Sample records for confer partial protection

  1. Immunological correlates for protection against intranasal challenge of Bacillus anthracis spores conferred by a protective antigen-based vaccine in rabbits.

    PubMed

    Weiss, Shay; Kobiler, David; Levy, Haim; Marcus, Hadar; Pass, Avi; Rothschild, Nili; Altboum, Zeev

    2006-01-01

    Correlates between immunological parameters and protection against Bacillus anthracis infection in animals vaccinated with protective antigen (PA)-based vaccines could provide surrogate markers to evaluate the putative protective efficiency of immunization in humans. In previous studies we demonstrated that neutralizing antibody levels serve as correlates for protection in guinea pigs (S. Reuveny et al., Infect. Immun. 69:2888-2893, 2001; H. Marcus et al., Infect. Immun. 72:3471-3477, 2004). In this study we evaluated similar correlates for protection by active and passive immunization of New Zealand White rabbits. Full immunization and partial immunization were achieved by single and multiple injections of standard and diluted doses of a PA-based vaccine. Passive immunization was carried out by injection of immune sera from rabbits vaccinated with PA-based vaccine prior to challenge with B. anthracis spores. Immunized rabbits were challenged by intranasal spore instillation with one of two virulent strains (strains Vollum and ATCC 6605). The immune competence was estimated by measuring the level of total anti-PA antibodies, the neutralizing antibody titers, and the conferred protective immunity. The results indicate that total anti-PA antibody titers greater than 1 x 10(5) conferred protection, whereas lower titers (between 10(4) and 10(5)) provided partial protection but failed to predict protection. Neutralizing antibody titers between 500 and 800 provided partial protection, while titers higher than 1,000 conferred protection. In conclusion, this study emphasizes that regardless of the immunization regimen or the time of challenge, neutralizing antibody titers are better predictors of protection than total anti-PA titers.

  2. Familial and temperamental predictors of resilience in children at risk for conduct disorder and depression

    PubMed Central

    Shannon, Katherine E.; Beauchaine, Theodore P.; Brenner, Sharon L.; Neuhaus, Emily; Gatzke-Kopp, Lisa

    2009-01-01

    In this study, we evaluated predictors of resilience among 8- to 12-year-old children recruited from primarily low socioeconomic status neighborhoods, 117 of whom suffered from clinical levels of conduct problems and/or depression, and 63 of whom suffered from no significant symptoms. Tests of interactions were conducted between (a) paternal antisocial behavior and maternal depression and (b) several physiological indices of child temperament and emotionality in predicting (c) children’s conduct problems and depression. Both internalizing and externalizing outcomes among children were associated specifically with maternal melancholic depression, and not with nonmelancholic depression. In addition, low levels of respiratory sinus arrhythmia (RSA) among children conferred significant risk for depression, regardless of maternal melancholia, whereas high RSA offered partial protection. Furthermore, high levels of maternal melancholia conferred significant risk for child depression, regardless of paternal antisocial behavior, whereas low levels of maternal melancholia offered partial protection. Finally, low levels of electrodermal responding (EDR) conferred significant risk for conduct problems, regardless of paternal antisocial behavior, whereas high EDR offered partial protection. None of the identified protective factors offered complete immunity from psychopathology. These findings underscore the complexity of resilience and resilience-related processes, and suggest several potential avenues for future longitudinal research. PMID:17705899

  3. An adenovirus-vectored nasal vaccine confers rapid and sustained protection against anthrax in a single-dose regimen.

    PubMed

    Zhang, Jianfeng; Jex, Edward; Feng, Tsungwei; Sivko, Gloria S; Baillie, Leslie W; Goldman, Stanley; Van Kampen, Kent R; Tang, De-chu C

    2013-01-01

    Bacillus anthracis is the causative agent of anthrax, and its spores have been developed into lethal bioweapons. To mitigate an onslaught from airborne anthrax spores that are maliciously disseminated, it is of paramount importance to develop a rapid-response anthrax vaccine that can be mass administered by nonmedical personnel during a crisis. We report here that intranasal instillation of a nonreplicating adenovirus vector encoding B. anthracis protective antigen could confer rapid and sustained protection against inhalation anthrax in mice in a single-dose regimen in the presence of preexisting adenovirus immunity. The potency of the vaccine was greatly enhanced when codons of the antigen gene were optimized to match the tRNA pool found in human cells. In addition, an adenovirus vector encoding lethal factor can confer partial protection against inhalation anthrax and might be coadministered with a protective antigen-based vaccine.

  4. An Adenovirus-Vectored Nasal Vaccine Confers Rapid and Sustained Protection against Anthrax in a Single-Dose Regimen

    PubMed Central

    Jex, Edward; Feng, Tsungwei; Sivko, Gloria S.; Baillie, Leslie W.; Goldman, Stanley; Van Kampen, Kent R.; Tang, De-chu C.

    2013-01-01

    Bacillus anthracis is the causative agent of anthrax, and its spores have been developed into lethal bioweapons. To mitigate an onslaught from airborne anthrax spores that are maliciously disseminated, it is of paramount importance to develop a rapid-response anthrax vaccine that can be mass administered by nonmedical personnel during a crisis. We report here that intranasal instillation of a nonreplicating adenovirus vector encoding B. anthracis protective antigen could confer rapid and sustained protection against inhalation anthrax in mice in a single-dose regimen in the presence of preexisting adenovirus immunity. The potency of the vaccine was greatly enhanced when codons of the antigen gene were optimized to match the tRNA pool found in human cells. In addition, an adenovirus vector encoding lethal factor can confer partial protection against inhalation anthrax and might be coadministered with a protective antigen-based vaccine. PMID:23100479

  5. Partial protection of SIV-infected rhesus monkeys against superinfection with a heterologous SIV isolate

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Korber, Bette

    2009-01-01

    Although there is increasing evidence that individuals already infected with human immunodeficiency virus type 1 (HIV-1) can be infected with a heterologous strain of the virus, the extent of protection against superinfection conferred by the first infection and the biologic consequences of superinfection are not well understood. We explored these questions in the simian immunodeficiency virus (SIV)/rhesus monkey model of HIV-1/AIDS. We infected cohorts of rhesus monkeys with either SIVmac251 or SIVsmE660 and then exposed animals to the reciprocal virus through intrarectal inoculations. Employing a quantitative real-time PCR assay, we determined the replication kinetics of the two strains of virusmore » for 20 weeks. We found that primary infection with a replication-competent virus did not protect against acquisition of infection by a heterologous virus but did confer relative control of the superinfecting virus. In animals that became superinfected, there was a reduction in peak replication and rapid control of the second virus. The relative susceptibility to superinfection was not correlated with CD4(+) T-cell count, CD4(+) memory T-cell subsets, cytokine production by virus-specific CD8(+) or CD4(+) cells, or neutralizing antibodies at the time of exposure to the second virus. Although there were transient increases in viral loads of the primary virus and a modest decline in CD4(+) T-cell counts after superinfection, there was no evidence of disease acceleration. These findings indicate that an immunodeficiency virus infection confers partial protection against a second immunodeficiency virus infection, but this protection may be mediated by mechanisms other than classical adaptive immune responses.« less

  6. Novel Catanionic Surfactant Vesicle Vaccines Protect against Francisella tularensis LVS and Confer Significant Partial Protection against F. tularensis Schu S4 Strain

    PubMed Central

    Richard, Katharina; Mann, Barbara J.; Stocker, Lenea; Barry, Eileen M.; Qin, Aiping; Cole, Leah E.; Hurley, Matthew T.; Ernst, Robert K.; Michalek, Suzanne M.; Stein, Daniel C.; DeShong, Philip

    2014-01-01

    Francisella tularensis is a Gram-negative immune-evasive coccobacillus that causes tularemia in humans and animals. A safe and efficacious vaccine that is protective against multiple F. tularensis strains has yet to be developed. In this study, we tested a novel vaccine approach using artificial pathogens, synthetic nanoparticles made from catanionic surfactant vesicles that are functionalized by the incorporation of either F. tularensis type B live vaccine strain (F. tularensis LVS [LVS-V]) or F. tularensis type A Schu S4 strain (F. tularensis Schu S4 [Schu S4-V]) components. The immunization of C57BL/6 mice with “bare” vesicles, which did not express F. tularensis components, partially protected against F. tularensis LVS, presumably through activation of the innate immune response, and yet it failed to protect against the F. tularensis Schu S4 strain. In contrast, immunization with LVS-V fully protected mice against intraperitoneal (i.p.) F. tularensis LVS challenge, while immunization of mice with either LVS-V or Schu S4-V partially protected C57BL/6 mice against an intranasal (i.n.) F. tularensis Schu S4 challenge and significantly increased the mean time to death for nonsurvivors, particularly following the i.n. and heterologous (i.e., i.p./i.n.) routes of immunization. LVS-V immunization, but not immunization with empty vesicles, elicited high levels of IgG against nonlipopolysaccharide (non-LPS) epitopes that were increased after F. tularensis LVS challenge and significantly increased early cytokine production. Antisera from LVS-V-immunized mice conferred passive protection against challenge with F. tularensis LVS. Together, these data indicate that functionalized catanionic surfactant vesicles represent an important and novel tool for the development of a safe and effective F. tularensis subunit vaccine and may be applicable for use with other pathogens. PMID:24351755

  7. Antibodies generated by immunization with the NS1 protein of West Nile virus confer partial protection against lethal Japanese encephalitis virus challenge.

    PubMed

    Sun, EnCheng; Zhao, Jing; TaoYang; Xu, QingYuan; Qin, YongLi; Wang, WenShi; Wei, Peng; Wu, DongLai

    2013-09-27

    Japanese encephalitis virus (JEV) and West Nile virus (WNV) are two medically important flaviviruses that can cause severe hemorrhagic and encephalitic diseases in humans. Immune responses directed against the NS1 protein of flaviviruses can confer protection against lethal viral challenge. Previous studies have shown that the WNV NS1 protein harbors epitopes that elicit antibodies that cross react with JEV. Here we demonstrate that the WNV NS1 protein not only contains cross-reactive epitopes, but that the antibodies elicited by these cross-reactive epitopes provide partial protection against lethal JEV challenge in a mouse model. Mice immunized with WNV NS1 protein showed reduced morbidity and mortality following both intracerebral and intraperitoneal JEV challenge. WNV NS1 immunization attenuated the extent of lung pathology generated following JEV challenge, and delayed the appearance of other pathological findings including vascular cuffing. By screening and identifying the specific WNV NS1 protein-derived peptides recognized by serum antibodies elicited by immunization with WNV NS1 protein and by JEV challenge, we found after JEV challenge will induce several new epitopes, but which epitope primarily contribute to antibody-mediated cross protection need further evaluation. The knowledge and reagents generated in this study have potential applications in vaccine and subunit vaccine development for WNV and JEV. Copyright © 2013 Elsevier B.V. All rights reserved.

  8. Formalin-Inactivated Coxiella burnetii Phase I Vaccine-Induced Protection Depends on B Cells To Produce Protective IgM and IgG

    PubMed Central

    Peng, Ying; Schoenlaub, Laura; Elliott, Alexandra; Mitchell, William; Zhang, Yan

    2013-01-01

    To further understand the mechanisms of formalin-inactivated Coxiella burnetii phase I (PI) vaccine (PIV)-induced protection, we examined if B cell, T cell, CD4+ T cell, or CD8+ T cell deficiency in mice significantly affects the ability of PIV to confer protection against a C. burnetii infection. Interestingly, compared to wild-type (WT) mice, PIV conferred comparable levels of protection in CD4+ T cell- or CD8+ T cell-deficient mice and partial protection in T cell-deficient mice but did not provide measurable protection in B cell-deficient mice. These results suggest that PIV-induced protection depends on B cells. In addition, anti-PI-specific IgM was the major detectable antibody (Ab) in immune sera from PIV-vaccinated CD4+ T cell-deficient mice, and passive transfer of immune sera from PIV-vaccinated CD4+ T cell-deficient mice conferred significant protection. These results suggest that T cell-independent anti-PI-specific IgM may contribute to PIV-induced protection. Our results also suggested that PIV-induced protection may not depend on complement activation and Fc receptor-mediated effector functions. Furthermore, our results demonstrated that both IgM and IgG from PIV-vaccinated WT mouse sera were able to inhibit C. burnetii infection in vivo, but only IgM from PIV-vaccinated CD4+ T cell-deficient mouse sera inhibited C. burnetii infection. Collectively, these findings suggest that PIV-induced protection depends on B cells to produce protective IgM and IgG and that T cell-independent anti-PI-specific IgM may play a critical role in PIV-induced protection against C. burnetii infection. PMID:23545296

  9. An initial examination of the potential role of T-cell immunity in protection against feline immunodeficiency virus (FIV) infection.

    PubMed

    Aranyos, Alek M; Roff, Shannon R; Pu, Ruiyu; Owen, Jennifer L; Coleman, James K; Yamamoto, Janet K

    2016-03-14

    The importance of vaccine-induced T-cell immunity in conferring protection with prototype and commercial FIV vaccines is still unclear. Current studies performed adoptive transfer of T cells from prototype FIV-vaccinated cats to partial-to-complete feline leukocyte antigen (FLA)-matched cats a day before either homologous FIVPet or heterologous-subtype pathogenic FIVFC1 challenge. Adoptive-transfer (A-T) conferred a protection rate of 87% (13 of 15, p < 0.001) against FIVPet using the FLA-matched T cells, whereas all 12 control cats were unprotected. Furthermore, A-T conferred protection rate of 50% (6 of 12, p<0.023) against FIVFC1 using FLA-matched T cells, whereas all 8 control cats were unprotected. Transfer of FLA-matched T and B cells demonstrated that T cells are needed to confer A-T protection. In addition, complete FLA-matching and addition of T-cell numbers > 13 × 10(6) cells were required for A-T protection against FIVFC1 strain, reported to be a highly pathogenic virus resistant to vaccine-induced neutralizing-antibodies. The addition of FLA-matched B cells alone was not protective. The poor quality of the anti-FIV T-cell immunity induced by the vaccine likely contributed to the lack of protection in an FLA-matched recipient against FIVFC1. The quality of the immune response was determined by the presence of high mRNA levels of cytolysin (perforin) and cytotoxins (granzymes A, B, and H) and T helper-1 cytokines (interferon-γ [IFNγ] and IL2). Increased cytokine, cytolysin and cytotoxin production was detected in the donors which conferred protection in A-T studies. In addition, the CD4(+) and CD8(+) T-cell proliferation and/or IFNγ responses to FIV p24 and reverse transcriptase increased with each year in cats receiving 1X-3X vaccine boosts over 4 years. These studies demonstrate that anti-FIV T-cell immunity induced by vaccination with a dual-subtype FIV vaccine is essential for prophylactic protection against AIDS lentiviruses such as FIV and potentially HIV-1. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. An initial examination of the potential role of T-cell immunity in protection against feline immunodeficiency virus (FIV) infection

    PubMed Central

    Aranyos, Alek M.; Roff, Shannon R.; Pu, Riuyu; Owen, Jennifer L.; Coleman, James K.; Yamamoto, Janet K.

    2016-01-01

    The importance of vaccine-induced T-cell immunity in conferring protection with prototype and commercial FIV vaccines is still unclear. Current studies performed adoptive transfer of T cells from prototype FIV-vaccinated cats to partial-to-complete feline leukocyte antigen (FLA)-matched cats a day before either homologous FIVPet or heterologous-subtype pathogenic FIVFC1 challenge. Adoptive-transfer (A–T) conferred a protection rate of 87% (13 of 15, p<0.001) against FIVPet using FLA-matched T cells, whereas all 12 control cats were unprotected. Furthermore, A-T conferred protection rate of 50% (6 of 12, p<0.023) against FIVFC1 using FLA-matched T cells, whereas all 8 control cats were unprotected. Transfer of FLA-matched T and B cells demonstrated that T cells are needed to confer A-T protection. In addition, complete FLA-matching and addition of T-cell numbers >13×106 cells were required for A-T protection against FIVFC1 strain, reported to be a highly pathogenic virus resistant to vaccine-induced neutralizing-antibodies. The addition of FLA-matched B cells alone was not protective. The poor quality of the anti-FIV T-cell immunity induced by the vaccine likely contributed to the lack of protection in an FLA-matched recipient against FIVFC1. The quality of the immune response was determined by the presence of high mRNA levels of cytolysin (perforin) and cytotoxins (granzymes A, B, and H) and T helper-1 cytokines (interferon-γ [IFNγ] and IL2). Increased cytokine, cytolysin and cytotoxin production was detected in the donors which conferred protection in A-T studies. In addition, the CD4+ and CD8+ T-cell proliferation and/or IFNγ responses to FIV p24 and reverse transcriptase increased with each year in cats receiving 1X-3X vaccine boosts over 4 years. These studies demonstrate that anti-FIV T-cell immunity induced by vaccination with a dual-subtype FIV vaccine is essential for prophylactic protection against AIDS lentiviruses such as FIV and potentially HIV-1. PMID:26802606

  11. Passive Immunization with a Polyclonal Antiserum to the Hemoglobin Receptor of Haemophilus ducreyi Confers Protection against a Homologous Challenge in the Experimental Swine Model of Chancroid▿

    PubMed Central

    Leduc, Isabelle; Fusco, William G.; Choudhary, Neelima; Routh, Patty A.; Cholon, Deborah M.; Hobbs, Marcia M.; Almond, Glen W.; Orndorff, Paul E.; Elkins, Christopher

    2011-01-01

    Haemophilus ducreyi, the etiologic agent of chancroid, has an obligate requirement for heme. Heme is acquired by H. ducreyi from its human host via TonB-dependent transporters expressed at its bacterial surface. Of 3 TonB-dependent transporters encoded in the genome of H. ducreyi, only the hemoglobin receptor, HgbA, is required to establish infection during the early stages of the experimental human model of chancroid. Active immunization with a native preparation of HgbA (nHgbA) confers complete protection in the experimental swine model of chancroid, using either Freund's or monophosphoryl lipid A as adjuvants. To determine if transfer of anti-nHgbA serum is sufficient to confer protection, a passive immunization experiment using pooled nHgbA antiserum was conducted in the experimental swine model of chancroid. Pigs receiving this pooled nHgbA antiserum were protected from a homologous, but not a heterologous, challenge. Passively transferred polyclonal antibodies elicited to nHgbA bound the surface of H. ducreyi and partially blocked hemoglobin binding by nHgbA, but were not bactericidal. Taken together, these data suggest that the humoral immune response to the HgbA vaccine is protective against an H. ducreyi infection, possibly by preventing acquisition of the essential nutrient heme. PMID:21646451

  12. Passive immunization with a polyclonal antiserum to the hemoglobin receptor of Haemophilus ducreyi confers protection against a homologous challenge in the experimental swine model of chancroid.

    PubMed

    Leduc, Isabelle; Fusco, William G; Choudhary, Neelima; Routh, Patty A; Cholon, Deborah M; Hobbs, Marcia M; Almond, Glen W; Orndorff, Paul E; Elkins, Christopher

    2011-08-01

    Haemophilus ducreyi, the etiologic agent of chancroid, has an obligate requirement for heme. Heme is acquired by H. ducreyi from its human host via TonB-dependent transporters expressed at its bacterial surface. Of 3 TonB-dependent transporters encoded in the genome of H. ducreyi, only the hemoglobin receptor, HgbA, is required to establish infection during the early stages of the experimental human model of chancroid. Active immunization with a native preparation of HgbA (nHgbA) confers complete protection in the experimental swine model of chancroid, using either Freund's or monophosphoryl lipid A as adjuvants. To determine if transfer of anti-nHgbA serum is sufficient to confer protection, a passive immunization experiment using pooled nHgbA antiserum was conducted in the experimental swine model of chancroid. Pigs receiving this pooled nHgbA antiserum were protected from a homologous, but not a heterologous, challenge. Passively transferred polyclonal antibodies elicited to nHgbA bound the surface of H. ducreyi and partially blocked hemoglobin binding by nHgbA, but were not bactericidal. Taken together, these data suggest that the humoral immune response to the HgbA vaccine is protective against an H. ducreyi infection, possibly by preventing acquisition of the essential nutrient heme.

  13. Induction of partial immunity in both males and females is sufficient to protect females against sexual transmission of Chlamydia.

    PubMed

    O'Meara, C P; Armitage, C W; Kollipara, A; Andrew, D W; Trim, L; Plenderleith, M B; Beagley, K W

    2016-07-01

    Sexually transmitted Chlamydia trachomatis causes infertility, and because almost 90% of infections are asymptomatic, a vaccine is required for its eradication. Mathematical modeling studies have indicated that a vaccine eliciting partial protection (non-sterilizing) may prevent Chlamydia infection transmission, if administered to both sexes before an infection. However, reducing chlamydial inoculum transmitted by males and increasing infection resistance in females through vaccination to elicit sterilizing immunity has yet to be investigated experimentally. Here we show that a partially protective vaccine (chlamydial major outer membrane protein (MOMP) and ISCOMATRIX (IMX) provided sterilizing immunity against sexual transmission between immunized mice. Immunizing male or female mice before an infection reduced chlamydial burden and disease development, but did not prevent infection. However, infection and inflammatory disease responsible for infertility were absent in 100% of immunized female mice challenged intravaginally with ejaculate collected from infected immunized males. In contrast to the sterilizing immunity generated following recovery from a previous chlamydial infection, protective immunity conferred by MOMP/IMX occurred independent of resident memory T cells. Our results demonstrate that vaccination of males or females can further protect the opposing sex, whereas vaccination of both sexes can synergize to elicit sterilizing immunity against Chlamydia sexual transmission.

  14. Glutathione S-transferases as antioxidant defence agents confer pyrethroid resistance in Nilaparvata lugens.

    PubMed Central

    Vontas, J G; Small, G J; Hemingway, J

    2001-01-01

    Selection of a laboratory colony of the brown planthopper Nilaparvata lugens with the pyrethroids permethrin and lambda-cyhalothrin increased its resistance to both insecticides. Biochemical analysis and synergistic studies with metabolic inhibitors indicated that elevated glutathione S-transferases (GSTs) with a predominant peroxidase activity conferred resistance to both pyrethroids, whereas esterases conferred part of the resistance to permethrin. Purified esterases hydrolysed permethrin at a slow rate, but incubation of either pyrethroid or their primary metabolites with partially purified GSTs had no effect on the metabolic profile. Although GSTs were sensitive to inhibition by both pyrethroids, they did not serve as binding proteins, as previously hypothesized [Grant and Matsumura (1988) Insect Biochem. 18, 615-622]. We demonstrate that pyrethroids, in addition to their neurotoxic effect, induce oxidative stress and lipid peroxidation in insects. Pyrethroid exposure induced lipid peroxides, protein oxidation and depleted reduced glutathione. Elevated GSTs in the resistant strains attenuated the pyrethroid-induced lipid peroxidation and reduced mortality, whereas their in vivo inhibition eliminated their protective role. We therefore hypothesize that the main role of elevated GSTs in conferring resistance in N. lugens is through protecting tissues from oxidative damage. Our study extends the GSTs' range of efficacy to pyrethroid insecticides and possibly explains the role of elevated GSTs in other pyrethroid-resistant insects. PMID:11415437

  15. Protection of rhesus macaques against inhalational anthrax with a Bacillus anthracis capsule conjugate vaccine.

    PubMed

    Chabot, Donald J; Ribot, Wilson J; Joyce, Joseph; Cook, James; Hepler, Robert; Nahas, Debbie; Chua, Jennifer; Friedlander, Arthur M

    2016-07-25

    The efficacy of currently licensed anthrax vaccines is largely attributable to a single Bacillus anthracis immunogen, protective antigen. To broaden protection against possible strains resistant to protective antigen-based vaccines, we previously developed a vaccine in which the anthrax polyglutamic acid capsule was covalently conjugated to the outer membrane protein complex of Neisseria meningitidis serotype B and demonstrated that two doses of 2.5μg of this vaccine conferred partial protection of rhesus macaques against inhalational anthrax . Here, we demonstrate complete protection of rhesus macaques against inhalational anthrax with a higher 50μg dose of the same capsule conjugate vaccine. These results indicate that B. anthracis capsule is a highly effective vaccine component that should be considered for incorporation in future generation anthrax vaccines. Published by Elsevier Ltd.

  16. Potential Efficacy of Citicoline as Adjunct Therapy in Treatment of Cerebral Malaria

    PubMed Central

    El-Assaad, Fatima; Combes, Valery; Grau, Georges Emile Raymond

    2014-01-01

    Cerebral malaria (CM) is characterized by a dysregulated immune response that results in endothelial membrane destabilization and increased microparticle (MP) production. Citicoline (CTC) is a membrane stabilizer used for the treatment of neurological disorders. We evaluated the efficacy of CTC as adjunct therapy to aid recovery from experimental CM. We show that CTC reduces MP production in vitro; in combination with artesunate in vivo, confers partial protection against CM; and prolongs survival. PMID:24165175

  17. Preparation for emergence of an Eastern European porcine reproductive and respiratory syndrome virus (PRRSV) strain in Western Europe: Immunization with modified live virus vaccines or a field strain confers partial protection.

    PubMed

    Renson, P; Fablet, C; Le Dimna, M; Mahé, S; Touzain, F; Blanchard, Y; Paboeuf, F; Rose, N; Bourry, O

    2017-05-01

    The porcine reproductive and respiratory syndrome virus (PRRSV) causes huge economic losses for the swine industry worldwide. In the past several years, highly pathogenic strains that lead to even greater losses have emerged. For the Western European swine industry, one threat is the possible introduction of Eastern European PRRSV strains (example Lena genotype 1.3) which were shown to be more virulent than common Western resident strains under experimental conditions. To prepare for the possible emergence of this strain in Western Europe, we immunized piglets with a Western European PRRSV field strain (Finistere: Fini, genotype 1.1), a new genotype 1 commercial modified live virus (MLV) vaccine (MLV1) or a genotype 2 commercial MLV vaccine (MLV2) to evaluate and compare the level of protection that these strains conferred upon challenge with the Lena strain 4 weeks later. Results show that immunization with Fini, MLV1 or MLV2 strains shortened the Lena-induced hyperthermia. In the Fini group, a positive effect was also demonstrated in growth performance. The level of Lena viremia was reduced for all immunized groups (significantly so for Fini and MLV2). This reduction in Lena viremia was correlated with the level of Lena-specific IFNγ-secreting cells. In conclusion, we showed that a commercial MLV vaccine of genotype 1 or 2, as well as a field strain of genotype 1.1 may provide partial clinical and virological protection upon challenge with the Lena strain. The cross-protection induced by these immunizing strains was not related with the level of genetic similarity to the Lena strain. The slightly higher level of protection established with the field strain is attributed to a better cell-mediated immune response. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Vaccine potential of antigen cocktails composed of recombinant Toxoplasma gondii TgPI-1, ROP2 and GRA4 proteins against chronic toxoplasmosis in C3H mice.

