity as compared to analog or threshold detection laser altimetry techniques. However, these improvements come at the cost of a dramatically increased requirement for onboard real-time data processing. Reconfigurable computing has been shown to offer considerable performance advantages in performing this processing. These advantages have been demonstrated on the Multi-KiloHertz Micro-Laser Altimeter (MMLA), an aircraft based single-photon-counting laser altimeter developed by NASA Goddard Space Flight Center with several potential spaceflight applications. This paper describes how reconfigurable computing technology was employed to perform MMLA data processing in real-time under realistic operating constraints, along with the results observed. This paper also expands on these prior results to identify concepts for using reconfigurable computing to enable spaceflight single-photon-counting laser altimeter instruments.

Intrapulpal Temperature Increases Caused by 445-nm Diode Laser-Assisted Debonding of Self-Ligating Ceramic Brackets During Simulated Pulpal Fluid Circulation.

PubMed

Stein, Steffen; Wenzler, Johannes; Hellak, Andreas; Schauseil, Michael; Korbmacher-Steiner, Heike; Braun, Andreas

2018-04-01

This study investigated temperature increases in dental pulp resulting from laser-assisted debonding of ceramic brackets using a 445-nm diode laser. Eighteen ceramic brackets were bonded in standardized manner to 18 caries-free human third molars. Pulpal fluid circulation was simulated by pumping distilled water at 37°C through the pulp chamber. The brackets were irradiated with a 445-nm diode laser. Temperatures were measured using a thermal camera at points P1 (center of the pulp) and P2 (in the hard dental tissue) at the baseline (T0), at the start and end of laser application (T1 and T2), and the maximum during the sequence (T max ). Significant differences in the temperatures measured at P1 and P2 were observed among T0, T1, T2, and T max . Significant increases in temperature were noted at points P1 and P2, between T1 and T2, T1 and T max , and T2 and T max . The maximum P2 values were significantly higher than at P1. The maximum temperature increase measured in the pulp was 2.23°C, lower than the critical threshold of 5.5°C. On the basis of the laser settings used, there is no risk to the vitality of dental pulp during laser-assisted debonding of ceramic brackets with a 445-nm diode laser.

Endoscopic-assisted disruption of urinary calculi using a holmium:YAG laser in standing horses.

PubMed

Judy, Carter E; Galuppo, Larry D

2002-01-01

To describe a technique for endoscope-assisted disruption and removal of urinary calculi using a holmium:YAG laser in sedated, standing horses. Retrospective study. Six horses with urinary calculi. A holmium:YAG laser was used to disrupt naturally occurring urinary calculi in horses (4 geldings, 1 stallion, 1 mare). Ischial urethrotomy was performed in male horses to provide a portal for the endoscope and laser fiber. Calculus fragments were removed by a combination of lavage, transendoscopic basket snare removal, forceps, and digital manipulation. Ischial urethrotomies healed by second intention. Follow-up was obtained by recheck examination and telephone interview of owners. No major operative or postoperative complications occurred. Two calculi (1 stallion and 1 mare) were fragmented by a combination of laser ablation and manual disruption with a lithotrite. Postoperative dysuria occurred in the mare, but resolved after 1 month. Mean (+/- SD) follow-up was 306 +/- 149 days; no other complications were reported. Calcium carbonate urinary calculi (up to 15 cm in diameter) in horses can be effectively fragmented with a holmium:YAG laser. It is not known if this technique would be completely effective for larger calculi or extremely dense calculi. Calculus disruption by an endoscopically assisted holmium:YAG laser offers a minimally invasive method that can be performed in standing horses and that minimizes patient risk. Copyright 2002 by The American College of Veterinary Surgeons

Cough-induced rib fractures.

PubMed

Hanak, Viktor; Hartman, Thomas E; Ryu, Jay H

2005-07-01

To define the demographic, clinical, and radiological features of patients with cough-induced rib fractures and to assess potential risk factors. For this retrospective, single-center study, we identified all cases of cough-induced rib fractures diagnosed at the Mayo Clinic in Rochester, Minn, over a 9-year period between January 1, 1996, and January 31, 2005. Bone densitometry data from patients' medical records were analyzed, and T scores were used to classify patients into bone density categories. The mean +/- SD age of the 54 study patients at presentation was 55+/-17 years, and 42 patients (78%) were female. Patients presented with chest wall pain after onset of cough. Rib fracture was associated with chronic cough (> or =3 weeks' duration) in 85% of patients. Rib fractures were documented by chest radiography, rib radiography, computed tomography, or bone scan. Chest radiography had been performed in 52 patients and revealed rib fracture in 30 (58%). There were 112 fractured ribs in 54 patients. One half of patients had more than one fractured rib. Right-sided rib fractures alone were present in 17 patients (26 fractured ribs), left-sided in 23 patients (35 fractured ribs), and bilateral in 14 patients (51 fractured ribs). The most commonly fractured rib on both sides was rib 6. The fractures were most common at the lateral aspect of the rib cage. Bone densitometry was done in 26 patients and revealed osteopenia or osteoporosis in 17 (65%). Cough-induced rib fractures occur primarily in women with chronic cough. Middle ribs along the lateral aspect of the rib cage are affected most commonly. Although reduced bone density is likely a risk factor, cough-induced rib fractures can occur in the presence of normal bone density.

Measurement of breast volume using body scan technology(computer-aided anthropometry).

PubMed

Veitch, Daisy; Burford, Karen; Dench, Phil; Dean, Nicola; Griffin, Philip

2012-01-01

Assessment of breast volume is an important tool for preoperative planning in various breast surgeries and other applications, such as bra development. Accurate assessment can improve the consistency and quality of surgery outcomes. This study outlines a non-invasive method to measure breast volume using a whole body 3D laser surface anatomy scanner, the Cyberware WBX. It expands on a previous publication where this method was validated against patients undergoing mastectomy. It specifically outlines and expands the computer-aided anthropometric (CAA) method for extracting breast volumes in a non-invasive way from patients enrolled in a breast reduction study at Flinders Medical Centre, South Australia. This step-by-step description allows others to replicate this work and provides an additional tool to assist them in their own clinical practice and development of designs.

Laser Structuring of Thin Layers for Flexible Electronics by a Shock Wave-induced Delamination Process

NASA Astrophysics Data System (ADS)

Lorenz, Pierre; Ehrhardt, Martin; Zimmer, Klaus

The defect-free laser-assisted structuring of thin films on flexible substrates is a challenge for laser methods. However, solving this problem exhibits an outstanding potential for a pioneering development of flexible electronics. Thereby, the laser-assisted delamination method has a great application potential. At the delamination process: the localized removal of the layer is induced by a shock wave which is produced by a laser ablation process on the rear side of the substrate. In this study, the thin-film patterning process is investigated for different polymer substrates dependent on the material and laser parameters using a KrF excimer laser. The resultant structures were studied by optical microscopy and white light interferometry (WLI). The delamination process was tested at different samples (indium tin oxide (ITO) on polyethylene terephthalate (PET), epoxy-based negative photoresist (SU8) on polyimide (PI) and indium tin oxide/copper indium gallium selenide/molybdenum (ITO/CIGS/Mo) on PI.

Emerging and Future Applications of Matrix-Assisted Laser Desorption Ionization Time-of-Flight (MALDI-TOF) Mass Spectrometry in the Clinical Microbiology Laboratory: A Report of the Association for Molecular Pathology.

PubMed

Doern, Christopher D; Butler-Wu, Susan M

2016-11-01

The performance of matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MS) for routine bacterial and yeast identification as well as direct-from-blood culture bottle identification has been thoroughly evaluated in the peer-reviewed literature. Microbiologists are now moving beyond these methods to apply MS to other areas of the diagnostic process. This review discusses the emergence of advanced matrix-assisted laser desorption ionization time-of-flight MS applications, including the identification of filamentous fungi and mycobacteria and the current and future state of antimicrobial resistance testing. Copyright © 2016 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

Lasers in the in-vitro fertilization laboratory

NASA Astrophysics Data System (ADS)

Tadir, Yona; Neev, Joseph; Berns, Michael W.

1993-05-01

Laser beams are routinely used in the clinical practice of assisted reproduction. The main applications are in laparoscopic and hysteroscopic surgery. The potential applications of laser microbeams as a tool for gamete manipulations are studied and basic concepts are discussed.

In situ mitigation of subsurface and peripheral focused ion beam damage via simultaneous pulsed laser heating

DOE PAGES

Stanford, Michael G.; Lewis, Brett B.; Iberi, Vighter O.; ...

2016-02-16

Focused helium and neon ion (He(+)/Ne(+) ) beam processing has recently been used to push resolution limits of direct-write nanoscale synthesis. The ubiquitous insertion of focused He(+) /Ne(+) beams as the next-generation nanofabrication tool-of-choice is currently limited by deleterious subsurface and peripheral damage induced by the energetic ions in the underlying substrate. The in situ mitigation of subsurface damage induced by He(+)/Ne(+) ion exposures in silicon via a synchronized infrared pulsed laser-assisted process is demonstrated. The pulsed laser assist provides highly localized in situ photothermal energy which reduces the implantation and defect concentration by greater than 90%. The laser-assisted exposuremore » process is also shown to reduce peripheral defects in He(+) patterned graphene, which makes this process an attractive candidate for direct-write patterning of 2D materials. In conclusion, these results offer a necessary solution for the applicability of high-resolution direct-write nanoscale material processing via focused ion beams.« less

Laser-assisted metal spinning for an efficient and flexible processing of challenging materials

NASA Astrophysics Data System (ADS)

Brummer, C.; Eck, S.; Marsoner, S.; Arntz, K.; Klocke, F.

2016-03-01

The demand for components made from high performance materials like titanium or nickel-based alloys as well as strain-hardening stainless steel is steadily increasing. However, conventional forming operations conducted on these materials are generally very laborious and time-consuming. This is where the limitations of metal spinning also become apparent. Using a laser to apply heat localized to the forming zone during metal spinning facilitates to enhance the formability of a material. In order to analyse the potential of the new manufacturing process, experimental investigations on laser-assisted shear forming and multi-pass metal spinning have been performed with austenitic stainless steel X5CrNi18-10, nickel-based alloy Inconel 718 and titanium grade 2. It could be demonstrated that the formability of these materials can be enhanced by laser-assistance. Besides the resulting enhancement of forming limits for metal spinning of challenging materials, the forming forces were reduced and the product quality was improved significantly.

Electrospray-assisted laser desorption/ionization and tandem mass spectrometry of peptides and proteins.

PubMed

Peng, Ivory X; Shiea, Jentaie; Ogorzalek Loo, Rachel R; Loo, Joseph A

2007-01-01

We have constructed an electrospray-assisted laser desorption/ionization (ELDI) source which utilizes a nitrogen laser pulse to desorb intact molecules from matrix-containing sample solution droplets, followed by electrospray ionization (ESI) post-ionization. The ELDI source is coupled to a quadrupole ion trap mass spectrometer and allows sampling under ambient conditions. Preliminary data showed that ELDI produces ESI-like multiply charged peptides and proteins up to 29 kDa carbonic anhydrase and 66 kDa bovine albumin from single-protein solutions, as well as from complex digest mixtures. The generated multiply charged polypeptides enable efficient tandem mass spectrometric (MS/MS)-based peptide sequencing. ELDI-MS/MS of protein digests and small intact proteins was performed both by collisionally activated dissociation (CAD) and by nozzle-skimmer dissociation (NSD). ELDI-MS/MS may be a useful tool for protein sequencing analysis and top-down proteomics study, and may complement matrix-assisted laser desorption/ionization (MALDI)-based measurements. Copyright (c) 2007 John Wiley & Sons, Ltd.

Five-year comparative study on conventional and laser-assisted therapy of periimplantitis and periodontitis

NASA Astrophysics Data System (ADS)

Bach, Georg; Neckel, Claus P.

2000-03-01

Numerous groups have recommended the use of the diode laser to decontaminate infected root and implant surfaces. The aim of this study was to show the outcome after laser assisted and conventional therapy of periimplantitis and periodontitis administering approved treatment protocols. Between 1994 and 1999 a total of 50 patients with periimplantitis (20) and periodontitis (30) were treated in two groups each. Clinical, microbiological and radiographic evaluation was performed before and 6, 12, 24, 36, 48 and 60 months after treatment. In addition to the conventional treatment protocol, flap surgery, the tooth or implant surface was decontaminated with a 810 nm diode laser using 1 Watt output for 20 sec (CW mode). All accessible surfaces were decontaminated at the follow up dates. In the periimplantitis group recurrence of the marker bacteria was higher and faster over time for the conventionally operated patients. Also the clinical and radiographic reevaluation showed significantly better results. The laser group of the periodontitis patients also showed significantly better outcome in terms of clinical evaluation, microbiological counts, radiographic evaluation and tooth loss. In comparison to other long term studies our results for the conventional therapy were adequate, the laser assisted therapy brought up significantly better and reproducible results.

Laser robotically assisted nerve-sparing radical prostatectomy: a pilot study of technical feasibility in the canine model.

PubMed

Gianduzzo, Troy; Colombo, Jose R; Haber, Georges-Pascal; Hafron, Jason; Magi-Galluzzi, Cristina; Aron, Monish; Gill, Inderbir S; Kaouk, Jihad H

2008-08-05

To examine the feasibility of using laser energy during nerve-sparing robotically assisted radical prostatectomy (RARP), as the energy sources currently used for haemostasis in RARP adversely affect cavernous nerve function, while clips require application by a skilled assistant, but laser energy potentially allows precise dissection with minimal collateral tissue injury. We used laser-based RARP in 10 dogs, using the da Vinci S system (Intuitive Surgical, Sunnyvale, CA, USA) and a prototype robotic laser instrument. The potassium-titanyl-phosphate laser was used for dissection at 2-6 W, with intermittent use of the neodymium-doped yttrium-aluminium-garnet laser at 5 W for coagulating larger vessels. The peak intracavernosal pressure response to nerve stimulation was recorded as a percentage of mean arterial pressure (ICP%MAP) before and after RARP. Five dogs were killed immediately after RARP and five were maintained alive for 72 h; the haemoglobin and haematocrit levels were measured before and after RARP in the latter five dogs. All 10 procedures were performed solely using laser energy and no additional haemostatic manoeuvres. The median prostate excision time was 65 min. The ICP%MAP before and after RARP (median 98.5% and 77.0%, P = 0.12) were not significantly different; similarly, the respective haemoglobin (median 14.4 vs 12.6 g/dL, P = 0.06) and haematocrit levels (45.1% vs 40.2%, P = 0.06) were not significantly different. Two dogs had catheter-related complications and one had an anastomotic leak. There were no laser-related complications or postoperative haemorrhage. Laser RARP is feasible in dogs and further assessment is warranted.

Microhardness of demineralized enamel following home bleaching and laser-assisted in office bleaching

PubMed Central

Ghanbarzadeh, Majid; Akbari, Majid; Hamzei, Haniye

2015-01-01

Background There is little data regarding the effect of tooth whitening on microhardness of white spot lesions. This study was conducted to investigate the effect of home-bleaching and laser-assisted in-office bleaching on microhardness of demineralized enamel. Material and Methods Forty bovine incisors were selected and immersed in a demineralizing solution for 12 weeks to induce white spot lesions. Enamel blocks were prepared and randomly assigned to two groups of 20 each. The first group underwent home bleaching with 15% carbamide peroxide which was applied for 8 hours a day over a period of 15 days. In the second group, in-office bleaching was performed by 40% hydrogen peroxide and powered by irradiation from an 810 nm gallium-aluminum-arsenide (GaAlAs) diode laser (CW, 2W). This process was performed for 3 sessions every seven days, in 15 days. The specimens were stored in Fusayama Meyer artificial saliva during the experiment. Surface microhardness was assessed before and after the bleaching therapies in both groups. Results Microhardness decreased significantly following both home bleaching and laser-assisted in-office bleaching (p<0.05). There were no significant differences in hardness values among the two groups either before (p=0.131) or after (p=0.182) the bleaching procedures. Conclusions Tooth whitening through home bleaching or laser-assisted in-office bleaching can result in a significant reduction in microhardness of white spot lesions. Therefore, it is suggested to take protective measures on bleached demineralized enamel. Key words:White spot lesion, bleaching, laser, microhardness, demineralized enamel, home bleaching, in-office bleaching. PMID:26330939

Noncontact laser microsurgery of three-dimensional living objects for use in reproductive and regenerative medicine

NASA Astrophysics Data System (ADS)

Sitnikov, D. S.; Ilina, I. V.; Kosheleva, N. V.; Khramova, Yu V.; Filatov, M. A.; Semenova, M. L.; Zurina, I. M.; Gorkun, A. A.; Saburina, I. N.

2018-01-01

Laser microsurgery has enabled us to make highly precise and delicate processing of living biological specimens. We present the results of using femtosecond (fs) laser pulses in assisted reproductive technologies. Femtosecond laser dissection of outer shells of embryos (so-called laser-assisted hatching) as well as laser-mediated detachment of the desired amount of trophectoderm cells (so-called embryo biopsy) required for preimplantaion genetic diagnosis were successfully performed. The parameters of laser radiation were optimized so as to efficiently perform embryo biopsy and preserve the viability of the treated embryos. Effects of application of fs-laser radiation in the infrared (1028 nm) and visible (514 nm) wavelength ranges were studied. We also applied laser microsurgery to develop a new simple reproducible model for studying repair and regeneration in vitro. Nanosecond laser pulses were applied to perform localized microdissection of cell spheroids. After microdissection, the edges of the wound surface opened, the destruction of the initial spheroid structure was observed in the wound area, with surviving cells changing their shape into a round one. It was shown that the spheroid form partially restored in the first six hours with subsequent complete restoration within seven days due to remodeling of surviving cells.

Thermal effects in laser-assisted embryo hatching

NASA Astrophysics Data System (ADS)

Douglas-Hamilton, Diarmaid H.; Conia, Jerome D.

2000-08-01

Diode lasers [(lambda) equals 1480 nm] are used with in-vitro fertilization [IVF] as a promoter of embryo hatching. A focused laser beam is applied in vitro to form a channel in the zona pellucida (shell) of the pre-embryo. After transfer into the uterus, the embryo hatches: it extrudes itself through the channel and implants into the uterine wall. Laser-assisted hatching can result in improving implantation and pregnancy success rates. We present examples of zone pellucida ablation using animal models. In using the laser it is vital not to damage pre-embryo cells, e.g. by overheating. In order to define safe regimes we have derived some thermal side-effects of zona pellucida removal. The temperature profile in the beam and vicinity is predicted as function of laser pulse duration and power. In a crossed-beam experiment a HeNe laser probe detects the temperature-induced change in refractive index. We find that the diode laser beam produces superheated water approaching 200 C on the beam axis. Thermal histories during and following the laser pulse are given for regions in the neighborhood of the beam. We conclude that an optimum regime exists with pulse duration

77 FR 8223 - Notice of Availability for Exclusive, Non-Exclusive, or Partially-Exclusive Licensing of an...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-02-14

..., or Partially-Exclusive Licensing of an Invention Concerning a Computer Controlled System for Laser... provides a computer controlled system for laser energy delivery to the retina. Information is received from... Application Serial No. 13/130,380, entitled ``Computer Controlled System for Laser Energy Delivery to the...

ICCE/ICCAI 2000 Full & Short Papers (Computer-Assisted Language Learning).

ERIC Educational Resources Information Center

2000

This document contains the following full and short papers on computer-assisted language learning (CALL) from ICCE/ICCAI 2000 (International Conference on Computers in Education/International Conference on Computer-Assisted Instruction): (1) "A Computer-Assisted English Abstract Words Learning Environment on the Web" (Wenli Tsou and…

Laser Spot Detection Based on Reaction Diffusion.

PubMed

Vázquez-Otero, Alejandro; Khikhlukha, Danila; Solano-Altamirano, J M; Dormido, Raquel; Duro, Natividad

2016-03-01

Center-location of a laser spot is a problem of interest when the laser is used for processing and performing measurements. Measurement quality depends on correctly determining the location of the laser spot. Hence, improving and proposing algorithms for the correct location of the spots are fundamental issues in laser-based measurements. In this paper we introduce a Reaction Diffusion (RD) system as the main computational framework for robustly finding laser spot centers. The method presented is compared with a conventional approach for locating laser spots, and the experimental results indicate that RD-based computation generates reliable and precise solutions. These results confirm the flexibility of the new computational paradigm based on RD systems for addressing problems that can be reduced to a set of geometric operations.

Deposition Mechanism and Microstructure of Laser-Assisted Cold-Sprayed (LACS) Al-12 wt.%Si Coatings: Effects of Laser Power

NASA Astrophysics Data System (ADS)

Olakanmi, E. O.; Tlotleng, M.; Meacock, C.; Pityana, S.; Doyoyo, M.

2013-06-01

Surface treatment is one of the most costly processes for treating metallic components against corrosion. Laser-assisted cold spray (LACS) has an opportunity to decrease those costs particularly in transportation systems, chemical industries, and renewable energy systems. This article highlights some of those potential applications. In the LACS process, a laser beam irradiates the substrate and the particles, thereby softening both of them. Consequently, the particles deform upon impact at the substrate and build up a coating. To circumvent the processing problems associated with cold-spray (CS) deposition of low-temperature, corrosion-resistant Al-12 wt.%Si coatings, a preliminary investigation detailing the effect of laser power on its LACS deposition mechanism and microstructural properties is presented. The deposition efficiency, the microstructure, and the microhardness of the LACS-deposited coatings produced by a 4.4-kW Nd:YAG laser system were evaluated. The outcome of this study shows that pore- and crack-free Al-12 wt.%Si coatings were deposited via softening by laser irradiation and adiabatic shearing phenomena at an optimum laser power of 2.5 kW.

Selected developments in laser wire stripping. [cutting insulation from aerospace-type wires and cables

NASA Technical Reports Server (NTRS)

1977-01-01

The operation of mechanical and thermal strippers and the early development of laser wire strippers are reviewed. NASA sponsored development of laser wire stripping for space shuttle includes bench-type strippers as well as an advanced portable hand-held stripper which incorporates a miniaturized carbon dioxide laser and a rotating optics unit with a gas-jet assist and debris exhaust. Drives and controls girdle the wire and slit the remaining slug without manual assistance. This unit can strip wire sizes 26 through 12 gage. A larger-capacity hand-held unit for wire sizes through 1/0 gage was built using a neodynium-doped yttrium aluminum garnet (Nd:YAG) laser. The hand-held units have a flexible umbilical cable to an accompanying cart that carries the power supply, gas supply, cooling unit, and the controls.

Characterization of ethylcellulose and hydroxypropyl methylcellulose thin films deposited by matrix-assisted pulsed laser evaporation

NASA Astrophysics Data System (ADS)

Palla-Papavlu, A.; Rusen, L.; Dinca, V.; Filipescu, M.; Lippert, T.; Dinescu, M.

2014-05-01

In this study is reported the deposition of hydroxypropyl methylcellulose (HPMC) and ethylcellulose (EC) by matrix-assisted pulsed laser evaporation (MAPLE). Both HPMC and EC were deposited on silicon substrates using a Nd:YAG laser (266 nm, 5 ns laser pulse and 10 Hz repetition rate) and then characterized by atomic force microscopy and Fourier transform infrared spectroscopy. It was found that for laser fluences up to 450 mJ/cm2 the structure of the deposited HPMC and EC polymer in the thin film resembles to the bulk. Morphological investigations reveal island features on the surface of the EC thin films, and pores onto the HPMC polymer films. The obtained results indicate that MAPLE may be an alternative technique for the fabrication of new systems with desired drug release profile.

Launch and capture of a single particle in a pulse-laser-assisted dual-beam fiber-optic trap

NASA Astrophysics Data System (ADS)

Fu, Zhenhai; She, Xuan; Li, Nan; Hu, Huizhu

2018-06-01

The rapid loading and manipulation of microspheres in optical trap is important for its applications in optomechanics and precision force sensing. We investigate the microsphere behavior under coaction of a dual-beam fiber-optic trap and a pulse laser beam, which reveals a launched microsphere can be effectively captured in a spatial region. A suitable order of pulse duration for launch is derived according to the calculated detachment energy threshold of pulse laser. Furthermore, we illustrate the effect of structural parameters on the launching process, including the spot size of pulse laser, the vertical displacement of beam waist and the initial position of microsphere. Our result will be instructive in the optimal design of the pulse-laser-assisted optical tweezers for controllable loading mechanism of optical trap.

Computer-assisted innovations in craniofacial surgery.

PubMed

Rudman, Kelli; Hoekzema, Craig; Rhee, John

2011-08-01

Reconstructive surgery for complex craniofacial defects challenges even the most experienced surgeons. Preoperative reconstructive planning requires consideration of both functional and aesthetic properties of the mandible, orbit, and midface. Technological innovations allow for computer-assisted preoperative planning, computer-aided manufacturing of patient-specific implants (PSIs), and computer-assisted intraoperative navigation. Although many case reports discuss computer-assisted preoperative planning and creation of custom implants, a general overview of computer-assisted innovations is not readily available. This article reviews innovations in computer-assisted reconstructive surgery including anatomic considerations when using PSIs, technologies available for preoperative planning, work flow and process of obtaining a PSI, and implant materials available for PSIs. A case example follows illustrating the use of this technology in the reconstruction of an orbital-frontal-temporal defect with a PSI. Computer-assisted reconstruction of complex craniofacial defects provides the reconstructive surgeon with innovative options for challenging reconstructive cases. As technology advances, applications of computer-assisted reconstruction will continue to expand. © Thieme Medical Publishers.

