Chen, Jiang; Du, Yinan; He, Xueyan; Huang, Xingxu; Shi, Yun S
2017-03-31
The most powerful way to probe protein function is to characterize the consequence of its deletion. Compared to conventional gene knockout (KO), conditional knockout (cKO) provides an advanced gene targeting strategy with which gene deletion can be performed in a spatially and temporally restricted manner. However, for most species that are amphiploid, the widely used Cre-flox conditional KO (cKO) system would need targeting loci in both alleles to be loxP flanked, which in practice, requires time and labor consuming breeding. This is considerably significant when one is dealing with multiple genes. CRISPR/Cas9 genome modulation system is advantaged in its capability in targeting multiple sites simultaneously. Here we propose a strategy that could achieve conditional KO of multiple genes in mouse with Cre recombinase dependent Cas9 expression. By transgenic construction of loxP-stop-loxP (LSL) controlled Cas9 (LSL-Cas9) together with sgRNAs targeting EGFP, we showed that the fluorescence molecule could be eliminated in a Cre-dependent manner. We further verified the efficacy of this novel strategy to target multiple sites by deleting c-Maf and MafB simultaneously in macrophages specifically. Compared to the traditional Cre-flox cKO strategy, this sgRNAs-LSL-Cas9 cKO system is simpler and faster, and would make conditional manipulation of multiple genes feasible.
2014-01-01
Background Genome-wide microarrays have been useful for predicting chemical-genetic interactions at the gene level. However, interpreting genome-wide microarray results can be overwhelming due to the vast output of gene expression data combined with off-target transcriptional responses many times induced by a drug treatment. This study demonstrates how experimental and computational methods can interact with each other, to arrive at more accurate predictions of drug-induced perturbations. We present a two-stage strategy that links microarray experimental testing and network training conditions to predict gene perturbations for a drug with a known mechanism of action in a well-studied organism. Results S. cerevisiae cells were treated with the antifungal, fluconazole, and expression profiling was conducted under different biological conditions using Affymetrix genome-wide microarrays. Transcripts were filtered with a formal network-based method, sparse simultaneous equation models and Lasso regression (SSEM-Lasso), under different network training conditions. Gene expression results were evaluated using both gene set and single gene target analyses, and the drug’s transcriptional effects were narrowed first by pathway and then by individual genes. Variables included: (i) Testing conditions – exposure time and concentration and (ii) Network training conditions – training compendium modifications. Two analyses of SSEM-Lasso output – gene set and single gene – were conducted to gain a better understanding of how SSEM-Lasso predicts perturbation targets. Conclusions This study demonstrates that genome-wide microarrays can be optimized using a two-stage strategy for a more in-depth understanding of how a cell manifests biological reactions to a drug treatment at the transcription level. Additionally, a more detailed understanding of how the statistical model, SSEM-Lasso, propagates perturbations through a network of gene regulatory interactions is achieved. PMID:24444313
Paired termini stabilize antisense RNAs and enhance conditional gene silencing in Escherichia coli
Nakashima, Nobutaka; Tamura, Tomohiro; Good, Liam
2006-01-01
Reliable methods for conditional gene silencing in bacteria have been elusive. To improve silencing by expressed antisense RNAs (asRNAs), we systematically altered several design parameters and targeted multiple reporter and essential genes in Escherichia coli. A paired termini (PT) design, where flanking inverted repeats create paired dsRNA termini, proved effective. PTasRNAs targeted against the ackA gene within the acetate kinase-phosphotransacetylase operon (ackA-pta) triggered target mRNA decay and a 78% reduction in AckA activity with high genetic penetrance. PTasRNAs are abundant and stable and function through an RNase III independent mechanism that requires a large stoichiometric excess of asRNA. Conditional ackA silencing reduced carbon flux to acetate and increased heterologous gene expression. The PT design also improved silencing of the essential fabI gene. Full anti-fabI PTasRNA induction prevented growth and partial induction sensitized cells to a FabI inhibitor. PTasRNAs have potential for functional genomics, antimicrobial discovery and metabolic flux control. PMID:17062631
Paired termini stabilize antisense RNAs and enhance conditional gene silencing in Escherichia coli.
Nakashima, Nobutaka; Tamura, Tomohiro; Good, Liam
2006-01-01
Reliable methods for conditional gene silencing in bacteria have been elusive. To improve silencing by expressed antisense RNAs (asRNAs), we systematically altered several design parameters and targeted multiple reporter and essential genes in Escherichia coli. A paired termini (PT) design, where flanking inverted repeats create paired dsRNA termini, proved effective. PTasRNAs targeted against the ackA gene within the acetate kinase-phosphotransacetylase operon (ackA-pta) triggered target mRNA decay and a 78% reduction in AckA activity with high genetic penetrance. PTasRNAs are abundant and stable and function through an RNase III independent mechanism that requires a large stoichiometric excess of asRNA. Conditional ackA silencing reduced carbon flux to acetate and increased heterologous gene expression. The PT design also improved silencing of the essential fabI gene. Full anti-fabI PTasRNA induction prevented growth and partial induction sensitized cells to a FabI inhibitor. PTasRNAs have potential for functional genomics, antimicrobial discovery and metabolic flux control.
Differential Sensitivity of Target Genes to Translational Repression by miR-17~92
Jin, Hyun Yong; Oda, Hiroyo; Chen, Pengda; Kang, Seung Goo; Valentine, Elizabeth; Liao, Lujian; Zhang, Yaoyang; Gonzalez-Martin, Alicia; Shepherd, Jovan; Head, Steven R.; Kim, Pyeung-Hyeun; Fu, Guo; Liu, Wen-Hsien; Han, Jiahuai
2017-01-01
MicroRNAs (miRNAs) are thought to exert their functions by modulating the expression of hundreds of target genes and each to a small degree, but it remains unclear how small changes in hundreds of target genes are translated into the specific function of a miRNA. Here, we conducted an integrated analysis of transcriptome and translatome of primary B cells from mutant mice expressing miR-17~92 at three different levels to address this issue. We found that target genes exhibit differential sensitivity to miRNA suppression and that only a small fraction of target genes are actually suppressed by a given concentration of miRNA under physiological conditions. Transgenic expression and deletion of the same miRNA gene regulate largely distinct sets of target genes. miR-17~92 controls target gene expression mainly through translational repression and 5’UTR plays an important role in regulating target gene sensitivity to miRNA suppression. These findings provide molecular insights into a model in which miRNAs exert their specific functions through a small number of key target genes. PMID:28241004
Literature-based condition-specific miRNA-mRNA target prediction.
Oh, Minsik; Rhee, Sungmin; Moon, Ji Hwan; Chae, Heejoon; Lee, Sunwon; Kang, Jaewoo; Kim, Sun
2017-01-01
miRNAs are small non-coding RNAs that regulate gene expression by binding to the 3'-UTR of genes. Many recent studies have reported that miRNAs play important biological roles by regulating specific mRNAs or genes. Many sequence-based target prediction algorithms have been developed to predict miRNA targets. However, these methods are not designed for condition-specific target predictions and produce many false positives; thus, expression-based target prediction algorithms have been developed for condition-specific target predictions. A typical strategy to utilize expression data is to leverage the negative control roles of miRNAs on genes. To control false positives, a stringent cutoff value is typically set, but in this case, these methods tend to reject many true target relationships, i.e., false negatives. To overcome these limitations, additional information should be utilized. The literature is probably the best resource that we can utilize. Recent literature mining systems compile millions of articles with experiments designed for specific biological questions, and the systems provide a function to search for specific information. To utilize the literature information, we used a literature mining system, BEST, that automatically extracts information from the literature in PubMed and that allows the user to perform searches of the literature with any English words. By integrating omics data analysis methods and BEST, we developed Context-MMIA, a miRNA-mRNA target prediction method that combines expression data analysis results and the literature information extracted based on the user-specified context. In the pathway enrichment analysis using genes included in the top 200 miRNA-targets, Context-MMIA outperformed the four existing target prediction methods that we tested. In another test on whether prediction methods can re-produce experimentally validated target relationships, Context-MMIA outperformed the four existing target prediction methods. In summary, Context-MMIA allows the user to specify a context of the experimental data to predict miRNA targets, and we believe that Context-MMIA is very useful for predicting condition-specific miRNA targets.
A Novel PCR Assay for Listeria welshimeri Targeting Transcriptional Regulator Gene lwe1801
USDA-ARS?s Scientific Manuscript database
Transcriptional regulator genes encode a group of specialized molecules that play essential roles in microbial responses to changing external conditions. These genes have been shown to possess species or group specificity and are useful as detection targets for diagnostic application. The present st...
Osato, Naoki
2018-01-19
Transcriptional target genes show functional enrichment of genes. However, how many and how significantly transcriptional target genes include functional enrichments are still unclear. To address these issues, I predicted human transcriptional target genes using open chromatin regions, ChIP-seq data and DNA binding sequences of transcription factors in databases, and examined functional enrichment and gene expression level of putative transcriptional target genes. Gene Ontology annotations showed four times larger numbers of functional enrichments in putative transcriptional target genes than gene expression information alone, independent of transcriptional target genes. To compare the number of functional enrichments of putative transcriptional target genes between cells or search conditions, I normalized the number of functional enrichment by calculating its ratios in the total number of transcriptional target genes. With this analysis, native putative transcriptional target genes showed the largest normalized number of functional enrichments, compared with target genes including 5-60% of randomly selected genes. The normalized number of functional enrichments was changed according to the criteria of enhancer-promoter interactions such as distance from transcriptional start sites and orientation of CTCF-binding sites. Forward-reverse orientation of CTCF-binding sites showed significantly higher normalized number of functional enrichments than the other orientations. Journal papers showed that the top five frequent functional enrichments were related to the cellular functions in the three cell types. The median expression level of transcriptional target genes changed according to the criteria of enhancer-promoter assignments (i.e. interactions) and was correlated with the changes of the normalized number of functional enrichments of transcriptional target genes. Human putative transcriptional target genes showed significant functional enrichments. Functional enrichments were related to the cellular functions. The normalized number of functional enrichments of human putative transcriptional target genes changed according to the criteria of enhancer-promoter assignments and correlated with the median expression level of the target genes. These analyses and characters of human putative transcriptional target genes would be useful to examine the criteria of enhancer-promoter assignments and to predict the novel mechanisms and factors such as DNA binding proteins and DNA sequences of enhancer-promoter interactions.
Gene Therapy and Targeted Toxins for Glioma
Castro, Maria G.; Candolfi, Marianela; Kroeger, Kurt; King, Gwendalyn D.; Curtin, James F.; Yagiz, Kader; Mineharu, Yohei; Assi, Hikmat; Wibowo, Mia; Muhammad, AKM Ghulam; Foulad, David; Puntel, Mariana; Lowenstein, Pedro R.
2011-01-01
The most common primary brain tumor in adults is glioblastoma. These tumors are highly invasive and aggressive with a mean survival time of nine to twelve months from diagnosis to death. Current treatment modalities are unable to significantly prolong survival in patients diagnosed with glioblastoma. As such, glioma is an attractive target for developing novel therapeutic approaches utilizing gene therapy. This review will examine the available preclinical models for glioma including xenographs, syngeneic and genetic models. Several promising therapeutic targets are currently being pursued in pre-clinical investigations. These targets will be reviewed by mechanism of action, i.e., conditional cytotoxic, targeted toxins, oncolytic viruses, tumor suppressors/oncogenes, and immune stimulatory approaches. Preclinical gene therapy paradigms aim to determine which strategies will provide rapid tumor regression and long-term protection from recurrence. While a wide range of potential targets are being investigated preclinically, only the most efficacious are further transitioned into clinical trial paradigms. Clinical trials reported to date are summarized including results from conditionally cytotoxic, targeted toxins, oncolytic viruses and oncogene targeting approaches. Clinical trial results have not been as robust as preclinical models predicted; this could be due to the limitations of the GBM models employed. Once this is addressed, and we develop effective gene therapies in models that better replicate the clinical scenario, gene therapy will provide a powerful approach to treat and manage brain tumors. PMID:21453286
SNP discovery in candidate adaptive genes using exon capture in a free-ranging alpine ungulate
Gretchen H. Roffler; Stephen J. Amish; Seth Smith; Ted Cosart; Marty Kardos; Michael K. Schwartz; Gordon Luikart
2016-01-01
Identification of genes underlying genomic signatures of natural selection is key to understanding adaptation to local conditions. We used targeted resequencing to identify SNP markers in 5321 candidate adaptive genes associated with known immunological, metabolic and growth functions in ovids and other ungulates. We selectively targeted 8161 exons in protein-coding...
Kumagai, Katsuyoshi; Takanashi, Masakatsu; Ohno, Shin-Ichiro; Kuroda, Masahiko; Sudo, Katsuko
2017-05-03
Targeted mutant mice generated on a C57BL/6 background are powerful tools for analysis of the biological functions of genes, and gene targeting technologies using mouse embryonic stem (ES) cells have been used to generate such mice. Recently, a bacterial artificial chromosome (BAC) recombineering system was established for the construction of targeting vectors. However, gene retrieval from BACs for the generation of gene targeting vectors using this system remains difficult. Even when construction of a gene targeting vector is successful, the efficiency of production of targeted mutant mice from ES cells derived from C57BL/6 mice are poor. Therefore, in this study, we first improved the strategy for the retrieval of genes from BACs and their transfer into a DT-A plasmid, for the generation of gene targeting vectors using the BAC recombineering system. Then, we attempted to generate targeted mutant mice from ES cell lines derived from C57BL/6 mice, by culturing in serum-free medium. In conclusion, we established an improved strategy for the efficient generation of targeted mutant mice on a C57BL/6 background, which are useful for the in vivo analysis of gene functions and regulation.
Conditional RNAi: towards a silent gene therapy.
Lee, Sang-Kyung; Kumar, Priti
2009-07-02
RNA interference (RNAi) has the potential to permit the downregulation of virtually any gene. While transgenic RNAi enables stable propagation of the resulting phenotype to progeny, the dominant nature of RNAi limits its use to applications where the continued suppression of gene expression does not disturb normal cell functioning. This is of particular importance when the target gene product is essential for cell survival, development or differentiation. It is therefore desirable that knockdown be externally regulatable. This review is aimed at providing an overview of the approaches for conditional RNAi in mammalian systems, with a special mention of studies employing these approaches to target therapeutically/biologically relevant molecules, their advantages and disadvantages, and a pointer towards approaches best suited for RNAi-based gene therapy.
Hofmann, Andreas; Wenzel, Daniela; Becher, Ulrich M; Freitag, Daniel F; Klein, Alexandra M; Eberbeck, Dietmar; Schulte, Maike; Zimmermann, Katrin; Bergemann, Christian; Gleich, Bernhard; Roell, Wilhelm; Weyh, Thomas; Trahms, Lutz; Nickenig, Georg; Fleischmann, Bernd K; Pfeifer, Alexander
2009-01-06
Targeting of viral vectors is a major challenge for in vivo gene delivery, especially after intravascular application. In addition, targeting of the endothelium itself would be of importance for gene-based therapies of vascular disease. Here, we used magnetic nanoparticles (MNPs) to combine cell transduction and positioning in the vascular system under clinically relevant, nonpermissive conditions, including hydrodynamic forces and hypothermia. The use of MNPs enhanced transduction efficiency of endothelial cells and enabled direct endothelial targeting of lentiviral vectors (LVs) by magnetic force, even in perfused vessels. In addition, application of external magnetic fields to mice significantly changed LV/MNP biodistribution in vivo. LV/MNP-transduced cells exhibited superparamagnetic behavior as measured by magnetorelaxometry, and they were efficiently retained by magnetic fields. The magnetic interactions were strong enough to position MNP-containing endothelial cells at the intima of vessels under physiological flow conditions. Importantly, magnetic positioning of MNP-labeled cells was also achieved in vivo in an injury model of the mouse carotid artery. Intravascular gene targeting can be combined with positioning of the transduced cells via nanomagnetic particles, thereby combining gene- and cell-based therapies.
Problem-Solving Test: Conditional Gene Targeting Using the Cre/loxP Recombination System
ERIC Educational Resources Information Center
Szeberényi, József
2013-01-01
Terms to be familiar with before you start to solve the test: gene targeting, knock-out mutation, bacteriophage, complementary base-pairing, homologous recombination, deletion, transgenic organisms, promoter, polyadenylation element, transgene, DNA replication, RNA polymerase, Shine-Dalgarno sequence, restriction endonuclease, polymerase chain…
CRISPR/Cas9 mediates efficient conditional mutagenesis in Drosophila.
Xue, Zhaoyu; Wu, Menghua; Wen, Kejia; Ren, Menda; Long, Li; Zhang, Xuedi; Gao, Guanjun
2014-09-05
Existing transgenic RNA interference (RNAi) methods greatly facilitate functional genome studies via controlled silencing of targeted mRNA in Drosophila. Although the RNAi approach is extremely powerful, concerns still linger about its low efficiency. Here, we developed a CRISPR/Cas9-mediated conditional mutagenesis system by combining tissue-specific expression of Cas9 driven by the Gal4/upstream activating site system with various ubiquitously expressed guide RNA transgenes to effectively inactivate gene expression in a temporally and spatially controlled manner. Furthermore, by including multiple guide RNAs in a transgenic vector to target a single gene, we achieved a high degree of gene mutagenesis in specific tissues. The CRISPR/Cas9-mediated conditional mutagenesis system provides a simple and effective tool for gene function analysis, and complements the existing RNAi approach. Copyright © 2014 Xue et al.
Saito, Shinta; Ura, Kiyoe; Kodama, Miho; Adachi, Noritaka
2015-06-30
Targeted gene modification by homologous recombination provides a powerful tool for studying gene function in cells and animals. In higher eukaryotes, non-homologous integration of targeting vectors occurs several orders of magnitude more frequently than does targeted integration, making the gene-targeting technology highly inefficient. For this reason, negative-selection strategies have been employed to reduce the number of drug-resistant clones associated with non-homologous vector integration, particularly when artificial nucleases to introduce a DNA break at the target site are unavailable or undesirable. As such, an exon-trap strategy using a promoterless drug-resistance marker gene provides an effective way to counterselect non-homologous integrants. However, constructing exon-trapping targeting vectors has been a time-consuming and complicated process. By virtue of highly efficient att-mediated recombination, we successfully developed a simple and rapid method to construct plasmid-based vectors that allow for exon-trapping gene targeting. These exon-trap vectors were useful in obtaining correctly targeted clones in mouse embryonic stem cells and human HT1080 cells. Most importantly, with the use of a conditionally cytotoxic gene, we further developed a novel strategy for negative selection, thereby enhancing the efficiency of counterselection for non-homologous integration of exon-trap vectors. Our methods will greatly facilitate exon-trapping gene-targeting technologies in mammalian cells, particularly when combined with the novel negative selection strategy.
Targeted gene deletion of miRNAs in mice by TALEN system.
Takada, Shuji; Sato, Tempei; Ito, Yoshiaki; Yamashita, Satoshi; Kato, Tomoko; Kawasumi, Miyuri; Kanai-Azuma, Masami; Igarashi, Arisa; Kato, Tomomi; Tamano, Moe; Asahara, Hiroshi
2013-01-01
Mice are among the most valuable model animal species with an enormous amount of heritage in genetic modification studies. However, targeting genes in mice is sometimes difficult, especially for small genes, such as microRNAs (miRNAs) and targeting genes in repeat sequences. Here we optimized the application of TALEN system for mice and successfully obtained gene targeting technique in mice for intergenic region and series of microRNAs. Microinjection of synthesized RNA of TALEN targeting each gene in one cell stage of embryo was carried out and injected oocytes were transferred into pseudopregnant ICR female mice, producing a high success rate of the targeted deletion of miRNA genes. In our condition, TALEN RNA without poly(A) tail worked better than that of with poly(A) tail. This mutated allele in miRNA was transmitted to the next generation, suggesting the successful germ line transmission of this targeting method. Consistent with our notion of miRNAs maturation mechanism, in homozygous mutant mice of miR-10a, the non- mutated strand of miRNAs expression was completely diminished. This method will lead us to expand and accelerate our genetic research using mice in a high throughput way.
Hofmann, Andreas; Wenzel, Daniela; Becher, Ulrich M.; Freitag, Daniel F.; Klein, Alexandra M.; Eberbeck, Dietmar; Schulte, Maike; Zimmermann, Katrin; Bergemann, Christian; Gleich, Bernhard; Roell, Wilhelm; Weyh, Thomas; Trahms, Lutz; Nickenig, Georg; Fleischmann, Bernd K.; Pfeifer, Alexander
2009-01-01
Targeting of viral vectors is a major challenge for in vivo gene delivery, especially after intravascular application. In addition, targeting of the endothelium itself would be of importance for gene-based therapies of vascular disease. Here, we used magnetic nanoparticles (MNPs) to combine cell transduction and positioning in the vascular system under clinically relevant, nonpermissive conditions, including hydrodynamic forces and hypothermia. The use of MNPs enhanced transduction efficiency of endothelial cells and enabled direct endothelial targeting of lentiviral vectors (LVs) by magnetic force, even in perfused vessels. In addition, application of external magnetic fields to mice significantly changed LV/MNP biodistribution in vivo. LV/MNP-transduced cells exhibited superparamagnetic behavior as measured by magnetorelaxometry, and they were efficiently retained by magnetic fields. The magnetic interactions were strong enough to position MNP-containing endothelial cells at the intima of vessels under physiological flow conditions. Importantly, magnetic positioning of MNP-labeled cells was also achieved in vivo in an injury model of the mouse carotid artery. Intravascular gene targeting can be combined with positioning of the transduced cells via nanomagnetic particles, thereby combining gene- and cell-based therapies. PMID:19118196
Gene trap and gene inversion methods for conditional gene inactivation in the mouse
Xin, Hong-Bo; Deng, Ke-Yu; Shui, Bo; Qu, Shimian; Sun, Qi; Lee, Jane; Greene, Kai Su; Wilson, Jason; Yu, Ying; Feldman, Morris; Kotlikoff, Michael I.
2005-01-01
Conditional inactivation of individual genes in mice using site-specific recombinases is an extremely powerful method for determining the complex roles of mammalian genes in developmental and tissue-specific contexts, a major goal of post-genomic research. However, the process of generating mice with recombinase recognition sequences placed at specific locations within a gene, while maintaining a functional allele, is time consuming, expensive and technically challenging. We describe a system that combines gene trap and site-specific DNA inversion to generate mouse embryonic stem (ES) cell clones for the rapid production of conditional knockout mice, and the use of this system in an initial gene trap screen. Gene trapping should allow the selection of thousands of ES cell clones with defined insertions that can be used to generate conditional knockout mice, thereby providing extensive parallelism that eliminates the time-consuming steps of targeting vector construction and homologous recombination for each gene. PMID:15659575
Bockamp, Ernesto; Sprengel, Rolf; Eshkind, Leonid; Lehmann, Thomas; Braun, Jan M; Emmrich, Frank; Hengstler, Jan G
2008-03-01
Many mouse models are currently available, providing avenues to elucidate gene function and to recapitulate specific pathological conditions. To a large extent, successful translation of clinical evidence or analytical data into appropriate mouse models is possible through progress in transgenic or gene-targeting technology. Beginning with a review of standard mouse transgenics and conventional gene targeting, this article will move on to discussing the basics of conditional gene expression: the tetracycline (tet)-off and tet-on systems based on the transactivators tet-controlled transactivator (Tta) and reverse tet-on transactivator (rtTA) that allow downregulation or induction of gene expression; Cre or Flp recombinase-mediated modifications, including excision, inversion, insertion and interchromosomal translocation; combination of the tet and Cre systems, permitting inducible knockout, reporter gene activation or activation of point mutations; the avian retroviral system based on delivery of rtTA specifically into cells expressing the avian retroviral receptor, which enables cell type-specific, inducible gene expression; the tamoxifen system, one of the most frequently applied steroid receptor-based systems, allows rapid activation of a fusion protein between the gene of interest and a mutant domain of the estrogen receptor, whereby activation does not depend on transcription; and techniques for cell type-specific ablation. The diphtheria toxin receptor system offers the advantage that it can be combined with the 'zoo' of Cre recombinase driver mice. Having described the basics we move on to the cutting edge: generation of genome-wide sets of conditional knockout mice. To this end, large ongoing projects apply two strategies: gene trapping based on random integration of trapping vectors into introns leading to truncation of the transcript, and gene targeting, representing the directed approach using homologous recombination. It can be expected that in the near future genome-wide sets of such mice will be available. Finally, the possibilities of conditional expression systems for investigating gene function in tissue regeneration will be illustrated by examples for neurodegenerative disease, liver regeneration and wound healing of the skin.
March, Oliver P; Reichelt, Julia; Koller, Ulrich
2018-04-01
What is the topic of this review? This review concerns current gene editing strategies for blistering skin diseases with respect to individual genetic constellations and distinct conditions. What advances does it highlight? Specificity and safety dominate the discussion of gene editing applications for gene therapy, where a number of tools are implemented. Recent developments in this rapidly progressing field pose further questions regarding which tool is best suited for each particular use. The current treatment of inherited blistering skin diseases, such as epidermolysis bullosa (EB), is largely restricted to wound care and pain management. More effective therapeutic strategies are urgently required, and targeting the genetic basis of these severe diseases is now within reach. Here, we describe current gene editing tools and their potential to correct gene function in monogenetic blistering skin diseases. We present the features of the most frequently used gene editing techniques, transcription activator-like effector nuclease (TALEN) and clustered regularly interspaced short palindromic repeats/CRISPR-associated protein 9 (CRISPR/Cas9), determining their preferential application for specific genetic conditions, including the type of mutational inheritance, the targeting site within the gene or the possibility to target the mutation specifically. Both tools have traits beneficial in specific situations. Promising developments in the field engender gene editing as a potentially powerful therapeutic option for future clinical applications. © 2017 The Authors. Experimental Physiology © 2017 The Physiological Society.
Brett, Maggie; McPherson, John; Zang, Zhi Jiang; Lai, Angeline; Tan, Ee-Shien; Ng, Ivy; Ong, Lai-Choo; Cham, Breana; Tan, Patrick; Rozen, Steve; Tan, Ene-Choo
2014-01-01
Developmental delay and/or intellectual disability (DD/ID) affects 1–3% of all children. At least half of these are thought to have a genetic etiology. Recent studies have shown that massively parallel sequencing (MPS) using a targeted gene panel is particularly suited for diagnostic testing for genetically heterogeneous conditions. We report on our experiences with using massively parallel sequencing of a targeted gene panel of 355 genes for investigating the genetic etiology of eight patients with a wide range of phenotypes including DD/ID, congenital anomalies and/or autism spectrum disorder. Targeted sequence enrichment was performed using the Agilent SureSelect Target Enrichment Kit and sequenced on the Illumina HiSeq2000 using paired-end reads. For all eight patients, 81–84% of the targeted regions achieved read depths of at least 20×, with average read depths overlapping targets ranging from 322× to 798×. Causative variants were successfully identified in two of the eight patients: a nonsense mutation in the ATRX gene and a canonical splice site mutation in the L1CAM gene. In a third patient, a canonical splice site variant in the USP9X gene could likely explain all or some of her clinical phenotypes. These results confirm the value of targeted MPS for investigating DD/ID in children for diagnostic purposes. However, targeted gene MPS was less likely to provide a genetic diagnosis for children whose phenotype includes autism. PMID:24690944
Schuster, Martin; Greenberg, E Peter
2007-08-22
Quorum-sensing regulation of gene expression in Pseudomonas aeruginosa is complex. Two interconnected acyl-homoserine lactone (acyl-HSL) signal-receptor pairs, 3-oxo-dodecanoyl-HSL-LasR and butanoyl-HSL-RhlR, regulate more than 300 genes. The induction of most of the genes is delayed during growth of P. aeruginosa in complex medium, cannot be advanced by addition of exogenous signal, and requires additional regulatory components. Many of these late genes can be induced by addition of signals early by using specific media conditions. While several factors super-regulate the quorum receptors, others may co-regulate target promoters or may affect expression posttranscriptionally. To better understand the contributions of super-regulation and co-regulation to quorum-sensing gene expression, and to better understand the general structure of the quorum sensing network, we ectopically expressed the two receptors (in the presence of their cognate signals) and another component that affects quorum sensing, the stationary phase sigma factor RpoS, early in growth. We determined the effect on target gene expression by microarray and real-time PCR analysis. Our results show that many target genes (e.g. lasB and hcnABC) are directly responsive to receptor protein levels. Most genes (e.g. lasA, lecA, and phnAB), however, are not significantly affected, although at least some of these genes are directly regulated by quorum sensing. The majority of promoters advanced by RhlR appeared to be regulated directly, which allowed us to build a RhlR consensus sequence. The direct responsiveness of many quorum sensing target genes to receptor protein levels early in growth confirms the role of super-regulation in quorum sensing gene expression. The observation that the induction of most target genes is not affected by signal or receptor protein levels indicates that either target promoters are co-regulated by other transcription factors, or that expression is controlled posttranscriptionally. This architecture permits the integration of multiple signaling pathways resulting in quorum responses that require a "quorum" but are otherwise highly adaptable and receptive to environmental conditions.
Mariscal, Ana M; Kakizawa, Shigeyuki; Hsu, Jonathan Y; Tanaka, Kazuki; González-González, Luis; Broto, Alicia; Querol, Enrique; Lluch-Senar, Maria; Piñero-Lambea, Carlos; Sun, Lijie; Weyman, Philip D; Wise, Kim S; Merryman, Chuck; Tse, Gavin; Moore, Adam J; Hutchison, Clyde A; Smith, Hamilton O; Tomita, Masaru; Venter, J Craig; Glass, John I; Piñol, Jaume; Suzuki, Yo
2018-05-22
Functional genomics studies in minimal mycoplasma cells enable unobstructed access to some of the most fundamental processes in biology. Conventional transposon bombardment and gene knockout approaches often fail to reveal functions of genes that are essential for viability, where lethality precludes phenotypic characterization. Conditional inactivation of genes is effective for characterizing functions central to cell growth and division, but tools are limited for this purpose in mycoplasmas. Here we demonstrate systems for inducible repression of gene expression based on clustered regularly interspaced short palindromic repeats-mediated interference (CRISPRi) in Mycoplasma pneumoniae and synthetic Mycoplasma mycoides, two organisms with reduced genomes actively used in systems biology studies. In the synthetic cell, we also demonstrate inducible gene expression for the first time. Time-course data suggest rapid kinetics and reversible engagement of CRISPRi. Targeting of six selected endogenous genes with this system results in lowered transcript levels or reduced growth rates that agree with lack or shortage of data in previous transposon bombardment studies, and now produces actual cells to analyze. The ksgA gene encodes a methylase that modifies 16S rRNA, rendering it vulnerable to inhibition by the antibiotic kasugamycin. Targeting the ksgA gene with CRISPRi removes the lethal effect of kasugamycin and enables cell growth, thereby establishing specific and effective gene modulation with our system. The facile methods for conditional gene activation and inactivation in mycoplasmas open the door to systematic dissection of genetic programs at the core of cellular life.
Máximo, Wesley P. F.; Zanetti, Ronald; Paiva, Luciano V.
2018-01-01
Although several ant species are important targets for the development of molecular control strategies, only a few studies focus on identifying and validating reference genes for quantitative reverse transcription polymerase chain reaction (RT-qPCR) data normalization. We provide here an extensive study to identify and validate suitable reference genes for gene expression analysis in the ant Atta sexdens, a threatening agricultural pest in South America. The optimal number of reference genes varies according to each sample and the result generated by RefFinder differed about which is the most suitable reference gene. Results suggest that the RPS16, NADH and SDHB genes were the best reference genes in the sample pool according to stability values. The SNF7 gene expression pattern was stable in all evaluated sample set. In contrast, when using less stable reference genes for normalization a large variability in SNF7 gene expression was recorded. There is no universal reference gene suitable for all conditions under analysis, since these genes can also participate in different cellular functions, thus requiring a systematic validation of possible reference genes for each specific condition. The choice of reference genes on SNF7 gene normalization confirmed that unstable reference genes might drastically change the expression profile analysis of target candidate genes. PMID:29419794
Conditional genomic rearrangement by designed meiotic recombination using VDE (PI-SceI) in yeast.
Fukuda, Tomoyuki; Ohya, Yoshikazu; Ohta, Kunihiro
2007-10-01
Meiotic recombination plays critical roles in the acquisition of genetic diversity and has been utilized for conventional breeding of livestock and crops. The frequency of meiotic recombination is normally low, and is extremely low in regions called "recombination cold domains". Here, we describe a new and highly efficient method to modulate yeast meiotic gene rearrangements using VDE (PI-SceI), an intein-encoded endonuclease that causes an efficient unidirectional meiotic gene conversion at its recognition sequence (VRS). We designed universal targeting vectors, by use of which the strain that inserts the VRS at a desired site is acquired. Meiotic induction of the strains provided unidirectional gene conversions and frequent genetic rearrangements of flanking genes with little impact on cell viability. This system thus opens the way for the designed modulation of meiotic gene rearrangements, regardless of recombinational activity of chromosomal domains. Finally, the VDE-VRS system enabled us to conduct meiosis-specific conditional knockout of genes where VDE-initiated gene conversion disrupts the target gene during meiosis, serving as a novel approach to examine the functions of genes during germination of resultant spores.
Dreyfus, David H; Tompkins, S Mark; Fuleihan, Ramsay; Ghoda, Lucy Y
2007-01-01
Respiratory diseases provide an attractive target for gene silencing using small nucleic acids since the respiratory epithelium can be reached by inhalation therapy. Natural surfactant appears to facilitate the uptake and distribution of these types of molecules making aerosolized nucleic acids a possible new class of therapeutics. This article will review the rationale for the use of External Guide Sequence (EGS) in targeting specific mRNA molecules for RNase P-mediated intracellular destruction. Specific destruction of target mRNA results in gene-specific silencing similar to that instigated by siRNA via the RISC complex. The application of EGS molecules specific for influenza genes are discussed as well as the potential for synergy with siRNA. Furthermore, EGS could be adapted to target other respiratory diseases of viral etiology as well as conditions such as asthma. PMID:19707312
van der Weijden, Vera A; Chen, Shuai; Bauersachs, Stefan; Ulbrich, Susanne E; Schoen, Jennifer
2017-11-25
We recently developed an air-liquid interface long-term culture of differentiated bovine oviductal epithelial cells (ALI-BOEC). This ex vivo oviduct epithelium is capable of supporting embryo development in co-culture up to the blastocyst stage without addition of embryo culture medium. However, blastocyst rates in co-culture were markedly lower than in conventional in vitro embryo production procedures. In the present study, we assessed target gene expression of ALI-BOEC derived embryos to test their similarity to embryos from conventional in vitro embryo culture. We screened previously published data from developing bovine embryos and selected 41 genes which are either differentially expressed during embryo development, or reflect differences between various in vitro culture conditions or in vitro and in vivo embryos. Target gene expression was measured in 8-cell embryos and blastocysts using a 48.48 Dynamic Array™ on a Biomark HD instrument. For comparison with the ALI-BOEC system, we generated embryos by two different standard IVP protocols. The culture conditions lead to differential gene expression in both 8-cell embryos and blastocysts. Across the expression of all target genes the embryos developing on ALI-BOEC did not depart from conventional IVP embryos. These first results prove that gene expression in ALI-BOEC embryos is not largely aberrant. However, there was no clear indication for a more in vivo-like target gene expression of these embryos. This calls for further optimization of the ALI-BOEC system to increase its efficiency both quantitatively and qualitatively.
RAC-tagging: Recombineering And Cas9-assisted targeting for protein tagging and conditional analyses
Baker, Oliver; Gupta, Ashish; Obst, Mandy; Zhang, Youming; Anastassiadis, Konstantinos; Fu, Jun; Stewart, A. Francis
2016-01-01
A fluent method for gene targeting to establish protein tagged and ligand inducible conditional loss-of-function alleles is described. We couple new recombineering applications for one-step cloning of gRNA oligonucleotides and rapid generation of short-arm (~1 kb) targeting constructs with the power of Cas9-assisted targeting to establish protein tagged alleles in embryonic stem cells at high efficiency. RAC (Recombineering And Cas9)-tagging with Venus, BirM, APEX2 and the auxin degron is facilitated by a recombineering-ready plasmid series that permits the reuse of gene-specific reagents to insert different tags. Here we focus on protein tagging with the auxin degron because it is a ligand-regulated loss-of-function strategy that is rapid and reversible. Furthermore it includes the additional challenge of biallelic targeting. Despite high frequencies of monoallelic RAC-targeting, we found that simultaneous biallelic targeting benefits from long-arm (>4 kb) targeting constructs. Consequently an updated recombineering pipeline for fluent generation of long arm targeting constructs is also presented. PMID:27216209
Targeting gene therapy to cancer: a review.
Dachs, G U; Dougherty, G J; Stratford, I J; Chaplin, D J
1997-01-01
In recent years the idea of using gene therapy as a modality in the treatment of diseases other than genetically inherited, monogenic disorders has taken root. This is particularly obvious in the field of oncology where currently more than 100 clinical trials have been approved worldwide. This report will summarize some of the exciting progress that has recently been made with respect to both targeting the delivery of potentially therapeutic genes to tumor sites and regulating their expression within the tumor microenvironment. In order to specifically target malignant cells while at the same time sparing normal tissue, cancer gene therapy will need to combine highly selective gene delivery with highly specific gene expression, specific gene product activity, and, possibly, specific drug activation. Although the efficient delivery of DNA to tumor sites remains a formidable task, progress has been made in recent years using both viral (retrovirus, adenovirus, adeno-associated virus) and nonviral (liposomes, gene gun, injection) methods. In this report emphasis will be placed on targeted rather than high-efficiency delivery, although those would need to be combined in the future for effective therapy. To date delivery has been targeted to tumor-specific and tissue-specific antigens, such as epithelial growth factor receptor, c-kit receptor, and folate receptor, and these will be described in some detail. To increase specificity and safety of gene therapy further, the expression of the therapeutic gene needs to be tightly controlled within the target tissue. Targeted gene expression has been analyzed using tissue-specific promoters (breast-, prostate-, and melanoma-specific promoters) and disease-specific promoters (carcinoembryonic antigen, HER-2/neu, Myc-Max response elements, DF3/MUC). Alternatively, expression could be regulated externally with the use of radiation-induced promoters or tetracycline-responsive elements. Another novel possibility that will be discussed is the regulation of therapeutic gene products by tumor-specific gene splicing. Gene expression could also be targeted at conditions specific to the tumor microenvironment, such as glucose deprivation and hypoxia. We have concentrated on hypoxia-targeted gene expression and this report will discuss our progress in detail. Chronic hypoxia occurs in tissue that is more than 100-200 microns away from a functional blood supply. In solid tumors hypoxia is widespread both because cancer cells are more prolific than the invading endothelial cells that make up the blood vessels and because the newly formed blood supply is disorganized. Measurements of oxygen partial pressure in patients' tumors showed a high percentage of severe hypoxia readings (less than 2.5 mmHg), readings not seen in normal tissue. This is a major problem in the treatment of cancer, because hypoxic cells are resistant to radiotherapy and often to chemotherapy. However, severe hypoxia is also a physiological condition specific to tumors, which makes it a potentially exploitable target. We have utilized hypoxia response elements (HRE) derived from the oxygen-regulated phosphoglycerate kinase gene to control gene expression in human tumor cells in vitro and in experimental tumors. The list of genes that have been considered for use in the treatment of cancer is extensive. It includes cytokines and costimulatory cell surface molecules intended to induce an effective systemic immune response against tumor antigens that would not otherwise develop. Other inventive strategies include the use of internally expressed antibodies to target oncogenic proteins (intrabodies) and the use of antisense technology (antisense oligonucleotides, antigenes, and ribozymes). This report will concentrate more on novel genes encoding prodrug activating enzymes, so-called suicide genes (Herpes simplex virus thymidine kinase, Escherichia coli nitroreductase, E. (ABSTRACT TRUNCATED)
Kujoth, Gregory C.; Sullivan, Thomas D.; Merkhofer, Richard; Lee, Taek-Jin; Wang, Huafeng; Brandhorst, Tristan; Wüthrich, Marcel
2018-01-01
ABSTRACT Blastomyces dermatitidis is a human fungal pathogen of the lung that can lead to disseminated disease in healthy and immunocompromised individuals. Genetic analysis of this fungus is hampered by the relative inefficiency of traditional recombination-based gene-targeting approaches. Here, we demonstrate the feasibility of applying CRISPR/Cas9-mediated gene editing to Blastomyces, including to simultaneously target multiple genes. We created targeting plasmid vectors expressing Cas9 and either one or two single guide RNAs and introduced these plasmids into Blastomyces via Agrobacterium gene transfer. We succeeded in disrupting several fungal genes, including PRA1 and ZRT1, which are involved in scavenging and uptake of zinc from the extracellular environment. Single-gene-targeting efficiencies varied by locus (median, 60% across four loci) but were approximately 100-fold greater than traditional methods of Blastomyces gene disruption. Simultaneous dual-gene targeting proceeded with efficiencies similar to those of single-gene-targeting frequencies for the respective targets. CRISPR/Cas9 disruption of PRA1 or ZRT1 had a variable impact on growth under zinc-limiting conditions, showing reduced growth at early time points in low-passage-number cultures and growth similar to wild-type levels by later passage. Individual impairment of PRA1 or ZRT1 resulted in a reduction of the fungal burden in a mouse model of Blastomyces infection by a factor of ~1 log (range, up to 3 logs), and combined disruption of both genes had no additional impact on the fungal burden. These results underscore the utility of CRISPR/Cas9 for efficient gene disruption in dimorphic fungi and reveal a role for zinc metabolism in Blastomyces fitness in vivo. PMID:29615501
Xie, Qi; Liu, Xue; Zhang, Yinbing; Tang, Jinfu; Yin, Dedong; Fan, Bo; Zhu, Lihuang; Han, Liebao; Song, Guilong; Li, Dayong
2017-01-01
Due to its high biomass yield, low environmental impact, and widespread adaptability to poor soils and harsh conditions, switchgrass ( Panicum virgatum L.), a warm-region perennial herbaceous plant, has attracted much attention in recent years. However, little is known about microRNAs (miRNAs) and their functions in this bioenergy grass. Here, we identified and characterized a miRNA gene, Pvi-MIR319a , encoding microRNA319a in switchgrass. Transgenic rice lines generated by overexpressing the Pvi-MIR319a precursor gene exhibited broader leaves and delayed flowering compared with the control. Gene expression analysis indicated at least four putative target genes were downregulated. Additionally, we cloned a putative target gene ( PvPCF5 ) of Pvi-MIR319a from switchgrass. PvPCF5, a TCP transcription factor, is a nuclear-localized protein with transactivation activity and control the development of leaf. Our results suggest that Pvi-MIR319a and its target genes may be used as potential genetic regulators for future switchgrass genetic improvement.
Camphausen, Kevin; Purow, Benjamin; Sproull, Mary; Scott, Tamalee; Ozawa, Tomoko; Deen, Dennis F.; Tofilon, Philip J.
2005-01-01
Defining the molecules that regulate tumor cell survival is an essential prerequisite for the development of targeted approaches to cancer treatment. Whereas many studies aimed at identifying such targets use human tumor cells grown in vitro or as s.c. xenografts, it is unclear whether such experimental models replicate the phenotype of the in situ tumor cell. To begin addressing this issue, we have used microarray analysis to define the gene expression profile of two human glioma cell lines (U251 and U87) when grown in vitro and in vivo as s.c. or as intracerebral (i.c.) xenografts. For each cell line, the gene expression profile generated from tissue culture was significantly different from that generated from the s.c. tumor, which was significantly different from those grown i.c. The disparity between the i.c gene expression profiles and those generated from s.c. xenografts suggests that whereas an in vivo growth environment modulates gene expression, orthotopic growth conditions induce a different set of modifications. In this study the U251 and U87 gene expression profiles generated under the three growth conditions were also compared. As expected, the profiles of the two glioma cell lines were significantly different when grown as monolayer cultures. However, the glioma cell lines had similar gene expression profiles when grown i.c. These results suggest that tumor cell gene expression, and thus phenotype, as defined in vitro is affected not only by in vivo growth but also by orthotopic growth, which may have implications regarding the identification of relevant targets for cancer therapy. PMID:15928080
The spatial expression and regulation of transcription factors IDEF1 and IDEF2
Kobayashi, Takanori; Ogo, Yuko; Aung, May Sann; Nozoye, Tomoko; Itai, Reiko Nakanishi; Nakanishi, Hiromi; Yamakawa, Takashi; Nishizawa, Naoko K.
2010-01-01
Background and Aims Under conditions of low iron availability, rice plants induce genes involved in iron uptake and utilization. The iron deficiency-responsive cis-acting element binding factors 1 and 2 (IDEF1 and IDEF2) regulate transcriptional response to iron deficiency in rice roots. Clarification of the functions of IDEF1 and IDEF2 could uncover the gene regulation mechanism. Methods Spatial patterns of IDEF1 and IDEF2 expression were analysed by histochemical staining of IDEF1 and IDEF2 promoter-GUS transgenic rice lines. Expression patterns of the target genes of IDEF1 and IDEF2 were analysed using transformants with induced or repressed expression of IDEF1 or IDEF2 grown in iron-rich or in iron-deficient solutions for 1 d. Key Results IDEF1 and IDEF2 were highly expressed in the basal parts of the lateral roots and vascular bundles. IDEF1 and IDEF2 expression was dominant in leaf mesophyll and vascular cells, respectively. These expression patterns were similar under both iron-deficient and iron-sufficient conditions. IDEF1 was strongly expressed in pollen, ovaries, the aleurone layer and embryo. IDEF2 was expressed in pollen, ovaries and the dorsal vascular region of the endosperm. During seed germination, IDEF1 and IDEF2 were expressed in the endosperm and embryo. Expression of IDEF1 target genes was regulated in iron-rich roots similar to early iron-deficiency stages. In addition, the expression patterns of IDEF2 target genes were similar between iron-rich conditions and early or subsequent iron deficiency. Conclusions IDEF1 and IDEF2 are constitutively expressed during both vegetative and reproductive stages. The spatial expression patterns of IDEF1 and IDEF2 overlap with their target genes in restricted cell types, but not in all cells. The spatial expression patterns and gene regulation of IDEF1 and IDEF2 in roots are generally conserved under conditions of iron sufficiency and deficiency, suggesting complicated interactions with unknown factors for sensing and transmitting iron-deficiency signals. PMID:20197292
Schebelle, Laura; Wolf, Claudia; Stribl, Carola; Javaheri, Tahereh; Schnütgen, Frank; Ettinger, Andreas; Ivics, Zoltán; Hansen, Jens; Ruiz, Patricia; von Melchner, Harald; Wurst, Wolfgang; Floss, Thomas
2010-01-01
Recombinase-mediated cassette exchange (RMCE) exploits the possibility to unidirectionally exchange any genetic material flanked by heterotypic recombinase recognition sites (RRS) with target sites in the genome. Due to a limited number of available pre-fabricated target sites, RMCE in mouse embryonic stem (ES) cells has not been tapped to its full potential to date. Here, we introduce a universal system, which allows the targeted insertion of any given transcriptional unit into 85 742 previously annotated retroviral conditional gene trap insertions, representing 7013 independent genes in mouse ES cells, by RMCE. This system can be used to express any given cDNA under the control of endogenous trapped promoters in vivo, as well as for the generation of transposon ‘launch pads’ for chromosomal region-specific ‘Sleeping Beauty’ insertional mutagenesis. Moreover, transcription of the gene-of-interest is only activated upon Cre-recombinase activity, a feature that adds conditionality to this expression system, which is demonstrated in vivo. The use of the RMCE system presented in this work requires one single-cloning step followed by one overnight gateway clonase reaction and subsequent cassette exchange in ES cells with efficiencies of 40% in average. PMID:20139417
Single molecule targeted sequencing for cancer gene mutation detection.
Gao, Yan; Deng, Liwei; Yan, Qin; Gao, Yongqian; Wu, Zengding; Cai, Jinsen; Ji, Daorui; Li, Gailing; Wu, Ping; Jin, Huan; Zhao, Luyang; Liu, Song; Ge, Liangjin; Deem, Michael W; He, Jiankui
2016-05-19
With the rapid decline in cost of sequencing, it is now affordable to examine multiple genes in a single disease-targeted clinical test using next generation sequencing. Current targeted sequencing methods require a separate step of targeted capture enrichment during sample preparation before sequencing. Although there are fast sample preparation methods available in market, the library preparation process is still relatively complicated for physicians to use routinely. Here, we introduced an amplification-free Single Molecule Targeted Sequencing (SMTS) technology, which combined targeted capture and sequencing in one step. We demonstrated that this technology can detect low-frequency mutations using artificially synthesized DNA sample. SMTS has several potential advantages, including simple sample preparation thus no biases and errors are introduced by PCR reaction. SMTS has the potential to be an easy and quick sequencing technology for clinical diagnosis such as cancer gene mutation detection, infectious disease detection, inherited condition screening and noninvasive prenatal diagnosis.
Ohba, Kenji; Singh, Brijesh Kumar; Sinha, Rohit Anthony; Lesmana, Ronny; Liao, Xiao-Hui; Ghosh, Sujoy; Refetoff, Samuel
2016-01-01
Clinical symptoms may vary and not necessarily reflect serum thyroid hormone (TH) levels during acute and chronic hyperthyroidism as well as recovery from hyperthyroidism. We thus examined changes in hepatic gene expression and serum TH/TSH levels in adult male mice treated either with a single T3 (20 μg per 100 g body weight) injection (acute T3) or daily injections for 14 days (chronic T3) followed by 10 days of withdrawal. Gene expression arrays from livers harvested at these time points showed that among positively-regulated target genes, 320 were stimulated acutely and 429 chronically by T3. Surprisingly, only 69 of 680 genes (10.1%) were induced during both periods, suggesting desensitization of the majority of acutely stimulated target genes. About 90% of positively regulated target genes returned to baseline expression levels after 10 days of withdrawal; however, 67 of 680 (9.9%) did not return to baseline despite normalization of serum TH/TSH levels. Similar findings also were observed for negatively regulated target genes. Chromatin immunoprecipitation analysis of representative positively regulated target genes suggested that acetylation of H3K9/K14 was associated with acute stimulation, whereas trimethylation of H3K4 was associated with chronic stimulation. In an in vivo model of chronic intrahepatic hyperthyroidism since birth, adult male monocarboxylate transporter-8 knockout mice also demonstrated desensitization of most acutely stimulated target genes that were examined. In summary, we have identified transcriptional desensitization and incomplete recovery of gene expression during chronic hyperthyroidism and recovery. Our findings may be a potential reason for discordance between clinical symptoms and serum TH levels observed in these conditions. PMID:26866609
STUDIES OF NORMAL GENE EXPRESSION IN THE RAT NASAL EPITHELIUM USNG CDNA ARRAY TECHNOLOGY
Studies of Normal Gene Expression in the Rat Nasal Epithelium Using cDNA Array
The nasal epithelium is an important target site for chemically-induced toxicity and carcinogenicity .Gene expression data are being used increasingly for studies of such conditions. In or...
Identifying transcription factor functions and targets by phenotypic activation
Chua, Gordon; Morris, Quaid D.; Sopko, Richelle; Robinson, Mark D.; Ryan, Owen; Chan, Esther T.; Frey, Brendan J.; Andrews, Brenda J.; Boone, Charles; Hughes, Timothy R.
2006-01-01
Mapping transcriptional regulatory networks is difficult because many transcription factors (TFs) are activated only under specific conditions. We describe a generic strategy for identifying genes and pathways induced by individual TFs that does not require knowledge of their normal activation cues. Microarray analysis of 55 yeast TFs that caused a growth phenotype when overexpressed showed that the majority caused increased transcript levels of genes in specific physiological categories, suggesting a mechanism for growth inhibition. Induced genes typically included established targets and genes with consensus promoter motifs, if known, indicating that these data are useful for identifying potential new target genes and binding sites. We identified the sequence 5′-TCACGCAA as a binding sequence for Hms1p, a TF that positively regulates pseudohyphal growth and previously had no known motif. The general strategy outlined here presents a straightforward approach to discovery of TF activities and mapping targets that could be adapted to any organism with transgenic technology. PMID:16880382
Sub-cellular mRNA localization modulates the regulation of gene expression by small RNAs in bacteria
NASA Astrophysics Data System (ADS)
Teimouri, Hamid; Korkmazhan, Elgin; Stavans, Joel; Levine, Erel
2017-10-01
Small non-coding RNAs can exert significant regulatory activity on gene expression in bacteria. In recent years, substantial progress has been made in understanding bacterial gene expression by sRNAs. However, recent findings that demonstrate that families of mRNAs show non-trivial sub-cellular distributions raise the question of how localization may affect the regulatory activity of sRNAs. Here we address this question within a simple mathematical model. We show that the non-uniform spatial distributions of mRNA can alter the threshold-linear response that characterizes sRNAs that act stoichiometrically, and modulate the hierarchy among targets co-regulated by the same sRNA. We also identify conditions where the sub-cellular organization of cofactors in the sRNA pathway can induce spatial heterogeneity on sRNA targets. Our results suggest that under certain conditions, interpretation and modeling of natural and synthetic gene regulatory circuits need to take into account the spatial organization of the transcripts of participating genes.
Quarterman, Josh; Kim, Soo Rin; Kim, Pan-Jun; Jin, Yong-Su
2015-01-20
In order to determine beneficial gene deletions for ethanol production by the yeast Saccharomyces cerevisiae, we performed an in silico gene deletion experiment based on a genome-scale metabolic model. Genes coding for two oxidative phosphorylation reactions (cytochrome c oxidase and ubiquinol cytochrome c reductase) were identified by the model-based simulation as potential deletion targets for enhancing ethanol production and maintaining acceptable overall growth rate in oxygen-limited conditions. Since the two target enzymes are composed of multiple subunits, we conducted a genetic screening study to evaluate the in silico results and compare the effect of deleting various portions of the respiratory enzyme complexes. Over two-thirds of the knockout mutants identified by the in silico study did exhibit experimental behavior in qualitative agreement with model predictions, but the exceptions illustrate the limitation of using a purely stoichiometric model-based approach. Furthermore, there was a substantial quantitative variation in phenotype among the various respiration-deficient mutants that were screened in this study, and three genes encoding respiratory enzyme subunits were identified as the best knockout targets for improving hexose fermentation in microaerobic conditions. Specifically, deletion of either COX9 or QCR9 resulted in higher ethanol production rates than the parental strain by 37% and 27%, respectively, with slight growth disadvantages. Also, deletion of QCR6 led to improved ethanol production rate by 24% with no growth disadvantage. The beneficial effects of these gene deletions were consistently demonstrated in different strain backgrounds and with four common hexoses. The combination of stoichiometric modeling and genetic screening using a systematic knockout collection was useful for narrowing a large set of gene targets and identifying targets of interest. Copyright © 2014 Elsevier B.V. All rights reserved.
Uterine progesterone signaling is a target for metformin therapy in PCOS-like rats.
Hu, Min; Zhang, Yuehui; Feng, Jiaxing; Xu, Xue; Zhang, Jiao; Zhao, Wei; Guo, Xiaozhu; Li, Juan; Vestin, Edvin; Cui, Peng; Li, Xin; Wu, Xiao-Ke; Brännström, Mats; Shao, Linus R; Billig, Håkan
2018-05-01
Impaired progesterone (P4) signaling is linked to endometrial dysfunction and infertility in women with polycystic ovary syndrome (PCOS). Here, we report for the first time that elevated expression of progesterone receptor (PGR) isoforms A and B parallels increased estrogen receptor (ER) expression in PCOS-like rat uteri. The aberrant PGR-targeted gene expression in PCOS-like rats before and after implantation overlaps with dysregulated expression of Fkbp52 and Ncoa2 , two genes that contribute to the development of uterine P4 resistance. In vivo and in vitro studies of the effects of metformin on the regulation of the uterine P4 signaling pathway under PCOS conditions showed that metformin directly inhibits the expression of PGR and ER along with the regulation of several genes that are targeted dependently or independently of PGR-mediated uterine implantation. Functionally, metformin treatment corrected the abnormal expression of cell-specific PGR and ER and some PGR-target genes in PCOS-like rats with implantation. Additionally, we documented how metformin contributes to the regulation of the PGR-associated MAPK/ERK/p38 signaling pathway in the PCOS-like rat uterus. Our data provide novel insights into how metformin therapy regulates uterine P4 signaling molecules under PCOS conditions. © 2018 Society for Endocrinology.
Establishment of conditional vectors for hairpin siRNA knockdowns
Matsukura, Shiro; Jones, Peter A.; Takai, Daiya
2003-01-01
Small interference RNA (siRNA) is an emerging methodology in reverse genetics. Here we report the development of a new tetracycline-inducible vector-based siRNA system, which uses a tetracycline-responsive derivative of the U6 promoter and the tetracycline repressor for conditional in vivo transcription of short hairpin RNA. This method prevents potential lethality immediately after transfection of a vector when the targeted gene is indispensable, or the phenotype of the knockdown is lethal or results in a growth abnormality. We show that the controlled knockdown of DNA methyltransferase 1 (DNMT1) in human cancer resulted in growth arrest. Removal of the inducer, doxycycline, from treated cells led to re-expression of the targeted gene. Thus the method allows for a highly controlled approach to gene knockdown. PMID:12888529
Building Cre Knockin Rat Lines Using CRISPR/Cas9.
Ma, Yuanwu; Zhang, Lianfeng; Huang, Xingxu
2017-01-01
Conditional gene inactivation strategy helps researchers to study the gene functions that are critical in embryogenesis or in defined tissues of adulthood. The Cre/loxP system is widely used for conditional gene inactivation/activation in cells or organisms. Cre knockin animal lines are essential for gene expression or inactivation in a spatially and temporally restricted manner. However, to generate a Cre knockin line by traditional approach is laborious. Recently, the clustered regularly interspaced short palindromic repeats and CRISPR-associated protein 9 (CRISPR/Cas9) has been proven as a simple and efficient genome-editing tool. We have used CRISPR/Cas9 system to generate rat strains that carry Cre genes in different targeted gene loci by direct delivery of gRNAs/Cas9/donors into fertilized eggs. Here, we described a stepwise procedure for the generation of Cre knockin rat, including target site selection, RNA preparation, the construction of the template donor, pronuclear injection, and the genotyping of precise Cre insertion in F 0 rats. Taken together, the establishment of Cre knockin line can be achieved within 6 weeks.
Saik, Olga V; Demenkov, Pavel S; Ivanisenko, Timofey V; Bragina, Elena Yu; Freidin, Maxim B; Goncharova, Irina A; Dosenko, Victor E; Zolotareva, Olga I; Hofestaedt, Ralf; Lavrik, Inna N; Rogaev, Evgeny I; Ivanisenko, Vladimir A
2018-02-13
Hypertension and bronchial asthma are a major issue for people's health. As of 2014, approximately one billion adults, or ~ 22% of the world population, have had hypertension. As of 2011, 235-330 million people globally have been affected by asthma and approximately 250,000-345,000 people have died each year from the disease. The development of the effective treatment therapies against these diseases is complicated by their comorbidity features. This is often a major problem in diagnosis and their treatment. Hence, in this study the bioinformatical methodology for the analysis of the comorbidity of these two diseases have been developed. As such, the search for candidate genes related to the comorbid conditions of asthma and hypertension can help in elucidating the molecular mechanisms underlying the comorbid condition of these two diseases, and can also be useful for genotyping and identifying new drug targets. Using ANDSystem, the reconstruction and analysis of gene networks associated with asthma and hypertension was carried out. The gene network of asthma included 755 genes/proteins and 62,603 interactions, while the gene network of hypertension - 713 genes/proteins and 45,479 interactions. Two hundred and five genes/proteins and 9638 interactions were shared between asthma and hypertension. An approach for ranking genes implicated in the comorbid condition of two diseases was proposed. The approach is based on nine criteria for ranking genes by their importance, including standard methods of gene prioritization (Endeavor, ToppGene) as well as original criteria that take into account the characteristics of an associative gene network and the presence of known polymorphisms in the analysed genes. According to the proposed approach, the genes IL10, TLR4, and CAT had the highest priority in the development of comorbidity of these two diseases. Additionally, it was revealed that the list of top genes is enriched with apoptotic genes and genes involved in biological processes related to the functioning of central nervous system. The application of methods of reconstruction and analysis of gene networks is a productive tool for studying the molecular mechanisms of comorbid conditions. The method put forth to rank genes by their importance to the comorbid condition of asthma and hypertension was employed that resulted in prediction of 10 genes, playing the key role in the development of the comorbid condition. The results can be utilised to plan experiments for identification of novel candidate genes along with searching for novel pharmacological targets.
Wotton, Sandy; Terry, Anne; Kilbey, Anna; Jenkins, Alma; Herzyk, Pawel; Cameron, Ewan; Neil, James C.
2008-01-01
The Runx genes play divergent roles in development and cancer, where they can act either as oncogenes or tumour suppressors. We compared the effects of ectopic Runx expression in established fibroblasts, where all three genes produce an indistinguishable phenotype entailing epithelioid morphology and increased cell survival under stress conditions. Gene array analysis revealed a strongly overlapping transcriptional signature, with no examples of opposing regulation of the same target gene. A common set of 50 highly regulated genes was identified after further filtering on regulation by inducible RUNX1-ER. This set revealed a strong bias towards genes with annotated roles in cancer and development, and a preponderance of targets encoding extracellular or surface proteins, reflecting the marked effects of Runx on cell adhesion. Furthermore, in silico prediction of resistance to glucocorticoid growth inhibition was confirmed in fibroblasts and lymphoid cells expressing ectopic Runx. The effects of fibroblast expression of common RUNX1 fusion oncoproteins (RUNX1-ETO, TEL-RUNX1, CBFB-MYH11) were also tested. While two direct Runx activation target genes were repressed (Ncam1, Rgc32), the fusion proteins appeared to disrupt regulation of down-regulated targets (Cebpd, Id2, Rgs2) rather than impose constitutive repression. These results elucidate the oncogenic potential of the Runx family and reveal novel targets for therapeutic inhibition. PMID:18560354
Källman, Thomas; De Mita, Stéphane; Larsson, Hanna; Gyllenstrand, Niclas; Heuertz, Myriam; Parducci, Laura; Suyama, Yoshihisa; Lagercrantz, Ulf; Lascoux, Martin
2014-01-01
The ability of plants to track seasonal changes is largely dependent on genes assigned to the photoperiod pathway, and variation in those genes is thereby important for adaptation to local day length conditions. Extensive physiological data in several temperate conifer species suggest that populations are adapted to local light conditions, but data on the genes underlying this adaptation are more limited. Here we present nucleotide diversity data from 19 genes putatively involved in photoperiodic response in Norway spruce (Picea abies). Based on similarity to model plants the genes were grouped into three categories according to their presumed position in the photoperiod pathway: photoreceptors, circadian clock genes, and downstream targets. An HKA (Hudson, Kreitman and Aquade) test showed a significant excess of diversity at photoreceptor genes, but no departure from neutrality at circadian genes and downstream targets. Departures from neutrality were also tested with Tajima's D and Fay and Wu's H statistics under three demographic scenarios: the standard neutral model, a population expansion model, and a more complex population split model. Only one gene, the circadian clock gene PaPRR3 with a highly positive Tajima's D value, deviates significantly from all tested demographic scenarios. As the PaPRR3 gene harbours multiple non-synonymous variants it appears as an excellent candidate gene for control of photoperiod response in Norway spruce. PMID:24810273
Källman, Thomas; De Mita, Stéphane; Larsson, Hanna; Gyllenstrand, Niclas; Heuertz, Myriam; Parducci, Laura; Suyama, Yoshihisa; Lagercrantz, Ulf; Lascoux, Martin
2014-01-01
The ability of plants to track seasonal changes is largely dependent on genes assigned to the photoperiod pathway, and variation in those genes is thereby important for adaptation to local day length conditions. Extensive physiological data in several temperate conifer species suggest that populations are adapted to local light conditions, but data on the genes underlying this adaptation are more limited. Here we present nucleotide diversity data from 19 genes putatively involved in photoperiodic response in Norway spruce (Picea abies). Based on similarity to model plants the genes were grouped into three categories according to their presumed position in the photoperiod pathway: photoreceptors, circadian clock genes, and downstream targets. An HKA (Hudson, Kreitman and Aquade) test showed a significant excess of diversity at photoreceptor genes, but no departure from neutrality at circadian genes and downstream targets. Departures from neutrality were also tested with Tajima's D and Fay and Wu's H statistics under three demographic scenarios: the standard neutral model, a population expansion model, and a more complex population split model. Only one gene, the circadian clock gene PaPRR3 with a highly positive Tajima's D value, deviates significantly from all tested demographic scenarios. As the PaPRR3 gene harbours multiple non-synonymous variants it appears as an excellent candidate gene for control of photoperiod response in Norway spruce.
Poplawski, Shane G; Schoch, Hannah; Wimmer, Mathieu; Hawk, Joshua D; Walsh, Jennifer L; Giese, Karl P; Abel, Ted
2014-12-01
Hippocampus-dependent learning is known to induce changes in gene expression, but information on gene expression differences between different learning paradigms that require the hippocampus is limited. The bulk of studies investigating RNA expression after learning use the contextual fear conditioning task, which couples a novel environment with a footshock. Although contextual fear conditioning has been useful in discovering gene targets, gene expression after spatial memory tasks has received less attention. In this study, we used the object-location memory task and studied gene expression at two time points after learning in a high-throughput manner using a microfluidic qPCR approach. We found that expression of the classic immediate-early genes changes after object-location training in a fashion similar to that observed after contextual fear conditioning. However, the temporal dynamics of gene expression are different between the two tasks, with object-location memory producing gene expression changes that last at least 2 hours. Our findings indicate that different training paradigms may give rise to distinct temporal dynamics of gene expression after learning. Copyright © 2014 Elsevier Inc. All rights reserved.
Wimmer, Mathieu; Hawk, Joshua D.; Walsh, Jennifer L.; Giese, Karl P.; Abel, Ted
2014-01-01
Hippocampus-dependent learning is known to induce changes in gene expression, but information on gene expression differences between different learning paradigms that require the hippocampus is limited. The bulk of studies investigating RNA expression after learning use the contextual fear conditioning task, which couples a novel environment with a footshock. Although contextual fear conditioning has been useful in discovering gene targets, gene expression after spatial memory tasks has received less attention. In this study, we used the object-location memory task and studied gene expression at two time points after learning in a high-throughput manner using a microfluidic qPCR approach. We found that expression of the classic immediate-early genes changes after object-location training in a fashion similar to that observed after contextual fear conditioning. However, the temporal dynamics of gene expression are different between the two tasks, with object-location memory producing gene expression changes that last at least 2 hours. Our findings indicate that different training paradigms may give rise to distinct temporal dynamics of gene expression after learning. PMID:25242102
Sequential Metabolic Phases as a Means to Optimize Cellular Output in a Constant Environment
Bockmayr, Alexander; Holzhütter, Hermann-Georg
2015-01-01
Temporal changes of gene expression are a well-known regulatory feature of all cells, which is commonly perceived as a strategy to adapt the proteome to varying external conditions. However, temporal (rhythmic and non-rhythmic) changes of gene expression are also observed under virtually constant external conditions. Here we hypothesize that such changes are a means to render the synthesis of the metabolic output more efficient than under conditions of constant gene activities. In order to substantiate this hypothesis, we used a flux-balance model of the cellular metabolism. The total time span spent on the production of a given set of target metabolites was split into a series of shorter time intervals (metabolic phases) during which only selected groups of metabolic genes are active. The related flux distributions were calculated under the constraint that genes can be either active or inactive whereby the amount of protein related to an active gene is only controlled by the number of active genes: the lower the number of active genes the more protein can be allocated to the enzymes carrying non-zero fluxes. This concept of a predominantly protein-limited efficiency of gene expression clearly differs from other concepts resting on the assumption of an optimal gene regulation capable of allocating to all enzymes and transporters just that fraction of protein necessary to prevent rate limitation. Applying this concept to a simplified metabolic network of the central carbon metabolism with glucose or lactate as alternative substrates, we demonstrate that switching between optimally chosen stationary flux modes comprising different sets of active genes allows producing a demanded amount of target metabolites in a significantly shorter time than by a single optimal flux mode at fixed gene activities. Our model-based findings suggest that temporal expression of metabolic genes can be advantageous even under conditions of constant external substrate supply. PMID:25786979
Hao, Nan; Lee, Kian Leong; Furness, Sebastian G B; Bosdotter, Cecilia; Poellinger, Lorenz; Whitelaw, Murray L
2012-12-01
The aryl hydrocarbon receptor (AhR) is a signal-regulated transcription factor, which is canonically activated by the direct binding of xenobiotics. In addition, switching cells from adherent to suspension culture also activates the AhR, representing a nonxenobiotic, physiological activation of AhR signaling. Here, we show that the AhR is recruited to target gene enhancers in both ligand [isopropyl-2-(1,3-dithietane-2-ylidene)-2-[N-(4-methylthiazol-2-yl)carbamoyl]acetate (YH439)]-treated and suspension cells, suggesting a common mechanism of target gene induction between these two routes of AhR activation. However, gene expression profiles critically differ between xenobiotic- and suspension-activated AhR signaling. Por and Cldnd1 were regulated predominantly by ligand treatments, whereas, in contrast, ApoER2 and Ganc were regulated predominantly by the suspension condition. Classic xenobiotic-metabolizing AhR targets such as Cyp1a1, Cyp1b1, and Nqo1 were regulated by both ligand and suspension conditions. Temporal expression patterns of AhR target genes were also found to vary, with examples of transient activation, transient repression, or sustained alterations in expression. Furthermore, sequence analysis coupled with chromatin immunoprecipitation assays and reporter gene analysis identified a functional xenobiotic response element (XRE) in the intron 1 of the mouse Tiparp gene, which was also bound by hypoxia-inducible factor-1α during hypoxia and features a concatemer of four XRE cores (GCGTG). Our data suggest that this XRE concatemer site concurrently regulates the expression of both the Tiparp gene and its cis antisense noncoding RNA after ligand- or suspension-induced AhR activation. This work provides novel insights into how AhR signaling drives different transcriptional programs via the ligand versus suspension modes of activation.
Park, Sunchung; Oh, Sookyung; Ek-Ramos, Julissa; van Nocker, Steven
2010-06-01
The human Paf1 complex (Paf1C) subunit Parafibromin assists in mediating output from the Wingless/Int signaling pathway, and dysfunction of the encoding gene HRPT2 conditions specific cancer-related disease phenotypes. Here, we characterize the organismal and molecular roles of PLANT HOMOLOGOUS TO PARAFIBROMIN (PHP), the Arabidopsis (Arabidopsis thaliana) homolog of Parafibromin. PHP resides in an approximately 670-kD protein complex in nuclear extracts, and physically interacts with other known Paf1C-related proteins in vivo. In striking contrast to the developmental pleiotropy conferred by mutation in other plant Paf1C component genes in Arabidopsis, loss of PHP specifically conditioned accelerated phase transition from vegetative growth to flowering and resulted in misregulation of a very limited subset of genes that included the flowering repressor FLOWERING LOCUS C. Those genes targeted by PHP were distinguished from the bulk of Arabidopsis genes and other plant Paf1C targets by strong enrichment for trimethylation of lysine-27 on histone H3 (H3K27me3) within chromatin. These findings suggest that PHP is a component of a plant Paf1C protein in Arabidopsis, but has a more specialized role in modulating expression of a subset of Paf1C targets.
Jackson, Belinda M; Abete-Luzi, Patricia; Krause, Michael W; Eisenmann, David M
2014-04-16
The Wnt signaling pathway plays a fundamental role during metazoan development, where it regulates diverse processes, including cell fate specification, cell migration, and stem cell renewal. Activation of the beta-catenin-dependent/canonical Wnt pathway up-regulates expression of Wnt target genes to mediate a cellular response. In the nematode Caenorhabditis elegans, a canonical Wnt signaling pathway regulates several processes during larval development; however, few target genes of this pathway have been identified. To address this deficit, we used a novel approach of conditionally activated Wnt signaling during a defined stage of larval life by overexpressing an activated beta-catenin protein, then used microarray analysis to identify genes showing altered expression compared with control animals. We identified 166 differentially expressed genes, of which 104 were up-regulated. A subset of the up-regulated genes was shown to have altered expression in mutants with decreased or increased Wnt signaling; we consider these genes to be bona fide C. elegans Wnt pathway targets. Among these was a group of six genes, including the cuticular collagen genes, bli-1 col-38, col-49, and col-71. These genes show a peak of expression in the mid L4 stage during normal development, suggesting a role in adult cuticle formation. Consistent with this finding, reduction of function for several of the genes causes phenotypes suggestive of defects in cuticle function or integrity. Therefore, this work has identified a large number of putative Wnt pathway target genes during larval life, including a small subset of Wnt-regulated collagen genes that may function in synthesis of the adult cuticle.
Neuhaus, Christine; Eisenberger, Tobias; Decker, Christian; Nagl, Sandra; Blank, Cornelia; Pfister, Markus; Kennerknecht, Ingo; Müller-Hofstede, Cornelie; Charbel Issa, Peter; Heller, Raoul; Beck, Bodo; Rüther, Klaus; Mitter, Diana; Rohrschneider, Klaus; Steinhauer, Ute; Korbmacher, Heike M; Huhle, Dagmar; Elsayed, Solaf M; Taha, Hesham M; Baig, Shahid M; Stöhr, Heidi; Preising, Markus; Markus, Susanne; Moeller, Fabian; Lorenz, Birgit; Nagel-Wolfrum, Kerstin; Khan, Arif O; Bolz, Hanno J
2017-09-01
Combined retinal degeneration and sensorineural hearing impairment is mostly due to autosomal recessive Usher syndrome (USH1: congenital deafness, early retinitis pigmentosa (RP); USH2: progressive hearing impairment, RP). Sanger sequencing and NGS of 112 genes (Usher syndrome, nonsyndromic deafness, overlapping conditions), MLPA, and array-CGH were conducted in 138 patients clinically diagnosed with Usher syndrome. A molecular diagnosis was achieved in 97% of both USH1 and USH2 patients, with biallelic mutations in 97% (USH1) and 90% (USH2), respectively. Quantitative readout reliably detected CNVs (confirmed by MLPA or array-CGH), qualifying targeted NGS as one tool for detecting point mutations and CNVs. CNVs accounted for 10% of identified USH2A alleles, often in trans to seemingly monoallelic point mutations. We demonstrate PTC124-induced read-through of the common p.Trp3955* nonsense mutation (13% of detected USH2A alleles), a potential therapy target. Usher gene mutations were found in most patients with atypical Usher syndrome, but the diagnosis was adjusted in case of double homozygosity for mutations in OTOA and NR2E3 , genes implicated in isolated deafness and RP. Two patients with additional enamel dysplasia had biallelic PEX26 mutations, for the first time linking this gene to Heimler syndrome. Targeted NGS not restricted to Usher genes proved beneficial in uncovering conditions mimicking Usher syndrome.
Gene Suppression of Mouse Testis In Vivo Using Small Interfering RNA Derived from Plasmid Vectors
Takizawa, Takami; Ishikawa, Tomoko; Kosuge, Takuji; Mizuguchi, Yoshiaki; Sato, Yoko; Koji, Takehiko; Araki, Yoshihiko; Takizawa, Toshihiro
2012-01-01
We evaluated whether inhibiting gene expression by small interfering RNA (siRNA) can be used for an in vivo model using a germ cell-specific gene (Tex101) as a model target in mouse testis. We generated plasmid-based expression vectors of siRNA targeting the Tex101 gene and transfected them into postnatal day 10 mouse testes by in vivo electroporation. After optimizing the electroporation conditions using a vector transfected into the mouse testis, a combination of high- and low-voltage pulses showed excellent transfection efficiency for the vectors with minimal tissue damage, but gene suppression was transient. Gene suppression by in vivo electroporation may be helpful as an alternative approach when designing experiments to unravel the basic role of testicular molecules. PMID:22489107
DGCA: A comprehensive R package for Differential Gene Correlation Analysis.
McKenzie, Andrew T; Katsyv, Igor; Song, Won-Min; Wang, Minghui; Zhang, Bin
2016-11-15
Dissecting the regulatory relationships between genes is a critical step towards building accurate predictive models of biological systems. A powerful approach towards this end is to systematically study the differences in correlation between gene pairs in more than one distinct condition. In this study we develop an R package, DGCA (for Differential Gene Correlation Analysis), which offers a suite of tools for computing and analyzing differential correlations between gene pairs across multiple conditions. To minimize parametric assumptions, DGCA computes empirical p-values via permutation testing. To understand differential correlations at a systems level, DGCA performs higher-order analyses such as measuring the average difference in correlation and multiscale clustering analysis of differential correlation networks. Through a simulation study, we show that the straightforward z-score based method that DGCA employs significantly outperforms the existing alternative methods for calculating differential correlation. Application of DGCA to the TCGA RNA-seq data in breast cancer not only identifies key changes in the regulatory relationships between TP53 and PTEN and their target genes in the presence of inactivating mutations, but also reveals an immune-related differential correlation module that is specific to triple negative breast cancer (TNBC). DGCA is an R package for systematically assessing the difference in gene-gene regulatory relationships under different conditions. This user-friendly, effective, and comprehensive software tool will greatly facilitate the application of differential correlation analysis in many biological studies and thus will help identification of novel signaling pathways, biomarkers, and targets in complex biological systems and diseases.
Gene targeting in embryonic stem cells, II: conditional technologies
USDA-ARS?s Scientific Manuscript database
Genome modification via transgenesis has allowed researchers to link genotype and phenotype as an alternative approach to the characterization of random mutations through evolution. The synergy of technologies from the fields of embryonic stem (ES) cells, gene knockouts, and protein-mediated recombi...
Identification of Reference Genes for Normalizing Quantitative Real-Time PCR in Urechis unicinctus
NASA Astrophysics Data System (ADS)
Bai, Yajiao; Zhou, Di; Wei, Maokai; Xie, Yueyang; Gao, Beibei; Qin, Zhenkui; Zhang, Zhifeng
2018-06-01
The reverse transcription quantitative real-time PCR (RT-qPCR) has become one of the most important techniques of studying gene expression. A set of valid reference genes are essential for the accurate normalization of data. In this study, five candidate genes were analyzed with geNorm, NormFinder, BestKeeper and ΔCt methods to identify the genes stably expressed in echiuran Urechis unicinctus, an important commercial marine benthic worm, under abiotic (sulfide stress) and normal (adult tissues, embryos and larvae at different development stages) conditions. The comprehensive results indicated that the expression of TBP was the most stable at sulfide stress and in developmental process, while the expression of EF- 1- α was the most stable at sulfide stress and in various tissues. TBP and EF- 1- α were recommended as a suitable reference gene combination to accurately normalize the expression of target genes at sulfide stress; and EF- 1- α, TBP and TUB were considered as a potential reference gene combination for normalizing the expression of target genes in different tissues. No suitable gene combination was obtained among these five candidate genes for normalizing the expression of target genes for developmental process of U. unicinctus. Our results provided a valuable support for quantifying gene expression using RT-qPCR in U. unicinctus.
Combining Cytotoxic and Immune-Mediated Gene Therapy to Treat Brain Tumors
Curtin, James F.; King, Gwendalyn D.; Candolfi, Marianela; Greeno, Remy B.; Kroeger, Kurt M.; Lowenstein, Pedro R.; Castro, Maria G.
2006-01-01
Glioblastoma (GBM) is a type of intracranial brain tumor, for which there is no cure. In spite of advances in surgery, chemotherapy and radiotherapy, patients die within a year of diagnosis. Therefore, there is a critical need to develop novel therapeutic approaches for this disease. Gene therapy, which is the use of genes or other nucleic acids as drugs, is a powerful new treatment strategy which can be developed to treat GBM. Several treatment modalities are amenable for gene therapy implementation, e.g. conditional cytotoxic approaches, targeted delivery of toxins into the tumor mass, immune stimulatory strategies, and these will all be the focus of this review. Both conditional cytotoxicity and targeted toxin mediated tumor death, are aimed at eliminating an established tumor mass and preventing further growth. Tumors employ several defensive strategies that suppress and inhibit anti-tumor immune responses. A better understanding of the mechanisms involved in eliciting anti-tumor immune responses has identified promising targets for immunotherapy. Immunotherapy is designed to aid the immune system to recognize and destroy tumor cells in order to eliminate the tumor burden. Also, immune-therapeutic strategies have the added advantage that an activated immune system has the capability of recognizing tumor cells at distant sites from the primary tumor, therefore targeting metastasis distant from the primary tumor locale. Pre-clinical models and clinical trials have demonstrated that in spite of their location within the central nervous system (CNS), a tissue described as ‘immune privileged’, brain tumors can be effectively targeted by the activated immune system following various immunotherapeutic strategies. This review will highlight recent advances in brain tumor immunotherapy, with particular emphasis on advances made using gene therapy strategies, as well as reviewing other novel therapies that can be used in combination with immunotherapy. Another important aspect of implementing gene therapy in the clinical arena is to be able to image the targeting of the therapeutics to the tumors, treatment effectiveness and progression of disease. We have therefore reviewed the most exciting non-invasive, in vivo imaging techniques which can be used in combination with gene therapy to monitor therapeutic efficacy over time. PMID:16248789
Khang, Chang Hyun; Park, Sook-Young; Lee, Yong-Hwan; Kang, Seogchan
2005-06-01
Rapid progress in fungal genome sequencing presents many new opportunities for functional genomic analysis of fungal biology through the systematic mutagenesis of the genes identified through sequencing. However, the lack of efficient tools for targeted gene replacement is a limiting factor for fungal functional genomics, as it often necessitates the screening of a large number of transformants to identify the desired mutant. We developed an efficient method of gene replacement and evaluated factors affecting the efficiency of this method using two plant pathogenic fungi, Magnaporthe grisea and Fusarium oxysporum. This method is based on Agrobacterium tumefaciens-mediated transformation with a mutant allele of the target gene flanked by the herpes simplex virus thymidine kinase (HSVtk) gene as a conditional negative selection marker against ectopic transformants. The HSVtk gene product converts 5-fluoro-2'-deoxyuridine to a compound toxic to diverse fungi. Because ectopic transformants express HSVtk, while gene replacement mutants lack HSVtk, growing transformants on a medium amended with 5-fluoro-2'-deoxyuridine facilitates the identification of targeted mutants by counter-selecting against ectopic transformants. In addition to M. grisea and F. oxysporum, the method and associated vectors are likely to be applicable to manipulating genes in a broad spectrum of fungi, thus potentially serving as an efficient, universal functional genomic tool for harnessing the growing body of fungal genome sequence data to study fungal biology.
RNA interference can be used to disrupt gene function in tardigrades
Tenlen, Jennifer R.; McCaskill, Shaina; Goldstein, Bob
2012-01-01
How morphological diversity arises is a key question in evolutionary developmental biology. As a long-term approach to address this question, we are developing the water bear Hypsibius dujardini (Phylum Tardigrada) as a model system. We expect that using a close relative of two well-studied models, Drosophila (Phylum Arthropoda) and Caenorhabditis elegans (Phylum Nematoda), will facilitate identifying genetic pathways relevant to understanding the evolution of development. Tardigrades are also valuable research subjects for investigating how organisms and biological materials can survive extreme conditions. Methods to disrupt gene activity are essential to each of these efforts, but no such method yet exists for the Phylum Tardigrada. We developed a protocol to disrupt tardigrade gene functions by double-stranded RNA-mediated RNA interference (RNAi). We show that targeting tardigrade homologs of essential developmental genes by RNAi produced embryonic lethality, whereas targeting green fluorescent protein did not. Disruption of gene functions appears to be relatively specific by two criteria: targeting distinct genes resulted in distinct phenotypes that were consistent with predicted gene functions, and by RT-PCR, RNAi reduced the level of a target mRNA and not a control mRNA. These studies represent the first evidence that gene functions can be disrupted by RNAi in the phylum Tardigrada. Our results form a platform for dissecting tardigrade gene functions for understanding the evolution of developmental mechanisms and survival in extreme environments. PMID:23187800
RNA interference can be used to disrupt gene function in tardigrades.
Tenlen, Jennifer R; McCaskill, Shaina; Goldstein, Bob
2013-05-01
How morphological diversity arises is a key question in evolutionary developmental biology. As a long-term approach to address this question, we are developing the water bear Hypsibius dujardini (Phylum Tardigrada) as a model system. We expect that using a close relative of two well-studied models, Drosophila (Phylum Arthropoda) and Caenorhabditis elegans (Phylum Nematoda), will facilitate identifying genetic pathways relevant to understanding the evolution of development. Tardigrades are also valuable research subjects for investigating how organisms and biological materials can survive extreme conditions. Methods to disrupt gene activity are essential to each of these efforts, but no such method yet exists for the Phylum Tardigrada. We developed a protocol to disrupt tardigrade gene functions by double-stranded RNA-mediated RNA interference (RNAi). We showed that targeting tardigrade homologs of essential developmental genes by RNAi produced embryonic lethality, whereas targeting green fluorescent protein did not. Disruption of gene functions appears to be relatively specific by two criteria: targeting distinct genes resulted in distinct phenotypes that were consistent with predicted gene functions and by RT-PCR, RNAi reduced the level of a target mRNA and not a control mRNA. These studies represent the first evidence that gene functions can be disrupted by RNAi in the phylum Tardigrada. Our results form a platform for dissecting tardigrade gene functions for understanding the evolution of developmental mechanisms and survival in extreme environments.
Scott, Andrew; Tien, Yuan-Ching; Drury, Craig F; Reynolds, W Daniel; Topp, Edward
2018-03-01
The impact of amendment with swine manure compost (SMC), yard waste compost (YWC), or food waste compost (FWC) on the abundance of antibiotic resistance genes in soil was evaluated. Following a commercial-scale application of the composts in a field experiment, soils were sampled periodically for a decade, and archived air-dried. Soil DNA was extracted and gene targets quantified by qPCR. Compared with untreated control soil, all 3 amendment types increased the abundance of gene targets for up to 4 years postapplication. The abundance of several gene targets was much higher in soil amended with SMC than in soil receiving either YWC or FWC. The gene target ermB remained higher in the SMC treatment for a decade postapplication. Clostridia were significantly more abundant in the SMC-amended soil throughout the decade following application. Eight percent of Clostridium spp. isolates from the SMC treatment carried ermB. Overall, addition of organic amendments to soils has the potential to increase the abundance of antibiotic resistance genes. Amendments of fecal origin, such as SMC, will in addition entrain bacteria carrying antibiotic resistance genes. Environmentally recalcitrant clostridia, and the antibiotic resistance genes that they carry, will persist for many years under field conditions following the application of SMC.
Prokaryotic cDNA Subtraction: A Method to Rapidly Identify Functional Gene Biomarkers
2008-10-01
perchlorate-reducing bacteria (PRB) must not only be present, but they must also synthesize the enzymes that catalyze perchlorate reduction. The...synthesis of specific enzymes , termed gene expression, is often regulated by each cell in response to environmental conditions (e.g., influent water...diverse. MBT that target functional genes (e.g., genes that encode biodegradation enzymes ), might prove more useful for determining the capabilities of
MTA family of coregulators in nuclear receptor biology and pathology
Manavathi, Bramanandam; Singh, Kamini; Kumar, Rakesh
2007-01-01
Nuclear receptors (NRs) rely on coregulators (coactivators and corepressors) to modulate the transcription of target genes. By interacting with nucleosome remodeling complexes, NR coactivators potentiate transcription, whereas corepressors inhibit transcription of the target genes. Metastasis-associated proteins (MTA) represent an emerging family of novel NR coregulators. In general, MTA family members form independent nucleosome remodeling and deacetylation (NuRD) complexes and repress the transcription of different genes by recruiting histone deacetylases onto their target genes. However, MTA1 also acts as a coactivator in a promoter-context dependent manner. Recent findings that repression of estrogen receptor transactivation functions by MTA1, MTA1s, and MTA2 and regulation of MTA3 by estrogen signaling have indicated the significance of these proteins in NR signaling. Here, we highlight the action of MTA proteins on NR signaling and their roles in pathophysiological conditions. PMID:18174918
Transcriptional Regulatory Network Analysis of MYB Transcription Factor Family Genes in Rice.