    PubMed

    Picchio, Mariano S; Sánchez, Vanesa R; Arcon, Nadia; Soto, Ariadna S; Perrone Sibilia, Matías; Aldirico, María de Los Angeles; Urrutia, Mariela; Moretta, Rosalía; Fenoy, Ignacio M; Goldman, Alejandra; Martin, Valentina

    2018-02-01

    The development of an effective and safe vaccine to prevent Toxoplasma gondii infection is an important aim due to the great clinical and economic impact of this parasitosis. We have previously demonstrated that immunization with the serine protease inhibitor-1 (TgPI-1) confers partial protection to C3H/HeN and C57BL/6 mice. In order to improve the level of protection, in this work, we combined this novel antigen with ROP2 and/or GRA4 recombinant proteins (rTgPI-1+rROP2, rTgPI-1+rGRA4, rTgPI-1+rROP2+rGRA4) to explore the best combination against chronic toxoplasmosis in C3H/HeN mice. All tested vaccine formulations, administered following a homologous prime-boost protocol that combines intradermal and intranasal routes, conferred partial protection as measured by the reduction of brain cyst burden following oral challenge with tissue cysts of Me49 T. gondii strain. The highest level of protection was achieved by the mixture of rTgPI-1 and rROP2 proteins with an average parasite burden reduction of 50% compared to the unvaccinated control group. The vaccine-induced protective effect was related to the elicitation of systemic cellular and humoral immune responses that included antigen-specific spleen cell proliferation, the release of Th1/Th2 cytokines, and the generation of antigen-specific antibodies in serum. Additionally, mucosal immune responses were also induced, characterized by secretion of antigen-specific IgA antibodies in intestinal lavages and specific mesenteric lymph node cell proliferation. Our results demonstrate that rTgPI-1+rROP2 antigens seem a promising mixture to be combined with other immunogenic proteins in a multiantigenic vaccine formulation against toxoplasmosis. Copyright © 2018 Elsevier Inc. All rights reserved.

  19. Cell-wall preparation containing poly-γ-D-glutamate covalently linked to peptidoglycan, a straightforward extractable molecule, protects mice against experimental anthrax infection.

    PubMed

    Candela, Thomas; Dumetz, Fabien; Tosi-Couture, Evelyne; Mock, Michèle; Goossens, Pierre L; Fouet, Agnès

    2012-12-17

    Bacillus anthracis is the causative agent of anthrax that is characterized by septicemia and toxemia. Many vaccine strategies were described to counteract anthrax infection. In contrast with veterinary live vaccines, currently human vaccines are acellular with the protective antigen, a toxin component, as the main constituent. However, in animal models this vaccine is less efficient than the live vaccine. In this study, we analyzed the protection afforded by a single extractable surface element. The poly-γ-D-glutamate capsule is covalently linked to the peptidoglycan. A preparation of peptidoglycan-linked poly-γ-D-glutamate (GluPG) was tested for its immunogenicity and its protective effect. GluPG injection, in mice, elicited the production of specific antibodies directed against poly-glutamate and partially protected the animals against lethal challenges with a non-toxinogenic strain. When combined to protective antigen, GluPG immunization conferred full protection against cutaneous anthrax induced with a fully virulent strain. Copyright © 2012 Elsevier Ltd. All rights reserved.

  20. Random Fields and Collective Effects in Molecular Magnets

    DTIC Science & Technology

    2018-01-29

    longitudinal fields the final state consists of only partially reversed spins. Further, we measured the front speed as a function of applied magnetic...field. The theory of magnetic deflagration, together with a modification that takes into account the partial spin reversal, fits the transverse field...Conference Paper or Presentation Conference Name: APS March Meeting 2016 Conference Location: Baltimore, Paper Title: Time-resolved Measurements

  1. Intermittent Fasting Confers Protection in CNS Autoimmunity by Altering the Gut Microbiota.

    PubMed

    Cignarella, Francesca; Cantoni, Claudia; Ghezzi, Laura; Salter, Amber; Dorsett, Yair; Chen, Lei; Phillips, Daniel; Weinstock, George M; Fontana, Luigi; Cross, Anne H; Zhou, Yanjiao; Piccio, Laura

    2018-06-05

    Multiple sclerosis (MS) is more common in western countries with diet being a potential contributing factor. Here we show that intermittent fasting (IF) ameliorated clinical course and pathology of the MS model, experimental autoimmune encephalomyelitis (EAE). IF led to increased gut bacteria richness, enrichment of the Lactobacillaceae, Bacteroidaceae, and Prevotellaceae families and enhanced antioxidative microbial metabolic pathways. IF altered T cells in the gut with a reduction of IL-17 producing T cells and an increase in regulatory T cells. Fecal microbiome transplantation from mice on IF ameliorated EAE in immunized recipient mice on a normal diet, suggesting that IF effects are at least partially mediated by the gut flora. In a pilot clinical trial in MS patients, intermittent energy restriction altered blood adipokines and the gut flora resembling protective changes observed in mice. In conclusion, IF has potent immunomodulatory effects that are at least partially mediated by the gut microbiome. Copyright © 2018 Elsevier Inc. All rights reserved.

  2. Immunization of C57BL/6 Mice with GRA2 Combined with MPL Conferred Partial Immune Protection against Toxoplasma gondii

    PubMed

    Babaie, Jalal; Amiri, Samira; Homayoun, Robab; Azimi, Ebrahim; Mohabati, Reyhaneh; Berizi, Mahboobe; Sadaie, M. Reza; Golkar, Majid

    2018-01-01

    We have previously reported that immunization with GRA2 antigen of Toxoplasma gondii induces protective immunity in CBA/J (H2k) and BALB/c mice (H2d). We aimed to examine whether immunization of a distinct strain of rodent with recombinant dense granule antigens (GRA2) combined with monophosphorryl lipid A (MPL) adjuvant elicits protective immune response against T. gondii. C57BL/6 (H2b haplotype) mice were immunized with GRA2, formulated in MPL adjuvant. Strong humoral response, predominantly of IgG1 subclass and cellular response, IFN-γ, was detected at three weeks post immunization. Mice immunized with GRA2 had significantly (p < 0.01) fewer brain cysts than those in the adjuvant group, upon challenge infection. Despite the production of a strong antibody response, IFN-γ production and brain cyst reduction were not significant when the immunized mice were infected four months after the immunization. We can conclude that GRA2 immunization partially protects against T. gondii infection in C57BL/6 mice, though the potency and longevity of this antigen as a standalone vaccine may vary in distinct genetic backgrounds. This observation further emphasizes the utility of GRA2 for incorporation into a multi-antigenic vaccine against T. gondii.

  3. Larval Pacific herring, Clupea pallasii (Valenciennes), are highly susceptible to viral haemorrhagic septicaemia and survivors are partially protected after their metamorphosis to juveniles

    USGS Publications Warehouse

    Hershberger, P.K.; Gregg, J.; Pacheco, C.; Winton, J.; Richard, J.; Traxler, G.

    2007-01-01

    Pacific herring were susceptible to waterborne challenge with viral haemorrhagic septicaemia virus (VHSV) throughout their early life history stages, with significantly greater cumulative mortalities occurring among VHSV-exposed groups of 9-, 44-, 54- and 76-day-old larvae than among respective control groups. Similarly, among 89-day-1-year-old and 1+year old post-metamorphosed juveniles, cumulative mortality was significantly greater in VHSV-challenged groups than in respective control groups. Larval exposure to VHSV conferred partial protection to the survivors after their metamorphosis to juveniles as shown by significantly less cumulative mortalities among juvenile groups that survived a VHS epidemic as larvae than among groups that were previously nai??ve to VHSV. Magnitude of the protection, measured as relative per cent survival, was a direct function of larval age at first exposure and was probably a reflection of gradual developmental onset of immunocompetence. These results indicate the potential for easily overlooked VHS epizootics among wild larvae in regions where the virus is endemic and emphasize the importance of early life history stages of marine fish in influencing the ecological disease processes. ?? 2007 The Authors.

  4. The impact of phenotypic and genotypic G6PD deficiency on risk of plasmodium vivax infection: a case-control study amongst Afghan refugees in Pakistan.

    PubMed

    Leslie, Toby; Briceño, Marnie; Mayan, Ismail; Mohammed, Nasir; Klinkenberg, Eveline; Sibley, Carol Hopkins; Whitty, Christopher J M; Rowland, Mark

    2010-05-25

    The most common form of malaria outside Africa, Plasmodium vivax, is more difficult to control than P. falciparum because of the latent liver hypnozoite stage, which causes multiple relapses and provides an infectious reservoir. The African (A-) G6PD (glucose-6-phosphate dehydrogenase) deficiency confers partial protection against severe P. falciparum. Recent evidence suggests that the deficiency also confers protection against P. vivax, which could explain its wide geographical distribution in human populations. The deficiency has a potentially serious interaction with antirelapse therapies (8-aminoquinolines such as primaquine). If the level of protection was sufficient, antirelapse therapy could become more widely available. We therefore tested the hypothesis that G6PD deficiency is protective against vivax malaria infection. A case-control study design was used amongst Afghan refugees in Pakistan. The frequency of phenotypic and genotypic G6PD deficiency in individuals with vivax malaria was compared against controls who had not had malaria in the previous two years. Phenotypic G6PD deficiency was less common amongst cases than controls (cases: 4/372 [1.1%] versus controls 42/743 [5.7%]; adjusted odds ratio [AOR] 0.18 [95% confidence interval (CI) 0.06-0.52], p = 0.001). Genetic analysis demonstrated that the G6PD deficiency allele identified (Mediterranean type) was associated with protection in hemizygous deficient males (AOR = 0.12 [95% CI 0.02-0.92], p = 0.041). The deficiency was also protective in females carrying the deficiency gene as heterozygotes or homozygotes (pooled AOR = 0.37 [95% CI 0.15-0.94], p = 0.037). G6PD deficiency (Mediterranean type) conferred significant protection against vivax malaria infection in this population whether measured by phenotype or genotype, indicating a possible evolutionary role for vivax malaria in the selective retention of the G6PD deficiency trait in human populations. Further work is required on the genotypic protection associated with other types of G6PD deficiency and on developing simple point-of-care technologies to detect it before administering antirelapse therapy.

  5. Vaccination with liposomal leishmanial antigens adjuvanted with monophosphoryl lipid-trehalose dicorynomycolate (MPL-TDM) confers long-term protection against visceral leishmaniasis through a human administrable route.

    PubMed

    Ravindran, Rajesh; Maji, Mithun; Ali, Nahid

    2012-01-01

    The development of a long-term protective subunit vaccine against visceral leishmaniasis depends on antigens and adjuvants that can induce an appropriate immune response. The immunization of leishmanial antigens alone shows limited efficacy in the absence of an appropriate adjuvant. Earlier we demonstrated sustained protection against Leishmania donovani with leishmanial antigens entrapped in cationic liposomes through an intraperitoneal route. However, this route is not applicable for human administration. Herein, we therefore evaluated the immune response and protection induced by liposomal soluble leishmanial antigen (SLA) formulated with monophosphoryl lipid-trehalose dicorynomycolate (MPL-TDM) through a subcutaneous route. Subcutaneous immunization of BALB/c mice with SLA entrapped in liposomes or with MPL-TDM elicited partial protection against experimental visceral leishmaniasis. In contrast, liposomal SLA adjuvanted with MPL-TDM induced significantly higher levels of protection in liver and spleen in BALB/c mice challenged 10 days post-vaccination. Protection conferred by this formulation was sustained up to 12 weeks of immunization, and infection was controlled for at least 4 months of the challenge, similar to liposomal SLA immunization administered intraperitoneally. An analysis of cellular immune responses of liposomal SLA + MPL-TDM immunized mice demonstrated the induction of IFN-γ and IgG2a antibody production not only 10 days or 12 weeks post-vaccination but also 4 months after the challenge infection and a down regulation of IL-4 production after infection. Moreover, long-term immunity elicited by this formulation was associated with IFN-γ production also by CD8⁺ T cells. Taken together, our results suggest that liposomal SLA + MPL-TDM represent a good vaccine formulation for the induction of durable protection against L. donovani through a human administrable route.

  6. Joint American Nuclear Society and Health Physics Society Conference: Applicability of Radiation Response Models to Low Dose Protection Standards.

    PubMed

    Glines, Wayne M; Markham, Anna

    2018-05-01

    Seventy-five years after the Hanford Site was initially created as the primary plutonium production site for atomic weapons development under the Manhattan Project, the American Nuclear Society and the Health Physics Society are sponsoring a conference from 30 September through 3 October 2018, in Pasco, Washington, titled "Applicability of Radiation Response Models to Low Dose Protection Standards." The goal of this conference is to use current scientific data to update the approach to regulating low-level radiation doses; i.e., to answer a quintessential question of radiation protection-how to best develop radiation protection standards that protect human populations against detrimental effects while allowing the beneficial uses of radiation and radioactive materials. Previous conferences (e.g., "Wingspread Conference," "Arlie Conference") have attempted to address this question; but now, almost 20 y later, the key issues, goals, conclusions, and recommendations of those two conferences remain and are as relevant as they were then. Despite the best efforts of the conference participants and increased knowledge and understanding of the science underlying radiation effects in human populations, the bases of current radiation protection standards have evolved little. This 2018 conference seeks to provide a basis and path forward for evolving radiation protection standards to be more reflective of current knowledge and understanding of low dose response models.

  7. Intramuscular Adeno-Associated Virus-Mediated Expression of Monoclonal Antibodies Provides 100% Protection Against Ebola Virus Infection in Mice.

    PubMed

    van Lieshout, Laura P; Soule, Geoff; Sorensen, Debra; Frost, Kathy L; He, Shihua; Tierney, Kevin; Safronetz, David; Booth, Stephanie A; Kobinger, Gary P; Qiu, Xiangguo; Wootton, Sarah K

    2018-03-05

    The 2013-2016 West Africa outbreak demonstrated the epidemic potential of Ebola virus and highlighted the need for counter strategies. Monoclonal antibody (mAb)-based therapies hold promise as treatment options for Ebola virus infections. However, production of clinical-grade mAbs is labor intensive, and immunity is short lived. Conversely, adeno-associated virus (AAV)-mediated mAb gene transfer provides the host with a genetic blueprint to manufacture mAbs in vivo, leading to steady release of antibody over many months. Here we demonstrate that AAV-mediated expression of nonneutralizing mAb 5D2 or 7C9 confers 100% protection against mouse-adapted Ebola virus infection, while neutralizing mAb 2G4 was 83% protective. A 2-component cocktail, AAV-2G4/AAV-5D2, provided complete protection when administered 7 days prior to challenge and was partially protective with a 3-day lead time. Finally, AAV-mAb therapies provided sustained protection from challenge 5 months following AAV administration. AAV-mAb may be a viable alternative strategy for vaccination against emerging infectious diseases.

  8. 40 CFR 304.31 - Pre-hearing conference.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 27 2010-07-01 2010-07-01 false Pre-hearing conference. 304.31 Section 304.31 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SUPERFUND, EMERGENCY... CLAIMS Hearings Before the Arbitrator § 304.31 Pre-hearing conference. (a) The Arbitrator and the parties...

  9. Yersinia outer proteins (YOPS) E, K and N are antigenic but non-protective compared to V antigen, in a murine model of bubonic plague.

    PubMed

    Leary, S E; Griffin, K F; Galyov, E E; Hewer, J; Williamson, E D; Holmström, A; Forsberg, A; Titball, R W

    1999-03-01

    The pathogenic Yersiniae produce a range of virulence proteins, encoded by a 70 kb plasmid, which are essential for infection, and also form part of a contact-dependent virulence mechanism. One of these proteins, V antigen, has been shown to confer a high level of protection against parenteral infection with Y. pestis in murine models, and is considered to be a protective antigen. In this study, the protective efficacy of V antigen has been compared in the same model with that of other proteins (YopE, YopK and YopN), which are part of the contact-dependent virulence mechanism. Mice immunised with two intraperitoneal doses of V antigen or each of the Yops, administered with either Alhydrogel or interleukin-12, produced high antigen-specific serum IgG titres. As shown in previous studies, V+Alhydrogel was fully protective, and 5/5 mice survived a subcutaneous challenge with 90 or 9x10(3) LD50's of Y. pestis GB. In addition, these preliminary studies also showed that V+IL-12 was partially protective: 4/5 or 3/5 mice survived a challenge with 90 or 9x10(3) LD50's, respectively. In contrast, none of the mice immunised with the Yops survived the challenges, and there was no significant delay in the mean time to death compared to mice receiving a control protein. These results show that using two different vaccine regimens, Yops E, K and N, failed to elicit protective immune responses in a murine model of plague, whereas under the same conditions, V antigen was fully or partially protective. Copyright 1999 Academic Press.

  10. A Small Peptide (CEL-1000) Derived from the β-Chain of the Human Major Histocompatibility Complex Class II Molecule Induces Complete Protection against Malaria in an Antigen-Independent Manner

    PubMed Central

    Charoenvit, Yupin; Brice, Gary T.; Bacon, David; Majam, Victoria; Williams, Jackie; Abot, Esteban; Ganeshan, Harini; Sedegah, Martha; Doolan, Denise L.; Carucci, Daniel J.; Zimmerman, Daniel H.

    2004-01-01

    CEL-1000 (DGQEEKAGVVSTGLIGGG) is a novel potential preventative and therapeutic agent. We report that CEL-1000 confers a high degree of protection against Plasmodium sporozoite challenge in a murine model of malaria, as shown by the total absence of blood stage infection following challenge with 100 sporozoites (100% protection) and by a substantial reduction (400-fold) of liver stage parasite RNA following challenge with 50,000 sporozoites. CEL-1000 protection was demonstrated in A/J (H-2a) and C3H/HeJ (H-2k) mice but not in BALB/c (H-2d) or CAF1 (A/J × BALB/c F1 hybrid) mice. In CEL-1000-treated and protected mice, high levels of gamma interferon (IFN-γ) in serum and elevated frequencies of hepatic and splenic CD4+ IFN-γ-positive T cells were detected 24 h after administration of an additional dose of CEL-1000. Treatment of A/J mice that received CEL-1000 with antibodies against IFN-γ just prior to challenge abolished the protection, and a similar treatment with antibodies against CD4+ T cells partially reduced the level of protection, while treatment with control antibodies or antibodies specific for interleukin-12 (IL-12), CD8+ T cells, or NK cells had no effect. Our data establish that the protection induced by CEL-1000 is dependent on IFN-γ and is partially dependent on CD4+ T cells but is independent of CD8+ T cells, NK cells, and IL-12 at the effector phase and does not induce a detectable antibody response. PMID:15215094

  11. A small peptide (CEL-1000) derived from the beta-chain of the human major histocompatibility complex class II molecule induces complete protection against malaria in an antigen-independent manner.

    PubMed

    Charoenvit, Yupin; Brice, Gary T; Bacon, David; Majam, Victoria; Williams, Jackie; Abot, Esteban; Ganeshan, Harini; Sedegah, Martha; Doolan, Denise L; Carucci, Daniel J; Zimmerman, Daniel H

    2004-07-01

    CEL-1000 (DGQEEKAGVVSTGLIGGG) is a novel potential preventative and therapeutic agent. We report that CEL-1000 confers a high degree of protection against Plasmodium sporozoite challenge in a murine model of malaria, as shown by the total absence of blood stage infection following challenge with 100 sporozoites (100% protection) and by a substantial reduction (400-fold) of liver stage parasite RNA following challenge with 50,000 sporozoites. CEL-1000 protection was demonstrated in A/J (H-2(a)) and C3H/HeJ (H-2(k)) mice but not in BALB/c (H-2(d)) or CAF1 (A/J x BALB/c F(1) hybrid) mice. In CEL-1000-treated and protected mice, high levels of gamma interferon (IFN-gamma) in serum and elevated frequencies of hepatic and splenic CD4+ IFN-gamma-positive T cells were detected 24 h after administration of an additional dose of CEL-1000. Treatment of A/J mice that received CEL-1000 with antibodies against IFN-gamma just prior to challenge abolished the protection, and a similar treatment with antibodies against CD4+ T cells partially reduced the level of protection, while treatment with control antibodies or antibodies specific for interleukin-12 (IL-12), CD8+ T cells, or NK cells had no effect. Our data establish that the protection induced by CEL-1000 is dependent on IFN-gamma and is partially dependent on CD4+ T cells but is independent of CD8+ T cells, NK cells, and IL-12 at the effector phase and does not induce a detectable antibody response.

  12. Vaccination with Recombinant Microneme Proteins Confers Protection against Experimental Toxoplasmosis in Mice.

    PubMed

    Pinzan, Camila Figueiredo; Sardinha-Silva, Aline; Almeida, Fausto; Lai, Livia; Lopes, Carla Duque; Lourenço, Elaine Vicente; Panunto-Castelo, Ademilson; Matthews, Stephen; Roque-Barreira, Maria Cristina

    2015-01-01

    Toxoplasmosis, a zoonotic disease caused by Toxoplasma gondii, is an important public health problem and veterinary concern. Although there is no vaccine for human toxoplasmosis, many attempts have been made to develop one. Promising vaccine candidates utilize proteins, or their genes, from microneme organelle of T. gondii that are involved in the initial stages of host cell invasion by the parasite. In the present study, we used different recombinant microneme proteins (TgMIC1, TgMIC4, or TgMIC6) or combinations of these proteins (TgMIC1-4 and TgMIC1-4-6) to evaluate the immune response and protection against experimental toxoplasmosis in C57BL/6 mice. Vaccination with recombinant TgMIC1, TgMIC4, or TgMIC6 alone conferred partial protection, as demonstrated by reduced brain cyst burden and mortality rates after challenge. Immunization with TgMIC1-4 or TgMIC1-4-6 vaccines provided the most effective protection, since 70% and 80% of mice, respectively, survived to the acute phase of infection. In addition, these vaccinated mice, in comparison to non-vaccinated ones, showed reduced parasite burden by 59% and 68%, respectively. The protective effect was related to the cellular and humoral immune responses induced by vaccination and included the release of Th1 cytokines IFN-γ and IL-12, antigen-stimulated spleen cell proliferation, and production of antigen-specific serum antibodies. Our results demonstrate that microneme proteins are potential vaccines against T. gondii, since their inoculation prevents or decreases the deleterious effects of the infection.

  13. 40 CFR 78.13 - Scheduling orders and pre-hearing conferences.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 17 2013-07-01 2013-07-01 false Scheduling orders and pre-hearing conferences. 78.13 Section 78.13 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) APPEAL PROCEDURES § 78.13 Scheduling orders and pre-hearing conferences. (a) If a...

  14. Effectiveness of pentavalent rotavirus vaccine in a large urban population in the United States.

    PubMed

    Boom, Julie A; Tate, Jacqueline E; Sahni, Leila C; Rench, Marcia A; Hull, Jennifer J; Gentsch, Jon R; Patel, Manish M; Baker, Carol J; Parashar, Umesh D

    2010-02-01

    The goal was to assess the effectiveness of complete (3-dose) or partial (1- or 2-dose) immunization with pentavalent rotavirus vaccine (RV5) against rotavirus acute gastroenteritis (AGE) in US clinical practice. A case-control evaluation was conducted in February through June 2008 at an emergency department in Houston, Texas. Case patients with rotavirus AGE (N = 90) were identified through testing for rotavirus in fecal specimens obtained from 205 children 15 days through 23 months of age presenting with AGE. Control groups included rotavirus-negative AGE patients (N = 115), concurrently enrolled patients with acute respiratory infection (ARI) (N = 228), and up to 10 age- and zip code-matched children sampled from the Houston-Harris County Immunization Registry (HHCIR) for each case patient >8 months of age. Immunization data were obtained from parent records, health care providers, and/or the HHCIR. Vaccine effectiveness was calculated as 1 minus odds of RV5 vaccination for case patients versus control patients, after adjustment for age at presentation and birth date. The vaccine effectiveness of a complete RV5 series was 89% (95% confidence interval [CI]: 70%-96%) and 85% (95% CI: 55%-95%) with rotavirus-negative AGE and ARI control patients, respectively. Immunization data were available for 44% of case patients (n = 40) from the HHCIR; the estimated 3-dose vaccine effectiveness with these HHCIR control patients was 82% (95% CI: 19%-96%). A complete RV5 series conferred 100% protection (95% CI: 71%-100%) against severe rotavirus disease requiring hospitalization and 96% protection (95% CI: 72%-99%) against disease requiring intravenous hydration. Vaccine effectiveness of 1 and 2 doses against hospitalization and emergency department visits was 69% (95% CI: 13%-89%) and 81% (95% CI: 13%-96%), respectively, using rotavirus-negative AGE and ARI control groups combined. In this setting, a complete series of RV5 was highly effective against severe rotavirus AGE. Partial immunization also conferred substantial protection.

  15. The Impact of Phenotypic and Genotypic G6PD Deficiency on Risk of Plasmodium vivax Infection: A Case-Control Study amongst Afghan Refugees in Pakistan

    PubMed Central

    Leslie, Toby; Briceño, Marnie; Mayan, Ismail; Mohammed, Nasir; Klinkenberg, Eveline; Sibley, Carol Hopkins; Whitty, Christopher J. M.; Rowland, Mark

    2010-01-01

    Background The most common form of malaria outside Africa, Plasmodium vivax, is more difficult to control than P. falciparum because of the latent liver hypnozoite stage, which causes multiple relapses and provides an infectious reservoir. The African (A−) G6PD (glucose-6-phosphate dehydrogenase) deficiency confers partial protection against severe P. falciparum. Recent evidence suggests that the deficiency also confers protection against P. vivax, which could explain its wide geographical distribution in human populations. The deficiency has a potentially serious interaction with antirelapse therapies (8-aminoquinolines such as primaquine). If the level of protection was sufficient, antirelapse therapy could become more widely available. We therefore tested the hypothesis that G6PD deficiency is protective against vivax malaria infection. Methods and Findings A case-control study design was used amongst Afghan refugees in Pakistan. The frequency of phenotypic and genotypic G6PD deficiency in individuals with vivax malaria was compared against controls who had not had malaria in the previous two years. Phenotypic G6PD deficiency was less common amongst cases than controls (cases: 4/372 [1.1%] versus controls 42/743 [5.7%]; adjusted odds ratio [AOR] 0.18 [95% confidence interval (CI) 0.06–0.52], p = 0.001). Genetic analysis demonstrated that the G6PD deficiency allele identified (Mediterranean type) was associated with protection in hemizygous deficient males (AOR = 0.12 [95% CI 0.02–0.92], p = 0.041). The deficiency was also protective in females carrying the deficiency gene as heterozygotes or homozygotes (pooled AOR = 0.37 [95% CI 0.15–0.94], p = 0.037). Conclusions G6PD deficiency (Mediterranean type) conferred significant protection against vivax malaria infection in this population whether measured by phenotype or genotype, indicating a possible evolutionary role for vivax malaria in the selective retention of the G6PD deficiency trait in human populations. Further work is required on the genotypic protection associated with other types of G6PD deficiency and on developing simple point-of-care technologies to detect it before administering antirelapse therapy. Please see later in the article for the Editors' Summary PMID:20520804

  16. Role of mitogen-activated protein kinases and Mcl-1 in apoptosis induction by withaferin A in human breast cancer cells.