An Investigation of Laser Lighting Systems to Assist Aircraft

DOT National Transportation Integrated Search

1979-01-01

A model for the visual detectability of narrow light beams was developed and used to evaluate the system performance of two laser lighting system configurations: (1) a laser VASI and (2) a crossed beam glide path indicator. Laboratory experiments con...

Possible evidence of amide bond formation between sinapinic acid and lysine-containing bacterial proteins by matrix-assisted laser desorption/ionization (MALDI) at 355 nm

USDA-ARS?s Scientific Manuscript database

We previously reported the apparent formation of matrix adducts of 3,5-dimethoxy-4-hydroxy-cinnamic acid (sinapinic acid or SA) via covalent attachment to disulfide bond-containing proteins (HdeA, HdeB and YbgS) from bacterial cell lysates ionized by matrix-assisted laser desorption/ionization (MALD...

Top-down proteomic identification of Shiga toxin 2 subtypes from Shiga toxin-producing Escherichia coli by Matrix-Assisted Laser Desorption Ionization-Tandem Time of Flight mass spectrometry

USDA-ARS?s Scientific Manuscript database

We have analyzed 26 Shiga toxin-producing Escherichia coli (STEC) strains for Shiga toxin 2 (Stx2) production using matrix-assisted laser desorption/ionization time-of-flight-time-of-flight tandem mass spectrometry (MALDI-TOF-TOF-MS/MS) and top-down proteomic analysis. STEC strains were induced to ...

Bacteriophage cell lysis of Shiga toxin-producing Escherichia coli for top-down proteomic identification of Shiga toxin 1 & 2 using matrix-assisted laser desorption/ionization tandem time-of-light mass spectrometry

USDA-ARS?s Scientific Manuscript database

RATIONALE: Analysis of bacteria by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) often relies upon sample preparation methods that result in cell lysis, e.g. bead-beating. However, Shiga toxin-producing Escherichia coli (STEC) can undergo bacteriophage...

A laser unit for photodynamic therapy and robot-assisted microsurgery in dentistry

NASA Astrophysics Data System (ADS)

Chunikhin, A. A.; Bazikyan, E. A.; Pikhtin, N. A.

2017-06-01

Results are presented of photochemical experiments with an IR-laser unit for microsurgery and photodynamic therapy in dentistry. The efficiency of direct generation of singlet oxygen in model organic media in the continuous-wave and pulsed nanosecond modes is examined. The unit can serve both as an independent instrument and as a part of a complex for robot-assisted surgery and dentistry.

Rapid Identification of Cryptococcus neoformans and Cryptococcus gattii by Matrix-Assisted Laser Desorption Ionization–Time of Flight Mass Spectrometry ▿

PubMed Central

McTaggart, Lisa R.; Lei, Eric; Richardson, Susan E.; Hoang, Linda; Fothergill, Annette; Zhang, Sean X.

2011-01-01

Compared to DNA sequence analysis, matrix-assisted laser desorption ionization–time of flight mass spectrometry (MALDI-TOF MS) correctly identified 100% of Cryptococcus species, distinguishing the notable pathogens Cryptococcus neoformans and C. gattii. Identification was greatly enhanced by supplementing a commercial spectral library with additional entries to account for subspecies variability. PMID:21653762

Enhanced biofilm formation and melanin synthesis by the oyster settlement-promoting Shewanella colwelliana is related to hydrophobic surface and simulated intertidal environment.

PubMed

Mitra, Sayani; Gachhui, Ratan; Mukherjee, Joydeep

2015-01-01

A direct relationship between biofilm formation and melanogenesis in Shewanella colwelliana with increased oyster recruitment is already established. Previously, S. colwelliana was grown in a newly patented biofilm-cultivation device, the conico-cylindrical flask (CCF), offering interchangeable hydrophobic/hydrophilic surfaces. Melanization was enhanced when S. colwelliana was cultivated in a hydrophobic vessel compared with a hydrophilic vessel. In the present study, melanogenesis in the CCF was positively correlated with increased architectural parameters of the biofilm (mean thickness and biovolume obtained by confocal laser scanning microscopy) and melanin gene (melA) expression observed by densitometry. Niche intertidal conditions were mimicked in a process operated in an ultra-low-speed rotating disk bioreactor, which demonstrated enhanced biofilm formation, melanogenesis, exopolysaccharide synthesis and melA gene expression compared with a process where 12-h periodic immersion and emersion was prevented. The wettability properties of the settling plane as well as intermittent wetting and drying, which influenced biofilm formation and melA expression, may affect oyster settlement in nature.

Laser-Assisted Bending of Sharp Angles With Small Fillet Radius on Stainless Steel Sheets: Analysis of Experimental Set-Up and Processing Parameters

NASA Astrophysics Data System (ADS)

Gisario, Annamaria; Barletta, Massimiliano; Venettacci, Simone; Veniali, Francesco

2015-06-01

Achievement of sharp bending angles with small fillet radius on stainless steel sheets by mechanical bending requires sophisticated bending device and troublesome operational procedures, which can involve expensive molds, huge presses and large loads. In addition, springback is always difficult to control, thus often leading to final parts with limited precision and accuracy. In contrast, laser-assisted bending of metals is an emerging technology, as it often allows to perform difficult and multifaceted manufacturing tasks with relatively small efforts. In the present work, laser-assisted bending of stainless steel sheets to achieve sharp angles is thus investigated. First, bending trials were performed by combining laser irradiation with an auxiliary bending device triggered by a pneumatic actuator and based on kinematic of deformable quadrilaterals. Second, laser operational parameters, that is, scanning speed, power and number of passes, were varied to identify the most suitable processing settings. Bending angles and fillet radii were measured by coordinate measurement machine. Experimental data were elaborated by combined ANalysis Of Mean (ANOM) and ANalysis Of VAriance (ANOVA). Based on experimental findings, the best strategy to achieve an aircraft prototype from a stainless steel sheet was designed and implemented.

Study of vertical Si/SiO2 interface using laser-assisted atom probe tomography and transmission electron microscopy.

PubMed

Lee, J H; Lee, B H; Kim, Y T; Kim, J J; Lee, S Y; Lee, K P; Park, C G

2014-03-01

Laser-assisted atom probe tomography has opened the way to three-dimensional visualization of nanostructures. However, many questions related to the laser-matter interaction remain unresolved. We demonstrate that the interface reaction can be activated by laser-assisted field evaporation and affects the quantification of the interfacial composition. At a vertical interface between Si and SiO2, a SiO2 molecule tends to combine with a Si atom and evaporate as a SiO molecule, reducing the evaporation field. The features of the reaction depend on the direction of the laser illumination and the inner structure of tip. A high concentration of SiO is observed at a vertical interface between Si and SiO2 when the Si column is positioned at the center of the tip, whereas no significant SiO is detected when the SiO2 layer is at the center. The difference in the interfacial compositions of two samples was due to preferential evaporation of the Si layer. This was explained using transmission electron microscopy observations before and after atom probe experiments. Copyright © 2013 Elsevier Ltd. All rights reserved.

Laser assisted robotic surgery in cornea transplantation

NASA Astrophysics Data System (ADS)

Rossi, Francesca; Micheletti, Filippo; Magni, Giada; Pini, Roberto; Menabuoni, Luca; Leoni, Fabio; Magnani, Bernardo

2017-03-01

Robotic surgery is a reality in several surgical fields, such as in gastrointestinal surgery. In ophthalmic surgery the required high spatial precision is limiting the application of robotic system, and even if several attempts have been designed in the last 10 years, only some application in retinal surgery were tested in animal models. The combination of photonics and robotics can really open new frontiers in minimally invasive surgery, improving the precision, reducing tremor, amplifying scale of motion, and automating the procedure. In this manuscript we present the preliminary results in developing a vision guided robotic platform for laser-assisted anterior eye surgery. The robotic console is composed by a robotic arm equipped with an "end effector" designed to deliver laser light to the anterior corneal surface. The main intended application is for laser welding of corneal tissue in laser assisted penetrating keratoplasty and endothelial keratoplasty. The console is equipped with an integrated vision system. The experiment originates from a clear medical demand in order to improve the efficacy of different surgical procedures: when the prototype will be optimized, other surgical areas will be included in its application, such as neurosurgery, urology and spinal surgery.

Potassium-titanyl-phosphate laser assisted robotic partial nephrectomy in a porcine model: can robotic assistance optimize the power needed for effective cutting and hemostasis?

PubMed

Boris, Ronald S; Eun, Daniel; Bhandari, Akshay; Lyall, Kathryn; Bhandari, Mahendra; Rogers, Craig; Alassi, Osama; Menon, Mani

2007-01-01

A potassium-titanyl-phosphate (KTP) laser through robotic endo-wrist instrument has been evaluated as an ablative and hemostatic tool in robotic assisted laparoscopic partial nephrectomy (RALPN). Ten RALPN were performed in five domestic female pigs. The partial nephrectomies were performed with bulldog clamping of the pedicle. Flexible glass fiber carrying 532-nm green light laser was used through a robotic endowrist instrument in two cases. Power usage from 4 to 10 W was tested. The laser probe was explored both as a cutting knife and for hemostasis. The pelvicalyceal system was closed with a running suture. Partial nephrectomies using KTP laser were performed without complications. Mean operative times and warm ischemia times for laser cases were 96 and 18 min, respectively. Mean estimated blood loss was 60 ml compared with 50 ml for non-laser cases. Complete hemostasis with the laser alone could be achieved with a power of 4 W and was found to be effective. In our hands the laser fiber powered up to 10 W was not effective as a quick cutting agent. Histopathologic analysis of the renal remnant revealed a cauterized surface effect with average laser penetration depth less than 1 mm and minimal surrounding cellular injury. The new robotic endowrist instrument carrying flexible glass fiber transmitting 532-nm green light laser is a useful addition to the armamentarium of the robotic urologic setup. Its control by the console surgeon enables quicker and more complete hemostasis of the cut surface in renal sparing surgery using a porcine model. Histologically proven lased depth of less than 1 mm suggests minimal parenchyma damage in an acute setting. Laser application as a cutting agent, however, requires further investigation with interval power settings beyond the limits of this preliminary study. We estimate that effective cutting should be possible with a setting lower than traditionally recommended for solid organs.

Quantitative coronary angiography using image recovery techniques for background estimation in unsubtracted images

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wong, Jerry T.; Kamyar, Farzad; Molloi, Sabee

2007-10-15

Densitometry measurements have been performed previously using subtracted images. However, digital subtraction angiography (DSA) in coronary angiography is highly susceptible to misregistration artifacts due to the temporal separation of background and target images. Misregistration artifacts due to respiration and patient motion occur frequently, and organ motion is unavoidable. Quantitative densitometric techniques would be more clinically feasible if they could be implemented using unsubtracted images. The goal of this study is to evaluate image recovery techniques for densitometry measurements using unsubtracted images. A humanoid phantom and eight swine (25-35 kg) were used to evaluate the accuracy and precision of the followingmore » image recovery techniques: Local averaging (LA), morphological filtering (MF), linear interpolation (LI), and curvature-driven diffusion image inpainting (CDD). Images of iodinated vessel phantoms placed over the heart of the humanoid phantom or swine were acquired. In addition, coronary angiograms were obtained after power injections of a nonionic iodinated contrast solution in an in vivo swine study. Background signals were estimated and removed with LA, MF, LI, and CDD. Iodine masses in the vessel phantoms were quantified and compared to known amounts. Moreover, the total iodine in left anterior descending arteries was measured and compared with DSA measurements. In the humanoid phantom study, the average root mean square errors associated with quantifying iodine mass using LA and MF were approximately 6% and 9%, respectively. The corresponding average root mean square errors associated with quantifying iodine mass using LI and CDD were both approximately 3%. In the in vivo swine study, the root mean square errors associated with quantifying iodine in the vessel phantoms with LA and MF were approximately 5% and 12%, respectively. The corresponding average root mean square errors using LI and CDD were both 3%. The standard deviations in the differences between measured iodine mass in left anterior descending arteries using DSA and LA, MF, LI, or CDD were calculated. The standard deviations in the DSA-LA and DSA-MF differences (both {approx}21 mg) were approximately a factor of 3 greater than that of the DSA-LI and DSA-CDD differences (both {approx}7 mg). Local averaging and morphological filtering were considered inadequate for use in quantitative densitometry. Linear interpolation and curvature-driven diffusion image inpainting were found to be effective techniques for use with densitometry in quantifying iodine mass in vitro and in vivo. They can be used with unsubtracted images to estimate background anatomical signals and obtain accurate densitometry results. The high level of accuracy and precision in quantification associated with using LI and CDD suggests the potential of these techniques in applications where background mask images are difficult to obtain, such as lumen volume and blood flow quantification using coronary arteriography.« less

Computer vision barrel inspection

NASA Astrophysics Data System (ADS)

Wolfe, William J.; Gunderson, James; Walworth, Matthew E.

1994-02-01

One of the Department of Energy's (DOE) ongoing tasks is the storage and inspection of a large number of waste barrels containing a variety of hazardous substances. Martin Marietta is currently contracted to develop a robotic system -- the Intelligent Mobile Sensor System (IMSS) -- for the automatic monitoring and inspection of these barrels. The IMSS is a mobile robot with multiple sensors: video cameras, illuminators, laser ranging and barcode reader. We assisted Martin Marietta in this task, specifically in the development of image processing algorithms that recognize and classify the barrel labels. Our subsystem uses video images to detect and locate the barcode, so that the barcode reader can be pointed at the barcode.

Implementing Computer Technology in the Rehabilitation Process.

ERIC Educational Resources Information Center

McCollum, Paul S., Ed.; Chan, Fong, Ed.

1985-01-01

This special issue contains seven articles, addressing rehabilitation in the information age, computer-assisted rehabilitation services, computer technology in rehabilitation counseling, computer-assisted career exploration and vocational decision making, computer-assisted assessment, computer enhanced employment opportunities for persons with…

Bone mineral density test

MedlinePlus

... density test; Bone densitometry; DEXA scan; DXA; Dual-energy x-ray absorptiometry; p-DEXA; Osteoporosis - BMD ... most common and accurate way uses a dual-energy x-ray absorptiometry (DEXA) scan. DEXA uses low- ...

Laser-assisted nanomaterial deposition, nanomanufacturing, in situ monitoring and associated apparatus

DOEpatents

Mao, Samuel S; Grigoropoulos, Costas P; Hwang, David J; Minor, Andrew M

2013-11-12

Laser-assisted apparatus and methods for performing nanoscale material processing, including nanodeposition of materials, can be controlled very precisely to yield both simple and complex structures with sizes less than 100 nm. Optical or thermal energy in the near field of a photon (laser) pulse is used to fabricate submicron and nanometer structures on a substrate. A wide variety of laser material processing techniques can be adapted for use including, subtractive (e.g., ablation, machining or chemical etching), additive (e.g., chemical vapor deposition, selective self-assembly), and modification (e.g., phase transformation, doping) processes. Additionally, the apparatus can be integrated into imaging instruments, such as SEM and TEM, to allow for real-time imaging of the material processing.

[Advantages and disadvantages of femtosecond laser assisted LASIK and SMILE].

PubMed

Zhang, F J; Sun, M S

2018-01-11

With the development of excimer laser and femtosecond laser equipment, application of diversified and customized surgical decision in modern corneal refractive surgery has been an inevitable trend. However, how to make a personalized decision with an accurate surgical design to achieve better visual quality becomes the main focus in clinical applications. Small-incision lenticule extraction (SMILE) and femtosecond assisted laser in situ keratomileusis (FS-LASIK) have been commonly acknowledged as the mainstream of corneal refractive surgery for ametropia correction nowadays. Both methods have been verified by clinical practice for many years. This article compares and elaborates the different characteristics with advantages and disadvantages of the two methods so as to provide some reasonable treatment options for refractive surgery. (Chin J Ophthalmol, 2018, 54: 7-10) .

The efficacy of laser-assisted in-office bleaching and home bleaching on sound and demineralized enamel.

PubMed

Ahrari, Farzaneh; Akbari, Majid; Mohammadpour, Sakineh; Forghani, Maryam

2015-12-30

This study investigated the effectiveness of laser-assisted in-office bleaching and home-bleaching in sound and demineralized enamel. The sample consisted of 120 freshly-extracted bovine incisors. Half of the specimens were stored in a demineralizing solution to induce white spot lesions. Following exposure to a tea solution for 7.5 days, the specimens were randomly assigned to 4 groups of 30 according to the type of enamel and the bleaching procedure employed. Groups 1 and 2 consisted of demineralized teeth subjected to in-office bleaching and home bleaching, whereas in groups 3 and 4, sound teeth were subjected to in-office and home bleaching, respectively. A diode laser (810 nm, 2 W, continuous wave, four times for 15 seconds each) was employed for assisting the in-office process. The color of the specimens was measured before (T1) and after (T2) staining and during (T3) and after (T4) the bleaching procedures using a spectrophotometer. The color change (ΔE) between different treatments stages was compared among the groups. There were significant differences in the color change between T2 and T3 (ΔE T2-T3) and T2 and T4 (ΔE T2-T4) stages among the study groups (p<0.05). Pairwise comparison by Duncan test revealed that both ΔET2-T3 and ΔET2-T4 were significantly greater in demineralized teeth submitted to laser-assisted in-office bleaching (group 1) as compared to the other groups (P< 0.05). Laser-assisted in-office bleaching could provide faster and greater whitening effect than home bleaching on stained demineralized enamel, but both procedures produced comparable results on sound teeth.

8TH International Laser Physics Workshop Lphys󈨧 Budapest, July 2-6, 1999, Program

DTIC Science & Technology

1999-07-05

Gerhard J. MUller (Germany) Rudolf Steiner (Germany) Symposium Status and Future Directions of High-Power Laser Installations Co-Chairs: See Leang...Sciences, Kazan. Russia I.A. Shcherbakov General Physics Institute. Russian Academy of Sciences. Moscow, Russia R. Steiner Institute of Laser Technologies...14.50-15.15 R. Steiner , A. Pohl, A. Bentele, T. Meier (Ulm, Germany) Laser Doppler sensor for laser assisted injection 30 SEMINAR 5 --- LASER METHODS IN

A vision-based system for fast and accurate laser scanning in robot-assisted phonomicrosurgery.

PubMed

Dagnino, Giulio; Mattos, Leonardo S; Caldwell, Darwin G

2015-02-01

Surgical quality in phonomicrosurgery can be improved by open-loop laser control (e.g., high-speed scanning capabilities) with a robust and accurate closed-loop visual servoing systems. A new vision-based system for laser scanning control during robot-assisted phonomicrosurgery was developed and tested. Laser scanning was accomplished with a dual control strategy, which adds a vision-based trajectory correction phase to a fast open-loop laser controller. The system is designed to eliminate open-loop aiming errors caused by system calibration limitations and by the unpredictable topology of real targets. Evaluation of the new system was performed using CO(2) laser cutting trials on artificial targets and ex-vivo tissue. This system produced accuracy values corresponding to pixel resolution even when smoke created by the laser-target interaction clutters the camera view. In realistic test scenarios, trajectory following RMS errors were reduced by almost 80 % with respect to open-loop system performances, reaching mean error values around 30 μ m and maximum observed errors in the order of 60 μ m. A new vision-based laser microsurgical control system was shown to be effective and promising with significant positive potential impact on the safety and quality of laser microsurgeries.

Synthesis of Al2O3 thin films using laser assisted spray pyrolysis (LASP)

NASA Astrophysics Data System (ADS)

Dhonge, Baban P.; Mathews, Tom; Tripura Sundari, S.; Krishnan, R.; Balamurugan, A. K.; Kamruddin, M.; Subbarao, R. V.; Dash, S.; Tyagi, A. K.

2013-01-01

The present study reports the development of a laser assisted ultrasonic spray pyrolysis technique and synthesis of dense optical alumina films using the same. In this technique ultrasonically generated aerosols of aluminum acetylacetonate dissolved in ethanol and a laser beam (Nd:YAG, CW, 1064 nm) were fed coaxially and concurrently through a quartz tube on to a hot substrate mounted on an X-Y raster stage. At the laser focused spot the precursor underwent solvent evaporation and solute sublimation followed by precursor vapor decomposition giving rise to oxide coating, the substrate is rastered to get large surface area coating. The surface morphology revealed coalescence of particles with increase in laser power. The observed particle sizes were 17 nm for films synthesized without laser and 18, 21 and 25 nm for films made with laser at 25, 38 and 50 W, respectively. Refractive index of the films synthesized increased from 1.56 to 1.62 as the laser power increased from 0 to 50 W. The stoichiometry of films was studied using XPS and the increase in interfacial layer thickness with laser power was observed from dynamic SIMS depth profiling and ellipsometry.

Laser-assisted chemical vapor deposition setup for fast synthesis of graphene patterns

NASA Astrophysics Data System (ADS)

Zhang, Chentao; Zhang, Jianhuan; Lin, Kun; Huang, Yuanqing

2017-05-01

An automatic setup based on the laser-assisted chemical vapor deposition method has been developed for the rapid synthesis of graphene patterns. The key components of this setup include a laser beam control and focusing unit, a laser spot monitoring unit, and a vacuum and flow control unit. A laser beam with precision control of laser power is focused on the surface of a nickel foil substrate by the laser beam control and focusing unit for localized heating. A rapid heating and cooling process at the localized region is induced by the relative movement between the focalized laser spot and the nickel foil substrate, which causes the decomposing of gaseous hydrocarbon and the out-diffusing of excess carbon atoms to form graphene patterns on the laser scanning path. All the fabrication parameters that affect the quality and number of graphene layers, such as laser power, laser spot size, laser scanning speed, pressure of vacuum chamber, and flow rates of gases, can be precisely controlled and monitored during the preparation of graphene patterns. A simulation of temperature distribution was carried out via the finite element method, providing a scientific guidance for the regulation of temperature distribution during experiments. A multi-layer graphene ribbon with few defects was synthesized to verify its performance of the rapid growth of high-quality graphene patterns. Furthermore, this setup has potential applications in other laser-based graphene synthesis and processing.

Isolated Capsulorhexis Flap Technique in Femtosecond Laser-Assisted Cataract Surgery to Protect the Corneal Endothelial Cells.

PubMed

Li, Shaowei; Chen, Xu; Zhao, Jun; Xu, Man; Yu, Zhouxing

2017-12-18

To present a novel technique that using capsulorhexis flap to protect corneal endothelial cells during femtosecond laser-assisted cataract surgery. During the procedure, an isolated capsulorhexis flap was used to lift it up carefully by using OVD until the flap attached to the corneal inner layer. It kept steady during the phaco phase, and been removed by I/A tip after intraocular lens implantation. In our pilot study, the damage to the corneal endothelial cells from the phacoemulsification procedure were no more than the traditional phaco procedure, even femtosecond laser assisted cataract surgery. Isolated capsulorhexis flap technique initiate a new approach to protect the endothelial cell. It is a simple technique with a short learning curve, but still need a further investigation to prove the protection of corneal endothelial cells.

Endoscopic laser-assisted dacryocistorhinostomy DCR with the placement of a customised silicone and Teflon bicanalicular stent Endoscopic laser-assisted dacryocystorhinostomy (DCR).

PubMed

D'Ecclesia, A; Cocchi, R F; Giordano, F; Mazzilli, E; Longo, C; Laborante, A

We present our experience in endoscopic laser assisted dacryocystorhinostomy (DCR) analyzing the results obtained with a new technique that involves placing bicanalicolar silicone stent more Teflon tube, in combination with paraseptal silastic sheet. In our study 49 of 57 patients (85%) at a mean follow up of at least 12 months have not reported epiphora or more episodes of acute dacryocystitis. 49 out of the 57 patients (85%) in our group reported no additional epiphora or episodes of acute dacryocystitis. Endoscopic DCR is currently the gold standard for sac and post-sac stenosis given the minimal invasiveness of the procedure and the long-term results that appear comparable to those obtained with extrinsic DCR. The principal problem is cicatricial stenosis that can occlude the stoma over time.

[INVITED] Computational intelligence for smart laser materials processing

NASA Astrophysics Data System (ADS)

Casalino, Giuseppe

2018-03-01

Computational intelligence (CI) involves using a computer algorithm to capture hidden knowledge from data and to use them for training ;intelligent machine; to make complex decisions without human intervention. As simulation is becoming more prevalent from design and planning to manufacturing and operations, laser material processing can also benefit from computer generating knowledge through soft computing. This work is a review of the state-of-the-art on the methodology and applications of CI in laser materials processing (LMP), which is nowadays receiving increasing interest from world class manufacturers and 4.0 industry. The focus is on the methods that have been proven effective and robust in solving several problems in welding, cutting, drilling, surface treating and additive manufacturing using the laser beam. After a basic description of the most common computational intelligences employed in manufacturing, four sections, namely, laser joining, machining, surface, and additive covered the most recent applications in the already extensive literature regarding the CI in LMP. Eventually, emerging trends and future challenges were identified and discussed.

Computer Processing Of Tunable-Diode-Laser Spectra

NASA Technical Reports Server (NTRS)

May, Randy D.