Smita, Shuchi; Katiyar, Amit; Chinnusamy, Viswanathan; Pandey, Dev M; Bansal, Kailash C
2015-01-01
MYB transcription factor (TF) is one of the largest TF families and regulates defense responses to various stresses, hormone signaling as well as many metabolic and developmental processes in plants. Understanding these regulatory hierarchies of gene expression networks in response to developmental and environmental cues is a major challenge due to the complex interactions between the genetic elements. Correlation analyses are useful to unravel co-regulated gene pairs governing biological process as well as identification of new candidate hub genes in response to these complex processes. High throughput expression profiling data are highly useful for construction of co-expression networks. In the present study, we utilized transcriptome data for comprehensive regulatory network studies of MYB TFs by "top-down" and "guide-gene" approaches. More than 50% of OsMYBs were strongly correlated under 50 experimental conditions with 51 hub genes via "top-down" approach. Further, clusters were identified using Markov Clustering (MCL). To maximize the clustering performance, parameter evaluation of the MCL inflation score (I) was performed in terms of enriched GO categories by measuring F-score. Comparison of co-expressed cluster and clads analyzed from phylogenetic analysis signifies their evolutionarily conserved co-regulatory role. We utilized compendium of known interaction and biological role with Gene Ontology enrichment analysis to hypothesize function of coexpressed OsMYBs. In the other part, the transcriptional regulatory network analysis by "guide-gene" approach revealed 40 putative targets of 26 OsMYB TF hubs with high correlation value utilizing 815 microarray data. The putative targets with MYB-binding cis-elements enrichment in their promoter region, functional co-occurrence as well as nuclear localization supports our finding. Specially, enrichment of MYB binding regions involved in drought-inducibility implying their regulatory role in drought response in rice. Thus, the co-regulatory network analysis facilitated the identification of complex OsMYB regulatory networks, and candidate target regulon genes of selected guide MYB genes. The results contribute to the candidate gene screening, and experimentally testable hypotheses for potential regulatory MYB TFs, and their targets under stress conditions.
Lee, Chai-Jin; Kang, Dongwon; Lee, Sangseon; Lee, Sunwon; Kang, Jaewoo; Kim, Sun
2018-05-25
Determining functions of a gene requires time consuming, expensive biological experiments. Scientists can speed up this experimental process if the literature information and biological networks can be adequately provided. In this paper, we present a web-based information system that can perform in silico experiments of computationally testing hypothesis on the function of a gene. A hypothesis that is specified in English by the user is converted to genes using a literature and knowledge mining system called BEST. Condition-specific TF, miRNA and PPI (protein-protein interaction) networks are automatically generated by projecting gene and miRNA expression data to template networks. Then, an in silico experiment is to test how well the target genes are connected from the knockout gene through the condition-specific networks. The test result visualizes path from the knockout gene to the target genes in the three networks. Statistical and information-theoretic scores are provided on the resulting web page to help scientists either accept or reject the hypothesis being tested. Our web-based system was extensively tested using three data sets, such as E2f1, Lrrk2, and Dicer1 knockout data sets. We were able to re-produce gene functions reported in the original research papers. In addition, we comprehensively tested with all disease names in MalaCards as hypothesis to show the effectiveness of our system. Our in silico experiment system can be very useful in suggesting biological mechanisms which can be further tested in vivo or in vitro. http://biohealth.snu.ac.kr/software/insilico/. Copyright © 2018 Elsevier Inc. All rights reserved.
Chow, Chi-Nga; Zheng, Han-Qin; Wu, Nai-Yun; Chien, Chia-Hung; Huang, Hsien-Da; Lee, Tzong-Yi; Chiang-Hsieh, Yi-Fan; Hou, Ping-Fu; Yang, Tien-Yi; Chang, Wen-Chi
2016-01-04
Transcription factors (TFs) are sequence-specific DNA-binding proteins acting as critical regulators of gene expression. The Plant Promoter Analysis Navigator (PlantPAN; http://PlantPAN2.itps.ncku.edu.tw) provides an informative resource for detecting transcription factor binding sites (TFBSs), corresponding TFs, and other important regulatory elements (CpG islands and tandem repeats) in a promoter or a set of plant promoters. Additionally, TFBSs, CpG islands, and tandem repeats in the conserve regions between similar gene promoters are also identified. The current PlantPAN release (version 2.0) contains 16 960 TFs and 1143 TF binding site matrices among 76 plant species. In addition to updating of the annotation information, adding experimentally verified TF matrices, and making improvements in the visualization of transcriptional regulatory networks, several new features and functions are incorporated. These features include: (i) comprehensive curation of TF information (response conditions, target genes, and sequence logos of binding motifs, etc.), (ii) co-expression profiles of TFs and their target genes under various conditions, (iii) protein-protein interactions among TFs and their co-factors, (iv) TF-target networks, and (v) downstream promoter elements. Furthermore, a dynamic transcriptional regulatory network under various conditions is provided in PlantPAN 2.0. The PlantPAN 2.0 is a systematic platform for plant promoter analysis and reconstructing transcriptional regulatory networks. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
The loss-of-allele assay for ES cell screening and mouse genotyping.
Frendewey, David; Chernomorsky, Rostislav; Esau, Lakeisha; Om, Jinsop; Xue, Yingzi; Murphy, Andrew J; Yancopoulos, George D; Valenzuela, David M
2010-01-01
Targeting vectors used to create directed mutations in mouse embryonic stem (ES) cells consist, in their simplest form, of a gene for drug selection flanked by mouse genomic sequences, the so-called homology arms that promote site-directed homologous recombination between the vector and the target gene. The VelociGene method for the creation of targeted mutations in ES cells employs targeting vectors, called BACVecs, that are based on bacterial artificial chromosomes. Compared with conventional short targeting vectors, BacVecs provide two major advantages: (1) their much larger homology arms promote high targeting efficiencies without the need for isogenicity or negative selection strategies; and (2) they enable deletions and insertions of up to 100kb in a single targeting event, making possible gene-ablating definitive null alleles and other large-scale genomic modifications. Because of their large arm sizes, however, BACVecs do not permit screening by conventional assays, such as long-range PCR or Southern blotting, that link the inserted targeting vector to the targeted locus. To exploit the advantages of BACVecs for gene targeting, we inverted the conventional screening logic in developing the loss-of-allele (LOA) assay, which quantifies the number of copies of the native locus to which the mutation was directed. In a correctly targeted ES cell clone, the LOA assay detects one of the two native alleles (for genes not on the X or Y chromosome), the other allele being disrupted by the targeted modification. We apply the same principle in reverse as a gain-of-allele assay to quantify the copy number of the inserted targeting vector. The LOA assay reveals a correctly targeted clone as having lost one copy of the native target gene and gained one copy of the drug resistance gene or other inserted marker. The combination of these quantitative assays makes LOA genotyping unequivocal and amenable to automated scoring. We use the quantitative polymerase chain reaction (qPCR) as our method of allele quantification, but any method that can reliably distinguish the difference between one and two copies of the target gene can be used to develop an LOA assay. We have designed qPCR LOA assays for deletions, insertions, point mutations, domain swaps, conditional, and humanized alleles and have used the insert assays to quantify the copy number of random insertion BAC transgenics. Because of its quantitative precision, specificity, and compatibility with high throughput robotic operations, the LOA assay eliminates bottlenecks in ES cell screening and mouse genotyping and facilitates maximal speed and throughput for knockout mouse production. Copyright (c) 2010 Elsevier Inc. All rights reserved.
Li, Hansheng; Lin, Yuling; Chen, Xiaohui; Bai, Yu; Wang, Congqiao; Xu, Xiaoping; Wang, Yun
2018-01-01
While flavonoid metabolism’s regulation under light conditions by structural genes and transcription factors is understood, the roles of microRNAs (miRNAs) in this pathway have been rarely reported. In this paper, the accurate control of light was firstly enabled through the specially designed plant growth chamber which ensures consistency and accuracy of the cultivation of longan ECs and the repeatability of the experiments. Then, longan ECs were cultured in this chamber for 25 days. The change of growth rate of longan ECs was compared under different light qualities (dark, blue, green, white, green), intensities (16, 32, 64, 128, 256 μmol ·m-2 ·s-1), and durations (8 h, 12 h, 16 h, 20h, 24h). Results indicated that longan ECs had a high growth rate in the condition of blue or green light, at intensity ranged from 16 μmol·m-2·s-1 to 64 μmol·m-2·s-1, and duration from 8 h to 16 h. In addition, the contents of total flavonoids, rutin, and epicatechin were determined. Results indicated that flavonoid contents of longan ECs reached the highest value under blue light, at 32 μmol·m-2·s-1 and 12h/d. Blue light promoted the accumulation of epicatechin, but inhibited the synthesis of rutin. Finally, the expressions of flavonoid pathway genes, miRNAs and target genes were analyzed by qPCR. These results indicated that miR393 and its target gene DlTIR1-3, miR394 and its target gene DlAlMT12, and miR395 and its target gene DlAPS1 had a negative regulating relationship under blue light in longan ECs. Furthermore, miR393, miR394, and miR395 acted on target genes, which negatively regulated flavonoid key genes DlFLS and positively regulated key genes DlCHS, DlCHI, DlF3′H, DlDFR, DlLAR, and finally affected the accumulation of flavonoids. The treatment of longan ECs under the blue light at the intensity of 32 μmol·m-2·s-1 for 12 h/d inhibited the expression of miR393, miR394 and miR395, which promoted the expression of target genes and the accumulation of flavonoids and epicatechin, but inhibited the synthesis of rutin. PMID:29381727
Li, Hansheng; Lin, Yuling; Chen, Xiaohui; Bai, Yu; Wang, Congqiao; Xu, Xiaoping; Wang, Yun; Lai, Zhongxiong
2018-01-01
While flavonoid metabolism's regulation under light conditions by structural genes and transcription factors is understood, the roles of microRNAs (miRNAs) in this pathway have been rarely reported. In this paper, the accurate control of light was firstly enabled through the specially designed plant growth chamber which ensures consistency and accuracy of the cultivation of longan ECs and the repeatability of the experiments. Then, longan ECs were cultured in this chamber for 25 days. The change of growth rate of longan ECs was compared under different light qualities (dark, blue, green, white, green), intensities (16, 32, 64, 128, 256 μmol ·m-2 ·s-1), and durations (8 h, 12 h, 16 h, 20h, 24h). Results indicated that longan ECs had a high growth rate in the condition of blue or green light, at intensity ranged from 16 μmol·m-2·s-1 to 64 μmol·m-2·s-1, and duration from 8 h to 16 h. In addition, the contents of total flavonoids, rutin, and epicatechin were determined. Results indicated that flavonoid contents of longan ECs reached the highest value under blue light, at 32 μmol·m-2·s-1 and 12h/d. Blue light promoted the accumulation of epicatechin, but inhibited the synthesis of rutin. Finally, the expressions of flavonoid pathway genes, miRNAs and target genes were analyzed by qPCR. These results indicated that miR393 and its target gene DlTIR1-3, miR394 and its target gene DlAlMT12, and miR395 and its target gene DlAPS1 had a negative regulating relationship under blue light in longan ECs. Furthermore, miR393, miR394, and miR395 acted on target genes, which negatively regulated flavonoid key genes DlFLS and positively regulated key genes DlCHS, DlCHI, DlF3'H, DlDFR, DlLAR, and finally affected the accumulation of flavonoids. The treatment of longan ECs under the blue light at the intensity of 32 μmol·m-2·s-1 for 12 h/d inhibited the expression of miR393, miR394 and miR395, which promoted the expression of target genes and the accumulation of flavonoids and epicatechin, but inhibited the synthesis of rutin.
Wang, Min; Wang, Qinglian; Zhang, Baohong
2013-11-01
Reference genes are critical for normalization of the gene expression level of target genes. The widely used housekeeping genes may change their expression levels at different tissue under different treatment or stress conditions. Therefore, systematical evaluation on the housekeeping genes is required for gene expression analysis. Up to date, no work was performed to evaluate the housekeeping genes in cotton under stress treatment. In this study, we chose 10 housekeeping genes to systematically assess their expression levels at two different tissues (leaves and roots) under two different abiotic stresses (salt and drought) with three different concentrations. Our results show that there is no best reference gene for all tissues at all stress conditions. The reliable reference gene should be selected based on a specific condition. For example, under salt stress, UBQ7, GAPDH and EF1A8 are better reference genes in leaves; TUA10, UBQ7, CYP1, GAPDH and EF1A8 were better in roots. Under drought stress, UBQ7, EF1A8, TUA10, and GAPDH showed less variety of expression level in leaves and roots. Thus, it is better to identify reliable reference genes first before performing any gene expression analysis. However, using a combination of housekeeping genes as reference gene may provide a new strategy for normalization of gene expression. In this study, we found that combination of four housekeeping genes worked well as reference genes under all the stress conditions. © 2013.
Melnikova, Nataliya V.; Dmitriev, Alexey A.; Belenikin, Maxim S.; Koroban, Nadezhda V.; Speranskaya, Anna S.; Krinitsina, Anastasia A.; Krasnov, George S.; Lakunina, Valentina A.; Snezhkina, Anastasiya V.; Sadritdinova, Asiya F.; Kishlyan, Natalya V.; Rozhmina, Tatiana A.; Klimina, Kseniya M.; Amosova, Alexandra V.; Zelenin, Alexander V.; Muravenko, Olga V.; Bolsheva, Nadezhda L.; Kudryavtseva, Anna V.
2016-01-01
Cultivated flax (Linum usitatissimum L.) is an important plant valuable for industry. Some flax lines can undergo heritable phenotypic and genotypic changes (LIS-1 insertion being the most common) in response to nutrient stress and are called plastic lines. Offspring of plastic lines, which stably inherit the changes, are called genotrophs. MicroRNAs (miRNAs) are involved in a crucial regulatory mechanism of gene expression. They have previously been assumed to take part in nutrient stress response and can, therefore, participate in genotroph formation. In the present study, we performed high-throughput sequencing of small RNAs (sRNAs) extracted from flax plants grown under normal, phosphate deficient and nutrient excess conditions to identify miRNAs and evaluate their expression. Our analysis revealed expression of 96 conserved miRNAs from 21 families in flax. Moreover, 475 novel potential miRNAs were identified for the first time, and their targets were predicted. However, none of the identified miRNAs were transcribed from LIS-1. Expression of seven miRNAs (miR168, miR169, miR395, miR398, miR399, miR408, and lus-miR-N1) with up- or down-regulation under nutrient stress (on the basis of high-throughput sequencing data) was evaluated on extended sampling using qPCR. Reference gene search identified ETIF3H and ETIF3E genes as most suitable for this purpose. Down-regulation of novel potential lus-miR-N1 and up-regulation of conserved miR399 were revealed under the phosphate deficient conditions. In addition, the negative correlation of expression of lus-miR-N1 and its predicted target, ubiquitin-activating enzyme E1 gene, as well as, miR399 and its predicted target, ubiquitin-conjugating enzyme E2 gene, was observed. Thus, in our study, miRNAs expressed in flax plastic lines and genotrophs were identified and their expression and expression of their targets was evaluated using high-throughput sequencing and qPCR for the first time. These data provide new insights into nutrient stress response regulation in plastic flax cultivars. PMID:27092149
Fu, Wei; Xie, Wen; Zhang, Zhuo; Wang, Shaoli; Wu, Qingjun; Liu, Yong; Zhou, Xiaomao; Zhou, Xuguo; Zhang, Youjun
2013-01-01
Abstract: Quantitative real-time PCR (qRT-PCR), a primary tool in gene expression analysis, requires an appropriate normalization strategy to control for variation among samples. The best option is to compare the mRNA level of a target gene with that of reference gene(s) whose expression level is stable across various experimental conditions. In this study, expression profiles of eight candidate reference genes from the diamondback moth, Plutella xylostella, were evaluated under diverse experimental conditions. RefFinder, a web-based analysis tool, integrates four major computational programs including geNorm, Normfinder, BestKeeper, and the comparative ΔCt method to comprehensively rank the tested candidate genes. Elongation factor 1 (EF1) was the most suited reference gene for the biotic factors (development stage, tissue, and strain). In contrast, although appropriate reference gene(s) do exist for several abiotic factors (temperature, photoperiod, insecticide, and mechanical injury), we were not able to identify a single universal reference gene. Nevertheless, a suite of candidate reference genes were specifically recommended for selected experimental conditions. Our finding is the first step toward establishing a standardized qRT-PCR analysis of this agriculturally important insect pest. PMID:23983612
ERIC Educational Resources Information Center
Pletcher, Mathew T.; Wiltshire, Tim; Tarantino, Lisa M.; Mayford, Mark; Reijmers, Leon G.; Coats, Jennifer K.
2006-01-01
Targeted mutagenesis in mice has shown that genes from a wide variety of gene families are involved in memory formation. The efficient identification of genes involved in learning and memory could be achieved by random mutagenesis combined with high-throughput phenotyping. Here, we provide the first report of a mutagenesis screen that has…
Identification of novel Cyclooxygenase-2-dependent genes in Helicobacter pylori infection in vivo
Walduck, Anna K; Weber, Matthias; Wunder, Christian; Juettner, Stefan; Stolte, Manfred; Vieth, Michael; Wiedenmann, Bertram; Meyer, Thomas F; Naumann, Michael; Hoecker, Michael
2009-01-01
Background Helicobacter pylori is a crucial determining factor in the pathogenesis of benign and neoplastic gastric diseases. Cyclooxygenase-2 (Cox-2) is the inducible key enzyme of arachidonic acid metabolism and is a central mediator in inflammation and cancer. Expression of the Cox-2 gene is up-regulated in the gastric mucosa during H. pylori infection but the pathobiological consequences of this enhanced Cox-2 expression are not yet characterized. The aim of this study was to identify novel genes down-stream of Cox-2 in an in vivo model, thereby identifying potential targets for the study of the role of Cox- 2 in H. pylori pathogenesis and the initiation of pre- cancerous changes. Results Gene expression profiles in the gastric mucosa of mice treated with a specific Cox-2 inhibitor (NS398) or vehicle were analysed at different time points (6, 13 and 19 wk) after H. pylori infection. H. pylori infection affected the expression of 385 genes over the experimental period, including regulators of gastric physiology, proliferation, apoptosis and mucosal defence. Under conditions of Cox-2 inhibition, 160 target genes were regulated as a result of H. pylori infection. The Cox-2 dependent subset included those influencing gastric physiology (Gastrin, Galr1), epithelial barrier function (Tjp1, connexin45, Aqp5), inflammation (Icam1), apoptosis (Clu) and proliferation (Gdf3, Igf2). Treatment with NS398 alone caused differential expression of 140 genes, 97 of which were unique, indicating that these genes are regulated under conditions of basal Cox-2 expression. Conclusion This study has identified a panel of novel Cox-2 dependent genes influenced under both normal and the inflammatory conditions induced by H. pylori infection. These data provide important new links between Cox-2 and inflammatory processes, epithelial repair and integrity. PMID:19317916
Gene therapy for inherited retinal degenerations: initial successes and future challenges
NASA Astrophysics Data System (ADS)
Gupta, Priya R.; Huckfeldt, Rachel M.
2017-10-01
Inherited retinal degenerations are a clinically and genetically heterogeneous group of conditions that have historically shared an untreatable course. In recent years, however, a wide range of therapeutic strategies have demonstrated efficacy in preclinical studies and entered clinical trials with a common goal of improving visual function for patients affected with these conditions. Gene therapy offers a particularly elegant and precise opportunity to target the causative genetic mutations underlying these monogenic diseases. The present review will provide an overview of gene therapy with particular emphasis on key clinical results to date and challenges for the future.
Wyler, Steven C; Spencer, W Clay; Green, Noah H; Rood, Benjamin D; Crawford, LaTasha; Craige, Caryne; Gresch, Paul; McMahon, Douglas G; Beck, Sheryl G; Deneris, Evan
2016-02-03
Newborn neurons enter an extended maturation stage, during which they acquire excitability characteristics crucial for development of presynaptic and postsynaptic connectivity. In contrast to earlier specification programs, little is known about the regulatory mechanisms that control neuronal maturation. The Pet-1 ETS (E26 transformation-specific) factor is continuously expressed in serotonin (5-HT) neurons and initially acts in postmitotic precursors to control acquisition of 5-HT transmitter identity. Using a combination of RNA sequencing, electrophysiology, and conditional targeting approaches, we determined gene expression patterns in maturing flow-sorted 5-HT neurons and the temporal requirements for Pet-1 in shaping these patterns for functional maturation of mouse 5-HT neurons. We report a profound disruption of postmitotic expression trajectories in Pet-1(-/-) neurons, which prevented postnatal maturation of 5-HT neuron passive and active intrinsic membrane properties, G-protein signaling, and synaptic responses to glutamatergic, lysophosphatidic, and adrenergic agonists. Unexpectedly, conditional targeting revealed a postnatal stage-specific switch in Pet-1 targets from 5-HT synthesis genes to transmitter receptor genes required for afferent modulation of 5-HT neuron excitability. Five-HT1a autoreceptor expression depended transiently on Pet-1, thus revealing an early postnatal sensitive period for control of 5-HT excitability genes. Chromatin immunoprecipitation followed by sequencing revealed that Pet-1 regulates 5-HT neuron maturation through direct gene activation and repression. Moreover, Pet-1 directly regulates the 5-HT neuron maturation factor Engrailed 1, which suggests Pet-1 orchestrates maturation through secondary postmitotic regulatory factors. The early postnatal switch in Pet-1 targets uncovers a distinct neonatal stage-specific function for Pet-1, during which it promotes maturation of 5-HT neuron excitability. The regulatory mechanisms that control functional maturation of neurons are poorly understood. We show that in addition to inducing brain serotonin (5-HT) synthesis and reuptake, the Pet-1 ETS (E26 transformation-specific) factor subsequently globally coordinates postmitotic expression trajectories of genes necessary for maturation of 5-HT neuron excitability. Further, Pet-1 switches its transcriptional targets as 5-HT neurons mature from 5-HT synthesis genes to G-protein-coupled receptors, which are necessary for afferent synaptic modulation of 5-HT neuron excitability. Our findings uncover gene-specific switching of downstream targets as a previously unrecognized regulatory strategy through which continuously expressed transcription factors control acquisition of neuronal identity at different stages of development. Copyright © 2016 the authors 0270-6474/16/361758-17$15.00/0.
Versatile control of Plasmodium falciparum gene expression with an inducible protein-RNA interaction
Goldfless, Stephen J.; Wagner, Jeffrey C.; Niles, Jacquin C.
2014-01-01
The available tools for conditional gene expression in Plasmodium falciparum are limited. Here, to enable reliable control of target gene expression, we build a system to efficiently modulate translation. We overcame several problems associated with other approaches for regulating gene expression in P. falciparum. Specifically, our system functions predictably across several native and engineered promoter contexts, and affords control over reporter and native parasite proteins irrespective of their subcellular compartmentalization. Induction and repression of gene expression are rapid, homogeneous, and stable over prolonged periods. To demonstrate practical application of our system, we used it to reveal direct links between antimalarial drugs and their native parasite molecular target. This is an important out come given the rapid spread of resistance, and intensified efforts to efficiently discover and optimize new antimalarial drugs. Overall, the studies presented highlight the utility of our system for broadly controlling gene expression and performing functional genetics in P. falciparum. PMID:25370483
Reetz, Julia; Herchenröder, Ottmar; Pützer, Brigitte M.
2014-01-01
Due to the fundamental progress in elucidating the molecular mechanisms of human diseases and the arrival of the post-genomic era, increasing numbers of therapeutic genes and cellular targets are available for gene therapy. Meanwhile, the most important challenge is to develop gene delivery vectors with high efficiency through target cell selectivity, in particular under in situ conditions. The most widely used vector system to transduce cells is based on adenovirus (Ad). Recent endeavors in the development of selective Ad vectors that target cells or tissues of interest and spare the alteration of all others have focused on the modification of the virus broad natural tropism. A popular way of Ad targeting is achieved by directing the vector towards distinct cellular receptors. Redirecting can be accomplished by linking custom-made peptides with specific affinity to cellular surface proteins via genetic integration, chemical coupling or bridging with dual-specific adapter molecules. Ideally, targeted vectors are incapable of entering cells via their native receptors. Such altered vectors offer new opportunities to delineate functional genomics in a natural environment and may enable efficient systemic therapeutic approaches. This review provides a summary of current state-of-the-art techniques to specifically target adenovirus-based gene delivery vectors. PMID:24699364
Gene expression inference with deep learning.
Chen, Yifei; Li, Yi; Narayan, Rajiv; Subramanian, Aravind; Xie, Xiaohui
2016-06-15
Large-scale gene expression profiling has been widely used to characterize cellular states in response to various disease conditions, genetic perturbations, etc. Although the cost of whole-genome expression profiles has been dropping steadily, generating a compendium of expression profiling over thousands of samples is still very expensive. Recognizing that gene expressions are often highly correlated, researchers from the NIH LINCS program have developed a cost-effective strategy of profiling only ∼1000 carefully selected landmark genes and relying on computational methods to infer the expression of remaining target genes. However, the computational approach adopted by the LINCS program is currently based on linear regression (LR), limiting its accuracy since it does not capture complex nonlinear relationship between expressions of genes. We present a deep learning method (abbreviated as D-GEX) to infer the expression of target genes from the expression of landmark genes. We used the microarray-based Gene Expression Omnibus dataset, consisting of 111K expression profiles, to train our model and compare its performance to those from other methods. In terms of mean absolute error averaged across all genes, deep learning significantly outperforms LR with 15.33% relative improvement. A gene-wise comparative analysis shows that deep learning achieves lower error than LR in 99.97% of the target genes. We also tested the performance of our learned model on an independent RNA-Seq-based GTEx dataset, which consists of 2921 expression profiles. Deep learning still outperforms LR with 6.57% relative improvement, and achieves lower error in 81.31% of the target genes. D-GEX is available at https://github.com/uci-cbcl/D-GEX CONTACT: xhx@ics.uci.edu Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Gene expression inference with deep learning
Chen, Yifei; Li, Yi; Narayan, Rajiv; Subramanian, Aravind; Xie, Xiaohui
2016-01-01
Motivation: Large-scale gene expression profiling has been widely used to characterize cellular states in response to various disease conditions, genetic perturbations, etc. Although the cost of whole-genome expression profiles has been dropping steadily, generating a compendium of expression profiling over thousands of samples is still very expensive. Recognizing that gene expressions are often highly correlated, researchers from the NIH LINCS program have developed a cost-effective strategy of profiling only ∼1000 carefully selected landmark genes and relying on computational methods to infer the expression of remaining target genes. However, the computational approach adopted by the LINCS program is currently based on linear regression (LR), limiting its accuracy since it does not capture complex nonlinear relationship between expressions of genes. Results: We present a deep learning method (abbreviated as D-GEX) to infer the expression of target genes from the expression of landmark genes. We used the microarray-based Gene Expression Omnibus dataset, consisting of 111K expression profiles, to train our model and compare its performance to those from other methods. In terms of mean absolute error averaged across all genes, deep learning significantly outperforms LR with 15.33% relative improvement. A gene-wise comparative analysis shows that deep learning achieves lower error than LR in 99.97% of the target genes. We also tested the performance of our learned model on an independent RNA-Seq-based GTEx dataset, which consists of 2921 expression profiles. Deep learning still outperforms LR with 6.57% relative improvement, and achieves lower error in 81.31% of the target genes. Availability and implementation: D-GEX is available at https://github.com/uci-cbcl/D-GEX. Contact: xhx@ics.uci.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:26873929
USDA-ARS?s Scientific Manuscript database
In recent years, the scientific literature has become replete with examples of the improvement of abiotic stress tolerance by overexpression of specific genes. Few studies, however, have evaluated transgenic plants under field conditions or the impact of overexpression on non-target traits. We pre...
Westermann, Frank; Muth, Daniel; Benner, Axel; Bauer, Tobias; Henrich, Kai-Oliver; Oberthuer, André; Brors, Benedikt; Beissbarth, Tim; Vandesompele, Jo; Pattyn, Filip; Hero, Barbara; König, Rainer; Fischer, Matthias; Schwab, Manfred
2008-01-01
Background Amplified MYCN oncogene resulting in deregulated MYCN transcriptional activity is observed in 20% of neuroblastomas and identifies a highly aggressive subtype. In MYCN single-copy neuroblastomas, elevated MYCN mRNA and protein levels are paradoxically associated with a more favorable clinical phenotype, including disseminated tumors that subsequently regress spontaneously (stage 4s-non-amplified). In this study, we asked whether distinct transcriptional MYCN or c-MYC activities are associated with specific neuroblastoma phenotypes. Results We defined a core set of direct MYCN/c-MYC target genes by applying gene expression profiling and chromatin immunoprecipitation (ChIP, ChIP-chip) in neuroblastoma cells that allow conditional regulation of MYCN and c-MYC. Their transcript levels were analyzed in 251 primary neuroblastomas. Compared to localized-non-amplified neuroblastomas, MYCN/c-MYC target gene expression gradually increases from stage 4s-non-amplified through stage 4-non-amplified to MYCN amplified tumors. This was associated with MYCN activation in stage 4s-non-amplified and predominantly c-MYC activation in stage 4-non-amplified tumors. A defined set of MYCN/c-MYC target genes was induced in stage 4-non-amplified but not in stage 4s-non-amplified neuroblastomas. In line with this, high expression of a subset of MYCN/c-MYC target genes identifies a patient subtype with poor overall survival independent of the established risk markers amplified MYCN, disease stage, and age at diagnosis. Conclusions High MYCN/c-MYC target gene expression is a hallmark of malignant neuroblastoma progression, which is predominantly driven by c-MYC in stage 4-non-amplified tumors. In contrast, moderate MYCN function gain in stage 4s-non-amplified tumors induces only a restricted set of target genes that is still compatible with spontaneous regression. PMID:18851746
Bishop, Kathleen A; Harrington, Anne; Kouranova, Evguenia; Weinstein, Edward J; Rosen, Clifford J; Cui, Xiaoxia; Liaw, Lucy
2016-07-07
Targeted gene mutation in the mouse is a primary strategy to understand gene function and relation to phenotype. The Knockout Mouse Project (KOMP) had an initial goal to develop a public resource of mouse embryonic stem (ES) cell clones that carry null mutations in all genes. Indeed, many useful novel mouse models have been generated from publically accessible targeted mouse ES cell lines. However, there are limitations, including incorrect targeting or cassette structure, and difficulties with germline transmission of the allele from chimeric mice. In our experience, using a small sample of targeted ES cell clones, we were successful ∼50% of the time in generating germline transmission of a correctly targeted allele. With the advent of CRISPR/Cas9 as a mouse genome modification tool, we assessed the efficiency of creating a conditional targeted allele in one gene, dedicator of cytokinesis 7 (Dock7), for which we were unsuccessful in generating a null allele using a KOMP targeted ES cell clone. The strategy was to insert loxP sites to flank either exons 3 and 4, or exons 3 through 7. By coinjecting Cas9 mRNA, validated sgRNAs, and oligonucleotide donors into fertilized eggs from C57BL/6J mice, we obtained a variety of alleles, including mice homozygous for the null alleles mediated by nonhomologous end joining, alleles with one of the two desired loxP sites, and correctly targeted alleles with both loxP sites. We also found frequent mutations in the inserted loxP sequence, which is partly attributable to the heterogeneity in the original oligonucleotide preparation. Copyright © 2016 Bishop et al.
Translational Advances of Hydrofection by Hydrodynamic Injection
Herrero, María José; Aliño, Salvador F.
2018-01-01
Hydrodynamic gene delivery has proven to be a safe and efficient procedure for gene transfer, able to mediate, in murine model, therapeutic levels of proteins encoded by the transfected gene. In different disease models and targeting distinct organs, it has been demonstrated to revert the pathologic symptoms and signs. The therapeutic potential of hydrofection led different groups to work on the clinical translation of the procedure. In order to prevent the hemodynamic side effects derived from the rapid injection of a large volume, the conditions had to be moderated to make them compatible with its use in mid-size animal models such as rat, hamster and rabbit and large animals as dog, pig and primates. Despite the different approaches performed to adapt the conditions of gene delivery, the results obtained in any of these mid-size and large animals have been poorer than those obtained in murine model. Among these different strategies to reduce the volume employed, the most effective one has been to exclude the vasculature of the target organ and inject the solution directly. This procedure has permitted, by catheterization and surgical procedures in large animals, achieving protein expression levels in tissue close to those achieved in gold standard models. These promising results and the possibility of employing these strategies to transfer gene constructs able to edit genes, such as CRISPR, have renewed the clinical interest of this procedure of gene transfer. In order to translate the hydrodynamic gene delivery to human use, it is demanding the standardization of the procedure conditions and the molecular parameters of evaluation in order to be able to compare the results and establish a homogeneous manner of expressing the data obtained, as ‘classic’ drugs. PMID:29494564
Felicidade, Ingrid; Marcarini, Juliana Cristina; Carreira, Clísia Mara; Amarante, Marla Karine; Afman, Lydia A; Mantovani, Mário Sérgio; Ribeiro, Lúcia Regina
2015-01-01
The prevalence of obesity has risen dramatically and the World Health Organization estimates that 700 million people will be obese worldwide by 2015. Approximately, 50% of the Brazilian population above 20 years of age is overweight, and 16% is obese. This study aimed to evaluate the differences in the expression of PPARα target genes in human peripheral blood mononuclear cells (PBMCs) and free fatty acids (FFA) in obese and non-obese individuals after 24 h of fasting. We first presented evidence that Brazilian people exhibit expression changes in PPARα target genes in PBMCs under fasting conditions. Q-PCR was utilized to assess the mRNA expression levels of target genes. In both groups, the FFA concentrations increased significantly after 24 h of fasting. The basal FFA mean concentration was two-fold higher in the obese group compared with the non-obese group. After fasting, all genes evaluated in this study showed increased expression levels compared with basal expression in both groups. However, our results reveal no differences in gene expression between the obese and non-obese, more studies are necessary to precisely delineate the associated mechanisms, particularly those that include groups with different degrees of obesity and patients with diabetes mellitus type 2 because the expression of the main genes that are involved in β-oxidation and glucose level maintenance are affected by these factors. © 2014 S. Karger AG, Basel.
Harnik, Branko; Miron, Richard J; Buser, Daniel; Gruber, Reinhard
2017-03-01
Angiogenesis is essential for the consolidation of bone allografts. The underlying molecular mechanism, however, remains unclear. Soluble factors released from demineralized freeze-dried bone target mesenchymal cells; however, their effect on endothelial cells has not been investigated so far. The aim of the present study was therefore to examine the effect of conditioned medium from demineralized freeze-dried bone on human umbilical endothelial cells in vitro. Conditioned medium was first prepared from demineralized freeze-dried bone following 24 hours incubation at room temperature to produce demineralized bone conditioned media. Thereafter, conditioned medium was used to stimulate human umbilical vein endothelial cells in vitro by determining the cell response based on viability, proliferation, expression of apoptotic genes, a Boyden chamber to determine cell migration, and the formation of branches. The authors report here that conditioned medium decreased viability and proliferation of endothelial cells. Neither of the apoptotic marker genes was significantly altered when endothelial cells were exposed to conditioned medium. The Boyden chamber revealed that endothelial cells migrate toward conditioned medium. Moreover, conditioned medium moderately stimulated the formation of branches. These findings support the concept that conditioned medium from demineralized freeze-dried bone targets endothelial cells by decreasing their proliferation and enhancing their motility under these in vitro conditions.
Agronomic performance of Populus deltoides trees engineered for biofuel production
Macaya-Sanz, David; Chen, Jin?Gui; Kalluri, Udaya C.; ...
2017-11-30
Background: One of the major barriers to the development of lignocellulosic feedstocks is the recalcitrance of plant cell walls to deconstruction and saccharification. Recalcitrance can be reduced by targeting genes involved in cell wall biosynthesis, but this can have unintended consequences that compromise the agronomic performance of the trees under field conditions. Here we report the results of a field trial of fourteen distinct transgenic Populus deltoides lines that had previously demonstrated reduced recalcitrance without yield penalties under greenhouse conditions.Results: Survival and productivity of the trial were excellent in the first year, and there was little evidence for reduced performancemore » of the transgenic lines with modified target gene expression. Surprisingly, the most striking phenotypic effects in this trial were for two empty-vector control lines that had modified bud set and bud flush. This is most likely due to somaclonal variation or insertional mutagenesis. Traits related to yield, crown architecture, herbivory, pathogen response, and frost damage showed few significant differences between target gene transgenics and empty vector controls. However, there were a few interesting exceptions. Lines overexpressing the DUF231 gene, a putative O-acetyltransferase, showed early bud flush and marginally increased height growth. Lines overexpressing the DUF266 gene, a putative glycosyltransferase, had significantly decreased stem internode length and slightly higher volume index. Finally, lines overexpressing the PFD2 gene, a putative member of the prefoldin complex, had a slightly reduced volume index.Conclusions: This field trial demonstrates that these cell wall modifications, which decreased cell wall recalcitrance under laboratory conditions, did not seriously compromise first-year performance in the field, despite substantial challenges, including an outbreak of a stem boring insect (Gypsonoma haimbachiana), attack by a leaf rust pathogen (Melampsora spp.), and a late frost event. This bodes well for the potential utility of these lines as advanced biofuels feedstocks.« less
Agronomic performance of Populus deltoides trees engineered for biofuel production
DOE Office of Scientific and Technical Information (OSTI.GOV)
Macaya-Sanz, David; Chen, Jin?Gui; Kalluri, Udaya C.
Background: One of the major barriers to the development of lignocellulosic feedstocks is the recalcitrance of plant cell walls to deconstruction and saccharification. Recalcitrance can be reduced by targeting genes involved in cell wall biosynthesis, but this can have unintended consequences that compromise the agronomic performance of the trees under field conditions. Here we report the results of a field trial of fourteen distinct transgenic Populus deltoides lines that had previously demonstrated reduced recalcitrance without yield penalties under greenhouse conditions.Results: Survival and productivity of the trial were excellent in the first year, and there was little evidence for reduced performancemore » of the transgenic lines with modified target gene expression. Surprisingly, the most striking phenotypic effects in this trial were for two empty-vector control lines that had modified bud set and bud flush. This is most likely due to somaclonal variation or insertional mutagenesis. Traits related to yield, crown architecture, herbivory, pathogen response, and frost damage showed few significant differences between target gene transgenics and empty vector controls. However, there were a few interesting exceptions. Lines overexpressing the DUF231 gene, a putative O-acetyltransferase, showed early bud flush and marginally increased height growth. Lines overexpressing the DUF266 gene, a putative glycosyltransferase, had significantly decreased stem internode length and slightly higher volume index. Finally, lines overexpressing the PFD2 gene, a putative member of the prefoldin complex, had a slightly reduced volume index.Conclusions: This field trial demonstrates that these cell wall modifications, which decreased cell wall recalcitrance under laboratory conditions, did not seriously compromise first-year performance in the field, despite substantial challenges, including an outbreak of a stem boring insect (Gypsonoma haimbachiana), attack by a leaf rust pathogen (Melampsora spp.), and a late frost event. This bodes well for the potential utility of these lines as advanced biofuels feedstocks.« less
Genome-wide screen identifies a novel prognostic signature for breast cancer survival
Mao, Xuan Y.; Lee, Matthew J.; Zhu, Jeffrey; ...
2017-01-21
Large genomic datasets in combination with clinical data can be used as an unbiased tool to identify genes important in patient survival and discover potential therapeutic targets. We used a genome-wide screen to identify 587 genes significantly and robustly deregulated across four independent breast cancer (BC) datasets compared to normal breast tissue. Gene expression of 381 genes was significantly associated with relapse-free survival (RFS) in BC patients. We used a gene co-expression network approach to visualize the genetic architecture in normal breast and BCs. In normal breast tissue, co-expression cliques were identified enriched for cell cycle, gene transcription, cell adhesion,more » cytoskeletal organization and metabolism. In contrast, in BC, only two major co-expression cliques were identified enriched for cell cycle-related processes or blood vessel development, cell adhesion and mammary gland development processes. Interestingly, gene expression levels of 7 genes were found to be negatively correlated with many cell cycle related genes, highlighting these genes as potential tumor suppressors and novel therapeutic targets. A forward-conditional Cox regression analysis was used to identify a 12-gene signature associated with RFS. A prognostic scoring system was created based on the 12-gene signature. This scoring system robustly predicted BC patient RFS in 60 sampling test sets and was further validated in TCGA and METABRIC BC data. Our integrated study identified a 12-gene prognostic signature that could guide adjuvant therapy for BC patients and includes novel potential molecular targets for therapy.« less
Genome-wide screen identifies a novel prognostic signature for breast cancer survival
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mao, Xuan Y.; Lee, Matthew J.; Zhu, Jeffrey
Large genomic datasets in combination with clinical data can be used as an unbiased tool to identify genes important in patient survival and discover potential therapeutic targets. We used a genome-wide screen to identify 587 genes significantly and robustly deregulated across four independent breast cancer (BC) datasets compared to normal breast tissue. Gene expression of 381 genes was significantly associated with relapse-free survival (RFS) in BC patients. We used a gene co-expression network approach to visualize the genetic architecture in normal breast and BCs. In normal breast tissue, co-expression cliques were identified enriched for cell cycle, gene transcription, cell adhesion,more » cytoskeletal organization and metabolism. In contrast, in BC, only two major co-expression cliques were identified enriched for cell cycle-related processes or blood vessel development, cell adhesion and mammary gland development processes. Interestingly, gene expression levels of 7 genes were found to be negatively correlated with many cell cycle related genes, highlighting these genes as potential tumor suppressors and novel therapeutic targets. A forward-conditional Cox regression analysis was used to identify a 12-gene signature associated with RFS. A prognostic scoring system was created based on the 12-gene signature. This scoring system robustly predicted BC patient RFS in 60 sampling test sets and was further validated in TCGA and METABRIC BC data. Our integrated study identified a 12-gene prognostic signature that could guide adjuvant therapy for BC patients and includes novel potential molecular targets for therapy.« less
Soheili, Sara; Ghafourian, Sobhan; Sekawi, Zamberi; Neela, Vasantha Kumari; Sadeghifard, Nourkhoda; Taherikalani, Morovat; Khosravi, Afra; Ramli, Ramliza; Hamat, Rukman Awang
2015-01-01
The toxin-antitoxin (TA) system is a regulatory system where two sets of genes encode the toxin and its corresponding antitoxin. In this study, the prevalence of TA systems in independently isolated clinical isolates of Enterococcus faecium and Enterococcus faecalis was determined, the dominant TA system was identified, different virulence genes in E. faecium and E. faecalis were surveyed, the level of expression of the virulence and TA genes in normal and stress conditions was determined, and finally their associations with the TA genes were defined. Remarkably, the analysis demonstrated higBA and mazEF in all clinical isolates, and their locations were on chromosomes and plasmids, respectively. On the other hand, a quantitative analysis of TA and virulence genes revealed that the expression level in both genes is different under normal and stress conditions. The results obtained by anti-mazF peptide nucleic acids demonstrated that the expression level of virulence genes had decreased. These findings demonstrate an association between TA systems and virulence factors. The mazEF on the plasmids and the higBA TA genes on the chromosomes of all E. faecium and E. faecalis strains were dominant. Additionally, there was a decrease in the expression of virulence genes in the presence of anti-mazF peptide nucleic acids. Therefore, it is suggested that mazEF TA systems are potent and sensitive targets in all E. faecium and E. faecalis strains.
Soheili, Sara; Ghafourian, Sobhan; Sekawi, Zamberi; Neela, Vasantha Kumari; Sadeghifard, Nourkhoda; Taherikalani, Morovat; Khosravi, Afra; Ramli, Ramliza; Hamat, Rukman Awang
2015-01-01
The toxin–antitoxin (TA) system is a regulatory system where two sets of genes encode the toxin and its corresponding antitoxin. In this study, the prevalence of TA systems in independently isolated clinical isolates of Enterococcus faecium and Enterococcus faecalis was determined, the dominant TA system was identified, different virulence genes in E. faecium and E. faecalis were surveyed, the level of expression of the virulence and TA genes in normal and stress conditions was determined, and finally their associations with the TA genes were defined. Remarkably, the analysis demonstrated higBA and mazEF in all clinical isolates, and their locations were on chromosomes and plasmids, respectively. On the other hand, a quantitative analysis of TA and virulence genes revealed that the expression level in both genes is different under normal and stress conditions. The results obtained by anti-mazF peptide nucleic acids demonstrated that the expression level of virulence genes had decreased. These findings demonstrate an association between TA systems and virulence factors. The mazEF on the plasmids and the higBA TA genes on the chromosomes of all E. faecium and E. faecalis strains were dominant. Additionally, there was a decrease in the expression of virulence genes in the presence of anti-mazF peptide nucleic acids. Therefore, it is suggested that mazEF TA systems are potent and sensitive targets in all E. faecium and E. faecalis strains. PMID:26005332
USDA-ARS?s Scientific Manuscript database
Diseases and pests of soybean often reduce soybean yields. Targeted breeding that incorporates known genes for resistance and non-targeted breeding that eliminates susceptible plants in breeding populations reduces the impact of soybean pathogens and pests. Maturity group III soybean cultivars relea...
Farasat, Iman; Salis, Howard M.
2016-01-01
The ability to precisely modify genomes and regulate specific genes will greatly accelerate several medical and engineering applications. The CRISPR/Cas9 (Type II) system binds and cuts DNA using guide RNAs, though the variables that control its on-target and off-target activity remain poorly characterized. Here, we develop and parameterize a system-wide biophysical model of Cas9-based genome editing and gene regulation to predict how changing guide RNA sequences, DNA superhelical densities, Cas9 and crRNA expression levels, organisms and growth conditions, and experimental conditions collectively control the dynamics of dCas9-based binding and Cas9-based cleavage at all DNA sites with both canonical and non-canonical PAMs. We combine statistical thermodynamics and kinetics to model Cas9:crRNA complex formation, diffusion, site selection, reversible R-loop formation, and cleavage, using large amounts of structural, biochemical, expression, and next-generation sequencing data to determine kinetic parameters and develop free energy models. Our results identify DNA supercoiling as a novel mechanism controlling Cas9 binding. Using the model, we predict Cas9 off-target binding frequencies across the lambdaphage and human genomes, and explain why Cas9’s off-target activity can be so high. With this improved understanding, we propose several rules for designing experiments for minimizing off-target activity. We also discuss the implications for engineering dCas9-based genetic circuits. PMID:26824432
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ragnum, Harald Bull; Røe, Kathrine; Division of Medicine, Department of Oncology, Akershus University Hospital, Lørenskog
2013-11-15
Purpose: We explored changes in hypoxia-inducible factor 1 (HIF1) signaling during androgen deprivation therapy (ADT) of androgen-sensitive prostate cancer xenografts under conditions in which no significant change in immunostaining of the hypoxia marker pimonidazole had occurred. Methods and Materials: Gene expression profiles of volume-matched androgen-exposed and androgen-deprived CWR22 xenografts, with similar pimonidazole-positive fractions, were compared. Direct targets of androgen receptor (AR) and HIF1 transcription factors were identified among the differentially expressed genes by using published lists. Biological processes affected by ADT were determined by gene ontology analysis. HIF1α protein expression in xenografts and biopsy samples from 35 patients receiving neoadjuvantmore » ADT was assessed by immunohistochemistry. Results: A total of 1344 genes showed more than 2-fold change in expression by ADT, including 35 downregulated and 5 upregulated HIF1 targets. Six genes were shared HIF1 and AR targets, and their downregulation was confirmed with quantitative RT-PCR. Significant suppression of the biological processes proliferation, metabolism, and stress response in androgen-deprived xenografts was found, consistent with tumor regression. Nineteen downregulated HIF1 targets were involved in those significant biological processes, most of them in metabolism. Four of these were shared AR and HIF1 targets, including genes encoding the regulatory glycolytic proteins HK2, PFKFB3, and SLC2A1. Most of the downregulated HIF1 targets were induced by hypoxia in androgen-responsive prostate cancer cell lines, confirming their role as hypoxia-responsive HIF1 targets in prostate cancer. Downregulation of HIF1 targets was consistent with the absence of HIF1α protein in xenografts and downregulation in patients by ADT (P<.001). Conclusions: AR repression by ADT may lead to downregulation of HIF1 signaling independently of hypoxic fraction, and this may contribute to tumor regression. HIF1α expression is probably not a useful hypoxia biomarker during ADT in prostate cancer.« less
Genetics Home Reference: alopecia areata
... areata the immune system targets hair follicles , stopping hair growth. However, the condition does not permanently damage the follicles, which is why hair may later regrow. Many of the genes that ...
Beisel, Chase L.; Storz, Gisela
2011-01-01
SUMMARY Bacteria selectively consume some carbon sources over others through a regulatory mechanism termed catabolite repression. Here, we show that the base pairing RNA Spot 42 plays a broad role in catabolite repression in Escherichia coli by directly repressing genes involved in central and secondary metabolism, redox balancing, and the consumption of diverse non-preferred carbon sources. Many of the genes repressed by Spot 42 are transcriptionally activated by the global regulator CRP. Since CRP represses Spot 42, these regulators participate in a specific regulatory circuit called a multi-output feedforward loop. We found that this loop can reduce leaky expression of target genes in the presence of glucose and can maintain repression of target genes under changing nutrient conditions. Our results suggest that base pairing RNAs in feedforward loops can help shape the steady-state levels and dynamics of gene expression. PMID:21292161
Morecroft, Ian; White, Katie; Caruso, Paola; Nilsen, Margaret; Loughlin, Lynn; Alba, Raul; Reynolds, Paul N; Danilov, Sergei M; Baker, Andrew H; MacLean, Margaret R
2012-01-01
Serotonin is produced by pulmonary arterial endothelial cells (PAEC) via tryptophan hydroxylase-1 (Tph1). Pathologically, serotonin acts on underlying pulmonary arterial cells, contributing to vascular remodeling associated with pulmonary arterial hypertension (PAH). The effects of hypoxia on PAEC-Tph1 activity are unknown. We investigated the potential of a gene therapy approach to PAH using selective inhibition of PAEC-Tph1 in vivo in a hypoxic model of PAH. We exposed cultured bovine pulmonary arterial smooth muscle cells (bPASMCs) to conditioned media from human PAECs (hPAECs) before and after hypoxic exposure. Serotonin levels were increased in hypoxic PAEC media. Conditioned media evoked bPASMC proliferation, which was greater with hypoxic PAEC media, via a serotonin-dependent mechanism. In vivo, adenoviral vectors targeted to PAECs (utilizing bispecific antibody to angiotensin-converting enzyme (ACE) as the selective targeting system) were used to deliver small hairpin Tph1 RNA sequences in rats. Hypoxic rats developed PAH and increased lung Tph1. PAEC-Tph1 expression and development of PAH were attenuated by our PAEC-Tph1 gene knockdown strategy. These results demonstrate that hypoxia induces Tph1 activity and selective knockdown of PAEC-Tph1 attenuates hypoxia-induced PAH in rats. Further investigation of pulmonary endothelial-specific Tph1 inhibition via gene interventions is warranted. PMID:22525513
Phenotyping of VIGS-mediated gene silencing in rice using a vector derived from a DNA virus.
Kant, Ravi; Dasgupta, Indranil
2017-07-01
Target genes in rice can be optimally silenced if inserted in antisense or hairpin orientation in the RTBV-derived VIGS vector and plants grown at 28 °C and 80% humidity after inoculation. Virus induced gene silencing (VIGS) is a method used to transiently silence genes in dicot as well as monocot plants. For the important monocot species rice, the Rice tungro bacilliform virus (RTBV)-derived VIGS system (RTBV-VIGS), which uses agroinoculation to initiate silencing, has not been standardized for optimal use. Here, using RTBV-VIGS, three sets of conditions were tested to achieve optimal silencing of the rice marker gene phytoene desaturase (pds). The effect of orientation of the insert in the RTBV-VIGS plasmid (sense, antisense and hairpin) on the silencing of the target gene was then evaluated using rice magnesium chelatase subunit H (chlH). Finally, the rice Xa21 gene, conferring resistance against bacterial leaf blight disease (BLB) was silenced using RTBV-VIGS system. In each case, real-time PCR-based assessment indicated approximately 40-80% fall in the accumulation levels of the transcripts of pds, chlH and Xa21. In the case of pds, the appearance of white streaks in the emerging leaves, and for chlH, chlorophyll levels and F v /F m ratio were assessed as phenotypes for silencing. For Xa21, the resistance levels to BLB were assessed by measuring the lesion length and the percent diseased areas of leaves, following challenge inoculation with Xanthomonas oryzae. In each case, the RTBV-MVIGS system gave rise to a discernible phenotype indicating the silencing of the respective target gene using condition III (temperature 28 °C, humidity 80% and 1 mM MES and 20 µM acetosyringone in secondary agrobacterium culture), which revealed the robustness of this gene silencing system for rice.
Sakuma, Tetsushi; Takenaga, Mitsumasa; Kawabe, Yoshinori; Nakamura, Takahiro; Kamihira, Masamichi; Yamamoto, Takashi
2015-01-01
Gene knock-in techniques have rapidly evolved in recent years, along with the development and maturation of genome editing technology using programmable nucleases. We recently reported a novel strategy for microhomology-mediated end-joining-dependent integration of donor DNA by using TALEN or CRISPR/Cas9 and optimized targeting vectors, named PITCh (Precise Integration into Target Chromosome) vectors. Here we describe TALEN and PITCh vector-mediated integration of long gene cassettes, including a single-chain Fv-Fc (scFv-Fc) gene, in Chinese hamster ovary (CHO) cells, with comparison of targeting and cloning efficiency among several donor design and culture conditions. We achieved 9.6-kb whole plasmid integration and 7.6-kb backbone-free integration into a defined genomic locus in CHO cells. Furthermore, we confirmed the reasonable productivity of recombinant scFv-Fc protein of the knock-in cells. Using our protocol, the knock-in cell clones could be obtained by a single transfection and a single limiting dilution using a 96-well plate, without constructing targeting vectors containing long homology arms. Thus, the study described herein provides a highly practical strategy for gene knock-in of large DNA in CHO cells, which accelerates high-throughput generation of cell lines stably producing any desired biopharmaceuticals, including huge antibody proteins. PMID:26473830
Sakuma, Tetsushi; Takenaga, Mitsumasa; Kawabe, Yoshinori; Nakamura, Takahiro; Kamihira, Masamichi; Yamamoto, Takashi
2015-10-09
Gene knock-in techniques have rapidly evolved in recent years, along with the development and maturation of genome editing technology using programmable nucleases. We recently reported a novel strategy for microhomology-mediated end-joining-dependent integration of donor DNA by using TALEN or CRISPR/Cas9 and optimized targeting vectors, named PITCh (Precise Integration into Target Chromosome) vectors. Here we describe TALEN and PITCh vector-mediated integration of long gene cassettes, including a single-chain Fv-Fc (scFv-Fc) gene, in Chinese hamster ovary (CHO) cells, with comparison of targeting and cloning efficiency among several donor design and culture conditions. We achieved 9.6-kb whole plasmid integration and 7.6-kb backbone-free integration into a defined genomic locus in CHO cells. Furthermore, we confirmed the reasonable productivity of recombinant scFv-Fc protein of the knock-in cells. Using our protocol, the knock-in cell clones could be obtained by a single transfection and a single limiting dilution using a 96-well plate, without constructing targeting vectors containing long homology arms. Thus, the study described herein provides a highly practical strategy for gene knock-in of large DNA in CHO cells, which accelerates high-throughput generation of cell lines stably producing any desired biopharmaceuticals, including huge antibody proteins.
Cui, Bintao; Smooker, Peter M; Rouch, Duncan A; Deighton, Margaret A
2016-08-01
Accurate and reproducible measurement of gene transcription requires appropriate reference genes, which are stably expressed under different experimental conditions to provide normalization. Staphylococcus capitis is a human pathogen that produces biofilm under stress, such as imposed by antimicrobial agents. In this study, a set of five commonly used staphylococcal reference genes (gyrB, sodA, recA, tuf and rpoB) were systematically evaluated in two clinical isolates of Staphylococcus capitis (S. capitis subspecies urealyticus and capitis, respectively) under erythromycin stress in mid-log and stationary phases. Two public software programs (geNorm and NormFinder) and two manual calculation methods, reference residue normalization (RRN) and relative quantitative (RQ), were applied. The potential reference genes selected by the four algorithms were further validated by comparing the expression of a well-studied biofilm gene (icaA) with phenotypic biofilm formation in S. capitis under four different experimental conditions. The four methods differed considerably in their ability to predict the most suitable reference gene or gene combination for comparing icaA expression under different conditions. Under the conditions used here, the RQ method provided better selection of reference genes than the other three algorithms; however, this finding needs to be confirmed with a larger number of isolates. This study reinforces the need to assess the stability of reference genes for analysis of target gene expression under different conditions and the use of more than one algorithm in such studies. Although this work was conducted using a specific human pathogen, it emphasizes the importance of selecting suitable reference genes for accurate normalization of gene expression more generally.
Hafemeister, Christoph; Nicotra, Adrienne B.; Jagadish, S.V. Krishna; Bonneau, Richard; Purugganan, Michael
2016-01-01
Environmental gene regulatory influence networks (EGRINs) coordinate the timing and rate of gene expression in response to environmental signals. EGRINs encompass many layers of regulation, which culminate in changes in accumulated transcript levels. Here, we inferred EGRINs for the response of five tropical Asian rice (Oryza sativa) cultivars to high temperatures, water deficit, and agricultural field conditions by systematically integrating time-series transcriptome data, patterns of nucleosome-free chromatin, and the occurrence of known cis-regulatory elements. First, we identified 5447 putative target genes for 445 transcription factors (TFs) by connecting TFs with genes harboring known cis-regulatory motifs in nucleosome-free regions proximal to their transcriptional start sites. We then used network component analysis to estimate the regulatory activity for each TF based on the expression of its putative target genes. Finally, we inferred an EGRIN using the estimated transcription factor activity (TFA) as the regulator. The EGRINs include regulatory interactions between 4052 target genes regulated by 113 TFs. We resolved distinct regulatory roles for members of the heat shock factor family, including a putative regulatory connection between abiotic stress and the circadian clock. TFA estimation using network component analysis is an effective way of incorporating multiple genome-scale measurements into network inference. PMID:27655842
Albihlal, Waleed S; Obomighie, Irabonosi; Blein, Thomas; Persad, Ramona; Chernukhin, Igor; Crespi, Martin; Bechtold, Ulrike; Mullineaux, Philip M
2018-05-19
In Arabidopsis thaliana, HEAT SHOCK TRANSCRIPTION FACTORA1b (HSFA1b) controls resistance to environmental stress and is a determinant of reproductive fitness by influencing seed yield. To understand how HSFA1b achieves this, we surveyed its genome-wide targets (ChIP-seq) and its impact on the transcriptome (RNA-seq) under non-stress (NS), heat stress (HS) in the wild type, and in HSFA1b-overexpressing plants under NS. A total of 952 differentially expressed HSFA1b-targeted genes were identified, of which at least 85 are development associated and were bound predominantly under NS. A further 1780 genes were differentially expressed but not bound by HSFA1b, of which 281 were classified as having development-associated functions. These genes are indirectly regulated through a hierarchical network of 27 transcription factors (TFs). Furthermore, we identified 480 natural antisense non-coding RNA (cisNAT) genes bound by HSFA1b, defining a further mode of indirect regulation. Finally, HSFA1b-targeted genomic features not only harboured heat shock elements, but also MADS box, LEAFY, and G-Box promoter motifs. This revealed that HSFA1b is one of eight TFs that target a common group of stress defence and developmental genes. We propose that HSFA1b transduces environmental cues to many stress tolerance and developmental genes to allow plants to adjust their growth and development continually in a varying environment.
HisB as novel selection marker for gene targeting approaches in Aspergillus niger.
Fiedler, Markus R M; Gensheimer, Tarek; Kubisch, Christin; Meyer, Vera
2017-03-08
For Aspergillus niger, a broad set of auxotrophic and dominant resistance markers is available. However, only few offer targeted modification of a gene of interest into or at a genomic locus of choice, which hampers functional genomics studies. We thus aimed to extend the available set by generating a histidine auxotrophic strain with a characterized hisB locus for targeted gene integration and deletion in A. niger. A histidine-auxotrophic strain was established via disruption of the A. niger hisB gene by using the counterselectable pyrG marker. After curing, a hisB - , pyrG - strain was obtained, which served as recipient strain for further studies. We show here that both hisB orthologs from A. nidulans and A. niger can be used to reestablish histidine prototrophy in this recipient strain. Whereas the hisB gene from A. nidulans was suitable for efficient gene targeting at different loci in A. niger, the hisB gene from A. niger allowed efficient integration of a Tet-on driven luciferase reporter construct at the endogenous non-functional hisB locus. Subsequent analysis of the luciferase activity revealed that the hisB locus is tight under non-inducing conditions and allows even higher luciferase expression levels compared to the pyrG integration locus. Taken together, we provide here an alternative selection marker for A. niger, hisB, which allows efficient homologous integration rates as well as high expression levels which compare favorably to the well-established pyrG selection marker.
Predicting essential genes for identifying potential drug targets in Aspergillus fumigatus.
Lu, Yao; Deng, Jingyuan; Rhodes, Judith C; Lu, Hui; Lu, Long Jason
2014-06-01
Aspergillus fumigatus (Af) is a ubiquitous and opportunistic pathogen capable of causing acute, invasive pulmonary disease in susceptible hosts. Despite current therapeutic options, mortality associated with invasive Af infections remains unacceptably high, increasing 357% since 1980. Therefore, there is an urgent need for the development of novel therapeutic strategies, including more efficacious drugs acting on new targets. Thus, as noted in a recent review, "the identification of essential genes in fungi represents a crucial step in the development of new antifungal drugs". Expanding the target space by rapidly identifying new essential genes has thus been described as "the most important task of genomics-based target validation". In previous research, we were the first to show that essential gene annotation can be reliably transferred between distantly related four Prokaryotic species. In this study, we extend our machine learning approach to the much more complex Eukaryotic fungal species. A compendium of essential genes is predicted in Af by transferring known essential gene annotations from another filamentous fungus Neurospora crassa. This approach predicts essential genes by integrating diverse types of intrinsic and context-dependent genomic features encoded in microbial genomes. The predicted essential datasets contained 1674 genes. We validated our results by comparing our predictions with known essential genes in Af, comparing our predictions with those predicted by homology mapping, and conducting conditional expressed alleles. We applied several layers of filters and selected a set of potential drug targets from the predicted essential genes. Finally, we have conducted wet lab knockout experiments to verify our predictions, which further validates the accuracy and wide applicability of the machine learning approach. The approach presented here significantly extended our ability to predict essential genes beyond orthologs and made it possible to predict an inventory of essential genes in Eukaryotic fungal species, amongst which a preferred subset of suitable drug targets may be selected. By selecting the best new targets, we believe that resultant drugs would exhibit an unparalleled clinical impact against a naive pathogen population. Additional benefits that a compendium of essential genes can provide are important information on cell function and evolutionary biology. Furthermore, mapping essential genes to pathways may also reveal critical check points in the pathogen's metabolism. Finally, this approach is highly reproducible and portable, and can be easily applied to predict essential genes in many more pathogenic microbes, especially those unculturable. Copyright © 2014 Elsevier Ltd. All rights reserved.
Visualization and Analysis of MiRNA-Targets Interactions Networks.
León, Luis E; Calligaris, Sebastián D
2017-01-01
MicroRNAs are a class of small, noncoding RNA molecules of 21-25 nucleotides in length that regulate the gene expression by base-pairing with the target mRNAs, mainly leading to down-regulation or repression of the target genes. MicroRNAs are involved in diverse regulatory pathways in normal and pathological conditions. In this context, it is highly important to identify the targets of specific microRNA in order to understand the mechanism of its regulation and consequently its involvement in disease. However, the microRNA target identification is experimentally laborious and time-consuming. The in silico prediction of microRNA targets is an extremely useful approach because you can identify potential mRNA targets, reduce the number of possibilities and then, validate a few microRNA-mRNA interactions in an in vitro experimental model. In this chapter, we describe, in a simple way, bioinformatics guidelines to use miRWalk database and Cytoscape software for analyzing microRNA-mRNA interactions through their visualization as a network.
Liu, Yong-Nan; Lu, Xiao-Xiao; Ren, Ang; Shi, Liang; Jiang, Ai-Liang; Yu, Han-Shou; Zhao, Ming-Wen
2017-01-01
Ganoderma lucidum has been considered an emerging model species for studying how environmental factors regulate the growth, development, and secondary metabolism of Basidiomycetes. Heat stress, which is one of the most important environmental abiotic stresses, seriously affects the growth, development, and yield of microorganisms. Understanding the response to heat stress has gradually become a hotspot in microorganism research. But suitable reference genes for expression analysis under heat stress have not been reported in G. lucidum. In this study, we systematically identified 11 candidate reference genes that were measured using reverse transcriptase quantitative polymerase chain reaction, and the gene expression stability was analyzed under heat stress conditions using geNorm and NormFinder. The results show that 5 reference genes-CYP and TIF, followed by UCE2, ACTIN, and UBQ1-are the most stable genes under our experimental conditions. Moreover, the relative expression levels of 3 heat stress response genes (hsp17.4, hsp70, and hsp90) were analyzed under heat stress conditions with different normalization strategies. The results show that use of a gene with unstable expression (SAND) as the reference gene leads to biased data and misinterpretations of the target gene expression level under heat stress.
NASA Astrophysics Data System (ADS)
Wu, Shuang; Zhou, Jiannan; Cao, Xupeng; Xue, Song
2016-02-01
Isochrysis zhangjiangensis is a potential marine microalga for biodiesel production, which accumulates lipid under nitrogen limitation conditions, but the mechanism on molecular level is veiled. Quantitative real-time polymerase chain reaction (qPCR) provides the possibility to investigate the gene expression levels, and a valid reference for data normalization is an essential prerequisite for firing up the analysis. In this study, five housekeeping genes, actin (ACT), α-tubulin (TUA), ß-tubulin (TUB), ubiquitin (UBI), 18S rRNA (18S) and one target gene, diacylglycerol acyltransferase (DGAT), were used for determining the reference. By analyzing the stabilities based on calculation of the stability index and on operating the two types of software, geNorm and bestkeeper, it showed that the reference genes widely used in higher plant and microalgae, such as UBI, TUA and 18S, were not the most stable ones in nitrogen-stressed I. zhangjiangensis, and thus are not suitable for exploring the mRNA expression levels under these experimental conditions. Our results show that ACT together with TUB is the most feasible internal control for investigating gene expression under nitrogen-stressed conditions. Our findings will contribute not only to future qPCR studies of I. zhangjiangensis, but also to verification of comparative transcriptomics studies of the microalgae under similar conditions.
Reconstructing directed gene regulatory network by only gene expression data.
Zhang, Lu; Feng, Xi Kang; Ng, Yen Kaow; Li, Shuai Cheng
2016-08-18
Accurately identifying gene regulatory network is an important task in understanding in vivo biological activities. The inference of such networks is often accomplished through the use of gene expression data. Many methods have been developed to evaluate gene expression dependencies between transcription factor and its target genes, and some methods also eliminate transitive interactions. The regulatory (or edge) direction is undetermined if the target gene is also a transcription factor. Some methods predict the regulatory directions in the gene regulatory networks by locating the eQTL single nucleotide polymorphism, or by observing the gene expression changes when knocking out/down the candidate transcript factors; regrettably, these additional data are usually unavailable, especially for the samples deriving from human tissues. In this study, we propose the Context Based Dependency Network (CBDN), a method that is able to infer gene regulatory networks with the regulatory directions from gene expression data only. To determine the regulatory direction, CBDN computes the influence of source to target by evaluating the magnitude changes of expression dependencies between the target gene and the others with conditioning on the source gene. CBDN extends the data processing inequality by involving the dependency direction to distinguish between direct and transitive relationship between genes. We also define two types of important regulators which can influence a majority of the genes in the network directly or indirectly. CBDN can detect both of these two types of important regulators by averaging the influence functions of candidate regulator to the other genes. In our experiments with simulated and real data, even with the regulatory direction taken into account, CBDN outperforms the state-of-the-art approaches for inferring gene regulatory network. CBDN identifies the important regulators in the predicted network: 1. TYROBP influences a batch of genes that are related to Alzheimer's disease; 2. ZNF329 and RB1 significantly regulate those 'mesenchymal' gene expression signature genes for brain tumors. By merely leveraging gene expression data, CBDN can efficiently infer the existence of gene-gene interactions as well as their regulatory directions. The constructed networks are helpful in the identification of important regulators for complex diseases.
Ge, Shujun; Murugesan, Nivetha; Pachter, Joel S
2009-09-01
While the expression of the C-C chemokine ligand 2 (CCL2) in the central nervous system (CNS) is associated with numerous neuroinflammatory conditions, the critical cellular sources of this chemokine, which is responsible for disease processes-as well as associated pathogenic mechanisms, remain unresolved. As the potential for anti-CCL2 therapeutics in treating neuroinflammatory disease is likely to be contingent upon effective drug delivery to the source(s) and/or target(s) of CCL2 action in the CNS, tools to highlight the course of CCL2 action during neuroinflammation are imperative. In response to this need, we used the Cre/loxP and FLP-FRT recombination system to develop the first two, cell-conditional CCL2 knockout mice-separately targeting CCL2 gene elimination to astrocytes and endothelial cells, both of which have been considered to play crucial though undefined roles in neuroinflammatory disease. Specifically, mice containing a floxed CCL2 allele were intercrossed with GFAP-Cre or Tie2-Cre transgenic mice to generate mice with CCL2-deficient astrocytes (astrocyte KO) or endothelial cells (endothelial KO), respectively. Polymerase chain reaction, reverse transcription polymerase chain reaction/quantitative reverse transcriptase polymerase chain reaction, and enzyme-linked immunosorbent assay of CCL2 gene, RNA, and protein, respectively, from cultured astrocytes and brain microvascular endothelial cells (BMEC) established the efficiency and specificity of the CCL2 gene deletions and a CCL2 null phenotype in these CNS cells. Effective cell-conditional knockout of CCL2 was also confirmed in an in vivo setting, wherein astrocytes and BMEC were retrieved by immune-guided laser capture microdissection from their in situ positions in the brains of mice experiencing acute, lipopolysaccharide-mediated endotoxemia to induce CCL2 gene expression. In vivo analysis further revealed apparent cross-talk between BMEC and astrocytes regarding the regulation of astrocyte CCL2 expression. Use of astrocyte KO and endothelial KO mice should prove critical in elaborating the pathogenic mechanisms of and optimizing the treatments for neuroinflammatory disease.
Dual role of Brg chromatin remodeling factor in Sonic hedgehog signaling during neural development.
Zhan, Xiaoming; Shi, Xuanming; Zhang, Zilai; Chen, Yu; Wu, Jiang I
2011-08-02
Sonic hedgehog (Shh) signaling plays diverse roles during animal development and adult tissue homeostasis through differential regulation of Gli family transcription factors. Dysregulated Shh signaling activities have been linked to birth defects and tumorigenesis. Here we report that Brg, an ATP-dependent chromatin remodeling factor, has dual functions in regulating Shh target gene expression. Using a Brg conditional deletion in Shh-responding neural progenitors and fibroblasts, we demonstrate that Brg is required both for repression of the basal expression and for the activation of signal-induced transcription of Shh target genes. In developing telencephalons deficient for Brg, Shh target genes were derepressed, whereas Brg-deleted cerebellar granule neuron precursors failed to respond to Shh to increase their proliferation. The repressor function of Brg was mediated through Gli3 and both the repressor and activator functions of Brg appeared to be independent of its ATPase activity. Furthermore, Brg facilitates Gli coactivator histone deacetylase (HDAC) binding to the regulatory regions of Shh target genes, providing a possible mechanism for its positive role in Shh signaling. Our results thus reveal that a complex chromatin regulation mechanism underlies the precise transcription outcomes of Shh signaling and its diverse roles during development.
Coregulation of srGAP1 by Wnt and Androgen Receptor Signaling: A New Target for Treatment of CRPC
2015-10-01
Specific Aim 1: Test the... Specific Aim2: Test the hypothesis that down regulating srGAP1 in CRPC cells change phenotypic...direct interaction between AR and β-catenin seemed to elicit a specific expression of a set of target genes in low androgen conditions in CRPC.
Stage-specific control of early B cell development by the transcription factor Ikaros
Gültekin, Sinan; Dakic, Aleksandar; Axelsson, Elin; Minnich, Martina; Ebert, Anja; Werner, Barbara; Roth, Mareike; Cimmino, Luisa; Dickins, Ross A.; Zuber, Johannes; Jaritz, Markus; Busslinger, Meinrad
2018-01-01
Ikaros is an essential regulator of lymphopoiesis. Here, we studied the B-cell-specific function of Ikaros by conditional Ikzf1 inactivation in pro-B cells. B-cell development was arrested at an aberrant ‘pro-B’ cell stage characterized by increased cell adhesion and loss of pre-B cell receptor signaling. Ikaros was found to activate genes coding for pre-BCR signal transducers and to repress genes involved in the downregulation of pre-BCR signaling and upregulation of the integrin signaling pathway. Unexpectedly, derepression of Aiolos expression could not compensate for the loss of Ikaros in pro-B cells. Ikaros induced or suppressed active chromatin at regulatory elements of activated or repressed target genes. Notably, Ikaros binding and target gene expression was dynamically regulated at distinct stages of early B-lymphopoiesis. PMID:24509509
2013-01-01
Background The development of new therapies for orphan genetic diseases represents an extremely important medical and social challenge. Drug repositioning, i.e. finding new indications for approved drugs, could be one of the most cost- and time-effective strategies to cope with this problem, at least in a subset of cases. Therefore, many computational approaches based on the analysis of high throughput gene expression data have so far been proposed to reposition available drugs. However, most of these methods require gene expression profiles directly relevant to the pathologic conditions under study, such as those obtained from patient cells and/or from suitable experimental models. In this work we have developed a new approach for drug repositioning, based on identifying known drug targets showing conserved anti-correlated expression profiles with human disease genes, which is completely independent from the availability of ‘ad hoc’ gene expression data-sets. Results By analyzing available data, we provide evidence that the genes displaying conserved anti-correlation with drug targets are antagonistically modulated in their expression by treatment with the relevant drugs. We then identified clusters of genes associated to similar phenotypes and showing conserved anticorrelation with drug targets. On this basis, we generated a list of potential candidate drug-disease associations. Importantly, we show that some of the proposed associations are already supported by independent experimental evidence. Conclusions Our results support the hypothesis that the identification of gene clusters showing conserved anticorrelation with drug targets can be an effective method for drug repositioning and provide a wide list of new potential drug-disease associations for experimental validation. PMID:24088245
Rentsch, D; Hirner, B; Schmelzer, E; Frommer, W B
1996-01-01
A yeast mutant lacking SHR3, a protein specifically required for correct targeting of plasma membrane amino acid permeases, was used to study the targeting of plant transporters and as a tool to isolate new SHR3-independent amino acid transporters. For this purpose, an shr3 mutant was transformed with an Arabidopsis cDNA library. Thirty-four clones were capable of growth under selective conditions, but none showed homology with SHR3. However, genes encoding eight different amino acid transporters belonging to three different transporter families were isolated. Five of these are members of the general amino acid permease (AAP) gene family, one is a member of the NTR family, encoding an oligopeptide transporter, and two belong to a new class of transporter genes. A functional analysis of the latter two genes revealed that they encode specific proline transporters (ProT) that are distantly related to the AAP gene family. ProT1 was found to be expressed in all organs, but highest levels were found in roots, stems, and flowers. Expression in flowers was highest in the floral stalk phloem that enters the carpels and was downregulated after fertilization, indicating a specific role in supplying the ovules with proline. ProT2 transcripts were found ubiquitously throughout the plant, but expression was strongly induced under water or salt stress, implying that ProT2 plays an important role in nitrogen distribution during water stress, unlike members of the AAP gene family whose expression was repressed under the same conditions. These results corroborate the general finding that under water stress, amino acid export is impaired whereas proline export is increased. PMID:8776904
Pierce, M L; Ruffner, D E
1998-01-01
Antisense-mediated gene inhibition uses short complementary DNA or RNA oligonucleotides to block expression of any mRNA of interest. A key parameter in the success or failure of an antisense therapy is the identification of a suitable target site on the chosen mRNA. Ultimately, the accessibility of the target to the antisense agent determines target suitability. Since accessibility is a function of many complex factors, it is currently beyond our ability to predict. Consequently, identification of the most effective target(s) requires examination of every site. Towards this goal, we describe a method to construct directed ribozyme libraries against any chosen mRNA. The library contains nearly equal amounts of ribozymes targeting every site on the chosen transcript and the library only contains ribozymes capable of binding to that transcript. Expression of the ribozyme library in cultured cells should allow identification of optimal target sites under natural conditions, subject to the complexities of a fully functional cell. Optimal target sites identified in this manner should be the most effective sites for therapeutic intervention. PMID:9801305
Maruyama, Fumito; Kenzaka, Takehiko; Yamaguchi, Nobuyasu; Tani, Katsuji; Nasu, Masao
2005-01-01
Rolling circle amplification (RCA) generates large single-stranded and tandem repeats of target DNA as amplicons. This technique was applied to in situ nucleic acid amplification (in situ RCA) to visualize and count single Escherichia coli cells carrying a specific gene sequence. The method features (i) one short target sequence (35 to 39 bp) that allows specific detection; (ii) maintaining constant fluorescent intensity of positive cells permeabilized extensively after amplicon detection by fluorescence in situ hybridization, which facilitates the detection of target bacteria in various physiological states; and (iii) reliable enumeration of target bacteria by concentration on a gelatin-coated membrane filter. To test our approach, the presence of the following genes were visualized by in situ RCA: green fluorescent protein gene, the ampicillin resistance gene and the replication origin region on multicopy pUC19 plasmid, as well as the single-copy Shiga-like toxin gene on chromosomes inside E. coli cells. Fluorescent antibody staining after in situ RCA also simultaneously identified cells harboring target genes and determined the specificity of in situ RCA. E. coli cells in a nonculturable state from a prolonged incubation were periodically sampled and used for plasmid uptake study. The numbers of cells taking up plasmids determined by in situ RCA was up to 106-fold higher than that measured by selective plating. In addition, in situ RCA allowed the detection of cells taking up plasmids even when colony-forming cells were not detected during the incubation period. By optimizing the cell permeabilization condition for in situ RCA, this method can become a valuable tool for studying free DNA uptake, especially in nonculturable bacteria. PMID:16332770
Sorensen, Annette; Mairs, Robert J; Braidwood, Lynne; Joyce, Craig; Conner, Joe; Pimlott, Sally; Brown, Moira; Boyd, Marie
2012-04-01
Oncolytic herpes viruses show promise for cancer treatment. However, it is unlikely that they will fulfill their therapeutic potential when used as monotherapies. An alternative strategy is to use these viruses not only as oncolytic agents but also as a delivery mechanism of therapeutic transgenes to enhance tumor cell killing. The herpes simplex virus 1 deletion mutant HSV1716 is a conditionally replicating oncolytic virus that selectively replicates in and lyses dividing tumor cells. It has a proven safety profile in clinical trials and has demonstrated efficacy as a gene-delivery vehicle. To enhance its therapeutic potential, we have engineered HSV1716 to convey the noradrenaline transporter (NAT) gene (HSV1716/NAT), whose expression endows infected cells with the capacity to accumulate the noradrenaline analog metaiodobenzylguanidine (MIBG). Thus, the NAT gene-infected cells are susceptible to targeted radiotherapy using radiolabeled (131)I-MIBG, a strategy that has already shown promise for combined targeted radiotherapy-gene therapy in cancer cells after plasmid-mediated transfection. We used HSV1716/NAT as a dual cell lysis-gene delivery vehicle for targeting the NAT transgene to human tumor xenografts in vivo. In tumor xenografts that did not express NAT, intratumoral or intravenous injection of HSV1716/NAT induced the capacity for active uptake of (131)I-MIBG. Administration of HSV1716/NAT and (131)I-MIBG resulted in decreased tumor growth and enhanced survival relative to injection of either agent alone. Efficacy was dependent on the scheduling of delivery of the 2 agents. These findings support a role for combination radiotherapy-gene therapy for cancer using HSV1716 expressing the NAT transgene and targeted radionuclide therapy.
Identification of Logic Relationships between Genes and Subtypes of Non-Small Cell Lung Cancer
Su, Yansen; Pan, Linqiang
2014-01-01
Non-small cell lung cancer (NSCLC) has two major subtypes: adenocarcinoma (AC) and squamous cell carcinoma (SCC). The diagnosis and treatment of NSCLC are hindered by the limited knowledge about the pathogenesis mechanisms of subtypes of NSCLC. It is necessary to research the molecular mechanisms related with AC and SCC. In this work, we improved the logic analysis algorithm to mine the sufficient and necessary conditions for the presence states (presence or absence) of phenotypes. We applied our method to AC and SCC specimens, and identified lower and higher logic relationships between genes and two subtypes of NSCLC. The discovered relationships were independent of specimens selected, and their significance was validated by statistic test. Compared with the two earlier methods (the non-negative matrix factorization method and the relevance analysis method), the current method outperformed these methods in the recall rate and classification accuracy on NSCLC and normal specimens. We obtained biomarkers. Among biomarkers, genes have been used to distinguish AC from SCC in practice, and other six genes were newly discovered biomarkers for distinguishing subtypes. Furthermore, NKX2-1 has been considered as a molecular target for the targeted therapy of AC, and other genes may be novel molecular targets. By gene ontology analysis, we found that two biological processes (‘epidermis development’ and ‘cell adhesion’) were closely related with the tumorigenesis of subtypes of NSCLC. More generally, the current method could be extended to other complex diseases for distinguishing subtypes and detecting the molecular targets for targeted therapy. PMID:24743794
Wang, Xiaolong; Zhou, PeiHua; Sun, XueJun; Wei, GuangBing; Zhang, Li; Wang, Hui; Yao, JianFeng; Jia, PengBo; Zheng, JianBao
2016-05-01
One of the current challenges facing cancer gene therapy is the tumour-specific targeting of therapeutic genes. Effective targeting in gene therapy requires accurate spatial and temporal control of gene expression. To develop a sufficient and accurate tumour-targeting method for cancer gene therapy, we have investigated the use of hyperthermia to control the expression of a transgene under the control of the human telomerase reverse transcriptase (hTERT) promoter and eight heat shock elements (8HSEs). Luciferase reporters were constructed by inserting eight HSEs and the hTERT promoter (8HSEs-hTERTp) upstream of the pGL4.20 vector luciferase gene. The luciferase activity of the hTERT promoter and 8HSEs-hTERT promoter were then compared in the presence and absence of heat. The differences in luciferase activity were analysed using dual luciferase assays in SW480 (high hTERT expression), MKN28 and MRC-5 cells (low hTERT expression). The luciferase activity of the Hsp70B promoter was also compared to the 8HSEs-hTERT promoter in the above listed cell lines. Lentiviral vector and heat-induced expression of EGFP expression under the control of the 8HSEs-hTERT promoter in cultured cells and mouse tumour xenografts was measured by reverse transcription polymerase (RT-PCR), Western blot and immunofluorescence assays. hTERT promoter activity was higher in SW480 cells than in MKN28 or MRC-5 cells. At 43 °C, the luciferase activity of the 8HSEs-hTERT promoter was significantly increased in SW480 cells, but not in MKN28 or MRC-5 cells. Importantly, the differences in luciferase activity were much more obvious in both high (SW480) and low (MKN28 and MRC-5) hTERT expressing cells when the activity of the 8HSEs-hTERT promoter was compared to the Hsp70B promoter. Moreover, under the control of 8HSEs-hTERT promoter in vitro and in vivo, EGFP expression was obviously increased by heat treatment in SW480 cells but not in MKN28 or MRC-5 cells, nor was expression increased under normal temperature conditions. The hTERT promoter is a potentially powerful tumour-specific promoter and gene therapy tool for cancer treatment. Incorporating heat-inducible therapeutic elements (8HSEs) into the hTERT promoter may enhance the efficiency and specificity of cancer targeting gene therapy under hyperthermic clinical conditions.
Katz, Ira K; Lamprecht, Raphael
2015-02-01
RNA transcription is needed for memory formation. However, the ability to identify genes whose expression is altered by learning is greatly impaired because of methodological difficulties in profiling gene expression in specific neurons involved in memory formation. Here, we report a novel approach to monitor the expression of genes after learning in neurons in specific brain pathways needed for memory formation. In this study, we aimed to monitor gene expression after fear learning. We retrogradely labeled discrete thalamic neurons that project to the lateral amygdala (LA) of rats. The labeled neurons were dissected, using laser microdissection microscopy, after fear conditioning learning or unpaired training. The RNAs from the dissected neurons were subjected to microarray analysis. The levels of selected RNAs detected by the microarray analysis to be altered by fear conditioning were also assessed by nanostring analysis. We observed that the expression of genes involved in the regulation of translation, maturation and degradation of proteins was increased 6 h after fear conditioning compared to unpaired or naïve trained rats. These genes were not expressed 24 h after training or in cortical neurons that project to the LA. The expression of genes involved in transcription regulation and neuronal development was altered after fear conditioning learning in the cortical-LA pathway. The present study provides key information on the identity of genes expressed in discrete thalamic and cortical neurons that project to the LA after fear conditioning. Such an approach could also serve to identify gene products as targets for the development of a new generation of therapeutic agents that could be aimed to functionally identified brain circuits to treat memory-related disorders. © 2014 International Society for Neurochemistry.
Genome engineering using a synthetic gene circuit in Bacillus subtilis.
Jeong, Da-Eun; Park, Seung-Hwan; Pan, Jae-Gu; Kim, Eui-Joong; Choi, Soo-Keun
2015-03-31
Genome engineering without leaving foreign DNA behind requires an efficient counter-selectable marker system. Here, we developed a genome engineering method in Bacillus subtilis using a synthetic gene circuit as a counter-selectable marker system. The system contained two repressible promoters (B. subtilis xylA (Pxyl) and spac (Pspac)) and two repressor genes (lacI and xylR). Pxyl-lacI was integrated into the B. subtilis genome with a target gene containing a desired mutation. The xylR and Pspac-chloramphenicol resistant genes (cat) were located on a helper plasmid. In the presence of xylose, repression of XylR by xylose induced LacI expression, the LacIs repressed the Pspac promoter and the cells become chloramphenicol sensitive. Thus, to survive in the presence of chloramphenicol, the cell must delete Pxyl-lacI by recombination between the wild-type and mutated target genes. The recombination leads to mutation of the target gene. The remaining helper plasmid was removed easily under the chloramphenicol absent condition. In this study, we showed base insertion, deletion and point mutation of the B. subtilis genome without leaving any foreign DNA behind. Additionally, we successfully deleted a 2-kb gene (amyE) and a 38-kb operon (ppsABCDE). This method will be useful to construct designer Bacillus strains for various industrial applications. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Kajaste-Rudnitski, Anna; Naldini, Luigi
2015-04-01
Hematopoietic gene therapy has tremendous potential to treat human disease. Nevertheless, for gene therapy to be efficacious, effective gene transfer into target cells must be reached without inducing detrimental effects on their biological properties. This remains a great challenge for the field as high vector doses and prolonged ex vivo culture conditions are still required to reach significant transduction levels of clinically relevant human hematopoietic stem and progenitor cells (HSPCs), while other potential target cells such as primary macrophages can hardly be transduced. The reasons behind poor permissiveness of primary human hematopoietic cells to gene transfer partly reside in the retroviral origin of lentiviral vectors (LVs). In particular, host antiviral factors referred to as restriction factors targeting the retroviral life cycle can hamper LV transduction efficiency. Furthermore, LVs may activate innate immune sensors not only in differentiated hematopoietic cells but also in HSPCs, with potential consequences on transduction efficiency as well as their biological properties. Therefore, better understanding of the vector-host interactions in the context of hematopoietic gene transfer is important for the development of safer and more efficient gene therapy strategies. In this review, we briefly summarize the current knowledge regarding innate immune recognition of lentiviruses in primary human hematopoietic cells as well as discuss its relevance for LV-based ex vivo gene therapy approaches.