    PubMed

    Hahm, Eun-Ryeong; Lee, Joomin; Singh, Shivendra V

    2014-11-01

    Withaferin A (WA), a bioactive constituent of Ayurvedic medicine plant Withania somnifera, is a potent apoptosis inducer in cancer cells but the mechanism of cell death induction is not fully characterized. The present study was undertaken to determine the role of mitogen-activated protein kinases (MAPK), including c-jun NH2 -terminal kinase (JNK), extracellular signal-regulated kinase (ERK), and p38 MAPK, and anti-apoptotic protein myeloid cell leukemia-1 (Mcl-1) in regulation of WA-induced apoptosis using human breast cancer cells. Exposure of MCF-7 (estrogen responsive) and SUM159 (triple negative) human breast cancer cells to WA resulted in increased phosphorylation of ERK, JNK, and p38 MAPK, but these effects were relatively more pronounced in the former cell line than in SUM159. Overexpression of manganese-superoxide dismutase conferred partial protection against WA-mediated hyperphosphorylation of ERK, but not JNK or p38 MAPK. Cell death resulting from WA treatment in MCF-7 cells was significantly augmented by pharmacological inhibition of ERK and p38 MAPK. Interestingly, the WA-induced apoptosis in MCF-7 cells was partially but significantly blocked in the presence of a JNK-specific inhibitor. Pharmacological inhibition of ERK or JNK had no effect on WA-induced apoptosis in SUM159 cells. The WA-treated cells exhibited induction of long and short forms of Mcl-1. RNA interference of Mcl-1 alone triggered apoptosis. Furthermore, the WA-induced cell death in MCF-7 cells was modestly but significantly augmented by knockdown of the Mcl-1 protein. These observations indicate that: MAPK have cell line-specific role in cell death by WA, and Mcl-1 induction confers modest protection against WA-induced apoptosis. © 2013 Wiley Periodicals, Inc.

  17. Passive Antibody Administration (Immediate Immunity) as a Specific Defense Against Biological Weapons

    PubMed Central

    2002-01-01

    The potential threat of biological warfare with a specific agent is proportional to the susceptibility of the population to that agent. Preventing disease after exposure to a biological agent is partially a function of the immunity of the exposed individual. The only available countermeasure that can provide immediate immunity against a biological agent is passive antibody. Unlike vaccines, which require time to induce protective immunity and depend on the host’s ability to mount an immune response, passive antibody can theoretically confer protection regardless of the immune status of the host. Passive antibody therapy has substantial advantages over antimicrobial agents and other measures for postexposure prophylaxis, including low toxicity and high specific activity. Specific antibodies are active against the major agents of bioterrorism, including anthrax, smallpox, botulinum toxin, tularemia, and plague. This article proposes a biological defense initiative based on developing, producing, and stockpiling specific antibody reagents that can be used to protect the population against biological warfare threats. PMID:12141970

  18. Single-dose live-attenuated Nipah virus vaccines confer complete protection by eliciting antibodies directed against surface glycoproteins

    PubMed Central

    DeBuysscher, Blair L.; Scott, Dana; Marzi, Andrea; Prescott, Joseph; Feldmann, Heinz

    2016-01-01

    Background Nipah virus (NiV), a zoonotic pathogen causing severe respiratory illness and encephalitis in humans, emerged in Malaysia in 1998 with subsequent outbreaks on an almost annual basis since 2001 in parts of the Indian subcontinent. The high case fatality rate, human-to-human transmission, wide-ranging reservoir distribution and lack of licensed intervention options are making NiV a serious regional and potential global public health problem. The objective of this study was to develop a fast-acting, single-dose NiV vaccine that could be implemented in a ring vaccination approach during outbreaks. Methods In this study we have designed new live-attenuated vaccine vectors based on recombinant vesicular stomatitis viruses (rVSV) expressing NiV glycoproteins (G or F) or nucleoprotein (N) and evaluated their protective efficacy in Syrian hamsters, an established NiV animal disease model. We further characterized the humoral immune response to vaccination in hamsters using ELISA and neutralization assays and performed serum transfer studies. Results Vaccination of Syrian hamsters with a single dose of the rVSV vaccine vectors resulted in strong humoral immune responses with neutralizing activities found only in those animals vaccinated with rVSV expressing NiV G or F proteins. Vaccinated animals with neutralizing antibody responses were completely protected from lethal NiV disease, whereas animals vaccinated with rVSV expressing NiV N showed only partial protection. Protection of NiV G or F vaccinated animals was conferred by antibodies, most likely the neutralizing fraction, as demonstrated by serum transfer studies. Protection of N-vaccinated hamsters was not antibody-dependent indicating a role of adaptive cellular responses for protection. Conclusions The rVSV vectors expressing Nipah virus G or F are prime candidates for new ‘emergency vaccines’ to be utilized for NiV outbreak management. PMID:24631094

  19. Single-dose live-attenuated Nipah virus vaccines confer complete protection by eliciting antibodies directed against surface glycoproteins.

    PubMed

    DeBuysscher, Blair L; Scott, Dana; Marzi, Andrea; Prescott, Joseph; Feldmann, Heinz

    2014-05-07

    Nipah virus (NiV), a zoonotic pathogen causing severe respiratory illness and encephalitis in humans, emerged in Malaysia in 1998 with subsequent outbreaks on an almost annual basis since 2001 in parts of the Indian subcontinent. The high case fatality rate, human-to-human transmission, wide-ranging reservoir distribution and lack of licensed intervention options are making NiV a serious regional and potential global public health problem. The objective of this study was to develop a fast-acting, single-dose NiV vaccine that could be implemented in a ring vaccination approach during outbreaks. In this study we have designed new live-attenuated vaccine vectors based on recombinant vesicular stomatitis viruses (rVSV) expressing NiV glycoproteins (G or F) or nucleoprotein (N) and evaluated their protective efficacy in Syrian hamsters, an established NiV animal disease model. We further characterized the humoral immune response to vaccination in hamsters using ELISA and neutralization assays and performed serum transfer studies. Vaccination of Syrian hamsters with a single dose of the rVSV vaccine vectors resulted in strong humoral immune responses with neutralizing activities found only in those animals vaccinated with rVSV expressing NiV G or F proteins. Vaccinated animals with neutralizing antibody responses were completely protected from lethal NiV disease, whereas animals vaccinated with rVSV expressing NiV N showed only partial protection. Protection of NiV G or F vaccinated animals was conferred by antibodies, most likely the neutralizing fraction, as demonstrated by serum transfer studies. Protection of N-vaccinated hamsters was not antibody-dependent indicating a role of adaptive cellular responses for protection. The rVSV vectors expressing Nipah virus G or F are prime candidates for new 'emergency vaccines' to be utilized for NiV outbreak management. Published by Elsevier Ltd.

  20. Binding of Escherichia coli Does Not Protect Tulane Virus from Heat-Inactivation Regardless the Expression of HBGA-Like Molecules

    PubMed Central

    Li, Qianqian; Wang, Dapeng; Yang, David; Shan, Lei; Tian, Peng

    2017-01-01

    Histo-blood group antigens (HBGAs) are considered as receptors/co-receptors for human norovirus (HuNoV). It has been reported that binding of HuNoV-derived virus-like particles (VLPs) to HBGA-like molecules-expressing bacteria increased the stability of VLPs to heat-denaturation (HD). In this study, we tested for HBGA-like-binding-conveyed protection against HD on viral replication using Tulane virus (TV) and Escherichia coli O86:H2 (O86:H2), with E. coli K-12 (K-12) used as a control. Expression of HBGA type B was confirmed by ELISA in O86:H2 but not in K-12. Binding of TV was confirmed by ELISA in O86:H2 (P/N = 2.23) but not in K-12 (P/N = 1.90). Pre-incubation of TV with free HBGA could completely inhibit its ability to bind to O86:H2 (p = 0.004), while producing no significant change in its ability to bind K-12 (p = 0.635). We utilized a bacterial-capture-RT-qPCR procedure to confirm that both bacterial strains were capable of binding TV, and that O86:H2 exhibited fivefold greater binding capacity than K-12. Pre-incubation of TV with free HBGA would partially inhibit the binding of TV to O86:H2 (p = 0.047). In contrast, not only did pre-incubation of TV with free HBGA not inhibit the binding of TV to K-12, binding was slightly enhanced (p = 0.13). The viral infectivity assay allowed us to conduct a direct evaluation of the ability of HBGA-like-bound bacteria to confer HD protection to TV. Prior to inoculate to LLC-MK2 cells, TV was incubated with each bacterial strain at ratios of 1:0, 1:1 and 100:1, then both partially and fully HD. The viral amplification was quantitated by RT-qPCR 48 h later. The binding of bacteria to TV reduced viral replication in a dose-dependent matter. We found that neither bound O86:H2 nor K-12 conferred protection of TV against partial or full HD conditions. Partial HD reduction of viral replication was not significantly impacted by the binding of either bacterial strain, with infectivity losses of 99.03, 99.42, 96.32, 96.10, and 98.88% for TV w/o bacteria, TV w/O86:H2 (1:1), TV w/O86:H2 (100:1), TV w/K-12 (1:1), and TV w/K-12 (100:1), respectively. Full HD reduction of viral replication was not impacted by the binding of either bacterial strain, as full loss of infectivity was observed in all cases. PMID:28983282

  1. Heterogeneous alleles comprising G6PD deficiency trait in West Africa exert contrasting effects on two major clinical presentations of severe malaria.

    PubMed

    Shah, Shivang S; Rockett, Kirk A; Jallow, Muminatou; Sisay-Joof, Fatou; Bojang, Kalifa A; Pinder, Margaret; Jeffreys, Anna; Craik, Rachel; Hubbart, Christina; Wellems, Thomas E; Kwiatkowski, Dominic P

    2016-01-07

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency exhibits considerable allelic heterogeneity which manifests with variable biochemical and clinical penetrance. It has long been thought that G6PD deficiency confers partial protection against severe malaria, however prior genetic association studies have disagreed with regard to the strength and specificity of a protective effect, which might reflect differences in the host genetic background, environmental influences, or in the specific clinical phenotypes considered. A case-control association study of severe malaria was conducted in The Gambia, a region in West Africa where there is considerable allelic heterogeneity underlying expression of G6PD deficiency trait, evaluating the three major nonsynonymous polymorphisms known to be associated with enzyme deficiency (A968G, T542A, and C202T) in a cohort of 3836 controls and 2379 severe malaria cases. Each deficiency allele exhibited a similar trend toward protection against severe malaria overall (15-26% reduced risk); however, in stratifying severe malaria to two of its constituent clinical subphenotypes, severe malarial anaemia (SMA) and cerebral malaria (CM), the three deficiency alleles exhibited trends of opposing effect, with risk conferred to SMA and protection with respect to CM. To assess the overall effect of G6PD deficiency trait, deficiency alleles found across all three loci were pooled. G6PD deficiency trait was found to be significantly associated with protection from severe malaria overall (OR 0.83 [0.75-0.92], P = 0.0006), but this was limited to CM (OR 0.73 [0.61-0.87], P = 0.0005), with a trend toward increased risk for SMA, especially in fully-deficient individuals (OR 1.43 [0.99-2.08], P = 0.056). Sex-stratified testing largely comported with these results, with evidence suggesting that protection by G6PD deficiency trait is conferred to both males and females, though susceptibility to SMA may be restricted to fully-deficient male hemizygotes. In a part of Africa where multiple alleles contribute to expression of G6PD deficiency trait, these findings clarify and extend previous work done in populations where a single variant predominates, and taken together suggest a causal role for G6PD deficiency trait itself with respect to severe malaria, with opposing effects seen on two major clinical subphenotypes.

  2. Frontiers in Human Information Processing Conference

    DTIC Science & Technology

    2008-02-25

    Frontiers in Human Information Processing - Vision, Attention , Memory , and Applications: A Tribute to George Sperling, a Festschrift. We are grateful...with focus on the formal, computational, and mathematical approaches that unify the areas of vision, attention , and memory . The conference also...Information Processing Conference Final Report AFOSR GRANT # FA9550-07-1-0346 The AFOSR Grant # FA9550-07-1-0346 provided partial support for the Conference

  3. 40 CFR 305.26 - Prehearing conference.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 40 Protection of Environment 29 2012-07-01 2012-07-01 false Prehearing conference. 305.26 Section 305.26 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SUPERFUND, EMERGENCY... LIABILITY ACT (CERCLA) ADMINISTRATIVE HEARING PROCEDURES FOR CLAIMS AGAINST THE SUPERFUND Prehearing...

  4. 40 CFR 305.26 - Prehearing conference.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 29 2013-07-01 2013-07-01 false Prehearing conference. 305.26 Section 305.26 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SUPERFUND, EMERGENCY... LIABILITY ACT (CERCLA) ADMINISTRATIVE HEARING PROCEDURES FOR CLAIMS AGAINST THE SUPERFUND Prehearing...

  5. 2016 International Conference on Charged Lepton Flavor Violation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dukes, Edmond Craig

    Partial support for participation for students and postdocs who wished to attend to give poster presentations at the 2016 International Conference on Charged Lepton Flavor Violation (CLFV 2016) in Charlottesville, VA.

  6. Environment, epigenetics and reproduction.

    PubMed

    Skinner, Michael K

    2017-07-01

    A conference summary of the third biannual Kenya Africa Conference "Environment, Epigenetics and Reproduction" is provided. A partial special Environmental Epigenetics issue containing a number of papers in Volume 3, Issue 3 and 4 are discussed.

  7. Protective-antigen (PA) based anthrax vaccines confer protection against inhalation anthrax by precluding the establishment of a systemic infection

    PubMed Central

    Merkel, Tod J; Perera, Pin-Yu; Lee, Gloria M; Verma, Anita; Hiroi, Toyoko; Yokote, Hiroyuki; Waldmann, Thomas A; Perera, Liyanage P

    2013-01-01

    An intense effort has been launched to develop improved anthrax vaccines that confer rapid, long lasting protection preferably with an extended stability profile amenable for stockpiling. Protective antigen (PA)-based vaccines are most favored as immune responses directed against PA are singularly protective, although the actual protective mechanism remains to be unraveled. Herein we show that contrary to the prevailing view, an efficacious PA-based vaccine confers protection against inhalation anthrax by preventing the establishment of a toxin-releasing systemic infection. Equally importantly, antibodies measured by the in vitro lethal toxin neutralization activity assay (TNA) that is considered as a reliable correlate of protection, especially for PA protein-based vaccines adjuvanted with aluminum salts appear to be not absolutely essential for this protective immune response. PMID:23787486

  8. Protective-antigen (PA) based anthrax vaccines confer protection against inhalation anthrax by precluding the establishment of a systemic infection.

    PubMed

    Merkel, Tod J; Perera, Pin-Yu; Lee, Gloria M; Verma, Anita; Hiroi, Toyoko; Yokote, Hiroyuki; Waldmann, Thomas A; Perera, Liyanage P

    2013-09-01

    An intense effort has been launched to develop improved anthrax vaccines that confer rapid, long lasting protection preferably with an extended stability profile amenable for stockpiling. Protective antigen (PA)-based vaccines are most favored as immune responses directed against PA are singularly protective, although the actual protective mechanism remains to be unraveled. Herein we show that contrary to the prevailing view, an efficacious PA-based vaccine confers protection against inhalation anthrax by preventing the establishment of a toxin-releasing systemic infection. Equally importantly, antibodies measured by the in vitro lethal toxin neutralization activity assay (TNA) that is considered as a reliable correlate of protection, especially for PA protein-based vaccines adjuvanted with aluminum salts appear to be not absolutely essential for this protective immune response.

  9. 40 CFR 304.31 - Pre-hearing conference.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 40 Protection of Environment 29 2012-07-01 2012-07-01 false Pre-hearing conference. 304.31 Section 304.31 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SUPERFUND, EMERGENCY PLANNING, AND COMMUNITY RIGHT-TO-KNOW PROGRAMS ARBITRATION PROCEDURES FOR SMALL SUPERFUND COST RECOVERY...

  10. 40 CFR 304.31 - Pre-hearing conference.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 29 2013-07-01 2013-07-01 false Pre-hearing conference. 304.31 Section 304.31 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SUPERFUND, EMERGENCY PLANNING, AND COMMUNITY RIGHT-TO-KNOW PROGRAMS ARBITRATION PROCEDURES FOR SMALL SUPERFUND COST RECOVERY...

  11. 40 CFR 304.31 - Pre-hearing conference.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 Protection of Environment 28 2011-07-01 2011-07-01 false Pre-hearing conference. 304.31 Section 304.31 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SUPERFUND, EMERGENCY PLANNING, AND COMMUNITY RIGHT-TO-KNOW PROGRAMS ARBITRATION PROCEDURES FOR SMALL SUPERFUND COST RECOVERY...

  12. FLT3-ITD induces expression of Pim kinases through STAT5 to confer resistance to the PI3K/Akt pathway inhibitors on leukemic cells by enhancing the mTORC1/Mcl-1 pathway.

    PubMed

    Okada, Keigo; Nogami, Ayako; Ishida, Shinya; Akiyama, Hiroki; Chen, Cheng; Umezawa, Yoshihiro; Miura, Osamu

    2018-02-06

    FLT3-ITD is the most frequent tyrosine kinase mutation in acute myeloid leukemia (AML) associated with poor prognosis. We previously reported that activation of STAT5 confers resistance to PI3K/Akt inhibitors on the FLT3-ITD-positive AML cell line MV4-11 and 32D cells driven by FLT3-ITD (32D/ITD) but not by FLT3 mutated in the tyrosine kinase domain (32D/TKD). Here, we report the involvement of Pim kinases expressed through STAT5 activation in acquisition of this resistance. The specific pan-Pim kinase inhibitor AZD1208 as well as PIM447 in combination with the PI3K inhibitor GDC-0941 or the Akt inhibitor MK-2206 cooperatively downregulated the mTORC1/4EBP1 pathway, formation of the eIF4E/eIF4G complex, and Mcl-1 expression leading to activation of Bak and Bax to induce caspase-dependent apoptosis synergistically in these cells. These cooperative effects were enhanced or inhibited by knock down of mTOR or expression of its activated mutant, respectively. Overexpression of Mcl-1 conferred the resistance on 32D/ITD cells to combined inhibition of the PI3K/Akt pathway and Pim kinases, while the Mcl-1-specific BH3 mimetic A-1210477 conquered the resistance of MV4-11 cells to GDC-0941. Furthermore, overexpression of Pim-1 in 32D/TKD enhanced the mTORC1/Mcl-1 pathway and partially protected it from the PI3K/Akt inhibitors or the FLT3 inhibitor gilteritinib to confer the resistance to PI3K/Akt inhibitors. Finally, AZD1208 and GDC-0941 cooperatively inhibited the mTORC1/Mcl-1 pathway and reduced viable cell numbers of primary AML cells from some FLT3-ITD positive cases. Thus, Pim kinases may protect the mTORC1/4EBP1/Mcl-1 pathway to confer the resistance to the PI3K/Akt inhibitors on FLT3-ITD cells and represent promising therapeutic targets.

  13. Environment, epigenetics and reproduction

    PubMed Central

    Skinner, Michael K

    2017-01-01

    Abstract A conference summary of the third biannual Kenya Africa Conference “Environment, Epigenetics and Reproduction” is provided. A partial special Environmental Epigenetics issue containing a number of papers in Volume 3, Issue 3 and 4 are discussed. PMID:29492316

  14. The Report of the National Invitational Conference on Consumer Protection in Postsecondary Education. Report No. 53.

    ERIC Educational Resources Information Center

    Education Commission of the States, Denver, CO.

    This report covers the background, major issues, major recommendations, and agencies and associations represented at the National Invitational Conference on Consumer Protection in Postsecondary Education held at Denver, Colorado in June 1974. Major recommendations of the conference suggest that: (1) The states should provide by legislation or by…

  15. Functional Transplant of a Dengue Virus Serotype 3 (DENV3)-Specific Human Monoclonal Antibody Epitope into DENV1.

    PubMed

    Messer, William B; Yount, Boyd L; Royal, Scott R; de Alwis, Ruklanthi; Widman, Douglas G; Smith, Scott A; Crowe, James E; Pfaff, Jennifer M; Kahle, Kristen M; Doranz, Benjamin J; Ibarra, Kristie D; Harris, Eva; de Silva, Aravinda M; Baric, Ralph S

    2016-05-15

    The four dengue virus (DENV) serotypes, DENV1 through 4, are endemic throughout tropical and subtropical regions of the world. While first infection confers long-term protective immunity against viruses of the infecting serotype, a second infection with virus of a different serotype carries a greater risk of severe dengue disease, including dengue hemorrhagic fever and dengue shock syndrome. Recent studies demonstrate that humans exposed to DENV infections develop neutralizing antibodies that bind to quaternary epitopes formed by the viral envelope (E) protein dimers or higher-order assemblies required for the formation of the icosahedral viral envelope. Here we show that the quaternary epitope target of the human DENV3-specific neutralizing monoclonal antibody (MAb) 5J7 can be partially transplanted into a DENV1 strain by changing the core residues of the epitope contained within a single monomeric E molecule. MAb 5J7 neutralized the recombinant DENV1/3 strain in cell culture and was protective in a mouse model of infection with the DENV1/3 strain. However, the 5J7 epitope was only partially recreated by transplantation of the core residues because MAb 5J7 bound and neutralized wild-type (WT) DENV3 better than the DENV1/3 recombinant. Our studies demonstrate that it is possible to transplant a large number of discontinuous residues between DENV serotypes and partially recreate a complex antibody epitope, while retaining virus viability. Further refinement of this approach may lead to new tools for measuring epitope-specific antibody responses and new vaccine platforms. Dengue virus is the most important mosquito-borne pathogen of humans worldwide, with approximately one-half the world's population living in regions where dengue is endemic. Dengue immunity following infection is robust and thought to be conferred by antibodies raised against the infecting virus. However, the specific viral components that these antibodies recognize and how they neutralize the virus have been incompletely described. Here we map a region on dengue virus serotype 3 recognized by the human neutralizing antibody 5J7 and then test the functional significance of this region by transplanting it into a serotype 1 virus. Our studies demonstrate a region on dengue virus necessary for 5J7 binding and neutralization. Our work also demonstrates the technical feasibility of engineering dengue viruses to display targets of protective antibodies. This technology can be used to develop new dengue vaccines and diagnostic assays. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  16. Pellagra-like condition is xeroderma pigmentosum/Cockayne syndrome complex and niacin confers clinical benefit.

    PubMed

    Hijazi, H; Salih, M A; Hamad, M H A; Hassan, H H; Salih, S B M; Mohamed, K A; Mukhtar, M M; Karrar, Z A; Ansari, S; Ibrahim, N; Alkuraya, F S

    2015-01-01

    An extremely rare pellagra-like condition has been described, which was partially responsive to niacin and associated with a multisystem involvement. The condition was proposed to represent a novel autosomal recessive entity but the underlying mutation remained unknown for almost three decades. The objective of this study was to identify the causal mutation in the pellagra-like condition and investigate the mechanism by which niacin confers clinical benefit. Autozygosity mapping and exome sequencing were used to identify the causal mutation, and comet assay on patient fibroblasts before and after niacin treatment to assess its effect on DNA damage. We identified a single disease locus that harbors a novel mutation in ERCC5, thus confirming that the condition is in fact xeroderma pigmentosum/Cockayne syndrome (XP/CS) complex. Importantly, we also show that the previously described dermatological response to niacin is consistent with a dramatic protective effect against ultraviolet-induced DNA damage in patient fibroblasts conferred by niacin treatment. Our findings show the power of exome sequencing in reassigning previously described novel clinical entities, and suggest a mechanism for the dermatological response to niacin in patients with XP/CS complex. This raises interesting possibilities about the potential therapeutic use of niacin in XP. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  17. ImprimatinC1, a novel plant immune-priming compound, functions as a partial agonist of salicylic acid

    PubMed Central

    Noutoshi, Yoshiteru; Jikumaru, Yusuke; Kamiya, Yuji; Shirasu, Ken

    2012-01-01

    Plant activators are agrochemicals that protect crops from pathogens. They confer durable resistance to a broad range of diseases by activating intrinsic immune mechanisms in plants. To obtain leads regarding useful compounds, we have screened a chemical library using an established method that allows selective identification of immune-priming compounds. Here, we report the characterisation of one of the isolated chemicals, imprimatinC1, and its structural derivative imprimatinC2. ImprimatinC1 functions as a weak analogue of salicylic acid (SA) and activates the expression of defence-related genes. However, it lacks antagonistic activity toward jasmonic acid. Structure-activity relationship analysis suggests that imprimatinC1 and C2 can be metabolised to 4-chlorobenzoic acid and 3,4-chlorobenzoic acid, respectively, to function in Arabidopsis. We also found that imprimatinC1 and C2 and their potential functional metabolites acted as partial agonists of SA. Thus, imprimatinC compounds could be useful tools for dissecting SA-dependent signal transduction pathways. PMID:23050089

  18. ImprimatinC1, a novel plant immune-priming compound, functions as a partial agonist of salicylic acid.

    PubMed

    Noutoshi, Yoshiteru; Jikumaru, Yusuke; Kamiya, Yuji; Shirasu, Ken

    2012-01-01

    Plant activators are agrochemicals that protect crops from pathogens. They confer durable resistance to a broad range of diseases by activating intrinsic immune mechanisms in plants. To obtain leads regarding useful compounds, we have screened a chemical library using an established method that allows selective identification of immune-priming compounds. Here, we report the characterisation of one of the isolated chemicals, imprimatinC1, and its structural derivative imprimatinC2. ImprimatinC1 functions as a weak analogue of salicylic acid (SA) and activates the expression of defence-related genes. However, it lacks antagonistic activity toward jasmonic acid. Structure-activity relationship analysis suggests that imprimatinC1 and C2 can be metabolised to 4-chlorobenzoic acid and 3,4-chlorobenzoic acid, respectively, to function in Arabidopsis. We also found that imprimatinC1 and C2 and their potential functional metabolites acted as partial agonists of SA. Thus, imprimatinC compounds could be useful tools for dissecting SA-dependent signal transduction pathways.