1991-01-01

Tunable-diode-laser spectrometer measuring transmission spectrum of gas operates under control of computer, which also processes measurement data. Measurements in three channels processed into spectra. Computer controls current supplied to tunable diode laser, stepping it through small increments of wavelength while processing spectral measurements at each step. Program includes library of routines for general manipulation and plotting of spectra, least-squares fitting of direct-transmission and harmonic-absorption spectra, and deconvolution for determination of laser linewidth and for removal of instrumental broadening of spectral lines.

77 FR 39498 - Guidances for Industry and Food and Drug Administration Staff: Computer-Assisted Detection...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-07-03

...] Guidances for Industry and Food and Drug Administration Staff: Computer-Assisted Detection Devices Applied... Clinical Performance Assessment: Considerations for Computer-Assisted Detection Devices Applied to... guidance, entitled ``Computer-Assisted Detection Devices Applied to Radiology Images and Radiology Device...

Assessment of refractive outcome of femtosecond-assisted LASIK for hyperopia correction

PubMed Central

El-Naggar, Mohamed Tarek; Hovaghimian, Dikran Gilbert

2017-01-01

Introduction Laser vision correction for hyperopia is challenging. The purpose of the study was to assess the refractive outcomes of femtosecond-assisted laser in situ keratomileusis (LASIK) for hyperopic correction using wavefront-optimized ablation profiles. Methods This retrospective case series study included 20 Egyptian patients (40 eyes) with hyperopia or hyperopic astigmatism with a mean manifest refraction spherical equivalent (MRSE) of +2.55D±1.17 (range from +1.00 to +6.00) who had uneventful femtosecond-a assisted LASIK with wavefront-optimized aspheric ablation profile using refractive surgery suite (WaveLight FS200 Femtosecond Laser and WaveLight EX500 Excimer Laser) performed in the Research Institute of Ophthalmology and International Eye Hospital, Giza, Egypt. Statistical analysis was done using Microsoft Excel (Microsoft Corporation, Seattle, WA, USA). Results The procedure significantly reduced the MRSE and cylinder post-operatively (95% were ± 0.50D and 100% ± 1.00 D), with stability of refraction and UDVA over the follow-up period (up to 12 months) after surgery. No eye lost any line of the CDVA, which reflects the excellent safety profile of the procedure; on the other hand, one eye (5%) gained one line and one eye (5%) even gained two lines. There were no significant complications during the procedure. Conclusions Femtosecond-assisted laser in situ keratomileusis for hyperopia showed predictable, effective, and safe refractive outcomes that were stable through 12 months. Longer follow-up period is required to detect any further regression PMID:28461870

Photoionization of water molecules by a train of attosecond pulses assisted by a near-infrared laser: delay and polarization control

NASA Astrophysics Data System (ADS)

Martini, Lara; Boll, Diego I. R.; Fojón, Omar A.

2017-08-01

Basic reactions involving water molecules are essential to understand the interaction between radiation and the biological tissue because living cells are composed mostly by water. Therefore, the knowledge of ionization of the latter is crucial in many domains of Biology and Physics. So, we study theoretically the photoionization of water molecules by extreme ultraviolet attopulse trains assisted by lasers in the near-infrared range. We use a separable Coulomb-Volkov model in which the temporal evolution of the system can be divided into three stages allowing spatial and temporal separation for the Coulomb and Volkov final state wavefunctions. First, we analyze photoelectron angular distributions for different delays between the attopulse train and the assistant laser field. We compare our results for water and Ne atoms as they belong to the same isoelectronic series. Moreover, we contrast our calculations with previous theoretical and experimental work for Ar atoms due to the similarities of the orbitals involved in the reaction. Second, we study the effect of varying the relative orientations of the attopulse and laser field polarizations and we compare our predictions with other theories and experiments. We expect these studies contribute to the improvement of polarization experiments and the development of the attopulse trains and assistant laser fields technologies. Finally, we hope our work promote progress on the control of the chemical reactivity of water molecules since this could be useful in different fields such as radiobiology and medical physics.

Laser-assisted advanced assembly for MEMS fabrication

NASA Astrophysics Data System (ADS)

Atanasov, Yuriy Andreev

Micro Electro-Mechanical Systems (MEMS) are currently fabricated using methods originally designed for manufacturing semiconductor devices, using minimum if any assembly at all. The inherited limitations of this approach narrow the materials that can be employed and reduce the design complexity, imposing limitations on MEMS functionality. The proposed Laser-Assisted Advanced Assembly (LA3) method solves these problems by first fabricating components followed by assembly of a MEMS device. Components are micro-machined using a laser or by photolithography followed by wet/dry etching out of any material available in a thin sheet form. A wide range of materials can be utilized, including biocompatible metals, ceramics, polymers, composites, semiconductors, and materials with special properties such as memory shape alloys, thermoelectric, ferromagnetic, piezoelectric, and more. The approach proposed allows enhancing the structural and mechanical properties of the starting materials through heat treatment, tribological coatings, surface modifications, bio-functionalization, and more, a limited, even unavailable possibility with existing methods. Components are transferred to the substrate for assembly using the thermo-mechanical Selective Laser Assisted Die Transfer (tmSLADT) mechanism for microchips assembly, already demonstrated by our team. Therefore, the mechanical and electronic part of the MEMS can be fabricated using the same equipment/method. The viability of the Laser-Assisted Advanced Assembly technique for MEMS is demonstrated by fabricating magnetic switches for embedding in a conductive carbon-fiber metamaterial for use in an Electromagnetic-Responsive Mobile Cyber-Physical System (E-RMCPS), which is expected to improve the wireless communication system efficiency within a battery-powered device.

CO2 laser arthroscopy-through the arthroscope

NASA Astrophysics Data System (ADS)

Garrick, James G.

1990-06-01

Orthopedists have been among the last of the specialists to utilize lasers in surgery. Even today, laser usage in orthopedics is almost exclusively limited to arthroscopy procedures. Although other types of lasers have been approved for use in orthopedics, nearly all laser-assisted arthroscopic procedures have involved the carbon dioxide laser in the knee. These techniques involve skills and problems not previously encountered. In an attempt to simplify the usage and circumvent some of the problems, we describe a means of laser energy delivery through the arthroscope.

Lasers '81

DOE Office of Scientific and Technical Information (OSTI.GOV)

Collins, C.B.

1982-01-01

Progress in lasers is discussed. The subjects addressed include: excimer lasers, surface spectroscopy, modern laser spectroscopy, free electron lasers, cavities and propagation, lasers in medicine, X-ray and gamma ray lasers, laser spectroscopy of small molecules and clusters, optical bistability, excitons, nonlinear optics in the X-ray and gamma ray regions, collective atomic phenomena, tunable IR lasers, far IR/submillimeter lasers, and laser-assisted collisions. Also treated are: special applications, multiphoton processes in atoms and small molecules, nuclear pumped lasers, material processing and applications, polarization, high energy lasers, laser chemistry, IR molecular lasers, laser applications of collision and dissociation phenomena, solid state laser materials,more » phase conjugation, advances in laser technology for fusion, metal vapor lasers, picosecond phenomena, laser ranging and geodesy, and laser photochemistry of complex molecules.« less

Analysis of Phospholipid Mixtures from Biological Tissues by Matrix-Assisted Laser Desorption and Ionization Time-of-Flight Mass Spectrometry (MALDI-TOF MS): A Laboratory Experiment

ERIC Educational Resources Information Center

Eibisch, Mandy; Fuchs, Beate; Schiller, Jurgen; Sub, Rosmarie; Teuber, Kristin

2011-01-01

Matrix-assisted laser desorption and ionization time-of-flight mass spectrometry (MALDI-TOF MS) is increasingly used to investigate the phospholipid (PL) compositions of tissues and body fluids, often without previous separation of the total mixture into the individual PL classes. Therefore, the questions of whether all PL classes are detectable…

Nanoparticle-assisted laser desorption/ionization mass spectrometry: Novel sample preparation methods and nanoparticle screening for plant metabolite imaging

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yagnik, Gargey B.

The main goal of the presented research is development of nanoparticle based matrix-assisted laser desorption ionization-mass spectrometry (MALDI-MS). This dissertation includes the application of previously developed data acquisition methods, development of novel sample preparation methods, application and comparison of novel nanoparticle matrices, and comparison of two nanoparticle matrix application methods for MALDI-MS and MALDI-MS imaging.

The influence of assist gas on magnetic properties of electrotechnical steel sheets cut with laser

NASA Astrophysics Data System (ADS)

Gaworska-Koniarek, Dominika; Szubzda, Bronisław; Wilczyński, Wiesław; Drosik, Jerzy; Karaś, Kazimierz

2011-07-01

The paper presents the influence of assist gas (air and nitrogen) during laser cutting on magnetization, magnetic permeability and loss characteristics of non-oriented electrical steels. The research was made on an non-oriented M330-50A grade electrical steels by means of single sheet tester. In order to enhance the effect of cutting and the same degradation zone on magnetic properties, strips with different width were achieved. Measurements results indicate that application of air as assist gas has more destructive effect on magnetic properties of electrical steels than nitrogen one.

Femtosecond laser-assisted compared with standard cataract surgery for removal of advanced cataracts.

PubMed

Hatch, Kathryn M; Schultz, Tim; Talamo, Jonathan H; Dick, H Burkhard

2015-09-01

To compare effective phacoemulsification time (EPT) for the removal of brunescent cataracts treated with femtosecond laser-assisted cataract surgery with standard cataract phacoemulsification techniques. Ruhr University Eye Hospital, Bochum, Germany. Comparative prospective case study. The Lens Opacities Classification System III (LOCS III) grading system was used to measure eyes divided into 4 groups having cataract surgery. Groups 1 and 2 contained eyes with LOCS III grade nuclear opalescence (NO) 3 cataracts treated with standard cataract surgery and femtosecond laser-assisted cataract surgery, respectively. Groups 3 and 4 contained brunescent cataracts, LOCS III grades NO5, treated with standard cataract surgery and femtosecond laser-assisted cataract surgery, respectively. There were 240 eyes, with 60 eyes in each group. The EPT in Group 1 ranged from 0.46 to 3.10 (mean 1.38); the EPT in all eyes in Group 2 was 0 (P < .001). The EPT in Groups 3 and 4 was 2.12 to 19.29 (mean 6.85) and 0 to 6.75 (mean 1.35), respectively (P < .001). A comparison between EPT in Groups 1 and 4 showed that EPT in Group 4 was also lower than in Group 1 (P = .013). Groups 4 and 1 were the most statistically similar of all groups compared, suggesting that EPT for a femtosecond laser-treated grade 5 cataract was most similar to that of a standard-treated grade 3 cataract. Femtosecond laser pretreatment for brunescent cataracts allowed for a significant reduction in EPT compared with manual standard phacoemulsification techniques. Drs. Hatch, Talamo, and Dick are consultants to Abbott Medical Optics, Inc. Dr. Schultz has no financial or proprietary interest in any material or method mentioned. Copyright © 2015 ASCRS and ESCRS. Published by Elsevier Inc. All rights reserved.

Spectrophotometric analysis of the effectiveness of a novel in-office laser-assisted tooth bleaching method using Er,Cr:YSGG laser.

PubMed

Dionysopoulos, Dimitrios; Strakas, Dimitrios; Tolidis, Kosmas; Tsitrou, Effrosyni; Koumpia, Effimia; Koliniotou-Koumpia, Eugenia

2017-11-01

The purpose of this in vitro study was to compare the effectiveness of a novel Er,Cr:YSGG laser-assisted in-office tooth bleaching method with a conventional method by spectrophotometric analysis of the tooth color change. Furthermore, the influence of the application time of the bleaching gel on the effectiveness of the methods and the maintenance of the results 7 days and 1 month after the treatments were also evaluated. Twenty-four bovine incisors were stained and randomly distributed into four groups. Group 1 specimens received an in-office bleaching treatment with 35% H 2 O 2 for 2 × 15 min. Group 2 specimens received the same treatment but with extended application time (2 × 20 min). In Group 3, the same in-office bleaching procedure (2 × 15 min) was carried out as that in Group 1, using Er,Cr:YSGG laser irradiation for 2 × 15 s on each specimen to catalyze the reaction of H 2 O 2 breakdown. Group 4 specimens received the same bleaching treatment as Group 3 but with extended application time (2 × 20 min). Er,Cr:YSGG laser-assisted tooth bleaching treatment is more effective than the conventional treatment regarding color change of the teeth. Application time of the bleaching agent may influence the effectiveness of the methods. The color change of the tested treatments decreases after 7 days and 1 month. The clinical relevance of this study is that this novel laser-assisted bleaching treatment may be more advantageous in color change and application time compared to the conventional bleaching treatment.

Long-term clinical evaluation of a 800-nm long-pulsed diode laser with a large spot size and vacuum-assisted suction for hair removal.

PubMed

Ibrahimi, Omar A; Kilmer, Suzanne L

2012-06-01

The long-pulsed diode (800-810-nm) laser is one of the most commonly used and effective lasers for hair removal. Limitations of currently available devices include a small treatment spot size, treatment-associated pain, and the need for skin cooling. To evaluate the long-term hair reduction capabilities of a long-pulsed diode laser with a large spot size and vacuum assisted suction. Thirty-five subjects were enrolled in a prospective, self-controlled, single-center study of axillary hair removal. The study consisted of three treatments using a long-pulsed diode laser with a large spot size and vacuum-assisted suction at 4- to 6-week intervals with follow-up visits 6 and 15 months after the last treatment. Hair clearance was quantified using macro hair-count photographs taken at baseline and at 6- and 15-month follow-up visits. Changes in hair thickness and color, levels of treatment-associated pain, and adverse events were additional study endpoints. There was statistically significant hair clearance at the 6 (54%) and 15-month (42%) follow-up visits. Remaining hairs were thinner and lighter at the 15-month follow-up visit, and the majority of subjects reported feeling up to mild to moderate pain during treatment without the use of pretreatment anesthesia or skin cooling. A long-pulsed diode laser with a large spot size and vacuum-assisted suction is safe and effective for long-term hair removal. This is the largest prospective study to evaluate long-term hair removal and the first to quantify decreases in hair thickness and darkness with treatment. © 2012 by the American Society for Dermatologic Surgery, Inc. Published by Wiley Periodicals, Inc.

Application of Laser in Oral Surgery

PubMed Central

Asnaashari, Mohammad; Zadsirjan, Saeede

2014-01-01

In this review collected from the literature on usage of laser in oral minor surgery based on a Medline search in the time period between the years: 2008 and 2013, the most current evidence on laser-assisted oral minor surgery is going to be surveyed. PMID:25653807

Coulomb-repulsion-assisted double ionization from doubly excited states of argon

NASA Astrophysics Data System (ADS)

Liao, Qing; Winney, Alexander H.; Lee, Suk Kyoung; Lin, Yun Fei; Adhikari, Pradip; Li, Wen

2017-08-01

We report a combined experimental and theoretical study to elucidate nonsequential double-ionization dynamics of argon atoms at laser intensities near and below the recollision-induced ionization threshold. Three-dimensional momentum measurements of two electrons arising from strong-field nonsequential double ionization are achieved with a custom-built electron-electron-ion coincidence apparatus, showing laser intensity-dependent Coulomb repulsion effect between the two outgoing electrons. Furthermore, a previously predicted feature of double ionization from doubly excited states is confirmed in the distributions of sum of two-electron momenta. A classical ensemble simulation suggests that Coulomb-repulsion-assisted double ionization from doubly excited states is at play at low laser intensity. This mechanism can explain the dependence of Coulomb repulsion effect on the laser intensity, as well as the transition from side-by-side to back-to-back dominant emission along the laser polarization direction.

Atmospheric pressure matrix-assisted laser desorption ionization as a plume diagnostic tool in laser evaporation methods

NASA Astrophysics Data System (ADS)

Callahan, John H.; Galicia, Marsha C.; Vertes, Akos

2002-09-01

Laser evaporation techniques, including matrix-assisted pulsed laser evaporation (MAPLE), are attracting increasing attention due to their ability to deposit thin layers of undegraded synthetic and biopolymers. Laser evaporation methods can be implemented in reflection geometry with the laser and the substrate positioned on the same side of the target. In some applications (e.g. direct write, DW), however, transmission geometry is used, i.e. the thin target is placed between the laser and the substrate. In this case, the laser pulse perforates the target and transfers some target material to the substrate. In order to optimize evaporation processes it is important to know the composition of the target plume and the material deposited from the plume. We used a recently introduced analytical method, atmospheric pressure matrix-assisted laser desorption ionization (AP-MALDI) to characterize the ionic components of the plume both in reflection and in transmission geometry. This technique can also be used to directly probe materials deposited on surfaces (such as glass slides) by laser evaporation methods. The test compound (small peptides, e.g. Angiotensin I, ATI or Substance P) was mixed with a MALDI matrix (α-cyano-4-hydroxycinnamic acid (CHCA), sinapinic acid (SA) or 2,5-dihydroxybenzoic acid (DHB)) and applied to the stainless steel (reflection geometry) or transparent conducting (transmission geometry) target holder. In addition to the classical dried droplet method, we also used electrospray target deposition to gain better control of crystallite size, thickness and homogeneity. The target was mounted in front of the inlet orifice of an ion trap mass spectrometer (IT-MS) that sampled the ionic components of the plume generated by a nitrogen laser. We studied the effect of several parameters, such as, the orifice to target distance, illumination geometry, extracting voltage distribution and sample preparation on the generated ions. Various analyte-matrix and matrix-matrix cluster ions were observed with relatively low abundance of the matrix ions.

Calculation of Ophthalmic Viscoelastic Device–Induced Focus Shift During Femtosecond Laser–Assisted Cataract Surgery

PubMed Central

de Freitas, Carolina P.; Cabot, Florence; Manns, Fabrice; Culbertson, William; Yoo, Sonia H.; Parel, Jean-Marie

2015-01-01

Purpose. To assess if a change in refractive index of the anterior chamber during femtosecond laser-assisted cataract surgery can affect the laser beam focus position. Methods. The index of refraction and chromatic dispersion of six ophthalmic viscoelastic devices (OVDs) was measured with an Abbe refractometer. Using the Gullstrand eye model, the index values were used to predict the error in the depth of a femtosecond laser cut when the anterior chamber is filled with OVD. Two sources of error produced by the change in refractive index were evaluated: the error in anterior capsule position measured with optical coherence tomography biometry and the shift in femtosecond laser beam focus depth. Results. The refractive indices of the OVDs measured ranged from 1.335 to 1.341 in the visible light (at 587 nm). The error in depth measurement of the refilled anterior chamber ranged from −5 to +7 μm. The OVD produced a shift of the femtosecond laser focus ranging from −1 to +6 μm. Replacement of the aqueous humor with OVDs with the densest compound produced a predicted error in cut depth of 13 μm anterior to the expected cut. Conclusions. Our calculations show that the change in refractive index due to anterior chamber refilling does not sufficiently shift the laser beam focus position to cause the incomplete capsulotomies reported during femtosecond laser–assisted cataract surgery. PMID:25626971

Computer-Assisted Exposure Treatment for Flight Phobia

ERIC Educational Resources Information Center

Tortella-Feliu, Miguel; Bornas, Xavier; Llabres, Jordi

2008-01-01

This review introduces the state of the art in computer-assisted treatment for behavioural disorders. The core of the paper is devoted to describe one of these interventions providing computer-assisted exposure for flight phobia treatment, the Computer-Assisted Fear of Flying Treatment (CAFFT). The rationale, contents and structure of the CAFFT…

Experimental diode laser-assisted microvascular anastomosis.

PubMed

Reali, U M; Gelli, R; Giannotti, V; Gori, F; Pratesi, R; Pini, R

1993-05-01

An experimental study to evaluate a diode-laser approach to microvascular end-to-end anastomoses is reported. Studies were carried out on the femoral arteries and veins of Wistar rats, and effective welding of vessel tissue was obtained at low laser power, by enhancing laser absorption with indocyanine green (Cardio-green) solution. The histologic and surgical effects of this laser technique were examined and compared with those of conventional microvascular sutured anastomoses.

Ion acoustic wave assisted laser beat wave terahertz generation in a plasma channel

NASA Astrophysics Data System (ADS)

Tyagi, Yachna; Tripathi, Deepak; Walia, Keshav; Garg, Deepak

2018-04-01

Resonant excitation of terahertz (THz) radiation by non-linear mixing of two lasers in the presence of an electrostatic wave is investigated. The electrostatic wave assists in k matching and contributes to non-linear coupling. In this plasma channel, the electron plasma frequency becomes minimum on the axis. The beat frequency ponderomotive force imparts an oscillating velocity to the electrons. In the presence of an ion-acoustic wave, density perturbation due to the ion-acoustic wave couples with the oscillating velocity of the electrons and give rise to non-linear current that gives rise to an ion-acoustic wave frequency assisted THz radiation field. The normalized field amplitude of ion acoustic wave assisted THz varies inversely for ω/ωp . The field amplitude of ion acoustic wave assisted THz decreases as ω/ωp increases.

Gas flow parameters in laser cutting of wood- nozzle design

Treesearch

Kali Mukherjee; Tom Grendzwell; Parwaiz A.A. Khan; Charles McMillin

1990-01-01

The Automated Lumber Processing System (ALPS) is an ongoing team research effort to optimize the yield of parts in a furniture rough mill. The process is designed to couple aspects of computer vision, computer optimization of yield, and laser cutting. This research is focused on optimizing laser wood cutting. Laser machining of lumber has the advantage over...

Modeling Laboratory Astrophysics Experiments using the CRASH code

NASA Astrophysics Data System (ADS)

Trantham, Matthew; Drake, R. P.; Grosskopf, Michael; Bauerle, Matthew; Kruanz, Carolyn; Keiter, Paul; Malamud, Guy; Crash Team

2013-10-01

The understanding of high energy density systems can be advanced by laboratory astrophysics experiments. Computer simulations can assist in the design and analysis of these experiments. The Center for Radiative Shock Hydrodynamics (CRASH) at the University of Michigan developed a code that has been used to design and analyze high-energy-density experiments on OMEGA, NIF, and other large laser facilities. This Eulerian code uses block-adaptive mesh refinement (AMR) with implicit multigroup radiation transport and electron heat conduction. This poster/talk will demonstrate some of the experiments the CRASH code has helped design or analyze including: Radiative shocks experiments, Kelvin-Helmholtz experiments, Rayleigh-Taylor experiments, plasma sheet, and interacting jets experiments. This work is funded by the Predictive Sciences Academic Alliances Program in NNSA-ASC via grant DEFC52- 08NA28616, by the NNSA-DS and SC-OFES Joint Program in High-Energy-Density Laboratory Plasmas, grant number DE-FG52-09NA29548, and by the National Laser User Facility Program, grant number DE-NA0000850.

MALDI-MS analysis and theoretical evaluation of olanzapine as a UV laser desorption ionization (LDI) matrix.

PubMed

Musharraf, Syed Ghulam; Ameer, Mariam; Ali, Arslan

2017-01-05

Matrix-assisted laser desorption/ionization mass spectrometry (MALDI-MS) being soft ionization technique, has become a method of choice for high-throughput analysis of proteins and peptides. In this study, we have explored the potential of atypical anti-psychotic drug olanzapine (OLZ) as a matrix for MALDI-MS analysis of peptides aided with the theoretical studies. Seven small peptides were employed as target analytes to check performance of olanzapine and compared with conventional MALDI matrix α-cyano-4-hydroxycinnamic acid (HCCA). All peptides were successfully detected when olanzapine was used as a matrix. Moreover, peptides angiotensin Ι and angiotensin ΙΙ were detected with better S/N ratio and resolution with this method as compared to their analysis by HCCA. Computational studies were performed to determine the thermochemical properties of olanzapine in order to further evaluate its similarity to MALDI matrices which were found in good agreement with the data of existing MALDI matrices. Copyright © 2016. Published by Elsevier B.V.

An Interview with Matthew P. Greving, PhD. Interview by Vicki Glaser.

PubMed

Greving, Matthew P

2011-10-01

Matthew P. Greving is Chief Scientific Officer at Nextval Inc., a company founded in early 2010 that has developed a discovery platform called MassInsight™.. He received his PhD in Biochemistry from Arizona State University, and prior to that he spent nearly 7 years working as a software engineer. This experience in solving complex computational problems fueled his interest in developing technologies and algorithms related to acquisition and analysis of high-dimensional biochemical data. To address the existing problems associated with label-based microarray readouts, he beganwork on a technique for label-free mass spectrometry (MS) microarray readout compatible with both matrix-assisted laser/desorption ionization (MALDI) and matrix-free nanostructure initiator mass spectrometry (NIMS). This is the core of Nextval’s MassInsight technology, which utilizes picoliter noncontact deposition of high-density arrays on mass-readout substrates along with computational algorithms for high-dimensional data processingand reduction.

The Application of Web-based Computer-assisted Instruction Courseware within Health Assessment

NASA Astrophysics Data System (ADS)

Xiuyan, Guo

Health assessment is a clinical nursing course and places emphasis on clinical skills. The application of computer-assisted instruction in the field of nursing teaching solved the problems in the traditional lecture class. This article stated teaching experience of web-based computer-assisted instruction, based upon a two-year study of computer-assisted instruction courseware use within the course health assessment. The computer-assisted instruction courseware could develop teaching structure, simulate clinical situations, create teaching situations and facilitate students study.

Rapidly assessing changes in bone mineral balance using natural stable calcium isotopes

PubMed Central

Morgan, Jennifer L. L.; Skulan, Joseph L.; Gordon, Gwyneth W.; Romaniello, Stephen J.; Smith, Scott M.; Anbar, Ariel D.

