Weiss, Shay; Kobiler, David; Levy, Haim; Marcus, Hadar; Pass, Avi; Rothschild, Nili; Altboum, Zeev
2006-01-01
Correlates between immunological parameters and protection against Bacillus anthracis infection in animals vaccinated with protective antigen (PA)-based vaccines could provide surrogate markers to evaluate the putative protective efficiency of immunization in humans. In previous studies we demonstrated that neutralizing antibody levels serve as correlates for protection in guinea pigs (S. Reuveny et al., Infect. Immun. 69:2888-2893, 2001; H. Marcus et al., Infect. Immun. 72:3471-3477, 2004). In this study we evaluated similar correlates for protection by active and passive immunization of New Zealand White rabbits. Full immunization and partial immunization were achieved by single and multiple injections of standard and diluted doses of a PA-based vaccine. Passive immunization was carried out by injection of immune sera from rabbits vaccinated with PA-based vaccine prior to challenge with B. anthracis spores. Immunized rabbits were challenged by intranasal spore instillation with one of two virulent strains (strains Vollum and ATCC 6605). The immune competence was estimated by measuring the level of total anti-PA antibodies, the neutralizing antibody titers, and the conferred protective immunity. The results indicate that total anti-PA antibody titers greater than 1 x 10(5) conferred protection, whereas lower titers (between 10(4) and 10(5)) provided partial protection but failed to predict protection. Neutralizing antibody titers between 500 and 800 provided partial protection, while titers higher than 1,000 conferred protection. In conclusion, this study emphasizes that regardless of the immunization regimen or the time of challenge, neutralizing antibody titers are better predictors of protection than total anti-PA titers.
Negi, Vidya Devi; Nagarajan, Arvindhan G.; Chakravortty, Dipshikha
2010-01-01
Pregnancy is a transient immuno-compromised condition which has evolved to avoid the immune rejection of the fetus by the maternal immune system. The altered immune response of the pregnant female leads to increased susceptibility to invading pathogens, resulting in abortion and congenital defects of the fetus and a subnormal response to vaccination. Active vaccination during pregnancy may lead to abortion induced by heightened cell mediated immune response. In this study, we have administered the highly attenuated vaccine strain ΔpmrG-HM-D (DV-STM-07) in female mice before the onset of pregnancy and followed the immune reaction against challenge with virulent S. Typhimurium in pregnant mice. Here we demonstrate that DV-STM-07 vaccine gives protection against Salmonella in pregnant mice and also prevents Salmonella induced abortion. This protection is conferred by directing the immune response towards Th2 activation and Th1 suppression. The low Th1 response prevents abortion. The use of live attenuated vaccine just before pregnancy carries the risk of transmission to the fetus. We have shown that this vaccine is safe as the vaccine strain is quickly eliminated from the mother and is not transmitted to the fetus. This vaccine also confers immunity to the new born mice of vaccinated mothers. Since there is no evidence of the vaccine candidate reaching the new born mice, we hypothesize that it may be due to trans-colostral transfer of protective anti-Salmonella antibodies. These results suggest that our vaccine DV-STM-07 can be very useful in preventing abortion in the pregnant individuals and confer immunity to the new born. Since there are no such vaccine candidates which can be given to the new born and to the pregnant women, this vaccine holds a very bright future to combat Salmonella induced pregnancy loss. PMID:20161765
Recurrent generalized tetanus: a case report.
Alhaji, M A; Mustapha, M G; Ashir, G M; Akuhwa, R T; Bello, M A; Farouk, A G
2011-04-01
We describe recurrent generalized tetanus in a four-year-old unimmunized boy following recurrent suppurative otitis media (SOM) within an 11-month period. There are not many published reports on recurrent tetanus. We highlight the importance of both primary immunizations and the need for active immunization before discharge as the infection does not confer a lifelong immunity. The usefulness of booster doses of tetanus toxoid and missed opportunities for immunization are emphasized.
ERIC Educational Resources Information Center
Bouchard, Claude; And Others
1995-01-01
Presents eight papers: "Physical Activity and Health"; "Exercise and Physical Health"; "Exercise and Physical Health: Cancer and Immune Function"; "Exercise and Psychosocial Health"; "Physical Activity, Health, and Wellbeing at Different Life Stages"; "Descriptive Epidemiology of…
Granoff, Dan M
2009-06-24
Killing of Neisseria meningitidis can result from complement-mediated serum bactericidal activity (SBA) or opsonophagocytosis (OPA), or a combination of the two mechanisms. While SBA titers > or =1:4 confer protection, recent evidence suggests that this threshold titer may not be required. For example, the incidence of meningococcal disease declines between ages 1 and 4 years without evidence of acquisition of SBA titers > or =1:4. Meningococcal polysaccharide vaccination also elicited OPA and lowered the risk of disease in patients with late complement component deficiencies whose sera did not support SBA. Sera from healthy adults immunized with an outer membrane vesicle vaccine showed OPA killing of N. meningitidis with C6-depleted complement, and whole blood from complement-sufficient non-immunized adults with SBA titers <1:4 also frequently had killing activity. Collectively the data indicate that SBA titers <1:4 and/or vaccine-induced OPA can confer protection against meningococcal disease.
Granoff, Dan M.
2009-01-01
Killing of Neisseria meningitidis can result from complement-mediated bactericidal activity (SBA) or opsonophagocytosis (OPA), or a combination of the two mechanisms. While SBA titers ≥1:4 confer protection, recent evidence suggests that this threshold titer may not be required. For example, the incidence of meningococcal disease declines between ages 1 and 4 years without evidence of acquisition of SBA titers ≥1:4. Meningococcal polysaccharide vaccination also elicited OPA and lowered the risk of disease in patients with late complement component deficiencies whose sera did not support SBA. Sera from healthy adults immunized with an outer membrane vesicle vaccine showed OPA killing of N. meningitidis with C6-depleted complement, and whole blood from complement-sufficient non-immunized adults with SBA titers <1:4 also frequently had killing activity. Collectively the data indicate that SBA titers <1:4 and/or vaccine-induced OPA can confer protection against meningococcal disease. PMID:19477054
Merkel, Tod J; Perera, Pin-Yu; Lee, Gloria M; Verma, Anita; Hiroi, Toyoko; Yokote, Hiroyuki; Waldmann, Thomas A; Perera, Liyanage P
2013-01-01
An intense effort has been launched to develop improved anthrax vaccines that confer rapid, long lasting protection preferably with an extended stability profile amenable for stockpiling. Protective antigen (PA)-based vaccines are most favored as immune responses directed against PA are singularly protective, although the actual protective mechanism remains to be unraveled. Herein we show that contrary to the prevailing view, an efficacious PA-based vaccine confers protection against inhalation anthrax by preventing the establishment of a toxin-releasing systemic infection. Equally importantly, antibodies measured by the in vitro lethal toxin neutralization activity assay (TNA) that is considered as a reliable correlate of protection, especially for PA protein-based vaccines adjuvanted with aluminum salts appear to be not absolutely essential for this protective immune response. PMID:23787486
Merkel, Tod J; Perera, Pin-Yu; Lee, Gloria M; Verma, Anita; Hiroi, Toyoko; Yokote, Hiroyuki; Waldmann, Thomas A; Perera, Liyanage P
2013-09-01
An intense effort has been launched to develop improved anthrax vaccines that confer rapid, long lasting protection preferably with an extended stability profile amenable for stockpiling. Protective antigen (PA)-based vaccines are most favored as immune responses directed against PA are singularly protective, although the actual protective mechanism remains to be unraveled. Herein we show that contrary to the prevailing view, an efficacious PA-based vaccine confers protection against inhalation anthrax by preventing the establishment of a toxin-releasing systemic infection. Equally importantly, antibodies measured by the in vitro lethal toxin neutralization activity assay (TNA) that is considered as a reliable correlate of protection, especially for PA protein-based vaccines adjuvanted with aluminum salts appear to be not absolutely essential for this protective immune response.
YODA MAP3K kinase regulates plant immune responses conferring broad-spectrum disease resistance.
Sopeña-Torres, Sara; Jordá, Lucía; Sánchez-Rodríguez, Clara; Miedes, Eva; Escudero, Viviana; Swami, Sanjay; López, Gemma; Piślewska-Bednarek, Mariola; Lassowskat, Ines; Lee, Justin; Gu, Yangnan; Haigis, Sabine; Alexander, Danny; Pattathil, Sivakumar; Muñoz-Barrios, Antonio; Bednarek, Pawel; Somerville, Shauna; Schulze-Lefert, Paul; Hahn, Michael G; Scheel, Dierk; Molina, Antonio
2018-04-01
Mitogen-activated protein kinases (MAPKs) cascades play essential roles in plants by transducing developmental cues and environmental signals into cellular responses. Among the latter are microbe-associated molecular patterns perceived by pattern recognition receptors (PRRs), which trigger immunity. We found that YODA (YDA) - a MAPK kinase kinase regulating several Arabidopsis developmental processes, like stomatal patterning - also modulates immune responses. Resistance to pathogens is compromised in yda alleles, whereas plants expressing the constitutively active YDA (CA-YDA) protein show broad-spectrum resistance to fungi, bacteria, and oomycetes with different colonization modes. YDA functions in the same pathway as ERECTA (ER) Receptor-Like Kinase, regulating both immunity and stomatal patterning. ER-YDA-mediated immune responses act in parallel to canonical disease resistance pathways regulated by phytohormones and PRRs. CA-YDA plants exhibit altered cell-wall integrity and constitutively express defense-associated genes, including some encoding putative small secreted peptides and PRRs whose impairment resulted in enhanced susceptibility phenotypes. CA-YDA plants show strong reprogramming of their phosphoproteome, which contains protein targets distinct from described MAPKs substrates. Our results suggest that, in addition to stomata development, the ER-YDA pathway regulates an immune surveillance system conferring broad-spectrum disease resistance that is distinct from the canonical pathways mediated by described PRRs and defense hormones. © 2018 Universidad Politécnica de Madrid (UPM) New Phytologist © 2018 New Phytologist Trust.
Epigenetic modifiers in immunotherapy: a focus on checkpoint inhibitors.
Terranova-Barberio, Manuela; Thomas, Scott; Munster, Pamela N
2016-06-01
Immune surveillance should be directed to suppress tumor development and progression, involving a balance of coinhibitory and costimulatory signals that amplify immune response without overwhelming the host. Immunotherapy confers durable clinical benefit in 'immunogenic tumors', whereas in other tumors the responses are modest. Thus, immune checkpoint inhibitors may need to be combined with strategies to boost immune response or increase the tumor immune profile. Epigenetic aberrations contribute significantly to carcinogenesis. Recent findings suggest that epigenetic drugs prime the immune response by increasing expression of tumor-associated antigens and immune-related genes, as well as modulating chemokines and cytokines involved in immune system activation. This review describes our current understanding regarding epigenetic and immunotherapy combination, focusing on immune response priming to checkpoint blockade.
Immune and genetic gardening of the intestinal microbiome
Jacobs, Jonathan P.; Braun, Jonathan
2014-01-01
The mucosal immune system – consisting of adaptive and innate immune cells as well as the epithelium – is profoundly influenced by its microbial environment. There is now growing evidence that the converse is also true, that the immune system shapes the composition of the intestinal microbiome. During conditions of health, this bidirectional interaction achieves a homeostasis in which inappropriate immune responses to nonpathogenic microbes are averted and immune activity suppresses blooms of potentially pathogenic microbes (pathobionts). Genetic alteration in immune/epithelial function can affect host gardening of the intestinal microbiome, contributing to the diversity of intestinal microbiota within a population and in some cases allowing for unfavorable microbial ecologies (dysbiosis) that confer disease susceptibility. PMID:24613921
Gramzinski, Robert A.; Doolan, Denise L.; Sedegah, Martha; Davis, Heather L.; Krieg, Arthur M.; Hoffman, Stephen L.
2001-01-01
Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-γ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-γ. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria. PMID:11179339
Cardenas, Horacio; Arango, Daniel; Nicholas, Courtney; Duarte, Silvia; Nuovo, Gerard J; He, Wei; Voss, Oliver H; Gonzalez-Mejia, M Elba; Guttridge, Denis C; Grotewold, Erich; Doseff, Andrea I
2016-03-01
The increasing prevalence of inflammatory diseases and the adverse effects associated with the long-term use of current anti-inflammatory therapies prompt the identification of alternative approaches to reestablish immune balance. Apigenin, an abundant dietary flavonoid, is emerging as a potential regulator of inflammation. Here, we show that apigenin has immune-regulatory activity in vivo. Apigenin conferred survival to mice treated with a lethal dose of Lipopolysaccharide (LPS) restoring normal cardiac function and heart mitochondrial Complex I activity. Despite the adverse effects associated with high levels of splenocyte apoptosis in septic models, apigenin had no effect on reducing cell death. However, we found that apigenin decreased LPS-induced apoptosis in lungs, infiltration of inflammatory cells and chemotactic factors' accumulation, re-establishing normal lung architecture. Using NF-κB luciferase transgenic mice, we found that apigenin effectively modulated NF-κB activity in the lungs, suggesting the ability of dietary compounds to exert immune-regulatory activity in an organ-specific manner. Collectively, these findings provide novel insights into the underlying immune-regulatory mechanisms of dietary nutraceuticals in vivo.
Discovering naturally processed antigenic determinants that confer protective T cell immunity
Gilchuk, Pavlo; Spencer, Charles T.; Conant, Stephanie B.; Hill, Timothy; Gray, Jennifer J.; Niu, Xinnan; Zheng, Mu; Erickson, John J.; Boyd, Kelli L.; McAfee, K. Jill; Oseroff, Carla; Hadrup, Sine R.; Bennink, Jack R.; Hildebrand, William; Edwards, Kathryn M.; Crowe, James E.; Williams, John V.; Buus, Søren; Sette, Alessandro; Schumacher, Ton N.M.; Link, Andrew J.; Joyce, Sebastian
2013-01-01
CD8+ T cells (TCD8) confer protective immunity against many infectious diseases, suggesting that microbial TCD8 determinants are promising vaccine targets. Nevertheless, current T cell antigen identification approaches do not discern which epitopes drive protective immunity during active infection — information that is critical for the rational design of TCD8-targeted vaccines. We employed a proteomics-based approach for large-scale discovery of naturally processed determinants derived from a complex pathogen, vaccinia virus (VACV), that are presented by the most frequent representatives of four major HLA class I supertypes. Immunologic characterization revealed that many previously unidentified VACV determinants were recognized by smallpox-vaccinated human peripheral blood cells in a variegated manner. Many such determinants were recognized by HLA class I–transgenic mouse immune TCD8 too and elicited protective TCD8 immunity against lethal intranasal VACV infection. Notably, efficient processing and stable presentation of immune determinants as well as the availability of naive TCD8 precursors were sufficient to drive a multifunctional, protective TCD8 response. Our approach uses fundamental insights into T cell epitope processing and presentation to define targets of protective TCD8 immunity within human pathogens that have complex proteomes, suggesting that this approach has general applicability in vaccine sciences. PMID:23543059
Discovering naturally processed antigenic determinants that confer protective T cell immunity.
Gilchuk, Pavlo; Spencer, Charles T; Conant, Stephanie B; Hill, Timothy; Gray, Jennifer J; Niu, Xinnan; Zheng, Mu; Erickson, John J; Boyd, Kelli L; McAfee, K Jill; Oseroff, Carla; Hadrup, Sine R; Bennink, Jack R; Hildebrand, William; Edwards, Kathryn M; Crowe, James E; Williams, John V; Buus, Søren; Sette, Alessandro; Schumacher, Ton N M; Link, Andrew J; Joyce, Sebastian
2013-05-01
CD8+ T cells (TCD8) confer protective immunity against many infectious diseases, suggesting that microbial TCD8 determinants are promising vaccine targets. Nevertheless, current T cell antigen identification approaches do not discern which epitopes drive protective immunity during active infection - information that is critical for the rational design of TCD8-targeted vaccines. We employed a proteomics-based approach for large-scale discovery of naturally processed determinants derived from a complex pathogen, vaccinia virus (VACV), that are presented by the most frequent representatives of four major HLA class I supertypes. Immunologic characterization revealed that many previously unidentified VACV determinants were recognized by smallpox-vaccinated human peripheral blood cells in a variegated manner. Many such determinants were recognized by HLA class I-transgenic mouse immune TCD8 too and elicited protective TCD8 immunity against lethal intranasal VACV infection. Notably, efficient processing and stable presentation of immune determinants as well as the availability of naive TCD8 precursors were sufficient to drive a multifunctional, protective TCD8 response. Our approach uses fundamental insights into T cell epitope processing and presentation to define targets of protective TCD8 immunity within human pathogens that have complex proteomes, suggesting that this approach has general applicability in vaccine sciences.
NLR-Associating Transcription Factor bHLH84 and Its Paralogs Function Redundantly in Plant Immunity
Xu, Fang; Kapos, Paul; Cheng, Yu Ti; Li, Meng; Zhang, Yuelin; Li, Xin
2014-01-01
In plants and animals, nucleotide-binding and leucine-rich repeat domain containing (NLR) immune receptors are utilized to detect the presence or activities of pathogen-derived molecules. However, the mechanisms by which NLR proteins induce defense responses remain unclear. Here, we report the characterization of one basic Helix-loop-Helix (bHLH) type transcription factor (TF), bHLH84, identified from a reverse genetic screen. It functions as a transcriptional activator that enhances the autoimmunity of NLR mutant snc1 (suppressor of npr1-1, constitutive 1) and confers enhanced immunity in wild-type backgrounds when overexpressed. Simultaneously knocking out three closely related bHLH paralogs attenuates RPS4-mediated immunity and partially suppresses the autoimmune phenotypes of snc1, while overexpression of the other two close paralogs also renders strong autoimmunity, suggesting functional redundancy in the gene family. Intriguingly, the autoimmunity conferred by bHLH84 overexpression can be largely suppressed by the loss-of-function snc1-r1 mutation, suggesting that SNC1 is required for its proper function. In planta co-immunoprecipitation revealed interactions between not only bHLH84 and SNC1, but also bHLH84 and RPS4, indicating that bHLH84 associates with these NLRs. Together with previous finding that SNC1 associates with repressor TPR1 to repress negative regulators, we hypothesize that nuclear NLR proteins may interact with both transcriptional repressors and activators during immune responses, enabling potentially faster and more robust transcriptional reprogramming upon pathogen recognition. PMID:25144198
Baughn, R E; Musher, D M; Simmons, C B
1977-01-01
Although several lines of evidence suggest that cellular immune mechanisms play a role in controlling infection due to Treponema pallidum, recent studies have shown that induction of acquired cellular resistance by antigenically unrelated organisms fails to protect rabbits against syphilitic infection, thereby casting doubt on this hypothesis. In the present paper we describe attempts to transfer immunity to syphilis by using spleen cells from chancre-immune rabbits. Intravenous infusion of 2 X 10(8) spleen lymphocytes was capable of transferring acquired cellular resistance to Listeria and delayed hypersensitivity to tuberculin. However, in eight separate experiments using outbred or inbred rabbits, 2 X 10(8) spleen cells from syphilis-immune animals failed to confer resistance to T. pallidum whether by intravenous or intradermal challenge. Mixing immune lymphocytes with treponemes immediately before intradermal inoculation also failed to confer resistance. Despite the fact that syphilitic infection stimulates cellular immune mechanisms and induces acquired cellular resistance to antigenically unrelated organisms, cellular immunity may not play an important role in immunity to syphilis. PMID:143456
Leduc, Isabelle; Fusco, William G.; Choudhary, Neelima; Routh, Patty A.; Cholon, Deborah M.; Hobbs, Marcia M.; Almond, Glen W.; Orndorff, Paul E.; Elkins, Christopher
2011-01-01
Haemophilus ducreyi, the etiologic agent of chancroid, has an obligate requirement for heme. Heme is acquired by H. ducreyi from its human host via TonB-dependent transporters expressed at its bacterial surface. Of 3 TonB-dependent transporters encoded in the genome of H. ducreyi, only the hemoglobin receptor, HgbA, is required to establish infection during the early stages of the experimental human model of chancroid. Active immunization with a native preparation of HgbA (nHgbA) confers complete protection in the experimental swine model of chancroid, using either Freund's or monophosphoryl lipid A as adjuvants. To determine if transfer of anti-nHgbA serum is sufficient to confer protection, a passive immunization experiment using pooled nHgbA antiserum was conducted in the experimental swine model of chancroid. Pigs receiving this pooled nHgbA antiserum were protected from a homologous, but not a heterologous, challenge. Passively transferred polyclonal antibodies elicited to nHgbA bound the surface of H. ducreyi and partially blocked hemoglobin binding by nHgbA, but were not bactericidal. Taken together, these data suggest that the humoral immune response to the HgbA vaccine is protective against an H. ducreyi infection, possibly by preventing acquisition of the essential nutrient heme. PMID:21646451
Leduc, Isabelle; Fusco, William G; Choudhary, Neelima; Routh, Patty A; Cholon, Deborah M; Hobbs, Marcia M; Almond, Glen W; Orndorff, Paul E; Elkins, Christopher
2011-08-01
Haemophilus ducreyi, the etiologic agent of chancroid, has an obligate requirement for heme. Heme is acquired by H. ducreyi from its human host via TonB-dependent transporters expressed at its bacterial surface. Of 3 TonB-dependent transporters encoded in the genome of H. ducreyi, only the hemoglobin receptor, HgbA, is required to establish infection during the early stages of the experimental human model of chancroid. Active immunization with a native preparation of HgbA (nHgbA) confers complete protection in the experimental swine model of chancroid, using either Freund's or monophosphoryl lipid A as adjuvants. To determine if transfer of anti-nHgbA serum is sufficient to confer protection, a passive immunization experiment using pooled nHgbA antiserum was conducted in the experimental swine model of chancroid. Pigs receiving this pooled nHgbA antiserum were protected from a homologous, but not a heterologous, challenge. Passively transferred polyclonal antibodies elicited to nHgbA bound the surface of H. ducreyi and partially blocked hemoglobin binding by nHgbA, but were not bactericidal. Taken together, these data suggest that the humoral immune response to the HgbA vaccine is protective against an H. ducreyi infection, possibly by preventing acquisition of the essential nutrient heme.
Leppkes, Moritz; Neurath, Markus F; Herrmann, Martin; Becker, Christoph
2016-01-01
Genome-wide association studies have provided many genetic alterations, conferring susceptibility to multifactorial polygenic diseases, such as inflammatory bowel diseases. Yet, how specific genetic alterations functionally affect intestinal inflammation often remains elusive. It is noteworthy that a large overlap of genes involved in immune deficiencies with those conferring inflammatory bowel disease risk has been noted. This has provided new arguments for the debate on whether inflammatory bowel disease arises from either an excess or a deficiency in the immune system. In this review, we highlight the functional effect of an inflammatory bowel disease-risk allele, which cannot be deduced from genome-wide association studies data alone. As exemplified by the transcription factor signal transducer and activator of transcription 3 (STAT3), we show that a single gene can have a plethora of effects in various cell types of the gut. These effects may individually contribute to the restoration of intestinal homeostasis on the one hand or pave the way for excessive immunopathology on the other, as an inflammatory "rheo-STAT". © Society for Leukocyte Biology.
Song, Lin; Chen, Xiaolin; Liu, Xiaodong; Zhang, Fubo; Hu, Linfeng; Yue, Yang; Li, Kecheng; Li, Pengcheng
2015-01-01
Three marine macroalgae, i.e., Grateloupia filicina, Ulva pertusa and Sargassum qingdaoense, were selected as the deputies of Rhodophyta, Chlorophyta and Ochrophyta for comparative analysis of the molecular structures and biological activities of sulfated polysaccharides (SP). The ratio of water-soluble polysaccharides, the monosaccharide composition and the sulfated contents of three extracted SPs were determined, and their structures were characterized by Fourier transformation infrared spectroscopy. In addition, biological activity analysis showed that all three SPs had immune-modulatory activity both in vitro and in vivo, and SPs from S. qingdaoense had the best effect. Further bioassays showed that three SPs could not only enhance the immunity level stimulated by inactivated avian influenza virus (AIV) in vivo but also significantly inhibited the activity of activated AIV (H9N2 subtype) in vitro. G. filicina SP exhibited the strongest anti-AIV activity. These results revealed the variations in structural features and bioactivities among three SPs and indicated the potential adjuvants for immune-enhancement and anti-AIV. PMID:26729137
Cardenas, Horacio; Arango, Daniel; Nicholas, Courtney; Duarte, Silvia; Nuovo, Gerard J.; He, Wei; Voss, Oliver H.; Gonzalez-Mejia, M. Elba; Guttridge, Denis C.; Grotewold, Erich; Doseff, Andrea I.
2016-01-01
The increasing prevalence of inflammatory diseases and the adverse effects associated with the long-term use of current anti-inflammatory therapies prompt the identification of alternative approaches to reestablish immune balance. Apigenin, an abundant dietary flavonoid, is emerging as a potential regulator of inflammation. Here, we show that apigenin has immune-regulatory activity in vivo. Apigenin conferred survival to mice treated with a lethal dose of Lipopolysaccharide (LPS) restoring normal cardiac function and heart mitochondrial Complex I activity. Despite the adverse effects associated with high levels of splenocyte apoptosis in septic models, apigenin had no effect on reducing cell death. However, we found that apigenin decreased LPS-induced apoptosis in lungs, infiltration of inflammatory cells and chemotactic factors’ accumulation, re-establishing normal lung architecture. Using NF-κB luciferase transgenic mice, we found that apigenin effectively modulated NF-κB activity in the lungs, suggesting the ability of dietary compounds to exert immune-regulatory activity in an organ-specific manner. Collectively, these findings provide novel insights into the underlying immune-regulatory mechanisms of dietary nutraceuticals in vivo. PMID:26938530
2002-01-01
The potential threat of biological warfare with a specific agent is proportional to the susceptibility of the population to that agent. Preventing disease after exposure to a biological agent is partially a function of the immunity of the exposed individual. The only available countermeasure that can provide immediate immunity against a biological agent is passive antibody. Unlike vaccines, which require time to induce protective immunity and depend on the host’s ability to mount an immune response, passive antibody can theoretically confer protection regardless of the immune status of the host. Passive antibody therapy has substantial advantages over antimicrobial agents and other measures for postexposure prophylaxis, including low toxicity and high specific activity. Specific antibodies are active against the major agents of bioterrorism, including anthrax, smallpox, botulinum toxin, tularemia, and plague. This article proposes a biological defense initiative based on developing, producing, and stockpiling specific antibody reagents that can be used to protect the population against biological warfare threats. PMID:12141970
Monaris, D.; Sbrogio-Almeida, M. E.; Dib, C. C.; Canhamero, T. A.; Souza, G. O.; Vasconcellos, S. A.; Ferreira, L. C. S.
2015-01-01
Leptospirosis is a global zoonotic disease caused by different Leptospira species, such as Leptospira interrogans, that colonize the renal tubules of wild and domestic animals. Thus far, attempts to develop effective leptospirosis vaccines, both for humans and animals, have failed to induce immune responses capable of conferring protection and simultaneously preventing renal colonization. In this study, we evaluated the protective immunity induced by subunit vaccines containing seven different recombinant Leptospira interrogans outer membrane proteins, including the carboxy-terminal portion of the immunoglobulinlike protein A (LigAC) and six novel antigens, combined with aluminum hydroxide (alum) or Salmonella flagellin (FliC) as adjuvants. Hamsters vaccinated with the different formulations elicited high antigen-specific antibody titers. Immunization with LigAC, either with alum or flagellin, conferred protective immunity but did not prevent renal colonization. Similarly, animals immunized with LigAC or LigAC coadministered with six leptospiral proteins with alum adjuvant conferred protection but did not reduce renal colonization. In contrast, immunizing animals with the pool of seven antigens in combination with flagellin conferred protection and significantly reduced renal colonization by the pathogen. The present study emphasizes the relevance of antigen composition and added adjuvant in the efficacy of antileptospirosis subunit vaccines and shows the complex relationship between immune responses and renal colonization by the pathogen. PMID:26108285
Pandya, Kalgi D; Palomo-Caturla, Isabel; Walker, Justin A; K Sandilya, Vijay; Zhong, Zhijiu; Alugupalli, Kishore R
2018-06-15
T cell-dependent B cell responses typically develop in germinal centers. Abs generated during such responses are isotype switched and have a high affinity to the Ag because of somatic hypermutation of Ab genes. B cell responses to purified polysaccharides are T cell independent and do not result in the formation of bona fide germinal centers, and the dominant Ab isotype produced during such responses is IgM with very few or no somatic mutations. Activation-induced cytidine deaminase (AID) is required for both somatic hypermutation and Ig isotype switching in humans and mice. To test the extent to which unmutated polysaccharide-specific IgM confers protective immunity, we immunized wildtype and AID -/- mice with either heat-killed Salmonella enterica serovar Typhi ( S. Typhi) or purified Vi polysaccharide (ViPS). We found that wildtype and AID -/- mice immunized with heat-killed S. Typhi generated similar anti-ViPS IgM responses. As expected, wildtype, but not AID -/- mice generated ViPS-specific IgG. However, the differences in the Ab-dependent killing of S. Typhi mediated by the classical pathway of complement activation were not statistically significant. In ViPS-immunized wildtype and AID -/- mice, the ViPS-specific IgM levels and S. Typhi bactericidal Ab titers at 7 but not at 28 d postimmunization were also comparable. To test the protective immunity conferred by these immunizations, mice were challenged with a chimeric S. Typhimurium strain expressing ViPS. Compared with their naive counterparts, immunized wildtype and AID -/- mice exhibited significantly reduced bacterial burden regardless of the route of infection. These data indicate that an unmutated IgM response to ViPS contributes to protective immunity to S. Typhi. Copyright © 2018 by The American Association of Immunologists, Inc.
Diuretics Prime Plant Immunity in Arabidopsis thaliana
Noutoshi, Yoshiteru; Ikeda, Mika; Shirasu, Ken
2012-01-01
Plant activators are agrochemicals that activate the plant immune system, thereby enhancing disease resistance. Due to their prophylactic and durable effects on a wide spectrum of diseases, plant activators can provide synergistic crop protection when used in combination with traditional pest controls. Although plant activators have achieved great success in wet-rice farming practices in Asia, their use is still limited. To isolate novel plant activators applicable to other crops, we screened a chemical library using a method that can selectively identify immune-priming compounds. Here, we report the isolation and characterization of three diuretics, bumetanide, bendroflumethiazide and clopamide, as immune-priming compounds. These drugs upregulate the immunity-related cell death of Arabidopsis suspension-cultured cells induced with an avirulent strain of Pseudomonas syringae pv. tomato in a concentration-dependent manner. The application of these compounds to Arabidopsis plants confers disease resistance to not only the avirulent but also a virulent strain of the pathogen. Unlike salicylic acid, an endogenous phytohormone that governs disease resistance in response to biotrophic pathogens, the three diuretic compounds analyzed here do not induce PR1 or inhibit plant growth, showing potential as lead compounds in a practical application. PMID:23144763
Elahi, Shokrollah; Buchanan, Rachelle M; Attah-Poku, Sam; Townsend, Hugh G G; Babiuk, Lorne A; Gerdts, Volker
2006-04-01
Innate immunity plays an important role in protection against respiratory infections in humans and animals. Host defense peptides such as beta-defensins represent major components of innate immunity. We recently developed a novel porcine model of pertussis, an important respiratory disease of young children and infants worldwide. Here, we investigated the role of porcine beta-defensin 1 (pBD-1), a porcine defensin homologue of human beta-defensin 2, in conferring protection against respiratory infection with Bordetella pertussis. In this model, newborn piglets were fully susceptible to infection and developed severe bronchopneumonia. In contrast, piglets older than 4 weeks of age were protected against infection with B. pertussis. Protection was associated with the expression of pBD-1 in the upper respiratory tract. In fact, pBD-1 expression was developmentally regulated, and the absence of pBD-1 was thought to contribute to the increased susceptibility of newborn piglets to infection with B. pertussis. Bronchoalveolar lavage specimens collected from older animals as well as chemically synthesized pBD-1 displayed strong antimicrobial activity against B. pertussis in vitro. Furthermore, in vivo treatment of newborn piglets with only 500 mug pBD-1 at the time of challenge conferred protection against infection with B. pertussis. Interestingly, pBD-1 displayed no bactericidal activity in vitro against Bordetella bronchiseptica, a closely related natural pathogen of pigs. Our results demonstrate that host defense peptides play an important role in protection against pertussis and are essential in modulating innate immune responses against respiratory infections.
Wizel, Benjamin; Persson, Josefine; Thörn, Karolina; Nagy, Eszter; Harandi, Ali M
2012-06-19
Genital herpes caused by herpes simplex virus type 2 (HSV-2) remains the leading cause of genital ulcers worldwide. Given the disappointing results of the recent genital herpes vaccine trials in humans, development of novel vaccine strategies capable of eliciting protective mucosal and systemic immune responses to HSV-2 is urgently required. Here we tested the ability of the adjuvant IC31(®) in combination with HSV-2 glycoprotein D (gD) used through intranasal (i.n.), intradermal (i.d.), or subcutaneous (s.c.) immunization routes for induction of protective immunity against genital herpes infection in C57BL/6 mice. Immunization with gD plus IC31(®) through all three routes of immunization developed elevated gD-specific serum antibody responses with HSV-2 neutralizing activity. Whereas the skin routes promoted the induction of a mixed IgG2c/IgG1 isotype profile, the i.n. route only elicited IgG1 antibodies. All immunization routes were able to induce gD-specific IgG antibody responses in the vaginas of mice immunized with IC31(®)-adjuvanted gD. Although specific lymphoproliferative responses were observed in splenocytes from mice of most groups vaccinated with IC31(®)-adjuvanted gD, only i.d. immunization resulted in a significant splenic IFN-γ response. Further, immunization with gD plus IC31(®) conferred 80-100% protection against an otherwise lethal vaginal HSV-2 challenge with amelioration of viral replication and disease severity in the vagina. These results warrant further exploration of IC31(®) for induction of protective immunity against genital herpes and other sexually transmitted infections. Copyright © 2012 Elsevier Ltd. All rights reserved.
Vu, David M; Kelly, Dominic; Heath, Paul T; McCarthy, Noel D; Pollard, Andrew J; Granoff, Dan M
2006-07-15
Group C meningococcal conjugate-vaccine effectiveness in the United Kingdom declines from ~90% in the first year to 0% between 1 and 4 years after immunization in infants immunized at 2, 3, and 4 months of age and to 61% in toddlers given a single dose. Confidence intervals are wide, and the extent of protection is uncertain. Serum samples were obtained from children 3-5 years of age who were participants in a preschool booster-vaccine trial. Serum bactericidal activity was measured with human complement. Group C anticapsular antibody concentrations were measured by a radioantigen binding assay. Passive protection was analyzed in an infant rat bacteremia model. Serum samples from UK children who had been immunized 2-3 years earlier as infants or toddlers had higher levels of radioantigen binding, bactericidal activity, and passive protection than did historical control serum samples from unimmunized children (P<.05). A higher proportion of children immunized as infants had serum bactericidal activity titers > or =1 : 4 (considered to be protective) than those immunized as toddlers (61% vs. 24%; P<.01), but there were no significant differences in the proportion of serum samples conferring passive protection (50% and 41%, respectively; P=.4). We found no evidence of lower immunity in children immunized as infants than as toddlers. On the basis of serum bactericidal activity and/or passive protection, 40%-50% of both age groups are protected at 2-3 years after immunization, which was significantly greater than in unimmunized historical controls (<5%).
Tsuda, Kenichi; Mine, Akira; Bethke, Gerit; Igarashi, Daisuke; Botanga, Christopher J; Tsuda, Yayoi; Glazebrook, Jane; Sato, Masanao; Katagiri, Fumiaki
2013-01-01
Network robustness is a crucial property of the plant immune signaling network because pathogens are under a strong selection pressure to perturb plant network components to dampen plant immune responses. Nevertheless, modulation of network robustness is an area of network biology that has rarely been explored. While two modes of plant immunity, Effector-Triggered Immunity (ETI) and Pattern-Triggered Immunity (PTI), extensively share signaling machinery, the network output is much more robust against perturbations during ETI than PTI, suggesting modulation of network robustness. Here, we report a molecular mechanism underlying the modulation of the network robustness in Arabidopsis thaliana. The salicylic acid (SA) signaling sector regulates a major portion of the plant immune response and is important in immunity against biotrophic and hemibiotrophic pathogens. In Arabidopsis, SA signaling was required for the proper regulation of the vast majority of SA-responsive genes during PTI. However, during ETI, regulation of most SA-responsive genes, including the canonical SA marker gene PR1, could be controlled by SA-independent mechanisms as well as by SA. The activation of the two immune-related MAPKs, MPK3 and MPK6, persisted for several hours during ETI but less than one hour during PTI. Sustained MAPK activation was sufficient to confer SA-independent regulation of most SA-responsive genes. Furthermore, the MPK3 and SA signaling sectors were compensatory to each other for inhibition of bacterial growth as well as for PR1 expression during ETI. These results indicate that the duration of the MAPK activation is a critical determinant for modulation of robustness of the immune signaling network. Our findings with the plant immune signaling network imply that the robustness level of a biological network can be modulated by the activities of network components.
Martin, Genevieve E; Gouillou, Maelenn; Hearps, Anna C; Angelovich, Thomas A; Cheng, Allen C; Lynch, Fiona; Cheng, Wan-Jung; Paukovics, Geza; Palmer, Clovis S; Novak, Richard M; Jaworowski, Anthony; Landay, Alan L; Crowe, Suzanne M
2013-01-01
Aging is associated with immune dysfunction and the related development of conditions with an inflammatory pathogenesis. Some of these immune changes are also observed in HIV infection, but the interaction between immune changes with aging and HIV infection are unknown. Whilst sex differences in innate immunity are recognized, little research into innate immune aging has been performed on women. This cross-sectional study of HIV positive and negative women used whole blood flow cytometric analysis to characterize monocyte and CD8(+) T cell subsets. Plasma markers of innate immune activation were measured using standard ELISA-based assays. HIV positive women exhibited elevated plasma levels of the innate immune activation markers CXCL10 (p<0.001), soluble CD163 (sCD163, p = 0.001), sCD14 (p = 0.022), neopterin (p = 0.029) and an increased proportion of CD16(+) monocytes (p = 0.009) compared to uninfected controls. Levels of the innate immune aging biomarkers sCD163 and the proportion of CD16(+) monocytes were equivalent to those observed in HIV negative women aged 14.5 and 10.6 years older, respectively. CXCL10 increased with age at an accelerated rate in HIV positive women (p = 0.002) suggesting a synergistic effect between HIV and aging on innate immune activation. Multivariable modeling indicated that age-related increases in innate immune biomarkers CXCL10 and sCD163 are independent of senescent changes in CD8(+) T lymphocytes. Quantifying the impact of HIV on immune aging reveals that HIV infection in women confers the equivalent of a 10-14 year increase in the levels of innate immune aging markers. These changes may contribute to the increased risk of inflammatory age-related diseases in HIV positive women.
Noutoshi, Yoshiteru; Jikumaru, Yusuke; Kamiya, Yuji; Shirasu, Ken
2012-01-01
Plant activators are agrochemicals that protect crops from pathogens. They confer durable resistance to a broad range of diseases by activating intrinsic immune mechanisms in plants. To obtain leads regarding useful compounds, we have screened a chemical library using an established method that allows selective identification of immune-priming compounds. Here, we report the characterisation of one of the isolated chemicals, imprimatinC1, and its structural derivative imprimatinC2. ImprimatinC1 functions as a weak analogue of salicylic acid (SA) and activates the expression of defence-related genes. However, it lacks antagonistic activity toward jasmonic acid. Structure-activity relationship analysis suggests that imprimatinC1 and C2 can be metabolised to 4-chlorobenzoic acid and 3,4-chlorobenzoic acid, respectively, to function in Arabidopsis. We also found that imprimatinC1 and C2 and their potential functional metabolites acted as partial agonists of SA. Thus, imprimatinC compounds could be useful tools for dissecting SA-dependent signal transduction pathways. PMID:23050089
Noutoshi, Yoshiteru; Jikumaru, Yusuke; Kamiya, Yuji; Shirasu, Ken
2012-01-01
Plant activators are agrochemicals that protect crops from pathogens. They confer durable resistance to a broad range of diseases by activating intrinsic immune mechanisms in plants. To obtain leads regarding useful compounds, we have screened a chemical library using an established method that allows selective identification of immune-priming compounds. Here, we report the characterisation of one of the isolated chemicals, imprimatinC1, and its structural derivative imprimatinC2. ImprimatinC1 functions as a weak analogue of salicylic acid (SA) and activates the expression of defence-related genes. However, it lacks antagonistic activity toward jasmonic acid. Structure-activity relationship analysis suggests that imprimatinC1 and C2 can be metabolised to 4-chlorobenzoic acid and 3,4-chlorobenzoic acid, respectively, to function in Arabidopsis. We also found that imprimatinC1 and C2 and their potential functional metabolites acted as partial agonists of SA. Thus, imprimatinC compounds could be useful tools for dissecting SA-dependent signal transduction pathways.
Desjardins, M; Filion, L G; Robertson, S; Kobylinski, L; Cameron, D W
1996-01-01
To study the mechanisms of inducible immunity to Haemophilus ducreyi infection in the temperature-dependent rabbit model of chancroid, we conducted passive immunization experiments and characterized the inflammatory infiltrate of chancroidal lesions. Polyclonal immunoglobulin G was purified from immune sera raised against H. ducreyi 35000 whole-cell lysate or a pilus preparation and from naive control rabbits. Rabbits were passively immunized with 24 or 48 mg of purified polyclonal immunoglobulin G intravenously, followed 24 h after infusion by homologous titered infectious challenge. Despite titratable antibody, no significant difference in infection or disease was observed. We then evaluated the immunohistology of lesions produced by homologous-strain challenge in sham-immunized rabbits and those protectively vaccinated by pilus preparation immunization. Immunohistochemical stains for CD5 and CD4 T-lymphocyte markers were performed on lesion sections 4, 10, 15, and 21 days from infection. Lesions of pilus preparation vaccinees compared with those of controls had earlier infiltration with significantly more T lymphocytes (CD5+) and with a greater proportion of CD4+ T lymphocytes at day 4 (33% +/- 55% versus 9.7% +/- 2%; P = 0.002), corroborating earlier sterilization (5.0 +/- 2 versus 13.7 +/- 0.71 days; P < 0.001) and lesion resolution. Intraepithelial challenge of pilus-vaccinated rabbits with 100 micrograms of the pilus preparation alone produced indurated lesions within 48 h with lymphoid and plasmacytoid infiltration, edema, and extravasation of erythrocytes. We conclude that passive immunization may not confer a vaccine effect in this model and that active vaccination with a pilus preparation induces a delayed-type hypersensitivity skin test response and confers protection through cell-mediated immunity seen as an amplified lymphocytic infiltrate and accelerated maturation of the T-lymphocyte response. PMID:8613391
Investing in life saving vaccines to guarantee life of future generations in Africa.
Mihigo, R M; Okeibunor, J C; O'Malley, H; Masresha, B; Mkanda, P; Zawaira, F
2016-11-21
The World Health Organization's Regional Offices for Africa and for the Eastern Mediterranean in conjunction with the African Union and the Government of Ethiopia hosted a ministerial conference on immunization in Africa from 24 to 25 February 2016 in Addis Ababa, Ethiopia under the theme "towards universal immunization coverage as a cornerstone for health and development in Africa". The conference brought together African leaders - including health and finance ministers, and parliamentarians thus creating a powerful platform for governments to demonstrate their commitment to advancing universal access to immunization on the continent in line with the Global Vaccine Action Plan. The event also brought together advocates, technical experts, policymakers, partner agencies, donors and journalists to examine how best to drive forward immunization across Africa, ensuring every child has access to the vaccines they need. Key points highlighted throughout conference were: universal access to immunization is at the forefront of enabling Africa to reach its full potential - by improving health, driving economic growth and empowering future generations; it is one of the most cost-effective solutions in global health, with clear benefits for health and development; and immunization brings economic benefits too, reducing health care costs and increasing productivity. At the close of the conference, 46 African countries signed a historic ministerial declaration on "Universal Access to Immunization as a Cornerstone for Health and Development in Africa" signaling fierce determination among African leaders to secure the health and prosperity of their societies through immunization. Copyright © 2016 World Health Organization Regional Office for Africa. Published by Elsevier Ltd.. All rights reserved.
Probiotics, Prebiotics and Immunomodulation of Gut Mucosal Defences: Homeostasis and Immunopathology
Hardy, Holly; Harris, Jennifer; Lyon, Eleanor; Beal, Jane; Foey, Andrew D.
2013-01-01
Probiotics are beneficial microbes that confer a realistic health benefit on the host, which in combination with prebiotics, (indigestible dietary fibre/carbohydrate), also confer a health benefit on the host via products resulting from anaerobic fermentation. There is a growing body of evidence documenting the immune-modulatory ability of probiotic bacteria, it is therefore reasonable to suggest that this is potentiated via a combination of prebiotics and probiotics as a symbiotic mix. The need for probiotic formulations has been appreciated for the health benefits in “topping up your good bacteria” or indeed in an attempt to normalise the dysbiotic microbiota associated with immunopathology. This review will focus on the immunomodulatory role of probiotics and prebiotics on the cells, molecules and immune responses in the gut mucosae, from epithelial barrier to priming of adaptive responses by antigen presenting cells: immune fate decision—tolerance or activation? Modulation of normal homeostatic mechanisms, coupled with findings from probiotic and prebiotic delivery in pathological studies, will highlight the role for these xenobiotics in dysbiosis associated with immunopathology in the context of inflammatory bowel disease, colorectal cancer and hypersensitivity. PMID:23760057
Dahl, Lotte; Jensen, Trine Hammer; Gottschalck, Elisabeth; Karlskov-Mortensen, Peter; Jensen, Tove Dannemann; Nielsen, Line; Andersen, Mads Klindt; Buckland, Robin; Wild, T Fabian; Blixenkrone-Møller, Merete
2004-09-09
We have investigated the protective effect of immunization of a highly susceptible natural host of canine distemper virus (CDV) with DNA plasmids encoding the viral nucleoprotein (N) and hemagglutinin (H). The combined intradermal and intramuscular routes of immunization elicited high virus-neutralizing serum antibody titres in mink (Mustela vison). To mimic natural exposure, we also conducted challenge infection by horizontal transmission from infected contact animals. Other groups received a lethal challenge infection by administration to the mucosae of the respiratory tract and into the muscle. One of the mink vaccinated with N plasmid alone developed severe disease after challenge. In contrast, vaccination with the H plasmid together with the N plasmid conferred solid protection against disease and we were unable to detect CDV infection in PBMCs or in different tissues after challenge. Our findings show that DNA immunization by the combined intradermal and intramuscular routes can confer solid protective immunity against naturally transmitted morbillivirus infection and disease.
DEAF-1 regulates immunity gene expression in Drosophila.
Reed, Darien E; Huang, Xinhua M; Wohlschlegel, James A; Levine, Michael S; Senger, Kate
2008-06-17
Immunity genes are activated in the Drosophila fat body by Rel and GATA transcription factors. Here, we present evidence that an additional regulatory factor, deformed epidermal autoregulatory factor-1 (DEAF-1), also contributes to the immune response and is specifically important for the induction of two genes encoding antimicrobial peptides, Metchnikowin (Mtk) and Drosomycin (Drs). The systematic mutagenesis of a minimal Mtk 5' enhancer identified a sequence motif essential for both a response to LPS preparations in S2 cells and activation in the larval fat body in response to bacterial infection. Using affinity chromatography coupled to multidimensional protein identification technology (MudPIT), we identified DEAF-1 as a candidate regulator. DEAF-1 activates the expression of Mtk and Drs promoter-luciferase fusion genes in S2 cells. SELEX assays and footprinting data indicate that DEAF-1 binds to and activates Mtk and Drs regulatory DNAs via a TTCGGBT motif. The insertion of this motif into the Diptericin (Dpt) regulatory region confers DEAF-1 responsiveness to this normally DEAF-1-independent enhancer. The coexpression of DEAF-1 with Dorsal, Dif, and Relish results in the synergistic activation of transcription. We propose that DEAF-1 is a regulator of Drosophila immunity.
ERIC Educational Resources Information Center
Scopes, Jack
1990-01-01
Some approaches to dealing with contemporary issues on campus include Acquired Immune Deficiency Syndrome awareness--safe sex parties; crime prevention--students helping students, legislation, workshops and conferences; alcohol awareness--designated driver program and starting a nonalcoholic bar; cults on campus; sexual assault--"Hours Til…
Jensen, Kara; dela Pena-Ponce, Myra Grace; Piatak, Michael; Shoemaker, Rebecca; Oswald, Kelli; Jacobs, William R.; Fennelly, Glenn; Lucero, Carissa; Mollan, Katie R.; Hudgens, Michael G.; Amedee, Angela; Kozlowski, Pamela A.; Estes, Jacob D.; Lifson, Jeffrey D.; Van Rompay, Koen K. A.; Larsen, Michelle
2016-01-01
ABSTRACT Our goal is to develop a pediatric combination vaccine to protect the vulnerable infant population against human immunodeficiency virus type 1 (HIV-1) and tuberculosis (TB) infections. The vaccine consists of an auxotroph Mycobacterium tuberculosis strain that coexpresses HIV antigens. Utilizing an infant rhesus macaque model, we have previously shown that this attenuated M. tuberculosis (AMtb)-simian immunodeficiency virus (SIV) vaccine is immunogenic, and although the vaccine did not prevent oral SIV infection, a subset of vaccinated animals was able to partially control virus replication. However, unexpectedly, vaccinated infants required fewer SIV exposures to become infected compared to naive controls. Considering that the current TB vaccine, Mycobacterium bovis bacillus Calmette-Guérin (BCG), can induce potent innate immune responses and confer pathogen-unspecific trained immunity, we hypothesized that an imbalance between enhanced myeloid cell function and immune activation might have influenced the outcome of oral SIV challenge in AMtb-SIV-vaccinated infants. To address this question, we used archived samples from unchallenged animals from our previous AMtb-SIV vaccine studies and vaccinated additional infant macaques with BCG or AMtb only. Our results show that vaccinated infants, regardless of vaccine strain or regimen, had enhanced myeloid cell responses. However, CD4+ T cells were concurrently activated, and the persistence of these activated target cells in oral and/or gastrointestinal tissues may have facilitated oral SIV infection. Immune activation was more pronounced in BCG-vaccinated infant macaques than in AMtb-vaccinated infant macaques, indicating a role for vaccine attenuation. These findings underline the importance of understanding the interplay of vaccine-induced immunity and immune activation and its effect on HIV acquisition risk and outcome in infants. PMID:27655885
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liew, F.Y.; Howard, J.G.; Hale, C.
1984-01-01
Protective immunity against fatal L. tropica infection in genetically vulnerable BALB/c mice can be induced by prophylactic immunization with irradiated promastigotes even when heat-killed. Such immunity is adoptively transferable transiently into intact or durably into sub-lethally irradiated (200 or 550 rad) syngeneic recipients by splenic T but not B cells. The effector T cells are of the Lyt-1/sup +/2/sup -/ phenotype, devoid of demonstrable cytotoxic activity. The immune splenic T cell population expresses specific helper activity for antibody synthesis. A causal role for helper T cells in this capacity, however, seems unlikely, because it was shown that antibody does notmore » determine the protective immunity against L. tropica. The immunized donors show no detectable cutaneous DTH or its early memory recall in response to live or killed promastigotes or a soluble L. tropica antigen preparation. Spleen, lymph node, and peritoneal exudate cells from protectively immunized donors similarly fail to transfer DTH locally or systemically. These cells also lack demonstrable suppressive activity against the expression or induction of DTH to L. tropica. Thus, protection against L. tropica induced by prophylactic i.v. immunization with irradiated promastigotes appears to be conferred by Lyt-1/sup +/2/sup -/ T cells that are distinguishable from T cells mediating either both DTH and T help, or cytotoxicity.« less
Huang, Ya-Shu; Fisher, Morly; Nasrawi, Ziyad; Eichenbaum, Zehava
2011-06-01
The worldwide burden of the Group A Streptococcus (GAS) primary infection and sequelae is considerable, although immunization programs with broad coverage of the hyper variable GAS are still missing. We evaluate the streptococcal hemoprotein receptor (Shr), a conserved streptococcal protein, as a vaccine candidate against GAS infection. Mice were immunized intraperitoneally with purified Shr or intranasally with Shr-expressing Lactococcus lactis. The resulting humoral response in serum and secretions was determined. We evaluated protection from GAS infection in mice after active or passive vaccination with Shr, and Shr antiserum was tested for bactericidal activity. A robust Shr-specific immunoglobulin (Ig) G response was observed in mouse serum after intraperitoneal vaccination with Shr. Intranasal immunization elicited both a strong IgG reaction in the serum and a specific IgA reaction in secretions. Shr immunization in both models allowed enhanced protection from systemic GAS challenge. Rabbit Shr antiserum was opsonizing, and mice that were administrated with Shr antiserum prior to the infection demonstrated a significantly higher survival rate than did mice treated with normal rabbit serum. Shr is a promising vaccine candidate that is capable of eliciting bactericidal antibody response and conferring immunity against systemic GAS infection in both passive and active vaccination models.
Arabidopsis EF-Tu receptor enhances bacterial disease resistance in transgenic wheat.
Schoonbeek, Henk-Jan; Wang, Hsi-Hua; Stefanato, Francesca L; Craze, Melanie; Bowden, Sarah; Wallington, Emma; Zipfel, Cyril; Ridout, Christopher J
2015-04-01
Perception of pathogen (or microbe)-associated molecular patterns (PAMPs/MAMPs) by pattern recognition receptors (PRRs) is a key component of plant innate immunity. The Arabidopsis PRR EF-Tu receptor (EFR) recognizes the bacterial PAMP elongation factor Tu (EF-Tu) and its derived peptide elf18. Previous work revealed that transgenic expression of AtEFR in Solanaceae confers elf18 responsiveness and broad-spectrum bacterial disease resistance. In this study, we developed a set of bioassays to study the activation of PAMP-triggered immunity (PTI) in wheat. We generated transgenic wheat (Triticum aestivum) plants expressing AtEFR driven by the constitutive rice actin promoter and tested their response to elf18. We show that transgenic expression of AtEFR in wheat confers recognition of elf18, as measured by the induction of immune marker genes and callose deposition. When challenged with the cereal bacterial pathogen Pseudomonas syringae pv. oryzae, transgenic EFR wheat lines had reduced lesion size and bacterial multiplication. These results demonstrate that AtEFR can be transferred successfully from dicot to monocot species, further revealing that immune signalling pathways are conserved across these distant phyla. As novel PRRs are identified, their transfer between plant families represents a useful strategy for enhancing resistance to pathogens in crops. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.
Palm, Noah W.; Rosenstein, Rachel K.; Yu, Shuang; Schenten, Dominik; Florsheim, Esther; Medzhitov, Ruslan
2013-01-01
SUMMARY Venoms consist of toxic components that are delivered to their victims via bites or stings. Venoms also represent a major class of allergens in humans. Phospholipase A2 (PLA2) is a conserved component of venoms from multiple species and is the major allergen in bee venom. Here we examined how bee venom PLA2 is sensed by the innate immune system and induces a type 2 immune response in mice. We found that bee venom PLA2 induced a T helper type 2 (Th2) cell-type response and group 2 innate lymphoid cell activation via the enzymatic cleavage of membrane phospholipids and release of interleukin-33. Furthermore, we showed that the IgE response to PLA2 could protect mice from future challenge with a near-lethal dose of PLA2. These data suggest that the innate immune system can detect the activity of a conserved component of venoms and induce a protective immune response against a venom toxin. PMID:24210353
75 FR 43995 - Advisory Committee on Immunization Practices (ACIP)
Federal Register 2010, 2011, 2012, 2013, 2014
2010-07-27
...: The conference call will originate at the National Center for Immunization and Respiratory Diseases in.... CONTACT PERSON FOR MORE INFORMATION: Leola Mitchell, National Center for Immunization and Respiratory...
The Use of a Dexamethasone-inducible System to Synchronize Xa21 Expression to Study Rice Immunity.
Caddell, Daniel F; Wei, Tong; Park, Chang-Jin; Ronald, Pamela C
2015-05-05
Inducible gene expression systems offer researchers the opportunity to synchronize target gene expression at particular developmental stages and in particular tissues. The glucocorticoid receptor (GR), a vertebrate steroid receptor, has been well adopted for this purpose in plants. To generate steroid-inducible plants, a construct of GAL4-binding domain-VP16 activation domain-GR fusion (GVG) with the target gene under the control of upstream activation sequence (UAS) has been developed and extensively used in plant research. Immune receptors perceive conserved molecular patterns secreted by pathogens and initiate robust immune responses. The rice immune receptor, XA21 , recognizes a molecular pattern highly conserved in all sequenced genomes of Xanthomonas , and confers robust resistance to X. oryzae pv. oryzae ( Xoo ). However, identifying genes downstream of XA21 has been hindered because of the restrained lesion and thus limited defense response region in the plants expressing Xa21 . Inducible expression allows for a synchronized immune response across a large amount of rice tissue, well suited for studying XA21-mediated immunity by genome-wide approaches such as transcriptomics and proteomics. In this protocol, we describe the use of this GVG system to synchronize Xa21 expression.
The Use of a Dexamethasone-inducible System to Synchronize Xa21 Expression to Study Rice Immunity
Caddell, Daniel F.; Wei, Tong; Park, Chang-Jin; Ronald, Pamela C.
2016-01-01
Inducible gene expression systems offer researchers the opportunity to synchronize target gene expression at particular developmental stages and in particular tissues. The glucocorticoid receptor (GR), a vertebrate steroid receptor, has been well adopted for this purpose in plants. To generate steroid-inducible plants, a construct of GAL4-binding domain-VP16 activation domain-GR fusion (GVG) with the target gene under the control of upstream activation sequence (UAS) has been developed and extensively used in plant research. Immune receptors perceive conserved molecular patterns secreted by pathogens and initiate robust immune responses. The rice immune receptor, XA21, recognizes a molecular pattern highly conserved in all sequenced genomes of Xanthomonas, and confers robust resistance to X. oryzae pv. oryzae (Xoo). However, identifying genes downstream of XA21 has been hindered because of the restrained lesion and thus limited defense response region in the plants expressing Xa21. Inducible expression allows for a synchronized immune response across a large amount of rice tissue, well suited for studying XA21-mediated immunity by genome-wide approaches such as transcriptomics and proteomics. In this protocol, we describe the use of this GVG system to synchronize Xa21 expression. PMID:27525297
DAF-16-dependent suppression of immunity during reproduction in Caenorhabditis elegans.
Miyata, Sachiko; Begun, Jakob; Troemel, Emily R; Ausubel, Frederick M
2008-02-01
To further understand how the nematode Caenorhabditis elegans defends itself against pathogen attack, we analyzed enhanced pathogen resistance (epr) mutants obtained from a forward genetic screen. We also examined several well-characterized sterile mutants that exhibit an Epr phenotype. We found that sterility and pathogen resistance are highly correlated and that resistance in both epr and sterile mutants is dependent on DAF-16 activity. Our data indicate that a DAF-16-dependent signaling pathway distinct from previously described pathways is involved in the activation of genes that confer resistance to bacterial pathogens. The timing of DAF-16-dependent gene activation in sterile mutants coincides with the onset of embryonic development in wild-type animals, suggesting that signals from developing embryos normally downregulate the immune response.
Louradour, Isabelle; Sharma, Anurag; Morin-Poulard, Ismael; Letourneau, Manon; Vincent, Alain; Crozatier, Michèle; Vanzo, Nathalie
2017-11-01
Hematopoietic stem/progenitor cells in the adult mammalian bone marrow ensure blood cell renewal. Their cellular microenvironment, called 'niche', regulates hematopoiesis both under homeostatic and immune stress conditions. In the Drosophila hematopoietic organ, the lymph gland, the posterior signaling center (PSC) acts as a niche to regulate the hematopoietic response to immune stress such as wasp parasitism. This response relies on the differentiation of lamellocytes, a cryptic cell type, dedicated to pathogen encapsulation and killing. Here, we establish that Toll/NF-κB pathway activation in the PSC in response to wasp parasitism non-cell autonomously induces the lymph gland immune response. Our data further establish a regulatory network where co-activation of Toll/NF-κB and EGFR signaling by ROS levels in the PSC/niche controls lymph gland hematopoiesis under parasitism. Whether a similar regulatory network operates in mammals to control emergency hematopoiesis is an open question.
7 CFR 985.69 - Duration of immunities.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 8 2014-01-01 2014-01-01 false Duration of immunities. 985.69 Section 985.69 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING....69 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by...
7 CFR 920.66 - Duration of immunities.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 8 2014-01-01 2014-01-01 false Duration of immunities. 920.66 Section 920.66 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING... Miscellaneous Provisions § 920.66 Duration of immunities. The benefits, priviliges, and immunities conferred...
7 CFR 920.66 - Duration of immunities.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 8 2013-01-01 2013-01-01 false Duration of immunities. 920.66 Section 920.66 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING... Miscellaneous Provisions § 920.66 Duration of immunities. The benefits, priviliges, and immunities conferred...
7 CFR 947.83 - Duration of immunities.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 8 2014-01-01 2014-01-01 false Duration of immunities. 947.83 Section 947.83 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING... Miscellaneous Provisions § 947.83 Duration of immunities. The benefits, privileges, and immunities conferred...
7 CFR 985.69 - Duration of immunities.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 8 2012-01-01 2012-01-01 false Duration of immunities. 985.69 Section 985.69 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing....69 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by...
7 CFR 985.69 - Duration of immunities.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 8 2011-01-01 2011-01-01 false Duration of immunities. 985.69 Section 985.69 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing....69 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by...
7 CFR 920.66 - Duration of immunities.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 8 2011-01-01 2011-01-01 false Duration of immunities. 920.66 Section 920.66 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing... Miscellaneous Provisions § 920.66 Duration of immunities. The benefits, priviliges, and immunities conferred...
7 CFR 985.69 - Duration of immunities.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 8 2010-01-01 2010-01-01 false Duration of immunities. 985.69 Section 985.69 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing....69 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by...
7 CFR 920.66 - Duration of immunities.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 8 2010-01-01 2010-01-01 false Duration of immunities. 920.66 Section 920.66 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing... Miscellaneous Provisions § 920.66 Duration of immunities. The benefits, priviliges, and immunities conferred...
7 CFR 947.83 - Duration of immunities.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 8 2011-01-01 2011-01-01 false Duration of immunities. 947.83 Section 947.83 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing... Miscellaneous Provisions § 947.83 Duration of immunities. The benefits, privileges, and immunities conferred...
7 CFR 985.69 - Duration of immunities.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 8 2013-01-01 2013-01-01 false Duration of immunities. 985.69 Section 985.69 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING....69 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by...
7 CFR 947.83 - Duration of immunities.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 8 2010-01-01 2010-01-01 false Duration of immunities. 947.83 Section 947.83 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing... Miscellaneous Provisions § 947.83 Duration of immunities. The benefits, privileges, and immunities conferred...
7 CFR 947.83 - Duration of immunities.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 8 2012-01-01 2012-01-01 false Duration of immunities. 947.83 Section 947.83 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing... Miscellaneous Provisions § 947.83 Duration of immunities. The benefits, privileges, and immunities conferred...
7 CFR 947.83 - Duration of immunities.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 8 2013-01-01 2013-01-01 false Duration of immunities. 947.83 Section 947.83 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING... Miscellaneous Provisions § 947.83 Duration of immunities. The benefits, privileges, and immunities conferred...
7 CFR 920.66 - Duration of immunities.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 8 2012-01-01 2012-01-01 false Duration of immunities. 920.66 Section 920.66 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing... Miscellaneous Provisions § 920.66 Duration of immunities. The benefits, priviliges, and immunities conferred...
Thomas, Nicholas C; Oksenberg, Nir; Liu, Furong; Caddell, Daniel; Nalyvayko, Alina; Nguyen, Yen; Schwessinger, Benjamin; Ronald, Pamela C
2018-01-01
Rice ( Oryza sativa ) plants expressing the XA21 cell-surface receptor kinase are resistant to Xanthomonas oryzae pv. oryzae (Xoo) infection. We previously demonstrated that expressing a chimeric protein containing the ELONGATION FACTOR Tu RECEPTOR (EFR) ectodomain and the XA21 endodomain (EFR:XA21) in rice does not confer robust resistance to Xoo . To test if the XA21 ectodomain is required for Xoo resistance, we produced transgenic rice lines expressing a chimeric protein consisting of the XA21 ectodomain and EFR endodomain (XA21:EFR) and inoculated these lines with Xoo . We also tested if the XA21:EFR rice plants respond to a synthetic sulfated 21 amino acid derivative (RaxX21-sY) of the activator of XA21-mediated immunity, RaxX. We found that five independently transformed XA21:EFR rice lines displayed resistance to Xoo as measured by lesion length analysis, and showed that five lines share characteristic markers of the XA21 defense response (generation of reactive oxygen species and defense response gene expression) after treatment with RaxX21-sY. Our results indicate that expression of the XA21:EFR chimeric receptor in rice confers resistance to Xoo . These results suggest that the endodomain of the EFR and XA21 immune receptors are interchangeable and the XA21 ectodomain is the key determinant conferring robust resistance to Xoo .