  19. Pathogenic diversity of Phytophthora sojae and breeding strategies to develop Phytophthora-resistant soybeans

    PubMed Central

    Sugimoto, Takuma; Kato, Masayasu; Yoshida, Shinya; Matsumoto, Isao; Kobayashi, Tamotsu; Kaga, Akito; Hajika, Makita; Yamamoto, Ryo; Watanabe, Kazuhiko; Aino, Masataka; Matoh, Toru; Walker, David R.; Biggs, Alan R.; Ishimoto, Masao

    2012-01-01

    Phytophthora stem and root rot, caused by Phytophthora sojae, is one of the most destructive diseases of soybean [Glycine max (L.) Merr.], and the incidence of this disease has been increasing in several soybean-producing areas around the world. This presents serious limitations for soybean production, with yield losses from 4 to 100%. The most effective method to reduce damage would be to grow Phytophthora-resistant soybean cultivars, and two types of host resistance have been described. Race-specific resistance conditioned by single dominant Rps (“resistance to Phytophthora sojae”) genes and quantitatively inherited partial resistance conferred by multiple genes could both provide protection from the pathogen. Molecular markers linked to Rps genes or quantitative trait loci (QTLs) underlying partial resistance have been identified on several molecular linkage groups corresponding to chromosomes. These markers can be used to screen for Phytophthora-resistant plants rapidly and efficiently, and to combine multiple resistance genes in the same background. This paper reviews what is currently known about pathogenic races of P. sojae in the USA and Japan, selection of sources of Rps genes or minor genes providing partial resistance, and the current state and future scope of breeding Phytophthora-resistant soybean cultivars. PMID:23136490

  20. Main problems and suggested solutions for improving radiation protection in medicine in Ibero-American countries. Summary of an International Conference held in Madrid, 2016.

    PubMed

    Vano, Eliseo; Jimenez, Pablo; Ramirez, Raul; Zarzuela, Javier; Larcher, Ana Maria; Gallego, Eduardo; Gonzalez, Santiago; Del Rosario Perez, Maria

    2018-03-01

    During the International Conference on Radiation Protection in Medicine held in Bonn in 2012, several areas for improvement were identified, including specific actions related with justification, optimization, role of manufacturers, radiation protection education and training, strategic research, data collection on medical and occupational exposures, prevention of incidents and accidents, radiation safety culture, risk-benefit dialogue and implementation of the radiation safety standards. The outcomes of the Bonn Conference were summarized in the so-called 'Bonn Call for Action', identifying 10 priority actions to enhance RP in medicine. Trying to analyse the progress in the implementation of this 'Call for Action' in the Ibero-American region, several international organizations organized the 'Ibero-American Conference on Radiation Protection in Medicine' (Conferencia Iberoamericana sobre Protección Radiológica en Medicina, CIPRaM) held in Madrid, in October 2016. CIPRaM was structured in eight thematic sessions dealing with: diagnostic and dental radiology, image guided interventional radiology, nuclear medicine, radiation therapy, health authorities and radiation protection regulators, professional associations of technologists and nurses, professional associations of medical physicists and radiation protection experts, and universities and researchers in radiation protection in medicine. This paper summarizes the main results of that Conference based on the consensus achieved about main problems, solutions, and indicators to evaluate the implementation of the proposed solutions.

  1. Autovaccination confers protection against Devriesea agamarum associated septicemia but not dermatitis in bearded dragons (Pogona vitticeps).

    PubMed

    Hellebuyck, Tom; Van Steendam, Katleen; Deforce, Dieter; Blooi, Mark; Van Nieuwerburgh, Filip; Bullaert, Evelien; Ducatelle, Richard; Haesebrouck, Freddy; Pasmans, Frank; Martel, An

    2014-01-01

    Devrieseasis caused by Devriesea agamarum is a highly prevalent disease in captive desert lizards, resulting in severe dermatitis and in some cases mass mortality. In this study, we assessed the contribution of autovaccination to devrieseasis control by evaluating the capacity of 5 different formalin-inactivated D. agamarum vaccines to induce a humoral immune response in bearded dragons (Pogona vitticeps). Each vaccine contained one of the following adjuvants: CpG, incomplete Freund's, Ribi, aluminium hydroxide, or curdlan. Lizards were administrated one of the vaccines through subcutaneous injection and booster vaccination was given 3 weeks after primo-vaccination. An indirect ELISA was developed and used to monitor lizard serological responses. Localized adverse effects following subcutaneous immunization were observed in all but the Ribi adjuvanted vaccine group. Following homologous experimental challenge, the incomplete Freund's as well as the Ribi vaccine were observed to confer protection in bearded dragons against the development of D. agamarum associated septicemia but not against dermatitis. Subsequently, two-dimensional gelelectrophoresis followed by immunoblotting and mass spectrometry was conducted with serum obtained from 3 lizards that showed seroconversion after immunisation with the Ribi vaccine. Fructose-bisphosphate aldolase and aldo-keto reductase of D. agamarum reacted with serum from the latter lizards. Based on the demonstrated seroconversion and partial protection against D. agamarum associated disease following the use of formalin-inactivated vaccines as well as the identification of target antigens in Ribi vaccinated bearded dragons, this study provides promising information towards the development of a vaccination strategy to control devrieseasis in captive lizard collections.

  2. Autovaccination Confers Protection against Devriesea agamarum Associated Septicemia but Not Dermatitis in Bearded Dragons (Pogona vitticeps)

    PubMed Central

    Deforce, Dieter; Blooi, Mark; Van Nieuwerburgh, Filip; Bullaert, Evelien; Ducatelle, Richard; Haesebrouck, Freddy

    2014-01-01

    Devrieseasis caused by Devriesea agamarum is a highly prevalent disease in captive desert lizards, resulting in severe dermatitis and in some cases mass mortality. In this study, we assessed the contribution of autovaccination to devrieseasis control by evaluating the capacity of 5 different formalin-inactivated D. agamarum vaccines to induce a humoral immune response in bearded dragons (Pogona vitticeps). Each vaccine contained one of the following adjuvants: CpG, incomplete Freund's, Ribi, aluminium hydroxide, or curdlan. Lizards were administrated one of the vaccines through subcutaneous injection and booster vaccination was given 3 weeks after primo-vaccination. An indirect ELISA was developed and used to monitor lizard serological responses. Localized adverse effects following subcutaneous immunization were observed in all but the Ribi adjuvanted vaccine group. Following homologous experimental challenge, the incomplete Freund's as well as the Ribi vaccine were observed to confer protection in bearded dragons against the development of D. agamarum associated septicemia but not against dermatitis. Subsequently, two-dimensional gelelectrophoresis followed by immunoblotting and mass spectrometry was conducted with serum obtained from 3 lizards that showed seroconversion after immunisation with the Ribi vaccine. Fructose-bisphosphate aldolase and aldo-keto reductase of D. agamarum reacted with serum from the latter lizards. Based on the demonstrated seroconversion and partial protection against D. agamarum associated disease following the use of formalin-inactivated vaccines as well as the identification of target antigens in Ribi vaccinated bearded dragons, this study provides promising information towards the development of a vaccination strategy to control devrieseasis in captive lizard collections. PMID:25479609

  3. Children and Parent Participation in Child Protection Conferences: A Study in One English Local Authority

    ERIC Educational Resources Information Center

    Muench, Kerry; Diaz, Clive; Wright, Rebecca

    2017-01-01

    The overall purpose of a child protection conference is to safeguard children. The conferences are multi-agency meetings that aim to ensure children's safety, promote children's health and development, and identify when a child is at continuing risk of significant harm. Law and policies in the United Kingdom highlight that parents and children…

  4. Influence of temperature on the efficacy of homologous and heterologous DNA vaccines against viral hemorrhagic septicemia in Pacific Herring

    USGS Publications Warehouse

    Hart, Lucas; Lorenzen, Niels; Einer-Jensen, Katja; Purcell, Maureen; Hershberger, Paul

    2017-01-01

    Homologous and heterologous (genogroup Ia) DNA vaccines against viral hemorrhagic septicemia virus (genogroup IVa) conferred partial protection in Pacific Herring Clupea pallasii. Early protection at 2 weeks postvaccination (PV) was low and occurred only at an elevated temperature (12.6°C, 189 degree days), where the relative percent survival following viral exposure was similar for the two vaccines (IVa and Ia) and higher than that of negative controls at the same temperature. Late protection at 10 weeks PV was induced by both vaccines but was higher with the homologous vaccine at both 9.0°C and 12.6°C. Virus neutralization titers were detected among 55% of all vaccinated fish at 10 weeks PV. The results suggest that the immune response profile triggered by DNA vaccination of herring was similar to that reported for Rainbow Trout Oncorhynchus mykiss by Lorenzen and LaPatra in 2005, who found interferon responses in the early days PV and the transition to adaptive response later. However, the protective effect was far less prominent in herring, possibly reflecting different physiologies or adaptations of the two fish species.

  5. STABILIZATION OF PROTOPLASTS AND SPHEROPLASTS BY SPERMINE AND OTHER POLYAMINES

    PubMed Central

    Tabor, Celia W.

    1962-01-01

    Tabor, Celia W. (National Institute of Arthritis and Metabolic Diseases, Bethesda, Md.). Stabilization of protoplasts and spheroplasts by spermine and other polyamines. J. Bacteriol. 83:1101–1111. 1962.—Spermine (10−3m) or spermidine prevents lysis of lysozyme-produced protoplasts of Escherichia coli W, E. coli B, and Micrococcus lysodeikticus in hypotonic media. Spheroplasts prepared by the action of penicillin are also stabilized by these concentrations of spermine and spermidine, but the protection is not as complete. Streptomycin, polylysine, and Ca++ are also effective or partially effective stabilizers, but 1,4-diaminobutane, 1,5-diaminopentane, ornithine, Mg++, and monovalent cations have no protective action at 10−3m concentration, and only a slight effect at higher concentrations. The osmotic stability conferred on protoplasts by spermine is irreversible. However, the protective effect of polyamines against lysis is not accompanied by restoration of viability to lysozyme protoplasts. There is a marked reduction in the loss of ultra-violet-absorbing material from the protoplasts to the medium when 10−3m spermine is present. PMID:16561942

  6. The Report of the Second National Conference on Consumer Protection in Postsecondary Education. Report No. 64.

    ERIC Educational Resources Information Center

    Education Commission of the States, Denver, CO.

    The second National Conference on Consumer Protection in Postsecondary Education was a series of seminars on specific issues. The topics under discussion were (1) protecting the student financial interest; (2) student information needs and systems; (3) postsecondary education institutional responses; (4) regulations and safeguards; and (5) full…

  7. Withaferin A Suppresses Estrogen Receptor-α Expression in Human Breast Cancer Cells

    PubMed Central

    Hahm, Eun-Ryeong; Lee, Joomin; Huang, Yi; Singh, Shivendra V.

    2011-01-01

    We have shown previously that withaferin A (WA), a promising anticancer constituent of Ayurvedic medicine plant Withania somnifera, inhibits growth of MCF-7 and MDA-MB-231 human breast cancer cells in culture and MDA-MB-231 xenografts in vivo by causing apoptosis. However, the mechanism of WA-induced apoptosis is not fully understood. The present study was designed to systematically determine the role of tumor suppressor p53 and estrogen receptor-α (ER-α) in proapoptotic response to WA using MCF-7, T47D, and ER-α overexpressing MDA-MB-231 cells as a model. WA treatment resulted in induction as well as increased Ser15 phosphorylation of p53 in MCF-7 cells, but RNA interference of this tumor suppressor gene conferred modest protection at best against WA-induced apoptosis. WA-mediated growth inhibition and apoptosis induction in MCF-7 cells were significantly attenuated in the presence of 17β-estradiol (E2). Exposure of MCF-7 cells to WA resulted in a marked decrease in protein levels of ER-α (but not ER-β) and ER-α regulated gene product pS2, and this effect was markedly attenuated in the presence of E2. WA-mediated down-regulation of ER-α protein expression correlated with a decrease in its nuclear level, suppression of its mRNA level, and inhibition of E2-dependent activation of ERE2e1b-luciferase reporter gene. Ectopic expression of ER-α in the MDA-MB-231 cell line conferred partial but statistically significant protection against WA-mediated apoptosis, but not G2/M phase cell cycle arrest. Collectively, these results indicate that WA functions as an anti-estrogen, and the proapoptotic effect of this promising natural product is partially attenuated by p53 knockdown and E2-ER-α. PMID:21432907

  8. Immune protection of chickens conferred by a vaccine consisting of attenuated strains of Salmonella Enteritidis, Typhimurium and Infantis.

    PubMed

    Varmuzova, Karolina; Faldynova, Marcela; Elsheimer-Matulova, Marta; Sebkova, Alena; Polansky, Ondrej; Havlickova, Hana; Sisak, Frantisek; Rychlik, Ivan

    2016-10-15

    The colonization of poultry with different Salmonella enterica serovars poses an issue throughout the world. In this study we therefore tested the efficacy of a vaccine consisting of attenuated strains of Salmonella enterica serovars Enteritidis, Typhimurium and Infantis against challenge with the same serovars and with S. Agona, Dublin and Hadar. We tested oral and aerosol administration of the vaccine, with or without co-administration of cecal microbiota from adult hens. The protective effect was determined by bacterial counts of the challenge strains up to week 18 of life and by characterizing the immune response using real-time PCR specific for 16 different genes. We have shown that a vaccine consisting of attenuated S. Enteritidis, S. Typhimurium and S. Infantis protected chickens against challenge with the wild type strains of the same serovars and partially protected chickens also against challenge with isolates belonging to serovars Dublin or Hadar. Aerosol vaccination was more effective at inducing systemic immunity whilst oral vaccination stimulated a local immune response in the gut. Co-administration of cecal microbiota increased the protectiveness in the intestinal tract but slightly decreased the systemic immune response. Adjusting the vaccine composition and changing the administration route therefore affects vaccine efficacy.

  9. CP7_E2alf oral vaccination confers partial protection against early classical swine fever virus challenge and interferes with pathogeny-related cytokine responses

    PubMed Central

    2013-01-01

    The conventional C-strain vaccine induces early protection against classical swine fever (CSF), but infected animals cannot be distinguished from vaccinated animals. The CP7_E2alf marker vaccine, a pestivirus chimera, could be a suitable substitute for C-strain vaccine to control CSF outbreaks. In this study, single oral applications of CP7_E2alf and C-strain vaccines were compared for their efficacy to induce protection against a CSF virus (CSFV) challenge with the moderately virulent Bas-Rhin isolate, in pigs as early as two days post-immunization. This work emphasizes the powerful potential of CP7_E2alf vaccine administered orally by a rapid onset of partial protection similar to that induced by the C-strain vaccine. Furthermore, our results revealed that both vaccinations attenuated the effects induced by CSFV on production of the pig major acute phase protein (PigMAP), IFN-α, IL-12, IL-10, and TGF-β1 cytokines. By this interference, several cytokines that may play a role in the pathogeny induced by moderately virulent CSFV strains were revealed. New hypotheses concerning the role of each of these cytokines in CSFV pathogeny are discussed. Our results also show that oral vaccination with either vaccine (CP7_E2alf or C-strain) enhanced CSFV–specific IgG2 production, compared to infection alone. Interestingly, despite the similar antibody profiles displayed by both vaccines post-challenge, the production of CSFV-specific IgG1 and neutralizing antibodies without challenge was lower with CP7_E2alf vaccination than with C-strain vaccination, suggesting a slight difference in the balance of adaptive immune responses between these vaccines. PMID:23398967

  10. Exploration of the Factors That Support Learning: Web-Based Activity and Testing Systems in Community College Algebra [Conference Long Paper

    ERIC Educational Resources Information Center

    Hauk, Shandy; Matlen, Bryan J.

    2017-01-01

    This is an extended conference proceedings report [Long Paper] based on a shorter contributed report at the same conference. A variety of computerized learning platforms exist. In mathematics, most include sets of problems to complete. Feedback to users ranges from a single word like "Correct!" to offers of hints and partially- to…

  11. Identification of Western Equine Encephalitis Virus Structural Proteins That Confer Protection after DNA Vaccination▿

    PubMed Central

    Gauci, Penelope J.; Wu, Josh Q. H.; Rayner, George A.; Barabé, Nicole D.; Nagata, Leslie P.; Proll, David F.

    2010-01-01

    DNA vaccines encoding different portions of the structural proteins of western equine encephalitis virus were tested for the efficacy of their protection in a 100% lethal mouse model of the virus. The 6K-E1 structural protein encoded by the DNA vaccine conferred complete protection against challenge with the homologous strain and limited protection against challenge with a heterologous strain. PMID:19923571

  12. KEYNOTE ADDRESS

    EPA Science Inventory

    Over the past two decades an environmental conference series has emerged in Poland to become one of the premier forums on the chemical aspects of environmental protection. The forum is called Chemistry for the Protection of the Environment CPE). The first conference of this serie...

  13. Olive polyphenol effects in a mouse model of chronic ethanol addiction.

    PubMed

    Carito, Valentina; Ceccanti, Mauro; Cestari, Vincenzo; Natella, Fausta; Bello, Cristiano; Coccurello, Roberto; Mancinelli, Rosanna; Fiore, Marco

    2017-01-01

    Alcohol addiction elicits oxidative imbalance and it is well known that polyphenols possess antioxidant properties. We investigated whether or not polyphenols could confer a protective potential against alcohol-induced oxidative stress. We administered (per os) for two months 20 mg/kg of olive polyphenols containing mostly hydroxytyrosol in alcoholic adult male mice. Hydroxytyrosol metabolites as hydroxytyrosol sulfate 1 and hydroxytyrosol sulfate 2 were found in the serum of mice administered with polyphenols with the highest amount in animals treated with both polyphenols and alcohol. Oxidative stress was evaluated by FORT (free oxygen radical test) and FORD (free oxygen radical defense) tests. Alcoholic mice showed a worse oxidative status than nonalcoholic mice (higher FORT and lower FORD) but polyphenol supplementation partially counteracted the alcohol pro-oxidant effects, as evidenced by FORT. A better understanding of the antioxidant protection provided by polyphenols might be of primary interest for drug discovery and dietary-based prevention of the damage associated with chronic alcohol abuse. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. Trypanosoma cruzi infection in the opossum Didelphis marsupialis: absence of neonatal transmission and protection by maternal antibodies in experimental infections.

    PubMed

    Jansen, A M; Madeira, F B; Deane, M P

    1994-01-01

    The high rate of natural Trypanosoma cruzi infection found in opossums does not always correlate with appreciable densities of local triatomid populations. One alternative method which might bypass the invertebrate vector is direct transmission from mother to offspring. This possibility was investigated in five T. cruzi infected females and their litters (24 young). The influence of maternal antibodies transferred via lactation, on the course of experimental infection, was also examined. Our results show that neonatal transmission is probably not responsible for the high rate of natural T. cruzi infection among opossums. In addition antibodies of maternal origin confer a partial protection to the young. This was demonstrated by the finding of a double prepatency period and 4, 5 fold lower levels of circulating parasites, in experimentally infected pouch young from infected as compared to control uninfected mothers. On the other hand, the duration of patent parasitemia was twice as long as that observed in the control group.

  15. Age-dependent synapse withdrawal at axotomised neuromuscular junctions in Wlds mutant and Ube4b/Nmnat transgenic mice

    PubMed Central

    Gillingwater, Thomas H; Thomson, Derek; Mack, Till G A; Soffin, Ellen M; Mattison, Richard J; Coleman, Michael P; Ribchester, Richard R

    2002-01-01

    Axons in WldS mutant mice are protected from Wallerian degeneration by overexpression of a chimeric Ube4b/Nmnat (Wld) gene. Expression of Wld protein was independent of age in these mice. However we identified two distinct neuromuscular synaptic responses to axotomy. In young adult Wlds mice, axotomy induced progressive, asynchronous synapse withdrawal from motor endplates, strongly resembling neonatal synapse elimination. Thus, five days after axotomy, 50–90 % of endplates were still partially or fully occupied and expressed endplate potentials (EPPs). By 10 days, fewer than 20 % of endplates still showed evidence of synaptic activity. Recordings from partially occupied junctions indicated a progressive decrease in quantal content in inverse proportion to endplate occupancy. In Wlds mice aged > 7 months, axons were still protected from axotomy but synapses degenerated rapidly, in wild-type fashion: within three days less than 5 % of endplates contained vestiges of nerve terminals. The axotomy-induced synaptic withdrawal phenotype decayed with a time constant of ∼30 days. Regenerated synapses in mature Wlds mice recapitulated the juvenile phenotype. Within 4–6 days of axotomy 30–50 % of regenerated nerve terminals still occupied motor endplates. Age-dependent synapse withdrawal was also seen in transgenic mice expressing the Wld gene. Co-expression of Wld protein and cyan fluorescent protein (CFP) in axons and neuromuscular synapses did not interfere with the protection from axotomy conferred by the Wld gene. Thus, Wld expression unmasks age-dependent, compartmentally organised programmes of synapse withdrawal and degeneration. PMID:12231635

  16. Frequency of alleles conferring resistance to a Bacillus thuringiensis toxin in a Philippine population of Scirpophaga incertulas (Lepidoptera: Pyralidae).

    PubMed

    Bentur, J S; Andow, D A; Cohen, M B; Romena, A M; Gould, F

    2000-10-01

    Using the F2 screen methodology, we estimated the frequency of alleles conferring resistance to the Cry1Ab toxin of Bacillus thuringiensis Berliner in a Philippine population of the stem borer Scirpophaga incertulas (Walker). Evaluation of >450 isofemale lines for survival of F2 larvae on cry1Ab plants did not detect the presence of an allele conferring a high level of resistance. The frequency of such an allele in the sampled population was conservatively estimated to be <3.6 x 10(-3) with 95% confidence and a detection probability of 94%. However, there was evidence of the presence of alleles conferring partial resistance to Cry1Ab. The frequency of alleles for partial resistance was estimated as 4.8 x 10(-3) with a 95% CI between 1.3 x 10(-3) and 1.04 x 10(-2) and a detection probability of 94%. Our results suggest that the frequency of alleles conferring resistance to Cry1Ab in the population of S. incertulas sampled is not too high to preclude successful implementation of the high dose/refuge resistance management strategy.

  17. To Moscow with love: partial reconstruction of Vygotsky's trip to London.

    PubMed

    van der Veer, René; Zavershneva, Ekaterina

    2011-12-01

    The Russian psychologist Lev Vygotsky (1896-1934) left the Soviet Union only once to attend a conference on the education of the deaf in London. So far almost nothing was known about this trip, which took place in a period when Vygotsky was still completely unknown as a psychologist, both inside his own country and abroad. Making use of a newly discovered notebook, it proved possible to partially reconstruct Vygotsky's journey and stay in London. Vygotsky's very personal remarks show him to have been a very sensitive and spirited man, who was prey to strong emotions during the conference and afterwards. Rather surprisingly, Vygotsky's own paper about the education of the deaf was never presented during the conference and the stay in London appears to have had a limited value for his own scientific development.

  18. African Swine Fever Virus Georgia 2007 with a Deletion of Virulence-Associated Gene 9GL (B119L), when Administered at Low Doses, Leads to Virus Attenuation in Swine and Induces an Effective Protection against Homologous Challenge.

    PubMed

    O'Donnell, Vivian; Holinka, Lauren G; Krug, Peter W; Gladue, Douglas P; Carlson, Jolene; Sanford, Brenton; Alfano, Marialexia; Kramer, Edward; Lu, Zhiqiang; Arzt, Jonathan; Reese, Bo; Carrillo, Consuelo; Risatti, Guillermo R; Borca, Manuel V

    2015-08-01

    African swine fever virus (ASFV) is the etiological agent of an often lethal disease of domestic pigs. Disease control strategies have been hampered by the unavailability of vaccines against ASFV. Since its introduction in the Republic of Georgia, a highly virulent virus, ASFV Georgia 2007 (ASFV-G), has caused an epizootic that spread rapidly into Eastern European countries. Currently no vaccines are available or under development to control ASFV-G. In the past, genetically modified ASFVs harboring deletions of virulence-associated genes have proven attenuated in swine, inducing protective immunity against challenge with homologous parental viruses. Deletion of the gene 9GL (open reading frame [ORF] B119L) in highly virulent ASFV Malawi-Lil-20/1 produced an attenuated phenotype even when administered to pigs at 10(6) 50% hemadsorption doses (HAD50). Here we report the construction of a genetically modified ASFV-G strain (ASFV-G-Δ9GLv) harboring a deletion of the 9GL (B119L) gene. Like Malawi-Lil-20/1-Δ9GL, ASFV-G-Δ9GL showed limited replication in primary swine macrophages. However, intramuscular inoculation of swine with 10(4) HAD50 of ASFV-G-Δ9GL produced a virulent phenotype that, unlike Malawi-Lil-20/1-Δ9GL, induced a lethal disease in swine like parental ASFV-G. Interestingly, lower doses (10(2) to 10(3) HAD50) of ASFV-G-Δ9GL did not induce a virulent phenotype in swine and when challenged protected pigs against disease. A dose of 10(2) HAD50 of ASFV-G-Δ9GLv conferred partial protection when pigs were challenged at either 21 or 28 days postinfection (dpi). An ASFV-G-Δ9GL HAD50 of 10(3) conferred partial and complete protection at 21 and 28 dpi, respectively. The information provided here adds to our recent report on the first attempts toward experimental vaccines against ASFV-G. The main problem for controlling ASF is the lack of vaccines. Studies on ASFV virulence lead to the production of genetically modified attenuated viruses that induce protection in pigs but only against homologous virus challenges. Here we produced a recombinant ASFV lacking virulence-associated gene 9GL in an attempt to produce a vaccine against virulent ASFV-G, a highly virulent virus isolate detected in the Caucasus region in 2007 and now spreading though the Caucasus region and Eastern Europe. Deletion of 9GL, unlike with other ASFV isolates, did not attenuate completely ASFV-G. However, when delivered once at low dosages, recombinant ASFV-G-Δ9GL induces protection in swine against parental ASFV-G. The protection against ASFV-G is highly effective after 28 days postvaccination, whereas at 21 days postvaccination, animals survived the lethal challenge but showed signs of ASF. Here we report the design and development of an experimental vaccine that induces protection against virulent ASFV-G. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  19. African Swine Fever Virus Georgia 2007 with a Deletion of Virulence-Associated Gene 9GL (B119L), when Administered at Low Doses, Leads to Virus Attenuation in Swine and Induces an Effective Protection against Homologous Challenge

    PubMed Central

    O'Donnell, Vivian; Holinka, Lauren G.; Krug, Peter W.; Gladue, Douglas P.; Carlson, Jolene; Sanford, Brenton; Alfano, Marialexia; Kramer, Edward; Lu, Zhiqiang; Arzt, Jonathan; Reese, Bo; Carrillo, Consuelo; Risatti, Guillermo R.