2012-01-01

The ability to rapidly detect changes in bone mineral balance (BMB) would be of great value in the early diagnosis and evaluation of therapies for metabolic bone diseases such as osteoporosis and some cancers. However, measurements of BMB are hampered by difficulties with using biochemical markers to quantify the relative rates of bone resorption and formation and the need to wait months to years for altered BMB to produce changes in bone mineral density large enough to resolve by X-ray densitometry. We show here that, in humans, the natural abundances of Ca isotopes in urine change rapidly in response to changes in BMB. In a bed rest experiment, use of high-precision isotope ratio MS allowed the onset of bone loss to be detected in Ca isotope data after about 1 wk, long before bone mineral density has changed enough to be detectable with densitometry. The physiological basis of the relationship between Ca isotopes and BMB is sufficiently understood to allow quantitative translation of changes in Ca isotope abundances to changes in bone mineral density using a simple model. The rate of change of bone mineral density inferred from Ca isotopes is consistent with the rate observed by densitometry in long-term bed rest studies. Ca isotopic analysis provides a powerful way to monitor bone loss, potentially making it possible to diagnose metabolic bone disease and track the impact of treatments more effectively than is currently possible. PMID:22652567

Comparison of Cellular Alterations in Fat Cells Harvested With Laser-Assisted Liposuction and Suction-Assisted Liposuction.

PubMed

Yildiz, Kemalettin; Taşli, Pakize Neslihan; Şahin, Fikrettin; Güneren, Ethem

2016-05-01

The aim of the present study was to evaluate the viability and proliferative capacity of adipose-derived stem cells obtained by laser-assisted liposuction (LAL). Fat tissue was obtained from 7 male patients treated surgically for gynecomastia. On one side, harvesting was made before LAL, while it was implemented after LAL on the contralateral side. Viability, cell surface antigens, pluripotency, and apoptosis were assessed and compared in these samples. Cells harvested before and after LAL did not exhibit any significant difference in terms of surface cell markers. Number of viable stem cells was lower initially after exposure to laser, while this difference was reversed at the end of 72 hours. Genetic indicators of cellular differentiation were similar in both groups. Apoptosis indicators were increased remarkably after laser exposure in the first 24 hours, but this increase was absent 72 hours after LAL procedure. The authors' results have promising clinical relevance since mesenchymal stem cells harvested during LAL have maintained appropriate cellular features to be used for autologous fat transfer and fat grafting.

Tone-assisted time delay interferometry on GRACE Follow-On

NASA Astrophysics Data System (ADS)

Francis, Samuel P.; Shaddock, Daniel A.; Sutton, Andrew J.; de Vine, Glenn; Ware, Brent; Spero, Robert E.; Klipstein, William M.; McKenzie, Kirk

2015-07-01

We have demonstrated the viability of using the Laser Ranging Interferometer on the Gravity Recovery and Climate Experiment Follow-On (GRACE-FO) space mission to test key aspects of the interspacecraft interferometry proposed for detecting gravitational waves. The Laser Ranging Interferometer on GRACE-FO will be the first demonstration of interspacecraft interferometry. GRACE-FO shares many similarities with proposed space-based gravitational wave detectors based on the Laser Interferometer Space Antenna (LISA) concept. Given these similarities, GRACE-FO provides a unique opportunity to test novel interspacecraft interferometry techniques that a LISA-like mission will use. The LISA Experience from GRACE-FO Optical Payload (LEGOP) is a project developing tests of arm locking and time delay interferometry (TDI), two frequency stabilization techniques, that could be performed on GRACE-FO. In the proposed LEGOP TDI demonstration one GRACE-FO spacecraft will have a free-running laser while the laser on the other spacecraft will be locked to a cavity. It is proposed that two one-way interspacecraft phase measurements will be combined with an appropriate delay in order to produce a round-trip, dual one-way ranging (DOWR) measurement independent of the frequency noise of the free-running laser. This paper describes simulated and experimental tests of a tone-assisted TDI ranging (TDIR) technique that uses a least-squares fitting algorithm and fractional-delay interpolation to find and implement the delays needed to form the DOWR TDI combination. The simulation verifies tone-assisted TDIR works under GRACE-FO conditions. Using simulated GRACE-FO signals the tone-assisted TDIR algorithm estimates the time-varying interspacecraft range with a rms error of ±0.2 m , suppressing the free-running laser frequency noise by 8 orders of magnitude. The experimental results demonstrate the practicability of the technique, measuring the delay at the 6 ns level in the presence of a significant displacement signal.

Improving osteoblasts cells proliferation via femtosecond laser surface modification of 3D-printed poly-ɛ-caprolactone scaffolds for bone tissue engineering applications

NASA Astrophysics Data System (ADS)

Daskalova, A.; Ostrowska, B.; Zhelyazkova, A.; Święszkowski, W.; Trifonov, A.; Declercq, H.; Nathala, C.; Szlazak, K.; Lojkowski, M.; Husinsky, W.; Buchvarov, I.

2018-06-01

Synthetic polymer biomaterials incorporating cells are a promising technique for treatment of orthopedic injuries. To enhance the integration of biomaterials into the human body, additional functionalization of the scaffold surface should be carried out that would assist one in mimicking the natural cellular environment. In this study, we examined poly-ɛ-caprolactone (PCL) fiber matrices in view of optimizing the porous properties of the constructs. Altering the porosity of a PCL scaffold is expected to improve the material's biocompatibility, thus influencing its osteoconductivity and osteointegration. We produced 3D poly-ɛ-caprolactone (PCL) matrices by a fused deposition modeling method for bone and cartilage tissue engineering and performed femtosecond (fs) laser modification experiments to improve the surface properties of the PCL construct. Femtosecond laser processing is one of the useful tools for creating a vast diversity of surface patterns with reproducibility and precision. The processed surface of the PCL matrix was examined to follow the effect of the laser parameters, namely the laser pulse energy and repetition rate and the number ( N) of applied pulses. The modified zones were characterized by scanning electron microscopy (SEM), confocal microscopy, X-ray computed tomography and contact angle measurements. The results obtained demonstrated changes in the morphology of the processed surface. A decrease in the water contact angle was also seen after fs laser processing of fiber meshes. Our work demonstrated that a precise control of material surface properties could be achieved by applying a different number of laser pulses at various laser fluence values. We concluded that the structural features of the matrix remain unaffected and can be successfully modified through laser postmodification. The cells tests indicated that the micro-modifications created induced MG63 and MC3T3 osteoblast cellular orientation. The analysis of the MG63 and MC3T3 osteoblast attachment suggested regulation of cells volume migration.

[INVITED] Laser gas assisted treatment of Ti-alloy: Analysis of surface characteristics

NASA Astrophysics Data System (ADS)

Yilbas, B. S.; Ali, H.; Karatas, C.

2016-04-01

Laser gas assisted treatment of Ti6Al4V alloy surface is carried out and nitrogen/oxygen mixture with partial pressure of PO2/PN2=1/3 is introduced during the surface treatment process. Analytical tools are used to characterize the laser treated surfaces. The fracture toughness at the surface and the residual stress in the surface region of the laser treated layer are measured. Scratch tests are carried out to determine the friction coefficient of the treated surface. It is found that closely spaced regular laser scanning tracks generates a self-annealing effect in the laser treated layer while lowering the stress levels in the treated region. Introducing high pressure gas mixture impingement at the surface results in formation of oxide and nitride species including, TiO, TiO2, TiN and TiOxNy in the surface region. A dense layer consisting of fine size grains are formed in the surface region of the laser treated layer, which enhances the microhardness at the surface. The fracture toughness reduces after the laser treatment process because of the microhardness enhancement at the surface. The residual stress formed is comprehensive, which is in the order of -350 MPa.

Identification of multiple mRNA and DNA sequences from small tissue samples isolated by laser-assisted microdissection.

PubMed

Bernsen, M R; Dijkman, H B; de Vries, E; Figdor, C G; Ruiter, D J; Adema, G J; van Muijen, G N

1998-10-01

Molecular analysis of small tissue samples has become increasingly important in biomedical studies. Using a laser dissection microscope and modified nucleic acid isolation protocols, we demonstrate that multiple mRNA as well as DNA sequences can be identified from a single-cell sample. In addition, we show that the specificity of procurement of tissue samples is not compromised by smear contamination resulting from scraping of the microtome knife during sectioning of lesions. The procedures described herein thus allow for efficient RT-PCR or PCR analysis of multiple nucleic acid sequences from small tissue samples obtained by laser-assisted microdissection.

Design Principles for Computer-Assisted Instruction in Histology Education: An Exploratory Study

ERIC Educational Resources Information Center

Deniz, Hasan; Cakir, Hasan

2006-01-01

The purpose of this paper is to describe the development process and the key components of a computer-assisted histology material. Computer-assisted histology material is designed to supplement traditional histology education in a large Midwestern university. Usability information of the computer-assisted instruction (CAI) material was obtained…

45 CFR 233.35 - Computing the assistance payment under retrospective budgeting after the initial one or two...

Code of Federal Regulations, 2010 CFR

2010-10-01

... 45 Public Welfare 2 2010-10-01 2010-10-01 false Computing the assistance payment under... FINANCIAL ASSISTANCE PROGRAMS § 233.35 Computing the assistance payment under retrospective budgeting after... shall be computed retrospectively, i.e., shall be based on income and other relevant circumstances in...

Laser Assisted Microsurgical Anastomosis.

DTIC Science & Technology

1983-09-22

motion exercises of the patient post surgery and for the development of appropriate regimes for nursing and general rehabilitation of the patient...8217AD-Ai4S 48? LASER ASSISTED MICROSUROICAL ANASTOMOSIS(U) MIAMI UNIV i/i FL DEPT OF ORTHOPAEDICS AND REHABILITATION N E BURKHALTER 22 SEP 83 NBBI4-i-K...William E. Burkhalter, M.D. NOO014-81-K-0446 Professor of Orthopaedics and Rehabilitation 0. PERFORMING ORGANIZATION NAME AND ADDRESS 10. PROGRAM

[The pros and cons of femtosecond laser-assisted cataract surgery].

PubMed

Li, Z H; Ye, Z

2016-02-01

Femtosecond laser-assisted cataract surgery (FLACS) is known as an innovative new technology. Compared with traditional surgical approach, FLACS is more accurate, more predictable and less energy used. However, in the current stage of development, there still may be intraoperative and postoperative complications, or even serious complications. FLACS has obvious advantages in certain surgical steps, but there are still clear disadvantages, so it still cannot completely replace the traditional phacoemulsification surgery.

Determination of Macrolide Antibiotics Using Dispersive Liquid-Liquid Microextraction Followed by Surface-Assisted Laser Desorption/Ionization Mass Spectrometry

NASA Astrophysics Data System (ADS)

Chen, Kuan-Yu; Yang, Thomas C.; Chang, Sarah Y.

2012-06-01

A novel method for the determination of macrolide antibiotics using dispersive liquid-liquid microextraction coupled to surface-assisted laser desorption/ionization mass spectrometric detection was developed. Acetone and dichloromethane were used as the disperser solvent and extraction solvent, respectively. A mixture of extraction solvent and disperser solvent were rapidly injected into a 1.0 mL aqueous sample to form a cloudy solution. After the extraction, macrolide antibiotics were detected using surface-assisted laser desorption/ionization mass spectrometry (SALDI/MS) with colloidal silver as the matrix. Under optimum conditions, the limits of detection (LODs) at a signal-to-noise ratio of 3 were 2, 3, 3, and 2 nM for erythromycin (ERY), spiramycin (SPI), tilmicosin (TILM), and tylosin (TYL), respectively. This developed method was successfully applied to the determination of macrolide antibiotics in human urine samples.

Pulsed Laser-Assisted Focused Electron-Beam-Induced Etching of Titanium with XeF 2 : Enhanced Reaction Rate and Precursor Transport

DOE PAGES

Noh, J. H.; Fowlkes, J. D.; Timilsina, R.; ...

2015-01-28

We introduce a laser-assisted focused electron-beam-induced etching (LA-FEBIE) process which is a versatile, direct write nanofabrication method that allows nanoscale patterning and editing; we do this in order to enhance the etch rate of electron-beam-induced etching. The results demonstrate that the titanium electron stimulated etch rate via the XeF2 precursor can be enhanced up to a factor of 6 times with an intermittent pulsed laser assist. Moreover, the evolution of the etching process is correlated to in situ stage current measurements and scanning electron micrographs as a function of time. Finally, the increased etch rate is attributed to photothermally enhancedmore » Ti–F reaction and TiF4 desorption and in some regimes enhanced XeF2 surface diffusion to the reaction zone.« less

Patterning of Endothelial Cells and Mesenchymal Stem Cells by Laser-Assisted Bioprinting to Study Cell Migration.

PubMed

Bourget, Jean-Michel; Kérourédan, Olivia; Medina, Manuela; Rémy, Murielle; Thébaud, Noélie Brunehilde; Bareille, Reine; Chassande, Olivier; Amédée, Joëlle; Catros, Sylvain; Devillard, Raphaël

2016-01-01

Tissue engineering of large organs is currently limited by the lack of potent vascularization in vitro . Tissue-engineered bone grafts can be prevascularized in vitro using endothelial cells (ECs). The microvascular network architecture could be controlled by printing ECs following a specific pattern. Using laser-assisted bioprinting, we investigated the effect of distance between printed cell islets and the influence of coprinted mesenchymal cells on migration. When printed alone, ECs spread out evenly on the collagen hydrogel, regardless of the distance between cell islets. However, when printed in coculture with mesenchymal cells by laser-assisted bioprinting, they remained in the printed area. Therefore, the presence of mesenchymal cell is mandatory in order to create a pattern that will be conserved over time. This work describes an interesting approach to study cell migration that could be reproduced to study the effect of trophic factors.

Patterning of Endothelial Cells and Mesenchymal Stem Cells by Laser-Assisted Bioprinting to Study Cell Migration

PubMed Central

Medina, Manuela; Rémy, Murielle; Thébaud, Noélie Brunehilde; Bareille, Reine; Chassande, Olivier; Amédée, Joëlle; Catros, Sylvain

2016-01-01

Tissue engineering of large organs is currently limited by the lack of potent vascularization in vitro. Tissue-engineered bone grafts can be prevascularized in vitro using endothelial cells (ECs). The microvascular network architecture could be controlled by printing ECs following a specific pattern. Using laser-assisted bioprinting, we investigated the effect of distance between printed cell islets and the influence of coprinted mesenchymal cells on migration. When printed alone, ECs spread out evenly on the collagen hydrogel, regardless of the distance between cell islets. However, when printed in coculture with mesenchymal cells by laser-assisted bioprinting, they remained in the printed area. Therefore, the presence of mesenchymal cell is mandatory in order to create a pattern that will be conserved over time. This work describes an interesting approach to study cell migration that could be reproduced to study the effect of trophic factors. PMID:27833916

Oxygen-assisted multipass cutting of carbon fiber reinforced plastics with ultra-short laser pulses

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kononenko, T. V.; Komlenok, M. S.; Konov, V. I.

Deep multipass cutting of bidirectional and unidirectional carbon fiber reinforced plastics (CFRP) with picosecond laser pulses was investigated in different static atmospheres as well as with the assistance of an oxygen or nitrogen gas flow. The ablation rate was determined as a function of the kerf depth and the resulting heat affected zone was measured. An assisting oxygen gas flow is found to significantly increase the cutting productivity, but only in deep kerfs where the diminished evaporative ablation due to the reduced laser fluence reaching the bottom of the kerf does not dominate the contribution of reactive etching anymore. Oxygen-supportedmore » cutting was shown to also solve the problem that occurs when cutting the CFRP parallel to the fiber orientation where a strong deformation and widening of the kerf, which temporarily slows down the process speed, is revealed to be typical for processing in standard air atmospheres.« less

The Influence of Reconstruction Kernel on Bone Mineral and Strength Estimates Using Quantitative Computed Tomography and Finite Element Analysis.

PubMed

Michalski, Andrew S; Edwards, W Brent; Boyd, Steven K

2017-10-17

Quantitative computed tomography has been posed as an alternative imaging modality to investigate osteoporosis. We examined the influence of computed tomography convolution back-projection reconstruction kernels on the analysis of bone quantity and estimated mechanical properties in the proximal femur. Eighteen computed tomography scans of the proximal femur were reconstructed using both a standard smoothing reconstruction kernel and a bone-sharpening reconstruction kernel. Following phantom-based density calibration, we calculated typical bone quantity outcomes of integral volumetric bone mineral density, bone volume, and bone mineral content. Additionally, we performed finite element analysis in a standard sideways fall on the hip loading configuration. Significant differences for all outcome measures, except integral bone volume, were observed between the 2 reconstruction kernels. Volumetric bone mineral density measured using images reconstructed by the standard kernel was significantly lower (6.7%, p < 0.001) when compared with images reconstructed using the bone-sharpening kernel. Furthermore, the whole-bone stiffness and the failure load measured in images reconstructed by the standard kernel were significantly lower (16.5%, p < 0.001, and 18.2%, p < 0.001, respectively) when compared with the image reconstructed by the bone-sharpening kernel. These data suggest that for future quantitative computed tomography studies, a standardized reconstruction kernel will maximize reproducibility, independent of the use of a quantitative calibration phantom. Copyright © 2017 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Quantification and characterization of enzymatically produced hyaluronan with fluorophore-assisted carbohydrate electrophoresis.

PubMed

Kooy, Floor K; Ma, Muyuan; Beeftink, Hendrik H; Eggink, Gerrit; Tramper, Johannes; Boeriu, Carmen G

2009-01-15

Hyaluronan (HA) is a polysaccharide with high-potential medical applications, depending on the chain length and the chain length distribution. Special interest goes to homogeneous HA oligosaccharides, which can be enzymatically produced using Pasteurella multocida hyaluronan synthase (PmHAS). We have developed a sensitive, simple, and fast method, based on fluorophore-assisted carbohydrate electrophoresis (FACE), for characterization and quantification of polymerization products. A chromatographic pure fluorescent template was synthesized from HA tetrasaccharide (HA4) and 2-aminobenzoic acid. HA4-fluor and HA4 were used as template for PmHAS-mediated polymerization of nucleotide sugars. All products, fluorescent and nonfluorescent, were analyzed with gel electrophoresis and quantified using lane densitometry. Comparison of HA4- and HA4-fluor-derived polymers showed that the fluorophore did not negatively influence the PmHAS-mediated polymerization. Only even-numbered oligosaccharide products were observed using HA4-fluor or HA4 as template. The fluorophore intensity was linearly related to its concentration, and the limit of detection was determined to be 7.4pmol per product band. With this assay, we can now differentiate oligosaccharides of size range DP2 (degree of polymerization 2) to approximately DP400, monitor the progress of polymerization reactions, and measure subtle differences in polymerization rate. Quantifying polymerization products enables us to study the influence of experimental conditions on HA synthesis.

Experimental investigation on cleaning of corroded ancient coins using a Nd:YAG laser

NASA Astrophysics Data System (ADS)

Zhu, Huazhong; Lu, Jian; Ni, Xiaowu; Shen, Zhonghua

2017-05-01

The objective of the work reported is to study experimentally on the removal of corrosion layer from the ancient coins using laser beam as the conservation tool. With the use of Q-switched Nd:YAG laser radiation at 1064 nm, dry laser cleaning, steam laser cleaning and chemical-assisted laser cleaning were used to find out a more suitable and efficient laser treatment for corrosion removal. Cleaning tests were performed on ancient Chinese coins. Experimental results shows that the dry laser cleaning was not successful at removing all types of corrosion crust. It was possible to remove the outer thicker layer of the corrosion products (typically known as patina), but failed on the thinner layer of cuprite. The steam laser cleaning could decrease the initial removal threshold and improve the removal efficiency especially for the oxidation with powdery structure. As for chemical-assisted laser treatment, the cleaning results demonstrate that the combination of laser and chemical reagent could provide a considerable improvement in corrosion removal compared with the conventional laser treatments. Most of the corrosion contaminant was stripped, even the cuprite layer. Moreover, no secondary pollution was formed on the cleaned surface. X-ray fluorescence was applied to determine the variation of composition of surface layer and bulk metal before and after the coins cleaned. It shows that all of the three laser treatments were efficient to reduce the chlorine concentration on the surface of the coins more than 75%.

Endoscopic placement of Jones lacrimal tubes with the assistance of holmium YAG laser.

PubMed

Boboridis, Kostas G; Downes, Richard N

2005-06-01

The aim of this paper is to highlight the use of the Holmium YAG laser in the endoscopic placement of Lester Jones tubes in patients with a blocked canaliculus or failed lacrimal pump function. Sixteen cases with a non-functional canaliculus were included over a one-year period. Following caruncle excision, a 19 G needle is inserted through the medial canthal tissues into the nasal space. Nasal endoscopy confirms the accurate positioning in relation to the nasal anatomy. With the Holmium YAG laser, a tissue channel is fashioned around the guide needle through the structures of the lateral nasal wall to facilitate an accurate and secure placement of the Jones tube. The endoscopic, laser-assisted placement reduces the operating time to less than 20 minutes, minimizes tissue trauma and does not require the initial surgical steps of an open DCR procedure. There were 14 cases (87.5%) with securely retained tubes and two cases (12.5%) that required tube replacement. The advantage of the procedure is especially great in revision surgery where the ostium is opened through scar tissue. Nasal endoscopy with the assistance of the Holmium YAG laser offers simplicity and precision in the placement of Jones tubes. It minimizes tissue trauma and increases the surgical success rate.

Low-threshold ablation of enamel and dentin using Nd:YAG laser assisted with chromophore with different pulse shapes

NASA Astrophysics Data System (ADS)

Bonora, Stefano; Benazzato, Paolo; Stefani, Alessandro; Villoresi, Paolo

2004-05-01

Neodimium laser treatment has several drawbacks when used in the hard tissue cutting, because of the low absorption of the dental tissues at its wavelength. This investigation proved that the Nd:YAG radiation is a powerful ablation tool if it is used with the dye assisted method. Several in vitro tests on enamel and dentin were accomplished changing some laser parameters to have different pulse shapes and durations from 125μs up to 1.4ms. The importance of short time high power peaks, typical of crystal lasers, in the ablation process was investigated. The pulse shapes were analyzed by their intensity in space and time profiles. A first set of results found the optimum dye concentration be used in all the following tests. Furthermore the ablation threshold for this technique was found for each different pulse shapes and durations. A low energy ablation method was found to avoid temperature increase and surface cracks formation. In vitro temperature analysis was reported comparing the differences between no dye application laser treatment and with a dye spray applied. A strong reduction of the temperature increase was found in the dye assisted method. A discussion on the general findings and their possible clinical applications is presented.

Laser-assisted treatment of patients with hemorrhagic diathesis

NASA Astrophysics Data System (ADS)

Neckel, Claus P.

2000-03-01

Today more and more patients with bleeding disorder come to our office for treatment. The number of patients with therapeutic anticoagulation is growing steadily. Discontinuation of this therapy can often be crucial. On the other hand are oralsurgical procedures extremely sensitive to bleeding due to the constant presents of saliva with its high fibrinolytic activity. The aim of this study was to evaluate the use of a surgical diode (wavelength 810 nm) laser as accessory tool in the treatment of patients with hemorrhagic diathesis. Enclosed in the study were 123 patients with: (1) Coumarintherapy, a Quick test ratio of 15 - 25%; (2) More than 300 mg of ASS/die; (3) Hemophilia, a factor activity under 35%; (4) Morbus Werlhof with less than 30000 thrombocytes. 179 Surgical procedures: (1) Tooth extraction 86%; (2) Apexectomy 3%; (3) Tumorexcision 9%; (4) Curettage and flapsurgery 1%; (5) Gingivectomy 1%. All procedures were laser-assisted with a diode laser emitting 810 nm. The glass fibers used were depending on the procedures either 200, 400, or 600 micron. No coagulating agents or tissue adhesives were used in addition. The postoperative outcome and complication rates were compared to substitution therapy and tissue adhesives. Laser-assisted treatment of these patients shows a high predictability and success rate leaving out side effects of drugs and human cryoprecipitates. Postoperative impairment is diminished.

Gold Nanoparticle-Assisted Laser Therapy for the Disruption of Methicillin-Resistant Staphylococcus aureus Biofilms

DTIC Science & Technology

2016-11-28

agents. The use of laser therapy to kill bacteria or to enhance the bactericidal activity of conventional antibiotics has been previously reported in the...biofilm samples and activation of the laser. This ensured highly accurate alignment of the samples with the laser beam and reduced variability in the laser... active against biofilm infections are urgently needed. The data presented here provide important information on optimization and successful

Metalizing Solar Cells by Selective Electroplating

NASA Technical Reports Server (NTRS)

Dutta, S.; Palaschak, P. A.

1986-01-01

Contact patterns traced by laser scanning. Conductor paths deposited on silicon solar-cell wafers by laser irradiation followed by electroplating. Laser-assisted metalization technique offers better resolution and lower contact resistance than does conventional metalization by screen printing. At the same time, less expensive than metalization with masks and photolithography.