Immunoadolescence: Neuroimmune development and adolescent behavior
Brenhouse, Heather C.; Schwarz, Jaclyn M.
2016-01-01
The brain is increasingly appreciated to be a constantly rewired organ that yields age-specific behaviors and responses to the environment. Adolescence in particular is a unique period characterized by continued brain maturation, superimposed with transient needs of the organism to traverse a leap from parental dependence to independence. Here we describe how these needs require immune maturation, as well as brain maturation. Our immune system, which protects us from pathogens and regulates inflammation, is in constant communication with our nervous system. Together, neuro-immune signaling regulates our behavioral responses to the environment, making this interaction a likely substrate for adolescent development. We review here the identified as well as understudied components of neuro-immune interactions during adolescence. Synaptic pruning, neurite outgrowth, and neurotransmitter release during adolescence all regulate—and are regulated by—immune signals, which occur via blood-brain barrier dynamics and glial activity. We discuss these processes, as well as how immune signaling during this transitional period of development confers differential effects on behavior and vulnerability to mental illness. PMID:27260127
Molina, Matías Alejandro; Díaz, Ailén Magalí; Hesse, Christina; Ginter, Wiebke; Gentilini, María Virginia; Nuñez, Guillermo Gabriel; Canellada, Andrea Mercedes; Sparwasser, Tim; Berod, Luciana; Castro, Marisa Silvia; Manghi, Marcela Alejandra
2015-01-01
Probiotics can modulate the immune system, conferring beneficial effects on the host. Understanding how these microorganisms contribute to improve the health status is still a challenge. Previously, we have demonstrated that Enterococcus faecalis CECT7121 implants itself and persists in the murine gastrointestinal tract, and enhances and skews the profile of cytokines towards the Th1 phenotype in several biological models. Given the importance of dendritic cells (DCs) in the orchestration of immunity, the aim of this work was to elucidate the influence of E. faecalis CECT7121 on DCs and the outcome of the immune responses. In this work we show that E. faecalis CECT7121 induces a strong dose-dependent activation of DCs and secretion of high levels of IL-12, IL-6, TNFα, and IL-10. This stimulation is dependent on TLR signaling, and skews the activation of T cells towards the production of IFNγ. The influence of this activation in the establishment of Th responses in vivo shows the accumulation of specific IFNγ-producing cells. Our findings indicate that the activation exerted by E. faecalis CECT7121 on DCs and its consequence on the cellular adaptive immune response may have broad therapeutic implications in immunomodulation. PMID:25978357
Molina, Matías Alejandro; Díaz, Ailén Magalí; Hesse, Christina; Ginter, Wiebke; Gentilini, María Virginia; Nuñez, Guillermo Gabriel; Canellada, Andrea Mercedes; Sparwasser, Tim; Berod, Luciana; Castro, Marisa Silvia; Manghi, Marcela Alejandra
2015-01-01
Probiotics can modulate the immune system, conferring beneficial effects on the host. Understanding how these microorganisms contribute to improve the health status is still a challenge. Previously, we have demonstrated that Enterococcus faecalis CECT7121 implants itself and persists in the murine gastrointestinal tract, and enhances and skews the profile of cytokines towards the Th1 phenotype in several biological models. Given the importance of dendritic cells (DCs) in the orchestration of immunity, the aim of this work was to elucidate the influence of E. faecalis CECT7121 on DCs and the outcome of the immune responses. In this work we show that E. faecalis CECT7121 induces a strong dose-dependent activation of DCs and secretion of high levels of IL-12, IL-6, TNFα, and IL-10. This stimulation is dependent on TLR signaling, and skews the activation of T cells towards the production of IFNγ. The influence of this activation in the establishment of Th responses in vivo shows the accumulation of specific IFNγ-producing cells. Our findings indicate that the activation exerted by E. faecalis CECT7121 on DCs and its consequence on the cellular adaptive immune response may have broad therapeutic implications in immunomodulation.
7 CFR 945.86 - Duration of immunities.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 8 2013-01-01 2013-01-01 false Duration of immunities. 945.86 Section 945.86 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING... § 945.86 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by...
7 CFR 945.86 - Duration of immunities.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 8 2014-01-01 2014-01-01 false Duration of immunities. 945.86 Section 945.86 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING... § 945.86 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by...
7 CFR 905.85 - Duration of immunities.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 8 2014-01-01 2014-01-01 false Duration of immunities. 905.85 Section 905.85 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING... immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this part shall...
7 CFR 905.85 - Duration of immunities.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 8 2013-01-01 2013-01-01 false Duration of immunities. 905.85 Section 905.85 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING... immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this part shall...
7 CFR 906.58 - Duration of immunities.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 8 2011-01-01 2011-01-01 false Duration of immunities. 906.58 Section 906.58 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing... immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart...
7 CFR 956.91 - Duration of immunities.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 8 2010-01-01 2010-01-01 false Duration of immunities. 956.91 Section 956.91 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing... immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart...
7 CFR 956.91 - Duration of immunities.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 8 2012-01-01 2012-01-01 false Duration of immunities. 956.91 Section 956.91 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing... immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart...
7 CFR 987.80 - Duration of immunities.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 8 2011-01-01 2011-01-01 false Duration of immunities. 987.80 Section 987.80 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing... of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this...
7 CFR 923.67 - Duration of immunities.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 8 2014-01-01 2014-01-01 false Duration of immunities. 923.67 Section 923.67 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING... immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart...
7 CFR 923.67 - Duration of immunities.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 8 2011-01-01 2011-01-01 false Duration of immunities. 923.67 Section 923.67 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing... immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart...
7 CFR 958.83 - Duration of immunities.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 8 2013-01-01 2013-01-01 false Duration of immunities. 958.83 Section 958.83 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING... § 958.83 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by...
7 CFR 958.83 - Duration of immunities.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 8 2014-01-01 2014-01-01 false Duration of immunities. 958.83 Section 958.83 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING... § 958.83 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by...
7 CFR 987.80 - Duration of immunities.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 8 2010-01-01 2010-01-01 false Duration of immunities. 987.80 Section 987.80 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing... of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this...
7 CFR 923.67 - Duration of immunities.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 8 2013-01-01 2013-01-01 false Duration of immunities. 923.67 Section 923.67 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING... immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart...
7 CFR 906.58 - Duration of immunities.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 8 2013-01-01 2013-01-01 false Duration of immunities. 906.58 Section 906.58 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING... immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart...
7 CFR 956.91 - Duration of immunities.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 8 2013-01-01 2013-01-01 false Duration of immunities. 956.91 Section 956.91 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING... immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart...
7 CFR 905.85 - Duration of immunities.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 8 2012-01-01 2012-01-01 false Duration of immunities. 905.85 Section 905.85 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing... immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this part shall...
7 CFR 956.91 - Duration of immunities.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 8 2014-01-01 2014-01-01 false Duration of immunities. 956.91 Section 956.91 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING... immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart...
7 CFR 906.58 - Duration of immunities.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 8 2014-01-01 2014-01-01 false Duration of immunities. 906.58 Section 906.58 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING... immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart...
7 CFR 905.85 - Duration of immunities.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 8 2010-01-01 2010-01-01 false Duration of immunities. 905.85 Section 905.85 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing... immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this part shall...
7 CFR 987.80 - Duration of immunities.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 8 2013-01-01 2013-01-01 false Duration of immunities. 987.80 Section 987.80 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING... of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this...
7 CFR 929.72 - Duration of immunities.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 8 2011-01-01 2011-01-01 false Duration of immunities. 929.72 Section 929.72 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing... Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of...
7 CFR 956.91 - Duration of immunities.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 8 2011-01-01 2011-01-01 false Duration of immunities. 956.91 Section 956.91 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing... immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart...
7 CFR 945.86 - Duration of immunities.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 8 2012-01-01 2012-01-01 false Duration of immunities. 945.86 Section 945.86 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing... § 945.86 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by...
7 CFR 958.83 - Duration of immunities.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 8 2012-01-01 2012-01-01 false Duration of immunities. 958.83 Section 958.83 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing... § 958.83 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by...
7 CFR 929.72 - Duration of immunities.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 8 2010-01-01 2010-01-01 false Duration of immunities. 929.72 Section 929.72 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing... Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of...
7 CFR 945.86 - Duration of immunities.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 8 2010-01-01 2010-01-01 false Duration of immunities. 945.86 Section 945.86 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing... § 945.86 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by...
7 CFR 906.58 - Duration of immunities.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 8 2012-01-01 2012-01-01 false Duration of immunities. 906.58 Section 906.58 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing... immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart...
7 CFR 929.72 - Duration of immunities.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 8 2012-01-01 2012-01-01 false Duration of immunities. 929.72 Section 929.72 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing... Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of...
7 CFR 929.72 - Duration of immunities.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 8 2013-01-01 2013-01-01 false Duration of immunities. 929.72 Section 929.72 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING... Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of...
7 CFR 923.67 - Duration of immunities.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 8 2012-01-01 2012-01-01 false Duration of immunities. 923.67 Section 923.67 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing... immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart...
7 CFR 945.86 - Duration of immunities.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 8 2011-01-01 2011-01-01 false Duration of immunities. 945.86 Section 945.86 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing... § 945.86 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by...
7 CFR 924.67 - Duration of immunities.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 8 2011-01-01 2011-01-01 false Duration of immunities. 924.67 Section 924.67 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing... § 924.67 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by...
7 CFR 958.83 - Duration of immunities.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 8 2010-01-01 2010-01-01 false Duration of immunities. 958.83 Section 958.83 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing... § 958.83 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by...
7 CFR 905.85 - Duration of immunities.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 8 2011-01-01 2011-01-01 false Duration of immunities. 905.85 Section 905.85 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing... immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this part shall...
7 CFR 958.83 - Duration of immunities.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 8 2011-01-01 2011-01-01 false Duration of immunities. 958.83 Section 958.83 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing... § 958.83 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by...
7 CFR 923.67 - Duration of immunities.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 8 2010-01-01 2010-01-01 false Duration of immunities. 923.67 Section 923.67 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing... immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart...
7 CFR 906.58 - Duration of immunities.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 8 2010-01-01 2010-01-01 false Duration of immunities. 906.58 Section 906.58 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing... immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart...
7 CFR 929.72 - Duration of immunities.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 8 2014-01-01 2014-01-01 false Duration of immunities. 929.72 Section 929.72 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING... Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of...
7 CFR 987.80 - Duration of immunities.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 8 2014-01-01 2014-01-01 false Duration of immunities. 987.80 Section 987.80 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING... of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this...
7 CFR 987.80 - Duration of immunities.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 8 2012-01-01 2012-01-01 false Duration of immunities. 987.80 Section 987.80 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing... of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this...
7 CFR 924.67 - Duration of immunities.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 8 2010-01-01 2010-01-01 false Duration of immunities. 924.67 Section 924.67 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing... § 924.67 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by...
Yermakova, Anastasiya; Mantis, Nicholas J
2013-09-01
SylH3 and 24B11 are murine monoclonal antibodies directed against different epitopes on ricin toxin's binding (RTB) subunit that have been shown to passively protect mice against ricin challenge. Here we report that Fab fragments of SylH3 and 24B11 neutralize ricin in a cell based assay, and in a mouse challenge model as effectively as their respective full length parental IgGs. These data demonstrate that immunity to ricin can occur independent of Fc-mediated clearance. Copyright © 2013 Elsevier Ltd. All rights reserved.
Current understanding of interactions between nanoparticles and the immune system
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dobrovolskaia, Marina A., E-mail: marina@mail.nih.
2016-05-15
The delivery of drugs, antigens, and imaging agents benefits from using nanotechnology-based carriers. The successful translation of nanoformulations to the clinic involves thorough assessment of their safety profiles, which, among other end-points, includes evaluation of immunotoxicity. The past decade of research focusing on nanoparticle interaction with the immune system has been fruitful in terms of understanding the basics of nanoparticle immunocompatibility, developing a bioanalytical infrastructure to screen for nanoparticle-mediated immune reactions, beginning to uncover the mechanisms of nanoparticle immunotoxicity, and utilizing current knowledge about the structure–activity relationship between nanoparticles' physicochemical properties and their effects on the immune system to guidemore » safe drug delivery. In the present review, we focus on the most prominent pieces of the nanoparticle–immune system puzzle and discuss the achievements, disappointments, and lessons learned over the past 15 years of research on the immunotoxicity of engineered nanomaterials. - Graphical abstract: API — active pharmaceutical ingredient; NP — nanoparticles; PCP — physicochemical properties, CARPA — complement activation-related pseudoallergy, ICH — International Conference on Harmonization. Display Omitted - Highlights: • Achievements, disappointments and lessons learned over past decade are reviewed. • Areas in focus include characterization, immunotoxicity and utility in drug delivery. • Future direction focusing on mechanistic immunotoxicity studies is proposed.« less
Richard, Katharina; Mann, Barbara J.; Stocker, Lenea; Barry, Eileen M.; Qin, Aiping; Cole, Leah E.; Hurley, Matthew T.; Ernst, Robert K.; Michalek, Suzanne M.; Stein, Daniel C.; DeShong, Philip
2014-01-01
Francisella tularensis is a Gram-negative immune-evasive coccobacillus that causes tularemia in humans and animals. A safe and efficacious vaccine that is protective against multiple F. tularensis strains has yet to be developed. In this study, we tested a novel vaccine approach using artificial pathogens, synthetic nanoparticles made from catanionic surfactant vesicles that are functionalized by the incorporation of either F. tularensis type B live vaccine strain (F. tularensis LVS [LVS-V]) or F. tularensis type A Schu S4 strain (F. tularensis Schu S4 [Schu S4-V]) components. The immunization of C57BL/6 mice with “bare” vesicles, which did not express F. tularensis components, partially protected against F. tularensis LVS, presumably through activation of the innate immune response, and yet it failed to protect against the F. tularensis Schu S4 strain. In contrast, immunization with LVS-V fully protected mice against intraperitoneal (i.p.) F. tularensis LVS challenge, while immunization of mice with either LVS-V or Schu S4-V partially protected C57BL/6 mice against an intranasal (i.n.) F. tularensis Schu S4 challenge and significantly increased the mean time to death for nonsurvivors, particularly following the i.n. and heterologous (i.e., i.p./i.n.) routes of immunization. LVS-V immunization, but not immunization with empty vesicles, elicited high levels of IgG against nonlipopolysaccharide (non-LPS) epitopes that were increased after F. tularensis LVS challenge and significantly increased early cytokine production. Antisera from LVS-V-immunized mice conferred passive protection against challenge with F. tularensis LVS. Together, these data indicate that functionalized catanionic surfactant vesicles represent an important and novel tool for the development of a safe and effective F. tularensis subunit vaccine and may be applicable for use with other pathogens. PMID:24351755
Adachi, Hiroaki; Ishihama, Nobuaki; Nakano, Takaaki; Yoshioka, Miki; Yoshioka, Hirofumi
2016-06-02
MEK2-SIPK/WIPK cascade, a Nicotiana benthamiana mitogen-activated protein kinase (MAPK) cascade, is an essential signaling pathway for plant immunity and involved in hypersensitive response (HR) accompanied by cell death. WRKY transcription factors as substrates of SIPK and WIPK have been isolated and implicated in HR cell death. Here, we show virus-induced gene silencing of WRKY genes compromised constitutively active MEK2-triggered cell death in N. benthamiana leaves. In general, HR cell death enhances susceptibility to necrotrophic pathogens such as Botrytis cinerea. However, the WRKY gene silencing elevated susceptibility to B. cinerea. These findings suggest that downstream WRKYs of MEK2-SIPK/WIPK cascade are required for cell death-dependent and -independent immunities in N. benthamiana.
7 CFR 953.78 - Duration of immunities.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 8 2013-01-01 2013-01-01 false Duration of immunities. 953.78 Section 953.78... SOUTHEASTERN STATES Order Regulating Handling Miscellaneous Provisions § 953.78 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart shall cease upon...
7 CFR 915.67 - Duration of immunities.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 8 2012-01-01 2012-01-01 false Duration of immunities. 915.67 Section 915.67... Order Regulating Handling Miscellaneous Provisions § 915.67 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this part shall cease upon its termination...
7 CFR 927.72 - Duration of immunities.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 8 2013-01-01 2013-01-01 false Duration of immunities. 927.72 Section 927.72... WASHINGTON Order Regulating Handling Miscellaneous Provisions § 927.72 Duration of immunities. The benefits, privileges, and immunities conferred by virtue of this subpart shall cease upon termination hereof, except...
7 CFR 953.78 - Duration of immunities.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 8 2012-01-01 2012-01-01 false Duration of immunities. 953.78 Section 953.78... SOUTHEASTERN STATES Order Regulating Handling Miscellaneous Provisions § 953.78 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart shall cease upon...
7 CFR 946.73 - Duration of immunities.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 8 2012-01-01 2012-01-01 false Duration of immunities. 946.73 Section 946.73... WASHINGTON Order Regulating Handling Miscellaneous Provisions § 946.73 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart shall cease upon the...
7 CFR 993.87 - Duration of immunities.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 8 2010-01-01 2010-01-01 false Duration of immunities. 993.87 Section 993.87... CALIFORNIA Order Regulating Handling Miscellaneous Provisions § 993.87 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart shall cease upon the...
7 CFR 946.73 - Duration of immunities.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 8 2014-01-01 2014-01-01 false Duration of immunities. 946.73 Section 946.73... WASHINGTON Order Regulating Handling Miscellaneous Provisions § 946.73 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart shall cease upon the...
7 CFR 927.72 - Duration of immunities.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 8 2011-01-01 2011-01-01 false Duration of immunities. 927.72 Section 927.72... WASHINGTON Order Regulating Handling Miscellaneous Provisions § 927.72 Duration of immunities. The benefits, privileges, and immunities conferred by virtue of this subpart shall cease upon termination hereof, except...
7 CFR 925.66 - Duration of immunities.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 8 2013-01-01 2013-01-01 false Duration of immunities. 925.66 Section 925.66... OF SOUTHEASTERN CALIFORNIA Miscellaneous Provisions § 925.66 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this part shall cease upon its termination...
7 CFR 922.67 - Duration of immunities.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 8 2012-01-01 2012-01-01 false Duration of immunities. 922.67 Section 922.67... COUNTIES IN WASHINGTON Order Regulating Handling Miscellaneous Provisions § 922.67 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart shall...
7 CFR 925.66 - Duration of immunities.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 8 2011-01-01 2011-01-01 false Duration of immunities. 925.66 Section 925.66... OF SOUTHEASTERN CALIFORNIA Miscellaneous Provisions § 925.66 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this part shall cease upon its termination...
7 CFR 953.78 - Duration of immunities.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 8 2011-01-01 2011-01-01 false Duration of immunities. 953.78 Section 953.78... SOUTHEASTERN STATES Order Regulating Handling Miscellaneous Provisions § 953.78 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart shall cease upon...
7 CFR 993.87 - Duration of immunities.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 8 2014-01-01 2014-01-01 false Duration of immunities. 993.87 Section 993.87... CALIFORNIA Order Regulating Handling Miscellaneous Provisions § 993.87 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart shall cease upon the...
7 CFR 989.88 - Duration of immunities.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 8 2012-01-01 2012-01-01 false Duration of immunities. 989.88 Section 989.88... GROWN IN CALIFORNIA Order Regulating Handling Miscellaneous Provisions § 989.88 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this amended subpart...
7 CFR 916.67 - Duration of immunities.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 8 2010-01-01 2010-01-01 false Duration of immunities. 916.67 Section 916.67... Order Regulating Handling Miscellaneous Provisions § 916.67 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this part shall cease upon its termination...
7 CFR 993.87 - Duration of immunities.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 8 2011-01-01 2011-01-01 false Duration of immunities. 993.87 Section 993.87... CALIFORNIA Order Regulating Handling Miscellaneous Provisions § 993.87 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart shall cease upon the...
7 CFR 915.67 - Duration of immunities.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 8 2010-01-01 2010-01-01 false Duration of immunities. 915.67 Section 915.67... Order Regulating Handling Miscellaneous Provisions § 915.67 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this part shall cease upon its termination...
7 CFR 989.88 - Duration of immunities.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 8 2013-01-01 2013-01-01 false Duration of immunities. 989.88 Section 989.88... GROWN IN CALIFORNIA Order Regulating Handling Miscellaneous Provisions § 989.88 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this amended subpart...
7 CFR 917.65 - Duration of immunities.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 8 2012-01-01 2012-01-01 false Duration of immunities. 917.65 Section 917.65... CALIFORNIA Order Regulating Handling Miscellaneous Provisions § 917.65 Duration of immunities. The benefits, privileges, and immunities conferred by virtue of the provisions of this subpart shall cease upon its...
7 CFR 982.84 - Duration of immunities.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 8 2013-01-01 2013-01-01 false Duration of immunities. 982.84 Section 982.84... WASHINGTON Order Regulating Handling Miscellaneous Provisions § 982.84 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart shall cease upon the...
7 CFR 927.72 - Duration of immunities.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 8 2012-01-01 2012-01-01 false Duration of immunities. 927.72 Section 927.72... WASHINGTON Order Regulating Handling Miscellaneous Provisions § 927.72 Duration of immunities. The benefits, privileges, and immunities conferred by virtue of this subpart shall cease upon termination hereof, except...
7 CFR 915.67 - Duration of immunities.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 8 2011-01-01 2011-01-01 false Duration of immunities. 915.67 Section 915.67... Order Regulating Handling Miscellaneous Provisions § 915.67 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this part shall cease upon its termination...
7 CFR 948.87 - Duration of immunities.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 8 2013-01-01 2013-01-01 false Duration of immunities. 948.87 Section 948.87... Order Regulating Handling Miscellaneous Provisions § 948.87 Duration of immunities. The benefits, privileges and immunities conferred upon any person by virtue of this subpart shall cease upon the...
7 CFR 982.84 - Duration of immunities.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 8 2014-01-01 2014-01-01 false Duration of immunities. 982.84 Section 982.84... WASHINGTON Order Regulating Handling Miscellaneous Provisions § 982.84 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart shall cease upon the...
7 CFR 993.87 - Duration of immunities.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 8 2012-01-01 2012-01-01 false Duration of immunities. 993.87 Section 993.87... CALIFORNIA Order Regulating Handling Miscellaneous Provisions § 993.87 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart shall cease upon the...
7 CFR 915.67 - Duration of immunities.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 8 2014-01-01 2014-01-01 false Duration of immunities. 915.67 Section 915.67... Order Regulating Handling Miscellaneous Provisions § 915.67 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this part shall cease upon its termination...
7 CFR 946.73 - Duration of immunities.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 8 2011-01-01 2011-01-01 false Duration of immunities. 946.73 Section 946.73... WASHINGTON Order Regulating Handling Miscellaneous Provisions § 946.73 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart shall cease upon the...
7 CFR 948.87 - Duration of immunities.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 8 2011-01-01 2011-01-01 false Duration of immunities. 948.87 Section 948.87... Order Regulating Handling Miscellaneous Provisions § 948.87 Duration of immunities. The benefits, privileges and immunities conferred upon any person by virtue of this subpart shall cease upon the...
7 CFR 948.87 - Duration of immunities.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 8 2014-01-01 2014-01-01 false Duration of immunities. 948.87 Section 948.87... Order Regulating Handling Miscellaneous Provisions § 948.87 Duration of immunities. The benefits, privileges and immunities conferred upon any person by virtue of this subpart shall cease upon the...
7 CFR 917.65 - Duration of immunities.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 8 2010-01-01 2010-01-01 false Duration of immunities. 917.65 Section 917.65... CALIFORNIA Order Regulating Handling Miscellaneous Provisions § 917.65 Duration of immunities. The benefits, privileges, and immunities conferred by virtue of the provisions of this subpart shall cease upon its...
7 CFR 989.88 - Duration of immunities.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 8 2010-01-01 2010-01-01 false Duration of immunities. 989.88 Section 989.88... GROWN IN CALIFORNIA Order Regulating Handling Miscellaneous Provisions § 989.88 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this amended subpart...
7 CFR 922.67 - Duration of immunities.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 8 2013-01-01 2013-01-01 false Duration of immunities. 922.67 Section 922.67... COUNTIES IN WASHINGTON Order Regulating Handling Miscellaneous Provisions § 922.67 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart shall...
7 CFR 922.67 - Duration of immunities.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 8 2014-01-01 2014-01-01 false Duration of immunities. 922.67 Section 922.67... COUNTIES IN WASHINGTON Order Regulating Handling Miscellaneous Provisions § 922.67 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart shall...
7 CFR 982.84 - Duration of immunities.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 8 2011-01-01 2011-01-01 false Duration of immunities. 982.84 Section 982.84... WASHINGTON Order Regulating Handling Miscellaneous Provisions § 982.84 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart shall cease upon the...
7 CFR 915.67 - Duration of immunities.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 8 2013-01-01 2013-01-01 false Duration of immunities. 915.67 Section 915.67... Order Regulating Handling Miscellaneous Provisions § 915.67 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this part shall cease upon its termination...
7 CFR 917.65 - Duration of immunities.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 8 2011-01-01 2011-01-01 false Duration of immunities. 917.65 Section 917.65... CALIFORNIA Order Regulating Handling Miscellaneous Provisions § 917.65 Duration of immunities. The benefits, privileges, and immunities conferred by virtue of the provisions of this subpart shall cease upon its...
7 CFR 917.65 - Duration of immunities.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 8 2013-01-01 2013-01-01 false Duration of immunities. 917.65 Section 917.65... CALIFORNIA Order Regulating Handling Miscellaneous Provisions § 917.65 Duration of immunities. The benefits, privileges, and immunities conferred by virtue of the provisions of this subpart shall cease upon its...
7 CFR 982.84 - Duration of immunities.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 8 2010-01-01 2010-01-01 false Duration of immunities. 982.84 Section 982.84... WASHINGTON Order Regulating Handling Miscellaneous Provisions § 982.84 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart shall cease upon the...
7 CFR 922.67 - Duration of immunities.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 8 2011-01-01 2011-01-01 false Duration of immunities. 922.67 Section 922.67... COUNTIES IN WASHINGTON Order Regulating Handling Miscellaneous Provisions § 922.67 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart shall...
7 CFR 989.88 - Duration of immunities.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 8 2014-01-01 2014-01-01 false Duration of immunities. 989.88 Section 989.88... GROWN IN CALIFORNIA Order Regulating Handling Miscellaneous Provisions § 989.88 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this amended subpart...
7 CFR 925.66 - Duration of immunities.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 8 2012-01-01 2012-01-01 false Duration of immunities. 925.66 Section 925.66... OF SOUTHEASTERN CALIFORNIA Miscellaneous Provisions § 925.66 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this part shall cease upon its termination...
7 CFR 993.87 - Duration of immunities.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 8 2013-01-01 2013-01-01 false Duration of immunities. 993.87 Section 993.87... CALIFORNIA Order Regulating Handling Miscellaneous Provisions § 993.87 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart shall cease upon the...
7 CFR 946.73 - Duration of immunities.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 8 2013-01-01 2013-01-01 false Duration of immunities. 946.73 Section 946.73... WASHINGTON Order Regulating Handling Miscellaneous Provisions § 946.73 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart shall cease upon the...
7 CFR 953.78 - Duration of immunities.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 8 2010-01-01 2010-01-01 false Duration of immunities. 953.78 Section 953.78... SOUTHEASTERN STATES Order Regulating Handling Miscellaneous Provisions § 953.78 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart shall cease upon...
7 CFR 917.65 - Duration of immunities.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 8 2014-01-01 2014-01-01 false Duration of immunities. 917.65 Section 917.65... CALIFORNIA Order Regulating Handling Miscellaneous Provisions § 917.65 Duration of immunities. The benefits, privileges, and immunities conferred by virtue of the provisions of this subpart shall cease upon its...
7 CFR 922.67 - Duration of immunities.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 8 2010-01-01 2010-01-01 false Duration of immunities. 922.67 Section 922.67... COUNTIES IN WASHINGTON Order Regulating Handling Miscellaneous Provisions § 922.67 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart shall...
7 CFR 982.84 - Duration of immunities.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 8 2012-01-01 2012-01-01 false Duration of immunities. 982.84 Section 982.84... WASHINGTON Order Regulating Handling Miscellaneous Provisions § 982.84 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart shall cease upon the...
7 CFR 927.72 - Duration of immunities.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 8 2014-01-01 2014-01-01 false Duration of immunities. 927.72 Section 927.72... WASHINGTON Order Regulating Handling Miscellaneous Provisions § 927.72 Duration of immunities. The benefits, privileges, and immunities conferred by virtue of this subpart shall cease upon termination hereof, except...
7 CFR 989.88 - Duration of immunities.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 8 2011-01-01 2011-01-01 false Duration of immunities. 989.88 Section 989.88... GROWN IN CALIFORNIA Order Regulating Handling Miscellaneous Provisions § 989.88 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this amended subpart...
7 CFR 925.66 - Duration of immunities.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 8 2010-01-01 2010-01-01 false Duration of immunities. 925.66 Section 925.66... OF SOUTHEASTERN CALIFORNIA Miscellaneous Provisions § 925.66 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this part shall cease upon its termination...
7 CFR 946.73 - Duration of immunities.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 8 2010-01-01 2010-01-01 false Duration of immunities. 946.73 Section 946.73... WASHINGTON Order Regulating Handling Miscellaneous Provisions § 946.73 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart shall cease upon the...
7 CFR 925.66 - Duration of immunities.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 8 2014-01-01 2014-01-01 false Duration of immunities. 925.66 Section 925.66... OF SOUTHEASTERN CALIFORNIA Miscellaneous Provisions § 925.66 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this part shall cease upon its termination...
7 CFR 953.78 - Duration of immunities.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 8 2014-01-01 2014-01-01 false Duration of immunities. 953.78 Section 953.78... SOUTHEASTERN STATES Order Regulating Handling Miscellaneous Provisions § 953.78 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart shall cease upon...
7 CFR 916.67 - Duration of immunities.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 8 2011-01-01 2011-01-01 false Duration of immunities. 916.67 Section 916.67... Order Regulating Handling Miscellaneous Provisions § 916.67 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this part shall cease upon its termination...
7 CFR 927.72 - Duration of immunities.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 8 2010-01-01 2010-01-01 false Duration of immunities. 927.72 Section 927.72... WASHINGTON Order Regulating Handling Miscellaneous Provisions § 927.72 Duration of immunities. The benefits, privileges, and immunities conferred by virtue of this subpart shall cease upon termination hereof, except...
7 CFR 948.87 - Duration of immunities.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 8 2010-01-01 2010-01-01 false Duration of immunities. 948.87 Section 948.87... Order Regulating Handling Miscellaneous Provisions § 948.87 Duration of immunities. The benefits, privileges and immunities conferred upon any person by virtue of this subpart shall cease upon the...
7 CFR 948.87 - Duration of immunities.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 8 2012-01-01 2012-01-01 false Duration of immunities. 948.87 Section 948.87... Order Regulating Handling Miscellaneous Provisions § 948.87 Duration of immunities. The benefits, privileges and immunities conferred upon any person by virtue of this subpart shall cease upon the...
Plant innate immunity: an updated insight into defense mechanism.
Muthamilarasan, Mehanathan; Prasad, Manoj
2013-06-01
Plants are invaded by an array of pathogens of which only a few succeed in causing disease. The attack by others is countered by a sophisticated immune system possessed by the plants. The plant immune system is broadly divided into two, viz. microbial-associated molecular-patterns-triggered immunity (MTI) and effector-triggered immunity (ETI). MTI confers basal resistance, while ETI confers durable resistance, often resulting in hypersensitive response. Plants also possess systemic acquired resistance (SAR), which provides long-term defense against a broad-spectrum of pathogens. Salicylic-acid-mediated systemic acquired immunity provokes the defense response throughout the plant system during pathogen infection at a particular site. Trans-generational immune priming allows the plant to heritably shield their progeny towards pathogens previously encountered. Plants circumvent the viral infection through RNA interference phenomena by utilizing small RNAs. This review summarizes the molecular mechanisms of plant immune system, and the latest breakthroughs reported in plant defense. We discuss the plant–pathogen interactions and integrated defense responses in the context of presenting an integral understanding in plant molecular immunity.
7 CFR 981.88 - Duration of immunities.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 8 2012-01-01 2012-01-01 false Duration of immunities. 981.88 Section 981.88... Regulating Handling Miscellaneous Provisions § 981.88 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart shall cease upon its termination except with...
7 CFR 981.88 - Duration of immunities.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 8 2014-01-01 2014-01-01 false Duration of immunities. 981.88 Section 981.88... Regulating Handling Miscellaneous Provisions § 981.88 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart shall cease upon its termination except with...
7 CFR 932.71 - Duration of immunities.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 8 2013-01-01 2013-01-01 false Duration of immunities. 932.71 Section 932.71... Regulating Handling Miscellaneous Provisions § 932.71 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart shall cease upon the termination of this...
7 CFR 984.87 - Duration of immunities.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 8 2011-01-01 2011-01-01 false Duration of immunities. 984.87 Section 984.87... Regulating Handling Miscellaneous Provisions § 984.87 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart shall cease upon the termination hereof except...
7 CFR 983.85 - Duration of immunities.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 8 2013-01-01 2013-01-01 false Duration of immunities. 983.85 Section 983.85..., ARIZONA, AND NEW MEXICO Miscellaneous Provisions § 983.85 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this part shall cease upon its termination...
7 CFR 966.87 - Duration of immunities.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 8 2014-01-01 2014-01-01 false Duration of immunities. 966.87 Section 966.87... Regulating Handling Miscellaneous Provisions § 966.87 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart shall cease upon the termination of this...
7 CFR 932.71 - Duration of immunities.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 8 2012-01-01 2012-01-01 false Duration of immunities. 932.71 Section 932.71... Regulating Handling Miscellaneous Provisions § 932.71 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart shall cease upon the termination of this...
7 CFR 959.87 - Duration of immunities.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 8 2010-01-01 2010-01-01 false Duration of immunities. 959.87 Section 959.87... Regulating Handling Miscellaneous Provisions § 959.87 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart shall cease upon the termination of this...
7 CFR 966.87 - Duration of immunities.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 8 2013-01-01 2013-01-01 false Duration of immunities. 966.87 Section 966.87... Regulating Handling Miscellaneous Provisions § 966.87 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart shall cease upon the termination of this...
7 CFR 984.87 - Duration of immunities.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 8 2010-01-01 2010-01-01 false Duration of immunities. 984.87 Section 984.87... Regulating Handling Miscellaneous Provisions § 984.87 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart shall cease upon the termination hereof except...
7 CFR 959.87 - Duration of immunities.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 8 2013-01-01 2013-01-01 false Duration of immunities. 959.87 Section 959.87... Regulating Handling Miscellaneous Provisions § 959.87 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart shall cease upon the termination of this...
7 CFR 932.71 - Duration of immunities.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 8 2011-01-01 2011-01-01 false Duration of immunities. 932.71 Section 932.71... Regulating Handling Miscellaneous Provisions § 932.71 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart shall cease upon the termination of this...
7 CFR 932.71 - Duration of immunities.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 8 2014-01-01 2014-01-01 false Duration of immunities. 932.71 Section 932.71... Regulating Handling Miscellaneous Provisions § 932.71 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart shall cease upon the termination of this...
7 CFR 959.87 - Duration of immunities.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 8 2014-01-01 2014-01-01 false Duration of immunities. 959.87 Section 959.87... Regulating Handling Miscellaneous Provisions § 959.87 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart shall cease upon the termination of this...
7 CFR 983.85 - Duration of immunities.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 8 2011-01-01 2011-01-01 false Duration of immunities. 983.85 Section 983.85..., ARIZONA, AND NEW MEXICO Miscellaneous Provisions § 983.85 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this part shall cease upon its termination...
7 CFR 966.87 - Duration of immunities.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 8 2010-01-01 2010-01-01 false Duration of immunities. 966.87 Section 966.87... Regulating Handling Miscellaneous Provisions § 966.87 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart shall cease upon the termination of this...
7 CFR 959.87 - Duration of immunities.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 8 2011-01-01 2011-01-01 false Duration of immunities. 959.87 Section 959.87... Regulating Handling Miscellaneous Provisions § 959.87 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart shall cease upon the termination of this...
7 CFR 984.87 - Duration of immunities.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 8 2013-01-01 2013-01-01 false Duration of immunities. 984.87 Section 984.87... Regulating Handling Miscellaneous Provisions § 984.87 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart shall cease upon the termination hereof except...
7 CFR 981.88 - Duration of immunities.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 8 2011-01-01 2011-01-01 false Duration of immunities. 981.88 Section 981.88... Regulating Handling Miscellaneous Provisions § 981.88 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart shall cease upon its termination except with...
7 CFR 984.87 - Duration of immunities.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 8 2014-01-01 2014-01-01 false Duration of immunities. 984.87 Section 984.87... Regulating Handling Miscellaneous Provisions § 984.87 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart shall cease upon the termination hereof except...
7 CFR 983.85 - Duration of immunities.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 8 2012-01-01 2012-01-01 false Duration of immunities. 983.85 Section 983.85..., ARIZONA, AND NEW MEXICO Miscellaneous Provisions § 983.85 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this part shall cease upon its termination...
7 CFR 984.87 - Duration of immunities.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 8 2012-01-01 2012-01-01 false Duration of immunities. 984.87 Section 984.87... Regulating Handling Miscellaneous Provisions § 984.87 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart shall cease upon the termination hereof except...
7 CFR 981.88 - Duration of immunities.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 8 2010-01-01 2010-01-01 false Duration of immunities. 981.88 Section 981.88... Regulating Handling Miscellaneous Provisions § 981.88 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart shall cease upon its termination except with...
7 CFR 981.88 - Duration of immunities.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 8 2013-01-01 2013-01-01 false Duration of immunities. 981.88 Section 981.88... Regulating Handling Miscellaneous Provisions § 981.88 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart shall cease upon its termination except with...
7 CFR 959.87 - Duration of immunities.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 8 2012-01-01 2012-01-01 false Duration of immunities. 959.87 Section 959.87... Regulating Handling Miscellaneous Provisions § 959.87 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart shall cease upon the termination of this...
7 CFR 966.87 - Duration of immunities.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 8 2012-01-01 2012-01-01 false Duration of immunities. 966.87 Section 966.87... Regulating Handling Miscellaneous Provisions § 966.87 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart shall cease upon the termination of this...
7 CFR 932.71 - Duration of immunities.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 8 2010-01-01 2010-01-01 false Duration of immunities. 932.71 Section 932.71... Regulating Handling Miscellaneous Provisions § 932.71 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart shall cease upon the termination of this...
7 CFR 983.85 - Duration of immunities.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 8 2014-01-01 2014-01-01 false Duration of immunities. 983.85 Section 983.85..., ARIZONA, AND NEW MEXICO Miscellaneous Provisions § 983.85 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this part shall cease upon its termination...
7 CFR 966.87 - Duration of immunities.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 8 2011-01-01 2011-01-01 false Duration of immunities. 966.87 Section 966.87... Regulating Handling Miscellaneous Provisions § 966.87 Duration of immunities. The benefits, privileges, and immunities conferred upon any person by virtue of this subpart shall cease upon the termination of this...
New clinical advances in immunotherapy for the treatment of solid tumours
Zavala, Valentina A; Kalergis, Alexis M
2015-01-01
Advances in understanding the mechanisms of cancer cells for evading the immune system surveillance, including how the immune system modulates the phenotype of tumours, have allowed the development of new therapies that benefit from this complex cellular network to specifically target and destroy cancer cells. Immunotherapy researchers have mainly focused on the discovery of tumour antigens that could confer specificity to immune cells to detect and destroy cancer cells, as well as on the mechanisms leading to an improved activation of effector immune cells. The Food and Drug Administration approval in 2010 of ipilumumab for melanoma treatment and of pembrolizumab in 2014, monoclonal antibodies against T-lymphocyte-associated antigen 4 and programmed cell death 1, respectively, are encouraging examples of how research in this area can successfully translate into clinical use with promising results. Currently, several ongoing clinical trials are in progress testing new anti-cancer therapies based on the enhancement of immune cell activity against tumour antigens. Here we discuss the general concepts related to immunotherapy and the recent application to the treatment of cancer with positive results that support their consideration of clinical application to patients. PMID:25826229
Antibody treatment of human tumor xenografts elicits active anti-tumor immunity in nude mice
Liebman, Meredith A.; Roche, Marly I.; Williams, Brent R.; Kim, Jae; Pageau, Steven C.; Sharon, Jacqueline
2007-01-01
Athymic nude mice bearing subcutaneous tumor xenografts of the human anti-colorectal cancer cell line SW480 were used as a preclinical model to explore anti-tumor immunotherapies. Intratumor or systemic treatment of the mice with murine anti-SW480 serum, recombinant anti-SW480 polyclonal antibodies, or the anti-colorectal cancer monoclonal antibody CO17-1A, caused retardation or regression of SW480 tumor xenografts. Interestingly, when mice that had regressed their tumors were re-challenged with SW480 cells, these mice regressed the new tumors without further antibody treatment. Adoptive transfer of spleen cells from mice that had regressed their tumors conferred anti-tumor immunity to naïve nude mice. Pilot experiments suggest that the transferred anti-tumor immunity is mediated by T cells of both γδ and αβ lineages. These results demonstrate that passive anti-tumor immunotherapy can elicit active immunity and support a role for extra-thymic γδ and αβ T cells in tumor rejection. Implications for potential immunotherapies include injection of tumor nodules in cancer patients with anti-tumor antibodies to induce anti-tumor T cell immunity. PMID:17920694
Pre-existing immunity against Ad vectors: humoral, cellular, and innate response, what's important?.
Fausther-Bovendo, Hugues; Kobinger, Gary P
2014-01-01
Pre-existing immunity against human adenovirus (HAd) serotype 5 derived vector in the human population is widespread, thus hampering its clinical use. Various components of the immune system, including neutralizing antibodies (nAbs), Ad specific T cells and type I IFN activated NK cells, contribute to dampening the efficacy of Ad vectors in individuals with pre-existing Ad immunity. In order to circumvent pre-existing immunity to adenovirus, numerous strategies, such as developing alternative Ad serotypes, varying immunization routes and utilizing prime-boost regimens, are under pre-clinical or clinical phases of development. However, these strategies mainly focus on one arm of pre-existing immunity. Selection of alternative serotypes has been largely driven by the absence in the human population of nAbs against them with little attention paid to cross-reactive Ad specific T cells. Conversely, varying the route of immunization appears to mainly rely on avoiding Ad specific tissue-resident T cells. Finally, prime-boost regimens do not actually circumvent pre-existing immunity but instead generate immune responses of sufficient magnitude to confer protection despite pre-existing immunity. Combining the above strategies and thus taking into account all components regulating pre-existing Ad immunity will help further improve the development of Ad vectors for animal and human use.
The immunomodulatory effect of plant lectins: a review with emphasis on ArtinM properties.
Souza, Maria A; Carvalho, Fernanda C; Ruas, Luciana P; Ricci-Azevedo, Rafael; Roque-Barreira, Maria Cristina
2013-10-01
Advances in the glycobiology and immunology fields have provided many insights into the role of carbohydrate-protein interactions in the immune system. We aim to present a comprehensive review of the effects that some plant lectins exert as immunomodulatory agents, showing that they are able to positively modify the immune response to certain pathological conditions, such as cancer and infections. The present review comprises four main themes: (1) an overview of plant lectins that exert immunomodulatory effects and the mechanisms accounting for these activities; (2) general characteristics of the immunomodulatory lectin ArtinM from the seeds of Artocarpus heterophyllus; (3) activation of innate immunity cells by ArtinM and consequent induction of Th1 immunity; (4) resistance conferred by ArtinM administration in infections with intracellular pathogens, such as Leishmania (Leishmania) major, Leishmania (Leishmania) amazonensis, and Paracoccidioides brasiliensis. We believe that this review will be a valuable resource for more studies in this relatively neglected area of research, which has the potential to reveal carbohydrate targets for novel prophylactic and therapeutic strategies.
Sensing Self and Foreign Circular RNAs by Intron Identity.
Chen, Y Grace; Kim, Myoungjoo V; Chen, Xingqi; Batista, Pedro J; Aoyama, Saeko; Wilusz, Jeremy E; Iwasaki, Akiko; Chang, Howard Y
2017-07-20
Circular RNAs (circRNAs) are single-stranded RNAs that are joined head to tail with largely unknown functions. Here we show that transfection of purified in vitro generated circRNA into mammalian cells led to potent induction of innate immunity genes and confers protection against viral infection. The nucleic acid sensor RIG-I is necessary to sense foreign circRNA, and RIG-I and foreign circRNA co-aggregate in cytoplasmic foci. CircRNA activation of innate immunity is independent of a 5' triphosphate, double-stranded RNA structure, or the primary sequence of the foreign circRNA. Instead, self-nonself discrimination depends on the intron that programs the circRNA. Use of a human intron to express a foreign circRNA sequence abrogates immune activation, and mature human circRNA is associated with diverse RNA binding proteins reflecting its endogenous splicing and biogenesis. These results reveal innate immune sensing of circRNA and highlight introns-the predominant output of mammalian transcription-as arbiters of self-nonself identity. Copyright © 2017 Elsevier Inc. All rights reserved.
Wang, Shui; Gu, Yangnan; Zebell, Sophia G.; Anderson, Lisa K.; Wang, Wei; Mohan, Rajinikanth; Dong, Xinnian
2014-01-01
SUMMARY Effector-triggered immunity (ETI), the major host defense mechanism in plants, is often associated with programmed cell death (PCD). Plants lack close homologs of caspases, the key mediators of PCD in animals. So although the NB-LRR receptors involved in ETI are well studied, how they activate PCD and confer disease resistance remains elusive. We show that the Arabidopsis nuclear envelope protein, CPR5, negatively regulates ETI and the associated PCD through a physical interaction with CYCLIN-DEPENDENT KINASE INHIBITORs (CKIs). Upon ETI induction, CKIs are released from CPR5 to cause over-activation of another core cell cycle regulator, E2F. In cki and e2f mutants, ETI responses induced by both TIR-NB-LRR and CC-NB-LRR classes of immune receptors are compromised. We further show that E2F is deregulated during ETI probably through CKI-mediated hyperphosphorylation of RETINOBLASTOMA-RELATED 1 (RBR1). This study demonstrates that canonical cell cycle regulators also play important noncanonical roles in plant immunity. PMID:25455564
Girard, Marc P; Picot, Valentina; Longuet, Christophe; Nabel, Gary J
2015-08-07
The 2014 Cent Gardes Conference took place on October 5-7, 2014, at the Fondation Mérieux Conference Center, on the shores of the Annecy Lake and aimed to review the progress and promise of HIV vaccines. The elicitation of broadly neutralizing antibodies (bNAbs), their use in passive immunization, as well as their genetic delivery (vector immunoprophylaxis) by a recombinant Adenovirus-associated virus (AAV) vector were reviewed in a preceding article [1]. Approaches to the elicitation of long-lasting T cell or mucosal immunity were also discussed and are now reviewed here. The possibility of eliciting mucosal IgAs was discussed, since it was demonstrated that transcytosis-blocking IgAs can protect monkeys against repeated vaginal challenge with a pathogenic chimeric simian and human immunodeficiency virus (SHIV). The possibility of purging the HIV reservoirs from HIV-infected persons and developing a cure of the disease was also discussed. Copyright © 2015. Published by Elsevier Ltd.. All rights reserved.
Engineering Molecular Immunity Against Plant Viruses.
Zaidi, Syed Shan-E-Ali; Tashkandi, Manal; Mahfouz, Magdy M
2017-01-01
Genomic engineering has been used to precisely alter eukaryotic genomes at the single-base level for targeted gene editing, replacement, fusion, and mutagenesis, and plant viruses such as Tobacco rattle virus have been developed into efficient vectors for delivering genome-engineering reagents. In addition to altering the host genome, these methods can target pathogens to engineer molecular immunity. Indeed, recent studies have shown that clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9) systems that target the genomes of DNA viruses can interfere with viral activity and limit viral symptoms in planta, demonstrating the utility of this system for engineering molecular immunity in plants. CRISPR/Cas9 can efficiently target single and multiple viral infections and confer plant immunity. Here, we discuss the use of site-specific nucleases to engineer molecular immunity against DNA and RNA viruses in plants. We also explore how to address the potential challenges encountered when producing plants with engineered resistance to single and mixed viral infections. © 2017 Elsevier Inc. All rights reserved.
Nucleic acid-induced antiviral immunity in invertebrates: an evolutionary perspective.
Wang, Pei-Hui; Weng, Shao-Ping; He, Jian-Guo
2015-02-01
Nucleic acids derived from viral pathogens are typical pathogen associated molecular patterns (PAMPs). In mammals, the recognition of viral nucleic acids by pattern recognition receptors (PRRs), which include Toll-like receptors (TLRs) and retinoic acid-inducible gene (RIG)-I-like receptors (RLRs), induces the release of inflammatory cytokines and type I interferons (IFNs) through the activation of nuclear factor κB (NF-κB) and interferon regulatory factor (IRF) 3/7 pathways, triggering the host antiviral state. However, whether nucleic acids can induce similar antiviral immunity in invertebrates remains ambiguous. Several studies have reported that nucleic acid mimics, especially dsRNA mimic poly(I:C), can strongly induce non-specific antiviral immune responses in insects, shrimp, and oyster. This behavior shows multiple similarities to the hallmarks of mammalian IFN responses. In this review, we highlight the current understanding of nucleic acid-induced antiviral immunity in invertebrates. We also discuss the potential recognition and regulatory mechanisms that confer non-specific antiviral immunity on invertebrate hosts. Copyright © 2014 Elsevier Ltd. All rights reserved.
Patterns of HIV/SIV Prevention and Control by Passive Antibody Immunization.
Yamamoto, Hiroyuki; Matano, Tetsuro
2016-01-01
Neutralizing antibody (NAb) responses are promising immune effectors for control of human immunodeficiency virus (HIV) infection. Protective activity and mechanisms of immunodeficiency virus-specific NAbs have been increasingly scrutinized in animals infected with simian immunodeficiency virus (SIV), chimeric simian/human immunodeficiency virus (SHIV) and related viruses. Studies on such models have unraveled a previously underscored protective potential against in vivo immunodeficiency virus replication. Pre-challenge NAb titers feasibly provide sterile protection from SIV/SHIV infection by purging the earliest onset of viral replication and likely modulate innate immune cell responses. Sufficient sub-sterile NAb titers after established infection also confer dose-dependent reduction of viremia, and in certain earlier time frames augment adaptive immune cell responses and even provide rebound-free viral control. Here, we provide an overview of the obtained patterns of SIV/SHIV protection and viral control by various types of NAb passive immunizations and discuss how these notions may be extrapolated to NAb-based clinical control of HIV infection.
Kemland, Lieselore; Anoz-Carbonell, Ernesto; Buchanan, Susan K.; De Mot, René
2017-01-01
ABSTRACT Modular bacteriocins represent a major group of secreted protein toxins with a narrow spectrum of activity, involved in interference competition between Gram-negative bacteria. These antibacterial proteins include a domain for binding to the target cell and a toxin module at the carboxy terminus. Self-inhibition of producers is provided by coexpression of linked immunity genes that transiently inhibit the toxin’s activity through formation of bacteriocin-immunity complexes or by insertion in the inner membrane, depending on the type of toxin module. We demonstrate strain-specific inhibitory activity for PmnH, a Pseudomonas bacteriocin with an unprecedented dual-toxin architecture, hosting both a colicin M domain, potentially interfering with peptidoglycan synthesis, and a novel colicin N-type domain, a pore-forming module distinct from the colicin Ia-type domain in Pseudomonas aeruginosa pyocin S5. A downstream-linked gene product confers PmnH immunity upon susceptible strains. This protein, ImnH, has a transmembrane topology similar to that of Pseudomonas colicin M-like and pore-forming immunity proteins, although homology with either of these is essentially absent. The enhanced killing activity of PmnH under iron-limited growth conditions reflects parasitism of the ferrichrome-type transporter for entry into target cells, a strategy shown here to be used as well by monodomain colicin M-like bacteriocins from pseudomonads. The integration of a second type of toxin module in a bacteriocin gene could offer a competitive advantage against bacteria displaying immunity against only one of both toxic activities. PMID:28223456
Aubert, M; Beytout, J; Callamand, P; Cheymol, J; Combadière, B; Dahlab, A; Denis, F; Dodet, B; Dommergues, M-A; Gagneur, A; Gaillat, J; Gavazzi, G; Gras-le-Guen, C; Haas, H; Hau-Rainsard, I; Malvy, D; de Monléon, J-V; Picherot, G; Pinquier, D; Pretet, J-L; Pulcini, C; Rabaud, C; Regnier, F; Rogeaux, O; Savagner, C; Soubeyrand, B; Valdiguié, M; Weil-Olivier, C
2013-04-01
Every year, the National Foundation for Infectious Diseases brings together more than 300 participants to review progress in vaccine research and development and identify the most promising avenues of research. These conferences are among the most important scientific meetings entirely dedicated to vaccine research for both humans and animals, and provide a mix of plenary sessions with invited presentations by acknowledged international experts, parallel sessions, poster sessions, and informal exchanges between experts and young researchers. During the Fifteenth Conference that took place in Baltimore in May 2012, various topics were addressed, including the scientific basis for vaccinology; exploration of the immune response; novel vaccine design; new adjuvants; evaluation of the impact of newly introduced vaccines (such as rotavirus, HPV vaccines); vaccine safety; and immunization strategies. The new techniques of systems biology allow for a more comprehensive approach to the study of immune responses in order to identify correlates of protection and to design novel vaccines against chronic diseases such as AIDS or malaria, against which natural immunity is incomplete. Copyright © 2013. Published by Elsevier SAS.
Golshani, Maryam; Rafati, Sima; Nejati-Moheimani, Mehdi; Ghasemian, Melina; Bouzari, Saeid
2016-12-25
In the present study, immunogenicity and protective efficacy of the Brucella outer membrane protein 2b (Omp2b) was evaluated in BALB/c mice using Protein/Protein, DNA/DNA and DNA/Protein vaccine strategies. Immunization of mice with three vaccine regimens elicited a strong specific IgG response (higher IgG2a titers over IgG1 titers) and provided Th1-oriented immune response. Vaccination of BALB/c mice with the DNA/Pro regimen induced higher levels of IFN-γ/IL-2 and conferred more protection levels against B. melitenisis and B. abortus challenge than did the protein or DNA alone. In conclusion, Omp2b is able to stimulate specific immune responses and to confer cross protection against B. melitensis and B. abortus infection. Therefore, it could be introduced as a new potential candidate for the development of a subunit vaccine against Brucella infection. Copyright © 2016 Elsevier B.V. All rights reserved.
Active immunity induced by passive IgG post-exposure protection against ricin.
Hu, Charles Chen; Yin, Junfei; Chau, Damon; Cherwonogrodzky, John W; Hu, Wei-Gang
2014-01-21
Therapeutic antibodies can confer an instant protection against biothreat agents when administered. In this study, intact IgG and F(ab')2 from goat anti-ricin hyperimmune sera were compared for the protection against lethal ricin mediated intoxication. Similar ricin-binding affinities and neutralizing activities in vitro were observed between IgG and F(ab')2 when compared at the same molar concentration. In a murine ricin intoxication model, both IgG and F(ab')2 could rescue 100% of the mice by one dose (3 nmol) administration of antibodies 1 hour after 5 × LD50 ricin challenge. Nine days later, when the rescued mice received a second ricin challenge (5 × LD50), only the IgG-treated mice survived; the F(ab')2-treated mice did not. The experimental design excluded the possibility of residual goat IgG responsible for the protection against the second ricin challenge. Results confirmed that the active immunity against ricin in mice was induced quickly following the passive delivery of a single dose of goat IgG post-exposure. Furthermore, it was demonstrated that the induced active immunity against ricin in mice lasted at least 5 months. Therefore, passive IgG therapy not only provides immediate protection to the victim after ricin exposure, but also elicits an active immunity against ricin that subsequently results in long term protection.
Active Immunity Induced by Passive IgG Post-Exposure Protection against Ricin
Hu, Charles Chen; Yin, Junfei; Chau, Damon; Cherwonogrodzky, John W.; Hu, Wei-Gang
2014-01-01
Therapeutic antibodies can confer an instant protection against biothreat agents when administered. In this study, intact IgG and F(ab’)2 from goat anti-ricin hyperimmune sera were compared for the protection against lethal ricin mediated intoxication. Similar ricin-binding affinities and neutralizing activities in vitro were observed between IgG and F(ab’)2 when compared at the same molar concentration. In a murine ricin intoxication model, both IgG and F(ab’)2 could rescue 100% of the mice by one dose (3 nmol) administration of antibodies 1 hour after 5 × LD50 ricin challenge. Nine days later, when the rescued mice received a second ricin challenge (5 × LD50), only the IgG-treated mice survived; the F(ab’)2-treated mice did not. The experimental design excluded the possibility of residual goat IgG responsible for the protection against the second ricin challenge. Results confirmed that the active immunity against ricin in mice was induced quickly following the passive delivery of a single dose of goat IgG post-exposure. Furthermore, it was demonstrated that the induced active immunity against ricin in mice lasted at least 5 months. Therefore, passive IgG therapy not only provides immediate protection to the victim after ricin exposure, but also elicits an active immunity against ricin that subsequently results in long term protection. PMID:24451844
Du, MeiRong; Piao, HaiLan; Li, DaJin
2014-03-01
After the first and second international conferences on reproductive immunology held by Dr. DaJin Li in Shanghai, the related investigators all over the world hope to get together to share their latest findings with each other. Drs. DaJin Li and MeiRong Du sponsored and organized the third international conference on reproductive immunology at the Obstetrics and Gynecology Hospital affiliated with Fudan University, Shanghai, China, in the autumn of 2013. This congress brought together more than 100 International and National investigators representing a wide range of scientific disciplines. All the investigators actively work on reproductive immunology using human or large and small animal models. A range of reproductive immunological topics including the maternal-fetal immune regulation, reproductive tract mucosal immunology, immunocontraception, and pregnancy complications were highlighted and discussed in this conference. This conference supplied a good platform for the international reproductive immunologists to exchange their latest study progression and discuss the development direction of reproductive immunology in the near future. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Dimier-Poisson, Isabelle; Aline, Fleur; Bout, Daniel; Mévélec, Marie-Noëlle
2006-03-06
Toxoplasma gondii enters the mucosal surfaces of the host, and so immunity at these sites is of major interest. Due to the compartmentalization of the immune response, systemic immunization does not induce high levels of immunity at mucosal surfaces. Intranasal immunization has been shown to be very effective in inducing both systemic and mucosal immune responses. Immunization with mRNA can induce both humoral and cell-mediated immune responses, both of which are important in conferring immunity to T. gondii. The efficacy of RNA vaccination by the nasal route with T. gondii RNA was evaluated. We assessed the percentage of cumulative survival after an oral challenge with a lethal dose of T. gondii cysts (40 cysts), and the number of brain cysts following a challenge with a sublethal dose of T. gondii 76 K cysts (15 cysts). Vaccinated mice were found to be significantly better protected than non-immunized mice after a challenge with a lethal dose of cysts; and a challenge with a sublethal dose also resulted in fewer brain cysts than in non-immunized mice. Sera and intestinal secretions of immunized mice recognized T. gondii antigens, suggesting that a specific humoral immune response may occur. Moreover, a specific lymphoproliferative response observed in cervical lymph nodes may confer protection. These preliminary findings suggest that RNA vaccination by a mucosal route could be feasible.
Anti-Idiotype Probes for Toxin Detection
1991-09-13
NMurine macrophage activation by staphylococcal exotoxins. Gordo,, Conference .)n Staphylococcal Diseases . Salve Regina Univ. Newport. RI. 16 I I...multisystem disease , toxic shock syndrome. The toxins are serologically distinct, single polypeptide chains, with sizes ranging from 22 kDa to approximately...pleotropic effects on the immune system and in the pathogenesis of disease (21,22,66). Glucocorticoids were reported to be potent inhibitors of the LPS
The green vaccine: A global strategy to combat infectious and autoimmune diseases
Davoodi-Semiromi, Abdoreza; Samson, Nalapalli; Daniell, Henry
2009-01-01
Plant derived oral green vaccines eliminate expenses associated with fermenters, purification, cold storage/transportation and sterile delivery. Green vaccines are expressed via the plant nuclear or chloroplast genomes. Chloroplast expression has advantages of hyper-expression of therapeutic proteins (10,000 copies of trans-gene per cell), efficient oral delivery and transgene containment via maternal inheritance. To date, 23 vaccine antigens against 16 different bacterial, viral or protozoan pathogens have been expressed in chloroplasts. Mice subcutaneously immunized with the chloroplast derived anthrax protective antigen conferred 100% protection against lethal doses of the anthrax toxin. Oral immunization (ORV) of F1-V antigens without adjuvant conferred greater protection (88%) against 50-fold lethal dose of aerosolized plague (Yersinia pestis) than subcutaneous (SQV) immunization (33%). Oral immunization of malarial vaccine antigens fused to the cholera antigen (CTB-AMA1/CTB-Msp1) conferred prolonged immunity (50% life span), 100% protection against cholera toxin challenge and inhibited proliferation of the malarial parasite. Protection was correlated with antigen-specific titers of intestinal, serum IgA & IgG1 in ORV and only IgG1 in SQV mice, but no other immunoglobulin. High level expression in edible plant chloroplasts ideal for oral delivery and long-term immunity observed should facilitate development of low cost human vaccines for large populations, at times of outbreak. PMID:19430198
Recent advances in the field of nutritional immunology.
Monk, Jennifer M; Hou, Tim Y; Chapkin, Robert S
2011-11-01
Every 4 years, researchers in the cross-disciplinary field of nutritional immunology convene for a FASEB-sponsored meeting entitled, "Nutritional Immunology: Role in Health and Disease", which was held this summer in Carefree, AZ, USA. The scope of the conference encompassed a diverse list of research topics, including, but not restricted to, obesity and immune dysfunction, nutrient-gene interactions, mucosal immunity and a discussion of future directions for the field. Here, we summarize some of the findings shared at the conference, specifically focusing on obesity, immunological function of dietary components (n-3 polyunsaturated fatty acids and flavanoids), gut immunity and the microbiota, and relevant emerging technologies and databases.
Pandemic HIV-1 Vpu overcomes intrinsic herd immunity mediated by tetherin.
Iwami, Shingo; Sato, Kei; Morita, Satoru; Inaba, Hisashi; Kobayashi, Tomoko; Takeuchi, Junko S; Kimura, Yuichi; Misawa, Naoko; Ren, Fengrong; Iwasa, Yoh; Aihara, Kazuyuki; Koyanagi, Yoshio
2015-07-17
Among the four groups of HIV-1 (M, N, O, and P), HIV-1M alone is pandemic and has rapidly expanded across the world. However, why HIV-1M has caused a devastating pandemic while the other groups remain contained is unclear. Interestingly, only HIV-1M Vpu, a viral protein, can robustly counteract human tetherin, which tethers budding virions. Therefore, we hypothesize that this property of HIV-1M Vpu facilitates human-to-human viral transmission. Adopting a multilayered experimental-mathematical approach, we demonstrate that HIV-1M Vpu confers a 2.38-fold increase in the prevalence of HIV-1 transmission. When Vpu activity is lost, protected human populations emerge (i.e., intrinsic herd immunity develops) through the anti-viral effect of tetherin. We also reveal that all Vpus of transmitted/founder HIV-1M viruses maintain anti-tetherin activity. These findings indicate that tetherin plays the role of a host restriction factor, providing 'intrinsic herd immunity', whereas Vpu has evolved in HIV-1M as a tetherin antagonist.
MUC1-C integrates PD-L1 induction with repression of immune effectors in non-small-cell lung cancer.