Bessonov, Kyrylo; Walkey, Christopher J.; Shelp, Barry J.; van Vuuren, Hennie J. J.; Chiu, David; van der Merwe, George
2013-01-01
Analyzing time-course expression data captured in microarray datasets is a complex undertaking as the vast and complex data space is represented by a relatively low number of samples as compared to thousands of available genes. Here, we developed the Interdependent Correlation Clustering (ICC) method to analyze relationships that exist among genes conditioned on the expression of a specific target gene in microarray data. Based on Correlation Clustering, the ICC method analyzes a large set of correlation values related to gene expression profiles extracted from given microarray datasets. ICC can be applied to any microarray dataset and any target gene. We applied this method to microarray data generated from wine fermentations and selected NSF1, which encodes a C2H2 zinc finger-type transcription factor, as the target gene. The validity of the method was verified by accurate identifications of the previously known functional roles of NSF1. In addition, we identified and verified potential new functions for this gene; specifically, NSF1 is a negative regulator for the expression of sulfur metabolism genes, the nuclear localization of Nsf1 protein (Nsf1p) is controlled in a sulfur-dependent manner, and the transcription of NSF1 is regulated by Met4p, an important transcriptional activator of sulfur metabolism genes. The inter-disciplinary approach adopted here highlighted the accuracy and relevancy of the ICC method in mining for novel gene functions using complex microarray datasets with a limited number of samples. PMID:24130853
Abdelrahman, Mostafa; Al-Sadi, Abdullah M; Pour-Aboughadareh, Alireza; Burritt, David J; Tran, Lam-Son Phan
2018-03-12
Developing more crops able to sustainably produce high yields when grown under biotic/abiotic stresses is an important goal, if crop production and food security are to be guaranteed in the face of ever-increasing human population and unpredictable global climatic conditions. However, conventional crop improvement, through random mutagenesis or genetic recombination, is time-consuming and cannot keep pace with increasing food demands. Targeted genome editing (GE) technologies, especially clustered regularly interspaced short palindromic repeats (CRISPR)/(CRISPR)-associated protein 9 (Cas9), have great potential to aid in the breeding of crops that are able to produce high yields under conditions of biotic/abiotic stress. This is due to their high efficiency, accuracy and low risk of off-target effects, compared with conventional random mutagenesis methods. The use of CRISPR/Cas9 system has grown very rapidly in recent years with numerous examples of targeted mutagenesis in crop plants, including gene knockouts, modifications, and the activation and repression of target genes. The potential of the GE approach for crop improvement has been clearly demonstrated. However, the regulation and social acceptance of GE crops still remain a challenge. In this review, we evaluate the recent applications of the CRISPR/Cas9-mediated GE, as a means to produce crop plants with greater resilience to the stressors they encounter when grown under increasing stressful environmental conditions. Copyright © 2018 Elsevier Masson SAS. All rights reserved.
Gorrepati, Lakshmi; Krause, Michael W.; Chen, Weiping; Brodigan, Thomas M.; Correa-Mendez, Margarita; Eisenmann, David M.
2015-01-01
The evolutionarily conserved Wnt/β-catenin signaling pathway plays a fundamental role during metazoan development, regulating numerous processes including cell fate specification, cell migration, and stem cell renewal. Wnt ligand binding leads to stabilization of the transcriptional effector β-catenin and upregulation of target gene expression to mediate a cellular response. During larval development of the nematode Caenorhabditis elegans, Wnt/β-catenin pathways act in fate specification of two hypodermal cell types, the ventral vulval precursor cells (VPCs) and the lateral seam cells. Because little is known about targets of the Wnt signaling pathways acting during larval VPC and seam cell differentiation, we sought to identify genes regulated by Wnt signaling in these two hypodermal cell types. We conditionally activated Wnt signaling in larval animals and performed cell type–specific "mRNA tagging" to enrich for VPC and seam cell–specific mRNAs, and then used microarray analysis to examine gene expression compared to control animals. Two hundred thirty-nine genes activated in response to Wnt signaling were identified, and we characterized 50 genes further. The majority of these genes are expressed in seam and/or vulval lineages during normal development, and reduction of function for nine genes caused defects in the proper division, fate specification, fate execution, or differentiation of seam cells and vulval cells. Therefore, the combination of these techniques was successful at identifying potential cell type–specific Wnt pathway target genes from a small number of cells and at increasing our knowledge of the specification and behavior of these C. elegans larval hypodermal cells. PMID:26048561
Gorrepati, Lakshmi; Krause, Michael W; Chen, Weiping; Brodigan, Thomas M; Correa-Mendez, Margarita; Eisenmann, David M
2015-06-05
The evolutionarily conserved Wnt/β-catenin signaling pathway plays a fundamental role during metazoan development, regulating numerous processes including cell fate specification, cell migration, and stem cell renewal. Wnt ligand binding leads to stabilization of the transcriptional effector β-catenin and upregulation of target gene expression to mediate a cellular response. During larval development of the nematode Caenorhabditis elegans, Wnt/β-catenin pathways act in fate specification of two hypodermal cell types, the ventral vulval precursor cells (VPCs) and the lateral seam cells. Because little is known about targets of the Wnt signaling pathways acting during larval VPC and seam cell differentiation, we sought to identify genes regulated by Wnt signaling in these two hypodermal cell types. We conditionally activated Wnt signaling in larval animals and performed cell type-specific "mRNA tagging" to enrich for VPC and seam cell-specific mRNAs, and then used microarray analysis to examine gene expression compared to control animals. Two hundred thirty-nine genes activated in response to Wnt signaling were identified, and we characterized 50 genes further. The majority of these genes are expressed in seam and/or vulval lineages during normal development, and reduction of function for nine genes caused defects in the proper division, fate specification, fate execution, or differentiation of seam cells and vulval cells. Therefore, the combination of these techniques was successful at identifying potential cell type-specific Wnt pathway target genes from a small number of cells and at increasing our knowledge of the specification and behavior of these C. elegans larval hypodermal cells. Copyright © 2015 Gorrepati et al.
Mirza, M S; Rademaker, J L; Janse, J D; Akkermans, A D
1993-11-01
In this article we report on the polymerase chain reaction amplification of a partial 16S rRNA gene from the plant pathogenic bacterium Clavibacter michiganensis subsp. sepedonicus. A partial sequence (about 400 base pairs) of the gene was determined that covered two variable regions important for oligonucleotide probe development. A specific 24mer oligonucleotide probe targeted against the V6 region of 16S rRNA was designed. Specificity of the probe was determined using dot blot hybridization. Under stringent conditions (60 degrees C), the probe hybridized with all 16 Cl. michiganensis subsp. sepedonicus strains tested. Hybridization did not occur with 32 plant pathogenic and saprophytic bacteria used as controls under the same conditions. Under less stringent conditions (55 degrees C) the related Clavibacter michiganensis subsp. insidiosus, Clavibacter michiganensis subsp. nebraskensis, and Clavibacter michiganensis subsp. tesselarius also showed hybridization. At even lower stringency (40 degrees C), all Cl. michiganensis subspecies tested including Clavibacter michiganensis subsp. michiganensis showed hybridization signal, suggesting that under these conditions the probe may be used as a species-specific probe for Cl. michiganensis.
Sasse, Anna; Hamer, Stefanie N; Amich, Jorge; Binder, Jasmin; Krappmann, Sven
2016-01-01
Pathogenicity of the saprobe Aspergillus fumigatus strictly depends on nutrient acquisition during infection, as fungal growth determines colonisation and invasion of a susceptible host. Primary metabolism has to be considered as a valid target for antimycotic therapy, based on the fact that several fungal anabolic pathways are not conserved in higher eukaryotes. To test whether fungal proliferation during invasive aspergillosis relies on endogenous biosynthesis of aromatic amino acids, defined auxotrophic mutants of A. fumigatus were generated and assessed for their infectious capacities in neutropenic mice and found to be strongly attenuated in virulence. Moreover, essentiality of the complete biosynthetic pathway could be demonstrated, corroborated by conditional gene expression in infected animals and inhibitor studies. This brief report not only validates the aromatic amino acid biosynthesis pathway of A. fumigatus to be a promising antifungal target but furthermore demonstrates feasibility of conditional gene expression in a murine infection model of aspergillosis. PMID:26605426
Cho, Lily Ting-yin; Andrews, Robert; Carroll, Thomas; Iyer, Vivek; Tate, Peri; Rosen, Barry; Stunnenberg, Hendrik G.; Fisher, Amanda G.; Skarnes, William C.
2017-01-01
Abstract Mouse embryonic stem (ES) cells are a popular model system to study biological processes, though uncovering recessive phenotypes requires inactivating both alleles. Building upon resources from the International Knockout Mouse Consortium (IKMC), we developed a targeting vector for second allele inactivation in conditional-ready IKMC ‘knockout-first’ ES cell lines. We applied our technology to several epigenetic regulators, recovering bi-allelic targeted clones with a high efficiency of 60% and used Flp recombinase to restore expression in two null cell lines to demonstrate how our system confirms causality through mutant phenotype reversion. We designed our strategy to select against re-targeting the ‘knockout-first’ allele and identify essential genes in ES cells, including the histone methyltransferase Setdb1. For confirmation, we exploited the flexibility of our system, enabling tamoxifen inducible conditional gene ablation while controlling for genetic background and tamoxifen effects. Setdb1 ablated ES cells exhibit severe growth inhibition, which is not rescued by exogenous Nanog expression or culturing in naive pluripotency ‘2i’ media, suggesting that the self-renewal defect is mediated through pluripotency network independent pathways. Our strategy to generate null mutant mouse ES cells is applicable to thousands of genes and repurposes existing IKMC Intermediate Vectors. PMID:28981838
Rienksma, Rienk A; Suarez-Diez, Maria; Spina, Lucie; Schaap, Peter J; Martins dos Santos, Vitor A P
2014-12-01
Systems-level metabolic network reconstructions and the derived constraint-based (CB) mathematical models are efficient tools to explore bacterial metabolism. Approximately one-fourth of the Mycobacterium tuberculosis (Mtb) genome contains genes that encode proteins directly involved in its metabolism. These represent potential drug targets that can be systematically probed with CB models through the prediction of genes essential (or the combination thereof) for the pathogen to grow. However, gene essentiality depends on the growth conditions and, so far, no in vitro model precisely mimics the host at the different stages of mycobacterial infection, limiting model predictions. These limitations can be circumvented by combining expression data from in vivo samples with a validated CB model, creating an accurate description of pathogen metabolism in the host. To this end, we present here a thoroughly curated and extended genome-scale CB metabolic model of Mtb quantitatively validated using 13C measurements. We describe some of the efforts made in integrating CB models and high-throughput data to generate condition specific models, and we will discuss challenges ahead. This knowledge and the framework herein presented will enable to identify potential new drug targets, and will foster the development of optimal therapeutic strategies. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.
YY1 Regulates Melanocyte Development and Function by Cooperating with MITF
Bell, Robert J. A.; Tran, Thanh-Nga T.; Haq, Rizwan; Liu, Huifei; Love, Kevin T.; Langer, Robert; Anderson, Daniel G.; Larue, Lionel; Fisher, David E.
2012-01-01
Studies of coat color mutants have greatly contributed to the discovery of genes that regulate melanocyte development and function. Here, we generated Yy1 conditional knockout mice in the melanocyte-lineage and observed profound melanocyte deficiency and premature gray hair, similar to the loss of melanocytes in human piebaldism and Waardenburg syndrome. Although YY1 is a ubiquitous transcription factor, YY1 interacts with M-MITF, the Waardenburg Syndrome IIA gene and a master transcriptional regulator of melanocytes. YY1 cooperates with M-MITF in regulating the expression of piebaldism gene KIT and multiple additional pigmentation genes. Moreover, ChIP–seq identified genome-wide YY1 targets in the melanocyte lineage. These studies mechanistically link genes implicated in human conditions of melanocyte deficiency and reveal how a ubiquitous factor (YY1) gains lineage-specific functions by co-regulating gene expression with a lineage-restricted factor (M-MITF)—a general mechanism which may confer tissue-specific gene expression in multiple lineages. PMID:22570637
[Development of pseudoviral competitive internal controls for RT-PCR detection of dengue virus].
Hang, Xiao-Tong; Li, Jian-Dong; Zhang, Quan-Fu; Li, Chuan; Zhang, Shuo; Liang, Mi-Fang; Li, De-Xin
2010-02-01
Development of pseudoviral competitive internal controls for RT-PCR laboratory detection of dengue virus. The internal controls target gene were obtained by insertion of a 180 bp non-related DNA fragment into RT-PCR detection target of dengue virus between the forward and reverse PCR primer binding regions. A yellow florescence protein reporter gene was induced at downstream of internal controls target gene via internal ribosome entry site gene. HEK 293T cells were transfected with plasmid containing this whole cassette and lentiviral packaging support plasmid. Pseudoviral particle was recovered from the supernatant and analyzed quantitatively and qualitatively in simulated samples at the same tube under different experimental conditions. The established pseudoviral competitive internal controls can be used in the RT-PCR detection of different serotype dengue virus and the whole detection process can be monitored. The obtained fragment is easy to be differentiated in agarose electrophoresis. The pseudoviral competitive internal controls could be used for the quality control of the laboratory diagnosis process, simple to prepare, stable for storage, easy to be transformed into internal controls for other RNA virus.
Heun, Yvonn; Hildebrand, Staffan; Heidsieck, Alexandra; Gleich, Bernhard; Anton, Martina; Pircher, Joachim; Ribeiro, Andrea; Mykhaylyk, Olga; Eberbeck, Dietmar; Wenzel, Daniela; Pfeifer, Alexander; Woernle, Markus; Krötz, Florian; Pohl, Ulrich; Mannell, Hanna
2017-01-01
In the field of vascular gene therapy, targeting systems are promising advancements to improve site-specificity of gene delivery. Here, we studied whether incorporation of magnetic nanoparticles (MNP) with different magnetic properties into ultrasound sensitive microbubbles may represent an efficient way to enable gene targeting in the vascular system after systemic application. Thus, we associated novel silicon oxide-coated magnetic nanoparticle containing microbubbles (SO-Mag MMB) with lentiviral particles carrying therapeutic genes and determined their physico-chemical as well as biological properties compared to MMB coated with polyethylenimine-coated magnetic nanoparticles (PEI-Mag MMB). While there were no differences between both MMB types concerning size and lentivirus binding, SO-Mag MMB exhibited superior characteristics regarding magnetic moment, magnetizability as well as transduction efficiency under static and flow conditions in vitro . Focal disruption of lentiviral SO-Mag MMB by ultrasound within isolated vessels exposed to an external magnetic field decisively improved localized VEGF expression in aortic endothelium ex vivo and enhanced the angiogenic response. Using the same system in vivo , we achieved a highly effective, site-specific lentiviral transgene expression in microvessels of the mouse dorsal skin after arterial injection. Thus, we established a novel lentiviral MMB technique, which has great potential towards site-directed vascular gene therapy.
Cusick, Kathleen D; Fitzgerald, Lisa A; Pirlo, Russell K; Cockrell, Allison L; Petersen, Emily R; Biffinger, Justin C
2014-01-01
Neurospora crassa has served as a model organism for studying circadian pathways and more recently has gained attention in the biofuel industry due to its enhanced capacity for cellulase production. However, in order to optimize N. crassa for biotechnological applications, metabolic pathways during growth under different environmental conditions must be addressed. Reverse-transcription quantitative PCR (RT-qPCR) is a technique that provides a high-throughput platform from which to measure the expression of a large set of genes over time. The selection of a suitable reference gene is critical for gene expression studies using relative quantification, as this strategy is based on normalization of target gene expression to a reference gene whose expression is stable under the experimental conditions. This study evaluated twelve candidate reference genes for use with N. crassa when grown in continuous culture bioreactors under different light and temperature conditions. Based on combined stability values from NormFinder and Best Keeper software packages, the following are the most appropriate reference genes under conditions of: (1) light/dark cycling: btl, asl, and vma1; (2) all-dark growth: btl, tbp, vma1, and vma2; (3) temperature flux: btl, vma1, act, and asl; (4) all conditions combined: vma1, vma2, tbp, and btl. Since N. crassa exists as different cell types (uni- or multi-nucleated), expression changes in a subset of the candidate genes was further assessed using absolute quantification. A strong negative correlation was found to exist between ratio and threshold cycle (CT) values, demonstrating that CT changes serve as a reliable reflection of transcript, and not gene copy number, fluctuations. The results of this study identified genes that are appropriate for use as reference genes in RT-qPCR studies with N. crassa and demonstrated that even with the presence of different cell types, relative quantification is an acceptable method for measuring gene expression changes during growth in bioreactors.
Goncalves, Priscila; Anderson, Kelli; Thompson, Emma L; Melwani, Aroon; Parker, Laura M; Ross, Pauline M; Raftos, David A
2016-10-01
Marine organisms need to adapt in order to cope with the adverse effects of ocean acidification and warming. Transgenerational exposure to CO2 stress has been shown to enhance resilience to ocean acidification in offspring from a number of species. However, the molecular basis underlying such adaptive responses is currently unknown. Here, we compared the transcriptional profiles of two genetically distinct oyster breeding lines following transgenerational exposure to elevated CO2 in order to explore the molecular basis of acclimation or adaptation to ocean acidification in these organisms. The expression of key target genes associated with antioxidant defence, metabolism and the cytoskeleton was assessed in oysters exposed to elevated CO2 over three consecutive generations. This set of target genes was chosen specifically to test whether altered responsiveness of intracellular stress mechanisms contributes to the differential acclimation of oyster populations to climate stressors. Transgenerational exposure to elevated CO2 resulted in changes to both basal and inducible expression of those key target genes (e.g. ecSOD, catalase and peroxiredoxin 6), particularly in oysters derived from the disease-resistant, fast-growing B2 line. Exposure to CO2 stress over consecutive generations produced opposite and less evident effects on transcription in a second population that was derived from wild-type (nonselected) oysters. The analysis of key target genes revealed that the acute responses of oysters to CO2 stress appear to be affected by population-specific genetic and/or phenotypic traits and by the CO2 conditions to which their parents had been exposed. This supports the contention that the capacity for heritable change in response to ocean acidification varies between oyster breeding lines and is mediated by parental conditioning. © 2016 John Wiley & Sons Ltd.
Huang, Songqian; Cao, Xiaojuan; Tian, Xianchang; Wang, Weimin
2016-01-01
MicroRNAs (miRNAs) exert important roles in animal growth, immunity, and development, and regulate gene expression at the post-transcriptional level. Knowledges about the diversities of miRNAs and their roles in accessory air-breathing organs (ABOs) of fish remain unknown. In this work, we used high-throughput sequencing to identify known and novel miRNAs from the posterior intestine, an important ABO, in loach (Misgurnus anguillicaudatus) under normal and intestinal air-breathing inhibited conditions. A total of 204 known and 84 novel miRNAs were identified, while 47 miRNAs were differentially expressed between the two small RNA libraries (i.e. between the normal and intestinal air-breathing inhibited group). Potential miRNA target genes were predicted by combining our transcriptome data of the posterior intestine of the loach under the same conditions, and then annotated using COG, GO, KEGG, Swissprot and Nr databases. The regulatory networks of miRNAs and their target genes were analyzed. The abundances of nine known miRNAs were validated by qRT-PCR. The relative expression profiles of six known miRNAs and their eight corresponding target genes, and two novel potential miRNAs were also detected. Histological characteristics of the posterior intestines in both normal and air-breathing inhibited group were further analyzed. This study contributes to our understanding on the functions and molecular regulatory mechanisms of miRNAs in accessory air-breathing organs of fish.
Construction of a novel peptide nucleic acid piezoelectric gene sensor microarray detection system.
Chen, Ming; Liu, Minghua; Yu, Lili; Cai, Guoru; Chen, Qinghai; Wu, Rong; Wang, Feng; Zhang, Bo; Jiang, Tianlun; Fu, Welling
2005-08-01
A novel 2 x 5 clamped style piezoelectric gene sensor microarray has been successfully constructed. Every crystal unit of the fabricated gene sensor can oscillate independently without interfering with each other. The bis-peptide nucleic acid (bis-PNA) probe, which can combine with target DNA or RNA sequences more effectively and specifically than a DNA probe, was designed and immobilized on the surface of the gene sensor microarray to substitute the conventional DNA probe for direct detection of the hepatitis B virus (HBV) genomic DNA. Detection conditions were then explored and optimized. Results showed that PBS buffer of pH 6.8, an ion concentration of 20 mmol/liter, and a probe concentration of 1.5 micromol/liter were optimal for the detection system. Under such optimized experimental conditions, the specificity of bis-PNA was proved much higher than that of DNA probe. The relationship between quantity of target and decrease of frequency showed a typical saturation curve when concentrations of target HBV DNA varied from 10 pg/liter to 100 microg/liter, and 10 microg/liter was the watershed, with a statistic linear regression equation of I gC = -2.7455 + 0.0691 deltaF and the correlating coefficient of 0.9923. Fortunately, this is exactly the most ordinary variant range of the HBV virus concentration in clinical hepatitis samples. So, a good technical platform is successfully constructed and it will be applied to detect HBV quantitatively in clinical samples.
A resource of vectors and ES cells for targeted deletion of microRNAs in mice
Prosser, Haydn M.; Koike-Yusa, Hiroko; Cooper, James D.; Law, Frances C.; Bradley, Allan
2011-01-01
The 21-23 nucleotide single-stranded RNAs classified as microRNAs (miRNA) perform fundamental roles in a wide range of cellular and developmental processes. miRNAs regulate protein expression through sequence-specific base pairing with target messenger RNAs (mRNA) reducing both their stability and the process of protein translation1, 2. At least 30% of protein coding genes appear to be conserved targets for miRNAs1. In contrast to the protein coding genes3, 4, no public resource of miRNA mouse mutant alleles exists. We have generated a library of highly germ-line transmissible C57BL/6N mouse mutant embryonic stem (ES) cells with targeted deletions for the majority of miRNA genes currently annotated within the miRBase registry5. These alleles have been designed to be highly adaptable research tools that can be efficiently altered to create reporter, conditional and other allelic variants. This ES cell resource can be searched electronically and is available from ES cell repositories for distribution to the scientific community6. PMID:21822254
Wan, Qiao; Chen, Shuilian; Shan, Zhihui; Yang, Zhonglu; Chen, Limiao; Zhang, Chanjuan; Yuan, Songli; Hao, Qinnan; Zhang, Xiaojuan; Qiu, Dezhen; Chen, Haifeng; Zhou, Xinan
2017-01-01
Real-time quantitative reverse transcription PCR is a sensitive and widely used technique to quantify gene expression. To achieve a reliable result, appropriate reference genes are highly required for normalization of transcripts in different samples. In this study, 9 previously published reference genes (60S, Fbox, ELF1A, ELF1B, ACT11, TUA5, UBC4, G6PD, CYP2) of soybean [Glycine max (L.) Merr.] were selected. The expression stability of the 9 genes was evaluated under conditions of biotic stress caused by infection with soybean mosaic virus, nitrogen stress, across different cultivars and developmental stages. ΔCt and geNorm algorithms were used to evaluate and rank the expression stability of the 9 reference genes. Results obtained from two algorithms showed high consistency. Moreover, results of pairwise variation showed that two reference genes were sufficient to normalize the expression levels of target genes under each experimental setting. For virus infection, ELF1A and ELF1B were the most stable reference genes for accurate normalization. For different developmental stages, Fbox and G6PD had the highest expression stability between two soybean cultivars (Tanlong No. 1 and Tanlong No. 2). ELF1B and ACT11 were identified as the most stably expressed reference genes both under nitrogen stress and among different cultivars. The results showed that none of the candidate reference genes were uniformly expressed at different conditions, and selecting appropriate reference genes was pivotal for gene expression studies with particular condition and tissue. The most stable combination of genes identified in this study will help to achieve more accurate and reliable results in a wide variety of samples in soybean.
Mutagenesis and phenotyping resources in zebrafish for studying development and human disease
Varshney, Gaurav Kumar
2014-01-01
The zebrafish (Danio rerio) is an important model organism for studying development and human disease. The zebrafish has an excellent reference genome and the functions of hundreds of genes have been tested using both forward and reverse genetic approaches. Recent years have seen an increasing number of large-scale mutagenesis projects and the number of mutants or gene knockouts in zebrafish has increased rapidly, including for the first time conditional knockout technologies. In addition, targeted mutagenesis techniques such as zinc finger nucleases, transcription activator-like effector nucleases and clustered regularly interspaced short sequences (CRISPR) or CRISPR-associated (Cas), have all been shown to effectively target zebrafish genes as well as the first reported germline homologous recombination, further expanding the utility and power of zebrafish genetics. Given this explosion of mutagenesis resources, it is now possible to perform systematic, high-throughput phenotype analysis of all zebrafish gene knockouts. PMID:24162064
Using RNA-seq data to select reference genes for normalizing gene expression in apple roots.
Zhou, Zhe; Cong, Peihua; Tian, Yi; Zhu, Yanmin
2017-01-01
Gene expression in apple roots in response to various stress conditions is a less-explored research subject. Reliable reference genes for normalizing quantitative gene expression data have not been carefully investigated. In this study, the suitability of a set of 15 apple genes were evaluated for their potential use as reliable reference genes. These genes were selected based on their low variance of gene expression in apple root tissues from a recent RNA-seq data set, and a few previously reported apple reference genes for other tissue types. Four methods, Delta Ct, geNorm, NormFinder and BestKeeper, were used to evaluate their stability in apple root tissues of various genotypes and under different experimental conditions. A small panel of stably expressed genes, MDP0000095375, MDP0000147424, MDP0000233640, MDP0000326399 and MDP0000173025 were recommended for normalizing quantitative gene expression data in apple roots under various abiotic or biotic stresses. When the most stable and least stable reference genes were used for data normalization, significant differences were observed on the expression patterns of two target genes, MdLecRLK5 (MDP0000228426, a gene encoding a lectin receptor like kinase) and MdMAPK3 (MDP0000187103, a gene encoding a mitogen-activated protein kinase). Our data also indicated that for those carefully validated reference genes, a single reference gene is sufficient for reliable normalization of the quantitative gene expression. Depending on the experimental conditions, the most suitable reference genes can be specific to the sample of interest for more reliable RT-qPCR data normalization.
Using RNA-seq data to select reference genes for normalizing gene expression in apple roots
Zhou, Zhe; Cong, Peihua; Tian, Yi
2017-01-01
Gene expression in apple roots in response to various stress conditions is a less-explored research subject. Reliable reference genes for normalizing quantitative gene expression data have not been carefully investigated. In this study, the suitability of a set of 15 apple genes were evaluated for their potential use as reliable reference genes. These genes were selected based on their low variance of gene expression in apple root tissues from a recent RNA-seq data set, and a few previously reported apple reference genes for other tissue types. Four methods, Delta Ct, geNorm, NormFinder and BestKeeper, were used to evaluate their stability in apple root tissues of various genotypes and under different experimental conditions. A small panel of stably expressed genes, MDP0000095375, MDP0000147424, MDP0000233640, MDP0000326399 and MDP0000173025 were recommended for normalizing quantitative gene expression data in apple roots under various abiotic or biotic stresses. When the most stable and least stable reference genes were used for data normalization, significant differences were observed on the expression patterns of two target genes, MdLecRLK5 (MDP0000228426, a gene encoding a lectin receptor like kinase) and MdMAPK3 (MDP0000187103, a gene encoding a mitogen-activated protein kinase). Our data also indicated that for those carefully validated reference genes, a single reference gene is sufficient for reliable normalization of the quantitative gene expression. Depending on the experimental conditions, the most suitable reference genes can be specific to the sample of interest for more reliable RT-qPCR data normalization. PMID:28934340
Mahajan, Ameya S.; Kondhare, Kirtikumar R.; Rajabhoj, Mohit P.; Kumar, Amit; Ghate, Tejashree; Ravindran, Nevedha; Habib, Farhat; Siddappa, Sundaresha; Banerjee, Anjan K.
2016-01-01
Potato Homeobox 15 (POTH15) is a KNOX-I (Knotted1-like homeobox) family gene in potato that is orthologous to Shoot Meristemless (STM) in Arabidopsis. Despite numerous reports on KNOX genes from different species, studies in potato are limited. Here, we describe photoperiodic regulation of POTH15, its overexpression phenotype, and identification of its potential targets in potato (Solanum tuberosum ssp. andigena). qRT-PCR analysis showed a higher abundance of POTH15 mRNA in shoot tips and stolons under tuber-inducing short-day conditions. POTH15 promoter activity was detected in apical and axillary meristems, stolon tips, tuber eyes, and meristems of tuber sprouts, indicating its role in meristem maintenance and leaf development. POTH15 overexpression altered multiple morphological traits including leaf and stem development, leaflet number, and number of nodes and branches. In particular, the rachis of the leaf was completely reduced and leaves appeared as a bouquet of leaflets. Comparative transcriptomic analysis of 35S::GUS and two POTH15 overexpression lines identified more than 6000 differentially expressed genes, including 2014 common genes between the two overexpression lines. Functional analysis of these genes revealed their involvement in responses to hormones, biotic/abiotic stresses, transcription regulation, and signal transduction. qRT-PCR of selected candidate target genes validated their differential expression in both overexpression lines. Out of 200 randomly chosen POTH15 targets, 173 were found to have at least one tandem TGAC core motif, characteristic of KNOX interaction, within 3.0kb in the upstream sequence of the transcription start site. Overall, this study provides insights to the role of POTH15 in controlling diverse developmental processes in potato. PMID:27217546
Shen, Jie; Li, Jia; Wang, Baoli; Jin, Hongting; Wang, Meina; Zhang, Yejia; Yang, Yunzhi; Im, Hee-Jeong; O'Keefe, Regis; Chen, Di
2013-12-01
While transforming growth factor β (TGFβ) signaling plays a critical role in chondrocyte metabolism, the TGFβ signaling pathways and target genes involved in cartilage homeostasis and the development of osteoarthritis (OA) remain unclear. Using an in vitro cell culture method and an in vivo mouse genetic approach, we undertook this study to investigate TGFβ signaling in chondrocytes and to determine whether Mmp13 and Adamts5 are critical downstream target genes of TGFβ signaling. TGFβ receptor type II (TGFβRII)-conditional knockout (KO) (TGFβRII(Col2ER)) mice were generated by breeding TGFβRII(flox/flox) mice with Col2-CreER-transgenic mice. Histologic, histomorphometric, and gene expression analyses were performed. In vitro TGFβ signaling studies were performed using chondrogenic rat chondrosarcoma cells. To determine whether Mmp13 and Adamts5 are critical downstream target genes of TGFβ signaling, TGFβRII/matrix metalloproteinase 13 (MMP-13)- and TGFβRII/ADAMTS-5-double-KO mice were generated and analyzed. Inhibition of TGFβ signaling (deletion of the Tgfbr2 gene in chondrocytes) resulted in up-regulation of Runx2, Mmp13, and Adamts5 expression in articular cartilage tissue and progressive OA development in TGFβRII(Col2ER) mice. Deletion of the Mmp13 or Adamts5 gene significantly ameliorated the OA-like phenotype induced by the loss of TGFβ signaling. Treatment of TGFβRII(Col2ER) mice with an MMP-13 inhibitor also slowed OA progression. Mmp13 and Adamts5 are critical downstream target genes involved in the TGFβ signaling pathway during the development of OA. Copyright © 2013 by the American College of Rheumatology.
Carr, Paul D.; Tuckwell, Danny; Hey, Peter M.; Simon, Laurence; d'Enfert, Christophe; Birch, Mike; Oliver, Jason D.; Bromley, Michael J.
2010-01-01
Genes that are essential for viability represent potential targets for the development of anti-infective agents. However, relatively few have been determined in the filamentous fungal pathogen Aspergillus fumigatus. A novel solution employing parasexual genetics coupled with transposon mutagenesis using the Fusarium oxysporum transposon impala had previously enabled the identification of 20 essential genes from A. fumigatus; however, further use of this system required a better understanding of the mode of action of the transposon itself. Examination of a range of conditions indicated that impala is activated by prolonged exposure to low temperatures. This newly identified property was then harnessed to identify 96 loci that are critical for viability in A. fumigatus, including genes required for RNA metabolism, organelle organization, protein transport, ribosome biogenesis, and transcription, as well as a number of noncoding RNAs. A number of these genes represent potential targets for much-needed novel antifungal drugs. PMID:20097738
A CRISPR Cas9-based gene drive platform for genetic interaction analysis in Candida albicans
Shapiro, Rebecca S.; Chavez, Alejandro; Porter, Caroline B. M.; Hamblin, Meagan; Kaas, Christian S.; DiCarlo, James E.; Zeng, Guisheng; Xu, Xiaoli; Revtovich, Alexey V.; Kirienko, Natalia V.; Wang, Yue; Church, George M.; Collins, James J.
2018-01-01
Candida albicans is the leading cause of fungal infections; yet, complex genetic interaction analysis remains cumbersome in this diploid pathogen. Here, we developed a CRISPR-Cas9-based ‘gene drive array’ (GDA) platform to facilitate efficient genetic analysis in C. albicans. In our system, a modified DNA donor molecule acts as a selfish genetic element, replaces the targeted site, and propagates to replace additional wild-type loci. Using mating-competent C. albicans haploids, each carrying a different gene drive disabling a gene of interest, we are able to create diploid strains that are homozygous double-deletion mutants. We generate double-gene deletion libraries to demonstrate this technology, targeting antifungal efflux and biofilm adhesion factors. We screen these libraries to identify virulence regulators and determine how genetic networks shift under diverse conditions. This platform transforms our ability to perform genetic interaction analysis in C. albicans and is readily extended to other fungal pathogens. PMID:29062088
The drug target genes show higher evolutionary conservation than non-target genes.
Lv, Wenhua; Xu, Yongdeng; Guo, Yiying; Yu, Ziqi; Feng, Guanglong; Liu, Panpan; Luan, Meiwei; Zhu, Hongjie; Liu, Guiyou; Zhang, Mingming; Lv, Hongchao; Duan, Lian; Shang, Zhenwei; Li, Jin; Jiang, Yongshuai; Zhang, Ruijie
2016-01-26
Although evidence indicates that drug target genes share some common evolutionary features, there have been few studies analyzing evolutionary features of drug targets from an overall level. Therefore, we conducted an analysis which aimed to investigate the evolutionary characteristics of drug target genes. We compared the evolutionary conservation between human drug target genes and non-target genes by combining both the evolutionary features and network topological properties in human protein-protein interaction network. The evolution rate, conservation score and the percentage of orthologous genes of 21 species were included in our study. Meanwhile, four topological features including the average shortest path length, betweenness centrality, clustering coefficient and degree were considered for comparison analysis. Then we got four results as following: compared with non-drug target genes, 1) drug target genes had lower evolutionary rates; 2) drug target genes had higher conservation scores; 3) drug target genes had higher percentages of orthologous genes and 4) drug target genes had a tighter network structure including higher degrees, betweenness centrality, clustering coefficients and lower average shortest path lengths. These results demonstrate that drug target genes are more evolutionarily conserved than non-drug target genes. We hope that our study will provide valuable information for other researchers who are interested in evolutionary conservation of drug targets.
Willcocks, Samuel J; Stabler, Richard A; Atkins, Helen S; Oyston, Petra F; Wren, Brendan W
2018-05-31
Yersinia pseudotuberculosis is a zoonotic pathogen, causing mild gastrointestinal infection in humans. From this comparatively benign pathogenic species emerged the highly virulent plague bacillus, Yersinia pestis, which has experienced significant genetic divergence in a relatively short time span. Much of our knowledge of Yersinia spp. evolution stems from genomic comparison and gene expression studies. Here we apply transposon-directed insertion site sequencing (TraDIS) to describe the essential gene set of Y. pseudotuberculosis IP32953 in optimised in vitro growth conditions, and contrast these with the published essential genes of Y. pestis. The essential genes of an organism are the core genetic elements required for basic survival processes in a given growth condition, and are therefore attractive targets for antimicrobials. One such gene we identified is yptb3665, which encodes a peptide deformylase, and here we report for the first time, the sensitivity of Y. pseudotuberculosis to actinonin, a deformylase inhibitor. Comparison of the essential genes of Y. pseudotuberculosis with those of Y. pestis revealed the genes whose importance are shared by both species, as well as genes that were differentially required for growth. In particular, we find that the two species uniquely rely upon different iron acquisition and respiratory metabolic pathways under similar in vitro conditions. The discovery of uniquely essential genes between the closely related Yersinia spp. represent some of the fundamental, species-defining points of divergence that arose during the evolution of Y. pestis from its ancestor. Furthermore, the shared essential genes represent ideal candidates for the development of novel antimicrobials against both species.
Differential co-expression analysis of rheumatoid arthritis with microarray data.
Wang, Kunpeng; Zhao, Liqiang; Liu, Xuefeng; Hao, Zhenyong; Zhou, Yong; Yang, Chuandong; Li, Hongqiang
2014-11-01
The aim of the present study was to investigate the underlying molecular mechanisms of rheumatoid arthritis (RA) using microarray expression profiles from osteoarthritis and RA patients, to improve diagnosis and treatment strategies for the condition. The gene expression profile of GSE27390 was downloaded from Gene Expression Omnibus, including 19 samples from patients with RA (n=9) or osteoarthritis (n=10). Firstly, the differentially expressed genes (DEGs) were obtained with the thresholds of |logFC|>1.0 and P<0.05, using the t‑test method in LIMMA package. Then, differentially co-expressed genes (DCGs) and differentially co-expressed links (DCLs) were screened with q<0.25 by the differential coexpression analysis and differential regulation analysis of gene expression microarray data package. Secondly, pathway enrichment analysis for DCGs was performed by the Database for Annotation, Visualization and Integrated Discovery and the DCLs associated with RA were selected by comparing the obtained DCLs with known transcription factor (TF)-targets in the TRANSFAC database. Finally, the obtained TFs were mapped to the known TF-targets to construct the network using cytoscape software. A total of 1755 DEGs, 457 DCGs and 101988 DCLs were achieved and there were 20 TFs in the obtained six TF-target relations (STAT3-TNF, PBX1‑PLAU, SOCS3-STAT3, GATA1-ETS2, ETS1-ICAM4 and CEBPE‑GATA1) and 457 DCGs. A number of TF-target relations in the constructed network were not within DCLs when the TF and target gene were DCGs. The identified TFs may have an important role in the pathogenesis of RA and have the potential to be used as biomarkers for the development of novel diagnostic and therapeutic strategies for RA.
Hibio, Naoki; Hino, Kimihiro; Shimizu, Eigo; Nagata, Yoshiro; Ui-Tei, Kumiko
2012-01-01
MicroRNAs (miRNAs) are key regulators of sequence-specific gene silencing. However, crucial factors that determine the efficacy of miRNA-mediated target gene silencing are poorly understood. Here we mathematized base-pairing stability and showed that miRNAs with an unstable 5′ terminal duplex and stable seed-target duplex exhibit strong silencing activity. The results are consistent with the previous findings that an RNA strand with unstable 5′ terminal in miRNA duplex easily loads onto the RNA-induced silencing complex (RISC), and miRNA recognizes target mRNAs with seed-complementary sequences to direct posttranscriptional repression. Our results suggested that both the unwinding and target recognition processes of miRNAs could be proficiently controlled by the thermodynamics of base-pairing in protein-free condition. Interestingly, such thermodynamic parameters might be evolutionarily well adapted to the body temperatures of various species. PMID:23251782
Horvath, David P; Hansen, Stephanie A; Moriles-Miller, Janet P; Pierik, Ronald; Yan, Changhui; Clay, David E; Scheffler, Brian; Clay, Sharon A
2015-07-01
Weeds reduce yield in soybeans (Glycine max) through incompletely defined mechanisms. The effects of weeds on the soybean transcriptome were evaluated in field conditions during four separate growing seasons. RNASeq data were collected from six biological samples of soybeans growing with or without weeds. Weed species and the methods to maintain weed-free controls varied between years to mitigate treatment effects, and to allow detection of general soybean weed responses. Soybean plants were not visibly nutrient- or water-stressed. We identified 55 consistently downregulated genes in weedy plots. Many of the downregulated genes were heat shock genes. Fourteen genes were consistently upregulated. Several transcription factors including a PHYTOCHROME INTERACTING FACTOR 3-like gene (PIF3) were included among the upregulated genes. Gene set enrichment analysis indicated roles for increased oxidative stress and jasmonic acid signaling responses during weed stress. The relationship of this weed-induced PIF3 gene to genes involved in shade avoidance responses in Arabidopsis provide evidence that this gene may be important in the response of soybean to weeds. These results suggest that the weed-induced PIF3 gene will be a target for manipulating weed tolerance in soybean. No claim to original US government works New Phytologist © 2015 New Phytologist Trust.
NASA Astrophysics Data System (ADS)
Lee, Ja-Yun; Wu, Tzong-Yuan; Hsu, I.-Jen
2008-04-01
The cloning and transcription techniques on gene cloned fluorescent proteins have been widely used in many applications. They have been used as reporters of some conditions in a series of reactions. However, it is usually difficult to monitor the specific target with the exactly number of proteins during the process in turbid media, especially at micrometer scales. We successfully revealed an alternative way to monitor the cell cycle behavior and quantitatively analyzed the target cells with green and red fluorescent proteins (GFP and RFP) during different phases of the cell cycle by quantitatively analyzing its behavior and also monitoring its spatial distribution.
Anti-Inflammatory Nutrition as a Pharmacological Approach to Treat Obesity
Sears, Barry; Ricordi, Camillo
2011-01-01
Obesity is a multifactorial condition resulting from improper balances of hormones and gene expression induced by the diet. Obesity also has a strong inflammatory component that can be driven by diet-induced increases in arachidonic acid. The purpose of this paper is to discuss the molecular targets that can be addressed by anti-inflammatory nutrition. These molecular targets range from reduction of proinflammatory eicosanoids to the modulation of features of the innate immune system, such as toll-like receptors and gene transcription factors. From knowledge of the impact of these dietary nutrients on these various molecular targets, it becomes possible to develop a general outline of an anti-inflammatory diet that can offer a unique synergism with more traditional pharmacological approaches in treating obesity and its associated comorbidities. PMID:20953366
Rapid depletion of budding yeast proteins by fusion to a heat-inducible degron.
Sanchez-Diaz, Alberto; Kanemaki, Masato; Marchesi, Vanessa; Labib, Karim
2004-03-02
One effective way to study the biological function of a protein in vivo is to inactivate it and see what happens to the cell. For proteins that are dispensable for cell viability, the corresponding gene can simply be deleted from its chromosomal locus. The study of essential proteins is more challenging, however, because the function of the protein must be inactivated conditionally. Here, we describe a method that allows the target protein to be depleted rapidly and conditionally, so that the immediate effects on the cell can be examined. The chromosomal locus of a budding yeast gene is modified so that a "heat-inducible degron cassette" is added to the N terminus of the encoded protein, causing it to be degraded by a specific ubiquitin-mediated pathway when cells are shifted from 24 degrees to 37 degrees C. Degradation requires recognition of the degron cassette by the evolutionarily conserved Ubr1 protein, which is associated with a ubiquitin-conjugating enzyme. To promote rapid and conditional depletion of the target protein, we use a yeast strain in which expression of the UBR1 gene can be either repressed or strongly induced. Degron strains are constructed by a simple "one-step" approach using the polymerase chain reaction.
Subclinical Pregnancy Toxemia-Induced Gene Expression Changes in Ovine Placenta and Uterus
Kasimanickam, Ramanathan K.
2016-01-01
The objective was to elucidate gene expression differences in uterus, caruncle, and cotyledon of ewes with subclinical pregnancy toxemia (SCPT) and healthy ewes, and to identify associated biological functions and pathways involved in pregnancy toxemia. On Day 136 (±1 day) post-breeding, ewes (n = 18) had body condition score (BCS; 1–5; 1, emaciated; 5, obese) assessed, and blood samples were collected for plasma glucose and β-hydroxybutyrate (BHBA) analyses. The ewes were euthanized, and tissue samples were collected from the gravid uterus and placentomes. Based on BCS (2.0 ± 0.02), glucose (2.4 ± 0.33), and BHBA (0.97 ± 0.06) concentrations, ewes (n = 10) were grouped as healthy (n = 5) and subclinical SCPT (n = 5) ewes. The mRNA expressions were determined by quantitative PCR method, and prediction of miRNA partners and target genes for the predicted miRNA were identified using miRDB (http://mirdb.org/miRDB/). Top ranked target genes were used to identify associated biological functions and pathways in response to SPCT using PANTHER. The angiogenesis genes VEGF and PlGF, and AdipoQ, AdipoR2, PPARG, LEP, IGF1, IGF2, IL1b, and TNFα mRNA expressions were lower in abundances, whereas hypoxia genes eNOS, HIF1a, and HIF 2a, and sFlt1 and KDR mRNA expressions were greater in abundances in uterus and placenta of SCPT ewes compared to healthy ewes (P < 0.05). The predicted miRNA and associated target genes contributed to several biological processes, including apoptosis, biological adhesion, biological regulation, cellular component biogenesis, cellular process, developmental process, immune system process, localization, metabolic process, multicellular organismal process, reproduction, and response to stimulus. The target genes were involved in several pathways including angiogenesis, cytoskeletal regulation, hypoxia response via HIF activation, interleukin signaling, ubiquitin proteasome, and VEGF signaling pathway. In conclusion, genes associated with blood vessel remodeling were lower in abundances and that the genes associated with hypoxic conditions were greater in abundances in the uteroplacental compartment of SCPT ewes. It is obvious that the factors that influence placental vascular development and angiogenesis as noted in this study set the course for hemodynamic changes and hence have a major impact on the rate of transplacental nutrient exchange, fetal growth, and health of the dam. PMID:27626035
Randise-Hinchliff, Carlo; Coukos, Robert; Sood, Varun; Sumner, Michael Chas; Zdraljevic, Stefan; Meldi Sholl, Lauren; Garvey Brickner, Donna; Ahmed, Sara; Watchmaker, Lauren; Brickner, Jason H
2016-03-14
In budding yeast, targeting of active genes to the nuclear pore complex (NPC) and interchromosomal clustering is mediated by transcription factor (TF) binding sites in the gene promoters. For example, the binding sites for the TFs Put3, Ste12, and Gcn4 are necessary and sufficient to promote positioning at the nuclear periphery and interchromosomal clustering. However, in all three cases, gene positioning and interchromosomal clustering are regulated. Under uninducing conditions, local recruitment of the Rpd3(L) histone deacetylase by transcriptional repressors blocks Put3 DNA binding. This is a general function of yeast repressors: 16 of 21 repressors blocked Put3-mediated subnuclear positioning; 11 of these required Rpd3. In contrast, Ste12-mediated gene positioning is regulated independently of DNA binding by mitogen-activated protein kinase phosphorylation of the Dig2 inhibitor, and Gcn4-dependent targeting is up-regulated by increasing Gcn4 protein levels. These different regulatory strategies provide either qualitative switch-like control or quantitative control of gene positioning over different time scales. © 2016 Randise-Hinchliff et al.
Hossain, M A Motalib; Ali, Md Eaqub; Hamid, Sharifah Bee Abd; Hossain, S M Azad; Asing; Nizar, Nina Naquiah Ahmad; Uddin, Mohammad Nasir; Ali, Lokman; Asaduzzaman, Md; Akanda, Md Jahurul Haque
2017-06-01
Replacement of beef by buffalo and vice versa is frequent in global markets, but their authentication is challenging in processed foods due to the fragmentation of most biomarkers including DNA. The shortening of target sequences through use of two target sites might ameliorate assay reliability because it is highly unlikely that both targets will be lost during food processing. For the first time, we report a tetraplex polymerase chain reaction (PCR) assay targeting two different DNA regions in beef (106 and 120-bp) and buffalo (90 and 138-bp) mitochondrial genes to discriminate beef and buffalo in processed foods. All targets were stable under boiling, autoclaving and microwave cooking conditions. A survey in Malaysian markets revealed 71% beef curries contained buffalo but there was no buffalo in beef burgers. The assay detected down to 0.01ng DNA and 1% meat in admixed and burger products. Copyright © 2016 Elsevier Ltd. All rights reserved.
Quadros, Rolen M; Miura, Hiromi; Harms, Donald W; Akatsuka, Hisako; Sato, Takehito; Aida, Tomomi; Redder, Ronald; Richardson, Guy P; Inagaki, Yutaka; Sakai, Daisuke; Buckley, Shannon M; Seshacharyulu, Parthasarathy; Batra, Surinder K; Behlke, Mark A; Zeiner, Sarah A; Jacobi, Ashley M; Izu, Yayoi; Thoreson, Wallace B; Urness, Lisa D; Mansour, Suzanne L; Ohtsuka, Masato; Gurumurthy, Channabasavaiah B
2017-05-17
Conditional knockout mice and transgenic mice expressing recombinases, reporters, and inducible transcriptional activators are key for many genetic studies and comprise over 90% of mouse models created. Conditional knockout mice are generated using labor-intensive methods of homologous recombination in embryonic stem cells and are available for only ~25% of all mouse genes. Transgenic mice generated by random genomic insertion approaches pose problems of unreliable expression, and thus there is a need for targeted-insertion models. Although CRISPR-based strategies were reported to create conditional and targeted-insertion alleles via one-step delivery of targeting components directly to zygotes, these strategies are quite inefficient. Here we describe Easi-CRISPR (Efficient additions with ssDNA inserts-CRISPR), a targeting strategy in which long single-stranded DNA donors are injected with pre-assembled crRNA + tracrRNA + Cas9 ribonucleoprotein (ctRNP) complexes into mouse zygotes. We show for over a dozen loci that Easi-CRISPR generates correctly targeted conditional and insertion alleles in 8.5-100% of the resulting live offspring. Easi-CRISPR solves the major problem of animal genome engineering, namely the inefficiency of targeted DNA cassette insertion. The approach is robust, succeeding for all tested loci. It is versatile, generating both conditional and targeted insertion alleles. Finally, it is highly efficient, as treating an average of only 50 zygotes is sufficient to produce a correctly targeted allele in up to 100% of live offspring. Thus, Easi-CRISPR offers a comprehensive means of building large-scale Cre-LoxP animal resources.
Puniya, Bhanwar Lal; Allen, Laura; Hochfelder, Colleen; Majumder, Mahbubul; Helikar, Tomáš
2016-01-01
Dysregulation in signal transduction pathways can lead to a variety of complex disorders, including cancer. Computational approaches such as network analysis are important tools to understand system dynamics as well as to identify critical components that could be further explored as therapeutic targets. Here, we performed perturbation analysis of a large-scale signal transduction model in extracellular environments that stimulate cell death, growth, motility, and quiescence. Each of the model’s components was perturbed under both loss-of-function and gain-of-function mutations. Using 1,300 simulations under both types of perturbations across various extracellular conditions, we identified the most and least influential components based on the magnitude of their influence on the rest of the system. Based on the premise that the most influential components might serve as better drug targets, we characterized them for biological functions, housekeeping genes, essential genes, and druggable proteins. The most influential components under all environmental conditions were enriched with several biological processes. The inositol pathway was found as most influential under inactivating perturbations, whereas the kinase and small lung cancer pathways were identified as the most influential under activating perturbations. The most influential components were enriched with essential genes and druggable proteins. Moreover, known cancer drug targets were also classified in influential components based on the affected components in the network. Additionally, the systemic perturbation analysis of the model revealed a network motif of most influential components which affect each other. Furthermore, our analysis predicted novel combinations of cancer drug targets with various effects on other most influential components. We found that the combinatorial perturbation consisting of PI3K inactivation and overactivation of IP3R1 can lead to increased activity levels of apoptosis-related components and tumor-suppressor genes, suggesting that this combinatorial perturbation may lead to a better target for decreasing cell proliferation and inducing apoptosis. Finally, our approach shows a potential to identify and prioritize therapeutic targets through systemic perturbation analysis of large-scale computational models of signal transduction. Although some components of the presented computational results have been validated against independent gene expression data sets, more laboratory experiments are warranted to more comprehensively validate the presented results. PMID:26904540
He, Hua; Liang, Gang; Li, Yang; Wang, Fang; Yu, Diqiu
2014-01-01
Nitrogen is an essential macronutrient required for plant growth and development. A number of genes respond to nitrogen starvation conditions. However, the functions of most of these nitrogen starvation-responsive genes are unclear. Our recent survey suggested that many microRNAs (miRNAs) are responsive to nitrogen starvation in Arabidopsis thaliana. Here, we identified a new miRNA (miR5090) from the complementary transcript of the MIR826 gene. Further investigation uncovered that both miRNA genes recently evolved from the inverse duplication of their common target gene, ALKENYL HYDROXALKYL PRODUCING2 (AOP2). Similar to miR826, miR5090 is induced by nitrogen starvation. By contrast, the AOP2 transcript level was negatively correlated with miR826 and miR5090 under nitrogen starvation. GUS-fused AOP2 expression suggested that AOP2 was posttranscriptionally suppressed by miR826 and miR5090. miRNA transgenic plants with significantly low AOP2 expression accumulated fewer Met-derived glucosinolates, phenocopying the aop2 mutants. Most glucosinolate synthesis-associated genes were repressed under nitrogen starvation conditions. Furthermore, miRNA transgenic plants with less glucosinolate displayed enhanced tolerance to nitrogen starvation, including high biomass, more lateral roots, increased chlorophyll, and decreased anthocyanin. Meanwhile, nitrogen starvation-responsive genes were up-regulated in transgenic plants, implying improved nitrogen uptake activity. Our study reveals a mechanism by which Arabidopsis thaliana regulates the synthesis of glucosinolates to adapt to environmental changes in nitrogen availability. PMID:24367020
Exploring the roles of DNA methylation in the metal-reducing bacterium Shewanella oneidensis MR-1
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bendall, Matthew L.; Luong, Khai; Wetmore, Kelly M.
2013-08-30
We performed whole genome analyses of DNA methylation in Shewanella 17 oneidensis MR-1 to examine its possible role in regulating gene expression and 18 other cellular processes. Single-Molecule Real Time (SMRT) sequencing 19 revealed extensive methylation of adenine (N6mA) throughout the 20 genome. These methylated bases were located in five sequence motifs, 21 including three novel targets for Type I restriction/modification enzymes. The 22 sequence motifs targeted by putative methyltranferases were determined via 23 SMRT sequencing of gene knockout mutants. In addition, we found S. 24 oneidensis MR-1 cultures grown under various culture conditions displayed 25 different DNA methylation patterns.more » However, the small number of differentially 26 methylated sites could not be directly linked to the much larger number of 27 differentially expressed genes in these conditions, suggesting DNA methylation is 28 not a major regulator of gene expression in S. oneidensis MR-1. The enrichment 29 of methylated GATC motifs in the origin of replication indicate DNA methylation 30 may regulate genome replication in a manner similar to that seen in Escherichia 31 coli. Furthermore, comparative analyses suggest that many 32 Gammaproteobacteria, including all members of the Shewanellaceae family, may 33 also utilize DNA methylation to regulate genome replication.« less
Shibata, Masahiro; Hayashi, Masayuki; Oe, Mika; Ojima, Koichi
2016-01-01
We aimed to understand the roles of miRNAs in the muscle tissue maturation and those of circulating microRNAs (c-miRNAs) in beef production of Japanese Black (JB) cattle (Wagyu), a breed with genetically background of superior intermuscular fat depot, by comparing different feeding conditions (indoor grain-feeding vs. grazing on pasture). The cattle at 18 months old were assigned to pasture feeding or conventional indoor grain feeding conditions for 5 months. Microarray analysis of c-miRNAs from the plasma extracellular vesicles led to the detection of a total of 202 bovine miRNAs in the plasma, including 15 miRNAs that differed between the feeding conditions. Validation of the microarray results by qPCR showed that the circulating miR-10b level in the grazing cattle was upregulated compared to that of the grain-fed cattle. In contrast, the levels of miR-17-5p, miR-19b, miR-29b, miR-30b-5p, miR-98, miR-142-5p, miR-301a, miR-374b, miR-425-5p, and miR-652 were lower in the grazing cattle than in the grain-fed cattle. Bioinformatic analysis indicated that the predicted target genes of those c-miRNAs were enriched in gene ontology terms associated with blood vessel morphogenesis, plasma membrane, focal adhesion, endocytosis, collagen, ECM-receptor interaction, and phosphorylation. In the grazing cattle, the elevation of miR-10b expression in the plasma was coincident with its elevation in the longissimus lumborum (LL) muscle. Expression of bovine-specific miR-2478, the most plasma-enriched miRNA, tended to be also upregulated in the muscle but not in the plasma. Furthermore, grazing caused the downregulated mRNA expression of predicted miR-10b and/or miR-2478 target genes, such as DNAJB2, PTEN, and SCD1. Thus, the feeding system used for JB cattle affected the c-miRNAs that could be indicators of grain feeding. Among these, miR-10b expression was especially associated with feeding-induced changes and with the expression of the potential target genes responsible for glucose homeostasis and intramuscular fat depot in the LL muscle of JB cattle. PMID:27611783
Kim, Nari; Sun, Hwa-Young; Youn, Min-Young; Yoo, Joo-Yeon
2013-04-01
To determine the functional specificity of inflammation, it is critical to orchestrate the timely activation and repression of inflammatory responses. Here, we explored the PAF1 (RNA polymerase II associated factor)-mediated signal- and locus-specific repression of genes induced through the pro-inflammatory cytokine interleukin (IL)-1β. Using microarray analysis, we identified the PAF1 target genes whose expression was further enhanced by PAF1 knockdown in IL-1β-stimulated HepG2 hepatocarcinomas. PAF1 bound near the transcription start sites of target genes and dissociated on stimulation. In PAF1-deficient cells, more elongating RNA polymerase II and acetylated histones were observed, although IL-1β-mediated activation and recruitment of nuclear factor κB (NF-κB) were not altered. Under basal conditions, PAF1 blocked histone acetyltransferase general control non-depressible 5 (GCN5)-mediated acetylation on H3K9 and H4K5 residues. On IL-1β stimulation, activated GCN5 discharged PAF1 from chromatin, allowing productive transcription to occur. PAF1 bound to histones but not to acetylated histones, and the chromatin-binding domain of PAF1 was essential for target gene repression. Moreover, IL-1β-induced cell migration was similarly controlled through counteraction between PAF1 and GCN5. These results suggest that the IL-1β signal-specific exchange of PAF1 and GCN5 on the target locus limits inappropriate gene induction and facilitates the timely activation of inflammatory responses.
SNP discovery in candidate adaptive genes using exon capture in a free-ranging alpine ungulate
Roffler, Gretchen H.; Amish, Stephen J.; Smith, Seth; Cosart, Ted F.; Kardos, Marty; Schwartz, Michael K.; Luikart, Gordon
2016-01-01
Identification of genes underlying genomic signatures of natural selection is key to understanding adaptation to local conditions. We used targeted resequencing to identify SNP markers in 5321 candidate adaptive genes associated with known immunological, metabolic and growth functions in ovids and other ungulates. We selectively targeted 8161 exons in protein-coding and nearby 5′ and 3′ untranslated regions of chosen candidate genes. Targeted sequences were taken from bighorn sheep (Ovis canadensis) exon capture data and directly from the domestic sheep genome (Ovis aries v. 3; oviAri3). The bighorn sheep sequences used in the Dall's sheep (Ovis dalli dalli) exon capture aligned to 2350 genes on the oviAri3 genome with an average of 2 exons each. We developed a microfluidic qPCR-based SNP chip to genotype 476 Dall's sheep from locations across their range and test for patterns of selection. Using multiple corroborating approaches (lositan and bayescan), we detected 28 SNP loci potentially under selection. We additionally identified candidate loci significantly associated with latitude, longitude, precipitation and temperature, suggesting local environmental adaptation. The three methods demonstrated consistent support for natural selection on nine genes with immune and disease-regulating functions (e.g. Ovar-DRA, APC, BATF2, MAGEB18), cell regulation signalling pathways (e.g. KRIT1, PI3K, ORRC3), and respiratory health (CYSLTR1). Characterizing adaptive allele distributions from novel genetic techniques will facilitate investigation of the influence of environmental variation on local adaptation of a northern alpine ungulate throughout its range. This research demonstrated the utility of exon capture for gene-targeted SNP discovery and subsequent SNP chip genotyping using low-quality samples in a nonmodel species.
Kammermeier, Jochen; Drury, Suzanne; James, Chela T; Dziubak, Robert; Ocaka, Louise; Elawad, Mamoun; Beales, Philip; Lench, Nicholas; Uhlig, Holm H; Bacchelli, Chiara; Shah, Neil
2014-11-01
Multiple monogenetic conditions with partially overlapping phenotypes can present with inflammatory bowel disease (IBD)-like intestinal inflammation. With novel genotype-specific therapies emerging, establishing a molecular diagnosis is becoming increasingly important. We have introduced targeted next-generation sequencing (NGS) technology as a prospective screening tool in children with very early onset IBD (VEOIBD). We evaluated the coverage of 40 VEOIBD genes in two separate cohorts undergoing targeted gene panel sequencing (TGPS) (n=25) and whole exome sequencing (WES) (n=20). TGPS revealed causative mutations in four genes (IL10RA, EPCAM, TTC37 and SKIV2L) discovered unexpected phenotypes and directly influenced clinical decision making by supporting as well as avoiding haematopoietic stem cell transplantation. TGPS resulted in significantly higher median coverage when compared with WES, fewer coverage deficiencies and improved variant detection across established VEOIBD genes. Excluding or confirming known VEOIBD genotypes should be considered early in the disease course in all cases of therapy-refractory VEOIBD, as it can have a direct impact on patient management. To combine both described NGS technologies would compensate for the limitations of WES for disease-specific application while offering the opportunity for novel gene discovery in the research setting. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.
Fisher, Cynthia L; Marks, Hendrik; Cho, Lily Ting-Yin; Andrews, Robert; Wormald, Sam; Carroll, Thomas; Iyer, Vivek; Tate, Peri; Rosen, Barry; Stunnenberg, Hendrik G; Fisher, Amanda G; Skarnes, William C
2017-12-01
Mouse embryonic stem (ES) cells are a popular model system to study biological processes, though uncovering recessive phenotypes requires inactivating both alleles. Building upon resources from the International Knockout Mouse Consortium (IKMC), we developed a targeting vector for second allele inactivation in conditional-ready IKMC 'knockout-first' ES cell lines. We applied our technology to several epigenetic regulators, recovering bi-allelic targeted clones with a high efficiency of 60% and used Flp recombinase to restore expression in two null cell lines to demonstrate how our system confirms causality through mutant phenotype reversion. We designed our strategy to select against re-targeting the 'knockout-first' allele and identify essential genes in ES cells, including the histone methyltransferase Setdb1. For confirmation, we exploited the flexibility of our system, enabling tamoxifen inducible conditional gene ablation while controlling for genetic background and tamoxifen effects. Setdb1 ablated ES cells exhibit severe growth inhibition, which is not rescued by exogenous Nanog expression or culturing in naive pluripotency '2i' media, suggesting that the self-renewal defect is mediated through pluripotency network independent pathways. Our strategy to generate null mutant mouse ES cells is applicable to thousands of genes and repurposes existing IKMC Intermediate Vectors. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Sun, Di; Wang, Qian; Chen, Zhi; Li, Jilun; Wen, Ying
2017-01-01
Alternative σ factors in bacteria redirect RNA polymerase to recognize alternative promoters, thereby facilitating coordinated gene expression necessary for adaptive responses. The gene sig8 ( sav_741 ) in Streptomyces avermitilis encodes an alternative σ factor, σ 8 , highly homologous to σ B in Streptomyces coelicolor . Studies reported here demonstrate that σ 8 is an important regulator of both avermectin production and stress responses in S. avermitilis . σ 8 inhibited avermectin production by indirectly repressing expression of cluster-situated activator gene aveR , and by directly initiating transcription of its downstream gene sav_742 , which encodes a direct repressor of ave structural genes. σ 8 had no effect on cell growth or morphological differentiation under normal growth conditions. Growth of a sig8- deletion mutant was less than that of wild-type strain on YMS plates following treatment with heat, H 2 O 2 , diamide, NaCl, or KCl. sig8 transcription was strongly induced by these environmental stresses, indicating response by σ 8 itself. A series of σ 8 -dependent genes responsive to heat, oxidative and osmotic stress were identified by EMSAs, qRT-PCR and in vitro transcription experiments. These findings indicate that σ 8 plays an important role in mediating protective responses to various stress conditions by activating transcription of its target genes. Six σ 8 -binding promoter sequences were determined and consensus binding sequence BGVNVH-N 15 -GSNNHH (B: C, T or G, V: A, C or G, S: C or G, H: A, C or T, N: any nucleotide) was identified, leading to prediction of the σ 8 regulon. The list consists of 940 putative σ 8 target genes, assignable to 17 functional groups, suggesting the wide range of cellular functions controlled by σ 8 in S. avermitilis .
Gambone, Julia E.; Dusaban, Stephanie S.; Loperena, Roxana; Nakata, Yuji
2011-01-01
The requirement of c-Myb during erythropoiesis spurred an interest in identifying c-Myb target genes that are important for erythroid development. Here, we determined that the neuropeptide neuromedin U (NmU) is a c-Myb target gene. Silencing NmU, c-myb, or NmU's cognate receptor NMUR1 expression in human CD34+ cells impaired burst-forming unit-erythroid (BFU-E) and colony-forming unit-erythroid (CFU-E) formation compared with control. Exogenous addition of NmU peptide to NmU or c-myb siRNA-treated CD34+ cells rescued BFU-E and yielded a greater number of CFU-E than observed with control. No rescue of BFU-E and CFU-E growth was observed when NmU peptide was exogenously added to NMUR1 siRNA-treated cells compared with NMUR1 siRNA-treated cells cultured without NmU peptide. In K562 and CD34+ cells, NmU activated protein kinase C-βII, a factor associated with hematopoietic differentiation-proliferation. CD34+ cells cultured under erythroid-inducing conditions, with NmU peptide and erythropoietin added at day 6, revealed an increase in endogenous NmU and c-myb gene expression at day 8 and a 16% expansion of early erythroblasts at day 10 compared to cultures without NmU peptide. Combined, these data strongly support that the c-Myb target gene NmU functions as a novel cofactor for erythropoiesis and expands early erythroblasts. PMID:21378276
A Machine Learning Approach to Predict Gene Regulatory Networks in Seed Development in Arabidopsis
Ni, Ying; Aghamirzaie, Delasa; Elmarakeby, Haitham; Collakova, Eva; Li, Song; Grene, Ruth; Heath, Lenwood S.
2016-01-01
Gene regulatory networks (GRNs) provide a representation of relationships between regulators and their target genes. Several methods for GRN inference, both unsupervised and supervised, have been developed to date. Because regulatory relationships consistently reprogram in diverse tissues or under different conditions, GRNs inferred without specific biological contexts are of limited applicability. In this report, a machine learning approach is presented to predict GRNs specific to developing Arabidopsis thaliana embryos. We developed the Beacon GRN inference tool to predict GRNs occurring during seed development in Arabidopsis based on a support vector machine (SVM) model. We developed both global and local inference models and compared their performance, demonstrating that local models are generally superior for our application. Using both the expression levels of the genes expressed in developing embryos and prior known regulatory relationships, GRNs were predicted for specific embryonic developmental stages. The targets that are strongly positively correlated with their regulators are mostly expressed at the beginning of seed development. Potential direct targets were identified based on a match between the promoter regions of these inferred targets and the cis elements recognized by specific regulators. Our analysis also provides evidence for previously unknown inhibitory effects of three positive regulators of gene expression. The Beacon GRN inference tool provides a valuable model system for context-specific GRN inference and is freely available at https://github.com/BeaconProjectAtVirginiaTech/beacon_network_inference.git. PMID:28066488
Asgeirsdóttir, Sigridur A; Talman, Eduard G; de Graaf, Inge A; Kamps, Jan A A M; Satchell, Simon C; Mathieson, Peter W; Ruiters, Marcel H J; Molema, Grietje
2010-01-25
Applications of small-interfering RNA (siRNA) call for specific and efficient delivery of siRNA into particular cell types. We developed a novel, non-viral targeting system to deliver siRNA specifically into inflammation-activated endothelial cells. This was achieved by conjugating the cationic amphiphilic lipid SAINT to antibodies recognizing the inflammatory cell adhesion molecule E-selectin. These anti-E-selectin-SAINT lipoplexes (SAINTarg) maintained antigen recognition capacity of the parental antibody in vitro, and ex vivo in human kidney tissue slices subjected to inflammatory conditions. Regular SAINT mediated transfection resulted in efficient gene silencing in human microvascular endothelial cells (HMEC-1) and conditionally immortalized glomerular endothelial cells (ciGEnC). However, primary human umbilical vein endothelial cells (HUVEC) transfected poorly, a phenomenon that we could quantitatively correlate with a cell-type specific capacity to facilitate siRNA uptake. Importantly, SAINTarg increased siRNA uptake and transfection specificity for activated endothelial cells. Transfection with SAINTarg delivered significantly more siRNA into activated HUVEC, compared to transfection with non-targeted SAINT. The enhanced uptake of siRNA was corroborated by improved silencing of both gene- and protein expression of VE-cadherin in activated HUVEC, indicating that SAINTarg delivered functionally active siRNA into endothelial cells. The obtained results demonstrate a successful design of a small nucleotide carrier system with improved and specific siRNA delivery into otherwise difficult-to-transfect primary endothelial cells, which in addition reduced considerably the amount of siRNA needed for gene silencing. Copyright 2009 Elsevier B.V. All rights reserved.
Keshri, Jitendra; Mishra, Avinash; Jha, Bhavanath
2013-03-30
Population indices of bacteria and archaea were investigated from saline-alkaline soil and a possible microbe-environment pattern was established using gene targeted metagenomics. Clone libraries were constructed using 16S rRNA and functional gene(s) involved in carbon fixation (cbbL), nitrogen fixation (nifH), ammonia oxidation (amoA) and sulfur metabolism (apsA). Molecular phylogeny revealed the dominance of Actinobacteria, Firmicutes and Proteobacteria along with archaeal members of Halobacteraceae. The library consisted of novel bacterial (20%) and archaeal (38%) genera showing ≤95% similarity to previously retrieved sequences. Phylogenetic analysis indicated ability of inhabitant to survive in stress condition. The 16S rRNA gene libraries contained novel gene sequences and were distantly homologous with cultured bacteria. Functional gene libraries were found unique and most of the clones were distantly related to Proteobacteria, while clones of nifH gene library also showed homology with Cyanobacteria and Firmicutes. Quantitative real-time PCR exhibited that bacterial abundance was two orders of magnitude higher than archaeal. The gene(s) quantification indicated the size of the functional guilds harboring relevant key genes. The study provides insights on microbial ecology and different metabolic interactions occurring in saline-alkaline soil, possessing phylogenetically diverse groups of bacteria and archaea, which may be explored further for gene cataloging and metabolic profiling. Copyright © 2012 Elsevier GmbH. All rights reserved.
Pathway-selective sensitization of Mycobacterium tuberculosis for target-based whole-cell screening
Abrahams, Garth L.; Kumar, Anuradha; Savvi, Suzana; Hung, Alvin W.; Wen, Shijun; Abell, Chris; Barry, Clifton E.; Sherman, David R.; Boshoff, Helena I.M.; Mizrahi, Valerie
2012-01-01
SUMMARY Whole-cell screening of Mycobacterium tuberculosis (Mtb) remains a mainstay of drug discovery but subsequent target elucidation often proves difficult. Conditional mutants that under-express essential genes have been used to identify compounds with known mechanism of action by target-based whole-cell screening (TB-WCS). Here, the feasibility of TB-WCS in Mtb was assessed by generating mutants that conditionally express pantothenate synthetase (panC), diaminopimelate decarboxylase (lysA) and isocitrate lyase (icl1). The essentiality of panC and lysA, and conditional essentiality of icl1 for growth on fatty acids, was confirmed. Depletion of PanC and Icl1 rendered the mutants hypersensitive to target-specific inhibitors. Stable reporter strains were generated for use in high-throughput screening, and their utility demonstrated by identifying compounds that display greater potency against a PanC-depleted strain. These findings illustrate the power of TB-WCS as a tool for tuberculosis drug discovery. PMID:22840772
Vallat, Laurent; Kemper, Corey A; Jung, Nicolas; Maumy-Bertrand, Myriam; Bertrand, Frédéric; Meyer, Nicolas; Pocheville, Arnaud; Fisher, John W; Gribben, John G; Bahram, Seiamak
2013-01-08
Cellular behavior is sustained by genetic programs that are progressively disrupted in pathological conditions--notably, cancer. High-throughput gene expression profiling has been used to infer statistical models describing these cellular programs, and development is now needed to guide orientated modulation of these systems. Here we develop a regression-based model to reverse-engineer a temporal genetic program, based on relevant patterns of gene expression after cell stimulation. This method integrates the temporal dimension of biological rewiring of genetic programs and enables the prediction of the effect of targeted gene disruption at the system level. We tested the performance accuracy of this model on synthetic data before reverse-engineering the response of primary cancer cells to a proliferative (protumorigenic) stimulation in a multistate leukemia biological model (i.e., chronic lymphocytic leukemia). To validate the ability of our method to predict the effects of gene modulation on the global program, we performed an intervention experiment on a targeted gene. Comparison of the predicted and observed gene expression changes demonstrates the possibility of predicting the effects of a perturbation in a gene regulatory network, a first step toward an orientated intervention in a cancer cell genetic program.
Park, Mira; Hong, Soon Gyu; Park, Hyun; Lee, Byeong-ha
2018-01-01
Sanionia uncinata is a dominant moss species in the maritime Antarctic. Due to its high adaptability to harsh environments, this extremophile plant has been considered a good target for studying the molecular adaptation mechanisms of plants to a variety of environmental stresses. Despite the importance of S. uncinata as a representative Antarctic plant species for the identification and characterization of genes associated with abiotic stress tolerance, suitable reference genes, which are critical for RT-qPCR analyses, have not yet been identified. In this report, 11 traditionally used and 6 novel candidate reference genes were selected from transcriptome data of S. uncinata and the expression stability of these genes was evaluated under various abiotic stress conditions using three statistical algorithms; geNorm, NormFinder, and BestKeeper. The stability ranking analysis selected the best reference genes depending on the stress conditions. Among the 17 candidates, the most stable references were POB1 and UFD2 for cold stress, POB1 and AKB for drought treatment, and UFD2 and AKB for the field samples from a different water contents in Antarctica. Overall, novel genes POB1 and AKB were the most reliable references across all samples, irrespective of experimental conditions. In addition, 6 novel candidate genes including AKB, POB1 and UFD2, were more stable than the housekeeping genes traditionally used for internal controls, indicating that transcriptome data can be useful for identifying novel robust normalizers. The reference genes validated in this study will be useful for improving the accuracy of RT-qPCR analysis for gene expression studies of S. uncinata in Antarctica and for further functional genomic analysis of bryophytes. PMID:29920565
Frazier, Courtney L.; San Filippo, Joseph; Lambowitz, Alan M.; Mills, David A.
2003-01-01
Despite their commercial importance, there are relatively few facile methods for genomic manipulation of the lactic acid bacteria. Here, the lactococcal group II intron, Ll.ltrB, was targeted to insert efficiently into genes encoding malate decarboxylase (mleS) and tetracycline resistance (tetM) within the Lactococcus lactis genome. Integrants were readily identified and maintained in the absence of a selectable marker. Since splicing of the Ll.ltrB intron depends on the intron-encoded protein, targeted invasion with an intron lacking the intron open reading frame disrupted TetM and MleS function, and MleS activity could be partially restored by expressing the intron-encoded protein in trans. Restoration of splicing from intron variants lacking the intron-encoded protein illustrates how targeted group II introns could be used for conditional expression of any gene. Furthermore, the modified Ll.ltrB intron was used to separately deliver a phage resistance gene (abiD) and a tetracycline resistance marker (tetM) into mleS, without the need for selection to drive the integration or to maintain the integrant. Our findings demonstrate the utility of targeted group II introns as a potential food-grade mechanism for delivery of industrially important traits into the genomes of lactococci. PMID:12571038
Improved bioactivity of G-rich triplex-forming oligonucleotides containing modified guanine bases
Rogers, Faye A; Lloyd, Janice A; Tiwari, Meetu Kaushik
2014-01-01
Triplex structures generated by sequence-specific triplex-forming oligonucleotides (TFOs) have proven to be promising tools for gene targeting strategies. In addition, triplex technology has been highly utilized to study the molecular mechanisms of DNA repair, recombination and mutagenesis. However, triplex formation utilizing guanine-rich oligonucleotides as third strands can be inhibited by potassium-induced self-association resulting in G-quadruplex formation. We report here that guanine-rich TFOs partially substituted with 8-aza-7-deaza-guanine (PPG) have improved target site binding in potassium compared with TFOs containing the natural guanine base. We designed PPG-substituted TFOs to bind to a polypurine sequence in the supFG1 reporter gene. The binding efficiency of PPG-substituted TFOs to the target sequence was analyzed using electrophoresis mobility gel shift assays. We have determined that in the presence of potassium, the non-substituted TFO, AG30 did not bind to its target sequence, however binding was observed with the PPG-substituted AG30 under conditions with up to 140 mM KCl. The PPG-TFOs were able to maintain their ability to induce genomic modifications as measured by an assay for gene-targeted mutagenesis. In addition, these compounds were capable of triplex-induced DNA double strand breaks, which resulted in activation of apoptosis. PMID:25483840
Gene therapy to target ER stress in brain diseases.
Valenzuela, Vicente; Martínez, Gabriela; Duran-Aniotz, Claudia; Hetz, Claudio
2016-10-01
Gene therapy based on the use of Adeno-associated viruses (AAVs) is emerging as a safe and stable strategy to target molecular pathways involved in a variety of brain diseases. Endoplasmic reticulum (ER) stress is proposed as a transversal feature of most animal models and clinical samples from patients affected with neurodegenerative diseases. Manipulation of the unfolded protein response (UPR), a major homeostatic reaction under ER stress conditions, had proved beneficial in diverse models of neurodegeneration. Although increasing number of drugs are available to target ER stress, the use of small molecules to treat chronic brain diseases is challenging because of poor blood brain barrier permeability and undesirable side effects due to the role of the UPR in the physiology of peripheral organs. Gene therapy is currently considered a possible future alternative to circumvent these problems by the delivery of therapeutic agents to selective regions and cell types of the nervous system. Here we discuss current efforts to design gene therapy strategies to alleviate ER stress on a disease context. This article is part of a Special Issue entitled SI:ER stress. Copyright © 2016 Elsevier B.V. All rights reserved.
Small RNA-mediated responses to low- and high-temperature stresses in cotton
Wang, Qiongshan; Liu, Nian; Yang, Xiyan; Tu, Lili; Zhang, Xianlong
2016-01-01
MicroRNAs (miRNAs) are one class of endogenous non-coding RNAs modulating the expression of target genes involved in plant development and stress tolerance, by degrading mRNA or repressing translation. In this study, small RNA and mRNA degradome sequencing were used to identify low- and high-temperature stress-responsive miRNAs and their targets in cotton (Gossypium hirsutum). Cotton seedlings were treated under different temperature conditions (4, 12, 25, 35, and 42 °C) and then the effects were investigated. In total, 319 known miRNAs and 800 novel miRNAs were identified, and 168 miRNAs were differentially expressed between different treatments. The targets of these miRNAs were further analysed by degradome sequencing. Based on studies from Gene Ontology and Kyoto Encyclopedia of Genes and Genomes, the majority of the miRNAs are from genes that are likely involved in response to hormone stimulus, oxidation-reduction reaction, photosynthesis, plant–pathogen interaction and plant hormone signal transduction pathways. This study provides new insight into the molecular mechanisms of plant response to extreme temperature stresses, and especially the roles of miRNAs under extreme temperatures. PMID:27752116
Zhu, Guidong; Su, Wei; Jin, Guishan; Xu, Fujian; Hao, Shuyu; Guan, Fangxia; Jia, William; Liu, Fusheng
2011-05-16
The development of the cancer stem cell (CSCs) niche theory has provided a new target for the treatment of gliomas. Gene therapy using oncolytic viral vectors has shown great potential for the therapeutic targeting of CSCs. To explore whether a viral vector carrying an exogenous Endo-Angio fusion gene (VAE) can infect and kill glioma stem cells (GSCs), as well as inhibit their vascular niche in vitro, we have collected surgical specimens of human high-grade glioma (world health organization, WHO Classes III-VI) from which we isolated and cultured GSCs under conditions originally designed for the selective expansion of neural stem cells. Our results demonstrate the following: (1) Four lines of GSCs (isolated from 20 surgical specimens) could grow in suspension, were multipotent, had the ability to self-renew and expressed the neural stem cell markers, CD133 and nestin. (2) VAE could infect GSCs and significantly inhibit their viability. (3) The Endo-Angio fusion gene was expressed in GSCs 48 h after VAE infection and could inhibit the proliferation of human brain microvascular endothelial cells (HBMEC). (4) Residual viable cells lose the ability of self-renewal and adherent differentiation. In conclusion, VAE can significantly inhibit the activity of GSCs in vitro and the expression of exogenous Endo-Angio fusion gene can inhibit HBMEC proliferation. VAE can be used as a novel virus-gene therapy strategy for glioma. Copyright © 2011 Elsevier B.V. All rights reserved.
Todgham, Anne E; Hofmann, Gretchen E
2009-08-01
Ocean acidification from the uptake of anthropogenic CO(2) is expected to have deleterious consequences for many calcifying marine animals. Forecasting the vulnerability of these marine organisms to climate change is linked to an understanding of whether species possess the physiological capacity to compensate for the potentially adverse effects of ocean acidification. We carried out a microarray-based transcriptomic analysis of the physiological response of larvae of a calcifying marine invertebrate, the purple sea urchin, Strongylocentrotus purpuratus, to CO(2)-driven seawater acidification. In lab-based cultures, larvae were raised under conditions approximating current ocean pH conditions (pH 8.01) and at projected, more acidic pH conditions (pH 7.96 and 7.88) in seawater aerated with CO(2) gas. Targeting expression of approximately 1000 genes involved in several biological processes, this study captured changes in gene expression patterns that characterize the transcriptomic response to CO(2)-driven seawater acidification of developing sea urchin larvae. In response to both elevated CO(2) scenarios, larvae underwent broad scale decreases in gene expression in four major cellular processes: biomineralization, cellular stress response, metabolism and apoptosis. This study underscores that physiological processes beyond calcification are impacted greatly, suggesting that overall physiological capacity and not just a singular focus on biomineralization processes is essential for forecasting the impact of future CO(2) conditions on marine organisms. Conducted on targeted and vulnerable species, genomics-based studies, such as the one highlighted here, have the potential to identify potential ;weak links' in physiological function that may ultimately determine an organism's capacity to tolerate future ocean conditions.
The Molecular Mechanism of Ethylene-Mediated Root Hair Development Induced by Phosphate Starvation
Song, Li; Yu, Haopeng; Dong, Jinsong; Liu, Dong
2016-01-01
Enhanced root hair production, which increases the root surface area for nutrient uptake, is a typical adaptive response of plants to phosphate (Pi) starvation. Although previous studies have shown that ethylene plays an important role in root hair development induced by Pi starvation, the underlying molecular mechanism is not understood. In this work, we characterized an Arabidopsis mutant, hps5, that displays constitutive ethylene responses and increased sensitivity to Pi starvation due to a mutation in the ethylene receptor ERS1. hps5 accumulates high levels of EIN3 protein, a key transcription factor involved in the ethylene signaling pathway, under both Pi sufficiency and deficiency. Pi starvation also increases the accumulation of EIN3 protein. Combined molecular, genetic, and genomic analyses identified a group of genes that affect root hair development by regulating cell wall modifications. The expression of these genes is induced by Pi starvation and is enhanced in the EIN3-overexpressing line. In contrast, the induction of these genes by Pi starvation is suppressed in ein3 and ein3eil1 mutants. EIN3 protein can directly bind to the promoter of these genes, some of which are also the immediate targets of RSL4, a key transcription factor that regulates root hair development. Based on these results, we propose that under normal growth conditions, the level of ethylene is low in root cells; a group of key transcription factors, including RSL4 and its homologs, trigger the transcription of their target genes to promote root hair development; Pi starvation increases the levels of the protein EIN3, which directly binds to the promoters of the genes targeted by RSL4 and its homologs and further increase their transcription, resulting in the enhanced production of root hairs. This model not only explains how ethylene mediates root hair responses to Pi starvation, but may provide a general mechanism for how ethylene regulates root hair development under both stress and non-stress conditions. PMID:27427911
Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.
Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige
2007-07-26
Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.
Killiny, Nabil; Hajeri, Subhas; Tiwari, Siddharth; Gowda, Siddarame; Stelinski, Lukasz L
2014-01-01
Silencing of genes through RNA interference (RNAi) in insects has gained momentum during the past few years. RNAi has been used to cause insect mortality, inhibit insect growth, increase insecticide susceptibility, and prevent the development of insecticide resistance. We investigated the efficacy of topically applied dsRNA to induce RNAi for five Cytochrome P450 genes family 4 (CYP4) in Diaphorina citri. We previously reported that these CYP4 genes are associated with the development of insecticide resistance in D. citri. We targeted five CYP4 genes that share a consensus sequence with one dsRNA construct. Quantitative PCR confirmed suppressed expression of the five CYP4 genes as a result of dsRNA topically applied to the thoracic region of D. citri when compared to the expression levels in a control group. Western blot analysis indicated a reduced signal of cytochrome P450 proteins (45 kDa) in adult D. citri treated with the dsRNA. In addition, oxidase activity and insecticide resistance were reduced for D. citri treated with dsRNA that targeted specific CYP4 genes. Mortality was significantly higher in adults treated with dsRNA than in adults treated with water. Our results indicate that topically applied dsRNA can penetrate the cuticle of D. citri and induce RNAi. These results broaden the scope of RNAi as a mechanism to manage pests by targeting a broad range of genes. The results also support the application of RNAi as a viable tool to overcome insecticide resistance development in D. citri populations. However, further research is needed to develop grower-friendly delivery systems for the application of dsRNA under field conditions. Considering the high specificity of dsRNA, this tool can also be used for management of D. citri by targeting physiologically critical genes involved in growth and development.
Killiny, Nabil; Hajeri, Subhas; Tiwari, Siddharth; Gowda, Siddarame; Stelinski, Lukasz L.
2014-01-01
Silencing of genes through RNA interference (RNAi) in insects has gained momentum during the past few years. RNAi has been used to cause insect mortality, inhibit insect growth, increase insecticide susceptibility, and prevent the development of insecticide resistance. We investigated the efficacy of topically applied dsRNA to induce RNAi for five Cytochrome P450 genes family 4 (CYP4) in Diaphorina citri. We previously reported that these CYP4 genes are associated with the development of insecticide resistance in D. citri. We targeted five CYP4 genes that share a consensus sequence with one dsRNA construct. Quantitative PCR confirmed suppressed expression of the five CYP4 genes as a result of dsRNA topically applied to the thoracic region of D. citri when compared to the expression levels in a control group. Western blot analysis indicated a reduced signal of cytochrome P450 proteins (45 kDa) in adult D. citri treated with the dsRNA. In addition, oxidase activity and insecticide resistance were reduced for D. citri treated with dsRNA that targeted specific CYP4 genes. Mortality was significantly higher in adults treated with dsRNA than in adults treated with water. Our results indicate that topically applied dsRNA can penetrate the cuticle of D. citri and induce RNAi. These results broaden the scope of RNAi as a mechanism to manage pests by targeting a broad range of genes. The results also support the application of RNAi as a viable tool to overcome insecticide resistance development in D. citri populations. However, further research is needed to develop grower-friendly delivery systems for the application of dsRNA under field conditions. Considering the high specificity of dsRNA, this tool can also be used for management of D. citri by targeting physiologically critical genes involved in growth and development. PMID:25330026
Müller, Patrick; Rößler, Jens; Schwarz-Finsterle, Jutta; Schmitt, Eberhard; Hausmann, Michael
2016-07-01
Recently, advantages concerning targeting specificity of PCR constructed oligonucleotide FISH probes in contrast to established FISH probes, e.g. BAC clones, have been demonstrated. These techniques, however, are still using labelling protocols with DNA denaturing steps applying harsh heat treatment with or without further denaturing chemical agents. COMBO-FISH (COMBinatorial Oligonucleotide FISH) allows the design of specific oligonucleotide probe combinations in silico. Thus, being independent from primer libraries or PCR laboratory conditions, the probe sequences extracted by computer sequence data base search can also be synthesized as single stranded PNA-probes (Peptide Nucleic Acid probes) or TINA-DNA (Twisted Intercalating Nucleic Acids). Gene targets can be specifically labelled with at least about 20 probes obtaining visibly background free specimens. By using appropriately designed triplex forming oligonucleotides, the denaturing procedures can completely be omitted. These results reveal a significant step towards oligonucleotide-FISH maintaining the 3d-nanostructure and even the viability of the cell target. The method is demonstrated with the detection of Her2/neu and GRB7 genes, which are indicators in breast cancer diagnosis and therapy. Copyright © 2016. Published by Elsevier Inc.
Meng, Jia; Kanzaki, Gregory; Meas, Diane; Lam, Christopher K.; Crummer, Heather; Tain, Justina; Xu, H. Howard
2013-01-01
Regulated antisense RNA (asRNA) expression has been employed successfully in Gram-positive bacteria for genome-wide essential gene identification and drug target determination. However, there have been no published reports describing the application of asRNA gene silencing for comprehensive analyses of essential genes in Gram-negative bacteria. In this study, we report the first genome-wide identification of asRNA constructs for essential genes in Escherichia coli. We screened 250,000 library transformants for conditional growth-inhibitory recombinant clones from two shot-gun genomic libraries of E. coli using a paired-termini expression vector (pHN678). After sequencing plasmid inserts of 675 confirmed inducer-sensitive cell clones, we identified 152 separate asRNA constructs of which 134 inserts came from essential genes while 18 originated from non-essential genes (but share operons with essential genes). Among the 79 individual essential genes silenced by these asRNA constructs, 61 genes (77%) engage in processes related to protein synthesis. The cell-based assays of an asRNA clone targeting fusA (encoding elongation factor G) showed that the induced cells were sensitized 12 fold to fusidic acid, a known specific inhibitor. Our results demonstrate the utility of the paired-termini expression vector and feasibility of large-scale gene silencing in E. coli using regulated asRNA expression. PMID:22268863
A Tightly Regulated Genetic Selection System with Signaling-Active Alleles of Phytochrome B.