Visual based laser speckle pattern recognition method for structural health monitoring

NASA Astrophysics Data System (ADS)

Park, Kyeongtaek; Torbol, Marco

2017-04-01

This study performed the system identification of a target structure by analyzing the laser speckle pattern taken by a camera. The laser speckle pattern is generated by the diffuse reflection of the laser beam on a rough surface of the target structure. The camera, equipped with a red filter, records the scattered speckle particles of the laser light in real time and the raw speckle image of the pixel data is fed to the graphic processing unit (GPU) in the system. The algorithm for laser speckle contrast analysis (LASCA) computes: the laser speckle contrast images and the laser speckle flow images. The k-mean clustering algorithm is used to classify the pixels in each frame and the clusters' centroids, which function as virtual sensors, track the displacement between different frames in time domain. The fast Fourier transform (FFT) and the frequency domain decomposition (FDD) compute the modal properties of the structure: natural frequencies and damping ratios. This study takes advantage of the large scale computational capability of GPU. The algorithm is written in Compute Unifies Device Architecture (CUDA C) that allows the processing of speckle images in real time.

Usability of an Adaptive Computer Assistant that Improves Self-care and Health Literacy of Older Adults

PubMed Central

Blanson Henkemans, O. A.; Rogers, W. A.; Fisk, A. D.; Neerincx, M. A.; Lindenberg, J.; van der Mast, C. A. P. G.

2014-01-01

Summary Objectives We developed an adaptive computer assistant for the supervision of diabetics’ self-care, to support limiting illness and need for acute treatment, and improve health literacy. This assistant monitors self-care activities logged in the patient’s electronic diary. Accordingly, it provides context-aware feedback. The objective was to evaluate whether older adults in general can make use of the computer assistant and to compare an adaptive computer assistant with a fixed one, concerning its usability and contribution to health literacy. Methods We conducted a laboratory experiment in the Georgia Tech Aware Home wherein 28 older adults participated in a usability evaluation of the computer assistant, while engaged in scenarios reflecting normal and health-critical situations. We evaluated the assistant on effectiveness, efficiency, satisfaction, and educational value. Finally, we studied the moderating effects of the subjects’ personal characteristics. Results Logging self-care tasks and receiving feedback from the computer assistant enhanced the subjects’ knowledge of diabetes. The adaptive assistant was more effective in dealing with normal and health-critical situations, and, generally, it led to more time efficiency. Subjects’ personal characteristics had substantial effects on the effectiveness and efficiency of the two computer assistants. Conclusions Older adults were able to use the adaptive computer assistant. In addition, it had a positive effect on the development of health literacy. The assistant has the potential to support older diabetics’ self care while maintaining quality of life. PMID:18213433

An experimental study on minimally occlusive laser-assisted vascular anastomosis in bypass surgery: the importance of temperature monitoring during laser welding procedures.

PubMed

Esposito, G; Rossi, F; Puca, A; Albanese, A; Sabatino, G; Matteini, P; Lofrese, G; Maira, G; Pini, R

2010-01-01

Laser welding has been proposed as an alternative technique to conventional stitching in microvascular anastomosis, with the advantages of improving the vascular healing process and reducing the risk of malfunction of a bypass. Our group recently proposed a laser-assisted end-to-side anastomotic technique, providing the advantages of laser welding and reducing the occlusion time of the recipient vessel, that is important in neurosurgical bypass procedures, in order to reduce the risk of cerebral ischemia. This in vivo study focuses on the control of the temperature dynamics developing in the welded tissue. A jugular vein graft was harvested and implanted on the rabbit carotid artery by means of two end-to-side anastomosis. Laser welding procedure was then carried out to implant the bypass. A real-time monitoring of the temperature during welding was performed with an infrared thermocamera, in order to control the laser-induced heating effect on the external surface of the vessel walls. The temperature analysis highlighted the dynamic of the heating effect in space and time and enabled us to define an optimal temperature range in operative conditions. The temperature control provided safe tissue heating confined within the directly irradiated area, with negligible damage to surrounding tissues, as well as effective sealing and welding of the vessel edges at the anastomotic sites. The average occlusion time of the carotid artery was about 11 minutes. After a follow-up of 30 days, all the bypasses were patent and no signs of thrombosis or leak point pressure were present, thus confirming the safety of this laser-assisted anastomotic procedure.

Laser-assisted in situ keratomileusis with optimized, fast-repetition, and cyclotorsion control excimer laser to treat hyperopic astigmatism with high cylinder.

PubMed

Alió Del Barrio, Jorge L; Tiveron, Mauro; Plaza-Puche, Ana B; Amesty, María A; Casanova, Laura; García, María J; Alió, Jorge L

2017-10-18

To evaluate the visual outcomes after femtosecond laser-assisted laser in situ keratomileusis (LASIK) surgery to correct primary compound hyperopic astigmatism with high cylinder using a fast repetition rate excimer laser platform with optimized aspheric profiles and cyclotorsion control. Eyes with primary simple or compound hyperopic astigmatism and a cylinder power ≥3.00 D had uneventful femtosecond laser-assisted LASIK with a fast repetition rate excimer laser ablation, aspheric profiles, and cyclotorsion control. Visual, refractive, and aberrometric results were evaluated at the 3- and 6-month follow-up. The astigmatic outcome was evaluated using the Alpins method and ASSORT software. This study enrolled 80 eyes at 3 months and 50 eyes at 6 months. The significant reduction in refractive sphere and cylinder 3 and 6 months postoperatively (p<0.01) was associated with an improved uncorrected distance visual acuity (p<0.01). A total of 23.75% required retreatment 3 months after surgery. Efficacy and safety indices at 6 months were 0.90 and 1.00, respectively. At 6 months, 80% of eyes had an SE within ±0.50 D and 96% within ±1.00 D. No significant differences were detected between the third and the sixth postoperative months in refractive parameters. A significant increase in the spherical aberration was detected, but not in coma. The correction index was 0.94 at 3 months. Laser in situ keratomileusis for primary compound hyperopic astigmatism with high cylinder (>3.00 D) using the latest excimer platforms with cyclotorsion control, fast repetition rate, and optimized aspheric profiles is safe, moderately effective, and predictable.

Laser-assisted delivery of vitamin C, vitamin E, and ferulic acid formula serum decreases fractional laser postoperative recovery by increased beta fibroblast growth factor expression.

PubMed

Waibel, Jill S; Mi, Qing-Sheng; Ozog, David; Qu, Le; Zhou, Li; Rudnick, Ashley; Al-Niaimi, Firas; Woodward, Julie; Campos, Valerie; Mordon, Serge

2016-03-01

Laser-assisted drug delivery is an emerging technology to achieve greater penetration by existing topical medications to reach desired targets in the tissue. The objective of this research was to study whether laser-assisted delivery of Vitamin C, E, and Ferulic immediately postoperatively of fractional ablative laser could improve wound healing. Secondary objectives were to evaluate the potential molecular markers involved in this wound-healing process. A double blinded, prospective, single center, randomized split face trial of Vitamin C, E, and Ferulic topical formula #740019 to decrease postoperative recovery time in fractional ablative laser resurfacing for photo damage. Fifteen healthy men and women of ages 30-55 years were treated with the Vitamin C, E, and Ferulic acid serum to one side of face and vehicle to the other side of face, within 2 minutes immediately after fractional ablative CO2 laser surgery and daily during the healing process. Patients were evaluated daily on days 1-7 using photographs, patient questionnaires, and molecular evaluation. Clinically, postoperative Vitamin C, E, and Ferulic delivery resulted in decreased edema versus vehicle on postoperative day 7 and decreased erythema versus vehicle on postoperative days 3 and 5. Molecularly, the expression of basic fibroblast growth factor (bFGF) was significantly increased at day 5 on the lesion treated with Vitamin C, E, and Ferulic acid serum compared to vehicle control on the other side. This is first study to show that Vitamin C, E, and Ferulic acid correlate with more rapid wound healing post-fractional ablative laser. Elevated bFGF could be involved in the Vitamin C, E, and Ferulic acid-induced rapid wound healing. © 2015 Wiley Periodicals, Inc.

Laser drilling of thermal barrier coated jet-engine components

NASA Astrophysics Data System (ADS)

Sezer, H. K.

Aero engine hot end components are often covered with ceramic Thermal Barrier Coatings (TBCs). Laser drilling in the TBC coated components can be a source of service life TBC degradation and spallation. The present study aims to understand the mechanisms of TBC delamination and develop techniques to drill holes without damaging the TBC, Nimonic 263 workpieces coated with TBC are used in the experiments. Microwave non-destructive testing (NDT) is employed to monitor the integrity of the coating /substrate interfaces of the post-laser drilled materials. A numerical modelling technique is used to investigate the role of melt ejection on TBC delamination. The model accounts for the vapour and the assist gas flow effects in the process. Broadly, melt ejection induced mechanical stresses for the TBC coating / bond coating and thermal effects for the bond coating / substrate interfaces are found the key delamination mechanisms. Experiments are carried out to validate the findings from the model. Various techniques that enable laser drilling without damaging the TBC are demonstrated. Twin jet assisted acute angle laser drilling is one successful technique that has been analysed using the melt ejection simulation. Optimisation of the twin jet assisted acute angle laser drilling process parameters is carried out using Design of Experiments (DoE) and statistical modelling approaches. Finally, an industrial case study to develop a high speed, high quality laser drilling system for combustor cans is described. Holes are drilled by percussion and trepan drilling in TBC coated and uncoated Haynes 230 workpieces. The production rate of percussion drilling is significantly higher than the trepan drilling, however metallurgical hole quality and reproducibility is poor. A number of process parameters are investigated to improve these characteristics. Gas type and gas pressure effects on various characteristics of the inclined laser drilled holes are investigated through theoretical and experimental work.

Utility and safety of the flexible-fiber CO2 laser in endoscopic endonasal transsphenoidal surgery.

PubMed

Jayarao, Mayur; Devaiah, Anand K; Chin, Lawrence S

2011-01-01

This study sought to report on the utility and safety of the flexible-fiber CO2 laser in endoscopic endonasal transsphenoidal surgery. A retrospective chart review identified 16 patients who underwent laser-assisted transsphenoidal surgery. All tumor pathology types were considered. Results were assessed based on hormone status, tumor size, pathology, complications, and resection rates. Sixteen pituitary lesions (pituitary adenomas, 12; Rathke cleft cyst, 2; pituitary cyst and craniopharyngioma, 1 each) with an average size of 22.7 mm were identified by radiographic and pathologic criteria. All patients underwent flexible-fiber CO2 laser-assisted endoscopic endonasal transsphenoidal surgery. Of the adenomas, 8 were nonsecreting and 4 were secreting (3 prolactinomas and 1 ACTH secreting). Gross total resection was achieved in 7 of 16 patients (43.75%) with hormone remission in all patients (100%) after a mean follow-up of 19.3 months. Postoperative complications occurred in 3 patients (18.75%): 2 patients developed transient diabetes insipidus (DI) and 1 developed a CSF leak requiring surgical repair. Five patients (31.25%) underwent postoperative radiation to the residual lesions. We found that CO2-laser-assisted endoscopic endonasal transsphenoidal surgery for sellar tumors is a minimally invasive approach using a tool that is quick and effective at cutting and coagulation. The surgery has a low rate of complication, and no laser-related complications were encountered. The laser fiber allows the surgeon to safely cut and coagulate without the line-of-sight problems encountered with conventional CO2 lasers. Further studies are recommended to further define its role in endoscopic endonasal sellar surgery. Copyright © 2011 Elsevier Inc. All rights reserved.

Integrated Cooling-Vacuum-Assisted Non-Fractional 1540 nm Erbium:Glass Laser is Effective in Treating Acne Scars.

PubMed

Politi, Yael; Levi, Assi; Lapidoth, Moshe

2016-11-01

Acne scars are a common result of in ammatory acne, affecting many patients worldwide. Among which, atrophic scars are the most prevalent form, presenting as dermal depressions caused by inflammatory degeneration of dermal collagen. Mid-infrared laser skin interaction is characterized by its modest absorption in water and nite penetration to the mid-dermis. Since collagen is a desirable laser target, 1540-nm wavelength is amenable for collagen remodeling within the depressed area of atrophic scars. To evaluate the safety and efficacy of acne scars treatment using an integrated cooling-vacuum-assisted 1540 nm Erbium: Glass Laser. This interventional prospective study included 25 volunteers (10 men, 15 women) with post acne atrophic scars. Patients were treated with a mid-infrared non-fractional 1540 nm Er:Glass laser (Alma Lasers Ltd. Caesarea, Israel) with integrat- ed cooling- vacuum assisted technology. Acne scars were exposed to 3 stacked laser pulses (400-600 mJ/pulse, 4 mm spot size, frequency of 3 Hz). Patients underwent 3-6 treatment sessions with a 2-3 week interval and were followed-up 1 month and 3 months after the last treatment. Clinical photographs were taken by high resolution digital camera before and after treatment. Clinical evaluation was performed by two independent dermatologists and results were graded on a scale of 0 (exacerbation) to 4 (76%-100% improvement). Patients' and physicians' satisfaction were also recorded (on a 1-5 scale). Pain perception and adverse effects were evaluated as well. Almost all patients (24/25) demonstrated a moderate to significant improvement. Average improvement was 3.9 and 4.1 points on the quartile scale used for outcome assessment 1 and 3 months following the last session, respectively. Patient satisfaction rate was 4.2. Side effects were minimal and transient: erythema, mild transient vesicles, and mild pain or inconvenience. CONCLUSION Cooling-Vacuum-Assisted mid-infrared non-fractional Er:Glass 1540 nm laser is safe and effective in the treatment of atrophic acne scars. J Drugs Dermatol. 2016;15(11):1359-1363..

Toward robot-assisted neurosurgical lasers.

PubMed

Motkoski, Jason W; Yang, Fang Wei; Lwu, Shelly H H; Sutherland, Garnette R

2013-04-01

Despite the potential increase in precision and accuracy, laser technology is not widely used in neurological surgery. This in part relates to challenges associated with the early introduction of lasers into neurosurgery. Considerable advances in laser technology have occurred, which together with robotic technology could create an ideal platform for neurosurgical application. In this study, a 980-nm contact diode laser was integrated with neuroArm. Preclinical evaluation involved partial hepatectomy, bilateral nephrectomy, splenectomy, and bilateral submandibular gland excision in a Sprague-Dawley rat model (n = 50). Total surgical time, blood loss as weight of surgical gauze before and after the procedure, and the incidence of thermal, vascular, or lethal injury were recorded and converted to an overall performance score. Thermal damage was evaluated in the liver using tissue samples stained with hematoxylin and eosin. Clinical studies involved step-wise integration of the 980-nm laser system into four neurosurgical cases. Results demonstrate the successful integration of contact laser technology into microsurgery, with and without robotic assistance. In preclinical studies, the laser improved microsurgical performance and reduced thermal damage, while neuroArm decreased intra- and intersurgeon variability. Clinical studies demonstrate dutility in meningioma resection (n = 4). Together, laser and robotic technology offered a more consistent, expedient, and precise tool for microsurgery.

Temperature field simulation on Ti6Al4V and Inconel718 heated by continuous infrared laser

NASA Astrophysics Data System (ADS)

Wang, Yanshen; Zhang, Zheng; Feng, Weiwei; Wang, Bo; Gai, Yuxian

2014-08-01

Laser assisted machining technology can heat and soften metals, which can be used for improving the machinability of superalloys such as Ti6Al4V and Inconel718. Researches on temperature field simulation of Ti6Al4V and Inconel718 are conducted in this paper. A thermal differential equation is established based on Fourier's law and energy conservation law. Then, a model using ABAQUS for simulating heat transfer process is brought out, which is then experimentally validated. Using the simulation model, detailed investigations on temperature field simulation are carried out in Ti6Al4V and Inconel718. According to simulation, surface temperature of the two superalloys eventually reaches their peak values, and the peak temperature of Ti6Al4V is much higher than that of Inconel718. To further investigate temperature heated by laser, laser parameters such as power, scanning velocity, laser spot radius and inclination angle are set to be variables separately for simulation. Simulation results show that laser power and laser spot radius are predominant factors in heating process compared with the influence of scanning velocity and inclination angle. Simulations in this paper provide valuable references for parameter optimization in the following laser heating experiments, which plays an important role in laser assisted machining.

Effect of Laser-assisted and Conventional In-office Bleaching on Monomer Release from Microhybrid and Nanohybrid Composite.

PubMed

Omrani, Ladan Ranjbar; Farjadfar, Shayan; Pedram, Parham; Sadray, Sima; Kamangar, Sedighe Sadat Hashemi; Chiniforoush, Nasim

2017-06-30

Bleaching might affect structural properties of composite materials, and lead to monomer release. This study aimed to evaluate the effect of Laser-assisted and conventional in-office bleaching on the release of BIS-GMA, TEGDMA, and UDMA monomers from a nanohybrid and a microhybrid BIS-GMA based composite. 32 samples of each composite, were divided into 4 subgroups; subgroup 1: Conventional in-office bleaching (CIB) with the Opalescence Boost PF 38% gel, subgroup 2: Laser-assisted bleaching (LBO) with the Opalescence Boost PF 38% gel, subgroup 3: Laser-assisted bleaching (LBH) with the JW Power bleaching gel, subgroup 4: (CO) control without bleaching. All the samples were immersed in tubes of 2cc Ethanol 75% medium. The released monomers were analyzed using the high performance liquid chromatography (HPLC) method 24 h, 7, and 28 days. Data's were analyzed by Univariate Analysis of Variance test followed by Tukeys HSD. The amount of TEGDMA monomer released was not significant. However, nanohybrid composites showed significantly more monomer release than microhybrid composites (P < 0.05). For UDMA the interaction was significant only after 1 week. In microhybrid composites, the CO subgroup showed more monomer release than LBH and LBO. In nanohybrid composites, LBH showed more monomer release than CIB and CO subgroups. For BIS-GMA monomers the interaction was significant at all time periods and the LBH subgroup of nanohybrid composite had significantly more BIS_GMA release in comparison to other subgroups. Bleaching by laser with JW Power Bleaching gel led to more monomer release in nanohybrid composite.

Laser Doppler velocimetry using a modified computer mouse

NASA Astrophysics Data System (ADS)

Zaron, Edward D.

2016-10-01

A computer mouse has been modified for use as a low-cost laser Doppler interferometer and used to measure the two-component fluid velocity of a flowing soap film. The mouse sensor contains two vertical cavity surface emitting lasers, photodiodes, and signal processing hardware integrated into a single package, approximately 1 cm2 in size, and interfaces to a host computer via a standard USB port. Using the principle of self-mixing interferometry, whereby laser light re-enters the laser cavity after being scattered from a moving target, the Doppler shift and velocity of scatterers dispersed in the flow are measured. Observations of the boundary layer in a turbulent soap film channel flow demonstrate the capabilities of the sensor.

3D Nanoprinting via laser-assisted electron beam induced deposition: growth kinetics, enhanced purity, and electrical resistivity

DOE PAGES

Lewis, Brett B.; Winkler, Robert; Sang, Xiahan; ...

2017-04-07

Here, we investigate the growth, purity, grain structure/morphology, and electrical resistivity of 3D platinum nanowires synthesized via electron beam induced deposition with and without an in situ pulsed laser assist process which photothermally couples to the growing Pt–C deposits. Notably, we demonstrate: 1) higher platinum concentration and a coalescence of the otherwise Pt–C nanogranular material, 2) a slight enhancement in the deposit resolution and 3) a 100-fold improvement in the conductivity of suspended nanowires grown with the in situ photothermal assist process, while retaining a high degree of shape fidelity.

Determining position inside building via laser rangefinder and handheld computer

DOEpatents

Ramsey, Jr James L. [Albuquerque, NM; Finley, Patrick [Albuquerque, NM; Melton, Brad [Albuquerque, NM

2010-01-12

An apparatus, computer software, and a method of determining position inside a building comprising selecting on a PDA at least two walls of a room in a digitized map of a building or a portion of a building, pointing and firing a laser rangefinder at corresponding physical walls, transmitting collected range information to the PDA, and computing on the PDA a position of the laser rangefinder within the room.

Using the Computer in Special Vocational Programs. Inservice Activities.

ERIC Educational Resources Information Center

Lane, Kenneth; Ward, Raymond

This inservice manual is intended to assist vocational education teachers in using the techniques of computer-assisted instruction in special vocational education programs. Addressed in the individual units are the following topics: the basic principles of computer-assisted instruction (TRS-80 computers and typing on a computer keyboard); money…

Promoting Intrinsic and Extrinsic Motivation among Chemistry Students Using Computer-Assisted Instruction

ERIC Educational Resources Information Center

Gambari, Isiaka A.; Gbodi, Bimpe E.; Olakanmi, Eyitao U.; Abalaka, Eneojo N.

2016-01-01

The role of computer-assisted instruction in promoting intrinsic and extrinsic motivation among Nigerian secondary school chemistry students was investigated in this study. The study employed two modes of computer-assisted instruction (computer simulation instruction and computer tutorial instructional packages) and two levels of gender (male and…

Matrix-assisted laser-induced gas-phase aggregation of C 60 oxides

NASA Astrophysics Data System (ADS)

Barrow, Mark P.; Tower, Nicole J.; Taylor ^*, , Roger; Drewello, Thomas

1998-08-01

Matrix-assisted laser desorption/ionisation of C 60 oxides, in conjunction with reflectron time-of-flight mass spectrometry, leads to an unprecedented gas-phase aggregation resulting in the formation of C 120O n- ·. products. The analysis of the product distribution obtained for oxides of varying oxygen content strongly suggests that the structures of these species are closely related to oxo-bridged isolated fullerene cages rather than to species featuring a fused giant fullerene core.

Matrix-assisted laser desorption ionization-time of flight mass spectrometry for direct bacterial identification from positive blood culture pellets.

PubMed

Prod'hom, Guy; Bizzini, Alain; Durussel, Christian; Bille, Jacques; Greub, Gilbert

2010-04-01

An ammonium chloride erythrocyte-lysing procedure was used to prepare a bacterial pellet from positive blood cultures for direct matrix-assisted laser desorption-ionization time of flight (MALDI-TOF) mass spectrometry analysis. Identification was obtained for 78.7% of the pellets tested. Moreover, 99% of the MALDI-TOF identifications were congruent at the species level when considering valid scores. This fast and accurate method is promising.

Spinal cord deformation due to nozzle gas flow effects using optical coherence tomography

NASA Astrophysics Data System (ADS)

Wong, Ronnie J.; Jivraj, Jamil; Vuong, Barry; Ramjist, Joel; Sun, Cuiru; Huang, Yize; Yang, Victor X. D.

2015-03-01

The use of gas assistance in laser machining hard materials is well established in manufacturing but not in the context of surgery. Laser cutting of osseous tissue in the context of neurosurgery can benefit from gas-assist but requires an understanding of flow and pressure effects to minimize neural tissue damage. In this study we acquire volumetric flow rates through a gas nozzle on the spinal cord, with dura and without dura.

Percutaneous laser-assisted recanalization of long chronic iliac artery occlusions: primary and mid-term results.

PubMed

Balzer, Jörn O; Gastinger, Verena; Thalhammer, Axel; Ritter, Ralf G; Lindhoff-Last, Edelgard; Schmitz-Rixen, Thomas; Vogl, Thomas J

2006-02-01

We report the primary and mid-term outcome of patients with long chronic iliac artery occlusions after percutaneous excimer-laser-assisted interventional recanalization. Between 2000 and 2001, 43 patients with 46 chronic occlusions of either the common iliac artery (n=27), the external iliac artery ( n=13) or both (n=3) underwent laser-assisted percutaneous transluminal angioplasty and implantation of stents. The average length of the occlusion was 57.1+/-26 mm. After laser-assisted angioplasty and implantation of a total of 60 stents, the patients were followed up for up to 4 years. Patency rates were analyzed by ankle-brachial index (ABI) measurement and duplex ultrasound. The primary technical success rate was 95.3%, with a major complication rate of 6.9%. Clinical improvement as categorized by the Rutherford guidelines could be observed in 97.6% of cases. The ABI of all patients improved from an average of 0.46+/-0.08 before intervention to 0.97+/-0.13 at the end of the follow-up period. The overall primary patency rate was 86.1%. Four reinterventions were successful (secondary patency rate 95.4%). The mid-term results of the percutaneous recanalization of iliac artery occlusions with primary and secondary patency rates of 86.1 and 95.4% are similar to those of the treatment of short stenoses.

Laser and optics activities at CREOL

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stickley, C.M.

1995-06-01

CREOL is an interdisciplinary institute with a mission to foster and support research and education in the optical and laser sciences and engineering. CREOL`s principal members are its 21-strong faculty. The faculty are encouraged and supported in developing, maintaining, and expanding innovative and sponsored research programs, especially ones that are coupled to industry`s needs. The CREOL Director and Assistant Director, through empowerment by the CREOL faculty, coordinate and oversee the interactive, interdisciplinary projects of the faculty, the 85 graduate students and the 39 research staff. CREOL integrates these research efforts with the general educational mission and goals of the university,more » develops comprehensive course work in the optical and laser sciences and engineering, provides guidance and instruction to graduate students, administers MS and PhD programs, and provides facilities, funds, and administrative support to assist the faculty in carrying out CREOL`s mission and obtaining financial support for the research projects. CREOL`s specific areas of research activity include the following: IR systems; nonlinear optics; crystal growth; nonlinear integrated optics; new solid-state lasers; tunable far-infrared lasers; thin-film optics; theory; semiconductor lasers; x-ray/optical scattering; laser-induced damage; free-electron lasers; solid-state spectroscopy; x-ray sources and applications; laser propagation; laser processing of materials; optical design; optical limiting/sensor protection; diffractive optics; quantum well optoelectronics; dense plasmas/high-field physics; laser radar and remote sensing; diode-based lasers; and glass science.« less

Bibliography of Soviet Laser Developments, No. 18, October - December 1974

DTIC Science & Technology

1975-04-25

IIV Lasers, Laser Theory , Laser Biological Effects, Laser Communications, Laser Computer Technology, Holography, Laser Chemical Effects...spectros.copy of laser materials; ultrashort pulse generation; crystal growing; theoretical aspects of advanced lasers; and general laser theory Laser...Semiconductor: Mixed Junction 5 6. Semiconductor: Heterojunction ^ 7. Semiconductor: Theory 8. Nd:Glass B. Liquid Lasers 1

Robotic Assisted Simple Prostatectomy versus Holmium Laser Enucleation of the Prostate for Lower Urinary Tract Symptoms in Patients with Large Volume Prostate: A Comparative Analysis from a High Volume Center.