Bouillez, A; Rajabi, H; Jin, C; Samur, M; Tagde, A; Alam, M; Hiraki, M; Maeda, T; Hu, X; Adeegbe, D; Kharbanda, S; Wong, K-K; Kufe, D
2017-07-13
Immunotherapeutic approaches, particularly programmed death 1/programmed death ligand 1 (PD-1/PD-L1) blockade, have improved the treatment of non-small-cell lung cancer (NSCLC), supporting the premise that evasion of immune destruction is of importance for NSCLC progression. However, the signals responsible for upregulation of PD-L1 in NSCLC cells and whether they are integrated with the regulation of other immune-related genes are not known. Mucin 1 (MUC1) is aberrantly overexpressed in NSCLC, activates the nuclear factor-κB (NF-κB) p65→︀ZEB1 pathway and confers a poor prognosis. The present studies demonstrate that MUC1-C activates PD-L1 expression in NSCLC cells. We show that MUC1-C increases NF-κB p65 occupancy on the CD274/PD-L1 promoter and thereby drives CD274 transcription. Moreover, we demonstrate that MUC1-C-induced activation of NF-κB→︀ZEB1 signaling represses the TLR9 (toll-like receptor 9), IFNG, MCP-1 (monocyte chemoattractant protein-1) and GM-CSF genes, and that this signature is associated with decreases in overall survival. In concert with these results, targeting MUC1-C in NSCLC tumors suppresses PD-L1 and induces these effectors of innate and adaptive immunity. These findings support a previously unrecognized central role for MUC1-C in integrating PD-L1 activation with suppression of immune effectors and poor clinical outcome.
Carrasco, Peter; Franco-Paredes, Carlos; Andrus, Jon; Waller, Katie; Maassen, Alison; Symenouh, Emi; Hafalia, Gabrielle
2015-08-07
For more than 35 years, most national immunization programs have established managerial structures and processes for delivering vaccination services to their populations. These days, immunization managers are facing an increasing number of challenges due to the introduction of new vaccines, shifting demographic patterns, complex networks of service providers, and maintaining the gains achieved with previous vaccination efforts. To confront these challenges, better program performance will require better managerial practices, which incorporates new technologies. To that end, the International Association of Immunization Managers (IAIM) is the first global professional association launched to promote superior leadership and management skills among health professionals involved with vaccination efforts worldwide. From 3 to 4 March 2015, approximately 132 members from 70 countries representing six regions, gathered in Istanbul, Turkey for the inaugural conference of IAIM. In the two-day program, members selected thirteen peers to constitute the Governing Council. The 12 articles of the bylaws of the Association were also ratified. This conference was a forum for sharing managerial best practices through networking sessions, breakout sessions, and presentations. Members also learned about IAIM sponsored training opportunities to deepen their managerial competencies through peer-to-peer exchanges and scholarship training programs. We believe that the IAIM inaugural conference was an appropriate platform for equipping managers with tools and professional network of peers to support them in achieving national, regional and global immunization goals, including those of the Global Vaccine Action Plan of the World Health Organization. Copyright © 2015. Published by Elsevier Ltd.. All rights reserved.
TLR expression and NK cell activation after human yellow fever vaccination.
Neves, Patrícia Cristina da Costa; Matos, Denise Cristina de Souza; Marcovistz, Rugimar; Galler, Ricardo
2009-09-18
The yellow fever vaccine is very effective with a single injection conferring protection for at least 10 years. Recent evidence suggests that the innate immune cells activated through Toll-like receptors (TLRs), are critical determinants of the robustness of the adaptive response. Therefore, we investigated the NK cell status in eight healthy volunteers after vaccination with YF 17DD virus. Shortly after vaccination, we observed increased expression of TLR-3 and TLR-9 in NK cells and markers such as CD69, HLA-DP-DQ-DR, CD38 and CD16. The up-regulation of CD69 was positively correlated with the presence of TLRs throughout the post-vaccination period and the circulating IFN-gamma was significantly augmented. These results suggest that TLRs may play an important role in NK cell activation during the immune response to vaccination, indicating a potential role for NK cells in helping the development of long-lasting protective memory.
Okeibunor, J C; Akanmori, B D; Balcha, G M; Mihigo, R; Vaz, R M; Nshimirimana, D
2013-08-20
The African Regional Office of the World Health Organization (WHO AFRO) organized the annual regional conference on immunization (ARCI) from 10 to 12 December 2012 in Dar es Salaam, Tanzania, under the theme, "Innovations, access and the right of all to vaccines". The meeting reviewed the status of immunization in the region and identified all innovations, strategies and technologies available and how these could be fully utilized to enhance the access and the rights of all to vaccines. Over 50 oral presentations were made in plenary and parallel sessions of the conference which was attended by over 200 participants drawn from national immunization programs, academia, public health experts and immunization partners. In addition there were 40 poster presentations. This manuscript summarizes of the meeting, highlighting the innovations in immunization being piloted or scaled-up, their impact and suggesting ways to further improve immunization service delivery for the eradication, elimination and control of vaccine-preventable diseases in the region. Copyright © 2013. Published by Elsevier Ltd.. All rights reserved.
Ferreira, Daniela M.; Moreno, Adriana T.; Ferreira, Patricia C. D.; Lima, Fernanda A.; Santos, Fernanda L.; Sakauchi, Maria Aparecida; Takata, Célia S.; Higashi, Hisako G.; Raw, Isaías; Kubrusly, Flavia S.; Ho, Paulo L.
2010-01-01
Streptococcus pneumoniae is the leading cause of respiratory acute infections around the world. In Latin America, approximately 20,000 children under 5 years of age die of pneumococcal diseases annually. Pneumococcal surface protein A (PspA) is among the best-characterized pneumococcal antigens that confer protection in animal models of pneumococcal infections and, as such, is a good alternative for the currently available conjugated vaccines. Efficient immune responses directed to PspA in animal models have already been described. Nevertheless, few low cost adjuvants for a subunit pneumococcal vaccine have been proposed to date. Here, we have tested the adjuvant properties of the whole cell Bordetella pertussis vaccine (wP) that is currently part of the DTP (diphtheria-tetanus-pertussis) vaccine administrated to children in several countries, as an adjuvant to PspA. Nasal immunization of BALB/c mice with a combination of PspA5 and wP or wPlow – a new generation vaccine that contains low levels of B. pertussis LPS – conferred protection against a respiratory lethal challenge with S. pneumoniae. Both PspA5-wP and PspA5-wPlow vaccines induced high levels of systemic and mucosal antibodies against PspA5, with similar profile, indicating no essential requirement for B. pertussis LPS in the adjuvant properties of wP. Accordingly, nasal immunization of C3H/HeJ mice with PspA5-wP conferred protection against the pneumococcal challenge, thus ruling out a role for TLR4 responses in the adjuvant activity and the protection mechanisms triggered by the vaccines. The high levels of anti-PspA5 antibodies correlated with increased cross-reactivity against PspAs from different clades and also reflected in cross-protection. In addition, passive immunization experiments indicated that antibodies played an important role in protection in this model. Finally, subcutaneous immunization with a combination of PspA5 with DTPlow protected mice against challenge with two different pneumococcal strains, opening the possibility for the development of a combined infant vaccine composed of DTP and PspA. PMID:20523738
Genetic diversity confers colony-level benefits due to individual immunity
USDA-ARS?s Scientific Manuscript database
Several costs and benefits arise as a consequence of eusociality and group-living. With increasing group size, spread of disease among nest-mates poses selective pressure on both individual immunity and group-level mechanisms of disease resistance (social immunity). Another factor known to influence...
Chen, Chunhong; Newell, Kim; Lawrence, Gregory J.; Ellis, Jeffrey G.; Anderson, Peter A.; Dodds, Peter N.
2016-01-01
NOD-like receptors (NLRs) are central components of the plant immune system. L6 is a Toll/interleukin-1 receptor (TIR) domain-containing NLR from flax (Linum usitatissimum) conferring immunity to the flax rust fungus. Comparison of L6 to the weaker allele L7 identified two polymorphic regions in the TIR and the nucleotide binding (NB) domains that regulate both effector ligand-dependent and -independent cell death signaling as well as nucleotide binding to the receptor. This suggests that a negative functional interaction between the TIR and NB domains holds L7 in an inactive/ADP-bound state more tightly than L6, hence decreasing its capacity to adopt the active/ATP-bound state and explaining its weaker activity in planta. L6 and L7 variants with a more stable ADP-bound state failed to bind to AvrL567 in yeast two-hybrid assays, while binding was detected to the signaling active variants. This contrasts with current models predicting that effectors bind to inactive receptors to trigger activation. Based on the correlation between nucleotide binding, effector interaction, and immune signaling properties of L6/L7 variants, we propose that NLRs exist in an equilibrium between ON and OFF states and that effector binding to the ON state stabilizes this conformation, thereby shifting the equilibrium toward the active form of the receptor to trigger defense signaling. PMID:26744216
Innate Immune Mechanisms in Transplant Allograft Vasculopathy
Jane-wit, D; Fang, C; Goldstein, DR
2016-01-01
Purpose of Review Allograft vasculopathy (AV) is the leading cause of late allograft loss following solid organ transplantation. Ischemia reperfusion injury (IRI) and donor specific antibody (DSA)-induced complement activation confer heightened risk for AV via numerous innate immune mechanisms including MyD88, HMGB1, and complement induced non-canonical NF-kB signaling. Recent Findings The role of MyD88, a signal adaptor downstream of the toll-like receptors (TLR), has been defined in an experimental heart transplant model, which demonstrated that recipient MyD88 enhanced AV. Importantly, triggering receptor on myeloid receptor 1(Trem1), a MyD88 amplifying signal, was present in rejecting human cardiac transplant biopsies and enhanced the development of AV in mice. HMGB1, a nuclear protein that activates TLRs, also enhanced the development of AV. Complement activation elicits assembly of membrane attack complexes (MAC) on endothelial cells which activate non-canonical NF-kB signaling, a novel complement effector pathway that induces pro-inflammatory genes and potentiates endothelial cell mediated alloimmune T cell activation, processes which enhance AV. Summary Innate immune mediators including HMGB1, MyD88, and non-canonical NFκB signaling via complement activation contribute to AV. These pathways represent potential therapeutic targets to reduce AV after solid organ transplantation. PMID:27077602
Evasion of immunosurveillance by genomic alterations of PPARγ/RXRα in bladder cancer.
Korpal, Manav; Puyang, Xiaoling; Jeremy Wu, Zhenhua; Seiler, Roland; Furman, Craig; Oo, Htoo Z; Seiler, Michael; Irwin, Sean; Subramanian, Vanitha; Julie Joshi, Jaya; Wang, Chris K; Rimkunas, Victoria; Tortora, Davide; Yang, Hua; Kumar, Namita; Kuznetsov, Galina; Matijevic, Mark; Chow, Jesse; Kumar, Pavan; Zou, Jian; Feala, Jacob; Corson, Laura; Henry, Ryan; Selvaraj, Anand; Davis, Allison; Bloudoff, Kristjan; Douglas, James; Kiss, Bernhard; Roberts, Morgan; Fazli, Ladan; Black, Peter C; Fekkes, Peter; Smith, Peter G; Warmuth, Markus; Yu, Lihua; Hao, Ming-Hong; Larsen, Nicholas; Daugaard, Mads; Zhu, Ping
2017-07-24
Muscle-invasive bladder cancer (MIBC) is an aggressive disease with limited therapeutic options. Although immunotherapies are approved for MIBC, the majority of patients fail to respond, suggesting existence of complementary immune evasion mechanisms. Here, we report that the PPARγ/RXRα pathway constitutes a tumor-intrinsic mechanism underlying immune evasion in MIBC. Recurrent mutations in RXRα at serine 427 (S427F/Y), through conformational activation of the PPARγ/RXRα heterodimer, and focal amplification/overexpression of PPARγ converge to modulate PPARγ/RXRα-dependent transcription programs. Immune cell-infiltration is controlled by activated PPARγ/RXRα that inhibits expression/secretion of inflammatory cytokines. Clinical data sets and an in vivo tumor model indicate that PPARγ High /RXRα S427F/Y impairs CD8 + T-cell infiltration and confers partial resistance to immunotherapies. Knockdown of PPARγ or RXRα and pharmacological inhibition of PPARγ significantly increase cytokine expression suggesting therapeutic approaches to reviving immunosurveillance and sensitivity to immunotherapies. Our study reveals a class of tumor cell-intrinsic "immuno-oncogenes" that modulate the immune microenvironment of cancer.Muscle-invasive bladder cancer (MIBC) is a potentially lethal disease. Here the authors characterize diverse genetic alterations in MIBC that convergently lead to constitutive activation of PPARgamma/RXRalpha and result in immunosurveillance escape by inhibiting CD8+ T-cell recruitment.
An XA21-Associated Kinase (OsSERK2) Regulates Immunity Mediated by the XA21 and XA3 Immune Receptors
Chen, Xuewei; Zuo, Shimin; Schwessinger, Benjamin; Chern, Mawsheng; Canlas, Patrick E.; Ruan, Deling; Zhou, Xiaogang; Wang, Jing; Daudi, Arsalan; Petzold, Christopher J.; Heazlewood, Joshua L.; Ronald, Pamela C.
2014-01-01
The rice XA21 immune receptor kinase and the structurally related XA3 receptor confer immunity to Xanthomonas oryzae pv. oryzae (Xoo), the causal agent of bacterial leaf blight. Here we report the isolation of OsSERK2 (rice somatic embryogenesis receptor kinase 2) and demonstrate that OsSERK2 positively regulates immunity mediated by XA21 and XA3 as well as the rice immune receptor FLS2 (OsFLS2). Rice plants silenced for OsSerk2 display altered morphology and reduced sensitivity to the hormone brassinolide. OsSERK2 interacts with the intracellular domains of each immune receptor in the yeast two-hybrid system in a kinase activity-dependent manner. OsSERK2 undergoes bidirectional transphosphorylation with XA21 in vitro and forms a constitutive complex with XA21 in vivo. These results demonstrate an essential role for OsSERK2 in the function of three rice immune receptors and suggest that direct interaction with the rice immune receptors is critical for their function. Taken together, our findings suggest that the mechanism of OsSERK2-meditated regulation of rice XA21, XA3, and FLS2 differs from that of AtSERK3/BAK1-mediated regulation of Arabidopsis FLS2 and EFR. PMID:24482436
Vasanthakumar, Ajithkumar; Kallies, Axel
2017-11-03
Cytokines play an integral role in shaping innate and adaptive immune responses. Members of the interleukin (IL)-1 family regulate a plethora of immune-cell-mediated processes, which include pathogen defense and tissue homeostasis. Notably, the IL-1 family cytokine IL-33 promotes adaptive and innate type 2 immune responses, confers viral protection and facilitates glucose metabolism and tissue repair. At the cellular level, IL-33 stimulates differentiation, maintenance, and function of various immune cell types, including regulatory T cells, effector CD4 + and CD8 + T cells, macrophages, and type 2 innate lymphoid cells (ILC2s). Other IL-1 family members, such as IL-1β and IL-18 promote type 1 responses, while IL-37 limits immune activation. Although IL-1 cytokines play critical roles in immunity and tissue repair, their deregulated expression is often linked to autoimmune and inflammatory diseases. Therefore, IL-1 cytokines are regulated tightly by posttranscriptional mechanisms and decoy receptors. In this review, we discuss the biology and function of IL-1 family cytokines, with a specific focus on regulation and function of IL-33 in immune and tissue homeostasis. Copyright © 2017 Cold Spring Harbor Laboratory Press; all rights reserved.
Zhu, Feng; Liu, Taiping; Zhao, Chenhao; Lu, Xiao; Zhang, Jian; Xu, Wenyue
2017-01-01
As a malaria transmission-blocking vaccine alone does not confer a direct benefit to the recipient, it is necessary to develop a vaccine that not only blocks malaria transmission but also protects vaccinated individuals. In this study we observed that a whole-killed blood-stage vaccine (WKV) not only conferred protection against the blood-stage challenge but also markedly inhibited the transmission of different strains of the malaria parasite. Although the parasitemia is much lower in WKV-immunized mice challenged with malaria parasites, the gametocytemia is comparable between control and immunized mice during the early stages of infection. The depletion of CD4 + T cells prior to the adoptive transfer of parasites into WKV-immunized mice has no effect on the development of the malaria parasite in the mosquito, but the adoptive transfer of the serum from the immunized mice into the parasite-inoculated mice remarkably suppresses the development of malaria parasites in mosquitoes. Furthermore, immunized mice challenged with the malaria parasite generate higher levels of parasite-specific Abs and the inflammatory cytokines MCP-1 and IFN-γ. However, the adoptive transfer of parasite-specific IgG or the depletion of MCP-1, but not IFN-γ, to some extent is closely associated with the suppression of malaria parasite development in mosquitoes. These data strongly suggest that WKV-induced immune responses confer protection against the mosquito stage, which is largely dependent on malaria parasite-specific Abs and MCP-1. This finding sheds new light on blocking malaria transmission through the immunization of individuals with the WKV. Copyright © 2016 by The American Association of Immunologists, Inc.
Lytle, Allison M; Brown, Harrison C; Paik, Na Yoon; Knight, Kristopher A; Wright, J Fraser; Spencer, H Trent; Doering, Christopher B
2016-01-01
Immune responses to coagulation factors VIII (FVIII) and IX (FIX) represent primary obstacles to hemophilia treatment. Previously, we showed that hematopoietic stem cell (HSC) retroviral gene therapy induces immune nonresponsiveness to FVIII in both naive and preimmunized murine hemophilia A settings. Liver-directed adeno-associated viral (AAV)-FIX vector gene transfer achieved similar results in preclinical hemophilia B models. However, as clinical immune responses to FVIII and FIX differ, we investigated the ability of liver-directed AAV-FVIII gene therapy to affect FVIII immunity in hemophilia A mice. Both FVIII naive and preimmunized mice were administered recombinant AAV8 encoding a liver-directed bioengineered FVIII expression cassette. Naive animals receiving high or mid-doses subsequently achieved near normal FVIII activity levels. However, challenge with adjuvant-free recombinant FVIII induced loss of FVIII activity and anti-FVIII antibodies in mid-dose, but not high-dose AAV or HSC lentiviral (LV) vector gene therapy cohorts. Furthermore, unlike what was shown previously for FIX gene transfer, AAV-FVIII administration to hemophilia A inhibitor mice conferred no effect on anti-FVIII antibody or inhibitory titers. These data suggest that functional differences exist in the immune modulation achieved to FVIII or FIX in hemophilia mice by gene therapy approaches incorporating liver-directed AAV vectors or HSC-directed LV. PMID:26909355
Gaillard, María Emilia; Bottero, Daniela; Zurita, María Eugenia; Carriquiriborde, Francisco; Martin Aispuro, Pablo; Bartel, Erika; Sabater-Martínez, David; Bravo, María Sol; Castuma, Celina; Hozbor, Daniela Flavia
2017-01-01
Maternal safety through pertussis vaccination and subsequent maternal–fetal-antibody transfer are well documented, but information on infant protection from pertussis by such antibodies and by subsequent vaccinations is scarce. Since mice are used extensively for maternal-vaccination studies, we adopted that model to narrow those gaps in our understanding of maternal pertussis immunization. Accordingly, we vaccinated female mice with commercial acellular pertussis (aP) vaccine and measured offspring protection against Bordetella pertussis challenge and specific-antibody levels with or without revaccination. Maternal immunization protected the offspring against pertussis, with that immune protection transferred to the offspring lasting for several weeks, as evidenced by a reduction (4–5 logs, p < 0.001) in the colony-forming-units recovered from the lungs of 16-week-old offspring. Moreover, maternal-vaccination-acquired immunity from the first pregnancy still conferred protection to offspring up to the fourth pregnancy. Under the conditions of our experimental protocol, protection to offspring from the aP-induced immunity is transferred both transplacentally and through breastfeeding. Adoptive-transfer experiments demonstrated that transferred antibodies were more responsible for the protection detected in offspring than transferred whole spleen cells. In contrast to reported findings, the protection transferred was not lost after the vaccination of infant mice with the same or other vaccine preparations, and conversely, the immunity transferred from mothers did not interfere with the protection conferred by infant vaccination with the same or different vaccines. These results indicated that aP-vaccine immunization of pregnant female mice conferred protective immunity that is transferred both transplacentally and via offspring breastfeeding without compromising the protection boostered by subsequent infant vaccination. These results—though admittedly not necessarily immediately extrapolatable to humans—nevertheless enabled us to test hypotheses under controlled conditions through detailed sampling and data collection. These findings will hopefully refine hypotheses that can then be validated in subsequent human studies. PMID:28932228
Dietz, Andrew C.; Duncan, Christine N.; Alter, Blanche P.; Bresters, Dorine; Cowan, Morton J.; Notarangelo, Luigi; Rosenberg, Philip S.; Shenoy, Shalini; Skinner, Roderick; Walters, Mark C.; Wagner, John; Baker, K. Scott; Pulsipher, Michael A.
2016-01-01
An international consensus conference sponsored by the Pediatric Blood and Marrow Transplant consortium entitled, “Late Effects Screening and Recommendations Following Allogeneic Hematopoietic Cell Transplant for Immune Deficiency and Non-malignant Hematologic Disease was held in Minneapolis, Minnesota on May 10–11, 2016. The purpose of the conference was to address the unmet need for a greater understanding of and the screening for long-term complications in the growing population of survivors of transplantation for nonmalignant disorders. The conference focused on transplantation for hemoglobinopathy, immune deficiency, and inherited bone marrow syndromes. A multidisciplinary group of experts in the disease areas and transplant late effects presented the current state of understanding of how the underlying disease, pretransplant therapies, and transplant related factors uniquely interact to influence the development of late toxicities. Recommendations were put forth by the group for the late effects screening of survivors of transplantation for these non-malignant disorders. The findings and recommendations that came from this conference will be presented in a series of six additional manuscripts in the upcoming months. In this manuscript we explore the need for screening practices specific to the survivors of transplantation for non-malignant diseases and the metholodologic challenges associated with the study of these patients. PMID:27737772
VPS9a Activates the Rab5 GTPase ARA7 to Confer Distinct Pre- and Postinvasive Plant Innate Immunity.
Nielsen, Mads E; Jürgens, Gerd; Thordal-Christensen, Hans
2017-08-01
Plant innate immunity can effectively prevent the proliferation of filamentous pathogens. Papilla formation at the site of attack is essential for preinvasive immunity; in postinvasive immunity, the encasement of pathogen structures inside host cells can hamper disease. Whereas papillae are highly dependent on transcytosis of premade material, little is known about encasement formation. Here, we show that endosome-associated VPS9a, the conserved guanine-nucleotide exchange factor activating Rab5 GTPases, is required for both pre- and postinvasive immunity against a nonadapted powdery mildew fungus ( Blumeria graminis f. sp hordei ) in Arabidopsis thaliana Surprisingly, VPS9a acts in addition to two previously well-described innate immunity components and thus represents an additional step in the regulation of how plants resist pathogens. We found VPS9a to be important for delivering membrane material to the encasement and VPS9a also plays a predominant role in postinvasive immunity. GTP-bound Rab5 GTPases accumulate in the encasement, but not the papillae, suggesting that two independent pathways form these defense structures. VPS9a also mediates defense to an adapted powdery mildew fungus, thus regulating a durable type of defense that works in both host and nonhost resistance. We propose that VPS9a plays a conserved role in organizing cellular endomembrane trafficking, required for delivery of defense components in response to powdery mildew fungi. © 2017 American Society of Plant Biologists. All rights reserved.
The rice immune receptor XA21 recognizes a tyrosine-sulfated protein from a Gram-negative bacterium.
Pruitt, Rory N; Schwessinger, Benjamin; Joe, Anna; Thomas, Nicholas; Liu, Furong; Albert, Markus; Robinson, Michelle R; Chan, Leanne Jade G; Luu, Dee Dee; Chen, Huamin; Bahar, Ofir; Daudi, Arsalan; De Vleesschauwer, David; Caddell, Daniel; Zhang, Weiguo; Zhao, Xiuxiang; Li, Xiang; Heazlewood, Joshua L; Ruan, Deling; Majumder, Dipali; Chern, Mawsheng; Kalbacher, Hubert; Midha, Samriti; Patil, Prabhu B; Sonti, Ramesh V; Petzold, Christopher J; Liu, Chang C; Brodbelt, Jennifer S; Felix, Georg; Ronald, Pamela C
2015-07-01
Surveillance of the extracellular environment by immune receptors is of central importance to eukaryotic survival. The rice receptor kinase XA21, which confers robust resistance to most strains of the Gram-negative bacterium Xanthomonas oryzae pv. oryzae (Xoo), is representative of a large class of cell surface immune receptors in plants and animals. We report the identification of a previously undescribed Xoo protein, called RaxX, which is required for activation of XA21-mediated immunity. Xoo strains that lack RaxX, or carry mutations in the single RaxX tyrosine residue (Y41), are able to evade XA21-mediated immunity. Y41 of RaxX is sulfated by the prokaryotic tyrosine sulfotransferase RaxST. Sulfated, but not nonsulfated, RaxX triggers hallmarks of the plant immune response in an XA21-dependent manner. A sulfated, 21-amino acid synthetic RaxX peptide (RaxX21-sY) is sufficient for this activity. Xoo field isolates that overcome XA21-mediated immunity encode an alternate raxX allele, suggesting that coevolutionary interactions between host and pathogen contribute to RaxX diversification. RaxX is highly conserved in many plant pathogenic Xanthomonas species. The new insights gained from the discovery and characterization of the sulfated protein, RaxX, can be applied to the development of resistant crop varieties and therapeutic reagents that have the potential to block microbial infection of both plants and animals.
2017-01-01
Plant innate immunity can effectively prevent the proliferation of filamentous pathogens. Papilla formation at the site of attack is essential for preinvasive immunity; in postinvasive immunity, the encasement of pathogen structures inside host cells can hamper disease. Whereas papillae are highly dependent on transcytosis of premade material, little is known about encasement formation. Here, we show that endosome-associated VPS9a, the conserved guanine-nucleotide exchange factor activating Rab5 GTPases, is required for both pre- and postinvasive immunity against a nonadapted powdery mildew fungus (Blumeria graminis f. sp hordei) in Arabidopsis thaliana. Surprisingly, VPS9a acts in addition to two previously well-described innate immunity components and thus represents an additional step in the regulation of how plants resist pathogens. We found VPS9a to be important for delivering membrane material to the encasement and VPS9a also plays a predominant role in postinvasive immunity. GTP-bound Rab5 GTPases accumulate in the encasement, but not the papillae, suggesting that two independent pathways form these defense structures. VPS9a also mediates defense to an adapted powdery mildew fungus, thus regulating a durable type of defense that works in both host and nonhost resistance. We propose that VPS9a plays a conserved role in organizing cellular endomembrane trafficking, required for delivery of defense components in response to powdery mildew fungi. PMID:28808134
The rice immune receptor XA21 recognizes a tyrosine-sulfated protein from a Gram-negative bacterium
Pruitt, Rory N.; Schwessinger, Benjamin; Joe, Anna; Thomas, Nicholas; Liu, Furong; Albert, Markus; Robinson, Michelle R.; Chan, Leanne Jade G.; Luu, Dee Dee; Chen, Huamin; Bahar, Ofir; Daudi, Arsalan; De Vleesschauwer, David; Caddell, Daniel; Zhang, Weiguo; Zhao, Xiuxiang; Li, Xiang; Heazlewood, Joshua L.; Ruan, Deling; Majumder, Dipali; Chern, Mawsheng; Kalbacher, Hubert; Midha, Samriti; Patil, Prabhu B.; Sonti, Ramesh V.; Petzold, Christopher J.; Liu, Chang C.; Brodbelt, Jennifer S.; Felix, Georg; Ronald, Pamela C.
2015-01-01
Surveillance of the extracellular environment by immune receptors is of central importance to eukaryotic survival. The rice receptor kinase XA21, which confers robust resistance to most strains of the Gram-negative bacterium Xanthomonas oryzae pv. oryzae (Xoo), is representative of a large class of cell surface immune receptors in plants and animals. We report the identification of a previously undescribed Xoo protein, called RaxX, which is required for activation of XA21-mediated immunity. Xoo strains that lack RaxX, or carry mutations in the single RaxX tyrosine residue (Y41), are able to evade XA21-mediated immunity. Y41 of RaxX is sulfated by the prokaryotic tyrosine sulfotransferase RaxST. Sulfated, but not nonsulfated, RaxX triggers hallmarks of the plant immune response in an XA21-dependent manner. A sulfated, 21–amino acid synthetic RaxX peptide (RaxX21-sY) is sufficient for this activity. Xoo field isolates that overcome XA21-mediated immunity encode an alternate raxX allele, suggesting that coevolutionary interactions between host and pathogen contribute to RaxX diversification. RaxX is highly conserved in many plant pathogenic Xanthomonas species. The new insights gained from the discovery and characterization of the sulfated protein, RaxX, can be applied to the development of resistant crop varieties and therapeutic reagents that have the potential to block microbial infection of both plants and animals. PMID:26601222
Silva, Éverton F.; Medeiros, Marco A.; McBride, Alan J. A.; Matsunaga, Jim; Esteves, Gabriela S.; Ramos, João G. R.; Santos, Cleiton S.; Croda, Júlio; Homma, Akira; Dellagostin, Odir A.; Haake, David A.; Reis, Mitermayer G.; Ko, Albert I.
2007-01-01
Subunit vaccines are a potential intervention strategy against leptospirosis, which is a major public health problem in developing countries and a veterinary disease in livestock and companion animals worldwide. Leptospiral immunoglobulin-like (Lig) proteins are a family of surface-exposed determinants that have Ig-like repeat domains found in virulence factors such as intimin and invasin. We expressed fragments of the repeat domain regions of LigA and LigB from Leptospira interrogans serovar Copenhageni. Immunization of Golden Syrian hamsters with Lig fragments in Freund’s adjuvant induced robust antibody responses against recombinant protein and native protein, as detected by ELISA and immunoblot, respectively. A single fragment, LigANI, which corresponds to the six carboxy-terminal Ig-like repeat domains of the LigA molecule, conferred immunoprotection against mortality (67-100%, P <0.05) in hamsters which received a lethal inoculum of L. interrogans serovar Copenhageni. However, immunization with this fragment did not confer sterilizing immunity. These findings indicate that the carboxy-terminal portion of LigA is an immunoprotective domain and may serve as a vaccine candidate for human and veterinary leptospirosis. PMID:17629368
Silva, Everton F; Medeiros, Marco A; McBride, Alan J A; Matsunaga, Jim; Esteves, Gabriela S; Ramos, João G R; Santos, Cleiton S; Croda, Júlio; Homma, Akira; Dellagostin, Odir A; Haake, David A; Reis, Mitermayer G; Ko, Albert I
2007-08-14
Subunit vaccines are a potential intervention strategy against leptospirosis, which is a major public health problem in developing countries and a veterinary disease in livestock and companion animals worldwide. Leptospiral immunoglobulin-like (Lig) proteins are a family of surface-exposed determinants that have Ig-like repeat domains found in virulence factors such as intimin and invasin. We expressed fragments of the repeat domain regions of LigA and LigB from Leptospira interrogans serovar Copenhageni. Immunization of Golden Syrian hamsters with Lig fragments in Freund's adjuvant induced robust antibody responses against recombinant protein and native protein, as detected by ELISA and immunoblot, respectively. A single fragment, LigANI, which corresponds to the six carboxy-terminal Ig-like repeat domains of the LigA molecule, conferred immunoprotection against mortality (67-100%, P<0.05) in hamsters which received a lethal inoculum of L. interrogans serovar Copenhageni. However, immunization with this fragment did not confer sterilizing immunity. These findings indicate that the carboxy-terminal portion of LigA is an immunoprotective domain and may serve as a vaccine candidate for human and veterinary leptospirosis.
The role of Peroxiredoxin 4 in inflammatory response and aging
Klichko, Vladimir I.; Orr, William C.; Radyuk, Svetlana N.
2015-01-01
In prior studies, we determined that moderate overexpression of the Drosophila endoplasmic reticulum (ER)-localized peroxiredoxin (Prx), dPrx4, reduced oxidative damage and conferred beneficial effects on lifespan, while high level expression increased the incidence of tissue-specific apoptosis and dramatically shortened longevity. The detrimental pro-apoptotic and life-shortening effects were attributed to aberrant localization of dPrx4 and the apparent ER stress elicited by dPrx4 overexpression. In addition, activation of both the NF-κB- and JAK/STAT- mediated stress responses was detected, although it wasn’t clear whether these served as functional alarm signals. Here we extend these findings to show that activation of the NF-κB -dependent immunity-related/inflammatory genes, associated with lifespan shortening effects, is dependent on the activity of a Drosophila NF-κB ortholog, Relish. In the absence of Relish, the pro-inflammatory effects typically elicited by dPrx4 overexpression were not detected. The absence of Relish not only prevented hyperactivation of the immunity-related genes but also significantly rescued the severe shortening of lifespan normally observed in dPrx4 over-expressors. Overactivation of the immune/inflammatory responses was also lessened by JAK/STAT signaling. In addition we found that cellular immune/pro-inflammatory responses provoked by the oxidant paraquat but not bacteria are mediated via dPrx4 activity in the ER, as up-regulation of the immune-related genes was eliminated in flies underexpressing dPrx4 whereas immune responses triggered by bacteria were unaffected. Finally, efforts to reveal critical tissues where dPrx4 modulates longevity showed that broad targeting of dPrx4 to neuronal tissue had strong beneficial effects, while targeting expression to the fat body had deleterious effects. PMID:26689888
13th ERS Lung Science Conference. The most important take home messages: News from the Underground.
Bikov, Andras; Boots, Agnes; Bjerg, Anders; Jacinto, Tiago; Olland, Anne; Skoczyński, Szymon
2015-06-01
The 13th ERS Lung Science Conference (LSC) was organised to bring academics together from all over the world to present and discuss the latest developments regarding lung infection and immunity. The conference took place in breathtaking Estoril, Portugal; however, it wasn't the beautiful surroundings that were our main motivation to attend, but instead the scientific merit of the conference and the chance to create new scientific collaborations. The scientific programme [1] was packed with the most up-to-date content in the field of lung infection and immunity and included some of the top researchers within this exciting area. Moreover, the convenient size of the LSC offered the opportunity to renew and intensify friendships and collaborations. In particular, for researchers at the start of their career, this is a great feature and we therefore warmly recommend the LSC to ERS Juniors Members!
Interferon-inducible effector mechanisms in cell-autonomous immunity
MacMicking, John D.
2014-01-01
Interferons (IFNs) induce the expression of hundreds of genes as part of an elaborate antimicrobial programme designed to combat infection in all nucleated cells — a process termed cell-autonomous immunity. As described in this Review, recent genomic and subgenomic analyses have begun to assign functional properties to novel IFN-inducible effector proteins that restrict bacteria, protozoa and viruses in different subcellular compartments and at different stages of the pathogen life cycle. Several newly described host defence factors also participate in canonical oxidative and autophagic pathways by spatially coordinating their activities to enhance microbial killing. Together, these IFN-induced effector networks help to confer vertebrate host resistance to a vast and complex microbial world. PMID:22531325
Nakatsuka, Yoshinari; Vandenbon, Alexis; Mino, Takashi; Yoshinaga, Masanori; Uehata, Takuya; Cui, Xiaotong; Sato, Ayuko; Tsujimura, Tohru; Suzuki, Yutaka; Sato, Atsuyasu; Handa, Tomohiro; Chin, Kazuo; Sawa, Teiji; Hirai, Toyohiro; Takeuchi, Osamu
2018-04-25
Inhaled pathogens including Pseudomonas aeruginosa initially encounter airway epithelial cells (AECs), which are poised to evoke cell-intrinsic innate defense, affecting second tier of hematopoietic cell-mediated immune reaction. However, it is largely unknown how pulmonary immune responses mediated by a variety of immune cells are coordinated. Here we show that Regnase-1, an endoribonuclease expressed in AECs and immune cells, plays an essential role in coordinating innate responses and adaptive immunity against P. aeruginosa infection. Intratracheal treatment of mice with heat-killed P. aeruginosa resulted in prolonged disappearance of Regnase-1 consistent with sustained expression of Regnase-1 target inflammatory genes, whereas the transcription factor NF-κB was only transiently activated. AEC-specific deletion of Regnase-1 not only augmented innate defenses against P. aeruginosa but also enhanced secretion of Pseudomonas-specific IgA and Th17 accumulation in the lung, culminating in conferring significant resistance against P. aeruginosa re-infection in vivo. Although Regnase-1 directly controls distinct sets of genes in each of AECs and T cells, degradation of Regnase-1 in both cell types is beneficial for maximizing acquired immune responses. Collectively, these results demonstrate that Regnase-1 orchestrates AEC-mediated and immune cell-mediated host defense against pulmonary bacterial infection.
Neutrophils Are Central to Antibody-Mediated Protection against Genital Chlamydia.
Naglak, Elizabeth K; Morrison, Sandra G; Morrison, Richard P
2017-10-01
Determining the effector populations involved in humoral protection against genital chlamydia infection is crucial to development of an effective chlamydial vaccine. Antibody has been implicated in protection studies in multiple animal models, and we previously showed that the passive transfer of immune serum alone does not confer immunity in the mouse. Using the Chlamydia muridarum model of genital infection, we demonstrate a protective role for both Chlamydia -specific immunoglobulin G (IgG) and polymorphonuclear neutrophils and show the importance of an antibody/effector cell interaction in mediating humoral immunity. While neutrophils were found to contribute significantly to antibody-mediated protection in vivo , natural killer (NK) cells were dispensable for protective immunity. Furthermore, gamma interferon (IFN-γ)-stimulated primary peritoneal neutrophils (PPNs) killed chlamydiae in vitro in an antibody-dependent manner. The results from this study support the view that an IFN-γ-activated effector cell population cooperates with antibody to protect against genital chlamydia and establish neutrophils as a key effector cell in this response. Copyright © 2017 Naglak et al.
He, Yong; Manischewitz, Jody; Meseda, Clement A; Merchlinsky, Michael; Vassell, Russell A; Sirota, Lev; Berkower, Ira; Golding, Hana; Weiss, Carol D
2007-10-01
The smallpox vaccine Dryvax, which consists of replication-competent vaccinia virus, elicits antibodies that play a major role in protection. Several vaccinia proteins generate neutralizing antibodies, but their importance for protection is unknown. We investigated the potency of antibodies to the A27 protein of the mature virion in neutralization and protection experiments and the contributions of A27 antibodies to Dryvax-induced immunity. Using a recombinant A27 protein (rA27), we confirmed that A27 contains neutralizing determinants and that vaccinia immune globulin (VIG) derived from Dryvax recipients contains reactivity to A27. However, VIG neutralization was not significantly reduced when A27 antibodies were removed, and antibodies elicited by an rA27 enhanced the protection conferred by VIG in passive transfer experiments. These findings demonstrate that A27 antibodies do not represent the major fraction of neutralizing activity in VIG and suggest that immunity may be augmented by vaccines and immune globulins that include strong antibody responses to A27.
Guirola, María; Urquiza, Dioslaida; Alvarez, Anabel; Cannan-Haden, Leonardo; Caballero, Evelin; Guillén, Gerardo
2006-03-01
In this study, we used an adoptive lymphocyte transfer experiment to evaluate the ability of the P64k recombinant protein to recruit T-helper activity and induce immunologic memory response to the polysaccharide moiety in a meningococcal serogroup C conjugate vaccine. Adoptive transfer of splenocytes from mice immunized with the glycoconjugate conferred antipolysaccharide immunologic memory to naive recipient mice. The observed anamnestic immune response was characterized by more rapid kinetics, isotype switching from IgM to IgG and higher antipolysaccharide antibody titers compared with those reached in groups transferred with splenocytes from plain polysaccharide or phosphate-immunized mice. The memory response generated was also long lasting. Sera from mice transferred with cells from conjugate-immunized mice were the only protective in the infant rat passive protection assay, and also showed higher bactericidal titers. We demonstrated that priming the mice immune system with the glycoconjugate using the P64k protein as carrier induced a memory response to the polysaccharide, promoting a switch of the T-cell-independent response to a T-cell dependent one.
Esser, E Stein; Romanyuk, AndreyA; Vassilieva, Elena V; Jacob, Joshy; Prausnitz, Mark R; Compans, Richard W; Skountzou, Ioanna
2016-08-28
Maternal and neonatal tetanus claim tens of thousands lives every year in developing countries, but could be prevented by hygienic practices and improved immunization of pregnant women. This study tested the hypothesis that skin vaccination can overcome the immunologically transformed state of pregnancy and enhance protective immunity to tetanus in mothers and their newborns. To achieve this goal, we developed microneedle patches (MNPs) that efficiently delivered unadjuvanted tetanus toxoid to skin of pregnant mice and demonstrated that this route induced superior immune responses in female mice conferring 100% survival to tetanus toxin challenge when compared to intramuscular vaccination. Mice born to MNP-vaccinated mothers showed detectable tetanus-specific IgG antibodies up to 12weeks of age and complete protection to tetanus toxin challenge up at 6weeks of age. In contrast, none of the 6-week old mice born to intramuscularly vaccinated mothers survived challenge. Although pregnant mice vaccinated with unadjuvanted tetanus toxoid had 30% lower IgG and IgG1 titers than mice vaccinated intramuscularly with Alum®-adjuvanted tetanus toxoid vaccine, IgG2a titers and antibody affinity maturation were similar between these groups. We conclude that skin immunization with MNPs containing unadjuvanted tetanus toxoid can confer potent protective efficacy to mothers and their offspring using a delivery method well suited for expanding vaccination coverage in developing countries. Copyright © 2016 Elsevier B.V. All rights reserved.
TolC plays a crucial role in immune protection conferred by Edwardsiella tarda whole-cell vaccines.
Wang, Chao; Peng, Bo; Li, Hui; Peng, Xuan-Xian
2016-07-12
Although vaccines developed from live organisms have better efficacy than those developed from dead organisms, the mechanisms underlying this differential efficacy remain unexplored. In this study, we combined sub-immunoproteomics with immune challenge to investigate the action of the outer membrane proteome in the immune protection conferred by four Edwardsiella tarda whole-cell vaccines prepared via different treatments and to identify protective immunogens that play a key role in this immune protection. Thirteen spots representing five outer membrane proteins and one cytoplasmic protein were identified, and it was found that their abundance was altered in relation with the immune protective abilities of the four vaccines. Among these proteins, TolC and OmpA were found to be the key immunogens conferring the first and second highest degrees of protection, respectively. TolC was detected in the two effective vaccines (live and inactivated-30-F). The total antiserum and anti-OmpA titers were higher for the two effective vaccines than for the two ineffective vaccines (inactivated-80-F and inactivated-100). Further evidence demonstrated that the live and inactivated-30-F vaccines demonstrated stronger abilities to induce CD8+ and CD4+ T cell differentiation than the other two evaluated vaccines. Our results indicate that the outer membrane proteome changes dramatically following different treatments, which contributes to the effectiveness of whole-cell vaccines.
Smallpox subunit vaccine produced in planta confers protection in mice
Golovkin, Maxim; Spitsin, Sergei; Andrianov, Vyacheslav; Smirnov, Yuriy; Xiao, Yuhong; Pogrebnyak, Natalia; Markley, Karen; Brodzik, Robert; Gleba, Yuri; Isaacs, Stuart N.; Koprowski, Hilary
2007-01-01
We report here the in planta production of the recombinant vaccinia virus B5 antigenic domain (pB5), an attractive component of a subunit vaccine against smallpox. The antigenic domain was expressed by using efficient transient and constitutive plant expression systems and tested by various immunization routes in two animal models. Whereas oral administration in mice or the minipig with collard-derived insoluble pB5 did not generate an anti-B5 immune response, intranasal administration of soluble pB5 led to a rise of B5-specific immunoglobulins, and parenteral immunization led to a strong anti-B5 immune response in both mice and the minipig. Mice immunized i.m. with pB5 generated an antibody response that reduced virus spread in vitro and conferred protection from challenge with a lethal dose of vaccinia virus. These results indicate the feasibility of producing safe and inexpensive subunit vaccines by using plant production systems. PMID:17428917
Probiotics as an Immune Modulator.
Kang, Hye-Ji; Im, Sin-Hyeog
2015-01-01
Probiotics are nonpathogenic live microorganism that can provide a diverse health benefits on the host when consumed in adequate amounts. Probiotics are consumed in diverse ways including dairy product, food supplements and functional foods with specific health claims. Recently, many reports suggest that certain probiotic strains or multi strain mixture have potent immunomodulatory activity in diverse disorders including allergic asthma, atopic dermatitis and rheumatoid arthritis. However, underlying mechanism of action is still unclear and efficacy of probiotic administration is quite different depending on the type of strains and the amounts of doses. We and others have suggested that live probiotics or their metabolites could interact with diverse immune cells (antigen presenting cells and T cells) and confer them to have immunoregulatory functions. Through this interaction, probiotics could contribute to maintaining immune homeostasis by balancing pro-inflammatory and anti-inflammatory immune responses. However, the effect of probiotics in prevention or modulation of ongoing disease is quite diverse even within a same species. Therefore, identification of functional probiotics with specific immune regulatory property is a certainly important issue. Herein, we briefly review selection methods for immunomodulatory probiotic strains and the mechanism of action of probiotics in immune modulation.
An RLP23-SOBIR1-BAK1 complex mediates NLP-triggered immunity.
Albert, Isabell; Böhm, Hannah; Albert, Markus; Feiler, Christina E; Imkampe, Julia; Wallmeroth, Niklas; Brancato, Caterina; Raaymakers, Tom M; Oome, Stan; Zhang, Heqiao; Krol, Elzbieta; Grefen, Christopher; Gust, Andrea A; Chai, Jijie; Hedrich, Rainer; Van den Ackerveken, Guido; Nürnberger, Thorsten
2015-10-05
Plants and animals employ innate immune systems to cope with microbial infection. Pattern-triggered immunity relies on the recognition of microbe-derived patterns by pattern recognition receptors (PRRs). Necrosis and ethylene-inducing peptide 1-like proteins (NLPs) constitute plant immunogenic patterns that are unique, as these proteins are produced by multiple prokaryotic (bacterial) and eukaryotic (fungal, oomycete) species. Here we show that the leucine-rich repeat receptor protein (LRR-RP) RLP23 binds in vivo to a conserved 20-amino-acid fragment found in most NLPs (nlp20), thereby mediating immune activation in Arabidopsis thaliana. RLP23 forms a constitutive, ligand-independent complex with the LRR receptor kinase (LRR-RK) SOBIR1 (Suppressor of Brassinosteroid insensitive 1 (BRI1)-associated kinase (BAK1)-interacting receptor kinase 1), and recruits a second LRR-RK, BAK1, into a tripartite complex upon ligand binding. Stable, ectopic expression of RLP23 in potato (Solanum tuberosum) confers nlp20 pattern recognition and enhanced immunity to destructive oomycete and fungal plant pathogens, such as Phytophthora infestans and Sclerotinia sclerotiorum. PRRs that recognize widespread microbial patterns might be particularly suited for engineering immunity in crop plants.
Huang, Yi-Ting; Liao, Jia-Teh; Yen, Li-Chen; Chang, Yung-Kun; Lin, Yi-Ling; Liao, Ching-Len
2015-09-11
To construct safer recombinant flavivirus vaccine, we exploited Japanese encephalitis virus (JEV) replicon-based platform to generate single-round infectious particles (SRIPs) that expressed heterologous neutralizing epitope SP70 derived from enterovirus-71 (EV71). Such pseudo-infectious virus particles, named SRIP-SP70, although are not genuine viable viruses, closely mimic live virus infection to elicit immune responses within one round of viral life cycle. We found that, besides gaining of full protection to thwart JEV lethal challenge, female outbred ICR mice, when were immunized with SRIP-SP70 by prime-boost protocol, could not only induce SP70-specific and IgG2a predominant antibodies but also provide their newborns certain degree of protection against EV71 lethal challenge. Our results therefore exemplify that this vaccination strategy could indeed confer an immunized host a dual protective immunity against subsequent lethal challenge from JEV or EV71.
Kaulfuß, Meike; Wensing, Ina; Windmann, Sonja; Hrycak, Camilla Patrizia; Bayer, Wibke
2017-02-06
In the Friend retrovirus mouse model we developed potent adenovirus-based vaccines that were designed to induce either strong Friend virus GagL 85-93 -specific CD8 + T cell or antibody responses, respectively. To optimize the immunization outcome we evaluated vaccination strategies using combinations of these vaccines. While the vaccines on their own confer strong protection from a subsequent Friend virus challenge, the simple combination of the vaccines for the establishment of an optimized immunization protocol did not result in a further improvement of vaccine effectivity. We demonstrate that the co-immunization with GagL 85-93 /leader-gag encoding vectors together with envelope-encoding vectors abrogates the induction of GagL 85-93 -specific CD8 + T cells, and in successive immunization protocols the immunization with the GagL 85-93 /leader-gag encoding vector had to precede the immunization with an envelope encoding vector for the efficient induction of GagL 85-93 -specific CD8 + T cells. Importantly, the antibody response to envelope was in fact enhanced when the mice were adenovirus-experienced from a prior immunization, highlighting the expedience of this approach. To circumvent the immunosuppressive effect of envelope on immune responses to simultaneously or subsequently administered immunogens, we developed a two immunizations-based vaccination protocol that induces strong immune responses and confers robust protection of highly Friend virus-susceptible mice from a lethal Friend virus challenge.
Yin, Yuelan; Lian, Kai; Zhao, Dan; Tao, Chengwu; Chen, Xiang; Tan, Weijun; Wang, Xiaobo; Xu, Zhengzhong; Hu, Maozhi; Rao, Yan; Zhou, Xiaohui; Pan, Zhiming; Zhang, Xiaoming; Jiao, Xin'an
2017-01-01
Deaths associated with tuberculosis (TB) is rising and accounted for 1.4 million deaths in 2015 many of which were due to drug-resistant bacteria. Vaccines represent an important medical intervention, but the current Bacilli Calmette-Guerin (BCG) vaccine is not ideal for the protection of teenagers and adults. Therefore, a safe and effective vaccine is urgently needed. In this study, we designed a novel vaccine using an attenuated Listeria monocytogenes strain carrying fusion antigen FbpB-ESAT-6 (rLM) and characterized its safety and protective efficacy against Mycobacterium tuberculosis ( M.tb ) infection in mice. Compared to the wild type strain yzuLM4 and parental strain LMΔ actA/plcB (LM1-2), the virulence of rLM was significantly reduced as judged by its infectious kinetics and LD 50 dose. Further characterization of intravenous immunization showed that prime-boost vaccination significantly increased the levels of Th1 cytokines (IFN-γ, IL-17, and IL-6), and enhanced cytotoxic T lymphocyte (CTL) CTLs activity, suggesting that rLM could elicit potent Th1/Th17 responses. More importantly, rLM significantly conferred the protection against M.tb H37Rv challenge. Collectively, our findings indicated that rLM is a novel and useful tool to prevent M.tb infection, and can be potentially be used to boost BCG-primed immunity.
Solana, José Carlos; Ramírez, Laura; Corvo, Laura; de Oliveira, Camila Indiani; Barral-Netto, Manoel; Requena, José María
2017-01-01
Background The immunization with genetically attenuated Leishmania cell lines has been associated to the induction of memory and effector T cell responses against Leishmania able to control subsequent challenges. A Leishmania infantum null mutant for the HSP70-II genes has been described, possessing a non-virulent phenotype. Methodology/Principal findings The L. infantum attenuated parasites (LiΔHSP70-II) were inoculated in BALB/c (intravenously and subcutaneously) and C57BL/6 (subcutaneously) mice. An asymptomatic infection was generated and parasites diminished progressively to become undetectable in most of the analyzed organs. However, inoculation resulted in the long-term induction of parasite specific IFN-γ responses able to control the disease caused by a challenge of L. major infective promastigotes. BALB/c susceptible mice showed very low lesion development and a drastic decrease in parasite burdens in the lymph nodes draining the site of infection and internal organs. C57BL/6 mice did not show clinical manifestation of disease, correlated to the rapid migration of Leishmania specific IFN-γ producing T cells to the site of infection. Conclusion/Significance Inoculation of the LiΔHSP70-II attenuated line activates mammalian immune system for inducing moderate pro-inflammatory responses. These responses are able to confer long-term protection in mice against the infection of L. major virulent parasites. PMID:28558043
Nuclear Factor-kappaB in Autoimmunity: Man and Mouse
Miraghazadeh, Bahar; Cook, Matthew C.
2018-01-01
NF-κB (nuclear factor-kappa B) is a transcription complex crucial for host defense mediated by innate and adaptive immunity, where canonical NF-κB signaling, mediated by nuclear translocation of RelA, c-Rel, and p50, is important for immune cell activation, differentiation, and survival. Non-canonical signaling mediated by nuclear translocation of p52 and RelB contributes to lymphocyte maturation and survival and is also crucial for lymphoid organogenesis. We outline NF-κB signaling and regulation, then summarize important molecular contributions of NF-κB to mechanisms of self-tolerance. We relate these mechanisms to autoimmune phenotypes described in what is now a substantial catalog of immune defects conferred by mutations in NF-κB pathways in mouse models. Finally, we describe Mendelian autoimmune syndromes arising from human NF-κB mutations, and speculate on implications for understanding sporadic autoimmune disease. PMID:29686669
Lein, B
1995-12-01
Several immune-based HIV therapy studies presented at the Interscience Conference on Antimicrobial Agents Chemotherapy (ICAAC) are summarized. These studies involve the following therapies: HIV-IT, a gene therapy approach to augmenting the body's anti-HIV responses; interferon-alpha n3, a new formulation of alpha interferon with fewer toxicities; transfer of immune responses from one individual to another, also called passive immune therapy; and interleukin-2 (IL-2) in combination with protease inhibitors.
Systems analysis of protective immune responses to RTS,S malaria vaccination in humans
Kazmin, Dmitri; Nakaya, Helder I.; Lee, Eva K.; Johnson, Matthew J.; van der Most, Robbert; van den Berg, Robert A.; Ballou, W. Ripley; Jongert, Erik; Wille-Reece, Ulrike; Ockenhouse, Christian; Aderem, Alan; Zak, Daniel E.; Sadoff, Jerald; Hendriks, Jenny; Wrammert, Jens; Ahmed, Rafi; Pulendran, Bali
2017-01-01
RTS,S is an advanced malaria vaccine candidate and confers significant protection against Plasmodium falciparum infection in humans. Little is known about the molecular mechanisms driving vaccine immunity. Here, we applied a systems biology approach to study immune responses in subjects receiving three consecutive immunizations with RTS,S (RRR), or in those receiving two immunizations of RTS,S/AS01 following a primary immunization with adenovirus 35 (Ad35) (ARR) vector expressing circumsporozoite protein. Subsequent controlled human malaria challenge (CHMI) of the vaccinees with Plasmodium-infected mosquitoes, 3 wk after the final immunization, resulted in ∼50% protection in both groups of vaccinees. Circumsporozoite protein (CSP)-specific antibody titers, prechallenge, were associated with protection in the RRR group. In contrast, ARR-induced lower antibody responses, and protection was associated with polyfunctional CD4+ T-cell responses 2 wk after priming with Ad35. Molecular signatures of B and plasma cells detected in PBMCs were highly correlated with antibody titers prechallenge and protection in the RRR cohort. In contrast, early signatures of innate immunity and dendritic cell activation were highly associated with protection in the ARR cohort. For both vaccine regimens, natural killer (NK) cell signatures negatively correlated with and predicted protection. These results suggest that protective immunity against P. falciparum can be achieved via multiple mechanisms and highlight the utility of systems approaches in defining molecular correlates of protection to vaccination. PMID:28193898
Arabidopsis TNL-WRKY domain receptor RRS1 contributes to temperature-conditioned RPS4 auto-immunity
Heidrich, Katharina; Tsuda, Kenichi; Blanvillain-Baufumé, Servane; Wirthmueller, Lennart; Bautor, Jaqueline; Parker, Jane E.
2013-01-01
In plant effector-triggered immunity (ETI), intracellular nucleotide binding-leucine rich repeat (NLR) receptors are activated by specific pathogen effectors. The Arabidopsis TIR (Toll-Interleukin-1 receptor domain)-NLR (denoted TNL) gene pair, RPS4 and RRS1, confers resistance to Pseudomonas syringae pv tomato (Pst) strain DC3000 expressing the Type III-secreted effector, AvrRps4. Nuclear accumulation of AvrRps4, RPS4, and the TNL resistance regulator EDS1 is necessary for ETI. RRS1 possesses a C-terminal “WRKY” transcription factor DNA binding domain suggesting that important RPS4/RRS1 recognition and/or resistance signaling events occur at the nuclear chromatin. In Arabidopsis accession Ws-0, the RPS4Ws/RRS1Ws allelic pair governs resistance to Pst/AvrRps4 accompanied by host programed cell death (pcd). In accession Col-0, RPS4Col/RRS1Col effectively limits Pst/AvrRps4 growth without pcd. Constitutive expression of HA-StrepII tagged RPS4Col (in a 35S:RPS4-HS line) confers temperature-conditioned EDS1-dependent auto-immunity. Here we show that a high (28°C, non-permissive) to moderate (19°C, permissive) temperature shift of 35S:RPS4-HS plants can be used to follow defense-related transcriptional dynamics without a pathogen effector trigger. By comparing responses of 35S:RPS4-HS with 35S:RPS4-HS rrs1-11 and 35S:RPS4-HS eds1-2 mutants, we establish that RPS4Col auto-immunity depends entirely on EDS1 and partially on RRS1Col. Examination of gene expression microarray data over 24 h after temperature shift reveals a mainly quantitative RRS1Col contribution to up- or down-regulation of a small subset of RPS4Col-reprogramed, EDS1-dependent genes. We find significant over-representation of WRKY transcription factor binding W-box cis-elements within the promoters of these genes. Our data show that RRS1Col contributes to temperature-conditioned RPS4Col auto-immunity and are consistent with activated RPS4Col engaging RRS1Col for resistance signaling. PMID:24146667
García, Ana V; Blanvillain-Baufumé, Servane; Huibers, Robin P; Wiermer, Marcel; Li, Guangyong; Gobbato, Enrico; Rietz, Steffen; Parker, Jane E
2010-07-01
An important layer of plant innate immunity to host-adapted pathogens is conferred by intracellular nucleotide-binding/oligomerization domain-leucine rich repeat (NB-LRR) receptors recognizing specific microbial effectors. Signaling from activated receptors of the TIR (Toll/Interleukin-1 Receptor)-NB-LRR class converges on the nucleo-cytoplasmic immune regulator EDS1 (Enhanced Disease Susceptibility1). In this report we show that a receptor-stimulated increase in accumulation of nuclear EDS1 precedes or coincides with the EDS1-dependent induction and repression of defense-related genes. EDS1 is capable of nuclear transport receptor-mediated shuttling between the cytoplasm and nucleus. By enhancing EDS1 export from inside nuclei (through attachment of an additional nuclear export sequence (NES)) or conditionally releasing EDS1 to the nucleus (by fusion to a glucocorticoid receptor (GR)) in transgenic Arabidopsis we establish that the EDS1 nuclear pool is essential for resistance to biotrophic and hemi-biotrophic pathogens and for transcriptional reprogramming. Evidence points to post-transcriptional processes regulating receptor-triggered accumulation of EDS1 in nuclei. Changes in nuclear EDS1 levels become equilibrated with the cytoplasmic EDS1 pool and cytoplasmic EDS1 is needed for complete resistance and restriction of host cell death at infection sites. We propose that coordinated nuclear and cytoplasmic activities of EDS1 enable the plant to mount an appropriately balanced immune response to pathogen attack.
Yosef, Ido; Goren, Moran G; Kiro, Ruth; Edgar, Rotem; Qimron, Udi
2011-12-13
Prokaryotic DNA arrays arranged as clustered regularly interspaced short palindromic repeats (CRISPR), along with their associated proteins, provide prokaryotes with adaptive immunity by RNA-mediated targeting of alien DNA or RNA matching the sequences between the repeats. Here, we present a thorough screening system for the identification of bacterial proteins participating in immunity conferred by the Escherichia coli CRISPR system. We describe the identification of one such protein, high-temperature protein G (HtpG), a homolog of the eukaryotic chaperone heat-shock protein 90. We demonstrate that in the absence of htpG, the E. coli CRISPR system loses its suicidal activity against λ prophage and its ability to provide immunity from lysogenization. Transcomplementation of htpG restores CRISPR activity. We further show that inactivity of the CRISPR system attributable to htpG deficiency can be suppressed by expression of Cas3, a protein that is essential for its activity. Accordingly, we also find that the steady-state level of overexpressed Cas3 is significantly enhanced following HtpG expression. We conclude that HtpG is a newly identified positive modulator of the CRISPR system that is essential for maintaining functional levels of Cas3.
Yosef, Ido; Goren, Moran G.; Kiro, Ruth; Edgar, Rotem; Qimron, Udi
2011-01-01
Prokaryotic DNA arrays arranged as clustered regularly interspaced short palindromic repeats (CRISPR), along with their associated proteins, provide prokaryotes with adaptive immunity by RNA-mediated targeting of alien DNA or RNA matching the sequences between the repeats. Here, we present a thorough screening system for the identification of bacterial proteins participating in immunity conferred by the Escherichia coli CRISPR system. We describe the identification of one such protein, high-temperature protein G (HtpG), a homolog of the eukaryotic chaperone heat-shock protein 90. We demonstrate that in the absence of htpG, the E. coli CRISPR system loses its suicidal activity against λ prophage and its ability to provide immunity from lysogenization. Transcomplementation of htpG restores CRISPR activity. We further show that inactivity of the CRISPR system attributable to htpG deficiency can be suppressed by expression of Cas3, a protein that is essential for its activity. Accordingly, we also find that the steady-state level of overexpressed Cas3 is significantly enhanced following HtpG expression. We conclude that HtpG is a newly identified positive modulator of the CRISPR system that is essential for maintaining functional levels of Cas3. PMID:22114197
Akt signaling is critical for memory CD8+ T-cell development and tumor immune surveillance.
Rogel, Anne; Willoughby, Jane E; Buchan, Sarah L; Leonard, Henry J; Thirdborough, Stephen M; Al-Shamkhani, Aymen
2017-02-14
Memory CD8 + T cells confer long-term immunity against tumors, and anticancer vaccines therefore should maximize their generation. Multiple memory CD8 + T-cell subsets with distinct functional and homing characteristics exist, but the signaling pathways that regulate their development are ill defined. Here we examined the role of the serine/threonine kinase Akt in the generation of protective immunity by CD8 + T cells. Akt is known to be activated by the T-cell antigen receptor and the cytokine IL-2, but its role in T-cell immunity in vivo has not been explored. Using CD8 + T cells from pdk1 K465E/K465E knockin mice, we found that decreased Akt activity inhibited the survival of T cells during the effector-to-memory cell transition and abolished their differentiation into C-X-C chemokine receptor 3 (CXCR3) lo CD43 lo effector-like memory cells. Consequently, antitumor immunity by CD8 + T cells that display defective Akt signaling was substantially diminished during the memory phase. Reduced memory T-cell survival and altered memory cell differentiation were associated with up-regulation of the proapoptotic protein Bim and the T-box transcription factor eomesodermin, respectively. These findings suggest an important role for effector-like memory CD8 + T cells in tumor immune surveillance and identify Akt as a key signaling node in the development of protective memory CD8 + T-cell responses.