Hu, Wei; Lagarias, J Clark
2017-01-01
Selectable markers derived from plant genes circumvent the potential risk of antibiotic/herbicide-resistance gene transfer into neighboring plant species, endophytic bacteria, and mycorrhizal fungi. Toward this goal, we have engineered and validated signaling-active alleles of phytochrome B (eYHB) as plant-derived selection marker genes in the model plant Arabidopsis (Arabidopsis thaliana). By probing the relationship of construct size and induction conditions to optimal phenotypic selection, we show that eYHB-based alleles are robust substitutes for antibiotic/herbicide-dependent marker genes as well as surprisingly sensitive reporters of off-target transgene expression. © 2017 American Society of Plant Biologists. All Rights Reserved.
A Tightly Regulated Genetic Selection System with Signaling-Active Alleles of Phytochrome B1[OPEN
2017-01-01
Selectable markers derived from plant genes circumvent the potential risk of antibiotic/herbicide-resistance gene transfer into neighboring plant species, endophytic bacteria, and mycorrhizal fungi. Toward this goal, we have engineered and validated signaling-active alleles of phytochrome B (eYHB) as plant-derived selection marker genes in the model plant Arabidopsis (Arabidopsis thaliana). By probing the relationship of construct size and induction conditions to optimal phenotypic selection, we show that eYHB-based alleles are robust substitutes for antibiotic/herbicide-dependent marker genes as well as surprisingly sensitive reporters of off-target transgene expression. PMID:27881727
Rational design of inducible CRISPR guide RNAs for de novo assembly of transcriptional programs
Ferry, Quentin R. V.; Lyutova, Radostina; Fulga, Tudor A.
2017-01-01
CRISPR-based transcription regulators (CRISPR-TRs) have transformed the current synthetic biology landscape by allowing specific activation or repression of any target gene. Here we report a modular and versatile framework enabling rapid implementation of inducible CRISPR-TRs in mammalian cells. This strategy relies on the design of a spacer-blocking hairpin (SBH) structure at the 5′ end of the single guide RNA (sgRNA), which abrogates the function of CRISPR-transcriptional activators. By replacing the SBH loop with ligand-controlled RNA-cleaving units, we demonstrate conditional activation of quiescent sgRNAs programmed to respond to genetically encoded or externally delivered triggers. We use this system to couple multiple synthetic and endogenous target genes with specific inducers, and assemble gene regulatory modules demonstrating parallel and orthogonal transcriptional programs. We anticipate that this ‘plug and play' approach will be a valuable addition to the synthetic biology toolkit, facilitating the understanding of natural gene circuits and the design of cell-based therapeutic strategies. PMID:28256578
Lobel, Lior; Herskovits, Anat A.
2016-01-01
Bacteria sense and respond to many environmental cues, rewiring their regulatory network to facilitate adaptation to new conditions/niches. Global transcription factors that co-regulate multiple pathways simultaneously are essential to this regulatory rewiring. CodY is one such global regulator, controlling expression of both metabolic and virulence genes in Gram-positive bacteria. Branch chained amino acids (BCAAs) serve as a ligand for CodY and modulate its activity. Classically, CodY was considered to function primarily as a repressor under rich growth conditions. However, our previous studies of the bacterial pathogen Listeria monocytogenes revealed that CodY is active also when the bacteria are starved for BCAAs. Under these conditions, CodY loses the ability to repress genes (e.g., metabolic genes) and functions as a direct activator of the master virulence regulator gene, prfA. This observation raised the possibility that CodY possesses multiple functions that allow it to coordinate gene expression across a wide spectrum of metabolic growth conditions, and thus better adapt bacteria to the mammalian niche. To gain a deeper understanding of CodY’s regulatory repertoire and identify direct target genes, we performed a genome wide analysis of the CodY regulon and DNA binding under both rich and minimal growth conditions, using RNA-Seq and ChIP-Seq techniques. We demonstrate here that CodY is indeed active (i.e., binds DNA) under both conditions, serving as a repressor and activator of different genes. Further, we identified new genes and pathways that are directly regulated by CodY (e.g., sigB, arg, his, actA, glpF, gadG, gdhA, poxB, glnR and fla genes), integrating metabolism, stress responses, motility and virulence in L. monocytogenes. This study establishes CodY as a multifaceted factor regulating L. monocytogenes physiology in a highly versatile manner. PMID:26895237
Silencing of Essential Genes within a Highly Coordinated Operon in Escherichia coli.
Goh, Shan; Hohmeier, Angela; Stone, Timothy C; Offord, Victoria; Sarabia, Francisco; Garcia-Ruiz, Cristina; Good, Liam
2015-08-15
Essential bacterial genes located within operons are particularly challenging to study independently because of coordinated gene expression and the nonviability of knockout mutants. Essentiality scores for many operon genes remain uncertain. Antisense RNA (asRNA) silencing or in-frame gene disruption of genes may help establish essentiality but can lead to polar effects on genes downstream or upstream of the target gene. Here, the Escherichia coli ribF-ileS-lspA-fkpB-ispH operon was used to evaluate the possibility of independently studying an essential gene using expressed asRNA and target gene overexpression to deregulate coupled expression. The gene requirement for growth in conditional silencing strains was determined by the relationship of target mRNA reduction with growth inhibition as the minimum transcript level required for 50% growth (MTL50). Mupirocin and globomycin, the protein inhibitors of IleS and LspA, respectively, were used in sensitization assays of strains containing both asRNA-expressing and open reading frame-expressing plasmids to examine deregulation of the overlapping ileS-lspA genes. We found upstream and downstream polar silencing effects when either ileS or lspA was silenced, indicating coupled expression. Weighted MTL50 values (means and standard deviations) of ribF, ileS, and lspA were 0.65 ± 0.18, 0.64 ± 0.06, and 0.76 ± 0.10, respectively. However, they were not significantly different (P = 0.71 by weighted one-way analysis of variance). The gene requirement for ispH could not be determined due to insufficient growth reduction. Mupirocin and globomycin sensitization experiments indicated that ileS-lspA expression could not be decoupled. The results highlight the inherent challenges associated with genetic analyses of operons; however, coupling of essential genes may provide opportunities to improve RNA-silencing antimicrobials. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Silencing of Essential Genes within a Highly Coordinated Operon in Escherichia coli
Hohmeier, Angela; Stone, Timothy C.; Offord, Victoria; Sarabia, Francisco; Garcia-Ruiz, Cristina; Good, Liam
2015-01-01
Essential bacterial genes located within operons are particularly challenging to study independently because of coordinated gene expression and the nonviability of knockout mutants. Essentiality scores for many operon genes remain uncertain. Antisense RNA (asRNA) silencing or in-frame gene disruption of genes may help establish essentiality but can lead to polar effects on genes downstream or upstream of the target gene. Here, the Escherichia coli ribF-ileS-lspA-fkpB-ispH operon was used to evaluate the possibility of independently studying an essential gene using expressed asRNA and target gene overexpression to deregulate coupled expression. The gene requirement for growth in conditional silencing strains was determined by the relationship of target mRNA reduction with growth inhibition as the minimum transcript level required for 50% growth (MTL50). Mupirocin and globomycin, the protein inhibitors of IleS and LspA, respectively, were used in sensitization assays of strains containing both asRNA-expressing and open reading frame-expressing plasmids to examine deregulation of the overlapping ileS-lspA genes. We found upstream and downstream polar silencing effects when either ileS or lspA was silenced, indicating coupled expression. Weighted MTL50 values (means and standard deviations) of ribF, ileS, and lspA were 0.65 ± 0.18, 0.64 ± 0.06, and 0.76 ± 0.10, respectively. However, they were not significantly different (P = 0.71 by weighted one-way analysis of variance). The gene requirement for ispH could not be determined due to insufficient growth reduction. Mupirocin and globomycin sensitization experiments indicated that ileS-lspA expression could not be decoupled. The results highlight the inherent challenges associated with genetic analyses of operons; however, coupling of essential genes may provide opportunities to improve RNA-silencing antimicrobials. PMID:26070674
Gene therapy for PIDs: progress, pitfalls and prospects.
Mukherjee, Sayandip; Thrasher, Adrian J
2013-08-10
Substantial progress has been made in the past decade in treating several primary immunodeficiency disorders (PIDs) with gene therapy. Current approaches are based on ex-vivo transfer of therapeutic transgene via viral vectors to patient-derived autologous hematopoietic stem cells (HSCs) followed by transplantation back to the patient with or without conditioning. The overall outcome from all the clinical trials targeting different PIDs has been extremely encouraging but not without caveats. Malignant outcomes from insertional mutagenesis have featured prominently in the adverse events associated with these trials and have warranted intense pre-clinical investigation into defining the tendencies of different viral vectors for genomic integration. Coupled with issues pertaining to transgene expression, the therapeutic landscape has undergone a paradigm shift in determining safety, stability and efficacy of gene therapy approaches. In this review, we aim to summarize the progress made in the gene therapy trials targeting ADA-SCID, SCID-X1, CGD and WAS, review the pitfalls, and outline the recent advancements which are expected to further enhance favourable risk benefit ratios for gene therapeutic approaches in the future. Copyright © 2013 Elsevier B.V. All rights reserved.
Transcriptomic study of 39 ostreid herpesvirus 1 genes during an experimental infection.
Segarra, Amélie; Faury, Nicole; Pépin, Jean-François; Renault, Tristan
2014-06-01
Massive mortality outbreaks have been reported in France since 2008 among Pacific oysters, Crassostrea gigas, with the detection of a particular OsHV-1 variant called μVar. Virus infection can be induced in healthy spat in experimental conditions allowing to better understand the disease process, including viral gene expression. Although gene expression of other herpesviruses has been widely studied, we provide the first study following viral gene expression of OsHV-1 over time. In this context, an in vivo transcriptomic study targeting 39 OsHV-1 genes was carried out during an experimental infection of Pacific oyster spat. For the first time, several OsHV-1 mRNAs were detected by real-time PCR at 0 h, 2 h, 4 h, 18 h, 26 h and 42 h post-injection. Several transcripts were detected at 2h post-infection and at 18 h post-infection for all selected ORFs. Quantification of virus gene expression at different times of infection was also carried out using an oyster housekeeping gene, Elongation factor. Developing an OsHV-1-specific reverse transcriptase real time PCR targeting 39 viral gene appears a new tool in terms of diagnosis and can be used to complement viral DNA detection in order to monitor viral replication. Copyright © 2014. Published by Elsevier Inc.
Lipid Nanoparticles Enabling Gene Therapies: From Concepts to Clinical Utility.
Kulkarni, Jayesh A; Cullis, Pieter R; van der Meel, Roy
2018-04-23
Genetic drugs based on RNA or DNA have remarkable therapeutic potential as virtually any disease can be treated by silencing a pathological gene, expressing a beneficial protein, or by editing defective genes. However, therapies based on nucleic acid polymers require sophisticated delivery systems to deliver these macromolecules to the interior of target cells. In this study, we review progress in developing nonviral lipid nanoparticle (LNP) delivery systems that have attractive properties, including ease of manufacture, reduced immune responses, multidosing capabilities, larger payloads, and flexibility of design. LNP systems represent the most advanced delivery systems for genetic drugs as it is expected that an LNP-short interfering RNA (siRNA) formulation will receive clinical approval from the Food and Drug Administration (FDA) in 2018 for treatment of the hereditary condition transthyretin-mediated amyloidosis, a fatal condition for which there is currently no treatment. This achievement is largely due to the development of optimized ionizable cationic lipids, arguably the most important factor in the clinical success of LNP-siRNA. In addition, we highlight potential LNP applications, including targeting tissues beyond the liver and therapeutic approaches based on messenger RNA or Clustered Regularly Interspaced Short Palindromic Repeats/Cas.
Targeted discovery of glycoside hydrolases from a switchgrass-adapted compost community
DOE Office of Scientific and Technical Information (OSTI.GOV)
Allgaier, M.; Reddy, A.; Park, J. I.
2009-11-15
Development of cellulosic biofuels from non-food crops is currently an area of intense research interest. Tailoring depolymerizing enzymes to particular feedstocks and pretreatment conditions is one promising avenue of research in this area. Here we added a green-waste compost inoculum to switchgrass (Panicum virgatum) and simulated thermophilic composting in a bioreactor to select for a switchgrass-adapted community and to facilitate targeted discovery of glycoside hydrolases. Small-subunit (SSU) rRNA-based community profiles revealed that the microbial community changed dramatically between the initial and switchgrass-adapted compost (SAC) with some bacterial populations being enriched over 20-fold. We obtained 225 Mbp of 454-titanium pyrosequence datamore » from the SAC community and conservatively identified 800 genes encoding glycoside hydrolase domains that were biased toward depolymerizing grass cell wall components. Of these, {approx}10% were putative cellulases mostly belonging to families GH5 and GH9. We synthesized two SAC GH9 genes with codon optimization for heterologous expression in Escherichia coli and observed activity for one on carboxymethyl cellulose. The active GH9 enzyme has a temperature optimum of 50 C and pH range of 5.5 to 8 consistent with the composting conditions applied. We demonstrate that microbial communities adapt to switchgrass decomposition using simulated composting condition and that full-length genes can be identified from complex metagenomic sequence data, synthesized and expressed resulting in active enzyme.« less
Targeted Discovery of Glycoside Hydrolases from a Switchgrass-Adapted Compost Community
DOE Office of Scientific and Technical Information (OSTI.GOV)
Reddy, Amitha; Allgaier, Martin; Park, Joshua I.
2011-05-11
Development of cellulosic biofuels from non-food crops is currently an area of intense research interest. Tailoring depolymerizing enzymes to particular feedstocks and pretreatment conditions is one promising avenue of research in this area. Here we added a green-waste compost inoculum to switchgrass (Panicum virgatum) and simulated thermophilic composting in a bioreactor to select for a switchgrass-adapted community and to facilitate targeted discovery of glycoside hydrolases. Smallsubunit (SSU) rRNA-based community profiles revealed that the microbial community changed dramatically between the initial and switchgrass-adapted compost (SAC) with some bacterial populations being enriched over 20-fold. We obtained 225 Mbp of 454-titanium pyrosequence datamore » from the SAC community and conservatively identified 800 genes encoding glycoside hydrolase domains that were biased toward depolymerizing grass cell wall components. Of these, ,10percent were putative cellulasesmostly belonging to families GH5 and GH9. We synthesized two SAC GH9 genes with codon optimization for heterologous expression in Escherichia coli and observed activity for one on carboxymethyl cellulose. The active GH9 enzyme has a temperature optimum of 50uC and pH range of 5.5 to 8 consistent with the composting conditions applied. We demonstrate that microbial communities adapt to switchgrass decomposition using simulated composting condition and that full-length genes can be identified from complex metagenomic sequence data, synthesized and expressed resulting in active enzyme.« less
Genome-wide profiling of diel and circadian gene expression in the malaria vector Anopheles gambiae.
Rund, Samuel S C; Hou, Tim Y; Ward, Sarah M; Collins, Frank H; Duffield, Giles E
2011-08-09
Anopheles gambiae, the primary African vector of malaria parasites, exhibits numerous rhythmic behaviors including flight activity, swarming, mating, host seeking, egg laying, and sugar feeding. However, little work has been performed to elucidate the molecular basis for these daily rhythms. To study how gene expression is regulated globally by diel and circadian mechanisms, we have undertaken a DNA microarray analysis of An. gambiae under light/dark cycle (LD) and constant dark (DD) conditions. Adult mated, non-blood-fed female mosquitoes were collected every 4 h for 48 h, and samples were processed with DNA microarrays. Using a cosine wave-fitting algorithm, we identified 1,293 and 600 rhythmic genes with a period length of 20-28 h in the head and body, respectively, under LD conditions, representing 9.7 and 4.5% of the An. gambiae gene set. A majority of these genes was specific to heads or bodies. Examination of mosquitoes under DD conditions revealed that rhythmic programming of the transcriptome is dependent on an interaction between the endogenous clock and extrinsic regulation by the LD cycle. A subset of genes, including the canonical clock components, was expressed rhythmically under both environmental conditions. A majority of genes had peak expression clustered around the day/night transitions, anticipating dawn and dusk. Genes cover diverse biological processes such as transcription/translation, metabolism, detoxification, olfaction, vision, cuticle regulation, and immunity, and include rate-limiting steps in the pathways. This study highlights the fundamental roles that both the circadian clock and light play in the physiology of this important insect vector and suggests targets for intervention.
The Human Paraoxonase Gene Cluster As a Target in the Treatment of Atherosclerosis
She, Zhi-Gang; Chen, Hou-Zao; Yan, Yunfei; Li, Hongliang
2012-01-01
Abstract The paraoxonase (PON) gene cluster contains three adjacent gene members, PON1, PON2, and PON3. Originating from the same fungus lactonase precursor, all of the three PON genes share high sequence identity and a similar β propeller protein structure. PON1 and PON3 are primarily expressed in the liver and secreted into the serum upon expression, whereas PON2 is ubiquitously expressed and remains inside the cell. Each PON member has high catalytic activity toward corresponding artificial organophosphate, and all exhibit activities to lactones. Therefore, all three members of the family are regarded as lactonases. Under physiological conditions, they act to degrade metabolites of polyunsaturated fatty acids and homocysteine (Hcy) thiolactone, among other compounds. By detoxifying both oxidized low-density lipoprotein and Hcy thiolactone, PONs protect against atherosclerosis and coronary artery diseases, as has been illustrated by many types of in vitro and in vivo experimental evidence. Clinical observations focusing on gene polymorphisms also indicate that PON1, PON2, and PON3 are protective against coronary artery disease. Many other conditions, such as diabetes, metabolic syndrome, and aging, have been shown to relate to PONs. The abundance and/or activity of PONs can be regulated by lipoproteins and their metabolites, biological macromolecules, pharmacological treatments, dietary factors, and lifestyle. In conclusion, both previous results and ongoing studies provide evidence, making the PON cluster a prospective target for the treatment of atherosclerosis. Antioxid. Redox Signal. 16, 597–632. PMID:21867409
Vermeirssen, Vanessa; De Clercq, Inge; Van Parys, Thomas; Van Breusegem, Frank; Van de Peer, Yves
2014-01-01
The abiotic stress response in plants is complex and tightly controlled by gene regulation. We present an abiotic stress gene regulatory network of 200,014 interactions for 11,938 target genes by integrating four complementary reverse-engineering solutions through average rank aggregation on an Arabidopsis thaliana microarray expression compendium. This ensemble performed the most robustly in benchmarking and greatly expands upon the availability of interactions currently reported. Besides recovering 1182 known regulatory interactions, cis-regulatory motifs and coherent functionalities of target genes corresponded with the predicted transcription factors. We provide a valuable resource of 572 abiotic stress modules of coregulated genes with functional and regulatory information, from which we deduced functional relationships for 1966 uncharacterized genes and many regulators. Using gain- and loss-of-function mutants of seven transcription factors grown under control and salt stress conditions, we experimentally validated 141 out of 271 predictions (52% precision) for 102 selected genes and mapped 148 additional transcription factor-gene regulatory interactions (49% recall). We identified an intricate core oxidative stress regulatory network where NAC13, NAC053, ERF6, WRKY6, and NAC032 transcription factors interconnect and function in detoxification. Our work shows that ensemble reverse-engineering can generate robust biological hypotheses of gene regulation in a multicellular eukaryote that can be tested by medium-throughput experimental validation. PMID:25549671
Vermeirssen, Vanessa; De Clercq, Inge; Van Parys, Thomas; Van Breusegem, Frank; Van de Peer, Yves
2014-12-01
The abiotic stress response in plants is complex and tightly controlled by gene regulation. We present an abiotic stress gene regulatory network of 200,014 interactions for 11,938 target genes by integrating four complementary reverse-engineering solutions through average rank aggregation on an Arabidopsis thaliana microarray expression compendium. This ensemble performed the most robustly in benchmarking and greatly expands upon the availability of interactions currently reported. Besides recovering 1182 known regulatory interactions, cis-regulatory motifs and coherent functionalities of target genes corresponded with the predicted transcription factors. We provide a valuable resource of 572 abiotic stress modules of coregulated genes with functional and regulatory information, from which we deduced functional relationships for 1966 uncharacterized genes and many regulators. Using gain- and loss-of-function mutants of seven transcription factors grown under control and salt stress conditions, we experimentally validated 141 out of 271 predictions (52% precision) for 102 selected genes and mapped 148 additional transcription factor-gene regulatory interactions (49% recall). We identified an intricate core oxidative stress regulatory network where NAC13, NAC053, ERF6, WRKY6, and NAC032 transcription factors interconnect and function in detoxification. Our work shows that ensemble reverse-engineering can generate robust biological hypotheses of gene regulation in a multicellular eukaryote that can be tested by medium-throughput experimental validation. © 2014 American Society of Plant Biologists. All rights reserved.
Gene delivery to the lungs: pulmonary gene therapy for cystic fibrosis.
Villate-Beitia, Ilia; Zarate, Jon; Puras, Gustavo; Pedraz, José Luis
2017-07-01
Cystic fibrosis (CF) is a monogenic autosomal recessive disorder where the defective gene, the cystic fibrosis transmembrane conductance regulator (CFTR), is well identified. Moreover, the respiratory tract can be targeted through noninvasive aerosolized formulations for inhalation. Therefore, gene therapy is considered a plausible strategy to address this disease. Conventional gene therapy strategies rely on the addition of a correct copy of the CFTR gene into affected cells in order to restore the channel activity. In recent years, genome correction strategies have emerged, such as zinc-finger nucleases, transcription activator-like effector nucleases and clustered regularly interspaced short palindromic repeats associated to Cas9 nucleases. These gene editing tools aim to repair the mutated gene at its original genomic locus with high specificity. Besides, the success of gene therapy critically depends on the nucleic acids carriers. To date, several clinical studies have been carried out to add corrected copies of the CFTR gene into target cells using viral and non-viral vectors, some of them with encouraging results. Regarding genome editing systems, preliminary in vitro studies have been performed in order to repair the CFTR gene. In this review, after briefly introducing the basis of CF, we discuss the up-to-date gene therapy strategies to address the disease. The review focuses on the main factors to take into consideration when developing gene delivery strategies, such as the design of vectors and plasmid DNA, in vitro/in vivo tests, translation to human use, administration methods, manufacturing conditions and regulatory issues.
NASA Astrophysics Data System (ADS)
Amini, Bahram; Kamali, Mehdi; Salouti, Mojtaba; Yaghmaei, Parichehreh
2018-06-01
Colorimetric DNA detection is preferred over other methods for clinical molecular diagnosis because it does not require expensive equipment. In the present study, the colorimetric method based on gold nanoparticles (GNPs) and endonuclease enzyme was used for the detection of P. aeruginosa ETA gene. Firstly, the primers and probe for P. aeruginosa exotoxin A (ETA) gene were designed and checked for specificity by the PCR method. Then, GNPs were synthesized using the citrate reduction method and conjugated with the prepared probe to develop the new nano-biosensor. Next, the extracted target DNA of the bacteria was added to GNP-probe complex to check its efficacy for P. aeruginosa ETA gene diagnosis. A decrease in absorbance was seen when GNP-probe-target DNA cleaved into the small fragments of BamHI endonuclease due to the weakened electrostatic interaction between GNPs and the shortened DNA. The right shift of the absorbance peak from 530 to 562 nm occurred after adding the endonuclease. It was measured using a UV-VIS absorption spectroscopy that indicates the existence of the P. aeruginosa ETA gene. Sensitivity was determined in the presence of different concentrations of target DNA of P. aeruginosa. The results obtained from the optimized conditions showed that the absorbance value has linear correlation with concentration of target DNA (R: 0.9850) in the range of 10-50 ng mL-1 with the limit detection of 9.899 ng mL-1. Thus, the specificity of the new method for detection of P. aeruginosa was established in comparison with other bacteria. Additionally, the designed assay was quantitatively applied to detect the P. aeruginosa ETA gene from 103 to 108 CFU mL-1 in real samples with a detection limit of 320 CFU mL-1.
Site-specific gene transfer into the rat spinal cord by photomechanical waves
NASA Astrophysics Data System (ADS)
Ando, Takahiro; Sato, Shunichi; Toyooka, Terushige; Uozumi, Yoichi; Nawashiro, Hiroshi; Ashida, Hiroshi; Obara, Minoru
2011-10-01
Nonviral, site-specific gene delivery to deep tissue is required for gene therapy of a spinal cord injury. However, an efficient method satisfying these requirements has not been established. This study demonstrates efficient and targeted gene transfer into the spinal cord by using photomechanical waves (PMWs), which were generated by irradiating a black laser absorbing rubber with 532-nm nanosecond Nd:YAG laser pulses. After a solution of plasmid DNA coding for enhanced green fluorescent protein (EGFP) or luciferase was intraparenchymally injected into the spinal cord, PMWs were applied to the target site. In the PMW application group, we observed significant EGFP gene expression in the white matter and remarkably high luciferase activity only in the spinal cord segment exposed to the PMWs. We also assessed hind limb movements 24 h after the application of PMWs based on the Basso-Beattie-Bresnahan (BBB) score to evaluate the noninvasiveness of this method. Locomotor evaluation showed no significant decrease in BBB score under optimum laser irradiation conditions. These findings demonstrated that exogenous genes can be efficiently and site-selectively delivered into the spinal cord by applying PMWs without significant locomotive damage.
E3 ubiquitin ligase Mule targets β-catenin under conditions of hyperactive Wnt signaling
Dominguez-Brauer, Carmen; Khatun, Rahima; Elia, Andrew J.; Thu, Kelsie L.; Ramachandran, Parameswaran; Baniasadi, Shakiba P.; Hao, Zhenyue; Jones, Lisa D.; Haight, Jillian; Sheng, Yi; Mak, Tak W.
2017-01-01
Wnt signaling, named after the secreted proteins that bind to cell surface receptors to activate the pathway, plays critical roles both in embryonic development and the maintenance of homeostasis in many adult tissues. Two particularly important cellular programs orchestrated by Wnt signaling are proliferation and stem cell self-renewal. Constitutive activation of the Wnt pathway resulting from mutation or improper modulation of pathway components contributes to cancer development in various tissues. Colon cancers frequently bear inactivating mutations of the adenomatous polyposis coli (APC) gene, whose product is an important component of the destruction complex that regulates β-catenin levels. Stabilization and nuclear localization of β-catenin result in the expression of a panel of Wnt target genes. We previously showed that Mule/Huwe1/Arf-BP1 (Mule) controls murine intestinal stem and progenitor cell proliferation by modulating the Wnt pathway via c-Myc. Here we extend our investigation of Mule’s influence on oncogenesis by showing that Mule interacts directly with β-catenin and targets it for degradation under conditions of hyperactive Wnt signaling. Our findings suggest that Mule uses various mechanisms to fine-tune the Wnt pathway and provides multiple safeguards against tumorigenesis. PMID:28137882
E3 ubiquitin ligase Mule targets β-catenin under conditions of hyperactive Wnt signaling.
Dominguez-Brauer, Carmen; Khatun, Rahima; Elia, Andrew J; Thu, Kelsie L; Ramachandran, Parameswaran; Baniasadi, Shakiba P; Hao, Zhenyue; Jones, Lisa D; Haight, Jillian; Sheng, Yi; Mak, Tak W
2017-02-14
Wnt signaling, named after the secreted proteins that bind to cell surface receptors to activate the pathway, plays critical roles both in embryonic development and the maintenance of homeostasis in many adult tissues. Two particularly important cellular programs orchestrated by Wnt signaling are proliferation and stem cell self-renewal. Constitutive activation of the Wnt pathway resulting from mutation or improper modulation of pathway components contributes to cancer development in various tissues. Colon cancers frequently bear inactivating mutations of the adenomatous polyposis coli ( APC ) gene, whose product is an important component of the destruction complex that regulates β-catenin levels. Stabilization and nuclear localization of β-catenin result in the expression of a panel of Wnt target genes. We previously showed that Mule/Huwe1/Arf-BP1 (Mule) controls murine intestinal stem and progenitor cell proliferation by modulating the Wnt pathway via c-Myc. Here we extend our investigation of Mule's influence on oncogenesis by showing that Mule interacts directly with β-catenin and targets it for degradation under conditions of hyperactive Wnt signaling. Our findings suggest that Mule uses various mechanisms to fine-tune the Wnt pathway and provides multiple safeguards against tumorigenesis.
Kondo, Ayano; Yamamoto, Shogo; Nakaki, Ryo; Shimamura, Teppei; Hamakubo, Takao; Sakai, Juro; Kodama, Tatsuhiko; Yoshida, Tetsuo; Aburatani, Hiroyuki; Osawa, Tsuyoshi
2017-02-28
Conditions of the tumor microenvironment, such as hypoxia and nutrient starvation, play critical roles in cancer progression. However, the role of acidic extracellular pH in cancer progression is not studied as extensively as that of hypoxia. Here, we show that extracellular acidic pH (pH 6.8) triggered activation of sterol regulatory element-binding protein 2 (SREBP2) by stimulating nuclear translocation and promoter binding to its targets, along with intracellular acidification. Interestingly, inhibition of SREBP2, but not SREBP1, suppressed the upregulation of low pH-induced cholesterol biosynthesis-related genes. Moreover, acyl-CoA synthetase short-chain family member 2 (ACSS2), a direct SREBP2 target, provided a growth advantage to cancer cells under acidic pH. Furthermore, acidic pH-responsive SREBP2 target genes were associated with reduced overall survival of cancer patients. Thus, our findings show that SREBP2 is a key transcriptional regulator of metabolic genes and progression of cancer cells, partly in response to extracellular acidification. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.
Katiyar, Amit; Smita, Shuchi; Muthusamy, Senthilkumar K.; Chinnusamy, Viswanathan; Pandey, Dev M.; Bansal, Kailash C.
2015-01-01
Small non-coding RNAs (sRNAs) namely microRNAs (miRNAs) and trans-acting small interfering RNAs (tasi-RNAs) play a crucial role in post-transcriptional regulation of gene expression and thus the control plant development and stress responses. In order to identify drought-responsive miRNAs and tasi-RNAs in sorghum, we constructed small RNA libraries from a drought tolerant (M35-1) and susceptible (C43) sorghum genotypes grown under control and drought stress conditions, and sequenced by Illumina Genome Analyzer IIx. Ninety seven conserved and 526 novel miRNAs representing 472 unique miRNA families were identified from sorghum. Ninety-six unique miRNAs were found to be regulated by drought stress, of which 32 were up- and 49 were down-regulated (fold change ≥ 2 or ≤ −2) at least in one genotype, while the remaining 15 miRNAs showed contrasting drought-regulated expression pattern between genotypes. A maximum of 17 and 18 miRNAs was differentially regulated under drought stress condition in the sensitive and tolerant genotypes, respectively. These results suggest that genotype dependent stress responsive regulation of miRNAs may contribute, at least in part, to the differential drought tolerance of sorghum genotypes. We also identified two miR390-directed TAS3 gene homologs and the auxin response factors as tasi-RNA targets. We predicted more than 1300 unique target genes for the novel and conserved miRNAs. These target genes were predicted to be involved in different cellular, metabolic, response to stimulus, biological regulation, and developmental processes. Genome-wide identification of stress-responsive miRNAs, tasi-RNAs and their targets identified in this study will be useful in unraveling the molecular mechanisms underlying drought stress responses and genetic improvement of biomass production and stress tolerance in sorghum. PMID:26236318
2014-01-01
Background Microalgae can accumulate considerable amounts of lipids under different nutrient-deficient conditions, making them as one of the most promising sustainable sources for biofuel production. These inducible processes provide a powerful experimental basis for fully understanding the mechanisms of physiological acclimation, lipid hyperaccumulation and gene expression in algae. In this study, three nutrient-deficiency strategies, viz nitrogen-, phosphorus- and iron-deficiency were applied to trigger the lipid hyperaccumulation in an oleaginous Chlorella pyrenoidosa. Regular patterns of growth characteristics, lipid accumulation, physiological parameters, as well as the expression patterns of lipid biosynthesis-related genes were fully analyzed and compared. Results Our results showed that all the nutrient stress conditions could enhance the lipid content considerably compared with the control. The total lipid and neutral lipid contents exhibit the most marked increment under nitrogen deficiency, achieving 50.32% and 34.29% of dry cell weight at the end of cultivation, respectively. Both photosynthesis indicators and reactive oxygen species parameters reveal that physiological stress turned up when exposed to nutrient depletions. Time-course transcript patterns of lipid biosynthesis-related genes showed that diverse expression dynamics probably contributes to the different lipidic phenotypes under stress conditions. By analyzing the correlation between lipid content and gene expression level, we pinpoint several genes viz. rbsL, me g6562, accA, accD, dgat g2354, dgat g3280 and dgat g7063, which encode corresponding enzymes or subunits of malic enzyme, ACCase and diacylglycerol acyltransferase in the de novo TAG biosynthesis pathway, are highly related to lipid accumulation and might be exploited as target genes for genetic modification. Conclusion This study provided us not only a comprehensive picture of adaptive mechanisms from physiological perspective, but also a number of targeted genes that can be used for a systematic metabolic engineering. Besides, our results also represented the feasibility of lipid production through trophic transition cultivation modes, throwing light on a two-stage microalgal lipid production strategy with which heterotrophy stage provides sufficient robust seed and nitrogen-starvation photoautotrophy stage enhances the overall lipid productivity. PMID:24479413
Mediator-dependent Nuclear Receptor Functions
Chen, Wei; Roeder, Robert
2011-01-01
As gene-specific transcription factors, nuclear hormone receptors are broadly involved in many important biological processes. Their function on target genes requires the stepwise assembly of different coactivator complexes that facilitate chromatin remodeling and subsequent preinitiation complex (PIC) formation and function. Mediator has proved to be a crucial, and general, nuclear receptor-interacting coactivator, with demonstrated functions in transcription steps ranging from chromatin remodeling to subsequent PIC formation and function. Here we discuss (i) our current understanding of pathways that nuclear receptors and other interacting cofactors employ to recruit Mediator to target gene enhancers and promoters, including conditional requirements for the strong NR-Mediator interactions mediated by the NR AF2 domain and the MED1 LXXLLL motifs and (ii) mechanisms by which Mediator acts to transmit signals from enhancer-bound nuclear receptors to the general transcription machinery at core promoters to effect PIC formation and function. PMID:21854863
Zhou, Xuguo; Gao, Xiwu
2014-01-01
Finding a suitable reference gene is the key for qRT-PCR analysis. However, none of the reference gene discovered thus far can be utilized universally under various biotic and abiotic experimental conditions. In this study, we further examine the stability of candidate reference genes under a single abiotic factor, insecticide treatment. After being exposed to eight commercially available insecticides, which belong to five different classes, the expression profiles of eight housekeeping genes in the sweetpotato whitefly, Bemisia tabaci, one of the most invasive and destructive pests in the world, were investigated using qRT-PCR analysis. In summary, elongation factor 1α (EF1α), α-tubulin (TUB1α) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were identified as the most stable reference genes under the insecticide treatment. The initial assessment of candidate reference genes was further validated with the expression of two target genes, a P450 (Cyp6cm1) and a glutathione S-transferase (GST). However, ranking of reference genes varied substantially among intra- and inter-classes of insecticides. These combined data strongly suggested the necessity of conducting custom reference gene selection designed for each and every experimental condition, even when examining the same abiotic or biotic factor. PMID:24498122
Wan, Pin-Jun; Tang, Yao-Hua; Yuan, San-Yue; He, Jia-Chun; Wang, Wei-Xia; Lai, Feng-Xiang; Fu, Qiang
2017-01-01
Nilaparvata lugens (Stål) (Hemiptera: Delphacidae) is a major rice pest that harbors an endosymbiont ascomycete fungus, Entomomyces delphacidicola str. NLU (also known as yeast-like symbiont, YLS). Driving by demand of novel population management tactics (e.g. RNAi), the importance of YLS has been studied and revealed, which greatly boosts the interest of molecular level studies related to YLS. The current study focuses on reference genes for RT-qPCR studies related to YLS. Eight previously unreported YLS genes were cloned, and their expressions were evaluated for N. lugens samples of different developmental stages and sexes, and under different nutritional conditions and temperatures. Expression stabilities were analyzed by BestKeeper, geNorm, NormFinder, ΔCt method and RefFinder. Furthermore, the selected reference genes for RT-qPCR of YLS genes were validated using targeted YLS genes that respond to different nutritional conditions (amino acid deprivation) and RNAi. The results suggest that ylsRPS15p/ylsACT are the most suitable reference genes for temporal gene expression profiling, while ylsTUB/ylsACT and ylsRPS15e/ylsGADPH are the most suitable reference gene choices for evaluating nutrition and temperature effects. Validation studies demonstrated the advantage of using endogenous YLS reference genes for YLS studies. PMID:28198810
Than, Minh T; Kudlow, Brian A; Han, Min
2013-06-01
Identifying the physiological functions of microRNAs (miRNAs) is often challenging because miRNAs commonly impact gene expression under specific physiological conditions through complex miRNA::mRNA interaction networks and in coordination with other means of gene regulation, such as transcriptional regulation and protein degradation. Such complexity creates difficulties in dissecting miRNA functions through traditional genetic methods using individual miRNA mutations. To investigate the physiological functions of miRNAs in neurons, we combined a genetic "enhancer" approach complemented by biochemical analysis of neuronal miRNA-induced silencing complexes (miRISCs) in C. elegans. Total miRNA function can be compromised by mutating one of the two GW182 proteins (AIN-1), an important component of miRISC. We found that combining an ain-1 mutation with a mutation in unc-3, a neuronal transcription factor, resulted in an inappropriate entrance into the stress-induced, alternative larval stage known as dauer, indicating a role of miRNAs in preventing aberrant dauer formation. Analysis of this genetic interaction suggests that neuronal miRNAs perform such a role partly by regulating endogenous cyclic guanosine monophosphate (cGMP) signaling, potentially influencing two other dauer-regulating pathways. Through tissue-specific immunoprecipitations of miRISC, we identified miRNAs and their likely target mRNAs within neuronal tissue. We verified the biological relevance of several of these miRNAs and found that many miRNAs likely regulate dauer formation through multiple dauer-related targets. Further analysis of target mRNAs suggests potential miRNA involvement in various neuronal processes, but the importance of these miRNA::mRNA interactions remains unclear. Finally, we found that neuronal genes may be more highly regulated by miRNAs than intestinal genes. Overall, our study identifies miRNAs and their targets, and a physiological function of these miRNAs in neurons. It also suggests that compromising other aspects of gene expression, along with miRISC, can be an effective approach to reveal miRNA functions in specific tissues under specific physiological conditions.
Simple Monitoring of Gene Targeting Efficiency in Human Somatic Cell Lines Using the PIGA Gene
Karnan, Sivasundaram; Konishi, Yuko; Ota, Akinobu; Takahashi, Miyuki; Damdindorj, Lkhagvasuren; Hosokawa, Yoshitaka; Konishi, Hiroyuki
2012-01-01
Gene targeting in most of human somatic cell lines has been labor-intensive because of low homologous recombination efficiency. The development of an experimental system that permits a facile evaluation of gene targeting efficiency in human somatic cell lines is the first step towards the improvement of this technology and its application to a broad range of cell lines. In this study, we utilized phosphatidylinositol glycan anchor biosynthesis class A (PIGA), a gene essential for the synthesis of glycosylphosphatidyl inositol (GPI) anchors, as a reporter of gene targeting events in human somatic cell lines. Targeted disruption of PIGA was quantitatively detected with FLAER, a reagent that specifically binds to GPI anchors. Using this PIGA-based reporter system, we successfully detected adeno-associated virus (AAV)-mediated gene targeting events both with and without promoter-trap enrichment of gene-targeted cell population. The PIGA-based reporter system was also capable of reproducing previous findings that an AAV-mediated gene targeting achieves a remarkably higher ratio of homologous versus random integration (H/R ratio) of targeting vectors than a plasmid-mediated gene targeting. The PIGA-based system also detected an approximately 2-fold increase in the H/R ratio achieved by a small negative selection cassette introduced at the end of the AAV-based targeting vector with a promoter-trap system. Thus, our PIGA-based system is useful for monitoring AAV-mediated gene targeting and will assist in improving gene targeting technology in human somatic cell lines. PMID:23056640
Ulrich, Julia; Dao, Van Anh; Majumdar, Upalparna; Schmitt-Engel, Christian; Schwirz, Jonas; Schultheis, Dorothea; Ströhlein, Nadi; Troelenberg, Nicole; Grossmann, Daniela; Richter, Tobias; Dönitz, Jürgen; Gerischer, Lizzy; Leboulle, Gérard; Vilcinskas, Andreas; Stanke, Mario; Bucher, Gregor
2015-09-03
Insect pest control is challenged by insecticide resistance and negative impact on ecology and health. One promising pest specific alternative is the generation of transgenic plants, which express double stranded RNAs targeting essential genes of a pest species. Upon feeding, the dsRNA induces gene silencing in the pest resulting in its death. However, the identification of efficient RNAi target genes remains a major challenge as genomic tools and breeding capacity is limited in most pest insects impeding whole-animal-high-throughput-screening. We use the red flour beetle Tribolium castaneum as a screening platform in order to identify the most efficient RNAi target genes. From about 5,000 randomly screened genes of the iBeetle RNAi screen we identify 11 novel and highly efficient RNAi targets. Our data allowed us to determine GO term combinations that are predictive for efficient RNAi target genes with proteasomal genes being most predictive. Finally, we show that RNAi target genes do not appear to act synergistically and that protein sequence conservation does not correlate with the number of potential off target sites. Our results will aid the identification of RNAi target genes in many pest species by providing a manageable number of excellent candidate genes to be tested and the proteasome as prime target. Further, the identified GO term combinations will help to identify efficient target genes from organ specific transcriptomes. Our off target analysis is relevant for the sequence selection used in transgenic plants.
Baumgartner, C K; Mattson, J G; Weiler, H; Shi, Q; Montgomery, R R
2017-01-01
Essentials Platelet-Factor (F) VIII gene therapy is a promising treatment in hemophilia A. This study aims to evaluate if platelet-FVIII expression would increase the risk for thrombosis. Targeting FVIII expression to platelets does not induce or elevate thrombosis risk. Platelets expressing FVIII are neither hyper-activated nor hyper-responsive. Background Targeting factor (F) VIII expression to platelets is a promising gene therapy approach for hemophilia A, and is successful even in the presence of inhibitors. It is well known that platelets play important roles not only in hemostasis, but also in thrombosis and inflammation. Objective To evaluate whether platelet-FVIII expression might increase thrombotic risk and thereby compromise the safety of this approach. Methods In this study, platelet-FVIII-expressing transgenic mice were examined either in steady-state conditions or under prothrombotic conditions induced by inflammation or the FV Leiden mutation. Native whole blood thrombin generation assay, rotational thromboelastometry analysis and ferric chloride-induced vessel injury were used to evaluate the hemostatic properties. Various parameters associated with thrombosis risk, including D-dimer, thrombin-antithrombin complexes, fibrinogen, tissue fibrin deposition, platelet activation status and activatability, and platelet-leukocyte aggregates, were assessed. Results We generated a new line of transgenic mice that expressed 30-fold higher levels of platelet-expressed FVIII than are therapeutically required to restore hemostasis in hemophilic mice. Under both steady-state conditions and prothrombotic conditions induced by lipopolysaccharide-mediated inflammation or the FV Leiden mutation, supratherapeutic levels of platelet-expressed FVIII did not appear to be thrombogenic. Furthermore, FVIII-expressing platelets were neither hyperactivated nor hyperactivatable upon agonist activation. Conclusion We conclude that, in mice, more than 30-fold higher levels of platelet-expressed FVIII than are required for therapeutic efficacy in hemophilia A are not associated with a thrombotic predilection. © 2016 International Society on Thrombosis and Haemostasis.
Kovacheva, Marineta; Zepp, Michael; Berger, Stefan M; Berger, Martin R
2014-07-30
Increased bone sialoprotein (BSP) serum levels are related to breast cancer skeletal metastasis, but their relevance is unknown. We elucidated novel intracellular BSP functions by a conditional knockdown of BSP. Conditional MDA-MB-231 subclones were equipped with a novel gene expression cassette containing a tet-reg-ulated miRNA providing knockdown of BSP production. These clones were used to assess the effect of BSP on morphology, proliferation, migration, colony formation and gene expression in vitro, and on soft tissue and osteolytic le-sions in a xenograft model by three imaging methods. BSP knockdown caused significant anti-proliferative, anti-migratory and anti-clonogenic effects in vitro (p<0.001). In vivo, significant de-creases of soft tissue and osteolytic lesions (p<0.03) were recorded after 3 weeks of miRNA treatment, leading to complete remission within 6 weeks. Microarray data revealed that 0.3% of genes were modulated in response to BSP knockdown. Upregulated genes included the endoplasmic reticulum stress genes ATF3 and DDIT3, the tumor suppressor gene EGR1, ID2 (related to breast epithelial differentiation), c-FOS and SERPINB2, whereas the metastasis associated genes CD44 and IL11 were downregulated. Also, activation of apoptotic pathways was demonstrated. These results implicate that intracellular BSP is essential for breast cancer skeletal metastasis and a target for treating these lesions.
Kovacheva, Marineta; Zepp, Michael; Berger, Stefan M.; Berger, Martin R.
2014-01-01
Increased bone sialoprotein (BSP) serum levels are related to breast cancer skeletal metastasis, but their relevance is unknown. We elucidated novel intracellular BSP functions by a conditional knockdown of BSP. Conditional MDA-MB-231 subclones were equipped with a novel gene expression cassette containing a tet-regulated miRNA providing knockdown of BSP production. These clones were used to assess the effect of BSP on morphology, proliferation, migration, colony formation and gene expression in vitro, and on soft tissue and osteolytic lesions in a xenograft model by three imaging methods. BSP knockdown caused significant anti-proliferative, anti-migratory and anti-clonogenic effects in vitro (p<0.001). In vivo, significant decreases of soft tissue and osteolytic lesions (p<0.03) were recorded after 3 weeks of miRNA treatment, leading to complete remission within 6 weeks. Microarray data revealed that 0.3% of genes were modulated in response to BSP knockdown. Upregulated genes included the endoplasmic reticulum stress genes ATF3 and DDIT3, the tumor suppressor gene EGR1, ID2 (related to breast epithelial differentiation), c-FOS and SERPINB2, whereas the metastasis associated genes CD44 and IL11 were downregulated. Also, activation of apoptotic pathways was demonstrated. These results implicate that intracellular BSP is essential for breast cancer skeletal metastasis and a target for treating these lesions. PMID:24980816
2017-01-01
Real-time quantitative PCR (qPCR) is the most reliable and accurate technique for analyses of gene expression. Endogenous reference genes are being used to normalize qPCR data even though their expression may vary under different conditions and in different tissues. Nonetheless, verification of expression of reference genes in selected studied tissue is essential in order to accurately assess the level of expression of target genes of interest. Therefore, in this study, we attempted to examine six commonly used reference genes in order to identify the gene being expressed most constantly under the influence of testosterone in the kidneys and hypothalamus. The reference genes include glyceraldehyde-3-phosphate dehydrogenase (GAPDH), actin beta (ACTB), beta-2 microglobulin (B2m), hypoxanthine phosphoribosyltransferase 1 (HPRT), peptidylprolylisomerase A (Ppia) and hydroxymethylbilane synthase (Hmbs). The cycle threshold (Ct) value for each gene was determined and data obtained were analyzed using the software programs NormFinder, geNorm, BestKeeper, and rank aggregation. Results showed that Hmbs and Ppia genes were the most stably expressed in the hypothalamus. Meanwhile, in kidneys, Hmbs and GAPDH appeared to be the most constant genes. In conclusion, variations in expression levels of reference genes occur in kidneys and hypothalamus under similar conditions; thus, it is important to verify reference gene levels in these tissues prior to commencing any studies. PMID:28591185
Pollard, Patrick J; Spencer-Dene, Bradley; Shukla, Deepa; Howarth, Kimberley; Nye, Emma; El-Bahrawy, Mona; Deheragoda, Maesha; Joannou, Maria; McDonald, Stuart; Martin, Alison; Igarashi, Peter; Varsani-Brown, Sunita; Rosewell, Ian; Poulsom, Richard; Maxwell, Patrick; Stamp, Gordon W; Tomlinson, Ian P M
2007-04-01
Germline mutations in the fumarate hydratase (FH) tumor suppressor gene predispose to leiomyomatosis, renal cysts, and renal cell cancer (HLRCC). HLRCC tumors overexpress HIF1alpha and hypoxia pathway genes. We conditionally inactivated mouse Fh1 in the kidney. Fh1 mutants developed multiple clonal renal cysts that overexpressed Hif1alpha and Hif2alpha. Hif targets, such as Glut1 and Vegf, were upregulated. We found that Fh1-deficient murine embryonic stem cells and renal carcinomas from HLRCC showed similar overexpression of HIF and hypoxia pathway components to the mouse cysts. Our data have shown in vivo that pseudohypoxic drive, resulting from HIF1alpha (and HIF2alpha) overexpression, is a direct consequence of Fh1 inactivation. Our mouse may be useful for testing therapeutic interventions that target angiogenesis and HIF-prolyl hydroxylation.
RNA Recognition and Stress Granule Formation by TIA Proteins
Waris, Saboora; Wilce, Matthew Charles James; Wilce, Jacqueline Anne
2014-01-01
Stress granule (SG) formation is a primary mechanism through which gene expression is rapidly modulated when the eukaryotic cell undergoes cellular stresses (including heat, oxidative, viral infection, starvation). In particular, the sequestration of specifically targeted translationally stalled mRNAs into SGs limits the expression of a subset of genes, but allows the expression of heatshock proteins that have a protective effect in the cell. The importance of SGs is seen in several disease states in which SG function is disrupted. Fundamental to SG formation are the T cell restricted intracellular antigen (TIA) proteins (TIA-1 and TIA-1 related protein (TIAR)), that both directly bind to target RNA and self-associate to seed the formation of SGs. Here a summary is provided of the current understanding of the way in which TIA proteins target specific mRNA, and how TIA self-association is triggered under conditions of cellular stress. PMID:25522169
Wedler, Jonas; Weston, Anna; Rausenberger, Julia; Butterweck, Veronika
2016-10-01
Classical production of rose oil is based on water steam distillation from the flowers of Rosa damascena. During this process, large quantities of waste water accrue which are discharged to the environment, causing severe pollution of both, groundwater and surface water due to a high content of polyphenols. We recently developed a strategy to purify the waste water into a polyphenol-depleted and a polyphenol-enriched fraction RF20-(SP-207). RF20-(SP-207) and sub-fraction F(IV) significantly inhibited cell proliferation and migration of HaCaT cells. Since there is a close interplay between these actions and inflammatory processes, here we focused on the fractions' influence on pro-inflammatory biomarkers. HaCaT keratinocytes were treated with RF20-(SP-207), F(IV) (both at 50μg/mL) and ellagic acid (10μM) for 24h under TNF-α (20ng/mL) stimulated and non-stimulated conditions. Gene expression of IL-1β, IL-6, IL-8, RANTES and MCP-1 was analyzed by reverse transcriptase polymerase chain reaction (RT-PCR) and cellular protein secretion of IL-8, RANTES and MCP-1 was determined by ELISA based assays. RF20-(SP-207) and F(IV) significantly decreased the expression and cellular protein secretion of IL-1β, IL-6, IL-8, RANTES and MCP-1. The diminishing effects on inflammatory target gene expression were slightly less pronounced under TNF-α stimulated conditions. In conclusion, the recovered polyphenol fraction RF20-(SP-207) from rose oil distillation waste water markedly modified inflammatory target gene expression in vitro, and, therefore, could be further developed as alternative treatment of acute and chronic inflammation. Copyright © 2016 Elsevier B.V. All rights reserved.
Ablation of the MiR-17-92 MicroRNA Cluster in Germ Cells Causes Subfertility in Female Mice.
Wang, Jian; Xu, Bo; Tian, Geng G; Sun, Tao; Wu, Ji
2018-01-01
Oogenesis is a highly complex process that is intricately regulated by interactions of multiple genes and signaling molecules. However, the underlying molecular mechanisms are poorly understood. There is emerging evidence that microRNAs contribute to oogenesis. Here, we aimed to investigate the role of miR-17-92 cluster in regulating oogenesis. The miR-17-92 cluster was genetically ablated in germ cells of female mice by applying the Cre-loxp system for conditional gene knockout. Mating experiment, superovulation and histological analysis were used to assess the fertility of the model female mice. TUNEL assay was used to identify apoptotic cells in ovaries. The expression level of apoptosis- and follicular atresia- related genes was evaluated by qRT-PCR. Western blotting was performed to detect protein expression. Bioinformatics software and dual luciferase reporter assay were applied to predict and verify the target of miR-17-92 cluster. Deletion of miR-17-92 cluster in germ cells of female mice caused increased oocyte degradation and follicular atresia, perturbed oogenesis, and ultimately led to subfertility. Genes involved in follicular atresia and the mitochondrial apoptotic pathway were obviously up-regulated. Furthermore, we verified that miR-19a regulated oogenesis at the post-transcriptional level by targeting Bmf in the ovaries of miR-17-92 cluster conditional knockout female mice. The miR-17-92 cluster is an important regulator of oogenesis. These findings will assist in better understanding the etiology of disorders in oogenesis and in developing new therapeutic targets for female infertility. © 2018 The Author(s). Published by S. Karger AG, Basel.
Varala, Kranthi; Marshall-Colón, Amy; Cirrone, Jacopo; Brooks, Matthew D; Pasquino, Angelo V; Léran, Sophie; Mittal, Shipra; Rock, Tara M; Edwards, Molly B; Kim, Grace J; Ruffel, Sandrine; McCombie, W Richard; Shasha, Dennis; Coruzzi, Gloria M
2018-06-19
This study exploits time, the relatively unexplored fourth dimension of gene regulatory networks (GRNs), to learn the temporal transcriptional logic underlying dynamic nitrogen (N) signaling in plants. Our "just-in-time" analysis of time-series transcriptome data uncovered a temporal cascade of cis elements underlying dynamic N signaling. To infer transcription factor (TF)-target edges in a GRN, we applied a time-based machine learning method to 2,174 dynamic N-responsive genes. We experimentally determined a network precision cutoff, using TF-regulated genome-wide targets of three TF hubs (CRF4, SNZ, and CDF1), used to "prune" the network to 155 TFs and 608 targets. This network precision was reconfirmed using genome-wide TF-target regulation data for four additional TFs (TGA1, HHO5/6, and PHL1) not used in network pruning. These higher-confidence edges in the GRN were further filtered by independent TF-target binding data, used to calculate a TF "N-specificity" index. This refined GRN identifies the temporal relationship of known/validated regulators of N signaling (NLP7/8, TGA1/4, NAC4, HRS1, and LBD37/38/39) and 146 additional regulators. Six TFs-CRF4, SNZ, CDF1, HHO5/6, and PHL1-validated herein regulate a significant number of genes in the dynamic N response, targeting 54% of N-uptake/assimilation pathway genes. Phenotypically, inducible overexpression of CRF4 in planta regulates genes resulting in altered biomass, root development, and 15 NO 3 - uptake, specifically under low-N conditions. This dynamic N-signaling GRN now provides the temporal "transcriptional logic" for 155 candidate TFs to improve nitrogen use efficiency with potential agricultural applications. Broadly, these time-based approaches can uncover the temporal transcriptional logic for any biological response system in biology, agriculture, or medicine. Copyright © 2018 the Author(s). Published by PNAS.
Integration of oxygen signaling at the consensus HRE.
Wenger, Roland H; Stiehl, Daniel P; Camenisch, Gieri
2005-10-18
The hypoxia-inducible factor 1 (HIF-1) was initially identified as a transcription factor that regulated erythropoietin gene expression in response to a decrease in oxygen availability in kidney tissue. Subsequently, a family of oxygen-dependent protein hydroxylases was found to regulate the abundance and activity of three oxygen-sensitive HIFalpha subunits, which, as part of the HIF heterodimer, regulated the transcription of at least 70 different effector genes. In addition to responding to a decrease in tissue oxygenation, HIF is proactively induced, even under normoxic conditions, in response to stimuli that lead to cell growth, ultimately leading to higher oxygen consumption. The growing cell thus profits from an anticipatory increase in HIF-dependent target gene expression. Growth stimuli-activated signaling pathways that influence the abundance and activity of HIFs include pathways in which kinases are activated and pathways in which reactive oxygen species are liberated. These pathways signal to the HIF protein hydroxylases, as well as to HIF itself, by means of covalent or redox modifications and protein-protein interactions. The final point of integration of all of these pathways is the hypoxia-response element (HRE) of effector genes. Here, we provide comprehensive compilations of the known growth stimuli that promote increases in HIF abundance, of protein-protein interactions involving HIF, and of the known HIF effector genes. The consensus HRE derived from a comparison of the HREs of these HIF effectors will be useful for identification of novel HIF target genes, design of oxygen-regulated gene therapy, and prediction of effects of future drugs targeting the HIF system.
Kudo, Toru; Sasaki, Yohei; Terashima, Shin; Matsuda-Imai, Noriko; Takano, Tomoyuki; Saito, Misa; Kanno, Maasa; Ozaki, Soichi; Suwabe, Keita; Suzuki, Go; Watanabe, Masao; Matsuoka, Makoto; Takayama, Seiji; Yano, Kentaro
2016-10-13
In quantitative gene expression analysis, normalization using a reference gene as an internal control is frequently performed for appropriate interpretation of the results. Efforts have been devoted to exploring superior novel reference genes using microarray transcriptomic data and to evaluating commonly used reference genes by targeting analysis. However, because the number of specifically detectable genes is totally dependent on probe design in the microarray analysis, exploration using microarray data may miss some of the best choices for the reference genes. Recently emerging RNA sequencing (RNA-seq) provides an ideal resource for comprehensive exploration of reference genes since this method is capable of detecting all expressed genes, in principle including even unknown genes. We report the results of a comprehensive exploration of reference genes using public RNA-seq data from plants such as Arabidopsis thaliana (Arabidopsis), Glycine max (soybean), Solanum lycopersicum (tomato) and Oryza sativa (rice). To select reference genes suitable for the broadest experimental conditions possible, candidates were surveyed by the following four steps: (1) evaluation of the basal expression level of each gene in each experiment; (2) evaluation of the expression stability of each gene in each experiment; (3) evaluation of the expression stability of each gene across the experiments; and (4) selection of top-ranked genes, after ranking according to the number of experiments in which the gene was expressed stably. Employing this procedure, 13, 10, 12 and 21 top candidates for reference genes were proposed in Arabidopsis, soybean, tomato and rice, respectively. Microarray expression data confirmed that the expression of the proposed reference genes under broad experimental conditions was more stable than that of commonly used reference genes. These novel reference genes will be useful for analyzing gene expression profiles across experiments carried out under various experimental conditions.
Hoover, Sharon E; Xu, Weihong; Xiao, Wenzhong; Burkholder, William F
2010-08-01
The SOS response to DNA damage in bacteria is a well-known component of the complex transcriptional responses to genotoxic environmental stresses such as exposure to reactive oxygen species, alkylating agents, and many of the antibiotics targeting DNA replication. However, bacteria such as Bacillus subtilis also respond to conditions that perturb DNA replication via a transcriptional response mediated by the replication initiation protein DnaA. In addition to regulating the initiation of DNA replication, DnaA directly regulates the transcription of specific genes. Conditions that perturb DNA replication can trigger the accumulation of active DnaA, activating or repressing the transcription of genes in the DnaA regulon. We report here that simply growing B. subtilis in LB medium altered DnaA-dependent gene expression in a manner consistent with the accumulation of active DnaA and that this was part of a general transcriptional response to manganese limitation. The SOS response to DNA damage was not induced under these conditions. One of the genes positively regulated by DnaA in Bacillus subtilis encodes a protein that inhibits the initiation of sporulation, Sda. Sda expression was induced as cells entered stationary phase in LB medium but not in LB medium supplemented with manganese, and the induction of Sda inhibited sporulation-specific gene expression and the onset of spore morphogenesis. In the absence of Sda, manganese-limited cells initiated spore development but failed to form mature spores. These data highlight that DnaA-dependent gene expression may influence the response of bacteria to a range of environmental conditions, including conditions that are not obviously associated with genotoxic stress.
Hoover, Sharon E.; Xu, Weihong; Xiao, Wenzhong; Burkholder, William F.
2010-01-01
The SOS response to DNA damage in bacteria is a well-known component of the complex transcriptional responses to genotoxic environmental stresses such as exposure to reactive oxygen species, alkylating agents, and many of the antibiotics targeting DNA replication. However, bacteria such as Bacillus subtilis also respond to conditions that perturb DNA replication via a transcriptional response mediated by the replication initiation protein DnaA. In addition to regulating the initiation of DNA replication, DnaA directly regulates the transcription of specific genes. Conditions that perturb DNA replication can trigger the accumulation of active DnaA, activating or repressing the transcription of genes in the DnaA regulon. We report here that simply growing B. subtilis in LB medium altered DnaA-dependent gene expression in a manner consistent with the accumulation of active DnaA and that this was part of a general transcriptional response to manganese limitation. The SOS response to DNA damage was not induced under these conditions. One of the genes positively regulated by DnaA in Bacillus subtilis encodes a protein that inhibits the initiation of sporulation, Sda. Sda expression was induced as cells entered stationary phase in LB medium but not in LB medium supplemented with manganese, and the induction of Sda inhibited sporulation-specific gene expression and the onset of spore morphogenesis. In the absence of Sda, manganese-limited cells initiated spore development but failed to form mature spores. These data highlight that DnaA-dependent gene expression may influence the response of bacteria to a range of environmental conditions, including conditions that are not obviously associated with genotoxic stress. PMID:20511500
Feinstein, P. G.; Kornfeld, K.; Hogness, D. S.; Mann, R. S.
1995-01-01
In Drosophila, the specific morphological characteristics of each segment are determined by the homeotic genes that regulate the expression of downstream target genes. We used a subtractive hybridization procedure to isolate activated target genes of the homeotic gene Ultrabithorax (Ubx). In addition, we constructed a set of mutant genotypes that measures the regulatory contribution of individual homeotic genes to a complex target gene expression pattern. Using these mutants, we demonstrate that homeotic genes can regulate target gene expression at the start of gastrulation, suggesting a previously unknown role for the homeotic genes at this early stage. We also show that, in abdominal segments, the levels of expression for two target genes increase in response to high levels of Ubx, demonstrating that the normal down-regulation of Ubx in these segments is functional. Finally, the DNA sequence of cDNAs for one of these genes predicts a protein that is similar to a human proto-oncogene involved in acute myeloid leukemias. These results illustrate potentially general rules about the homeotic control of target gene expression and suggest that subtractive hybridization can be used to isolate interesting homeotic target genes. PMID:7498738
Expression-based clustering of CAZyme-encoding genes of Aspergillus niger.
Gruben, Birgit S; Mäkelä, Miia R; Kowalczyk, Joanna E; Zhou, Miaomiao; Benoit-Gelber, Isabelle; De Vries, Ronald P
2017-11-23
The Aspergillus niger genome contains a large repertoire of genes encoding carbohydrate active enzymes (CAZymes) that are targeted to plant polysaccharide degradation enabling A. niger to grow on a wide range of plant biomass substrates. Which genes need to be activated in certain environmental conditions depends on the composition of the available substrate. Previous studies have demonstrated the involvement of a number of transcriptional regulators in plant biomass degradation and have identified sets of target genes for each regulator. In this study, a broad transcriptional analysis was performed of the A. niger genes encoding (putative) plant polysaccharide degrading enzymes. Microarray data focusing on the initial response of A. niger to the presence of plant biomass related carbon sources were analyzed of a wild-type strain N402 that was grown on a large range of carbon sources and of the regulatory mutant strains ΔxlnR, ΔaraR, ΔamyR, ΔrhaR and ΔgalX that were grown on their specific inducing compounds. The cluster analysis of the expression data revealed several groups of co-regulated genes, which goes beyond the traditionally described co-regulated gene sets. Additional putative target genes of the selected regulators were identified, based on their expression profile. Notably, in several cases the expression profile puts questions on the function assignment of uncharacterized genes that was based on homology searches, highlighting the need for more extensive biochemical studies into the substrate specificity of enzymes encoded by these non-characterized genes. The data also revealed sets of genes that were upregulated in the regulatory mutants, suggesting interaction between the regulatory systems and a therefore even more complex overall regulatory network than has been reported so far. Expression profiling on a large number of substrates provides better insight in the complex regulatory systems that drive the conversion of plant biomass by fungi. In addition, the data provides additional evidence in favor of and against the similarity-based functions assigned to uncharacterized genes.
Advances in ultrasound-targeted microbubble-mediated gene therapy for liver fibrosis.
Huang, Cuiyuan; Zhang, Hong; Bai, Ruidan
2017-07-01
Hepatic fibrosis develops as a wound-healing scar in response to acute and chronic liver inflammation and can lead to cirrhosis in patients with chronic hepatitis B and C. The condition arises due to increased synthesis and reduced degradation of extracellular matrix (ECM) and is a common pathological sequela of chronic liver disease. Excessive deposition of ECM in the liver causes liver dysfunction, ascites, and eventually upper gastrointestinal bleeding as well as a series of complications. However, fibrosis can be reversed before developing into cirrhosis and has thus been the subject of extensive researches particularly at the gene level. Currently, therapeutic genes are imported into the damaged liver to delay or prevent the development of liver fibrosis by regulating the expression of exogenous genes. One technique of gene delivery uses ultrasound targeting of microbubbles combined with therapeutic genes where the time and intensity of the ultrasound can control the release process. Ultrasound irradiation of microbubbles in the vicinity of cells changes the permeability of the cell membrane by its cavitation effect and enhances gene transfection. In this paper, recent progress in the field is reviewed with emphasis on the following aspects: the types of ultrasound microbubbles, the construction of an ultrasound-mediated gene delivery system, the mechanism of ultrasound microbubble-mediated gene transfer and the application of ultrasound microbubbles in the treatment of liver fibrosis.
Martin, Guiomar; Soy, Judit; Monte, Elena
2016-01-01
Members of the PIF quartet (PIFq; PIF1, PIF3, PIF4, and PIF5) collectively contribute to induce growth in Arabidopsis seedlings under short day (SD) conditions, specifically promoting elongation at dawn. Their action involves the direct regulation of growth-related and hormone-associated genes. However, a comprehensive definition of the PIFq-regulated transcriptome under SD is still lacking. We have recently shown that SD and free-running (LL) conditions correspond to "growth" and "no growth" conditions, respectively, correlating with greater abundance of PIF protein in SD. Here, we present a genomic analysis whereby we first define SD-regulated genes at dawn compared to LL in the wild type, followed by identification of those SD-regulated genes whose expression depends on the presence of PIFq. By using this sequential strategy, we have identified 349 PIF/SD-regulated genes, approximately 55% induced and 42% repressed by both SD and PIFq. Comparison with available databases indicates that PIF/SD-induced and PIF/SD-repressed sets are differently phased at dawn and mid-morning, respectively. In addition, we found that whereas rhythmicity of the PIF/SD-induced gene set is lost in LL, most PIF/SD-repressed genes keep their rhythmicity in LL, suggesting differential regulation of both gene sets by the circadian clock. Moreover, we also uncovered distinct overrepresented functions in the induced and repressed gene sets, in accord with previous studies in other examined PIF-regulated processes. Interestingly, promoter analyses showed that, whereas PIF/SD-induced genes are enriched in direct PIF targets, PIF/SD-repressed genes are mostly indirectly regulated by the PIFs and might be more enriched in ABA-regulated genes.
Pseudomonas aeruginosa essentials: an update on investigation of essential genes.
Juhas, Mario
2015-11-01
Pseudomonas aeruginosa is the leading cause of nosocomial infections, particularly in immunocompromised, cancer, burn and cystic fibrosis patients. Development of novel antimicrobials against P. aeruginosa is therefore of the highest importance. Although the first reports on P. aeruginosa essential genes date back to the early 2000s, a number of more sensitive genomic approaches have been used recently to better define essential genes in this organism. These analyses highlight the evolution of the definition of an 'essential' gene from the traditional to the context-dependent. Essential genes, particularly those indispensable under the clinically relevant conditions, are considered to be promising targets of novel antibiotics against P. aeruginosa. This review provides an update on the investigation of P. aeruginosa essential genes. Special focus is on recently identified P. aeruginosa essential genes and their exploitation for the development of antimicrobials.
Bernal, Laura; Alvarado-Vázquez, Abigail; Ferreira, David Wilson; Paige, Candler A; Ulecia-Morón, Cristina; Hill, Bailey; Caesar, Marina; Romero-Sandoval, E Alfonso
2017-02-01
Macrophages orchestrate the initiation and resolution of inflammation by producing pro- and anti-inflammatory products. An imbalance in these mediators may originate from a deficient or excessive immune response. Therefore, macrophages are valid therapeutic targets to restore homeostasis under inflammatory conditions. We hypothesize that a specific mannosylated nanoparticle effectively induces gene expression in human macrophages under inflammatory conditions without undesirable immunogenic responses. THP-1 macrophages were challenged with lipopolysaccharide (LPS, 5μg/mL). Polyethylenimine (PEI) nanoparticles grafted with a mannose receptor ligand (Man-PEI) were used as a gene delivery method. Nanoparticle toxicity, Man-PEI cellular uptake rate and gene induction efficiency (GFP, CD14 or CD68) were studied. Potential immunogenic responses were evaluated by measuring the production of tumor necrosis factor-alpha (TNF-α), Interleukin (IL)-6 and IL-10. Man-PEI did not produce cytotoxicity, and it was effectively up-taken by THP-1 macrophages (69%). This approach produced a significant expression of GFP (mRNA and protein), CD14 and CD68 (mRNA), and transiently and mildly reduced IL-6 and IL-10 levels in LPS-challenged macrophages. Our results indicate that Man-PEI is suitable for inducing an efficient gene overexpression in human macrophages under inflammatory conditions with limited immunogenic responses. Our promising results set the foundation to test this technology to induce functional anti-inflammatory genes. Copyright © 2016 Elsevier GmbH. All rights reserved.
Puttini, Stefania; Ouvrard-Pascaud, Antoine; Palais, Gael; Beggah, Ahmed T; Gascard, Philippe; Cohen-Tannoudji, Michel; Babinet, Charles; Blot-Chabaud, Marcel; Jaisser, Frederic
2005-03-16
Functional genomic analysis is a challenging step in the so-called post-genomic field. Identification of potential targets using large-scale gene expression analysis requires functional validation to identify those that are physiologically relevant. Genetically modified cell models are often used for this purpose allowing up- or down-expression of selected targets in a well-defined and if possible highly differentiated cell type. However, the generation of such models remains time-consuming and expensive. In order to alleviate this step, we developed a strategy aimed at the rapid and efficient generation of genetically modified cell lines with conditional, inducible expression of various target genes. Efficient knock-in of various constructs, called targeted transgenesis, in a locus selected for its permissibility to the tet inducible system, was obtained through the stimulation of site-specific homologous recombination by the meganuclease I-SceI. Our results demonstrate that targeted transgenesis in a reference inducible locus greatly facilitated the functional analysis of the selected recombinant cells. The efficient screening strategy we have designed makes possible automation of the transfection and selection steps. Furthermore, this strategy could be applied to a variety of highly differentiated cells.
TLX-Its Emerging Role for Neurogenesis in Health and Disease.
Sobhan, Praveen K; Funa, Keiko
2017-01-01
The orphan nuclear receptor TLX, also called NR2E1, is a factor important in the regulation of neural stem cell (NSC) self-renewal, neurogenesis, and maintenance. As a transcription factor, TLX is vital for the expression of genes implicated in neurogenesis, such as DNA replication, cell cycle, adhesion and migration. It acts by way of repressing or activating target genes, as well as controlling protein-protein interactions. Growing evidence suggests that dysregulated TLX acts in the initiation and progression of human disorders of the nervous system. This review describes recent knowledge about TLX expression, structure, targets, and biological functions, relevant to maintaining adult neural stem cells related to both neuropsychiatric conditions and certain nervous system tumours.
Mutation and virulence assessment of chromosomal genes of Rhodococcus equi 103
Pei, Yanlong; Parreira, Valeria; Nicholson, Vivian M.; Prescott, John F.
2007-01-01
Rhodococcus equi can cause severe or fatal pneumonia in foals as well as in immunocompromised animals and humans. Its ability to persist in macrophages is fundamental to how it causes disease, but the basis of this is poorly understood. To examine further the general application of a recently developed system of targeted gene mutation and to assess the importance of different genes in resistance to innate immune defenses, we disrupted the genes encoding high-temperature requirement A (htrA), nitrate reductase (narG), peptidase D (pepD), phosphoribosylaminoimidazole-succinocarboxamide synthase (purC), and superoxide dismutase (sodC) in strain 103 of R. equi using a double-crossover homologous recombination approach. Virulence testing by clearance after intravenous injection in mice showed that the htrA and narG mutants were fully attenuated, the purC and sodC mutants were unchanged, and the pepD mutant was slightly attenuated. Complementation with the pREM shuttle plasmid restored the virulence of the htrA and pepD mutants but not that of the narG mutant. A single-crossover mutation approach was simpler and faster than the double-crossover homologous recombination technique and was used to obtain mutations in 6 other genes potentially involved in virulence (clpB, fadD8, fbpB, glnA1, regX3, and sigF). These mutants were not attenuated in the mouse clearance assay. We were not able to obtain mutants for genes furA, galE, and sigE using the single-crossover mutation approach. In summary, the targeted-mutation system had general applicability but was not always completely successful, perhaps because some genes are essential under the growth conditions used or because the success of mutation depends on the target genes. PMID:17193875
Role and regulation of autophagy in heat stress responses of tomato plants
Zhou, Jie; Wang, Jian; Yu, Jing-Quan; Chen, Zhixiang
2014-01-01
As sessile organisms, plants are constantly exposed to a wide spectrum of stress conditions such as high temperature, which causes protein misfolding. Misfolded proteins are highly toxic and must be efficiently removed to reduce cellular proteotoxic stress if restoration of native conformations is unsuccessful. Although selective autophagy is known to function in protein quality control by targeting degradation of misfolded and potentially toxic proteins, its role and regulation in heat stress responses have not been analyzed in crop plants. In the present study, we found that heat stress induced expression of autophagy-related (ATG) genes and accumulation of autophagosomes in tomato plants. Virus-induced gene silencing (VIGS) of tomato ATG5 and ATG7 genes resulted in increased sensitivity of tomato plants to heat stress based on both increased development of heat stress symptoms and compromised photosynthetic parameters of heat-stressed leaf tissues. Silencing of tomato homologs for the selective autophagy receptor NBR1, which targets ubiquitinated protein aggregates, also compromised tomato heat tolerance. To better understand the regulation of heat-induced autophagy, we found that silencing of tomato ATG5, ATG7, or NBR1 compromised heat-induced expression of not only the targeted genes but also other autophagy-related genes. Furthermore, we identified two tomato genes encoding proteins highly homologous to Arabidopsis WRKY33 transcription factor, which has been previously shown to interact physically with an autophagy protein. Silencing of tomato WRKY33 genes compromised tomato heat tolerance and reduced heat-induced ATG gene expression and autophagosome accumulation. Based on these results, we propose that heat-induced autophagy in tomato is subject to cooperative regulation by both WRKY33 and ATG proteins and plays a critical role in tomato heat tolerance, mostly likely through selective removal of heat-induced protein aggregates. PMID:24817875
Gupta, Divya; Harvey, Stephen A. K.; Kaminski, Naftali
2011-01-01
Purpose. To identify the changes in postnatal mouse conjunctival forniceal gene expression and their regulation by Klf4 during the eye-opening stage when the goblet cells first appear. Methods. Laser microdissection (LMD) was used to collect conjunctival forniceal cells from postnatal (PN) day 9, PN14 and PN20 wild-type (WT), and PN14 Klf4-conditional null (Klf4CN) mice, in which goblet cells are absent, developing, present, and missing, respectively. Microarrays were used to compare gene expression among these groups. Expression of selected genes was validated by quantitative RT-PCR, and spatiotemporal expression was assessed by in situ hybridization. Results. This study identified 668, 251, 1160, and 139 transcripts that were increased and 492, 377, 1419, and 57 transcripts that were decreased between PN9 and PN14, PN14 and PN20, PN9 and PN20, and PN14 WT and Klf4CN conjunctiva, respectively. Transcripts encoding transcription factors Spdef, FoxA1, and FoxA3 that regulate goblet cell development in other mucosal epithelia, and epithelium-specific Ets (ESE) transcription factor family members were increased during conjunctival development. Components of pathways related to the mesenchymal–epithelial transition, glycoprotein biosynthesis, mucosal immunity, signaling, and endocytic and neural regulation were increased during conjunctival development. Conjunctival Klf4 target genes differed significantly from the previously identified corneal Klf4 target genes, implying tissue-dependent regulatory targets for Klf4. Conclusions. The changes in gene expression accompanying mouse conjunctival development were identified, and the role of Klf4 in this process was determined. This study provides new probes for examining conjunctival development and function and reveals that the gene regulatory network necessary for goblet cell development is conserved across different mucosal epithelia. PMID:21398290
Meng, Jia; Kanzaki, Gregory; Meas, Diane; Lam, Christopher K; Crummer, Heather; Tain, Justina; Xu, H Howard
2012-04-01
Regulated antisense RNA (asRNA) expression has been employed successfully in Gram-positive bacteria for genome-wide essential gene identification and drug target determination. However, there have been no published reports describing the application of asRNA gene silencing for comprehensive analyses of essential genes in Gram-negative bacteria. In this study, we report the first genome-wide identification of asRNA constructs for essential genes in Escherichia coli. We screened 250 000 library transformants for conditional growth inhibitory recombinant clones from two shotgun genomic libraries of E. coli using a paired-termini expression vector (pHN678). After sequencing plasmid inserts of 675 confirmed inducer sensitive cell clones, we identified 152 separate asRNA constructs of which 134 inserts came from essential genes, while 18 originated from nonessential genes (but share operons with essential genes). Among the 79 individual essential genes silenced by these asRNA constructs, 61 genes (77%) engage in processes related to protein synthesis. The cell-based assays of an asRNA clone targeting fusA (encoding elongation factor G) showed that the induced cells were sensitized 12-fold to fusidic acid, a known specific inhibitor. Our results demonstrate the utility of the paired-termini expression vector and feasibility of large-scale gene silencing in E. coli using regulated asRNA expression. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.
ARMOUR - A Rice miRNA: mRNA Interaction Resource.
Sanan-Mishra, Neeti; Tripathi, Anita; Goswami, Kavita; Shukla, Rohit N; Vasudevan, Madavan; Goswami, Hitesh
2018-01-01
ARMOUR was developed as A Rice miRNA:mRNA interaction resource. This informative and interactive database includes the experimentally validated expression profiles of miRNAs under different developmental and abiotic stress conditions across seven Indian rice cultivars. This comprehensive database covers 689 known and 1664 predicted novel miRNAs and their expression profiles in more than 38 different tissues or conditions along with their predicted/known target transcripts. The understanding of miRNA:mRNA interactome in regulation of functional cellular machinery is supported by the sequence information of the mature and hairpin structures. ARMOUR provides flexibility to users in querying the database using multiple ways like known gene identifiers, gene ontology identifiers, KEGG identifiers and also allows on the fly fold change analysis and sequence search query with inbuilt BLAST algorithm. ARMOUR database provides a cohesive platform for novel and mature miRNAs and their expression in different experimental conditions and allows searching for their interacting mRNA targets, GO annotation and their involvement in various biological pathways. The ARMOUR database includes a provision for adding more experimental data from users, with an aim to develop it as a platform for sharing and comparing experimental data contributed by research groups working on rice.
Cui, Julia Yue; Klaassen, Curtis D
2016-09-01
The pregnane X receptor (PXR) and constitutive androstane receptor (CAR) are well-known xenobiotic-sensing nuclear receptors with overlapping functions. However, there lacks a quantitative characterization to distinguish between the PXR and CAR target genes and signaling pathways in the liver. The present study performed a transcriptomic comparison of the PXR- and CAR-targets using RNA-Seq in livers of adult wild-type mice that were treated with the prototypical PXR ligand PCN (200mg/kg, i.p. once daily for 4days in corn oil) or the prototypical CAR ligand TCPOBOP (3mg/kg, i.p., once daily for 4days in corn oil). At the given doses, TCPOBOP differentially regulated many more genes (2125) than PCN (212), and 147 of the same genes were differentially regulated by both chemicals. As expected, the top pathways differentially regulated by both PCN and TCPOBOP were involved in xenobiotic metabolism, and they also up-regulated genes involved in retinoid metabolism, but down-regulated genes involved in inflammation and iron homeostasis. Regarding unique pathways, PXR activation appeared to overlap with the aryl hydrocarbon receptor signaling, whereas CAR activation appeared to overlap with the farnesoid X receptor signaling, acute-phase response, and mitochondrial dysfunction. The mRNAs of differentially regulated drug-processing genes (DPGs) partitioned into three patterns, namely TCPOBOP-induced, PCN-induced, as well as TCPOBOP-suppressed gene clusters. The cumulative mRNAs of the differentially regulated DPGs, phase-I and -II enzymes, as well as efflux transporters were all up-regulated by both PCN and TCPOBOPOP, whereas the cumulative mRNAs of the uptake transporters were down-regulated only by TCPOBOP. The absolute mRNA abundance in control and receptor-activated conditions was examined in each DPG category to predict the contribution of specific DPG genes in the PXR/CAR-mediated pharmacokinetic responses. The preferable differential regulation by TCPOBOP in the entire hepatic transcriptome correlated with a marked change in the expression of many DNA and histone epigenetic modifiers. In conclusion, the present study has revealed known and novel, as well as common and unique targets of PXR and CAR in mouse liver following pharmacological activation using their prototypical ligands. Results from this study will further support the role of these receptors in regulating the homeostasis of xenobiotic and intermediary metabolism in the liver, and aid in distinguishing between PXR and CAR signaling at various physiological and pathophysiological conditions. This article is part of a Special Issue entitled: Xenobiotic nuclear receptors: New Tricks for An Old Dog, edited by Dr. Wen Xie. Copyright © 2016 Elsevier B.V. All rights reserved.
Sindarovska, Y R; Gerasymenko, I M; Sheludko, Y V; Olevinskaya, Z M; Spivak, N Y; Kuchuk, N V
2010-01-01
Human interferon alpha2b gene was transiently expressed in Nicotiana excelsior plants. Fusion with N. plumbaginifolia calreticulin signal peptide for improved apoplast targeting and carrying out the expression under optimized conditions resulted in maximal interferon activity of 3.2 x 10(3) IU/g fresh weight (FW) with an average of 2.1 +/- 0.8 x 10(3) IU/g FW. It proves that N. excelsior is a suitable host for Agrobacterium-mediated transient expression of genes encoding physiologically active human proteins. The transient expression conditions optimized for GFP marker protein were confirmed to be preferable for hIFN alpha2b.
STAT3 or USF2 Contributes to HIF Target Gene Specificity
Pawlus, Matthew R.; Wang, Liyi; Murakami, Aya; Dai, Guanhai; Hu, Cheng-Jun
2013-01-01
The HIF1- and HIF2-mediated transcriptional responses play critical roles in solid tumor progression. Despite significant similarities, including their binding to promoters of both HIF1 and HIF2 target genes, HIF1 and HIF2 proteins activate unique subsets of target genes under hypoxia. The mechanism for HIF target gene specificity has remained unclear. Using siRNA or inhibitor, we previously reported that STAT3 or USF2 is specifically required for activation of endogenous HIF1 or HIF2 target genes. In this study, using reporter gene assays and chromatin immuno-precipitation, we find that STAT3 or USF2 exhibits specific binding to the promoters of HIF1 or HIF2 target genes respectively even when over-expressed. Functionally, HIF1α interacts with STAT3 to activate HIF1 target gene promoters in a HIF1α HLH/PAS and N-TAD dependent manner while HIF2α interacts with USF2 to activate HIF2 target gene promoters in a HIF2α N-TAD dependent manner. Physically, HIF1α HLH and PAS domains are required for its interaction with STAT3 while both N- and C-TADs of HIF2α are involved in physical interaction with USF2. Importantly, addition of functional USF2 binding sites into a HIF1 target gene promoter increases the basal activity of the promoter as well as its response to HIF2+USF2 activation while replacing HIF binding site with HBS from a HIF2 target gene does not change the specificity of the reporter gene. Importantly, RNA Pol II on HIF1 or HIF2 target genes is primarily associated with HIF1α or HIF2α in a STAT3 or USF2 dependent manner. Thus, we demonstrate here for the first time that HIF target gene specificity is achieved by HIF transcription partners that are required for HIF target gene activation, exhibit specific binding to the promoters of HIF1 or HIF2 target genes and selectively interact with HIF1α or HIF2α protein. PMID:23991099
Zinc Finger Nuclease: A New Approach to Overcome Beta-Lactam Antibiotic Resistance
Shahbazi Dastjerdeh, Mansoureh; Kouhpayeh, Shirin; Sabzehei, Faezeh; Khanahmad, Hossein; Salehi, Mansour; Mohammadi, Zahra; Shariati, Laleh; Hejazi, Zahra; Rabiei, Parisa; Manian, Mostafa
2016-01-01
Background: The evolution of antibiotic-resistant bacteria (ARB) and antibiotic-resistance genes (ARGs) has been accelerated recently by the indiscriminate application of antibiotics. Antibiotic resistance has challenged the success of medical interventions and therefore is considered a hazardous threat to human health. Objectives: The present study aimed to describe the use of zinc finger nuclease (ZFN) technology to target and disrupt a plasmid-encoded β-lactamase, which prevents horizontal gene transfer-mediated evolution of ARBs. Materials and Methods: An engineered ZFN was designed to target a specific sequence in the ampicillin resistance gene (ampR) of the pTZ57R plasmid. The Escherichia coli bacteria already contained the pZFN kanamycin-resistant (kanaR) plasmid as the case or the pP15A, kanaR empty vector as the control, were transformed with the pTZ57R; the ability of the designed ZFN to disrupt the β-lactamase gene was evaluated with the subsequent disturbed ability of the bacteria to grow on ampicillin (amp) and ampicillin-kanamycin (amp-kana)-containing media. The effect of mild hypothermia on the ZFN gene targeting efficiency was also evaluated. Results: The growth of bacteria in the case group on the amp and amp-kana-containing media was significantly lower compared with the control group at 37°C (P < 0.001). Despite being more efficient in hypothermic conditions at 30°C (P < 0.001), there were no significant associations between the incubation temperature and the ZFN gene targeting efficiency. Conclusions: Our findings revealed that the ZFN technology could be employed to overcome ampicillin resistance by the targeted disruption of the ampicillin resistance gene, which leads to inactivation of β-lactam synthesis. Therefore, ZFN technology could be engaged to decrease the antibiotic resistance issue with the construction of a ZFN archive against different ARGs. To tackle the resistance issue at the environmental level, recombinant phages expressing ZFNs against different ARGs could be constructed and released into both hospital and urban wastewater systems. PMID:27099691
Adaptation to climate through flowering phenology: a case study in Medicago truncatula.
Burgarella, Concetta; Chantret, Nathalie; Gay, Laurène; Prosperi, Jean-Marie; Bonhomme, Maxime; Tiffin, Peter; Young, Nevin D; Ronfort, Joelle
2016-07-01
Local climatic conditions likely constitute an important selective pressure on genes underlying important fitness-related traits such as flowering time, and in many species, flowering phenology and climatic gradients strongly covary. To test whether climate shapes the genetic variation on flowering time genes and to identify candidate flowering genes involved in the adaptation to environmental heterogeneity, we used a large Medicago truncatula core collection to examine the association between nucleotide polymorphisms at 224 candidate genes and both climate variables and flowering phenotypes. Unlike genome-wide studies, candidate gene approaches are expected to enrich for the number of meaningful trait associations because they specifically target genes that are known to affect the trait of interest. We found that flowering time mediates adaptation to climatic conditions mainly by variation at genes located upstream in the flowering pathways, close to the environmental stimuli. Variables related to the annual precipitation regime reflected selective constraints on flowering time genes better than the other variables tested (temperature, altitude, latitude or longitude). By comparing phenotype and climate associations, we identified 12 flowering genes as the most promising candidates responsible for phenological adaptation to climate. Four of these genes were located in the known flowering time QTL region on chromosome 7. However, climate and flowering associations also highlighted largely distinct gene sets, suggesting different genetic architectures for adaptation to climate and flowering onset. © 2016 John Wiley & Sons Ltd.