PubMed

Umari, Paolo; Fossati, Nicola; Gandaglia, Giorgio; Pokorny, Morgan; De Groote, Ruben; Geurts, Nicolas; Goossens, Marijn; Schatterman, Peter; De Naeyer, Geert; Mottrie, Alexandre

2017-04-01

We report a comparative analysis of robotic assisted simple prostatectomy vs holmium laser enucleation of the prostate in patients who had benign prostatic hyperplasia with a large volume prostate (greater than 100 ml). A total of 81 patients underwent robotic assisted simple prostatectomy and 45 underwent holmium laser enucleation of the prostate in a 7-year period. Patients were preoperatively assessed with transrectal ultrasound and uroflowmetry. Functional parameters were assessed postoperatively during followup. Perioperative outcomes included operative time, postoperative hemoglobin, catheterization time and hospitalization. Complications were reported according to the Clavien-Dindo classification. Compared to the holmium laser enucleation group, patients treated with prostatectomy were significantly younger (median age 69 vs 74 years, p = 0.032) and less healthy (Charlson comorbidity index 2 or greater in 62% vs 29%, p = 0.0003), and had a lower rate of suprapubic catheterization (23% vs 42%, p = 0.028) and a higher preoperative I-PSS (International Prostate Symptom Score) (25 vs 21, p = 0.049). Both groups showed an improvement in the maximum flow rate (15 vs 11 ml per second, p = 0.7), and a significant reduction in post-void residual urine (-73 vs -100 ml, p = 0.4) and I-PSS (-20 vs -18, p = 0.8). Median operative time (105 vs 105 minutes, p = 0.9) and postoperative hemoglobin (13.2 vs 13.8 gm/dl, p = 0.08) were similar for robotic assisted prostatectomy and holmium laser enucleation, respectively. Median catheterization time (3 vs 2 days, p = 0.005) and median hospitalization (4 vs 2 days, p = 0.0001) were slightly shorter in the holmium laser group. Complication rates were similar with no Clavien grade greater than 3 in either group. Our results from a single center suggest comparable outcomes for robotic assisted simple prostatectomy and holmium laser enucleation of the prostate in patients with a large volume prostate. These findings require external validation at other high volume centers. Copyright © 2017 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

Intravesical dosimetry applied to laser positioning in photodynamic therapy

NASA Astrophysics Data System (ADS)

Beslon, Guillaume; Ambroise, Philippe; Heit, Bernard; Bremont, Jacques; Guillemin, Francois H.

1996-12-01

Superficial bladder tumor is a challenging indication for photodynamic therapy. Due to lack of specificity of the sensitizers, the light has to be precisely monitored over the bladder surface, illuminated by an isotropic source, to restrict the cytotoxic effect to the tumor without affecting the normal epithelium. In order to assist the surgeon while processing the therapy, an urothelium illumination model is proposed. It is computed through a spline interpolation, on the basis of 12 intravesical sensors. This paper presents the overall system architecture and details the modelization and visualization processes. With this model, the surgeon is able to master the source displacement inside the bladder and to homogenize the tissue exposure.

Three years of biomedical FEL use in medicine and surgery How far have we come?

NASA Astrophysics Data System (ADS)

Jean, Benedikt

1997-02-01

Since the FEL has been made available for biophysical research in the IR, it has revolutionized the optimization strategies of laser-tissue interaction and the minimizing of adverse effects, in particular for photoablative use in surgery. Its tunability together with the free combination of wavelength and energy made it an efficient research tool, allowing the reduction of risks and costs of preclinical biomedical research. New computer-assisted surgical techniques evolved and the broader data basis of IR photothermal ablation allows more accurate predictive modelling of the efficiency and the adverse effects of photoablation. New applications for diagnostic imaging as well as the first clinical applications in neurosurgery lay ahead.

Magnetic-Force-Assisted Straightening of Bent Mild Steel Strip by Laser Irradiation

NASA Astrophysics Data System (ADS)

Dutta, Polash P.; Kalita, Karuna; Dixit, Uday S.; Liao, Hengcheng

2017-12-01

This study proposes a technique to straighten bent metallic strips with magnetic-force-assisted laser irradiation. Experiments were conducted for three different types of mechanically-bent mild strips. The first type was bent strips without any heat treatment. The second type was stress-relieved and third type was subcritical-annealed bent strips. These strips were straightened following different schemes of laser irradiation sequence to understand the performance of straightening. A parametric study was conducted by varying laser power and scanning speed. Micro-hardness, tensile test, Charpy impact test and microstructure after straightening were also studied. Different scanning schemes provided different microstructures and mechanical properties. Any serious deterioration in the quality of straightened strips was not noticed. Overall, subcritical-annealed bent strips provided the best performance in straightening. The proposed straightening scheme has potential of becoming an industrial practice.

Laser assisted soldering: microdroplet accumulation with a microjet device.

PubMed

Chan, E K; Lu, Q; Bell, B; Motamedi, M; Frederickson, C; Brown, D T; Kovach, I S; Welch, A J

1998-01-01

We investigated the feasibility of a microjet to dispense protein solder for laser assisted soldering. Successive micro solder droplets were deposited on rat dermis and bovine intima specimens. Fixed laser exposure was synchronized with the jetting of each droplet. After photocoagulation, each specimen was cut into two halves at the center of solder coagulum. One half was fixed immediately, while the other half was soaked in phosphate-buffered saline for a designated hydration period before fixation (1 hour, 1, 2, and 7 days). After each hydration period, all tissue specimens were prepared for scanning electron microscopy (SEM). Stable solder coagulum was created by successive photocoagulation of microdroplets even after the soldered tissue exposed to 1 week of hydration. This preliminary study suggested that tissue soldering with successive microdroplets is feasible even with fixed laser parameters without active feedback control.

Model studies of laser absorption computed tomography for remote air pollution measurement

NASA Technical Reports Server (NTRS)

Wolfe, D. C., Jr.; Byer, R. L.

1982-01-01

Model studies of the potential of laser absorption-computed tomography are presented which demonstrate the possibility of sensitive remote atmospheric pollutant measurements, over kilometer-sized areas, with two-dimensional resolution, at modest laser source powers. An analysis of this tomographic reconstruction process as a function of measurement SNR, laser power, range, and system geometry, shows that the system is able to yield two-dimensional maps of pollutant concentrations at ranges and resolutions superior to those attainable with existing, direct-detection laser radars.

Computer Modeling of Direct Metal Laser Sintering

NASA Technical Reports Server (NTRS)

Cross, Matthew

2014-01-01

A computational approach to modeling direct metal laser sintering (DMLS) additive manufacturing process is presented. The primary application of the model is for determining the temperature history of parts fabricated using DMLS to evaluate residual stresses found in finished pieces and to assess manufacturing process strategies to reduce part slumping. The model utilizes MSC SINDA as a heat transfer solver with imbedded FORTRAN computer code to direct laser motion, apply laser heating as a boundary condition, and simulate the addition of metal powder layers during part fabrication. Model results are compared to available data collected during in situ DMLS part manufacture.

High-resolution computer-generated reflection holograms with three-dimensional effects written directly on a silicon surface by a femtosecond laser.

PubMed

Wædegaard, Kristian J; Balling, Peter

2011-02-14

An infrared femtosecond laser has been used to write computer-generated holograms directly on a silicon surface. The high resolution offered by short-pulse laser ablation is employed to write highly detailed holograms with resolution up to 111 kpixels/mm2. It is demonstrated how three-dimensional effects can be realized in computer-generated holograms. Three-dimensional effects are visualized as a relative motion between different parts of the holographic reconstruction, when the hologram is moved relative to the reconstructing laser beam. Potential security applications are briefly discussed.

A Computer-Controlled Laser Bore Scanner

NASA Astrophysics Data System (ADS)

Cheng, Charles C.

1980-08-01

This paper describes the design and engineering of a laser scanning system for production applications. The laser scanning techniques, the timing control, the logic design of the pattern recognition subsystem, the digital computer servo control for the loading and un-loading of parts, and the laser probe rotation and its synchronization will be discussed. The laser inspection machine is designed to automatically inspect the surface of precision-bored holes, such as those in automobile master cylinders, without contacting the machined surface. Although the controls are relatively sophisticated, operation of the laser inspection machine is simple. A laser light beam from a commercially available gas laser, directed through a probe, scans the entire surface of the bore. Reflected light, picked up through optics by photoelectric sensors, generates signals that are fed to a mini-computer for processing. A pattern recognition techniques program in the computer determines acceptance or rejection of the part being inspected. The system's acceptance specifications are adjustable and are set to the user's established tolerances. However, the computer-controlled laser system is capable of defining from 10 to 75 rms surface finish, and voids or flaws from 0.0005 to 0.020 inch. Following the successful demonstration with an engineering prototype, the described laser machine has proved its capability to consistently ensure high-quality master brake cylinders. It thus provides a safety improvement for the automotive braking system. Flawless, smooth cylinder bores eliminate premature wearing of the rubber seals, resulting in a longer-lasting master brake cylinder and a safer and more reliable automobile. The results obtained from use of this system, which has been in operation about a year for replacement of a tedious, manual operation on one of the high-volume lines at the Bendix Hydraulics Division, have been very satisfactory.

A Study on the Development of a Robot-Assisted Automatic Laser Hair Removal System

PubMed Central

Lim, Hyoung-woo; Park, Sungwoo; Noh, Seungwoo; Lee, Dong-Hun; Yoon, Chiyul; Koh, Wooseok; Kim, Youdan; Chung, Jin Ho; Kim, Hee Chan

2014-01-01

Abstract Background and Objective: The robot-assisted automatic laser hair removal (LHR) system is developed to automatically detect any arbitrary shape of the desired LHR treatment area and to provide uniform laser irradiation to the designated skin area. Methods: For uniform delivery of laser energy, a unit of a commercial LHR device, a laser distance sensor, and a high-resolution webcam are attached at the six axis industrial robot's end-effector, which can be easily controlled using a graphical user interface (GUI). During the treatment, the system provides real-time treatment progress as well as the total number of “pick and place” automatically. Results: During the test, it was demonstrated that the arbitrary shapes were detected, and that the laser was delivered uniformly. The localization error test and the area-per-spot test produced satisfactory outcome averages of 1.04 mm error and 38.22 mm2/spot, respectively. Conclusions: Results showed that the system successfully demonstrated accuracy and effectiveness. The proposed system is expected to become a promising device in LHR treatment. PMID:25343281

Study on laser-assisted drug delivery with optical coherence tomography

NASA Astrophysics Data System (ADS)

Tsai, Wen-Guei; Tsai, Ting-Yen; Yang, Chih-Hsun; Tsai, Meng-Tsan

2017-04-01

The nail provides a functional protection to the fingertips and surrounding tissue from external injuries. Nail plate divided into three layers including dorsal, intermediate, and ventral layers. The dorsal layer consists of compact, hard keratins, limiting topical drug delivery through the nail. In this study, we investigate the application of fractional CO2 laser that produces arrays of microthermal ablation zones (MAZs) to facilitate drug delivery in the nails. Moreover, optical coherence tomography (OCT) is implemented for real-time monitoring of the laser-skin tissue interaction, sparing the patient from invasive surgical sampling procedure. Observations of drug diffusion through the induced MAZ array are achieved by evaluating the time-dependent OCT intensity variance. Subsequently, nails are treated with cream and liquid topical drugs to investigate the feasibility and diffusion efficacy of laser-assisted drug delivery. Our results show that fractional CO2 laser improves the efficacy of topical drug delivery in the nail plate, and that OCT could potentially be used for in vivo monitoring of the depth of laser penetration as well as real-time observations of drug delivery.

A study on the development of a robot-assisted automatic laser hair removal system.

PubMed

Lim, Hyoung-Woo; Park, Sungwoo; Noh, Seungwoo; Lee, Dong-Hun; Yoon, Chiyul; Koh, Wooseok; Kim, Youdan; Chung, Jin Ho; Kim, Hee Chan; Kim, Sungwan

2014-11-01

Abstract Background and Objective: The robot-assisted automatic laser hair removal (LHR) system is developed to automatically detect any arbitrary shape of the desired LHR treatment area and to provide uniform laser irradiation to the designated skin area. For uniform delivery of laser energy, a unit of a commercial LHR device, a laser distance sensor, and a high-resolution webcam are attached at the six axis industrial robot's end-effector, which can be easily controlled using a graphical user interface (GUI). During the treatment, the system provides real-time treatment progress as well as the total number of "pick and place" automatically. During the test, it was demonstrated that the arbitrary shapes were detected, and that the laser was delivered uniformly. The localization error test and the area-per-spot test produced satisfactory outcome averages of 1.04 mm error and 38.22 mm(2)/spot, respectively. RESULTS showed that the system successfully demonstrated accuracy and effectiveness. The proposed system is expected to become a promising device in LHR treatment.

Femtosecond laser refractive surgery: small-incision lenticule extraction vs. femtosecond laser-assisted LASIK.

PubMed

Lee, Jimmy K; Chuck, Roy S; Park, Choul Yong

2015-07-01

Small-incision lenticule extraction (SMILE) is a novel technique devised to correct refractive errors. SMILE circumvents excimer laser photoablation of cornea, as the stromal lenticule cut by femtosecond laser is removed manually. Smaller incisions and preservation of anterior corneal biomechanical strength have been suggested as some of the advantages of SMILE over femtosecond laser-assisted LASIK (FS-LASIK). In this review, we compared previous published results of SMILE and FS-LASIK. The advantage, efficacy and safety of SMILE are compared with FS-LASIK. SMILE achieved similar efficacy, predictability and safety as FS-LASIK. Greater preservations of corneal biomechanical strength and corneal nerves were observed in SMILE when compared with LASIK or PRK. Additionally, the incidence of postoperative dry eye syndrome was found to be less problematic in SMILE than in FS-LASIK. SMILE is a promising new surgery for refractive error correction. Prospective and retrospective studies of SMILE have shown that results of SMILE are similar to FS-LASIK. With advances in femtosecond laser technology, SMILE may gain greater acceptance in the future.

Performance benefits from pulsed laser heating in heat assisted magnetic recording

NASA Astrophysics Data System (ADS)

Xu, B. X.; Cen, Z. H.; Goh, J. H.; Li, J. M.; Toh, Y. T.; Zhang, J.; Ye, K. D.; Quan, C. G.

2014-05-01

Smaller cross track thermal spot size and larger down track thermal gradient are desired for increasing the density of heat assisted magnetic recording. Both parameters are affected significantly by the thermal energy accumulation and diffusion in the recording media. Pulsed laser heating is one of the ways to reduce the thermal diffusion. In this paper, we describe the benefits from the pulsed laser heating such as the dependences of the cross track thermal width, down track thermal gradient, the required laser pulse/average powers, and the transducer temperature rise on the laser pulse width at different media thermal properties. The results indicate that as the pulse width decreases, the thermal width decreases, the thermal gradient increases, the required pulse power increases and the average power decreases. For shorter pulse heating, the effects of the medium thermal properties on the thermal performances become weaker. This can greatly relax the required thermal properties of the media. The results also show that the pulsed laser heating can effectively reduce the transducer temperature rise and allow the transducer to reach its "dynamically" stable temperature more quickly.

Determination of Flavonoids, Phenolic Acids, and Xanthines in Mate Tea (Ilex paraguariensis St.-Hil.)

PubMed Central

Bojić, Mirza; Simon Haas, Vicente; Maleš, Željan

2013-01-01

Raw material, different formulations of foods, and dietary supplements of mate demands control of the content of bioactive substances for which high performance thin layer chromatography (TLC), described here, presents simple and rapid approach for detections as well as quantification. Using TLC densitometry, the following bioactive compounds were identified and quantified: chlorogenic acid (2.1 mg/g), caffeic acid (1.5 mg/g), rutin (5.2 mg/g), quercetin (2.2 mg/g), and kaempferol (4.5 mg/g). The results obtained with TLC densitometry for caffeine (5.4 mg/g) and theobromine (2.7 mg/g) show no statistical difference to the content of total xanthines (7.6 mg/g) obtained by UV-Vis spectrophotometry. Thus, TLC remains a technique of choice for simple and rapid analysis of great number of samples as well as a primary screening technique in plant analysis. PMID:23841023

Comparison of laser and power bleaching techniques in tooth color change.

PubMed

Fekrazad, Reza; Alimazandarani, Shervin; Kalhori, Katayoun Am; Assadian, Hadi; Mirmohammadi, Seyed-Mahdi

2017-04-01

Laser-assisted bleaching uses laser beam to accelerate release of free radicals within the bleaching gel to decrease time of whitening procedure. The aim of this study was to compare the efficacy of power bleaching using Opalescence Xtra Boost® and laser bleaching technique using LaserSmile gel and diode laser as an activator in their tooth whitening capacity. Student t test showed that the laser bleaching group significantly outperformed the power bleaching group in changing ∆E ( p =0.977). Similarly, while comparing the groups in changing ∆L, the laser bleaching group indicated significantly superior results ( p =0.953). Statistical data from student t test while comparing the groups in changing the parameter of yellowness indicated that samples in laser bleaching group underwent a more significant reduction than power-bleached samples ( p =0.85). Correspondingly, changes in whiteness were statistically tested through student t test, showing that laser bleaching technique increased whiteness of the samples significantly more than those treated by power bleaching ( p =0.965). The digital color evaluation data was in accordance with spectrophotometry and showed that laser bleaching outperformed power bleaching technique. Both techniques were able to increase whiteness and decrease yellowness ratio of the samples. ΔE decrease for laser bleaching and power bleaching groups were 3.05 and 1.67, respectively. Tooth color change in laser bleaching group was 1.88 times more than that of power bleaching group ( p <0.001). It could be concluded that under the conditions of this study, both laser-assisted and power bleaching techniques were capable of altering tooth color change, but laser bleaching was deemed a more efficient technique in this regard. Key words: Laser, power bleaching, tooth color introduction.

Designing and Creating Computer-Assisted Instruction.

ERIC Educational Resources Information Center

McMeen, George R.

Designed to encourage the use of a defined methodology and careful planning in creating computer-assisted instructional programs, this paper describes the instructional design process, compares computer-assisted instruction (CAI) and programmed instruction (PI), and discusses pragmatic concerns in computer programming. Topics addressed include:…

Phase Analysis of Laser Direct Etching and Water Assisted Laser Combined Etching of SiC Ceramics

NASA Astrophysics Data System (ADS)

Yuan, Genfu; Cong, Qidong; Zhang, Chen; Xie, Bingbing

2017-12-01

In this study, to discover the etching mechanism of SiC ceramics under laser direct etching and water-jet assisted laser combined etching, the phenomena of substance change on the etched surface were investigated. Also, the rules of substance transfer in etching are discussed. The elemental content change and the phase change of the etching products on the etched surface were analyzed by energy dispersive spectroscopy (EDS) and X-ray diffraction (XRD), respectively. These studies showed a high amount of carbon black on the etched surface, because of the decomposition of SiC ceramics under the high-power-density laser irradiation. SiC decomposed to Si under the laser irradiation, and the subsequent chemical reaction of Si and O2 easily produced SiO2. The SiO2 on the etched surface melted and vaporized, whereas most of SiO2 was removed through splashing, changing the chemical composition of the etched surface. Following the water jet introduction, an increased amount of O existed on the combined etching surface, because the chemical reaction of SiC and H2O easily produced SiO2 under the high-power-density laser irradiation.

Laser-assisted fibrinogen bonding of umbilical vein grafts.

PubMed

Oz, M C; Williams, M R; Souza, J E; Dardik, H; Treat, M R; Bass, L S; Nowygrod, R

1993-06-01

Despite success with autologous tissue welding, laser welding of synthetic vascular prostheses has not been possible. The graft material appears inert and fails to allow the collagen breakdown and electrostatic bonding that results in tissue welding. To develop a laser welding system for graft material, we repaired glutaraldehyde-tanned human umbilical cord vein graft incisions using laser-assisted fibrinogen bonding (LAFB) technology. Modified umbilical vein graft was incised transversely (1.2 cm). Incisions were repaired using sutures, laser energy alone, or LAFB. For LAFB, indocyanine green dye was mixed with human fibrinogen and the compound applied with forceps onto the weld site prior to exposure to 808 nm diode laser energy (power density 4.8 W/cm 2). Bursting pressures for sutured repairs (126.6 +/- 23.4 mm Hg) were similar to LAFB anastomoses (111.6 +/- 55.0 mm Hg). No evidence of collateral thermal injury to the graft material was noted. In vivo evaluation of umbilical graft bonding with canine arteries demonstrates that LAFB can reliably reinforce sutured anastomoses. The described system for bonding graft material with laser exposed fibrinogen may allow creation or reinforcement of vascular anastomoses in procedures where use of autologous tissue is not feasible.

Black phosphorus-assisted laser desorption ionization mass spectrometry for the determination of low-molecular-weight compounds in biofluids.

PubMed

He, Xiao-Mei; Ding, Jun; Yu, Lei; Hussain, Dilshad; Feng, Yu-Qi

2016-09-01

Quantitative analysis of small molecules by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) has been a challenging task due to matrix-derived interferences in low m/z region and poor reproducibility of MS signal response. In this study, we developed an approach by applying black phosphorus (BP) as a matrix-assisted laser desorption ionization (MALDI) matrix for the quantitative analysis of small molecules for the first time. Black phosphorus-assisted laser desorption/ionization mass spectrometry (BP/ALDI-MS) showed clear background and exhibited superior detection sensitivity toward quaternary ammonium compounds compared to carbon-based materials. By combining stable isotope labeling (SIL) strategy with BP/ALDI-MS (SIL-BP/ALDI-MS), a variety of analytes labeled with quaternary ammonium group were sensitively detected. Moreover, the isotope-labeled forms of analytes also served as internal standards, which broadened the analyte coverage of BP/ALDI-MS and improved the reproducibility of MS signals. Based on these advantages, a reliable method for quantitative analysis of aldehydes from complex biological samples (saliva, urine, and serum) was successfully established. Good linearities were obtained for five aldehydes in the range of 0.1-20.0 μM with correlation coefficients (R (2)) larger than 0.9928. The LODs were found to be 20 to 100 nM. Reproducibility of the method was obtained with intra-day and inter-day relative standard deviations (RSDs) less than 10.4 %, and the recoveries in saliva samples ranged from 91.4 to 117.1 %. Taken together, the proposed SIL-BP/ALDI-MS strategy has proved to be a reliable tool for quantitative analysis of aldehydes from complex samples. Graphical Abstract An approach for the determination of small molecules was developed by using black phosphorus (BP) as a matrix-assisted laser desorption ionization (MALDI) matrix.

Safety and efficacy of femtosecond laser-assisted arcuate keratotomy to treat irregular astigmatism after penetrating keratoplasty.

PubMed

Fadlallah, Ali; Mehanna, Chadi; Saragoussi, Jean-Jacques; Chelala, Elias; Amari, Belkacem; Legeais, Jean-Marc

2015-06-01

To determine the refractive efficacy, predictability, stability, and complication rate of Intralase femtosecond laser-assisted astigmatic keratotomy (AK) for irregular astigmatism after penetrating keratoplasty (PKP). Ophthalmology Department, Hôtel-Dieu, Paris, France. Retrospective case series. Femtosecond laser-assisted AK was performed to treat high irregular astigmatism (>5.0 diopters [D]) after PKP. The uncorrected (UDVA) and corrected (CDVA) distance visual acuities, manifest refraction, vector analysis, and complications were evaluated. The study evaluated 62 eyes of 57 patients over a mean follow-up of 28 months ± 3.5 (SD). Preoperatively, the mean CDVA was 0.51 ± 0.26 logMAR and the mean UDVA was 0.98 ± 0.24 logMAR; 6 months postoperatively, the mean CDVA and UDVA improved to 0.40 ± 0.22 logMAR and 0.60 ± 0.2 logMAR, respectively (both P < .01). The mean preoperative absolute astigmatism was 7.1 ± 1.72 D; 6 months postoperatively, the mean refractive astigmatism was 2.6 ± 2.4 D (P < .001). The UDVA, CDVA, and astigmatism remained stable up to the end of follow-up. The efficacy index was 0.81 at 6 months and 0.67 at 2 years. There were 2 cases of microperforation, 3 cases of infectious keratitis, 3 graft rejection episodes, and 1 case of endophthalmitis. Overcorrection occurred in 12 eyes. Femtosecond laser-assisted AK was effective in reducing irregular astigmatism after PKP. Predictability of astigmatism correction is variable over time with a decrease in the efficacy index 2 years postoperatively. Refinement of the treatment nomogram for femtosecond laser-assisted AK for high astigmatism after PKP remains a major issue. No author has a financial or proprietary interest in any material or method mentioned. Copyright © 2015 ASCRS and ESCRS. Published by Elsevier Inc. All rights reserved.