    2015-01-01

    ABSTRACT African swine fever virus (ASFV) is the etiological agent of an often lethal disease of domestic pigs. Disease control strategies have been hampered by the unavailability of vaccines against ASFV. Since its introduction in the Republic of Georgia, a highly virulent virus, ASFV Georgia 2007 (ASFV-G), has caused an epizootic that spread rapidly into Eastern European countries. Currently no vaccines are available or under development to control ASFV-G. In the past, genetically modified ASFVs harboring deletions of virulence-associated genes have proven attenuated in swine, inducing protective immunity against challenge with homologous parental viruses. Deletion of the gene 9GL (open reading frame [ORF] B119L) in highly virulent ASFV Malawi-Lil-20/1 produced an attenuated phenotype even when administered to pigs at 106 50% hemadsorption doses (HAD50). Here we report the construction of a genetically modified ASFV-G strain (ASFV-G-Δ9GLv) harboring a deletion of the 9GL (B119L) gene. Like Malawi-Lil-20/1-Δ9GL, ASFV-G-Δ9GL showed limited replication in primary swine macrophages. However, intramuscular inoculation of swine with 104 HAD50 of ASFV-G-Δ9GL produced a virulent phenotype that, unlike Malawi-Lil-20/1-Δ9GL, induced a lethal disease in swine like parental ASFV-G. Interestingly, lower doses (102 to 103 HAD50) of ASFV-G-Δ9GL did not induce a virulent phenotype in swine and when challenged protected pigs against disease. A dose of 102 HAD50 of ASFV-G-Δ9GLv conferred partial protection when pigs were challenged at either 21 or 28 days postinfection (dpi). An ASFV-G-Δ9GL HAD50 of 103 conferred partial and complete protection at 21 and 28 dpi, respectively. The information provided here adds to our recent report on the first attempts toward experimental vaccines against ASFV-G. IMPORTANCE The main problem for controlling ASF is the lack of vaccines. Studies on ASFV virulence lead to the production of genetically modified attenuated viruses that induce protection in pigs but only against homologous virus challenges. Here we produced a recombinant ASFV lacking virulence-associated gene 9GL in an attempt to produce a vaccine against virulent ASFV-G, a highly virulent virus isolate detected in the Caucasus region in 2007 and now spreading though the Caucasus region and Eastern Europe. Deletion of 9GL, unlike with other ASFV isolates, did not attenuate completely ASFV-G. However, when delivered once at low dosages, recombinant ASFV-G-Δ9GL induces protection in swine against parental ASFV-G. The protection against ASFV-G is highly effective after 28 days postvaccination, whereas at 21 days postvaccination, animals survived the lethal challenge but showed signs of ASF. Here we report the design and development of an experimental vaccine that induces protection against virulent ASFV-G. PMID:26063424

  20. Partial Bibliography of Work on Expert Systems,

    DTIC Science & Technology

    1982-12-01

    Bibliography: AAAI American Association for Artificial Intelligence ACM Association for Computing Machinery AFIPS American Federation of Information...Processing Societies ECAI European Conference on Artificial Intelligence IEEE Institute for Electrical and Electronic Engineers IFIPS International...Federation of Information Processing Societies IJCAI International Joint Conferences on Artificial Intelligence SIGPLAN ACM Special Interest Group on

  1. Support for the 38th International Conference on High Energy Physics, 3-10 August 2016

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim, Young-Kee

    The 38th International Conference on High Energy Physics (ICHEP) held in Chicago from August 3 to 10, 2016 was for physicists from around the world to gather to share the latest advancements in particle physics, astrophysics/cosmology, and accelerator science and to discuss plans for major future facilities. DOE funding provided partial support for space rental audio-visual services for scientific presentations at the conference.

  2. Melatonin partially protects 661W cells from H2O2-induced death by inhibiting Fas/FasL-caspase-3.

    PubMed

    Sánchez-Bretaño, Aída; Baba, Kenkichi; Janjua, Uzair; Piano, Ilaria; Gargini, Claudia; Tosini, Gianluca

    2017-01-01

    Previous studies have shown that melatonin (MEL) signaling is involved in the modulation of photoreceptor viability during aging. Recent work by our laboratory suggested that MEL may protect cones by modulating the Fas/FasL-caspase-3 pathway. In this study, we first investigated the presence of MEL receptors (MT 1 and MT 2 ) in 661W cells, then whether MEL can prevent H 2 O 2 -induced cell death, and last, through which pathway MEL confers protection. The mRNA and proteins of the MEL receptors were detected with quantitative PCR (q-PCR) and immunocytochemistry, respectively. To test the protective effect of MEL, 661W cells were treated with H 2 O 2 for 2 h in the presence or absence of MEL, a MEL agonist, and an antagonist. To study the pathways involved in H 2 O 2 -mediated cell death, a Fas/FasL antagonist was used before the exposure to H 2 O 2 . Finally, Fas/FasL and caspase-3 mRNA was analyzed with q-PCR and immunocytochemistry in cells treated with H 2 O 2 and/or MEL. Cell viability was analyzed by using Trypan Blue. Both MEL receptors (MT 1 and MT 2 ) were detected at the mRNA and protein levels in 661W cells. MEL partially prevented H 2 O 2 -mediated cell death (20-25%). This effect was replicated with IIK7 (a melatonin receptor agonist) when used at a concentration of 1 µM. Preincubation with luzindole (a melatonin receptor antagonist) blocked MEL protection. Kp7-6, an antagonist of Fas/FasL, blocked cell death caused by H 2 O 2 similarly to what was observed for MEL. Fas, FasL, and caspase-3 expression was increased in cells treated with H 2 O 2 , and this effect was prevented by MEL. Finally, MEL treatment partially prevented the activation of caspase-3 caused by H 2 O 2 . The results demonstrate that MEL receptors are present and functional in 661W cells. MEL can prevent photoreceptor cell death induced by H 2 O 2 via the inhibition of the proapoptotic pathway Fas/FasL-caspase-3.

  3. TAK-242, a small-molecule inhibitor of Toll-like receptor 4 signalling, unveils similarities and differences in lipopolysaccharide- and lipidinduced inflammation and insulin resistance in muscle cells

    PubMed Central

    Hussey, Sophie E.; Liang, Hanyu; Costford, Sheila R.; Klip, Amira; DeFronzo, Ralph A.; Sanchez-Avila, Alicia; Ely, Brian; Musi, Nicolas

    2012-01-01

    Emerging evidence suggests that TLR (Toll-like receptor) 4 and downstream pathways [MAPKs (mitogen-activated protein kinases) and NF-κB (nuclear factor κB)] play an important role in the pathogenesis of insulin resistance. LPS (lipopolysaccharide) and saturated NEFA (non-esterified fatty acids) activate TLR4, and plasma concentrations of these TLR4 ligands are elevated in obesity and Type 2 diabetes. Our goals were to define the role of TLR4 on the insulin resistance caused by LPS and saturated NEFA, and to dissect the independent contribution of LPS and NEFA to the activation of TLR4-driven pathways by employing TAK-242, a specific inhibitor of TLR4. LPS caused robust activation of the MAPK and NF-κB pathways in L6 myotubes, along with impaired insulin signalling and glucose transport. TAK-242 completely prevented the inflammatory response (MAPK and NF-κB activation) caused by LPS, and, in turn, improved LPS-induced insulin resistance. Similar to LPS, stearate strongly activated MAPKs, although stimulation of the NF-κB axis was modest. As seen with LPS, the inflammatory response caused by stearate was accompanied by impaired insulin action. TAK-242 also blunted stearate-induced inflammation; yet, the protective effect conferred by TAK-242 was partial and observed only on MAPKs. Consequently, the insulin resistance caused by stearate was only partially improved by TAK-242. In summary, TAK-242 provides complete and partial protection against LPS- and NEFA-induced inflammation and insulin resistance, respectively. Thus, LPS-induced insulin resistance depends entirely on TLR4, whereas NEFA works through TLR4-dependent and -independent mechanisms to impair insulin action. PMID:23050932

  4. TAK-242, a small-molecule inhibitor of Toll-like receptor 4 signalling, unveils similarities and differences in lipopolysaccharide- and lipid-induced inflammation and insulin resistance in muscle cells.

    PubMed

    Hussey, Sophie E; Liang, Hanyu; Costford, Sheila R; Klip, Amira; DeFronzo, Ralph A; Sanchez-Avila, Alicia; Ely, Brian; Musi, Nicolas

    2012-11-30

    Emerging evidence suggests that TLR (Toll-like receptor) 4 and downstream pathways [MAPKs (mitogen-activated protein kinases) and NF-κB (nuclear factor κB)] play an important role in the pathogenesis of insulin resistance. LPS (lipopolysaccharide) and saturated NEFA (non-esterified fatty acids) activate TLR4, and plasma concentrations of these TLR4 ligands are elevated in obesity and Type 2 diabetes. Our goals were to define the role of TLR4 on the insulin resistance caused by LPS and saturated NEFA, and to dissect the independent contribution of LPS and NEFA to the activation of TLR4-driven pathways by employing TAK-242, a specific inhibitor of TLR4. LPS caused robust activation of the MAPK and NF-κB pathways in L6 myotubes, along with impaired insulin signalling and glucose transport. TAK-242 completely prevented the inflammatory response (MAPK and NF-κB activation) caused by LPS, and, in turn, improved LPS-induced insulin resistance. Similar to LPS, stearate strongly activated MAPKs, although stimulation of the NF-κB axis was modest. As seen with LPS, the inflammatory response caused by stearate was accompanied by impaired insulin action. TAK-242 also blunted stearate-induced inflammation; yet, the protective effect conferred by TAK-242 was partial and observed only on MAPKs. Consequently, the insulin resistance caused by stearate was only partially improved by TAK-242. In summary, TAK-242 provides complete and partial protection against LPS- and NEFA-induced inflammation and insulin resistance, respectively. Thus, LPS-induced insulin resistance depends entirely on TLR4, whereas NEFA works through TLR4-dependent and -independent mechanisms to impair insulin action.

  5. NATIONAL CONFERENCE ON TOOLS FOR URBAN WATER RESOURCE MANAGEMENT AND PROTECTION: PROCEEDINGS, CHICAGO, IL, FEBRUARY 7-10, 2000

    EPA Science Inventory

    A wide array of effective water quality management and protection tools have been developed for urban environments, but implementation is hindered by a shortage of technology transfer opportunities. This National Conference on Tools for Urban Water Resource Management and Protec...

  6. 40 CFR 179.50 - Conduct at oral hearings or conferences.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... conferences. 179.50 Section 179.50 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED... dignity and observe the same standards of practice and ethics that would be required of parties in a... directions, use of dilatory tactics, or refusal to adhere to reasonable standards of orderly and ethical...

  7. 76 FR 43658 - Marine Protected Areas Federal Advisory Committee; Public Meetings

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-07-21

    ... Areas Federal Advisory Committee; Public Meetings AGENCY: Department of Commerce, National Ocean Service... conference call of the Marine Protected Areas Federal Advisory Committee (Committee). The web conference... are being given. Members of the public wishing to listen in should contact Denise Ellis-Hibbett at the...

  8. Modelling Risk to US Military Populations from Stopping Blanket Mandatory Polio Vaccination.

    PubMed

    Burgess, Colleen; Burgess, Andrew; McMullen, Kellie

    2017-01-01

    Transmission of polio poses a threat to military forces when deploying to regions where such viruses are endemic. US-born soldiers generally enter service with immunity resulting from childhood immunization against polio; moreover, new recruits are routinely vaccinated with inactivated poliovirus vaccine (IPV), supplemented based upon deployment circumstances. Given residual protection from childhood vaccination, risk-based vaccination may sufficiently protect troops from polio transmission. This analysis employed a mathematical system for polio transmission within military populations interacting with locals in a polio-endemic region to evaluate changes in vaccination policy. Removal of blanket immunization had no effect on simulated polio incidence among deployed military populations when risk-based immunization was employed; however, when these individuals reintegrated with their base populations, risk of transmission to nondeployed personnel increased by 19%. In the absence of both blanket- and risk-based immunization, transmission to nondeployed populations increased by 25%. The overall number of new infections among nondeployed populations was negligible for both scenarios due to high childhood immunization rates, partial protection against transmission conferred by IPV, and low global disease incidence levels. Risk-based immunization driven by deployment to polio-endemic regions is sufficient to prevent transmission among both deployed and nondeployed US military populations.

  9. The health advantage of a vegan diet: exploring the gut microbiota connection.

    PubMed

    Glick-Bauer, Marian; Yeh, Ming-Chin

    2014-10-31

    This review examines whether there is evidence that a strict vegan diet confers health advantages beyond that of a vegetarian diet or overall healthy eating. Few studies include vegan subjects as a distinct experimental group, yet when vegan diets are directly compared to vegetarian and omnivorous diets, a pattern of protective health benefits emerges. The relatively recent inclusion of vegan diets in studies of gut microbiota and health allows us the opportunity to assess whether the vegan gut microbiota is distinct, and whether the health advantages characteristic of a vegan diet may be partially explained by the associated microbiota profile. The relationship between diet and the intestinal microbial profile appears to follow a continuum, with vegans displaying a gut microbiota most distinct from that of omnivores, but not always significantly different from that of vegetarians. The vegan gut profile appears to be unique in several characteristics, including a reduced abundance of pathobionts and a greater abundance of protective species. Reduced levels of inflammation may be the key feature linking the vegan gut microbiota with protective health effects. However, it is still unclear whether a therapeutic vegan diet can be prescribed to alter the gut microflora for long-term health benefits.

  10. The Health Advantage of a Vegan Diet: Exploring the Gut Microbiota Connection

    PubMed Central

    Glick-Bauer, Marian; Yeh, Ming-Chin

    2014-01-01

    This review examines whether there is evidence that a strict vegan diet confers health advantages beyond that of a vegetarian diet or overall healthy eating. Few studies include vegan subjects as a distinct experimental group, yet when vegan diets are directly compared to vegetarian and omnivorous diets, a pattern of protective health benefits emerges. The relatively recent inclusion of vegan diets in studies of gut microbiota and health allows us the opportunity to assess whether the vegan gut microbiota is distinct, and whether the health advantages characteristic of a vegan diet may be partially explained by the associated microbiota profile. The relationship between diet and the intestinal microbial profile appears to follow a continuum, with vegans displaying a gut microbiota most distinct from that of omnivores, but not always significantly different from that of vegetarians. The vegan gut profile appears to be unique in several characteristics, including a reduced abundance of pathobionts and a greater abundance of protective species. Reduced levels of inflammation may be the key feature linking the vegan gut microbiota with protective health effects. However, it is still unclear whether a therapeutic vegan diet can be prescribed to alter the gut microflora for long-term health benefits. PMID:25365383

  11. Systemic Immunization with Papillomavirus L1 Protein Completely Prevents the Development of Viral Mucosal Papillomas

    NASA Astrophysics Data System (ADS)

    Suzich, Joann A.; Ghim, Shin-Je; Palmer-Hill, Frances J.; White, Wendy I.; Tamura, James K.; Bell, Judith A.; Newsome, Joseph A.; Bennett Jenson, A.; Schlegel, Richard

    1995-12-01

    Infection of mucosal epithelium by papillomaviruses is responsible for the induction of genital and oral warts and plays a critical role in the development of human cervical and oropharyngeal cancer. We have employed a canine model to develop a systemic vaccine that completely protects against experimentally induced oral mucosal papillomas. The major capsid protein, L1, of canine oral papillomavirus (COPV) was expressed in Sf9 insect cells in native conformation. L1 protein, which self-assembled into virus-like particles, was purified on CsCl gradients and injected intradermally into the foot pad of beagles. Vaccinated animals developed circulating antibodies against COPV and became completely resistant to experimental challenge with COPV. Successful immunization was strictly dependent upon native L1 protein conformation and L1 type. Partial protection was achieved with as little as 0.125 ng of L1 protein, and adjuvants appeared useful for prolonging the host immune response. Serum immunoglobulins passively transferred from COPV L1-immunized beagles to naive beagles conferred protection from experimental infection with COPV. Our results indicate the feasibility of developing a human vaccine to prevent mucosal papillomas, which can progress to malignancy.

  12. A protein-based smallpox vaccine protects mice from vaccinia and ectromelia virus challenges when given as a prime and single boost

    PubMed Central

    Xiao, Yuhong; Aldaz-Carroll, Lydia; Ortiz, Alexandra M.; Whitbeck, J. Charles; Alexander, Edward; Lou, Huan; Davis, J. Heather L.; Braciale, Thomas J.; Eisenberg, Roselyn J.; Cohen, Gary H.; Isaacs, Stuart N.

    2007-01-01

    The heightened concern about the intentional release of variola virus has led to the need to develop safer smallpox vaccines. While subunit vaccine strategies are safer than live virus vaccines, subunit vaccines have been hampered by the need for multiple boosts to confer optimal protection. Here we developed a protein-based subunit vaccine strategy that provides rapid protection in mouse models of orthopoxvirus infections after a prime and single boost. Mice vaccinated with vaccinia virus envelope proteins from the mature virus (MV) and extracellular virus (EV) adjuvanted with CpG-ODN and alum were protected from lethal intranasal challenge with vaccinia virus and the mouse-specific ectromelia virus. Organs from mice vaccinated with three proteins (A33, B5 and L1) and then sacrificed after challenge contained significantly lower titers of virus when compared to control groups of mice that were not vaccinated or that received sub-optimal formulations of the vaccine. Sera from groups of mice obtained prior to challenge had neutralizing activity against the MV and also inhibited comet formation indicating anti-EV activity. Long-term partial protection was also seen in mice challenged with vaccinia virus 6 months after initial vaccinations. Thus, this work represents a step toward the development of a practical subunit smallpox vaccine. PMID:17098336

  13. Immune parameters to p67C antigen adjuvanted with ISA206VG correlate with protection against East Coast fever.

    PubMed

    Lacasta, Anna; Mwalimu, Stephen; Kibwana, Elisabeth; Saya, Rosemary; Awino, Elias; Njoroge, Thomas; Poole, Jane; Ndiwa, Nicholas; Pelle, Roger; Nene, Vishvanath; Steinaa, Lucilla

    2018-03-07

    East Coast fever (ECF) is a lymphoproliferative disease caused by the tick-transmitted protozoan parasite Theileria parva. ECF is one of the most serious cattle tick-borne diseases in Sub-Saharan Africa. We have previously demonstrated that three doses of the C-terminal part of the sporozoite protein p67 (p67C) adjuvanted with ISA206VG confers partial protection against ECF at a herd level. We have tested the efficacy of two doses of this experimental vaccine, as reducing the vaccination regimen would facilitate its deployment in the field. We reconfirm that three antigen doses gave a significant level of protection to severe disease (46%, ECF score < 6) when compared with the control group, while two doses did not (23%). Animals receiving three doses of p67C developed higher antibody titers and CD4 + T-cell proliferation indices, than those which received two doses. A new panel of immune parameters were tested in order to identify factors correlating with protection: CD4 + proliferation index, total IgG, IgG1, IgG2 and IgM half maximal titers and neutralization capacity of the sera with and without complement. We show that some of the cellular and humoral immune responses provide preliminary correlates of protection. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  14. Comparative Efficacy of Hemagglutinin, Nucleoprotein, and Matrix 2 Protein Gene-Based Vaccination against H5N1 Influenza in Mouse and Ferret

    PubMed Central

    Rao, Srinivas S.; Kong, Wing-Pui; Wei, Chih-Jen; Van Hoeven, Neal; Gorres, J. Patrick; Nason, Martha; Andersen, Hanne; Tumpey, Terrence M.; Nabel, Gary J.

    2010-01-01

    Efforts to develop a broadly protective vaccine against the highly pathogenic avian influenza A (HPAI) H5N1 virus have focused on highly conserved influenza gene products. The viral nucleoprotein (NP) and ion channel matrix protein (M2) are highly conserved among different strains and various influenza A subtypes. Here, we investigate the relative efficacy of NP and M2 compared to HA in protecting against HPAI H5N1 virus. In mice, previous studies have shown that vaccination with NP and M2 in recombinant DNA and/or adenovirus vectors or with adjuvants confers protection against lethal challenge in the absence of HA. However, we find that the protective efficacy of NP and M2 diminishes as the virulence and dose of the challenge virus are increased. To explore this question in a model relevant to human disease, ferrets were immunized with DNA/rAd5 vaccines encoding NP, M2, HA, NP+M2 or HA+NP+M2. Only HA or HA+NP+M2 vaccination conferred protection against a stringent virus challenge. Therefore, while gene-based vaccination with NP and M2 may provide moderate levels of protection against low challenge doses, it is insufficient to confer protective immunity against high challenge doses of H5N1 in ferrets. These immunogens may require combinatorial vaccination with HA, which confers protection even against very high doses of lethal viral challenge. PMID:20352112

  15. African Swine Fever Virus Georgia Isolate Harboring Deletions of MGF360 and MGF505 Genes Is Attenuated in Swine and Confers Protection against Challenge with Virulent Parental Virus

    PubMed Central

    O'Donnell, Vivian; Holinka, Lauren G.; Gladue, Douglas P.; Sanford, Brenton; Krug, Peter W.; Lu, Xiqiang; Arzt, Jonathan; Reese, Bo; Carrillo, Consuelo; Risatti, Guillermo R.

    2015-01-01

    ABSTRACT African swine fever virus (ASFV) is the etiological agent of a contagious and often lethal disease of domestic pigs that has significant economic consequences for the swine industry. The control of African swine fever (ASF) has been hampered by the unavailability of vaccines. Experimental vaccines have been developed using genetically modified live attenuated ASFVs where viral genes involved in virus virulence were removed from the genome. Multigene family 360 (MGF360) and MGF505 represent a group of genes sharing partial sequence and structural identities that have been connected with ASFV host range specificity, blocking of the host innate response, and virus virulence. Here we report the construction of a recombinant virus (ASFV-G-ΔMGF) derived from the highly virulent ASFV Georgia 2007 isolate (ASFV-G) by specifically deleting six genes belonging to MGF360 or MGF505: MGF505-1R, MGF360-12L, MGF360-13L, MGF360-14L, MGF505-2R, and MGF505-3R. ASFV-G-ΔMGF replicates as efficiently in primary swine macrophage cell cultures as the parental virus. In vivo, ASFV-G-ΔMGF is completely attenuated in swine, since pigs inoculated intramuscularly (i.m.) with either 102 or 104 50% hemadsorbing doses (HAD50) remained healthy, without signs of the disease. Importantly, when these animals were subsequently exposed to highly virulent parental ASFV-G, no signs of the disease were observed, although a proportion of these animals harbored the challenge virus. This is the first report demonstrating the role of MGF genes acting as independent determinants of ASFV virulence. Additionally, ASFV-G-ΔMGF is the first experimental vaccine reported to induce protection in pigs challenged with highly virulent and epidemiologically relevant ASFV-G. IMPORTANCE The main problem for controlling ASF is the lack of vaccines. Studies focusing on understanding ASFV virulence led to the production of genetically modified recombinant viruses that, while attenuated, are able to confer protection in pigs challenged with homologous viruses. Here we have produced an attenuated recombinant ASFV derived from highly virulent ASFV strain Georgia (ASFV-G) lacking only six of the multigene family 360 (MGF360) and MGF505 genes (ASFV-G-ΔMGF). It is demonstrated, by first time, that deleting specific MGF genes alone can completely attenuate a highly virulent field ASFV isolate. Recombinant virus ASFV-G-ΔMGF effectively confers protection in pigs against challenge with ASFV-G when delivered once via the intramuscular (i.m.) route. The protection against ASFV-G is highly effective by 28 days postvaccination. This is the first report of an experimental vaccine that induces solid protection against virulent ASFV-G. PMID:25810553

  16. Dicer-2-Dependent Generation of Viral DNA from Defective Genomes of RNA Viruses Modulates Antiviral Immunity in Insects.

    PubMed

    Poirier, Enzo Z; Goic, Bertsy; Tomé-Poderti, Lorena; Frangeul, Lionel; Boussier, Jérémy; Gausson, Valérie; Blanc, Hervé; Vallet, Thomas; Loyd, Hyelee; Levi, Laura I; Lanciano, Sophie; Baron, Chloé; Merkling, Sarah H; Lambrechts, Louis; Mirouze, Marie; Carpenter, Susan; Vignuzzi, Marco; Saleh, Maria-Carla

    2018-03-14

    The RNAi pathway confers antiviral immunity in insects. Virus-specific siRNA responses are amplified via the reverse transcription of viral RNA to viral DNA (vDNA). The nature, biogenesis, and regulation of vDNA are unclear. We find that vDNA produced during RNA virus infection of Drosophila and mosquitoes is present in both linear and circular forms. Circular vDNA (cvDNA) is sufficient to produce siRNAs that confer partially protective immunity when challenged with a cognate virus. cvDNAs bear homology to defective viral genomes (DVGs), and DVGs serve as templates for vDNA and cvDNA synthesis. Accordingly, DVGs promote the amplification of vDNA-mediated antiviral RNAi responses in infected Drosophila. Furthermore, vDNA synthesis is regulated by the DExD/H helicase domain of Dicer-2 in a mechanism distinct from its role in siRNA generation. We suggest that, analogous to mammalian RIG-I-like receptors, Dicer-2 functions like a pattern recognition receptor for DVGs to modulate antiviral immunity in insects. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

  17. Shaping the Security Environment Newport paper no. 29

    DTIC Science & Technology

    2006-11-29

    interest in and set the stage for a ministerial conference. That ministerial conference, held in November 2006 in Cotonou , Benin, brought together...awareness has been at least partially met. The Accra workshop and Cotonou Ministerial Conference were both considered suc- cessful in that the outputs...Organization and the Maritime Organization for West and Central Africa in the Accra workshop and Cotonou S H A P I N G T H E S E C U R I T Y E N V I R

  18. Suboptimal protection against H5N1 highly pathogenic avian influenza viruses from Vietnam in ducks vaccinated with commercial poultry vaccines.

    PubMed

    Cha, Ra Mi; Smith, Diane; Shepherd, Eric; Davis, C Todd; Donis, Ruben; Nguyen, Tung; Nguyen, Hoang Dang; Do, Hoa Thi; Inui, Ken; Suarez, David L; Swayne, David E; Pantin-Jackwood, Mary

    2013-10-09

    Domestic ducks are the second most abundant poultry species in many Asian countries including Vietnam, and play a critical role in the epizootiology of H5N1 highly pathogenic avian influenza (HPAI) [FAO]. In this study, we examined the protective efficacy in ducks of two commercial H5N1 vaccines widely used in Vietnam; Re-1 containing A/goose/Guangdong/1/1996 hemagglutinin (HA) clade 0 antigens, and Re-5 containing A/duck/Anhui/1/2006 HA clade 2.3.4 antigens. Ducks received two doses of either vaccine at 7 and at 14 or 21 days of age followed by challenge at 30 days of age with viruses belonging to the HA clades 1.1, 2.3.4.3, 2.3.2.1.A and 2.3.2.1.B isolated between 2008 and 2011 in Vietnam. Ducks vaccinated with the Re-1 vaccine were protected after infection with the two H5N1 HPAI viruses isolated in 2008 (HA clades 1.1 and 2.3.4.3) showing no mortality and limited virus shedding. The Re-1 and Re-5 vaccines conferred 90-100% protection against mortality after challenge with the 2010 H5N1 HPAI viruses (HA clade 2.3.2.1.A); but vaccinated ducks shed virus for more than 7 days after challenge. Similarly, the Re-1 and Re-5 vaccines only showed partial protection against the 2011 H5N1 HPAI viruses (HA clade 2.3.2.1.A and 2.3.2.1.B), with a high proportion of vaccinated ducks shedding virus for more than 10 days. Furthermore, 50% mortality was observed in ducks vaccinated with Re-1 and challenged with the 2.3.2.1.B virus. The HA proteins of the 2011 challenge viruses had the greatest number of amino acid differences from the two vaccines as compared to the viruses from 2008 and 2009, which correlates with the lesser protection observed with these viruses. These studies demonstrate the suboptimal protection conferred by the Re-1 and Re-5 commercial vaccines in ducks against H5N1 HPAI clade 2.3.2.1 viruses, and underscore the importance of monitoring vaccine efficacy in the control of H5N1 HPAI in ducks. Published by Elsevier Ltd.