2009-04-01
progenitor cells ’ ability to survive under non-attachment culture conditions, which is composed of primary mammoshpere and secondary mammosphere. Both... cell lineages in early mouse development depend on SOX2 function. Genes Dev, 17: 126-140, 2003 8. Chambers, I., Colby, D., Robertson, M., Nichols, J...Rivett, D., Jones, K., and Dalton, S. LIF/STAT3 controls ES cell self-renewal and pluripotency by a Myc-dependent mechanism. Development , 132: 885-896
Byun, Mi Young; Cui, Li Hua; Lee, Jungeun; Park, Hyun; Lee, Andosung; Kim, Woo Taek; Lee, Hyoungseok
2018-01-01
Few plant species can survive in Antarctica, the harshest environment for living organisms. Deschampsia antarctica is the only natural grass species to have adapted to and colonized the maritime Antarctic. To investigate the molecular mechanism of the Antarctic adaptation of this plant, we identified and characterized D. antarctica C-repeat binding factor 4 (DaCBF4), which belongs to monocot CBF group IV. The transcript level of DaCBF4 in D. antarctica was markedly increased by cold and dehydration stress. To assess the roles of DaCBF4 in plants, we generated a DaCBF4-overexpressing transgenic rice plant (Ubi:DaCBF4) and analyzed its abiotic stress response phenotype. Ubi:DaCBF4 displayed enhanced tolerance to cold stress without growth retardation under any condition compared to wild-type plants. Because the cold-specific phenotype of Ubi:DaCBF4 was similar to that of Ubi:DaCBF7 (Byun et al., 2015), we screened for the genes responsible for the improved cold tolerance in rice by selecting differentially regulated genes in both transgenic rice lines. By comparative transcriptome analysis using RNA-seq, we identified 9 and 15 genes under normal and cold-stress conditions, respectively, as putative downstream targets of the two D. antarctica CBFs. Overall, our results suggest that Antarctic hairgrass DaCBF4 mediates the cold-stress response of transgenic rice plants by adjusting the expression levels of a set of stress-responsive genes in transgenic rice plants. Moreover, selected downstream target genes will be useful for genetic engineering to enhance the cold tolerance of cereal plants, including rice. PMID:29774046
Byun, Mi Young; Cui, Li Hua; Lee, Jungeun; Park, Hyun; Lee, Andosung; Kim, Woo Taek; Lee, Hyoungseok
2018-01-01
Few plant species can survive in Antarctica, the harshest environment for living organisms. Deschampsia antarctica is the only natural grass species to have adapted to and colonized the maritime Antarctic. To investigate the molecular mechanism of the Antarctic adaptation of this plant, we identified and characterized D. antarctica C-repeat binding factor 4 ( DaCBF4 ), which belongs to monocot CBF group IV. The transcript level of DaCBF4 in D. antarctica was markedly increased by cold and dehydration stress. To assess the roles of DaCBF4 in plants, we generated a DaCBF4 -overexpressing transgenic rice plant ( Ubi:DaCBF4 ) and analyzed its abiotic stress response phenotype. Ubi:DaCBF4 displayed enhanced tolerance to cold stress without growth retardation under any condition compared to wild-type plants. Because the cold-specific phenotype of Ubi:DaCBF4 was similar to that of Ubi:DaCBF7 (Byun et al., 2015), we screened for the genes responsible for the improved cold tolerance in rice by selecting differentially regulated genes in both transgenic rice lines. By comparative transcriptome analysis using RNA-seq, we identified 9 and 15 genes under normal and cold-stress conditions, respectively, as putative downstream targets of the two D. antarctica CBFs. Overall, our results suggest that Antarctic hairgrass DaCBF4 mediates the cold-stress response of transgenic rice plants by adjusting the expression levels of a set of stress-responsive genes in transgenic rice plants. Moreover, selected downstream target genes will be useful for genetic engineering to enhance the cold tolerance of cereal plants, including rice.
Schiroli, Giulia; Ferrari, Samuele; Conway, Anthony; Jacob, Aurelien; Capo, Valentina; Albano, Luisa; Plati, Tiziana; Castiello, Maria C; Sanvito, Francesca; Gennery, Andrew R; Bovolenta, Chiara; Palchaudhuri, Rahul; Scadden, David T; Holmes, Michael C; Villa, Anna; Sitia, Giovanni; Lombardo, Angelo; Genovese, Pietro; Naldini, Luigi
2017-10-11
Targeted genome editing in hematopoietic stem/progenitor cells (HSPCs) is an attractive strategy for treating immunohematological diseases. However, the limited efficiency of homology-directed editing in primitive HSPCs constrains the yield of corrected cells and might affect the feasibility and safety of clinical translation. These concerns need to be addressed in stringent preclinical models and overcome by developing more efficient editing methods. We generated a humanized X-linked severe combined immunodeficiency (SCID-X1) mouse model and evaluated the efficacy and safety of hematopoietic reconstitution from limited input of functional HSPCs, establishing thresholds for full correction upon different types of conditioning. Unexpectedly, conditioning before HSPC infusion was required to protect the mice from lymphoma developing when transplanting small numbers of progenitors. We then designed a one-size-fits-all IL2RG (interleukin-2 receptor common γ-chain) gene correction strategy and, using the same reagents suitable for correction of human HSPC, validated the edited human gene in the disease model in vivo, providing evidence of targeted gene editing in mouse HSPCs and demonstrating the functionality of the IL2RG -edited lymphoid progeny. Finally, we optimized editing reagents and protocol for human HSPCs and attained the threshold of IL2RG editing in long-term repopulating cells predicted to safely rescue the disease, using clinically relevant HSPC sources and highly specific zinc finger nucleases or CRISPR (clustered regularly interspaced short palindromic repeats)/Cas9 (CRISPR-associated protein 9). Overall, our work establishes the rationale and guiding principles for clinical translation of SCID-X1 gene editing and provides a framework for developing gene correction for other diseases. Copyright © 2017 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.
A comparative study of disease genes and drug targets in the human protein interactome
2015-01-01
Background Disease genes cause or contribute genetically to the development of the most complex diseases. Drugs are the major approaches to treat the complex disease through interacting with their targets. Thus, drug targets are critical for treatment efficacy. However, the interrelationship between the disease genes and drug targets is not clear. Results In this study, we comprehensively compared the network properties of disease genes and drug targets for five major disease categories (cancer, cardiovascular disease, immune system disease, metabolic disease, and nervous system disease). We first collected disease genes from genome-wide association studies (GWAS) for five disease categories and collected their corresponding drugs based on drugs' Anatomical Therapeutic Chemical (ATC) classification. Then, we obtained the drug targets for these five different disease categories. We found that, though the intersections between disease genes and drug targets were small, disease genes were significantly enriched in targets compared to their enrichment in human protein-coding genes. We further compared network properties of the proteins encoded by disease genes and drug targets in human protein-protein interaction networks (interactome). The results showed that the drug targets tended to have higher degree, higher betweenness, and lower clustering coefficient in cancer Furthermore, we observed a clear fraction increase of disease proteins or drug targets in the near neighborhood compared with the randomized genes. Conclusions The study presents the first comprehensive comparison of the disease genes and drug targets in the context of interactome. The results provide some foundational network characteristics for further designing computational strategies to predict novel drug targets and drug repurposing. PMID:25861037
A comparative study of disease genes and drug targets in the human protein interactome.
Sun, Jingchun; Zhu, Kevin; Zheng, W; Xu, Hua
2015-01-01
Disease genes cause or contribute genetically to the development of the most complex diseases. Drugs are the major approaches to treat the complex disease through interacting with their targets. Thus, drug targets are critical for treatment efficacy. However, the interrelationship between the disease genes and drug targets is not clear. In this study, we comprehensively compared the network properties of disease genes and drug targets for five major disease categories (cancer, cardiovascular disease, immune system disease, metabolic disease, and nervous system disease). We first collected disease genes from genome-wide association studies (GWAS) for five disease categories and collected their corresponding drugs based on drugs' Anatomical Therapeutic Chemical (ATC) classification. Then, we obtained the drug targets for these five different disease categories. We found that, though the intersections between disease genes and drug targets were small, disease genes were significantly enriched in targets compared to their enrichment in human protein-coding genes. We further compared network properties of the proteins encoded by disease genes and drug targets in human protein-protein interaction networks (interactome). The results showed that the drug targets tended to have higher degree, higher betweenness, and lower clustering coefficient in cancer Furthermore, we observed a clear fraction increase of disease proteins or drug targets in the near neighborhood compared with the randomized genes. The study presents the first comprehensive comparison of the disease genes and drug targets in the context of interactome. The results provide some foundational network characteristics for further designing computational strategies to predict novel drug targets and drug repurposing.
Zhang, Tingting; Hu, Shuhao; Yan, Caixia; Li, Chunjuan; Zhao, Xiaobo; Wan, Shubo; Shan, Shihua
2017-02-01
In the present investigation, a total of 60 conserved peanut (Arachis hypogaea L.) microRNA (miRNA) sequences, belonging to 16 families, were identified using bioinformatics methods. There were 392 target gene sequences, identified from 58 miRNAs with Target-align software and BLASTx analyses. Gene Ontology (GO) functional analysis suggested that these target genes were involved in mediating peanut growth and development, signal transduction and stress resistance. There were 55 miRNA sequences, verified employing a poly (A) tailing test, with a success rate of up to 91.67%. Twenty peanut target gene sequences were randomly selected, and the 5' rapid amplification of the cDNA ends (5'-RACE) method were used to validate the cleavage sites of these target genes. Of these, 14 (70%) peanut miRNA targets were verified by means of gel electrophoresis, cloning and sequencing. Furthermore, functional analysis and homologous sequence retrieval were conducted for target gene sequences, and 26 target genes were chosen as the objects for stress resistance experimental study. Real-time fluorescence quantitative PCR (qRT-PCR) technology was applied to measure the expression level of resistance-associated miRNAs and their target genes in peanut exposed to Aspergillus flavus (A. flavus) infection and drought stress, respectively. In consequence, 5 groups of miRNAs & targets were found accorded with the mode of miRNA negatively controlling the expression of target genes. This study, preliminarily determined the biological functions of some resistance-associated miRNAs and their target genes in peanut. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
Benner, Ina; Diner, Rachel E; Lefebvre, Stephane C; Li, Dian; Komada, Tomoko; Carpenter, Edward J; Stillman, Jonathon H
2013-01-01
Increased atmospheric pCO2 is expected to render future oceans warmer and more acidic than they are at present. Calcifying organisms such as coccolithophores that fix and export carbon into the deep sea provide feedbacks to increasing atmospheric pCO2. Acclimation experiments suggest negative effects of warming and acidification on coccolithophore calcification, but the ability of these organisms to adapt to future environmental conditions is not well understood. Here, we tested the combined effect of pCO2 and temperature on the coccolithophore Emiliania huxleyi over more than 700 generations. Cells increased inorganic carbon content and calcification rate under warm and acidified conditions compared with ambient conditions, whereas organic carbon content and primary production did not show any change. In contrast to findings from short-term experiments, our results suggest that long-term acclimation or adaptation could change, or even reverse, negative calcification responses in E. huxleyi and its feedback to the global carbon cycle. Genome-wide profiles of gene expression using RNA-seq revealed that genes thought to be essential for calcification are not those that are most strongly differentially expressed under long-term exposure to future ocean conditions. Rather, differentially expressed genes observed here represent new targets to study responses to ocean acidification and warming.
Ruocco, Nadia; Maria Fedele, Anna; Costantini, Susan; Romano, Giovanna; Ianora, Adrianna; Costantini, Maria
2017-08-01
The marine environment is continually subjected to the action of stressors (including natural toxins), which represent a constant danger for benthic communities. In the present work using network analysis we identified ten genes on the basis of associated functions (FOXA, FoxG, GFI-1, nodal, JNK, OneCut/Hnf6, TAK1, tcf4, TCF7, VEGF) in the sea urchin Paracentrotus lividus, having key roles in different processes, such as embryonic development and asymmetry, cell fate specification, cell differentiation and morphogenesis, and skeletogenesis. These genes are correlated with three HUB genes, Foxo, Jun and HIF1A. Real Time qPCR revealed that during sea urchin embryonic development the expression levels of these genes were modulated by three diatom-derived polyunsaturated aldehydes (PUAs), decadienal, heptadienal and octadienal. Our findings show how changes in gene expression levels may be used as an early indicator of stressful conditions in the marine environment. The identification of key genes and the molecular pathways in which they are involved represents a fundamental tool in understanding how marine organisms try to afford protection against toxicants, to avoid deleterious consequences and irreversible damages. The genes identified in this work as targets for PUAs can be considered as possible biomarkers to detect exposure to different environmental pollutants. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
Xie, Zeyi; Zhou, Zhilin; Li, Hongmin; Yu, Jingjing; Jiang, Jiaojiao; Tang, Zhonghou; Ma, Daifu; Zhang, Baohong; Han, Yonghua; Li, Zongyun
2018-05-21
Sweetpotato (Ipomoea batatas L.) is a globally important economic food crop. It belongs to Convolvulaceae family and origins in the tropics; however, sweetpotato is sensitive to cold stress during storage. In this study, we performed transcriptome sequencing to investigate the sweetpotato response to chilling stress during storage. A total of 110,110 unigenes were generated via high-throughput sequencing. Differentially expressed genes (DEGs) analysis showed that 18,681 genes were up-regulated and 21,983 genes were down-regulated in low temperature condition. Many DEGs were related to the cell membrane system, antioxidant enzymes, carbohydrate metabolism, and hormone metabolism, which are potentially associated with sweetpotato resistance to low temperature. The existence of DEGs suggests a molecular basis for the biochemical and physiological consequences of sweetpotato in low temperature storage conditions. Our analysis will provide a new target for enhancement of sweetpotato cold stress tolerance in postharvest storage through genetic manipulation. Copyright © 2018. Published by Elsevier Inc.
Network Analysis of Rodent Transcriptomes in Spaceflight
NASA Technical Reports Server (NTRS)
Ramachandran, Maya; Fogle, Homer; Costes, Sylvain
2017-01-01
Network analysis methods leverage prior knowledge of cellular systems and the statistical and conceptual relationships between analyte measurements to determine gene connectivity. Correlation and conditional metrics are used to infer a network topology and provide a systems-level context for cellular responses. Integration across multiple experimental conditions and omics domains can reveal the regulatory mechanisms that underlie gene expression. GeneLab has assembled rich multi-omic (transcriptomics, proteomics, epigenomics, and epitranscriptomics) datasets for multiple murine tissues from the Rodent Research 1 (RR-1) experiment. RR-1 assesses the impact of 37 days of spaceflight on gene expression across a variety of tissue types, such as adrenal glands, quadriceps, gastrocnemius, tibalius anterior, extensor digitorum longus, soleus, eye, and kidney. Network analysis is particularly useful for RR-1 -omics datasets because it reinforces subtle relationships that may be overlooked in isolated analyses and subdues confounding factors. Our objective is to use network analysis to determine potential target nodes for therapeutic intervention and identify similarities with existing disease models. Multiple network algorithms are used for a higher confidence consensus.
The Mechanism of Gene Targeting in Human Somatic Cells
Kan, Yinan; Ruis, Brian; Lin, Sherry; Hendrickson, Eric A.
2014-01-01
Gene targeting in human somatic cells is of importance because it can be used to either delineate the loss-of-function phenotype of a gene or correct a mutated gene back to wild-type. Both of these outcomes require a form of DNA double-strand break (DSB) repair known as homologous recombination (HR). The mechanism of HR leading to gene targeting, however, is not well understood in human cells. Here, we demonstrate that a two-end, ends-out HR intermediate is valid for human gene targeting. Furthermore, the resolution step of this intermediate occurs via the classic DSB repair model of HR while synthesis-dependent strand annealing and Holliday Junction dissolution are, at best, minor pathways. Moreover, and in contrast to other systems, the positions of Holliday Junction resolution are evenly distributed along the homology arms of the targeting vector. Most unexpectedly, we demonstrate that when a meganuclease is used to introduce a chromosomal DSB to augment gene targeting, the mechanism of gene targeting is inverted to an ends-in process. Finally, we demonstrate that the anti-recombination activity of mismatch repair is a significant impediment to gene targeting. These observations significantly advance our understanding of HR and gene targeting in human cells. PMID:24699519
Histone-Targeted Nucleic Acid Delivery for Tissue Regenerative Applications
NASA Astrophysics Data System (ADS)
Munsell, Erik V.
Nucleic acid delivery has garnered significant attention as an innovative therapeutic approach for treating a wide variety of diseases. However, the design of non-viral delivery systems that negotiate efficient intracellular trafficking and nuclear entry represents a significant challenge. Overcoming these hurdles requires a combination of well-controlled materials approaches with techniques to understand and direct cellular delivery. Recent investigations have highlighted the roles histone tail sequences play in directing nuclear delivery and retention, as well as activating DNA transcription. We established the ability to recapitulate these natural histone tail activities within non-viral gene nanocarriers, driving gene transfer/expression by enabling effective navigation to the nucleus via retrograde vesicular trafficking. A unique finding of this histone-targeted approach was that nanocarriers gained enhanced access to the nucleus during mitosis. The work described in this dissertation builds off of these fundamental insights to facilitate the translation of this histone-targeted delivery approach toward regenerative medicine applications. During native tissue repair, actively proliferating mesenchymal stem cells (MSCs) respond to a complex series of growth factor signals that direct their differentiation. Accordingly, the investigations in this work focused on utilizing the histone-targeted nanocarriers to enhance osteogenic growth factor gene transfer in dividing MSCs leading to augmented MSC chondrogenic differentiation, an essential first step in skeletal tissue repair. Concurrently, additional studies focused on optimizing the histone-targeted nanocarrier design strategy to enable improved plasmid DNA (pDNA) binding stability and tunable harnessing of native cellular processing pathways for enhanced gene transfer. Overall, the work presented herein demonstrated substantial increases in growth factor expression following histone-targeted gene transfer. This enhanced expression enabled more robust levels of chondrogenesis in MSCs than treatments with equivalent amounts of recombinant growth factor protein. Additionally, nanocarrier design optimization provided effective pDNA condensation and controllable interactions with native histone effectors. Importantly, these optimized nanocarriers conferred stable nanoplex formation and maintained transfection efficiency under physiologically relevant conditions. Taken together, these advances may help drive the clinical translation of histone-targeted nucleic acid delivery strategies for the regeneration of damaged tissue following traumatic injury.
Dimitrova, Nadya; Zamudio, Jesse R.; Jong, Robyn M.; Soukup, Dylan; Resnick, Rebecca; Sarma, Kavitha; Ward, Amanda J.; Raj, Arjun; Lee, Jeannie; Sharp, Phillip A.; Jacks, Tyler
2014-01-01
SUMMARY The p53-regulated long non-coding RNA lincRNA-p21 has been proposed to act in trans via several mechanisms ranging from repressing genes in the p53 transcriptional network to regulating mRNA translation and protein stability. To further examine lincRNA-p21 function we generated a conditional knockout mouse model. We find that lincRNA-p21 predominantly functions in cis to activate expression of its neighboring gene, p21. Mechanistically, we show that lincRNA-p21 acts in concert with hnRNP-K as a co-activator for p53-dependent p21 transcription. Additional phenotypes of lincRNA-p21 deficiency could be attributed to diminished p21 levels, including deregulated expression and altered chromatin state of some Polycomb target genes, defective G1/S checkpoint, increased proliferation rates, and enhanced reprogramming efficiency. These findings indicate that lincRNA-p21 affects global gene expression and influences the p53 tumor suppressor pathway by acting in cis as a locus-restricted co-activator for p53-mediated p21 expression. PMID:24857549
Reconstitutional Mutagenesis of the Maize P Gene by Short-Range Ac Transpositions
Moreno, M. A.; Chen, J.; Greenblatt, I.; Dellaporta, S. L.
1992-01-01
The tendency for Ac to transpose over short intervals has been utilized to develop insertional mutagenesis and fine structure genetic mapping strategies in maize. We recovered excisions of Ac from the P gene and insertions into nearby chromosomal sites. These closely linked Ac elements reinserted into the P gene, reconstituting over 250 unstable variegated alleles. Reconstituted alleles condition a variety of variegation patterns that reflect the position and orientation of Ac within the P gene. Molecular mapping and DNA sequence analyses have shown that reinsertion sites are dispersed throughout a 12.3-kb chromosomal region in the promoter, exons and introns of the P gene, but in some regions insertions sites were clustered in a nonrandom fashion. Transposition profiles and target site sequence data obtained from these studies have revealed several features of Ac transposition including its preference for certain target sites. These results clearly demonstrate the tendency of Ac to transpose to nearby sites in both proximal and distal directions from the donor site. With minor modifications, reconstitutional mutagenesis should be applicable to many Ac-induced mutations in maize and in other plant species and can possibly be extended to other eukaryotic transposon systems as well. PMID:1325389
ICG: a wiki-driven knowledgebase of internal control genes for RT-qPCR normalization.
Sang, Jian; Wang, Zhennan; Li, Man; Cao, Jiabao; Niu, Guangyi; Xia, Lin; Zou, Dong; Wang, Fan; Xu, Xingjian; Han, Xiaojiao; Fan, Jinqi; Yang, Ye; Zuo, Wanzhu; Zhang, Yang; Zhao, Wenming; Bao, Yiming; Xiao, Jingfa; Hu, Songnian; Hao, Lili; Zhang, Zhang
2018-01-04
Real-time quantitative PCR (RT-qPCR) has become a widely used method for accurate expression profiling of targeted mRNA and ncRNA. Selection of appropriate internal control genes for RT-qPCR normalization is an elementary prerequisite for reliable expression measurement. Here, we present ICG (http://icg.big.ac.cn), a wiki-driven knowledgebase for community curation of experimentally validated internal control genes as well as their associated experimental conditions. Unlike extant related databases that focus on qPCR primers in model organisms (mainly human and mouse), ICG features harnessing collective intelligence in community integration of internal control genes for a variety of species. Specifically, it integrates a comprehensive collection of more than 750 internal control genes for 73 animals, 115 plants, 12 fungi and 9 bacteria, and incorporates detailed information on recommended application scenarios corresponding to specific experimental conditions, which, collectively, are of great help for researchers to adopt appropriate internal control genes for their own experiments. Taken together, ICG serves as a publicly editable and open-content encyclopaedia of internal control genes and accordingly bears broad utility for reliable RT-qPCR normalization and gene expression characterization in both model and non-model organisms. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Eggleston, Paul; Zhao, Yuguang
2001-01-01
Background Gene targeting would offer a number of advantages over current transposon-based strategies for insect transformation. These include freedom from both position effects associated with quasi-random integration and concerns over transgene instability mediated by endogenous transposases, independence from phylogenetic restrictions on transposon mobility and the ability to generate gene knockouts. Results We describe here our initial investigations of gene targeting in the mosquito. The target site was a hygromycin resistance gene, stably maintained as part of an extrachromosomal array. Using a promoter-trap strategy to enrich for targeted events, a neomycin resistance gene was integrated into the target site. This resulted in knockout of hygromycin resistance concurrent with the expression of high levels of neomycin resistance from the resident promoter. PCR amplification of the targeted site generated a product that was specific to the targeted cell line and consistent with precise integration of the neomycin resistance gene into the 5' end of the hygromycin resistance gene. Sequencing of the PCR product and Southern analysis of cellular DNA subsequently confirmed this molecular structure. Conclusions These experiments provide the first demonstration of gene targeting in mosquito tissue and show that mosquito cells possess the necessary machinery to bring about precise integration of exogenous sequences through homologous recombination. Further development of these procedures and their extension to chromosomally located targets hold much promise for the exploitation of gene targeting in a wide range of medically and economically important insect species. PMID:11513755
Specific genetic modifications of domestic animals by gene targeting and animal cloning
Wang, Bin; Zhou, Jiangfeng
2003-01-01
The technology of gene targeting through homologous recombination has been extremely useful for elucidating gene functions in mice. The application of this technology was thought impossible in the large livestock species until the successful creation of the first mammalian clone "Dolly" the sheep. The combination of the technologies for gene targeting of somatic cells with those of animal cloning made it possible to introduce specific genetic mutations into domestic animals. In this review, the principles of gene targeting in somatic cells and the challenges of nuclear transfer using gene-targeted cells are discussed. The relevance of gene targeting in domestic animals for applications in bio-medicine and agriculture are also examined. PMID:14614774
Stefansson, Ingunn M.; Birkeland, Even; Bø, Trond Hellem; Øyan, Anne M.; Trovik, Jone; Kalland, Karl-Henning; Jonassen, Inge; Salvesen, Helga B.; Wik, Elisabeth; Akslen, Lars A.
2015-01-01
Aims Tumor necrosis is associated with aggressive features of endometrial cancer and poor prognosis. Here, we investigated gene expression patterns and potential treatment targets related to presence of tumor necrosis in primary endometrial cancer lesions. Methods and Results By DNA microarray analysis, expression of genes related to tumor necrosis reflected multiple tumor-microenvironment interactions like tissue hypoxia, angiogenesis and inflammation pathways. A tumor necrosis signature of 38 genes and a related patient cluster (Cluster I, 67% of the cases) were associated with features of aggressive tumors such as type II cancers, estrogen receptor negative tumors and vascular invasion. Further, the tumor necrosis signature was increased in tumor cells grown in hypoxic conditions in vitro. Multiple genes with increased expression are known to be activated by HIF1A and NF-kB. Conclusions Our findings indicate that the presence of tumor necrosis within primary tumors is associated with hypoxia, angiogenesis and inflammation responses. HIF1A, NF-kB and PI3K/mTOR might be potential treatment targets in aggressive endometrial cancers with presence of tumor necrosis. PMID:26485755
Bredholt, Geir; Mannelqvist, Monica; Stefansson, Ingunn M; Birkeland, Even; Bø, Trond Hellem; Øyan, Anne M; Trovik, Jone; Kalland, Karl-Henning; Jonassen, Inge; Salvesen, Helga B; Wik, Elisabeth; Akslen, Lars A
2015-11-24
Tumor necrosis is associated with aggressive features of endometrial cancer and poor prognosis. Here, we investigated gene expression patterns and potential treatment targets related to presence of tumor necrosis in primary endometrial cancer lesions. By DNA microarray analysis, expression of genes related to tumor necrosis reflected multiple tumor-microenvironment interactions like tissue hypoxia, angiogenesis and inflammation pathways. A tumor necrosis signature of 38 genes and a related patient cluster (Cluster I, 67% of the cases) were associated with features of aggressive tumors such as type II cancers, estrogen receptor negative tumors and vascular invasion. Further, the tumor necrosis signature was increased in tumor cells grown in hypoxic conditions in vitro. Multiple genes with increased expression are known to be activated by HIF1A and NF-kB. Our findings indicate that the presence of tumor necrosis within primary tumors is associated with hypoxia, angiogenesis and inflammation responses. HIF1A, NF-kB and PI3K/mTOR might be potential treatment targets in aggressive endometrial cancers with presence of tumor necrosis.
Leung, Chi K.; Wang, Ying; Deonarine, Andrew; Tang, Lanlan; Prasse, Stephanie
2013-01-01
Negative-feedback loops between transcription factors and repressors in responses to xenobiotics, oxidants, heat, hypoxia, DNA damage, and infection have been described. Although common, the function of feedback is largely unstudied. Here, we define a negative-feedback loop between the Caenorhabditis elegans detoxification/antioxidant response factor SKN-1/Nrf and its repressor wdr-23 and investigate its function in vivo. Although SKN-1 promotes stress resistance and longevity, we find that tight regulation by WDR-23 is essential for growth and reproduction. By disabling SKN-1 transactivation of wdr-23, we reveal that feedback is required to set the balance between growth/reproduction and stress resistance/longevity. We also find that feedback is required to set the sensitivity of a core SKN-1 target gene to an electrophile. Interestingly, the effect of feedback on target gene induction is greatly reduced when the stress response is strongly activated, presumably to ensure maximum activation of cytoprotective genes during potentially fatal conditions. Our work provides a framework for understanding the function of negative feedback in inducible stress responses and demonstrates that manipulation of feedback alone can shift the balance of competing animal processes toward cell protection, health, and longevity. PMID:23836880
Obayashi, Takeshi; Kinoshita, Kengo
2010-05-01
Gene coexpression analyses are a powerful method to predict the function of genes and/or to identify genes that are functionally related to query genes. The basic idea of gene coexpression analyses is that genes with similar functions should have similar expression patterns under many different conditions. This approach is now widely used by many experimental researchers, especially in the field of plant biology. In this review, we will summarize recent successful examples obtained by using our gene coexpression database, ATTED-II. Specifically, the examples will describe the identification of new genes, such as the subunits of a complex protein, the enzymes in a metabolic pathway and transporters. In addition, we will discuss the discovery of a new intercellular signaling factor and new regulatory relationships between transcription factors and their target genes. In ATTED-II, we provide two basic views of gene coexpression, a gene list view and a gene network view, which can be used as guide gene approach and narrow-down approach, respectively. In addition, we will discuss the coexpression effectiveness for various types of gene sets.
Virus Delivery of CRISPR Guides to the Murine Prostate for Gene Alteration.
Riedel, Maria; Berthelsen, Martin F; Bakiri, Latifa; Wagner, Erwin F; Thomsen, Martin K
2018-04-27
With an increasing incidence of prostate cancer, identification of new tumor drivers or modulators is crucial. Genetically engineered mouse models (GEMM) for prostate cancer are hampered by tumor heterogeneity and its complex microevolution dynamics. Traditional prostate cancer mouse models include, amongst others, germline and conditional knockouts, transgenic expression of oncogenes, and xenograft models. Generation of de novo mutations in these models is complex, time-consuming, and costly. In addition, most of traditional models target the majority of the prostate epithelium, whereas human prostate cancer is well known to evolve as an isolated event in only a small subset of cells. Valuable models need to simulate not only prostate cancer initiation, but also progression to advanced disease. Here we describe a method to target a few cells in the prostate epithelium by transducing cells by viral particles. The delivery of an engineered virus to the murine prostate allows alteration of gene expression in the prostate epithelia. Virus type and quantity will hereby define the number of targeted cells for gene alteration by transducing a few cells for cancer initiation and many cells for gene therapy. Through surgery-based injection in the anterior lobe, distal from the urinary track, the tumor in this model can expand without impairing the urinary function of the animal. Furthermore, by targeting only a subset of prostate epithelial cells the technique enables clonal expansion of the tumor, and therefore mimics human tumor initiation, progression, as well as invasion through the basal membrane. This novel technique provides a powerful prostate cancer model with improved physiological relevance. Animal suffering is limited, and since no additional breeding is required, overall animal count is reduced. At the same time, analysis of new candidate genes and pathways is accelerated, which in turn is more cost efficient.
Zinke, Ingo; Schütz, Christina S.; Katzenberger, Jörg D.; Bauer, Matthias; Pankratz, Michael J.
2002-01-01
We have identified genes regulated by starvation and sugar signals in Drosophila larvae using whole-genome microarrays. Based on expression profiles in the two nutrient conditions, they were organized into different categories that reflect distinct physiological pathways mediating sugar and fat metabolism, and cell growth. In the category of genes regulated in sugar-fed, but not in starved, animals, there is an upregulation of genes encoding key enzymes of the fat biosynthesis pathway and a downregulation of genes encoding lipases. The highest and earliest activated gene upon sugar ingestion is sugarbabe, a zinc finger protein that is induced in the gut and the fat body. Identification of potential targets using microarrays suggests that sugarbabe functions to repress genes involved in dietary fat breakdown and absorption. The current analysis provides a basis for studying the genetic mechanisms underlying nutrient signalling. PMID:12426388
Kalani, Behrooz Sadeghi; Irajian, Gholamreza; Lotfollahi, Lida; Abdollahzadeh, Esmail; Razavi, Shabnam
2018-06-04
Listeria monocytogenes is known as a major food-borne pathogen causing a severe life-threatening disease, listeriosis, in susceptible patients. This bacterium has special features that facilitate its survival in different conditions and cause resistance to antibacterial agents and biocides. Toxin-antitoxin (TA) system has a potential to be introduced as an antibacterial target because of its participation in cell physiology, including stress response, antiphage activity, biofilm formation, and resistance to antibiotics. In this study, after the identification of 6 genes of 3 TA pairs (lM/E-lM/F, lM/S-lM/B and ydc/D-ydc/E) via existing databases, the presence and expression level of these genes were investigated by PCR and q-PCR techniques, respectively. The result of RT-qPCR revealed that identified genes were expressed in different strains and ydc (maz) increased under thermal stress. It seems that the products of these genes play an important role in the physiology and survival of the bacterium especially in heat stress. Presence of 6 detected TA genes in all of the tested isolates demonstrated that TA system could be an antibacterial target in L. monocytogenes; however, more research is needed to explain the actual role of these genes. Copyright © 2018. Published by Elsevier Ltd.
Reverse strand-displacement amplification strategy for rapid detection of p53 gene.
Wang, Lisha; Han, Ying; Xiao, Shuai; Lv, Sha; Wang, Cong; Zhang, Nan; Wang, Zhengyong; Tang, Yongqiong; Li, Hongbo; Lyu, Jianxin; Xu, Huo; Shen, Zhifa
2018-09-01
The development of rapid approaches to detect prognostic markers is significant in reducing the morbidity and mortality of cancer. In this paper, we describe a rapid and specific biosensing platform for target DNA (p53 gene as a model) detection based on reverse strand displacement amplification (R-SDA). When the p53 gene is added, multifuctional molecular beacon (MMB) is unfolded via the hybridization with p53 gene. With the assist of Klenow fragment (KF) and Nt.BbvCI (the nicking endonuclease), p53 gene recycling could be initiated and considerable amount of complementary sequences for the MMBs (Nicked fragments, NFs) could be formed, generating enhanced fluorescence signal. Using this amplification strategy, the proposed biosensor displays the detection limit of 1 nM and a wide linear range from 1 to 100 nM, even if only one type of probe is involved. Notably, remarkable detection specificity for single-base mismatched target p53 gene is achieved. Moreover, the described biosensor also exhibited the stability in real biological samples (human serum). The rapid detection strategy can be performed less than 30 min without harsh reaction conditions or expensive nanoparticles. This biosensor shows great potential for application in clinic assay, especially, for early cancer diagnosis. Copyright © 2018 Elsevier B.V. All rights reserved.
Mutation and virulence assessment of chromosomal genes of Rhodococcus equi 103.
Pei, Yanlong; Parreira, Valeria; Nicholson, Vivian M; Prescott, John F
2007-01-01
Rhodococcus equi can cause severe or fatal pneumonia in foals as well as in immunocompromised animals and humans. Its ability to persist in macrophages is fundamental to how it causes disease, but the basis of this is poorly understood. To examine further the general application of a recently developed system of targeted gene mutation and to assess the importance of different genes in resistance to innate immune defenses, we disrupted the genes encoding high-temperature requirement A (htrA), nitrate reductase (narG), peptidase D (pepD), phosphoribosylaminoimidazole-succinocarboxamide synthase (purC), and superoxide dismutase (sodC) in strain 103 of R. equi using a double-crossover homologous recombination approach. Virulence testing by clearance after intravenous injection in mice showed that the htrA and narG mutants were fully attenuated, the purC and sodC mutants were unchanged, and the pepD mutant was slightly attenuated. Complementation with the pREM shuttle plasmid restored the virulence of the htrA and pepD mutants but not that of the narG mutant. A single-crossover mutation approach was simpler and faster than the double-crossover homologous recombination technique and was used to obtain mutations in 6 other genes potentially involved in virulence (clpB, fadD8, fbpB, glnA1, regX3, and sigF). These mutants were not attenuated in the mouse clearance assay. We were not able to obtain mutants for genesfurA, galE, and sigE using the single-crossover mutation approach. In summary, the targeted-mutation system had general applicability but was not always completely successful, perhaps because some genes are essential under the growth conditions used or because the success of mutation depends on the target genes.
Choi, Doo-Sup; Wang, Dan; Dadgar, Jahan; Chang, Wesley S; Messing, Robert O
2002-11-15
Conventional gene targeting is a powerful tool to study the influence of specific genes on behavior. However, conclusions relevant for adult animals are limited by consequences of gene loss during development. Mice lacking protein kinase C epsilon (PKCepsilon) consume less alcohol and show greater acute sensitivity to alcohol than do wild-type mice. There are no selective inhibitors of PKCepsilon that can be administered systemically and cross the blood-brain barrier to test whether these phenotypes result from loss of PKCepsilon during development or in adulthood. Here we used conditional expression of PKCepsilon in the basal forebrain, amygdala, and cerebellum to rescue wild-type responses to alcohol in adult PKCepsilon(-/-) mice. Subsequent suppression of transgenic PKCepsilon restored PKCepsilon(-/-) behaviors. These findings establish that PKCepsilon signaling in the adult brain regulates alcohol consumption and sensitivity. If this extends to humans, then PKCepsilon inhibitors might prove useful as novel therapeutics for alcoholism.
Frawley, Thomas; O'Brien, Cathal P; Conneally, Eibhlin; Vandenberghe, Elisabeth; Percy, Melanie; Langabeer, Stephen E; Haslam, Karl
2018-02-01
The classical Philadelphia chromosome-negative myeloproliferative neoplasms (MPNs), consisting of polycythemia vera, essential thrombocythemia, and primary myelofibrosis, are a heterogeneous group of neoplasms that harbor driver mutations in the JAK2, CALR, and MPL genes. The detection of mutations in these genes has been incorporated into the recent World Health Organization (WHO) diagnostic criteria for MPN. Given a pressing clinical need to screen for mutations in these genes in a routine diagnostic setting, a targeted next-generation sequencing (NGS) assay for the detection of MPN-associated mutations located in JAK2 exon 14, JAK2 exon 12, CALR exon 9, and MPL exon 10 was developed to provide a single platform alternative to reflexive, stepwise diagnostic algorithms. Polymerase chain reaction (PCR) primers were designed to target mutation hotspots in JAK2 exon 14, JAK2 exon 12, MPL exon 10, and CALR exon 9. Multiplexed PCR conditions were optimized by using qualitative PCR followed by NGS. Diagnostic genomic DNA from 35 MPN patients, known to harbor driver mutations in one of the target genes, was used to validate the assay. One hundred percent concordance was observed between the previously-identified mutations and those detected by NGS, with no false positives, nor any known mutations missed (specificity = 100%, CI = 0.96, sensitivity = 100%, CI = 0.89). Improved resolution of mutation sequences was also revealed by NGS analysis. Detection of diagnostically relevant driver mutations of MPN is enhanced by employing a targeted multiplex NGS approach. This assay presents a robust solution to classical MPN mutation screening, providing an alternative to time-consuming sequential analyses.
Allam, Mai A; Saker, Mahmoud M
2017-01-01
The overall objective of this work is to optimize the transformation system for date palm as a first step toward production of date palm clones resistant to noxious pests. A construct harboring the cholesterol oxidase (ChoA) gene, which renders plant resistance against insect attack, is introduced into embryogenic date palm callus using the PDS-1000/He particle bombardment system. The process involves the establishment of embryogenic callus cultures as well as immature embryo-derived microcalli that are used as target tissues for shooting and optimization of transformation conditions. This chapter in addition explains molecular and histochemical assays conducted to confirm gene integration and expression.
Yang, Heng; Liu, Xianxia; Hu, Guangdong; Xie, Yifan; Lin, Shan; Zhao, Zongsheng; Chen, Jingbo
2018-05-05
Given the important role of nutritional status for reproductive performance, we aimed to explore the potential microRNA (miRNA)-mRNA pairs and their regulatory roles associated with nutritional status in seasonal reproducing sheep. Individual ewes were treated with and without 0.3 kg/day concentrates, and the body condition score, estrus rate, and related miRNAs and target genes were compared. A total of 261 differentially expressed miRNAs were identified, including 148 hypothalamus-expressed miRNAs and 113 ovary-expressed miRNAs, and 349 target genes were predicted to be associated with nutritional status and seasonal reproduction in sheep. Ultimately, the miR-200b-GNAQ pair was screened and validated as differentially expressed, and a dual luciferase reporter assay showed that miR-200b could bind to the 3'-untranslated region of GNAQ to mediate the hypothalamic-pituitary-ovarian axis. Thus, miR-200b and its target gene GNAQ likely represent an important negative feedback loop, providing a link between nutritional status and seasonal reproduction in sheep toward enhancing reproductive performance and productivity. Copyright © 2018. Published by Elsevier Inc.
Evaluation of Acanthamoeba Myosin-IC as a Potential Therapeutic Target
Lorenzo-Morales, Jacob; López-Arencibia, Atteneri; Reyes-Batlle, María; Piñero, José E.; Valladares, Basilio; Maciver, Sutherland K.
2014-01-01
Members of the genus Acanthamoeba are facultative pathogens of humans, causing a sight-threatening keratitis and a fatal encephalitis. We have targeted myosin-IC by using small interfering RNA (siRNA) silencing as a therapeutic approach, since it is known that the function of this protein is vital for the amoeba. In this work, specific siRNAs against the Acanthamoeba myosin-IC gene were developed. Treated and control amoebae were cultured in growth and encystment media to evaluate the induced effects after myosin-IC gene knockdown, as we have anticipated that cyst formation may be impaired. The effects of myosin-IC gene silencing were inhibition of cyst formation, inhibition of completion of cytokinesis, inhibition of osmoregulation under osmotic stress conditions, and death of the amoebae. The finding that myosin-IC silencing caused incompletion of cytokinesis is in agreement with earlier suggestions that the protein plays a role in cell locomotion, which is necessary to pull daughter cells apart after mitosis in a process known as “traction-mediated cytokinesis”. We conclude that myosin-IC is a very promising potential drug target for the development of much-needed antiamoebal drugs and that it should be further exploited for Acanthamoeba therapy. PMID:24468784
Kim, Hyo-Soo; Skurk, Carsten; Maatz, Henrike; Shiojima, Ichiro; Ivashchenko, Yuri; Yoon, Suk-Won; Park, Young-Bae; Walsh, Kenneth
2005-06-01
To identify new antiapoptotic targets of the PI3K-Akt signaling pathway in endothelial cells, adenovirus-mediated Akt1 gene transfer and oligonucleotide microarrays were used to examine Akt-regulated transcripts. DNA microarray analysis revealed that HSP70 expression underwent the greatest fold activation of 12,532 transcripts examined in human umbilical vein endothelial cells (HUVEC) transduced with constitutively active Akt1. Akt1 gene transfer increased HSP70 transcript expression by 24.8-fold as determined by quantitative PCR and promoted a dose-dependent up-regulation of HSP70 protein as determined by Western immunoblot analysis. Gene transfer of FOXO3a, a downstream target of Akt in endothelial cells, significantly suppressed both basal and stress-induced HSP70 protein expression. FOXO3a induced caspase-9-dependent apoptosis in HUVEC, and cotransduction with Ad-HSP70 rescued endothelial cells from FOXO3a-induced apoptosis under basal and stress conditions. Our results identify HSP70 as a new antiapoptotic target of Akt-FOXO3a signaling in endothelial cells that controls viability through modulation of the stress-induced intrinsic cell death pathway.
New and emerging targeted therapies for cystic fibrosis
Rowe, Steven M
2016-01-01
Cystic fibrosis (CF) is a monogenic autosomal recessive disorder that affects about 70 000 people worldwide. The clinical manifestations of the disease are caused by defects in the cystic fibrosis transmembrane conductance regulator (CFTR) protein. The discovery of the CFTR gene in 1989 has led to a sophisticated understanding of how thousands of mutations in the CFTR gene affect the structure and function of the CFTR protein. Much progress has been made over the past decade with the development of orally bioavailable small molecule drugs that target defective CFTR proteins caused by specific mutations. Furthermore, there is considerable optimism about the prospect of gene replacement or editing therapies to correct all mutations in cystic fibrosis. The recent approvals of ivacaftor and lumacaftor represent the genesis of a new era of precision medicine in the treatment of this condition. These drugs are having a positive impact on the lives of people with cystic fibrosis and are potentially disease modifying. This review provides an update on advances in our understanding of the structure and function of the CFTR, with a focus on state of the art targeted drugs that are in development. PMID:27030675
Nicotinic Receptor Gene CHRNA4 Interacts with Processing Load in Attention
Espeseth, Thomas; Sneve, Markus Handal; Rootwelt, Helge; Laeng, Bruno
2010-01-01
Background Pharmacological studies suggest that cholinergic neurotransmission mediates increases in attentional effort in response to high processing load during attention demanding tasks [1]. Methodology/Principal Findings In the present study we tested whether individual variation in CHRNA4, a gene coding for a subcomponent in α4β2 nicotinic receptors in the human brain, interacted with processing load in multiple-object tracking (MOT) and visual search (VS). We hypothesized that the impact of genotype would increase with greater processing load in the MOT task. Similarly, we predicted that genotype would influence performance under high but not low load in the VS task. Two hundred and two healthy persons (age range = 39–77, Mean = 57.5, SD = 9.4) performed the MOT task in which twelve identical circular objects moved about the display in an independent and unpredictable manner. Two to six objects were designated as targets and the remaining objects were distracters. The same observers also performed a visual search for a target letter (i.e. X or Z) presented together with five non-targets while ignoring centrally presented distracters (i.e. X, Z, or L). Targets differed from non-targets by a unique feature in the low load condition, whereas they shared features in the high load condition. CHRNA4 genotype interacted with processing load in both tasks. Homozygotes for the T allele (N = 62) had better tracking capacity in the MOT task and identified targets faster in the high load trials of the VS task. Conclusion The results support the hypothesis that the cholinergic system modulates attentional effort, and that common genetic variation can be used to study the molecular biology of cognition. PMID:21203548
Azad, A. K. M.; Keith, Jonathan M.
2017-01-01
Small molecule inhibitors, such as lapatinib, are effective against breast cancer in clinical trials, but tumor cells ultimately acquire resistance to the drug. Maintaining sensitization to drug action is essential for durable growth inhibition. Recently, adaptive reprogramming of signaling circuitry has been identified as a major cause of acquired resistance. We developed a computational framework using a Bayesian statistical approach to model signal rewiring in acquired resistance. We used the p1-model to infer potential aberrant gene-pairs with differential posterior probabilities of appearing in resistant-vs-parental networks. Results were obtained using matched gene expression profiles under resistant and parental conditions. Using two lapatinib-treated ErbB2-positive breast cancer cell-lines: SKBR3 and BT474, our method identified similar dysregulated signaling pathways including EGFR-related pathways as well as other receptor-related pathways, many of which were reported previously as compensatory pathways of EGFR-inhibition via signaling cross-talk. A manual literature survey provided strong evidence that aberrant signaling activities in dysregulated pathways are closely related to acquired resistance in EGFR tyrosine kinase inhibitors. Our approach predicted literature-supported dysregulated pathways complementary to both node-centric (SPIA, DAVID, and GATHER) and edge-centric (ESEA and PAGI) methods. Moreover, by proposing a novel pattern of aberrant signaling called V-structures, we observed that genes were dysregulated in resistant-vs-sensitive conditions when they were involved in the switch of dependencies from targeted to bypass signaling events. A literature survey of some important V-structures suggested they play a role in breast cancer metastasis and/or acquired resistance to EGFR-TKIs, where the mRNA changes of TGFBR2, LEF1 and TP53 in resistant-vs-sensitive conditions were related to the dependency switch from targeted to bypass signaling links. Our results suggest many signaling pathway structures are compromised in acquired resistance, and V-structures of aberrant signaling within/among those pathways may provide further insights into the bypass mechanism of targeted inhibition. PMID:28288164
Xiang, Xi; Tang, Yuanjiao; Leng, Qianying; Zhang, Lingyan; Qiu, Li
2016-02-01
The purpose of this study was to optimize an ultrasound-targeted microbubble destruction (UTMD) technique to improve the in vivo transfection efficiency of the gene encoding enhanced green fluorescent protein (EGFP) in the synovial pannus in an antigen-induced arthritis rabbit model. A mixture of microbubbles and plasmids was locally injected into the knee joints of an antigen-induced arthritis (AIA) rabbits. The plasmid concentrations and ultrasound conditions were varied in the experiments. We also tested local articular and intravenous injections. The rabbits were divided into five groups: (1) ultrasound+microbubbles+plasmid; (2) ultrasound+plasmid; (3) microbubble+plasmid; (4) plasmid only; (5) untreated controls. EGFP expression was observed by fluorescent microscope and immunohistochemical staining in the synovial pannus of each group. The optimal plasmid dosage and ultrasound parameter were determined based on the results of EGFP expression and the present and absent of tissue damage under light microscopy. The irradiation procedure was performed to observe the duration of the EGFP expression in the synovial pannus and other tissues and organs, as well as the damage to the normal cells. The optimal condition was determined to be a 1-MHz ultrasound pulse applied for 5 min with a power output of 2 W/cm(2) and a 20% duty cycle along with 300 μg of plasmid. Under these conditions, the synovial pannus showed significant EGFP expression without significant damage to the surrounding normal tissue. The EGFP expression induced by the local intra-articular injection was significantly more increased than that induced by the intravenous injection. The EGFP expression in the synovial pannus of the ultrasound+microbubbles+plasmid group was significantly higher than that of the other four groups (P<0.05). The expression peaked on day 5, remained detectable on day 40 and disappeared on day 60. No EGFP expression was detected in the other tissues and organs. The UTMD technique can significantly enhance the in vivo gene transfection efficiency without significant tissue damage in the synovial pannus of an AIA model. Thus, this could become a safe and effective non-viral gene transfection procedure for arthritis therapy. Copyright © 2015 Elsevier B.V. All rights reserved.
Cavanagh, Colin R; Chao, Shiaoman; Wang, Shichen; Huang, Bevan Emma; Stephen, Stuart; Kiani, Seifollah; Forrest, Kerrie; Saintenac, Cyrille; Brown-Guedira, Gina L; Akhunova, Alina; See, Deven; Bai, Guihua; Pumphrey, Michael; Tomar, Luxmi; Wong, Debbie; Kong, Stephan; Reynolds, Matthew; da Silva, Marta Lopez; Bockelman, Harold; Talbert, Luther; Anderson, James A; Dreisigacker, Susanne; Baenziger, Stephen; Carter, Arron; Korzun, Viktor; Morrell, Peter Laurent; Dubcovsky, Jorge; Morell, Matthew K; Sorrells, Mark E; Hayden, Matthew J; Akhunov, Eduard
2013-05-14
Domesticated crops experience strong human-mediated selection aimed at developing high-yielding varieties adapted to local conditions. To detect regions of the wheat genome subject to selection during improvement, we developed a high-throughput array to interrogate 9,000 gene-associated single-nucleotide polymorphisms (SNP) in a worldwide sample of 2,994 accessions of hexaploid wheat including landraces and modern cultivars. Using a SNP-based diversity map we characterized the impact of crop improvement on genomic and geographic patterns of genetic diversity. We found evidence of a small population bottleneck and extensive use of ancestral variation often traceable to founders of cultivars from diverse geographic regions. Analyzing genetic differentiation among populations and the extent of haplotype sharing, we identified allelic variants subjected to selection during improvement. Selective sweeps were found around genes involved in the regulation of flowering time and phenology. An introgression of a wild relative-derived gene conferring resistance to a fungal pathogen was detected by haplotype-based analysis. Comparing selective sweeps identified in different populations, we show that selection likely acts on distinct targets or multiple functionally equivalent alleles in different portions of the geographic range of wheat. The majority of the selected alleles were present at low frequency in local populations, suggesting either weak selection pressure or temporal variation in the targets of directional selection during breeding probably associated with changing agricultural practices or environmental conditions. The developed SNP chip and map of genetic variation provide a resource for advancing wheat breeding and supporting future population genomic and genome-wide association studies in wheat.
Cavanagh, Colin R.; Chao, Shiaoman; Wang, Shichen; Huang, Bevan Emma; Stephen, Stuart; Kiani, Seifollah; Forrest, Kerrie; Saintenac, Cyrille; Brown-Guedira, Gina L.; Akhunova, Alina; See, Deven; Bai, Guihua; Pumphrey, Michael; Tomar, Luxmi; Wong, Debbie; Kong, Stephan; Reynolds, Matthew; da Silva, Marta Lopez; Bockelman, Harold; Talbert, Luther; Anderson, James A.; Dreisigacker, Susanne; Baenziger, Stephen; Carter, Arron; Korzun, Viktor; Morrell, Peter Laurent; Dubcovsky, Jorge; Morell, Matthew K.; Sorrells, Mark E.; Hayden, Matthew J.; Akhunov, Eduard
2013-01-01
Domesticated crops experience strong human-mediated selection aimed at developing high-yielding varieties adapted to local conditions. To detect regions of the wheat genome subject to selection during improvement, we developed a high-throughput array to interrogate 9,000 gene-associated single-nucleotide polymorphisms (SNP) in a worldwide sample of 2,994 accessions of hexaploid wheat including landraces and modern cultivars. Using a SNP-based diversity map we characterized the impact of crop improvement on genomic and geographic patterns of genetic diversity. We found evidence of a small population bottleneck and extensive use of ancestral variation often traceable to founders of cultivars from diverse geographic regions. Analyzing genetic differentiation among populations and the extent of haplotype sharing, we identified allelic variants subjected to selection during improvement. Selective sweeps were found around genes involved in the regulation of flowering time and phenology. An introgression of a wild relative-derived gene conferring resistance to a fungal pathogen was detected by haplotype-based analysis. Comparing selective sweeps identified in different populations, we show that selection likely acts on distinct targets or multiple functionally equivalent alleles in different portions of the geographic range of wheat. The majority of the selected alleles were present at low frequency in local populations, suggesting either weak selection pressure or temporal variation in the targets of directional selection during breeding probably associated with changing agricultural practices or environmental conditions. The developed SNP chip and map of genetic variation provide a resource for advancing wheat breeding and supporting future population genomic and genome-wide association studies in wheat. PMID:23630259
Luo, Yan; Wang, Yongsheng; Liu, Jun; Cui, Chenchen; Wu, Yongyan; Lan, Hui; Chen, Qi; Liu, Xu; Quan, Fusheng; Guo, Zekun; Zhang, Yong
2016-02-08
Targeting exogenous genes at milk protein loci via gene-targeting technology is an ideal strategy for producing large quantities of pharmaceutical proteins. Transcription-activator-like effector (TALE) nucleases (TALENs) are an efficient genome-editing tool. However, the off-target effects may lead to unintended gene mutations. In this study, we constructed TALENs and TALE nickases directed against exon 2 of the bovine β-lactoglobulin (BLG) locus. The nickases can induce a site-specific DNA single-strand break, without inducing double-strand break and nonhomologous end joining mediated gene mutation, and lower cell apoptosis rate than TALENs. After co-transfecting the bovine fetal fibroblasts with human serum albumin (HSA) gene-targeting vector and TALE nickase expression vectors, approximately 4.8% (40/835) of the cell clones contained HSA at BLG locus. Unexpectedly, one homozygous gene-targeted cell clone (1/835, 0.1%) was obtained by targeting both alleles of BLG in a single round of transfection. The recombinant protein mimicking the endogenous BLG was highly expressed and correctly folded in the mammary glands of the targeted cows, and the expression level of HSA was significantly increased in the homozygous targeted cows. Results suggested that the combination of TALE nickase-mediated gene targeting and somatic cell nuclear transfer is a feasible and safe approach in producing gene-targeted livestock.
Chui, A; Murthi, P; Gunatillake, T; Brennecke, S P; Ignjatovic, V; Monagle, P T; Whitelock, J M; Said, J M
2014-08-01
Fetal growth restriction (FGR) is a key cause of adverse pregnancy outcome where maternal and fetal factors are identified as contributing to this condition. Idiopathic FGR is associated with altered vascular endothelial cell functions. Decorin (DCN) has important roles in the regulation of endothelial cell functions in vascular environments. DCN expression is reduced in FGR. The objectives were to determine the functional consequences of reduced DCN in a human microvascular endothelial cell line model (HMVEC), and to determine downstream targets of DCN and their expression in primary placental microvascular endothelial cells (PLECs) from control and FGR-affected placentae. Short-interference RNA was used to reduce DCN expression in HMVECs and the effect on proliferation, angiogenesis and thrombin generation was determined. A Growth Factor PCR Array was used to identify downstream targets of DCN. The expression of target genes in control and FGR PLECs was performed. DCN reduction decreased proliferation and angiogenesis but increased thrombin generation with no effect on apoptosis. The array identified three targets of DCN: FGF17, IL18 and MSTN. Validation of target genes confirmed decreased expression of VEGFA, MMP9, EGFR1, IGFR1 and PLGF in HMVECs and PLECs from control and FGR pregnancies. Reduction of DCN in vascular endothelial cells leads to disrupted cell functions. The targets of DCN include genes that play important roles in angiogenesis and cellular growth. Therefore, differential expression of these may contribute to the pathogenesis of FGR and disease states in other microvascular circulations. Copyright © 2014 Elsevier Ltd. All rights reserved.
Goodman, Ann B
2006-12-01
Vitamin A (retinoid) is required in the adult brain to enable cognition, learning, and memory. While brain levels of retinoid diminish over the course of normal ageing, retinoid deficit is greater in late onset Alzheimer disease (LOAD) brains than in normal-aged controls. This paper reviews recent evidence supporting these statements and further suggests that genes necessary for the synthesis, transport and function of retinoid to and within the ageing brain are appropriate targets for treatment of LOAD. These genes tend to be clustered with genes that have been proposed as candidates in LOAD, are found at chromosomal regions linked to LOAD, and suggest the possibility of an overall coordinated regulation. This phenomenon is termed Chromeron and is analogous to the operon mechanism observed in prokaryotes. Suggested treatment targets are the retinoic-acid inactivating enzymes (CYP26)s, the retinol binding and transport proteins, retinol-binding protein (RBP)4 and transthyretin (TTR), and the retinoid receptors. TTR as a LOAD target is the subject of active investigation. The retinoid receptors and the retinoid-inactivating enzymes have previously been proposed as targets. This is the first report to suggest that RBP4 is an amenable treatment target in LOAD. RBP4 is elevated in type-2 diabetes and obesity, conditions associated with increased risk for LOAD. Fenretinide, a novel synthetic retinoic acid (RA) analog lowers RBP4 in glucose intolerant obese mice. The feasibility of using fenretinide either as an adjunct to present LOAD therapies, or on its own as an early prevention strategy should be determined. (c) 2006 Wiley-Liss, Inc.
Palanca-Wessels, Maria C; Convertine, Anthony J; Cutler-Strom, Richelle; Booth, Garrett C; Lee, Fan; Berguig, Geoffrey Y; Stayton, Patrick S; Press, Oliver W
2011-01-01
The application of small interfering RNA (siRNA) for cancer treatment is a promising strategy currently being explored in early phase clinical trials. However, efficient systemic delivery limits clinical implementation. We developed and tested a novel delivery system comprised of (i) an internalizing streptavidin-conjugated monoclonal antibody (mAb-SA) directed against CD22 and (ii) a biotinylated diblock copolymer containing both a positively charged siRNA condensing block and a pH-responsive block to facilitate endosome release. The modular design of the carrier facilitates the exchange of different targeting moieties and siRNAs to permit its usage in a variety of tumor types. The polymer was synthesized using the reversible addition fragmentation chain transfer (RAFT) technique and formed micelles capable of binding siRNA and mAb-SA. A hemolysis assay confirmed the predicted membrane destabilizing activity of the polymer under acidic conditions typical of the endosomal compartment. Enhanced siRNA uptake was demonstrated in DoHH2 lymphoma and transduced HeLa-R cells expressing CD22 but not in CD22 negative HeLa-R cells. Gene knockdown was significantly improved with CD22-targeted vs. nontargeted polymeric micelles. Treatment of DoHH2 cells with CD22-targeted polymeric micelles containing 15 nmol/l siRNA produced 70% reduction of gene expression. This CD22-targeted polymer carrier may be useful for siRNA delivery to lymphoma cells. PMID:21629223
Palanca-Wessels, Maria C; Convertine, Anthony J; Cutler-Strom, Richelle; Booth, Garrett C; Lee, Fan; Berguig, Geoffrey Y; Stayton, Patrick S; Press, Oliver W
2011-08-01
The application of small interfering RNA (siRNA) for cancer treatment is a promising strategy currently being explored in early phase clinical trials. However, efficient systemic delivery limits clinical implementation. We developed and tested a novel delivery system comprised of (i) an internalizing streptavidin-conjugated monoclonal antibody (mAb-SA) directed against CD22 and (ii) a biotinylated diblock copolymer containing both a positively charged siRNA condensing block and a pH-responsive block to facilitate endosome release. The modular design of the carrier facilitates the exchange of different targeting moieties and siRNAs to permit its usage in a variety of tumor types. The polymer was synthesized using the reversible addition fragmentation chain transfer (RAFT) technique and formed micelles capable of binding siRNA and mAb-SA. A hemolysis assay confirmed the predicted membrane destabilizing activity of the polymer under acidic conditions typical of the endosomal compartment. Enhanced siRNA uptake was demonstrated in DoHH2 lymphoma and transduced HeLa-R cells expressing CD22 but not in CD22 negative HeLa-R cells. Gene knockdown was significantly improved with CD22-targeted vs. nontargeted polymeric micelles. Treatment of DoHH2 cells with CD22-targeted polymeric micelles containing 15 nmol/l siRNA produced 70% reduction of gene expression. This CD22-targeted polymer carrier may be useful for siRNA delivery to lymphoma cells.
The P450 Monooxygenase BcABA1 Is Essential for Abscisic Acid Biosynthesis in Botrytis cinerea
Siewers, Verena; Smedsgaard, Jørn; Tudzynski, Paul
2004-01-01
The phytopathogenic ascomycete Botrytis cinerea is known to produce abscisic acid (ABA), which is thought to be involved in host-pathogen interaction. Biochemical analyses had previously shown that, in contrast to higher plants, the fungal ABA biosynthesis probably does not proceed via carotenoids but involves direct cyclization of farnesyl diphosphate and subsequent oxidation steps. We present here evidence that this “direct” pathway is indeed the only one used by an ABA-overproducing strain of B. cinerea. Targeted inactivation of the gene bccpr1 encoding a cytochrome P450 oxidoreductase reduced the ABA production significantly, proving the involvement of P450 monooxygenases in the pathway. Expression analysis of 28 different putative P450 monooxygenase genes revealed two that were induced under ABA biosynthesis conditions. Targeted inactivation showed that one of these, bcaba1, is essential for ABA biosynthesis: ΔBcaba1 mutants contained no residual ABA. Thus, bcaba1 represents the first identified fungal ABA biosynthetic gene. PMID:15240257
Tiny giants of gene regulation: experimental strategies for microRNA functional studies
Steinkraus, Bruno R.; Toegel, Markus
2016-01-01
The discovery over two decades ago of short regulatory microRNAs (miRNAs) has led to the inception of a vast biomedical research field dedicated to understanding these powerful orchestrators of gene expression. Here we aim to provide a comprehensive overview of the methods and techniques underpinning the experimental pipeline employed for exploratory miRNA studies in animals. Some of the greatest challenges in this field have been uncovering the identity of miRNA–target interactions and deciphering their significance with regard to particular physiological or pathological processes. These endeavors relied almost exclusively on the development of powerful research tools encompassing novel bioinformatics pipelines, high‐throughput target identification platforms, and functional target validation methodologies. Thus, in an unparalleled manner, the biomedical technology revolution unceasingly enhanced and refined our ability to dissect miRNA regulatory networks and understand their roles in vivo in the context of cells and organisms. Recurring motifs of target recognition have led to the creation of a large number of multifactorial bioinformatics analysis platforms, which have proved instrumental in guiding experimental miRNA studies. Subsequently, the need for discovery of miRNA–target binding events in vivo drove the emergence of a slew of high‐throughput multiplex strategies, which now provide a viable prospect for elucidating genome‐wide miRNA–target binding maps in a variety of cell types and tissues. Finally, deciphering the functional relevance of miRNA post‐transcriptional gene silencing under physiological conditions, prompted the evolution of a host of technologies enabling systemic manipulation of miRNA homeostasis as well as high‐precision interference with their direct, endogenous targets. WIREs Dev Biol 2016, 5:311–362. doi: 10.1002/wdev.223 For further resources related to this article, please visit the WIREs website. PMID:26950183
About miRNAs, miRNA seeds, target genes and target pathways.
Kehl, Tim; Backes, Christina; Kern, Fabian; Fehlmann, Tobias; Ludwig, Nicole; Meese, Eckart; Lenhof, Hans-Peter; Keller, Andreas
2017-12-05
miRNAs are typically repressing gene expression by binding to the 3' UTR, leading to degradation of the mRNA. This process is dominated by the eight-base seed region of the miRNA. Further, miRNAs are known not only to target genes but also to target significant parts of pathways. A logical line of thoughts is: miRNAs with similar (seed) sequence target similar sets of genes and thus similar sets of pathways. By calculating similarity scores for all 3.25 million pairs of 2,550 human miRNAs, we found that this pattern frequently holds, while we also observed exceptions. Respective results were obtained for both, predicted target genes as well as experimentally validated targets. We note that miRNAs target gene set similarity follows a bimodal distribution, pointing at a set of 282 miRNAs that seems to target genes with very high specificity. Further, we discuss miRNAs with different (seed) sequences that nonetheless regulate similar gene sets or pathways. Most intriguingly, we found miRNA pairs that regulate different gene sets but similar pathways such as miR-6886-5p and miR-3529-5p. These are jointly targeting different parts of the MAPK signaling cascade. The main goal of this study is to provide a general overview on the results, to highlight a selection of relevant results on miRNAs, miRNA seeds, target genes and target pathways and to raise awareness for artifacts in respective comparisons. The full set of information that allows to infer detailed results on each miRNA has been included in miRPathDB, the miRNA target pathway database (https://mpd.bioinf.uni-sb.de).
Li, Ruixue; Chen, Dandan; Wang, Taichu; Wan, Yizhen; Li, Rongfang; Fang, Rongjun; Wang, Yuting; Hu, Fei; Zhou, Hong; Li, Long; Zhao, Weiguo
2017-01-01
MicroRNAs (miRNAs) play important regulatory roles by targeting mRNAs for cleavage or translational repression. Identification of miRNA targets is essential to better understanding the roles of miRNAs. miRNA targets have not been well characterized in mulberry (Morus alba). To anatomize miRNA guided gene regulation under drought stress, transcriptome-wide high throughput degradome sequencing was used in this study to directly detect drought stress responsive miRNA targets in mulberry. A drought library (DL) and a contrast library (CL) were constructed to capture the cleaved mRNAs for sequencing. In CL, 409 target genes of 30 conserved miRNA families and 990 target genes of 199 novel miRNAs were identified. In DL, 373 target genes of 30 conserved miRNA families and 950 target genes of 195 novel miRNAs were identified. Of the conserved miRNA families in DL, mno-miR156, mno-miR172, and mno-miR396 had the highest number of targets with 54, 52 and 41 transcripts, respectively, indicating that these three miRNA families and their target genes might play important functions in response to drought stress in mulberry. Additionally, we found that many of the target genes were transcription factors. By analyzing the miRNA-target molecular network, we found that the DL independent networks consisted of 838 miRNA-mRNA pairs (63.34%). The expression patterns of 11 target genes and 12 correspondent miRNAs were detected using qRT-PCR. Six miRNA targets were further verified by RNA ligase-mediated 5' rapid amplification of cDNA ends (RLM-5' RACE). Gene Ontology (GO) annotations and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis revealed that these target transcripts were implicated in a broad range of biological processes and various metabolic pathways. This is the first study to comprehensively characterize target genes and their associated miRNAs in response to drought stress by degradome sequencing in mulberry. This study provides a framework for understanding the molecular mechanisms of drought resistance in mulberry.
[Gene therapy for inherited retinal dystrophies].
Côco, Monique; Han, Sang Won; Sallum, Juliana Maria Ferraz
2009-01-01
The inherited retinal dystrophies comprise a large number of disorders characterized by a slow and progressive retinal degeneration. They are the result of mutations in genes that express in either the photoreceptor cells or the retinal pigment epithelium. The mode of inheritance can be autosomal dominant, autosomal recessive, X linked recessive, digenic or mitochondrial DNA inherited. At the moment, there is no treatment for these conditions and the patients can expect a progressive loss of vision. Accurate genetic counseling and support for rehabilitation are indicated. Research into the molecular and genetic basis of disease is continually expanding and improving the prospects for rational treatments. In this way, gene therapy, defined as the introduction of exogenous genetic material into human cells for therapeutic purposes, may ultimately offer the greatest treatment for the inherited retinal dystrophies. The eye is an attractive target for gene therapy because of its accessibility, immune privilege and translucent media. A number of retinal diseases affecting the eye have known gene defects. Besides, there is a well characterized animal model for many of these conditions. Proposals for clinical trials of gene therapy for inherited retinal degenerations owing to defects in the gene RPE65, have recently received ethical approval and the obtained preliminary results brought large prospects in the improvement on patient's quality of life.
Thermal processing of bone: in vitro response of mesenchymal cells to bone-conditioned medium.
Sawada, K; Caballé-Serrano, J; Schuldt Filho, G; Bosshardt, D D; Schaller, B; Buser, D; Gruber, R
2015-08-01
The autoclaving, pasteurization, and freezing of bone grafts to remove bacteria and viruses, and for preservation, respectively, is considered to alter biological properties during graft consolidation. Fresh bone grafts release paracrine-like signals that are considered to support tissue regeneration. However, the impact of the autoclaving, pasteurization, and freezing of bone grafts on paracrine signals remains unknown. Therefore, conditioned medium was prepared from porcine cortical bone chips that had undergone thermal processing. The biological properties of the bone-conditioned medium were assessed by examining the changes in expression of target genes in oral fibroblasts. The data showed that conditioned medium obtained from bone chips that had undergone pasteurization and freezing changed the expression of adrenomedullin, pentraxin 3, BTB/POZ domain-containing protein 11, interleukin 11, NADPH oxidase 4, and proteoglycan 4 by at least five-fold in oral fibroblasts. Bone-conditioned medium obtained from autoclaved bone chips, however, failed to change the expression of the respective genes. Also, when bone-conditioned medium was prepared from fresh bone chips, autoclaving blocked the capacity of bone-conditioned medium to modulate gene expression. These in vitro results suggest that pasteurization and freezing of bone grafts preserve the release of biologically active paracrine signals, but autoclaving does not. Copyright © 2015 International Association of Oral and Maxillofacial Surgeons. Published by Elsevier Ltd. All rights reserved.
USDA-ARS?s Scientific Manuscript database
Domesticated crops have experienced strong human-driven selection aimed at the development of improved varieties adapted to local conditions. To detect regions of the wheat genome subject to selection during improvement, we developed a high-throughput array to interrogate 9,000 gene-associated DNA m...
Nutrient-dependent phosphorylation channels lipid synthesis to regulate PPARα
Jensen-Urstad, Anne P. L.; Song, Haowei; Lodhi, Irfan J.; Funai, Katsuhiko; Yin, Li; Coleman, Trey; Semenkovich, Clay F.
2013-01-01
Peroxisome proliferator-activated receptor (PPAR)α is a nuclear receptor that coordinates liver metabolism during fasting. Fatty acid synthase (FAS) is an enzyme that stores excess calories as fat during feeding, but it also activates hepatic PPARα by promoting synthesis of an endogenous ligand. Here we show that the mechanism underlying this paradoxical relationship involves the differential regulation of FAS in at least two distinct subcellular pools: cytoplasmic and membrane-associated. In mouse liver and cultured hepatoma cells, the ratio of cytoplasmic to membrane FAS-specific activity was increased with fasting, indicating higher cytoplasmic FAS activity under conditions associated with PPARα activation. This effect was due to a nutrient-dependent and compartment-selective covalent modification of FAS. Cytoplasmic FAS was preferentially phosphorylated during feeding or insulin treatment at Thr-1029 and Thr-1033, which flank a dehydratase domain catalytic residue. Mutating these sites to alanines promoted PPARα target gene expression. Rapamycin-induced inhibition of mammalian/mechanistic target of rapamycin complex 1 (mTORC1), a mediator of the feeding/insulin signal to induce lipogenesis, reduced FAS phosphorylation, increased cytoplasmic FAS enzyme activity, and increased PPARα target gene expression. Rapamycin-mediated induction of the same gene was abrogated with FAS knockdown. These findings suggest that hepatic FAS channels lipid synthesis through specific subcellular compartments that allow differential gene expression based on nutritional status. PMID:23585690
Guo, Longhua; Yang, Huanghao; Qiu, Bin; Xiao, Xueyang; Xue, Linlin; Kim, Donghwan; Chen, Guonan
2009-12-01
A capillary electrophoresis coupled with electrochemiluminescent detection system (CE-ECL) was developed for the detection of polymerase chain reaction (PCR) amplicons. The ECL luminophore, tris(1,10-phenanthroline) ruthenium(II) (Ru(phen)(3)(2+)), was labeled to the PCR primers before amplification. Ru(phen)(3)(2+) was then introduced to PCR amplicons by PCR amplification. Eventually, the PCR amplicons were separated and detected by the homemade CE-ECL system. The detection of a typical genetically modified organism (GMO), Roundup Ready Soy (RRS), was shown as an example to demonstrate the reliability of the proposed approach. Four pairs of primers were amplified by multiple PCR (MPCR) simultaneously, three of which were targeted on the specific sequence of exogenous genes of RRS, and another was targeted on the endogenous reference gene of soybean. Both the conditions for PCR amplification and CE-ECL separation and detection were investigated in detail. Results showed that, under the optimal conditions, the proposed method can accurately identifying RRS. The corresponding limit of detection (LOD) was below 0.01% with 35 PCR cycles.
CRISPR/Cas9-mediated gene targeting in Arabidopsis using sequential transformation.
Miki, Daisuke; Zhang, Wenxin; Zeng, Wenjie; Feng, Zhengyan; Zhu, Jian-Kang
2018-05-17
Homologous recombination-based gene targeting is a powerful tool for precise genome modification and has been widely used in organisms ranging from yeast to higher organisms such as Drosophila and mouse. However, gene targeting in higher plants, including the most widely used model plant Arabidopsis thaliana, remains challenging. Here we report a sequential transformation method for gene targeting in Arabidopsis. We find that parental lines expressing the bacterial endonuclease Cas9 from the egg cell- and early embryo-specific DD45 gene promoter can improve the frequency of single-guide RNA-targeted gene knock-ins and sequence replacements via homologous recombination at several endogenous sites in the Arabidopsis genome. These heritable gene targeting can be identified by regular PCR. Our approach enables routine and fine manipulation of the Arabidopsis genome.
Hussain, Khalid; Mungikar, Kanak; Kulkarni, Abhijeet; Kamble, Avinash
2018-05-05
Upon confrontation with unfavourable conditions, plants invoke a very complex set of biochemical and physiological reactions and alter gene expression patterns to combat the situations. MicroRNAs (miRNAs), a class of small non-coding RNA, contribute extensively in regulation of gene expression through translation inhibition or degradation of their target mRNAs during such conditions. Therefore, identification of miRNAs and their targets holds importance in understanding the regulatory networks triggered during stress. Structure and sequence similarity based in silico prediction of miRNAs in Cajanus cajan L. (Pigeonpea) draft genome sequence has been carried out earlier. These annotations also appear in related GenBank genome sequence entries. However, there are no reports available on context dependent miRNA expression and their targets in pigeonpea. Therefore, in the present study we addressed these questions computationally, using pigeonpea EST sequence information. We identified five novel pigeonpea miRNA precursors, their mature forms and targets. Interestingly, only one of these miRNAs (miR169i-3p) was identified earlier in draft genome sequence. We then validated expression of these miRNAs, experimentally. It was also observed that these miRNAs show differential expression patterns in response to Fusarium inoculation indicating their biotic stress responsive nature. Overall these results will help towards better understanding the regulatory network of defense during pigeonpea -pathogen interactions and role of miRNAs in the process. Copyright © 2018 Elsevier B.V. All rights reserved.
Analysis of physiological and miRNA responses to Pi deficiency in alfalfa (Medicago sativa L.).
Li, Zhenyi; Xu, Hongyu; Li, Yue; Wan, Xiufu; Ma, Zhao; Cao, Jing; Li, Zhensong; He, Feng; Wang, Yufei; Wan, Liqiang; Tong, Zongyong; Li, Xianglin
2018-03-01
The induction of miR399 and miR398 and the inhibition of miR156, miR159, miR160, miR171, miR2111, and miR2643 were observed under Pi deficiency in alfalfa. The miRNA-mediated genes involved in basic metabolic process, root and shoot development, stress response and Pi uptake. Inorganic phosphate (Pi) deficiency is known to be a limiting factor in plant development and growth. However, the underlying miRNAs associated with the Pi deficiency-responsive mechanism in alfalfa are unclear. To elucidate the molecular mechanism at the miRNA level, we constructed four small RNA (sRNA) libraries from the roots and shoots of alfalfa grown under normal or Pi-deficient conditions. In the present study, alfalfa plants showed reductions in biomass, photosynthesis, and Pi content and increases in their root-to-shoot ratio and citric, malic, and succinic acid contents under Pi limitation. Sequencing results identified 47 and 44 differentially expressed miRNAs in the roots and shoots, respectively. Furthermore, 909 potential target genes were predicted, and some targets were validated by RLM-RACE assays. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses showed prominent enrichment in signal transducer activity, binding and basic metabolic pathways for carbohydrates, fatty acids and amino acids; cellular response to hormone stimulus and response to auxin pathways were also enriched. qPCR results verified that the differentially expressed miRNA profile was consistent with sequencing results, and putative target genes exhibited opposite expression patterns. In this study, the miRNAs associated with the response to Pi limitation in alfalfa were identified. In addition, there was an enrichment of miRNA-targeted genes involved in biological regulatory processes such as basic metabolic pathways, root and shoot development, stress response, Pi transportation and citric acid secretion.
Amini, Bahram; Kamali, Mehdi; Salouti, Mojtaba; Yaghmaei, Parichehreh
2018-06-15
Colorimetric DNA detection is preferred over other methods for clinical molecular diagnosis because it does not require expensive equipment. In the present study, the colorimetric method based on gold nanoparticles (GNPs) and endonuclease enzyme was used for the detection of P. aeruginosa ETA gene. Firstly, the primers and probe for P. aeruginosa exotoxin A (ETA) gene were designed and checked for specificity by the PCR method. Then, GNPs were synthesized using the citrate reduction method and conjugated with the prepared probe to develop the new nano-biosensor. Next, the extracted target DNA of the bacteria was added to GNP-probe complex to check its efficacy for P. aeruginosa ETA gene diagnosis. A decrease in absorbance was seen when GNP-probe-target DNA cleaved into the small fragments of BamHI endonuclease due to the weakened electrostatic interaction between GNPs and the shortened DNA. The right shift of the absorbance peak from 530 to 562nm occurred after adding the endonuclease. It was measured using a UV-VIS absorption spectroscopy that indicates the existence of the P. aeruginosa ETA gene. Sensitivity was determined in the presence of different concentrations of target DNA of P. aeruginosa. The results obtained from the optimized conditions showed that the absorbance value has linear correlation with concentration of target DNA (R: 0.9850) in the range of 10-50ngmL -1 with the limit detection of 9.899ngmL -1 . Thus, the specificity of the new method for detection of P. aeruginosa was established in comparison with other bacteria. Additionally, the designed assay was quantitatively applied to detect the P. aeruginosa ETA gene from 10 3 to 10 8 CFUmL -1 in real samples with a detection limit of 320CFUmL -1 . Copyright © 2018 Elsevier B.V. All rights reserved.
Arai, Masayoshi
2016-01-01
With the development of cell biology and microbiology, it has become easy to culture many types of animal cells and microbes, and they are frequently used for phenotypic screening to explore medicinal seeds. On the other hand, it is recognized that cells and pathogenic microbes present in pathologic sites and infected regions of the human body display unique properties different from those under general culture conditions. We isolated several bioactive compounds from marine medicinal resources using constructed bioassay-guided separation focusing on the unique changes in the characteristics of cells and pathogenic microbes (Mycobacterium spp.) in the human body under disease conditions. In addition, we also carried out identification studies of target molecules of the bioactive compounds by methods utilizing the gene expression profile, transformants of cells or microbes, synthetic probe molecules of the isolated compounds, etc., since bioactive compounds isolated from the phenotypic screening system often target new molecules. This review presents our phenotypic screening systems, isolation of bioactive compounds from marine medicinal resources, and target identification of bioactive compounds.
Hunter, M Colby; Pozhitkov, Alex E; Noble, Peter A
2016-12-01
Conceptual models suggest that certain microorganisms (e.g., the "red" complex) are indicative of a specific disease state (e.g., periodontitis); however, recent studies have questioned the validity of these models. Here, the abundances of 500+ microbial species were determined in 16 patients with clinical signs of one of the following oral conditions: periodontitis, established caries, edentulism, and oral health. Our goal was to determine if the abundances of certain microorganisms reflect dysbiosis or a specific clinical condition that could be used as a 'signature' for dental research. Microbial abundances were determined by the analysis of 138,718 calibrated probes using Gene Meter methodology. Each 16S rRNA gene was targeted by an average of 194 unique probes (n=25nt). The calibration involved diluting pooled gene target samples, hybridizing each dilution to a DNA microarray, and fitting the probe intensities to adsorption models. The fit of the model to the experimental data was used to assess individual and aggregate probe behavior; good fits (R 2 >0.90) were retained for back-calculating microbial abundances from patient samples. The abundance of a gene was determined from the median of all calibrated individual probes or from the calibrated abundance of all aggregated probes. With the exception of genes with low abundances (<2 arbitrary units), the abundances determined by the different calibrations were highly correlated (r~1.0). Seventeen genera were classified as 'signatures of dysbiosis' because they had significantly higher abundances in patients with periodontitis and edentulism when contrasted with health. Similarly, 13 genera were classified as 'signatures of periodontitis', and 14 genera were classified as 'signatures of edentulism'. The signatures could be used, individually or in combination, to assess the clinical status of a patient (e.g., evaluating treatments such as antibiotic therapies). Comparisons of the same patient samples revealed high false negatives (45%) for next-generation-sequencing results and low false positives (7%) for Gene Meter results. Copyright © 2016 Elsevier B.V. All rights reserved.
Roubelakis, Maria G; Zotos, Pantelis; Papachristoudis, Georgios; Michalopoulos, Ioannis; Pappa, Kalliopi I; Anagnou, Nicholas P; Kossida, Sophia
2009-01-01
Background microRNAs (miRNAs) are single-stranded RNA molecules of about 20–23 nucleotides length found in a wide variety of organisms. miRNAs regulate gene expression, by interacting with target mRNAs at specific sites in order to induce cleavage of the message or inhibit translation. Predicting or verifying mRNA targets of specific miRNAs is a difficult process of great importance. Results GOmir is a novel stand-alone application consisting of two separate tools: JTarget and TAGGO. JTarget integrates miRNA target prediction and functional analysis by combining the predicted target genes from TargetScan, miRanda, RNAhybrid and PicTar computational tools as well as the experimentally supported targets from TarBase and also providing a full gene description and functional analysis for each target gene. On the other hand, TAGGO application is designed to automatically group gene ontology annotations, taking advantage of the Gene Ontology (GO), in order to extract the main attributes of sets of proteins. GOmir represents a new tool incorporating two separate Java applications integrated into one stand-alone Java application. Conclusion GOmir (by using up to five different databases) introduces miRNA predicted targets accompanied by (a) full gene description, (b) functional analysis and (c) detailed gene ontology clustering. Additionally, a reverse search initiated by a potential target can also be conducted. GOmir can freely be downloaded BRFAA. PMID:19534746
Roubelakis, Maria G; Zotos, Pantelis; Papachristoudis, Georgios; Michalopoulos, Ioannis; Pappa, Kalliopi I; Anagnou, Nicholas P; Kossida, Sophia
2009-06-16
microRNAs (miRNAs) are single-stranded RNA molecules of about 20-23 nucleotides length found in a wide variety of organisms. miRNAs regulate gene expression, by interacting with target mRNAs at specific sites in order to induce cleavage of the message or inhibit translation. Predicting or verifying mRNA targets of specific miRNAs is a difficult process of great importance. GOmir is a novel stand-alone application consisting of two separate tools: JTarget and TAGGO. JTarget integrates miRNA target prediction and functional analysis by combining the predicted target genes from TargetScan, miRanda, RNAhybrid and PicTar computational tools as well as the experimentally supported targets from TarBase and also providing a full gene description and functional analysis for each target gene. On the other hand, TAGGO application is designed to automatically group gene ontology annotations, taking advantage of the Gene Ontology (GO), in order to extract the main attributes of sets of proteins. GOmir represents a new tool incorporating two separate Java applications integrated into one stand-alone Java application. GOmir (by using up to five different databases) introduces miRNA predicted targets accompanied by (a) full gene description, (b) functional analysis and (c) detailed gene ontology clustering. Additionally, a reverse search initiated by a potential target can also be conducted. GOmir can freely be downloaded BRFAA.
Paternò, Annalisa; Marchesi, Ugo; Gatto, Francesco; Verginelli, Daniela; Quarchioni, Cinzia; Fusco, Cristiana; Zepparoni, Alessia; Amaddeo, Demetrio; Ciabatti, Ilaria
2009-12-09
The comparison of five real-time polymerase chain reaction (PCR) methods targeted at maize ( Zea mays ) endogenous sequences is reported. PCR targets were the alcohol dehydrogenase (adh) gene for three methods and high-mobility group (hmg) gene for the other two. The five real-time PCR methods have been checked under repeatability conditions at several dilution levels on both pooled DNA template from several genetically modified (GM) maize certified reference materials (CRMs) and single CRM DNA extracts. Slopes and R(2) coefficients of all of the curves obtained from the adopted regression model were compared within the same method and among all of the five methods, and the limit of detection and limit of quantitation were analyzed for each PCR system. Furthermore, method equivalency was evaluated on the basis of the ability to estimate the target haploid genome copy number at each concentration level. Results indicated that, among the five methods tested, one of the hmg-targeted PCR systems can be considered equivalent to the others but shows the best regression parameters and a higher repeteability along the dilution range. Thereby, it is proposed as a valid module to be coupled to different event-specific real-time PCR for maize genetically modified organism (GMO) quantitation. The resulting practicability improvement on the analytical control of GMOs is discussed.
Jamet, Stevie; Quentin, Yves; Coudray, Coralie; Texier, Pauline; Laval, Françoise; Daffé, Mamadou
2015-01-01
ABSTRACT Mycobacterium tuberculosis, the etiological agent of tuberculosis, is a Gram-positive bacterium with a unique cell envelope composed of an essential outer membrane. Mycolic acids, which are very-long-chain (up to C100) fatty acids, are the major components of this mycomembrane. The enzymatic pathways involved in the biosynthesis and transport of mycolates are fairly well documented and are the targets of the major antituberculous drugs. In contrast, only fragmented information is available on the expression and regulation of the biosynthesis genes. In this study, we report that the hadA, hadB, and hadC genes, which code for the mycolate biosynthesis dehydratase enzymes, are coexpressed with three genes that encode proteins of the translational apparatus. Consistent with the well-established control of the translation potential by nutrient availability, starvation leads to downregulation of the hadABC genes along with most of the genes required for the synthesis, modification, and transport of mycolates. The downregulation of a subset of the biosynthesis genes is partially dependent on RelMtb, the key enzyme of the stringent response. We also report the phylogenetic evolution scenario that has shaped the current genetic organization, characterized by the coregulation of the hadABC operon with genes of the translational apparatus and with genes required for the modification of the mycolates. IMPORTANCE Mycobacterium tuberculosis infects one-third of the human population worldwide, and despite the available therapeutic arsenal, it continues to kill millions of people each year. There is therefore an urgent need to identify new targets and develop a better understanding of how the bacterium is adapting itself to host defenses during infection. A prerequisite of this understanding is knowledge of how this adaptive skill has been implanted by evolution. Nutrient scarcity is an environmental condition the bacterium has to cope with during infection. In many bacteria, adaptation to starvation relies partly on the stringent response. M. tuberculosis's unique outer membrane layer, the mycomembrane, is crucial for its viability and virulence. Despite its being the target of the major antituberculosis drugs, only scattered information exists on how the genes required for biosynthesis of the mycomembrane are expressed and regulated during starvation. This work has addressed this issue as a step toward the identification of new targets in the fight against M. tuberculosis. PMID:26416833
Cereal phytochromes: targets of selection, targets for manipulation?