Akt signaling is critical for memory CD8+ T-cell development and tumor immune surveillance
Rogel, Anne; Willoughby, Jane E.; Buchan, Sarah L.; Leonard, Henry J.; Thirdborough, Stephen M.; Al-Shamkhani, Aymen
2017-01-01
Memory CD8+ T cells confer long-term immunity against tumors, and anticancer vaccines therefore should maximize their generation. Multiple memory CD8+ T-cell subsets with distinct functional and homing characteristics exist, but the signaling pathways that regulate their development are ill defined. Here we examined the role of the serine/threonine kinase Akt in the generation of protective immunity by CD8+ T cells. Akt is known to be activated by the T-cell antigen receptor and the cytokine IL-2, but its role in T-cell immunity in vivo has not been explored. Using CD8+ T cells from pdk1K465E/K465E knockin mice, we found that decreased Akt activity inhibited the survival of T cells during the effector-to-memory cell transition and abolished their differentiation into C-X-C chemokine receptor 3 (CXCR3)loCD43lo effector-like memory cells. Consequently, antitumor immunity by CD8+ T cells that display defective Akt signaling was substantially diminished during the memory phase. Reduced memory T-cell survival and altered memory cell differentiation were associated with up-regulation of the proapoptotic protein Bim and the T-box transcription factor eomesodermin, respectively. These findings suggest an important role for effector-like memory CD8+ T cells in tumor immune surveillance and identify Akt as a key signaling node in the development of protective memory CD8+ T-cell responses. PMID:28137869
Host response to Candida albicans bloodstream infection and sepsis
Duggan, Seána; Leonhardt, Ines; Hünniger, Kerstin; Kurzai, Oliver
2015-01-01
Candida albicans is a major cause of bloodstream infection which may present as sepsis and septic shock - major causes of morbidity and mortality world-wide. After invasion of the pathogen, innate mechanisms govern the early response. Here, we outline the models used to study these mechanisms and summarize our current understanding of innate immune responses during Candida bloodstream infection. This includes protective immunity as well as harmful responses resulting in Candida induced sepsis. Neutrophilic granulocytes are considered principal effector cells conferring protection and recognize C. albicans mainly via complement receptor 3. They possess a range of effector mechanisms, contributing to elimination of the pathogen. Neutrophil activation is closely linked to complement and modulated by activated mononuclear cells. A thorough understanding of these mechanisms will help in creating an individualized approach to patients suffering from systemic candidiasis and aid in optimizing clinical management. PMID:25785541
Aranyos, Alek M; Roff, Shannon R; Pu, Ruiyu; Owen, Jennifer L; Coleman, James K; Yamamoto, Janet K
2016-03-14
The importance of vaccine-induced T-cell immunity in conferring protection with prototype and commercial FIV vaccines is still unclear. Current studies performed adoptive transfer of T cells from prototype FIV-vaccinated cats to partial-to-complete feline leukocyte antigen (FLA)-matched cats a day before either homologous FIVPet or heterologous-subtype pathogenic FIVFC1 challenge. Adoptive-transfer (A-T) conferred a protection rate of 87% (13 of 15, p < 0.001) against FIVPet using the FLA-matched T cells, whereas all 12 control cats were unprotected. Furthermore, A-T conferred protection rate of 50% (6 of 12, p<0.023) against FIVFC1 using FLA-matched T cells, whereas all 8 control cats were unprotected. Transfer of FLA-matched T and B cells demonstrated that T cells are needed to confer A-T protection. In addition, complete FLA-matching and addition of T-cell numbers > 13 × 10(6) cells were required for A-T protection against FIVFC1 strain, reported to be a highly pathogenic virus resistant to vaccine-induced neutralizing-antibodies. The addition of FLA-matched B cells alone was not protective. The poor quality of the anti-FIV T-cell immunity induced by the vaccine likely contributed to the lack of protection in an FLA-matched recipient against FIVFC1. The quality of the immune response was determined by the presence of high mRNA levels of cytolysin (perforin) and cytotoxins (granzymes A, B, and H) and T helper-1 cytokines (interferon-γ [IFNγ] and IL2). Increased cytokine, cytolysin and cytotoxin production was detected in the donors which conferred protection in A-T studies. In addition, the CD4(+) and CD8(+) T-cell proliferation and/or IFNγ responses to FIV p24 and reverse transcriptase increased with each year in cats receiving 1X-3X vaccine boosts over 4 years. These studies demonstrate that anti-FIV T-cell immunity induced by vaccination with a dual-subtype FIV vaccine is essential for prophylactic protection against AIDS lentiviruses such as FIV and potentially HIV-1. Copyright © 2016 Elsevier Ltd. All rights reserved.
Aranyos, Alek M.; Roff, Shannon R.; Pu, Riuyu; Owen, Jennifer L.; Coleman, James K.; Yamamoto, Janet K.
2016-01-01
The importance of vaccine-induced T-cell immunity in conferring protection with prototype and commercial FIV vaccines is still unclear. Current studies performed adoptive transfer of T cells from prototype FIV-vaccinated cats to partial-to-complete feline leukocyte antigen (FLA)-matched cats a day before either homologous FIVPet or heterologous-subtype pathogenic FIVFC1 challenge. Adoptive-transfer (A–T) conferred a protection rate of 87% (13 of 15, p<0.001) against FIVPet using FLA-matched T cells, whereas all 12 control cats were unprotected. Furthermore, A-T conferred protection rate of 50% (6 of 12, p<0.023) against FIVFC1 using FLA-matched T cells, whereas all 8 control cats were unprotected. Transfer of FLA-matched T and B cells demonstrated that T cells are needed to confer A-T protection. In addition, complete FLA-matching and addition of T-cell numbers >13×106 cells were required for A-T protection against FIVFC1 strain, reported to be a highly pathogenic virus resistant to vaccine-induced neutralizing-antibodies. The addition of FLA-matched B cells alone was not protective. The poor quality of the anti-FIV T-cell immunity induced by the vaccine likely contributed to the lack of protection in an FLA-matched recipient against FIVFC1. The quality of the immune response was determined by the presence of high mRNA levels of cytolysin (perforin) and cytotoxins (granzymes A, B, and H) and T helper-1 cytokines (interferon-γ [IFNγ] and IL2). Increased cytokine, cytolysin and cytotoxin production was detected in the donors which conferred protection in A-T studies. In addition, the CD4+ and CD8+ T-cell proliferation and/or IFNγ responses to FIV p24 and reverse transcriptase increased with each year in cats receiving 1X-3X vaccine boosts over 4 years. These studies demonstrate that anti-FIV T-cell immunity induced by vaccination with a dual-subtype FIV vaccine is essential for prophylactic protection against AIDS lentiviruses such as FIV and potentially HIV-1. PMID:26802606
Baxter, David; Guppy, Martin J.
2013-01-01
The 23rd National Immunization Conference for Health Care Workers was held on December 7th, 2012 at the Manchester Conference Centre. There were over 220 delegates for this event sponsored by educational grants from Crucell, Glaxo Smith Kline, Pfizer Vaccines and Sanofi Pasteur. A number of speakers took the opportunity kindly afforded by Human Vaccines and Immunotherapeutics to write up their conference presentation as a paper for this special supplement. PMID:23857271
Drach, Marcel; Le Gargasson, Jean-Bernard; Mathonnat, Jacky; Da Silva, Alfred; Kaddar, Miloud; Colombini, Anaïs
2013-09-23
The introduction of new vaccines with much higher prices than traditional vaccines results in increasing budgetary pressure on immunization programs in GAVI-eligible countries, increasing the need to ensure their financial sustainability. In this context, the third EPIVAC (Epidemiology and Vaccinology) technical conference was held from February 16 to 18, 2012 at the Regional Institute of Public Health in Ouidah, Benin. Managers of ministries of health and finance from 11 West African countries (GAVI eligible countries), as well as former EPIVAC students and European experts, shared their knowledge and best practices on immunization financing at district and country level. The conference concluded by stressing five major priorities for the financial sustainability of national immunization programs (NIPs) in GAVI-eligible countries. - Strengthen public financing by increasing resources and fiscal space, improving budget processes, increasing contribution of local governments and strengthen efficiency of budget spending. - Promote equitable community financing which was recognized as a significant and essential contribution to the continuity of EPI operations. - Widen private funding by exploring prospects offered by sponsorship through foundations dedicated to immunization and by corporate social responsibility programs. - Contain the potential crowding-out effect of GAVI co-financing and ensure that decisions on new vaccine introductions are evidence-based. - Seek out innovative financing mechanisms such as taxes on food products or a national solidarity fund. Copyright © 2013. Published by Elsevier Ltd.. All rights reserved.
Vitiligo: Focus on Clinical Aspects, Immunopathogenesis, and Therapy.
Boniface, Katia; Seneschal, Julien; Picardo, Mauro; Taïeb, Alain
2018-02-01
Vitiligo is an acquired chronic depigmenting disorder of the skin, with an estimated prevalence of 0.5% of the general population, characterized by the development of white macules resulting from a loss of epidermal melanocytes. The nomenclature has been revised after an extensive international work within the vitiligo global issues consensus conference, and vitiligo (formerly non-segmental vitiligo) is now a consensus umbrella term for all forms of generalized vitiligo. Two other subsets of vitiligo are segmental vitiligo and unclassified/undetermined vitiligo, which corresponds to focal disease and rare variants. A series of hypopigmented disorders may masquerade as vitiligo, and some of them need to be ruled out by specific procedures including a skin biopsy. Multiple mechanisms are involved in melanocyte disappearance, namely genetic predisposition, environmental triggers, metabolic abnormalities, impaired renewal, and altered inflammatory and immune responses. The auto-immune/inflammatory theory is the leading hypothesis because (1) vitiligo is often associated with autoimmune diseases; (2) most vitiligo susceptibility loci identified through genome-wide association studies encode immunomodulatory proteins; and (3) prominent immune cell infiltrates are found in the perilesional margin of actively depigmenting skin. However, other studies support melanocyte intrinsic abnormalities with poor adaptation of melanocytes to stressors leading to melanocyte instability in the basal layer, and release of danger signals important for the activation of the immune system. Recent progress in the understanding of immune pathomechanisms opens interesting perspectives for innovative treatment strategies. The proof of concept in humans of targeting of the IFNγ /Th1 pathway is much awaited. The interplay between oxidative stress and altered immune responses suggests that additional strategies aiming at limiting type I interferon activation pathway as background stabilizing therapies could be an interesting approach in vitiligo. This review covers classification and clinical aspects, pathophysiology with emphasis on immunopathogenesis, and promising therapeutic approaches.
Plant Immunity Inducer Development and Application.
Dewen, Qiu; Yijie, Dong; Yi, Zhang; Shupeng, Li; Fachao, Shi
2017-05-01
Plant immunity inducers represent a new and rapidly developing field in plant-protection research. In this paper, we discuss recent research on plant immunity inducers and their development and applications in China. Plant immunity inducers include plant immunity-inducing proteins, chitosan oligosaccharides, and microbial inducers. These compounds and microorganisms can trigger defense responses and confer disease resistance in plants. We also describe the mechanisms of plant immunity inducers and how they promote plant health. Furthermore, we summarize the current situation in plant immunity inducer development in China and the global marketplace. Finally, we also deeply analyze the development trends and application prospects of plant immunity inducers in environmental protection and food safety.
Wang, Hang; Yang, Wei; Shen, Guoying; Zhang, Jianting; Lv, Wei; Ji, Binfeng; Meng, Chun
2015-07-01
Although immersion and oral vaccination are the most practical methods for fish farmers, their applications are very limited due to low immune stimulation effect. We used the protein transduction domain (PTD) of transactivating transcriptional factor (TAT) derived from HIV TAT protein to increase the delivery efficiency of aquatic protein vaccines. Vibrio parahaemolyticus outer membrane protein K (ompK), a reported vaccine candidate for the prevention of V. parahaemolyticus infection, was fused with TAT-PTD expressed in Escherichia coli. We found that PTD-ompK fusion protein effectively penetrated into marbled eel bodies. Analysis of ompK antibody titres demonstrated that immersion vaccination with PTD-ompK was superior to ompK alone and induced robust immune stimulation in marbled eels. Both active and passive protection analyses against immersive challenge with V. parahaemolyticus strains demonstrated that marbled eels immunized with PTD-ompK survived significantly longer than those immunized with ompK alone. Our results indicated that TAT-PTD could be served as is an efficient delivery system for aquatic immersion vaccinations against various infectious diseases commonly seen in aquatic farm industry. © 2015 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Libregts, Sten F.W.M.; Nolte, Martijn A., E-mail: m.nolte@sanquin.nl
Quiescence, self-renewal, lineage commitment and differentiation of hematopoietic stem cells (HSCs) towards fully mature blood cells are a complex process that involves both intrinsic and extrinsic signals. During steady-state conditions, most hematopoietic signals are provided by various resident cells inside the bone marrow (BM), which establish the HSC micro-environment. However, upon infection, the hematopoietic process is also affected by pathogens and activated immune cells, which illustrates an effective feedback mechanism to hematopoietic stem and progenitor cells (HSPCs) via immune-mediated signals. Here, we review the impact of pathogen-associated molecular patterns (PAMPs), damage-associated molecular patterns (DAMPs), costimulatory molecules and pro-inflammatory cytokines onmore » the quiescence, proliferation and differentiation of HSCs and more committed progenitors. As modulation of HSPC function via these immune-mediated signals holds an interesting parallel with the “three-signal-model” described for the activation and differentiation of naïve T-cells, we propose a novel “three-signal” concept for immune-driven hematopoiesis. In this model, the recognition of PAMPs and DAMPs will activate HSCs and induce proliferation, while costimulatory molecules and pro-inflammatory cytokines confer a second and third signal, respectively, which further regulate expansion, lineage commitment and differentiation of HSPCs. We review the impact of inflammatory stress on hematopoiesis along these three signals and we discuss whether they act independently from each other or that concurrence of these signals is important for an adequate response of HSPCs upon infection. - Highlights: • Inflammation and infection have a direct impact on hematopoiesis in the bone marrow. • We draw a striking parallel between immune-driven hematopoiesis and T cell activation. • We review how PAMPs and DAMPs, costimulation and cytokines influence HSPC function.« less
Structural basis for concerted recruitment and activation of IRF-3 by innate immune adaptor proteins
Zhao, Baoyu; Shu, Chang; Gao, Xinsheng; ...
2016-06-02
Type I IFNs are key cytokines mediating innate antiviral immunity. cGMP-AMP synthase, ritinoic acid-inducible protein 1 (RIG-I)–like receptors, and Toll-like receptors recognize microbial double-stranded (ds)DNA, dsRNA, and LPS to induce the expression of type I IFNs. These signaling pathways converge at the recruitment and activation of the transcription factor IRF-3 (IFN regulatory factor 3). The adaptor proteins STING (stimulator of IFN genes), MAVS (mitochondrial antiviral signaling), and TRIF (TIR domain-containing adaptor inducing IFN-β) mediate the recruitment of IRF-3 through a conserved pLxIS motif. Here in this paper, we show that the pLxIS motif of phosphorylated STING, MAVS, and TRIF bindsmore » to IRF-3 in a similar manner, whereas residues upstream of the motif confer specificity. The structure of the IRF-3 phosphomimetic mutant S386/396E bound to the cAMP response element binding protein (CREB)-binding protein reveals that the pLxIS motif also mediates IRF-3 dimerization and activation. Moreover, rotavirus NSP1 (nonstructural protein 1) employs a pLxIS motif to target IRF-3 for degradation, but phosphorylation of NSP1 is not required for its activity. These results suggest a concerted mechanism for the recruitment and activation of IRF-3 that can be subverted by viral proteins to evade innate immune responses.« less
Structural basis for concerted recruitment and activation of IRF-3 by innate immune adaptor proteins
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhao, Baoyu; Shu, Chang; Gao, Xinsheng
Type I IFNs are key cytokines mediating innate antiviral immunity. cGMP-AMP synthase, ritinoic acid-inducible protein 1 (RIG-I)–like receptors, and Toll-like receptors recognize microbial double-stranded (ds)DNA, dsRNA, and LPS to induce the expression of type I IFNs. These signaling pathways converge at the recruitment and activation of the transcription factor IRF-3 (IFN regulatory factor 3). The adaptor proteins STING (stimulator of IFN genes), MAVS (mitochondrial antiviral signaling), and TRIF (TIR domain-containing adaptor inducing IFN-β) mediate the recruitment of IRF-3 through a conserved pLxIS motif. Here in this paper, we show that the pLxIS motif of phosphorylated STING, MAVS, and TRIF bindsmore » to IRF-3 in a similar manner, whereas residues upstream of the motif confer specificity. The structure of the IRF-3 phosphomimetic mutant S386/396E bound to the cAMP response element binding protein (CREB)-binding protein reveals that the pLxIS motif also mediates IRF-3 dimerization and activation. Moreover, rotavirus NSP1 (nonstructural protein 1) employs a pLxIS motif to target IRF-3 for degradation, but phosphorylation of NSP1 is not required for its activity. These results suggest a concerted mechanism for the recruitment and activation of IRF-3 that can be subverted by viral proteins to evade innate immune responses.« less
Sedegah, Martha; Hollingdale, Michael R.; Farooq, Fouzia; Ganeshan, Harini; Belmonte, Maria; Kim, Yohan; Peters, Bjoern; Sette, Alessandro; Huang, Jun; McGrath, Shannon; Abot, Esteban; Limbach, Keith; Shi, Meng; Soisson, Lorraine; Diggs, Carter; Chuang, Ilin; Tamminga, Cindy; Epstein, Judith E.; Villasante, Eileen; Richie, Thomas L.
2014-01-01
Background Fifteen volunteers were immunized with three doses of plasmid DNA encoding P. falciparum circumsporozoite protein (CSP) and apical membrane antigen-1 (AMA1) and boosted with human adenovirus-5 (Ad) expressing the same antigens (DNA/Ad). Four volunteers (27%) demonstrated sterile immunity to controlled human malaria infection and, overall, protection was statistically significantly associated with ELISpot and CD8+ T cell IFN-γ activities to AMA1 but not CSP. DNA priming was required for protection, as 18 additional subjects immunized with Ad alone (AdCA) did not develop sterile protection. Methodology/Principal Findings We sought to identify correlates of protection, recognizing that DNA-priming may induce different responses than AdCA alone. Among protected volunteers, two and three had higher ELISpot and CD8+ T cell IFN-γ responses to CSP and AMA1, respectively, than non-protected volunteers. Unexpectedly, non-protected volunteers in the AdCA trial showed ELISpot and CD8+ T cell IFN-γ responses to AMA1 equal to or higher than the protected volunteers. T cell functionality assessed by intracellular cytokine staining for IFN-γ, TNF-α and IL-2 likewise did not distinguish protected from non-protected volunteers across both trials. However, three of the four protected volunteers showed higher effector to central memory CD8+ T cell ratios to AMA1, and one of these to CSP, than non-protected volunteers for both antigens. These responses were focused on discrete regions of CSP and AMA1. Class I epitopes restricted by A*03 or B*58 supertypes within these regions of AMA1 strongly recalled responses in three of four protected volunteers. We hypothesize that vaccine-induced effector memory CD8+ T cells recognizing a single class I epitope can confer sterile immunity to P. falciparum in humans. Conclusions/Significance We suggest that better understanding of which epitopes within malaria antigens can confer sterile immunity and design of vaccine approaches that elicit responses to these epitopes will increase the potency of next generation gene-based vaccines. PMID:25211344
Suppression of bacterial infection in rice by treatment with a sulfated peptide.
Wei, Tong; Chern, Mawsheng; Liu, Furong; Ronald, Pamela C
2016-12-01
The rice XA21 receptor kinase confers robust resistance to bacterial blight disease caused by Xanthomonas oryzae pv. oryzae (Xoo). A tyrosine-sulfated peptide from Xoo, called RaxX, triggers XA21-mediated immune responses, including the production of ethylene and reactive oxygen species and the induction of defence gene expression. It has not been tested previously whether these responses confer effective resistance to Xoo. Here, we describe a newly established post-inoculation treatment assay that facilitates investigations into the effect of the sulfated RaxX peptide in planta. In this assay, rice plants were inoculated with a virulent strain of Xoo and then treated with the RaxX peptide 2 days after inoculation. We found that post-inoculation treatment of XA21 plants with the sulfated RaxX peptide suppresses the development of Xoo infection in XA21 rice plants. The treated plants display restricted lesion development and reduced bacterial growth. Our findings demonstrate that exogenous application of sulfated RaxX activates XA21-mediated immunity in planta, and provides a potential strategy for the control of bacterial disease in the field. © 2016 BSPP and John Wiley & Sons Ltd.
Strategies to potentiate immune response after photodynamic therapy (Conference Presentation)
NASA Astrophysics Data System (ADS)
Hamblin, Michael R.
2017-02-01
Photodynamic therapy (PDT) has been used as a cancer therapy for forty years but has not yet advanced to a mainstream cancer treatment. Although PDT has been shown to be an efficient photochemical way to destroy local tumors by a combination of non-toxic dyes and harmless visible light, it is its additional effects in mediating the stimulation of the host immune system that gives PDT a great potential to become more widely used. Although the stimulation of tumor-specific cytotoxic T-cells that can destroy distant tumor deposits after PDT has been reported in some animal models, it remains the exception rather than the rule. This realization has prompted several investigators to test various combination approaches that could potentiate the immune recognition of tumor antigens that have been released after PDT. Some of these combination approaches use immunostimulants including various microbial preparations that activate Toll-like receptors and other receptors for pathogen associated molecular patterns. Other approaches use cytokines and growth factors whether directly administered or genetically encoded. A promising approach targets regulatory T-cells. We believe that by understanding the methods employed by tumors to evade immune response and neutralizing them, more precise ways of potentiating PDT-induced immunity can be devised.
Distinct colicin M-like bacteriocin-immunity pairs in Burkholderia.
Ghequire, Maarten G K; De Mot, René
2015-11-27
The Escherichia coli bacteriocin colicin M (ColM) acts via degradation of the cell wall precursor lipid II in target cells. ColM producers avoid self-inhibition by a periplasmic immunity protein anchored in the inner membrane. In this study, we identified colM-like bacteriocin genes in genomes of several β-proteobacterial strains belonging to the Burkholderia cepacia complex (Bcc) and the Burkholderia pseudomallei group. Two selected Burkholderia ambifaria proteins, designated burkhocins M1 and M2, were produced recombinantly and showed antagonistic activity against Bcc strains. In their considerably sequence-diverged catalytic domain, a conserved aspartate residue equally proved pivotal for cytotoxicity. Immunity to M-type burkhocins is conferred upon susceptible strains by heterologous expression of a cognate gene located either upstream or downstream of the toxin gene. These genes lack homology with currently known ColM immunity genes and encode inner membrane-associated proteins of two distinct types, differing in predicted transmembrane topology and moiety exposed to the periplasm. The addition of burkhocins to the bacteriocin complement of Burkholderia reveals a wider phylogenetic distribution of ColM-like bacteriotoxins, beyond the γ-proteobacterial genera Escherichia, Pectobacterium and Pseudomonas, and illuminates the diversified nature of immunity-providing proteins.
Mohammed, Rebar N.; Watson, H. Angharad; Vigar, Miriam; Ohme, Julia; Thomson, Amanda; Humphreys, Ian R.; Ager, Ann
2016-01-01
Summary Cytotoxic CD8+ T lymphocytes play a critical role in the host response to infection by viruses. The ability to secrete cytotoxic chemicals and cytokines is considered pivotal for eliminating virus. Of equal importance is how effector CD8+ T cells home to virus-infected tissues. L-selectin has not been considered important for effector T cell homing, because levels are low on activated T cells. We report here that, although L-selectin expression is downregulated following T cell priming in lymph nodes, L-selectin is re-expressed on activated CD8+ T cells entering the bloodstream, and recruitment of activated CD8+ T cells from the bloodstream into virus-infected tissues is L-selectin dependent. Furthermore, L-selectin on effector CD8+ T cells confers protective immunity to two evolutionally distinct viruses, vaccinia and influenza, which infect mucosal and visceral organs, respectively. These results connect homing and a function of virus-specific CD8+ T cells to a single molecule, L-selectin. PMID:26804910
Yang, Victoria C; Rayburn, Maire C; Chigerwe, Munashe
2017-12-01
Plasma administration has been recommended in calves older than 48h with failure of passive immunity (FPI) to provide immunity consistent with adequate colostral ingestion. However, the protective serum immunoglobulin G (IgG) concentrations (≥1000mg/dL) of plasma derived IgG only lasts up to 12h. In addition to IgG, maternally derived colostral cells also confer immunity. The objective of the study was to determine the effect of intravenous plasma transfusion on granulocyte and monocyte oxidative and phagocytic activity in calves with FPI. Twenty-seven, one day-old, Jersey calves were assigned into 3 groups. The colostral (CL, N=9) group received 3L of colostrum once by oroesophageal tubing. Two other groups of calves received 1L of colostrum once by oroesophageal tubing and were assigned based on their health status (sick or non-sick) at 4days of age, as the sick-group (SG, N=7) or the non-sick (NG, N=11) groups. At 4days of age, the SG and NG groups were administered plasma intravenously at 30mL/kg. Granulocyte and monocyte oxidative and phagocytic activity was determined by flow cytometry. There was no significant difference in the granulocyte and monocyte oxidative or phagocytic activity among the 3 groups (P>0.05). Plasma administration had no significant effect on the oxidative or phagocytic activity of granulocytes or monocytes. In clinical practice, plasma administration for enhancing oxidative or phagocytic activity of granulocytes or monocytes, alone, might not be justified in calves with FPI. Copyright © 2017 Elsevier Ltd. All rights reserved.
Molecular mechanisms mediating immune priming in Anopheles gambiae mosquitos
USDA-ARS?s Scientific Manuscript database
The Anopheles gambiae immune priming response is triggered when Plasmodium ookinetes invade the mosquito midgut and the microbiota comes in direct contact with injured cells. This is a long-lasting response that confers the challenged mosquito enhanced ability to control subsequent Plasmodium infect...
Sedlik, C; Dadaglio, G; Saron, M F; Deriaud, E; Rojas, M; Casal, S I; Leclerc, C
2000-07-01
Many approaches are currently being developed to deliver exogenous antigen into the major histocompatibility complex class I-restricted antigen pathway, leading to in vivo priming of CD8(+) cytotoxic T cells. One attractive possibility consists of targeting the antigen to phagocytic or macropinocytic antigen-presenting cells. In this study, we demonstrate that strong CD8(+) class I-restricted cytotoxic responses are induced upon intraperitoneal immunization of mice with different peptides, characterized as CD8(+) T-cell epitopes, bound to 1-microm synthetic latex microspheres and injected in the absence of adjuvant. The cytotoxic response induced against a lymphocytic choriomeningitis virus (LCMV) peptide linked to these microspheres was compared to the cytotoxic T-lymphocyte (CTL) response obtained upon immunization with the nonreplicative porcine parvovirus-like particles (PPV:VLP) carrying the same peptide (PPV:VLP-LCMV) previously described (C. Sedlik, M. F. Saron, J. Sarraseca, I. Casal, and C. Leclerc, Proc. Natl. Acad. Sci. USA 94:7503-7508, 1997). We show that the induction of specific CTL activity by peptides bound to microspheres requires CD4(+) T-cell help in contrast to the CTL response obtained with the peptide delivered by viral pseudoparticles. Furthermore, PPV:VLP are 100-fold more efficient than microspheres in generating a strong CTL response characterized by a high frequency of specific T cells of high avidity. Moreover, PPV:VLP-LCMV are able to protect mice against a lethal LCMV challenge whereas microspheres carrying the LCMV epitope fail to confer such protection. This study demonstrates the crucial involvement of the frequency and avidity of CTLs in conferring antiviral protective immunity and highlights the importance of considering these parameters when developing new vaccine strategies.
Steroid hormone regulation of antiviral immunity.
Padgett, D A; Loria, R M; Sheridan, J F
2000-01-01
Recent observations in both humans and animals have demonstrated that stress is immunomodulatory and can alter the pathogenesis of microbial infections to the extent that it may be adverse to health. Stress disrupts homeostasis, and the body responds through endocrine and nervous system interactions in an effort to re-establish the health of the host. However, the resulting physiologic changes associated with stress, such as the rise in serum glucocorticoids (GCs), are implicated in suppression of antiviral immunity. Therefore, it would be of significance to counterregulate stress-mediated immunosuppression during viral infection to improve immune responses and limit virus-mediated damage. The data in this study focus upon the antiglucocorticoid influence of a native steroid hormone that has been shown to augment immune function and protect animals against lethal viral infections. Androstenediol (5-androstene-3 beta,17 beta-diol, AED), a metabolite of dehydroepiandrosterone (DHEA), confers protection against lethal infection with influenza A virus. The protective activity appears to counterbalance the function of the regulatory GCs because AED prevents GC-mediated suppression of IL-1, TNF-alpha, and IL-2 secretion. Furthermore, AED inhibits GC-induced transcription of a GC-sensitive reporter gene.
Gorantala, Jyotsna; Grover, Sonam; Rahi, Amit; Chaudhary, Prerna; Rajwanshi, Ravi; Sarin, Neera Bhalla; Bhatnagar, Rakesh
2014-04-20
In concern with frequent recurrence of anthrax in endemic areas and inadvertent use of its spores as biological weapon, the development of an effective anthrax vaccine suitable for both human and veterinary needs is highly desirable. A simple oral delivery through expression in plant system could offer promising alternative to the current methods that rely on injectable vaccines extracted from bacterial sources. In the present study, we have expressed protective antigen (PA) gene in Indian mustard by Agrobacterium-mediated transformation and in tobacco by plastid transformation. Putative transgenic lines were verified for the presence of transgene and its expression by molecular analysis. PA expressed in transgenic lines was biologically active as evidenced by macrophage lysis assay. Intraperitoneal (i.p.) and oral immunization with plant PA in murine model indicated high serum PA specific IgG and IgA antibody titers. PA specific mucosal immune response was noted in orally immunized groups. Further, antibodies indicated lethal toxin neutralizing potential in-vitro and conferred protection against in-vivo toxin challenge. Oral immunization experiments demonstrated generation of immunoprotective response in mice. Thus, our study examines the feasibility of oral PA vaccine expressed in an edible plant system against anthrax. Copyright © 2014 Elsevier B.V. All rights reserved.
Host-parasite interactions: Resist or tolerate but never stop running
USDA-ARS?s Scientific Manuscript database
A Conference exploring ‘The impact of the environment on innate immunity: the threat of diseases’ was held 4-9 May 2009 in Obergurgl, Austria, thanks to support from the European Science Foundation (ESF), Innsbruck University and the Austrian Science Foundation. The goals of the conference were to e...
Tabatabaei, M; Mosaffa, N; Ghods, R; Nikoo, S; Kazemnejad, S; Khanmohammadi, M; Mirzadeghan, E; Mahmoudi, A R; Bolouri, M R; Falak, R; Keshavarzi, B; Ramezani, M; Zarnani, A H
2018-04-01
As a prophylactic cancer vaccine, human amniotic membrane epithelial cells (hAECs) conferred effective protection in a murine model of colon cancer. The immunized mice mounted strong cross-protective CTL and antibody responses. Tumor burden was significantly reduced in tumor-bearing mice after immunization with hAECs. Placental cancer immunotherapy could be a promising approach for primary prevention of cancer. In spite of being the star of therapeutic strategies for cancer treatment, the results of immunotherapeutic approaches are still far from expectations. In this regard, primary prevention of cancer using prophylactic cancer vaccines has gained considerable attention. The immunologic similarities between cancer development and placentation have helped researchers to unravel molecular mechanisms responsible for carcinogenesis and to take advantage of stem cells from reproductive organs to elicit robust anti-cancer immune responses. Here, we showed that vaccination of mice with human amniotic membrane epithelial cells (hAECs) conferred effective protection against colon cancer and led to expansion of systemic and splenic cytotoxic T cell population and induction of cross-protective cytotoxic responses against tumor cells. Vaccinated mice mounted tumor-specific Th1 responses and produced cross-reactive antibodies against cell surface markers of cancer cells. Tumor burden was also significantly reduced in tumor-bearing mice immunized with hAECs. Our findings pave the way for potential future application of hAECs as an effective prophylactic cancer vaccine. © 2017 UICC.
Pros and cons of VP1-specific maternal IgG for the protection of Enterovirus 71 infection.
Kim, Young-In; Song, Jae-Hyoung; Kwon, Bo-Eun; Kim, Ha-Neul; Seo, Min-Duk; Park, KwiSung; Lee, SangWon; Yeo, Sang-Gu; Kweon, Mi-Na; Ko, Hyun-Jeong; Chang, Sun-Young
2015-11-27
Enterovirus 71 (EV71) causes hand, foot, and mouth diseases and can result in severe neurological disorders when it infects the central nervous system. Thus, there is a need for the development of effective vaccines against EV71 infection. Here we report that viral capsid protein 1 (VP1), one of the main capsid proteins of EV71, efficiently elicited VP1-specific immunoglobulin G (IgG) in the serum of mice immunized with recombinant VP1. The VP1-specific IgG produced in female mice was efficiently transferred to their offspring, conferring protection against EV71 infection immediately after birth. VP1-specific antibody can neutralize EV71 infection and protect host cells. VP1-specific maternal IgG in offspring was maintained for over 6 months. However, the pre-existence of VP1-specific maternal IgG interfered with the production of VP1-specific IgG antibody secreting cells by active immunization in offspring. Therefore, although our results showed the potential for VP1-specific maternal IgG protection against EV71 in neonatal mice, other strategies must be developed to overcome the hindrance of maternal IgG in active immunization. In this study, we developed an effective and feasible animal model to evaluate the protective efficacy of humoral immunity against EV71 infection using a maternal immunity concept. Copyright © 2015 Elsevier Ltd. All rights reserved.
Singh, Amit Kumar; Kingston, Joseph Jeyabalaji; Murali, Harishchandra Sripathy; Batra, Harsh Vardhan
2014-03-05
In the present study, a bivalent chimeric protein rVE comprising immunologically active domains of Yersinia pestis LcrV and YopE was assessed for its prophylactic abilities against Yersinia enterocolitica O:8 infection in murine model. Mice immunized with rVE elicited significantly higher antibody titers with substantial contribution from the rV component (3:1 ratio). Robust and significant resistance to Y. enterocolitica infection with 100% survival (P<0.001) was seen in rVE vaccinated mice when intra peritoneal (I.P.) challenged with 10(8)CFU of Y. enterocolitica O:8 against the 75%, 60% and 75% survival seen in mice immunized with rV, rE, rV+rE, respectively. Macrophage monolayer supplemented with anti-rVE polysera illustrated efficient protection (89.41% survival) against challenge of Y. enterocolitica O:8. In contrast to sera from sham-immunized mice, immunization with anti-rVE polysera provided complete protection to BALB/c mice against I.P. challenge with 10(8)CFU of Y. enterocolitica O:8 and developed no conspicuous signs of infection in necropsy. The histopathological analysis of microtome sections confirmed significantly reduced lesion size or no lesion in liver and intestine upon infection in anti-rVE immunized mice. The findings from this study demonstrated the fusion protein rVE as a potential candidate subunit vaccine and showed the functional role of antibodies in protection against Y. enterocolitica infections. Copyright © 2014 Elsevier Ltd. All rights reserved.
Li, Xiao-Feng; Dong, Hao-Long; Wang, Hong-Jiang; Huang, Xing-Yao; Qiu, Ye-Feng; Ji, Xue; Ye, Qing; Li, Chunfeng; Liu, Yang; Deng, Yong-Qiang; Jiang, Tao; Cheng, Gong; Zhang, Fu-Chun; Davidson, Andrew D; Song, Ya-Jun; Shi, Pei-Yong; Qin, Cheng-Feng
2018-02-14
The global spread of Zika virus (ZIKV) and its unexpected association with congenital defects necessitates the rapid development of a safe and effective vaccine. Here we report the development and characterization of a recombinant chimeric ZIKV vaccine candidate (termed ChinZIKV) that expresses the prM-E proteins of ZIKV using the licensed Japanese encephalitis live-attenuated vaccine SA14-14-2 as the genetic backbone. ChinZIKV retains its replication activity and genetic stability in vitro, while exhibiting an attenuation phenotype in multiple animal models. Remarkably, immunization of mice and rhesus macaques with a single dose of ChinZIKV elicits robust and long-lasting immune responses, and confers complete protection against ZIKV challenge. Significantly, female mice immunized with ChinZIKV are protected against placental and fetal damage upon ZIKV challenge during pregnancy. Overall, our study provides an alternative vaccine platform in response to the ZIKV emergency, and the safety, immunogenicity, and protection profiles of ChinZIKV warrant further clinical development.
Dynamics of adaptive immunity against phage in bacterial populations
NASA Astrophysics Data System (ADS)
Bradde, Serena; Vucelja, Marija; Tesileanu, Tiberiu; Balasubramanian, Vijay
The CRISPR (clustered regularly interspaced short palindromic repeats) mechanism allows bacteria to adaptively defend against phages by acquiring short genomic sequences (spacers) that target specific sequences in the viral genome. We propose a population dynamical model where immunity can be both acquired and lost. The model predicts regimes where bacterial and phage populations can co-exist, others where the populations oscillate, and still others where one population is driven to extinction. Our model considers two key parameters: (1) ease of acquisition and (2) spacer effectiveness in conferring immunity. Analytical calculations and numerical simulations show that if spacers differ mainly in ease of acquisition, or if the probability of acquiring them is sufficiently high, bacteria develop a diverse population of spacers. On the other hand, if spacers differ mainly in their effectiveness, their final distribution will be highly peaked, akin to a ``winner-take-all'' scenario, leading to a specialized spacer distribution. Bacteria can interpolate between these limiting behaviors by actively tuning their overall acquisition rate.
Mechanisms of Cross-protection by Influenza Virus M2-based Vaccines.
Lee, Yu-Na; Kim, Min-Chul; Lee, Young-Tae; Kim, Yu-Jin; Kang, Sang-Moo
2015-10-01
Current influenza virus vaccines are based on strain-specific surface glycoprotein hemagglutinin (HA) antigens and effective only when the predicted vaccine strains and circulating viruses are well-matched. The current strategy of influenza vaccination does not prevent the pandemic outbreaks and protection efficacy is reduced or ineffective if mutant strains emerge. It is of high priority to develop effective vaccines and vaccination strategies conferring a broad range of cross protection. The extracellular domain of M2 (M2e) is highly conserved among human influenza A viruses and has been utilized to develop new vaccines inducing cross protection against different subtypes of influenza A virus. However, immune mechanisms of cross protection by M2e-based vaccines still remain to be fully elucidated. Here, we review immune correlates and mechanisms conferring cross protection by M2e-based vaccines. Molecular and cellular immune components that are known to be involved in M2 immune-mediated protection include antibodies, B cells, T cells, alveolar macrophages, Fc receptors, complements, and natural killer cells. Better understanding of protective mechanisms by immune responses induced by M2e vaccination will help facilitate development of broadly cross protective vaccines against influenza A virus.
Leukotriene B4-loaded microspheres: a new therapeutic strategy to modulate cell activation
Nicolete, Roberto; Rius, Cristina; Piqueras, Laura; Jose, Peter J; Sorgi, Carlos A; Soares, Edson G; Sanz, Maria J; Faccioli, Lúcia H
2008-01-01
Background Leukotriene B4 (LTB4) is a potent inflammatory mediator that also stimulates the immune response. In addition, it promotes polymorphonuclear leukocyte phagocytosis, chemotaxis, chemokinesis and modulates cytokines release. Regarding chemical instability of the leukotriene molecule, in the present study we assessed the immunomodulatory activities conferred by LTB4 released from microspheres (MS). A previous oil-in-water emulsion solvent extraction-evaporation method was chosen to prepare LTB4-loaded MS. Results In the mice cremasteric microcirculation, intraescrotal injection of 0.1 ml of LTB4-loaded MS provoked significant increases in leukocyte rolling flux, adhesion and emigration besides significant decreases in the leukocyte rolling velocity. LTB4-loaded MS also increase peroxisome proliferator-activated receptor-α (PPARα) expression by murine peritoneal macrophages and stimulate them to generate nitrite levels. Monocyte chemoattractant protein-1 (MCP-1) and nitric oxide (NO) productions were also increased when human umbilical vein and artery endothelial cells (HUVECs and HUAECs, respectively) were stimulated with LTB4-loaded MS. Conclusion LTB4-loaded MS preserve the biological activity of the encapsulated mediator indicating their use as a new strategy to modulate cell activation, especially in the innate immune response. PMID:18627613
Maes, Michael; Nowak, Gabriel; Caso, Javier R; Leza, Juan Carlos; Song, Cai; Kubera, Marta; Klein, Hans; Galecki, Piotr; Noto, Cristiano; Glaab, Enrico; Balling, Rudi; Berk, Michael
2016-07-01
Meta-analyses confirm that depression is accompanied by signs of inflammation including increased levels of acute phase proteins, e.g., C-reactive protein, and pro-inflammatory cytokines, e.g., interleukin-6. Supporting the translational significance of this, a meta-analysis showed that anti-inflammatory drugs may have antidepressant effects. Here, we argue that inflammation and depression research needs to get onto a new track. Firstly, the choice of inflammatory biomarkers in depression research was often too selective and did not consider the broader pathways. Secondly, although mild inflammatory responses are present in depression, other immune-related pathways cannot be disregarded as new drug targets, e.g., activation of cell-mediated immunity, oxidative and nitrosative stress (O&NS) pathways, autoimmune responses, bacterial translocation, and activation of the toll-like receptor and neuroprogressive pathways. Thirdly, anti-inflammatory treatments are sometimes used without full understanding of their effects on the broader pathways underpinning depression. Since many of the activated immune-inflammatory pathways in depression actually confer protection against an overzealous inflammatory response, targeting these pathways may result in unpredictable and unwanted results. Furthermore, this paper discusses the required improvements in research strategy, i.e., path and drug discovery processes, omics-based techniques, and systems biomedicine methodologies. Firstly, novel methods should be employed to examine the intracellular networks that control and modulate the immune, O&NS and neuroprogressive pathways using omics-based assays, including genomics, transcriptomics, proteomics, metabolomics, epigenomics, immunoproteomics and metagenomics. Secondly, systems biomedicine analyses are essential to unravel the complex interactions between these cellular networks, pathways, and the multifactorial trigger factors and to delineate new drug targets in the cellular networks or pathways. Drug discovery processes should delineate new drugs targeting the intracellular networks and immune-related pathways.
Flynn, J N; Cannon, C A; Neil, J C; Jarrett, O
1997-01-01
Cats were immunized with a 46-residue multiepitopic synthetic peptide of feline immunodeficiency virus (FIV) comprising immunodominant epitopes present in the third variable domain of the envelope glycoprotein, transmembrane glycoprotein (TM), and p24 Gag core protein, using Quil A as an adjuvant. All vaccinated cats developed a humoral response which recognized the synthetic peptide immunogen and the intact viral core and envelope proteins. A FIV Gag- and Env-specific effector cytotoxic T-lymphocyte response was also detected in the peripheral blood of vaccinated cats, which peaked at week 30. This response appeared to be major histocompatibility complex restricted. Epitope mapping studies revealed that both the cellular and humoral immune responses were directed principally to a peptide within the TM glycoprotein, CNQNQFFCK. However, vaccination did not confer protection when cats were challenged with the Petaluma isolate of FIV at week 35. PMID:9311839
Coming of Age: CD96 Emerges as Modulator of Immune Responses.
Georgiev, Hristo; Ravens, Inga; Papadogianni, Georgia; Bernhardt, Günter
2018-01-01
CD96 represents a type I transmembrane glycoprotein belonging to the immunoglobulin superfamily. CD96 is expressed mainly by cells of hematopoietic origin, in particular on T and NK cells. Upon interaction with CD155 present on target cells, CD96 was found to inhibit mouse NK cells, and absence of this interaction either by blocking with antibody or knockout of CD96 showed profound beneficial effects in containment of tumors and metastatic spread in murine model systems. However, our knowledge regarding CD96 functions remains fragmentary. In this review, we will discuss structural features of CD96 and their putative impact on function as well as some unresolved issues such as a potential activation that may be conferred by human but not mouse CD96. This is of importance for translation into human cancer therapy. We will also address CD96 activities in the context of the immune regulatory network that consists of CD155, CD96, CD226, and TIGIT.
Reconstitution and structure of a bacterial Pnkp1RnlHen1 RNA repair complex
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Pei; Selvadurai, Kiruthika; Huang, Raven H.
Ribotoxins cleave essential RNAs for cell killing, and RNA repair neutralizes the damage inflicted by ribotoxins for cell survival. We report a new bacterial RNA repair complex that performs RNA repair linked to immunity. This new RNA repair complex is a 270-kDa heterohexamer composed of three proteins—Pnkp1, Rnl and Hen1—that are required to repair ribotoxin-cleaved RNA in vitro. The crystal structure of the complex reveals the molecular architecture of the heterohexamer as two rhomboid-shaped ring structures of Pnkp1–Rnl–Hen1 heterotrimer fused at the Pnkp1 dimer interface. The four active sites required for RNA repair are located on the inner rim ofmore » each ring. Furthermore, the architecture and the locations of the active sites of the Pnkp1–Rnl–Hen1 heterohexamer suggest an ordered series of repair reactions at the broken RNA ends that confer immunity to recurrent damage.« less
Jawale, Chetan V.
2014-01-01
The Escherichia coli heat-labile enterotoxin B subunit (LTB) is a potent vaccine adjuvant. Salmonella enterica serovar Enteritidis ghosts carrying LTB (S. Enteritidis-LTB ghosts) were genetically constructed using a novel plasmid, pJHL187-LTB, designed for the coexpression of the LTB and E lysis proteins. S. Enteritidis-LTB ghosts were characterized using scanning electron microscopy to visualize their transmembrane tunnel structures. The expression of LTB in S. Enteritidis-LTB ghost preparations was confirmed by immunoblot and enzyme-linked immunosorbent assays. The parenteral adjuvant activity of LTB was demonstrated by immunizing chickens with either S. Enteritidis-LTB ghosts or S. Enteritidis ghosts. Chickens were intramuscularly primed at 5 weeks of age and subsequently boosted at 8 weeks of age. In total, 60 chickens were equally divided into three groups (n = 20 for each): group A, nonvaccinated control; group B, immunized with S. Enteritidis-LTB ghosts; and group C, immunized with S. Enteritidis ghosts. Compared with the nonimmunized chickens (group A), the immunized chickens (groups B and C) exhibited increased titers of plasma IgG and intestinal secretory IgA antibodies. The CD3+ CD4+ subpopulation of T cells was also significantly increased in both immunized groups. Among the immunized chickens, those in group B exhibited significantly increased titers of specific plasma IgG and intestinal secretory IgA (sIgA) antibodies compared with those in group C, indicating the immunomodulatory effects of the LTB adjuvant. Furthermore, both immunized groups exhibited decreased bacterial loads in their feces and internal organs. These results indicate that parenteral immunization with S. Enteritidis-LTB ghosts can stimulate superior induction of systemic and mucosal immune responses compared to immunization with S. Enteritidis ghosts alone, thus conferring efficient protection against salmonellosis. PMID:24671556
ERIC Educational Resources Information Center
Visser, Adriaan
1997-01-01
Reports on the third Dead Sea Conference, stressing the importance of the human self-healing potential. Integrative theoretical models, integrative techniques, and workshops presented at the conference are reviewed. Presentations on cancer and immunology are reviewed. A need remains for education, counseling, and research integrating these…
Mutnal, Manohar B; Schachtele, Scott J; Hu, Shuxian; Lokensgard, James R
2013-07-31
Highly active antiretroviral therapy (HAART) restores inflammatory immune responses in AIDS patients which may unmask previous subclinical infections or paradoxically exacerbate symptoms of opportunistic infections. In resource-poor settings, 25% of patients receiving HAART may develop CNS-related immune reconstitution inflammatory syndrome (IRIS). Here we describe a reliable mouse model to study underlying immunopathological mechanisms of CNS-IRIS. Utilizing our HSV brain infection model and mice with MAIDS, we investigated the effect of immune reconstitution on MAIDS mice harboring opportunistic viral brain infection. Using multi-color flow cytometry, we quantitatively measured the cellular infiltrate and microglial activation. Infection with the LP-BM5 retroviral mixture was found to confer susceptibility to herpes simplex virus (HSV)-1 brain infection to normally-resistant C57BL/6 mice. Increased susceptibility to brain infection was due to severe immunodeficiency at 8 wks p.i. and a marked increase in programmed death-1 (PD-1) expression on CD4+ and CD8+ T-cells. Both T-cell loss and opportunistic brain infection were associated with high level PD-1 expression because PD-1-knockout mice infected with LP-BM5 did not exhibit lymphopenia and retained resistance to HSV-1. In addition, HSV-infection of MAIDS mice stimulated peripheral immune cell infiltration into the brain and its ensuing microglial activation. Interestingly, while opportunistic herpes virus brain infection of C57BL/6 MAIDS mice was not itself lethal, when T-cell immunity was reconstituted through adoptive transfer of virus-specific CD3+ T-cells, it resulted in significant mortality among recipients. This immune reconstitution-induced mortality was associated with exacerbated neuroinflammation, as determined by MHC class II expression on resident microglia and elevated levels of Th1 cytokines in the brain. Taken together, these results indicate development of an immune reconstitution disease within the central nervous system (CNS-IRD). Experimental immune reconstitution disease of the CNS using T-cell repopulation of lymphopenic murine hosts harboring opportunistic brain infections may help elucidate neuroimmunoregulatory networks that produce CNS-IRIS in patients initiating HAART.
Chern, Mawsheng; Xu, Qiufang; Bart, Rebecca S; Bai, Wei; Ruan, Deling; Sze-To, Wing Hoi; Canlas, Patrick E; Jain, Rashmi; Chen, Xuewei; Ronald, Pamela C
2016-05-01
Systemic acquired resistance, mediated by the Arabidopsis NPR1 gene and the rice NH1 gene, confers broad-spectrum immunity to diverse pathogens. NPR1 and NH1 interact with TGA transcription factors to activate downstream defense genes. Despite the importance of this defense response, the signaling components downstream of NPR1/NH1 and TGA proteins are poorly defined. Here we report the identification of a rice mutant, snim1, which suppresses NH1-mediated immunity and demonstrate that two genes encoding previously uncharacterized cysteine-rich-receptor-like kinases (CRK6 and CRK10), complement the snim1 mutant phenotype. Silencing of CRK6 and CRK10 genes individually in the parental genetic background recreates the snim1 phenotype. We identified a rice mutant in the Kitaake genetic background with a frameshift mutation in crk10; this mutant also displays a compromised immune response highlighting the important role of crk10. We also show that elevated levels of NH1 expression lead to enhanced CRK10 expression and that the rice TGA2.1 protein binds to the CRK10 promoter. These experiments demonstrate a requirement for CRKs in NH1-mediated immunity and establish a molecular link between NH1 and induction of CRK10 expression.
The molecular basis of bacterial-insect symbiosis.
Douglas, Angela E
2014-11-25
Insects provide experimentally tractable and cost-effective model systems to investigate the molecular basis of animal-bacterial interactions. Recent research is revealing the central role of the insect innate immune system, especially anti-microbial peptides and reactive oxygen species, in regulating the abundance and composition of the microbiota in various insects, including Drosophila and the mosquitoes Aedes and Anopheles. Interactions between the immune system and microbiota are, however, bidirectional with evidence that members of the resident microbiota can promote immune function, conferring resistance to pathogens and parasites by both activation of immune effectors and production of toxins. Antagonistic and mutualistic interactions among bacteria have also been implicated as determinants of the microbiota composition, including exclusion of pathogens, but the molecular mechanisms are largely unknown. Some bacteria are crucial for insect nutrition, through provisioning of specific nutrients (e.g., B vitamins, essential amino acids) and modulation of the insect nutritional sensing and signaling pathways (e.g., insulin signaling) that regulate nutrient allocation, especially to lipid and other energy reserves. A key challenge for future research is to identify the molecular interaction between specific bacterial effectors and animal receptors, as well as to determine how these interactions translate into microbiota-dependent signaling, metabolism, and immune function in the host. Copyright © 2014. Published by Elsevier Ltd.
Kongsgaard, Michael; Bassi, Maria R; Rasmussen, Michael; Skjødt, Karsten; Thybo, Søren; Gabriel, Mette; Hansen, Morten Bagge; Christensen, Jan Pravsgaard; Thomsen, Allan Randrup; Buus, Soren; Stryhn, Anette
2017-04-06
Outbreaks of Yellow Fever occur regularly in endemic areas of Africa and South America frequently leading to mass vaccination campaigns straining the availability of the attenuated Yellow Fever vaccine, YF-17D. The WHO has recently decided to discontinue regular booster-vaccinations since a single vaccination is deemed to confer life-long immune protection. Here, we have examined humoral (neutralizing antibody) and cellular (CD8 and CD4 T cell) immune responses in primary and booster vaccinees (the latter spanning 8 to 36 years after primary vaccination). After primary vaccination, we observed strong cellular immune responses with T cell activation peaking ≈2 weeks and subsiding to background levels ≈ 4 weeks post-vaccination. The number of antigen-specific CD8+ T cells declined over the following years. In >90% of vaccinees, in vitro expandable T cells could still be detected >10 years post-vaccination. Although most vaccinees responded to a booster vaccination, both the humoral and cellular immune responses observed following booster vaccination were strikingly reduced compared to primary responses. This suggests that pre-existing immunity efficiently controls booster inoculums of YF-17D. In a situation with epidemic outbreaks, one could argue that a more efficient use of a limited supply of the vaccine would be to focus on primary vaccinations.
A humoral immune response confers protection against Haemophilus ducreyi infection.
Cole, Leah E; Toffer, Kristen L; Fulcher, Robert A; San Mateo, Lani R; Orndorff, Paul E; Kawula, Thomas H
2003-12-01
Haemophilus ducreyi is the etiologic agent of the sexually transmitted genital ulcer disease chancroid. Neither naturally occurring chancroid nor experimental infection with H. ducreyi results in protective immunity. Likewise, a single inoculation of H. ducreyi does not protect pigs against subsequent infection. Accordingly, we used the swine model of chancroid infection to examine the impact of multiple inoculations on a host's immune response. After three successive inoculations with H. ducreyi, pigs developed a modestly protective immune response evidenced by the decreased recovery of viable bacteria from lesions. All lesions biopsied 2 days after the first and second inoculations contained viable H. ducreyi cells, yet only 55% of the lesions biopsied 2 days after the third inoculation did. Nearly 90% of the lesions biopsied 7 days after the first inoculation contained viable H. ducreyi cells, but this percentage dropped to only 16% after the third inoculation. Between the first and third inoculations, the average recovery of CFU from lesions decreased approximately 100-fold. The reduced recovery of bacteria corresponded directly with a fivefold increase in H. ducreyi-specific antibody titers and the emergence of bactericidal activity. These immune sera were protective when administered to naïve pigs prior to challenge with H. ducreyi. These data suggest that pigs mount an effective humoral immune response to H. ducreyi after multiple exposures to the organism.
The Meninges: New Therapeutic Targets For Multiple Sclerosis
Russi, Abigail E.; Brown, Melissa A.
2014-01-01
The CNS is largely comprised of non-regenerating cells, including neurons and myelin-producing oligodendrocytes, which are particularly vulnerable to immune cell mediated damage. To protect the CNS, mechanisms exist that normally restrict the transit of peripheral immune cells into the brain and spinal cord, conferring an “immune specialized” status. Thus, there has been a long-standing debate as to how these restrictions are overcome in several inflammatory diseases of the CNS, including multiple sclerosis (MS). In this review, we highlight the role of the meninges, tissues that surround and protect the CNS and enclose the cerebral spinal fluid, in promoting chronic inflammation that leads to neuronal damage. Although the meninges have traditionally been considered structures that provide physical protection for the brain and spinal cord, new data has established these tissues as sites of active immunity. It has been hypothesized that the meninges are important players in normal immunosurveillance of the CNS but also serve as initial sites of anti-myelin immune responses. The resulting robust meningeal inflammation elicits loss of localized blood barrier integrity and facilitates a large-scale influx of immune cells into the CNS parenchyma. We propose that targeting of the cells and molecules mediating these inflammatory responses within the meninges offers promising therapies for MS that are free from the constraints imposed by the blood brain barrier. Importantly, such therapies may avoid the systemic immunosuppression often associated with the existing treatments. PMID:25241937
New frontiers in pediatric allogeneic stem cell transplantation
Talano, Julie-An M.; Pulsipher, Michael A.; Symons, Heather J.; Militano, Olga; Shereck, Evan B.; Giller, Roger H.; Hancock, Laura; Morris, Erin; Cairo, Mitchell S.
2015-01-01
The inaugural meeting of “New Frontiers in Pediatric Allogeneic Stem Cell Transplantation” organized by the Pediatric Blood and Transplant Consortium (PBMTC) was held at the American Society of Pediatric Hematology and Oncology Annual Meeting. This meeting provided an international platform for physicians and investigators active in the research and utilization of pediatric allogeneic stem cell transplantation (AlloSCT) in children and adolescents with malignant and non-malignant disease, to share information and develop future collaborative strategies. The primary objectives of the conference included: 1) to present advances in AlloSCT in pediatric ALL and novel pre- and post-immunotherapy; 2) to highlight new strategies in alternative allogeneic stem cell donor sources for children and adolescents with non-malignant hematological disorders; 3) to discuss timing of immune reconstitution after AlloSCT and methods of facilitating more rapid recovery of immunity; 4) to identify strategies of utilizing AlloSCT in pediatric myeloproliferative disorders (MPD); 5) to develop diagnostic and therapeutic approaches to hematological complications post pediatric AlloSCT; 6) to enhance the understanding of new novel cellular therapeutic approaches to pediatric malignant and non-malignant hematological disorders; and 7) to discuss optimizing drug therapy in pediatric recipients of AlloSCT. This paper will provide a brief overview of the conference. PMID:24820213
Schworer, Stephen A.; Smirnova, Irina I.; Kurbatova, Irina; Bagina, Uliana; Churova, Maria; Fowler, Trent; Roy, Ananda L.; Degterev, Alexei; Poltorak, Alexander
2014-01-01
Pathogen recognition by the innate immune system initiates the production of proinflammatory cytokines but can also lead to programmed host cell death. Necroptosis, a caspase-independent cell death pathway, can contribute to the host defense against pathogens or cause damage to host tissues. Receptor-interacting protein (RIP1) is a serine/threonine kinase that integrates inflammatory and necroptotic responses. To investigate the mechanisms of RIP1-mediated activation of immune cells, we established a genetic screen on the basis of RIP1-mediated necroptosis in wild-derived MOLF/EiJ mice, which diverged from classical laboratory mice over a million years ago. When compared with C57BL/6, MOLF/EiJ macrophages were resistant to RIP1-mediated necroptosis induced by Toll-like receptors. Using a forward genetic approach in a backcross panel of mice, we identified cylindromatosis (CYLD), a deubiquitinase known to act directly on RIP1 and promote necroptosis in TNF receptor signaling, as the gene conferring the trait. We demonstrate that CYLD is required for Toll-like receptor-induced necroptosis and describe a novel mechanism by which CYLD is down-regulated at the transcriptional level in MOLF/EiJ macrophages to confer protection from necroptosis. PMID:24706750
Davicino, Roberto C; Méndez-Huergo, Santiago P; Eliçabe, Ricardo J; Stupirski, Juan C; Autenrieth, Ingo; Di Genaro, María S; Rabinovich, Gabriel A
2017-08-15
Yersinia enterocolitica is an enteropathogenic bacterium that causes gastrointestinal disorders, as well as extraintestinal manifestations. To subvert the host's immune response, Y. enterocolitica uses a type III secretion system consisting of an injectisome and effector proteins, called Yersinia outer proteins (Yops), that modulate activation, signaling, and survival of immune cells. In this article, we show that galectin-1 (Gal-1), an immunoregulatory lectin widely expressed in mucosal tissues, contributes to Y. enterocolitica pathogenicity by undermining protective antibacterial responses. We found higher expression of Gal-1 in the spleen and Peyer's patches of mice infected orogastrically with Y. enterocolitica serotype O:8 compared with noninfected hosts. This effect was prevented when mice were infected with Y. enterocolitica lacking YopP or YopH, two critical effectors involved in bacterial immune evasion. Consistent with a regulatory role for this lectin during Y. enterocolitica pathogenesis, mice lacking Gal-1 showed increased weight and survival, lower bacterial load, and attenuated intestinal pathology compared with wild-type mice. These protective effects involved modulation of NF-κB activation, TNF production, and NO synthesis in mucosal tissue and macrophages, as well as systemic dysregulation of IL-17 and IFN-γ responses. In vivo neutralization of these proinflammatory cytokines impaired bacterial clearance and eliminated host protection conferred by Gal-1 deficiency. Finally, supplementation of recombinant Gal-1 in mice lacking Gal-1 or treatment of wild-type mice with a neutralizing anti-Gal-1 mAb confirmed the immune inhibitory role of this endogenous lectin during Y. enterocolitica infection. Thus, targeting Gal-1-glycan interactions may contribute to reinforce antibacterial responses by reprogramming innate and adaptive immune mechanisms. Copyright © 2017 by The American Association of Immunologists, Inc.
Amiel, Eyal; Lovewell, Rustin R; O'Toole, George A; Hogan, Deborah A; Berwin, Brent
2010-07-01
Pseudomonas aeruginosa is a pathogenic Gram-negative bacterium that causes severe opportunistic infections in immunocompromised individuals; in particular, severity of infection with P. aeruginosa positively correlates with poor prognosis in cystic fibrosis (CF) patients. Establishment of chronic infection by this pathogen is associated with downregulation of flagellar expression and of other genes that regulate P. aeruginosa motility. The current paradigm is that loss of flagellar expression enables immune evasion by the bacteria due to loss of engagement by phagocytic receptors that recognize flagellar components and loss of immune activation through flagellin-mediated Toll-like receptor (TLR) signaling. In this work, we employ bacterial and mammalian genetic approaches to demonstrate that loss of motility, not the loss of the flagellum per se, is the critical factor in the development of resistance to phagocytosis by P. aeruginosa. We demonstrate that isogenic P. aeruginosa mutants deficient in flagellar function, but retaining an intact flagellum, are highly resistant to phagocytosis by both murine and human phagocytic cells at levels comparable to those of flagellum-deficient mutants. Furthermore, we show that loss of MyD88 signaling in murine phagocytes does not recapitulate the phagocytic deficit observed for either flagellum-deficient or motility-deficient P. aeruginosa mutants. Our data demonstrate that loss of bacterial motility confers a dramatic resistance to phagocytosis that is independent of both flagellar expression and TLR signaling. These findings provide an explanation for the well-documented observation of nonmotility in clinical P. aeruginosa isolates and for how this phenotype confers upon the bacteria an advantage in the context of immune evasion.
Magnus, Tim; Schreiner, Bettina; Korn, Thomas; Jack, Carolyn; Guo, Hong; Antel, Jack; Ifergan, Igal; Chen, Lieping; Bischof, Felix; Bar-Or, Amit; Wiendl, Heinz
2005-03-09
Inflammation of the CNS is usually locally limited to avoid devastating consequences. Critical players involved in this immune regulatory process are the resident immune cells of the brain, the microglia. Interactions between the growing family of B7 costimulatory ligands and their receptors are increasingly recognized as important pathways for costimulation and/or inhibition of immune responses. Human and mouse microglial cells constitutively express B7 homolog 1 (B7-H1) in vitro. However, under inflammatory conditions [presence of interferon-gamma (IFN-gamma) or T-helper 1 supernatants], a significant upregulation of B7-H1 was detectable. Expression levels of B7-H1 protein on microglial cells were substantially higher compared with astrocytes or splenocytes. Coculture experiments of major histocompatibility complex class II-positive antigen-presenting cells (APC) with syngeneic T cells in the presence of antigen demonstrated the functional consequences of B7-H1 expression on T-cell activation. In the presence of a neutralizing anti-B7-H1 antibody, both the production of inflammatory cytokines (IFN-gamma and interleukin-2) and the upregulation of activation markers (inducible costimulatory signal) by T cells were markedly enhanced. Interestingly, this effect was clearly more pronounced when microglial cells were used as APC, compared with astrocytes or splenocytes. Furthermore, B7-H1 was highly upregulated during the course of myelin oligodendrocyte glycoprotein-induced and proteolipid protein-induced experimental allergic encephalomyelitis in vivo. Expression was predominantly localized to areas of strongest inflammation and could be colocalized with microglial cells/macrophages as well as T cells. Together, our data propose microglial B7-H1 as an important immune inhibitory molecule capable of downregulating T-cell activation in the CNS and thus confining immunopathological damage.
The Ying and Yang of STAT3 in Human Disease.
Vogel, Tiphanie P; Milner, Joshua D; Cooper, Megan A
2015-10-01
The transcription factor signal transducer and activator of transcription 3 (STAT3) is a critical regulator of multiple, diverse cellular processes. Heterozgyous, germline, loss-of-function mutations in STAT3 lead to the primary immune deficiency Hyper-IgE syndrome. Heterozygous, somatic, gain-of-function mutations in STAT3 have been reported in malignancy. Recently, germline, heterozygous mutations in STAT3 that confer a gain-of-function have been discovered and result in early-onset, multi-organ autoimmunity. This review summarizes what is known about the role of STAT3 in human disease.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chern, Mawsheng; Xu, Qiufang; Bart, Rebecca S.