The efficacy of laser-assisted in-office bleaching and home bleaching on sound and demineralized enamel

PubMed Central

Akbari, Majid; Mohammadpour, Sakineh

2015-01-01

Aims: This study investigated the effectiveness of laser-assisted in-office bleaching and home-bleaching in sound and demineralized enamel. Materials and Methods: The sample consisted of 120 freshly-extracted bovine incisors. Half of the specimens were stored in a demineralizing solution to induce white spot lesions. Following exposure to a tea solution for 7.5 days, the specimens were randomly assigned to 4 groups of 30 according to the type of enamel and the bleaching procedure employed. Groups 1 and 2 consisted of demineralized teeth subjected to in-office bleaching and home bleaching, whereas in groups 3 and 4, sound teeth were subjected to in-office and home bleaching, respectively. A diode laser (810 nm, 2 W, continuous wave, four times for 15 seconds each) was employed for assisting the in-office process. The color of the specimens was measured before (T1) and after (T2) staining and during (T3) and after (T4) the bleaching procedures using a spectrophotometer. The color change (ΔE) between different treatments stages was compared among the groups. Results: There were significant differences in the color change between T2 and T3 (ΔE T2–T3) and T2 and T4 (ΔE T2–T4) stages among the study groups (p<0.05). Pairwise comparison by Duncan test revealed that both ΔET2–T3 and ΔET2–T4 were significantly greater in demineralized teeth submitted to laser-assisted in-office bleaching (group 1) as compared to the other groups (P< 0.05). Conclusion: Laser-assisted in-office bleaching could provide faster and greater whitening effect than home bleaching on stained demineralized enamel, but both procedures produced comparable results on sound teeth. PMID:26877590

Spray drift and off-target loss reduction with a precision air-assisted sprayer

USDA-ARS?s Scientific Manuscript database

Spray drift and off-target losses are inherent problems of conventional air-assisted sprayers. Their low efficiencies cause environmental pollutions resulting in public anxieties. A new drift reduction technology incorporating laser scanning capabilities with a variable-rate air-assisted sprayer w...

Hydroxyapatite thin films grown by pulsed laser deposition and matrix assisted pulsed laser evaporation: Comparative study

NASA Astrophysics Data System (ADS)

Popescu-Pelin, G.; Sima, F.; Sima, L. E.; Mihailescu, C. N.; Luculescu, C.; Iordache, I.; Socol, M.; Socol, G.; Mihailescu, I. N.

2017-10-01

Pulsed Laser Deposition (PLD) and Matrix Assisted Pulsed Laser Evaporation (MAPLE) techniques were applied for growing hydroxyapatite (HA) thin films on titanium substrates. All experiments were conducted in a reaction chamber using a KrF* excimer laser source (λ = 248 nm, τFWHM ≈ 25 ns). Half of the samples were post-deposition thermally treated at 500 °C in a flux of water vapours in order to restore crystallinity and improve adherence. Coating surface morphologies and topographies specific to the deposition method were evidenced by scanning electron, atomic force microscopy investigations and profilometry. They were shown to depend on deposition technique and also on the post-deposition treatment. Crystalline structure of the coatings evaluated by X-ray diffraction was improved after thermal treatment. Biocompatibility of coatings, cellular adhesion, proliferation and differentiation tests were conducted using human mesenchymal stem cells (MSCs). Results showed that annealed MAPLE deposited HA coatings were supporting MSCs proliferation, while annealed PLD obtained films were stimulating osteogenic differentiation.

[Laser-assisted lipolysis for gynecomastia: safe and effective skin retraction].

PubMed

Trelles, Mario; Bonanad, Enrique; Moreno-Moraga, Javier; Alcolea, Justo; Mordon, Serge; Leclère, Franck Marie

2013-01-01

To evaluate efficacy of laser lipolysis in the treatment of gynecomastia to correct breast volume, flaccidity and excess skin without its excision. Prospectively, 32 patients with gynecomastia under tumescent anaesthesia and sedation underwent laser lipolysis with 980 nm diode laser, 15W continuous emission and 8 to 12 kJ energy per breast. Externally cold air was used to protect the skin. No drainages were used but a compressive bandage. Patients evaluated results on a VAS scale. Two doctors evaluated results comparing before and 6 month after photographs and also measured the areola and chest diameter. Twenty three patients considered results as Very Good, 7 Good and 2 Fair Cutaneous retraction of the areola was noticeable one month after the surgery and was maximum 6 months after. Evaluation by doctors was 26 Very Good, 5 Good and 1 Fair. There were no burns, ischemia or lesions in areolas or nipples. Laser assisted liposuction is a simple and efficacious technique, barely traumatic and permits a rapid reincorporation to normal activities.

The Effect of Collimating Lens Focusing on Laser Beam Shape in Matrix Assisted Laser Desorption/Ionization Mass Spectrometry (MALDI-MS)

NASA Astrophysics Data System (ADS)

O'Rourke, Matthew B.; Raymond, Benjamin B. A.; Djordjevic, Steven P.; Padula, Matthew P.

2018-03-01

Tissue imaging using matrix assisted laser desorption/ionization mass spectrometry (MALDI-MS) is a well-established technique that, in recent years, has seen wider adoption and novel application. Applications such imaging mass spectrometry (IMS) and biotyping are beginning to gain greater exposure and use; however, with limitations in optimization methods, producing the best result often relies on the ability to customize the physical characteristics of the instrumentation, a task that is challenging for most mass spectrometry laboratories. With this in mind, we have described the effect of making simple adjustments to the laser optics at the final collimating lens area, to adjust the laser beam size and shape in order to allow greater customization of the instrument for improving techniques such as IMS. We have therefore been able to demonstrate that improvements can be made without requiring the help of an electrical engineer or external funding in a way that only costs a small amount of time. [Figure not available: see fulltext.

The Effect of Collimating Lens Focusing on Laser Beam Shape in Matrix Assisted Laser Desorption/Ionization Mass Spectrometry (MALDI-MS).

PubMed

O'Rourke, Matthew B; Raymond, Benjamin B A; Djordjevic, Steven P; Padula, Matthew P

2018-03-01

Tissue imaging using matrix assisted laser desorption/ionization mass spectrometry (MALDI-MS) is a well-established technique that, in recent years, has seen wider adoption and novel application. Applications such imaging mass spectrometry (IMS) and biotyping are beginning to gain greater exposure and use; however, with limitations in optimization methods, producing the best result often relies on the ability to customize the physical characteristics of the instrumentation, a task that is challenging for most mass spectrometry laboratories. With this in mind, we have described the effect of making simple adjustments to the laser optics at the final collimating lens area, to adjust the laser beam size and shape in order to allow greater customization of the instrument for improving techniques such as IMS. We have therefore been able to demonstrate that improvements can be made without requiring the help of an electrical engineer or external funding in a way that only costs a small amount of time. Graphical Abstract ᅟ.

Tunable Optical Sources.

DTIC Science & Technology

1980-11-01

finite aperture size 5. A. E. Siegman , "Unstable optical resonators for laser of the YAG rod, applications," Proc. IEEE 53, 217-287 (1965); "Unstable...Pumped LiNbO3 Tunable Source Radial Birefringent Element Computer Controlled Laser Attenuator Slab Configuration Laser Source 20. ABSTRACT (Continue on...have invented and demonstrated a computer controlled laser attenu- ator. .... Cont inued DD Il 7 1473 EDITION OF I NOV 01 IS OBSOLETE UNCLASSIFIEDAN

Intelligent Computer-Assisted Language Learning.

ERIC Educational Resources Information Center

Harrington, Michael

1996-01-01

Introduces the field of intelligent computer assisted language learning (ICALL) and relates them to current practice in computer assisted language learning (CALL) and second language learning. Points out that ICALL applies expertise from artificial intelligence and the computer and cognitive sciences to the development of language learning…

Program Models A Laser Beam Focused In An Aerosol Spray

NASA Technical Reports Server (NTRS)

Barton, J. P.

1996-01-01

Monte Carlo analysis performed on packets of light. Program for Analysis of Laser Beam Focused Within Aerosol Spray (FLSPRY) developed for theoretical analysis of propagation of laser pulse optically focused within aerosol spray. Applied for example, to analyze laser ignition arrangement in which focused laser pulse used to ignite liquid aerosol fuel spray. Scattering and absorption of laser light by individual aerosol droplets evaluated by use of electromagnetic Lorenz-Mie theory. Written in FORTRAN 77 for both UNIX-based computers and DEC VAX-series computers. VAX version of program (LEW-16051). UNIX version (LEW-16065).

Raman-Assisted Passively Mode-Locked Fiber Laser

NASA Astrophysics Data System (ADS)

Zhao, Lei; Yao, Pei-Jun; Gu, Chun; Xu, Li-Xin

2018-04-01

Not Available Supported by the National Natural Science Foundation of China under Grant No 61675188, and the Open Fund of Key Laboratory Pulse Power Laser Technology of China under Grant No SKL2016KF03.

Future World of Illicit Nuclear Trade: Mitigating the Threat

DTIC Science & Technology

2013-07-29

uranium with lasers that is similar to MLIS. 3 Most of the equipment, including four carbon monoxide lasers and vacuum chambers, was delivered. But...Centrifuge Facility 43 Figure 10: Centrifuge Output vs. Goods Required 44 3b Digging Deeper: Laser Enrichment of Uranium 47 Box 3...Major Foreign Assistance to Iran’s Pre-2004 Laser Enrichment Program 50 4. Key Information: The Special Challenge of the Spread of Classified 53

Exploring the experience of clients with tetraplegia utilizing assistive technology for computer access.

PubMed

Folan, Alyce; Barclay, Linda; Cooper, Cathy; Robinson, Merren

2015-01-01

Assistive technology for computer access can be used to facilitate people with a spinal cord injury to utilize mainstream computer applications, thereby enabling participation in a variety of meaningful occupations. The aim of this study was to gain an understanding of the experiences of clients with tetraplegia trialing assistive technologies for computer access during different stages in a public rehabilitation service. In order to explore the experiences of clients with tetraplegia trialing assistive technologies for computer use, qualitative methodology was selected. Data were collected from seven participants using semi-structured interviews, which were audio-taped, transcribed and analyzed thematically. Three main themes were identified. These were: getting back into life, assisting in adjusting to injury and learning new skills. The findings from this study demonstrated that people with tetraplegia can be assisted to return to previous life roles or engage in new roles, through developing skills in the use of assistive technology for computer access. Being able to use computers for meaningful activities contributed to the participants gaining an enhanced sense of self-efficacy, and thereby quality of life. Implications for Rehabilitation Findings from this pilot study indicate that people with tetraplegia can be assisted to return to previous life roles, and develop new roles that have meaning to them through the use of assistive technologies for computer use. Being able to use the internet to socialize, and complete daily tasks, contributed to the participants gaining a sense of control over their lives. Early introduction to assistive technology is important to ensure sufficient time for newly injured people to feel comfortable enough with the assistive technology to use the computers productively by the time of discharge. Further research into this important and expanding area is indicated.

Mid-term survival analysis of closed wedge high tibial osteotomy: A comparative study of computer-assisted and conventional techniques.

PubMed

Bae, Dae Kyung; Song, Sang Jun; Kim, Kang Il; Hur, Dong; Jeong, Ho Yeon

2016-03-01

The purpose of the present study was to compare the clinical and radiographic results and survival rates between computer-assisted and conventional closing wedge high tibial osteotomies (HTOs). Data from a consecutive cohort comprised of 75 computer-assisted HTOs and 75 conventional HTOs were retrospectively reviewed. The Knee Society knee and function scores, Hospital for Special Surgery (HSS) score and femorotibial angle (FTA) were compared between the two groups. Survival rates were also compared with procedure failure. The knee and function scores at one year postoperatively were slightly better in the computer-assisted group than those in conventional group (90.1 vs. 86.1) (82.0 vs. 76.0). The HSS scores at one year postoperatively were slightly better for the computer-assisted HTOs than those of conventional HTOs (89.5 vs. 81.8). The inlier of the postoperative FTA was wider in the computer-assisted group than that in the conventional HTO group (88.0% vs. 58.7%), and mean postoperative FTA was greater in the computer-assisted group that in the conventional HTO group (valgus 9.0° vs. valgus 7.6°, p<0.001). The five- and 10-year survival rates were 97.1% and 89.6%, respectively. No difference was detected in nine-year survival rates (p=0.369) between the two groups, although the clinical and radiographic results were better in the computer-assisted group that those in the conventional HTO group. Mid-term survival rates did not differ between computer-assisted and conventional HTOs. A comparative analysis of longer-term survival rate is required to demonstrate the long-term benefit of computer-assisted HTO. III. Copyright © 2015 Elsevier B.V. All rights reserved.

Influence of Culture Media on Detection of Carbapenem Hydrolysis by Matrix-Assisted Laser Desorption Ionization-Time of Flight Mass Spectrometry.

PubMed

Ramos, Ana Carolina; Carvalhaes, Cecília Godoy; Cordeiro-Moura, Jhonatha Rodrigo; Rockstroh, Anna Carolina; Machado, Antonia Maria Oliveira; Gales, Ana Cristina

2016-07-01

In this study, we evaluated the influence of distinct bacterial growth media on detection of carbapenemase hydrolysis by matrix-assisted laser desorption ionization-time of flight mass spectrometry. False-negative results were observed for OXA-25-, OXA-26-, and OXA-72-producing Acinetobacter baumannii isolates grown on MacConkey agar medium. The other culture media showed 100% sensitivity and 100% specificity for detecting carbapenemase. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Identification of Non-diphtheriae Corynebacterium by Use of Matrix-Assisted Laser Desorption Ionization–Time of Flight Mass Spectrometry

PubMed Central

Alatoom, Adnan A.; Cazanave, Charles J.; Cunningham, Scott A.; Ihde, Sherry M.

2012-01-01

We evaluated the Bruker Biotyper matrix-assisted laser desorption ionization–time of flight (MALDI-TOF) mass spectrometry for identification of 92 clinical isolates of Corynebacterium species in comparison to identification using rpoB or 16S rRNA gene sequencing. Eighty isolates (87%) yielded a score of ≥1.700, and all of these were correctly identified to the species level with the exception of Corynebacterium aurimucosum being misidentified as the closely related Corynebacterium minutissimum. PMID:22075579

Use of Matrix-Assisted Laser Desorption Ionization–Time of Flight Mass Spectrometry for Caspofungin Susceptibility Testing of Candida and Aspergillus Species

PubMed Central

De Carolis, Elena; Vella, Antonietta; Florio, Ada R.; Posteraro, Patrizia; Perlin, David S.; Posteraro, Brunella

2012-01-01

Matrix-assisted laser desorption ionization–time of flight mass spectrometry (MALDI-TOF MS) was evaluated for testing susceptibility to caspofungin of wild-type and fks mutant isolates of Candida and Aspergillus. Complete essential agreement was observed with the CLSI reference method, with categorical agreement for 94.1% of the Candida isolates tested. Thus, MALDI-TOF MS is a reliable and accurate method to detect fungal isolates with reduced caspofungin susceptibility. PMID:22535984

Use of matrix-assisted laser desorption ionization-time of flight mass spectrometry for caspofungin susceptibility testing of Candida and Aspergillus species.

PubMed

De Carolis, Elena; Vella, Antonietta; Florio, Ada R; Posteraro, Patrizia; Perlin, David S; Sanguinetti, Maurizio; Posteraro, Brunella

2012-07-01

Matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) was evaluated for testing susceptibility to caspofungin of wild-type and fks mutant isolates of Candida and Aspergillus. Complete essential agreement was observed with the CLSI reference method, with categorical agreement for 94.1% of the Candida isolates tested. Thus, MALDI-TOF MS is a reliable and accurate method to detect fungal isolates with reduced caspofungin susceptibility.

Computational Modeling and Real-Time Control of Patient-Specific Laser Treatment of Cancer

PubMed Central

Fuentes, D.; Oden, J. T.; Diller, K. R.; Hazle, J. D.; Elliott, A.; Shetty, A.; Stafford, R. J.

2014-01-01

An adaptive feedback control system is presented which employs a computational model of bioheat transfer in living tissue to guide, in real-time, laser treatments of prostate cancer monitored by magnetic resonance thermal imaging (MRTI). The system is built on what can be referred to as cyberinfrastructure - a complex structure of high-speed network, large-scale parallel computing devices, laser optics, imaging, visualizations, inverse-analysis algorithms, mesh generation, and control systems that guide laser therapy to optimally control the ablation of cancerous tissue. The computational system has been successfully tested on in-vivo, canine prostate. Over the course of an 18 minute laser induced thermal therapy (LITT) performed at M.D. Anderson Cancer Center (MDACC) in Houston, Texas, the computational models were calibrated to intra-operative real time thermal imaging treatment data and the calibrated models controlled the bioheat transfer to within 5°C of the predetermined treatment plan. The computational arena is in Austin, Texas and managed at the Institute for Computational Engineering and Sciences (ICES). The system is designed to control the bioheat transfer remotely while simultaneously providing real-time remote visualization of the on-going treatment. Post operative histology of the canine prostate reveal that the damage region was within the targeted 1.2cm diameter treatment objective. PMID:19148754

Computational modeling and real-time control of patient-specific laser treatment of cancer.

PubMed

Fuentes, D; Oden, J T; Diller, K R; Hazle, J D; Elliott, A; Shetty, A; Stafford, R J

2009-04-01

An adaptive feedback control system is presented which employs a computational model of bioheat transfer in living tissue to guide, in real-time, laser treatments of prostate cancer monitored by magnetic resonance thermal imaging. The system is built on what can be referred to as cyberinfrastructure-a complex structure of high-speed network, large-scale parallel computing devices, laser optics, imaging, visualizations, inverse-analysis algorithms, mesh generation, and control systems that guide laser therapy to optimally control the ablation of cancerous tissue. The computational system has been successfully tested on in vivo, canine prostate. Over the course of an 18 min laser-induced thermal therapy performed at M.D. Anderson Cancer Center (MDACC) in Houston, Texas, the computational models were calibrated to intra-operative real-time thermal imaging treatment data and the calibrated models controlled the bioheat transfer to within 5 degrees C of the predetermined treatment plan. The computational arena is in Austin, Texas and managed at the Institute for Computational Engineering and Sciences (ICES). The system is designed to control the bioheat transfer remotely while simultaneously providing real-time remote visualization of the on-going treatment. Post-operative histology of the canine prostate reveal that the damage region was within the targeted 1.2 cm diameter treatment objective.

Unpredictable long-term tissue effects in laser-assisted vasovasostomy

NASA Astrophysics Data System (ADS)

Gilbert, Peter T. O.

2000-05-01

Macroscopic Nd:YAG laser-assisted vasovasostomy was introduced to clinical practice as an attractive alternative to conventional microsurgical suture techniques. In this simple procedure the approximated vasal ends are welded by 0.5 sec laser pulses of 10 W power. The anastomosis is secured by two superficial seromuscular 5 - 0 PDS sutures placed on diametrically opposed sites of the vasal circumference. To date, 17 patients have undergone macroscopic laser-assisted vasovasostomy. In each case the operation was carried out under general anesthesia. There were no serious intra- or postoperative complications. Twelve patients were available for long-term followup (4 years). Sperm counts were obtained two months following surgery and from then on every two years. Whereas patency rate reached 75% at the first control examination, it dropped to 33% after two years. After that period no further deterioration was observed. Probably the main reason for this phenomenon is sperm leaking through mucosal defects at the anastomosis with subsequent formation of intramural sperm granuloma and delayed stenosis of the vasal lumen. This tissue reaction may also occur in the different suture techniques thus accounting for the well- established discrepancy of patency and pregnancy rates in microsurgical vasovasostomy.

Commnity Petascale Project for Accelerator Science And Simulation: Advancing Computational Science for Future Accelerators And Accelerator Technologies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Spentzouris, Panagiotis; /Fermilab; Cary, John

The design and performance optimization of particle accelerators are essential for the success of the DOE scientific program in the next decade. Particle accelerators are very complex systems whose accurate description involves a large number of degrees of freedom and requires the inclusion of many physics processes. Building on the success of the SciDAC-1 Accelerator Science and Technology project, the SciDAC-2 Community Petascale Project for Accelerator Science and Simulation (ComPASS) is developing a comprehensive set of interoperable components for beam dynamics, electromagnetics, electron cooling, and laser/plasma acceleration modelling. ComPASS is providing accelerator scientists the tools required to enable the necessarymore » accelerator simulation paradigm shift from high-fidelity single physics process modeling (covered under SciDAC1) to high-fidelity multiphysics modeling. Our computational frameworks have been used to model the behavior of a large number of accelerators and accelerator R&D experiments, assisting both their design and performance optimization. As parallel computational applications, the ComPASS codes have been shown to make effective use of thousands of processors.« less

Real-time analysis keratometer

NASA Technical Reports Server (NTRS)

Adachi, Iwao P. (Inventor); Adachi, Yoshifumi (Inventor); Frazer, Robert E. (Inventor)

1987-01-01

A computer assisted keratometer in which a fiducial line pattern reticle illuminated by CW or pulsed laser light is projected on a corneal surface through lenses, a prismoidal beamsplitter quarterwave plate, and objective optics. The reticle surface is curved as a conjugate of an ideal corneal curvature. The fiducial image reflected from the cornea undergoes a polarization shift through the quarterwave plate and beamsplitter whereby the projected and reflected beams are separated and directed orthogonally. The reflected beam fiducial pattern forms a moire pattern with a replica of the first recticle. This moire pattern contains transverse aberration due to differences in curvature between the cornea and the ideal corneal curvature. The moire pattern is analyzed in real time by computer which displays either the CW moire pattern or a pulsed mode analysis of the transverse aberration of the cornea under observation, in real time. With the eye focused on a plurality of fixation points in succession, a survey of the entire corneal topography is made and a contour map or three dimensional plot of the cornea can be made as a computer readout in addition to corneal radius and refractive power analysis.

Numerical simulation of the shape of laser cut for fiber and CO2 lasers

NASA Astrophysics Data System (ADS)

Zaitsev, A. V.; Ermolaev, G. V.; Polyanskiy, T. A.; Gurin, A. M.

2017-10-01

The results of numerical modeling of steel plate laser cutting with nitrogen as assist gas with consideration of heat transfer into a bulk material are presented. In this work we studied a distribution of absorbed radiation energy inside cut kerf and the difference between CO2 and fiber laser radiation propagation and absorption. The influence of secondary absorption of reflected from the cut front radiation on stability of melt hydrodynamics is discussed for different laser types.

Changes in Corneal Density After Accelerated Corneal Collagen Cross-linking With Different Irradiation Intensities and Energy Exposures: 1-Year Follow-up.

PubMed

Akkaya Turhan, Semra; Toker, Ebru

2017-11-01

To determine and compare the changes in corneal density after 2 different protocols of accelerated corneal collagen cross-linking (A-CXL) in patients with progressive keratoconus. Two groups of eyes received A-CXL treatment; 20 eyes received A-CXL using continuous UVA light exposure at 9 mW/cm for 10 minutes with a total energy dose of 5.4 J/cm, and 24 eyes received A-CXL using continuous UVA light exposure at 30 mW/cm for 4 minutes with a total energy dose of 7.2 J/cm. Corneal density was measured with Scheimpflug tomography at 1, 3, 6, and 12 months of follow-up. Densitometry peaked at 1 month (mean: 16.34 ± 3.80, P = 0.006, 9-mW/cm A-CXL; mean: 20.90 ± 2.81, P < 0.0001, 30-mw/cm A-CXL) in both groups, and it decreased over time in 30-mW/cm A-CXL. However, in 9-mW/cm A-CXL, increased corneal densitometry plateaued until 6 months postoperatively and started to decrease thereafter. Densitometry completely returned to baseline after 12 months in both groups. The mean change in density at 1- and 3-month follow-up was higher in the 30-mW A-CXL group than in the 9-mW A-CXL group (P = 0.003, P = 0.044; respectively). High-energy exposure tends to induce more haze in the early posttreatment period, but it is reversible.

Densitometric and biochemical values of broiler tibias at different ages.

PubMed

Barreiro, F R; Sagula, A L; Junqueira, O M; Pereira, G T; Baraldi-Artoni, S M

2009-12-01

The objective of this experiment was to determine the normal values of bone radiographic density (BRD) by using the optical densitometry in radiographic images and the biochemical values represented by serum calcium, ash percentage, and minerals (calcium, phosphorus, and magnesium) from tibia ash of Cobb broilers at 8, 22, and 43 d of age. A total of 14 broilers were used for densitometric analysis, and 15 were used for biochemical dosages. The BRD values increased (P < 0.05) with age and in all tibia regions (proximal epiphysis, diaphysis, and distal epiphysis), concluding that growth was a determinative factor for bone performance, demanding a higher BRD during broiler development. Tibia proximal epiphysis presented higher BRD values in relation to the other bone regions (P < 0.05), as a result of a possible biomechanical adaptation to ligaments and tension of the muscle tendons at this region, allowing the support of the muscle mass increase. The serum calcium values were kept constant, as a result of the appropriate nutritional levels of the diet that supported the animal homeostasis. The bone ash and mineral percentage increased (P < 0.05) at 22 d of age, due to the higher mineral requirement in this age. The correlation between bone densitometry and the invasive techniques showed that the bone densitometry can substitute the determination of mineral percentage in the ash. This experiment presented normal values of the noninvasive and invasive methods more used in aviculture, allowing us to compare, subsequently, pathological and physiological values or results of broilers fed with different diets.