Sawers, Ruairidh J H; Sheehan, Moira J; Brutnell, Thomas P
2005-03-01
Plants respond to shading through an adaptive syndrome termed shade avoidance. In high-density crop plantings, shade avoidance generally increases extension growth at the expense of yield and can be at odds with the agronomic performance of the crop as a whole. Studies in Arabidopsis are beginning to reveal the essential role phytochromes play in regulating this process and to identify genes underlying the response. In this article, we focus on how phytochrome signaling networks have been targeted in cereal breeding programs in the past and discuss the potential to alter these pathways through breeding and transgenic manipulation to develop crops that perform better under typical high density conditions.
Marti, Romain; Tien, Yuan-Ching; Murray, Roger; Scott, Andrew; Sabourin, Lyne; Topp, Edward
2014-05-01
Animal manures recycled onto crop production land carry antibiotic-resistant bacteria. The present study evaluated the fate in soil of selected genes associated with antibiotic resistance or genetic mobility in field plots cropped to vegetables and managed according to normal farming practice. Referenced to unmanured soil, fertilization with swine or dairy manure increased the relative abundance of the gene targets sul1, erm(B), str(B), int1, and IncW repA. Following manure application in the spring of 2012, gene copy number decayed exponentially, reaching background levels by the fall of 2012. In contrast, gene copy number following manure application in the fall of 2012 or spring of 2013 increased significantly in the weeks following application and then declined. In both cases, the relative abundance of gene copy numbers had not returned to background levels by the fall of 2013. Overall, these results suggest that under conditions characteristic of agriculture in a humid continental climate, a 1-year period following a commercial application of raw manure is sufficient to ensure that an additional soil burden of antibiotic resistance genes approaches background. The relative abundance of several gene targets exceeded background during the growing season following a spring application or an application done the previous fall. Results from the present study reinforce the advisability of treating manure prior to use in crop production systems.
Weyda, István; Yang, Lei; Vang, Jesper; Ahring, Birgitte K; Lübeck, Mette; Lübeck, Peter S
2017-04-01
In recent years, versatile genetic tools have been developed and applied to a number of filamentous fungi of industrial importance. However, the existing techniques have limitations when it comes to achieve the desired genetic modifications, especially for efficient gene targeting. In this study, we used Aspergillus carbonarius as a host strain due to its potential as a cell factory, and compared three gene targeting techniques by disrupting the ayg1 gene involved in the biosynthesis of conidial pigment in A. carbonarius. The absence of the ayg1 gene leads to phenotypic change in conidia color, which facilitated the analysis on the gene targeting frequency. The examined transformation techniques included Agrobacterium-mediated transformation (AMT) and protoplast-mediated transformation (PMT). Furthermore, the PMT for the disruption of the ayg1 gene was carried out with bipartite gene targeting fragments and the recently adapted CRISPR-Cas9 system. All three techniques were successful in generating Δayg1 mutants, but showed different efficiencies. The most efficient method for gene targeting was AMT, but further it was shown to be dependent on the choice of Agrobacterium strain. However, there are different advantages and disadvantages of all three gene targeting methods which are discussed, in order to facilitate future approaches for fungal strain improvements. Copyright © 2017 Elsevier B.V. All rights reserved.
Chen, Jiang; Ding, Jie; Wang, Ziwei; Zhu, Jian; Wang, Xuejian; Du, Jiyi
2017-03-21
This study aims to identify downstream target genes regulated by lysine-specific demethylase 1 (LSD1) in colon cancer cells and investigate the molecular mechanisms of LSD1 influencing invasion and metastasis of colon cancer. We obtained the expression changes of downstream target genes regulated by small-interfering RNA-LSD1 and LSD1-overexpression via gene expression profiling in two human colon cancer cell lines. An Affymetrix Human Transcriptome Array 2.0 was used to identify differentially expressed genes (DEGs). We screened out LSD1-target gene associated with proliferation, metastasis, and invasion from DEGs via Gene Ontology and Pathway Studio. Subsequently, four key genes (CABYR, FOXF2, TLE4, and CDH1) were computationally predicted as metastasis-related LSD1-target genes. ChIp-PCR was applied after RT-PCR and Western blot validations to detect the occupancy of LSD1-target gene promoter-bound LSD1. A total of 3633 DEGs were significantly upregulated, and 4642 DEGs were downregulated in LSD1-silenced SW620 cells. A total of 4047 DEGs and 4240 DEGs were upregulated and downregulated in LSD1-overexpressed HT-29 cells, respectively. RT-PCR and Western blot validated the microarray analysis results. ChIP assay results demonstrated that LSD1 might be negative regulators for target genes CABYR and CDH1. The expression level of LSD1 is negatively correlated with mono- and dimethylation of histone H3 lysine4(H3K4) at LSD1- target gene promoter region. No significant mono-methylation and dimethylation of H3 lysine9 methylation was detected at the promoter region of CABYR and CDH1. LSD1- depletion contributed to the upregulation of CABYR and CDH1 through enhancing the dimethylation of H3K4 at the LSD1-target genes promoter. LSD1- overexpression mediated the downregulation of CABYR and CDH1expression through decreasing the mono- and dimethylation of H3K4 at LSD1-target gene promoter in colon cancer cells. CABYR and CDH1 might be potential LSD1-target genes in colon carcinogenesis.
Tanaka, Seiji; Miyazawa-Onami, Mayumi; Iida, Tetsushi; Araki, Hiroyuki
2015-08-01
Isolation of a 'tight' conditional mutant of a gene of interest is an effective way of studying the functions of essential genes. Strategies that use ubiquitin-mediated protein degradation to eliminate the product of a gene of interest, such as heat-inducible degron (td) and auxin-inducible degron (AID), are powerful methods for constructing conditional mutants. However, these methods do not work with some genes. Here, we describe an improved AID system (iAID) for isolating tight conditional mutants in the budding yeast Saccharomyces cerevisiae. In this method, transcriptional repression by the 'Tet-OFF' promoter is combined with proteolytic elimination of the target protein by the AID system. To provide examples, we describe the construction of tight mutants of the replication factors Dpb11 and Mcm10, dpb11-iAID, and mcm10-iAID. Because Dpb11 and Mcm10 are required for the initiation of DNA replication, their tight mutants are unable to enter S phase. This is the case for dpb11-iAID and mcm10-iAID cells after the addition of tetracycline and auxin. Both the 'Tet-OFF' promoter and the AID system have been shown to work in model eukaryotes other than budding yeast. Therefore, the iAID system is not only useful in budding yeast, but also can be applied to other model systems to isolate tight conditional mutants. Copyright © 2015 John Wiley & Sons, Ltd.
The AP-1 transcription factor FOSL1 causes melanocyte reprogramming and transformation.
Maurus, K; Hufnagel, A; Geiger, F; Graf, S; Berking, C; Heinemann, A; Paschen, A; Kneitz, S; Stigloher, C; Geissinger, E; Otto, C; Bosserhoff, A; Schartl, M; Meierjohann, S
2017-09-07
The MAPK pathway is activated in the majority of melanomas and is the target of therapeutic approaches. Under normal conditions, it initiates the so-called immediate early response, which encompasses the transient transcription of several genes belonging to the AP-1 transcription factor family. Under pathological conditions, such as continuous MAPK pathway overactivation due to oncogenic alterations occurring in melanoma, these genes are constitutively expressed. The consequences of a permanent expression of these genes are largely unknown. Here, we show that FOSL1 is the main immediate early AP-1 member induced by melanoma oncogenes. We first examined its role in established melanoma cells. We found that FOSL1 is involved in melanoma cell migration as well as cell proliferation and anoikis-independent growth, which is mediated by the gene product of its target gene HMGA1, encoding a multipotent chromatin modifier. As FOSL1 expression is increased in patient melanoma samples compared to nevi, we investigated the effect of enhanced FOSL1 expression on melanocytes. Intriguingly, we found that FOSL1 acts oncogenic and transforms melanocytes, enabling subcutaneous tumor growth in vivo. During the process of transformation, FOSL1 reprogrammed the melanocytes and downregulated MITF in a HMGA1-dependent manner. At the same time, AXL was upregulated, leading to a shift in the MITF/AXL balance. Furthermore, FOSL1 re-enforced pro-tumorigenic transcription factors MYC, E2F3 and AP-1. Together, this led to the enhancement of several growth-promoting processes, such as ribosome biogenesis, cellular detachment and pyrimidine metabolism. Overall, we demonstrate that FOSL1 is a novel reprogramming factor for melanocytes with potent tumor transformation potential.
Benner, Ina; Diner, Rachel E.; Lefebvre, Stephane C.; Li, Dian; Komada, Tomoko; Carpenter, Edward J.; Stillman, Jonathon H.
2013-01-01
Increased atmospheric pCO2 is expected to render future oceans warmer and more acidic than they are at present. Calcifying organisms such as coccolithophores that fix and export carbon into the deep sea provide feedbacks to increasing atmospheric pCO2. Acclimation experiments suggest negative effects of warming and acidification on coccolithophore calcification, but the ability of these organisms to adapt to future environmental conditions is not well understood. Here, we tested the combined effect of pCO2 and temperature on the coccolithophore Emiliania huxleyi over more than 700 generations. Cells increased inorganic carbon content and calcification rate under warm and acidified conditions compared with ambient conditions, whereas organic carbon content and primary production did not show any change. In contrast to findings from short-term experiments, our results suggest that long-term acclimation or adaptation could change, or even reverse, negative calcification responses in E. huxleyi and its feedback to the global carbon cycle. Genome-wide profiles of gene expression using RNA-seq revealed that genes thought to be essential for calcification are not those that are most strongly differentially expressed under long-term exposure to future ocean conditions. Rather, differentially expressed genes observed here represent new targets to study responses to ocean acidification and warming. PMID:23980248
Muthusamy, Senthilkumar K; Lenka, Sangram K; Katiyar, Amit; Chinnusamy, Viswanathan; Singh, Ashok K; Bansal, Kailash C
2018-06-19
Photosynthetic fixation of CO 2 is more efficient in C 4 than in C 3 plants. Rice is a C 3 plant and a potential target for genetic engineering of the C 4 pathway. It is known that genes encoding C 4 enzymes are present in C 3 plants. However, no systematic analysis has been conducted to determine if these C 4 gene family members are expressed in diverse rice genotypes. In this study, we identified 15 genes belonging to the five C 4 gene families in rice genome through BLAST search using known maize C 4 photosynthetic pathway genes. Phylogenetic relationship of rice C 4 photosynthetic pathway genes and their isoforms with other grass genomes (Brachypodium, maize, Sorghum and Setaria), showed that these genes were highly conserved across grass genomes. Spatiotemporal, hormone, and abiotic stress specific expression pattern of the identified genes revealed constitutive as well as inductive responses of the C 4 photosynthetic pathway in different tissues and developmental stages of rice. Expression levels of C 4 specific gene family members in flag leaf during tillering stage were quantitatively analyzed in five rice genotypes covering three species, viz. Oryza sativa, ssp. japonica (cv. Nipponbare), Oryza sativa, ssp. indica (cv IR64, Swarna), and two wild species Oryza barthii and Oryza australiensis. The results showed that all the identified genes expressed in rice and exhibited differential expression pattern during different growth stages, and in response to biotic and abiotic stress conditions and hormone treatments. Our study concludes that C 4 photosynthetic pathway genes present in rice play a crucial role in stress regulation and might act as targets for C 4 pathway engineering via CRISPR-mediated breeding.
Multiplex conditional mutagenesis in zebrafish using the CRISPR/Cas system.
Yin, L; Maddison, L A; Chen, W
2016-01-01
The clustered regularly interspaced short palindromic repeat (CRISPR)/CRISPR-associated protein (Cas) system is a powerful tool for genome editing in numerous organisms. However, the system is typically used for gene editing throughout the entire organism. Tissue and temporal specific mutagenesis is often desirable to determine gene function in a specific stage or tissue and to bypass undesired consequences of global mutations. We have developed the CRISPR/Cas system for conditional mutagenesis in transgenic zebrafish using tissue-specific and/or inducible expression of Cas9 and U6-driven expression of sgRNA. To allow mutagenesis of multiple targets, we have isolated four distinct U6 promoters and designed Golden Gate vectors to easily assemble transgenes with multiple sgRNAs. We provide experimental details on the reagents and applications for multiplex conditional mutagenesis in zebrafish. Copyright © 2016 Elsevier Inc. All rights reserved.
Karnan, Sivasundaram; Ota, Akinobu; Konishi, Yuko; Wahiduzzaman, Md; Hosokawa, Yoshitaka; Konishi, Hiroyuki
2016-01-01
The adeno-associated virus (AAV)-based targeting vector has been one of the tools commonly used for genome modification in human cell lines. It allows for relatively efficient gene targeting associated with 1–4-log higher ratios of homologous-to-random integration of targeting vectors (H/R ratios) than plasmid-based targeting vectors, without actively introducing DNA double-strand breaks. In this study, we sought to improve the efficiency of AAV-mediated gene targeting by introducing a 2A-based promoter-trap system into targeting constructs. We generated three distinct AAV-based targeting vectors carrying 2A for promoter trapping, each targeting a GFP-based reporter module incorporated into the genome, PIGA exon 6 or PIGA intron 5. The absolute gene targeting efficiencies and H/R ratios attained using these vectors were assessed in multiple human cell lines and compared with those attained using targeting vectors carrying internal ribosome entry site (IRES) for promoter trapping. We found that the use of 2A for promoter trapping increased absolute gene targeting efficiencies by 3.4–28-fold and H/R ratios by 2–5-fold compared to values obtained with IRES. In CRISPR-Cas9-assisted gene targeting using plasmid-based targeting vectors, the use of 2A did not enhance the H/R ratios but did upregulate the absolute gene targeting efficiencies compared to the use of IRES. PMID:26657635
Stress amplifies sex differences in primate prefrontal profiles of gene expression.
Lee, Alex G; Hagenauer, Megan; Absher, Devin; Morrison, Kathleen E; Bale, Tracy L; Myers, Richard M; Watson, Stanley J; Akil, Huda; Schatzberg, Alan F; Lyons, David M
2017-11-02
Stress is a recognized risk factor for mood and anxiety disorders that occur more often in women than men. Prefrontal brain regions mediate stress coping, cognitive control, and emotion. Here, we investigate sex differences and stress effects on prefrontal cortical profiles of gene expression in squirrel monkey adults. Dorsolateral, ventrolateral, and ventromedial prefrontal cortical regions from 18 females and 12 males were collected after stress or no-stress treatment conditions. Gene expression profiles were acquired using HumanHT-12v4.0 Expression BeadChip arrays adapted for squirrel monkeys. Extensive variation between prefrontal cortical regions was discerned in the expression of numerous autosomal and sex chromosome genes. Robust sex differences were also identified across prefrontal cortical regions in the expression of mostly autosomal genes. Genes with increased expression in females compared to males were overrepresented in mitogen-activated protein kinase and neurotrophin signaling pathways. Many fewer genes with increased expression in males compared to females were discerned, and no molecular pathways were identified. Effect sizes for sex differences were greater in stress compared to no-stress conditions for ventromedial and ventrolateral prefrontal cortical regions but not dorsolateral prefrontal cortex. Stress amplifies sex differences in gene expression profiles for prefrontal cortical regions involved in stress coping and emotion regulation. Results suggest molecular targets for new treatments of stress disorders in human mental health.
Tao, Hui; Li, Xue; Qiu, Jian-Feng; Liu, Heng-Jiang; Zhang, Da-Yan; Chu, Feng; Sima, Yanghu; Xu, Shi-Qing
2017-10-01
Hatching behavior is a key target in silkworm (Bombyx mori) rearing, especially for the control of Lepidoptera pests. According to previous research, hatching rhythms appear to be controlled by a clock mechanism that restricts or "gates" hatching to a particular time. However, the underlying mechanism remains elusive. Under 12-h light:12-h dark photoperiod (LD) conditions, the transcriptional levels of the chitinase5 (Cht5) and hatching enzyme-like (Hel) genes, as well as the enzymatic activities of their gene products, oscillated in time with ambient light cycles, as did the transcriptional levels of the cryptochrome 1, cryptochrome 2, period (per), and timeless genes, which are key components of the negative feedback loop of the circadian rhythm. These changes were related to the expression profile of the ecdysteroid receptor gene and the hatching behavior of B. mori eggs. However, under continuous light or dark conditions, the hatching behavior, the expression levels of Cht5 and Hel, as well as the enzymatic activities of their gene products, were not synchronized unlike under LD conditions. In addition, immunohistochemistry experiments showed that light promoted the translocation of PER from the cytoplasm to the nucleus. In conclusion, LD cycles regulate the hatching rhythm of B. mori via negative feedback loop of the circadian oscillator. © 2017 Wiley Periodicals, Inc.
Whole-Genome Thermodynamic Analysis Reduces siRNA Off-Target Effects
Chen, Xi; Liu, Peng; Chou, Hui-Hsien
2013-01-01
Small interfering RNAs (siRNAs) are important tools for knocking down targeted genes, and have been widely applied to biological and biomedical research. To design siRNAs, two important aspects must be considered: the potency in knocking down target genes and the off-target effect on any nontarget genes. Although many studies have produced useful tools to design potent siRNAs, off-target prevention has mostly been delegated to sequence-level alignment tools such as BLAST. We hypothesize that whole-genome thermodynamic analysis can identify potential off-targets with higher precision and help us avoid siRNAs that may have strong off-target effects. To validate this hypothesis, two siRNA sets were designed to target three human genes IDH1, ITPR2 and TRIM28. They were selected from the output of two popular siRNA design tools, siDirect and siDesign. Both siRNA design tools have incorporated sequence-level screening to avoid off-targets, thus their output is believed to be optimal. However, one of the sets we tested has off-target genes predicted by Picky, a whole-genome thermodynamic analysis tool. Picky can identify off-target genes that may hybridize to a siRNA within a user-specified melting temperature range. Our experiments validated that some off-target genes predicted by Picky can indeed be inhibited by siRNAs. Similar experiments were performed using commercially available siRNAs and a few off-target genes were also found to be inhibited as predicted by Picky. In summary, we demonstrate that whole-genome thermodynamic analysis can identify off-target genes that are missed in sequence-level screening. Because Picky prediction is deterministic according to thermodynamics, if a siRNA candidate has no Picky predicted off-targets, it is unlikely to cause off-target effects. Therefore, we recommend including Picky as an additional screening step in siRNA design. PMID:23484018
Chai, Hui; Yan, Zhaoyuan; Huang, Ke; Jiang, Yuanqing; Zhang, Lin
2018-02-01
This study aimed to systematically investigate the relationship between miRNA expression and the occurrence of ventricular septal defect (VSD), and characterize the miRNA target genes and pathways that can lead to VSD. The miRNAs that were differentially expressed in blood samples from VSD and normal infants were screened and validated by implementing miRNA microarrays and qRT-PCR. The target genes regulated by differentially expressed miRNAs were predicted using three target gene databases. The functions and signaling pathways of the target genes were enriched using the GO database and KEGG database, respectively. The transcription and protein expression of specific target genes in critical pathways were compared in the VSD and normal control groups using qRT-PCR and western blotting, respectively. Compared with the normal control group, the VSD group had 22 differentially expressed miRNAs; 19 were downregulated and three were upregulated. The 10,677 predicted target genes participated in many biological functions related to cardiac development and morphogenesis. Four target genes (mGLUR, Gq, PLC, and PKC) were involved in the PKC pathway and four (ECM, FAK, PI3 K, and PDK1) were involved in the PI3 K-Akt pathway. The transcription and protein expression of these eight target genes were significantly upregulated in the VSD group. The 22 miRNAs that were dysregulated in the VSD group were mainly downregulated, which may result in the dysregulation of several key genes and biological functions related to cardiac development. These effects could also be exerted via the upregulation of eight specific target genes, the subsequent over-activation of the PKC and PI3 K-Akt pathways, and the eventual abnormal cardiac development and VSD.
CRISPR/Cas9-Mediated Correction of the FANCD1 Gene in Primary Patient Cells.
Skvarova Kramarzova, Karolina; Osborn, Mark J; Webber, Beau R; DeFeo, Anthony P; McElroy, Amber N; Kim, Chong Jai; Tolar, Jakub
2017-06-14
Fanconi anemia (FA) is an inherited condition characterized by impaired DNA repair, physical anomalies, bone marrow failure, and increased incidence of malignancy. Gene editing holds great potential to precisely correct the underlying genetic cause such that gene expression remains under the endogenous control mechanisms. This has been accomplished to date only in transformed cells or their reprogrammed induced pluripotent stem cell counterparts; however, it has not yet been reported in primary patient cells. Here we show the ability to correct a mutation in Fanconi anemia D1 ( FANCD1 ) primary patient fibroblasts. The clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 system was employed to target and correct a FANCD1 gene deletion. Homologous recombination using an oligonucleotide donor was achieved and a pure population of modified cells was obtained by using inhibitors of poly adenosine diphosphate-ribose polymerase (poly ADP-ribose polymerase). FANCD1 function was restored and we did not observe any promiscuous cutting of the CRISPR/Cas9 at off target sites. This consideration is crucial in the context of the pre-malignant FA phenotype. Altogether we show the ability to correct a patient mutation in primary FANCD1 cells in a precise manner. These proof of principle studies support expanded application of gene editing for FA.
Evolving phage vectors for cell targeted gene delivery.
Larocca, David; Burg, Michael A; Jensen-Pergakes, Kristen; Ravey, Edward Prenn; Gonzalez, Ana Maria; Baird, Andrew
2002-03-01
We adapted filamentous phage vectors for targeted gene delivery to mammalian cells by inserting a mammalian reporter gene expression cassette (GFP) into the vector backbone and fusing the pIII coat protein to a cell targeting ligand (i.e. FGF2, EGF). Like transfection with animal viral vectors, targeted phage gene delivery is concentration, time, and ligand dependent. Importantly, targeted phage particles are specific for the appropriate target cell surface receptor. Phage have distinct advantages over existing gene therapy vectors because they are simple, economical to produce at high titer, have no intrinsic tropism for mammalian cells, and are relatively simple to genetically modify and evolve. Initially transduction by targeted phage particles was low resulting in foreign gene expression in 1-2% of transfected cells. We increased transduction efficiency by modifying both the transfection protocol and vector design. For example, we stabilized the display of the targeting ligand to create multivalent phagemid-based vectors with transduction efficiencies of up to 45% in certain cell lines when combined with genotoxic treatment. Taken together, these studies establish that the efficiency of phage-mediated gene transfer can be significantly improved through genetic modification. We are currently evolving phage vectors with enhanced cell targeting, increased stability, reduced immunogenicity and other properties suitable for gene therapy.
SH3BP4, a novel pigmentation gene, is inversely regulated by miR-125b and MITF
Kim, Kyu-Han; Lee, Tae Ryong; Cho, Eun-Gyung
2017-01-01
Our previous work has identified miR-125b as a negative regulator of melanogenesis. However, the specific melanogenesis-related genes targeted by this miRNA had not been identified. In this study, we established a screening strategy involving three consecutive analytical approaches—analysis of target genes of miR-125b, expression correlation analysis between each target gene and representative pigmentary genes, and functional analysis of candidate genes related to melanogenesis—to discover melanogenesis-related genes targeted by miR-125b. Through these analyses, we identified SRC homology 3 domain-binding protein 4 (SH3BP4) as a novel pigmentation gene. In addition, by combining bioinformatics analysis and experimental validation, we demonstrated that SH3BP4 is a direct target of miR-125b. Finally, we found that SH3BP4 is transcriptionally regulated by microphthalmia-associated transcription factor as its direct target. These findings provide important insights into the roles of miRNAs and their targets in melanogenesis. PMID:28819321
2015-10-24
zebrafish reference genome sequence and its relationship to the human genome . Nature. 2013;496(7446):498–503. 21. Linney E, Upchurch L, Donerly S. Zebrafish...To obtain a broader understanding of the effects of dichlorvos on liver metabolism, we per- formed a genome -wide analysis of gene expression in the ...condition) for whole genome transcript ana- lysis, and fixed another set of fish for histological evaluation (n = 5/condition). We determined the target
Zhu, Xun; Wan, Hu; Shakeel, Muhammad; Zhan, Sha; Jin, Byung-Rae; Li, Jianhong
2014-01-01
The brown planthopper (BPH), Nilaparvata lugens (Hemiptera, Delphacidae), is one of the most important rice pests. Abundant genetic studies on BPH have been conducted using reverse-transcription quantitative real-time PCR (qRT-PCR). Using qRT-PCR, the expression levels of target genes are calculated on the basis of endogenous controls. These genes need to be appropriately selected by experimentally assessing whether they are stably expressed under different conditions. However, such studies on potential reference genes in N. lugens are lacking. In this paper, we presented a systematic exploration of eight candidate reference genes in N. lugens, namely, actin 1 (ACT), muscle actin (MACT), ribosomal protein S11 (RPS11), ribosomal protein S15e (RPS15), alpha 2-tubulin (TUB), elongation factor 1 delta (EF), 18S ribosomal RNA (18S), and arginine kinase (AK) and used four alternative methods (BestKeeper, geNorm, NormFinder, and the delta Ct method) to evaluate the suitability of these genes as endogenous controls. We examined their expression levels among different experimental factors (developmental stage, body part, geographic population, temperature variation, pesticide exposure, diet change, and starvation) following the MIQE (Minimum Information for publication of Quantitative real time PCR Experiments) guidelines. Based on the results of RefFinder, which integrates four currently available major software programs to compare and rank the tested candidate reference genes, RPS15, RPS11, and TUB were found to be the most suitable reference genes in different developmental stages, body parts, and geographic populations, respectively. RPS15 was the most suitable gene under different temperature and diet conditions, while RPS11 was the most suitable gene under different pesticide exposure and starvation conditions. This work sheds light on establishing a standardized qRT-PCR procedure in N. lugens, and serves as a starting point for screening for reference genes for expression studies of related insects. PMID:24466124
Yuan, Miao; Lu, Yanhui; Zhu, Xun; Wan, Hu; Shakeel, Muhammad; Zhan, Sha; Jin, Byung-Rae; Li, Jianhong
2014-01-01
The brown planthopper (BPH), Nilaparvata lugens (Hemiptera, Delphacidae), is one of the most important rice pests. Abundant genetic studies on BPH have been conducted using reverse-transcription quantitative real-time PCR (qRT-PCR). Using qRT-PCR, the expression levels of target genes are calculated on the basis of endogenous controls. These genes need to be appropriately selected by experimentally assessing whether they are stably expressed under different conditions. However, such studies on potential reference genes in N. lugens are lacking. In this paper, we presented a systematic exploration of eight candidate reference genes in N. lugens, namely, actin 1 (ACT), muscle actin (MACT), ribosomal protein S11 (RPS11), ribosomal protein S15e (RPS15), alpha 2-tubulin (TUB), elongation factor 1 delta (EF), 18S ribosomal RNA (18S), and arginine kinase (AK) and used four alternative methods (BestKeeper, geNorm, NormFinder, and the delta Ct method) to evaluate the suitability of these genes as endogenous controls. We examined their expression levels among different experimental factors (developmental stage, body part, geographic population, temperature variation, pesticide exposure, diet change, and starvation) following the MIQE (Minimum Information for publication of Quantitative real time PCR Experiments) guidelines. Based on the results of RefFinder, which integrates four currently available major software programs to compare and rank the tested candidate reference genes, RPS15, RPS11, and TUB were found to be the most suitable reference genes in different developmental stages, body parts, and geographic populations, respectively. RPS15 was the most suitable gene under different temperature and diet conditions, while RPS11 was the most suitable gene under different pesticide exposure and starvation conditions. This work sheds light on establishing a standardized qRT-PCR procedure in N. lugens, and serves as a starting point for screening for reference genes for expression studies of related insects.
Konishi, Yuko; Karnan, Sivasundaram; Takahashi, Miyuki; Ota, Akinobu; Damdindorj, Lkhagvasuren; Hosokawa, Yoshitaka; Konishi, Hiroyuki
2012-09-01
Gene targeting in a broad range of human somatic cell lines has been hampered by inefficient homologous recombination. To improve this technology and facilitate its widespread application, it is critical to first have a robust and efficient research system for measuring gene targeting efficiency. Here, using a fusion gene consisting of hygromycin B phosphotransferase and 3'-truncated enhanced GFP (HygR-5' EGFP) as a reporter gene, we created a molecular system monitoring the ratio of homologous to random integration (H/R ratio) of targeting vectors into the genome. Cell clones transduced with a reporter vector containing HygR-5' EGFP were efficiently established from two human somatic cell lines. Established HygR-5' EGFP reporter clones retained their capacity to monitor gene targeting efficiency for a longer duration than a conventional reporter system using an unfused 5' EGFP gene. With the HygR-5' EGFP reporter system, we reproduced previous findings of gene targeting frequency being up-regulated by the use of an adeno-associated viral (AAV) backbone, a promoter-trap system, or a longer homology arm in a targeting vector, suggesting that this system accurately monitors H/R ratio. Thus, our HygR-5' EGFP reporter system will assist in the development of an efficient AAV-based gene targeting technology.
Kleinmanns, Julia A; Schatlowski, Nicole; Heckmann, David; Schubert, Daniel
2017-01-01
HIGHLIGHTS The PRC2 interacting protein BLISTER likely acts downstream of PRC2 to silence Polycomb target genes and is a key regulator of specific stress responses in Arabidopsis . Polycomb group (PcG) proteins are key epigenetic regulators of development. The highly conserved Polycomb repressive complex 2 (PRC2) represses thousands of target genes by trimethylating H3K27 (H3K27me3). Plant specific PcG components and functions are largely unknown, however, we previously identified the plant-specific protein BLISTER (BLI) as a PRC2 interactor. BLI regulates PcG target genes and promotes cold stress resistance. To further understand the function of BLI , we analyzed the transcriptional profile of bli-1 mutants. Approximately 40% of the up-regulated genes in bli are PcG target genes, however, bli-1 mutants did not show changes in H3K27me3 levels at all tested genes, indicating that BLI regulates PcG target genes downstream of or in parallel to PRC2. Interestingly, a significant number of BLI regulated H3K27me3 target genes is regulated by the stress hormone absciscic acid (ABA). We further reveal an overrepresentation of genes responding to abiotic stresses such as drought, high salinity, or heat stress among the up-regulated genes in bli mutants. Consistently, bli mutants showed reduced desiccation stress tolerance. We conclude that the PRC2 associated protein BLI is a key regulator of stress-responsive genes in Arabidopsis : it represses ABA-responsive PcG target genes, likely downstream of PRC2, and promotes resistance to several stresses such as cold and drought.
High-frequency promoter firing links THO complex function to heavy chromatin formation.
Mouaikel, John; Causse, Sébastien Z; Rougemaille, Mathieu; Daubenton-Carafa, Yves; Blugeon, Corinne; Lemoine, Sophie; Devaux, Frédéric; Darzacq, Xavier; Libri, Domenico
2013-11-27
The THO complex is involved in transcription, genome stability, and messenger ribonucleoprotein (mRNP) formation, but its precise molecular function remains enigmatic. Under heat shock conditions, THO mutants accumulate large protein-DNA complexes that alter the chromatin density of target genes (heavy chromatin), defining a specific biochemical facet of THO function and a powerful tool of analysis. Here, we show that heavy chromatin distribution is dictated by gene boundaries and that the gene promoter is necessary and sufficient to convey THO sensitivity in these conditions. Single-molecule fluorescence in situ hybridization measurements show that heavy chromatin formation correlates with an unusually high firing pace of the promoter with more than 20 transcription events per minute. Heavy chromatin formation closely follows the modulation of promoter firing and strongly correlates with polymerase occupancy genome wide. We propose that the THO complex is required for tuning the dynamic of gene-nuclear pore association and mRNP release to the same high pace of transcription initiation. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.
Spina Bifida: Pathogenesis, Mechanisms, and Genes in Mice and Humans
Abou Chaar, Mohamad K.; Ahmad-Annuar, Azlina
2017-01-01
Spina bifida is among the phenotypes of the larger condition known as neural tube defects (NTDs). It is the most common central nervous system malformation compatible with life and the second leading cause of birth defects after congenital heart defects. In this review paper, we define spina bifida and discuss the phenotypes seen in humans as described by both surgeons and embryologists in order to compare and ultimately contrast it to the leading animal model, the mouse. Our understanding of spina bifida is currently limited to the observations we make in mouse models, which reflect complete or targeted knockouts of genes, which perturb the whole gene(s) without taking into account the issue of haploinsufficiency, which is most prominent in the human spina bifida condition. We thus conclude that the need to study spina bifida in all its forms, both aperta and occulta, is more indicative of the spina bifida in surviving humans and that the measure of deterioration arising from caudal neural tube defects, more commonly known as spina bifida, must be determined by the level of the lesion both in mouse and in man. PMID:28286691
NASA Astrophysics Data System (ADS)
Valdivia-Silva, Julio E.; Lavan, David; Diego Orihuela-Tacuri, M.; Sanabria, Gabriela
2016-07-01
Currently, studies in Drosophila melanogaster has shown emerging evidence that microgravity stimuli can be detected at the genetic level. Analysis of the transcriptome in the pupal stage of the fruit flies under microgravity conditions versus ground controls has suggested the presence of a few candidate genes as "gravity sensors" which are experimentally validated. Additionally, several studies have shown that microgravity causes inhibitory effects in different types of cancer cells, although the genes involved and responsible for these effects are still unknown. Here, we demonstrate that the genes suggested as the sensors of gravitational waves in Drosophila melanogaster and their human counterpart (orthologous genes) are highly involved in carcinogenesis, proliferation, anti-apoptotic signals, invasiveness, and metastatic potential of breast cancer cell tumors. The transcriptome analyses suggested that the observed inhibitory effect in cancer cells could be due to changes in the genetic expression of these candidates. These results encourage the possibility of new therapeutic targets managed together and not in isolation.
Hybrid promoters directed tBid gene expression to breast cancer cells by transcriptional targeting.
Farokhimanesh, Samila; Rahbarizadeh, Fatemeh; Rasaee, Mohammad J; Kamali, Abbas; Mashkani, Baratali
2010-01-01
Developing cancer gene therapy constructs based on transcriptional targeting of genes to cancer cells is a new and promising modality for treatment of cancer. Introducing truncated Bid (tBid), a recently known member of the Bcl-2 family, eradicates cancer cells efficiently. For transcriptional targeting of tBid, two dual-specificity promoters, combining cancer specific core promoters and response modules, were designed. These two core promoter modules contained cancer specific promoters of MUC1 and Survivin genes accompanied by hypoxia-responsive elements and estrogen responsive elements (microenvironment condition of breast cancer cells) which were employed to achieve a higher and more specific level of tBid expression in breast cancer cells. Correlation of the level of tBid expression in normal and cancer cell lines with promoter activity was measured by RT-PCR after treatment with hypoxia and estrogen. The level of tBid expression under control of new hybrid promoters was compared with its expression under control of cytomegalovirus (CMV) promoter as a control. Our data revealed that the level of tBid expression in breast cancer cells were nearly 11 times more than normal cells because of the cancer specific promoters, although tBid expression under control of CMV promoter was almost the same in normal and cancer cell lines. Increased apoptosis was detected in the transfected breast cancer cell lines by the Caspase-3 activity assay. The application of these promoters may prove to have the advantage of tumor selective gene therapy in breast cancer cells and low-potential toxicity for normal tissues.
NASA Astrophysics Data System (ADS)
Yuan, Chenyan; An, Yanli; Zhang, Jia; Li, Hongbo; Zhang, Hao; Wang, Ling; Zhang, Dongsheng
2014-08-01
Gene therapy holds great promise for treating cancers, but their clinical applications are being hampered due to uncontrolled gene delivery and expression. To develop a targeted, safe and efficient tumor therapy system, we constructed a tissue-specific suicide gene delivery system by using magnetic nanoparticles (MNPs) as carriers for the combination of gene therapy and hyperthermia on hepatoma. The suicide gene was hepatoma-targeted and hypoxia-enhanced, and the MNPs possessed the ability to elevate temperature to the effective range for tumor hyperthermia as imposed on an alternating magnetic field (AMF). The tumoricidal effects of targeted gene therapy associated with hyperthermia were evaluated in vitro and in vivo. The experiment demonstrated that hyperthermia combined with a targeted gene therapy system proffer an effective tool for tumor therapy with high selectivity and the synergistic effect of hepatoma suppression.
Pfleger, Brian; Mendez-Perez, Daniel
2013-11-05
Disclosed are systems and methods for coupling translation of a target gene to a detectable response gene. A version of the invention includes a translation-coupling cassette. The translation-coupling cassette includes a target gene, a response gene, a response-gene translation control element, and a secondary structure-forming sequence that reversibly forms a secondary structure masking the response-gene translation control element. Masking of the response-gene translation control element inhibits translation of the response gene. Full translation of the target gene results in unfolding of the secondary structure and consequent translation of the response gene. Translation of the target gene is determined by detecting presence of the response-gene protein product. The invention further includes RNA transcripts of the translation-coupling cassettes, vectors comprising the translation-coupling cassettes, hosts comprising the translation-coupling cassettes, methods of using the translation-coupling cassettes, and gene products produced with the translation-coupling cassettes.
Pfleger, Brian; Mendez-Perez, Daniel
2015-05-19
Disclosed are systems and methods for coupling translation of a target gene to a detectable response gene. A version of the invention includes a translation-coupling cassette. The translation-coupling cassette includes a target gene, a response gene, a response-gene translation control element, and a secondary structure-forming sequence that reversibly forms a secondary structure masking the response-gene translation control element. Masking of the response-gene translation control element inhibits translation of the response gene. Full translation of the target gene results in unfolding of the secondary structure and consequent translation of the response gene. Translation of the target gene is determined by detecting presence of the response-gene protein product. The invention further includes RNA transcripts of the translation-coupling cassettes, vectors comprising the translation-coupling cassettes, hosts comprising the translation-coupling cassettes, methods of using the translation-coupling cassettes, and gene products produced with the translation-coupling cassettes.
Successful transient expression of Cas9 and single guide RNA genes in Chlamydomonas reinhardtii.
Jiang, Wenzhi; Brueggeman, Andrew J; Horken, Kempton M; Plucinak, Thomas M; Weeks, Donald P
2014-11-01
The clustered regularly interspaced short palindromic repeat (CRISPR)/Cas9 system has become a powerful and precise tool for targeted gene modification (e.g., gene knockout and gene replacement) in numerous eukaryotic organisms. Initial attempts to apply this technology to a model, the single-cell alga, Chlamydomonas reinhardtii, failed to yield cells containing edited genes. To determine if the Cas9 and single guide RNA (sgRNA) genes were functional in C. reinhardtii, we tested the ability of a codon-optimized Cas9 gene along with one of four different sgRNAs to cause targeted gene disruption during a 24-h period immediately following transformation. All three exogenously supplied gene targets as well as the endogenous FKB12 (rapamycin sensitivity) gene of C. reinhardtii displayed distinct Cas9/sgRNA-mediated target site modifications as determined by DNA sequencing of cloned PCR amplicons of the target site region. Success in transient expression of Cas9 and sgRNA genes contrasted with the recovery of only a single rapamycin-resistant colony bearing an appropriately modified FKB12 target site in 16 independent transformation experiments involving >10(9) cells. Failure to recover transformants with intact or expressed Cas9 genes following transformation with the Cas9 gene alone (or even with a gene encoding a Cas9 lacking nuclease activity) provided strong suggestive evidence for Cas9 toxicity when Cas9 is produced constitutively in C. reinhardtii. The present results provide compelling evidence that Cas9 and sgRNA genes function properly in C. reinhardtii to cause targeted gene modifications and point to the need for a focus on development of methods to properly stem Cas9 production and/or activity following gene editing. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
Zhang, Weixiong; Ruan, Jianhua; Ho, Tuan-Hua David; You, Youngsook; Yu, Taotao; Quatrano, Ralph S
2005-07-15
A fundamental problem of computational genomics is identifying the genes that respond to certain endogenous cues and environmental stimuli. This problem can be referred to as targeted gene finding. Since gene regulation is mainly determined by the binding of transcription factors and cis-regulatory DNA sequences, most existing gene annotation methods, which exploit the conservation of open reading frames, are not effective in finding target genes. A viable approach to targeted gene finding is to exploit the cis-regulatory elements that are known to be responsible for the transcription of target genes. Given such cis-elements, putative target genes whose promoters contain the elements can be identified. As a case study, we apply the above approach to predict the genes in model plant Arabidopsis thaliana which are inducible by a phytohormone, abscisic acid (ABA), and abiotic stress, such as drought, cold and salinity. We first construct and analyze two ABA specific cis-elements, ABA-responsive element (ABRE) and its coupling element (CE), in A.thaliana, based on their conservation in rice and other cereal plants. We then use the ABRE-CE module to identify putative ABA-responsive genes in A.thaliana. Based on RT-PCR verification and the results from literature, this method has an accuracy rate of 67.5% for the top 40 predictions. The cis-element based targeted gene finding approach is expected to be widely applicable since a large number of cis-elements in many species are available.
Geib, Elena; Brock, Matthias
2017-01-01
Fungi are treasure chests for yet unexplored natural products. However, exploitation of their real potential remains difficult as a significant proportion of biosynthetic gene clusters appears silent under standard laboratory conditions. Therefore, elucidation of novel products requires gene activation or heterologous expression. For heterologous gene expression, we previously developed an expression platform in Aspergillus niger that is based on the transcriptional regulator TerR and its target promoter P terA . In this study, we extended this system by regulating expression of terR by the doxycycline inducible Tet-on system. Reporter genes cloned under the control of the target promoter P terA remained silent in the absence of doxycycline, but were strongly expressed when doxycycline was added. Reporter quantification revealed that the coupled system results in about five times higher expression rates compared to gene expression under direct control of the Tet-on system. As production of secondary metabolites generally requires the expression of several biosynthetic genes, the suitability of the self-cleaving viral peptide sequence P2A was tested in this optimised expression system. P2A allowed polycistronic expression of genes required for Asp-melanin formation in combination with the gene coding for the red fluorescent protein tdTomato. Gene expression and Asp-melanin formation was prevented in the absence of doxycycline and strongly induced by addition of doxycycline. Fluorescence studies confirmed the correct subcellular localisation of the respective enzymes. This tightly regulated but strongly inducible expression system enables high level production of secondary metabolites most likely even those with toxic potential. Furthermore, this system is compatible with polycistronic gene expression and, thus, suitable for the discovery of novel natural products.
Hipp, Jason D; Davies, Kelvin P; Tar, Moses; Valcic, Mira; Knoll, Abraham; Melman, Arnold; Christ, George J
2007-02-01
To identify early diabetes-related alterations in gene expression in bladder and erectile tissue that would provide novel diagnostic and therapeutic treatment targets to prevent, delay or ameliorate the ensuing bladder and erectile dysfunction. The RG-U34A rat GeneChip (Affymetrix Inc., Sunnyvale, CA, USA) oligonucleotide microarray (containing approximately 8799 genes) was used to evaluate gene expression in corporal and male bladder tissue excised from rats 1 week after confirmation of a diabetic state, but before demonstrable changes in organ function in vivo. A conservative analytical approach was used to detect alterations in gene expression, and gene ontology (GO) classifications were used to identify biological themes/pathways involved in the aetiology of the organ dysfunction. In all, 320 and 313 genes were differentially expressed in bladder and corporal tissue, respectively. GO analysis in bladder tissue showed prominent increases in biological pathways involved in cell proliferation, metabolism, actin cytoskeleton and myosin, as well as decreases in cell motility, and regulation of muscle contraction. GO analysis in corpora showed increases in pathways related to ion channel transport and ion channel activity, while there were decreases in collagen I and actin genes. The changes in gene expression in these initial experiments are consistent with the pathophysiological characteristics of the bladder and erectile dysfunction seen later in the diabetic disease process. Thus, the observed changes in gene expression might be harbingers or biomarkers of impending organ dysfunction, and could provide useful diagnostic and therapeutic targets for a variety of progressive urological diseases/conditions (i.e. lower urinary tract symptoms related to benign prostatic hyperplasia, erectile dysfunction, etc.).
htsint: a Python library for sequencing pipelines that combines data through gene set generation.
Richards, Adam J; Herrel, Anthony; Bonneaud, Camille
2015-09-24
Sequencing technologies provide a wealth of details in terms of genes, expression, splice variants, polymorphisms, and other features. A standard for sequencing analysis pipelines is to put genomic or transcriptomic features into a context of known functional information, but the relationships between ontology terms are often ignored. For RNA-Seq, considering genes and their genetic variants at the group level enables a convenient way to both integrate annotation data and detect small coordinated changes between experimental conditions, a known caveat of gene level analyses. We introduce the high throughput data integration tool, htsint, as an extension to the commonly used gene set enrichment frameworks. The central aim of htsint is to compile annotation information from one or more taxa in order to calculate functional distances among all genes in a specified gene space. Spectral clustering is then used to partition the genes, thereby generating functional modules. The gene space can range from a targeted list of genes, like a specific pathway, all the way to an ensemble of genomes. Given a collection of gene sets and a count matrix of transcriptomic features (e.g. expression, polymorphisms), the gene sets produced by htsint can be tested for 'enrichment' or conditional differences using one of a number of commonly available packages. The database and bundled tools to generate functional modules were designed with sequencing pipelines in mind, but the toolkit nature of htsint allows it to also be used in other areas of genomics. The software is freely available as a Python library through GitHub at https://github.com/ajrichards/htsint.
Neerincx, Pieter BT; Casel, Pierrot; Prickett, Dennis; Nie, Haisheng; Watson, Michael; Leunissen, Jack AM; Groenen, Martien AM; Klopp, Christophe
2009-01-01
Background Reliable annotation linking oligonucleotide probes to target genes is essential for functional biological analysis of microarray experiments. We used the IMAD, OligoRAP and sigReannot pipelines to update the annotation for the ARK-Genomics Chicken 20 K array as part of a joined EADGENE/SABRE workshop. In this manuscript we compare their annotation strategies and results. Furthermore, we analyse the effect of differences in updated annotation on functional analysis for an experiment involving Eimeria infected chickens and finally we propose guidelines for optimal annotation strategies. Results IMAD, OligoRAP and sigReannot update both annotation and estimated target specificity. The 3 pipelines can assign oligos to target specificity categories although with varying degrees of resolution. Target specificity is judged based on the amount and type of oligo versus target-gene alignments (hits), which are determined by filter thresholds that users can adjust based on their experimental conditions. Linking oligos to annotation on the other hand is based on rigid rules, which differ between pipelines. For 52.7% of the oligos from a subset selected for in depth comparison all pipelines linked to one or more Ensembl genes with consensus on 44.0%. In 31.0% of the cases none of the pipelines could assign an Ensembl gene to an oligo and for the remaining 16.3% the coverage differed between pipelines. Differences in updated annotation were mainly due to different thresholds for hybridisation potential filtering of oligo versus target-gene alignments and different policies for expanding annotation using indirect links. The differences in updated annotation packages had a significant effect on GO term enrichment analysis with consensus on only 67.2% of the enriched terms. Conclusion In addition to flexible thresholds to determine target specificity, annotation tools should provide metadata describing the relationships between oligos and the annotation assigned to them. These relationships can then be used to judge the varying degrees of reliability allowing users to fine-tune the balance between reliability and coverage. This is important as it can have a significant effect on functional microarray analysis as exemplified by the lack of consensus on almost one third of the terms found with GO term enrichment analysis based on updated IMAD, OligoRAP or sigReannot annotation. PMID:19615109
Neerincx, Pieter Bt; Casel, Pierrot; Prickett, Dennis; Nie, Haisheng; Watson, Michael; Leunissen, Jack Am; Groenen, Martien Am; Klopp, Christophe
2009-07-16
Reliable annotation linking oligonucleotide probes to target genes is essential for functional biological analysis of microarray experiments. We used the IMAD, OligoRAP and sigReannot pipelines to update the annotation for the ARK-Genomics Chicken 20 K array as part of a joined EADGENE/SABRE workshop. In this manuscript we compare their annotation strategies and results. Furthermore, we analyse the effect of differences in updated annotation on functional analysis for an experiment involving Eimeria infected chickens and finally we propose guidelines for optimal annotation strategies. IMAD, OligoRAP and sigReannot update both annotation and estimated target specificity. The 3 pipelines can assign oligos to target specificity categories although with varying degrees of resolution. Target specificity is judged based on the amount and type of oligo versus target-gene alignments (hits), which are determined by filter thresholds that users can adjust based on their experimental conditions. Linking oligos to annotation on the other hand is based on rigid rules, which differ between pipelines.For 52.7% of the oligos from a subset selected for in depth comparison all pipelines linked to one or more Ensembl genes with consensus on 44.0%. In 31.0% of the cases none of the pipelines could assign an Ensembl gene to an oligo and for the remaining 16.3% the coverage differed between pipelines. Differences in updated annotation were mainly due to different thresholds for hybridisation potential filtering of oligo versus target-gene alignments and different policies for expanding annotation using indirect links. The differences in updated annotation packages had a significant effect on GO term enrichment analysis with consensus on only 67.2% of the enriched terms. In addition to flexible thresholds to determine target specificity, annotation tools should provide metadata describing the relationships between oligos and the annotation assigned to them. These relationships can then be used to judge the varying degrees of reliability allowing users to fine-tune the balance between reliability and coverage. This is important as it can have a significant effect on functional microarray analysis as exemplified by the lack of consensus on almost one third of the terms found with GO term enrichment analysis based on updated IMAD, OligoRAP or sigReannot annotation.
Seinen, Erwin; Burgerhof, Johannes G. M.; Jansen, Ritsert C.; Sibon, Ody C. M.
2010-01-01
Background RNAi technology is widely used to downregulate specific gene products. Investigating the phenotype induced by downregulation of gene products provides essential information about the function of the specific gene of interest. When RNAi is applied in Drosophila melanogaster or Caenorhabditis elegans, often large dsRNAs are used. One of the drawbacks of RNAi technology is that unwanted gene products with sequence similarity to the gene of interest can be down regulated too. To verify the outcome of an RNAi experiment and to avoid these unwanted off-target effects, an additional non-overlapping dsRNA can be used to down-regulate the same gene. However it has never been tested whether this approach is sufficient to reduce the risk of off-targets. Methodology We created a novel tool to analyse the occurance of off-target effects in Drosophila and we analyzed 99 randomly chosen genes. Principal Findings Here we show that nearly all genes contain non-overlapping internal sequences that do show overlap in a common off-target gene. Conclusion Based on our in silico findings, off-target effects should not be ignored and our presented on-line tool enables the identification of two RNA interference constructs, free of overlapping off-targets, from any gene of interest. PMID:20957038
Bai, Qianqian; Wang, Xiaoying; Chen, Xi; Shi, Guiqing; Liu, Zhipeng; Guo, Chengjin; Xiao, Kai
2018-01-01
MicroRNAs (miRNA) families act as critical regulators for plant growth, development, and responses to abiotic stresses. In this study, we characterized TaemiR408, a miRNA family member of wheat ( Triticum aestivum ), for the role in mediating plant responses to Pi starvation and salt stress. TaemiR408 targets six genes that encode proteins involving biochemical metabolism, microtubule organization, and signaling transduction. 5'- and 3'-RACE analyses confirmed the mRNA cleavage of target genes mediated by this wheat miRNA. TaemiR408 showed induced expression patterns upon Pi starvation and salt stress and whose upregulated expression was gradually repressed by the normal recovery treatments. The target genes of TaemiR408 exhibited reverse expression patterns to this miRNA, whose transcripts were downregulated under Pi starvation and salt stress and the reduced expression was recovered by the followed normal condition. These results suggest the regulation of the target genes under TaemiR408 through a cleavage mechanism. Tobacco lines with TaemiR408 overexpression exhibited enhanced stress tolerance, showing improved phenotype, biomass, and photosynthesis behavior compared with wild type under both Pi starvation and salt treatments, which closely associate increased P accumulation upon Pi deprivation and elevated osmolytes under salt stress, respectively. Phosphate transporter (PT) gene NtPT2 displays upregulated transcripts in the Pi-deprived TaemiR408 overexpressors; knockdown of this PT gene reduces Pi acquisition under low-Pi stress, confirming its role in improving plant Pi taken up. Likewise, NtPYL2 and NtSAPK3 , genes encoding abscisic acid (ABA) receptor and SnRK2 protein, respectively, exhibited upregulated transcripts in salt-challenged TaemiR408 overexpressors; knockdown of them caused deteriorated growth and lowered osmolytes amounts of plants upon salt treatment. Thus, TaemiR408 is crucial for plant adaptations to Pi starvation and salt stress through regulating Pi acquisition under low-Pi stress and remodel ABA signaling pathway and osmoprotects biosynthesis under salt stress.
High density DNA microarrays: algorithms and biomedical applications.
Liu, Wei-Min
2004-08-01
DNA microarrays are devices capable of detecting the identity and abundance of numerous DNA or RNA segments in samples. They are used for analyzing gene expressions, identifying genetic markers and detecting mutations on a genomic scale. The fundamental chemical mechanism of DNA microarrays is the hybridization between probes and targets due to the hydrogen bonds of nucleotide base pairing. Since the cross hybridization is inevitable, and probes or targets may form undesirable secondary or tertiary structures, the microarray data contain noise and depend on experimental conditions. It is crucial to apply proper statistical algorithms to obtain useful signals from noisy data. After we obtained the signals of a large amount of probes, we need to derive the biomedical information such as the existence of a transcript in a cell, the difference of expression levels of a gene in multiple samples, and the type of a genetic marker. Furthermore, after the expression levels of thousands of genes or the genotypes of thousands of single nucleotide polymorphisms are determined, it is usually important to find a small number of genes or markers that are related to a disease, individual reactions to drugs, or other phenotypes. All these applications need careful data analyses and reliable algorithms.
The first crop plant genetically engineered to release an insect pheromone for defence
Bruce, Toby J.A.; Aradottir, Gudbjorg I.; Smart, Lesley E.; Martin, Janet L.; Caulfield, John C.; Doherty, Angela; Sparks, Caroline A.; Woodcock, Christine M.; Birkett, Michael A.; Napier, Johnathan A.; Jones, Huw D.; Pickett, John A.
2015-01-01
Insect pheromones offer potential for managing pests of crop plants. Volatility and instability are problems for deployment in agriculture but could be solved by expressing genes for the biosynthesis of pheromones in the crop plants. This has now been achieved by genetically engineering a hexaploid variety of wheat to release (E)-β-farnesene (Eβf), the alarm pheromone for many pest aphids, using a synthetic gene based on a sequence from peppermint with a plastid targeting amino acid sequence, with or without a gene for biosynthesis of the precursor farnesyl diphosphate. Pure Eβf was produced in stably transformed wheat lines with no other detectable phenotype but requiring targeting of the gene produced to the plastid. In laboratory behavioural assays, three species of cereal aphids were repelled and foraging was increased for a parasitic natural enemy. Although these studies show considerable potential for aphid control, field trials employing the single and double constructs showed no reduction in aphids or increase in parasitism. Insect numbers were low and climatic conditions erratic suggesting the need for further trials or a closer imitation, in the plant, of alarm pheromone release. PMID:26108150
Nutrigenomics of extra-virgin olive oil: A review.
Piroddi, Marta; Albini, Adriana; Fabiani, Roberto; Giovannelli, Lisa; Luceri, Cristina; Natella, Fausta; Rosignoli, Patrizia; Rossi, Teresa; Taticchi, Agnese; Servili, Maurizio; Galli, Francesco
2017-01-02
Nutrigenomics data on the functional components of olive oil are still sparse, but rapidly increasing. Olive oil is the main source of fat and health-promoting component of the Mediterranean diet. Positive effects have been observed on genes involved in the pathobiology of most prevalent age- and lifestyle-related human conditions, such as cancer, cardiovascular disease and neurodegeneration. Other effects on health-promoting genes have been identified for bioactive components of olives and olive leafs. Omics technologies are offering unique opportunities to identify nutritional and health biomarkers associated with these gene responses, the use of which in personalized and even predictive protocols of investigation, is a main breakthrough in modern medicine and nutrition. Gene regulation properties of the functional components of olive oil, such as oleic acid, biophenols and vitamin E, point to a role for these molecules as natural homeostatic and even hormetic factors with applications as prevention agents in conditions of premature and pathologic aging. Therapeutic applications can be foreseen in conditions of chronic inflammation, and particularly in cancer, which will be discussed in detail in this review paper as major clinical target of nutritional interventions with olive oil and its functional components. © 2016 BioFactors, 43(1):17-41, 2017. © 2016 International Union of Biochemistry and Molecular Biology.
Transgenic mouse models in the study of reproduction: insights into GATA protein function.
Tevosian, Sergei G
2014-07-01
For the past 2 decades, transgenic technology in mice has allowed for an unprecedented insight into the transcriptional control of reproductive development and function. The key factor among the mouse genetic tools that made this rapid advance possible is a conditional transgenic approach, a particularly versatile method of creating gene deletions and substitutions in the mouse genome. A centerpiece of this strategy is an enzyme, Cre recombinase, which is expressed from defined DNA regulatory elements that are active in the tissue of choice. The regulatory DNA element (either genetically engineered or natural) assures Cre expression only in predetermined cell types, leading to the guided deletion of genetically modified (flanked by loxP or 'floxed' by loxP) gene loci. This review summarizes and compares the studies in which genes encoding GATA family transcription factors were targeted either globally or by Cre recombinases active in the somatic cells of ovaries and testes. The conditional gene loss experiments require detailed knowledge of the spatial and temporal expression of Cre activity, and the challenges in interpreting the outcomes are highlighted. These studies also expose the complexity of GATA-dependent regulation of gonadal gene expression and suggest that gene function is highly context dependent. © 2014 Society for Reproduction and Fertility.
Javan, Bita; Shahbazi, Majid
2017-01-01
Transcriptional targeting is the best approach for specific gene therapy. Hypoxia is a common feature of the tumour microenvironment. Therefore, targeting gene expression in hypoxic cells by placing transgene under the control of a hypoxia-responsive promoter can be a good strategy for cancer-specific gene therapy. The hypoxia-inducible gene expression system has been investigated more in suicide gene therapy and it can also be of great help in knocking down cancer gene therapy with siRNAs. However, this system needs to be optimised to have maximum efficacy with minimum side effects in normal tissues. The combination of tissue-/tumour-specific promoters with HRE core sequences has been found to enhance the specificity and efficacy of this system. In this review, hypoxia-inducible gene expression system as well as gene therapy strategies targeting tumour hypoxia will be discussed. This review will also focus on hypoxia-inducible tumour-specific promoters as a dual-targeting transcriptional regulation systems developed for cancer-specific gene therapy. PMID:28798809
Kikuta, Hiroshi; Laplante, Mary; Navratilova, Pavla; Komisarczuk, Anna Z.; Engström, Pär G.; Fredman, David; Akalin, Altuna; Caccamo, Mario; Sealy, Ian; Howe, Kerstin; Ghislain, Julien; Pezeron, Guillaume; Mourrain, Philippe; Ellingsen, Staale; Oates, Andrew C.; Thisse, Christine; Thisse, Bernard; Foucher, Isabelle; Adolf, Birgit; Geling, Andrea; Lenhard, Boris; Becker, Thomas S.
2007-01-01
We report evidence for a mechanism for the maintenance of long-range conserved synteny across vertebrate genomes. We found the largest mammal-teleost conserved chromosomal segments to be spanned by highly conserved noncoding elements (HCNEs), their developmental regulatory target genes, and phylogenetically and functionally unrelated “bystander” genes. Bystander genes are not specifically under the control of the regulatory elements that drive the target genes and are expressed in patterns that are different from those of the target genes. Reporter insertions distal to zebrafish developmental regulatory genes pax6.1/2, rx3, id1, and fgf8 and miRNA genes mirn9-1 and mirn9-5 recapitulate the expression patterns of these genes even if located inside or beyond bystander genes, suggesting that the regulatory domain of a developmental regulatory gene can extend into and beyond adjacent transcriptional units. We termed these chromosomal segments genomic regulatory blocks (GRBs). After whole genome duplication in teleosts, GRBs, including HCNEs and target genes, were often maintained in both copies, while bystander genes were typically lost from one GRB, strongly suggesting that evolutionary pressure acts to keep the single-copy GRBs of higher vertebrates intact. We show that loss of bystander genes and other mutational events suffered by duplicated GRBs in teleost genomes permits target gene identification and HCNE/target gene assignment. These findings explain the absence of evolutionary breakpoints from large vertebrate chromosomal segments and will aid in the recognition of position effect mutations within human GRBs. PMID:17387144
Turankar, Ravindra P; Pandey, Shradha; Lavania, Mallika; Singh, Itu; Nigam, Astha; Darlong, Joydeepa; Darlong, Fam; Sengupta, Utpal
2015-03-01
PCR assay is a highly sensitive, specific and reliable diagnostic tool for the identification of pathogens in many infectious diseases. Genome sequencing Mycobacterium leprae revealed several gene targets that could be used for the detection of DNA from clinical and environmental samples. The PCR sensitivity of particular gene targets for specific clinical and environmental isolates has not yet been established. The present study was conducted to compare the sensitivity of RLEP, rpoT, Sod A and 16S rRNA gene targets in the detection of M. leprae in slit skin smear (SSS), blood, soil samples of leprosy patients and their surroundings. Leprosy patients were classified into Paucibacillary (PB) and Multibacillary (MB) types. Ziehl-Neelsen (ZN) staining method for all the SSS samples and Bacteriological Index (BI) was calculated for all patients. Standard laboratory protocol was used for DNA extraction from SSS, blood and soil samples. PCR technique was performed for the detection of M. leprae DNA from all the above-mentioned samples. RLEP gene target was able to detect the presence of M. leprae in 83% of SSS, 100% of blood samples and in 36% of soil samples and was noted to be the best out of all other gene targets (rpoT, Sod A and 16S rRNA). It was noted that the RLEP gene target was able to detect the highest number (53%) of BI-negative leprosy patients amongst all the gene targets used in this study. Amongst all the gene targets used in this study, PCR positivity using RLEP gene target was the highest in all the clinical and environmental samples. Further, the RLEP gene target was able to detect 53% of blood samples as positive in BI-negative leprosy cases indicating its future standardization and use for diagnostic purposes. Copyright © 2015 Asian African Society for Mycobacteriology. Published by Elsevier Ltd. All rights reserved.
Hepatic signaling by the mechanistic target of rapamycin complex 2 (mTORC2)
Lamming, Dudley W.; Demirkan, Gokhan; Boylan, Joan M.; Mihaylova, Maria M.; Peng, Tao; Ferreira, Jonathan; Neretti, Nicola; Salomon, Arthur; Sabatini, David M.; Gruppuso, Philip A.
2014-01-01
The mechanistic target of rapamycin (mTOR) exists in two complexes that regulate diverse cellular processes. mTOR complex 1 (mTORC1), the canonical target of rapamycin, has been well studied, whereas the physiological role of mTORC2 remains relatively uncharacterized. In mice in which the mTORC2 component Rictor is deleted in liver [Rictor-knockout (RKO) mice], we used genomic and phosphoproteomic analyses to characterize the role of hepatic mTORC2 in vivo. Overnight food withdrawal followed by refeeding was used to activate mTOR signaling. Rapamycin was administered before refeeding to specify mTORC2-mediated events. Hepatic mTORC2 regulated a complex gene expression and post-translational network that affects intermediary metabolism, ribosomal biogenesis, and proteasomal biogenesis. Nearly all changes in genes related to intermediary metabolic regulation were replicated in cultured fetal hepatocytes, indicating a cell-autonomous effect of mTORC2 signaling. Phosphoproteomic profiling identified mTORC2-related signaling to 144 proteins, among which were metabolic enzymes and regulators. A reduction of p38 MAPK signaling in the RKO mice represents a link between our phosphoproteomic and gene expression results. We conclude that hepatic mTORC2 exerts a broad spectrum of biological effects under physiological conditions. Our findings provide a context for the development of targeted therapies to modulate mTORC2 signaling.—Lamming, D. W., Demirkan, G., Boylan, J. M., Mihaylova, M. M., Peng, T., Ferreira, J., Neretti, N., Salomon, A., Sabatini, D. M., Gruppuso, P. A. Hepatic signaling by the mechanistic target of rapamycin complex 2 (mTORC2). PMID:24072782
Flores-Herrera, Patricio; Arredondo-Zelada, Oscar; Marshall, Sergio H; Gómez, Fernando A
2018-06-01
Piscirickettsia salmonis is a highly aggressive facultative intracellular bacterium that challenges the sustainability of Chilean salmon production. Due to the limited knowledge of its biology, there is a need to identify key molecular markers that could help define the pathogenic potential of this bacterium. We think a model system should be implemented that efficiently evaluates the expression of putative bacterial markers by using validated, stable, and highly specific housekeeping genes to properly select target genes, which could lead to identifying those responsible for infection and disease induction in naturally infected fish. Here, we selected a set of validated reference or housekeeping genes for RT-qPCR expression analyses of P. salmonis under different growth and stress conditions, including an in vitro infection kinetic. After a thorough screening, we selected sdhA as the most reliable housekeeping gene able to represent stable and highly specific host reference genes for RT-qPCR-driven P. salmonis analysis. Copyright © 2018. Published by Elsevier B.V.
Li, Fangwei; Shi, Wenhua; Wan, Yixin; Wang, Qingting; Feng, Wei; Yan, Xin; Wang, Jian; Chai, Limin; Zhang, Qianqian; Li, Manxiang
2017-12-01
The expression of microRNA (miR)-140-5p is known to be reduced in both pulmonary arterial hypertension (PAH) patients and monocrotaline-induced PAH models in rat. Identification of target genes for miR-140-5p with bioinformatics analysis may reveal new pathways and connections in PAH. This study aimed to explore downstream target genes and relevant signaling pathways regulated by miR-140-5p to provide theoretical evidences for further researches on role of miR-140-5p in PAH. Multiple downstream target genes and upstream transcription factors (TFs) of miR-140-5p were predicted in the analysis. Gene ontology (GO) enrichment analysis indicated that downstream target genes of miR-140-5p were enriched in many biological processes, such as biological regulation, signal transduction, response to chemical stimulus, stem cell proliferation, cell surface receptor signaling pathways. Kyoto Encyclopedia of Genes and Genome (KEGG) pathway analysis found that downstream target genes were mainly located in Notch, TGF-beta, PI3K/Akt, and Hippo signaling pathway. According to TF-miRNA-mRNA network, the important downstream target genes of miR-140-5p were PPI, TGF-betaR1, smad4, JAG1, ADAM10, FGF9, PDGFRA, VEGFA, LAMC1, TLR4, and CREB. After thoroughly reviewing published literature, we found that 23 target genes and seven signaling pathways were truly inhibited by miR-140-5p in various tissues or cells; most of these verified targets were in accordance with our present prediction. Other predicted targets still need further verification in vivo and in vitro .
Andrews, Erik; Wang, Yue; Xia, Tian; Cheng, Wenqing; Cheng, Chao
2017-01-01
Gene expression regulators, such as transcription factors (TFs) and microRNAs (miRNAs), have varying regulatory targets based on the tissue and physiological state (context) within which they are expressed. While the emergence of regulator-characterizing experiments has inferred the target genes of many regulators across many contexts, methods for transferring regulator target genes across contexts are lacking. Further, regulator target gene lists frequently are not curated or have permissive inclusion criteria, impairing their use. Here, we present a method called iterative Contextual Transcriptional Activity Inference of Regulators (icTAIR) to resolve these issues. icTAIR takes a regulator’s previously-identified target gene list and combines it with gene expression data from a context, quantifying that regulator’s activity for that context. It then calculates the correlation between each listed target gene’s expression and the quantitative score of regulatory activity, removes the uncorrelated genes from the list, and iterates the process until it derives a stable list of refined target genes. To validate and demonstrate icTAIR’s power, we use it to refine the MSigDB c3 database of TF, miRNA and unclassified motif target gene lists for breast cancer. We then use its output for survival analysis with clinicopathological multivariable adjustment in 7 independent breast cancer datasets covering 3,430 patients. We uncover many novel prognostic regulators that were obscured prior to refinement, in particular NFY, and offer a detailed look at the composition and relationships among the breast cancer prognostic regulome. We anticipate icTAIR will be of general use in contextually refining regulator target genes for discoveries across many contexts. The icTAIR algorithm can be downloaded from https://github.com/icTAIR. PMID:28103241
Programmable genetic circuits for pathway engineering.
Hoynes-O'Connor, Allison; Moon, Tae Seok
2015-12-01
Synthetic biology has the potential to provide decisive advances in genetic control of metabolic pathways. However, there are several challenges that synthetic biologists must overcome before this vision becomes a reality. First, a library of diverse and well-characterized sensors, such as metabolite-sensing or condition-sensing promoters, must be constructed. Second, robust programmable circuits that link input conditions with a specific gene regulation response must be developed. Finally, multi-gene targeting strategies must be integrated with metabolically relevant sensors and complex, robust logic. Achievements in each of these areas, which employ the CRISPR/Cas system, in silico modeling, and dynamic sensor-regulators, among other tools, provide a strong basis for future research. Overall, the future for synthetic biology approaches in metabolic engineering holds immense promise. Copyright © 2015 Elsevier Ltd. All rights reserved.
Reiber, Kathrin; Reeves, Emer P; Neville, Claire M; Winkler, Robert; Gebhardt, Peter; Kavanagh, Kevin; Doyle, Sean
2005-07-01
Three non-ribosomal peptide synthetase genes, termed sidD, sidC and sidE, have been identified in Aspergillus fumigatus. Gene expression analysis by RT-PCR confirms that expression of both sidD and C was reduced by up to 90% under iron-replete conditions indicative of a likely role in siderophore biosynthesis. SidE expression was less sensitive to iron levels. In addition, two proteins purified from mycelia grown under iron-limiting conditions corresponded to SidD ( approximately 200 kDa) and SidC (496 kDa) as determined by MALDI ToF peptide mass fingerprinting and MALDI LIFT-ToF/ToF. Siderophore synthetases are unique in bacteria and fungi and represent an attractive target for antimicrobial chemotherapy.
Balcik-Ercin, Pelin; Cetin, Metin; Yalim-Camci, Irem; Odabas, Gorkem; Tokay, Nurettin; Sayan, A Emre; Yagci, Tamer
2018-03-07
ZEB2 is a transcriptional repressor that regulates epithelial-to-mesenchymal transition (EMT) through binding to bipartite E-box motifs in gene regulatory regions. Despite the abundant presence of E-boxes within the human genome and the multiplicity of pathophysiological processes regulated during ZEB2-induced EMT, only a small fraction of ZEB2 targets has been identified so far. Hence, we explored genome-wide ZEB2 binding by chromatin immunoprecipitation-sequencing (ChIP-seq) under endogenous ZEB2 expression conditions. For ChIP-Seq we used an anti-ZEB2 monoclonal antibody, clone 6E5, in SNU398 hepatocellular carcinoma cells exhibiting a high endogenous ZEB2 expression. The ChIP-Seq targets were validated using ChIP-qPCR, whereas ZEB2-dependent expression of target genes was assessed by RT-qPCR and Western blotting in shRNA-mediated ZEB2 silenced SNU398 cells and doxycycline-induced ZEB2 overexpressing colorectal carcinoma DLD1 cells. Changes in target gene expression were also assessed using primary human tumor cDNA arrays in conjunction with RT-qPCR. Additional differential expression and correlation analyses were performed using expO and Human Protein Atlas datasets. Over 500 ChIP-Seq positive genes were annotated, and intervals related to these genes were found to include the ZEB2 binding motif CACCTG according to TOMTOM motif analysis in the MEME Suite database. Assessment of ZEB2-dependent expression of target genes in ZEB2-silenced SNU398 cells and ZEB2-induced DLD1 cells revealed that the GALNT3 gene serves as a ZEB2 target with the highest, but inversely correlated, expression level. Remarkably, GALNT3 also exhibited the highest enrichment in the ChIP-qPCR validation assays. Through the analyses of primary tumor cDNA arrays and expO datasets a significant differential expression and a significant inverse correlation between ZEB2 and GALNT3 expression were detected in most of the tumors. We also explored ZEB2 and GALNT3 protein expression using the Human Protein Atlas dataset and, again, observed an inverse correlation in all analyzed tumor types, except malignant melanoma. In contrast to a generally negative or weak ZEB2 expression, we found that most tumor tissues exhibited a strong or moderate GALNT3 expression. Our observation that ZEB2 negatively regulates a GalNAc-transferase (GALNT3) that is involved in O-glycosylation adds another layer of complexity to the role of ZEB2 in cancer progression and metastasis. Proteins glycosylated by GALNT3 may be exploited as novel diagnostics and/or therapeutic targets.
NAT1/DAP5/p97 and Atypical Translational Control in the Drosophila Circadian Oscillator
Bradley, Sean; Narayanan, Siddhartha; Rosbash, Michael
2012-01-01
Circadian rhythms are driven by gene expression feedback loops in metazoans. Based on the success of genetic screens for circadian mutants in Drosophila melanogaster, we undertook a targeted RNAi screen to study the impact of translation control genes on circadian locomotor activity rhythms in flies. Knockdown of vital translation factors in timeless protein-positive circadian neurons caused a range of effects including lethality. Knockdown of the atypical translation factor NAT1 had the strongest effect and lengthened circadian period. It also dramatically reduced PER protein levels in pigment dispersing factor (PDF) neurons. BELLE (BEL) protein was also reduced by the NAT1 knockdown, presumably reflecting a role of NAT1 in belle mRNA translation. belle and NAT1 are also targets of the key circadian transcription factor Clock (CLK). Further evidence for a role of NAT1 is that inhibition of the target of rapamycin (TOR) kinase increased oscillator activity in cultured wings, which is absent under conditions of NAT1 knockdown. Moreover, the per 5′- and 3′-UTRs may function together to facilitate cap-independent translation under conditions of TOR inhibition. We suggest that NAT1 and cap-independent translation are important for per mRNA translation, which is also important for the circadian oscillator. A circadian translation program may be especially important in fly pacemaker cells. PMID:22904033
Considerations for designing chemical screening strategies in plant biology
Serrano, Mario; Kombrink, Erich; Meesters, Christian
2015-01-01
Traditionally, biologists regularly used classical genetic approaches to characterize and dissect plant processes. However, this strategy is often impaired by redundancy, lethality or pleiotropy of gene functions, which prevent the isolation of viable mutants. The chemical genetic approach has been recognized as an alternative experimental strategy, which has the potential to circumvent these problems. It relies on the capacity of small molecules to modify biological processes by specific binding to protein target(s), thereby conditionally modifying protein function(s), which phenotypically resemble mutation(s) of the encoding gene(s). A successful chemical screening campaign comprises three equally important elements: (1) a reliable, robust, and quantitative bioassay, which allows to distinguish between potent and less potent compounds, (2) a rigorous validation process for candidate compounds to establish their selectivity, and (3) an experimental strategy for elucidating a compound's mode of action and molecular target. In this review we will discuss details of this general strategy and additional aspects that deserve consideration in order to take full advantage of the power provided by the chemical approach to plant biology. In addition, we will highlight some success stories of recent chemical screenings in plant systems, which may serve as teaching examples for the implementation of future chemical biology projects. PMID:25904921
A HIF-LIMD1 negative feedback mechanism mitigates the pro-tumorigenic effects of hypoxia.
Foxler, Daniel E; Bridge, Katherine S; Foster, John G; Grevitt, Paul; Curry, Sean; Shah, Kunal M; Davidson, Kathryn M; Nagano, Ai; Gadaleta, Emanuela; Rhys, Hefin I; Kennedy, Paul T; Hermida, Miguel A; Chang, Ting-Yu; Shaw, Peter E; Reynolds, Louise E; McKay, Tristan R; Wang, Hsei-Wei; Ribeiro, Paulo S; Plevin, Michael J; Lagos, Dimitris; Lemoine, Nicholas R; Rajan, Prabhakar; Graham, Trevor A; Chelala, Claude; Hodivala-Dilke, Kairbaan M; Spendlove, Ian; Sharp, Tyson V
2018-06-21
The adaptive cellular response to low oxygen tensions is mediated by the hypoxia-inducible factors (HIFs), a family of heterodimeric transcription factors composed of HIF-α and HIF-β subunits. Prolonged HIF expression is a key contributor to cellular transformation, tumorigenesis and metastasis. As such, HIF degradation under hypoxic conditions is an essential homeostatic and tumour-suppressive mechanism. LIMD1 complexes with PHD2 and VHL in physiological oxygen levels (normoxia) to facilitate proteasomal degradation of the HIF-α subunit. Here, we identify LIMD1 as a HIF-1 target gene, which mediates a previously uncharacterised, negative regulatory feedback mechanism for hypoxic HIF-α degradation by modulating PHD2-LIMD1-VHL complex formation. Hypoxic induction of LIMD1 expression results in increased HIF-α protein degradation, inhibiting HIF-1 target gene expression, tumour growth and vascularisation. Furthermore, we report that copy number variation at the LIMD1 locus occurs in 47.1% of lung adenocarcinoma patients, correlates with enhanced expression of a HIF target gene signature and is a negative prognostic indicator. Taken together, our data open a new field of research into the aetiology, diagnosis and prognosis of LIMD1 -negative lung cancers. © 2018 The Authors. Published under the terms of the CC BY 4.0 license.
Gao, Shan; Hein, San; Dagnæs-Hansen, Frederik; Weyer, Kathrin; Yang, Chuanxu; Nielsen, Rikke; Christensen, Erik I; Fenton, Robert A; Kjems, Jørgen
2014-01-01
RNAi-based strategies provide a great therapeutic potential for treatment of various human diseases including kidney disorders, but face the challenge of in vivo delivery and specific targeting. The chitosan delivery system has previously been shown to target siRNA specifically to the kidneys in mice when administered intravenously. Here we confirm by 2D and 3D bioimaging that chitosan formulated siRNA is retained in the kidney for more than 48 hours where it accumulates in proximal tubule epithelial cells (PTECs), a process that was strongly dependent on the molecular weight of chitosan. Chitosan/siRNA nanoparticles, administered to chimeric mice with conditional knockout of the megalin gene, distributed almost exclusively in cells that expressed megalin, implying that the chitosan/siRNA particle uptake was mediated by a megalin-dependent endocytotic pathway. Knockdown of the water channel aquaporin 1 (AQP1) by up to 50% in PTECs was achieved utilizing the systemic i.v. delivery of chitosan/AQP1 siRNA in mice. In conclusion, specific targeting PTECs with the chitosan nanoparticle system may prove to be a useful strategy for knockdown of specific genes in PTECs, and provides a potential therapeutic strategy for treating various kidney diseases.
Gao, Shan; Hein, San; Dagnæs-Hansen, Frederik; Weyer, Kathrin; Yang, Chuanxu; Nielsen, Rikke; Christensen, Erik I; Fenton, Robert A; Kjems, Jørgen
2014-01-01
RNAi-based strategies provide a great therapeutic potential for treatment of various human diseases including kidney disorders, but face the challenge of in vivo delivery and specific targeting. The chitosan delivery system has previously been shown to target siRNA specifically to the kidneys in mice when administered intravenously. Here we confirm by 2D and 3D bioimaging that chitosan formulated siRNA is retained in the kidney for more than 48 hours where it accumulates in proximal tubule epithelial cells (PTECs), a process that was strongly dependent on the molecular weight of chitosan. Chitosan/siRNA nanoparticles, administered to chimeric mice with conditional knockout of the megalin gene, distributed almost exclusively in cells that expressed megalin, implying that the chitosan/siRNA particle uptake was mediated by a megalin-dependent endocytotic pathway. Knockdown of the water channel aquaporin 1 (AQP1) by up to 50% in PTECs was achieved utilizing the systemic i.v. delivery of chitosan/AQP1 siRNA in mice. In conclusion, specific targeting PTECs with the chitosan nanoparticle system may prove to be a useful strategy for knockdown of specific genes in PTECs, and provides a potential therapeutic strategy for treating various kidney diseases. PMID:25157280
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hsin, I-Lun; Hsiao, Yueh-Chieh; Institute of Medicine, Chung Shan Medical University, Taichung 40201, Taiwan
2012-09-15
Endoplasmic reticulum (ER) stress is activated under severe cellular conditions. GADD153, a member of the C/EBP family, is an unfolded protein response (UPR) responsive transcription factor. Increased levels of lipocalin 2, an acute phase protein, have been found in several epithelial cancers. The aim of this study is to investigate the function of lipocalin 2 in lung cancer cells under ER stress. Treatment with thapsigargin, an ER stress activator, led to increases in cytotoxicity, ER stress, apoptosis, and lipocalin 2 expression in A549 cells. GADD153 silencing decreased lipocalin 2 expression in A549 cells. On chromatin immunoprecipitation assay, ER stress increasedmore » GADD153 DNA binding to lipocalin 2 promoter. Furthermore, silencing of lipocalin 2 mitigated ER stress-mediated apoptosis in A549 cells. Our findings demonstrated that lipocalin 2 is a new GADD153 target gene that mediates ER stress-induced apoptosis. Highlights: ► We demonstrate that Lipocalin 2 is a new GADD153 target gene. ► Lipocalin 2 mediates ER stress-induced apoptosis. ► ER stress-induced lipocalin 2 expression is calcium-independent in A549 cells. ► Lipocalin 2 dose not play a major role in ER stress-induced autophagy.« less
Rodriguez-Cuenca, Sergio; Cochemé, Helena M; Logan, Angela; Abakumova, Irina; Prime, Tracy A; Rose, Claudia; Vidal-Puig, Antonio; Smith, Anthony C; Rubinsztein, David C; Fearnley, Ian M; Jones, Bruce A; Pope, Simon; Heales, Simon J R; Lam, Brian Y H; Neogi, Sudeshna Guha; McFarlane, Ian; James, Andrew M; Smith, Robin A J; Murphy, Michael P
2010-01-01
The mitochondria-targeted quinone MitoQ protects mitochondria in animal studies of pathologies in vivo and is being developed as a therapy for humans. However, it is unclear whether the protective action of MitoQ is entirely due to its antioxidant properties, because long-term MitoQ administration may alter whole-body metabolism and gene expression. To address this point, we administered high levels of MitoQ orally to wild-type C57BL/6 mice for up to 28 weeks and investigated the effects on whole-body physiology, metabolism, and gene expression, finding no measurable deleterious effects. In addition, because antioxidants can act as pro-oxidants under certain conditions in vitro, we examined the effects of MitoQ administration on markers of oxidative damage. There were no changes in the expression of mitochondrial or antioxidant genes as assessed by DNA microarray analysis. There were also no increases in oxidative damage to mitochondrial protein, DNA, or cardiolipin, and the activities of mitochondrial enzymes were unchanged. Therefore, MitoQ does not act as a pro-oxidant in vivo. These findings indicate that mitochondria-targeted antioxidants can be safely administered long-term to wild-type mice. Copyright 2009 Elsevier Inc. All rights reserved.
New and emerging targeted therapies for cystic fibrosis.
Quon, Bradley S; Rowe, Steven M
2016-03-30
Cystic fibrosis (CF) is a monogenic autosomal recessive disorder that affects about 70,000 people worldwide. The clinical manifestations of the disease are caused by defects in the cystic fibrosis transmembrane conductance regulator (CFTR) protein. The discovery of the CFTR gene in 1989 has led to a sophisticated understanding of how thousands of mutations in the CFTR gene affect the structure and function of the CFTR protein. Much progress has been made over the past decade with the development of orally bioavailable small molecule drugs that target defective CFTR proteins caused by specific mutations. Furthermore, there is considerable optimism about the prospect of gene replacement or editing therapies to correct all mutations in cystic fibrosis. The recent approvals of ivacaftor and lumacaftor represent the genesis of a new era of precision medicine in the treatment of this condition. These drugs are having a positive impact on the lives of people with cystic fibrosis and are potentially disease modifying. This review provides an update on advances in our understanding of the structure and function of the CFTR, with a focus on state of the art targeted drugs that are in development. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.
Takeuchi, Yasuto; Inubushi, Masayuki; Jin, Yong-Nan; Murai, Chika; Tsuji, Atsushi B; Hata, Hironobu; Kitagawa, Yoshimasa; Saga, Tsuneo
2014-12-01
HIF-1/HRE pathway is a promising target for the imaging and the treatment of intractable malignancy (HIF-1; hypoxia-inducible factor 1, HRE; hypoxia-responsive element). The purposes of our study are: (1) to assess the gene activation levels resulting from various numbers of HREs under various hypoxic conditions, (2) to evaluate the bidirectional activity of multiple HREs, and (3) to confirm whether multiple HREs can induce gene expression in vivo. Human colon carcinoma HCT116 cells were transiently transfected by the constructs containing a firefly luciferase reporter gene and various numbers (2, 4, 6, 8, 10, and 12) of HREs (nHRE+, nHRE-). The relative luciferase activities were measured under various durations of hypoxia (6, 12, 18, and 24 h), O2 concentrations (1, 2, 4, 8, and 16 %), and various concentrations of deferoxamine mesylate (20, 40, 80, 160, and 320 µg/mL growth medium). The bidirectional gene activation levels by HREs were examined in the constructs (dual-luc-nHREs) containing firefly and Renilla luciferase reporter genes at each side of nHREs. Finally, to test whether the construct containing 12HRE and the NIS reporter gene (12HRE-NIS) can induce gene expression in vivo, SPECT imaging was performed in a mouse xenograft model. (1) gene activation levels by HREs tended to increase with increasing HRE copy number, but a saturation effect was observed in constructs with more than 6 or 8 copies of an HRE, (2) gene activation levels by HREs increased remarkably during 6-12 h of hypoxia, but not beyond 12 h, (3) gene activation levels by HREs decreased with increasing O2 concentrations, but could be detected even under mild hypoxia at 16 % O2, (4) the bidirectionally proportional activity of the HRE was confirmed regardless of the hypoxic severity, and (5) NIS expression driven by 12 tandem copies of an HRE in response to hypoxia could be visualized on in vivo SPECT imaging. The results of this study will help in the understanding and assessment of the activity of multiple HREs under hypoxia and become the basis for hypoxia-targeted imaging and therapy in the future.
Targeted deletion of miR-132/-212 impairs memory and alters the hippocampal transcriptome.
Hansen, Katelin F; Sakamoto, Kensuke; Aten, Sydney; Snider, Kaitlin H; Loeser, Jacob; Hesse, Andrea M; Page, Chloe E; Pelz, Carl; Arthur, J Simon C; Impey, Soren; Obrietan, Karl
2016-02-01
miR-132 and miR-212 are structurally related microRNAs that have been found to exert powerful modulatory effects within the central nervous system (CNS). Notably, these microRNAs are tandomly processed from the same noncoding transcript, and share a common seed sequence: thus it has been difficult to assess the distinct contribution of each microRNA to gene expression within the CNS. Here, we employed a combination of conditional knockout and transgenic mouse models to examine the contribution of the miR-132/-212 gene locus to learning and memory, and then to assess the distinct effects that each microRNA has on hippocampal gene expression. Using a conditional deletion approach, we show that miR-132/-212 double-knockout mice exhibit significant cognitive deficits in spatial memory, recognition memory, and in tests of novel object recognition. Next, we utilized transgenic miR-132 and miR-212 overexpression mouse lines and the miR-132/-212 double-knockout line to explore the distinct effects of these two miRNAs on the transcriptional profile of the hippocampus. Illumina sequencing revealed that miR-132/-212 deletion increased the expression of 1138 genes; Venn analysis showed that 96 of these genes were also downregulated in mice overexpressing miR-132. Of the 58 genes that were decreased in animals overexpressing miR-212, only four of them were also increased in the knockout line. Functional gene ontology analysis of downregulated genes revealed significant enrichment of genes related to synaptic transmission, neuronal proliferation, and morphogenesis, processes known for their roles in learning, and memory formation. These data, coupled with previous studies, firmly establish a role for the miR-132/-212 gene locus as a key regulator of cognitive capacity. Further, although miR-132 and miR-212 share a seed sequence, these data indicate that these miRNAs do not exhibit strongly overlapping mRNA targeting profiles, thus indicating that these two genes may function in a complex, nonredundant manner to shape the transcriptional profile of the CNS. The dysregulation of miR-132/-212 expression could contribute to signaling mechanisms that are involved in an array of cognitive disorders. © 2016 Hansen et al.; Published by Cold Spring Harbor Laboratory Press.