  19. 18th International Mouse Genome Conference

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lossie, Amy C.; Meehan, Thomas P.; Castillo, Andrew

    2005-07-01

    The 18th International Mouse Genome Conference was held in Seattle, WA, US on October 18-22,2004. The meeting was partially supported by the Department of Energy, Grant No. DE-FG02-04ER63851. Abstracts can be seen at imgs.org and the summary of the meeting was published in Mammalian Genome, Vol 16, Number 7, Pages 471-475.

  20. Bioavailable Concentrations of Delphinidin and Its Metabolite, Gallic Acid, Induce Antioxidant Protection Associated with Increased Intracellular Glutathione in Cultured Endothelial Cells

    PubMed Central

    Goszcz, Katarzyna; Deakin, Sherine J.; Duthie, Garry G.; Stewart, Derek

    2017-01-01

    Despite limited bioavailability and rapid degradation, dietary anthocyanins are antioxidants with cardiovascular benefits. This study tested the hypothesis that the antioxidant protection conferred by the anthocyanin, delphinidin, is mediated by modulation of endogenous antioxidant defences, driven by its degradation product, gallic acid. Delphinidin was found to degrade rapidly (t1/2 ~ 30 min), generating gallic acid as a major degradation product. Both delphinidin and gallic acid generated oxygen-centred radicals at high (100 μM) concentrations in vitro. In a cultured human umbilical vein endothelial cell model of oxidative stress, the antioxidant protective effects of both delphinidin and gallic acid displayed a hormesic profile; 100 μM concentrations of both were cytotoxic, but relatively low concentrations (100 nM–1 μM) protected the cells and were associated with increased intracellular glutathione. We conclude that delphinidin is intrinsically unstable and unlikely to confer any direct antioxidant activity in vivo yet it offered antioxidant protection to cells at low concentrations. This paradox might be explained by the ability of the degradation product, gallic acid, to confer benefit. The findings are important in understanding the mode of protection conferred by anthocyanins and reinforce the necessity to conduct in vitro experiments at biologically relevant concentrations. PMID:29081896

  1. Protective Immunity and Reduced Renal Colonization Induced by Vaccines Containing Recombinant Leptospira interrogans Outer Membrane Proteins and Flagellin Adjuvant

    PubMed Central

    Monaris, D.; Sbrogio-Almeida, M. E.; Dib, C. C.; Canhamero, T. A.; Souza, G. O.; Vasconcellos, S. A.; Ferreira, L. C. S.

    2015-01-01

    Leptospirosis is a global zoonotic disease caused by different Leptospira species, such as Leptospira interrogans, that colonize the renal tubules of wild and domestic animals. Thus far, attempts to develop effective leptospirosis vaccines, both for humans and animals, have failed to induce immune responses capable of conferring protection and simultaneously preventing renal colonization. In this study, we evaluated the protective immunity induced by subunit vaccines containing seven different recombinant Leptospira interrogans outer membrane proteins, including the carboxy-terminal portion of the immunoglobulinlike protein A (LigAC) and six novel antigens, combined with aluminum hydroxide (alum) or Salmonella flagellin (FliC) as adjuvants. Hamsters vaccinated with the different formulations elicited high antigen-specific antibody titers. Immunization with LigAC, either with alum or flagellin, conferred protective immunity but did not prevent renal colonization. Similarly, animals immunized with LigAC or LigAC coadministered with six leptospiral proteins with alum adjuvant conferred protection but did not reduce renal colonization. In contrast, immunizing animals with the pool of seven antigens in combination with flagellin conferred protection and significantly reduced renal colonization by the pathogen. The present study emphasizes the relevance of antigen composition and added adjuvant in the efficacy of antileptospirosis subunit vaccines and shows the complex relationship between immune responses and renal colonization by the pathogen. PMID:26108285

  2. 1987 Oak Ridge model conference: Proceedings: Volume 2, Environmental protection

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Not Available

    1987-01-01

    See the abstract for Volume I for general information on the conference. Topics discussed in Volume II include data management techiques for environmental protection efforts, the use of models in environmental auditing, in emergency plans, chemical accident emergency response, risk assessment, monitoring of waste sites, air and water monitoring of waste sites, and in training programs. (TEM)

  3. 75 FR 66752 - ILP Effectiveness Evaluation 2010; Additional Notice of Multi-Stakeholder Technical Conference on...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-10-29

    ... Licensing Process October 21, 2010. As announced in the May 18, 2010, ``Notice of Interviews... at [email protected]com by October 29, 2010 to receive the toll-free telephone number and password... Stephanie Obadia at [email protected]com by October 29, 2010. For more information about this conference...

  4. A conserved 19-kDa Eimeria tenella antigen is a profilin-like protein.

    PubMed

    Fetterer, R H; Miska, K B; Jenkins, M C; Barfield, R C

    2004-12-01

    A wide range of recombinant proteins from Eimeria species have been reported to offer some degree of protection against infection and disease, but the specific biological function of these proteins is largely unknown. Previous studies have demonstrated a 19-kDa protein of unknown function designated SZ-1 in sporozoites and merozoites of Eimeria acervulina that can be used to confer partial protection against coccidiosis. Reverse transcriptase-polymerase chain reaction indicated that the gene for SZ-1 is expressed by all the asexual stages of Eimeria tenella. Rabbit antisera to recombinant SZ-1 recognized an approximately 19-kDa protein from extracts of E. tenella sporozoites, merozoites, sporulated oocysts, and oocysts in various stages of sporulation. Immunofluorescence antibody staining indicated specific staining of E. tenella sporozoites and merozoites. Staining was most intense in the cytoplasm of the posterior end of the parasite. The primary amino acid sequence of the gene for E. tenella SZ-1 deduced from the E. tenella genome indicated a conserved domain for the actin-regulatory protein profilin. A conserved binding site for poly-L-proline (PLP), characteristic of profilin was also observed. SZ-1 was separated from soluble extract of E. tenella proteins by affinity chromatography using a PLP ligand, confirming the ability of SZ-1 to bind PLP. SZ-1 also partially inhibited the polymerization of actin. The current results are consistent with the classification of SZ-1 as a profilin-related protein.

  5. [Omentin: Role in insulin resistance, inflammation and cardiovascular protection].

    PubMed

    Hernández-Díaz, Adrián; Arana-Martínez, Julio C; Carbó, Roxana; Espinosa-Cervantes, Román; Sánchez-Muñoz, Fausto

    2016-01-01

    The omentin is an adipokine, which role is due to the capacity of regulate metabolic (insulin sensitivity) and anti-inflammatory activities, thus conferring vascular protection during obesity and diabetes mellitus type 2. By this, it is important to know the mechanisms by which omentin confers cardiovascular protection, with the purpose of establish omentin a possible therapeutic target or molecule on this scenario. Copyright © 2015 Instituto Nacional de Cardiología Ignacio Chávez. Publicado por Masson Doyma México S.A. All rights reserved.

  6. Incorporation of a recombinant Eimeria maxima IMP1 antigen into nanoparticles confers protective immunity against E. Maxima challenge infection.

    PubMed

    Jenkins, Mark C; Stevens, Laura; O'Brien, Celia; Parker, Carolyn; Miska, Katrzyna; Konjufca, Vjollca

    2018-02-14

    The purpose of this study was to determine if conjugating a recombinant Eimeria maxima protein, namely EmaxIMP1, into 20 nm polystyrene nanoparticles (NP) could improve the level of protective immunity against E. maxima challenge infection. Recombinant EmaxIMP1 was expressed in Escherichia coli as a poly-His fusion protein, purified by NiNTA chromatography, and conjugated to 20 nm polystyrene NP (NP-EmaxIMP1). NP-EMaxIMP1 or control non-recombinant (NP-NR) protein were delivered per os to newly-hatched broiler chicks with subsequent booster immunizations at 3 and 21 days of age. In battery cage studies (n = 4), chickens immunized with NP-EMaxIMP1 displayed complete protection as measured by weight gain (WG) against E. maxima challenge compared to chickens immunized with NP-NR. WG in the NP-EMaxIMP1-immunized groups was identical to WG in chickens that were not infected with E. maxima infected chickens. In floor pen studies (n = 2), chickens immunized with NP-EMaxIMP1 displayed partial protection as measured by WG against E. maxima challenge compared to chickens immunized with NP-NR. In order to understand the basis for immune stimulation, newly-hatched chicks were inoculated per os with NP-EMaxIMP1 or NP-NR protein, and the small intestine, bursa, and spleen, were examined for NP localization at 1 h and 6 h post-inoculation. Within 1 h, both NP-EMaxIMP1 and NP-NR were observed in all 3 tissues. An increase was observed in the level of NP-EmaxIMP1 and NP-NR in all tissues at 6 h post-inoculation. These data indicate that 20 nm NP-EmaxIMP1 or NP-NR reached deeper tissues within hours of oral inoculation and elicited complete to partial immunity against E. maxima challenge infection. Published by Elsevier Ltd.

  7. Vaccine and Monoclonal Antibody That Enhance Mouse Resistance to Candidiasis ▿

    PubMed Central

    Xin, Hong; Cutler, Jim E.

    2011-01-01

    Previously we showed that antibodies specific for the glycan β-1,2-mannotriose [β-(Man)3] on the cell surface of Candida albicans protect mice against disseminated candidiasis (H. Xin, S. Dziadek, D. R. Bundle, and J. E. Cutler, Proc. Natl. Acad. Sci. U. S. A. 105:13526–13531, 2008). Furthermore, six 14-mer peptides that are within the N-terminal portion of C. albicans wall proteins were conjugated to the glycan in an attempt to create immunogenic glycopeptide conjugates. By a dendritic cell (DC)-based immunization approach, all were immunogenic and three of the six conjugates induced a high degree of protection in mice. Interestingly, whereas all six peptides induced antibody responses when used alone to pulse DCs for subsequent immunizations, three peptides induced protection, and one in particular, peptide Fba (derived from fructose-bisphosphate aldolase), induced robust protective responses and is the focus of the current work. Fba peptide is not restricted by the major histocompatibility complex class II (MHC-II), as it induced anti-Fba antibodies in mice of different H-2 haplotypes and in rabbits. Furthermore, the peptide induced protection against disease caused by different C. albicans strains. Partial protection was achieved when alum was used in place of DCs for Fba immunizations. The passive transfer of immune sera from Fba-vaccinated mice, but not immune serum preabsorbed with fungal cells, conferred protection in naïve mice. This result, along with our finding that a monoclonal antibody specific for the peptide, E2-9 (IgM), protected mice against candidiasis, provide strong evidence that antibodies contribute to protection. Our work demonstrates the utility of cell wall peptides alone or as glycopeptides in vaccines designed for the induction of immunity against candidiasis and monoclonal antibodies as a rapid immunoprotective approach against the disease. PMID:21832099

  8. Molecular Quantum Mechanics 2010: From Methylene to DNA and Beyond Conference Support

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    None, None

    This grant was $12500 for partial support of an international conference, Molecular Quantum Mechanics 2010, which was held on the campus of the University of California, Berkeley, from 24 to 29 May 2010. The conference involved more than 250 participants. The conference schedule ran from as early as 8:00 AM to as late as 10:30 PM at night, in order to accommodate six historical lectures, 16 plenary lectures, 42 invited talks and two very strong poster sessions containing 143 contributed posters. Since 1989, the Molecular Quantum Mechanics (MQM) series of international conferences has show- cased the frontiers of research inmore » quantum chemistry with a strong focus on basic theory and algorithms, as well as highlights of topical applications. Both were strongly in evidence at MQM 2010. At the same time as embracing the future, the MQM conferences also honour the lifetime contributions of some of the most prominent scientists in the field of theoretical and computational quantum chemistry. MQM 2010 recognised the work of Prof. Henry F. ‘Fritz’ Schaefer of the Center for Computational Chemistry at the University of Georgia, who was previously on the faculty at Berkeley The travel of invited speakers was partially covered by sponsorships from Dell Computer, Hewlett-Packard, Journal of Chemical Theory and Computation, Virginia Tech College of Science, Molecular Physics, Q-Chem Inc and the American Institute of Physics. By contrast, the conference grant from the Department of Energy was used to provide fellowships and scholarships to enable graduate students and postdoctoral fellows to attend the meeting, and thereby broaden the participation of young scientists at a meeting where in the past most of the attendees have been more senior faculty researchers. We believe that we were very successful in this regard: 118 students and postdocs attended out of the total of 256 participants. In detail, the DOE sponsorship money was partially used for dormitory scholarships that covered the cost of shared accommodation for students and postdocs at Berkeley dormitories. This covered the $200-$305 cost of a shared room for the 5-day duration of the conference. The only condition of these scholarships was that the awardee must present a poster at the meeting. Approximately $7565 was spent for these dormitory scholarships. The remaining expenditures of $4800 was used for 12 merit scholarships which were awarded to students whose poster presentations were judged the best at the conference. This amount covered a significant part of their travel and registration fees.« less

  9. American Council on Consumer Interests. Annual Conference. The Proceedings. Convention Theme: Ideas/Commitment/Action (22nd, Atlanta, Georgia, April 7-10, 1976).

    ERIC Educational Resources Information Center

    Mohr, Lillian Holmen

    These proceedings consist of 25 conference papers on consumer interests: (1) Consumer Leaders of Yesteryear, (2) Potentials for Professionalism in Consumer Affairs, (3) Legislative Priorities--The Washington Scene, (4) Consumer Protection--The Municipal Approach, (5) Virginia Approach to Consumer Protection, (6) An Explanation of Electric Utility…

  10. Changes in Fish Assemblages following the Establishment of a Network of No-Take Marine Reserves and Partially-Protected Areas

    PubMed Central

    Kelaher, Brendan P.; Coleman, Melinda A.; Broad, Allison; Rees, Matthew J.; Jordan, Alan; Davis, Andrew R.

    2014-01-01

    Networks of no-take marine reserves and partially-protected areas (with limited fishing) are being increasingly promoted as a means of conserving biodiversity. We examined changes in fish assemblages across a network of marine reserves and two different types of partially-protected areas within a marine park over the first 5 years of its establishment. We used Baited Remote Underwater Video (BRUV) to quantify fish communities on rocky reefs at 20–40 m depth between 2008–2011. Each year, we sampled 12 sites in 6 no-take marine reserves and 12 sites in two types of partially-protected areas with contrasting levels of protection (n = 4 BRUV stations per site). Fish abundances were 38% greater across the network of marine reserves compared to the partially-protected areas, although not all individual reserves performed equally. Compliance actions were positively associated with marine reserve responses, while reserve size had no apparent relationship with reserve performance after 5 years. The richness and abundance of fishes did not consistently differ between the two types of partially-protected areas. There was, therefore, no evidence that the more regulated partially-protected areas had additional conservation benefits for reef fish assemblages. Overall, our results demonstrate conservation benefits to fish assemblages from a newly established network of temperate marine reserves. They also show that ecological monitoring can contribute to adaptive management of newly established marine reserve networks, but the extent of this contribution is limited by the rate of change in marine communities in response to protection. PMID:24454934

  11. Expression library immunization can confer protection against lethal challenge with African swine fever virus.

    PubMed

    Lacasta, Anna; Ballester, María; Monteagudo, Paula L; Rodríguez, Javier M; Salas, María L; Accensi, Francesc; Pina-Pedrero, Sonia; Bensaid, Albert; Argilaguet, Jordi; López-Soria, Sergio; Hutet, Evelyne; Le Potier, Marie Frédérique; Rodríguez, Fernando

    2014-11-01

    African swine fever is one of the most devastating pig diseases, against which there is no vaccine available. Recent work from our laboratory has demonstrated the protective potential of DNA vaccines encoding three African swine fever viral antigens (p54, p30, and the hemagglutinin extracellular domain) fused to ubiquitin. Partial protection was afforded in the absence of detectable antibodies prior to virus challenge, and survival correlated with the presence of a large number of hemagglutinin-specific CD8(+) T cells in blood. Aiming to demonstrate the presence of additional CD8(+) T-cell determinants with protective potential, an expression library containing more than 4,000 individual plasmid clones was constructed, each one randomly containing a Sau3AI restriction fragment of the viral genome (p54, p30, and hemagglutinin open reading frames [ORFs] excluded) fused to ubiquitin. Immunization of farm pigs with the expression library yielded 60% protection against lethal challenge with the virulent E75 strain. These results were further confirmed by using specific-pathogen-free pigs after challenging them with 10(4) hemadsorbing units (HAU) of the cell culture-adapted strain E75CV1. On this occasion, 50% of the vaccinated pigs survived the lethal challenge, and 2 out of the 8 immunized pigs showed no viremia or viral excretion at any time postinfection. In all cases, protection was afforded in the absence of detectable specific antibodies prior to challenge and correlated with the detection of specific T-cell responses at the time of sacrifice. In summary, our results clearly demonstrate the presence of additional protective determinants within the African swine fever virus (ASFV) genome and open up the possibility for their future identification. African swine fever is a highly contagious disease of domestic and wild pigs that is endemic in many sub-Saharan countries, where it causes important economic losses and is currently in continuous expansion across Europe. Unfortunately, there is no treatment nor an available vaccine. Early attempts using attenuated vaccines demonstrated their potential to protect pigs against experimental infection. However, their use in the field remains controversial due to safety issues. Although inactive and subunit vaccines did not confer solid protection against experimental ASFV infection, our DNA vaccination results have generated new expectations, confirming the key role of T-cell responses in protection and the existence of multiple ASFV antigens with protective potential, more of which are currently being identified. Thus, the future might bring complex and safe formulations containing more than a single viral determinant to obtain broadly protective vaccines. We believe that obtaining the optimal vaccine formulation it is just a matter of time, investment, and willingness. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  12. 76 FR 76713 - California Independent System Operator Corporation; Notice of Technical Conference

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-12-08

    ...) proposal to eliminate convergence bidding at intertie scheduling points. Take notice that such conference...'s proposal to eliminate convergence bidding at intertie scheduling points. A subsequent notice... Act of 1973. For accessibility accommodations please send an email to [email protected] or call...

  13. CONFERENCE SUMMARY: PRACTICAL ASPECTS OF THE DESIGN AND USE OF GAC

    EPA Science Inventory

    This article is based on papers presented at a 1989 conference on the design and use of granular activated carbon (GAC) systems. The conference was cosponsored by the AWWA Research Foundation and the US Environmental Protection Agency. Topics covered include reasons for the use...

  14. Facial protection conferred by cycle safety helmets: use of digitized image processing to develop a new nondestructive test.

    PubMed

    Harrison, M; Shepherd, J P

    1997-07-01

    Cycle safety helmets are designed to prevent head injury. Although most commercially available helmets conform to one of several national and international standards, individual designs differ widely, particularly in relation to face coverage. A method was developed to assess the potential for the differing designs to protect the face from injury. A nonimpact test was assessed, using digitized image-processing software (Digithurst Ltd.) to measure the shadow cast by a helmet rim under a collimated plane light source onto the face of a mannequin headform. Twelve helmet designs available internationally were tested and ranked with respect to the direct protection conferred (area of the face directly covered by the helmet) and indirect protection (area of the face shaded). The three highest-ranking helmets for direct protection (Rosebank Stackhat, Asphalt Warrior, and Lazer Voyager) also ranked the highest for indirect protection. These helmets were more inferiorly extended and were of a more bulky construction. It was concluded that the dimensions of cycle helmets in relation to face coverage are crucial in influencing the extent to which facial protection is conferred. International test standards need urgent revision to ensure that face coverage is optimized. Lower-face protection could be achieved through incorporation of a lower-face bar to cycle helmets.

  15. Advances and challenges in malaria vaccine development.

    PubMed

    Crompton, Peter D; Pierce, Susan K; Miller, Louis H

    2010-12-01

    Malaria caused by Plasmodium falciparum remains a major public health threat, especially among children and pregnant women in Africa. An effective malaria vaccine would be a valuable tool to reduce the disease burden and could contribute to elimination of malaria in some regions of the world. Current malaria vaccine candidates are directed against human and mosquito stages of the parasite life cycle, but thus far, relatively few proteins have been studied for potential vaccine development. The most advanced vaccine candidate, RTS,S, conferred partial protection against malaria in phase II clinical trials and is currently being evaluated in a phase III trial in Africa. New vaccine targets need to be identified to improve the chances of developing a highly effective malaria vaccine. A better understanding of the mechanisms of naturally acquired immunity to malaria may lead to insights for vaccine development.

  16. Fourth conference on radiation protection and dosimetry: Proceedings, program, and abstracts

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Casson, W.H.; Thein, C.M.; Bogard, J.S.

    This Conference is the fourth in a series of conferences organized by staff members of Oak Ridge National Laboratory in an effort to improve communication in the field of radiation protection and dosimetry. Scientists, regulators, managers, professionals, technologists, and vendors from the United States and countries around the world have taken advantage of this opportunity to meet with their contemporaries and peers in order to exchange information and ideas. The program includes over 100 papers in 9 sessions, plus an additional session for works in progress. Papers are presented in external dosimetry, internal dosimetry, radiation protection programs and assessments, developmentsmore » in instrumentation and materials, environmental and medical applications, and on topics related to standards, accreditation, and calibration. Individual papers are indexed separately on EDB.« less

  17. The 1991 International Aerospace and Ground Conference on Lightning and Static Electricity, volume 2

    NASA Technical Reports Server (NTRS)

    1991-01-01

    The proceedings of the conference are reported. The conference focussed on lightning protection, detection, and forecasting. The conference was divided into 26 sessions based on research in lightning, static electricity, modeling, and mapping. These sessions spanned the spectrum from basic science to engineering, concentrating on lightning prediction and detection and on safety for ground facilities, aircraft, and aerospace vehicles.

  18. 48 CFR 1552.223-71 - EPA Green Meetings and Conferences.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true EPA Green Meetings and Conferences. 1552.223-71 Section 1552.223-71 Federal Acquisition Regulations System ENVIRONMENTAL PROTECTION... provision or language substantially the same as the provision in solicitations for meetings and conference...

  19. 1 CFR 301.1 - Establishment and location.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... information about the Conference either by accessing its Web site at http://www.acus.gov, by calling the Conference offices at (202) 480-2080, or by contacting [email protected]gov. The Conference's recommendations may be obtained by accessing its Web site or by visiting the reading room at its offices. ...

  20. Immunity to Intracellular Salmonella Depends on Surface-associated Antigens

    PubMed Central

    Claudi, Beatrice; Mazé, Alain; Schemmer, Anne K.; Kirchhoff, Dennis; Schmidt, Alexander; Burton, Neil; Bumann, Dirk

    2012-01-01

    Invasive Salmonella infection is an important health problem that is worsening because of rising antimicrobial resistance and changing Salmonella serovar spectrum. Novel vaccines with broad serovar coverage are needed, but suitable protective antigens remain largely unknown. Here, we tested 37 broadly conserved Salmonella antigens in a mouse typhoid fever model, and identified antigen candidates that conferred partial protection against lethal disease. Antigen properties such as high in vivo abundance or immunodominance in convalescent individuals were not required for protectivity, but all promising antigen candidates were associated with the Salmonella surface. Surprisingly, this was not due to superior immunogenicity of surface antigens compared to internal antigens as had been suggested by previous studies and novel findings for CD4 T cell responses to model antigens. Confocal microscopy of infected tissues revealed that many live Salmonella resided alone in infected host macrophages with no damaged Salmonella releasing internal antigens in their vicinity. In the absence of accessible internal antigens, detection of these infected cells might require CD4 T cell recognition of Salmonella surface-associated antigens that could be processed and presented even from intact Salmonella. In conclusion, our findings might pave the way for development of an efficacious Salmonella vaccine with broad serovar coverage, and suggest a similar crucial role of surface antigens for immunity to both extracellular and intracellular pathogens. PMID:23093937

  1. Modelling Risk to US Military Populations from Stopping Blanket Mandatory Polio Vaccination

    PubMed Central

    Burgess, Andrew

    2017-01-01

    Objectives Transmission of polio poses a threat to military forces when deploying to regions where such viruses are endemic. US-born soldiers generally enter service with immunity resulting from childhood immunization against polio; moreover, new recruits are routinely vaccinated with inactivated poliovirus vaccine (IPV), supplemented based upon deployment circumstances. Given residual protection from childhood vaccination, risk-based vaccination may sufficiently protect troops from polio transmission. Methods This analysis employed a mathematical system for polio transmission within military populations interacting with locals in a polio-endemic region to evaluate changes in vaccination policy. Results Removal of blanket immunization had no effect on simulated polio incidence among deployed military populations when risk-based immunization was employed; however, when these individuals reintegrated with their base populations, risk of transmission to nondeployed personnel increased by 19%. In the absence of both blanket- and risk-based immunization, transmission to nondeployed populations increased by 25%. The overall number of new infections among nondeployed populations was negligible for both scenarios due to high childhood immunization rates, partial protection against transmission conferred by IPV, and low global disease incidence levels. Conclusion Risk-based immunization driven by deployment to polio-endemic regions is sufficient to prevent transmission among both deployed and nondeployed US military populations. PMID:29104608

  2. Autoinducer-2 Plays a Crucial Role in Gut Colonization and Probiotic Functionality of Bifidobacterium breve UCC2003

    PubMed Central

    Bottacini, Francesca; Lanigan, Noreen; Casey, Pat G.; Huys, Geert; Nelis, Hans J.; van Sinderen, Douwe; Coenye, Tom

    2014-01-01

    In the present study we show that luxS of Bifidobacterium breve UCC2003 is involved in the production of the interspecies signaling molecule autoinducer-2 (AI-2), and that this gene is essential for gastrointestinal colonization of a murine host, while it is also involved in providing protection against Salmonella infection in Caenorhabditis elegans. We demonstrate that a B. breve luxS-insertion mutant is significantly more susceptible to iron chelators than the WT strain and that this sensitivity can be partially reverted in the presence of the AI-2 precursor DPD. Furthermore, we show that several genes of an iron starvation-induced gene cluster, which are downregulated in the luxS-insertion mutant and which encodes a presumed iron-uptake system, are transcriptionally upregulated under in vivo conditions. Mutation of two genes of this cluster in B. breve UCC2003 renders the derived mutant strains sensitive to iron chelators while deficient in their ability to confer gut pathogen protection to Salmonella-infected nematodes. Since a functional luxS gene is present in all tested members of the genus Bifidobacterium, we conclude that bifidobacteria operate a LuxS-mediated system for gut colonization and pathogen protection that is correlated with iron acquisition. PMID:24871429

  3. Autoinducer-2 plays a crucial role in gut colonization and probiotic functionality of Bifidobacterium breve UCC2003.

    PubMed

    Christiaen, Steven E A; O'Connell Motherway, Mary; Bottacini, Francesca; Lanigan, Noreen; Casey, Pat G; Huys, Geert; Nelis, Hans J; van Sinderen, Douwe; Coenye, Tom

    2014-01-01

    In the present study we show that luxS of Bifidobacterium breve UCC2003 is involved in the production of the interspecies signaling molecule autoinducer-2 (AI-2), and that this gene is essential for gastrointestinal colonization of a murine host, while it is also involved in providing protection against Salmonella infection in Caenorhabditis elegans. We demonstrate that a B. breve luxS-insertion mutant is significantly more susceptible to iron chelators than the WT strain and that this sensitivity can be partially reverted in the presence of the AI-2 precursor DPD. Furthermore, we show that several genes of an iron starvation-induced gene cluster, which are downregulated in the luxS-insertion mutant and which encodes a presumed iron-uptake system, are transcriptionally upregulated under in vivo conditions. Mutation of two genes of this cluster in B. breve UCC2003 renders the derived mutant strains sensitive to iron chelators while deficient in their ability to confer gut pathogen protection to Salmonella-infected nematodes. Since a functional luxS gene is present in all tested members of the genus Bifidobacterium, we conclude that bifidobacteria operate a LuxS-mediated system for gut colonization and pathogen protection that is correlated with iron acquisition.