Systemic acquired resistance, mediated by the Arabidopsis NPR1 gene and the rice NH1 gene, confers broad-spectrum immunity to diverse pathogens. NPR1 and NH1 interact with TGA transcription factors to activate downstream defense genes. Despite the importance of this defense response, the signaling components downstream of NPR1/NH1 and TGA proteins are poorly defined. Here we report the identification of a rice mutant, snim1, which suppresses NH1-mediated immunity and demonstrate that two genes encoding previously uncharacterized cysteine-rich-receptor-like kinases ( CRK6 and CRK10), complement the snim1 mutant phenotype. Silencing of CRK6 and CRK10 genes individually in the parental genetic background recreates the snim1more » phenotype. We identified a rice mutant in the Kitaake genetic background with a frameshift mutation in crk10; this mutant also displays a compromised immune response highlighting the important role of crk10. We also show that elevated levels of NH1 expression lead to enhanced CRK10 expression and that the rice TGA2.1 protein binds to the CRK10 promoter. Furthermore, these experiments demonstrate a requirement for CRKs in NH1-mediated immunity and establish a molecular link between NH1 and induction of CRK10 expression.« less
Lee, Yu-Na; Lee, Young-Tae; Kim, Min-Chul; Gewirtz, Andrew T.; Kang, Sang-Moo
2016-01-01
The currently used vaccine strategy to combat influenza A virus (IAV) aims to provide highly specific immunity to circulating seasonal IAV strains. However, the outbreak of 2009 influenza pandemic highlights the danger in this strategy. Here, we tested the hypothesis that universal vaccination that offers broader but weaker protection would result in cross protective T-cell responses after primary IAV infection, which would subsequently provide protective immunity against future pandemic strains. Specifically, we used tandem repeat M2e epitopes on virus-like particles (M2e5x VLP) that induced heterosubtypic immunity by eliciting antibodies to a conserved M2e epitope. M2e5x VLP was found to be superior to strain-specific current split vaccine in conferring heterosubtypic cross protection and in equipping the host with cross-protective lung-resident nucleoprotein-specific memory CD8+ T cell responses to a subsequent secondary infection with a new pandemic potential strain. Immune correlates for subsequent heterosubtypic immunity by M2e5x VLP vaccination were found to be virus-specific CD8+ T cells secreting IFN-γ and expressing lung-resident memory phenotypic markers CD69+ and CD103+ as well as M2e antibodies. Hence, vaccination with M2e5x VLP may be developable as a new strategy to combat future pandemic outbreaks. PMID:26864033
Chang, Yi-Hsuan; Yan, Hao-Zhi; Liou, Ruey-Fen
2015-02-01
The interaction between Phytophthora pathogens and host plants involves the exchange of complex molecular signals from both sides. Recent studies of Phytophthora have led to the identification of various apoplastic elicitors known to trigger plant immunity. Here, we provide evidence that the protein encoded by OPEL of Phytophthora parasitica is a novel elicitor. Homologues of OPEL were identified only in oomycetes, but not in fungi and other organisms. Quantitative reverse transcription-polymerase chain reaction (RT-PCR) revealed that OPEL is expressed throughout the development of P. parasitica and is especially highly induced after plant infection. Infiltration of OPEL recombinant protein from Escherichia coli into leaves of Nicotiana tabacum (cv. Samsun NN) resulted in cell death, callose deposition, the production of reactive oxygen species and induced expression of pathogen-associated molecular pattern (PAMP)-triggered immunity markers and salicylic acid-responsive defence genes. Moreover, the infiltration conferred systemic resistance against a broad spectrum of pathogens, including Tobacco mosaic virus, the bacteria wilt pathogen Ralstonia solanacearum and P. parasitica. In addition to the signal peptide, OPEL contains three conserved domains: a thaumatin-like domain, a glycine-rich protein domain and a glycosyl hydrolase (GH) domain. Intriguingly, mutation of a putative laminarinase active site motif in the predicted GH domain abolished its elicitor activity, which suggests enzymatic activity of OPEL in triggering the defence response. © 2014 BSPP AND JOHN WILEY & SONS LTD.
Guo, Jingjing; Sun, Xiahui; Yin, Huiquan; Wang, Ting; Li, Yan; Zhou, Chunxue; Zhou, Huaiyu; He, Shenyi; Cong, Hua
2018-01-01
Multiple antigenic peptide (MAP) vaccines have advantages over traditional Toxoplasma gondii vaccines, but are more susceptible to enzymatic degradation. As an effective delivery system, chitosan microspheres (CS) can overcome this obstacle and act as a natural adjuvant to promote T helper 1 (Th1) cellular immune responses. In this study, we use chitosan microparticles to deliver multiple antigenic epitopes from GRA10 (G10E), containing three dominant epitopes. When G10E was entrapped within chitosan microparticles (G10E-CS), adequate peptides for eliciting immune response were loaded in the microsphere core and this complex released G10E peptides stably. The efficiency of G10E-CS was detected both in vitro , via cell culture, and through in vivo mouse immunization. In vitro , G10E-CS activated Dendritic Cells (DC) and T lymphocytes by upregulating the secretion of costimulatory molecules (CD40 and CD86). In vivo , Th1 biased cellular and humoral immune responses were activated in mice vaccinated with G10E-CS, accompanied by significantly increased production of IFN-γ, IL-2, and IgG, and decreases in IL-4, IL-10, and IgG1. Immunization with G10E-CS conferred significant protection with prolonged survival in mice model of acute toxoplasmosis and statistically significant decreases in cyst burden in murine chronic toxoplasmosis. The results from this study indicate that chitosan microspheres used as an effective system to deliver a linked antigenic peptides is a promising strategy for the development of efficient vaccine against T. gondii .
Park, Chang-Jin; Wei, Tong; Sharma, Rita; Ronald, Pamela C
2017-12-01
The rice immune receptor XA21 confers resistance to the bacterial pathogen, Xanthomonas oryzae pv. oryzae (Xoo). To elucidate the mechanism of XA21-mediated immunity, we previously performed a yeast two-hybrid screening for XA21 interactors and identified XA21 binding protein 21 (XB21). Here, we report that XB21 is an auxilin-like protein predicted to function in clathrin-mediated endocytosis. We demonstrate an XA21/XB21 in vivo interaction using co-immunoprecipitation in rice. Overexpression of XB21 in rice variety Kitaake and a Kitaake transgenic line expressing XA21 confers a necrotic lesion phenotype and enhances resistance to Xoo. RNA sequencing reveals that XB21 overexpression results in the differential expression of 8735 genes (4939 genes up- and 3846 genes down-regulated) (≥2-folds, FDR ≤0.01). The up-regulated genes include those predicted to be involved in 'cell death' and 'vesicle-mediated transport'. These results indicate that XB21 plays a role in the plant immune response and in regulation of cell death. The up-regulation of genes controlling 'vesicle-mediated transport' in XB21 overexpression lines is consistent with a functional role for XB21 as an auxilin.
Ravindran, Rajesh; Maji, Mithun; Ali, Nahid
2012-01-01
The development of a long-term protective subunit vaccine against visceral leishmaniasis depends on antigens and adjuvants that can induce an appropriate immune response. The immunization of leishmanial antigens alone shows limited efficacy in the absence of an appropriate adjuvant. Earlier we demonstrated sustained protection against Leishmania donovani with leishmanial antigens entrapped in cationic liposomes through an intraperitoneal route. However, this route is not applicable for human administration. Herein, we therefore evaluated the immune response and protection induced by liposomal soluble leishmanial antigen (SLA) formulated with monophosphoryl lipid-trehalose dicorynomycolate (MPL-TDM) through a subcutaneous route. Subcutaneous immunization of BALB/c mice with SLA entrapped in liposomes or with MPL-TDM elicited partial protection against experimental visceral leishmaniasis. In contrast, liposomal SLA adjuvanted with MPL-TDM induced significantly higher levels of protection in liver and spleen in BALB/c mice challenged 10 days post-vaccination. Protection conferred by this formulation was sustained up to 12 weeks of immunization, and infection was controlled for at least 4 months of the challenge, similar to liposomal SLA immunization administered intraperitoneally. An analysis of cellular immune responses of liposomal SLA + MPL-TDM immunized mice demonstrated the induction of IFN-γ and IgG2a antibody production not only 10 days or 12 weeks post-vaccination but also 4 months after the challenge infection and a down regulation of IL-4 production after infection. Moreover, long-term immunity elicited by this formulation was associated with IFN-γ production also by CD8⁺ T cells. Taken together, our results suggest that liposomal SLA + MPL-TDM represent a good vaccine formulation for the induction of durable protection against L. donovani through a human administrable route.
Lalsiamthara, Jonathan; Lee, John Hwa
2017-02-01
The protective efficacy and immunological profiles of chickens immunized with an attenuated Salmonella Enteritidis (SE) constitutively secreting double mutant heat labile enterotoxin (dmLT) were investigated. The dmLT is a detoxified variant of Escherichia coli heat labile toxin and is a potent mucosal adjuvant capable of inducing both humoral and cell-mediated immunity. In this study, four-week-old chickens were inoculated with SE-dmLT strain JOL1641, parental SE strain JOL1087 or phosphate buffered saline control. Peripheral blood mononuclear cells of SE-dmLT inoculated birds showed significant proliferation upon stimulation with SE antigens as compared to the control and JOL1087 groups (P⩽0.05). One week post-challenge, the ratio of CD3 + CD4 + to CD3 + CD8 + T-cells showed a significant increase in the immunized groups. Significant increases in IFN-γ levels were observed in JOL1641 birds immunized via oral and intramuscular routes. While immunizations with the JOL1087 strain via the intramuscular route also induced significant increases in IFN-γ, immunization via the oral route did not trigger significant changes. Pro-inflammatory cytokine IL-6 was also elevated significantly in immunized birds; a significant elevation of IL-10 was observed only in oral immunization with JOL1641 (P⩽0.05). JOL1641 immunized birds showed significant reduction of challenge bacterial-organ recovery as compared to JOL1087 and non-immunized birds. Collectively, our results revealed that immunization with the adjuvant-secreting S. Enteritidis confers protection against wild type SE challenge via induction of strong cell proliferative response, augmentation of CD3 + CD4 + : CD3 + CD8 + T-cells ratio and enhancement of IFN-γ, IL-6 and IL-10 cytokine secretion. Copyright © 2016 Elsevier Ltd. All rights reserved.
ALD1 Regulates Basal Immune Components and Early Inducible Defense Responses in Arabidopsis.
Cecchini, Nicolás M; Jung, Ho Won; Engle, Nancy L; Tschaplinski, Timothy J; Greenberg, Jean T
2015-04-01
Robust immunity requires basal defense machinery to mediate timely responses and feedback cycles to amplify defenses against potentially spreading infections. AGD2-LIKE DEFENSE RESPONSE PROTEIN 1 (ALD1) is needed for the accumulation of the plant defense signal salicylic acid (SA) during the first hours after infection with the pathogen Pseudomonas syringae and is also upregulated by infection and SA. ALD1 is an aminotransferase with multiple substrates and products in vitro. Pipecolic acid (Pip) is an ALD1-dependent bioactive product induced by P. syringae. Here, we addressed roles of ALD1 in mediating defense amplification as well as the levels and responses of basal defense machinery. ALD1 needs immune components PAD4 and ICS1 (an SA synthesis enzyme) to confer disease resistance, possibly through a transcriptional amplification loop between them. Furthermore, ALD1 affects basal defense by controlling microbial-associated molecular pattern (MAMP) receptor levels and responsiveness. Vascular exudates from uninfected ALD1-overexpressing plants confer local immunity to the wild type and ald1 mutants yet are not enriched for Pip. We infer that, in addition to affecting Pip accumulation, ALD1 produces non-Pip metabolites that play roles in immunity. Thus, distinct metabolite signals controlled by the same enzyme affect basal and early defenses versus later defense responses, respectively.
ERIC Educational Resources Information Center
Navy Personnel Research and Development Center, San Diego, CA.
The 169 paper and symposium presentations given during 57 sessions of the conference are provided in these two volumes. The first volume contains the keynote speech, which addressed military entrance processing command and its acquired immune deficiency snydrome testing program. Symposia topics in this volume include: (1) computerized diagnostic…
ERIC Educational Resources Information Center
American Journalism Historians' Association.
The Newspapers and Journalism section of the proceedings of this conference of journalism historians contains the following 22 papers: "'For Want of the Actual Necessaries of Life': Survival Strategies of Frontier Journalists in the Trans-Mississippi West" (Larry Cebula); "'Legal Immunity for Free Speaking': Judge Thomas M. Cooley,…
Soto-Suárez, Mauricio; Baldrich, Patricia; Weigel, Detlef; Rubio-Somoza, Ignacio; San Segundo, Blanca
2017-01-01
MicroRNAs (miRNAs) play a pivotal role in regulating gene expression during plant development. Although a substantial fraction of plant miRNAs has proven responsive to pathogen infection, their role in disease resistance remains largely unknown, especially during fungal infections. In this study, we screened Arabidopsis thaliana lines in which miRNA activity has been reduced using artificial miRNA target mimics (MIM lines) for their response to fungal pathogens. Reduced activity of miR396 (MIM396 plants) was found to confer broad resistance to necrotrophic and hemibiotrophic fungal pathogens. MiR396 levels gradually decreased during fungal infection, thus, enabling its GRF (GROWTH-REGULATING FACTOR) transcription factor target genes to trigger host reprogramming. Pathogen resistance in MIM396 plants is based on a superactivation of defense responses consistent with a priming event during pathogen infection. Notably, low levels of miR396 are not translated in developmental defects in absence of pathogen challenge. Our findings support a role of miR396 in regulating plant immunity, and broaden our knowledge about the molecular players and processes that sustain defense priming. That miR396 modulates innate immunity without growth costs also suggests fine-tuning of miR396 levels as an effective biotechnological means for protection against pathogen infection. PMID:28332603
Chlamydia psittaci Genetic Variants Differ in Virulence by Modulation of Host Immunity
Laxton, Jonathan D.; Wang, Xiaofei; Obert, Caroline A.; Arva Tatireddigari, Venkat R. R.; van Rooijen, Nico; Hatch, Thomas P.; Byrne, Gerald I.
2011-01-01
Background. Psittacosis is a zoonosis caused by Chlamydia psittaci and is characterized by severe pneumonia and systemic infection. We sought to determine the basis of the 1000-fold difference in lethal dose of 2 C. psittaci 6BC strains in mice. Methods. Genomes of the strains were sequenced. Mice were infected intraperitoneally and the growth kinetics, immune responses, and pathology were compared. Results. The 2 strains differed by the presence of a 7.5-kb plasmid in the attenuated strain and 7 nonsynonomous single-nucleotide polymorphisms between the chromosomes, including a serine/threonine protein kinase gene pkn5. The plasmid was cured from the attenuated strain, but it remained nonlethal. Strains did not differ in growth kinetics in vitro or in vivo. Infection with the attenuated strain led to influx of activated macrophages with relatively minor organ damage. In contrast, the virulent strain caused an influx of nonactivated macrophages, neutrophils, and significant end organ damage. Mice infected with the virulent strain survived challenge when coinfected with either the plasmid-positive or plasmid-negative attenuated strain, indicating that an active process elicited by the attenuated strain reduces inflammation and disease. Conclusions. C. psittaci modulates virulence by alteration of host immunity, which is conferred by small differences in the chromosome. PMID:21791668
Macrophages under pressure: the role of macrophage polarization in hypertension.
Harwani, Sailesh C
2018-01-01
Hypertension is a multifactorial disease involving the nervous, renal, and cardiovascular systems. Macrophages are the most abundant and ubiquitous immune cells, placing them in a unique position to serve as key mediators between these components. The polarization of macrophages confers vast phenotypic and functional plasticity, allowing them to act as proinflammatory, homeostatic, and anti-inflammatory agents. Key differences between the M1 and M2 phenotypes, the 2 subsets at the extremes of this polarization spectrum, place macrophages at a juncture to mediate many mechanisms involved in the pathogenesis of hypertension. Neuronal and non-neuronal regulation of the immune system, that is, the "neuroimmuno" axis, plays an integral role in the polarization of macrophages. In hypertension, the neuroimmuno axis results in synchronization of macrophage mobilization from immune cell reservoirs and their chemotaxis, via increased expression of chemoattractants, to end organs critical in the development of hypertension. This complicated system is largely coordinated by the dichotomous actions of the autonomic neuronal and non-neuronal activation of cholinergic, adrenergic, and neurohormonal receptors on macrophages, leading to their ability to "switch" between phenotypes at sites of active inflammation. Data from experimental models and human studies are in concordance with each other and support a central role for macrophage polarization in the pathogenesis of hypertension. Copyright © 2017 Elsevier Inc. All rights reserved.
Chlamydia psittaci genetic variants differ in virulence by modulation of host immunity.
Miyairi, Isao; Laxton, Jonathan D; Wang, Xiaofei; Obert, Caroline A; Arva Tatireddigari, Venkat R R; van Rooijen, Nico; Hatch, Thomas P; Byrne, Gerald I
2011-08-15
Psittacosis is a zoonosis caused by Chlamydia psittaci and is characterized by severe pneumonia and systemic infection. We sought to determine the basis of the 1000-fold difference in lethal dose of 2 C. psittaci 6BC strains in mice. Genomes of the strains were sequenced. Mice were infected intraperitoneally and the growth kinetics, immune responses, and pathology were compared. The 2 strains differed by the presence of a 7.5-kb plasmid in the attenuated strain and 7 nonsynonomous single-nucleotide polymorphisms between the chromosomes, including a serine/threonine protein kinase gene pkn5. The plasmid was cured from the attenuated strain, but it remained nonlethal. Strains did not differ in growth kinetics in vitro or in vivo. Infection with the attenuated strain led to influx of activated macrophages with relatively minor organ damage. In contrast, the virulent strain caused an influx of nonactivated macrophages, neutrophils, and significant end organ damage. Mice infected with the virulent strain survived challenge when coinfected with either the plasmid-positive or plasmid-negative attenuated strain, indicating that an active process elicited by the attenuated strain reduces inflammation and disease. C. psittaci modulates virulence by alteration of host immunity, which is conferred by small differences in the chromosome.
Song, Baifen; Yang, Xijing; Sun, Hunan; Yu, Liquan; Ma, Jinzhu; Wu, Zhijun; Cui, Yudong
2017-04-01
Streptococcus is one of the main pathogens that cause bovine mastitis. They includes into S.agalactiae, S.dysgalactiae, and S.uberis. The GapC protein is a virulence factor that is expressed on the surface of Streptococcus species. GapC is highly antigenic and immunization with GapC confers cross-protection against all three species. Our previous data showed that amino acids 1-150 of GapC (GapC 1-150 ) of S. dysgalactiae conferred similar immunoprotection compared to full-length GapC. Thus, the present study aimed to construct a recombinant Escherichia coli XL1-Blue strain that displayed GapC 1-150 on its surface, and to investigate the immunogenicity of the surface-localized GapC 1-150 . To do so, the ompA gene of the E. coli XL1-Blue strain was replaced with the lpp'-ompA-gapC1 1-150 or lpp'-ompA genes by λ Red recombination, the former of which fused GapC 1-150 to an Lpp lipoprotein signal peptide and amino acids 1-159 of OmpA; the recombinant strains were named XL1-Blue/LOG76 and XL1-Blue/LO11, respectively. GapC 1-150 was confirmed to localize to the surface of the XL1-Blue/LOG76 strain by an indirect enzyme-linked immunosorbent assay (ELISA), a fluorescence-activated cell sorter analysis, and laser-scanning confocal microscopy. Then, ICR mice were immunized intramuscularly with the XL1-Blue/LOG76 or XL1-Blue/LO11 strains, or recombinant GapC 1-150 . The sera of the immunized mice were collected and the anti-GapC 1-150 antibody levels were detected by ELISA. Lymphocytes secreting interleukin (IL)-4 and interferon-γ were detected by an enzyme-linked ImmunoSpot assay, as was the level of IL-17A level in the supernatant of cultured splenic lymphocytes. The mice immunized with the XL1-Blue/LOG76 strain or GapC 1-150 exhibited better cellular and humoral immunity. Lastly, the immunized mice were challenged with S. uberis, S. dysgalactiae, and S. agalactiae strains, and mice that were immunized with the XL1-Blue/LOG76 strain were better protected than those that were immunized with the XL1-Blue/LO11 strain. These results indicate that it is feasible to display GapC 1-150 on the E. coli surface as a vaccine against Streptococcus species. Copyright © 2017. Published by Elsevier Ltd.
Thomas, Nicholas C; Schwessinger, Benjamin; Liu, Furong; Chen, Huamin; Wei, Tong; Nguyen, Yen P; Shaker, Isaac W F; Ronald, Pamela C
2016-01-01
The rice XA21 receptor kinase confers robust resistance to the bacterial pathogen Xanthomonas oryzae pv. oryzae ( Xoo ). We developed a detached leaf infection assay to quickly and reliably measure activation of the XA21-mediated immune response using genetic markers. We used RNA sequencing of elf18 treated EFR:XA21:GFP plants to identify candidate genes that could serve as markers for XA21 activation. From this analysis, we identified eight genes that are up-regulated in both in elf18 treated EFR:XA21:GFP rice leaves and Xoo infected XA21 rice leaves. These results provide a rapid and reliable method to assess bacterial-rice interactions.
Zhou, Fengmin; Goodsell, Amanda; Uematsu, Yasushi; Vajdy, Michael
2009-04-01
Seasonal influenza virus infections cause considerable morbidity and mortality in the world, and there is a serious threat of a pandemic influenza with the potential to cause millions of deaths. Therefore, practical influenza vaccines and vaccination strategies that can confer protection against intranasal infection with influenza viruses are needed. In this study, we demonstrate that using LTK63, a nontoxic mutant of the heat-labile toxin from Escherichia coli, as an adjuvant for both mucosal and systemic immunizations, systemic (intramuscular) immunization or combinations of mucosal (intranasal) and intramuscular immunizations protected mice against intranasal challenge with a lethal dose of live influenza virus at 3.5 months after the second immunization.
Urban, Nicole H; Chamberlin, Brett; Ramage, Samuel; Roberts, Zachary; Loria, Roger M; Beckman, Matthew J
2008-06-01
A large body of evidence suggests that the immune system directly impacts bone physiology. We tested whether immune regulating hormones (IRH), 17beta-androstenediol (beta-AED), 7beta,17beta-androstenetriol (beta-AET) or the 17alpha-androstenediol (alpha-AED), and 7alpha,17beta-androstenetriol (alpha-AET) metabolites could directly influence bone remodeling in vitro using human fetal osteoblasts (FOB-9). The impact on bone remodeling was examined by comparing the ratio of RANKL/OPG gene expression in response to AED and AET compounds. The alpha-AED was found to significantly increase in the ratio of RANKL/OPG gene expression and altering the morphology of RANKL stained FOB-9 cells. Cell viability was assessed using a Live/Dead assay. Again alpha-AED was unique in its ability to reduce the proportion of viable cells, and to induce mild apoptosis of FOB-9 cells. Treatment of FOB-9 cells with WY14643, an activator of PPAR-alpha and -gamma, also significantly elevated the percentage of dead cells. This increase was abolished by co-treatment with GW9962, a specific inhibitor of PPAR-gamma. Analysis of PPAR-gamma mRNA by Quantitative RT-PCR and its activation by DNA binding demonstrated that alpha-AED increased PPAR-gamma activation by 19%, while beta-AED conferred a 37% decrease in PPAR-gamma activation. In conclusion, alpha-AED opposed beta-AED by elevating a bone resorption scenario in osteoblast cells. The increase in RANKL/OPG is modulated by an activation of PPAR-gamma that in turn caused mild apoptosis of FOB-9 cells.
Geisbert, Joan B; Shedlock, Devon J; Xu, Ling; Lamoreaux, Laurie; Custers, Jerome H. H. V; Popernack, Paul M; Yang, Zhi-Yong; Pau, Maria G; Roederer, Mario; Koup, Richard A; Goudsmit, Jaap; Jahrling, Peter B; Nabel, Gary J
2006-01-01
Background Ebola virus causes a hemorrhagic fever syndrome that is associated with high mortality in humans. In the absence of effective therapies for Ebola virus infection, the development of a vaccine becomes an important strategy to contain outbreaks. Immunization with DNA and/or replication-defective adenoviral vectors (rAd) encoding the Ebola glycoprotein (GP) and nucleoprotein (NP) has been previously shown to confer specific protective immunity in nonhuman primates. GP can exert cytopathic effects on transfected cells in vitro, and multiple GP forms have been identified in nature, raising the question of which would be optimal for a human vaccine. Methods and Findings To address this question, we have explored the efficacy of mutant GPs from multiple Ebola virus strains with reduced in vitro cytopathicity and analyzed their protective effects in the primate challenge model, with or without NP. Deletion of the GP transmembrane domain eliminated in vitro cytopathicity but reduced its protective efficacy by at least one order of magnitude. In contrast, a point mutation was identified that abolished this cytopathicity but retained immunogenicity and conferred immune protection in the absence of NP. The minimal effective rAd dose was established at 1010 particles, two logs lower than that used previously. Conclusions Expression of specific GPs alone vectored by rAd are sufficient to confer protection against lethal challenge in a relevant nonhuman primate model. Elimination of NP from the vaccine and dose reductions to 1010 rAd particles do not diminish protection and simplify the vaccine, providing the basis for selection of a human vaccine candidate. PMID:16683867
IgE and mast cells in host defense against parasites and venoms
Mukai, Kaori; Tsai, Mindy; Galli, Stephen J.
2016-01-01
IgE-dependent mast cell activation is a major effector mechanism underlying the pathology associated with allergic disorders. The most dramatic of these IgE-associated disorders is the fatal anaphylaxis which can occur in some people who have developed IgE antibodies to otherwise innocuous antigens, such as those contained in certain foods and medicines. Why would such a highly “maladaptive” immune response develop in evolution, and be retained to the present day? Host defense against parasites has long been considered the only beneficial function that might be conferred by IgE and mast cells. However, recent studies have provided evidence that, in addition to participating in host resistance to certain parasites, mast cells and IgE are critical components of innate (mast cells) and adaptive (mast cells and IgE) immune responses that can enhance host defense against the toxicity of certain arthropod and animal venoms, including enhancing the survival of mice injected with such venoms. Yet, in some people, developing IgE antibodies to insect or snake venoms puts them at risk for having a potentially fatal anaphylactic reaction upon subsequent exposure to such venoms. Delineating the mechanisms underlying beneficial versus detrimental innate and adaptive immune responses associated with mast cell activation and IgE is likely to enhance our ability to identify potential therapeutic targets in such settings, not only for reducing the pathology associated with allergic disorders but perhaps also for enhancing immune protection against pathogens and animal venoms. PMID:27225312
IgE and mast cells in host defense against parasites and venoms.
Mukai, Kaori; Tsai, Mindy; Starkl, Philipp; Marichal, Thomas; Galli, Stephen J
2016-09-01
IgE-dependent mast cell activation is a major effector mechanism underlying the pathology associated with allergic disorders. The most dramatic of these IgE-associated disorders is the fatal anaphylaxis which can occur in some people who have developed IgE antibodies to otherwise innocuous antigens, such as those contained in certain foods and medicines. Why would such a highly "maladaptive" immune response develop in evolution and be retained to the present day? Host defense against parasites has long been considered the only beneficial function that might be conferred by IgE and mast cells. However, recent studies have provided evidence that, in addition to participating in host resistance to certain parasites, mast cells and IgE are critical components of innate (mast cells) and adaptive (mast cells and IgE) immune responses that can enhance host defense against the toxicity of certain arthropod and animal venoms, including enhancing the survival of mice injected with such venoms. Yet, in some people, developing IgE antibodies to insect or snake venoms puts them at risk for having a potentially fatal anaphylactic reaction upon subsequent exposure to such venoms. Delineating the mechanisms underlying beneficial versus detrimental innate and adaptive immune responses associated with mast cell activation and IgE is likely to enhance our ability to identify potential therapeutic targets in such settings, not only for reducing the pathology associated with allergic disorders but perhaps also for enhancing immune protection against pathogens and animal venoms.
Immunological Effects of Probiotics and their Significance to Human Health
NASA Astrophysics Data System (ADS)
Gill, Harsharn S.; Grover, Sunita; Batish, Virender K.; Gill, Preet
Probiotics are defined as live microorganisms which when administered in adequate amounts confer a health benefit upon the host (FAO/WHO, 2001). Lactic acid bacteria, particularly Lactobacillus and Bifidobacterium species are commonly used as probiotics. Other less commonly used probiotics include the yeast Sacchromyces cerevisiae and some non-pathogenic Escherichia coli and Bacillus species. Studies over the past 20 years have demonstrated that probiotic intake is able to confer a range of health benefits including modulation of the immune system, protection against gastrointestinal and respiratory tract infections, lowering of blood cholesterol levels, attenuation of overt immuno-inflammatory disorders (such as inflammatory bowel disease, allergies) and anti-cancer effects. However, the strongest clinical evidence for probiotics relates to their effectiveness in improving gut health and modulating (via stimulation or regulation) the host immune system. This chapter provides an overview of the current status of our knowledge regarding the immunostimulatory and immunoregulatory effects of probiotics on the immune system and their significance to human health.
Adverse Events After Routine Immunization of Extremely Low Birth Weight Infants
DeMeo, Stephen D.; Raman, Sudha R.; Hornik, Christoph P.; Wilson, Catherine C.; Clark, Reese; Smith, P. Brian
2015-01-01
Importance Immunization of extremely low birth weight (ELBW) infants in the neonatal intensive care unit (NICU) is associated with adverse events including fever and apnea/bradycardia in the immediate post-immunization period. This presents a diagnostic dilemma for clinicians, leading to the potential for immunization delay and sepsis evaluations. Objective To compare the incidence of sepsis evaluations, need for increased respiratory support, intubation, seizures, and death among immunized ELBW infants in the 3 days pre- and post-immunization. Design Multicenter retrospective cohort study. Setting 348 NICUs managed by the Pediatrix Medical Group. Participants 13,926 ELBW infants ≤28 weeks gestation who were discharged between 2007 and 2012. Exposure At least one immunization between day of life 53 and 110. Main Outcomes and Measures Incidence of sepsis evaluations, need for increased respiratory support, intubation, seizures, and death. Results Most (91%) of the infants received 3 or more immunizations. The incidence of sepsis evaluations increased from 5.4/1000 patient days in the pre-immunization period to 19.3/1000 patient days post-immunization (adjusted rate ratio [ARR], 3.7; 95% CI, 3.2–4.4). The need for increased respiratory support increased from 6.6/1000 patient days in the pre-immunization period to 14.0/1000 patient days post-immunization (ARR, 2.1; 95% CI, 1.9–2.5), and intubation increased from 2.0/1000 patient days to 3.6/1000 patient days (ARR, 1.7; 95% CI, 1.3–2.2). The post-immunization incidence of adverse events was similar across immunization types, including combination vaccines when compared to single-dose vaccines. Infants who were 23–24 weeks gestation had a higher risk of sepsis evaluation and intubation post-immunization. A prior history of sepsis was associated with higher risk of sepsis evaluation post-immunization. Conclusion ELBW infants in the NICU had an increased incidence of sepsis evaluations as well as increased respiratory support and intubation after routine immunization. Our findings provide no evidence to suggest that clinicians should not use combination vaccines in ELBW infants. Further studies are needed to determine whether timing or spacing of immunization administrations confers risk for the developing adverse events and whether a prior history of sepsis confers risk for an altered immune response in ELBW infants. PMID:26030302
Immune Activity, Body Condition and Human-Associated Environmental Impacts in a Wild Marine Mammal
Brock, Patrick M.; Hall, Ailsa J.; Goodman, Simon J.; Cruz, Marilyn; Acevedo-Whitehouse, Karina
2013-01-01
Within individuals, immunity may compete with other life history traits for resources, such as energy and protein, and the damage caused by immunopathology can sometimes outweigh the protective benefits that immune responses confer. However, our understanding of the costs of immunity in the wild and how they relate to the myriad energetic demands on free-ranging organisms is limited. The endangered Galapagos sea lion (Zalophus wollebaeki) is threatened simultaneously by disease from domestic animals and rapid changes in food availability driven by unpredictable environmental variation. We made use of this unique ecology to investigate the relationship between changes in immune activity and changes in body condition. We found that during the first three months of life, changes in antibody concentration were negatively correlated with changes in mass per unit length, skinfold thickness and serum albumin concentration, but only in a sea lion colony exposed to anthropogenic environmental impacts. It has previously been shown that changes in antibody concentration during early Galapagos sea lion development were higher in a colony exposed to anthropogenic environmental impacts than in a control colony. This study allows for the possibility that these relatively large changes in antibody concentration are associated with negative impacts on fitness through an effect on body condition. Our findings suggest that energy availability and the degree of plasticity in immune investment may influence disease risk in natural populations synergistically, through a trade-off between investment in immunity and resistance to starvation. The relative benefits of such investments may change quickly and unpredictably, which allows for the possibility that individuals fine-tune their investment strategies in response to changes in environmental conditions. In addition, our results suggest that anthropogenic environmental impacts may impose subtle energetic costs on individuals, which could contribute to population declines, especially in times of energy shortage. PMID:23840603
Peng, Ying; Schoenlaub, Laura; Elliott, Alexandra; Mitchell, William; Zhang, Yan
2013-01-01
To further understand the mechanisms of formalin-inactivated Coxiella burnetii phase I (PI) vaccine (PIV)-induced protection, we examined if B cell, T cell, CD4+ T cell, or CD8+ T cell deficiency in mice significantly affects the ability of PIV to confer protection against a C. burnetii infection. Interestingly, compared to wild-type (WT) mice, PIV conferred comparable levels of protection in CD4+ T cell- or CD8+ T cell-deficient mice and partial protection in T cell-deficient mice but did not provide measurable protection in B cell-deficient mice. These results suggest that PIV-induced protection depends on B cells. In addition, anti-PI-specific IgM was the major detectable antibody (Ab) in immune sera from PIV-vaccinated CD4+ T cell-deficient mice, and passive transfer of immune sera from PIV-vaccinated CD4+ T cell-deficient mice conferred significant protection. These results suggest that T cell-independent anti-PI-specific IgM may contribute to PIV-induced protection. Our results also suggested that PIV-induced protection may not depend on complement activation and Fc receptor-mediated effector functions. Furthermore, our results demonstrated that both IgM and IgG from PIV-vaccinated WT mouse sera were able to inhibit C. burnetii infection in vivo, but only IgM from PIV-vaccinated CD4+ T cell-deficient mouse sera inhibited C. burnetii infection. Collectively, these findings suggest that PIV-induced protection depends on B cells to produce protective IgM and IgG and that T cell-independent anti-PI-specific IgM may play a critical role in PIV-induced protection against C. burnetii infection. PMID:23545296
Human Virus-Derived Small RNAs Can Confer Antiviral Immunity in Mammals.
Qiu, Yang; Xu, Yanpeng; Zhang, Yao; Zhou, Hui; Deng, Yong-Qiang; Li, Xiao-Feng; Miao, Meng; Zhang, Qiang; Zhong, Bo; Hu, Yuanyang; Zhang, Fu-Chun; Wu, Ligang; Qin, Cheng-Feng; Zhou, Xi
2017-06-20
RNA interference (RNAi) functions as a potent antiviral immunity in plants and invertebrates; however, whether RNAi plays antiviral roles in mammals remains unclear. Here, using human enterovirus 71 (HEV71) as a model, we showed HEV71 3A protein as an authentic viral suppressor of RNAi during viral infection. When the 3A-mediated RNAi suppression was impaired, the mutant HEV71 readily triggered the production of abundant HEV71-derived small RNAs with canonical siRNA properties in cells and mice. These virus-derived siRNAs were produced from viral dsRNA replicative intermediates in a Dicer-dependent manner and loaded into AGO, and they were fully active in degrading cognate viral RNAs. Recombinant HEV71 deficient in 3A-mediated RNAi suppression was significantly restricted in human somatic cells and mice, whereas Dicer deficiency rescued HEV71 infection independently of type I interferon response. Thus, RNAi can function as an antiviral immunity, which is induced and suppressed by a human virus, in mammals. Copyright © 2017 Elsevier Inc. All rights reserved.
Caddell, Daniel F; Park, Chang-Jin; Thomas, Nicholas C; Canlas, Patrick E; Ronald, Pamela C
2017-12-01
The rice immune receptor XA21 confers resistance to Xanthomonas oryzae pv. oryzae (Xoo), the causal agent of bacterial leaf blight. We previously demonstrated that an auxilin-like protein, XA21 BINDING PROTEIN 21 (XB21), positively regulates resistance to Xoo. To further investigate the function of XB21, we performed a yeast two-hybrid screen. We identified 22 unique XB21 interacting proteins, including LEUCINE-RICH REPEAT PROTEIN 1 (LRR1), which we selected for further analysis. Silencing of LRR1 in the XA21 genetic background (XA21-LRR1Ri) compromises resistance to Xoo compared with control XA21 plants. XA21-LRR1Ri plants have reduced Xa21 transcript levels and reduced expression of genes that serve as markers of XA21-mediated activation. Overexpression of LRR1 is insufficient to alter resistance to Xoo in rice lines lacking XA21. Taken together, our results indicate that LRR1 is required for wild-type Xa21 transcript expression and XA21-mediated immunity.
Askarian, Fatemeh; Lapek, John D; Dongre, Mitesh; Tsai, Chih-Ming; Kumaraswamy, Monika; Kousha, Armin; Valderrama, J Andrés; Ludviksen, Judith A; Cavanagh, Jorunn P; Uchiyama, Satoshi; Mollnes, Tom E; Gonzalez, David J; Wai, Sun N; Nizet, Victor; Johannessen, Mona
2018-01-01
Staphylococcus aureus produces membrane-derived vesicles (MVs), which share functional properties to outer membrane vesicles. Atomic force microscopy revealed that S. aureus -derived MVs are associated with the bacterial surface or released into the surrounding environment depending on bacterial growth conditions. By using a comparative proteomic approach, a total of 131 and 617 proteins were identified in MVs isolated from S. aureus grown in Luria-Bertani and brain-heart infusion broth, respectively. Purified S. aureus MVs derived from the bacteria grown in either media induced comparable levels of cytotoxicity and neutrophil-activation. Administration of exogenous MVs increased the resistance of S. aureus to killing by whole blood or purified human neutrophils ex vivo and increased S. aureus survival in vivo . Finally, immunization of mice with S. aureus -derived MVs induced production of IgM, total IgG, IgG1, IgG2a, and IgG2b resulting in protection against subcutaneous and systemic S. aureus infection. Collectively, our results suggest S. aureus MVs can influence bacterial-host interactions during systemic infections and provide protective immunity in murine models of infection.
Inactivated coxsackievirus A10 experimental vaccines protect mice against lethal viral challenge.
Shen, Chaoyun; Liu, Qingwei; Zhou, Yu; Ku, Zhiqiang; Wang, Lili; Lan, Ke; Ye, Xiaohua; Huang, Zhong
2016-09-22
Coxsackievirus A10 (CVA10) has become one of the major causative agents of hand, foot and mouth disease (HFMD). It is now recognized that CVA10 should be targeted for vaccine development. We report here that β-propiolactone inactivated whole-virus based CVA10 vaccines can elicit protective immunity in mice. We prepared two inactivated CVA10 experimental vaccines derived from the prototype strain CVA10/Kowalik and from a clinical isolate CVA10/S0148b, respectively. Immunization with the experimental vaccines elicited CVA10-specific serum antibodies in mice. The antisera from vaccinated mice could potently neutralize in vitro infection with either homologous or heterologous CVA10 strains. Importantly, passive transfer of the anti-CVA10 sera protected recipient mice against CVA10/Kowalik or CVA10/S0148b infections. Moreover, active immunization with the inactivated vaccines also conferred protection against homologous and heterologous infections in mice. Collectively, our results demonstrate the proof-of-concept for inactivated whole-virus based CVA10 vaccines. Copyright © 2016 Elsevier Ltd. All rights reserved.
Generation of a Listeria vaccine strain by enhanced Caspase-1 activation
Warren, Sarah E.; Duong, Hien; Mao, Dat Phat; Armstrong, Abraham; Rajan, Jayant; Miao, Edward A.; Aderem, Alan
2012-01-01
The immunostimulatory properties conferred by vaccine adjuvants require Caspase-1 for processing of IL-1β and IL-18. Caspase-1 is activated in response to a breach of the cytosolic compartment by microbes and the process is initiated by intracellular pattern recognition receptors within inflammasomes. Listeria monocytogenes is detected in the cytosol by the NLRC4, NLRP3 and AIM2 inflammasomes. NLRC4 is activated by flagellin, and L. monocytogenes evades this detector by repressing flagellin expression. We generated an L. monocytogenes strain that was forced to express flagellin in the host cell cytosol. This strain hyperactivated Caspase-1 and was preferentially cleared via NLRC4 detection in an IL-1β/IL-18 independent manner. We also created a strain of L. monocytogenes with forced expression of another NLRC4 agonist, PrgJ from the Type III secretion system of S. typhimurium. Forced expression of flagellin or PrgJ resulted in attenuation, yet both strains conferred protective immunity in mice against lethal challenge with L. monocytogenes. This work is the first demonstration of specific targeting of the Caspase-1 activation pathway to generate a safe and potent L. monocytogenes based vaccine. Moreover, the attenuated strains with embedded flagellin or PrgJ adjuvants, represent attractive vectors for vaccines aimed at eliciting T cell responses. PMID:21538346
USDA-ARS?s Scientific Manuscript database
The purpose of this study was to determine if incorporating a recombinant Eimeria maxima protein, namely rEmaxIMP1, into gold nanoparticles (NP) could improve the level of protective immunity against E. maxima challenge infection. Recombinant EmaxIMP1 was expressed in Escherchia coli as a poly-His f...
ERIC Educational Resources Information Center
Luna, G. Cajetan; And Others
This proceedings of the first international conference on Acquired Immune Deficiency Syndrome (AIDS) and homeless youth included over 125 delegates from 32 countries. There was strong consensus among delegates that street youth are often in high and multiple Human Immunodeficiency Virus (HIV) risk situations, and programmatic responses are needed.…
Influenza Virus-Like Particles Containing M2 Induce Broadly Cross Protective Immunity
Song, Jae-Min; Wang, Bao-Zhong; Park, Kyoung-Mi; Van Rooijen, Nico; Quan, Fu-Shi; Kim, Min-Chul; Jin, Hyun-Tak; Pekosz, Andrew; Compans, Richard W.; Kang, Sang-Moo
2011-01-01
Background Current influenza vaccines based on the hemagglutinin protein are strain specific and do not provide good protection against drifted viruses or emergence of new pandemic strains. An influenza vaccine that can confer cross-protection against antigenically different influenza A strains is highly desirable for improving public health. Methodology/Principal Findings To develop a cross protective vaccine, we generated influenza virus-like particles containing the highly conserved M2 protein in a membrane-anchored form (M2 VLPs), and investigated their immunogenicity and breadth of cross protection. Immunization of mice with M2 VLPs induced anti-M2 antibodies binding to virions of various strains, M2 specific T cell responses, and conferred long-lasting cross protection against heterologous and heterosubtypic influenza viruses. M2 immune sera were found to play an important role in providing cross protection against heterosubtypic virus and an antigenically distinct 2009 pandemic H1N1 virus, and depletion of dendritic and macrophage cells abolished this cross protection, providing new insight into cross-protective immune mechanisms. Conclusions/Significance These results suggest that presenting M2 on VLPs in a membrane-anchored form is a promising approach for developing broadly cross protective influenza vaccines. PMID:21267073
Johnson, P R; Olmsted, R A; Prince, G A; Murphy, B R; Alling, D W; Walsh, E E; Collins, P L
1987-01-01
The degree of antigenic relatedness between human respiratory syncytial virus (RSV) subgroups A and B was estimated from antibody responses induced in cotton rats by respiratory tract infection with RSV. Glycoprotein-specific enzyme-linked immunosorbent assays of antibody responses induced by RSV infection demonstrated that the F glycoproteins of subgroups A and B were antigenically closely related (relatedness, R approximately 50%), whereas the G glycoproteins were only distantly related (R approximately 5%). Intermediate levels of antigenic relatedness (R approximately 25%) were seen in neutralizing antibodies from cotton rats infected with RSV of the two subgroups. Immunity against the F glycoprotein of subgroup A, induced by vaccinia-A2-F, conferred a high level of protection which was of comparable magnitude against challenge by RSV of either subgroup. In comparison, immunity against the G glycoprotein of subgroup A, induced by vaccinia-A2-G, conferred less complete, but significant, protection. Importantly, in vaccinia-A2-G-immunized animals, suppression of homologous challenge virus replication was significantly greater (13-fold) than that observed for the heterologous virus. PMID:3305988
Martínez-Torrecuadrada, J L; Díaz-Laviada, M; Roy, P; Sánchez, C; Vela, C; Sánchez-Vizcaíno, J M; Casal, J I
1996-06-01
African horsesickness virus serotype 4 (AHSV-4) outer capsid protein VP2, or VP2 and VP5 plus inner capsid protein VP7, derived from single or dual recombinant baculovirus expression vectors were used in different combinations to immunize horses. When the proteins were purified by affinity chromatography, the combination of all three proteins induced low levels of neutralizing antibodies and conferred protection against virulent virus challenge. However, purified VP2 or VP2 and VP5 in the absence of VP7 failed to induce neutralizing antibodies and protection. Immunization with non-purified proteins enhanced the titres of neutralizing antibodies. Again, the combination of the three proteins was able to confer total protection to immunized horses, which showed absence of viraemia. The antigenicity of recombinant VP2 was analysed with a collection of 30 MAbs. Both purified and unpurified recombinant VP2 proteins showed different antigenic patterns in comparison to that of VP2 on virions. An immunization experiment with four more horses confirmed these results. The vaccine described here would not only prevent the disease, but would drastically reduce the propagation of the virus by vectors.
Poirier, Enzo Z; Goic, Bertsy; Tomé-Poderti, Lorena; Frangeul, Lionel; Boussier, Jérémy; Gausson, Valérie; Blanc, Hervé; Vallet, Thomas; Loyd, Hyelee; Levi, Laura I; Lanciano, Sophie; Baron, Chloé; Merkling, Sarah H; Lambrechts, Louis; Mirouze, Marie; Carpenter, Susan; Vignuzzi, Marco; Saleh, Maria-Carla
2018-03-14
The RNAi pathway confers antiviral immunity in insects. Virus-specific siRNA responses are amplified via the reverse transcription of viral RNA to viral DNA (vDNA). The nature, biogenesis, and regulation of vDNA are unclear. We find that vDNA produced during RNA virus infection of Drosophila and mosquitoes is present in both linear and circular forms. Circular vDNA (cvDNA) is sufficient to produce siRNAs that confer partially protective immunity when challenged with a cognate virus. cvDNAs bear homology to defective viral genomes (DVGs), and DVGs serve as templates for vDNA and cvDNA synthesis. Accordingly, DVGs promote the amplification of vDNA-mediated antiviral RNAi responses in infected Drosophila. Furthermore, vDNA synthesis is regulated by the DExD/H helicase domain of Dicer-2 in a mechanism distinct from its role in siRNA generation. We suggest that, analogous to mammalian RIG-I-like receptors, Dicer-2 functions like a pattern recognition receptor for DVGs to modulate antiviral immunity in insects. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.
Vaccine approaches conferring cross-protection against influenza viruses
Vemula, Sai V.; Sayedahmed, Ekramy E; Sambhara, Suryaprakash; Mittal, Suresh K.
2018-01-01
Introduction Annual vaccination is one of the most efficient and cost-effective strategies to prevent and control influenza epidemics. Most of currently available influenza vaccines are strong inducer of antibody responses against viral surface proteins, hemagglutinin (HA) and neuraminidase (NA), but are poor inducers of cell-mediated immune responses against conserved internal proteins. Moreover, due to the high variability of viral surface proteins because of antigenic drift or antigenic shift, many of the currently licensed vaccines confer little or no protection against drift or shift variants. Areas covered Next generation influenza vaccines that can induce humoral immune responses to receptor-binding epitopes as well as broadly neutralizing conserved epitopes, and cell-mediated immune responses against highly conserved internal proteins would be effective against variant viruses as well as a novel pandemic influenza until circulating strain-specific vaccines become available. Here we discuss vaccine approaches that have potential to provide broad spectrum protection against influenza viruses. Expert opinion Based on current progress in defining cross-protective influenza immunity, it seems that the development of a universal influenza vaccine is feasible. It would revolutionize the strategy for influenza pandemic preparedness, and significantly impact the shelf-life and protection efficacy of seasonal influenza vaccines. PMID:28925296
Davoodi-Semiromi, Abdoreza; Schreiber, Melissa; Nallapali, Samson; Verma, Dheeraj; Singh, Nameirakpam D.; Banks, Robert K.; Chakrabarti, Debopam; Daniell, Henry
2009-01-01
Summary Cholera and malaria are major diseases causing high mortality. The only licensed cholera vaccine is expensive; immunity is lost in children within 3 years and adults are not fully protected. No vaccine is yet available for malaria. Therefore, in this study, the cholera toxin-B subunit (CTB) of Vibrio cholerae fused to malarial vaccine antigens apical membrane antigen-1 (AMA1) and merozoite surface protein-1 (MSP1) was expressed in lettuce and tobacco chloroplasts. Southern blot analysis confirmed homoplasmy and stable integration of transgenes. CTB-AMA1 and CTB-MSP1 fusion proteins accumulated up to 13.17% and 10.11% (total soluble protein, TSP) in tobacco and up to 7.3% and 6.1% (TSP) in lettuce respectively. Nine groups of mice (n = 10/group) were immunized subcutaneously (SQV) or orally (ORV) with purified antigens or transplastomic tobacco leaves. Significant levels of antigen-specific antibody titres of immunized mice completely inhibited proliferation of the malarial parasite and cross-reacted with the native parasite proteins in immunoblots and immunofluorescence studies. Protection against cholera toxin challenge in both ORV (100%) and SQV (89%) mice correlated with CTB-specific titres of intestinal, serum IgA and IgG1 in ORV and only IgG1 in SQV mice, but no other immunoglobulin. Increasing numbers of interleukin-10+ T cell but not Foxp3+ regulatory T cells, suppression of interferon-γ and absence of interleukin-17 were observed in protected mice, suggesting that immunity is conferred via the Tr1/Th2 immune response. Dual immunity against two major infectious diseases provided by chloroplast-derived vaccine antigens for long-term (>300 days, 50% of mouse life span) offers a realistic platform for low cost vaccines and insight into mucosal and systemic immunity. PMID:20051036
Plant-pathogen interactions: toward development of next-generation disease-resistant plants.
Nejat, Naghmeh; Rookes, James; Mantri, Nitin L; Cahill, David M
2017-03-01
Briskly evolving phytopathogens are dire threats to our food supplies and threaten global food security. From the recent advances made toward high-throughput sequencing technologies, understanding of pathogenesis and effector biology, and plant innate immunity, translation of these means into new control tools is being introduced to develop durable disease resistance. Effectoromics as a powerful genetic tool for uncovering effector-target genes, both susceptibility genes and executor resistance genes in effector-assisted breeding, open up new avenues to improve resistance. TALENs (Transcription Activator-Like Effector Nucleases), engineered nucleases and CRISPR (Clustered Regulatory Interspaced Short Palindromic Repeats)/Cas9 systems are breakthrough and powerful techniques for genome editing, providing efficient mechanisms for targeted crop protection strategies in disease resistance programs. In this review, major advances in plant disease management to confer durable disease resistance and novel strategies for boosting plant innate immunity are highlighted.
Formation and role of exosomes in cancer.
Brinton, Lindsey T; Sloane, Hillary S; Kester, Mark; Kelly, Kimberly A
2015-02-01
Exosomes offer new insight into cancer biology with both diagnostic and therapeutic implications. Because of their cell-to-cell communication, exosomes influence tumor progression, metastasis, and therapeutic efficacy. They can be isolated from blood and other bodily fluids to reveal disease processes occurring within the body, including cancerous growth. In addition to being a reservoir of cancer biomarkers, they can be re-engineered to reinstate tumor immunity. Tumor exosomes interact with various cells of the microenvironment to confer tumor-advantageous changes that are responsible for stromal activation, induction of the angiogenic switch, increased vascular permeability, and immune escape. Exosomes also contribute to metastasis by aiding in the epithelial-to-mesenchymal transition and formation of the pre-metastatic niche. Furthermore, exosomes protect tumor cells from the cytotoxic effects of chemotherapy drugs and transfer chemoresistance properties to nearby cells. Thus, exosomes are essential to many lethal elements of cancer and it is important to understand their biogenesis and role in cancer.
The meninges: new therapeutic targets for multiple sclerosis.
Russi, Abigail E; Brown, Melissa A
2015-02-01
The central nervous system (CNS) largely comprises nonregenerating cells, including neurons and myelin-producing oligodendrocytes, which are particularly vulnerable to immune cell-mediated damage. To protect the CNS, mechanisms exist that normally restrict the transit of peripheral immune cells into the brain and spinal cord, conferring an "immune-specialized" status. Thus, there has been a long-standing debate as to how these restrictions are overcome in several inflammatory diseases of the CNS, including multiple sclerosis (MS). In this review, we highlight the role of the meninges, tissues that surround and protect the CNS and enclose the cerebral spinal fluid, in promoting chronic inflammation that leads to neuronal damage. Although the meninges have traditionally been considered structures that provide physical protection for the brain and spinal cord, new data have established these tissues as sites of active immunity. It has been hypothesized that the meninges are important players in normal immunosurveillance of the CNS but also serve as initial sites of anti-myelin immune responses. The resulting robust meningeal inflammation elicits loss of localized blood-brain barrier (BBB) integrity and facilitates a large-scale influx of immune cells into the CNS parenchyma. We propose that targeting the cells and molecules mediating these inflammatory responses within the meninges offers promising therapies for MS that are free from the constraints imposed by the BBB. Importantly, such therapies may avoid the systemic immunosuppression often associated with the existing treatments. Copyright © 2015 Elsevier Inc. All rights reserved.
Chern, Mawsheng; Xu, Qiufang; Bart, Rebecca S.; ...
2016-05-13
Systemic acquired resistance, mediated by the Arabidopsis NPR1 gene and the rice NH1 gene, confers broad-spectrum immunity to diverse pathogens. NPR1 and NH1 interact with TGA transcription factors to activate downstream defense genes. Despite the importance of this defense response, the signaling components downstream of NPR1/NH1 and TGA proteins are poorly defined. Here we report the identification of a rice mutant, snim1, which suppresses NH1-mediated immunity and demonstrate that two genes encoding previously uncharacterized cysteine-rich-receptor-like kinases ( CRK6 and CRK10), complement the snim1 mutant phenotype. Silencing of CRK6 and CRK10 genes individually in the parental genetic background recreates the snim1more » phenotype. We identified a rice mutant in the Kitaake genetic background with a frameshift mutation in crk10; this mutant also displays a compromised immune response highlighting the important role of crk10. We also show that elevated levels of NH1 expression lead to enhanced CRK10 expression and that the rice TGA2.1 protein binds to the CRK10 promoter. Furthermore, these experiments demonstrate a requirement for CRKs in NH1-mediated immunity and establish a molecular link between NH1 and induction of CRK10 expression.« less
Anand, Sneha; Madhubala, Rentala
2015-06-02
Visceral leishmaniasis caused by Leishmania donovani is the most severe systemic form of the disease. There are still no vaccines available for humans and there are limitations associated with the current therapeutic regimens for leishmaniasis. Recently, we reported functional importance of Arabino-1, 4-lactone oxidase (ALO) enzyme from L. donovani involved in ascorbate biosynthesis pathway. In this study, we have shown that ΔALO parasites do not affect the ability of null mutants to invade visceral organs but severely impair parasite persistence beyond 16 week in BALB/c mice and hence are safe as an immunogen. Both short term (5 week) and long term (20 week) immunization with ΔALO parasites conferred sustained protection against virulent challenge in BALB/c mice, activated splenocytes and resulted in induction of pro-inflammatory cytokine response. Protection in immunized mice after challenge correlated with the stimulation of IFN-γ producing CD4(+) and CD8(+) T cells. Antigen-mediated cell immunity correlated with robust nitrite and superoxide generation, macrophage-derived oxidants critical in controlling Leishmania infection. Our data shows that live attenuated ΔALO parasites are safe, induce protective immunity and can provide sustained protection against Leishmania donovani. We further conclude that the parasites attenuated in their anti-oxidative defence mechanism can be exploited as vaccine candidates.
Is there a maternally induced immunological imprinting phase à la Konrad Lorenz?
Lemke, H; Lange, H
1999-10-01
In mammals, IgG antibodies are transferred from mothers to the offspring. Since these maternal antibodies result mainly from thymus-dependent immune responses which have undergone immune maturation through somatic hypermutations, they represent the highest quality of the collective maternal immunological experience. Maternal antibodies not only confer passive immunity as long as the newborn's immune system has not fully developed, but also exert an active stimulation as indicated by their regulatory influence on isotype expression, long-term idiotypic alterations, determination of the adult B and T cell repertoire, induction of antigen reactive IgM as well as an affinity enhancement of a proportion of early primary antibodies. The fact that several of these features can only be induced during limited sensitive periods shortly after birth is reminiscent of the behavioural imprinting as defined by Konrad Lorenz. We therefore propose that during early ontogeny there is an immunological imprinting phase with characteristics analogous to behavioural imprinting: (i) the internal imprinting effect is induced by external signals, (ii) in contrast to normal learning, immunological imprinting is also only possible during certain development phases and (iii) it is characterised by an (almost) irreversible result. Hence, if particular immunological experiences are only possible during such sensitive phases, maternal immunoglobulins and consequently the mother's immunological experience is of prime importance for the start of the ontogenetic development of the immune system.
Sedlik, C.; Dadaglio, G.; Saron, M. F.; Deriaud, E.; Rojas, M.; Casal, S. I.; Leclerc, C.
2000-01-01
Many approaches are currently being developed to deliver exogenous antigen into the major histocompatibility complex class I-restricted antigen pathway, leading to in vivo priming of CD8+ cytotoxic T cells. One attractive possibility consists of targeting the antigen to phagocytic or macropinocytic antigen-presenting cells. In this study, we demonstrate that strong CD8+ class I-restricted cytotoxic responses are induced upon intraperitoneal immunization of mice with different peptides, characterized as CD8+ T-cell epitopes, bound to 1-μm synthetic latex microspheres and injected in the absence of adjuvant. The cytotoxic response induced against a lymphocytic choriomeningitis virus (LCMV) peptide linked to these microspheres was compared to the cytotoxic T-lymphocyte (CTL) response obtained upon immunization with the nonreplicative porcine parvovirus-like particles (PPV:VLP) carrying the same peptide (PPV:VLP-LCMV) previously described (C. Sedlik, M. F. Saron, J. Sarraseca, I. Casal, and C. Leclerc, Proc. Natl. Acad. Sci. USA 94:7503–7508, 1997). We show that the induction of specific CTL activity by peptides bound to microspheres requires CD4+ T-cell help in contrast to the CTL response obtained with the peptide delivered by viral pseudoparticles. Furthermore, PPV:VLP are 100-fold more efficient than microspheres in generating a strong CTL response characterized by a high frequency of specific T cells of high avidity. Moreover, PPV:VLP-LCMV are able to protect mice against a lethal LCMV challenge whereas microspheres carrying the LCMV epitope fail to confer such protection. This study demonstrates the crucial involvement of the frequency and avidity of CTLs in conferring antiviral protective immunity and highlights the importance of considering these parameters when developing new vaccine strategies. PMID:10846055
Amiel, Eyal; Lovewell, Rustin R.; O'Toole, George A.; Hogan, Deborah A.; Berwin, Brent
2010-01-01
Pseudomonas aeruginosa is a pathogenic Gram-negative bacterium that causes severe opportunistic infections in immunocompromised individuals; in particular, severity of infection with P. aeruginosa positively correlates with poor prognosis in cystic fibrosis (CF) patients. Establishment of chronic infection by this pathogen is associated with downregulation of flagellar expression and of other genes that regulate P. aeruginosa motility. The current paradigm is that loss of flagellar expression enables immune evasion by the bacteria due to loss of engagement by phagocytic receptors that recognize flagellar components and loss of immune activation through flagellin-mediated Toll-like receptor (TLR) signaling. In this work, we employ bacterial and mammalian genetic approaches to demonstrate that loss of motility, not the loss of the flagellum per se, is the critical factor in the development of resistance to phagocytosis by P. aeruginosa. We demonstrate that isogenic P. aeruginosa mutants deficient in flagellar function, but retaining an intact flagellum, are highly resistant to phagocytosis by both murine and human phagocytic cells at levels comparable to those of flagellum-deficient mutants. Furthermore, we show that loss of MyD88 signaling in murine phagocytes does not recapitulate the phagocytic deficit observed for either flagellum-deficient or motility-deficient P. aeruginosa mutants. Our data demonstrate that loss of bacterial motility confers a dramatic resistance to phagocytosis that is independent of both flagellar expression and TLR signaling. These findings provide an explanation for the well-documented observation of nonmotility in clinical P. aeruginosa isolates and for how this phenotype confers upon the bacteria an advantage in the context of immune evasion. PMID:20457788
Watson, Gregory A; Naran, Sanjay; Zhang, Xinglu; Stang, Michael T; Queiroz de Oliveira, Pierre E; Hughes, Steven J
2011-01-01
Introduction The CD95/CD95L pathway plays a critical role in tissue homeostasis and immune system regulation; however, the function of this pathway in malignancy remains poorly understood. We hypothesized that CD95L expression in esophageal adenocarcinoma confers advantages to the neoplasm other than immune privilege. Methods CD95L expression was characterized in immortalized squamous esophagus (HET-1A) and Barrett esophagus (BAR-T) cells; adenocarcinoma cell lines FLO-1, SEG-1, and BIC-1, and MDA468 (- control); and KFL cells (+ control). Analyses included reverse transcription-polymerase chain reaction, immunoblots of whole cell and secretory vesicle lysates, FACScan analysis, laser scanning confocal microscopy of native proteins and fluorescent constructs, and assessment of apoptosis and ERK1/2 pathways. Results Cleaved, soluble CD95L is expressed at both the RNA and protein levels in these cell lines derived from esophageal adenocarcinoma and other human tissues. CD95L was neither trafficked to the cell membrane nor secreted into the media or within vesicles, rather the protein seems to be sequestered in the cytoplasm. CD95 and CD95L colocalize by immunofluorescence, but an interaction was not proven by immunoprecipitation. Overexpression of CD95L in the adenocarcinoma cell lines induced robust apoptosis and, under conditions of pan-caspase inhibition, resulted in activation of ERK signaling. Conclusions CD95L localization in EA cells is inconsistent with the conference of immune privilege and is more consistent with a function that promotes tumor growth through alternative CD95 signaling. Reduced cell surface expression of CD95 affects cell sensitivity to extracellular apoptotic signals more significantly than alterations in downstream modulators of apoptosis. PMID:21390183
The diabetes type 1 locus Idd6 modulates activity of CD4+CD25+ regulatory T-cells.
Rogner, Ute Christine; Lepault, Françoise; Gagnerault, Marie-Claude; Vallois, David; Morin, Joëlle; Avner, Philip; Boitard, Christian
2006-01-01
The genetic locus Idd6 confers susceptibility to the spontaneous development of type 1 diabetes in the NOD mouse. Our studies on disease resistance of the congenic mouse strain NOD.C3H 6.VIII showed that Idd6 influences T-cell activities in the peripheral immune system and suggest that a major mechanism by which the Idd6 locus modifies diabetes development is via modulation of regulatory T-cell activities. Our transfer experiments using total splenocytes and purified T-cells demonstrated that the locus specifically controls the efficiency of disease protection mediated by the regulatory CD4(+)CD25(+) T-cell subset. Our data also implicate the Idd6 locus in controlling the balance between infiltrating lymphocytes and antigen-presenting cells within the pancreatic islet.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Park, Chang-Jin; Wei, Tong; Sharma, Rita
The rice immune receptor XA21 confers resistance to the bacterial pathogen, Xanthomonas oryzae pv. oryzae (Xoo). To elucidate the mechanism of XA21-mediated immunity, we previously performed a yeast two-hybrid screening for XA21 interactors and identified XA21 binding protein 21 (XB21). Here, we report that XB21 is an auxilin-like protein predicted to function in clathrin-mediated endocytosis. We demonstrate an XA21/XB21 in vivo interaction using co-immunoprecipitation in rice. Overexpression of XB21 in rice variety Kitaake and a Kitaake transgenic line expressing XA21 confers a necrotic lesion phenotype and enhances resistance to Xoo. RNA sequencing reveals that XB21 overexpression results in the differentialmore » expression of 8735 genes (4939 genes up- and 3846 genes down-regulated) (≥2-folds, FDR ≤0.01). The up-regulated genes include those predicted to be involved in ‘cell death’ and ‘vesicle-mediated transport’. These results indicate that XB21 plays a role in the plant immune response and in regulation of cell death. The up-regulation of genes controlling ‘vesicle-mediated transport’ in XB21 overexpression lines is consistent with a functional role for XB21 as an auxilin.« less
Park, Chang-Jin; Wei, Tong; Sharma, Rita; ...