Targeted deletion of miR-132/-212 impairs memory and alters the hippocampal transcriptome
Hansen, Katelin F.; Sakamoto, Kensuke; Aten, Sydney; Snider, Kaitlin H.; Loeser, Jacob; Hesse, Andrea M.; Page, Chloe E.; Pelz, Carl; Arthur, J. Simon C.; Impey, Soren
2016-01-01
miR-132 and miR-212 are structurally related microRNAs that have been found to exert powerful modulatory effects within the central nervous system (CNS). Notably, these microRNAs are tandomly processed from the same noncoding transcript, and share a common seed sequence: thus it has been difficult to assess the distinct contribution of each microRNA to gene expression within the CNS. Here, we employed a combination of conditional knockout and transgenic mouse models to examine the contribution of the miR-132/-212 gene locus to learning and memory, and then to assess the distinct effects that each microRNA has on hippocampal gene expression. Using a conditional deletion approach, we show that miR-132/-212 double-knockout mice exhibit significant cognitive deficits in spatial memory, recognition memory, and in tests of novel object recognition. Next, we utilized transgenic miR-132 and miR-212 overexpression mouse lines and the miR-132/-212 double-knockout line to explore the distinct effects of these two miRNAs on the transcriptional profile of the hippocampus. Illumina sequencing revealed that miR-132/-212 deletion increased the expression of 1138 genes; Venn analysis showed that 96 of these genes were also downregulated in mice overexpressing miR-132. Of the 58 genes that were decreased in animals overexpressing miR-212, only four of them were also increased in the knockout line. Functional gene ontology analysis of downregulated genes revealed significant enrichment of genes related to synaptic transmission, neuronal proliferation, and morphogenesis, processes known for their roles in learning, and memory formation. These data, coupled with previous studies, firmly establish a role for the miR-132/-212 gene locus as a key regulator of cognitive capacity. Further, although miR-132 and miR-212 share a seed sequence, these data indicate that these miRNAs do not exhibit strongly overlapping mRNA targeting profiles, thus indicating that these two genes may function in a complex, nonredundant manner to shape the transcriptional profile of the CNS. The dysregulation of miR-132/-212 expression could contribute to signaling mechanisms that are involved in an array of cognitive disorders. PMID:26773099
Generating gene knockout rats by homologous recombination in embryonic stem cells
Tong, Chang; Huang, Guanyi; Ashton, Charles; Li, Ping; Ying, Qi-Long
2013-01-01
We describe here a detailed protocol for generating gene knockout rats by homologous recombination in embryonic stem (ES) cells. This protocol comprises the following procedures: derivation and expansion of rat ES cells, construction of gene-targeting vectors, generation of gene-targeted rat ES cells and, finally, production of gene-targeted rats. The major differences between this protocol and the classical mouse gene-targeting protocol include ES cell culture methods, drug selection scheme, colony picking and screening strategies. This ES cell–based gene-targeting technique allows sophisticated genetic modifications to be performed in the rat, as many laboratories have been doing in the mouse for the past two decades. Recently we used this protocol to generate Tp53 (also known as p53) gene knockout rats. The entire process requires ~1 year to complete, from derivation of ES cells to generation of knockout rats. PMID:21637202
I-SceI-Induced Gene Replacement at a Natural Locus in Embryonic Stem Cells
Cohen-Tannoudji, Michel; Robine, Sylvie; Choulika, André; Pinto, Daniel; El Marjou, Fatima; Babinet, Charles; Louvard, Daniel; Jaisser, Frédéric
1998-01-01
Gene targeting is a very powerful tool for studying mammalian development and physiology and for creating models of human diseases. In many instances, however, it is desirable to study different modifications of a target gene, but this is limited by the generally low frequency of homologous recombination in mammalian cells. We have developed a novel gene-targeting strategy in mouse embryonic stem cells that is based on the induction of endogenous gap repair processes at a defined location within the genome by induction of a double-strand break (DSB) in the gene to be mutated. This strategy was used to knock in an NH2-ezrin mutant in the villin gene, which encodes an actin-binding protein expressed in the brush border of the intestine and the kidney. To induce the DSB, an I-SceI yeast meganuclease restriction site was first introduced by gene targeting to the villin gene, followed by transient expression of I-SceI. The repair of the ensuing DSB was achieved with high efficiency (6 × 10−6) by a repair shuttle vector sharing only a 2.8-kb region of homology with the villin gene and no negative selection marker. Compared to conventional gene-targeting experiments at the villin locus, this represents a 100-fold stimulation of gene-targeting frequency, notwithstanding a much lower length of homology. This strategy will be very helpful in facilitating the targeted introduction of several types of mutations within a gene of interest. PMID:9488460
Wang, Kui; Kievit, Forrest M; Florczyk, Stephen J; Stephen, Zachary R; Zhang, Miqin
2015-10-12
Cationic nanoparticles (NPs) for targeted gene delivery are conventionally evaluated using 2D in vitro cultures. However, this does not translate well to corresponding in vivo studies because of the marked difference in NP behavior in the presence of the tumor microenvironment. In this study, we investigated whether prostate cancer (PCa) cells cultured in three-dimensional (3D) chitosan-alginate (CA) porous scaffolds could model cationic NP-mediated gene targeted delivery to tumors in vitro. We assessed in vitro tumor cell proliferation, formation of tumor spheroids, and expression of marker genes that promote tumor malignancy in CA scaffolds. The efficacy of NP-targeted gene delivery was evaluated in PCa cells in 2D cultures, PCa tumor spheroids grown in CA scaffolds, and PCa tumors in a mouse TRAMP-C2 flank tumor model. PCa cells cultured in CA scaffolds grew into tumor spheroids and displayed characteristics of higher malignancy as compared to those in 2D cultures. Significantly, targeted gene delivery was only observed in cells cultured in CA scaffolds, whereas cells cultured on 2D plates showed no difference in gene delivery between targeted and nontarget control NPs. In vivo NP evaluation confirmed targeted gene delivery, indicating that only CA scaffolds correctly modeled NP-mediated targeted delivery in vivo. These findings suggest that CA scaffolds serve as a better in vitro platform than 2D cultures for evaluation of NP-mediated targeted gene delivery to PCa.
2012-01-01
Background Development and application of transcriptomics-based gene classifiers for ecotoxicological applications lag far behind those of biomedical sciences. Many such classifiers discovered thus far lack vigorous statistical and experimental validations. A combination of genetic algorithm/support vector machines and genetic algorithm/K nearest neighbors was used in this study to search for classifiers of endocrine-disrupting chemicals (EDCs) in zebrafish. Searches were conducted on both tissue-specific and tissue-combined datasets, either across the entire transcriptome or within individual transcription factor (TF) networks previously linked to EDC effects. Candidate classifiers were evaluated by gene set enrichment analysis (GSEA) on both the original training data and a dedicated validation dataset. Results Multi-tissue dataset yielded no classifiers. Among the 19 chemical-tissue conditions evaluated, the transcriptome-wide searches yielded classifiers for six of them, each having approximately 20 to 30 gene features unique to a condition. Searches within individual TF networks produced classifiers for 15 chemical-tissue conditions, each containing 100 or fewer top-ranked gene features pooled from those of multiple TF networks and also unique to each condition. For the training dataset, 10 out of 11 classifiers successfully identified the gene expression profiles (GEPs) of their targeted chemical-tissue conditions by GSEA. For the validation dataset, classifiers for prochloraz-ovary and flutamide-ovary also correctly identified the GEPs of corresponding conditions while no classifier could predict the GEP from prochloraz-brain. Conclusions The discrepancies in the performance of these classifiers were attributed in part to varying data complexity among the conditions, as measured to some degree by Fisher’s discriminant ratio statistic. This variation in data complexity could likely be compensated by adjusting sample size for individual chemical-tissue conditions, thus suggesting a need for a preliminary survey of transcriptomic responses before launching a full scale classifier discovery effort. Classifier discovery based on individual TF networks could yield more mechanistically-oriented biomarkers. GSEA proved to be a flexible and effective tool for application of gene classifiers but a similar and more refined algorithm, connectivity mapping, should also be explored. The distribution characteristics of classifiers across tissues, chemicals, and TF networks suggested a differential biological impact among the EDCs on zebrafish transcriptome involving some basic cellular functions. PMID:22849515
Gene essentiality, conservation index and co-evolution of genes in cyanobacteria.
Tiruveedula, Gopi Siva Sai; Wangikar, Pramod P
2017-01-01
Cyanobacteria, a group of photosynthetic prokaryotes, dominate the earth with ~ 1015 g wet biomass. Despite diversity in habitats and an ancient origin, cyanobacterial phylum has retained a significant core genome. Cyanobacteria are being explored for direct conversion of solar energy and carbon dioxide into biofuels. For this, efficient cyanobacterial strains will need to be designed via metabolic engineering. This will require identification of target knockouts to channelize the flow of carbon toward the product of interest while minimizing deletions of essential genes. We propose "Gene Conservation Index" (GCI) as a quick measure to predict gene essentiality in cyanobacteria. GCI is based on phylogenetic profile of a gene constructed with a reduced dataset of cyanobacterial genomes. GCI is the percentage of organism clusters in which the query gene is present in the reduced dataset. Of the 750 genes deemed to be essential in the experimental study on S. elongatus PCC 7942, we found 494 to be conserved across the phylum which largely comprise of the essential metabolic pathways. On the contrary, the conserved but non-essential genes broadly comprise of genes required under stress conditions. Exceptions to this rule include genes such as the glycogen synthesis and degradation enzymes, deoxyribose-phosphate aldolase (DERA), glucose-6-phosphate 1-dehydrogenase (zwf) and fructose-1,6-bisphosphatase class1, which are conserved but non-essential. While the essential genes are to be avoided during gene knockout studies as potentially lethal deletions, the non-essential but conserved set of genes could be interesting targets for metabolic engineering. Further, we identify clusters of co-evolving genes (CCG), which provide insights that may be useful in annotation. Principal component analysis (PCA) plots of the CCGs are demonstrated as data visualization tools that are complementary to the conventional heatmaps. Our dataset consists of phylogenetic profiles for 23,643 non-redundant cyanobacterial genes. We believe that the data and the analysis presented here will be a great resource to the scientific community interested in cyanobacteria.
Murali, Reena; John, Philips George; Peter S, David
2015-05-15
The ability of small interfering RNA (siRNA) to do posttranscriptional gene regulation by knocking down targeted genes is an important research topic in functional genomics, biomedical research and in cancer therapeutics. Many tools had been developed to design exogenous siRNA with high experimental inhibition. Even though considerable amount of work has been done in designing exogenous siRNA, design of effective siRNA sequences is still a challenging work because the target mRNAs must be selected such that their corresponding siRNAs are likely to be efficient against that target and unlikely to accidentally silence other transcripts due to sequence similarity. In some cases, siRNAs may tolerate mismatches with the target mRNA, but knockdown of genes other than the intended target could make serious consequences. Hence to design siRNAs, two important concepts must be considered: the ability in knocking down target genes and the off target possibility on any nontarget genes. So before doing gene silencing by siRNAs, it is essential to analyze their off target effects in addition to their inhibition efficacy against a particular target. Only a few methods have been developed by considering both efficacy and off target possibility of siRNA against a gene. In this paper we present a new design of neural network model with whole stacking energy (ΔG) that enables to identify the efficacy and off target effect of siRNAs against target genes. The tool lists all siRNAs against a particular target with their inhibition efficacy and number of matches or sequence similarity with other genes in the database. We could achieve an excellent performance of Pearson Correlation Coefficient (R=0. 74) and Area Under Curve (AUC=0.906) when the threshold of whole stacking energy is ≥-34.6 kcal/mol. To the best of the author's knowledge, this is one of the best score while considering the "combined efficacy and off target possibility" of siRNA for silencing a gene. The proposed model shall be useful for designing exogenous siRNA for therapeutic applications and gene silencing techniques in the area of bioinformatics. The software is developed as a desktop application and available at http://opsid.in/opsid/. Copyright © 2015 Elsevier B.V. All rights reserved.
Zheng, Yu-Tao; Li, Hong-Bo; Lu, Ming-Xing; Du, Yu-Zhou
2014-01-01
Quantitative real time PCR (qRT-PCR) has emerged as a reliable and reproducible technique for studying gene expression analysis. For accurate results, the normalization of data with reference genes is particularly essential. Once the transcriptome sequencing of Frankliniella occidentalis was completed, numerous unigenes were identified and annotated. Unfortunately, there are no studies on the stability of reference genes used in F. occidentalis. In this work, seven candidate reference genes, including actin, 18S rRNA, H3, tubulin, GAPDH, EF-1 and RPL32, were evaluated for their suitability as normalization genes under different experimental conditions using the statistical software programs BestKeeper, geNorm, Normfinder and the comparative ΔCt method. Because the rankings of the reference genes provided by each of the four programs were different, we chose a user-friendly web-based comprehensive tool RefFinder to get the final ranking. The result demonstrated that EF-1 and RPL32 displayed the most stable expression in different developmental stages; RPL32 and GAPDH showed the most stable expression at high temperatures, while 18S and EF-1 exhibited the most stable expression at low temperatures. In this study, we validated the suitable reference genes in F. occidentalis for gene expression profiling under different experimental conditions. The choice of internal standard is very important in the normalization of the target gene expression levels, thus validating and selecting the best genes will help improve the quality of gene expression data of F. occidentalis. What is more, these validated reference genes could serve as the basis for the selection of candidate reference genes in other insects. PMID:25356721
Zheng, Yu-Tao; Li, Hong-Bo; Lu, Ming-Xing; Du, Yu-Zhou
2014-01-01
Quantitative real time PCR (qRT-PCR) has emerged as a reliable and reproducible technique for studying gene expression analysis. For accurate results, the normalization of data with reference genes is particularly essential. Once the transcriptome sequencing of Frankliniella occidentalis was completed, numerous unigenes were identified and annotated. Unfortunately, there are no studies on the stability of reference genes used in F. occidentalis. In this work, seven candidate reference genes, including actin, 18S rRNA, H3, tubulin, GAPDH, EF-1 and RPL32, were evaluated for their suitability as normalization genes under different experimental conditions using the statistical software programs BestKeeper, geNorm, Normfinder and the comparative ΔCt method. Because the rankings of the reference genes provided by each of the four programs were different, we chose a user-friendly web-based comprehensive tool RefFinder to get the final ranking. The result demonstrated that EF-1 and RPL32 displayed the most stable expression in different developmental stages; RPL32 and GAPDH showed the most stable expression at high temperatures, while 18S and EF-1 exhibited the most stable expression at low temperatures. In this study, we validated the suitable reference genes in F. occidentalis for gene expression profiling under different experimental conditions. The choice of internal standard is very important in the normalization of the target gene expression levels, thus validating and selecting the best genes will help improve the quality of gene expression data of F. occidentalis. What is more, these validated reference genes could serve as the basis for the selection of candidate reference genes in other insects.
Functional profiles of orphan membrane transporters in the life cycle of the malaria parasite
Kenthirapalan, Sanketha; Waters, Andrew P.; Matuschewski, Kai; Kooij, Taco W. A.
2016-01-01
Assigning function to orphan membrane transport proteins and prioritizing candidates for detailed biochemical characterization remain fundamental challenges and are particularly important for medically relevant pathogens, such as malaria parasites. Here we present a comprehensive genetic analysis of 35 orphan transport proteins of Plasmodium berghei during its life cycle in mice and Anopheles mosquitoes. Six genes, including four candidate aminophospholipid transporters, are refractory to gene deletion, indicative of essential functions. We generate and phenotypically characterize 29 mutant strains with deletions of individual transporter genes. Whereas seven genes appear to be dispensable under the experimental conditions tested, deletion of any of the 22 other genes leads to specific defects in life cycle progression in vivo and/or host transition. Our study provides growing support for a potential link between heavy metal homeostasis and host switching and reveals potential targets for rational design of new intervention strategies against malaria. PMID:26796412
Underwater Application of Quantitative PCR on an Ocean Mooring
Preston, Christina M.; Harris, Adeline; Ryan, John P.; Roman, Brent; Marin, Roman; Jensen, Scott; Everlove, Cheri; Birch, James; Dzenitis, John M.; Pargett, Douglas; Adachi, Masao; Turk, Kendra; Zehr, Jonathon P.; Scholin, Christopher A.
2011-01-01
The Environmental Sample Processor (ESP) is a device that allows for the underwater, autonomous application of DNA and protein probe array technologies as a means to remotely identify and quantify, in situ, marine microorganisms and substances they produce. Here, we added functionality to the ESP through the development and incorporation of a module capable of solid-phase nucleic acid extraction and quantitative PCR (qPCR). Samples collected by the instrument were homogenized in a chaotropic buffer compatible with direct detection of ribosomal RNA (rRNA) and nucleic acid purification. From a single sample, both an rRNA community profile and select gene abundances were ascertained. To illustrate this functionality, we focused on bacterioplankton commonly found along the central coast of California and that are known to vary in accordance with different oceanic conditions. DNA probe arrays targeting rRNA revealed the presence of 16S rRNA indicative of marine crenarchaea, SAR11 and marine cyanobacteria; in parallel, qPCR was used to detect 16S rRNA genes from the former two groups and the large subunit RuBisCo gene (rbcL) from Synecchococcus. The PCR-enabled ESP was deployed on a coastal mooring in Monterey Bay for 28 days during the spring-summer upwelling season. The distributions of the targeted bacterioplankon groups were as expected, with the exception of an increase in abundance of marine crenarchaea in anomalous nitrate-rich, low-salinity waters. The unexpected co-occurrence demonstrated the utility of the ESP in detecting novel events relative to previously described distributions of particular bacterioplankton groups. The ESP can easily be configured to detect and enumerate genes and gene products from a wide range of organisms. This study demonstrated for the first time that gene abundances could be assessed autonomously, underwater in near real-time and referenced against prevailing chemical, physical and bulk biological conditions. PMID:21829630
Beer, Lucian; Mlitz, Veronika; Gschwandtner, Maria; Berger, Tanja; Narzt, Marie-Sophie; Gruber, Florian; Brunner, Patrick M; Tschachler, Erwin; Mildner, Michael
2015-10-01
Reverse transcription polymerase chain reaction (qRT-PCR) has become a mainstay in many areas of skin research. To enable quantitative analysis, it is necessary to analyse expression of reference genes (RGs) for normalization of target gene expression. The selection of reliable RGs therefore has an important impact on the experimental outcome. In this study, we aimed to identify and validate the best suited RGs for qRT-PCR in human primary keratinocytes (KCs) over a broad range of experimental conditions using the novel bioinformatics tool 'RefGenes', which is based on a manually curated database of published microarray data. Expression of 6 RGs identified by RefGenes software and 12 commonly used RGs were validated by qRT-PCR. We assessed whether these 18 markers fulfilled the requirements for a valid RG by the comprehensive ranking of four bioinformatics tools and the coefficient of variation (CV). In an overall ranking, we found GUSB to be the most stably expressed RG, whereas the expression values of the commonly used RGs, GAPDH and B2M were significantly affected by varying experimental conditions. Our results identify RefGenes as a powerful tool for the identification of valid RGs and suggest GUSB as the most reliable RG for KCs. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Genetic adaptation of the antibacterial human innate immunity network.
Casals, Ferran; Sikora, Martin; Laayouni, Hafid; Montanucci, Ludovica; Muntasell, Aura; Lazarus, Ross; Calafell, Francesc; Awadalla, Philip; Netea, Mihai G; Bertranpetit, Jaume
2011-07-11
Pathogens have represented an important selective force during the adaptation of modern human populations to changing social and other environmental conditions. The evolution of the immune system has therefore been influenced by these pressures. Genomic scans have revealed that immune system is one of the functions enriched with genes under adaptive selection. Here, we describe how the innate immune system has responded to these challenges, through the analysis of resequencing data for 132 innate immunity genes in two human populations. Results are interpreted in the context of the functional and interaction networks defined by these genes. Nucleotide diversity is lower in the adaptors and modulators functional classes, and is negatively correlated with the centrality of the proteins within the interaction network. We also produced a list of candidate genes under positive or balancing selection in each population detected by neutrality tests and showed that some functional classes are preferential targets for selection. We found evidence that the role of each gene in the network conditions the capacity to evolve or their evolvability: genes at the core of the network are more constrained, while adaptation mostly occurred at particular positions at the network edges. Interestingly, the functional classes containing most of the genes with signatures of balancing selection are involved in autoinflammatory and autoimmune diseases, suggesting a counterbalance between the beneficial and deleterious effects of the immune response.
Genetic adaptation of the antibacterial human innate immunity network
2011-01-01
Background Pathogens have represented an important selective force during the adaptation of modern human populations to changing social and other environmental conditions. The evolution of the immune system has therefore been influenced by these pressures. Genomic scans have revealed that immune system is one of the functions enriched with genes under adaptive selection. Results Here, we describe how the innate immune system has responded to these challenges, through the analysis of resequencing data for 132 innate immunity genes in two human populations. Results are interpreted in the context of the functional and interaction networks defined by these genes. Nucleotide diversity is lower in the adaptors and modulators functional classes, and is negatively correlated with the centrality of the proteins within the interaction network. We also produced a list of candidate genes under positive or balancing selection in each population detected by neutrality tests and showed that some functional classes are preferential targets for selection. Conclusions We found evidence that the role of each gene in the network conditions the capacity to evolve or their evolvability: genes at the core of the network are more constrained, while adaptation mostly occurred at particular positions at the network edges. Interestingly, the functional classes containing most of the genes with signatures of balancing selection are involved in autoinflammatory and autoimmune diseases, suggesting a counterbalance between the beneficial and deleterious effects of the immune response. PMID:21745391
Li, Yanan; Zeng, Xiaobo; Zhou, Xuejuan; Li, Youguo
2016-12-04
Lipid transfer protein superfamily is involved in lipid transport and metabolism. This study aimed to construct mutants of three lipid transfer protein encoding genes in Mesorhizobium huakuii 7653R, and to study the phenotypes and function of mutations during symbiosis with Astragalus sinicus. We used bioinformatics to predict structure characteristics and biological functions of lipid transfer proteins, and conducted semi-quantitative and fluorescent quantitative real-time PCR to analyze the expression levels of target genes in free-living and symbiotic conditions. Using pK19mob insertion mutagenesis to construct mutants, we carried out pot plant experiments to observe symbiotic phenotypes. MCHK-5577, MCHK-2172 and MCHK-2779 genes encoding proteins belonged to START/RHO alpha_C/PITP/Bet_v1/CoxG/CalC (SRPBCC) superfamily, involved in lipid transport or metabolism, and were identical to M. loti at 95% level. Gene relative transcription level of the three genes all increased compared to free-living condition. We obtained three mutants. Compared with wild-type 7653R, above-ground biomass of plants and nodulenitrogenase activity induced by the three mutants significantly decreased. Results indicated that lipid transfer protein encoding genes of Mesorhizobium huakuii 7653R may play important roles in symbiotic nitrogen fixation, and the mutations significantly affected the symbiotic phenotypes. The present work provided a basis to study further symbiotic function mechanism associated with lipid transfer proteins from rhizobia.
Huang, Lixing; Hu, Jiao; Su, Yongquan; Qin, Yingxue; Kong, Wendi; Ma, Ying; Xu, Xiaojin; Lin, Mao; Yan, Qingpi
2015-01-01
The capability of Vibrio alginolyticus to adhere to fish mucus is a key virulence factor of the bacteria. Our previous research showed that stress conditions, such as Cu(2+), Pb(2+), Hg(2+), and low pH, can reduce this adhesion ability. Non-coding (nc) RNAs play a crucial role in regulating bacterial gene expression, affecting the bacteria's pathogenicity. To investigate the mechanism(s) underlying the decline in adhesion ability caused by stressors, we combined high-throughput sequencing with computational techniques to detect stressed ncRNA dynamics. These approaches yielded three commonly altered ncRNAs that are predicted to regulate the bacterial chemotaxis pathway, which plays a key role in the adhesion process of bacteria. We hypothesized they play a key role in the adhesion process of V. alginolyticus. In this study, we validated the effects of these three ncRNAs on their predicted target genes and their role in the V. alginolyticus adhesion process with RNA interference (i), quantitative real-time polymerase chain reaction (qPCR), northern blot, capillary assay, and in vitro adhesion assays. The expression of these ncRNAs and their predicted target genes were confirmed by qPCR and northern blot, which reinforced the reliability of the sequencing data and the target prediction. Overexpression of these ncRNAs was capable of reducing the chemotactic and adhesion ability of V. alginolyticus, and the expression levels of their target genes were also significantly reduced. Our results indicated that these three ncRNAs: (1) are able to regulate the bacterial chemotaxis pathway, and (2) play a key role in the adhesion process of V. alginolyticus.
Bi, Yanqi; Pei, Guangsheng; Sun, Tao; Chen, Zixi; Chen, Lei; Zhang, Weiwen
2018-01-01
Microbial small RNAs (sRNAs) play essential roles against many stress conditions in cyanobacteria. However, little is known on their regulatory mechanisms on biofuels tolerance. In our previous sRNA analysis, a trans -encoded sRNA Nc117 was found involved in the tolerance to ethanol and 1-butanol in Synechocystis sp. PCC 6803. However, its functional mechanism is yet to be determined. In this study, functional characterization of sRNA Nc117 was performed. Briefly, the exact length of the trans -encoded sRNA Nc117 was determined to be 102 nucleotides using 3' RACE, and the positive regulation of Nc117 on short chain alcohols tolerance was further confirmed. Then, computational target prediction and transcriptomic analysis were integrated to explore the potential targets of Nc117. A total of 119 up-regulated and 116 down-regulated genes were identified in nc117 overexpression strain compared with the wild type by comparative transcriptomic analysis, among which the upstream regions of five genes were overlapped with those predicted by computational target approach. Based on the phenotype analysis of gene deletion and overexpression strains under short chain alcohols stress, one gene slr0007 encoding D-glycero-alpha-D-manno-heptose 1-phosphate guanylyltransferase was determined as a potential target of Nc117, suggesting that the synthesis of LPS or S-layer glycoprotein may be responsible for the tolerance enhancement. As the first reported trans -encoded sRNA positively regulating biofuels tolerance in cyanobacteria, this study not only provided evidence for a new regulatory mechanism of trans -encoded sRNA in cyanobacteria, but also valuable information for rational construction of high-tolerant cyanobacterial chassis.
Nigam, Deepti; Sawant, Samir V
2013-01-01
Technological development led to an increased interest in systems biological approaches in plants to characterize developmental mechanism and candidate genes relevant to specific tissue or cell morphology. AUX-IAA proteins are important plant-specific putative transcription factors. There are several reports on physiological response of this family in Arabidopsis but in cotton fiber the transcriptional network through which AUX-IAA regulated its target genes is still unknown. in-silico modelling of cotton fiber development specific gene expression data (108 microarrays and 22,737 genes) using Algorithm for the Reconstruction of Accurate Cellular Networks (ARACNe) reveals 3690 putative AUX-IAA target genes of which 139 genes were known to be AUX-IAA co-regulated within Arabidopsis. Further AUX-IAA targeted gene regulatory network (GRN) had substantial impact on the transcriptional dynamics of cotton fiber, as showed by, altered TF networks, and Gene Ontology (GO) biological processes and metabolic pathway associated with its target genes. Analysis of the AUX-IAA-correlated gene network reveals multiple functions for AUX-IAA target genes such as unidimensional cell growth, cellular nitrogen compound metabolic process, nucleosome organization, DNA-protein complex and process related to cell wall. These candidate networks/pathways have a variety of profound impacts on such cellular functions as stress response, cell proliferation, and cell differentiation. While these functions are fairly broad, their underlying TF networks may provide a global view of AUX-IAA regulated gene expression and a GRN that guides future studies in understanding role of AUX-IAA box protein and its targets regulating fiber development. PMID:24497725
Regulation of circadian clock transcriptional output by CLOCK:BMAL1
Trott, Alexandra J.
2018-01-01
The mammalian circadian clock relies on the transcription factor CLOCK:BMAL1 to coordinate the rhythmic expression of 15% of the transcriptome and control the daily regulation of biological functions. The recent characterization of CLOCK:BMAL1 cistrome revealed that although CLOCK:BMAL1 binds synchronously to all of its target genes, its transcriptional output is highly heterogeneous. By performing a meta-analysis of several independent genome-wide datasets, we found that the binding of other transcription factors at CLOCK:BMAL1 enhancers likely contribute to the heterogeneity of CLOCK:BMAL1 transcriptional output. While CLOCK:BMAL1 rhythmic DNA binding promotes rhythmic nucleosome removal, it is not sufficient to generate transcriptionally active enhancers as assessed by H3K27ac signal, RNA Polymerase II recruitment, and eRNA expression. Instead, the transcriptional activity of CLOCK:BMAL1 enhancers appears to rely on the activity of ubiquitously expressed transcription factors, and not tissue-specific transcription factors, recruited at nearby binding sites. The contribution of other transcription factors is exemplified by how fasting, which effects several transcription factors but not CLOCK:BMAL1, either decreases or increases the amplitude of many rhythmically expressed CLOCK:BMAL1 target genes. Together, our analysis suggests that CLOCK:BMAL1 promotes a transcriptionally permissive chromatin landscape that primes its target genes for transcription activation rather than directly activating transcription, and provides a new framework to explain how environmental or pathological conditions can reprogram the rhythmic expression of clock-controlled genes. PMID:29300726
Yin, Yufang; Wang, Qian; Xiao, Li; Wang, Fengjiao; Song, Zhuo; Zhou, Cuilan; Liu, Xuan; Xing, Chungen; He, Nongyue; Li, Kai; Feng, Yan; Zhang, Jia
2018-03-01
In the past decades, significant progresses have been achieved in genetic engineering of nucleases. Among the genetically engineered nucleases, zinc finger nucleases, transcription activator-like (TAL) effector nucleases, and CRIPSPR/Cas9 system form a new field of gene editing. The gene editing efficiency or targeting effect and the off-target effect are the two major determinant factors in evaluating the usefulness of a new enzyme. Engineering strategies in improving these gene editing enzymes, particularly in minimizing their off-target effects, are the focus of this paper. Examples of using these genetically engineered enzymes in genome modification are discussed in order to better understand the requirement of engineering efforts in obtaining more powerful and useful gene editing enzymes. In addition, the identification of naturally existed anti-Cas proteins has been employed in minimizing off-target effects. Considering the future application in human gene therapy, optimization of these well recognized gene editing enzymes and exploration of more novel enzymes are both required. Before people find an ideal gene editing system having virtually no off-target effect, technologies used to screen and identify off-target effects are of importance in clinical trials employing gene therapy.
Identification of potential target genes of ROR-alpha in THP1 and HUVEC cell lines.
Gulec, Cagri; Coban, Neslihan; Ozsait-Selcuk, Bilge; Sirma-Ekmekci, Sema; Yildirim, Ozlem; Erginel-Unaltuna, Nihan
2017-04-01
ROR-alpha is a nuclear receptor, activity of which can be modulated by natural or synthetic ligands. Due to its possible involvement in, and potential therapeutic target for atherosclerosis, we aimed to identify ROR-alpha target genes in monocytic and endothelial cell lines. We performed chromatin immunoprecipitation (ChIP) followed by tiling array (ChIP-on-chip) for ROR-alpha in monocytic cell line THP1 and endothelial cell line HUVEC. Following bioinformatic analysis of the array data, we tested four candidate genes in terms of dependence of their expression level on ligand-mediated ROR-alpha activity, and two of them in terms of promoter occupancy by ROR-alpha. Bioinformatic analyses of ChIP-on-chip data suggested that ROR-alpha binds to genomic regions near the transcription start site (TSS) of more than 3000 genes in THP1 and HUVEC. Potential ROR-alpha target genes in both cell types seem to be involved mainly in membrane receptor activity, signal transduction and ion transport. While SPP1 and IKBKA were shown to be direct target genes of ROR-alpha in THP1 monocytes, inflammation related gene HMOX1 and heat shock protein gene HSPA8 were shown to be potential target genes of ROR-alpha. Our results suggest that ROR-alpha may regulate signaling receptor activity, and transmembrane transport activity through its potential target genes. ROR-alpha seems also to play role in cellular sensitivity to environmental substances like arsenite and chloroprene. Although, the expression analyses have shown that synthetic ROR-alpha ligands can modulate some of potential ROR-alpha target genes, functional significance of ligand-dependent modulation of gene expression needs to be confirmed with further analyses. Copyright © 2017 Elsevier Inc. All rights reserved.
González-Segovia, Eric; Ross-Ibarra, Jeffrey; Simpson, June K.
2017-01-01
Background Gene regulatory variation has been proposed to play an important role in the adaptation of plants to environmental stress. In the central highlands of Mexico, farmer selection has generated a unique group of maize landraces adapted to the challenges of the highland niche. In this study, gene expression in Mexican highland maize and a reference maize breeding line were compared to identify evidence of regulatory variation in stress-related genes. It was hypothesised that local adaptation in Mexican highland maize would be associated with a transcriptional signature observable even under benign conditions. Methods Allele specific expression analysis was performed using the seedling-leaf transcriptome of an F1 individual generated from the cross between the highland adapted Mexican landrace Palomero Toluqueño and the reference line B73, grown under benign conditions. Results were compared with a published dataset describing the transcriptional response of B73 seedlings to cold, heat, salt and UV treatments. Results A total of 2,386 genes were identified to show allele specific expression. Of these, 277 showed an expression difference between Palomero Toluqueño and B73 alleles under benign conditions that anticipated the response of B73 cold, heat, salt and/or UV treatments, and, as such, were considered to display a prior stress response. Prior stress response candidates included genes associated with plant hormone signaling and a number of transcription factors. Construction of a gene co-expression network revealed further signaling and stress-related genes to be among the potential targets of the transcription factors candidates. Discussion Prior activation of responses may represent the best strategy when stresses are severe but predictable. Expression differences observed here between Palomero Toluqueño and B73 alleles indicate the presence of cis-acting regulatory variation linked to stress-related genes in Palomero Toluqueño. Considered alongside gene annotation and population data, allele specific expression analysis of plants grown under benign conditions provides an attractive strategy to identify functional variation potentially linked to local adaptation. PMID:28852597
Differential C3NET reveals disease networks of direct physical interactions
2011-01-01
Background Genes might have different gene interactions in different cell conditions, which might be mapped into different networks. Differential analysis of gene networks allows spotting condition-specific interactions that, for instance, form disease networks if the conditions are a disease, such as cancer, and normal. This could potentially allow developing better and subtly targeted drugs to cure cancer. Differential network analysis with direct physical gene interactions needs to be explored in this endeavour. Results C3NET is a recently introduced information theory based gene network inference algorithm that infers direct physical gene interactions from expression data, which was shown to give consistently higher inference performances over various networks than its competitors. In this paper, we present, DC3net, an approach to employ C3NET in inferring disease networks. We apply DC3net on a synthetic and real prostate cancer datasets, which show promising results. With loose cutoffs, we predicted 18583 interactions from tumor and normal samples in total. Although there are no reference interactions databases for the specific conditions of our samples in the literature, we found verifications for 54 of our predicted direct physical interactions from only four of the biological interaction databases. As an example, we predicted that RAD50 with TRF2 have prostate cancer specific interaction that turned out to be having validation from the literature. It is known that RAD50 complex associates with TRF2 in the S phase of cell cycle, which suggests that this predicted interaction may promote telomere maintenance in tumor cells in order to allow tumor cells to divide indefinitely. Our enrichment analysis suggests that the identified tumor specific gene interactions may be potentially important in driving the growth in prostate cancer. Additionally, we found that the highest connected subnetwork of our predicted tumor specific network is enriched for all proliferation genes, which further suggests that the genes in this network may serve in the process of oncogenesis. Conclusions Our approach reveals disease specific interactions. It may help to make experimental follow-up studies more cost and time efficient by prioritizing disease relevant parts of the global gene network. PMID:21777411
Park, Sang-Je; Kim, Young-Hyun; Lee, Youngjeon; Kim, Kyoung-Min; Kim, Heui-Soo; Lee, Sang-Rae; Kim, Sun-Uk; Kim, Sang-Hyun; Kim, Ji-Su; Jeong, Kang-Jin; Lee, Kyoung-Min; Huh, Jae-Won; Chang, Kyu-Tae
2013-01-01
Reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR) has been widely used to quantify relative gene expression because of the specificity, sensitivity, and accuracy of this technique. In order to obtain reliable gene expression data from RT-qPCR experiments, it is important to utilize optimal reference genes for the normalization of target gene expression under varied experimental conditions. Previously, we developed and validated a novel icv-STZ cynomolgus monkey model for Alzheimer's disease (AD) research. However, in order to enhance the reliability of this disease model, appropriate reference genes must be selected to allow meaningful analysis of the gene expression levels in the icv-STZ cynomolgus monkey brain. In this study, we assessed the expression stability of 9 candidate reference genes in 2 matched-pair brain samples (5 regions) of control cynomolgus monkeys and those who had received intracerebroventricular injection of streptozotocin (icv-STZ). Three well-known analytical programs geNorm, NormFinder, and BestKeeper were used to choose the suitable reference genes from the total sample group, control group, and icv-STZ group. Combination analysis of the 3 different programs clearly indicated that the ideal reference genes are RPS19 and YWHAZ in the total sample group, GAPDH and RPS19 in the control group, and ACTB and GAPDH in the icv-STZ group. Additionally, we validated the normalization accuracy of the most appropriate reference genes (RPS19 and YWHAZ) by comparison with the least stable gene (TBP) using quantification of the APP and MAPT genes in the total sample group. To the best of our knowledge, this research is the first study to identify and validate the appropriate reference genes in cynomolgus monkey brains. These findings provide useful information for future studies involving the expression of target genes in the cynomolgus monkey.
A new type of gene-disruption cassette with a rescue gene for Pichia pastoris.
Shibui, Tatsuro; Hara, Hiroyoshi
2017-09-01
Pichia pastoris has been used for the production of many recombinant proteins, and many useful mutant strains have been created. However, the efficiency of mutant isolation by gene-targeting is usually low and the procedure is difficult for those inexperienced in yeast genetics. In order to overcome these issues, we developed a new gene-disruption system with a rescue gene using an inducible Cre/mutant-loxP system. With only short homology regions, the gene-disruption cassette of the system replaces its target-gene locus containing a mutation with a compensatory rescue gene. As the cassette contains the AOX1 promoter-driven Cre gene, when targeted strains are grown on media containing methanol, the DNA fragment, i.e., the marker, rescue and Cre genes, between the mutant-loxP sequences in the cassette is excised, leaving only the remaining mutant-loxP sequence in the genome, and consequently a target gene-disrupted mutant can be isolated. The system was initially validated on ADE2 gene disruption, where the disruption can easily be detected by color-change of the colonies. Then, the system was applied for knocking-out URA3 and OCH1 genes, reported to be difficult to accomplish by conventional gene-targeting methods. All three gene-disruption cassettes with their rescue genes replaced their target genes, and the Cre/mutant-loxP system worked well to successfully isolate their knock-out mutants. This study identified a new gene-disruption system that could be used to effectively and strategically knock out genes of interest, especially whose deletion is detrimental to growth, without using special strains, e.g., deficient in nonhomologous end-joining, in P. pastoris. © 2017 American Institute of Chemical Engineers Biotechnol. Prog., 33:1201-1208, 2017. © 2017 American Institute of Chemical Engineers.
Gene therapy for ocular diseases meditated by ultrasound and microbubbles (Review)
WAN, CAIFENG; LI, FENGHUA; LI, HONGLI
2015-01-01
The eye is an ideal target organ for gene therapy as it is easily accessible and immune-privileged. With the increasing insight into the underlying molecular mechanisms of ocular diseases, gene therapy has been proposed as an effective approach. Successful gene therapy depends on efficient gene transfer to targeted cells to prove stable and prolonged gene expression with minimal toxicity. At present, the main hindrance regarding the clinical application of gene therapy is not the lack of an ideal gene, but rather the lack of a safe and efficient method to selectively deliver genes to target cells and tissues. Ultrasound-targeted microbubble destruction (UTMD), with the advantages of high safety, repetitive applicability and tissue targeting, has become a potential strategy for gene- and drug delivery. When gene-loaded microbubbles are injected, UTMD is able to enhance the transport of the gene to the targeted cells. High-amplitude oscillations of microbubbles act as cavitation nuclei which can effectively focus ultrasound energy, produce oscillations and disruptions that increase the permeability of the cell membrane and create transient pores in the cell membrane. Thereby, the efficiency of gene therapy can be significantly improved. The UTMD-mediated gene delivery system has been widely used in pre-clinical studies to enhance gene expression in a site-specific manner in a variety of organs. With reasonable application, the effects of sonoporation can be spatially and temporally controlled to improve localized tissue deposition of gene complexes for ocular gene therapy applications. In addition, appropriately powered, focused ultrasound combined with microbubbles can induce a reversible disruption of the blood-retinal barrier with no significant side effects. The present review discusses the current status of gene therapy of ocular diseases as well as studies on gene therapy of ocular diseases meditated by UTMD. PMID:26151686
Core Promoter Functions in the Regulation of Gene Expression of Drosophila Dorsal Target Genes*
Zehavi, Yonathan; Kuznetsov, Olga; Ovadia-Shochat, Avital; Juven-Gershon, Tamar
2014-01-01
Developmental processes are highly dependent on transcriptional regulation by RNA polymerase II. The RNA polymerase II core promoter is the ultimate target of a multitude of transcription factors that control transcription initiation. Core promoters consist of core promoter motifs, e.g. the initiator, TATA box, and the downstream core promoter element (DPE), which confer specific properties to the core promoter. Here, we explored the importance of core promoter functions in the dorsal-ventral developmental gene regulatory network. This network includes multiple genes that are activated by different nuclear concentrations of Dorsal, an NFκB homolog transcription factor, along the dorsal-ventral axis. We show that over two-thirds of Dorsal target genes contain DPE sequence motifs, which is significantly higher than the proportion of DPE-containing promoters in Drosophila genes. We demonstrate that multiple Dorsal target genes are evolutionarily conserved and functionally dependent on the DPE. Furthermore, we have analyzed the activation of key Dorsal target genes by Dorsal, as well as by another Rel family transcription factor, Relish, and the dependence of their activation on the DPE motif. Using hybrid enhancer-promoter constructs in Drosophila cells and embryo extracts, we have demonstrated that the core promoter composition is an important determinant of transcriptional activity of Dorsal target genes. Taken together, our results provide evidence for the importance of core promoter composition in the regulation of Dorsal target genes. PMID:24634215
Luo, Ming; Gilbert, Brian; Ayliffe, Michael
2016-07-01
Mutagenesis continues to play an essential role for understanding plant gene function and, in some instances, provides an opportunity for plant improvement. The development of gene editing technologies such as TALENs and zinc fingers has revolutionised the targeted mutation specificity that can now be achieved. The CRISPR/Cas9 system is the most recent addition to gene editing technologies and arguably the simplest requiring only two components; a small guide RNA molecule (sgRNA) and Cas9 endonuclease protein which complex to recognise and cleave a specific 20 bp target site present in a genome. Target specificity is determined by complementary base pairing between the sgRNA and target site sequence enabling highly specific, targeted mutation to be readily engineered. Upon target site cleavage, error-prone endogenous repair mechanisms produce small insertion/deletions at the target site usually resulting in loss of gene function. CRISPR/Cas9 gene editing has been rapidly adopted in plants and successfully undertaken in numerous species including major crop species. Its applications are not restricted to mutagenesis and target site cleavage can be exploited to promote sequence insertion or replacement by recombination. The multiple applications of this technology in plants are described.
The Transcription Factors Islet and Lim3 Combinatorially Regulate Ion Channel Gene Expression
Wolfram, Verena; Southall, Tony D.; Günay, Cengiz; Prinz, Astrid A.; Brand, Andrea H.
2014-01-01
Expression of appropriate ion channels is essential to allow developing neurons to form functional networks. Our previous studies have identified LIM-homeodomain (HD) transcription factors (TFs), expressed by developing neurons, that are specifically able to regulate ion channel gene expression. In this study, we use the technique of DNA adenine methyltransferase identification (DamID) to identify putative gene targets of four such TFs that are differentially expressed in Drosophila motoneurons. Analysis of targets for Islet (Isl), Lim3, Hb9, and Even-skipped (Eve) identifies both ion channel genes and genes predicted to regulate aspects of dendritic and axonal morphology. Significantly, some ion channel genes are bound by more than one TF, consistent with the possibility of combinatorial regulation. One such gene is Shaker (Sh), which encodes a voltage-dependent fast K+ channel (Kv1.1). DamID reveals that Sh is bound by both Isl and Lim3. We used body wall muscle as a test tissue because in conditions of low Ca2+, the fast K+ current is carried solely by Sh channels (unlike neurons in which a second fast K+ current, Shal, also contributes). Ectopic expression of isl, but not Lim3, is sufficient to reduce both Sh transcript and Sh current level. By contrast, coexpression of both TFs is additive, resulting in a significantly greater reduction in both Sh transcript and current compared with isl expression alone. These observations provide evidence for combinatorial activity of Isl and Lim3 in regulating ion channel gene expression. PMID:24523544
The Genome-Wide Interaction Network of Nutrient Stress Genes in Escherichia coli.
Côté, Jean-Philippe; French, Shawn; Gehrke, Sebastian S; MacNair, Craig R; Mangat, Chand S; Bharat, Amrita; Brown, Eric D
2016-11-22
Conventional efforts to describe essential genes in bacteria have typically emphasized nutrient-rich growth conditions. Of note, however, are the set of genes that become essential when bacteria are grown under nutrient stress. For example, more than 100 genes become indispensable when the model bacterium Escherichia coli is grown on nutrient-limited media, and many of these nutrient stress genes have also been shown to be important for the growth of various bacterial pathogens in vivo To better understand the genetic network that underpins nutrient stress in E. coli, we performed a genome-scale cross of strains harboring deletions in some 82 nutrient stress genes with the entire E. coli gene deletion collection (Keio) to create 315,400 double deletion mutants. An analysis of the growth of the resulting strains on rich microbiological media revealed an average of 23 synthetic sick or lethal genetic interactions for each nutrient stress gene, suggesting that the network defining nutrient stress is surprisingly complex. A vast majority of these interactions involved genes of unknown function or genes of unrelated pathways. The most profound synthetic lethal interactions were between nutrient acquisition and biosynthesis. Further, the interaction map reveals remarkable metabolic robustness in E. coli through pathway redundancies. In all, the genetic interaction network provides a powerful tool to mine and identify missing links in nutrient synthesis and to further characterize genes of unknown function in E. coli Moreover, understanding of bacterial growth under nutrient stress could aid in the development of novel antibiotic discovery platforms. With the rise of antibiotic drug resistance, there is an urgent need for new antibacterial drugs. Here, we studied a group of genes that are essential for the growth of Escherichia coli under nutrient limitation, culture conditions that arguably better represent nutrient availability during an infection than rich microbiological media. Indeed, many such nutrient stress genes are essential for infection in a variety of pathogens. Thus, the respective proteins represent a pool of potential new targets for antibacterial drugs that have been largely unexplored. We have created all possible double deletion mutants through a genetic cross of nutrient stress genes and the E. coli deletion collection. An analysis of the growth of the resulting clones on rich media revealed a robust, dense, and complex network for nutrient acquisition and biosynthesis. Importantly, our data reveal new genetic connections to guide innovative approaches for the development of new antibacterial compounds targeting bacteria under nutrient stress. Copyright © 2016 Côté et al.
Bacteriophage-Derived Vectors for Targeted Cancer Gene Therapy
Pranjol, Md Zahidul Islam; Hajitou, Amin
2015-01-01
Cancer gene therapy expanded and reached its pinnacle in research in the last decade. Both viral and non-viral vectors have entered clinical trials, and significant successes have been achieved. However, a systemic administration of a vector, illustrating safe, efficient, and targeted gene delivery to solid tumors has proven to be a major challenge. In this review, we summarize the current progress and challenges in the targeted gene therapy of cancer. Moreover, we highlight the recent developments of bacteriophage-derived vectors and their contributions in targeting cancer with therapeutic genes following systemic administration. PMID:25606974
Bacteriophage-derived vectors for targeted cancer gene therapy.
Pranjol, Md Zahidul Islam; Hajitou, Amin
2015-01-19
Cancer gene therapy expanded and reached its pinnacle in research in the last decade. Both viral and non-viral vectors have entered clinical trials, and significant successes have been achieved. However, a systemic administration of a vector, illustrating safe, efficient, and targeted gene delivery to solid tumors has proven to be a major challenge. In this review, we summarize the current progress and challenges in the targeted gene therapy of cancer. Moreover, we highlight the recent developments of bacteriophage-derived vectors and their contributions in targeting cancer with therapeutic genes following systemic administration.
Towards β-globin gene-targeting with integrase-defective lentiviral vectors.
Inanlou, Davoud Nouri; Yakhchali, Bagher; Khanahmad, Hossein; Gardaneh, Mossa; Movassagh, Hesam; Cohan, Reza Ahangari; Ardestani, Mehdi Shafiee; Mahdian, Reza; Zeinali, Sirous
2010-11-01
We have developed an integrase-defective lentiviral (LV) vector in combination with a gene-targeting approach for gene therapy of β-thalassemia. The β-globin gene-targeting construct has two homologous stems including sequence upstream and downstream of the β-globin gene, a β-globin gene positioned between hygromycin and neomycin resistant genes and a herpes simplex virus type 1 thymidine kinase (HSVtk) suicide gene. Utilization of integrase-defective LV as a vector for the β-globin gene increased the number of selected clones relative to non-viral methods. This method represents an important step toward the ultimate goal of a clinical gene therapy for β-thalassemia.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Müller, Patrick; Rößler, Jens; Schwarz-Finsterle, Jutta
Recently, advantages concerning targeting specificity of PCR constructed oligonucleotide FISH probes in contrast to established FISH probes, e.g. BAC clones, have been demonstrated. These techniques, however, are still using labelling protocols with DNA denaturing steps applying harsh heat treatment with or without further denaturing chemical agents. COMBO-FISH (COMBinatorial Oligonucleotide FISH) allows the design of specific oligonucleotide probe combinations in silico. Thus, being independent from primer libraries or PCR laboratory conditions, the probe sequences extracted by computer sequence data base search can also be synthesized as single stranded PNA-probes (Peptide Nucleic Acid probes). Gene targets can be specifically labelled with atmore » least about 20 PNA-probes obtaining visibly background free specimens. By using appropriately designed triplex forming oligonucleotides, the denaturing procedures can completely be omitted. These results reveal a significant step towards oligonucleotide-FISH maintaining the 3D-nanostructure and even the viability of the cell target. The method is demonstrated with the detection of Her2/neu and GRB7 genes, which are indicators in breast cancer diagnosis and therapy. - Highlights: • Denaturation free protocols preserve 3D architecture of chromosomes and nuclei. • Labelling sets are determined in silico for duplex and triplex binding. • Probes are produced chemically with freely chosen backbones and base variants. • Peptide nucleic acid backbones reduce hindering charge interactions. • Intercalating side chains stabilize binding of short oligonucleotides.« less
Mumbach, Maxwell R; Satpathy, Ansuman T; Boyle, Evan A; Dai, Chao; Gowen, Benjamin G; Cho, Seung Woo; Nguyen, Michelle L; Rubin, Adam J; Granja, Jeffrey M; Kazane, Katelynn R; Wei, Yuning; Nguyen, Trieu; Greenside, Peyton G; Corces, M Ryan; Tycko, Josh; Simeonov, Dimitre R; Suliman, Nabeela; Li, Rui; Xu, Jin; Flynn, Ryan A; Kundaje, Anshul; Khavari, Paul A; Marson, Alexander; Corn, Jacob E; Quertermous, Thomas; Greenleaf, William J; Chang, Howard Y
2018-01-01
The challenge of linking intergenic mutations to target genes has limited molecular understanding of human diseases. Here we show that H3K27ac HiChIP generates high-resolution contact maps of active enhancers and target genes in rare primary human T cell subtypes and coronary artery smooth muscle cells. Differentiation of naive T cells into T helper 17 cells or regulatory T cells creates subtype-specific enhancer–promoter interactions, specifically at regions of shared DNA accessibility. These data provide a principled means of assigning molecular functions to autoimmune and cardiovascular disease risk variants, linking hundreds of noncoding variants to putative gene targets. Target genes identified with HiChIP are further supported by CRISPR interference and activation at linked enhancers, by the presence of expression quantitative trait loci, and by allele-specific enhancer loops in patient-derived primary cells. The majority of disease-associated enhancers contact genes beyond the nearest gene in the linear genome, leading to a fourfold increase in the number of potential target genes for autoimmune and cardiovascular diseases. PMID:28945252
Zhao, Qing-Qing; Hu, Yu-Lan; Zhou, Yang; Li, Ni; Han, Min; Tang, Gu-Ping; Qiu, Feng; Tabata, Yasuhiko; Gao, Jian-Qing
2012-01-01
The success of gene transfection is largely dependent on the development of a vehicle or vector that can efficiently deliver a gene to cells with minimal toxicity. A liver cancer-targeted specific peptide (FQHPSF sequence) was successfully synthesized and linked with chitosan-linked polyethylenimine (CP) to form a new targeted gene delivery vector called CPT (CP/peptide). The structure of CPT was confirmed by (1)H nuclear magnetic resonance spectroscopy and ultraviolet spectrophotometry. The particle size of CPT/ DNA complexes was measured using laser diffraction spectrometry and the cytotoxicity of the copolymer was evaluated by methylthiazol tetrazolium method. The transfection efficiency evaluation of the CP copolymer was performed using luciferase activity assay. Cellular internalization of the CP/DNA complex was observed under confocal laser scanning microscopy. The targeting specificity of the polymer coupled to peptide was measured by competitive inhibition transfection study. The liver targeting specificity of the CPT copolymer in vivo was demonstrated by combining the copolymer with a therapeutic gene, interleukin-12, and assessed by its abilities in suppressing the growth of ascites tumor in mouse model. The results showed that the liver cancer-targeted specific peptide was successfully synthesized and linked with CP to form a new targeted gene delivery vector called CPT. The composition of CPT was confirmed and the vector showed low cytotoxicity and strong targeting specificity to liver tumors in vitro. The in vivo study results showed that interleukin-12 delivered by the new gene vector CPT/DNA significantly enhanced the antitumor effect on ascites tumor-bearing imprinting control region mice as compared with polyethylenimine (25 kDa), CP, and other controls, which further demonstrate the targeting specificity of the new synthesized polymer. The synthesized CPT copolymer was proven to be an effective liver cancer-targeted vector for therapeutic gene delivery, which could be a potential candidate for targeted cancer gene therapy.
Chondrodysplasia with multiple dislocations: comprehensive study of a series of 30 cases.
Ranza, E; Huber, C; Levin, N; Baujat, G; Bole-Feysot, C; Nitschke, P; Masson, C; Alanay, Y; Al-Gazali, L; Bitoun, P; Boute, O; Campeau, P; Coubes, C; McEntagart, M; Elcioglu, N; Faivre, L; Gezdirici, A; Johnson, D; Mihci, E; Nur, B G; Perrin, L; Quelin, C; Terhal, P; Tuysuz, B; Cormier-Daire, V
2017-06-01
The group of chondrodysplasia with multiple dislocations includes several entities, characterized by short stature, dislocation of large joints, hand and/or vertebral anomalies. Other features, such as epiphyseal or metaphyseal changes, cleft palate, intellectual disability are also often part of the phenotype. In addition, several conditions with overlapping features are related to this group and broaden the spectrum. The majority of these disorders have been linked to pathogenic variants in genes encoding proteins implicated in the synthesis or sulfation of proteoglycans (PG). In a series of 30 patients with multiple dislocations, we have performed exome sequencing and subsequent targeted analysis of 15 genes, implicated in chondrodysplasia with multiple dislocations, and related conditions. We have identified causative pathogenic variants in 60% of patients (18/30); when a clinical diagnosis was suspected, this was molecularly confirmed in 53% of cases. Forty percent of patients remain without molecular etiology. Pathogenic variants in genes implicated in PG synthesis are of major importance in chondrodysplasia with multiple dislocations and related conditions. The combination of hand features, growth failure severity, radiological aspects of long bones and of vertebrae allowed discrimination among the different conditions. We propose key diagnostic clues to the clinician. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Identification of neuronal target genes for CCAAT/Enhancer Binding Proteins
Kfoury, N.; Kapatos, G.
2009-01-01
CCAAT/Enhancer Binding Proteins (C/EBPs) play pivotal roles in development and plasticity of the nervous system. Identification of the physiological targets of C/EBPs (C/EBP target genes) should therefore provide insight into the underlying biology of these processes. We used unbiased genome-wide mapping to identify 115 C/EBPβ target genes in PC12 cells that include transcription factors, neurotransmitter receptors, ion channels, protein kinases and synaptic vesicle proteins. C/EBPβ binding sites were located primarily within introns, suggesting novel regulatory functions, and were associated with binding sites for other developmentally important transcription factors. Experiments using dominant negatives showed C/EBPβ to repress transcription of a subset of target genes. Target genes in rat brain were subsequently found to preferentially bind C/EBPα, β and δ. Analysis of the hippocampal transcriptome of C/EBPβ knockout mice revealed dysregulation of a high percentage of transcripts identified as C/EBP target genes. These results support the hypothesis that C/EBPs play non-redundant roles in the brain. PMID:19103292
miRNAs mediate SnRK1-dependent energy signaling in Arabidopsis
Confraria, Ana; Martinho, Cláudia; Elias, Alexandre; Rubio-Somoza, Ignacio; Baena-González, Elena
2013-01-01
The SnRK1 protein kinase, the plant ortholog of mammalian AMPK and yeast Snf1, is activated by the energy depletion caused by adverse environmental conditions. Upon activation, SnRK1 triggers extensive transcriptional changes to restore homeostasis and promote stress tolerance and survival partly through the inhibition of anabolism and the activation of catabolism. Despite the identification of a few bZIP transcription factors as downstream effectors, the mechanisms underlying gene regulation, and in particular gene repression by SnRK1, remain mostly unknown. microRNAs (miRNAs) are 20–24 nt RNAs that regulate gene expression post-transcriptionally by driving the cleavage and/or translation attenuation of complementary mRNA targets. In addition to their role in plant development, mounting evidence implicates miRNAs in the response to environmental stress. Given the involvement of miRNAs in stress responses and the fact that some of the SnRK1-regulated genes are miRNA targets, we postulated that miRNAs drive part of the transcriptional reprogramming triggered by SnRK1. By comparing the transcriptional response to energy deprivation between WT and dcl1-9, a mutant deficient in miRNA biogenesis, we identified 831 starvation genes misregulated in the dcl1-9 mutant, out of which 155 are validated or predicted miRNA targets. Functional clustering analysis revealed that the main cellular processes potentially co-regulated by SnRK1 and miRNAs are translation and organelle function and uncover TCP transcription factors as one of the most highly enriched functional clusters. TCP repression during energy deprivation was impaired in miR319 knockdown (MIM319) plants, demonstrating the involvement of miR319 in the stress-dependent regulation of TCPs. Altogether, our data indicates that miRNAs are components of the SnRK1 signaling cascade contributing to the regulation of specific mRNA targets and possibly tuning down particular cellular processes during the stress response. PMID:23802004
Stabilization of Foxp3 expression by CRISPR-dCas9-based epigenome editing in mouse primary T cells.
Okada, Masahiro; Kanamori, Mitsuhiro; Someya, Kazue; Nakatsukasa, Hiroko; Yoshimura, Akihiko
2017-01-01
Epigenome editing is expected to manipulate transcription and cell fates and to elucidate the gene expression mechanisms in various cell types. For functional epigenome editing, assessing the chromatin context-dependent activity of artificial epigenetic modifier is required. In this study, we applied clustered regularly interspaced short palindromic repeats (CRISPR)-dCas9-based epigenome editing to mouse primary T cells, focusing on the Forkhead box P3 (Foxp3) gene locus, a master transcription factor of regulatory T cells (Tregs). The Foxp3 gene locus is regulated by combinatorial epigenetic modifications, which determine the Foxp3 expression. Foxp3 expression is unstable in transforming growth factor beta (TGF-β)-induced Tregs (iTregs), while stable in thymus-derived Tregs (tTregs). To stabilize Foxp3 expression in iTregs, we introduced dCas9-TET1CD (dCas9 fused to the catalytic domain (CD) of ten-eleven translocation dioxygenase 1 (TET1), methylcytosine dioxygenase) and dCas9-p300CD (dCas9 fused to the CD of p300, histone acetyltransferase) with guide RNAs (gRNAs) targeted to the Foxp3 gene locus. Although dCas9-TET1CD induced partial demethylation in enhancer region called conserved non-coding DNA sequences 2 (CNS2), robust Foxp3 stabilization was not observed. In contrast, dCas9-p300CD targeted to the promoter locus partly maintained Foxp3 transcription in cultured and primary T cells even under inflammatory conditions in vitro. Furthermore, dCas9-p300CD promoted expression of Treg signature genes and enhanced suppression activity in vitro. Our results showed that artificial epigenome editing modified the epigenetic status and gene expression of the targeted loci, and engineered cellular functions in conjunction with endogenous epigenetic modification, suggesting effective usage of these technologies, which help elucidate the relationship between chromatin states and gene expression.
Anticipated classes of new medications and molecular targets for pulmonary arterial hypertension
Morrell, Nicholas W.; Archer, Stephen L.; DeFelice, Albert; Evans, Steven; Fiszman, Monica; Martin, Thomas; Saulnier, Muriel; Rabinovitch, Marlene; Schermuly, Ralph; Stewart, Duncan; Truebel, Hubert; Walker, Gennyne; Stenmark, Kurt R.
2013-01-01
Pulmonary arterial hypertension (PAH) remains a life-limiting condition with a major impact on the ability to lead a normal life. Although existing therapies may improve the outlook in some patients there remains a major unmet need to develop more effective therapies in this condition. There have been significant advances in our understanding of the genetic, cell and molecular basis of PAH over the last few years. This research has identified important new targets that could be explored as potential therapies for PAH. In this review we discuss whether further exploitation of vasoactive agents could bring additional benefits over existing approaches. Approaches to enhance smooth muscle cell apotosis and the potential of receptor tyrosine kinase inhibition are summarised. We evaluate the role of inflammation, epigenetic changes and altered glycolytic metabolism as potential targets for therapy, and whether inherited genetic mutations in PAH have revealed druggable targets. The potential of cell based therapies and gene therapy are also discussed. Potential candidate pathways that could be explored in the context of experimental medicine are identified. PMID:23662201
Chatterjee, Anirban; Singh, Nidhi; Saluja, Mini
2013-01-01
GENES are made of DNA - the code of life. They are made up of two types of base pair from different number of hydrogen bonds AT, GC which can be turned into instruction. Everyone inherits genes from their parents and passes them on in turn to their children. Every person's genes are different, and the changes in sequence determine the inherited differences between each of us. Some changes, usually in a single gene, may cause serious diseases. Gene therapy is ‘the use of genes as medicine’. It involves the transfer of a therapeutic or working gene copy into specific cells of an individual in order to repair a faulty gene copy. Thus it may be used to replace a faulty gene, or to introduce a new gene whose function is to cure or to favorably modify the clinical course of a condition. It has a promising era in the field of periodontics. Gene therapy has been used as a mode of tissue engineering in periodontics. The tissue engineering approach reconstructs the natural target tissue by combining four elements namely: Scaffold, signaling molecules, cells and blood supply and thus can help in the reconstruction of damaged periodontium including cementum, gingival, periodontal ligament and bone. PMID:23869119
Chatterjee, Anirban; Singh, Nidhi; Saluja, Mini
2013-03-01
GENES are made of DNA - the code of life. They are made up of two types of base pair from different number of hydrogen bonds AT, GC which can be turned into instruction. Everyone inherits genes from their parents and passes them on in turn to their children. Every person's genes are different, and the changes in sequence determine the inherited differences between each of us. Some changes, usually in a single gene, may cause serious diseases. Gene therapy is 'the use of genes as medicine'. It involves the transfer of a therapeutic or working gene copy into specific cells of an individual in order to repair a faulty gene copy. Thus it may be used to replace a faulty gene, or to introduce a new gene whose function is to cure or to favorably modify the clinical course of a condition. It has a promising era in the field of periodontics. Gene therapy has been used as a mode of tissue engineering in periodontics. The tissue engineering approach reconstructs the natural target tissue by combining four elements namely: Scaffold, signaling molecules, cells and blood supply and thus can help in the reconstruction of damaged periodontium including cementum, gingival, periodontal ligament and bone.
Towards the production of salt-tolerant crops.
Barkla, B J; Vera-Estrella, R; Pantoja, O
1999-01-01
Crop production is affected by numerous environmental factors, with soil salinity and drought having the most detrimental effects. Attempts to improve yield under stress conditions by plant breeding have been unsuccessful, primarily due to the multigenic origin of the adaptive responses. The transfer of genes through genetic engineering of crop plants appears more feasible. Important adaptive mechanisms targeted for potential gene transfer would be the tonoplast Na+/H+ antiport, compatible solute synthesis and, regulation of water channel activity and expression, mechanisms involved in cellular osmoregulation. In this review we discuss recent advances in our understanding of these adaptive mechanisms.
Kleptoplast Regulation by an Antarctic Dinoflagellate
NASA Astrophysics Data System (ADS)
Gast, R. J.; Hehenberger, E.; Keeling, P.
2016-02-01
We are studying the evolutionary history and expression of plastid- targeted genes in an Antarctic dinoflagellate that steals chloroplasts from the haptophyte, Phaeocystis. Our project seeks to determine whether the kleptoplastidic dinoflagellate utilizes ancestral plastid proteins to regulate its stolen plastid, and how their transcription is related to environmental factors that are relevant to the Southern Ocean environment (temperature and light). To accomplish our goals, we have utilized high throughput transciptome analysis and RNA-Seq experiments of the dinoflagellate and Phaeocystis. Analysis of the dinoflagellate transcriptome has revealed complete mevalonic acid-independent and heme plastid-associated pathways as well as petF and petH transcripts with peridinin-plastid targeting sequences. In contrast, the proteins psaE, petJ, petC show similarity to non-Phaeocystis haptophyte homologs in their respective trees, and potentially carry haptophyte transit peptides. Anaylsis of RNA-Seq temperature and light experiments for the dinoflagellate indicate that there are significant differences in gene expression under the different environmental conditions, and we are in the process of identifying the genes associated with these changes. This work will help us to understand the environmental success of this alternative nutritional strategy.
MiR-980 is a memory suppressor microRNA that regulates the autism-susceptibility gene, A2bp1
Guven-Ozkan, Tugba; Busto, Germain U.; Schutte, Soleil S.; Cervantes-Sandoval, Isaac; O’Dowd, Diane K.; Davis, Ronald L.
2016-01-01
SUMMARY MicroRNAs have been associated with many different biological functions but little is known about their roles in conditioned behavior. We demonstrate that Drosophila miR-980 is a memory suppressor gene functioning in multiple regions of the adult brain. Memory acquisition and stability were both increased by miR-980 inhibition. Whole cell recordings and functional imaging experiments indicated that miR-980 regulates neuronal excitability. We identified the autism susceptibility gene, A2bp1, as an mRNA target for miR-980. A2bp1 levels varied inversely with miR-980 expression; memory performance was directly related to A2bp1 levels. In addition, A2bp1 knockdown reversed the memory gains produced by miR-980 inhibition, consistent with A2bp1 being a downstream target of miR-980 responsible for the memory phenotypes. Our results indicate that miR-980 represses A2bp1 expression to tune the excitable state of neurons, and the overall state of excitability translates to memory impairment or improvement. PMID:26876166
Acerbi, Enzo; Viganò, Elena; Poidinger, Michael; Mortellaro, Alessandra; Zelante, Teresa; Stella, Fabio
2016-01-01
T helper 17 (TH17) cells represent a pivotal adaptive cell subset involved in multiple immune disorders in mammalian species. Deciphering the molecular interactions regulating TH17 cell differentiation is particularly critical for novel drug target discovery designed to control maladaptive inflammatory conditions. Using continuous time Bayesian networks over a time-course gene expression dataset, we inferred the global regulatory network controlling TH17 differentiation. From the network, we identified the Prdm1 gene encoding the B lymphocyte-induced maturation protein 1 as a crucial negative regulator of human TH17 cell differentiation. The results have been validated by perturbing Prdm1 expression on freshly isolated CD4+ naïve T cells: reduction of Prdm1 expression leads to augmentation of IL-17 release. These data unravel a possible novel target to control TH17 polarization in inflammatory disorders. Furthermore, this study represents the first in vitro validation of continuous time Bayesian networks as gene network reconstruction method and as hypothesis generation tool for wet-lab biological experiments. PMID:26976045
Wells, Julie; Rivera, Miguel N; Kim, Woo Jae; Starbuck, Kristen; Haber, Daniel A
2010-07-01
WT1 encodes a tumor suppressor first identified by its inactivation in Wilms' Tumor. Although one WT1 splicing variant encodes a well-characterized zinc finger transcription factor, little is known about the function of the most prevalent WT1 isoform, whose DNA binding domain is disrupted by a three-amino acid (KTS) insertion. Using cells that conditionally express WT1(+KTS), we undertook a genome-wide chromatin immunoprecipitation and cloning analysis to identify candidate WT1(+KTS)-regulated promoters. We identified the planar cell polarity gene Scribble (SCRB) as the first WT1(+KTS) target gene in podocytes of the kidney. WT1 and SCRB expression patterns overlap precisely in developing renal glomeruli of mice, and WT1(+KTS) binds to a 33-nucleotide region within the Scribble promoter in mouse and human cell lines and kidneys. Together, our results support a role for the predominant WT1(+KTS) isoform in transcriptional regulation and suggest a link between the WT1-dependent tumor suppressor pathway and a key component of the planar cell polarity pathway.
Li, Fengqin; Xu, Yanmei; Yu, Xiang; Yu, Zhigang; He, Xunjun; Ji, Hongrui; Dong, Jinghao; Song, Yongbin; Yan, Hong; Zhang, Guiling
2016-08-15
One "signal on" electrochemical sensing strategy was constructed for the detection of a specific hepatitis B virus (HBV) gene sequence based on the protection-displacement-hybridization-based (PDHB) signaling mechanism. This sensing system is composed of three probes, one capturing probe (CP) and one assistant probe (AP) which are co-immobilized on the Au electrode surface, and one 3-methylene blue (MB) modified signaling probe (SP) free in the detection solution. One duplex are formed between AP and SP with the target, a specific HBV gene sequence, hybridizing with CP. This structure can drive the MB labels close to the electrode surface, thereby producing a large detection current. Two electrochemical testing techniques, alternating current voltammetry (ACV) and cyclic voltammetry (CV), were used for characterizing the sensor. Under the optimized conditions, the proposed sensor exhibits a high sensitivity with the detection limit of ∼5fM for the target. When used for the discrimination of point mutation, the sensor also features an outstanding ability and its peculiar high adjustability. Copyright © 2016 Elsevier B.V. All rights reserved.
Zhang, Hui; Zhang, Jinshan; Wei, Pengliang; Zhang, Botao; Gou, Feng; Feng, Zhengyan; Mao, Yanfei; Yang, Lan; Zhang, Heng; Xu, Nanfei; Zhu, Jian-Kang
2014-08-01
The CRISPR/Cas9 system has been demonstrated to efficiently induce targeted gene editing in a variety of organisms including plants. Recent work showed that CRISPR/Cas9-induced gene mutations in Arabidopsis were mostly somatic mutations in the early generation, although some mutations could be stably inherited in later generations. However, it remains unclear whether this system will work similarly in crops such as rice. In this study, we tested in two rice subspecies 11 target genes for their amenability to CRISPR/Cas9-induced editing and determined the patterns, specificity and heritability of the gene modifications. Analysis of the genotypes and frequency of edited genes in the first generation of transformed plants (T0) showed that the CRISPR/Cas9 system was highly efficient in rice, with target genes edited in nearly half of the transformed embryogenic cells before their first cell division. Homozygotes of edited target genes were readily found in T0 plants. The gene mutations were passed to the next generation (T1) following classic Mendelian law, without any detectable new mutation or reversion. Even with extensive searches including whole genome resequencing, we could not find any evidence of large-scale off-targeting in rice for any of the many targets tested in this study. By specifically sequencing the putative off-target sites of a large number of T0 plants, low-frequency mutations were found in only one off-target site where the sequence had 1-bp difference from the intended target. Overall, the data in this study point to the CRISPR/Cas9 system being a powerful tool in crop genome engineering. © 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.
Tripathi, Prateek; Rabara, Roel C; Reese, R Neil; Miller, Marissa A; Rohila, Jai S; Subramanian, Senthil; Shen, Qingxi J; Morandi, Dominique; Bücking, Heike; Shulaev, Vladimir; Rushton, Paul J
2016-02-09
The purpose of this project was to identify metabolites, proteins, genes, and promoters associated with water stress responses in soybean. A number of these may serve as new targets for the biotechnological improvement of drought responses in soybean (Glycine max). We identified metabolites, proteins, and genes that are strongly up or down regulated during rapid water stress following removal from a hydroponics system. 163 metabolites showed significant changes during water stress in roots and 93 in leaves. The largest change was a root-specific 160-fold increase in the coumestan coumestrol making it a potential biomarker for drought and a promising target for improving drought responses. Previous reports suggest that coumestrol stimulates mycorrhizal colonization and under certain conditions mycorrhizal plants have improved drought tolerance. This suggests that coumestrol may be part of a call for help to the rhizobiome during stress. About 3,000 genes were strongly up-regulated by drought and we identified regulators such as ERF, MYB, NAC, bHLH, and WRKY transcription factors, receptor-like kinases, and calcium signaling components as potential targets for soybean improvement as well as the jasmonate and abscisic acid biosynthetic genes JMT, LOX1, and ABA1. Drought stressed soybean leaves show reduced mRNA levels of stomatal development genes including FAMA-like, MUTE-like and SPEECHLESS-like bHLH transcription factors and leaves formed after drought stress had a reduction in stomatal density of 22.34 % and stomatal index of 17.56 %. This suggests that reducing stomatal density may improve drought tolerance. MEME analyses suggest that ABRE (CACGT/CG), CRT/DRE (CCGAC) and a novel GTGCnTGC/G element play roles in transcriptional activation and these could form components of synthetic promoters to drive expression of transgenes. Using transformed hairy roots, we validated the increase in promoter activity of GmWRKY17 and GmWRKY67 during dehydration and after 20 μM ABA treatment. Our toolbox provides new targets and strategies for improving soybean drought tolerance and includes the coumestan coumestrol, transcription factors that regulate stomatal density, water stress-responsive WRKY gene promoters and a novel DNA element that appears to be enriched in water stress responsive promoters.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Andersen, G.L.; He, Z.; DeSantis, T.Z.
Microarrays have proven to be a useful and high-throughput method to provide targeted DNA sequence information for up to many thousands of specific genetic regions in a single test. A microarray consists of multiple DNA oligonucleotide probes that, under high stringency conditions, hybridize only to specific complementary nucleic acid sequences (targets). A fluorescent signal indicates the presence and, in many cases, the abundance of genetic regions of interest. In this chapter we will look at how microarrays are used in microbial ecology, especially with the recent increase in microbial community DNA sequence data. Of particular interest to microbial ecologists, phylogeneticmore » microarrays are used for the analysis of phylotypes in a community and functional gene arrays are used for the analysis of functional genes, and, by inference, phylotypes in environmental samples. A phylogenetic microarray that has been developed by the Andersen laboratory, the PhyloChip, will be discussed as an example of a microarray that targets the known diversity within the 16S rRNA gene to determine microbial community composition. Using multiple, confirmatory probes to increase the confidence of detection and a mismatch probe for every perfect match probe to minimize the effect of cross-hybridization by non-target regions, the PhyloChip is able to simultaneously identify any of thousands of taxa present in an environmental sample. The PhyloChip is shown to reveal greater diversity within a community than rRNA gene sequencing due to the placement of the entire gene product on the microarray compared with the analysis of up to thousands of individual molecules by traditional sequencing methods. A functional gene array that has been developed by the Zhou laboratory, the GeoChip, will be discussed as an example of a microarray that dynamically identifies functional activities of multiple members within a community. The recent version of GeoChip contains more than 24,000 50mer oligonucleotide probes and covers more than 10,000 gene sequences in 150 gene categories involved in carbon, nitrogen, sulfur, and phosphorus cycling, metal resistance and reduction, and organic contaminant degradation. GeoChip can be used as a generic tool for microbial community analysis, and also link microbial community structure to ecosystem functioning. Examples of the application of both arrays in different environmental samples will be described in the two subsequent sections.« less
Rahman, Md Mahfujur; Ali, Md Eaqub; Hamid, Sharifah Bee Abd; Mustafa, Shuhaimi; Hashim, Uda; Hanapi, Ummi Kalthum
2014-08-01
A polymerase chain reaction (PCR) assay for the assessment of dog meat adulteration in meatballs was developed. The assay selectively amplified a 100-bp region of canine mitochondrial cytochrome b gene from pure, raw, processed and mixed backgrounds. The specificity of the assay was tested against 11 animals and 3 plants species, commonly available for meatball formulation. The stability of the assay was proven under extensively autoclaving conditions that breakdown target DNA. A blind test from ready to eat chicken and beef meatballs showed that the assay can repeatedly detect 0.2% canine meat tissues under complex matrices using 0.04 ng of dog DNA extracted from differentially treated meatballs. The simplicity, stability and sensitivity of the assay suggested that it could be used in halal food industry for the authentication of canine derivatives in processed foods. Copyright © 2014 Elsevier Ltd. All rights reserved.
2010-01-01
Subtraction technique has been broadly applied for target gene discovery. However, most current protocols apply relative differential subtraction and result in great amount clone mixtures of unique and differentially expressed genes. This makes it more difficult to identify unique or target-orientated expressed genes. In this study, we developed a novel method for subtraction at mRNA level by integrating magnetic particle technology into driver preparation and tester–driver hybridization to facilitate uniquely expressed gene discovery between peanut immature pod and leaf through a single round subtraction. The resulting target clones were further validated through polymerase chain reaction screening using peanut immature pod and leaf cDNA libraries as templates. This study has resulted in identifying several genes expressed uniquely in immature peanut pod. These target genes can be used for future peanut functional genome and genetic engineering research. PMID:21406066
Gene Expression Analysis to Assess the Relevance of Rodent Models to Human Lung Injury.
Sweeney, Timothy E; Lofgren, Shane; Khatri, Purvesh; Rogers, Angela J
2017-08-01
The relevance of animal models to human diseases is an area of intense scientific debate. The degree to which mouse models of lung injury recapitulate human lung injury has never been assessed. Integrating data from both human and animal expression studies allows for increased statistical power and identification of conserved differential gene expression across organisms and conditions. We sought comprehensive integration of gene expression data in experimental acute lung injury (ALI) in rodents compared with humans. We performed two separate gene expression multicohort analyses to determine differential gene expression in experimental animal and human lung injury. We used correlational and pathway analyses combined with external in vitro gene expression data to identify both potential drivers of underlying inflammation and therapeutic drug candidates. We identified 21 animal lung tissue datasets and three human lung injury bronchoalveolar lavage datasets. We show that the metasignatures of animal and human experimental ALI are significantly correlated despite these widely varying experimental conditions. The gene expression changes among mice and rats across diverse injury models (ozone, ventilator-induced lung injury, LPS) are significantly correlated with human models of lung injury (Pearson r = 0.33-0.45, P < 1E -16 ). Neutrophil signatures are enriched in both animal and human lung injury. Predicted therapeutic targets, peptide ligand signatures, and pathway analyses are also all highly overlapping. Gene expression changes are similar in animal and human experimental ALI, and provide several physiologic and therapeutic insights to the disease.
Schmitz, Ulf; Lai, Xin; Winter, Felix; Wolkenhauer, Olaf; Vera, Julio; Gupta, Shailendra K.
2014-01-01
MicroRNAs (miRNAs) are an integral part of gene regulation at the post-transcriptional level. Recently, it has been shown that pairs of miRNAs can repress the translation of a target mRNA in a cooperative manner, which leads to an enhanced effectiveness and specificity in target repression. However, it remains unclear which miRNA pairs can synergize and which genes are target of cooperative miRNA regulation. In this paper, we present a computational workflow for the prediction and analysis of cooperating miRNAs and their mutual target genes, which we refer to as RNA triplexes. The workflow integrates methods of miRNA target prediction; triplex structure analysis; molecular dynamics simulations and mathematical modeling for a reliable prediction of functional RNA triplexes and target repression efficiency. In a case study we analyzed the human genome and identified several thousand targets of cooperative gene regulation. Our results suggest that miRNA cooperativity is a frequent mechanism for an enhanced target repression by pairs of miRNAs facilitating distinctive and fine-tuned target gene expression patterns. Human RNA triplexes predicted and characterized in this study are organized in a web resource at www.sbi.uni-rostock.de/triplexrna/. PMID:24875477
Langston, Lance D; Symington, Lorraine S
2005-06-15
Targeted gene replacement (TGR) in yeast and mammalian cells is initiated by the two free ends of the linear targeting molecule, which invade their respective homologous sequences in the chromosome, leading to replacement of the targeted locus with a selectable gene from the targeting DNA. To study the postinvasion steps in recombination, we examined the effects of DNA structure-specific proteins on TGR frequency and heteroduplex DNA formation. In strains deleted of RAD1, MSH2, or MSH3, we find that the frequency of TGR is reduced and the mechanism of TGR is altered while the reverse is true for deletion of SGS1, suggesting that Rad1 and Msh2:Msh3 facilitate TGR while Sgs1 opposes it. The altered mechanism of TGR in the absence of Msh2:Msh3 and Rad1 reveals a separate role for these proteins in suppressing an alternate gene replacement pathway in which incorporation of both homology regions from a single strand of targeting DNA into heteroduplex with the targeted locus creates a mismatch between the selectable gene on the targeting DNA and the targeted gene in the chromosome.
Gene replacements and insertions in rice by intron targeting using CRISPR-Cas9.
Li, Jun; Meng, Xiangbing; Zong, Yuan; Chen, Kunling; Zhang, Huawei; Liu, Jinxing; Li, Jiayang; Gao, Caixia
2016-09-12
Sequence-specific nucleases have been exploited to create targeted gene knockouts in various plants(1), but replacing a fragment and even obtaining gene insertions at specific loci in plant genomes remain a serious challenge. Here, we report efficient intron-mediated site-specific gene replacement and insertion approaches that generate mutations using the non-homologous end joining (NHEJ) pathway using the clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR-associated protein 9 (Cas9) system. Using a pair of single guide RNAs (sgRNAs) targeting adjacent introns and a donor DNA template including the same pair of sgRNA sites, we achieved gene replacements in the rice endogenous gene 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) at a frequency of 2.0%. We also obtained targeted gene insertions at a frequency of 2.2% using a sgRNA targeting one intron and a donor DNA template including the same sgRNA site. Rice plants harbouring the OsEPSPS gene with the intended substitutions were glyphosate-resistant. Furthermore, the site-specific gene replacements and insertions were faithfully transmitted to the next generation. These newly developed approaches can be generally used to replace targeted gene fragments and to insert exogenous DNA sequences into specific genomic sites in rice and other plants.
Knutson, Todd P; Truong, Thu H; Ma, Shihong; Brady, Nicholas J; Sullivan, Megan E; Raj, Ganesh; Schwertfeger, Kathryn L; Lange, Carol A
2017-04-17
Estrogen and progesterone are potent breast mitogens. In addition to steroid hormones, multiple signaling pathways input to estrogen receptor (ER) and progesterone receptor (PR) actions via posttranslational events. Protein kinases commonly activated in breast cancers phosphorylate steroid hormone receptors (SRs) and profoundly impact their activities. To better understand the role of modified PRs in breast cancer, we measured total and phospho-Ser294 PRs in 209 human breast tumors represented on 2754 individual tissue spots within a tissue microarray and assayed the regulation of this site in human tumor explants cultured ex vivo. To complement this analysis, we assayed PR target gene regulation in T47D luminal breast cancer models following treatment with progestin (promegestone; R5020) and antiprogestins (mifepristone, onapristone, or aglepristone) in conditions under which the receptor is regulated by Lys388 SUMOylation (K388 intact) or is SUMO-deficient (via K388R mutation to mimic persistent Ser294 phosphorylation). Selected phospho-PR-driven target genes were validated by qRT-PCR and following RUNX2 shRNA knockdown in breast cancer cell lines. Primary and secondary mammosphere assays were performed to implicate phospho-Ser294 PRs, epidermal growth factor signaling, and RUNX2 in breast cancer stem cell biology. Phospho-Ser294 PR species were abundant in a majority (54%) of luminal breast tumors, and PR promoter selectivity was exquisitely sensitive to posttranslational modifications. Phospho-PR expression and target gene programs were significantly associated with invasive lobular carcinoma (ILC). Consistent with our finding that activated phospho-PRs undergo rapid ligand-dependent turnover, unique phospho-PR gene signatures were most prevalent in breast tumors clinically designated as PR-low to PR-null (luminal B) and included gene sets associated with cancer stem cell biology (HER2, PAX2, AHR, AR, RUNX). Validation studies demonstrated a requirement for RUNX2 in the regulation of selected phospho-PR target genes (SLC37A2). In vitro mammosphere formation assays support a role for phospho-Ser294-PRs via growth factor (EGF) signaling as well as RUNX2 as potent drivers of breast cancer stem cell fate. We conclude that PR Ser294 phosphorylation is a common event in breast cancer progression that is required to maintain breast cancer stem cell fate, in part via cooperation with growth factor-initiated signaling pathways and key phospho-PR target genes including SLC37A2 and RUNX2. Clinical measurement of phosphorylated PRs should be considered a useful marker of breast tumor stem cell potential. Alternatively, unique phospho-PR target gene sets may provide useful tools with which to identify patients likely to respond to selective PR modulators that block PR Ser294 phosphorylation as part of rational combination (i.e., with antiestrogens) endocrine therapies designed to durably block breast cancer recurrence.
The past and presence of gene targeting: from chemicals and DNA via proteins to RNA.
Geel, T M; Ruiters, M H J; Cool, R H; Halby, L; Voshart, D C; Andrade Ruiz, L; Niezen-Koning, K E; Arimondo, P B; Rots, M G
2018-06-05
The ability to target DNA specifically at any given position within the genome allows many intriguing possibilities and has inspired scientists for decades. Early gene-targeting efforts exploited chemicals or DNA oligonucleotides to interfere with the DNA at a given location in order to inactivate a gene or to correct mutations. We here describe an example towards correcting a genetic mutation underlying Pompe's disease using a nucleotide-fused nuclease (TFO-MunI). In addition to the promise of gene correction, scientists soon realized that genes could be inactivated or even re-activated without inducing potentially harmful DNA damage by targeting transcriptional modulators to a particular gene. However, it proved difficult to fuse protein effector domains to the first generation of programmable DNA-binding agents. The engineering of gene-targeting proteins (zinc finger proteins (ZFPs), transcription activator-like effectors (TALEs)) circumvented this problem. The disadvantage of protein-based gene targeting is that a fusion protein needs to be engineered for every locus. The recent introduction of CRISPR/Cas offers a flexible approach to target a (fusion) protein to the locus of interest using cheap designer RNA molecules. Many research groups now exploit this platform and the first human clinical trials have been initiated: CRISPR/Cas has kicked off a new era of gene targeting and is revolutionizing biomedical sciences.This article is part of a discussion meeting issue 'Frontiers in epigenetic chemical biology'. © 2018 The Author(s).
Jeong, Jae-Kyo; Kang, Min-Hee; Gurunathan, Sangiliyandi; Cho, Ssang-Goo; Park, Chankyu; Seo, Han Geuk; Kim, Jin-Hoi
2014-09-25
Real-time quantitative reverse-transcriptase polymerase chain reaction (RT-qPCR) is the most sensitive, and valuable technique for rare mRNA detection. However, the expression profiles of reference genes under different experimental conditions, such as different mouse strains, developmental stage, and culture conditions have been poorly studied. mRNA stability of the actb, gapdh, sdha, ablim, ywhaz, sptbn, h2afz, tgfb1, 18 s and wrnip genes was analyzed. Using the NormFinder program, the most stable genes are as follows: h2afz for the B6D2F-1 and C57BL/6 strains; sptbn for ICR; h2afz for KOSOM and CZB cultures of B6D2F-1 and C57BL/6 strain-derived embryos; wrnip for M16 culture of B6D2F-1 and C57BL/6 strain-derived embryos; ywhaz, tgfb1, 18 s, 18 s, ywhaz, and h2afz for zygote, 2-cell, 4-cell, 8-cell, molular, and blastocyst embryonic stages cultured in KSOM medium, respectively; h2afz, wrnip, wrnip, h2afz, ywhaz, and ablim for zygote, 2-cell, 4-cell, 8-cell, molular, and blastocyst stage embryos cultured in CZB medium, respectively; 18 s, h2afz, h2afz, actb, h2afz, and wrnip for zygote, 2-cell, 4-cell, 8-cell, molular, and blastocyst stage embryos cultured in M16 medium, respectively. These results demonstrated that candidate reference genes for normalization of target gene expression using RT-qPCR should be selected according to mouse strains, developmental stage, and culture conditions.