  4. The protective effect of dexmedetomidine in a rat ex vivo lung model of ischemia-reperfusion injury.

    PubMed

    Zhou, Yan; Zhou, Xinqiao; Zhou, Wenjuan; Pang, Qingfeng; Wang, Zhiping

    2018-01-01

    To investigate the effect of dexmedetomidine (Dex) in a rat ex vivo lung model of ischemia-reperfusion injury. An IL-2 ex vivo lung perfusion system was used to establish a rat ex vivo lung model of ischemia-reperfusion injury. Drugs were added to the perfusion solution for reperfusion. Lung injury was assessed by histopathological changes, airway pressure (Res), lung compliance (Compl), perfusion flow (Flow), pulmonary venous oxygen partial pressure (PaO2), and lung wet/dry (W/D) weight ratio. The levels of superoxide dismutase (SOD), malondialdehyde (MDA), 78 kDa glucose-regulated protein (GRP78) and CCAAT/enhancer-binding protein homologous protein (CHOP) were measured, respectively. The introduction of Dex attenuated the post-ischemia-reperfusion lung damage and MDA level, improved lung histology, W/D ratio, lung injury scores and SOD activity. Decreased mRNA and protein levels of GRP78 and CHOP compared with the IR group were observed after Dex treatment. The effect of Dex was dosage-dependence and a high dose of Dex (10 nM) was shown to confer the strongest protective effect against lung damage (P<0.05). Yohimbine, an α2 receptor antagonist, significantly reversed the protective effect of Dex in lung tissues (P<0.05). Dex reduced ischemia-reperfusion injury in rat ex vivo lungs.

  5. Public Policy on Ground-Water Quality Protection. Proceedings of a National Conference (Virginia Polytechnic Inst. and State University, Blacksburg, Virginia, April 13-16, 1977).

    ERIC Educational Resources Information Center

    Kerns, Waldon R., Ed.

    This publication contains the papers presented at a National Conference on Ground Water Quality Protection Policy held in April of 1977. Paper titles include: (1) Magnitude of the Ground-Water Contamination Problem; (2) Limited Degredation as a Ground-Water Quality Policy; (3) Surface and Subsurface Mining: Policy Implications; (4) Oil Well…

  6. Vesicular Stomatitis Virus Pseudotyped with Ebola Virus Glycoprotein Serves as a Protective, Noninfectious Vaccine against Ebola Virus Challenge in Mice

    PubMed Central

    Lennemann, Nicholas J.; Herbert, Andrew S.; Brouillette, Rachel; Rhein, Bethany; Bakken, Russell A.; Perschbacher, Katherine J.; Cooney, Ashley L.; Miller-Hunt, Catherine L.; Ten Eyck, Patrick; Biggins, Julia; Olinger, Gene; Dye, John M.

    2017-01-01

    ABSTRACT The recent Ebola virus (EBOV) epidemic in West Africa demonstrates the potential for a significant public health burden caused by filoviral infections. No vaccine or antiviral is currently FDA approved. To expand the vaccine options potentially available, we assessed protection conferred by an EBOV vaccine composed of vesicular stomatitis virus pseudovirions that lack native G glycoprotein (VSVΔG) and bear EBOV glycoprotein (GP). These pseudovirions mediate a single round of infection. Both single-dose and prime/boost vaccination regimens protected mice against lethal challenge with mouse-adapted Ebola virus (ma-EBOV) in a dose-dependent manner. The prime/boost regimen provided significantly better protection than a single dose. As N-linked glycans are thought to shield conserved regions of the EBOV GP receptor-binding domain (RBD), thereby blocking epitopes within the RBD, we also tested whether VSVΔG bearing EBOV GPs that lack GP1 N-linked glycans provided effective immunity against challenge with ma-EBOV or a more distantly related virus, Sudan virus. Using a prime/boost strategy, high doses of GP/VSVΔG partially or fully denuded of N-linked glycans on GP1 protected mice against ma-EBOV challenge, but these mutants were no more effective than wild-type (WT) GP/VSVΔG and did not provide cross protection against Sudan virus. As reported for other EBOV vaccine platforms, the protection conferred correlated with the quantity of EBOV GP-specific Ig produced but not with the production of neutralizing antibodies. Our results show that EBOV GP/VSVΔG pseudovirions serve as a successful vaccination platform in a rodent model of Ebola virus disease and that GP1 N-glycan loss does not influence immunogenicity or vaccination success. IMPORTANCE The West African Ebola virus epidemic was the largest to date, with more than 28,000 people infected. No FDA-approved vaccines are yet available, but in a trial vaccination strategy in West Africa, recombinant, infectious VSV encoding the Ebola virus glycoprotein effectively prevented virus-associated disease. VSVΔG pseudovirion vaccines may prove as efficacious and have better safety, but they have not been tested to date. Thus, we tested the efficacy of VSVΔG pseudovirions bearing Ebola virus glycoprotein as a vaccine platform. We found that wild-type Ebola virus glycoprotein, in the context of this platform, provides robust protection of EBOV-challenged mice. Further, we found that removal of the heavy glycan shield surrounding conserved regions of the glycoprotein does not enhance vaccine efficacy. PMID:28615211

  7. 75 FR 8719 - Notice of Agreements Filed

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-02-25

    ...) 523-5793 or [email protected] . Agreement No.: 011346-020. Title: Israel Trade Conference... Integrated Shipping Services, Ltd. Filing Party: Howard A. Levy, Esq.; Chairman; Israel Trade Conference; 80...

  8. Proactive and Adaptive Decision Support Study (PDS)

    DTIC Science & Technology

    2014-12-09

    situations diverge from known models. Note that identifying the mission is not an open -ended problem, and is consequently not intractable. The set of...Simulation ( BRIMS ) Conference, Amelia Island, FL, 2012. [9] L. P. Kaelbling, M. L. Littman, and A. R. Cassandra, “Planning and acting in partially...Simulation Conference ( BRIMS ), Sundance, Utah, 2011. PDS Study Final Report 15 Distribution Statement A. Approved for public release; distribution

  9. Cebpd Is Essential for Gamma-Tocotrienol Mediated Protection against Radiation-Induced Hematopoietic and Intestinal Injury

    PubMed Central

    Banerjee, Sudip; Shah, Sumit K.; Melnyk, Stepan B.; Hauer-Jensen, Martin

    2018-01-01

    Gamma-tocotrienol (GT3) confers protection against ionizing radiation (IR)-induced injury. However, the molecular targets that underlie the protective functions of GT3 are not yet known. We have reported that mice lacking CCAAT enhancer binding protein delta (Cebpd−/−) display increased mortality to IR due to injury to the hematopoietic and intestinal tissues and that Cebpd protects from IR-induced oxidative stress and cell death. The purpose of this study was to investigate whether Cebpd mediates the radio protective functions of GT3. We found that GT3-treated Cebpd−/− mice showed partial recovery of white blood cells compared to GT3-treated Cebpd+/+ mice at 2 weeks post-IR. GT3-treated Cebpd−/− mice showed an increased loss of intestinal crypt colonies, which correlated with increased expression of inflammatory cytokines and chemokines, increased levels of oxidized glutathione (GSSG), S-nitrosoglutathione (GSNO) and 3-nitrotyrosine (3-NT) after exposure to IR compared to GT3-treated Cebpd+/+ mice. Cebpd is induced by IR as well as a combination of IR and GT3 in the intestine. Studies have shown that granulocyte-colony stimulating factor (G-CSF), mediates the radioprotective functions of GT3. Interestingly, we found that IR alone as well as the combination of IR and GT3 caused robust augmentation of plasma G-CSF in both Cebpd+/+ and Cebpd−/− mice. These results identify a novel role for Cebpd in GT3-mediated protection against IR-induced injury, in part via modulation of IR-induced inflammation and oxidative/nitrosative stress, which is independent of G-CSF. PMID:29642403

  10. The targeted inhibition of mitochondrial Hsp90 overcomes the apoptosis resistance conferred by Bcl-2 in Hep3B cells via necroptosis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yan, Chunlan; Department of Physiology, Zhejiang University School of Medicine, Hangzhou, Zhejiang 310058; Oh, Joon Seok

    Previous studies have reported that a Gamitrinib variant containing triphenylphosphonium (G-TPP) binds to mitochondrial Hsp90 and rapidly inhibits its activity, thus inducing the apoptotic pathway in the cells. Accordingly, G-TPP shows a potential as a promising drug for the treatment of cancer. A cell can die from different types of cell death such as apoptosis, necrosis, necroptosis, and autophagic cell death. In this study, we further investigated the mechanisms and modes of cell death in the G-TPP-treated Hep3B and U937 cell lines. We discovered that G-TPP kills the U937 cells through the apoptotic pathway and the overexpression of Bcl-2 significantlymore » inhibits U937 cell death to G-TPP. We further discovered that G-TPP kills the Hep3B cells by activating necroptosis in combination with the partial activation of caspase-dependent apoptosis. Importantly, G-TPP overcomes the apoptosis resistance conferred by Bcl-2 in Hep3B cells via necroptosis. We also observed that G-TPP induces compensatory autophagy in the Hep3B cell line. We further found that whereas there is a Bcl-2-Beclin 1 interaction in response to G-TPP, silencing the beclin 1 gene failed to block LC3-II accumulation in the Hep3B cells, indicating that G-TPP triggers Beclin 1-independent protective autophagy in Hep3B cells. Taken together, these data reveal that G-TPP induces cell death through a combination of death pathways, including necroptosis and apoptosis, and overcomes the apoptosis resistance conferred by Bcl-2 in Hep3B cells via necroptosis. These findings are important for the therapeutic exploitation of necroptosis as an alternative cell death program to bypass the resistance to apoptosis. Highlights: ► G-TPP binds to mitochondrial Hsp90. ► G-TPP induces apoptosis in U937 human leukemia cancer cells. ► G-TPP induces combination of death pathways in Hep3B cell. ► G-TPP overcomes the resistance conferred by Bcl-2 in Hep3B cells via necroptosis. ► G-TPP triggers Beclin 1-independent protective autophagy in Hep3B cells.« less

  11. Chiral copper(II) complex-catalyzed reactions of partially protected carbohydrates.

    PubMed

    Allen, C Liana; Miller, Scott J

    2013-12-20

    Catalyst-controlled regioselective functionalization of partially protected saccharide molecules is a highly important yet under-developed area of carbohydrate chemistry. Such reactions allow for the reduction of protecting group manipulation steps required in syntheses involving sugars. Herein, an approach to these processes using enantiopure copper-bis(oxazoline) catalysts to control couplings of electrophiles to various partially protected sugars is reported. In a number of cases, divergent regioselectivity was observed as a function of the enantiomer of catalyst that is used.

  12. Immunization with plasmid DNA encoding the hemagglutinin and the nucleoprotein confers robust protection against a lethal canine distemper virus challenge.

    PubMed

    Dahl, Lotte; Jensen, Trine Hammer; Gottschalck, Elisabeth; Karlskov-Mortensen, Peter; Jensen, Tove Dannemann; Nielsen, Line; Andersen, Mads Klindt; Buckland, Robin; Wild, T Fabian; Blixenkrone-Møller, Merete

    2004-09-09

    We have investigated the protective effect of immunization of a highly susceptible natural host of canine distemper virus (CDV) with DNA plasmids encoding the viral nucleoprotein (N) and hemagglutinin (H). The combined intradermal and intramuscular routes of immunization elicited high virus-neutralizing serum antibody titres in mink (Mustela vison). To mimic natural exposure, we also conducted challenge infection by horizontal transmission from infected contact animals. Other groups received a lethal challenge infection by administration to the mucosae of the respiratory tract and into the muscle. One of the mink vaccinated with N plasmid alone developed severe disease after challenge. In contrast, vaccination with the H plasmid together with the N plasmid conferred solid protection against disease and we were unable to detect CDV infection in PBMCs or in different tissues after challenge. Our findings show that DNA immunization by the combined intradermal and intramuscular routes can confer solid protective immunity against naturally transmitted morbillivirus infection and disease.

  13. 75 FR 6397 - Notice of Agreements Filed

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-02-09

    ...)-523-5793 or tradeanalysi[email protected] . Agreement No.: 011346-019. Title: Israel Trade Conference.... Filing Party: Howard A. Levy, Esq.; Chairman; Israel Trade Conference; 80 Wall Street, Suite 1117; New...

  14. African Swine Fever Virus Georgia Isolate Harboring Deletions of MGF360 and MGF505 Genes Is Attenuated in Swine and Confers Protection against Challenge with Virulent Parental Virus.

    PubMed

    O'Donnell, Vivian; Holinka, Lauren G; Gladue, Douglas P; Sanford, Brenton; Krug, Peter W; Lu, Xiqiang; Arzt, Jonathan; Reese, Bo; Carrillo, Consuelo; Risatti, Guillermo R; Borca, Manuel V

    2015-06-01

    African swine fever virus (ASFV) is the etiological agent of a contagious and often lethal disease of domestic pigs that has significant economic consequences for the swine industry. The control of African swine fever (ASF) has been hampered by the unavailability of vaccines. Experimental vaccines have been developed using genetically modified live attenuated ASFVs where viral genes involved in virus virulence were removed from the genome. Multigene family 360 (MGF360) and MGF505 represent a group of genes sharing partial sequence and structural identities that have been connected with ASFV host range specificity, blocking of the host innate response, and virus virulence. Here we report the construction of a recombinant virus (ASFV-G-ΔMGF) derived from the highly virulent ASFV Georgia 2007 isolate (ASFV-G) by specifically deleting six genes belonging to MGF360 or MGF505: MGF505-1R, MGF360-12L, MGF360-13L, MGF360-14L, MGF505-2R, and MGF505-3R. ASFV-G-ΔMGF replicates as efficiently in primary swine macrophage cell cultures as the parental virus. In vivo, ASFV-G-ΔMGF is completely attenuated in swine, since pigs inoculated intramuscularly (i.m.) with either 10(2) or 10(4) 50% hemadsorbing doses (HAD50) remained healthy, without signs of the disease. Importantly, when these animals were subsequently exposed to highly virulent parental ASFV-G, no signs of the disease were observed, although a proportion of these animals harbored the challenge virus. This is the first report demonstrating the role of MGF genes acting as independent determinants of ASFV virulence. Additionally, ASFV-G-ΔMGF is the first experimental vaccine reported to induce protection in pigs challenged with highly virulent and epidemiologically relevant ASFV-G. The main problem for controlling ASF is the lack of vaccines. Studies focusing on understanding ASFV virulence led to the production of genetically modified recombinant viruses that, while attenuated, are able to confer protection in pigs challenged with homologous viruses. Here we have produced an attenuated recombinant ASFV derived from highly virulent ASFV strain Georgia (ASFV-G) lacking only six of the multigene family 360 (MGF360) and MGF505 genes (ASFV-G-ΔMGF). It is demonstrated, by first time, that deleting specific MGF genes alone can completely attenuate a highly virulent field ASFV isolate. Recombinant virus ASFV-G-ΔMGF effectively confers protection in pigs against challenge with ASFV-G when delivered once via the intramuscular (i.m.) route. The protection against ASFV-G is highly effective by 28 days postvaccination. This is the first report of an experimental vaccine that induces solid protection against virulent ASFV-G. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  15. 2010 Defense Industrial Base Critical Infrastructure Protection Conference (DIBCIP) Risk Reduction and Mitigation in the Defense Industrial Base

    DTIC Science & Technology

    2010-04-28

    Base Critical Infrastructure Protection Conference (DIBCIP) “Risk Reduction & Mitigation in the Defense Industrial Base ” April 26-28, 2010...Philadelphia, PA Agenda Tuesday, April 27, 2010 Keynote Address: The Economic Crisis and Its Impact on the DIB: Defense Industrial Base Forecasts 2010...Ms. Nancy Pomerleau, Exercise Director, Partnership Outreach Division, DHS-IP DIB 2010 DIB CIP DEFENSE INDUSTRIAL BASE CRITICAL

  16. 40 CFR 721.10146 - Partially fluorinated condensation polymer (generic).

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... polymer (generic). 721.10146 Section 721.10146 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... Specific Chemical Substances § 721.10146 Partially fluorinated condensation polymer (generic). (a) Chemical... as partially fluorinated condensation polymer (PMN P-07-87) is subject to reporting under this...

  17. European Science Notes. Volume 40, number 1

    NASA Astrophysics Data System (ADS)

    Shaffer, L. E.

    1986-01-01

    European Science Notes is a monthly publication with brief articles on recent developments in European scientific research. Partial contents: Shallow Water Acoustic at the UK's Royal Aircraft Establishment; Immunology Research in Israel; Life Sciences Research at the Weizmann Institute of Science; Symposium on Macromolecules; Mass Spectrometry Meetings; Automation and Robotization in the Welding Industry; 3rd International Conference on Composite Structures; Conference on Quantum Electronics; Very Short Laser Pulse Research.

  18. Notification: EPA Conferences - Maximizing Cost Efficiencies

    EPA Pesticide Factsheets

    Project #OA-FY15-0381, September 19, 2014. The U.S. Environmental Protection Agency (EPA) Office of Inspector General (OIG) plans to begin preliminary research in October 2014 for an audit of conference spending.

  19. Support for the 2001 Gordon Research Conference on the Origins of Solar Systems

    NASA Technical Reports Server (NTRS)

    Stevenson, David J.

    2002-01-01

    This grant provided partial support for participants at the Gordon Research Conference on Origins of Solar Systems, held at Connecticut College, June 17 through June 22, 2001. This conference was chaired by the PI (David Stevenson) and Pat Cassell (NASA Ames) was Vice-Chair. In addition to the money provided by this grant ($15,000), the Gordon Research Conference organization provided about $22,000 (in large part from registration fees) and BPI provided $10,000 (through Director David Black); the latter targeted primarily for students and postdocs. Accordingly the grant money from NASA was used to cover the costs of registration and travel for about one half of the invited speakers (22 in total) and discussion leaders (about 10 in total).

  20. Support for the 2001 Gordon Research Conference on the Origins of Solar Systems

    NASA Astrophysics Data System (ADS)

    Stevenson, David J.

    2002-01-01

    This grant provided partial support for participants at the Gordon Research Conference on Origins of Solar Systems, held at Connecticut College, June 17 through June 22, 2001. This conference was chaired by the PI (David Stevenson) and Pat Cassell (NASA Ames) was Vice-Chair. In addition to the money provided by this grant (15,000), the Gordon Research Conference organization provided about 22,000 (in large part from registration fees) and BPI provided 10,000 (through Director David Black); the latter targeted primarily for students and postdocs. Accordingly the grant money from NASA was used to cover the costs of registration and travel for about one half of the invited speakers (22 in total) and discussion leaders (about 10 in total).

  1. 76 FR 22091 - California Independent System, Operator Corporation; Supplemental Notice of Agenda and Discussion...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-04-20

    ... purposes only. All parties are invited to file written comments following the technical conference. A free... technical support for the free webcasts. It also offers access to this event via television in the DC area... questions during the conference via e-mail at [email protected] . FERC conferences are accessible under...

  2. Health Occupations Education. Biennial National Health Occupations Research Conference Proceedings. (5th, Nashville, Tennessee, December 1, 1993).

    ERIC Educational Resources Information Center

    Rzonca, Chet, Ed.

    These proceedings include the agenda of the conference, a list of its cosponsors, and the texts of the following six papers presented at the conference: "Hepatitis Vaccine: Are Health Occupations Education Students Protected?" (Cynthia Chappelka); "Integrated Academics: An HOE Model" (Karen E. Gable, Beverly Ransdell); "The Ability of Work Related…

  3. εPKC confers acute tolerance to cerebral ischemic reperfusion injury

    PubMed Central

    Bright, Rachel; Sun, Guo-Hua; Yenari, Midori A.; Steinberg, Gary K.; Mochly-Rosen, Daria

    2008-01-01

    In response to mild ischemic stress, the brain elicits endogenous survival mechanisms to protect cells against a subsequent lethal ischemic stress, referred to as ischemic tolerance. The molecular signals that mediate this protection are thought to involve the expression and activation of multiple kinases, including protein kinase C (PKC). Here we demonstrate that εPKC mediates cerebral ischemic tolerance in vivo. Systemic delivery of ψεRACK, an εPKC-selective peptide activator, confers neuroprotection against a subsequent cerebral ischemic event when delivered immediately prior to stroke. In addition, activation of εPKC by ψεRACK treatment decreases vascular tone in vivo, as demonstrated by a reduction in microvascular cerebral blood flow. Here we demonstrate the role of acute and transient εPKC in early cerebral tolerance in vivo and suggest that extra-parenchymal mechanisms, such as vasoconstriction, may contribute to the conferred protection. PMID:18586397

  4. Rate of biological invasions is lower in coastal marine protected areas.

    PubMed

    Ardura, A; Juanes, F; Planes, S; Garcia-Vazquez, E

    2016-09-09

    Marine biological invasions threaten biodiversity worldwide. Here we explore how Marine Protected areas, by reducing human use of the coast, confer resilience against the introduction of non-indigenous species (NIS), using two very different Pacific islands as case studies for developing and testing mathematical models. We quantified NIS vectors and promoters on Vancouver (Canada) and Moorea (French Polynesia) islands, sampled and barcoded NIS, and tested models at different spatial scales with different types of interaction among vectors and between marine protection and NIS frequency. In our results NIS were negatively correlated with the dimension of the protected areas and the intensity of the protection. Small to medium geographical scale protection seemed to be efficient against NIS introductions. The likely benefit of MPAs was by exclusion of aquaculture, principally in Canada. These results emphasize the importance of marine protected areas for biodiversity conservation, and suggest that small or medium protected zones would confer efficient protection against NIS introduction.

  5. Cancer-selective death of human breast cancer cells by leelamine is mediated by bax and bak activation.

    PubMed

    Sehrawat, Anuradha; Kim, Su-Hyeong; Hahm, Eun-Ryeong; Arlotti, Julie A; Eiseman, Julie; Shiva, Sruti S; Rigatti, Lora H; Singh, Shivendra V

    2017-02-01

    The present study is the first to report inhibition of breast cancer cell growth in vitro and in vivo and suppression of self-renewal of breast cancer stem cells (bCSC) by a pine bark component (leelamine). Except for a few recent publications in melanoma, anticancer pharmacology of this interesting phytochemical is largely elusive. Leelamine (LLM) dose-dependently inhibited viability of MDA-MB-231 (triple-negative), MCF-7 (estrogen receptor-positive), and SUM159 (triple-negative) human breast cancer cells in association with apoptotic cell death induction. To the contrary, a normal mammary epithelial cell line derived from fibrocystic breast disease and spontaneously immortalized (MCF-10A) was fully resistant to LLM-mediated cell growth inhibition and apoptosis induction. LLM also inhibited self-renewal of breast cancer stem cells. Apoptosis induction by LLM in breast cancer cells was accompanied by a modest increase in reactive oxygen species production, which was not due to inhibition of mitochondrial electron transport chain complexes. Nevertheless, ectopic expression of manganese superoxide dismutase conferred partial protection against LLM-induced cell death but only at a lower yet pharmacologically relevant concentration. Exposure of breast cancer cells to LLM resulted in (a) induction and/or activation of multidomain proapoptotic proteins Bax and Bak, (b) caspase-9 activation, and (c) cytosolic release of cytochrome c. Bax and Bak deficiency in immortalized fibroblasts conferred significant protection against cell death by LLM. Intraperitoneal administration of LLM (7.5 mg/kg; 5 times/wk) suppressed the growth of orthotopic SUM159 xenografts in mice without any toxicity. In conclusion, the present study provides critical preclinical data to warrant further investigation of LLM. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  6. Infection of Female BWF1 Lupus Mice with Malaria Parasite Attenuates B Cell Autoreactivity by Modulating the CXCL12/CXCR4 Axis and Its Downstream Signals PI3K/AKT, NFκB and ERK

    PubMed Central

    Badr, Gamal; Sayed, Ayat; Abdel-Maksoud, Mostafa A.; Mohamed, Amany O.; El-Amir, Azza; Abdel-Ghaffar, Fathy A.; Al-Quraishy, Saleh; Mahmoud, Mohamed H.

    2015-01-01

    Systemic lupus erythematosus (SLE) is a prototypic autoimmune disease characterized by abnormal autoreactivity in B cells. Lymphocytes and their soluble mediators contribute to the disease pathogenesis. We recently demonstrated that infecting lupus mice with malaria confers protection against lupus nephritis by attenuating oxidative stress in both liver and kidney tissues. In the current study, we further investigated B cell autoreactivity in female BWF1 lupus mice after infection with either live or gamma-irradiated malaria, using ELISA, flow cytometry and Western blot analysis. The lupus mice exhibited a significant elevation in plasma levels of IL-4, IL-6, IL-7, IL-12, IL-17, IFN-α, IFN-γ, TGF-β, BAFF and APRIL and a marked elevation of IgG2a, IgG3 and ant-dsDNA autoantibodies compared with normal healthy mice. Infecting lupus mice with live but not gamma-irradiated malaria parasite partially and significantly restored the levels of the soluble mediators that contribute to the progression of lupus. Furthermore, the B cells of lupus mice exhibited an increased proliferative capacity; aberrant overexpression of the chemokine receptor CXCR4; and a marked elevation in responsiveness to their cognate ligand (CXCL12) via aberrant activation of the PI3K/AKT, NFκB and ERK signaling pathways. Interestingly, infecting lupus mice with live but not gamma-irradiated malaria parasite restored a normal proliferative capacity, surface expression of CXCR4 and B cell response to CXCL-12. Taken together, our data present interesting findings that clarify, for the first time, the molecular mechanisms of how infection of lupus mice with malaria parasite controls B cell autoreactivity and thus confers protection against lupus severity. PMID:25909640

  7. Infection of Female BWF1 Lupus Mice with Malaria Parasite Attenuates B Cell Autoreactivity by Modulating the CXCL12/CXCR4 Axis and Its Downstream Signals PI3K/AKT, NFκB and ERK.