2017-06-02
The rice immune receptor XA21 confers resistance to the bacterial pathogen, Xanthomonas oryzae pv. oryzae (Xoo). To elucidate the mechanism of XA21-mediated immunity, we previously performed a yeast two-hybrid screening for XA21 interactors and identified XA21 binding protein 21 (XB21). Here, we report that XB21 is an auxilin-like protein predicted to function in clathrin-mediated endocytosis. We demonstrate an XA21/XB21 in vivo interaction using co-immunoprecipitation in rice. Overexpression of XB21 in rice variety Kitaake and a Kitaake transgenic line expressing XA21 confers a necrotic lesion phenotype and enhances resistance to Xoo. RNA sequencing reveals that XB21 overexpression results in the differentialmore » expression of 8735 genes (4939 genes up- and 3846 genes down-regulated) (≥2-folds, FDR ≤0.01). The up-regulated genes include those predicted to be involved in ‘cell death’ and ‘vesicle-mediated transport’. These results indicate that XB21 plays a role in the plant immune response and in regulation of cell death. The up-regulation of genes controlling ‘vesicle-mediated transport’ in XB21 overexpression lines is consistent with a functional role for XB21 as an auxilin.« less
Protein-protein interactions in the RPS4/RRS1 immune receptor complex
Sarris, Panagiotis F.
2017-01-01
Plant NLR (Nucleotide-binding domain and Leucine-rich Repeat) immune receptor proteins are encoded by Resistance (R) genes and confer specific resistance to pathogen races that carry the corresponding recognized effectors. Some NLR proteins function in pairs, forming receptor complexes for the perception of specific effectors. We show here that the Arabidopsis RPS4 and RRS1 NLR proteins are both required to make an authentic immune complex. Over-expression of RPS4 in tobacco or in Arabidopsis results in constitutive defense activation; this phenotype is suppressed in the presence of RRS1. RRS1 protein co-immunoprecipitates (co-IPs) with itself in the presence or absence of RPS4, but in contrast, RPS4 does not associate with itself in the absence of RRS1. In the presence of RRS1, RPS4 associates with defense signaling regulator EDS1 solely in the nucleus, in contrast to the extra-nuclear location found in the absence of RRS1. The AvrRps4 effector does not disrupt RPS4-EDS1 association in the presence of RRS1. In the absence of RRS1, AvrRps4 interacts with EDS1, forming nucleocytoplasmic aggregates, the formation of which is disturbed by the co-expression of PAD4 but not by SAG101. These data indicate that the study of an immune receptor protein complex in the absence of all components can result in misleading inferences, and reveals an NLR complex that dynamically interacts with the immune regulators EDS1/PAD4 or EDS1/SAG101, and with effectors, during the process by which effector recognition is converted to defense activation. PMID:28475615
Lee, Chan-Ho; Yoon, Seong-Jin; Lee, Sun-Mee
2012-01-01
Sepsis is a complex, multifactorial, rapidly progressive disease characterized by an overwhelming activation of the immune system and the countervailing antiinflammatory response. In the current study in murine peritoneal macrophages, chlorogenic acid suppressed endotoxin-induced high mobility group box 1 (HMGB1) release in a concentration-dependent manner. Administration of chlorogenic acid also attenuated systemic HMGB1 accumulation in vivo and prevented mortality induced by endotoxemia and polymicrobial sepsis. The mechanisms of action of chlorogenic acid included attenuation of the increase in toll-like receptor (TLR)-4 expression and suppression of sepsis-induced signaling pathways, such as c-Jun NH2-terminal kinase (JNK), p38 mitogen-activated protein kinase (MAPK) and nuclear factor (NF)-κB, which are critical for cytokine release. The protection conferred by chlorogenic acid was achieved through modulation of cytokine and chemokine release, suppression of immune cell apoptosis and augmentation of bacterial elimination. Chlorogenic acid warrants further evaluation as a potential therapeutic agent for the treatment of sepsis and other potentially fatal systemic inflammatory disorders. PMID:23168580
Submergence Confers Immunity Mediated by the WRKY22 Transcription Factor in Arabidopsis[W
Hsu, Fu-Chiun; Chou, Mei-Yi; Chou, Shu-Jen; Li, Ya-Ru; Peng, Hsiao-Ping; Shih, Ming-Che
2013-01-01
Transcriptional control plays an important role in regulating submergence responses in plants. Although numerous genes are highly induced during hypoxia, their individual roles in hypoxic responses are still poorly understood. Here, we found that expression of genes that encode members of the WRKY transcription factor family was rapidly and strongly induced upon submergence in Arabidopsis thaliana, and this induction correlated with induction of a large portion of innate immunity marker genes. Furthermore, prior submergence treatment conferred higher resistance to the bacterial pathogen Pseudomonas syringae in Arabidopsis. Among the WRKY genes tested, WRKY22 had the highest level of induction during the early stages of submergence. Compared with the wild type, WRKY22 T-DNA insertion mutants wrky22-1 and wrky22-2 had lower disease resistance and lower induction of innate immunity markers, such as FLG22-INDUCED RECEPTOR-LIKE KINASE1 (FRK1) and WRKY53, after submergence. Furthermore, transcriptomic analyses of wrky22-2 and chromatin immunoprecipitation identified several potential targets of WRKY22, which included genes encoding a TIR domain–containing protein, a plant peptide hormone, and many OLIGO PEPTIDE TRANSPORTER genes, all of which may lead to induction of innate immunity. In conclusion, we propose that submergence triggers innate immunity in Arabidopsis via WRKY22, a response that may protect against a higher probability of pathogen infection either during or after flooding. PMID:23897923
Sun, EnCheng; Zhao, Jing; TaoYang; Xu, QingYuan; Qin, YongLi; Wang, WenShi; Wei, Peng; Wu, DongLai
2013-09-27
Japanese encephalitis virus (JEV) and West Nile virus (WNV) are two medically important flaviviruses that can cause severe hemorrhagic and encephalitic diseases in humans. Immune responses directed against the NS1 protein of flaviviruses can confer protection against lethal viral challenge. Previous studies have shown that the WNV NS1 protein harbors epitopes that elicit antibodies that cross react with JEV. Here we demonstrate that the WNV NS1 protein not only contains cross-reactive epitopes, but that the antibodies elicited by these cross-reactive epitopes provide partial protection against lethal JEV challenge in a mouse model. Mice immunized with WNV NS1 protein showed reduced morbidity and mortality following both intracerebral and intraperitoneal JEV challenge. WNV NS1 immunization attenuated the extent of lung pathology generated following JEV challenge, and delayed the appearance of other pathological findings including vascular cuffing. By screening and identifying the specific WNV NS1 protein-derived peptides recognized by serum antibodies elicited by immunization with WNV NS1 protein and by JEV challenge, we found after JEV challenge will induce several new epitopes, but which epitope primarily contribute to antibody-mediated cross protection need further evaluation. The knowledge and reagents generated in this study have potential applications in vaccine and subunit vaccine development for WNV and JEV. Copyright © 2013 Elsevier B.V. All rights reserved.
Russano, A M; Agea, E; Casciari, C; de Benedictis, F M; Spinozzi, F
2008-11-01
Recent advances in allergy research mostly focussed on two major headings: improving protein allergen purification, which is aimed towards a better characterization of IgE- and T-cell reactive epitopes, and the potential new role for unconventional innate and regulatory T cells in controlling airway inflammation. These advancements could appear to be in conflict each other, as innate T cells have a poorly-defined antigen specificity that is often directed toward nonprotein substances, such as lipids. To reconcile these contrasting findings, the model of cypress pollinosis as paradigmatic for studying allergic diseases in adults is suggested. The biochemical characterization of major native protein allergens from undenatured pollen grain demonstrated that the most relevant substance with IgE-binding activity is a glycohydrolase enzyme, which easily denaturizes in stored grains. Moreover, lipids from the pollen membrane are implicated in early pollen grain capture and recognition by CD1(+) dendritic cells (DC) and CD1-restricted T lymphocytes. These T cells display Th0/Th2 functional activity and are also able to produce regulatory cytokines, such as IL-10 and TGF-beta. CD1(+) immature DCs expand in the respiratory mucosa of allergic subjects and are able to process both proteins and lipids. A final scenario may suggest that expansion and functional activation of CD1(+) DCs is a key step for mounting a Th0/Th2-deviated immune response, and that such innate response does not confer long-lasting protective immunity.
OK-432 synergizes with IFN-γ to confer dendritic cells with enhanced antitumor immunity.
Pan, Ke; Lv, Lin; Zheng, Hai-xia; Zhao, Jing-jing; Pan, Qiu-zhong; Li, Jian-jun; Weng, De-sheng; Wang, Dan-dan; Jiang, Shan-shan; Chang, Alfred E; Li, Qiao; Xia, Jian-chuan
2014-03-01
Generation of functional dendritic cells (DCs) with boosted immunity after the withdrawal of initial activation/maturation conditions remains a significant challenge. In this study, we investigated the impact of a newly developed maturation cocktail consisting of OK-432 and interferon-gamma (IFN-γ) on the function of human monocyte-derived DCs (MoDCs). We found that OK-432 plus IFN-γ stimulation could induce significantly stronger expression of surface molecules, production of cytokines, as well as migration of DCs compared with OK-432 stimulation alone. Most importantly, DCs matured with OK-432 plus IFN-γ-induced maintained secretion of interleukin-12 (IL-12)p70 in secondary culture after stimulus withdrawal. Functionally, OK-432 plus IFN-γ-conditioned DCs induce remarkable Th1 and Tc1 responses more effectively than OK-432 alone, even more than the use of α-type-1 cytokine cocktail. As a result, DCs matured with OK-432 plus IFN-γ can prime stronger cytotoxic lymphocyte (CTL) and natural killer (NK) cell response against tumor cells in vitro. Peripheral blood mononuclear cells activated by DCs matured with OK-432 plus IFN-γ also showed greater tumor growth inhibition in vivo in null mice. Molecular mechanistic analysis showed that DC maturation using IFN-γ in concert with OK-432 involves the activation of p38 and nuclear factor-kappa B (NF-κB) pathways. This study provided a novel strategy to generate more potent immune segments in DC vaccine.
Woo, Joo Yong; Jeong, Kwang Ju; Kim, Young Jin; Paek, Kyung-Hee
2016-01-01
In Arabidopsis, several L-type lectin receptor kinases (LecRKs) have been identified as putative immune receptors. However, to date, there have been few analyses of LecRKs in crop plants. Virus-induced gene silencing of CaLecRK-S.5 verified the role of CaLecRK-S.5 in broad-spectrum resistance. Compared with control plants, CaLecRK-S.5-silenced plants showed reduced hypersensitive response, reactive oxygen species burst, secondary metabolite production, mitogen-activated protein kinase activation, and defense-related gene expression in response to Tobacco mosaic virus pathotype P0 (TMV-P0) infection. Suppression of CaLecRK-S.5 expression significantly enhanced the susceptibility to Pepper mild mottle virus pathotype P1,2,3, Xanthomonas campestris pv. vesicatoria, Phytophthora capsici, as well as TMV-P0. Additionally, β-aminobutyric acid treatment and a systemic acquired resistance assay revealed that CaLecRK-S.5 is involved in priming of plant immunity. Pre-treatment with β-aminobutyric acid before viral infection restored the reduced disease resistance phenotypes shown in CaLecRK-S.5-silenced plants. Systemic acquired resistance was also abolished in CaLecRK-S.5-silenced plants. Finally, RNA sequencing analysis indicated that CaLecRK-S.5 positively regulates plant immunity at the transcriptional level. Altogether, these results suggest that CaLecRK-S.5-mediated broad-spectrum resistance is associated with the regulation of priming. PMID:27647723
Petitdidier, Elodie; Pagniez, Julie; Papierok, Gérard; Vincendeau, Philippe; Lemesre, Jean-Loup; Bras-Gonçalves, Rachel
2016-01-01
Preventive vaccination is a highly promising strategy for interrupting leishmaniasis transmission that can, additionally, contribute to elimination. A vaccine formulation based on naturally excreted secreted (ES) antigens was prepared from L. infantum promastigote culture supernatant. This vaccine achieved successful results in Phase III trials and was licensed and marketed as CaniLeish. We recently showed that newly identified ES promastigote surface antigen (PSA), from both viable promastigotes and axenically-grown amastigotes, represented the major constituent and the highly immunogenic antigen of L. infantum and L. amazonensis ES products. We report here that three immunizations with either the recombinant ES LaPSA-38S (rPSA) or its carboxy terminal part LaPSA-12S (Cter-rPSA), combined with QA-21 as adjuvant, confer high levels of protection in naive L. infantum-infected Beagle dogs, as checked by bone marrow parasite absence in respectively 78.8% and 80% of vaccinated dogs at 6 months post-challenge. The parasite burden in infected vaccinated dogs was significantly reduced compared to placebo group, as measured by q-PCR. Moreover, our results reveal humoral and cellular immune response clear-cut differences between vaccinated and control dogs. An early increase in specific IgG2 antibodies was observed in rPSA/QA-21- and Cter-rPSA/QA-21-immunized dogs only. They were found functionally active in vitro and were highly correlated with vaccine protection. In vaccinated protected dogs, IFN-γ and NO productions, as well as anti-leishmanial macrophage activity, were increased. These data strongly suggest that ES PSA or its carboxy-terminal part, in recombinant forms, induce protection in a canine model of zoonotic visceral leishmaniasis by inducing a Th1-dominant immune response and an appropriate specific antibody response. These data suggest that they could be considered as important active components in vaccine candidates. PMID:27223609
Petitdidier, Elodie; Pagniez, Julie; Papierok, Gérard; Vincendeau, Philippe; Lemesre, Jean-Loup; Bras-Gonçalves, Rachel
2016-05-01
Preventive vaccination is a highly promising strategy for interrupting leishmaniasis transmission that can, additionally, contribute to elimination. A vaccine formulation based on naturally excreted secreted (ES) antigens was prepared from L. infantum promastigote culture supernatant. This vaccine achieved successful results in Phase III trials and was licensed and marketed as CaniLeish. We recently showed that newly identified ES promastigote surface antigen (PSA), from both viable promastigotes and axenically-grown amastigotes, represented the major constituent and the highly immunogenic antigen of L. infantum and L. amazonensis ES products. We report here that three immunizations with either the recombinant ES LaPSA-38S (rPSA) or its carboxy terminal part LaPSA-12S (Cter-rPSA), combined with QA-21 as adjuvant, confer high levels of protection in naive L. infantum-infected Beagle dogs, as checked by bone marrow parasite absence in respectively 78.8% and 80% of vaccinated dogs at 6 months post-challenge. The parasite burden in infected vaccinated dogs was significantly reduced compared to placebo group, as measured by q-PCR. Moreover, our results reveal humoral and cellular immune response clear-cut differences between vaccinated and control dogs. An early increase in specific IgG2 antibodies was observed in rPSA/QA-21- and Cter-rPSA/QA-21-immunized dogs only. They were found functionally active in vitro and were highly correlated with vaccine protection. In vaccinated protected dogs, IFN-γ and NO productions, as well as anti-leishmanial macrophage activity, were increased. These data strongly suggest that ES PSA or its carboxy-terminal part, in recombinant forms, induce protection in a canine model of zoonotic visceral leishmaniasis by inducing a Th1-dominant immune response and an appropriate specific antibody response. These data suggest that they could be considered as important active components in vaccine candidates.
Schussek, Sophie; Trieu, Angela; Apte, Simon H; Sidney, John; Sette, Alessandro; Doolan, Denise L
2013-10-01
Apical membrane antigen 1 (AMA-1) is a leading blood-stage malaria vaccine candidate. Consistent with a key role in erythrocytic invasion, AMA-1-specific antibodies have been implicated in AMA-1-induced protective immunity. AMA-1 is also expressed in sporozoites and in mature liver schizonts where it may be a target of protective cell-mediated immunity. Here, we demonstrate for the first time that immunization with AMA-1 can induce sterile infection-blocking immunity against Plasmodium sporozoite challenge in 80% of immunized mice. Significantly higher levels of gamma interferon (IFN-γ)/interleukin-2 (IL-2)/tumor necrosis factor (TNF) multifunctional T cells were noted in immunized mice than in control mice. We also report the first identification of minimal CD8(+) and CD4(+) T cell epitopes on Plasmodium yoelii AMA-1. These data establish AMA-1 as a target of both preerythrocytic- and erythrocytic-stage protective immune responses and validate vaccine approaches designed to induce both cellular and humoral immunity.
Marcelin, Glendie; Sandbulte, Matthew R.; Webby, Richard J.
2012-01-01
SUMMARY Vaccines are instrumental in controlling the burden of influenza virus infection in humans and animals. Antibodies raised against both major viral surface glycoproteins, hemagglutinin (HA) and neuraminidase (NA), can contribute to protective immunity. Vaccine-induced HA antibodies have been characterized extensively, and they generally confer protection by blocking the attachment and fusion of a homologous virus onto host cells. Though not as well characterized, some functions of NA antibodies in influenza vaccine-mediated immunity have been recognized for many years. In this review we summarize the case for NA antibodies in influenza vaccine-mediated immunity. In the absence of well-matched HA antibodies, NA antibodies can provide varying degrees of protection against disease. NA proteins of seasonal influenza vaccines have been shown in some instances to elicit serum antibodies with cross-reactivity to avian- and swine-origin influenza strains, in addition to HA drift variants. NA-mediated immunity has been linked to [i] conserved NA epitopes amongst otherwise antigenically distinct strains, partly attributable to the segmented influenza viral genome; [ii] inhibition of NA enzymatic activity; and [iii] the NA content in vaccine formulations. There is potential to enhance the effectiveness of existing and future influenza vaccines by focusing greater attention on the antigenic characteristics and potency of the NA protein. PMID:22438243
Hewitson, James P.; Filbey, Kara J.; Esser-von Bieren, Julia; Camberis, Mali; Schwartz, Christian; Murray, Janice; Reynolds, Lisa A.; Blair, Natalie; Robertson, Elaine; Harcus, Yvonne; Boon, Louis; Huang, Stanley Ching-Cheng; Yang, Lihua; Tu, Yizheng; Miller, Mark J.; Voehringer, David; Le Gros, Graham; Harris, Nicola; Maizels, Rick M.
2015-01-01
Over 25% of the world's population are infected with helminth parasites, the majority of which colonise the gastrointestinal tract. However, no vaccine is yet available for human use, and mechanisms of protective immunity remain unclear. In the mouse model of Heligmosomoides polygyrus infection, vaccination with excretory-secretory (HES) antigens from adult parasites elicits sterilising immunity. Notably, three purified HES antigens (VAL-1, -2 and -3) are sufficient for effective vaccination. Protection is fully dependent upon specific IgG1 antibodies, but passive transfer confers only partial immunity to infection, indicating that cellular components are also required. Moreover, immune mice show greater cellular infiltration associated with trapping of larvae in the gut wall prior to their maturation. Intra-vital imaging of infected intestinal tissue revealed a four-fold increase in extravasation by LysM+GFP+ myeloid cells in vaccinated mice, and the massing of these cells around immature larvae. Mice deficient in FcRγ chain or C3 complement component remain fully immune, suggesting that in the presence of antibodies that directly neutralise parasite molecules, the myeloid compartment may attack larvae more quickly and effectively. Immunity to challenge infection was compromised in IL-4Rα- and IL-25-deficient mice, despite levels of specific antibody comparable to immune wild-type controls, while deficiencies in basophils, eosinophils or mast cells or CCR2-dependent inflammatory monocytes did not diminish immunity. Finally, we identify a suite of previously uncharacterised heat-labile vaccine antigens with homologs in human and veterinary parasites that together promote full immunity. Taken together, these data indicate that vaccine-induced immunity to intestinal helminths involves IgG1 antibodies directed against secreted proteins acting in concert with IL-25-dependent Type 2 myeloid effector populations. PMID:25816012
77 FR 21625 - Interpretations; Removal of Part 8
Federal Register 2010, 2011, 2012, 2013, 2014
2012-04-11
... course of conduct, conferring a right, privilege, authority, or immunity, or imposing an obligation.'' 1... Intergovernmental relations, Inventions and patents, Nuclear power plants and reactors. PART 8--INTERPRETATIONS...
On considering the influence of recovered individuals in disease propagations
NASA Astrophysics Data System (ADS)
Moraes, A. L. S.; Monteiro, L. H. A.
2016-05-01
Consider diseases transmitted through personal contacts, for which recovery usually confers complete and long-lasting immunity, like some of the common viral infections of childhood. Here, an epidemic model based on differential equations is proposed to evaluate the influence of the recovered (immune) individuals on the spread of such diseases. Indeed, immune individuals can affect the infection rate of susceptible individuals and the recovery rate of sick individuals. The predictive ability of the proposed model is assessed from records concerning the incidence of varicella in three European countries, in a pre-vaccination era.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jung, Ho Won; Tschaplinski, Timothy J; Wang, Lin
Upon local infection, plants possess inducible systemic defense responses against their natural enemies. Bacterial infection results in the accumulation to high levels of the mobile metabolite C9-dicarboxylic acid azelaic acid in the vascular sap of Arabidopsis. Azelaic acid confers local and systemic resistance against Pseudomonas syringae. The compound primes plants to strongly accumulate salicylic acid (SA), a known defense signal, upon infection. Mutation of a gene induced by azelaic acid (AZI1) results in the specific loss in plants of systemic immunity triggered by pathogen or azelaic acid and of the priming of SA induction. AZI1, a predicted secreted protein, ismore » also important for generating vascular sap that confers disease resistance. Thus, azelaic acid and AZI1 comprise novel components of plant systemic immunity involved in priming defenses.« less
New paradigms in type 2 immunity.
Pulendran, Bali; Artis, David
2012-07-27
Nearly half of the world's population harbors helminth infections or suffers from allergic disorders. A common feature of this population is the so-called "type 2 immune response," which confers protection against helminths, but also promotes pathologic responses associated with allergic inflammation. However, the mechanisms that initiate and control type 2 responses remain enigmatic. Recent advances have revealed a role for the innate immune system in orchestrating type 2 responses against a bewildering array of stimuli, from nanometer-sized allergens to 20-meter-long helminth parasites. Here, we review these advances and suggest that the human immune system has evolved multiple mechanisms of sensing such stimuli, from recognition of molecular patterns via innate immune receptors to detecting metabolic changes and tissue damage caused by these stimuli.
Ghequire, Maarten G K; Kemland, Lieselore; Anoz-Carbonell, Ernesto; Buchanan, Susan K; De Mot, René
2017-02-21
Modular bacteriocins represent a major group of secreted protein toxins with a narrow spectrum of activity, involved in interference competition between Gram-negative bacteria. These antibacterial proteins include a domain for binding to the target cell and a toxin module at the carboxy terminus. Self-inhibition of producers is provided by coexpression of linked immunity genes that transiently inhibit the toxin's activity through formation of bacteriocin-immunity complexes or by insertion in the inner membrane, depending on the type of toxin module. We demonstrate strain-specific inhibitory activity for PmnH, a Pseudomonas bacteriocin with an unprecedented dual-toxin architecture, hosting both a colicin M domain, potentially interfering with peptidoglycan synthesis, and a novel colicin N-type domain, a pore-forming module distinct from the colicin Ia-type domain in Pseudomonas aeruginosa pyocin S5. A downstream-linked gene product confers PmnH immunity upon susceptible strains. This protein, ImnH, has a transmembrane topology similar to that of Pseudomonas colicin M-like and pore-forming immunity proteins, although homology with either of these is essentially absent. The enhanced killing activity of PmnH under iron-limited growth conditions reflects parasitism of the ferrichrome-type transporter for entry into target cells, a strategy shown here to be used as well by monodomain colicin M-like bacteriocins from pseudomonads. The integration of a second type of toxin module in a bacteriocin gene could offer a competitive advantage against bacteria displaying immunity against only one of both toxic activities. IMPORTANCE In their continuous struggle for ecological space, bacteria face a huge load of contenders, including phylogenetically related strains that compete for the same niche. One important group of secreted antibacterial proteins assisting in eliminating these rivals are modular bacteriocins of Gram-negative bacteria, comprising a domain for docking onto the cell envelope of a target cell, a translocation domain enabling subsequent cellular entry, and a toxin module that kills target cells via enzymatic or pore-forming activity. We here demonstrate the antagonistic function of a Pseudomonas bacteriocin with unique architecture that combines a putative enzymatic colicin M-like domain and a novel pore-forming toxin module. For target cell recognition and entry, this bacteriocin hybrid takes advantage of the ferrichrome transporter, also parasitized by enzymatic Pseudomonas bacteriocins devoid of the pore-forming module. Bacteriocins with an expanded toxin potential may represent an inventive bacterial strategy to alleviate immunity in target cells. Copyright © 2017 Ghequire et al.
2014-01-01
Background The coinhibitory receptor Programmed Death-1 (PD-1) inhibits effector functions of activated T cells and prevents autoimmunity, however, cancer hijack this pathway to escape from immune attack. The costimulatory receptor glucocorticoid-induced TNFR related protein (GITR) is up-regulated on activated T cells and increases their proliferation, activation and cytokine production. We hypothesize that concomitant PD-1 blockade and GITR triggering would synergistically improve the effector functions of tumor-infiltrating T cells and increase the antitumor immunity. In present study, we evaluated the antitumor effects and mechanisms of combined PD-1 blockade and GITR triggering in a clinically highly relevant murine ID8 ovarian cancer model. Methods Mice with 7 days-established peritoneal ID8 ovarian cancer were treated intraperitoneally (i.p.) with either control, anti-PD-1, anti-GITR or anti-PD-1/GITR monoclonal antibody (mAb) and their survival was evaluated; the phenotype and function of tumor-associated immune cells in peritoneal cavity of treated mice was analyzed by flow cytometry, and systemic antigen-specific immune response was evaluated by ELISA and cytotoxicity assay. Results Combined anti-PD-1/GITR mAb treatment remarkably inhibited peritoneal ID8 tumor growth with 20% of mice tumor free 90 days after tumor challenge while treatment with either anti-PD-1 or anti-GITR mAb alone exhibited little antitumor effect. The durable antitumor effect was associated with a memory immune response and conferred by CD4+ cells and CD8+ T cells. The treatment of anti-PD-1/GITR mAb increased the frequencies of interferon-γ-producing effector T cells and decreased immunosuppressive regulatory T cells and myeloid-derived suppressor cells, shifting an immunosuppressive tumor milieu to an immunostimulatory state in peritoneal cavity. In addition, combined treatment of anti-PD-1/GITR mAb mounted an antigen-specific immune response as evidenced by antigen-specific IFN-γ production and cytolytic activity of spleen cells from treated mice. More importantly, combined treatment of anti-PD-1/GITR mAb and chemotherapeutic drugs (cisplatin or paclitaxel) further increased the antitumor efficacy with 80% of mice obtaining tumor-free long-term survival in murine ID8 ovarian cancer and 4 T1 breast cancer models. Conclusions Combined anti-PD-1/GITR mAb treatment induces a potent antitumor immunity, which can be further promoted by chemotherapeutic drugs. A combined strategy of anti-PD-1/GITR mAb plus cisplatin or paclitaxel should be considered translation into clinic. PMID:24502656
Yang, Ji-Rong; Chen, Chih-Yuan; Kuo, Chuan-Yi; Cheng, Chieh-Yu; Lee, Min-Shiuh; Cheng, Ming-Chu; Yang, Yu-Chih; Wu, Chia-Ying; Wu, Ho-Sheng; Liu, Ming-Tsan; Hsiao, Pei-Wen
2016-02-01
Avian influenza A(H6N1) virus is one of the most common viruses isolated from migrating birds and domestic poultry in many countries. The first and only known case of human infection by H6N1 virus in the world was reported in Taiwan in 2013. This led to concern that H6N1 virus may cause a threat to public health. In this study, we engineered a recombinant H6N1 virus-like particle (VLP) and investigated its vaccine effectiveness compared to the traditional egg-based whole inactivated virus (WIV) vaccine. The H6N1-VLPs exhibited similar morphology and functional characteristics to influenza viruses. Prime-boost intramuscular immunization in mice with unadjuvanted H6N1-VLPs were highly immunogenic and induced long-lasting antibody immunity. The functional activity of the VLP-elicited IgG antibodies was proved by in vitro seroprotective hemagglutination inhibition and microneutralization titers against the homologous human H6N1 virus, as well as in vivo viral challenge analyses which showed H6N1-VLP immunization significantly reduced viral load in the lung, and protected against human H6N1 virus infection. Of particular note, the H6N1-VLPs but not the H6N1-WIVs were able to confer cross-reactive humoral immunity; antibodies induced by H6N1-VLP vaccine robustly inhibited the hemagglutination activities and in vitro replication of distantly-related heterologous avian H6N1 viruses. Furthermore, the H6N1-VLPs were found to elicit significantly greater anti-HA2 antibody responses in immunized mice than H6N1-WIVs. Collectively, we demonstrated for the first time a novel H6N1-VLP vaccine that effectively provides broadly protective immunity against both human and avian H6N1 viruses. These results, which uncover the underlying mechanisms for induction of wide-range immunity against influenza viruses, may be useful for future influenza vaccine development. Copyright © 2015 Elsevier B.V. All rights reserved.
Immunoprotective properties of recombinant LigA and LigB in a hamster model of acute leptospirosis
Lourdault, Kristel; Matsunaga, James; Haake, David A.
2017-01-01
Leptospirosis is the most widespread zoonosis and is considered a major public health problem worldwide. Currently, there is no widely available vaccine against leptospirosis for use in humans. A purified, recombinant subunit vaccine that includes the last six immunoglobulin-like (Ig-like) domains of the leptospiral protein LigA (LigA7’-13) protects against lethal infection but not renal colonization after challenge by Leptospira interrogans. In this study, we examined whether the addition of the first seven Ig-like domains of LigB (LigB0-7) to LigA7’-13, can enhance immune protection and confer sterilizing immunity in the Golden Syrian hamster model of acute leptospirosis. Hamsters were subcutaneously immunized with soluble, recombinant LigA7’-13, LigB0-7, or a combination of LigA7’-13 and LigB0-7 in Freund’s adjuvant. Immunization with Lig proteins generated a strong humoral immune response with high titers of IgG that recognized homologous protein, and cross-reacted with the heterologous protein as assessed by ELISA. LigA7’-13 alone, or in combination with LigB0-7, protected all hamsters from intraperitoneal challenge with a lethal dose of L. interrogans serovar Copenhageni strain Fiocruz L1-130. However, bacteria were recovered from the kidneys of all animals. Of eight animals immunized with LigB0-7, only three survived Leptospira challenge, one of which lacked renal colonization and had antibodies to native LigB by immunoblot. In addition, sera from two of the three LigB0-7 immunized survivors cross-reacted with LigA11-13, a region of LigA that is sufficient for protection. In summary, we confirmed that LigA7’-13 protects hamsters from death but not infection, and immunization with LigB0-7, either alone or in combination with LigA7’-13, did not confer sterilizing immunity. PMID:28704385
DNA Vaccines - A Modern Gimmick or a Boon to Vaccinology?
Manickan, Elanchezhiyan; Karem, Kevin L; Rouse, Barry T
2017-01-01
The reports in 1993 that naked DNA encoding viral genes conferred protective immunity came as a surprise to most vaccinologists. This review analyses the expanding number of examples where plasmid DNA induces immune responses. Issues such as the type of immunity induced, mechanisms of immune protection, and how DNA vaccines compare with other approaches are emphasized. Additional issues discussed include the likely means by which DNA vaccines induce CTL, how the potency and type of immunity induced can be modified, and whether DNA vaccines represent a practical means of manipulating unwanted immune response occurring during immunoinflammatory diseases. It seems doubtful if DNA vaccines will replace currently effective vaccines, but they may prove useful for prophylactic use against some agents that at present lack an effective vaccine. DNA vaccines promise to be valuable to manipulate the immune response in situations where responses to agents are inappropriate or ineffective.
Drosophila immunity research on the move.
Eleftherianos, Ioannis; Schneider, David
2011-01-01
Drosophila has been established as useful model for infectious diseases because it allows large numbers of whole animals to be studied and provides powerful genetic tools and conservation with signaling and pathogenesis mechanisms in vertebrates. During the past twenty years, significant progress has been made on the characterization of innate immune responses against various pathogenic organisms in flies (Fig. 1). In this year's Drosophila Research Conference, which was held in San Diego (March 30-April 3) and sponsored by the Genetics Society of America, the immunity and pathogenesis session comprised seven platform presentations and 34 posters that highlighted the latest advances in Drosophila infection and immunity field. The presented work covered a wide range of studies from immune signaling pathways and the molecular basis of humoral and cellular immune mechanisms to the role of endosymbionts in fly immune function and effects of immune priming. Here, we give an overview of the presented work and we explain how these findings will open new avenues in Drosophila immunity research.
Van Blarcom, Thomas J.; Sofer-Podesta, Carolina; Ang, John; Boyer, Julie L.; Crystal, Ronald G.; Georgiou, George
2013-01-01
Genetic transfer of neutralizing antibodies has been shown to confer strong and persistent protection against bacterial and viral infectious agents. While it is well established that for many exogenous neutralizing antibodies increased antigen affinity correlates with protection, the effect of antigen affinity on antibodies produced in situ following adenoviral gene transfer has not been examined. The mouse IgG2b monoclonal antibody 2C12.4 recognizes the Yersinia pestis Type III secretion apparatus protein LcrV (V antigen) and confers protection in mice when administered as an IgG intraperitoneally or, following genetic immunization with engineered, replication-defective serotype 5 human adenovirus (Ad) 1. 2C12.4 was expressed as a scFv fragment in E. coli and was shown to display a KD=3.5 nM by surface plasmon resonance (SPR) analysis. The 2C12.4 scFv was subjected to random mutagenesis and variants with increased affinity were isolated by flow cytometry using the Anchored Periplasmic Expression (APEx) bacterial display system. After a single round of mutagenesis, variants displaying up to 35-fold lower KD values (H8, KD=100 pM) were isolated. The variable domains of the H8 scFv were used to replace those of the parental 2C12.4 IgG encoded in the Ad vector, AdαV giving rise to AdαV.H8. The two adenoviral vectors resulted in similar titers of anti-V antigen antibodies 3 days post-immunization with 109, 1010 or 1011 particle units. Following intranasal challenge with 363 LD50Y. pestis CO92, 54% of the mice immunized with 1010 pu of AdαV.H8 survived at the 14 day end point compared to only 15% survivors for the group immunized with AdαV expressing the lower affinity 2C12.4 (P<0.04, AdαV versus AdαV.H8). These results indicate that affinity maturation of a neutralizing antibody delivered by genetic transfer may confer increased protection not only for Y. pestis challenge but possibly for other pathogens. PMID:20393511
Workenhe, Samuel T; Simmons, Graydon; Pol, Jonathan G; Lichty, Brian D; Halford, William P; Mossman, Karen L
2014-01-01
Within the oncolytic virus field, the extent of virus replication that is essential for immune stimulation to control tumor growth remains unresolved. Using infected cell protein 0 (ICP0)-defective oncolytic Herpes simplex virus type 1 (HSV-1) and HSV-2 viruses (dICP0 and dNLS) that show differences in their in vitro replication and cytotoxicity, we investigated the inherent features of oncolytic HSV viruses that are required for potent antitumor activity. In vitro, the HSV-2 vectors showed rapid cytotoxicity despite lower viral burst sizes compared to HSV-1 vectors. In vivo, although both of the dICP0 vectors initially replicated to a similar level, HSV-1 dICP0 was rapidly cleared from the tumors. In spite of this rapid clearance, HSV-1 dICP0 treatment conferred significant survival benefit. HSV-1 dICP0-treated tumors showed significantly higher levels of danger-associated molecular patterns that correlated with higher numbers of antigen-presenting cells within the tumor and increased antigen-specific CD8+ T-cell levels in the peripheral blood. This study suggests that, at least in the context of oncolytic HSV, the initial stages of immunogenic virus replication leading to activation of antitumor immunity are more important than persistence of a replicating virus within the tumor. This knowledge provides important insight for the design of therapeutically successful oncolytic viruses.
Habibi, Mehri; Asadi Karam, Mohammad Reza; Shokrgozar, Mohammad Ali; Oloomi, Mana; Jafari, Anis; Bouzari, Saeid
2015-04-01
Urinary tract infections (UTIs) caused by Uropathogenic Escherichia coli (UPEC) and Proteus mirabilis are among the most common infections in the world. Currently there are no vaccines available to confer protection against UTI in humans. In this study, the immune responses and protection of FimH of UPEC with MrpH antigen of P. mirabilis in different vaccine formulations with and without MPL adjuvant were assessed. Mice intranasally immunized with the novel fusion protein MrpH·FimH induced a significant increase in IgG and IgA in serum, nasal wash, vaginal wash, and urine samples. Mice immunized with fusion MrpH·FimH also showed a significant boost in cellular immunity. Addition of MPL as the adjuvant enhanced FimH and MrpH specific humoral and cellular responses in both systemic and mucosal samples. Vaccination with MrpH·FimH alone or in combination with MPL showed the highest efficiency in clearing bladder and kidney infections in mice challenged with UPEC and P. mirabilis. These findings may indicate that the protection observed correlates with the systemic, mucosal and cellular immune responses induced by vaccination with these preparations. Our data suggest MrpH·FimH fusion protein with or without MPL as adjuvant could be potential vaccine candidates for elimination of UPEC and P. mirabilis. These data altogether are promising and these formulations are good candidates for elimination of UPEC and P. mirabilis. Copyright © 2014 Elsevier Ltd. All rights reserved.
Hepatitis B immunity in Australia: a comparison of national and prisoner population serosurveys.
Gidding, H F; Mahajan, D; Reekie, J; Lloyd, A R; Dwyer, D E; Butler, T
2015-10-01
In Australia, hepatitis B (HBV) vaccination is recommended for injecting drug users (IDUs), Indigenous adults and prisoners. We compared immunity to HBV in prisoners and the general population obtained from national serosurveys in 2007. Individuals with HBV surface antibody (HBsAb) positive sera were considered immune from past infection [HBV core antibody (HBcAb) positive] or from vaccination (HBcAb negative). Male prisoners aged 18-58 years had a higher HBsAb seroprevalence than the general population (46·4% vs. 39·4%, P = 0·061). Comparison of HBcAb results was possible for males aged 18-29 years. In this group, higher HBsAb seroprevalence was due to past infection (12·9% vs. 3·0%, P < 0·001), rather than vaccine-conferred immunity (35·3% vs. 43·4%, P = 0·097). All prisoner groups, but especially IDUs, those of Indigenous heritage or those with a previous episode of imprisonment had higher levels of immunity from past infection than the general population (19·3%, 33·0%, 17·1%, respectively, vs. 3·0%, P < 0·05). Indigenous prisoners, non-IDUs and first-time entrants had significantly lower levels of vaccine-conferred immunity than the general population (26·4%, 26·2% and 20·7% respectively vs. 43·4%, P < 0·05). Improving prison-based HBV vaccination would prevent transmission in the prison setting and protect vulnerable members of the community who are at high risk of both infection and entering the prison system.
Chen, Jeng-Chang; Ou, Liang-Shiou; Chan, Cheng-Chi; Kuo, Ming-Ling; Tseng, Li-Yun; Chang, Hsueh-Ling
2018-01-01
According to actively acquired tolerance, antigen exposure before full immune development in fetal or early neonatal life will cause tolerance to this specific antigen. In this study, we aimed to examine whether allogeneic tolerance could be elicited by in utero exposure to surface MHC antigens of allogenic cells or soluble form of MHC exosomes. Gestational day 14 FVB/N fetuses were subjected to intraperitoneal injection of allogeneic major histocompatibility complex (MHC) exosomes or highly enriched B-cells. Postnatally, the recipients were examined for the immune responses to donor alloantigens by lymphocyte proliferative reactions and skin transplantation. In utero exposure to allogeneic MHC exosomes abolished the alloreactivity of recipients' lymphocytes to the alloantigens, but could not confer skin allograft tolerance. In utero transplantation of highly enriched allogeneic B-cells generated low-level B-cell chimerism in the recipients. However, it only extended the survivals of skin allograft by a few days despite the lack of donor-specific alloreactivity of recipients' lymphocyte. Thus, an early in utero contact with exosomal or B-cell alloantigens did not lead to full skin tolerance but rather, at best, only to delayed skin rejection in the presence of microchimerism made by B-cell inocula. These results argued against the theory of actively acquired tolerance, and implicated that in utero exposure to marrow cells in previous studies was a unique model of allo-tolerance induction that involved the establishment of significant hematopoietic chimerism. Taken together with the discovery of in utero sensitization to ovalbumin in our previous studies, the immunological consequences of fetal exposure to foreign antigens might vary according to the type or nature of antigens introduced.
Emerging Infections of CNS: Avian Influenza A Virus, Rift Valley Fever Virus and Human Parechovirus.
Wiley, Clayton A; Bhardwaj, Nitin; Ross, Ted M; Bissel, Stephanie J
2015-09-01
History is replete with emergent pandemic infections that have decimated the human population. Given the shear mass of humans that now crowd the earth, there is every reason to suspect history will repeat itself. We describe three RNA viruses that have recently emerged in the human population to mediate severe neurological disease. These new diseases are results of new mutations in the infectious agents or new exposure pathways to the agents or both. To appreciate their pathogenesis, we summarize the essential virology and immune response to each agent. Infection is described in the context of known host defenses. Once the viruses evade immune defenses and enter central nervous system (CNS) cells, they rapidly co-opt host RNA processing to a cataclysmic extent. It is not clear why the brain is particularly susceptible to RNA viruses; but perhaps because of its tremendous dependence on RNA processing for physiological functioning, classical mechanisms of host defense (eg, interferon disruption of viral replication) are diminished or not available. Effectiveness of immunity, immunization and pharmacological therapies is reviewed to contextualize the scope of the public health challenge. Unfortunately, vaccines that confer protection from systemic disease do not necessarily confer protection for the brain after exposure through unconventional routes. © 2015 International Society of Neuropathology.
Méndez-Bravo, Alfonso; Calderón-Vázquez, Carlos; Ibarra-Laclette, Enrique; Raya-González, Javier; Ramírez-Chávez, Enrique; Molina-Torres, Jorge; Guevara-García, Angel A.; López-Bucio, José; Herrera-Estrella, Luis
2011-01-01
Alkamides are fatty acid amides of wide distribution in plants, structurally related to N-acyl-L-homoserine lactones (AHLs) from Gram-negative bacteria and to N- acylethanolamines (NAEs) from plants and mammals. Global analysis of gene expression changes in Arabidopsis thaliana in response to N-isobutyl decanamide, the most highly active alkamide identified to date, revealed an overrepresentation of defense-responsive transcriptional networks. In particular, genes encoding enzymes for jasmonic acid (JA) biosynthesis increased their expression, which occurred in parallel with JA, nitric oxide (NO) and H2O2 accumulation. The activity of the alkamide to confer resistance against the necrotizing fungus Botrytis cinerea was tested by inoculating Arabidopsis detached leaves with conidiospores and evaluating disease symptoms and fungal proliferation. N-isobutyl decanamide application significantly reduced necrosis caused by the pathogen and inhibited fungal proliferation. Arabidopsis mutants jar1 and coi1 altered in JA signaling and a MAP kinase mutant (mpk6), unlike salicylic acid- (SA) related mutant eds16/sid2-1, were unable to defend from fungal attack even when N-isobutyl decanamide was supplied, indicating that alkamides could modulate some necrotrophic-associated defense responses through JA-dependent and MPK6-regulated signaling pathways. Our results suggest a role of alkamides in plant immunity induction. PMID:22076141
Wang, Bao-Zhong; Gill, Harvinder S; He, Cheng; Ou, Changbo; Wang, Li; Wang, Ying-Chun; Feng, Hao; Zhang, Han; Prausnitz, Mark R; Compans, Richard W
2014-03-28
Influenza vaccines with broad cross-protection are urgently needed to prevent an emerging influenza pandemic. A fusion protein of the Toll-like receptor (TLR) 5-agonist domains from flagellin and multiple repeats of the conserved extracellular domain of the influenza matrix protein 2 (M2e) was constructed, purified and evaluated as such a vaccine. A painless vaccination method suitable for possible self-administration using coated microneedle arrays was investigated for skin-targeted delivery of the fusion protein in a mouse model. The results demonstrate that microneedle immunization induced strong humoral as well as mucosal antibody responses and conferred complete protection against homo- and heterosubtypic lethal virus challenges. Protective efficacy with microneedles was found to be significantly better than that seen with conventional intramuscular injection, and comparable to that observed with intranasal immunization. Because of its advantages for administration, safety and storage, microneedle delivery of M2e-flagellin fusion protein is a promising approach for an easy-to-administer universal influenza vaccine. Copyright © 2014 Elsevier B.V. All rights reserved.
Novel allelic variants in ACD6 cause hybrid necrosis in local collection of Arabidopsis thaliana.
Świadek, Magdalena; Proost, Sebastian; Sieh, Daniela; Yu, Jing; Todesco, Marco; Jorzig, Christian; Rodriguez Cubillos, Andrés Eduardo; Plötner, Björn; Nikoloski, Zoran; Chae, Eunyoung; Giavalisco, Patrick; Fischer, Axel; Schröder, Florian; Kim, Sang-Tae; Weigel, Detlef; Laitinen, Roosa A E
2017-01-01
Hybrid necrosis is a common type of hybrid incompatibility in plants. This phenomenon is caused by deleterious epistatic interactions, resulting in spontaneous activation of plant defenses associated with leaf necrosis, stunted growth and reduced fertility in hybrids. Specific combinations of alleles of ACCELERATED CELL DEATH 6 (ACD6) have been shown to be a common cause of hybrid necrosis in Arabidopsis thaliana. Increased ACD6 activity confers broad-spectrum resistance against biotrophic pathogens but reduces biomass production. We generated 996 crosses among individuals derived from a single collection area around Tübingen (Germany) and screened them for hybrid necrosis. Necrotic hybrids were further investigated by genetic linkage, amiRNA silencing, genomic complementation and metabolic profiling. Restriction site associated DNA (RAD)-sequencing was used to understand genetic diversity in the collection sites containing necrosis-inducing alleles. Novel combinations of ACD6 alleles found in neighbouring stands were found to activate the A. thaliana immune system. In contrast to what we observed in controlled conditions, necrotic hybrids did not show reduced fitness in the field. Metabolic profiling revealed changes associated with the activation of the immune system in ACD6-dependent hybrid necrosis. This study expands our current understanding of the active role of ACD6 in mediating trade-offs between defense responses and growth in A. thaliana. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.
Renaissance in tumor immunotherapy: possible combination with phototherapy (Conference Presentation)
NASA Astrophysics Data System (ADS)
Hamblin, Michael R.
2016-03-01
Photodynamic therapy (PDT) uses the combination of non-toxic dyes and harmless visible light to produce highly toxic reactive oxygen species that destroy tumors. The ideal cancer treatment should target both the primary tumor and the metastases with minimal toxicity. This is best accomplished by educating the body's immune system to recognize the tumor as foreign so that after the primary tumor is destroyed, distant metastases will also be eradicated. PDT may accomplish this feat and stimulate long-term, specific anti-tumor immunity. PDT causes an acute inflammatory response, the rapid induction of large amounts of necrotic and apoptotic tumor cells, induction of damage-associated molecular patterns (DAMPS) including heat-shock proteins, stimulates tumor antigen presentation to naïve T-cells, and generation of cytotoxic T-cells that can destroy distant tumor metastases. By using various syngeneic mouse tumors in immunocompetent mice, we have studied specific PDT regimens related to tumor type as well as mouse genotype and phenotype. We have investigated the role of tumor-associated antigens in PDT-induced immune response by choosing mouse tumors that express: model defined antigen, naturally-occurring cancer testis antigen, and oncogenic virus-derived antigen. We studied the synergistic combination of low-dose cyclophosphamide and PDT that unmasks the PDT-induced immune response by depleting the immunosuppressive T-regulatory cells. PDT combined with immunostimulants (toll-like receptor ligands) can synergistically maximize the generation of anti-tumor immunity by activating dendritic cells and switching immunosuppressive macrophages to a tumor rejection phenotype. Tumors expressing defined tumor-associated antigens with known MHC class I peptides allows anti-tumor immunity to be quantitatively compared.
Immune cell phenotype and function in sepsis
Rimmelé, Thomas; Payen, Didier; Cantaluppi, Vincenzo; Marshall, John; Gomez, Hernando; Gomez, Alonso; Murray, Patrick; Kellum, John A.
2015-01-01
Cells of the innate and adaptive immune systems play a critical role in the host response to sepsis. Moreover, their accessibility for sampling and their capacity to respond dynamically to an acute threat increases the possibility that leukocytes might serve as a measure of a systemic state of altered responsiveness in sepsis. The working group of the 14th Acute Dialysis Quality Initiative (ADQI) conference sought to obtain consensus on the characteristic functional and phenotypic changes in cells of the innate and adaptive immune system in the setting of sepsis. Techniques for the study of circulating leukocytes were also reviewed and the impact on cellular phenotypes and leukocyte function of non extracorporeal treatments and extracorporeal blood purification therapies proposed for sepsis was analyzed. A large number of alterations in the expression of distinct neutrophil and monocyte surface markers have been reported in septic patients. The most consistent alteration seen in septic neutrophils is their activation of a survival program that resists apoptotic death. Reduced expression of HLA-DR is a characteristic finding on septic monocytes but monocyte antimicrobial function does not appear to be significantly altered in sepsis. Regarding adaptive immunity, sepsis-induced apoptosis leads to lymphopenia in patients with septic shock and it involves all types of T cells (CD4, CD8 and Natural Killer) except T regulatory cells, thus favoring immunosuppression. Finally, numerous promising therapies targeting the host immune response to sepsis are under investigation. These potential treatments can have an effect on the number of immune cells, the proportion of cell subtypes and the cell function. PMID:26529661
IMMUNE CELL PHENOTYPE AND FUNCTION IN SEPSIS.
Rimmelé, Thomas; Payen, Didier; Cantaluppi, Vincenzo; Marshall, John; Gomez, Hernando; Gomez, Alonso; Murray, Patrick; Kellum, John A
2016-03-01
Cells of the innate and adaptive immune systems play a critical role in the host response to sepsis. Moreover, their accessibility for sampling and their capacity to respond dynamically to an acute threat increases the possibility that leukocytes might serve as a measure of a systemic state of altered responsiveness in sepsis.The working group of the 14th Acute Dialysis Quality Initiative (ADQI) conference sought to obtain consensus on the characteristic functional and phenotypic changes in cells of the innate and adaptive immune system in the setting of sepsis. Techniques for the study of circulating leukocytes were also reviewed and the impact on cellular phenotypes and leukocyte function of nonextracorporeal treatments and extracorporeal blood purification therapies proposed for sepsis was analyzed.A large number of alterations in the expression of distinct neutrophil and monocyte surface markers have been reported in septic patients. The most consistent alteration seen in septic neutrophils is their activation of a survival program that resists apoptotic death. Reduced expression of HLA-DR is a characteristic finding on septic monocytes, but monocyte antimicrobial function does not appear to be significantly altered in sepsis. Regarding adaptive immunity, sepsis-induced apoptosis leads to lymphopenia in patients with septic shock and it involves all types of T cells (CD4, CD8, and Natural Killer) except T regulatory cells, thus favoring immunosuppression. Finally, numerous promising therapies targeting the host immune response to sepsis are under investigation. These potential treatments can have an effect on the number of immune cells, the proportion of cell subtypes, and the cell function.
Fever and the thermal regulation of immunity: the immune system feels the heat
Evans, Sharon S.; Repasky, Elizabeth A.; Fisher, Daniel T.
2016-01-01
Fever is a cardinal response to infection that has been conserved in warm and cold-blooded vertebrates for over 600 million years of evolution. The fever response is executed by integrated physiological and neuronal circuitry and confers a survival benefit during infection. Here, we review our current understanding of how the inflammatory cues delivered by the thermal element of fever stimulate innate and adaptive immune responses. We further highlight the unexpected multiplicity of roles of the pyrogenic cytokine interleukin-6 (IL-6), both during fever induction as well as during the mobilization of lymphocytes to the lymphoid organs that are the staging ground for immune defence. Finally, we discuss the emerging evidence that suggests the adrenergic signalling pathways associated with thermogenesis shape immune cell function. PMID:25976513
Valenzuela-Muñoz, V; Boltaña, S; Gallardo-Escárate, C
2017-09-01
Salmon species cultured in Chile evidence different levels of susceptibility to the sea louse Caligus rogercresseyi. These differences have mainly been associated with specific immune responses. Moreover, iron regulation seems to be an important mechanism to confer immunity during the host infestation. This response called nutritional immunity has been described in bacterial infections, despite that no comprehensive studies involving in marine ectoparasites infestation have been reported. With this aim, we analysed the transcriptome profiles of Atlantic and coho salmon infected with C. rogercresseyi to evidence modulation of the iron metabolism as a proxy of nutritional immune responses. Whole transcriptome sequencing was performed in samples of skin and head kidney from Atlantic and coho salmon infected with sea lice. RNA-seq analyses revealed significant upregulation of transcripts in both salmon species at 7 and 14 dpi in skin and head kidney, respectively. However, iron regulation transcripts were differentially modulated, evidencing species-specific expression profiles. Genes related to heme degradation and iron transport such as hepcidin, transferrin and haptoglobin were primary upregulated in Atlantic salmon; meanwhile, in coho salmon, genes associated with heme biosynthesis were strongly transcribed. In summary, Atlantic salmon, which are more susceptible to infestation, presented molecular mechanisms to deplete cellular iron availability, suggesting putative mechanisms of nutritional immunity. In contrast, resistant coho salmon were less affected by sea lice, mainly activating pro-inflammatory mechanisms to cope with infestation. © 2017 John Wiley & Sons Ltd.
Progress toward Development of a Vaccine against Congenital Cytomegalovirus Infection
Permar, Sallie R.; Plotkin, Stanley A.
2017-01-01
ABSTRACT A vaccine against congenital human cytomegalovirus (CMV) infection is a major public health priority. Congenital CMV causes substantial long-term morbidity, particularly sensorineural hearing loss (SNHL), in newborns, and the public health impact of this infection on maternal and child health is underrecognized. Although progress toward development of a vaccine has been limited by an incomplete understanding of the correlates of protective immunity for the fetus, knowledge about some of the key components of the maternal immune response necessary for preventing transplacental transmission is accumulating. Moreover, although there have been concerns raised about observations indicating that maternal seropositivity does not fully prevent recurrent maternal CMV infections during pregnancy, it is becoming increasing clear that preconception immunity does confer some measure of protection against both CMV transmission and CMV disease (if transmission occurs) in the newborn infant. Although the immunity to CMV conferred by both infection and vaccination is imperfect, there are encouraging data emerging from clinical trials demonstrating the immunogenicity and potential efficacy of candidate CMV vaccines. In the face of the knowledge that between 20,000 and 30,000 infants are born with congenital CMV in the United States every year, there is an urgent and compelling need to accelerate the pace of vaccine trials. In this minireview, we summarize the status of CMV vaccines in clinical trials and provide a perspective on what would be required for a CMV immunization program to become incorporated into clinical practice. PMID:29046308
Baillie, Leslie W J; Rodriguez, Ana L; Moore, Stephen; Atkins, Helen S; Feng, Chiguang; Nataro, James P; Pasetti, Marcela F
2008-11-11
We previously demonstrated the ability of an orally administered attenuated Salmonella enterica serovar Typhimurium strain expressing the protective antigen (PA) of Bacillus anthracis to confer protection against lethal anthrax aerosol spore challenge [Stokes MG, Titball RW, Neeson BN, et al. Oral administration of a Salmonella enterica-based vaccine expressing Bacillus anthracis protective antigen confers protection against aerosolized B. anthracis. Infect Immun 2007;75(April (4)):1827-34]. To extend the utility of this approach to humans we constructed variants of S. enterica serovar Typhi Ty21a, an attenuated typhoid vaccine strain licensed for human use, which expressed and exported PA via two distinct plasmid-based transport systems: the Escherichia coli HlyA haemolysin and the S. Typhi ClyA export apparatus. Murine immunogenicity studies confirmed the ability of these constructs, especially Ty21a expressing the ClyA-PA fusion protein, to stimulate strong PA-specific immune responses following intranasal immunization. These responses were further enhanced by a subsequent boost with either parenterally delivered recombinant PA or the licensed US human alum-adsorbed anthrax vaccine (AVA). Anthrax toxin neutralizing antibody responses using this prime-boost regimen were rapid, vigorous and broad in nature. The results of this study demonstrate the feasibility of employing a mucosal prime with a licensed Salmonella Typhi vaccine strain followed by a parenteral protein boost to stimulate rapid protective immunity against anthrax.
Zhu, Zhuangzhi; Ye, Xiaohua; Ku, Zhiqiang; Liu, Qingwei; Shen, Chaoyun; Luo, Huafei; Luan, Hansen; Zhang, Chenghao; Tian, Shaoqiong; Lim, CheeYen; Huang, Zhong; Wang, Hao
2016-12-10
Recent large outbreaks of hand-foot-and-mouth disease (HFMD) have seriously affected the health of young children. Enterovirus 71 (EV71) is the main causative agent of HFMD. Herein, for the first time, rapidly dissolvable microneedles (MNs) loaded with EV71 virus-like particles (VLPs) were evaluated whether they could induce robust immune responses that confer protection against EV71 infection. The characteristics of prepared MNs including hygroscopy, mechanical strength, insertion capacity, dissolution profile, skin irritation and storage stability were comprehensively assessed. EV71 VLPs remained morphologically stable during fabrication. The MNs made of sodium hyaluronate maintained their insertion ability for at least 3h even at a high relative humidity of 75%. With the aid of spring-operated applicator, EV71 MNs (approximately 500μm length) could be readily penetrated into the mouse skin in vivo, and then rapidly dissolved to release encapsulated antigen within 2min. Additionally, MNs induced slight erythema that disappeared within a few hours. More importantly, mouse immunization and virus challenge studies demonstrated that MNs immunization induced high level of antibody responses conferring full protection against lethal EV71 virus challenge that were comparable to conventional intramuscular injection, but with only 1/10th of the delivered antigen (dose sparing). Consequently, our rapidly dissolving MNs may present as an effective and promising transcutaneous immunization device for HFMD prophylaxis among children. Copyright © 2016 Elsevier B.V. All rights reserved.
Campos-Neto, A; Webb, J R; Greeson, K; Coler, R N; Skeiky, Y A W; Reed, S G
2002-06-01
We have recently shown that a cocktail containing two leishmanial recombinant antigens (LmSTI1 and TSA) and interleukin-12 (IL-12) as an adjuvant induces solid protection in both a murine and a nonhuman primate model of cutaneous leishmaniasis. However, because IL-12 is difficult to prepare, is expensive, and does not have the stability required for a vaccine product, we have investigated the possibility of using DNA as an alternative means of inducing protective immunity. Here, we present evidence that the antigens TSA and LmSTI1 delivered in a plasmid DNA format either as single genes or in a tandem digene construct induce equally solid protection against Leishmania major infection in susceptible BALB/c mice. Immunization of mice with either TSA DNA or LmSTI1 DNA induced specific CD4(+)-T-cell responses of the Th1 phenotype without a requirement for specific adjuvant. CD8 responses, as measured by cytotoxic-T-lymphocyte activity, were generated after immunization with TSA DNA but not LmSTI1 DNA. Interestingly, vaccination of mice with TSA DNA consistently induced protection to a much greater extent than LmSTI1 DNA, thus supporting the notion that CD8 responses might be an important accessory arm of the immune response for acquired resistance against leishmaniasis. Moreover, the protection induced by DNA immunization was specific for infection with Leishmania, i.e., the immunization had no effect on the course of infection of the mice challenged with an unrelated intracellular pathogen such as Mycobacterium tuberculosis. Conversely, immunization of BALB/c mice with a plasmid DNA that is protective against challenge with M. tuberculosis had no effect on the course of infection of these mice with L. major. Together, these results indicate that the protection observed with the leishmanial DNA is mediated by acquired specific immune response rather than by the activation of nonspecific innate immune mechanisms. In addition, a plasmid DNA containing a fusion construct of the two genes was also tested. Similarly to the plasmids encoding individual proteins, the fusion construct induced both specific immune responses to the individual antigens and protection against challenge with L. major. These results confirm previous observations about the possibility of DNA immunization against leishmaniasis and lend support to the idea of using a single polygenic plasmid DNA construct to achieve polyspecific immune responses to several distinct parasite antigens.
The immunology of smallpox vaccines
Kennedy, Richard B; Ovsyannikova, Inna G; Jacobson, Robert M; Poland, Gregory A
2010-01-01
In spite of the eradication of smallpox over 30 years ago; orthopox viruses such as smallpox and monkeypox remain serious public health threats both through the possibility of bioterrorism and the intentional release of smallpox and through natural outbreaks of emerging infectious diseases such as monkeypox. The eradication effort was largely made possible by the availability of an effective vaccine based on the immunologically cross-protective vaccinia virus. Although the concept of vaccination dates back to the late 1800s with Edward Jenner, it is only in the past decade that modern immunologic tools have been applied toward deciphering poxvirus immunity. Smallpox vaccines containing vaccinia virus elicit strong humoral and cellular immune responses that confer cross-protective immunity against variola virus for decades after immunization. Recent studies have focused on: establishing the longevity of poxvirus-specific immunity, defining key immune epitopes targeted by T and B cells, developing subunit-based vaccines, and developing genotypic and phenotypic immune response profiles that predict either vaccine response or adverse events following immunization. PMID:19524427
Mucosal immunity to poliovirus.
Ogra, Pearay L; Okayasu, Hiromasa; Czerkinsky, Cecil; Sutter, Roland W
2011-10-01
The Global Polio Eradication Initiative (GPEI) currently based on use of oral poliovirus vaccine (OPV) has identified suboptimal immunogenicity of this vaccine as a major impediment to eradication, with a failure to induce protection against paralytic poliomyelitis in certain population segments in some parts of the world. The Mucosal Immunity and Poliovirus Vaccines: Impact on Wild Poliovirus Infection, Transmission and Vaccine Failure conference was organized to obtain a better understanding of the current status of global control of poliomyelitis and identify approaches to improve the immune responsiveness and effectiveness of the orally administered poliovirus vaccines in order to accelerate the global eradication of paralytic poliomyelitis.
Probiotics normalize the gut-brain-microbiota axis in immunodeficient mice
Smith, Carli J.; Emge, Jacob R.; Berzins, Katrina; Lung, Lydia; Khamishon, Rebecca; Shah, Paarth; Rodrigues, David M.; Sousa, Andrew J.; Reardon, Colin; Sherman, Philip M.; Barrett, Kim E.
2014-01-01
The gut-brain-microbiota axis is increasingly recognized as an important regulator of intestinal physiology. Exposure to psychological stress causes activation of the hypothalamic-pituitary-adrenal (HPA) axis and causes altered intestinal barrier function, intestinal dysbiosis, and behavioral changes. The primary aim of this study was to determine whether the effects of psychological stress on intestinal physiology and behavior, including anxiety and memory, are mediated by the adaptive immune system. Furthermore, we wanted to determine whether treatment with probiotics would normalize these effects. Here we demonstrate that B and T cell-deficient Rag1−/− mice displayed altered baseline behaviors, including memory and anxiety, accompanied by an overactive HPA axis, increased intestinal secretory state, dysbiosis, and decreased hippocampal c-Fos expression. Both local (intestinal physiology and microbiota) and central (behavioral and hippocampal c-Fos) changes were normalized by pretreatment with probiotics, indicating an overall benefit on health conferred by changes in the microbiota, independent of lymphocytes. Taken together, these findings indicate a role for adaptive immune cells in maintaining normal intestinal and brain health in mice and show that probiotics can overcome this immune-mediated deficit in the gut-brain-microbiota axis. PMID:25190473
Probiotics normalize the gut-brain-microbiota axis in immunodeficient mice.
Smith, Carli J; Emge, Jacob R; Berzins, Katrina; Lung, Lydia; Khamishon, Rebecca; Shah, Paarth; Rodrigues, David M; Sousa, Andrew J; Reardon, Colin; Sherman, Philip M; Barrett, Kim E; Gareau, Mélanie G
2014-10-15
The gut-brain-microbiota axis is increasingly recognized as an important regulator of intestinal physiology. Exposure to psychological stress causes activation of the hypothalamic-pituitary-adrenal (HPA) axis and causes altered intestinal barrier function, intestinal dysbiosis, and behavioral changes. The primary aim of this study was to determine whether the effects of psychological stress on intestinal physiology and behavior, including anxiety and memory, are mediated by the adaptive immune system. Furthermore, we wanted to determine whether treatment with probiotics would normalize these effects. Here we demonstrate that B and T cell-deficient Rag1(-/-) mice displayed altered baseline behaviors, including memory and anxiety, accompanied by an overactive HPA axis, increased intestinal secretory state, dysbiosis, and decreased hippocampal c-Fos expression. Both local (intestinal physiology and microbiota) and central (behavioral and hippocampal c-Fos) changes were normalized by pretreatment with probiotics, indicating an overall benefit on health conferred by changes in the microbiota, independent of lymphocytes. Taken together, these findings indicate a role for adaptive immune cells in maintaining normal intestinal and brain health in mice and show that probiotics can overcome this immune-mediated deficit in the gut-brain-microbiota axis. Copyright © 2014 the American Physiological Society.