New Wrinkles in Retinal Densitometry

PubMed Central

Masella, Benjamin D.; Hunter, Jennifer J.; Williams, David R.

2014-01-01

Purpose. Retinal densitometry provides objective information about retinal function. But, a number of factors, including retinal reflectance changes that are not directly related to photopigment depletion, complicate its interpretation. We explore these factors and suggest a method to minimize their impact. Methods. An adaptive optics scanning light ophthalmoscope (AOSLO) was used to measure changes in photoreceptor reflectance in monkeys before and after photopigment bleaching with 514-nm light. Reflectance measurements at 514 nm and 794 nm were recorded simultaneously. Several methods of normalization to extract the apparent optical density of the photopigment were compared. Results. We identified stimulus-related fluctuations in 794-nm reflectance that are not associated with photopigment absorptance and occur in both rods and cones. These changes had a magnitude approaching those associated directly with pigment depletion, precluding the use of infrared reflectance for normalization. We used a spatial normalization method instead, which avoided the fluctuations in the near infrared, as well as a confocal AOSLO designed to minimize light from layers other than the receptors. However, these methods produced a surprisingly low estimate of the apparent rhodopsin density (animal 1: 0.073 ± 0.006, animal 2: 0.032 ± 0.003). Conclusions. These results confirm earlier observations that changes in photopigment absorption are not the only source of retinal reflectance change during dark adaptation. It appears that the stray light that has historically reduced the apparent density of cone photopigment in retinal densitometry arises predominantly from layers near the photoreceptors themselves. Despite these complications, this method provides a valuable, objective measure of retinal function. PMID:25316726

Physician visits and preventive care among Asian American and Pacific Islander long-term survivors of colorectal cancer, USA, 1996-2006.

PubMed

Steele, C Brooke; Townsend, Julie S; Tai, Eric; Thomas, Cheryll C

2014-03-01

Published literature on receipt of preventive healthcare services among Asian American and Pacific Islander (API) cancer survivors is scarce. We describe patterns in receipt of preventive services among API long-term colorectal cancer (CRC) survivors. Surveillance, Epidemiology, and End Results registry-Medicare data were used to identify 9,737 API and white patients who were diagnosed with CRC during 1996-2000 and who survived 5 or more years beyond their diagnoses. We examined receipt of vaccines, mammography (females), bone densitometry (females), and cholesterol screening among the survivors and how the physician specialties they visited for follow-up care correlated to services received. APIs were less likely than whites to receive mammography (52.0 vs. 69.3 %, respectively; P < 0.0001) but more likely to receive influenza vaccine, cholesterol screening, and bone densitometry. These findings remained significant in our multivariable model, except for receipt of bone densitometry. APIs visited PCPs only and both PCPs and oncologists more frequently than whites (P < 0.0001). Women who visited both PCPs and oncologists compared with PCPs only were more likely to receive mammography (odds ratio = 1.40; 95 % confidence interval, 1.05-1.86). Visits to both PCPs and oncologists were associated with increased use of mammography. Although API survivors visited these specialties more frequently than white survivors, API women may need culturally appropriate outreach to increase their use of this test. Long-term cancer survivors need to be aware of recommended preventive healthcare services, as well as who will manage their primary care and cancer surveillance follow-up.

Official Positions for FRAX® Bone Mineral Density and FRAX® simplification from Joint Official Positions Development Conference of the International Society for Clinical Densitometry and International Osteoporosis Foundation on FRAX®.

PubMed

Lewiecki, E Michael; Compston, Juliet E; Miller, Paul D; Adachi, Jonathan D; Adams, Judith E; Leslie, William D; Kanis, John A; Moayyeri, Alireza; Adler, Robert A; Hans, Didier B; Kendler, David L; Diez-Perez, Adolfo; Krieg, Marc-Antoine; Masri, Basel K; Lorenc, Roman R; Bauer, Douglas C; Blake, Glen M; Josse, Robert G; Clark, Patricia; Khan, Aliya A

2011-01-01

Tools to predict fracture risk are useful for selecting patients for pharmacological therapy in order to reduce fracture risk and redirect limited healthcare resources to those who are most likely to benefit. FRAX® is a World Health Organization fracture risk assessment algorithm for estimating the 10-year probability of hip fracture and major osteoporotic fracture. Effective application of FRAX® in clinical practice requires a thorough understanding of its limitations as well as its utility. For some patients, FRAX® may underestimate or overestimate fracture risk. In order to address some of the common issues encountered with the use of FRAX® for individual patients, the International Society for Clinical Densitometry (ISCD) and International Osteoporosis Foundation (IOF) assigned task forces to review the medical evidence and make recommendations for optimal use of FRAX® in clinical practice. Among the issues addressed were the use of bone mineral density (BMD) measurements at skeletal sites other than the femoral neck, the use of technologies other than dual-energy X-ray absorptiometry, the use of FRAX® without BMD input, the use of FRAX® to monitor treatment, and the addition of the rate of bone loss as a clinical risk factor for FRAX®. The evidence and recommendations were presented to a panel of experts at the Joint ISCD-IOF FRAX® Position Development Conference, resulting in the development of Joint ISCD-IOF Official Positions addressing FRAX®-related issues. Copyright © 2011 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Remote steering of laser beams by radar- and laser-induced refractive-index gradients in the atmosphere Remote steering of laser beams

NASA Astrophysics Data System (ADS)

Zheltikov, A. M.; Shneider, M. N.; Voronin, A. A.; Sokolov, A. V.; Scully, M. O.

2012-01-01

Refractive-index gradients induced in the atmospheric air by properly tailored laser and microwave fields are shown to enable a remote steering of laser beams. Heating-assisted modulation of the refractive index of the air by microwave radiation is shown to support small-angle laser-beam bending with bending angles on the order of 10-2. Ionization of the atmospheric air by dyads of femto- and nanosecond laser pulses, on the other hand, can provide beam deflection angles in excess of π/5, offering an attractive strategy for radiation transfer, free-space communications, and laser-based standoff detection.

Topical 0.1% Bromfenac Sodium for Intraoperative Miosis Prevention and Prostaglandin E2 Inhibition in Femtosecond Laser-Assisted Cataract Surgery.

PubMed

Chen, Hui; Lin, Haotian; Chen, Wan; Zhang, Bo; Xiang, Wu; Li, Jing; Chen, Weirong

2017-04-01

The purpose of this study was to evaluate the effect of topical 0.1% bromfenac sodium, a nonsteroidal anti-inflammatory drug (NSAID), on intraoperative pupil dilation maintenance and prostaglandin E 2 (PGE 2 ) inhibition during femtosecond laser-assisted cataract surgery. Sixty patients (30 each in study and control groups) were included in this study. The patients received 0.1% bromfenac ophthalmic solution or control placebo twice a day for 3 days before surgery. Pupil size was measured at the initiation of femtosecond laser pretreatment and phacoemulsification. Aqueous humor was collected at the beginning of routine cataract surgery. PGE 2 levels were measured with an enzyme-linked immunoassay. Laser flare photometry was measured preoperatively and at 1 day postoperatively. Compared with untreated patients, the change in pupil size and postoperative day 1 aqueous flare were significantly reduced throughout the operation in the patients treated with 0.1% bromfenac (P < 0.001). Mean PGE 2 concentrations were also significantly decreased by treatment with 0.1% bromfenac (P < 0.001). The reduction of the pupil area and postoperative day 1 aqueous flare were significantly correlated with PGE 2 levels (P < 0.001). NSAID treatment, when administered before femtosecond laser-assisted cataract surgery, was effective in maintaining intraoperative pupil dilation, preventing miosis, and reducing PGE 2 levels.

Small-scale mechanical characterization of viscoelastic adhesive systems

NASA Astrophysics Data System (ADS)

Shean, T. A. V.

Aero engine hot end components are often covered with ceramic Thermal Barrier Coatings (TBCs). Laser drilling in the TBC coated components can be a source of service life TBC degradation and spallation. The present study aims to understand the mechanisms of TBC delamination and develop techniques to drill holes without damaging the TBC, Nimonic 263 workpieces coated with TBC are used in the experiments. Microwave non-destructive testing (NDT) is employed to monitor the integrity of the coating /substrate interfaces of the post-laser drilled materials. A numerical modelling technique is used to investigate the role of melt ejection on TBC delamination. The model accounts for the vapour and the assist gas flow effects in the process. Broadly, melt ejection induced mechanical stresses for the TBC coating / bond coating and thermal effects for the bond coating / substrate interfaces are found the key delamination mechanisms. Experiments are carried out to validate the findings from the model. Various techniques that enable laser drilling without damaging the TBC are demonstrated. Twin jet assisted acute angle laser drilling is one successful technique that has been analysed using the melt ejection simulation. Optimisation of the twin jet assisted acute angle laser drilling process parameters is carried out using Design of Experiments (DoE) and statistical modelling approaches. Finally, an industrial case study to develop a high speed, high quality laser drilling system for combustor cans is described. Holes are drilled by percussion and trepan drilling in TBC coated and uncoated Haynes 230 workpieces. The production rate of percussion drilling is significantly higher than the trepan drilling, however metallurgical hole quality and reproducibility is poor. A number of process parameters are investigated to improve these characteristics. Gas type and gas pressure effects on various characteristics of the inclined laser drilled holes are investigated through theoretical and experimental work.

Computer-assisted surgery of the paranasal sinuses: technical and clinical experience with 368 patients, using the Vector Vision Compact system.

PubMed

Stelter, K; Andratschke, M; Leunig, A; Hagedorn, H

2006-12-01

This paper presents our experience with a navigation system for functional endoscopic sinus surgery. In this study, we took particular note of the surgical indications and risks and the measurement precision and preparation time required, and we present one brief case report as an example. Between 2000 and 2004, we performed functional endoscopic sinus surgery on 368 patients at the Ludwig Maximilians University, Munich, Germany. We used the Vector Vision Compact system (BrainLAB) with laser registration. The indications for surgery ranged from severe nasal polyps and chronic sinusitis to malignant tumours of the paranasal sinuses and skull base. The time needed for data preparation was less than five minutes. The time required for preparation and patient registration depended on the method used and the experience of the user. In the later cases, it took 11 minutes on average, using Z-Touch registration. The clinical plausibility test produced an average deviation of 1.3 mm. The complications of system use comprised one intra-operative re-registration (18 per cent) and one complete failure (5 per cent). Despite the assistance of an accurate working computer, the anterior ethmoidal artery was incised in one case. However, in all 368 cases, we experienced no cerebrospinal fluid leaks, optic nerve lesions, retrobulbar haematomas or intracerebral bleeding. There were no deaths. From our experience with computer-guided surgical procedures, we conclude that computer-guided navigational systems are so accurate that the risk of misleading the surgeon is minimal. In the future, their use in certain specialized procedures will be not only sensible but mandatory. We recommend their use not only in difficult surgical situations but also in routine procedures and for surgical training.

Laser-assisted ignition and combustion characteristics of consolidated aluminum nanoparticles

NASA Astrophysics Data System (ADS)

Saceleanu, Florin; Wen, John Z.; Idir, Mahmoud; Chaumeix, Nabiha

2016-11-01

Aluminum (Al) nanoparticles have drawn much attention due to their high energy density and tunable ignition properties. In comparison with their micronscale counterpart, Al nanoparticles possess large specific surface area and low apparent activation energy of combustion, which reduce ignition delay significantly. In this paper, ignition and subsequently burning of consolidated Al nanoparticle pellets are performed via a continuous wave (CW) argon laser in a closed spherical chamber filled with oxygen. Pellets are fabricated using two types of nanoparticle sizes of 40-60 and 60-80 nm, respectively. A photodiode is used to measure the ignition delay, while a digital camera captures the location of the flame front. It is found that for the 40-60-nm nanoparticle pellets, ignition delay reduces with increasing the oxygen pressure or using the higher laser power. Analysis of the flame propagation rate suggests that oxygen diffusion is an important mechanism during burning of these porous nanoparticle pellets. The combustion characteristics of the Al pellets are compared to a simplified model of the diffusion-controlled oxidation mechanism. While experimental measurements of pellets of 40-60 nm Al particles agree with the computed diffusion-limiting mechanism, a shifted behavior is observed from the pellets of 60-80 nm Al particles, largely due to the inhomogeneity of their porous structures.

Monitoring sperm mitochondrial respiration response in a laser trap using ratiometric fluorescence

NASA Astrophysics Data System (ADS)

Mei, Adrian; Botvinick, Elliot; Berns, Michael

2005-08-01

Sperm motility is an important area in understanding male infertility. Various techniques, such as the Computer Assisted Sperm Analysis (CASA), have been used to understand sperm motility. Sperm motility is related to the energy (ATP) production of sperm. ATP is produced by the depolarization of the membrane potential of the inner membrane of the mitochondria. In this study, a mitochondrial dye, JC-1, has been used to monitor the energetics of the mitochondria. This fluorescent dye can emit at two different wavelengths, depending on the membrane potential of the mitochondria. It can fluoresce green at low membrane potential and red at high membrane potential. The ratio of the two colors (red/green) allows for an accurate measurement of the change of membrane potential. Various experiments were conducted to quantify the behavior of the dye within the sperm and the reaction of the sperm to trap. Sperm were trapped using laser tweezers. Results have shown that the ratio drops dramatically when sperm are trapped, indicating a depolarization of the membrane. The physiological response to this depolarization is yet to be determined, but the studies indicate that the sperm could have been slightly damaged by the laser. However, knowing that sperm depolarizes their membrane when trapped can help understand how sperm react to their environment and consequently help treat male infertility.

Computer Assisted Learning in Numeracy.

ERIC Educational Resources Information Center

Hollin, Freda

Computer-assisted learning in numeracy for adults is far less developed than computer-assisted learning in literacy. Although a great many software programs exist, few are suitable for adults and many offer only drill and practice exercises instead of teaching genuine computer skills. One approach instructors can take is to have their students use…

Laser-assisted solar-cell metallization processing

NASA Technical Reports Server (NTRS)

Dutta, S.

1984-01-01

A photolytic metal deposition system using a focused continuous wave ultraviolet laser, a photolytic metal deposition system using a mask and ultraviolet flood illumination, and a pyrolytic metal deposition system using a focused continuous wave laser were studied. Fabrication of solar cells, as well as characterization to determine the effects of transient heat on solar cell junctions were investigated.

Factors influencing laser cutting of wood

Treesearch

V.G. Barnekov; C.W. McMillin; H.A. Huber

1986-01-01

Factors influencing the ability of lasers to cut wood may be generally classified into these three areas: 1) characteristics of the laser beam; 2) equipment and processing variables; and 3) properties of the workpiece. Effects of beam power, mode, polarization, and stability are discussed as are aspects of optics, location of focal point, feed speed, gas-jet assist...

On the Gas Dynamics of Inert-Gas-Assisted Laser Cutting of Steel Plate

NASA Astrophysics Data System (ADS)

Brandt, A. D.; Settles, G. S.; Scroggs, S. D.

1996-11-01

Laser beam cutting of sheet metal requires an assist gas to blow away the molten material. Since the assist-gas dynamics influences the quality and speed of the cut, the orientation of the gas nozzle with respect to the kerf is also expected to be important. A 1 kW cw CO2 laser with nitrogen assist gas was used to cut mild steel sheet of 1 to 4 mm thickness, using a sonic coaxial nozzle as a baseline. Off-axis nozzles were oriented from 20 deg to 60 deg from normal with exit Mach numbers from 1 to 2.4. Results showed maximum cutting speed at a 40 deg nozzle orientation. Shadowgrams of a geometrically-similar model kerf then revealed a separated shock wave-boundary layer interaction within the kerf for the (untilted) coaxial nozzle case. This was alleviated, resulting in a uniform supersonic flow throughout the kerf and consequent higher cutting speeds, by tilting the nozzle between 20 deg and 45 deg from the normal. This result did not depend upon the exit Mach number of the nozzle. (Research supported by NSF Grant DMI-9400119.)

Fractional non-ablative laser-assisted drug delivery leads to improvement in male and female pattern hair loss.

PubMed

Bertin, Ana Carina Junqueira; Vilarinho, Adriana; Junqueira, Ana Lúcia Ariano

2018-02-16

Androgenetic alopecia, also known as male and female pattern hair loss, is a very prevalent condition; however, approved therapeutic options are limited. Fractionated laser has been proposed to assist in penetration of topical medications to the cutaneous tissue. We present four cases of androgenetic alopecia that underwent treatment with a non-ablative erbium glass fractional laser followed by the application of topical finasteride 0,05% and growth factors including basic fibroblast growth factor, insulin-like growth factor, vascular endothelial growth factor, and copper peptide 1%. During all laser treatment sessions, eight passes were performed, at 7 mJ, 3-9% of coverage and density of 120 mzt/cm 2 . A positive response was observed in all of the four patients. Photographs taken 2 weeks after the last session showed improvement in hair regrowth and density. No significant side effects were observed.

Thermally assisted nanosecond laser generation of ferric nanoparticles

NASA Astrophysics Data System (ADS)

Kurselis, K.; Kozheshkurt, V.; Kiyan, R.; Chichkov, B.; Sajti, L.

2018-03-01

A technique to increase nanosecond laser based production of ferric nanoparticles by elevating temperature of the iron target and controlling its surface exposure to oxygen is reported. High power near-infrared laser ablation of the iron target heated up to 600 °C enhances the particle generation efficiency by more than tenfold exceeding 6 μg/J. Temporal and thermal dependencies of the particle generation process indicate correlation of this enhancement with the oxidative processes that take place on the iron surface during the per spot interpulse delay. Nanoparticles, produced using the heat-assisted ablation technique, are examined using scanning electron and transmission electron microscopy confirming the presence of 1-100 nm nanoparticles with an exponential size distribution that contain multiple randomly oriented magnetite nanocrystallites. The described process enables the application of high power lasers and facilitates precise, uniform, and controllable direct deposition of ferric nanoparticle coatings at the industry-relevant rates.

Metal-Assisted Laser-Induced Gas Plasma for the Direct Analysis of Powder Using Pulse CO2 Laser

NASA Astrophysics Data System (ADS)

Khumaeni, A.; Lie, Z. S.; Kurniawan, K. H.; Kagawa, K.

2017-01-01

Analysis of powder samples available in small quantities has been carried out using metal-assisted gas plasma by utilizing a transversely excited atmospheric (TEA) CO2 laser. The powder was homogeneously mixed with Si grease, and the mixed powder was painted on a metal subtarget. When a TEA CO2 laser was directly focused on the metal subtarget at atmospheric pressure of He gas, a high-temperature He gas plasma was induced. It is assumed that the powder particles were vaporized to be effectively atomized and excited in the gas plasma region. This method has been employed in the rapid analyses of elements in organic and inorganic powder samples present in small quantities. Detection of trace elements of Cr and Pb has been successfully made by using the supplement powder and loam soil, respectively. The detection limits of Pb in loam soil were approximately 20 mg/kg.

Lubricant depletion under various laser heating conditions in Heat Assisted Magnetic Recording (HAMR)

NASA Astrophysics Data System (ADS)

Xiong, Shaomin; Wu, Haoyu; Bogy, David

2014-09-01

Heat assisted magnetic recording (HAMR) is expected to increase the storage areal density to more than 1 Tb/in2 in hard disk drives (HDDs). In this technology, a laser is used to heat the magnetic media to the Curie point (~400-600 °C) during the writing process. The lubricant on the top of a magnetic disk could evaporate and be depleted under the laser heating. The change of the lubricant can lead to instability of the flying slider and failure of the head-disk interface (HDI). In this study, a HAMR test stage is developed to study the lubricant thermal behavior. Various heating conditions are controlled for the study of the lubricant thermal depletion. The effects of laser heating repetitions and power levels on the lubricant depletion are investigated experimentally. The lubricant reflow behavior is discussed as well.

Improving the CD linearity and proximity performance of photomasks written on the Sigma7500-II DUV laser writer through embedded OPC

NASA Astrophysics Data System (ADS)

Österberg, Anders; Ivansen, Lars; Beyerl, Angela; Newman, Tom; Bowhill, Amanda; Sahouria, Emile; Schulze, Steffen

2007-10-01

Optical proximity correction (OPC) is widely used in wafer lithography to produce a printed image that best matches the design intent while optimizing CD control. OPC software applies corrections to the mask pattern data, but in general it does not compensate for the mask writer and mask process characteristics. The Sigma7500-II deep-UV laser mask writer projects the image of a programmable spatial light modulator (SLM) using partially coherent optics similar to wafer steppers, and the optical proximity effects of the mask writer are in principle correctable with established OPC methods. To enhance mask patterning, an embedded OPC function, LinearityEqualize TM, has been developed for the Sigma7500- II that is transparent to the user and which does not degrade mask throughput. It employs a Calibre TM rule-based OPC engine from Mentor Graphics, selected for the computational speed necessary for mask run-time execution. A multinode cluster computer applies optimized table-based CD corrections to polygonized pattern data that is then fractured into an internal writer format for subsequent data processing. This embedded proximity correction flattens the linearity behavior for all linewidths and pitches, which targets to improve the CD uniformity on production photomasks. Printing results show that the CD linearity is reduced to below 5 nm for linewidths down to 200 nm, both for clear and dark and for isolated and dense features, and that sub-resolution assist features (SRAF) are reliably printed down to 120 nm. This reduction of proximity effects for main mask features and the extension of the practical resolution for SRAFs expands the application space of DUV laser mask writing.

Really Large Scale Computer Graphic Projection Using Lasers and Laser Substitutes

NASA Astrophysics Data System (ADS)

Rother, Paul

1989-07-01

This paper reflects on past laser projects to display vector scanned computer graphic images onto very large and irregular surfaces. Since the availability of microprocessors and high powered visible lasers, very large scale computer graphics projection have become a reality. Due to the independence from a focusing lens, lasers easily project onto distant and irregular surfaces and have been used for amusement parks, theatrical performances, concert performances, industrial trade shows and dance clubs. Lasers have been used to project onto mountains, buildings, 360° globes, clouds of smoke and water. These methods have proven successful in installations at: Epcot Theme Park in Florida; Stone Mountain Park in Georgia; 1984 Olympics in Los Angeles; hundreds of Corporate trade shows and thousands of musical performances. Using new ColorRayTM technology, the use of costly and fragile lasers is no longer necessary. Utilizing fiber optic technology, the functionality of lasers can be duplicated for new and exciting projection possibilities. The use of ColorRayTM technology has enjoyed worldwide recognition in conjunction with Pink Floyd and George Michaels' world wide tours.

45 CFR 233.34 - Computing the assistance payment in the initial one or two months (AFDC).

Code of Federal Regulations, 2010 CFR

2010-10-01

... 45 Public Welfare 2 2010-10-01 2010-10-01 false Computing the assistance payment in the initial... § 233.34 Computing the assistance payment in the initial one or two months (AFDC). A State shall compute...) If the initial month is computed prospectively as in paragraph (a) of this section, the second month...

HPTLC-FLD-SERS as a facile and reliable screening tool: Exemplarily shown with tyramine in cheese.

PubMed

Wang, Liao; Xu, Xue-Ming; Chen, Yi-Sheng; Ren, Jie; Liu, Yun-Tao

2018-04-01

The serious cytotoxicity of tyramine attracted marked attention as it induced necrosis of human intestinal cells. This paper presented a novel and facile high performance thin-layer chromatography (HPTLC) method tailored for screening tyramine in cheese. Separation was performed on glass backed silica gel plates, using methanol/ethyl acetate/ammonia (6/4/1 v/v/v) as the mobile phase. Special efforts were focused on optimizing conditions (substrate preparation, laser wavelength, salt types and concentrations) of surface enhanced Raman spectroscopy (SERS) measurements directly on plates after derivatization, which enabled molecule-specific identification of targeted bands. In parallel, fluorescent densitometry (FLD) scanning at 380

Applicability of post-ionization theory to laser-assisted field evaporation of magnetite

DOE PAGES

Schreiber, Daniel K.; Chiaramonti, Ann N.; Gordon, Lyle M.; ...

2014-12-15

Analysis of the mean Fe ion charge state from laser-assisted field evaporation of magnetite (Fe3O4) reveals unexpected trends as a function of laser pulse energy that break from conventional post-ionization theory for metals. For Fe ions evaporated from magnetite, the effects of post-ionization are partially offset by the increased prevalence of direct evaporation into higher charge states with increasing laser pulse energy. Therefore the final charge state is related to both the field strength and the laser pulse energy, despite those variables themselves being intertwined when analyzing at a constant detection rate. Comparison of data collected at different base temperaturesmore » also show that the increased prevalence of Fe2+ at higher laser energies is possibly not a direct thermal effect. Conversely, the ratio of 16O+:16O2+ is well-correlated with field strength and unaffected by laser pulse energy on its own, making it a better overall indicator of the field evaporation conditions than the mean Fe charge state. Plotting the normalized field strength versus laser pulse energy also elucidates a non-linear dependence, in agreement with previous observations on semiconductors, that suggests a field-dependent laser absorption efficiency. Together these observations demonstrate that the field evaporation process for laser-pulsed oxides exhibits fundamental differences from metallic specimens that cannot be completely explained by post-ionization theory. Further theoretical studies, combined with detailed analytical observations, are required to understand fully the field evaporation process of non-metallic samples.« less