Hishikawa, Yoshitaka; An, Shucai; Yamamoto-Fukuda, Tomomi; Shibata, Yasuaki; Koji, Takehiko
2009-01-01
In situ polymerase chain reaction (in situ PCR), which can detect a few copies of genes within a cell by amplifying the target gene, was developed to better understand the biological functions of tissues. In this study, we optimized the protocol conditions for the detection of X chromosome-linked phosphoglycerate kinase-1 (pgk-1) gene in paraffin-embedded sections of mouse reproductive organs. The effects of various concentrations of proteinase K (PK) and PCR cycle numbers were examined. To label the amplified DNA, we used digoxigenin-dUTP (Dig), Cy-3-dUTP (Cy-3), or FluorX-dCTP (FluorX). The optimal concentration of PK was 50 µg/ml for the ovary and 10 µg/ml for the testis. Ten PCR cycles were optimal for Dig and 25 cycles were optimal for FluorX and Cy-3 in the ovary and testis. The signal-to-noise ratio of FluorX and Cy-3 for ovarian tissue was better than that of Dig. Using the above conditions, we detected 1–4 and 1–2 spots of pgk-1 in the nuclei of granulosa and germ cells, respectively. Our results indicate that in situ PCR is useful for detecting a specific gene in paraffin-embedded sections under optimized conditions of both PCR cycle number and PK concentration. PMID:19492023
A Large-Scale RNAi Screen Identifies SGK1 as a Key Survival Kinase for GBM Stem Cells.
Kulkarni, Shreya; Goel-Bhattacharya, Surbhi; Sengupta, Sejuti; Cochran, Brent H
2018-01-01
Glioblastoma multiforme (GBM) is the most common type of primary malignant brain cancer and has a very poor prognosis. A subpopulation of cells known as GBM stem-like cells (GBM-SC) have the capacity to initiate and sustain tumor growth and possess molecular characteristics similar to the parental tumor. GBM-SCs are known to be enriched in hypoxic niches and may contribute to therapeutic resistance. Therefore, to identify genetic determinants important for the proliferation and survival of GBM stem cells, an unbiased pooled shRNA screen of 10,000 genes was conducted under normoxic as well as hypoxic conditions. A number of essential genes were identified that are required for GBM-SC growth, under either or both oxygen conditions, in two different GBM-SC lines. Interestingly, only about a third of the essential genes were common to both cell lines. The oxygen environment significantly impacts the cellular genetic dependencies as 30% of the genes required under hypoxia were not required under normoxic conditions. In addition to identifying essential genes already implicated in GBM such as CDK4, KIF11 , and RAN , the screen also identified new genes that have not been previously implicated in GBM stem cell biology. The importance of the serum and glucocorticoid-regulated kinase 1 (SGK1) for cellular survival was validated in multiple patient-derived GBM stem cell lines using shRNA, CRISPR, and pharmacologic inhibitors. However, SGK1 depletion and inhibition has little effect on traditional serum grown glioma lines and on differentiated GBM-SCs indicating its specific importance in GBM stem cell survival. Implications: This study identifies genes required for the growth and survival of GBM stem cells under both normoxic and hypoxic conditions and finds SGK1 as a novel potential drug target for GBM. Mol Cancer Res; 16(1); 103-14. ©2017 AACR . ©2017 American Association for Cancer Research.
ARNetMiT R Package: association rules based gene co-expression networks of miRNA targets.
Özgür Cingiz, M; Biricik, G; Diri, B
2017-03-31
miRNAs are key regulators that bind to target genes to suppress their gene expression level. The relations between miRNA-target genes enable users to derive co-expressed genes that may be involved in similar biological processes and functions in cells. We hypothesize that target genes of miRNAs are co-expressed, when they are regulated by multiple miRNAs. With the usage of these co-expressed genes, we can theoretically construct co-expression networks (GCNs) related to 152 diseases. In this study, we introduce ARNetMiT that utilize a hash based association rule algorithm in a novel way to infer the GCNs on miRNA-target genes data. We also present R package of ARNetMiT, which infers and visualizes GCNs of diseases that are selected by users. Our approach assumes miRNAs as transactions and target genes as their items. Support and confidence values are used to prune association rules on miRNA-target genes data to construct support based GCNs (sGCNs) along with support and confidence based GCNs (scGCNs). We use overlap analysis and the topological features for the performance analysis of GCNs. We also infer GCNs with popular GNI algorithms for comparison with the GCNs of ARNetMiT. Overlap analysis results show that ARNetMiT outperforms the compared GNI algorithms. We see that using high confidence values in scGCNs increase the ratio of the overlapped gene-gene interactions between the compared methods. According to the evaluation of the topological features of ARNetMiT based GCNs, the degrees of nodes have power-law distribution. The hub genes discovered by ARNetMiT based GCNs are consistent with the literature.
Lim, Eileen C P; Brett, Maggie; Lai, Angeline H M; Lee, Siew-Peng; Tan, Ee-Shien; Jamuar, Saumya S; Ng, Ivy S L; Tan, Ene-Choo
2015-12-14
Next-generation sequencing (NGS) has revolutionized genetic research and offers enormous potential for clinical application. Sequencing the exome has the advantage of casting the net wide for all known coding regions while targeted gene panel sequencing provides enhanced sequencing depths and can be designed to avoid incidental findings in adult-onset conditions. A HaloPlex panel consisting of 180 genes within commonly altered chromosomal regions is available for use on both the Ion Personal Genome Machine (PGM) and MiSeq platforms to screen for causative mutations in these genes. We used this Haloplex ICCG panel for targeted sequencing of 15 patients with clinical presentations indicative of an abnormality in one of the 180 genes. Sequencing runs were done using the Ion 318 Chips on the Ion Torrent PGM. Variants were filtered for known polymorphisms and analysis was done to identify possible disease-causing variants before validation by Sanger sequencing. When possible, segregation of variants with phenotype in family members was performed to ascertain the pathogenicity of the variant. More than 97% of the target bases were covered at >20×. There was an average of 9.6 novel variants per patient. Pathogenic mutations were identified in five genes for six patients, with two novel variants. There were another five likely pathogenic variants, some of which were unreported novel variants. In a cohort of 15 patients, we were able to identify a likely genetic etiology in six patients (40%). Another five patients had candidate variants for which further evaluation and segregation analysis are ongoing. Our results indicate that the HaloPlex ICCG panel is useful as a rapid, high-throughput and cost-effective screening tool for 170 of the 180 genes. There is low coverage for some regions in several genes which might have to be supplemented by Sanger sequencing. However, comparing the cost, ease of analysis, and shorter turnaround time, it is a good alternative to exome sequencing for patients whose features are suggestive of a genetic etiology involving one of the genes in the panel.
Diet and Inflammation: Possible Effects on Immunity, Chronic Diseases, and Life Span.
Ricordi, Camillo; Garcia-Contreras, Marta; Farnetti, Sara
2015-01-01
Chronic inflammation negatively impacts all physiological functions, causing an array of degenerative conditions including diabetes; cancer; cardiovascular, osteo-articular, and neurodegenerative diseases; autoimmunity disorders; and aging. In particular, there is a growing knowledge of the role that gene transcription factors play in the inflammatory process. Obesity, metabolic syndrome, and diabetes represent multifactorial conditions resulting from improper balances of hormones and gene expression. In addition, these conditions have a strong inflammatory component that can potentially be impacted by the diet. It can reduce pro-inflammatory eicosanoids that can alter hormonal signaling cascades to the modulation of the innate immune system and gene transcription factors. Working knowledge of the impact of how nutrients, especially dietary fatty acids and polyphenols, can impact these various molecular targets makes it possible to develop a general outline of an anti-inflammatory diet that offers a unique, nonpharmacological approach in treating obesity, metabolic syndrome, and diabetes. Several important bioactive dietary components can exert their effect through selected inflammatory pathways that can affect metabolic and genetic changes. In fact, dietary components that can modulate glucose and insulin levels, as well as any other mediator that can activate nuclear factor-kB, can also trigger inflammation through common pathway master switches.
Simmons, Christopher W.; Reddy, Amitha P.; D’haeseleer, Patrik; ...
2014-12-31
New lignocellulolytic enzymes are needed that maintain optimal activity under the harsh conditions present during industrial enzymatic deconstruction of biomass, including high temperatures, the absence of free water, and the presence of inhibitors from the biomass. Enriching lignocellulolytic microbial communities under these conditions provides a source of microorganisms that may yield robust lignocellulolytic enzymes tolerant to the extreme conditions needed to improve the throughput and efficiency of biomass enzymatic deconstruction. Identification of promising enzymes from these systems is challenging due to complex substrate-enzyme interactions and requirements to assay for activity. In this study, metatranscriptomes from compost-derived microbial communities enriched onmore » rice straw under thermophilic and mesophilic conditions were sequenced and analyzed to identify lignocellulolytic enzymes overexpressed under thermophilic conditions. To determine differential gene expression across mesophilic and thermophilic treatments, a method was developed which pooled gene expression by functional category, as indicated by Pfam annotations, since microbial communities performing similar tasks are likely to have overlapping functions even if they share no specific genes. Differential expression analysis identified enzymes from glycoside hydrolase family 48, carbohydrate binding module family 2, and carbohydrate binding module family 33 domains as significantly overexpressed in the thermophilic community. Overexpression of these protein families in the thermophilic community resulted from expression of a small number of genes not currently represented in any protein database. Genes in overexpressed protein families were predominantly expressed by a single Actinobacteria genus, Micromonospora. In conclusion, coupling measurements of deconstructive activity with comparative analyses to identify overexpressed enzymes in lignocellulolytic communities provides a targeted approach for discovery of candidate enzymes for more efficient biomass deconstruction. Furthermore, glycoside hydrolase family 48 cellulases and carbohydrate binding module family 33 polysaccharide monooxygenases with carbohydrate binding module family 2 domains may improve saccharification of lignocellulosic biomass under high-temperature and low moisture conditions relevant to industrial biofuel production.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Simmons, Christopher W.; Reddy, Amitha P.; D’haeseleer, Patrik
New lignocellulolytic enzymes are needed that maintain optimal activity under the harsh conditions present during industrial enzymatic deconstruction of biomass, including high temperatures, the absence of free water, and the presence of inhibitors from the biomass. Enriching lignocellulolytic microbial communities under these conditions provides a source of microorganisms that may yield robust lignocellulolytic enzymes tolerant to the extreme conditions needed to improve the throughput and efficiency of biomass enzymatic deconstruction. Identification of promising enzymes from these systems is challenging due to complex substrate-enzyme interactions and requirements to assay for activity. In this study, metatranscriptomes from compost-derived microbial communities enriched onmore » rice straw under thermophilic and mesophilic conditions were sequenced and analyzed to identify lignocellulolytic enzymes overexpressed under thermophilic conditions. To determine differential gene expression across mesophilic and thermophilic treatments, a method was developed which pooled gene expression by functional category, as indicated by Pfam annotations, since microbial communities performing similar tasks are likely to have overlapping functions even if they share no specific genes. Differential expression analysis identified enzymes from glycoside hydrolase family 48, carbohydrate binding module family 2, and carbohydrate binding module family 33 domains as significantly overexpressed in the thermophilic community. Overexpression of these protein families in the thermophilic community resulted from expression of a small number of genes not currently represented in any protein database. Genes in overexpressed protein families were predominantly expressed by a single Actinobacteria genus, Micromonospora. In conclusion, coupling measurements of deconstructive activity with comparative analyses to identify overexpressed enzymes in lignocellulolytic communities provides a targeted approach for discovery of candidate enzymes for more efficient biomass deconstruction. Furthermore, glycoside hydrolase family 48 cellulases and carbohydrate binding module family 33 polysaccharide monooxygenases with carbohydrate binding module family 2 domains may improve saccharification of lignocellulosic biomass under high-temperature and low moisture conditions relevant to industrial biofuel production.« less
Witt, Anika; Salamon, Achim; Boy, Diana; Hansmann, Doris; Büttner, Andreas; Wree, Andreas; Bader, Rainer; Jonitz-Heincke, Anika
2017-01-01
The main goal of cartilage repair is to create functional tissue by enhancing the in vitro conditions to more physiological in vivo conditions. Chondrogenic growth factors play an important role in influencing cartilage homeostasis. Insulin-like growth factor (IGF)-1 and transforming growth factor (TGF)-β1 affect the expression of collagen type II (Col2) and glycosaminoglycans (GAGs) and, therefore, the targeted use of growth factors could make chondrogenic redifferentiation more efficient. In the present study, human chondrocytes were postmortally isolated from healthy articular cartilage and cultivated as monolayer or 3D pellet cultures either under normoxia or hypoxia and stimulated with IGF-1 and/or TGF-β1 to compare the impact of the different growth factors. The mRNA levels of the specific receptors (IGF1R, TGFBR1, TGFBR2) were analyzed at different time points. Moreover, gene expression rates of collagen type 1 and 2 in pellet cultures were observed over a period of 5 weeks. Additionally, hyaline-like Col2 protein and sulphated GAG (sGAG) levels were quantified. Stimulation with IGF-1 resulted in an enhanced expression of IGF1R and TGFBR2 whereas TGF-β1 stimulated TGFBR1 in the monolayer and pellet cultures. In monolayer, the differences reached levels of significance. This effect was more pronounced under hypoxic culture conditions. In pellet cultures, increased amounts of Col2 protein and sGAGs after incubation with TGF-β1 and/or IGF-1 were validated. In summary, constructing a gene expression profile regarding mRNA levels of specific growth factor receptors in monolayer cultures could be helpful for a targeted application of growth factors in cartilage tissue engineering. PMID:28534942
Ionotropic GABA and Glutamate Receptor Mutations and Human Neurologic Diseases.
Yuan, Hongjie; Low, Chian-Ming; Moody, Olivia A; Jenkins, Andrew; Traynelis, Stephen F
2015-07-01
The advent of whole exome/genome sequencing and the technology-driven reduction in the cost of next-generation sequencing as well as the introduction of diagnostic-targeted sequencing chips have resulted in an unprecedented volume of data directly linking patient genomic variability to disorders of the brain. This information has the potential to transform our understanding of neurologic disorders by improving diagnoses, illuminating the molecular heterogeneity underlying diseases, and identifying new targets for therapeutic treatment. There is a strong history of mutations in GABA receptor genes being involved in neurologic diseases, particularly the epilepsies. In addition, a substantial number of variants and mutations have been found in GABA receptor genes in patients with autism, schizophrenia, and addiction, suggesting potential links between the GABA receptors and these conditions. A new and unexpected outcome from sequencing efforts has been the surprising number of mutations found in glutamate receptor subunits, with the GRIN2A gene encoding the GluN2A N-methyl-d-aspartate receptor subunit being most often affected. These mutations are associated with multiple neurologic conditions, for which seizure disorders comprise the largest group. The GluN2A subunit appears to be a locus for epilepsy, which holds important therapeutic implications. Virtually all α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor mutations, most of which occur within GRIA3, are from patients with intellectual disabilities, suggesting a link to this condition. Similarly, the most common phenotype for kainate receptor variants is intellectual disability. Herein, we summarize the current understanding of disease-associated mutations in ionotropic GABA and glutamate receptor families, and discuss implications regarding the identification of human mutations and treatment of neurologic diseases. Copyright © 2015 by The American Society for Pharmacology and Experimental Therapeutics.
Ionotropic GABA and Glutamate Receptor Mutations and Human Neurologic Diseases
Yuan, Hongjie; Low, Chian-Ming; Moody, Olivia A.; Jenkins, Andrew
2015-01-01
The advent of whole exome/genome sequencing and the technology-driven reduction in the cost of next-generation sequencing as well as the introduction of diagnostic-targeted sequencing chips have resulted in an unprecedented volume of data directly linking patient genomic variability to disorders of the brain. This information has the potential to transform our understanding of neurologic disorders by improving diagnoses, illuminating the molecular heterogeneity underlying diseases, and identifying new targets for therapeutic treatment. There is a strong history of mutations in GABA receptor genes being involved in neurologic diseases, particularly the epilepsies. In addition, a substantial number of variants and mutations have been found in GABA receptor genes in patients with autism, schizophrenia, and addiction, suggesting potential links between the GABA receptors and these conditions. A new and unexpected outcome from sequencing efforts has been the surprising number of mutations found in glutamate receptor subunits, with the GRIN2A gene encoding the GluN2A N-methyl-d-aspartate receptor subunit being most often affected. These mutations are associated with multiple neurologic conditions, for which seizure disorders comprise the largest group. The GluN2A subunit appears to be a locus for epilepsy, which holds important therapeutic implications. Virtually all α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor mutations, most of which occur within GRIA3, are from patients with intellectual disabilities, suggesting a link to this condition. Similarly, the most common phenotype for kainate receptor variants is intellectual disability. Herein, we summarize the current understanding of disease-associated mutations in ionotropic GABA and glutamate receptor families, and discuss implications regarding the identification of human mutations and treatment of neurologic diseases. PMID:25904555
Hommais, Florence; Oger-Desfeux, Christine; Van Gijsegem, Frédérique; Castang, Sandra; Ligori, Sandrine; Expert, Dominique; Nasser, William; Reverchon, Sylvie
2008-11-01
Pathogenicity of the enterobacterium Erwinia chrysanthemi (Dickeya dadantii), the causative agent of soft-rot disease in many plants, is a complex process involving several factors whose production is subject to temporal regulation during infection. PecS is a transcriptional regulator that controls production of various virulence factors. Here, we used microarray analysis to define the PecS regulon and demonstrated that PecS notably regulates a wide range of genes that could be linked to pathogenicity and to a group of genes concerned with evading host defenses. Among the targets are the genes encoding plant cell wall-degrading enzymes and secretion systems and the genes involved in flagellar biosynthesis, biosurfactant production, and the oxidative stress response, as well as genes encoding toxin-like factors such as NipE and hemolysin-coregulated proteins. In vitro experiments demonstrated that PecS interacts with the regulatory regions of five new targets: an oxidative stress response gene (ahpC), a biosurfactant synthesis gene (rhlA), and genes encoding exported proteins related to other plant-associated bacterial proteins (nipE, virK, and avrL). The pecS mutant provokes symptoms more rapidly and with more efficiency than the wild-type strain, indicating that PecS plays a critical role in the switch from the asymptomatic phase to the symptomatic phase. Based on this, we propose that the temporal regulation of the different groups of genes required for the asymptomatic phase and the symptomatic phase is, in part, the result of a gradual modulation of PecS activity triggered during infection in response to changes in environmental conditions emerging from the interaction between both partners.
Hommais, Florence; Oger-Desfeux, Christine; Van Gijsegem, Frédérique; Castang, Sandra; Ligori, Sandrine; Expert, Dominique; Nasser, William; Reverchon, Sylvie
2008-01-01
Pathogenicity of the enterobacterium Erwinia chrysanthemi (Dickeya dadantii), the causative agent of soft-rot disease in many plants, is a complex process involving several factors whose production is subject to temporal regulation during infection. PecS is a transcriptional regulator that controls production of various virulence factors. Here, we used microarray analysis to define the PecS regulon and demonstrated that PecS notably regulates a wide range of genes that could be linked to pathogenicity and to a group of genes concerned with evading host defenses. Among the targets are the genes encoding plant cell wall-degrading enzymes and secretion systems and the genes involved in flagellar biosynthesis, biosurfactant production, and the oxidative stress response, as well as genes encoding toxin-like factors such as NipE and hemolysin-coregulated proteins. In vitro experiments demonstrated that PecS interacts with the regulatory regions of five new targets: an oxidative stress response gene (ahpC), a biosurfactant synthesis gene (rhlA), and genes encoding exported proteins related to other plant-associated bacterial proteins (nipE, virK, and avrL). The pecS mutant provokes symptoms more rapidly and with more efficiency than the wild-type strain, indicating that PecS plays a critical role in the switch from the asymptomatic phase to the symptomatic phase. Based on this, we propose that the temporal regulation of the different groups of genes required for the asymptomatic phase and the symptomatic phase is, in part, the result of a gradual modulation of PecS activity triggered during infection in response to changes in environmental conditions emerging from the interaction between both partners. PMID:18790868
Penrod, Nadia M; Moore, Jason H
2014-02-05
The demand for novel molecularly targeted drugs will continue to rise as we move forward toward the goal of personalizing cancer treatment to the molecular signature of individual tumors. However, the identification of targets and combinations of targets that can be safely and effectively modulated is one of the greatest challenges facing the drug discovery process. A promising approach is to use biological networks to prioritize targets based on their relative positions to one another, a property that affects their ability to maintain network integrity and propagate information-flow. Here, we introduce influence networks and demonstrate how they can be used to generate influence scores as a network-based metric to rank genes as potential drug targets. We use this approach to prioritize genes as drug target candidates in a set of ER⁺ breast tumor samples collected during the course of neoadjuvant treatment with the aromatase inhibitor letrozole. We show that influential genes, those with high influence scores, tend to be essential and include a higher proportion of essential genes than those prioritized based on their position (i.e. hubs or bottlenecks) within the same network. Additionally, we show that influential genes represent novel biologically relevant drug targets for the treatment of ER⁺ breast cancers. Moreover, we demonstrate that gene influence differs between untreated tumors and residual tumors that have adapted to drug treatment. In this way, influence scores capture the context-dependent functions of genes and present the opportunity to design combination treatment strategies that take advantage of the tumor adaptation process. Influence networks efficiently find essential genes as promising drug targets and combinations of targets to inform the development of molecularly targeted drugs and their use.
2014-01-01
Background The demand for novel molecularly targeted drugs will continue to rise as we move forward toward the goal of personalizing cancer treatment to the molecular signature of individual tumors. However, the identification of targets and combinations of targets that can be safely and effectively modulated is one of the greatest challenges facing the drug discovery process. A promising approach is to use biological networks to prioritize targets based on their relative positions to one another, a property that affects their ability to maintain network integrity and propagate information-flow. Here, we introduce influence networks and demonstrate how they can be used to generate influence scores as a network-based metric to rank genes as potential drug targets. Results We use this approach to prioritize genes as drug target candidates in a set of ER + breast tumor samples collected during the course of neoadjuvant treatment with the aromatase inhibitor letrozole. We show that influential genes, those with high influence scores, tend to be essential and include a higher proportion of essential genes than those prioritized based on their position (i.e. hubs or bottlenecks) within the same network. Additionally, we show that influential genes represent novel biologically relevant drug targets for the treatment of ER + breast cancers. Moreover, we demonstrate that gene influence differs between untreated tumors and residual tumors that have adapted to drug treatment. In this way, influence scores capture the context-dependent functions of genes and present the opportunity to design combination treatment strategies that take advantage of the tumor adaptation process. Conclusions Influence networks efficiently find essential genes as promising drug targets and combinations of targets to inform the development of molecularly targeted drugs and their use. PMID:24495353
Wohlfart, Sigrun; Söder, Stephan; Smahi, Asma; Schneider, Holm
2016-01-01
Hypohidrotic ectodermal dysplasia (HED) is a rare disorder characterized by deficient development of structures derived from the ectoderm including hair, nails, eccrine glands, and teeth. HED forms that are caused by mutations in the genes EDA, EDAR, or EDARADD may show almost identical phenotypes, explained by a common signaling pathway. Proper interaction of the proteins encoded by these three genes is important for the activation of the NF-κB signaling pathway and subsequent transcription of the target genes. Mutations in the gene EDARADD are most rarely implicated in HED. Here we describe a novel missense mutation, c.367G>A (p.Asp123Asn), in this gene which did not appear to influence the interaction between EDAR and EDARADD proteins, but led to an impaired ability to activate NF-κB signaling. Female members of the affected family showed either unilateral or bilateral amazia. In addition, an affected girl developed bilateral ovarian teratomas, possibly associated with her genetic condition. © 2015 Wiley Periodicals, Inc.
Adaptation to Potassium-Limitation Is Essential for Acinetobacter baumannii Pneumonia Pathogenesis.
Samir, Reham; Hussein, Salma H; Elhosseiny, Noha M; Khattab, Marwa S; Shawky, Alaa E; Attia, Ahmed S
2016-12-15
Acinetobacter baumannii is challenging the healthcare community as the cause of a wide range of untreatable infections. New targets need to be explored for the development of therapeutics. The potassium-dependent protein (Kdp) system was investigated via bioinformatics and genetic tools. An isogenic mutant was constructed in kdpE and complemented in trans Gene expression and the ability to grow under potassium-limited conditions were investigated. Finally, the role of KdpE in virulence was examined in the murine pneumonia model. The A. baumannii Kdp system has a distinct arrangement and is well conserved among A. baumannii strains. The genes encoding the 5 members of the system are transcriptionally linked. kdpE is upregulated >70-fold under potassium-limited conditions. The ΔkdpE mutant showed a significant growth defect under potassium-limited conditions and in the colonization of mice lungs. These defects could be restored upon introducing kdpE on a multiple-copy plasmid. Proteomic analyses indicated that KdpE could be regulating several proteins with potential involvement in pathogenesis. For the first time, A. baumannii KdpE is shown to be crucial to pneumonia onset, and targeting this system can be a viable approach to treating these fatal infections. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.
Gene expression studies of reference genes for quantitative real-time PCR: an overview in insects.
Shakeel, Muhammad; Rodriguez, Alicia; Tahir, Urfa Bin; Jin, Fengliang
2018-02-01
Whenever gene expression is being examined, it is essential that a normalization process is carried out to eliminate non-biological variations. The use of reference genes, such as glyceraldehyde-3-phosphate dehydrogenase, actin, and ribosomal protein genes, is the usual method of choice for normalizing gene expression. Although reference genes are used to normalize target gene expression, a major problem is that the stability of these genes differs among tissues, developmental stages, species, and responses to abiotic factors. Therefore, the use and validation of multiple reference genes are required. This review discusses the reasons that why RT-qPCR has become the preferred method for validating results of gene expression profiles, the use of specific and non-specific dyes and the importance of use of primers and probes for qPCR as well as to discuss several statistical algorithms developed to help the validation of potential reference genes. The conflicts arising in the use of classical reference genes in gene normalization and their replacement with novel references are also discussed by citing the high stability and low stability of classical and novel reference genes under various biotic and abiotic experimental conditions by employing various methods applied for the reference genes amplification.
Gislason, April S; Choy, Matthew; Bloodworth, Ruhi A M; Qu, Wubin; Stietz, Maria S; Li, Xuan; Zhang, Chenggang; Cardona, Silvia T
2017-01-01
Chemogenetic approaches to profile an antibiotic mode of action are based on detecting differential sensitivities of engineered bacterial strains in which the antibacterial target (usually encoded by an essential gene) or an associated process is regulated. We previously developed an essential-gene knockdown mutant library in the multidrug-resistant Burkholderia cenocepacia by transposon delivery of a rhamnose-inducible promoter. In this work, we used Illumina sequencing of multiplex-PCR-amplified transposon junctions to track individual mutants during pooled growth in the presence of antibiotics. We found that competition from nontarget mutants magnified the hypersensitivity of a clone underexpressing gyrB to novobiocin by 8-fold compared with hypersensitivity measured during clonal growth. Additional profiling of various antibiotics against a pilot library representing most categories of essential genes revealed a two-component system with unknown function, which, upon depletion of the response regulator, sensitized B. cenocepacia to novobiocin, ciprofloxacin, tetracycline, chloramphenicol, kanamycin, meropenem, and carbonyl cyanide 3-chlorophenylhydrazone, but not to colistin, hydrogen peroxide, and dimethyl sulfoxide. We named the gene cluster esaSR for enhanced sensitivity to antibiotics sensor and response regulator. Mutational analysis and efflux activity assays revealed that while esaS is not essential and is involved in antibiotic-induced efflux, esaR is an essential gene and regulates efflux independently of antibiotic-mediated induction. Furthermore, microscopic analysis of cells stained with propidium iodide provided evidence that depletion of EsaR has a profound effect on the integrity of cell membranes. In summary, we unraveled a previously uncharacterized two-component system that can be targeted to reduce antibiotic resistance in B. cenocepacia. Copyright © 2016 American Society for Microbiology.
Rubinstein, M; Japón, M A; Low, M J
1993-06-11
The introduction of small mutations instead of null alleles into the mouse genome has broad applications to the study of protein structure-function relationships and the creation of animal models of human genetic diseases. To test a simple mutational strategy we designed a targeting vector for the mouse proopiomelanocortin (POMC) gene containing a single nucleotide insertion that converts the initial tyrosine codon of beta-endorphin 1-31 to a premature translational termination codon and introduces a unique Hpal endonuclease restriction site. The targeting vector also contains a neo cassette immediately 3' to the last POMC exon and a herpes simplex virus thymidine kinase cassette to allow positive and negative selection. Homologous recombination occurred at a frequency of 1/30 clones of electroporated embryonic stem cells selected in G418 and gancyclovir. 10/11 clones identified initially by a polymerase chain reaction (PCR) strategy had the predicted structure without evidence of concatemer formation by Southern blot analysis. We used a combination of Hpa I digestion of PCR amplified fragments and direct nucleotide sequencing to further confirm that the point mutation was retained in 9/10 clones. The POMC gene was transcriptionally silent in embryonic stem cells and the targeted allele was not activated by the downstream phosphoglycerate kinase-1 promoter that transcribed the neo gene. Under the electroporation conditions used, we have demonstrated that a point mutation can be introduced with high efficiency and precision into the POMC gene using a replacement type vector containing a retained selectable marker without affecting expression of the allele in the embryonic stem cells. A similar strategy may be useful for a wide range of genes.
Rubinstein, M; Japón, M A; Low, M J
1993-01-01
The introduction of small mutations instead of null alleles into the mouse genome has broad applications to the study of protein structure-function relationships and the creation of animal models of human genetic diseases. To test a simple mutational strategy we designed a targeting vector for the mouse proopiomelanocortin (POMC) gene containing a single nucleotide insertion that converts the initial tyrosine codon of beta-endorphin 1-31 to a premature translational termination codon and introduces a unique Hpal endonuclease restriction site. The targeting vector also contains a neo cassette immediately 3' to the last POMC exon and a herpes simplex virus thymidine kinase cassette to allow positive and negative selection. Homologous recombination occurred at a frequency of 1/30 clones of electroporated embryonic stem cells selected in G418 and gancyclovir. 10/11 clones identified initially by a polymerase chain reaction (PCR) strategy had the predicted structure without evidence of concatemer formation by Southern blot analysis. We used a combination of Hpa I digestion of PCR amplified fragments and direct nucleotide sequencing to further confirm that the point mutation was retained in 9/10 clones. The POMC gene was transcriptionally silent in embryonic stem cells and the targeted allele was not activated by the downstream phosphoglycerate kinase-1 promoter that transcribed the neo gene. Under the electroporation conditions used, we have demonstrated that a point mutation can be introduced with high efficiency and precision into the POMC gene using a replacement type vector containing a retained selectable marker without affecting expression of the allele in the embryonic stem cells. A similar strategy may be useful for a wide range of genes. Images PMID:8392702
Quantitative Proteomic Analysis of the Hfq-Regulon in Sinorhizobium meliloti 2011
Sobrero, Patricio; Schlüter, Jan-Philip; Lanner, Ulrike; Schlosser, Andreas; Becker, Anke; Valverde, Claudio
2012-01-01
Riboregulation stands for RNA-based control of gene expression. In bacteria, small non-coding RNAs (sRNAs) are a major class of riboregulatory elements, most of which act at the post-transcriptional level by base-pairing target mRNA genes. The RNA chaperone Hfq facilitates antisense interactions between target mRNAs and regulatory sRNAs, thus influencing mRNA stability and/or translation rate. In the α-proteobacterium Sinorhizobium meliloti strain 2011, the identification and detection of multiple sRNAs genes and the broadly pleitropic phenotype associated to the absence of a functional Hfq protein both support the existence of riboregulatory circuits controlling gene expression to ensure the fitness of this bacterium in both free living and symbiotic conditions. In order to identify target mRNAs subject to Hfq-dependent riboregulation, we have compared the proteome of an hfq mutant and the wild type S. meliloti by quantitative proteomics following protein labelling with 15N. Among 2139 univocally identified proteins, a total of 195 proteins showed a differential abundance between the Hfq mutant and the wild type strain; 65 proteins accumulated ≥2-fold whereas 130 were downregulated (≤0.5-fold) in the absence of Hfq. This profound proteomic impact implies a major role for Hfq on regulation of diverse physiological processes in S. meliloti, from transport of small molecules to homeostasis of iron and nitrogen. Changes in the cellular levels of proteins involved in transport of nucleotides, peptides and amino acids, and in iron homeostasis, were confirmed with phenotypic assays. These results represent the first quantitative proteomic analysis in S. meliloti. The comparative analysis of the hfq mutant proteome allowed identification of novel strongly Hfq-regulated genes in S. meliloti. PMID:23119037
Quantitative proteomic analysis of the Hfq-regulon in Sinorhizobium meliloti 2011.
Sobrero, Patricio; Schlüter, Jan-Philip; Lanner, Ulrike; Schlosser, Andreas; Becker, Anke; Valverde, Claudio
2012-01-01
Riboregulation stands for RNA-based control of gene expression. In bacteria, small non-coding RNAs (sRNAs) are a major class of riboregulatory elements, most of which act at the post-transcriptional level by base-pairing target mRNA genes. The RNA chaperone Hfq facilitates antisense interactions between target mRNAs and regulatory sRNAs, thus influencing mRNA stability and/or translation rate. In the α-proteobacterium Sinorhizobium meliloti strain 2011, the identification and detection of multiple sRNAs genes and the broadly pleitropic phenotype associated to the absence of a functional Hfq protein both support the existence of riboregulatory circuits controlling gene expression to ensure the fitness of this bacterium in both free living and symbiotic conditions. In order to identify target mRNAs subject to Hfq-dependent riboregulation, we have compared the proteome of an hfq mutant and the wild type S. meliloti by quantitative proteomics following protein labelling with (15)N. Among 2139 univocally identified proteins, a total of 195 proteins showed a differential abundance between the Hfq mutant and the wild type strain; 65 proteins accumulated ≥2-fold whereas 130 were downregulated (≤0.5-fold) in the absence of Hfq. This profound proteomic impact implies a major role for Hfq on regulation of diverse physiological processes in S. meliloti, from transport of small molecules to homeostasis of iron and nitrogen. Changes in the cellular levels of proteins involved in transport of nucleotides, peptides and amino acids, and in iron homeostasis, were confirmed with phenotypic assays. These results represent the first quantitative proteomic analysis in S. meliloti. The comparative analysis of the hfq mutant proteome allowed identification of novel strongly Hfq-regulated genes in S. meliloti.
Hirsch, B; Endris, V; Lassmann, S; Weichert, W; Pfarr, N; Schirmacher, P; Kovaleva, V; Werner, M; Bonzheim, I; Fend, F; Sperveslage, J; Kaulich, K; Zacher, A; Reifenberger, G; Köhrer, K; Stepanow, S; Lerke, S; Mayr, T; Aust, D E; Baretton, G; Weidner, S; Jung, A; Kirchner, T; Hansmann, M L; Burbat, L; von der Wall, E; Dietel, M; Hummel, M
2018-04-01
The simultaneous detection of multiple somatic mutations in the context of molecular diagnostics of cancer is frequently performed by means of amplicon-based targeted next-generation sequencing (NGS). However, only few studies are available comparing multicenter testing of different NGS platforms and gene panels. Therefore, seven partner sites of the German Cancer Consortium (DKTK) performed a multicenter interlaboratory trial for targeted NGS using the same formalin-fixed, paraffin-embedded (FFPE) specimen of molecularly pre-characterized tumors (n = 15; each n = 5 cases of Breast, Lung, and Colon carcinoma) and a colorectal cancer cell line DNA dilution series. Detailed information regarding pre-characterized mutations was not disclosed to the partners. Commercially available and custom-designed cancer gene panels were used for library preparation and subsequent sequencing on several devices of two NGS different platforms. For every case, centrally extracted DNA and FFPE tissue sections for local processing were delivered to each partner site to be sequenced with the commercial gene panel and local bioinformatics. For cancer-specific panel-based sequencing, only centrally extracted DNA was analyzed at seven sequencing sites. Subsequently, local data were compiled and bioinformatics was performed centrally. We were able to demonstrate that all pre-characterized mutations were re-identified correctly, irrespective of NGS platform or gene panel used. However, locally processed FFPE tissue sections disclosed that the DNA extraction method can affect the detection of mutations with a trend in favor of magnetic bead-based DNA extraction methods. In conclusion, targeted NGS is a very robust method for simultaneous detection of various mutations in FFPE tissue specimens if certain pre-analytical conditions are carefully considered.
In Situ Gene Therapy via AAV-CRISPR-Cas9-Mediated Targeted Gene Regulation.
Moreno, Ana M; Fu, Xin; Zhu, Jie; Katrekar, Dhruva; Shih, Yu-Ru V; Marlett, John; Cabotaje, Jessica; Tat, Jasmine; Naughton, John; Lisowski, Leszek; Varghese, Shyni; Zhang, Kang; Mali, Prashant
2018-04-25
Development of efficacious in vivo delivery platforms for CRISPR-Cas9-based epigenome engineering will be critical to enable the ability to target human diseases without permanent modification of the genome. Toward this, we utilized split-Cas9 systems to develop a modular adeno-associated viral (AAV) vector platform for CRISPR-Cas9 delivery to enable the full spectrum of targeted in situ gene regulation functionalities, demonstrating robust transcriptional repression (up to 80%) and activation (up to 6-fold) of target genes in cell culture and mice. We also applied our platform for targeted in vivo gene-repression-mediated gene therapy for retinitis pigmentosa. Specifically, we engineered targeted repression of Nrl, a master regulator of rod photoreceptor determination, and demonstrated Nrl knockdown mediates in situ reprogramming of rod cells into cone-like cells that are resistant to retinitis pigmentosa-specific mutations, with concomitant prevention of secondary cone loss. Furthermore, we benchmarked our results from Nrl knockdown with those from in vivo Nrl knockout via gene editing. Taken together, our AAV-CRISPR-Cas9 platform for in vivo epigenome engineering enables a robust approach to target disease in a genomically scarless and potentially reversible manner. Copyright © 2018 The American Society of Gene and Cell Therapy. Published by Elsevier Inc. All rights reserved.
Carter, C. J.
2011-01-01
Many genes have been implicated in schizophrenia as have viral prenatal or adult infections and toxoplasmosis or Lyme disease. Several autoantigens also target key pathology-related proteins. These factors are interrelated. Susceptibility genes encode for proteins homologous to those of the pathogens while the autoantigens are homologous to pathogens' proteins, suggesting that the risk-promoting effects of genes and risk factors are conditional upon each other, and dependent upon protein matching between pathogen and susceptibility gene products. Pathogens' proteins may act as dummy ligands, decoy receptors, or via interactome interference. Many such proteins are immunogenic suggesting that antibody mediated knockdown of multiple schizophrenia gene products could contribute to the disease, explaining the immune activation in the brain and lymphocytes in schizophrenia, and the preponderance of immune-related gene variants in the schizophrenia genome. Schizophrenia may thus be a “pathogenetic” autoimmune disorder, caused by pathogens, genes, and the immune system acting together, and perhaps preventable by pathogen elimination, or curable by the removal of culpable antibodies and antigens. PMID:22567321
microRNA-mediated R gene regulation: molecular scabbards for double-edged swords.
Deng, Yingtian; Liu, Minglei; Li, Xiaofei; Li, Feng
2018-02-01
Plant resistance (R) proteins are immune receptors that recognize pathogen effectors and trigger rapid defense responses, namely effector-triggered immunity. R protein-mediated pathogen resistance is usually race specific. During plant-pathogen coevolution, plant genomes accumulated large numbers of R genes. Even though plant R genes provide important natural resources for breeding disease-resistant crops, their presence in the plant genome comes at a cost. Misregulation of R genes leads to developmental defects, such as stunted growth and reduced fertility. In the past decade, many microRNAs (miRNAs) have been identified to target various R genes in plant genomes. miRNAs reduce R gene levels under normal conditions and allow induction of R gene expression under various stresses. For these reasons, we consider R genes to be double-edged "swords" and miRNAs as molecular "scabbards". In the present review, we summarize the contributions and potential problems of these "swords" and discuss the features and production of the "scabbards", as well as the mechanisms used to pull the "sword" from the "scabbard" when needed.
Seamless Genome Editing in Rice via Gene Targeting and Precise Marker Elimination.
Nishizawa-Yokoi, Ayako; Saika, Hiroaki; Toki, Seiichi
2016-01-01
Positive-negative selection using hygromycin phosphotransferase (hpt) and diphtheria toxin A-fragment (DT-A) as positive and negative selection markers, respectively, allows enrichment of cells harboring target genes modified via gene targeting (GT). We have developed a successful GT system employing positive-negative selection and subsequent precise marker excision via the piggyBac transposon derived from the cabbage looper moth to introduce desired modifications into target genes in the rice genome. This approach could be applied to the precision genome editing of almost all endogenous genes throughout the genome, at least in rice.
In Silico Prediction and Validation of Gfap as an miR-3099 Target in Mouse Brain.
Abidin, Shahidee Zainal; Leong, Jia-Wen; Mahmoudi, Marzieh; Nordin, Norshariza; Abdullah, Syahril; Cheah, Pike-See; Ling, King-Hwa
2017-08-01
MicroRNAs are small non-coding RNAs that play crucial roles in the regulation of gene expression and protein synthesis during brain development. MiR-3099 is highly expressed throughout embryogenesis, especially in the developing central nervous system. Moreover, miR-3099 is also expressed at a higher level in differentiating neurons in vitro, suggesting that it is a potential regulator during neuronal cell development. This study aimed to predict the target genes of miR-3099 via in-silico analysis using four independent prediction algorithms (miRDB, miRanda, TargetScan, and DIANA-micro-T-CDS) with emphasis on target genes related to brain development and function. Based on the analysis, a total of 3,174 miR-3099 target genes were predicted. Those predicted by at least three algorithms (324 genes) were subjected to DAVID bioinformatics analysis to understand their overall functional themes and representation. The analysis revealed that nearly 70% of the target genes were expressed in the nervous system and a significant proportion were associated with transcriptional regulation and protein ubiquitination mechanisms. Comparison of in situ hybridization (ISH) expression patterns of miR-3099 in both published and in-house-generated ISH sections with the ISH sections of target genes from the Allen Brain Atlas identified 7 target genes (Dnmt3a, Gabpa, Gfap, Itga4, Lxn, Smad7, and Tbx18) having expression patterns complementary to miR-3099 in the developing and adult mouse brain samples. Of these, we validated Gfap as a direct downstream target of miR-3099 using the luciferase reporter gene system. In conclusion, we report the successful prediction and validation of Gfap as an miR-3099 target gene using a combination of bioinformatics resources with enrichment of annotations based on functional ontologies and a spatio-temporal expression dataset.
Gene therapy for cardiovascular disease mediated by ultrasound and microbubbles
2013-01-01
Gene therapy provides an efficient approach for treatment of cardiovascular disease. To realize the therapeutic effect, both efficient delivery to the target cells and sustained expression of transgenes are required. Ultrasound targeted microbubble destruction (UTMD) technique has become a potential strategy for target-specific gene and drug delivery. When gene-loaded microbubble is injected, the ultrasound-mediated microbubble destruction may spew the transported gene to the targeted cells or organ. Meanwhile, high amplitude oscillations of microbubbles increase the permeability of capillary and cell membrane, facilitating uptake of the released gene into tissue and cell. Therefore, efficiency of gene therapy can be significantly improved. To date, UTMD has been successfully investigated in many diseases, and it has achieved outstanding progress in the last two decades. Herein, we discuss the current status of gene therapy of cardiovascular diseases, and reviewed the progress of the delivery of genes to cardiovascular system by UTMD. PMID:23594865
Uncovering microRNA-mediated response to SO2 stress in Arabidopsis thaliana by deep sequencing.
Li, Lihong; Xue, Meizhao; Yi, Huilan
2016-10-05
Sulfur dioxide (SO2) is a major air pollutant and has significant impacts on plants. MicroRNAs (miRNAs) are a class of gene expression regulators that play important roles in response to environmental stresses. In this study, deep sequencing was used for genome-wide identification of miRNAs and their expression profiles in response to SO2 stress in Arabidopsis thaliana shoots. A total of 27 conserved miRNAs and 5 novel miRNAs were found to be differentially expressed under SO2 stress. qRT-PCR analysis showed mostly negative correlation between miRNA accumulation and target gene mRNA abundance, suggesting regulatory roles of these miRNAs during SO2 exposure. The target genes of SO2-responsive miRNAs encode transcription factors and proteins that regulate auxin signaling and stress response, and the miRNAs-mediated suppression of these genes could improve plant resistance to SO2 stress. Promoter sequence analysis of genes encoding SO2-responsive miRNAs showed that stress-responsive and phytohormone-related cis-regulatory elements occurred frequently, providing additional evidence of the involvement of miRNAs in adaption to SO2 stress. This study represents a comprehensive expression profiling of SO2-responsive miRNAs in Arabidopsis and broads our perspective on the ubiquitous regulatory roles of miRNAs under stress conditions. Copyright © 2016 Elsevier B.V. All rights reserved.
Kobayashi, Toshihiro; Kato-Itoh, Megumi; Yamaguchi, Tomoyuki; Tamura, Chihiro; Sanbo, Makoto; Hirabayashi, Masumi; Nakauchi, Hiromitsu
2012-11-01
Recent discovery of a method for derivation and culture of germline-competent rat pluripotent stem cells (PSCs) enables generation of transgenic rats or knock-out rats via genetic modification of such PSCs. This opens the way to use rats, as is routine in mice, for analyses of gene functions or physiological features. In mouse or human, one widely used technique to express a gene of interest stably and ubiquitously is to insert that gene into the Rosa26 locus via gene targeting of PSCs. Rosa26 knock-in mice conditionally expressing a reporter or a toxin gene have contributed to tracing or ablation of specific cell lineages. We successfully identified a rat orthologue of the mouse Rosa26 locus. Insertion of tdTomato, a variant of red fluorescent protein, into the Rosa26 locus of PSCs of various rat strains allows ubiquitous expression of tdTomato. Through germline transmission of one Rosa26-tdTomato knock-in embryonic stem cell line, we also obtained tdTomato knock-in rats. These expressed tdTomato ubiquitously throughout their bodies, which indicates that the rat Rosa26 locus conserves functions of its orthologues in mouse and human. The new tools described here (targeting vectors, knock-in PSCs, and rats) should be useful for a variety of research using rats.
Moin, Mazahar; Bakshi, Achala; Saha, Anusree; Udaya Kumar, M; Reddy, Attipalli R; Rao, K V; Siddiq, E A; Kirti, P B
2016-11-01
We have generated 3900 enhancer-based activation-tagged plants, in addition to 1030 stable Dissociator-enhancer plants in a widely cultivated indica rice variety, BPT-5204. Of them, 3000 were screened for water-use efficiency (WUE) by analysing photosynthetic quantum efficiency and yield-related attributes under water-limiting conditions that identified 200 activation-tagged mutants, which were analysed for flanking sequences at the site of enhancer integration in the genome. We have further selected five plants with low Δ 13 C, high quantum efficiency and increased plant yield compared with wild type for a detailed investigation. Expression studies of 18 genes in these mutants revealed that in four plants one of the three to four tagged genes became activated, while two genes were concurrently up-regulated in the fifth plant. Two genes coding for proteins involved in 60S ribosomal assembly, RPL6 and RPL23A, were among those that became activated by enhancers. Quantitative expression analysis of these two genes also corroborated the results on activating-tagging. The high up-regulation of RPL6 and RPL23A in various stress treatments and the presence of significant cis-regulatory elements in their promoter regions along with the high up-regulation of several of RPL genes in various stress treatments indicate that they are potential targets for manipulating WUE/abiotic stress tolerance. © 2016 John Wiley & Sons Ltd.
Yang, Chunxiao; Preisser, Evan L; Zhang, Hongjun; Liu, Yong; Dai, Liangying; Pan, Huipeng; Zhou, Xuguo
2016-01-01
The development of genetically engineered plants that employ RNA interference (RNAi) to suppress invertebrate pests opens up new avenues for insect control. While this biotechnology shows tremendous promise, the potential for both non-target and off-target impacts, which likely manifest via altered mRNA expression in the exposed organisms, remains a major concern. One powerful tool for the analysis of these un-intended effects is reverse transcriptase-quantitative polymerase chain reaction, a technique for quantifying gene expression using a suite of reference genes for normalization. The seven-spotted ladybeetle Coccinella septempunctata , a commonly used predator in both classical and augmentative biological controls, is a model surrogate species used in the environmental risk assessment (ERA) of plant incorporated protectants (PIPs). Here, we assessed the suitability of eight reference gene candidates for the normalization and analysis of C. septempunctata v-ATPase A gene expression under both biotic and abiotic conditions. Five computational tools with distinct algorisms, geNorm, Normfinder, BestKeeper , the Δ C t method, and RefFinder , were used to evaluate the stability of these candidates. As a result, unique sets of reference genes were recommended, respectively, for experiments involving different developmental stages, tissues, and ingested dsRNAs. By providing a foundation for standardized RT-qPCR analysis in C. septempunctata , our work improves the accuracy and replicability of the ERA of PIPs involving RNAi transgenic plants.
Update on Genetic Conditions Affecting the Skin and the Kidneys
Reimer, Antonia; He, Yinghong; Has, Cristina
2018-01-01
Genetic conditions affecting the skin and kidney are clinically and genetically heterogeneous, and target molecular components present in both organs. The molecular pathology involves defects of cell–matrix adhesion, metabolic or signaling pathways, as well as tumor suppressor genes. This article gives a clinically oriented overview of this group of disorders, highlighting entities which have been recently described, as well as the progress made in understanding well-known entities. The genetic bases as well as molecular cell biological mechanisms are described, with therapeutic applications. PMID:29552546
A Functional Genomics Approach to Identify Novel Breast Cancer Gene Targets in Yeast
2004-05-01
AD Award Number: DAMD17-03-1-0232 TITLE: A Functional Genomics Approach to Identify Novel Breast Cancer Gene Targets in Yeast PRINCIPAL INVESTIGATOR...Approach to Identify Novel Breast DAMD17-03-1-0232 Cancer Gene Targets in Yeast 6. A UTHOR(S) Craig Bennett, Ph.D. 7. PERFORMING ORGANIZA TION NAME(S...Unlimited 13. ABSTRACT (Maximum 200 Words) We are using the yeast Saccharomyces cerevisiae to identify new cancer gene targets that interact with the
Fe₃O₄ Nanoparticles in Targeted Drug/Gene Delivery Systems.
Shen, Lazhen; Li, Bei; Qiao, Yongsheng
2018-02-23
Fe₃O₄ nanoparticles (NPs), the most traditional magnetic nanoparticles, have received a great deal of attention in the biomedical field, especially for targeted drug/gene delivery systems, due to their outstanding magnetism, biocompatibility, lower toxicity, biodegradability, and other features. Naked Fe₃O₄ NPs are easy to aggregate and oxidize, and thus are often made with various coatings to realize superior properties for targeted drug/gene delivery. In this review, we first list the three commonly utilized synthesis methods of Fe₃O₄ NPs, and their advantages and disadvantages. In the second part, we describe coating materials that exhibit noticeable features that allow functionalization of Fe₃O₄ NPs and summarize their methods of drug targeting/gene delivery. Then our efforts will be devoted to the research status and progress of several different functionalized Fe₃O₄ NP delivery systems loaded with chemotherapeutic agents, and we present targeted gene transitive carriers in detail. In the following section, we illuminate the most effective treatment systems of the combined drug and gene therapy. Finally, we propose opportunities and challenges of the clinical transformation of Fe₃O₄ NPs targeting drug/gene delivery systems.
Guo, Yabin; Levin, Henry L
2010-02-01
The biological impact of transposons on the physiology of the host depends greatly on the frequency and position of integration. Previous studies of Tf1, a long terminal repeat retrotransposon in Schizosaccharomyces pombe, showed that integration occurs at the promoters of RNA polymerase II (Pol II) transcribed genes. To determine whether specific promoters are preferred targets of integration, we sequenced large numbers of insertions using high-throughput pyrosequencing. In four independent experiments we identified a total of 73,125 independent integration events. These data provided strong support for the conclusion that Pol II promoters are the targets of Tf1 integration. The size and number of the integration experiments resulted in reproducible measures of integration for each intergenic region and ORF in the S. pombe genome. The reproducibility of the integration activity from experiment to experiment demonstrates that we have saturated the full set of insertion sites that are actively targeted by Tf1. We found Tf1 integration was highly biased in favor of a specific set of Pol II promoters. The overwhelming majority (76%) of the insertions were distributed in intergenic sequences that contained 31% of the promoters of S. pombe. Interestingly, there was no correlation between the amount of integration at these promoters and their level of transcription. Instead, we found Tf1 had a strong preference for promoters that are induced by conditions of stress. This targeting of stress response genes coupled with the ability of Tf1 to regulate the expression of adjacent genes suggests Tf1 may improve the survival of S. pombe when cells are exposed to environmental stress.
Guo, Yabin; Levin, Henry L.
2010-01-01
The biological impact of transposons on the physiology of the host depends greatly on the frequency and position of integration. Previous studies of Tf1, a long terminal repeat retrotransposon in Schizosaccharomyces pombe, showed that integration occurs at the promoters of RNA polymerase II (Pol II) transcribed genes. To determine whether specific promoters are preferred targets of integration, we sequenced large numbers of insertions using high-throughput pyrosequencing. In four independent experiments we identified a total of 73,125 independent integration events. These data provided strong support for the conclusion that Pol II promoters are the targets of Tf1 integration. The size and number of the integration experiments resulted in reproducible measures of integration for each intergenic region and ORF in the S. pombe genome. The reproducibility of the integration activity from experiment to experiment demonstrates that we have saturated the full set of insertion sites that are actively targeted by Tf1. We found Tf1 integration was highly biased in favor of a specific set of Pol II promoters. The overwhelming majority (76%) of the insertions were distributed in intergenic sequences that contained 31% of the promoters of S. pombe. Interestingly, there was no correlation between the amount of integration at these promoters and their level of transcription. Instead, we found Tf1 had a strong preference for promoters that are induced by conditions of stress. This targeting of stress response genes coupled with the ability of Tf1 to regulate the expression of adjacent genes suggests Tf1 may improve the survival of S. pombe when cells are exposed to environmental stress. PMID:20040583
Conditional Cytotoxic Anti-HIV Gene Therapy for Selectable Cell Modification
Garg, Himanshu; Joshi, Anjali
2016-01-01
Gene therapy remains one of the potential strategies to achieve a cure for HIV infection. One of the major limitations of anti-HIV gene therapy concerns recovering an adequate number of modified cells to generate an HIV-proof immune system. Our study addresses this issue by developing a methodology that can mark conditional vector-transformed cells for selection and subsequently target HIV-infected cells for elimination by treatment with ganciclovir (GCV). We used the herpes simplex virus thymidine kinase (TK) mutant SR39, which is highly potent at killing cells at low GCV concentrations. This gene was cloned into a conditional HIV vector, pNL-GFPRRESA, which expresses the gene of interest as well as green fluorescent protein (GFP) in the presence of HIV Tat protein. We show here that TK-SR39 was more potent that wild-type TK (TK-WT) at eliminating infected cells at lower concentrations of GCV. As the vector expresses GFP in the presence of Tat, transient expression of Tat either by Tat RNA transfection or transduction by a nonintegrating lentiviral (NIL) vector marked the cells with GFP for selection. In cells selected by this strategy, TK-SR39 was more potent at limiting virus replication than TK-WT. Finally, in Jurkat cells modified and selected by this approach, infection with CXCR4-tropic Lai virus could be suppressed by treatment with GCV. GCV treatment limited the number of HIV-infected cells, virus production, as well as virus-induced cytopathic effects in this model. We provide proof of principle that TK-SR39 in a conditional HIV vector can provide a safe and effective anti-HIV strategy. PMID:26800572
Conditional Cytotoxic Anti-HIV Gene Therapy for Selectable Cell Modification.
Garg, Himanshu; Joshi, Anjali
2016-05-01
Gene therapy remains one of the potential strategies to achieve a cure for HIV infection. One of the major limitations of anti-HIV gene therapy concerns recovering an adequate number of modified cells to generate an HIV-proof immune system. Our study addresses this issue by developing a methodology that can mark conditional vector-transformed cells for selection and subsequently target HIV-infected cells for elimination by treatment with ganciclovir (GCV). We used the herpes simplex virus thymidine kinase (TK) mutant SR39, which is highly potent at killing cells at low GCV concentrations. This gene was cloned into a conditional HIV vector, pNL-GFPRRESA, which expresses the gene of interest as well as green fluorescent protein (GFP) in the presence of HIV Tat protein. We show here that TK-SR39 was more potent that wild-type TK (TK-WT) at eliminating infected cells at lower concentrations of GCV. As the vector expresses GFP in the presence of Tat, transient expression of Tat either by Tat RNA transfection or transduction by a nonintegrating lentiviral (NIL) vector marked the cells with GFP for selection. In cells selected by this strategy, TK-SR39 was more potent at limiting virus replication than TK-WT. Finally, in Jurkat cells modified and selected by this approach, infection with CXCR4-tropic Lai virus could be suppressed by treatment with GCV. GCV treatment limited the number of HIV-infected cells, virus production, as well as virus-induced cytopathic effects in this model. We provide proof of principle that TK-SR39 in a conditional HIV vector can provide a safe and effective anti-HIV strategy.
2011-01-01
Background Following genome sequencing of crop plants, one of the main challenges today is determining the function of all the predicted genes. When gene validation approaches are used for woody species, the main obstacle is the low recovery rate of transgenic plants from elite or commercial cultivars. Embryogenic calli have frequently been the target tissue for transformation, but the difficulty in producing or maintaining embryogenic tissues is one of the main problems encountered in genetic transformation of many woody plants, including Coffea arabica. Results We identified the conditions required for successful long-term proliferation of embryogenic cultures in C. arabica and designed a highly efficient and reliable Agrobacterium tumefaciens-mediated transformation method based on these conditions. The transformation protocol with LBA1119 harboring pBin 35S GFP was established by evaluating the effect of different parameters on transformation efficiency by GFP detection. Using embryogenic callus cultures, co-cultivation with LBA1119 OD600 = 0.6 for five days at 20 °C enabled reproducible transformation. The maintenance conditions for the embryogenic callus cultures, particularly a high auxin to cytokinin ratio, the age of the culture (optimum for 7-10 months of proliferation) and the use of a yellow callus phenotype, were the most important factors for achieving highly efficient transformation (> 90%). At the histological level, successful transformation was related to the number of proembryogenic masses present. All the selected plants were proved to be transformed by PCR and Southern blot hybridization. Conclusion Most progress in increasing transformation efficiency in coffee has been achieved by optimizing the production conditions of embryogenic cultures used as target tissues for transformation. This is the first time that a strong positive effect of the age of the culture on transformation efficiency was demonstrated. Our results make Agrobacterium-mediated transformation of embryogenic cultures a viable and useful tool both for coffee breeding and for the functional analysis of agronomically important genes. PMID:21595964
Identification and characterization of nuclear genes involved in photosynthesis in Populus
2014-01-01
Background The gap between the real and potential photosynthetic rate under field conditions suggests that photosynthesis could potentially be improved. Nuclear genes provide possible targets for improving photosynthetic efficiency. Hence, genome-wide identification and characterization of the nuclear genes affecting photosynthetic traits in woody plants would provide key insights on genetic regulation of photosynthesis and identify candidate processes for improvement of photosynthesis. Results Using microarray and bulked segregant analysis strategies, we identified differentially expressed nuclear genes for photosynthesis traits in a segregating population of poplar. We identified 515 differentially expressed genes in this population (FC ≥ 2 or FC ≤ 0.5, P < 0.05), 163 up-regulated and 352 down-regulated. Real-time PCR expression analysis confirmed the microarray data. Singular Enrichment Analysis identified 48 significantly enriched GO terms for molecular functions (28), biological processes (18) and cell components (2). Furthermore, we selected six candidate genes for functional examination by a single-marker association approach, which demonstrated that 20 SNPs in five candidate genes significantly associated with photosynthetic traits, and the phenotypic variance explained by each SNP ranged from 2.3% to 12.6%. This revealed that regulation of photosynthesis by the nuclear genome mainly involves transport, metabolism and response to stimulus functions. Conclusions This study provides new genome-scale strategies for the discovery of potential candidate genes affecting photosynthesis in Populus, and for identification of the functions of genes involved in regulation of photosynthesis. This work also suggests that improving photosynthetic efficiency under field conditions will require the consideration of multiple factors, such as stress responses. PMID:24673936
Dorval, Véronique; Smith, Pascal Y; Delay, Charlotte; Calvo, Ezequiel; Planel, Emmanuel; Zommer, Nadège; Buée, Luc; Hébert, Sébastien S
2012-01-01
The small non-protein-coding microRNAs (miRNAs) have emerged as critical regulators of neuronal differentiation, identity and survival. To date, however, little is known about the genes and molecular networks regulated by neuronal miRNAs in vivo, particularly in the adult mammalian brain. We analyzed whole genome microarrays from mice lacking Dicer, the enzyme responsible for miRNA production, specifically in postnatal forebrain neurons. A total of 755 mRNA transcripts were significantly (P<0.05, FDR<0.25) misregulated in the conditional Dicer knockout mice. Ten genes, including Tnrc6c, Dnmt3a, and Limk1, were validated by real time quantitative RT-PCR. Upregulated transcripts were enriched in nonneuronal genes, which is consistent with previous studies in vitro. Microarray data mining showed that upregulated genes were enriched in biological processes related to gene expression regulation, while downregulated genes were associated with neuronal functions. Molecular pathways associated with neurological disorders, cellular organization and cellular maintenance were altered in the Dicer mutant mice. Numerous miRNA target sites were enriched in the 3'untranslated region (3'UTR) of upregulated genes, the most significant corresponding to the miR-124 seed sequence. Interestingly, our results suggest that, in addition to miR-124, a large fraction of the neuronal miRNome participates, by order of abundance, in coordinated gene expression regulation and neuronal maintenance. Taken together, these results provide new clues into the role of specific miRNA pathways in the regulation of brain identity and maintenance in adult mice.
Heterologous gene expression driven by carbonic anhydrase gene promoter in Dunaliella salina
NASA Astrophysics Data System (ADS)
Chai, Yurong; Lu, Yumin; Wang, Tianyun; Hou, Weihong; Xue, Lexun
2006-12-01
Dunaliella salina, a halotolerant unicellular green alga without a rigid cell wall, can live in salinities ranging from 0.05 to 5 mol/L NaCl. These features of D. salina make it an ideal host for the production of antibodies, oral vaccine, and commercially valuable polypeptides. To produce high level of heterologous proteins from D. salina, highly efficient promoters are required to drive expression of target genes under controlled condition. In the present study, we cloned a 5' franking region of 1.4 kb from the carbonic anhydrase ( CAH) gene of D. salina by genomic walking and PCR. The fragment was ligated to the pMD18-T vector and characterized. Sequence analysis indicated that this region contained conserved motifs, including a TATA- like box and CAAT-box. Tandem (GT)n repeats that had a potential role of transcriptional control, were also found in this region. The transcription start site (TSS) of the CAH gene was determined by 5' RACE and nested PCR method. Transformation assays showed that the 1.4 kb fragment was able to drive expression of the selectable bar (bialaphos resistance) gene when the fusion was transformed into D. salina by biolistics. Northern blotting hybridizations showed that the bar transcript was most abundant in cells grown in 2 mol/L NaCl, and less abundant in 0.5 mol/L NaCl, indicating that expression of the bar gene was induced at high salinity. These results suggest the potential use of the CAH gene promoter to induce the expression of heterologous genes in D. salina under varied salt condition.
Gene Network for Identifying the Entropy Changes of Different Modules in Pediatric Sepsis.
Yang, Jing; Zhang, Pingli; Wang, Lumin
2016-01-01
Pediatric sepsis is a disease that threatens life of children. The incidence of pediatric sepsis is higher in developing countries due to various reasons, such as insufficient immunization and nutrition, water and air pollution, etc. Exploring the potential genes via different methods is of significance for the prevention and treatment of pediatric sepsis. This study aimed to identify potential genes associated with pediatric sepsis utilizing analysis of gene network and entropy. The mRNA expression in the blood samples collected from 20 septic children and 30 healthy controls was quantified by using Affymetrix HG-U133A microarray. Two condition-specific protein-protein interaction networks (PINs), one for the healthy control and the other one for the children with sepsis, were deduced by combining the fundamental human PINs with gene expression profiles in the two phenotypes. Subsequently, distinct modules from the two conditional networks were extracted by adopting a maximal clique-merging approach. Delta entropy (ΔS) was calculated between sepsis and control modules. Then, key genes displaying changes in gene composition were identified by matching the control and sepsis modules. Two objective modules were obtained, in which ribosomal protein RPL4 and RPL9 as well as TOP2A were probably considered as the key genes differentiating sepsis from healthy controls. According to previous reports and this work, TOP2A is the potential gene therapy target for pediatric sepsis. The relationship between pediatric sepsis and RPL4 and RPL9 needs further investigation. © 2016 The Author(s) Published by S. Karger AG, Basel.
Ferreira, Ana M; Tuominen, Iina; Sousa, Sónia; Gerbens, Frans; van Dijk-Bos, Krista; Osinga, Jan; Kooi, Krista A; Sanjabi, Bahram; Esendam, Chris; Oliveira, Carla; Terpstra, Peter; Hardonk, Menno; van der Sluis, Tineke; Zazula, Monika; Stachura, Jerzy; van der Zee, Ate G; Hollema, Harry; Sijmons, Rolf H; Aaltonen, Lauri A; Seruca, Raquel; Hofstra, Robert M W; Westers, Helga
2014-12-01
Microsatellite instability (MSI) in tumors results in an accumulation of mutations in (target) genes. Previous studies suggest that the profile of target genes differs according to tumor type. This paper describes the first genome-wide search for target genes for mismatch repair-deficient endometrial cancers. Genes expressed in normal endometrium containing coding repeats were analyzed for mutations in tumors. We identified 44 possible genes of which seven are highly mutated (>15%). Some candidates were also found mutated in colorectal and gastric tumors. The most frequently mutated gene, NRIP1 encoding nuclear receptor-interacting protein 1, was silenced in an endometrial tumor cell line and expression microarray experiments were performed. Silencing of NRIP1 was associated with differences in the expression of several genes in the estrogen-receptor network. Furthermore, an enrichment of genes related to cell cycle (regulation) and replication was observed. We present a new profile of target genes, some of them tissue specific, whereas others seem to play a more general role in MSI tumors. The high-mutation frequency combined with the expression data suggest, for the first time, an involvement of NRIP1 in endometrial cancer development. © 2014 WILEY PERIODICALS, INC.
Remodeling of ribosomal genes in somatic cells by Xenopus egg extract
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ostrup, Olga, E-mail: osvarcova@gmail.com; Stem Cell Epigenetics Laboratory, Institute of Basic Medical Sciences, Faculty of Medicine, University of Oslo, Oslo; Norwegian Center for Stem Cell Research, Oslo
Highlights: {yields} Xenopus egg extract remodels nuclei and alter cell growth characteristics. {yields} Ribosomal genes are reprogrammed within 6 h after extract exposure. {yields} rDNA reprogramming involves promoter targeting of SNF2H remodeling complex. {yields} Xenopus egg extract does not initiate stress-related response in somatic cells. {yields} Aza-cytidine elicits a stress-induced response in reprogrammed cells. -- Abstract: Extracts from Xenopus eggs can reprogram gene expression in somatic nuclei, however little is known about the earliest processes associated with the switch in the transcriptional program. We show here that an early reprogramming event is the remodeling of ribosomal chromatin and gene expression.more » This occurs within hours of extract treatment and is distinct from a stress response. Egg extract elicits remodeling of the nuclear envelope, chromatin and nucleolus. Nucleolar remodeling involves a rapid and stable decrease in ribosomal gene transcription, and promoter targeting of the nucleolar remodeling complex component SNF2H without affecting occupancy of the transcription factor UBF and the stress silencers SUV39H1 and SIRT1. During this process, nucleolar localization of UBF and SIRT1 is not altered. On contrary, azacytidine pre-treatment has an adverse effect on rDNA remodeling induced by extract and elicits a stress-type nuclear response. Thus, an early event of Xenopus egg extract-mediated nuclear reprogramming is the remodeling of ribosomal genes involving nucleolar remodeling complex. Condition-specific and rapid silencing of ribosomal genes may serve as a sensitive marker for evaluation of various reprogramming methods.« less
Methylation and microRNA-mediated epigenetic regulation of SOCS3
Boosani, Chandra S.; Agrawal, Devendra K.
2017-01-01
Epigenetic gene silencing of several genes causes different pathological conditions in humans, and DNA methylation has been identified as one of the key mechanisms that underlie this evolutionarily conserved phenomenon associated with developmental and pathological gene regulation. Recent advances in the miRNA technology with high throughput analysis of gene regulation further increased our understanding on the role of miRNAs regulating multiple gene expression. There is increasing evidence supporting that the miRNAs not only regulate gene expression but they also are involved in the hypermethylation of promoter sequences, which cumulatively contributes to the epigenetic gene silencing. Here, we critically evaluated the recent progress on the transcriptional regulation of an important suppressor protein that inhibits cytokine-mediated signaling, SOCS3, whose expression is directly regulated both by promoter methylation and also by microRNAs, affecting its vital cell regulating functions. SOCS3 was identified as a potent inhibitor of Jak/STAT signaling pathway which is frequently upregulated in several pathologies, including cardiovascular disease, cancer, diabetes, viral infections, and the expression of SOCS3 was inhibited or greatly reduced due to hypermethylation of the CpG islands in its promoter region or suppression of its expression by different microRNAs. Additionally, we discuss key intracellular signaling pathways regulated by SOCS3 involving cellular events, including cell proliferation, cell growth, cell migration and apoptosis. Identification of the pathway intermediates as specific targets would not only aid in the development of novel therapeutic drugs, but, would also assist in developing new treatment strategies that could successfully be employed in combination therapy to target multiple signaling pathways. PMID:25682267
Dziedzic, Slawomir A; Caplan, Allan B
2011-05-01
Eukaryotes use a common set of genes to perform two mechanistically similar autophagic processes. Bulk autophagy harvests proteins nonselectively and reuses their constitutents when nutrients are scarce. In contrast, different forms of selective autophagy target protein aggregates or damaged organelles that threaten to interfere with growth. Yeast uses one form of selective autophagy, called cytoplasm-to-vacuole targeting (Cvt), to engulf two vacuolar enzymes in Cvt vesicles ("CVT-somes") within which they are transported to vacuoles for maturation. While both are dispensable normally, bulk and selective autophagy help sustain life under stressful conditions. Consistent with this view, knocking out several genes participating in Cvt and specialized autophagic pathways heightened the sensitivity of Saccharomyces cerevisiae to inhibitory levels of Zn(2+). The loss of other autophagic genes, and genes responsible for apoptotic cell death, had no such effect. Unexpectedly, the loss of members of a third set of autophagy genes heightened cellular resistance to zinc as if they encoded proteins that actively contributed to zinc-induced cell death. Further studies showed that both sensitive and resistant strains accumulated similar amounts of H2O2 during zinc treatments, but that more sensitive strains showed signs of necrosis sooner. Although zinc lethality depended on autophagic proteins, studies with several reporter genes failed to reveal increased autophagic activity. In fact, microscopy analysis indicated that Zn(2+) partially inhibited fusion of Cvt vesicles with vacuoles. Further studies into how the loss of autophagic processes suppressed necrosis in yeast might reveal whether a similar process could occur in plants and animals.
S-nitrosylation in the regulation of gene transcription☆
Sha, Yonggang; Marshall, Harvey E.
2015-01-01
Background Post-translational modification of proteins by S-nitrosylation serves as a major mode of signaling in mammalian cells and a growing body of evidence has shown that transcription factors and their activating pathways are primary targets. S-nitrosylation directly modifies a number of transcription factors, including NF-κB, HIF-1, and AP-1. In addition, S-nitrosylation can indirectly regulate gene transcription by modulating other cell signaling pathways, in particular JNK kinase and ras. Scope of review The evolution of S-nitrosylation as a signaling mechanism in the regulation of gene transcription, physiological advantages of protein S-nitrosylation in the control of gene transcription, and discussion of the many transcriptional proteins modulated by S-nitrosylation is summarized. Major conclusions S-nitrosylation plays a crucial role in the control of mammalian gene transcription with numerous transcription factors regulated by this modification. Many of these proteins serve as immunomodulators, and inducible nitric oxide synthase (iNOS) is regarded as a principal mediatiator of NO-dependent S-nitrosylation. However, additional targets within the nucleus (e.g. histone deacetylases) and alternative mechanisms of S-nitrosylation (e.g. GAPDH-mediated trans-nitrosylation) are thought to play a role in NOS-dependent transcriptional regulation. General significance Derangement of SNO-regulated gene transcription is an important factor in a variety of pathological conditions including neoplasia and sepsis. A better understanding of protein S-nitrosylation as it relates to gene transcription and the physiological mechanisms behind this process is likely to lead to novel therapies for these disorders. This article is part of a Special Issue entitled Regulation of Cellular Processes by S-nitrosylation. PMID:21640163
Emerging Major Histocompatibility Complex Class I-Related Functions of NLRC5.
Chelbi, S T; Dang, A T; Guarda, G
2017-01-01
Recent evidence demonstrates a key role for the nucleotide-binding oligomerization domain-like receptor (NLR) family member NLRC5 (NLR family, CARD domain containing protein 5) in the transcriptional regulation of major histocompatibility complex (MHC) class I and related genes. Detailed information on NLRC5 target genes in various cell types and conditions is emerging. Thanks to its analogy to CIITA (class II major MHC transactivator), a NLR family member known for over 20 years to be the master regulator of MHC class II gene transcription, also the molecular mechanisms underlying NLRC5 function are being rapidly unraveled. MHC class I molecules are crucial in regulating innate and adaptive cytotoxic responses. Whereas CD8 + T cells detect antigens presented on MHC class I molecules by infected or transformed cells, natural killer (NK) lymphocytes eliminate target cells with downregulated MHC class I expression. Data uncovering the relevance of NLRC5 in homeostasis and activity of these two lymphocyte subsets have been recently reported. Given the importance of CD8 + T and NK cells in controlling infection and cancer, it is not surprising that NLRC5 is also starting to emerge as a central player in these diseases. This chapter summarizes and discusses novel insights into the molecular mechanisms underlying NLRC5 activity and its relevance to pathological conditions. A thorough understanding of both aspects is essential to evaluate the clinical significance and therapeutic potential of NLRC5. © 2017 Elsevier Inc. All rights reserved.
Shaibani, Aziz; Wong, Lee-Jun; Wei Zhang, Victor; Lewis, Richard Alan; Shinawi, Marwan
2015-01-01
Posterior column ataxia with retinitis pigmentosa (PCARP) is an autosomal recessive disorder characterized by severe sensory ataxia, muscle weakness and atrophy, and progressive pigmentary retinopathy. Recently, mutations in the FLVCR1 gene were described in four families with this condition. We investigated the molecular basis and studied the phenotype of PCARP in a new family. The proband is a 33-year-old woman presented with sensory polyneuropathy and retinitis pigmentosa (RP). The constellation of clinical findings with normal metabolic and genetic evaluation, including mitochondrial DNA (mtDNA) analysis and normal levels of phytanic acid and vitamin E, prompted us to seek other causes of our patient's condition. Sequencing of FLVCR1 in the proband and targeted mutation testing in her two affected siblings revealed two novel variants, c.1547G > A (p.R516Q) and c.1593+5_+8delGTAA predicted, respectively, to be highly conserved throughout evolution and affecting the normal splicing, therefore, deleterious. This study supports the pathogenic role of FLVCR1 in PCARP and expands the molecular and clinical spectra of PCARP. We show for the first time that nontransmembrane domain (TMD) mutations in the FLVCR1 can cause PCARP, suggesting different mechanisms for pathogenicity. Our clinical data reveal that impaired sensation can be part of the phenotypic spectrum of PCARP. This study along with previously reported cases suggests that targeted sequencing of the FLVCR1 gene should be considered in patients with severe sensory ataxia, RP, and peripheral sensory neuropathy.
Xiong, Mengneng; Zhu, Zhiping; Tian, Suwen; Zhu, Ruping; Bai, Shun; Fu, Kaiqiang; Davis, James G; Sun, Zheng; Baur, Joseph A; Zheng, Ke; Ye, Lan
2017-09-01
Rapamycin is a clinically important drug that is used in transplantation and cancer therapy but which causes a number of side effects, including male infertility. Its canonical target, mammalian target of rapamycin complex 1 (mTORC1), plays a key role in metabolism and binds chromatin; however, its precise role in the male germline has not been elucidated. Here, we inactivate the core component, Raptor, to show that mTORC1 function is critical for male meiosis and the inactivation of sex chromosomes. Disruption of the Raptor gene impairs chromosomal synapsis and prevents the efficient spreading of silencing factors into the XY chromatin. Accordingly, mRNA for XY-linked genes remains inappropriately expressed in Raptor -deficient mice. Molecularly, the failure to suppress gene expression corresponded with deficiencies in 2 repressive chromatin markers, H3K9 dimethylation and H3K9 trimethylation, in the XY body. Together, these results demonstrate that mTORC1 has an essential role in the meiotic progression and silencing of sex chromosomes in the male germline, which may explain the infertility that has been associated with such inhibitors as rapamycin.-Xiong, M., Zhu, Z., Tian, S., Zhu, R., Bai, S., Fu, K., Davis, J. G., Sun, Z., Baur, J. A., Zheng, K., Ye, L. Conditional ablation of Raptor in the male germline causes infertility due to meiotic arrest and impaired inactivation of sex chromosomes. © FASEB.
Conditional knockout of retinal determination genes in differentiating cells in Drosophila.
Jin, Meng; Eblimit, Aiden; Pulikkathara, Merlyn; Corr, Stuart; Chen, Rui; Mardon, Graeme
2016-08-01
Conditional gene knockout in postmitotic cells is a valuable technique which allows the study of gene function with spatiotemporal control. Surprisingly, in contrast to its long-term and extensive use in mouse studies, this technology is lacking in Drosophila. Here, we use a novel method for generating complete loss of eyes absent (eya) or sine oculis (so) function in postmitotic cells posterior to the morphogenetic furrow (MF). Specifically, genomic rescue constructs with flippase recognition target (FRT) sequences flanking essential exons are used to generate conditional null alleles. By removing gene function in differentiating cells, we show that eya and so are dispensable for larval photoreceptor differentiation, but are required for differentiation during pupal development. Both eya and so are necessary for photoreceptor survival and the apoptosis caused by loss of eya or so function is likely a secondary consequence of inappropriate differentiation. We also confirm their requirement for cone cell development and reveal a novel role in interommatidial bristle (IOB) formation. In addition, so is required for normal eye disc morphology. This is the first report of a knockout method to study eya and so function in postmitotic cells. This technology will open the door to a large array of new functional studies in virtually any tissue and at any stage of development or in adults. © 2016 Federation of European Biochemical Societies.
The druggable genome and support for target identification and validation in drug development.
Finan, Chris; Gaulton, Anna; Kruger, Felix A; Lumbers, R Thomas; Shah, Tina; Engmann, Jorgen; Galver, Luana; Kelley, Ryan; Karlsson, Anneli; Santos, Rita; Overington, John P; Hingorani, Aroon D; Casas, Juan P
2017-03-29
Target identification (determining the correct drug targets for a disease) and target validation (demonstrating an effect of target perturbation on disease biomarkers and disease end points) are important steps in drug development. Clinically relevant associations of variants in genes encoding drug targets model the effect of modifying the same targets pharmacologically. To delineate drug development (including repurposing) opportunities arising from this paradigm, we connected complex disease- and biomarker-associated loci from genome-wide association studies to an updated set of genes encoding druggable human proteins, to agents with bioactivity against these targets, and, where there were licensed drugs, to clinical indications. We used this set of genes to inform the design of a new genotyping array, which will enable association studies of druggable genes for drug target selection and validation in human disease. Copyright © 2017, American Association for the Advancement of Science.
Antibody targeting KIT as pretransplantation conditioning in immunocompetent mice.
Xue, Xingkui; Pech, Nancy K; Shelley, W Christopher; Srour, Edward F; Yoder, Mervin C; Dinauer, Mary C
2010-12-09
Inherited hematologic defects that lack an in vivo selective advantage following gene correction may benefit from effective yet minimally toxic cytoreduction of endogenous hematopoietic stem cells (HSCs) prior to transplantation of gene-modified HSCs. We studied the efficacy of administering a novel sequential treatment of parenteral ACK2, an antibody that blocks KIT, followed by low-dose irradiation (LD-IR) for conditioning of wild-type and X-linked chronic granulomatous disease (X-CGD) mice. In wild-type mice, combining ACK2 and LD-IR profoundly decreased endogenous competitive long-term HSC repopulating activity, and permitted efficient and durable donor-derived HSC engraftment after congenic transplantation. ACK2 alone was ineffective. The combination of ACK2 and LD-IR was also effective conditioning in X-CGD mice for engraftment of X-CGD donor HSCs transduced ex vivo with a lentiviral vector. We conclude that combining ACK2 with LD-IR is a promising approach to effectively deplete endogenous HSCs and facilitate engraftment of transplanted donor HSCs.
Stiefel, Philipp; Zambelli, Tomaso
2013-01-01
In their natural environment, bacteria often behave differently than they do under laboratory conditions. To gain insight into the physiology of bacteria in situ, dedicated approaches are required to monitor their adaptations and specific behaviors under environmental conditions. Optical microscopy is crucial for the observation of fundamental characteristics of bacteria, such as cell shape, size, and marker gene expression. Here, fluidic force microscopy (FluidFM) was exploited to isolate optically selected bacteria for subsequent identification and characterization. In this study, bacteriochlorophyll-producing bacteria, which can be visualized due to their characteristic fluorescence in the infrared range, were isolated from leaf washes. Bacterial communities from the phyllosphere were investigated because they harbor genes indicative of aerobic anoxygenic photosynthesis. Our data show that different species of Methylobacterium express their photosystem in planta, and they show a distinct pattern of bacteriochlorophyll production under laboratory conditions that is dependent on supplied carbon sources. PMID:23770907
DIANA-microT web server: elucidating microRNA functions through target prediction.
Maragkakis, M; Reczko, M; Simossis, V A; Alexiou, P; Papadopoulos, G L; Dalamagas, T; Giannopoulos, G; Goumas, G; Koukis, E; Kourtis, K; Vergoulis, T; Koziris, N; Sellis, T; Tsanakas, P; Hatzigeorgiou, A G
2009-07-01
Computational microRNA (miRNA) target prediction is one of the key means for deciphering the role of miRNAs in development and disease. Here, we present the DIANA-microT web server as the user interface to the DIANA-microT 3.0 miRNA target prediction algorithm. The web server provides extensive information for predicted miRNA:target gene interactions with a user-friendly interface, providing extensive connectivity to online biological resources. Target gene and miRNA functions may be elucidated through automated bibliographic searches and functional information is accessible through Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways. The web server offers links to nomenclature, sequence and protein databases, and users are facilitated by being able to search for targeted genes using different nomenclatures or functional features, such as the genes possible involvement in biological pathways. The target prediction algorithm supports parameters calculated individually for each miRNA:target gene interaction and provides a signal-to-noise ratio and a precision score that helps in the evaluation of the significance of the predicted results. Using a set of miRNA targets recently identified through the pSILAC method, the performance of several computational target prediction programs was assessed. DIANA-microT 3.0 achieved there with 66% the highest ratio of correctly predicted targets over all predicted targets. The DIANA-microT web server is freely available at www.microrna.gr/microT.
Trayhurn, Paul; Denyer, Gareth
2012-01-01
Microarray datasets are a rich source of information in nutritional investigation. Targeted mining of microarray data following initial, non-biased bioinformatic analysis can provide key insight into specific genes and metabolic processes of interest. Microarrays from human adipocytes were examined to explore the effects of macrophage secretions on the expression of the G-protein-coupled receptor (GPR) genes that encode fatty acid receptors/sensors. Exposure of the adipocytes to macrophage-conditioned medium for 4 or 24 h had no effect on GPR40 and GPR43 expression, but there was a marked stimulation of GPR84 expression (receptor for medium-chain fatty acids), the mRNA level increasing 13·5-fold at 24 h relative to unconditioned medium. Importantly, expression of GPR120, which encodes an n-3 PUFA receptor/sensor, was strongly inhibited by the conditioned medium (15-fold decrease in mRNA at 24 h). Macrophage secretions have major effects on the expression of fatty acid receptor/sensor genes in human adipocytes, which may lead to an augmentation of the inflammatory response in adipose tissue in obesity.
Trayhurn, Paul; Denyer, Gareth
2012-01-01
Microarray datasets are a rich source of information in nutritional investigation. Targeted mining of microarray data following initial, non-biased bioinformatic analysis can provide key insight into specific genes and metabolic processes of interest. Microarrays from human adipocytes were examined to explore the effects of macrophage secretions on the expression of the G-protein-coupled receptor (GPR) genes that encode fatty acid receptors/sensors. Exposure of the adipocytes to macrophage-conditioned medium for 4 or 24 h had no effect on GPR40 and GPR43 expression, but there was a marked stimulation of GPR84 expression (receptor for medium-chain fatty acids), the mRNA level increasing 13·5-fold at 24 h relative to unconditioned medium. Importantly, expression of GPR120, which encodes an n-3 PUFA receptor/sensor, was strongly inhibited by the conditioned medium (15-fold decrease in mRNA at 24 h). Macrophage secretions have major effects on the expression of fatty acid receptor/sensor genes in human adipocytes, which may lead to an augmentation of the inflammatory response in adipose tissue in obesity. PMID:25191551
Guelke, Eileen; Bucan, Vesna; Liebsch, Christina; Lazaridis, Andrea; Radtke, Christine; Vogt, Peter M; Reimers, Kerstin
2015-04-10
For the precise quantitative RT-PCR normalization a set of valid reference genes is obligatory. Moreover have to be taken into concern the experimental conditions as they bias the regulation of reference genes. Up till now, no reference targets have been described for the axolotl (Ambystoma mexicanum). In a search in the public database SalSite for genetic information of the axolotl we identified fourteen presumptive reference genes, eleven of which were further tested for their gene expression stability. This study characterizes the expressional patterns of 11 putative endogenous control genes during axolotl limb regeneration and in an axolotl tissue panel. All 11 reference genes showed variable expression. Strikingly, ACTB was to be found most stable expressed in all comparative tissue groups, so we reason it to be suitable for all different kinds of axolotl tissue-type investigations. Moreover do we suggest GAPDH and RPLP0 as suitable for certain axolotl tissue analysis. When it comes to axolotl limb regeneration, a validated pair of reference genes is ODC and RPLP0. With these findings, new insights into axolotl gene expression profiling might be gained. Copyright © 2015 Elsevier B.V. All rights reserved.
Gunia, Sven; Koch, Stefan; Hakenberg, Oliver W; May, Matthias; Kakies, Christoph; Erbersdobler, Andreas
2011-12-01
We evaluated HER2 expression profiles in 32 carcinoma in situ (CIS) and 31 non-CIS conditions (5 dysplasia and 26 reactive atypia) of the urinary bladder mucosa by applying breast cancer scoring rules. In situ hybridization was performed on tissue microarrays to assess HER2 gene amplification status. Our immunoprofiling data disclosed moderate to strong HER2 expression in CIS, including the basal layer of the urothelium, and absent to weak HER2 expression in non-CIS conditions. From the histologic differential diagnostic standpoint, immunostaining for HER2 protein represents a useful adjunct to aid in the delineation between CIS and non-CIS conditions of the bladder mucosa. Pathogenically, aberrant HER2 protein expression in CIS seems to be more commonly associated with polysomy than with gene amplification. From a therapeutic viewpoint, prospective clinical studies should investigate the potential benefit of HER2-targeted therapies in CIS, particularly in cases unresponsive to conventional therapeutic regimens.
Blaeser, Frank; Sanders, Matthew J; Truong, Nga; Ko, Shanelle; Wu, Long Jun; Wozniak, David F; Fanselow, Michael S; Zhuo, Min; Chatila, Talal A
2006-12-01
Signaling by the Ca(2+)/calmodulin kinase (CaMK) cascade has been implicated in neuronal gene transcription, synaptic plasticity, and long-term memory consolidation. The CaM kinase kinase alpha (CaMKKalpha) isoform is an upstream component of the CaMK cascade whose function in different behavioral and learning and memory paradigms was analyzed by targeted gene disruption in mice. CaMKKalpha mutants exhibited normal long-term spatial memory formation and cued fear conditioning but showed deficits in context fear during both conditioning and long-term follow-up testing. They also exhibited impaired activation of the downstream kinase CaMKIV/Gr and its substrate, the transcription factor cyclic AMP-responsive element binding protein (CREB) upon fear conditioning. Unlike CaMKIV/Gr-deficient mice, the CaMKKalpha mutants exhibited normal long-term potentiation and normal levels of anxiety-like behavior. These results demonstrate a selective role for CaMKKalpha in contextual fear memory and suggest that different combinations of upstream and downstream components of the CaMK cascade may serve distinct physiological functions.