[Breast milk: its nutritional composition and functional properties].
Tackoen, M
2012-09-01
Human milk is a complex biological fluid with thousands of components. The milk composition in the mammalian species is specific and adapted to the needs of the offspring. It contains macronutrients (proteins, lipids and carbohydrates), micronutrients (minerals and vitamins) and numerous biologically active substrates. Human milk not only covers the nutritional needs of the newborn but protects the baby against infection, inflammation and oxidative stress. It has immunomodulation properties and confers trophical protection to the intestinal mucosa. The newborn infant is particularly immature: innate immunity, adaptive immunity and intestinal immaturity. Human milk will offer this exogenous protective and immunomodulating source. The development of the composition of the intestinal microflora of the neonate will be impacted by pre- and probiotic components of human milk. Current scientific knowledge of human milk properties highlights interdependency of the different components, ontogeny of the intestinal function, development of the mucosal intestinal immune system, colonization by the intestinal microbiota and protection against pathogens. Quality of these interactions influences the newborn's short and long-term health status. The promotion of breastfeeding with the support of the Baby Friendly Hospital Initiative (BFHI) program and labeling has been shown to have positive impact in public health.
Quest for Correlates of Protection against Tuberculosis
Bhatt, Kamlesh; Verma, Sheetal; Ellner, Jerrold J.
2015-01-01
A major impediment to tuberculosis (TB) vaccine development is the lack of reliable correlates of immune protection or biomarkers that would predict vaccine efficacy. Gamma interferon (IFN-γ) produced by CD4+ T cells and, recently, multifunctional CD4+ T cells secreting IFN-γ, tumor necrosis factor (TNF), and interleukin-2 (IL-2) have been used in vaccine studies as a measurable immune parameter, reflecting activity of a vaccine and potentially predicting protection. However, accumulating experimental evidence suggests that host resistance against Mycobacterium tuberculosis infection is independent of IFN-γ and TNF secretion from CD4+ T cells. Furthermore, the booster vaccine MVA85A, despite generating a high level of multifunctional CD4+ T cell response in the host, failed to confer enhanced protection in vaccinated subjects. These findings suggest the need for identifying reliable correlates of protection to determine the efficacy of TB vaccine candidates. This article focuses on alternative pathways that mediate M. tuberculosis control and their potential for serving as markers of protection. The review also discusses the significance of investigating the natural human immune response to M. tuberculosis to identify the correlates of protection in vaccination. PMID:25589549
Purves, Joanne; Thomas, Jamie; Riboldi, Gustavo P.; Zapotoczna, Marta; Tarrant, Emma; Andrew, Peter W.; Londoño, Alejandra; Planet, Paul J.; Geoghegan, Joan A.; Waldron, Kevin J.
2018-01-01
Summary Excess copper is highly toxic and forms part of the host innate immune system's antibacterial arsenal, accumulating at sites of infection and acting within macrophages to kill engulfed pathogens. We show for the first time that a novel, horizontally gene transferred copper resistance locus (copXL), uniquely associated with the SCCmec elements of the highly virulent, epidemic, community acquired methicillin resistant Staphylococcus aureus (CA‐MRSA) USA300, confers copper hyper‐resistance. These genes are additional to existing core genome copper resistance mechanisms, and are not found in typical S. aureus lineages, but are increasingly identified in emerging pathogenic isolates. Our data show that CopX, a putative P1B‐3‐ATPase efflux transporter, and CopL, a novel lipoprotein, confer copper hyper‐resistance compared to typical S. aureus strains. The copXL genes form an operon that is tightly repressed in low copper environments by the copper regulator CsoR. Significantly, CopX and CopL are important for S. aureus USA300 intracellular survival within macrophages. Therefore, the emergence of new S. aureus clones with the copXL locus has significant implications for public health because these genes confer increased resistance to antibacterial copper toxicity, enhancing bacterial fitness by altering S. aureus interaction with innate immunity. PMID:29521441
Mathematical modelling of CRISPR-Cas system effects on biofilm formation.
Ali, Qasim; Wahl, Lindi M
2017-08-01
Clustered regularly interspaced short palindromic repeats (CRISPR), linked with CRISPR associated (Cas) genes, can confer adaptive immunity to bacteria, against bacteriophage infections. Thus from a therapeutic standpoint, CRISPR immunity increases biofilm resistance to phage therapy. Recently, however, CRISPR-Cas genes have been implicated in reducing biofilm formation in lysogenized cells. Thus CRISPR immunity can have complex effects on phage-host-lysogen interactions, particularly in a biofilm. In this contribution, we develop and analyse a series of dynamical systems to elucidate and disentangle these interactions. Two competition models are used to study the effects of lysogens (first model) and CRISPR-immune bacteria (second model) in the biofilm. In the third model, the effect of delivering lysogens to a CRISPR-immune biofilm is investigated. Using standard analyses of equilibria, stability and bifurcations, our models predict that lysogens may be able to displace CRISPR-immune bacteria in a biofilm, and thus suggest strategies to eliminate phage-resistant biofilms.
Zhao, Feijun; Wu, Yimou; Zhang, Xiaohong; Yu, Jian; Gu, Weiming; Liu, Shuangquan; Zeng, Tiebing; Zhang, Yuejun; Wang, Shiping
2011-10-01
In this study, the immune-modulatory and protective efficacy of using an interleukin-2 (IL-2) expression plasmid as a genetic adjuvant and chitosan (CS) nanoparticles as vectors to enhance a Tp92 DNA vaccine candidate were investigated in a Treponema pallidum (Tp) rabbit challenge model. CS vectoring of pTp92 or pIL-2 were both demonstrated to augment anti-Tp92 antibody levels induced by pTp92 DNA vaccines. Interestingly, the combination of CS vectored Tp92 and pIL-2 led to the greatest enhancements of anti-Tp92 antibodies and T-cell proliferation (p < 0.05). At week 10 after the first immunization, 15 of the 18 rabbits in each group were challenged with Tp Nichols strain and monitored for skin lesions and ulcer lesions. Ratios of positive skin lesions and ratios of ulcer lesions in groups immunized with pTp92 were significantly lower than those of the empty vector or PBS groups (p < 0.05), demonstrating that pTp92 immunization elicited significant protective efficacy against the Tp Nichols strain challenge. CS vectored and pIL-2 adjuvanted pTp92 immunized animals exhibited the lowest rates of positive skin and ulcer lesions. Male New Zealand white rabbits were randomly assigned to groups (n = 18/group) and immunized intramuscularly with pTp92 based plasmid DNA constructs (100 μg of DNA/rabbit/immunization). Two weeks before Tp challenge (Week 8), three rabbits from each group were used to determine cytokine measurements and fifteen rabbits from each group were used for Tp challenge studies. Intramuscular injection of pTp92 induced strong humoral and cellular immune responses and conferred protection from Tp challenge in rabbits. The use of CS as a pTp92 vector or pIL-2 as an adjuvant achieved a superior level of protective efficacy against Tp challenge, however CS vectored, IL-2 adjuvanted pTp92 immunization conferred the highest level of protective efficacy.
B lymphocytes confer immune tolerance via cell surface GARP-TGF-β complex.
Wallace, Caroline H; Wu, Bill X; Salem, Mohammad; Ansa-Addo, Ephraim A; Metelli, Alessandra; Sun, Shaoli; Gilkeson, Gary; Shlomchik, Mark J; Liu, Bei; Li, Zihai
2018-04-05
GARP, a cell surface docking receptor for binding and activating latent TGF-β, is highly expressed by platelets and activated Tregs. While GARP is implicated in immune invasion in cancer, the roles of the GARP-TGF-β axis in systemic autoimmune diseases are unknown. Although B cells do not express GARP at baseline, we found that the GARP-TGF-β complex is induced on activated human and mouse B cells by ligands for multiple TLRs, including TLR4, TLR7, and TLR9. GARP overexpression on B cells inhibited their proliferation, induced IgA class-switching, and dampened T cell-independent antibody production. In contrast, B cell-specific deletion of GARP-encoding gene Lrrc32 in mice led to development of systemic autoimmune diseases spontaneously as well as worsening of pristane-induced lupus-like disease. Canonical TGF-β signaling more readily upregulates GARP in Peyer patch B cells than in splenic B cells. Furthermore, we demonstrated that B cells are required for the induction of oral tolerance of T cell-dependent antigens via GARP. Our studies reveal for the first time to our knowledge that cell surface GARP-TGF-β is an important checkpoint for regulating B cell peripheral tolerance, highlighting a mechanism of autoimmune disease pathogenesis.
B lymphocytes confer immune tolerance via cell surface GARP-TGF-β complex
Wallace, Caroline H.; Wu, Bill X.; Salem, Mohammad; Ansa-Addo, Ephraim A.; Metelli, Alessandra; Sun, Shaoli; Gilkeson, Gary; Shlomchik, Mark J.
2018-01-01
GARP, a cell surface docking receptor for binding and activating latent TGF-β, is highly expressed by platelets and activated Tregs. While GARP is implicated in immune invasion in cancer, the roles of the GARP-TGF-β axis in systemic autoimmune diseases are unknown. Although B cells do not express GARP at baseline, we found that the GARP-TGF-β complex is induced on activated human and mouse B cells by ligands for multiple TLRs, including TLR4, TLR7, and TLR9. GARP overexpression on B cells inhibited their proliferation, induced IgA class-switching, and dampened T cell–independent antibody production. In contrast, B cell–specific deletion of GARP-encoding gene Lrrc32 in mice led to development of systemic autoimmune diseases spontaneously as well as worsening of pristane-induced lupus-like disease. Canonical TGF-β signaling more readily upregulates GARP in Peyer patch B cells than in splenic B cells. Furthermore, we demonstrated that B cells are required for the induction of oral tolerance of T cell–dependent antigens via GARP. Our studies reveal for the first time to our knowledge that cell surface GARP-TGF-β is an important checkpoint for regulating B cell peripheral tolerance, highlighting a mechanism of autoimmune disease pathogenesis. PMID:29618665
Cockroach Allergen Exposure and Risk of Asthma
Do, Danh C.; Zhao, Yilin; Gao, Peisong
2015-01-01
Cockroach sensitization is an important risk factor for the development of asthma. However, its underlying immune mechanisms and the genetic etiology for differences in allergic responses remain unclear. Cockroach allergens identification and their expression as biologically active recombinant proteins has provided a basis for studying the mechanisms regarding cockroach allergens induced allergic sensitization and asthma. Glycans in allergens may play a crucial role in the immunogenicity of allergic diseases. Protease-activated receptor (PAR)-2, Toll-like receptor (TLR), and C-type lectin receptors have been suggested to be important for the penetration of cockroach allergens through epithelial cells to mediate allergen uptake, dendritic cell maturation, antigen presenting cell (APC) function in T cell polarization, and cytokine production. Environmental pollutants, which often co-exist with the allergen, could synergistically elicit allergic inflammation, and aryl hydrocarbon receptor (AhR) activation and signaling may serve as a link between these two elements. Genetic factors may also play an important role in conferring the susceptibility to cockroach sensitization. Several genes have been associated with cockroach sensitization and asthma-related phenotypes. In this review, we will discuss the epidemiological evidence for cockroach allergen-induced asthma, cockroach allergens, the mechanisms regarding cockroach allergens induced innate immune responses, and the genetic basis for cockroach sensitization. PMID:26706467
The E3 ligase Cbl-b and TAM receptors regulate cancer metastasis via natural killer cells.
Paolino, Magdalena; Choidas, Axel; Wallner, Stephanie; Pranjic, Blanka; Uribesalgo, Iris; Loeser, Stefanie; Jamieson, Amanda M; Langdon, Wallace Y; Ikeda, Fumiyo; Fededa, Juan Pablo; Cronin, Shane J; Nitsch, Roberto; Schultz-Fademrecht, Carsten; Eickhoff, Jan; Menninger, Sascha; Unger, Anke; Torka, Robert; Gruber, Thomas; Hinterleitner, Reinhard; Baier, Gottfried; Wolf, Dominik; Ullrich, Axel; Klebl, Bert M; Penninger, Josef M
2014-03-27
Tumour metastasis is the primary cause of mortality in cancer patients and remains the key challenge for cancer therapy. New therapeutic approaches to block inhibitory pathways of the immune system have renewed hopes for the utility of such therapies. Here we show that genetic deletion of the E3 ubiquitin ligase Cbl-b (casitas B-lineage lymphoma-b) or targeted inactivation of its E3 ligase activity licenses natural killer (NK) cells to spontaneously reject metastatic tumours. The TAM tyrosine kinase receptors Tyro3, Axl and Mer (also known as Mertk) were identified as ubiquitylation substrates for Cbl-b. Treatment of wild-type NK cells with a newly developed small molecule TAM kinase inhibitor conferred therapeutic potential, efficiently enhancing anti-metastatic NK cell activity in vivo. Oral or intraperitoneal administration using this TAM inhibitor markedly reduced murine mammary cancer and melanoma metastases dependent on NK cells. We further report that the anticoagulant warfarin exerts anti-metastatic activity in mice via Cbl-b/TAM receptors in NK cells, providing a molecular explanation for a 50-year-old puzzle in cancer biology. This novel TAM/Cbl-b inhibitory pathway shows that it might be possible to develop a 'pill' that awakens the innate immune system to kill cancer metastases.
The 13th International Workshops on Opportunistic Protists (IWOP13).
Calderon, Enrique J; Cushion, Melanie T; Xiao, Lihua; Lorenzo-Morales, Jacob; Matos, Olga; Kaneshiro, Edna S; Weiss, Louis M
2015-01-01
The 13th International Workshops on Opportunistic Protists (IWOP-13) was held November 13-15, 2014 in Seville, Spain. The objectives of the IWOP meetings are to: (1) serve as a forum for exchange of new information among active researchers concerning the basic biology, molecular genetics, immunology, biochemistry, pathogenesis, drug development, therapy, and epidemiology of these immunodeficiency-associated pathogenic eukaryotic microorganisms that are seen in patients with AIDS and; (2) to foster the entry of new and young investigators into these underserved research areas. The IWOP meeting focuses on opportunistic protists; e.g. the free-living amoebae, Pneumocystis, Cryptosporidium, Toxoplasma, the Microsporidia, and kinetoplastid flagellates. This conference represents the major conference which brings together research groups working on these opportunistic pathogens. Progress has been achieved on understanding the biology of these pathogenic organisms, their involvement in disease causation in both immune deficient and immune competent hosts and is providing important insights into these emerging and reemerging pathogens. A continuing concern of the participants is the ongoing loss of scientific expertise and diversity in this research community. This decline is due to the small size of these research communities and an ongoing lack of understanding by the broader scientific community of the challenges and limitations faced by researchers working on these organisms, which makes these research communities very sensitive to declines in research funding. © 2015 The Author(s) Journal of Eukaryotic Microbiology © 2015 International Society of Protistologists.
Dietary selenium in adjuvant therapy of viral and bacterial infections.
Steinbrenner, Holger; Al-Quraishy, Saleh; Dkhil, Mohamed A; Wunderlich, Frank; Sies, Helmut
2015-01-01
Viral and bacterial infections are often associated with deficiencies in macronutrients and micronutrients, including the essential trace element selenium. In selenium deficiency, benign strains of Coxsackie and influenza viruses can mutate to highly pathogenic strains. Dietary supplementation to provide adequate or supranutritional selenium supply has been proposed to confer health benefits for patients suffering from some viral diseases, most notably with respect to HIV and influenza A virus (IAV) infections. In addition, selenium-containing multimicronutrient supplements improved several clinical and lifestyle variables in patients coinfected with HIV and Mycobacterium tuberculosis. Selenium status may affect the function of cells of both adaptive and innate immunity. Supranutritional selenium promotes proliferation and favors differentiation of naive CD4-positive T lymphocytes toward T helper 1 cells, thus supporting the acute cellular immune response, whereas excessive activation of the immune system and ensuing host tissue damage are counteracted through directing macrophages toward the M2 phenotype. This review provides an up-to-date overview on selenium in infectious diseases caused by viruses (e.g., HIV, IAV, hepatitis C virus, poliovirus, West Nile virus) and bacteria (e.g., M. tuberculosis, Helicobacter pylori). Data from epidemiologic studies and intervention trials, with selenium alone or in combination with other micronutrients, and animal experiments are discussed against the background of dietary selenium requirements to alter immune functions. © 2015 American Society for Nutrition.
Shukarev, Georgi; Callendret, Benoit; Luhn, Kerstin; Douoguih, Macaya
2017-01-01
ABSTRACT The consequences of the 2013–16 Ebola Zaire virus disease epidemic in West Africa were grave. The economies, healthcare systems and communities of Guinea, Sierra Leone and Liberia were devastated by over 18 months of active Ebola virus transmission, followed by sporadic resurgences potentially related to sexual transmission by survivors with viral persistence in body fluids following recovery. The need to develop and implement strategies to prevent and mitigate future outbreaks is now beyond dispute. The potential for unpredictable outbreaks of indeterminate duration, and control challenges posed by the possibility of sporadic re-emergence, mean that implementation of an effective vaccination program for outbreak containment necessitates a vaccine providing durable immunity. Heterologous prime-boost vaccine regimens deliver the same or similar antigens through different vaccine types, the first to prime and the second to boost the immune system. Ad26.ZEBOV/MVA-BN-Filo is an investigational Ebola Zaire vaccine regimen that uses this heterologous prime-boost approach. Preliminary Phase 1 data suggest that Ad26.ZEBOV/MVA-BN-Filo confers durable immunity for at least 240 d and is well-tolerated with a good safety profile. This regimen may therefore be suitable for prophylactic use in a regional or targeted population vaccination strategy, and could potentially aid prevention and control of future Ebola outbreaks. PMID:27925844
Schäfer, Birgit; Holzer, Georg W; Joachimsthaler, Alexandra; Coulibaly, Sogue; Schwendinger, Michael; Crowe, Brian A; Kreil, Thomas R; Barrett, P Noel; Falkner, Falko G
2011-01-01
Currently existing yellow fever (YF) vaccines are based on the live attenuated yellow fever virus 17D strain (YFV-17D). Although, a good safety profile was historically attributed to the 17D vaccine, serious adverse events have been reported, making the development of a safer, more modern vaccine desirable. A gene encoding the precursor of the membrane and envelope (prME) protein of the YFV-17D strain was inserted into the non-replicating modified vaccinia virus Ankara and into the D4R-defective vaccinia virus. Candidate vaccines based on the recombinant vaccinia viruses were assessed for immunogenicity and protection in a mouse model and compared to the commercial YFV-17D vaccine. The recombinant live vaccines induced γ-interferon-secreting CD4- and functionally active CD8-T cells, and conferred full protection against lethal challenge already after a single low immunization dose of 10(5) TCID(50). Surprisingly, pre-existing immunity against wild-type vaccinia virus did not negatively influence protection. Unlike the classical 17D vaccine, the vaccinia virus-based vaccines did not cause mortality following intracerebral administration in mice, demonstrating better safety profiles. The non-replicating recombinant YF candidate live vaccines induced a broad immune response after single dose administration, were effective even in the presence of a pre-existing immunity against vaccinia virus and demonstrated an excellent safety profile in mice.
Dietary Selenium in Adjuvant Therapy of Viral and Bacterial Infections12
Steinbrenner, Holger; Al-Quraishy, Saleh; Dkhil, Mohamed A; Wunderlich, Frank; Sies, Helmut
2015-01-01
Viral and bacterial infections are often associated with deficiencies in macronutrients and micronutrients, including the essential trace element selenium. In selenium deficiency, benign strains of Coxsackie and influenza viruses can mutate to highly pathogenic strains. Dietary supplementation to provide adequate or supranutritional selenium supply has been proposed to confer health benefits for patients suffering from some viral diseases, most notably with respect to HIV and influenza A virus (IAV) infections. In addition, selenium-containing multimicronutrient supplements improved several clinical and lifestyle variables in patients coinfected with HIV and Mycobacterium tuberculosis. Selenium status may affect the function of cells of both adaptive and innate immunity. Supranutritional selenium promotes proliferation and favors differentiation of naive CD4-positive T lymphocytes toward T helper 1 cells, thus supporting the acute cellular immune response, whereas excessive activation of the immune system and ensuing host tissue damage are counteracted through directing macrophages toward the M2 phenotype. This review provides an up-to-date overview on selenium in infectious diseases caused by viruses (e.g., HIV, IAV, hepatitis C virus, poliovirus, West Nile virus) and bacteria (e.g., M. tuberculosis, Helicobacter pylori). Data from epidemiologic studies and intervention trials, with selenium alone or in combination with other micronutrients, and animal experiments are discussed against the background of dietary selenium requirements to alter immune functions. PMID:25593145
Shukarev, Georgi; Callendret, Benoit; Luhn, Kerstin; Douoguih, Macaya
2017-02-01
The consequences of the 2013-16 Ebola Zaire virus disease epidemic in West Africa were grave. The economies, healthcare systems and communities of Guinea, Sierra Leone and Liberia were devastated by over 18 months of active Ebola virus transmission, followed by sporadic resurgences potentially related to sexual transmission by survivors with viral persistence in body fluids following recovery. The need to develop and implement strategies to prevent and mitigate future outbreaks is now beyond dispute. The potential for unpredictable outbreaks of indeterminate duration, and control challenges posed by the possibility of sporadic re-emergence, mean that implementation of an effective vaccination program for outbreak containment necessitates a vaccine providing durable immunity. Heterologous prime-boost vaccine regimens deliver the same or similar antigens through different vaccine types, the first to prime and the second to boost the immune system. Ad26.ZEBOV/MVA-BN-Filo is an investigational Ebola Zaire vaccine regimen that uses this heterologous prime-boost approach. Preliminary Phase 1 data suggest that Ad26.ZEBOV/MVA-BN-Filo confers durable immunity for at least 240 d and is well-tolerated with a good safety profile. This regimen may therefore be suitable for prophylactic use in a regional or targeted population vaccination strategy, and could potentially aid prevention and control of future Ebola outbreaks.
Morigi, Consuelo
2017-01-01
The 15th St Gallen International Breast Cancer Conference was held in Vienna for the second time, from 15th-18th March 2017. 4000 people from 105 countries all over the world were invited to take part in the event. The real highlight of the conference was the last day with the International Consensus Session which was chaired by around 50 experts on breast cancer worldwide. With reference to data from scientific research, the consensus panel tried to offer guidelines for the management of breast cancer with the aim of providing patients with optimal treatment. The topics covered focused on the treatment of breast cancer, consideration of surgery, radiotherapy, neo-adjuvant, and adjuvant systemic therapy for breast cancer, as well as genetics and prevention of breast cancer. In particular, in terms of precision medicine, an important topic of the conference was 'is it possible to think that it could become routine in clinical practice to use immunotherapy and targeted therapy based on genetic signatures?' In view of personalised therapy, it is important to take into consideration women's treatment preferences. It is also important not only to offer guidelines which help breast cancer experts all over the world to choose the proper treatment for women with breast cancer but also to discuss the pros and cons of the therapy with the patient. This allows for a better understanding of the disease. 'From the maximum tolerable to the minimum effective treatment: it is essential to escalate treatment when necessary and to de-escalate when unnecessary'. These few words could summarise the meaning of the 15th St Gallen International Breast Cancer Conference. Prof Martine Piccart-Gebhart was awarded with the St Gallen International Breast Cancer Award 2017 for her fundamental clinical research contribution and Prof Giuseppe Curigliano with the Umberto Veronesi Memorial Award which aims to recognise a physician's leading role in advancing the science and care of breast cancer patients. Curigliano, in his lecture, spoke about the revolutionary immunotherapy in the clinical management of breast cancer (BC). For the development of these therapies, it is necessary to identify the genetic determinants of BC immune phenotypes in which The Cancer Genome Atlas (TCGA) has contributed towards this. For example, the T helper (Th-1) phenotype (ICR4), which also exhibits upregulation of immune-regulatory transcripts (eg. PDL1, PD1, FOXP3, IDO1, and CTLA4), was associated with prolonged patients' survival. Chromosome segment 4q21, which includes genes encoding the Th-1 chemokines CXCL9-11, was significantly amplified only in the immune favourable phenotype (ICR4). The mutation and neo-antigen load progressively decreased from ICR4 to ICR1 but could not explain immune phenotypic differences. Mutations of TP53 were enriched in the immune favourable phenotype (ICR4). Instead, the presence of MAP3K1 and MAP2K4 mutations were closely associated with an immune unfavourable phenotype (ICR1). Using both the TCGA and the validation dataset, the degree of MAPK deregulation segregates BC according to their immune disposition. These findings suggest that mutational-driven deregulation of MAPK pathways is linked to the negative regulation of intratumoural immune response in BC. The main themes of this congress were: 1) Surgery of the primary tumour and margins; 2) Surgery of the axilla; 3) Radiotherapy: hypofractionated, 'boost' to tumour bed, partial breast, regional node, after mastectomy, advanced technology; 4) Pathology: subtypes, TILs; 5) Multi-gene signatures and therapy; 6) Endocrine therapy: pre- and post-menopausal and duration; 7) Chemotherapy: subtypes, stages; 8) Anti-HER-2 therapy; 9) Neo-adjuvant therapy; 10) Adjuvant bisphosponates; 11) Adjuvant diet and exercise.
NASA Astrophysics Data System (ADS)
Zhang, Zhihong
2017-02-01
Inflammatory monocytes/macrophages (Mon/Mφ) play an important role in cutaneous allergic inflammation. However, their migration and activation in dermatitis and how they accelerate the inflammatory reaction are largely unknown. Optical molecular imaging is the most promising tool for investigating the function and motility of immune cells in vivo. We have developed a multi-scale optical imaging approach to evaluate the spatio-temporal dynamic behavior and properties of immune cells from the whole field of organs to the cellular level at the inflammatory site in delayed type hypersensitivity reaction. Here, we developed some multi-color labeling mouse models based on the endogenous labeling with fluorescent proteins and the exogenous labeling with fluorescent dyes. We investigated the cell movement, cell interaction and function of immunocytes (e.g. Mon/Mφ, DC, T cells and neutrophils) in the skin allergy inflammation (e.g., contact hypersensitivity) by using intravital microscopy. The long-term imaging data showed that after inflammatory Mon/Mφ transendothelial migration in dermis, they migrating in interstitial space of dermis. Depletion of blood monocyte with clodronate liposome extremely reduced the inflammatory reaction. Our finding provided further insight into inflammatory Mon/Mφ mediating the inflammatory cascade through functional migration in allergic contact dermatitis.
Progress on adenovirus-vectored universal influenza vaccines.
Xiang, Kui; Ying, Guan; Yan, Zhou; Shanshan, Yan; Lei, Zhang; Hongjun, Li; Maosheng, Sun
2015-01-01
Influenza virus (IFV) infection causes serious health problems and heavy financial burdens each year worldwide. The classical inactivated influenza virus vaccine (IIVV) and live attenuated influenza vaccine (LAIV) must be updated regularly to match the new strains that evolve due to antigenic drift and antigenic shift. However, with the discovery of broadly neutralizing antibodies that recognize conserved antigens, and the CD8(+) T cell responses targeting viral internal proteins nucleoprotein (NP), matrix protein 1 (M1) and polymerase basic 1 (PB1), it is possible to develop a universal influenza vaccine based on the conserved hemagglutinin (HA) stem, NP, and matrix proteins. Recombinant adenovirus (rAd) is an ideal influenza vaccine vector because it has an ideal stability and safety profile, induces balanced humoral and cell-mediated immune responses due to activation of innate immunity, provides 'self-adjuvanting' activity, can mimic natural IFV infection, and confers seamless protection against mucosal pathogens. Moreover, this vector can be developed as a low-cost, rapid-response vaccine that can be quickly manufactured. Therefore, an adenovirus vector encoding conserved influenza antigens holds promise in the development of a universal influenza vaccine. This review will summarize the progress in adenovirus-vectored universal flu vaccines and discuss future novel approaches.
Roederer, Mario; Quaye, Lydia; Mangino, Massimo; Beddall, Margaret H.; Mahnke, Yolanda; Chattopadhyay, Pratip; Tosi, Isabella; Napolitano, Luca; Barberio, Manuela Terranova; Menni, Cristina; Villanova, Federica; Di Meglio, Paola; Spector, Tim D.; Nestle, Frank O.
2015-01-01
Summary Despite recent discoveries of genetic variants associated with autoimmunity and infection, genetic control of the human immune system during homeostasis is poorly understood. We undertook a comprehensive immunophenotyping approach, analysing 78,000 immune traits in 669 female twins. From the top 151 heritable traits (up to 96% heritable), we used replicated GWAS to obtain 297 SNP associations at 11 genetic loci explaining up to 36% of the variation of 19 traits. We found multiple associations with canonical traits of all major immune cell subsets, and uncovered insights into genetic control for regulatory T cells. This dataset also revealed traits associated with loci known to confer autoimmune susceptibility, providing mechanistic hypotheses linking immune traits with the etiology of disease. Our data establish a bioresource that links genetic control elements associated with normal immune traits to common autoimmune and infectious diseases, providing a shortcut to identifying potential mechanisms of immune-related diseases. PMID:25772697
Gut immunity in Lepidopteran insects.
Wu, Kai; Yang, Bing; Huang, Wuren; Dobens, Leonard; Song, Hongsheng; Ling, Erjun
2016-11-01
Lepidopteran insects constitute one of the largest fractions of animals on earth, but are considered pests in their relationship with man. Key to the success of this order of insects is its ability to digest food and absorb nutrition, which takes place in the midgut. Because environmental microorganisms can easily enter Lepidopteran guts during feeding, the innate immune response guards against pathogenic bacteria, virus and microsporidia that can be devoured with food. Gut immune responses are complicated by both resident gut microbiota and the surrounding peritrophic membrane and are distinct from immune responses in the body cavity, which depend on the function of the fat body and hemocytes. Due to their relevance to agricultural production, studies of Lepidopteran insect midgut and immunity are receiving more attention, and here we summarize gut structures and functions, and discuss how these confer immunity against different microorganisms. It is expected that increased knowledge of Lepidopteran gut immunity may be utilized for pest biological control in the future. Copyright © 2016 Elsevier Ltd. All rights reserved.
Roederer, Mario; Quaye, Lydia; Mangino, Massimo; Beddall, Margaret H; Mahnke, Yolanda; Chattopadhyay, Pratip; Tosi, Isabella; Napolitano, Luca; Terranova Barberio, Manuela; Menni, Cristina; Villanova, Federica; Di Meglio, Paola; Spector, Tim D; Nestle, Frank O
2015-04-09
Despite recent discoveries of genetic variants associated with autoimmunity and infection, genetic control of the human immune system during homeostasis is poorly understood. We undertook a comprehensive immunophenotyping approach, analyzing 78,000 immune traits in 669 female twins. From the top 151 heritable traits (up to 96% heritable), we used replicated GWAS to obtain 297 SNP associations at 11 genetic loci, explaining up to 36% of the variation of 19 traits. We found multiple associations with canonical traits of all major immune cell subsets and uncovered insights into genetic control for regulatory T cells. This data set also revealed traits associated with loci known to confer autoimmune susceptibility, providing mechanistic hypotheses linking immune traits with the etiology of disease. Our data establish a bioresource that links genetic control elements associated with normal immune traits to common autoimmune and infectious diseases, providing a shortcut to identifying potential mechanisms of immune-related diseases. Copyright © 2015 Elsevier Inc. All rights reserved.
Programming Native CRISPR Arrays for the Generation of Targeted Immunity.
Hynes, Alexander P; Labrie, Simon J; Moineau, Sylvain
2016-05-03
The adaptive immune system of prokaryotes, called CRISPR-Cas (clustered regularly interspaced short palindromic repeats and CRISPR-associated genes), results in specific cleavage of invading nucleic acid sequences recognized by the cell's "memory" of past encounters. Here, we exploited the properties of native CRISPR-Cas systems to program the natural "memorization" process, efficiently generating immunity not only to a bacteriophage or plasmid but to any specifically chosen DNA sequence. CRISPR-Cas systems have entered the public consciousness as genome editing tools due to their readily programmable nature. In industrial settings, natural CRISPR-Cas immunity is already exploited to generate strains resistant to potentially disruptive viruses. However, the natural process by which bacteria acquire new target specificities (adaptation) is difficult to study and manipulate. The target against which immunity is conferred is selected stochastically. By biasing the immunization process, we offer a means to generate customized immunity, as well as provide a new tool to study adaptation. Copyright © 2016 Hynes et al.
Immunity to Cryptococcus neoformans and C. gattii during cryptococcosis
Gibson, Josie F.; Johnston, Simon A.
2015-01-01
The vast majority of infection with cryptococcal species occurs with Cryptococcus neoformans in the severely immunocompromised. A significant exception to this is the infections of those with apparently normal immune systems by Cryptococcus gattii. Susceptibility to cryptococcosis can be broadly categorised as a defect in adaptive immune responses, especially in T cell immunity. However, innate immune cells such as macrophages play a key role and are likely the primary effector cell in the killing and ultimate clearance of cryptococcal infection. In this review we discuss the current state of our understanding of how the immune system responds to cryptococcal infection in health and disease, with reference to the work communicated at the 9th International Conference on Cryptococcus and Cryptococcosis (ICCC9). We have focussed on cell mediated responses, particularly early in infection, but with the aim of presenting a broad overview of our understanding of immunity to cryptococcal infection, highlighting some recent advances and offering some perspectives on future directions. PMID:25498576
Recent progress in the development of anthrax vaccines.
Kaur, Manpreet; Bhatnagar, Rakesh
2011-12-01
Bacillus anthracis is the etiological agent of anthrax. Although anthrax is primarily an epizootic disease; humans are at risk for contracting anthrax. The potential use of B. anthracis spores as biowarfare agent has led to immense attention. Prolonged vaccination schedule of current anthrax vaccine and variable protection conferred; often leading to failure of therapy. This highlights the need for alternative anthrax countermeasures. A number of approaches are being investigated to substitute or supplement the existing anthrax vaccines. These relied on expression of Protective antigen (PA), the key protective immunogen; in bacterial or plant systems; or utilization of attenuated strains of B. anthracis for immunization. Few studies have established potential of domain IV of PA for immunization. Other targets including the spore, capsule, S-layer and anthrax toxin components have been investigated for imparting protective immunity. It has been shown that co-immunization of PA with domain I of lethal factor that binds PA resulted in higher antibody responses. Of the epitope based vaccines, the loop neutralizing determinant, in particular; elicited robust neutralizing antibody response and conferred 97% protection upon challenge. DNA vaccination resulted in varying degree of protection and seems a promising approach. Additionally, the applicability of monoclonal and therapeutic antibodies in the treatment of anthrax has also been demonstrated. The recent progress in the direction of anthrax prophylaxis has been evaluated in this review.
Skyberg, Jerod A; Rollins, MaryClare F; Holderness, Jeff S; Marlenee, Nicole L; Schepetkin, Igor A; Goodyear, Andrew; Dow, Steven W; Jutila, Mark A; Pascual, David W
2012-01-01
Pulmonary Francisella tularensis and Burkholderia pseudomallei infections are highly lethal in untreated patients, and current antibiotic regimens are not always effective. Activating the innate immune system provides an alternative means of treating infection and can also complement antibiotic therapies. Several natural agonists were screened for their ability to enhance host resistance to infection, and polysaccharides derived from the Acai berry (Acai PS) were found to have potent abilities as an immunotherapeutic to treat F. tularensis and B. pseudomallei infections. In vitro, Acai PS impaired replication of Francisella in primary human macrophages co-cultured with autologous NK cells via augmentation of NK cell IFN-γ. Furthermore, Acai PS administered nasally before or after infection protected mice against type A F. tularensis aerosol challenge with survival rates up to 80%, and protection was still observed, albeit reduced, when mice were treated two days post-infection. Nasal Acai PS administration augmented intracellular expression of IFN-γ by NK cells in the lungs of F. tularensis-infected mice, and neutralization of IFN-γ ablated the protective effect of Acai PS. Likewise, nasal Acai PS treatment conferred protection against pulmonary infection with B. pseudomallei strain 1026b. Acai PS dramatically reduced the replication of B. pseudomallei in the lung and blocked bacterial dissemination to the spleen and liver. Nasal administration of Acai PS enhanced IFN-γ responses by NK and γδ T cells in the lungs, while neutralization of IFN-γ totally abrogated the protective effect of Acai PS against pulmonary B. pseudomallei infection. Collectively, these results demonstrate Acai PS is a potent innate immune agonist that can resolve F. tularensis and B. pseudomallei infections, suggesting this innate immune agonist has broad-spectrum activity against virulent intracellular pathogens.
Senju, Hiroaki; Kumagai, Asuka; Nakamura, Yoichi; Yamaguchi, Hiroyuki; Nakatomi, Katsumi; Fukami, Shota; Shiraishi, Kengo; Harada, Yuka; Nakamura, Mitsuhiro; Okamura, Haruki; Tanaka, Yoshimasa; Mukae, Hiroshi
2018-01-01
When pathogenic stresses are recognized by innate immune cells, inflammasomes are assembled and caspase-1 is activated, resulting in the conversion of pro-IL-18 into mature IL-18. Because natural killer (NK) cells express IL-18 receptors, IL-18 may play roles in immune functions of NK cells. In the present study, we examined the effect of IL-18 on NK cells derived from lung cancer patients and healthy adult volunteers. When peripheral blood NK cells were stimulated with IL-2, the cells formed clusters beginning on day 5-6 and proliferated thereafter, in which the number of NK cells increased by 10-fold in 10 days. When IL-18 was added, cell clusters were observed as early as on day 4 and NK cells proliferated vigorously. On day 10, the expansion rate was 56-fold on average, showing that IL-18 promoted the expansion of NK cells. It was also notable that IL-18 enhanced the expression of CD80, CD86, HLA-DR and HLA-DQ on NK cells, suggesting that IL-18 conferred NK cells an APC-like phenotype. When cellular cytotoxicity was determined, APC-like NK cells efficiently killed tumor cells and anti-tumor activity was augmented by the addition of tumor antigen-specific mAbs. In addition, IFN-γ was produced by APC-like NK cells in response to tumor cells, and the cytokine production was further enhanced by mAbs. Taken together, IL-18 not only promoted the expansion of NK cells, but also changed the phenotype of NK cells. IL-2/IL-18-induced NK cells might, therefore, serve as a bridge between innate immunity and adaptive immunity and be useful for cancer immunotherapy.
Sohn, Kee Hoon; Segonzac, Cécile; Rallapalli, Ghanasyam; Sarris, Panagiotis F; Woo, Joo Yong; Williams, Simon J; Newman, Toby E; Paek, Kyung Hee; Kobe, Bostjan; Jones, Jonathan D G
2014-10-01
Plant nucleotide-binding leucine-rich repeat (NB-LRR) disease resistance (R) proteins recognize specific "avirulent" pathogen effectors and activate immune responses. NB-LRR proteins structurally and functionally resemble mammalian Nod-like receptors (NLRs). How NB-LRR and NLR proteins activate defense is poorly understood. The divergently transcribed Arabidopsis R genes, RPS4 (resistance to Pseudomonas syringae 4) and RRS1 (resistance to Ralstonia solanacearum 1), function together to confer recognition of Pseudomonas AvrRps4 and Ralstonia PopP2. RRS1 is the only known recessive NB-LRR R gene and encodes a WRKY DNA binding domain, prompting suggestions that it acts downstream of RPS4 for transcriptional activation of defense genes. We define here the early RRS1-dependent transcriptional changes upon delivery of PopP2 via Pseudomonas type III secretion. The Arabidopsis slh1 (sensitive to low humidity 1) mutant encodes an RRS1 allele (RRS1SLH1) with a single amino acid (leucine) insertion in the WRKY DNA-binding domain. Its poor growth due to constitutive defense activation is rescued at higher temperature. Transcription profiling data indicate that RRS1SLH1-mediated defense activation overlaps substantially with AvrRps4- and PopP2-regulated responses. To better understand the genetic basis of RPS4/RRS1-dependent immunity, we performed a genetic screen to identify suppressor of slh1 immunity (sushi) mutants. We show that many sushi mutants carry mutations in RPS4, suggesting that RPS4 acts downstream or in a complex with RRS1. Interestingly, several mutations were identified in a domain C-terminal to the RPS4 LRR domain. Using an Agrobacterium-mediated transient assay system, we demonstrate that the P-loop motif of RPS4 but not of RRS1SLH1 is required for RRS1SLH1 function. We also recapitulate the dominant suppression of RRS1SLH1 defense activation by wild type RRS1 and show this suppression requires an intact RRS1 P-loop. These analyses of RRS1SLH1 shed new light on mechanisms by which NB-LRR protein pairs activate defense signaling, or are held inactive in the absence of a pathogen effector.
Sarris, Panagiotis F.; Woo, Joo Yong; Williams, Simon J.; Newman, Toby E.; Paek, Kyung Hee; Kobe, Bostjan; Jones, Jonathan D. G.
2014-01-01
Plant nucleotide-binding leucine-rich repeat (NB-LRR) disease resistance (R) proteins recognize specific “avirulent” pathogen effectors and activate immune responses. NB-LRR proteins structurally and functionally resemble mammalian Nod-like receptors (NLRs). How NB-LRR and NLR proteins activate defense is poorly understood. The divergently transcribed Arabidopsis R genes, RPS4 (resistance to Pseudomonas syringae 4) and RRS1 (resistance to Ralstonia solanacearum 1), function together to confer recognition of Pseudomonas AvrRps4 and Ralstonia PopP2. RRS1 is the only known recessive NB-LRR R gene and encodes a WRKY DNA binding domain, prompting suggestions that it acts downstream of RPS4 for transcriptional activation of defense genes. We define here the early RRS1-dependent transcriptional changes upon delivery of PopP2 via Pseudomonas type III secretion. The Arabidopsis slh1 (sensitive to low humidity 1) mutant encodes an RRS1 allele (RRS1SLH1) with a single amino acid (leucine) insertion in the WRKY DNA-binding domain. Its poor growth due to constitutive defense activation is rescued at higher temperature. Transcription profiling data indicate that RRS1SLH1-mediated defense activation overlaps substantially with AvrRps4- and PopP2-regulated responses. To better understand the genetic basis of RPS4/RRS1-dependent immunity, we performed a genetic screen to identify suppressor of slh1 immunity (sushi) mutants. We show that many sushi mutants carry mutations in RPS4, suggesting that RPS4 acts downstream or in a complex with RRS1. Interestingly, several mutations were identified in a domain C-terminal to the RPS4 LRR domain. Using an Agrobacterium-mediated transient assay system, we demonstrate that the P-loop motif of RPS4 but not of RRS1SLH1 is required for RRS1SLH1 function. We also recapitulate the dominant suppression of RRS1SLH1 defense activation by wild type RRS1 and show this suppression requires an intact RRS1 P-loop. These analyses of RRS1SLH1 shed new light on mechanisms by which NB-LRR protein pairs activate defense signaling, or are held inactive in the absence of a pathogen effector. PMID:25340333
Effect of nanovaccine chemistry on humoral immune response kinetics and maturation
NASA Astrophysics Data System (ADS)
Haughney, Shannon L.; Ross, Kathleen A.; Boggiatto, Paola M.; Wannemuehler, Michael J.; Narasimhan, Balaji
2014-10-01
Acute respiratory infections represent a significant portion of global morbidity and mortality annually. There is a critical need for efficacious vaccines against respiratory pathogens. To vaccinate against respiratory disease, pulmonary delivery is an attractive route because it mimics the route of natural infection and can confer both mucosal and systemic immunity. We have previously demonstrated that a single dose, intranasal vaccine based on polyanhydride nanoparticles elicited a protective immune response against Yersinia pestis for at least 40 weeks after immunization with F1-V. Herein, we investigate the effect of nanoparticle chemistry and its attributes on the kinetics and maturation of the antigen-specific serum antibody response. We demonstrate that manipulation of polyanhydride nanoparticle chemistry facilitated differential kinetics of development of antibody titers, avidity, and epitope specificity. The results provide new insights into the underlying role(s) of nanoparticle chemistry in providing long-lived humoral immunity and aid in the rational design of nanovaccine formulations to induce long-lasting and mature antibody responses.Acute respiratory infections represent a significant portion of global morbidity and mortality annually. There is a critical need for efficacious vaccines against respiratory pathogens. To vaccinate against respiratory disease, pulmonary delivery is an attractive route because it mimics the route of natural infection and can confer both mucosal and systemic immunity. We have previously demonstrated that a single dose, intranasal vaccine based on polyanhydride nanoparticles elicited a protective immune response against Yersinia pestis for at least 40 weeks after immunization with F1-V. Herein, we investigate the effect of nanoparticle chemistry and its attributes on the kinetics and maturation of the antigen-specific serum antibody response. We demonstrate that manipulation of polyanhydride nanoparticle chemistry facilitated differential kinetics of development of antibody titers, avidity, and epitope specificity. The results provide new insights into the underlying role(s) of nanoparticle chemistry in providing long-lived humoral immunity and aid in the rational design of nanovaccine formulations to induce long-lasting and mature antibody responses. Electronic supplementary information (ESI) available: Fig. S1. See DOI: 10.1039/c4nr03724c
Jia, Ran; Lu, Lu; Liang, Xiaozhen; Sun, Zhiwu; Tan, Lingbing; Xu, Menghua; Su, Liyun; Xu, Jin
2017-09-12
Respiratory Syncycial Virus (RSV) is the most important pathogen responsible for children's severe lower respiratory tract infection. So far no RSV vaccine has yet been authorized for clinical use. The main impediment that blocked development of RSV vaccine is that inactivated RSV vaccine could cause RSV vaccine-enhanced disease (RVED). The mechanism of RVED remains unclear. Recently some researchers found that insufficient activation of innate immunity, including Toll-like receptors (TLRs), might be associated with the onset of RVED. Based on the above findings, this research was conducted to further study the mechanism of RVED. We first vaccinated mice with formalin-inactivated RSV vaccine (FIRSV) and then exposed them to RSV to establish a RVED mouse model. Consequently, we found that mice previously inoculated with FIRSV showed obvious weight loss and extensive pneumonia, as well as T helper 2 cells (Th2)-biased immunity and suppressed CD8 + T cell immunity after viral exposure, suggesting that we have successfully established a RVED mouse model. Then based on this model, we further added Poly(U) (TLR7/8 agonist) and CpG (TLR9 agonist) in FIRSV to see if RVED could be ameliorated. As a result, mice inoculated with FIRSV supplemented with Poly(U) and CpG had a much relieved weight loss and pneumonia, as well as suppressed Th2-biased immunity and strengthened CD8 + T cell function. Thus, the insufficient stimulation of TLR7/8 and (or) TLR9 might play a role in the development of RVED, which could provide evidence for using TLR agonists as vaccine adjuvants to confer a protective immune response against RSV.
Protective Immunity to Ricin Toxin Conferred by Antibodies against the Toxin’s Binding Subunit (RTB)
Yermakova, Anastasiya; Mantis, Nicholas J.
2011-01-01
The B subunit (RTB) of ricin toxin is a galactose-/N-acetyl galactosamine-specific lectin that promotes attachment and entry of ricin into host cells. RTB is also the archetype of the so-called R-type lectin family, whose members include haemagglutinins of botulinum neurotoxin (BoNT) progenitor toxins, as well as the binding subunits of cytolethal distending toxins. Although RTB is an appealing subunit vaccine candidate, as well as a potential target for immunotherapeutics, the degree to which RTB immunization elicits protective antibodies against ricin toxin remains unresolved. To address this issue, groups of mice were immunized with RTB and then challenged with 5xLD50s of ricin administered intraperitoneally. Despite high RTB-specific serum antibody titers, groups of RTB immunized mice were only partially immune to ricin challenge. Analysis of a collection of RTB-specific B cell hybridomas suggested that only a small fraction of antibodies against RTB have demonstrable neutralizing activity. Two RTB-specific neutralizing monoclonal IgG1 antibodies, 24B11 and SylH3, when passively administered to mice, were sufficient to protect the animals against a 5xLD50 dose of ricin. Both 24B11 and SylH3 blocked ricin attachment to terminal galactose residues and prevented toxin binding to the surfaces of bone marrow-derived macrophages (BMM), suggesting that they function by steric hindrance and recognize epitopes located on RTB’s carbohydrate recognition sub-domains (1α or 2γ). These data raise the possibility of using specific RTB sub-domains, rather than RTB itself, as antigens to more efficiently elicit neutralizing antibodies and protective immunity against ricin. PMID:21872634
Human Immune Function and Microbial Pathogenesis in Human Spaceflight
NASA Technical Reports Server (NTRS)
Pierson, Duane J.; Ott, M.
2006-01-01
This oral presentation was requested by Conference conveners. The requested subject is microbial risk assessment considering changes in the human immune system during flight and microbial diversity of environmental samples aboard the International Space Station (ISS). The presentation will begin with an introduction discussing the goals and limitations of microbial risk assessment during flight. The main portion of the presentation will include changes in the immune system that have been published, historical data from microbial analyses, and initial modeling of the environmental flora aboard ISS. The presentation will conclude with future goals and techniques to enhance our ability to perform microbial risk assessment on long duration missions.
Resistance to hepatitis C virus: potential genetic and immunological determinants.
Mina, Michael M; Luciani, Fabio; Cameron, Barbara; Bull, Rowena A; Beard, Michael R; Booth, David; Lloyd, Andrew R
2015-04-01
Studies of individuals who were highly exposed but seronegative (HESN) for HIV infection led to the discovery that homozygosity for the Δ32 deletion mutation in the CCR5 gene prevents viral entry into target cells, and is associated with resistance to infection. Additionally, evidence for protective immunity has been noted in some HESN groups, such as sex workers in The Gambia. Population studies of individuals at high risk for hepatitis C virus infection suggest that an HESN phenotype exists. The body of evidence, which suggests that protective immunity allows clearance of hepatitis C virus without seroconversion is growing. Furthermore, proof-of-principle evidence from in-vitro studies shows that genetic polymorphisms can confer resistance to establishment of infection. This Review discusses the possibility that genetic mutations confer resistance against hepatitis C virus, and also explores evidence for protective immunity, including via genetically programmed variations in host responses. The data generally strengthens the notion that investigations of naturally arising polymorphisms within the hepatitis C virus interactome, and genetic association studies of well characterised HESN individuals, could identify potential targets for vaccine design and inform novel therapies. Copyright © 2015 Elsevier Ltd. All rights reserved.
Kim, Min-Chul; Song, Jae-Min; O, Eunju; Kwon, Young-Man; Lee, Youn-Jeong; Compans, Richard W; Kang, Sang-Moo
2013-01-01
The extracellular domain of M2 (M2e), a small ion channel membrane protein, is well conserved among different human influenza A virus strains. To improve the protective efficacy of M2e vaccines, we genetically engineered a tandem repeat of M2e epitope sequences (M2e5x) of human, swine, and avian origin influenza A viruses, which was expressed in a membrane-anchored form and incorporated in virus-like particles (VLPs). The M2e5x protein with the transmembrane domain of hemagglutinin (HA) was effectively incorporated into VLPs at a several 100-fold higher level than that on influenza virions. Intramuscular immunization with M2e5x VLP vaccines was highly effective in inducing M2e-specific antibodies reactive to different influenza viruses, mucosal and systemic immune responses, and cross-protection regardless of influenza virus subtypes in the absence of adjuvant. Importantly, immune sera were found to be sufficient for conferring protection in naive mice, which was long-lived and cross-protective. Thus, molecular designing and presenting M2e immunogens on VLPs provide a promising platform for developing universal influenza vaccines without using adjuvants. PMID:23247101
A clinically parameterized mathematical model of Shigella immunity to inform vaccine design
Wahid, Rezwanul; Toapanta, Franklin R.; Simon, Jakub K.; Sztein, Marcelo B.
2018-01-01
We refine and clinically parameterize a mathematical model of the humoral immune response against Shigella, a diarrheal bacteria that infects 80-165 million people and kills an estimated 600,000 people worldwide each year. Using Latin hypercube sampling and Monte Carlo simulations for parameter estimation, we fit our model to human immune data from two Shigella EcSf2a-2 vaccine trials and a rechallenge study in which antibody and B-cell responses against Shigella′s lipopolysaccharide (LPS) and O-membrane proteins (OMP) were recorded. The clinically grounded model is used to mathematically investigate which key immune mechanisms and bacterial targets confer immunity against Shigella and to predict which humoral immune components should be elicited to create a protective vaccine against Shigella. The model offers insight into why the EcSf2a-2 vaccine had low efficacy and demonstrates that at a group level a humoral immune response induced by EcSf2a-2 vaccine or wild-type challenge against Shigella′s LPS or OMP does not appear sufficient for protection. That is, the model predicts an uncontrolled infection of gut epithelial cells that is present across all best-fit model parameterizations when fit to EcSf2a-2 vaccine or wild-type challenge data. Using sensitivity analysis, we explore which model parameter values must be altered to prevent the destructive epithelial invasion by Shigella bacteria and identify four key parameter groups as potential vaccine targets or immune correlates: 1) the rate that Shigella migrates into the lamina propria or epithelium, 2) the rate that memory B cells (BM) differentiate into antibody-secreting cells (ASC), 3) the rate at which antibodies are produced by activated ASC, and 4) the Shigella-specific BM carrying capacity. This paper underscores the need for a multifaceted approach in ongoing efforts to design an effective Shigella vaccine. PMID:29304144
A clinically parameterized mathematical model of Shigella immunity to inform vaccine design.
Davis, Courtney L; Wahid, Rezwanul; Toapanta, Franklin R; Simon, Jakub K; Sztein, Marcelo B
2018-01-01
We refine and clinically parameterize a mathematical model of the humoral immune response against Shigella, a diarrheal bacteria that infects 80-165 million people and kills an estimated 600,000 people worldwide each year. Using Latin hypercube sampling and Monte Carlo simulations for parameter estimation, we fit our model to human immune data from two Shigella EcSf2a-2 vaccine trials and a rechallenge study in which antibody and B-cell responses against Shigella's lipopolysaccharide (LPS) and O-membrane proteins (OMP) were recorded. The clinically grounded model is used to mathematically investigate which key immune mechanisms and bacterial targets confer immunity against Shigella and to predict which humoral immune components should be elicited to create a protective vaccine against Shigella. The model offers insight into why the EcSf2a-2 vaccine had low efficacy and demonstrates that at a group level a humoral immune response induced by EcSf2a-2 vaccine or wild-type challenge against Shigella's LPS or OMP does not appear sufficient for protection. That is, the model predicts an uncontrolled infection of gut epithelial cells that is present across all best-fit model parameterizations when fit to EcSf2a-2 vaccine or wild-type challenge data. Using sensitivity analysis, we explore which model parameter values must be altered to prevent the destructive epithelial invasion by Shigella bacteria and identify four key parameter groups as potential vaccine targets or immune correlates: 1) the rate that Shigella migrates into the lamina propria or epithelium, 2) the rate that memory B cells (BM) differentiate into antibody-secreting cells (ASC), 3) the rate at which antibodies are produced by activated ASC, and 4) the Shigella-specific BM carrying capacity. This paper underscores the need for a multifaceted approach in ongoing efforts to design an effective Shigella vaccine.
The Interactions Between Kynurenine, Folate, Methionine and Pteridine Pathways in Obesity.
Engin, Ayse Basak; Engin, Atilla
2017-01-01
Obesity activates both innate and adaptive immune responses in adipose tissue. Elevated levels of eosinophils with depression of monocyte and neutrophil indicate the deficiencies in the immune system of morbidly obese individuals. Actually, adipose tissue macrophages are functional antigen-presenting cells that promote the proliferation of interferon-gamma (IFN-gamma)-producing CD4+ T cells in adipose tissue of obese subjects. Eventually, diet-induced obesity is associated with the loss of tissue homeostasis and development of type 1 inflammatory responses in visceral adipose tissue. Activity of inducible indoleamine 2,3-dioxygenase-1 (IDO-1) plays a major role under pro-inflammatory, IFN-gamma dominated settings. One of the two rate-limiting enzymes which can metabolize tryptophan to kynurenine is IDO-1. Tumor necrosis factor-alpha (TNF-alpha) correlates with IDO-1 in adipose compartments. Actually, IDO-1-mediated tryptophan catabolism due to chronic immune activation is the cause of reduced tryptophan plasma levels and be considered as the driving force for food intake in morbidly obese patients. Thus, decrease in plasma tryptophan levels and subsequent reduction in serotonin (5-HT) production provokes satiety dysregulation that leads to increased caloric uptake and obesity. However, after bariatric surgery, weight reduction does not lead to normalization of IDO-1 activity. Furthermore, there is a connection between arginine and tryptophan metabolic pathways in the generation of reactive nitrogen intermediates. Hence, abdominal obesity is associated with vascular endothelial dysfunction and reduced nitric oxide (NO) availability. IFN-gamma-induced activation of the inducible nitric oxide synthase (iNOS) and dissociation of endothelial adenosine monophosphate activated protein kinase (AMPK)- phosphoinositide 3-kinase (PI3K)-protein kinase B (Akt)- endothelial NO synthase (eNOS) pathway enhances oxidative stress production secondary to high-fat diet. Thus, reduced endothelial NO availability correlates with the increase in plasma non-esterified fatty acids and triglycerides levels. Additionally, in obese patients, folate-deficiency leads to hyperhomocysteinemia. Folic acid confers protection against hyperhomocysteinemia-induced oxidative stress.
Shikonin enhances efficacy of a gene-based cancer vaccine via induction of RANTES
2012-01-01
Background Shikonin, a phytochemical purified from Lithospermum erythrorhizon, has been shown to confer diverse pharmacological activities, including accelerating granuloma formation, wound healing, anti-inflammation and others, and is explored for immune-modifier activities for vaccination in this study. Transdermal gene-based vaccine is an attractive approach for delivery of DNA transgenes encoding specific tumor antigens to host skin tissues. Skin dendritic cells (DCs), a potent antigen-presenting cell type, is known to play a critical role in transmitting and orchestrating tumor antigen-specific immunities against cancers. The present study hence employs these various components for experimentation. Method The mRNA and protein expression of RANTES were detected by RT-PCR and ELISA, respectively. The regional expression of RANTES and tissue damage in test skin were evaluated via immunohistochemistry assay. Fluorescein isothiocyanate sensitization assay was performed to trace the trafficking of DCs from the skin vaccination site to draining lymph nodes. Adjuvantic effect of shikonin on gene gun-delivered human gp100 (hgp100) DNA cancer vaccine was studied in a human gp100-transfected B16 (B16/hgp100) tumor model. Results Among various phytochemicals tested, shikonin induced the highest level of expression of RANTES in normal skin tissues. In comparison, mouse RANTES cDNA gene transfection induced a higher level of mRANTES expression for a longer period, but caused more extensive skin damage. Topical application of shikonin onto the immunization site before gene gun-mediated vaccination augmented the population of skin DCs migrating into the draining lymph nodes. A hgp100 cDNA gene vaccination regimen with shikonin pretreatment as an adjuvant in a B16/hgp100 tumor model increased cytotoxic T lymphocyte activities in splenocytes and lymph node cells on target tumor cells. Conclusion Together, our findings suggest that shikonin can effectively enhance anti-tumor potency of a gene-based cancer vaccine via the induction of RANTES expression at the skin immunization site. PMID:22494696
Xiao, Yuhong; Daniell, Henry
2017-09-25
Oral polio vaccine (OPV) and Inactivated Polio Vaccine (IPV) have distinct advantages and limitations. IPV does not provide mucosal immunity and introduction of IPV to mitigate consequences of circulating vaccine-derived polio virus from OPV has very limited effect on transmission and OPV campaigns are essential for interrupting wild polio virus transmission, even in developed countries with a high coverage of IPV and protected sewer systems. The problem is magnified in many countries with limited resources. Requirement of refrigeration for storage and transportation for both IPV and OPV is also a major challenge in developing countries. Therefore, we present here long-term studies on comparison of a plant-based booster vaccine, which is free of virus and cold chain with IPV boosters and provide data on mucosal and systemic immunity and protection conferred by neutralizing antibodies. Mice were primed subcutaneously with IPV and boosted orally with lyophilized plant cells containing 1μg or 25μg polio viral protein 1 (VP1), once a month for three months or a single booster one year after the first prime. Our results show that VP1-IgG1 titers in single or double dose IPV dropped to background levels after one year of immunization. This decrease correlated with >50% reduction in seropositivity in double dose and <10% seropositivity in single dose IPV against serotype 1. Single dose IPV offered no or minimal protection against serotype 1 and 2 but conferred protection against serotype 3. VP1-IgA titers were negligible in IPV single or double dose vaccinated mice. VP1 antigen with two plant-derived adjuvants induced significantly high level and long lasting VP1-IgG1, IgA and neutralizing antibody titers (average 4.3-6.8 log2 titers). Plant boosters with VP1 and plant derived adjuvants maintained the same level titers from 29 to 400days and conferred the same level of protection against all three serotypes throughout the duration of this study. Even during period, when no plant booster was given (∼260days), VP1-IgG1 titers were maintained at high levels. Lyophilized plant cells expressing VP1 can be stored without losing efficacy, eliminating cold chain. Virus-free, cold-chain free vaccine is ready for further clinical development. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.
Shreya, Das; Uppalapati, Siva R; Kingston, Joseph J; Sripathy, Murali H; Batra, Harsh V
2015-05-01
Clostridium perfringens type A, an anaerobic pathogen is the most potent cause of soft tissue infections like gas gangrene and enteric diseases like food poisoning and enteritis. The disease manifestations are mediated via two important exotoxins, viz. myonecrotic alpha toxin (αC) and enterotoxin (CPE). In the present study, we synthesized a bivalent chimeric protein r-Cpae comprising C-terminal binding regions of αC and CPE using structural vaccinology rationale and assessed its protective efficacy against both alpha toxin (αC) and enterotoxin (CPE) respectively, in murine model. Active immunization of mice with r-Cpae generated high circulating serum IgG (systemic), significantly increased intestinal mucosal s-IgA antibody titres and resulted in substantial protection to the immunized animals (100% and 75% survival) with reduced tissue morbidity when administered with 5×LD(100) doses of αC (intramuscular) and CPE (intra-gastric gavage) respectively. Mouse RBCs and Caco-2 cells incubated with a mixture of anti-r-Cpae antibodies and αC and CPE respectively, illustrated significantly higher protection against the respective toxins. Passive immunization of mice with a similar mixture resulted in 91-100% survival at the end of the 15 days observation period while mice immunized with a concoction of sham sera and respective toxins died within 2-3 days. This work demonstrates the efficacy of the rationally designed r-Cpae chimeric protein as a potential sub unit vaccine candidate against αC and CPE of C. perfringens type A toxemia. Copyright © 2015 Elsevier Ltd. All rights reserved.
Rao, Srinivas S.; Kong, Wing-Pui; Wei, Chih-Jen; Van Hoeven, Neal; Gorres, J. Patrick; Nason, Martha; Andersen, Hanne; Tumpey, Terrence M.; Nabel, Gary J.
2010-01-01
Efforts to develop a broadly protective vaccine against the highly pathogenic avian influenza A (HPAI) H5N1 virus have focused on highly conserved influenza gene products. The viral nucleoprotein (NP) and ion channel matrix protein (M2) are highly conserved among different strains and various influenza A subtypes. Here, we investigate the relative efficacy of NP and M2 compared to HA in protecting against HPAI H5N1 virus. In mice, previous studies have shown that vaccination with NP and M2 in recombinant DNA and/or adenovirus vectors or with adjuvants confers protection against lethal challenge in the absence of HA. However, we find that the protective efficacy of NP and M2 diminishes as the virulence and dose of the challenge virus are increased. To explore this question in a model relevant to human disease, ferrets were immunized with DNA/rAd5 vaccines encoding NP, M2, HA, NP+M2 or HA+NP+M2. Only HA or HA+NP+M2 vaccination conferred protection against a stringent virus challenge. Therefore, while gene-based vaccination with NP and M2 may provide moderate levels of protection against low challenge doses, it is insufficient to confer protective immunity against high challenge doses of H5N1 in ferrets. These immunogens may require combinatorial vaccination with HA, which confers protection even against very high doses of lethal viral challenge. PMID:20352112
Effect of Prior Immunization on Induction of Cervical Cancer in Mice by Herpes Simplex Virus Type 2
NASA Astrophysics Data System (ADS)
Budd Wentz, W.; Heggie, Alfred D.; Anthony, Donald D.; Reagan, James W.
1983-12-01
Previous studies at this laboratory showed that repeated application of inactivated herpes simplex virus type 2 to the mouse cervix produces premalignant and malignant lesions. In the present study mice were inoculated with inactivated herpes simplex virus type 2 or control solution and Freund's adjuvant by intraperitoneal and subcutaneous routes before exposure of the cervix to inactivated virus. It appears that immunization with inactivated virus conferred a protection against the induction of cervical carcinoma.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fischer, Will; Korber, Bette
2009-01-01
Creation of a successful HIV vaccine will require the development of a strategy to generate cellular immunity with sufficient cross-clade breadth to deal with the extreme genetic diversity of the virus. Polyvalent mosaic immunogens derived from in silica recombination of natural strains of HIV are designed to induce cellular immune responses that maximally cover the sequence diversity of circulating virus isolates. Immunization of rhesus monkeys with plasmid DNA and recombinant vaccinia virus vaccine constructs expressing either consensus immunogens or polyvalent mosaic immunogens elicited a CD4+ T lymphocyte-biased response with comparably broad epitope-specific total T lymphocyte specificities. However, immunization with themore » mosaic immunogens induced HIV-specific CD8+ T lymphocyte responses with markedly greater depth and breadth. Therefore, the use of polyvalent mosaic immunogens is a promising strategy for a global vaccine for HIV.« less
CRISPR-Cas systems: prokaryotes upgrade to adaptive immunity
Barrangou, Rodolphe; Marraffini, Luciano A.
2014-01-01
Summary Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR), and associated proteins (Cas) comprise the CRISPR-Cas system, which confers adaptive immunity against exogenic elements in many bacteria and most archaea. CRISPR-mediated immunization occurs through the uptake of DNA from invasive genetic elements such as plasmids and viruses, followed by its integration into CRISPR loci. These loci are subsequently transcribed and processed into small interfering RNAs that guide nucleases for specific cleavage of complementary sequences. Conceptually, CRISPR-Cas shares functional features with the mammalian adaptive immune system, while also exhibiting characteristics of Lamarckian evolution. Because immune markers spliced from exogenous agents are integrated iteratively in CRISPR loci, they constitute a genetic record of vaccination events and reflect environmental conditions and changes over time. Cas endonucleases, which can be reprogrammed by small guide RNAs have shown unprecedented potential and flexibility for genome editing, and can be repurposed for numerous DNA targeting applications including transcriptional control. PMID:24766887
Del Medico Zajac, María Paula; Zanetti, Flavia Adriana; Esusy, María Soledad; Federico, Carlos Rodolfo; Zabal, Osvaldo; Valera, Alejandro Rafael; Calamante, Gabriela
In this study, we evaluated the immunogenicity and efficacy of mucosal delivery of a recombinant modified vaccinia Ankara virus (MVA) expressing the secreted version of bovine herpesvirus type 1 (BoHV-1) glycoprotein D (MVA-gDs) without addition of adjuvant in two animal models. First, we demonstrated the capability of MVA-gDs of inducing both local and systemic anti-gD humoral immune response after intranasal immunization of mice. Then, we confirmed that two doses of MVA-gDs administered intranasally to rabbits induced systemic anti-gD antibodies and conferred protection against BoHV-1 challenge. Our results show the potential of using MVA as a vector for the rational design of veterinary vaccines capable of inducing specific and protective immune responses both at local and systemic level.
Babaie, Jalal; Amiri, Samira; Homayoun, Robab; Azimi, Ebrahim; Mohabati, Reyhaneh; Berizi, Mahboobe; Sadaie, M. Reza; Golkar, Majid
2018-01-01
We have previously reported that immunization with GRA2 antigen of Toxoplasma gondii induces protective immunity in CBA/J (H2k) and BALB/c mice (H2d). We aimed to examine whether immunization of a distinct strain of rodent with recombinant dense granule antigens (GRA2) combined with monophosphorryl lipid A (MPL) adjuvant elicits protective immune response against T. gondii. C57BL/6 (H2b haplotype) mice were immunized with GRA2, formulated in MPL adjuvant. Strong humoral response, predominantly of IgG1 subclass and cellular response, IFN-γ, was detected at three weeks post immunization. Mice immunized with GRA2 had significantly (p < 0.01) fewer brain cysts than those in the adjuvant group, upon challenge infection. Despite the production of a strong antibody response, IFN-γ production and brain cyst reduction were not significant when the immunized mice were infected four months after the immunization. We can conclude that GRA2 immunization partially protects against T. gondii infection in C57BL/6 mice, though the potency and longevity of this antigen as a standalone vaccine may vary in distinct genetic backgrounds. This observation further emphasizes the utility of GRA2 for incorporation into a multi-antigenic vaccine against T. gondii.
Control of regulatory T cell lineage commitment and maintenance.
Josefowicz, Steven Z; Rudensky, Alexander
2009-05-01
Foxp3-expressing regulatory T (Treg) cells suppress pathology mediated by immune responses against self and foreign antigens and commensal microorganisms. Sustained expression of the transcription factor Foxp3, a key distinguishing feature of Treg cells, is required for their differentiation and suppressor function. In addition, Foxp3 expression prevents deviation of Treg cells into effector T cell lineages and confers dependence of Treg cell survival and expansion on growth factors, foremost interleukin-2, provided by activated effector T cells. In this review we discuss Treg cell differentiation and maintenance with a particular emphasis on molecular regulation of Foxp3 expression, arguably a key to mechanistic understanding of biology of regulatory T cells.
Liu, Ying; Ye, Ling; Lin, Fang; Gomaa, Yasmine; Flyer, David; Carrion, Ricardo; Patterson, Jean L; Prausnitz, Mark R; Smith, Gale; Glenn, Gregory; Wu, Hua; Compans, Richard W; Yang, Chinglai
2018-06-08
In this study, we investigated immune responses induced by purified Ebola virus (EBOV) soluble glycoprotein (sGP) subunit vaccines via intradermal immunization with microneedle (MN) patches in comparison with intramuscular (IM) injection in mice. Our results showed that MN delivery of EBOV sGP was superior to IM injection in eliciting higher levels and longer lasting antibody responses against EBOV sGP and GP antigens. Moreover, sGP-specific immune responses induced by MN or IM immunizations were effectively augmented by formulating sGP with a saponin-based adjuvant, and they were shown to confer complete protection of mice against lethal mouse-adapted EBOV (MA-EBOV) challenge. In comparison, mice that received sGP without adjuvant by MN or IM immunizations succumbed to lethal MA-EBOV challenge. These results show that immunization with EBOV sGP subunit vaccines with adjuvant by MN patches, which have been shown to provide improved safety and thermal stability, is a promising approach to protect against EBOV infection.
Lv, Li-Hong; Wan, Yun-Le; Lin, Yan; Zhang, Wei; Yang, Mei; Li, Guo-Lin; Lin, Hao-Ming; Shang, Chang-Zhen; Chen, Ya-Jin; Min, Jun
2012-05-04
Failure of immune surveillance related to inadequate host antitumor immune responses has been suggested as a possible cause of the high incidence of recurrence and poor overall survival outcome of hepatocellular carcinoma. The stress-induced heat shock proteins (HSPs) are known to act as endogenous "danger signals" that can improve tumor immunogenicity and induce natural killer (NK) cell responses. Exosome is a novel secretory pathway for HSPs. In our experiments, the immune regulatory effect of the HSP-bearing exosomes secreted by human hepatocellular carcinoma cells under stress conditions on NK cells was studied. ELISA results showed that the production of HSP60, HSP70, and HSP90 was up-regulated in both cell lines in a stress-specific manner. After exposure to hepatocellular carcinoma cell-resistant or sensitive anticancer drugs (hereafter referred to as "resistant" or "sensitive" anticancer drug), the membrane microvesicles were actively released by hepatocellular carcinoma cells, differing in their ability to present HSPs on the cell surface, which were characterized as exosomes. Acting as a decoy, the HSP-bearing exosomes efficiently stimulated NK cell cytotoxicity and granzyme B production, up-regulated the expression of inhibitory receptor CD94, and down-regulated the expression of activating receptors CD69, NKG2D, and NKp44. Notably, resistant anticancer drugs enhanced exosome release and generated more exosome-carried HSPs, which augmented the activation of the cytotoxic response. In summary, our findings demonstrated that exosomes derived from resistant anticancer drug-treated HepG2 cells conferred superior immunogenicity in inducing HSP-specific NK cell responses, which provided a clue for finding an efficient vaccine for hepatocellular carcinoma immunotherapy.
Tarr, Andrew J; Liu, Xiaoyu; Reed, Nathaniel S; Quan, Ning
2014-11-01
We found recently that controlled progressive challenge with subthreshold levels of E. coli can confer progressively stronger resistance to future reinfection-induced sickness behavior to the host. We have termed this type of inflammation "euflammation". In this study, we further characterized the kinetic changes in the behavior, immunological, and neuroendocrine aspects of euflammation. Results show euflammatory animals only display transient and subtle sickness behaviors of anorexia, adipsia, and anhedonia upon a later infectious challenge which would have caused much more severe and longer lasting sickness behavior if given without prior euflammatory challenges. Similarly, infectious challenge-induced corticosterone secretion was greatly ameliorated in euflammatory animals. At the site of E.coli priming injections, which we termed euflammation induction locus (EIL), innate immune cells displayed a partial endotoxin tolerant phenotype with reduced expression of innate activation markers and muted inflammatory cytokine expression upon ex vivo LPS stimulation, whereas innate immune cells outside EIL displayed largely opposite characteristics. Bacterial clearance function, however, was enhanced both inside and outside EIL. Finally, sickness induction by an infectious challenge placed outside the EIL was also abrogated. These results suggest euflammation could be used as an efficient method to "train" the innate immune system to resist the consequences of future infectious/inflammatory challenges. Copyright © 2014 Elsevier Inc. All rights reserved.
Rational design of adjuvants targeting the C-type lectin Mincle.
Decout, Alexiane; Silva-Gomes, Sandro; Drocourt, Daniel; Barbe, Sophie; André, Isabelle; Cueto, Francisco J; Lioux, Thierry; Sancho, David; Pérouzel, Eric; Vercellone, Alain; Prandi, Jacques; Gilleron, Martine; Tiraby, Gérard; Nigou, Jérôme
2017-03-07
The advances in subunit vaccines development have intensified the search for potent adjuvants, particularly adjuvants inducing cell-mediated immune responses. Identification of the C-type lectin Mincle as one of the receptors underlying the remarkable immunogenicity of the mycobacterial cell wall, via recognition of trehalose-6,6'-dimycolate (TDM), has opened avenues for the rational design of such molecules. Using a combination of chemical synthesis, biological evaluation, molecular dynamics simulations, and protein mutagenesis, we gained insight into the molecular bases of glycolipid recognition by Mincle. Unexpectedly, the fine structure of the fatty acids was found to play a key role in the binding of a glycolipid to the carbohydrate recognition domain of the lectin. Glucose and mannose esterified at O -6 by a synthetic α-ramified 32-carbon fatty acid showed agonist activity similar to that of TDM, despite their much simpler structure. Moreover, they were seen to stimulate proinflammatory cytokine production in primary human and murine cells in a Mincle-dependent fashion. Finally, they were found to induce strong Th1 and Th17 immune responses in vivo in immunization experiments in mice and conferred protection in a murine model of Mycobacterium tuberculosis infection. Here we describe the rational development of new molecules with powerful adjuvant properties.
Virus-like particle-based vaccine against coxsackievirus A6 protects mice against lethal infections.
Shen, Chaoyun; Ku, Zhiqiang; Zhou, Yu; Li, Dapeng; Wang, Lili; Lan, Ke; Liu, Qingwei; Huang, Zhong
2016-07-25
Coxsackievirus A6 (CA6) is emerging as one of the major causative agents of hand, foot, and mouth disease (HFMD) worldwide. However, no vaccine is currently available for preventing CA6 infection. Here, we report the development of a virus-like particle (VLP)-based recombinant vaccine for CA6. We produced CA6 VLPs in insect cells by infecting the cells with a baculovirus coexpressing the genes encoding CA6 P1 and 3CD. Biochemical analyses showed that the produced VLPs consisted of VP0, VP1, and VP3 capsid subunit proteins generated by the cleavage of P1 by 3CD. Mice immunized with these VLPs produced CA6-specific serum antibodies. Passive transfer of antisera from CA6 VLP-immunized mice protected recipient mice from lethal infections caused by homologous and heterologous CA6 strains. Moreover, active immunization of mice with CA6 VLPs efficiently conferred protection against both homologous and heterologous CA6 infections. These results suggested that CA6 VLP-based recombinant vaccine is a promising candidate vaccine for preventing CA6 infection and can be incorporated into a multivalent HFMD vaccine formulation to achieve broad-spectrum and effective prevention of this disease. Copyright © 2016 Elsevier Ltd. All rights reserved.
Kemperman, Robèr; Jonker, Marnix; Nauta, Arjen; Kuipers, Oscar P.; Kok, Jan
2003-01-01
A region of 12 kb flanking the structural gene of the cyclic antibacterial peptide circularin A of Clostridium beijerinckii ATCC 25752 was sequenced, and the putative proteins involved in the production and secretion of circularin A were identified. The genes are tightly organized in overlapping open reading frames. Heterologous expression of circularin A in Enterococcus faecalis was achieved, and five genes were identified as minimally required for bacteriocin production and secretion. Two of the putative proteins, CirB and CirC, are predicted to contain membrane-spanning domains, while CirD contains a highly conserved ATP-binding domain. Together with CirB and CirC, this ATP-binding protein is involved in the production of circularin A. The fifth gene, cirE, confers immunity towards circularin A when expressed in either Lactococcus lactis or E. faecalis and is needed in order to allow the bacteria to produce bacteriocin. Additional resistance against circularin A is conferred by the activity of the putative transporter consisting of CirB and CirD. PMID:14532033
Ribeiro, Carolina H.; Lynch, Nicholas J.; Stover, Cordula M.; Ali, Youssif M.; Valck, Carolina; Noya-Leal, Francisca; Schwaeble, Wilhelm J.; Ferreira, Arturo
2015-01-01
Trypanosoma cruzi is the causative agent of Chagas' disease, a chronic illness affecting 10 million people around the world. The complement system plays an important role in fighting microbial infections. The recognition molecules of the lectin pathway of complement activation, mannose-binding lectin (MBL), ficolins, and CL-11, bind to specific carbohydrates on pathogens, triggering complement activation through MBL-associated serine protease-2 (MASP-2). Previous in vitro work showed that human MBL and ficolins contribute to T. cruzi lysis. However, MBL-deficient mice are only moderately compromised in their defense against the parasite, as they may still activate the lectin pathway through ficolins and CL-11. Here, we assessed MASP-2-deficient mice, the only presently available mouse line with total lectin pathway deficiency, for a phenotype in T. cruzi infection. Total absence of lectin pathway functional activity did not confer higher susceptibility to T. cruzi infection, suggesting that it plays a minor role in the immune response against this parasite. PMID:25548381
The 12th International Workshops on Opportunistic Protists (IWOP-12)
Weiss, Louis M.; Cushion, Melanie T.; Didier, Elizabeth; Xiao, Lihua; Marciano-Cabral, Francine; Sinai, Anthony P.; Matos, Olga; Calderon, Enrique J.; Kaneshiro, Edna S.
2013-01-01
The 12th International Workshops on Opportunistic Protists (IWOP-12) was held in August 2012 in Tarrytown, New York. The objectives of the IWOP meetings are to: (1) serve as a forum for exchange of new information among active researchers concerning the basic biology, molecular genetics, immunology, biochemistry, pathogenesis, drug development, therapy, and epidemiology of these immunodeficiency-associated pathogenic eukaryotic microorganisms that are seen in patients with AIDS and (2) foster the entry of new and young investigators into these underserved research areas. The IWOP meeting focuses on opportunistic protists, e.g. the free-living amoebae, Pneumocystis, Cryptosporidium, Toxoplasma, the Microsporidia, and kinetoplastid flagellates. This conference represents the major conference that brings together research groups working on these opportunistic pathogens. Slow but steady progress is being achieved on understanding the biology of these pathogenic organisms, their involvement in disease causation in both immune-deficient and immune-competent hosts, and is providing critical insights into these emerging and reemerging pathogens. This IWOP meeting demonstrated the importance of newly developed genomic level information for many of these pathogens and how analysis of such large data sets is providing key insights into the basic biology of these organisms. A great concern is the loss of scientific expertise and diversity in the research community due to the ongoing decline in research funding. This loss of researchers is due to the small size of many of these research communities and a lack of appreciation by the larger scientific community concerning the state of art and challenges faced by researchers working on these organisms. PMID:23560871
Fournier, Philippe; Schirrmacher, Volker
2013-02-01
Monoclonal anti-tumor antibodies (mAbs) that are clinically effective usually recruit, via their constant fragment (Fc) domain, Fc receptor (FcR)-positive accessory cells of the immune system and engage these additionally against the tumor. Since T cells are FcR negative, these important cells are not getting involved. In contrast to mAbs, bispecific antibodies (bsAbs) can be designed in such a way that they involve T cells. bsAbs are artificially designed molecules that bind simultaneously to two different antigens, one on the tumor cell, the other one on an immune effector cell such as CD3 on T cells. Such dual antibody constructs can cross-link tumor cells and T cells. Many such bsAb molecules at the surface of tumor cells can thus build a bridge to T cells and aggregate their CD3 molecules, thereby activating them for cytotoxic activity. BsAbs can also contain a third binding site, for instance a Fc domain or a cytokine that would bind to its respective cytokine receptor. The present review discusses the pros and cons for the use of the Fc fragment during the development of bsAbs using either cell-fusion or recombinant DNA technologies. The recombinant antibody technology allows the generation of very efficient bsAbs containing no Fc domain such as the bi-specific T-cell engager (BiTE). The strong antitumor activity of these molecules makes them very interesting new cancer therapeutics. Over the last decade, we have developed another concept, namely to combine bsAbs and multivalent immunocytokines with a tumor cell vaccine. The latter are patient-derived tumor cells modified by infection with a virus. The virus-Newcastle Disease Virus (NDV)-introduces, at the surface of the tumor cells, viral molecules that can serve as general anchors for the bsAbs. Our strategy aims at redirecting, in an Fc-independent fashion, activities of T cells and accessory cells against autologous tumor antigens. It creates very promising perspectives for a new generation of efficient and safe cancer therapeutics that should confer long-lasting anti-tumor immunity.
Adachi, Hiroaki; Nakano, Takaaki; Miyagawa, Noriko; Ishihama, Nobuaki; Yoshioka, Miki; Katou, Yuri; Yaeno, Takashi
2015-01-01
Pathogen attack sequentially confers pattern-triggered immunity (PTI) and effector-triggered immunity (ETI) after sensing of pathogen patterns and effectors by plant immune receptors, respectively. Reactive oxygen species (ROS) play pivotal roles in PTI and ETI as signaling molecules. Nicotiana benthamiana RBOHB, an NADPH oxidase, is responsible for both the transient PTI ROS burst and the robust ETI ROS burst. Here, we show that RBOHB transactivation mediated by MAPK contributes to R3a/AVR3a-triggered ETI (AVR3a-ETI) ROS burst. RBOHB is markedly induced during the ETI and INF1-triggered PTI (INF1-PTI), but not flg22-tiggered PTI (flg22-PTI). We found that the RBOHB promoter contains a functional W-box in the R3a/AVR3a and INF1 signal-responsive cis-element. Ectopic expression of four phospho-mimicking mutants of WRKY transcription factors, which are MAPK substrates, induced RBOHB, and yeast one-hybrid analysis indicated that these mutants bind to the cis-element. Chromatin immunoprecipitation assays indicated direct binding of the WRKY to the cis-element in plants. Silencing of multiple WRKY genes compromised the upregulation of RBOHB, resulting in impairment of AVR3a-ETI and INF1-PTI ROS bursts, but not the flg22-PTI ROS burst. These results suggest that the MAPK-WRKY pathway is required for AVR3a-ETI and INF1-PTI ROS bursts by activation of RBOHB. PMID:26373453
NASA Astrophysics Data System (ADS)
Kobayashi, Hisataka
2017-02-01
Near infrared photoimmunotherapy (NIR-PIT) is a new type of molecularly-targeted photo-therapy based on conjugating a near infrared silica-phthalocyanine dye, IR700, to a monoclonal antibody (MAb) targeting target-specific cell-surface molecules. When exposed to NIR light, the conjugate rapidly induces a highly-selective cell death only in receptor-positive, MAb-IR700-bound cells. Current immunotherapies for cancer seek to modulate the balance among different immune cell populations, thereby promoting anti-tumor immune responses. However, because these are systemic therapies, they often cause treatment-limiting autoimmune adverse effects. It would be ideal to manipulate the balance between suppressor and effector cells within the tumor without disturbing homeostasis elsewhere in the body. CD4+CD25+Foxp3+ regulatory T cells (Tregs) are well-known immune-suppressor cells that play a key role in tumor immuno-evasion and have been the target of systemic immunotherapies. We used CD25-targeted NIR-PIT to selectively deplete Tregs, thus activating CD8+ T and NK cells and restoring local anti-tumor immunity. This not only resulted in regression of the treated tumor but also induced responses in separate untreated tumors of the same cell-line derivation. We conclude that CD25-targeted NIR-PIT causes spatially selective depletion of Tregs, thereby providing an alternative approach to cancer immunotherapy that can treat not only local tumors but also distant metastatic tumors.
Retamal-Díaz, Angello R.; Kalergis, Alexis M.; Bueno, Susan M.; González, Pablo A.
2017-01-01
Herpes simplex virus type 2 (HSV-2) is highly prevalent in the human population producing significant morbidity, mainly because of the generation of genital ulcers and neonatal encephalitis. Additionally, HSV-2 infection significantly increases the susceptibility of the host to acquire HIV and promotes the shedding of the latter in the coinfected. Despite numerous efforts to create a vaccine against HSV-2, no licensed vaccines are currently available. A long-standing strategy, based on few viral glycoproteins combined with adjuvants, recently displayed poor results in a Phase III clinical study fueling exploration on the development of mutant HSV viruses that are attenuated in vivo and elicit protective adaptive immune components, such as antiviral antibodies and T cells. Importantly, such specialized antiviral immune components are likely induced and modulated by dendritic cells, professional antigen presenting cells that process viral antigens and present them to T cells. However, HSV interferes with several functions of DCs and ultimately induces their death. Here, we propose that for an attenuated mutant virus to confer protective immunity against HSV in vivo based on adaptive immune components, such virus should also be attenuated in dendritic cells to promote a robust and effective antiviral response. We provide a background framework for this idea, considerations, as well as the means to assess this hypothesis. Addressing this hypothesis may provide valuable insights for the development of novel, safe, and effective vaccines against herpes simplex viruses. PMID:28848543
Schäfer, Birgit; Holzer, Georg W.; Joachimsthaler, Alexandra; Coulibaly, Sogue; Schwendinger, Michael; Crowe, Brian A.; Kreil, Thomas R.; Barrett, P. Noel; Falkner, Falko G.
2011-01-01
Background Currently existing yellow fever (YF) vaccines are based on the live attenuated yellow fever virus 17D strain (YFV-17D). Although, a good safety profile was historically attributed to the 17D vaccine, serious adverse events have been reported, making the development of a safer, more modern vaccine desirable. Methodology/Principal Findings A gene encoding the precursor of the membrane and envelope (prME) protein of the YFV-17D strain was inserted into the non-replicating modified vaccinia virus Ankara and into the D4R-defective vaccinia virus. Candidate vaccines based on the recombinant vaccinia viruses were assessed for immunogenicity and protection in a mouse model and compared to the commercial YFV-17D vaccine. The recombinant live vaccines induced γ-interferon-secreting CD4- and functionally active CD8-T cells, and conferred full protection against lethal challenge already after a single low immunization dose of 105 TCID50. Surprisingly, pre-existing immunity against wild-type vaccinia virus did not negatively influence protection. Unlike the classical 17D vaccine, the vaccinia virus-based vaccines did not cause mortality following intracerebral administration in mice, demonstrating better safety profiles. Conclusions/Significance The non-replicating recombinant YF candidate live vaccines induced a broad immune response after single dose administration, were effective even in the presence of a pre-existing immunity against vaccinia virus and demonstrated an excellent safety profile in mice. PMID:21931732
A DOG TEST FOR MEASURING THE IMMUNIZING POTENCY OF ANTIRABIES VACCINES
Webster, Leslie T.; Casals, J.
1940-01-01
1. A quantitative method is described for testing the immunizing potency of antirabies vaccines in dogs. 2. Phenolized, single-injection, canine vaccines from seven manufacturers, when administered to dogs according to directions, failed to protect them against the least measurable amount of test virus fatal to 50 per cent or more of controls. Chloroformized vaccines from two of three manufacturers, under the same conditions, gave equivocal or suggestive results. 3. Commercial chloroformized vaccines in 10 cc. doses, injected intraperitoneally rather than subcutaneously into dogs, conferred a significant degree of immunity but proved temporarily irritative to the peritoneum. 4. These results of canine vaccines in dogs parallel closely those already reported in mice. PMID:19870993
Koenig, M A; Roy, N C; McElrath, T; Shahidullah, M; Wojtyniak, B
1998-01-01
OBJECTIVES: Although maternal tetanus immunization has been shown to be highly effective in the prevention of neonatal tetanus, unresolved questions remain concerning the required minimum number of doses and the resulting duration of effective immunity. This study examined the duration of effective immunity against neonatal tetanus provided by maternal tetanus immunization. METHODS: A randomized, double-blind cholera vaccine trial of 41,571 children and nonpregnant adult women carried out in 1974 in the Matlab comparison area of rural Bangladesh provided a unique opportunity to address dose and immunity issues. RESULTS: Children of women who received either 1 or 2 injections of tetanus toxoid experienced 4- to 14-day mortality levels consistently lower than those of children of unimmunized mothers. Analysis of neonatal-tetanus-related mortality showed that 2 injections of tetanus toxoid provided significant protection for subsequent durations of up to 12 or 13 years. CONCLUSIONS: The data demonstrate that a limited-dose regimen of maternal tetanus toxoid provides significant and extended protection against the risk of neonatal tetanus death. PMID:9618617
Eisenthal, A; Ramakrishna, V; Skornick, Y; Shinitzky, M
1993-05-01
In the preceding paper we have demonstrated an increase in presentation of both major histocompatibility complex antigens (MHC) and a tumor-associated antigen of the weakly immunogenic B16 melanoma by a straight-forward technique. The method consists in modulating the tumor cell membrane by hydrostatic pressure and simultaneous chemical crosslinking of the cell-surface proteins. In B16-BL6 melanoma, the induced antigenic modulation was found to persist for over 48 h, which permitted the evaluation of the ability of modified B16-BL6 cells to induce immunity against unmodified B16-BL6 cells. In the present study, we have shown that a significant systemic immunity was induced only in mice that were immunized with modified B16-BL6 melanoma cells, whereas immunization with unmodified B16-BL6 cells had only a marginal effect when compared to the results in control sham-immunized mice. The induced immunity was specific since a single immunization affected the growth of B16-BL6 tumors but had no effect on MCA 106, an antigenically unrelated tumor. The addition of interleukin-2 to the immunization regimen had no effect on the antitumor responses induced by the modified B16-BL6 cells. The cell-mediated immunity conferred by immunization with treated B16-BL6 cells was confirmed in experiments in vitro where splenocytes from immunized mice could be sensitized to proliferate by the presence of B16-BL6 cells. In addition, the altered antigenicity of these melanoma cells appeared to correlate with their increased susceptibility to specific effectors. Thus, 51Cr-labeled B16-BL6 target cells, modified by pressure and crosslinking, in comparison to control labeled target cells, were lysed in much greater numbers by effectors such as lymphokine-activated killer cells and allogeneic cytotoxic lymphocytes (anti-H-2b), while such cells remained resistant to lysis by natural killer cells. Our findings indicate that the physical and chemical modifications of the tumor cells that are described here may be considered as a simple yet effective method for the preparation of tumor vaccines, which could be applied in tumor-bearing hosts.
Ingle, Nilesh B; Virkar, Rashmi G; Arankalle, Vidya A
2016-01-01
We documented earlier that Mw (heat-killed suspension of Mycobacterium indicus pranii ) adjuvant when used with conserved antigens, nucleoprotein (NP), and ectodomain of matrix (M2) protein (M2e) provided complete protection against homologous (clade 2.2) virus challenge in mice. The present study extends these observations to inter-clade challenge (clade 2.3.2.1) H5N1 virus and attempts to understand preliminary immunologic basis for the observed protection. Female BALB/c mice immunized with a single or two doses of vaccine formulations (clade 2.2 antigens) were challenged with 100LD50 homologous or heterologous (clade 2.3.2.1) virus. To understand the preliminary immunologic mechanism, we studied proportions of selected immune cell types, immune response gene expression, and Th1/Th2 cytokines induced by antigen-stimulated splenocytes from immunized mice, at different time points. Complete protection was conferred by Mw-HA, Mw-HA + NP, and Mw-HA + NP + M2e against homologous challenge. The protection correlated with IgG2a antibody titers indicating important role of Th1 response. Despite high inter-cladal antigenic differences, complete protection against the heterologous strain was achieved with Mw-HA + NP + M2e. Of note, a single dose with higher antigen concentrations (50 µg HA + 50 μg NP + 50 μg M2e) led to 80% protection against clade 2.3.2.1 strain. The protection conferred by Mw-HNM correlated with induction of IFN-γ, CD8 + T cytotoxic cells, and CD4 + T helper cells. Mw-adjuvanted HA + NP + M2e combination represents a promising vaccine candidate deserving further evaluation.
O'Meara, C P; Armitage, C W; Kollipara, A; Andrew, D W; Trim, L; Plenderleith, M B; Beagley, K W
2016-07-01
Sexually transmitted Chlamydia trachomatis causes infertility, and because almost 90% of infections are asymptomatic, a vaccine is required for its eradication. Mathematical modeling studies have indicated that a vaccine eliciting partial protection (non-sterilizing) may prevent Chlamydia infection transmission, if administered to both sexes before an infection. However, reducing chlamydial inoculum transmitted by males and increasing infection resistance in females through vaccination to elicit sterilizing immunity has yet to be investigated experimentally. Here we show that a partially protective vaccine (chlamydial major outer membrane protein (MOMP) and ISCOMATRIX (IMX) provided sterilizing immunity against sexual transmission between immunized mice. Immunizing male or female mice before an infection reduced chlamydial burden and disease development, but did not prevent infection. However, infection and inflammatory disease responsible for infertility were absent in 100% of immunized female mice challenged intravaginally with ejaculate collected from infected immunized males. In contrast to the sterilizing immunity generated following recovery from a previous chlamydial infection, protective immunity conferred by MOMP/IMX occurred independent of resident memory T cells. Our results demonstrate that vaccination of males or females can further protect the opposing sex, whereas vaccination of both sexes can synergize to elicit sterilizing immunity against Chlamydia sexual transmission.
Zeng, Melody Y.; Cisalpino, Daniel; Varadarajan, Saranyaraajan; Hellman, Judith; Warren, H. Shaw; Cascalho, Marilia; Inohara, Naohiro; Núñez, Gabriel
2016-01-01
The gut microbiota is compartmentalized in the intestinal lumen and induces local immune responses, but it remains unknown whether the gut microbiota can induce systemic response and contribute to systemic immunity. We report that selective gut symbiotic gram-negative bacteria were able to disseminate systemically to induce immunoglobulin G (IgG) response, which primarily targeted gram-negative bacterial antigens and conferred protection against systemic infections by E. coli and Salmonella by directly coating bacteria to promote killing by phagocytes. T cells and Toll-like receptor 4 on B cells were important in the generation of microbiota-specific IgG. We identified murein lipoprotein (MLP), a highly conserved gram-negative outer membrane protein, as a major antigen that induced systemic IgG homeostatically in both mice and humans. Administration of anti-MLP IgG conferred crucial protection against systemic Salmonella infection. Thus, our findings reveal an important function for the gut microbiota in combating systemic infection through the induction of protective IgG. PMID:26944199
Evaluation of New Vaccines in the Mouse and Guinea Pig Model of Tuberculosis
Baldwin, Susan L.; D’Souza, Celine; Roberts, Alan D.; Kelly, Brian P.; Frank, Anthony A.; Lui, Margaret A.; Ulmer, Jeffrey B.; Huygen, Kris; McMurray, David M.; Orme, Ian M.
1998-01-01
The results of this study provide the first evidence that two completely separate vaccine approaches, one based on a subunit vaccine consisting of a mild adjuvant admixed with purified culture filtrate proteins and enhanced by the cytokine interleukin-2 and the second based on immunization with DNA encoding the Ag85A protein secreted by Mycobacterium tuberculosis, could both prevent the onset of caseating disease, which is the hallmark of the guinea pig aerogenic infection model. In both cases, however, the survival of vaccinated guinea pigs was shorter than that conferred by Mycobacterium bovis BCG, with observed mortality of these animals probably due to consolidation of lung tissues by lymphocytic granulomas. An additional characteristic of these approaches was that neither induced skin test reactivity to commercial tuberculin. These data thus provide optimism that development of nonliving vaccines which can generate long-lived immunity approaching that conferred by the BCG vaccine is a feasible goal. PMID:9596772
Delivery of Probiotics in the Space Food System
NASA Technical Reports Server (NTRS)
Castro, S. L.; Ott, C. M.; Douglas, G. L.
2014-01-01
The addition of probiotic bacteria to the space food system is expected to confer immunostimulatory benefits on crewmembers during spaceflight, counteracting the immune dysregulation that has been documented in spaceflight. Specifically, the probiotic Lactobacillus acidophilus has been shown to promote health benefits including antagonism towards and inhibition of virulence related gene expression in pathogens, mucosal stimulation of immune cells, and a reduction in the occurrence and duration of cold and flu-like symptoms. The optimum delivery system for probiotics has not been determined for spaceflight, where the food system is shelf stable and the lack of refrigeration prevents the use of traditional dairy delivery methods. This work proposes to determine whether L. acidophilus is more viable, and therefore more likely to confer immune benefit, when delivered in a capsule form or when delivered in nonfat dry milk powder with a resuscitation opportunity upon rehydration, following 0, 4, and 8 months of storage at -80degC, 4degC, and 22degC, and both prior to and after challenge with simulated gastric and intestinal juices. We hypothesize that the low moisture neutral dairy matrix provided by the nonfat dry milk, and the rehydration step prior to consumption, will extend probiotic viability and stress tolerance compared to a capsule during potential storage conditions in spaceflight and in simulated digestion conditions.
Delivery of Probiotics in the Space Food System
NASA Technical Reports Server (NTRS)
Castro, S. L.; Ott, C. M.; Douglas, G. L.
2014-01-01
The addition of probiotic bacteria to the space food system is expected to confer immunostimulatory benefits on crewmembers during spaceflight, counteracting the immune dysregulation that has been documented in spaceflight [1]. Specifically, the probiotic Lactobacillus acidophilus has been shown to promote health benefits including antagonism towards and inhibition of virulence related gene expression in pathogens, mucosal stimulation of immune cells, and a reduction in the occurrence and duration of cold and flu-like symptoms [2-5]. The optimum delivery system for probiotics has not been determined for spaceflight, where the food system is shelf stable and the lack of refrigeration prevents the use of traditional dairy delivery methods. This work proposes to determine whether L. acidophilus is more viable, and therefore more likely to confer immune benefit, when delivered in a capsule form or when delivered in nonfat dry milk powder with a resuscitation opportunity upon rehydration, following 0, 4, and 8 months of storage at -80degC, 4degC, and 22degC, and both prior to and after challenge with simulated gastric and intestinal juices. We hypothesize that the low moisture neutral dairy matrix provided by the nonfat dry milk, and the rehydration step prior to consumption, will extend probiotic viability and stress tolerance compared to a capsule during potential storage conditions in spaceflight and in simulated digestion conditions.
Burns, Patricia; Reinheimer, Jorge; Vinderola, Gabriel
2011-10-01
In a previous work, bile-salt-resistant derivatives were obtained from non-intestinal lactobacilli. The aim of this work was to investigate the impact of bile adaptation of Lactobacillus delbrueckii subsp. lactis 200 on morphology, surface properties, in vivo interaction capacity with the gut and ability to activate the gut immune response. Electron microscopy studies, growth kinetics in the presence of bovine and porcine bile, the capacity to deconjugate bile acids, hydrophobicity, autoaggregation and co-aggregation capacities were studied for the parental strain and its bile-resistant derivative in vitro. Additionally, survival in intestinal fluid, the interaction with the gut and the immunomodulating capacities were studied in mice. Bile salt adaptation conferred upon the adapted strain a higher capacity to withstand physiological concentrations of bile salts and greater survival capacity in intestinal fluid. However, bile salt exposure reduced cell hydrophobicity, autoaggregation and adhesion capacities, resulting in reduced persistence in the intestinal lumen and delayed capacity to activate the gut immune response. Insight into the effects of bile salts upon the interaction and immunomodulating capacity of lactobacilli with the gut is provided, relating in vitro and in vivo results. Copyright © 2011 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.
P-glycoprotein multidrug transporter in inflammatory bowel diseases: More questions than answers
Cario, Elke
2017-01-01
The gastrointestinal barrier is constantly exposed to numerous environmental substrates that are foreign and potentially harmful. These xenobiotics can cause shifts in the intestinal microbiota composition, affect mucosal immune responses, disturb tissue integrity and impair regeneration. The multidrug transporter ABCB1/MDR1 p-glycoprotein (p-gp) plays a key role at the front line of host defence by efficiently protecting the gastrointestinal barrier from xenobiotic accumulation. This Editorial discusses how altered expression and function of ABCB1/MDR1 p-gp may contribute to the development and persistence of chronic intestinal inflammation in inflammatory bowel diseases (IBD). Recent evidence implies multiple interactions between intestinal microbiota, innate immunity and xenobiotic metabolism via p-gp. While decreased efflux activity may promote disease susceptibility and drug toxicity, increased efflux activity may confer resistance to therapeutic drugs in IBD. Mice deficient in MDR1A develop spontaneously chronic colitis, providing a highly valuable murine IBD model for the study of intestinal epithelial barrier function, immunoregulation, infectious co-triggers and novel therapeutic approaches. Possible associations of human ABCB1 gene polymorphisms with IBD susceptibility have been evaluated, but results are inconsistent. Future studies must focus on further elucidation of the pathophysiological relevance and immunological functions of p-gp and how its ambiguous effects could be therapeutically targeted in IBD. PMID:28321153
P-glycoprotein multidrug transporter in inflammatory bowel diseases: More questions than answers.
Cario, Elke
2017-03-07
The gastrointestinal barrier is constantly exposed to numerous environmental substrates that are foreign and potentially harmful. These xenobiotics can cause shifts in the intestinal microbiota composition, affect mucosal immune responses, disturb tissue integrity and impair regeneration. The multidrug transporter ABCB1/MDR1 p-glycoprotein (p-gp) plays a key role at the front line of host defence by efficiently protecting the gastrointestinal barrier from xenobiotic accumulation. This Editorial discusses how altered expression and function of ABCB1/MDR1 p-gp may contribute to the development and persistence of chronic intestinal inflammation in inflammatory bowel diseases (IBD). Recent evidence implies multiple interactions between intestinal microbiota, innate immunity and xenobiotic metabolism via p-gp. While decreased efflux activity may promote disease susceptibility and drug toxicity, increased efflux activity may confer resistance to therapeutic drugs in IBD. Mice deficient in MDR1A develop spontaneously chronic colitis, providing a highly valuable murine IBD model for the study of intestinal epithelial barrier function, immunoregulation, infectious co-triggers and novel therapeutic approaches. Possible associations of human ABCB1 gene polymorphisms with IBD susceptibility have been evaluated, but results are inconsistent. Future studies must focus on further elucidation of the pathophysiological relevance and immunological functions of p-gp and how its ambiguous effects could be therapeutically targeted in IBD.
Renson, P; Fablet, C; Le Dimna, M; Mahé, S; Touzain, F; Blanchard, Y; Paboeuf, F; Rose, N; Bourry, O
2017-05-01
The porcine reproductive and respiratory syndrome virus (PRRSV) causes huge economic losses for the swine industry worldwide. In the past several years, highly pathogenic strains that lead to even greater losses have emerged. For the Western European swine industry, one threat is the possible introduction of Eastern European PRRSV strains (example Lena genotype 1.3) which were shown to be more virulent than common Western resident strains under experimental conditions. To prepare for the possible emergence of this strain in Western Europe, we immunized piglets with a Western European PRRSV field strain (Finistere: Fini, genotype 1.1), a new genotype 1 commercial modified live virus (MLV) vaccine (MLV1) or a genotype 2 commercial MLV vaccine (MLV2) to evaluate and compare the level of protection that these strains conferred upon challenge with the Lena strain 4 weeks later. Results show that immunization with Fini, MLV1 or MLV2 strains shortened the Lena-induced hyperthermia. In the Fini group, a positive effect was also demonstrated in growth performance. The level of Lena viremia was reduced for all immunized groups (significantly so for Fini and MLV2). This reduction in Lena viremia was correlated with the level of Lena-specific IFNγ-secreting cells. In conclusion, we showed that a commercial MLV vaccine of genotype 1 or 2, as well as a field strain of genotype 1.1 may provide partial clinical and virological protection upon challenge with the Lena strain. The cross-protection induced by these immunizing strains was not related with the level of genetic similarity to the Lena strain. The slightly higher level of protection established with the field strain is attributed to a better cell-mediated immune response. Copyright © 2017 Elsevier B.V. All rights reserved.
Assessing the Effects of Trematode Infection on Invasive Green Crabs in Eastern North America
Blakeslee, April M. H.; Keogh, Carolyn L.; Fowler, Amy E.; Griffen, Blaine D.
2015-01-01
A common signature of marine invasions worldwide is a significant loss of parasites (= parasite escape) in non-native host populations, which may confer a release from some of the harmful effects of parasitism (e.g., castration, energy extraction, immune activation, behavioral manipulation) and possibly enhance the success of non-indigenous species. In eastern North America, the notorious invader Carcinus maenas (European green crab) has escaped more than two-thirds its native parasite load. However, one of its parasites, a trematode (Microphallus similis), can be highly prevalent in the non-native region; yet little is known about its potential impacts. We employed a series of laboratory experiments to determine whether and how M. similis infection intensity influences C. maenas, focusing on physiological assays of body mass index, energy storage, and immune activation, as well as behavioral analyses of foraging, shelter utilization, and conspicuousness. We found little evidence for enduring physiological or behavioral impacts four weeks after experimental infection, with the exception of mussel handling time which positively correlated with cyst intensity. However, we did find evidence for a short-term effect of M. similis infection during early stages of infection (soon after cercarial penetration) via a significant drop in circulating immune cells, and a significant increase in the crabs’ righting response time. Considering M. similis is the only common parasite infecting C. maenas in eastern North America, our results for minimal lasting effects of the trematode on the crab’s physiology and behavior may help explain the crab’s continued prominence as a strong predator and competitor in the region. PMID:26030816
Infectious Sporozoites of Plasmodium berghei Effectively Activate Liver CD8α+ Dendritic Cells
Parmar, Rajesh; Patel, Hardik; Yadav, Naveen; Parikh, Ritika; Patel, Khyati; Mohankrishnan, Aditi; Bhurani, Vishakha; Joshi, Urja; Dalai, Sarat Kumar
2018-01-01
Immunization with radiation-attenuated sporozoites (RAS) shown to confer complete sterile protection against Plasmodia liver-stage (LS) infection that lasts about 6 to 9 months in mice. We have found that the intermittent infectious sporozoite challenge to immune mice following RAS vaccination extends the longevity of sterile protection by maintaining CD8+ T cell memory responses to LS infection. It is reported that CD8α+ dendritic cells (DCs) are involved in the induction of LS-specific CD8+ T cells following RAS or genetically attenuated parasite (GAP) vaccination. In this study, we demonstrate that CD8α+ DCs respond differently to infectious sporozoite or RAS inoculation. The higher accumulation and activation of CD8α+ DCs was seen in the liver in response to infectious sporozoite 72 h postinoculation and found to be associated with higher expression of chemokines (CCL-20 and CCL-21) and type I interferon response via toll-like receptor signaling in liver. Moreover, the infectious sporozoites were found to induce qualitative changes in terms of the increased MHCII expression as well as costimulatory molecules including CD40 on the CD8α+ DCs compared to RAS inoculation. We have also found that infectious sporozoite challenge increased CD40L-expressing CD4+ T cells, which could help CD8+ T cells in the liver through “licensing” of the antigen-presenting cells. Our results suggest that infectious sporozoite challenge to prior RAS immunized mice modulates the CD8α+ DCs, which might be shaping the fate of memory CD8+ T cells against Plasmodium LS infection. PMID:29472929
The therapeutic value of targeting inflammation in gastrointestinal cancers
Sun, Beicheng; Karin, Michael
2014-01-01
Inflammation has been implicated in the initiation and progression of gastrointestinal (GI) cancers. Inflammation also plays important roles in subverting immune tolerance, escape from immune surveillance, and conferring resistance to chemotherapeutic agents. Targeting key regulators and mediators of inflammation represents an attractive strategy for GI cancer prevention and treatment. However, the targeting of inflammation in GI cancer is not straight-forward and sometimes inflammation may contribute to tumor regression. We discuss the origins and effects of inflammation in GI cancer and how to target it successfully. PMID:24881011
Zhang, Lei; Du, Liqun; Shen, Chenjia; Yang, Yanjun; Poovaiah, B W
2014-04-01
Transient changes in intracellular Ca(2+) concentration are essential signals for activation of plant immunity. It has also been reported that Ca(2+) signals suppress salicylic acid-mediated plant defense through AtSR1/CAMTA3, a member of the Ca(2+) /calmodulin-regulated transcription factor family that is conserved in multicellular eukaryotes. How plants overcome this negative regulation to mount an effective defense response during a stage of intracellular Ca(2+) surge is unclear. Here we report the identification and functional characterization of an important component of ubiquitin ligase, and the associated AtSR1 turnover. The AtSR1 interaction protein 1 (SR1IP1) was identified by CytoTrap two-hybrid screening. The loss-of-function mutant of SR1IP1 is more susceptible to bacterial pathogens, and over-expression of SR1IP1 confers enhanced resistance, indicating that SR1IP1 acts as a positive regulator of plant defense. SR1IP1 and AtSR1 act in the same signaling pathway to regulate plant immunity. SR1IP1 contains the structural features of a substrate adaptor in cullin 3-based E3 ubiquitin ligase, and was shown to serve as a substrate adaptor that recruits AtSR1 for ubiquitination and degradation when plants are challenged with pathogens. Hence, SR1IP1 positively regulates plant immunity by removing the defense suppressor AtSR1. These findings provide a mechanistic insight into how Ca(2+) -mediated actions are coordinated to achieve effective plant immunity. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.
Lo, Charlotte S; Sanii, Sanaz; Kroeger, David R; Milne, Katy; Talhouk, Aline; Chiu, Derek S; Rahimi, Kurosh; Shaw, Patricia A; Clarke, Blaise A; Nelson, Brad H
2017-02-15
Purpose: Some forms of chemotherapy can enhance antitumor immunity through immunogenic cell death, resulting in increased T-cell activation and tumor infiltration. Such effects could potentially sensitize tumors to immunotherapies, including checkpoint blockade. We investigated whether platinum- and taxane-based chemotherapy for ovarian cancer induces immunologic changes consistent with this possibility. Experimental Design: Matched pre- and post-neoadjuvant chemotherapy tumor samples from 26 high-grade serous carcinoma (HGSC) patients were analyzed by immunohistochemistry (IHC) for a large panel of immune cells and associated factors. The prognostic significance of post-chemotherapy TIL patterns was assessed in an expanded cohort ( n = 90). Results: Neoadjuvant chemotherapy was associated with increased densities of CD3 + , CD8 + , CD8 + TIA-1 + , PD-1 + and CD20 + TIL. Other immune subsets and factors were unchanged, including CD79a + CD138 + plasma cells, CD68 + macrophages, and MHC class I on tumor cells. Immunosuppressive cell types were also unchanged, including FoxP3 + PD-1 + cells (putative regulatory T cells), IDO-1 + cells, and PD-L1 + cells (both macrophages and tumor cells). Hierarchical clustering revealed three response patterns: (i) TIL high tumors showed increases in multiple immune markers after chemotherapy; (ii) TIL low tumors underwent similar increases, achieving patterns indistinguishable from the first group; and (iii) TIL negative cases generally remained negative. Despite the dramatic increases seen in the first two patterns, post-chemotherapy TIL showed limited prognostic significance. Conclusions: Chemotherapy augments pre-existing TIL responses but fails to relieve major immune-suppressive mechanisms or confer significant prognostic benefit. Our findings provide rationale for multipronged approaches to immunotherapy tailored to the baseline features of the tumor microenvironment. Clin Cancer Res; 23(4); 925-34. ©2016 AACR . ©2016 American Association for Cancer Research.
Evaluation of candidate vaccine approaches for MERS-CoV
Wang, Lingshu; Shi, Wei; Joyce, M. Gordon; ...
2015-07-28
The emergence of Middle East respiratory syndrome coronavirus (MERS-CoV) as a cause of severe respiratory disease highlights the need for effective approaches to CoV vaccine development. Efforts focused solely on the receptor-binding domain (RBD) of the viral Spike (S) glycoprotein may not optimize neutralizing antibody (NAb) responses. Here we show that immunogens based on full-length S DNA and S1 subunit protein elicit robust serum-neutralizing activity against several MERS-CoV strains in mice and non-human primates. Serological analysis and isolation of murine monoclonal antibodies revealed that immunization elicits NAbs to RBD and, non-RBD portions of S1 and S2 subunit. Multiple neutralization mechanismsmore » were demonstrated by solving the atomic structure of a NAb-RBD complex, through sequencing of neutralization escape viruses and by constructing MERS-CoV S variants for serological assays. Immunization of rhesus macaques confers protection against MERS-CoV-induced radiographic pneumonia, as assessed using computerized tomography, supporting this strategy as a promising approach for MERS-CoV vaccine development.« less
Probiotics in the management of lung diseases.
Mortaz, Esmaeil; Adcock, Ian M; Folkerts, Gert; Barnes, Peter J; Paul Vos, Arjan; Garssen, Johan
2013-01-01
The physiology and pathology of the respiratory and gastrointestinal tracts are closely related. This similarity between the two organs may underlie why dysfunction in one organ may induce illness in the other. For example, smoking is a major risk factor for COPD and IBD and increases the risk of developing Crohn's disease. Probiotics have been defined as "live microorganisms which, when administered in adequate amounts, confer health benefits on the host." In model systems probiotics regulate innate and inflammatory immune responses. Commonly used probiotics include lactic acid bacteria, particularly Lactobacillus, Bifidobacterium, and Saccharomyces, and these are often used as dietary supplements to provide a health benefit in gastrointestinal diseases including infections, inflammatory bowel disease, and colon cancer. In this respect, probiotics probably act as immunomodulatory agents and activators of host defence pathways which suggest that they could influence disease severity and incidence at sites distal to the gut. There is increasing evidence that orally delivered probiotics are able to regulate immune responses in the respiratory system. This review provides an overview of the possible role of probiotics and their mechanisms of action in the prevention and treatment of respiratory diseases.
Bayry, Jagadeesh; Beaussart, Audrey; Dufrêne, Yves F.; Sharma, Meenu; Bansal, Kushagra; Kniemeyer, Olaf; Aimanianda, Vishukumar; Brakhage, Axel A.; Kaveri, Srini V.; Kwon-Chung, Kyung J.
2014-01-01
In Aspergillus fumigatus, the conidial surface contains dihydroxynaphthalene (DHN)-melanin. Six-clustered gene products have been identified that mediate sequential catalysis of DHN-melanin biosynthesis. Melanin thus produced is known to be a virulence factor, protecting the fungus from the host defense mechanisms. In the present study, individual deletion of the genes involved in the initial three steps of melanin biosynthesis resulted in an altered conidial surface with masked surface rodlet layer, leaky cell wall allowing the deposition of proteins on the cell surface and exposing the otherwise-masked cell wall polysaccharides at the surface. Melanin as such was immunologically inert; however, deletion mutant conidia with modified surfaces could activate human dendritic cells and the subsequent cytokine production in contrast to the wild-type conidia. Cell surface defects were rectified in the conidia mutated in downstream melanin biosynthetic pathway, and maximum immune inertness was observed upon synthesis of vermelone onward. These observations suggest that although melanin as such is an immunologically inert material, it confers virulence by facilitating proper formation of the A. fumigatus conidial surface. PMID:24818666
Evaluation of candidate vaccine approaches for MERS-CoV
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Lingshu; Shi, Wei; Joyce, M. Gordon
The emergence of Middle East respiratory syndrome coronavirus (MERS-CoV) as a cause of severe respiratory disease highlights the need for effective approaches to CoV vaccine development. Efforts focused solely on the receptor-binding domain (RBD) of the viral Spike (S) glycoprotein may not optimize neutralizing antibody (NAb) responses. Here we show that immunogens based on full-length S DNA and S1 subunit protein elicit robust serum-neutralizing activity against several MERS-CoV strains in mice and non-human primates. Serological analysis and isolation of murine monoclonal antibodies revealed that immunization elicits NAbs to RBD and, non-RBD portions of S1 and S2 subunit. Multiple neutralization mechanismsmore » were demonstrated by solving the atomic structure of a NAb-RBD complex, through sequencing of neutralization escape viruses and by constructing MERS-CoV S variants for serological assays. Immunization of rhesus macaques confers protection against MERS-CoV-induced radiographic pneumonia, as assessed using computerized tomography, supporting this strategy as a promising approach for MERS-CoV vaccine development.« less
Zanchi, Caroline; Johnston, Paul R; Rolff, Jens
2017-10-01
The simultaneous expression of costly immune effectors such as multiple antimicrobial peptides is a hallmark of innate immunity of multicellular organisms, yet the adaptive advantage remains unresolved. Here, we test current hypotheses on the evolution of such defence cocktails. We use RNAi gene knock-down to explore, the effects of three highly expressed antimicrobial peptides, displaying different degrees of activity in vitro against Staphylococcus aureus, during an infection in the beetle Tenebrio molitor. We find that a defensin confers no survival benefit but reduces bacterial loads. A coleoptericin contributes to host survival without affecting bacterial loads. An attacin has no individual effect. Simultaneous knock-down of the defensin with the other AMPs results in increased mortality and elevated bacterial loads. Contrary to common expectations, the effects on host survival and bacterial load can be independent. The expression of multiple AMPs increases host survival and contributes to the control of persisting infections and tolerance. This is an emerging property that explains the adaptive benefit of defence cocktails. © 2017 John Wiley & Sons Ltd.
Yokoyama, Ayaka; Miyamoto, Hiroko; Kajihara, Masahiro; Maruyama, Junki; Nao, Naganori; Manzoor, Rashid; Takada, Ayato
2014-01-01
Both IgA and IgG antibodies are known to play important roles in protection against influenza virus infection. While IgG is the major isotype induced systemically, IgA is predominant in mucosal tissues, including the upper respiratory tract. Although IgA antibodies are believed to have unique advantages in mucosal immunity, information on direct comparisons of the in vitro antiviral activities of IgA and IgG antibodies recognizing the same epitope is limited. In this study, we demonstrate differences in antiviral activities between these isotypes using monoclonal IgA and IgG antibodies obtained from hybridomas of the same origin. Polymeric IgA-producing hybridoma cells were successfully subcloned from those originally producing monoclonal antibody S139/1, a hemaggulutinin (HA)-specific IgG that was generated against an influenza A virus strain of the H3 subtype but had cross-neutralizing activities against the H1, H2, H13, and H16 subtypes. These monoclonal S139/1 IgA and IgG antibodies were assumed to recognize the same epitope and thus used to compare their antiviral activities. We found that both S139/1 IgA and IgG antibodies strongly bound to the homologous H3 virus in an enzyme-linked immunosorbent assay, and there were no significant differences in their hemagglutination-inhibiting and neutralizing activities against the H3 virus. In contrast, S139/1 IgA showed remarkably higher cross-binding to and antiviral activities against H1, H2, and H13 viruses than S139/1 IgG. It was also noted that S139/1 IgA, but not IgG, drastically suppressed the extracellular release of the viruses from infected cells. Electron microscopy revealed that S139/1 IgA deposited newly produced viral particles on the cell surface, most likely by tethering the particles. These results suggest that anti-HA IgA has greater potential to prevent influenza A virus infection than IgG antibodies, likely due to increased avidity conferred by its multivalency, and that this advantage may be particularly important for heterosubtypic immunity. PMID:24465606
CSN-associated USP48 confers stability to nuclear NF-κB/RelA by trimming K48-linked Ub-chains.
Schweitzer, Katrin; Naumann, Michael
2015-02-01
Diligent balance of nuclear factor kappa B (NF-κB) activity is essential owing to NF-κB's decisive role in cellular processes including inflammation, immunity and cell survival. Ubiquitin/proteasome-system (UPS)-dependent degradation of activated NF-κB/RelA involves the cullin-RING-ubiquitin-ligase (CRL) ECS(SOCS1). The COP9 signalosome (CSN) controls ubiquitin (Ub) ligation by CRLs through the removal of the CRL-activating Ub-like modifier NEDD8 from their cullin subunits and through deubiquitinase (DUB) activity of associated DUBs. However, knowledge about DUBs involved in the regulation of NF-κB activity within the nucleus is scarce. In this study we observed that USP48, a DUB of hitherto ill-defined function identified through a siRNA screen, associates with the CSN and RelA in the nucleus. We show that USP48 trims rather than completely disassembles long K48-linked free and substrate-anchored Ub-chains, a catalytic property only shared with ataxin-3 (Atx3) and otubain-1 (OTU1), and that USP48 Ub-chain-trimming activity is regulated by casein-kinase-2 (CK2)-mediated phosphorylation in response to cytokine-stimulation. Functionally, we demonstrate for the first time the CSN and USP48 to cooperatively stabilize the nuclear pool of RelA, thereby facilitating timely induction and shutoff of NF-κB target genes. In summary, this study demonstrates that USP48, a nuclear DUB regulated by CK2, controls the UPS-dependent turnover of activated NF-κB/RelA in the nucleus together with the CSN. Thereby USP48 contributes to a timely control of immune responses. Copyright © 2014 Elsevier B.V. All rights reserved.
Pleural innate response activator B cells protect against pneumonia via a GM-CSF-IgM axis
Chousterman, Benjamin G.; Hilgendorf, Ingo; Robbins, Clinton S.; Theurl, Igor; Gerhardt, Louisa M.S.; Iwamoto, Yoshiko; Quach, Tam D.; Ali, Muhammad; Chen, John W.; Rothstein, Thomas L.; Nahrendorf, Matthias; Weissleder, Ralph
2014-01-01
Pneumonia is a major cause of mortality worldwide and a serious problem in critical care medicine, but the immunophysiological processes that confer either protection or morbidity are not completely understood. We show that in response to lung infection, B1a B cells migrate from the pleural space to the lung parenchyma to secrete polyreactive emergency immunoglobulin M (IgM). The process requires innate response activator (IRA) B cells, a transitional B1a-derived inflammatory subset which controls IgM production via autocrine granulocyte/macrophage colony-stimulating factor (GM-CSF) signaling. The strategic location of these cells, coupled with the capacity to produce GM-CSF–dependent IgM, ensures effective early frontline defense against bacteria invading the lungs. The study describes a previously unrecognized GM-CSF-IgM axis and positions IRA B cells as orchestrators of protective IgM immunity. PMID:24821911
A central role for S-nitrosothiols in plant disease resistance
Feechan, Angela; Kwon, Eunjung; Yun, Byung-Wook; Wang, Yiqin; Pallas, Jacqueline A.; Loake, Gary J.
2005-01-01
Animal S-nitrosoglutathione reductase (GSNOR) governs the extent of cellular S-nitrosylation, a key redox-based posttranslational modification. Mutations in AtGSNOR1, an Arabidopsis thaliana GSNOR, modulate the extent of cellular S-nitrosothiol (SNO) formation in this model plant species. Loss of AtGSNOR1 function increased SNO levels, disabling plant defense responses conferred by distinct resistance (R) gene subclasses. Furthermore, in the absence of AtGSNOR1, both basal and nonhost disease resistance are also compromised. Conversely, increased AtGSNOR1 activity reduced SNO formation, enhancing protection against ordinarily virulent microbial pathogens. Here we demonstrate that AtGSNOR1 positively regulates the signaling network controlled by the plant immune system activator, salicylic acid. This contrasts with the function of this enzyme in mice during endotoxic shock, where GSNOR antagonizes inflammatory responses. Our data imply SNO formation and turnover regulate multiple modes of plant disease resistance. PMID:15911759
Gut Immune Maturation Depends on Colonization with a Host-Specific Microbiota
Chung, Hachung; Pamp, Sünje J.; Hill, Jonathan A.; Surana, Neeraj K.; Edelman, Sanna M.; Troy, Erin B.; Reading, Nicola C.; Villablanca, Eduardo J.; Wang, Sen; Mora, Jorge R.; Umesaki, Yoshinori; Mathis, Diane; Benoist, Christophe; Relman, David A.; Kasper, Dennis L.
2012-01-01
SUMMARY Gut microbial induction of host immune maturation exemplifies host-microbe mutualism. We colonized germ-free (GF) mice with mouse microbiota (MMb) or human microbiota (HMb) to determine whether small intestinal immune maturation depends on a coevolved host-specific microbiota. Gut bacterial numbers and phylum abundance were similar in MMb and HMb mice, but bacterial species differed, especially the Firmicutes. HMb mouse intestines had low levels of CD4+ and CD8+ T cells, few proliferating T cells, few dendritic cells, and low antimicrobial peptide expression–all characteristics of GF mice. Rat microbiota also failed to fully expand intestinal T cell numbers in mice. Colonizing GF or HMb mice with mouse-segmented filamentous bacteria (SFB) partially restored T cell numbers, suggesting that SFB and other MMb organisms are required for full immune maturation in mice. Importantly, MMb conferred better protection against Salmonella infection than HMb. A host-specific microbiota appears to be critical for a healthy immune system. PMID:22726443
CRISPR-Cas systems: Prokaryotes upgrade to adaptive immunity.
Barrangou, Rodolphe; Marraffini, Luciano A
2014-04-24
Clustered regularly interspaced short palindromic repeats (CRISPR), and associated proteins (Cas) comprise the CRISPR-Cas system, which confers adaptive immunity against exogenic elements in many bacteria and most archaea. CRISPR-mediated immunization occurs through the uptake of DNA from invasive genetic elements such as plasmids and viruses, followed by its integration into CRISPR loci. These loci are subsequently transcribed and processed into small interfering RNAs that guide nucleases for specific cleavage of complementary sequences. Conceptually, CRISPR-Cas shares functional features with the mammalian adaptive immune system, while also exhibiting characteristics of Lamarckian evolution. Because immune markers spliced from exogenous agents are integrated iteratively in CRISPR loci, they constitute a genetic record of vaccination events and reflect environmental conditions and changes over time. Cas endonucleases, which can be reprogrammed by small guide RNAs have shown unprecedented potential and flexibility for genome editing and can be repurposed for numerous DNA targeting applications including transcriptional control. Copyright © 2014 Elsevier Inc. All rights reserved.
Protecting newborns against pertussis: the value of vaccinating during pregnancy.
Vilajeliu, Alba; García-Basteiro, Alberto L; Bayas, José M
2015-01-01
Resurgence of pertussis has recently been reported in several countries with long-standing pertussis immunization and high vaccination coverage. This situation requires consideration of alternative immunization strategies to protect newborns. In the absence of a vaccine that confers long-lasting immunity, maternal vaccination for pertussis during pregnancy seems to be a safe, immunogenic, effective and accepted strategy to protect infants during the first weeks of life. The existing scientific evidence provides the grounds for pregnant women and healthcare workers to make informed decisions regarding this measure as well as for countries with high pertussis-related infant morbidity and mortality that should consider implementation. Furthermore, this could be a promising strategy to address other vaccine-preventable diseases of pregnancy and the neonatal period.
Bárcena, J; Morales, M; Vázquez, B; Boga, J A; Parra, F; Lucientes, J; Pagès-Manté, A; Sánchez-Vizcaíno, J M; Blasco, R; Torres, J M
2000-02-01
We have developed a new strategy for immunization of wild rabbit populations against myxomatosis and rabbit hemorrhagic disease (RHD) that uses recombinant viruses based on a naturally attenuated field strain of myxoma virus (MV). The recombinant viruses expressed the RHDV major capsid protein (VP60) including a linear epitope tag from the transmissible gastroenteritis virus (TGEV) nucleoprotein. Following inoculation, the recombinant viruses induced specific antibody responses against MV, RHDV, and the TGEV tag. Immunization of wild rabbits by the subcutaneous and oral routes conferred protection against virulent RHDV and MV challenges. The recombinant viruses showed a limited horizontal transmission capacity, either by direct contact or in a flea-mediated process, promoting immunization of contact uninoculated animals.