    PubMed

    Badr, Gamal; Sayed, Ayat; Abdel-Maksoud, Mostafa A; Mohamed, Amany O; El-Amir, Azza; Abdel-Ghaffar, Fathy A; Al-Quraishy, Saleh; Mahmoud, Mohamed H

    2015-01-01

    Systemic lupus erythematosus (SLE) is a prototypic autoimmune disease characterized by abnormal autoreactivity in B cells. Lymphocytes and their soluble mediators contribute to the disease pathogenesis. We recently demonstrated that infecting lupus mice with malaria confers protection against lupus nephritis by attenuating oxidative stress in both liver and kidney tissues. In the current study, we further investigated B cell autoreactivity in female BWF1 lupus mice after infection with either live or gamma-irradiated malaria, using ELISA, flow cytometry and Western blot analysis. The lupus mice exhibited a significant elevation in plasma levels of IL-4, IL-6, IL-7, IL-12, IL-17, IFN-α, IFN-γ, TGF-β, BAFF and APRIL and a marked elevation of IgG2a, IgG3 and ant-dsDNA autoantibodies compared with normal healthy mice. Infecting lupus mice with live but not gamma-irradiated malaria parasite partially and significantly restored the levels of the soluble mediators that contribute to the progression of lupus. Furthermore, the B cells of lupus mice exhibited an increased proliferative capacity; aberrant overexpression of the chemokine receptor CXCR4; and a marked elevation in responsiveness to their cognate ligand (CXCL12) via aberrant activation of the PI3K/AKT, NFκB and ERK signaling pathways. Interestingly, infecting lupus mice with live but not gamma-irradiated malaria parasite restored a normal proliferative capacity, surface expression of CXCR4 and B cell response to CXCL-12. Taken together, our data present interesting findings that clarify, for the first time, the molecular mechanisms of how infection of lupus mice with malaria parasite controls B cell autoreactivity and thus confers protection against lupus severity.

  8. Sixteenth Space Simulation Conference Confirming Spaceworthiness Into the Next Millennium

    NASA Technical Reports Server (NTRS)

    Stecher, Joseph L., III (Editor)

    1990-01-01

    The conference provided participants with a forum to acquire and exchange information on the state of the art in space simulation, test technology, thermal simulation and protection, contamination, and techniques of test measurements.

  9. Exogenous Gene Transmission of Isocitrate Dehydrogenase 2 Mimics Ischemic Preconditioning Protection.

    PubMed

    Kolb, Alexander L; Corridon, Peter R; Zhang, Shijun; Xu, Weimin; Witzmann, Frank A; Collett, Jason A; Rhodes, George J; Winfree, Seth; Bready, Devin; Pfeffenberger, Zechariah J; Pomerantz, Jeremy M; Hato, Takashi; Nagami, Glenn T; Molitoris, Bruce A; Basile, David P; Atkinson, Simon J; Bacallao, Robert L

    2018-04-01

    Ischemic preconditioning confers organ-wide protection against subsequent ischemic stress. A substantial body of evidence underscores the importance of mitochondria adaptation as a critical component of cell protection from ischemia. To identify changes in mitochondria protein expression in response to ischemic preconditioning, we isolated mitochondria from ischemic preconditioned kidneys and sham-treated kidneys as a basis for comparison. The proteomic screen identified highly upregulated proteins, including NADP+-dependent isocitrate dehydrogenase 2 (IDH2), and we confirmed the ability of this protein to confer cellular protection from injury in murine S3 proximal tubule cells subjected to hypoxia. To further evaluate the role of IDH2 in cell protection, we performed detailed analysis of the effects of Idh2 gene delivery on kidney susceptibility to ischemia-reperfusion injury. Gene delivery of IDH2 before injury attenuated the injury-induced rise in serum creatinine ( P <0.05) observed in controls and increased the mitochondria membrane potential ( P <0.05), maximal respiratory capacity ( P <0.05), and intracellular ATP levels ( P <0.05) above those in controls. This communication shows that gene delivery of Idh2 can confer organ-wide protection against subsequent ischemia-reperfusion injury and mimics ischemic preconditioning. Copyright © 2018 by the American Society of Nephrology.

  10. Postexposure protection of guinea pigs against a lethal ebola virus challenge is conferred by RNA interference.

    PubMed

    Geisbert, Thomas W; Hensley, Lisa E; Kagan, Elliott; Yu, Erik Zhaoying; Geisbert, Joan B; Daddario-DiCaprio, Kathleen; Fritz, Elizabeth A; Jahrling, Peter B; McClintock, Kevin; Phelps, Janet R; Lee, Amy C H; Judge, Adam; Jeffs, Lloyd B; MacLachlan, Ian

    2006-06-15

    Ebola virus (EBOV) infection causes a frequently fatal hemorrhagic fever (HF) that is refractory to treatment with currently available antiviral therapeutics. RNA interference represents a powerful, naturally occurring biological strategy for the inhibition of gene expression and has demonstrated utility in the inhibition of viral replication. Here, we describe the development of a potential therapy for EBOV infection that is based on small interfering RNAs (siRNAs). Four siRNAs targeting the polymerase (L) gene of the Zaire species of EBOV (ZEBOV) were either complexed with polyethylenimine (PEI) or formulated in stable nucleic acid-lipid particles (SNALPs). Guinea pigs were treated with these siRNAs either before or after lethal ZEBOV challenge. Treatment of guinea pigs with a pool of the L gene-specific siRNAs delivered by PEI polyplexes reduced plasma viremia levels and partially protected the animals from death when administered shortly before the ZEBOV challenge. Evaluation of the same pool of siRNAs delivered using SNALPs proved that this system was more efficacious, as it completely protected guinea pigs against viremia and death when administered shortly after the ZEBOV challenge. Additional experiments showed that 1 of the 4 siRNAs alone could completely protect guinea pigs from a lethal ZEBOV challenge. Further development of this technology has the potential to yield effective treatments for EBOV HF as well as for diseases caused by other agents that are considered to be biological threats.

  11. Intranasal Immunization with Influenza Virus-Like Particles Containing Membrane-Anchored Cholera Toxin B or Ricin Toxin B Enhances Adaptive Immune Responses and Protection against an Antigenically Distinct Virus.

    PubMed

    Ji, Xianliang; Ren, Zhiguang; Xu, Na; Meng, Lingnan; Yu, Zhijun; Feng, Na; Sang, Xiaoyu; Li, Shengnan; Li, Yuanguo; Wang, Tiecheng; Zhao, Yongkun; Wang, Hualei; Zheng, Xuexing; Jin, Hongli; Li, Nan; Yang, Songtao; Cao, Jinshan; Liu, Wensen; Gao, Yuwei; Xia, Xianzhu

    2016-04-21

    Vaccination is the most effective means to prevent influenza virus infection, although current approaches are associated with suboptimal efficacy. Here, we generated virus-like particles (VLPs) composed of the hemagglutinin (HA), neuraminidase (NA) and matrix protein (M1) of A/Changchun/01/2009 (H1N1) with or without either membrane-anchored cholera toxin B (CTB) or ricin toxin B (RTB) as molecular adjuvants. The intranasal immunization of mice with VLPs containing membrane-anchored CTB or RTB elicited stronger humoral and cellular immune responses when compared to mice immunized with VLPs alone. Administration of VLPs containing CTB or RTB significantly enhanced virus-specific systemic and mucosal antibody responses, hemagglutination inhibiting antibody titers, virus neutralizing antibody titers, and the frequency of virus-specific IFN-γ and IL-4 secreting splenocytes. VLPs with and without CTB or RTB conferred complete protection against lethal challenge with a mouse-adapted homologous virus. When challenged with an antigenically distinct H1N1 virus, all mice immunized with VLPs containing CTB or RTB survived whereas mice immunized with VLPs alone showed only partial protection (80% survival). Our results suggest that membrane-anchored CTB and RTB possess strong adjuvant properties when incorporated into an intranasally-delivered influenza VLP vaccine. Chimeric influenza VLPs containing CTB or RTB may represent promising vaccine candidates for improved immunological protection against homologous and antigenically distinct influenza viruses.

  12. Intranasal Immunization with Influenza Virus-Like Particles Containing Membrane-Anchored Cholera Toxin B or Ricin Toxin B Enhances Adaptive Immune Responses and Protection against an Antigenically Distinct Virus

    PubMed Central

    Ji, Xianliang; Ren, Zhiguang; Xu, Na; Meng, Lingnan; Yu, Zhijun; Feng, Na; Sang, Xiaoyu; Li, Shengnan; Li, Yuanguo; Wang, Tiecheng; Zhao, Yongkun; Wang, Hualei; Zheng, Xuexing; Jin, Hongli; Li, Nan; Yang, Songtao; Cao, Jinshan; Liu, Wensen; Gao, Yuwei; Xia, Xianzhu

    2016-01-01

    Vaccination is the most effective means to prevent influenza virus infection, although current approaches are associated with suboptimal efficacy. Here, we generated virus-like particles (VLPs) composed of the hemagglutinin (HA), neuraminidase (NA) and matrix protein (M1) of A/Changchun/01/2009 (H1N1) with or without either membrane-anchored cholera toxin B (CTB) or ricin toxin B (RTB) as molecular adjuvants. The intranasal immunization of mice with VLPs containing membrane-anchored CTB or RTB elicited stronger humoral and cellular immune responses when compared to mice immunized with VLPs alone. Administration of VLPs containing CTB or RTB significantly enhanced virus-specific systemic and mucosal antibody responses, hemagglutination inhibiting antibody titers, virus neutralizing antibody titers, and the frequency of virus-specific IFN-γ and IL-4 secreting splenocytes. VLPs with and without CTB or RTB conferred complete protection against lethal challenge with a mouse-adapted homologous virus. When challenged with an antigenically distinct H1N1 virus, all mice immunized with VLPs containing CTB or RTB survived whereas mice immunized with VLPs alone showed only partial protection (80% survival). Our results suggest that membrane-anchored CTB and RTB possess strong adjuvant properties when incorporated into an intranasally-delivered influenza VLP vaccine. Chimeric influenza VLPs containing CTB or RTB may represent promising vaccine candidates for improved immunological protection against homologous and antigenically distinct influenza viruses. PMID:27110810

  13. Student Support for EIPBN 2012 Conference

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Farrow, Reginald C

    2013-01-29

    The 56th International Conference on Electron, Ion and Photon Beam Technology and Nanofabrication (EIPBN), 2012, was held at the Hilton Waikoloa Resort in Waikoloa, Hawaii, May 29 - June 2, 2012. The EIPBN Conference is recognized as the foremost international meeting dedicated to lithographic science and technology and its application to micro and nanofabrication techniques. The conference brought together 483 engineers and scientists from industries and universities from all over the world to discuss recent progress and future trends. Among the emerging technologies that are within the scope of EIPBN is Nanofabrication for Energy Sources along with nanofabrication for themore » realization of low power integrated circuits. Every year, EIPBN provides financial support for students to attend the conference. The students gave oral and poster presentations of their research and many published peer reviewed articles in a special conference issue of the Journal of Vacuum Science and Technology B. The Department of Energy Office of Basic Energy Sciences partially supported 41 students from US universities with a $5,000.« less

  14. Comparison of potential protection conferred by three immunization strategies (protein/protein, DNA/DNA, and DNA/protein) against Brucella infection using Omp2b in BALB/c Mice.

    PubMed

    Golshani, Maryam; Rafati, Sima; Nejati-Moheimani, Mehdi; Ghasemian, Melina; Bouzari, Saeid

    2016-12-25

    In the present study, immunogenicity and protective efficacy of the Brucella outer membrane protein 2b (Omp2b) was evaluated in BALB/c mice using Protein/Protein, DNA/DNA and DNA/Protein vaccine strategies. Immunization of mice with three vaccine regimens elicited a strong specific IgG response (higher IgG2a titers over IgG1 titers) and provided Th1-oriented immune response. Vaccination of BALB/c mice with the DNA/Pro regimen induced higher levels of IFN-γ/IL-2 and conferred more protection levels against B. melitenisis and B. abortus challenge than did the protein or DNA alone. In conclusion, Omp2b is able to stimulate specific immune responses and to confer cross protection against B. melitensis and B. abortus infection. Therefore, it could be introduced as a new potential candidate for the development of a subunit vaccine against Brucella infection. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. 33 CFR 154.814 - Facility requirements for vessel vapor overpressure and vacuum protection.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... maximum transfer rate determined at the pre-transfer conference required by § 156.120(w) of this chapter... section or a lower pressure agreed upon at the pre-transfer conference required by § 156.120(w) of this... paragraph (b) of this section or a higher pressure agreed upon at the pre-transfer conference required by...

  16. 33 CFR 154.814 - Facility requirements for vessel vapor overpressure and vacuum protection.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... maximum transfer rate determined at the pre-transfer conference required by § 156.120(w) of this chapter... section or a lower pressure agreed upon at the pre-transfer conference required by § 156.120(w) of this... paragraph (b) of this section or a higher pressure agreed upon at the pre-transfer conference required by...

  17. 33 CFR 154.814 - Facility requirements for vessel vapor overpressure and vacuum protection.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... maximum transfer rate determined at the pre-transfer conference required by § 156.120(w) of this chapter... section or a lower pressure agreed upon at the pre-transfer conference required by § 156.120(w) of this... paragraph (b) of this section or a higher pressure agreed upon at the pre-transfer conference required by...

  18. Brucellosis vaccines based on the open reading frames from genomic island 3 of Brucella abortus.

    PubMed

    Gómez, Leonardo; Alvarez, Francisco; Betancur, Daniel; Oñate, Angel

    2018-05-17

    Brucella abortus is the etiological agent of brucellosis, a zoonotic disease affecting cattle and humans. This disease has been partially controlled in cattle by immunization with live attenuated B. abortus S19 and RB51 strains. However, use of these vaccine strains has been associated with safety issues in animals and humans. New vaccines have since emerged in the prevention of brucellosis, particularly DNA vaccines, which have shown effectiveness and a good safety profile. Their protection efficacy in mice is associated with the induction of Th1 type and cytotoxic T cell mediated immune response against structural antigens and virulence factors expressed during B. abortus infection. Some antigenic candidate for vaccine design against brucellosis (mainly DNA vaccines) have been obtained from genomic island 3 (GI-3) of B. abortus, which encodes several open reading frames (ORFs) involved in the intracellular survival and virulence of this pathogen. The immunogenicity and protection conferred by these DNA vaccines in a murine model is reviewed in this article, suggesting that some of them could be safe and effective vaccine candidates against to prevent B. abortus infection. Copyright © 2018 Elsevier Ltd. All rights reserved.

  19. Gibberellins modulate auxin responses during tomato (Solanum lycopersicum L.) fruit development.

    PubMed

    Mignolli, Francesco; Vidoz, Maria L; Picciarelli, Piero; Mariotti, Lorenzo

    2018-06-10

    In tomato, auxin and gibberellins (GAs) interact with each other to drive fruit growth and development. While the role of auxin in directing GA biosynthesis and signal is already known, very little information has been obtained about GA-mediated control of auxin signalling and response. Interestingly, we show that GA 3 is able to modify the expression of several auxin signalling genes in the partial auxin-insensitive diageotropica (dgt) mutant, suggesting that GAs may override the control of DGT on auxin signal. Procera (pro) mutation, which confers a constitutively active GA signal, enhances the effects of exogenous auxin, indicating that PRO may act as a negative effector of auxin responses in fruits. Indeed, transcript modulation of some Aux/IAA and ARF genes in auxin-treated dgt/pro fruits, suggests that PRO controls their expression possibly bypassing DGT. It was also shown that GA biosynthesis, in response to auxin treatment, is largely controlled by DGT. It is therefore conceivable that the DGT-mediated increase of active GAs in auxin-treated or pollinated fruits, would promote PRO degradation, which in turn activates part of the auxin signalling cascade. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  20. Immunogenicity and protective efficacy of an elastase-dependent live attenuated swine influenza virus vaccine administered intranasally in pigs.

    PubMed

    Masic, Aleksandar; Lu, Xinya; Li, Junwei; Mutwiri, George K; Babiuk, Lorne A; Brown, Earl G; Zhou, Yan

    2010-10-08

    Influenza A virus is an important respiratory pathogen of swine that causes significant morbidity and economic impact on the swine industry. Vaccination is the first choice for prevention and control of influenza infections. Live attenuated influenza vaccines (LAIV) are approved for use in humans and horses and their application provides broad protective immunity, however no LAIV against swine influenza virus (SIV) exists in the market. Previously we reported that an elastase-dependent mutant SIV A/Sw/Sk-R345V (R345V) derived from A/Sw/Saskatchewan/18789/02 (H1N1) (SIV/Sk02) is highly attenuated in pigs. Two intratracheal administrations of R345V induced strong cell-mediated and humoral immune responses and provided a high degree of protection to antigenically different SIV infection in pigs. Here we evaluated the immunogenicity and the protective efficacy of R345V against SIV infection by intranasal administration, the more practical route for vaccination of pigs in the field. Our data showed that intranasally administered R345V live vaccine is capable of inducing strong antigen-specific IFN-γ response from local tracheo-bronchial lymphocytes and antibody responses in serum and respiratory mucosa after two applications. Intranasal vaccination of R345V provided pigs with complete protection not only from parental wild type virus infection, but also from homologous antigenic variant A/Sw/Indiana/1726/88 (H1N1) infection. Moreover, intranasal administration of R345V conferred partial protection from heterologous subtypic H3N2 SIV infection in pigs. Thus, R345V elastase-dependent mutant SIV can serve as a live vaccine against antigenically different swine influenza viruses in pigs. Copyright © 2010 Elsevier Ltd. All rights reserved.

  1. 40 CFR 49.122 - Partial delegation of administrative authority to a Tribe.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... authority to a Tribe. 49.122 Section 49.122 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY GRANTS... Partial delegation of administrative authority to a Tribe. (a) What is the purpose of this section? The... Indian Tribe partial authority to administer one or more of the Federal requirements in effect in subpart...

  2. 40 CFR 49.122 - Partial delegation of administrative authority to a Tribe.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... authority to a Tribe. 49.122 Section 49.122 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY GRANTS... Partial delegation of administrative authority to a Tribe. (a) What is the purpose of this section? The... Indian Tribe partial authority to administer one or more of the Federal requirements in effect in subpart...

  3. 40 CFR 49.122 - Partial delegation of administrative authority to a Tribe.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... authority to a Tribe. 49.122 Section 49.122 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY GRANTS... Partial delegation of administrative authority to a Tribe. (a) What is the purpose of this section? The... Indian Tribe partial authority to administer one or more of the Federal requirements in effect in subpart...

  4. 77 FR 38306 - GFIRST Conference Stakeholder Evaluation

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-06-27

    ...), National Cyber Security Division (NCSD), United States Computer Emergency Readiness Team (US-CERT) will...- CERT, [email protected] . SUPPLEMENTARY INFORMATION: GFIRST is DHS's premier cyber conference and continually seeks to enhance collaborative efforts among cyber constituencies, partners, and stakeholders. The...

  5. SIRT1 ameliorates oxidative stress induced neural cell death and is down-regulated in Parkinson's disease.

    PubMed

    Singh, Preeti; Hanson, Peter S; Morris, Christopher M

    2017-06-02

    Sirtuins (SIRTs) are NAD + dependent lysine deacetylases which are conserved from bacteria to humans and have been associated with longevity and lifespan extension. SIRT1, the best studied mammalian SIRT is involved in many physiological and pathological processes and changes in SIRT1 have been implicated in neurodegenerative disorders, with SIRT1 having a suggested protective role in Parkinson's disease. In this study, we determined the effect of SIRT1 on cell survival and α-synuclein aggregate formation in SH-SY5Y cells following oxidative stress. Over-expression of SIRT1 protected SH-SY5Y cells from toxin induced cell death and the protection conferred by SIRT1 was partially independent of its deacetylase activity, which was associated with the repression of NF-кB and cPARP expression. SIRT1 reduced the formation of α-synuclein aggregates but showed minimal co-localisation with α-synuclein. In post-mortem brain tissue obtained from patients with Parkinson's disease, Parkinson's disease with dementia, dementia with Lewy bodies and Alzheimer's disease, the activity of SIRT1 was observed to be down-regulated. These findings suggests a negative effect of oxidative stress in neurodegenerative disorders and possibly explain the reduced activity of SIRT1 in neurodegenerative disorders. Our study shows that SIRT1 is a pro-survival protein that is downregulated under cellular stress.

  6. The highly antigenic 53/25 kDa Taenia solium protein fraction with cathepsin-L like activity is present in the oncosphere/cysticercus and induces non-protective IgG antibodies in pigs

    PubMed Central

    Zimic, Mirko; Pajuelo, Mónica; Gilman, Robert H.; Gutiérrez, Andrés H.; Rueda, Luis D.; Flores, Myra; Chile, Nancy; Verástegui, Manuela; Gonzalez, Armando; García, Héctor H.; Sheen, Patricia

    2011-01-01

    Cathepsin L-like proteases are secreted by several parasites including Taenia solium. The mechanism used by T. solium oncospheres to degrade and penetrate the intestine and infect the host is incompletely understood. It is assumed that intestinal degradation is driven by the proteolytic activity of enzymes secreted by the oncosphere. Blocking the proteolytic activity by an antibody response would prevent the oncosphere penetration and further infection. Serine and cysteine proteases including chymotrypsin, trypsin, elastase, and cathepsin L, are secreted by T. solium and Taenia saginata oncospheres when cultured in vitro, being potential vaccine candidates. However, the purification of a sufficient quantity of proteases secreted by oncospheres to conduct a vaccine trial is costly and lengthy. A 53/25 kDa cathepsin L-like fraction partially purified from T. solium cyst fluid was described previously as an important antigen for immunodiagnostics. In this study we found that this antigen is present in the T. solium oncosphere and is also secreted by the cysticercus. This protein fraction was tested for its ability to protect pigs against an oral challenge with T. solium oncospheres in a vaccine trial. IgG antibodies against the 53/25 kDa cathepsin L-like protein fraction were elicited in the vaccinated animals but did not confer protection. PMID:22119017

  7. Democratic Superstring Field Theory and Its Gauge Fixing

    NASA Astrophysics Data System (ADS)

    Kroyter, M.

    This work is my contribution to the proceedings of the conference``SFT2010 -- the third international conference on string field theory and related topics'' and it reflects my talk there, which described the democratic string field theory and its gauge fixing. The democratic string field theory is the only fully RNS string field theory to date. It lives in the large Hilbert space and includes all picture numbers. Picture changing amounts in this formalism to a gauge transformation. We describe the theory and its properties and show that when partially gauge fixed it can be reduced to the modified theory and to the non-polynomial theory. In the latter case we can even include the Ramond sector in the picture-fixed action. We also show that another partial gauge-fixing leads to a new consistent string field theory at picture number -1.

  8. Geometric models, antenna gains, and protection ratios as developed for BC SAT-R2 conference software

    NASA Technical Reports Server (NTRS)

    Miller, E. F.

    1982-01-01

    Mathematical models used in the software package developed for use at the 1983 Regional Administrative Radio Conference on broadcasting satellites. The models described are those used in the Spectrum Orbit Utilization Program (SOUP) analysis. The geometric relationships necessary to model broadcasting satellite systems are discussed. Antenna models represent copolarized and cross polarized performance as functions of the off axis angle. The protection ratio is modelled as a co-channel value and a template representing systems with frequency offsets.

  9. Report on Tick-Borne Disease and Integrated Pest Management Conference

    EPA Pesticide Factsheets

    The US Environmental Protection Agency (EPA) and the Centers for Disease Control and Prevention (CDC) co-hosted a conference on Tick-Borne Disease Integrated Pest Management on March 5-6, 2013, in Arlington, VA. This document summarizes this meeting.

  10. 77 FR 19661 - City of Broken Bow, OK; Notice of Technical Conference

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-04-02

    ... for the Broken Bow Re-Regulation Dam Hydroelectric Project No. 12470. This conference will be held on... Liberty at (202) 502-6862 or [email protected]gov by April 5, 2012, to RSVP. Nathaniel J. Davis, Sr...

  11. TolC plays a crucial role in immune protection conferred by Edwardsiella tarda whole-cell vaccines.

    PubMed

    Wang, Chao; Peng, Bo; Li, Hui; Peng, Xuan-Xian

    2016-07-12

    Although vaccines developed from live organisms have better efficacy than those developed from dead organisms, the mechanisms underlying this differential efficacy remain unexplored. In this study, we combined sub-immunoproteomics with immune challenge to investigate the action of the outer membrane proteome in the immune protection conferred by four Edwardsiella tarda whole-cell vaccines prepared via different treatments and to identify protective immunogens that play a key role in this immune protection. Thirteen spots representing five outer membrane proteins and one cytoplasmic protein were identified, and it was found that their abundance was altered in relation with the immune protective abilities of the four vaccines. Among these proteins, TolC and OmpA were found to be the key immunogens conferring the first and second highest degrees of protection, respectively. TolC was detected in the two effective vaccines (live and inactivated-30-F). The total antiserum and anti-OmpA titers were higher for the two effective vaccines than for the two ineffective vaccines (inactivated-80-F and inactivated-100). Further evidence demonstrated that the live and inactivated-30-F vaccines demonstrated stronger abilities to induce CD8+ and CD4+ T cell differentiation than the other two evaluated vaccines. Our results indicate that the outer membrane proteome changes dramatically following different treatments, which contributes to the effectiveness of whole-cell vaccines.

  12. 46 CFR 169.721 - Storm sails and halyards (exposed and partially protected waters only).

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 46 Shipping 7 2011-10-01 2011-10-01 false Storm sails and halyards (exposed and partially... § 169.721 Storm sails and halyards (exposed and partially protected waters only). (a) Unless clearly unsuitable, each vessel must have one storm trysail of appropriate size. It must be sheeted independently of...

  13. 46 CFR 169.721 - Storm sails and halyards (exposed and partially protected waters only).

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Storm sails and halyards (exposed and partially... § 169.721 Storm sails and halyards (exposed and partially protected waters only). (a) Unless clearly unsuitable, each vessel must have one storm trysail of appropriate size. It must be sheeted independently of...

  14. 46 CFR 169.721 - Storm sails and halyards (exposed and partially protected waters only).

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 46 Shipping 7 2012-10-01 2012-10-01 false Storm sails and halyards (exposed and partially... § 169.721 Storm sails and halyards (exposed and partially protected waters only). (a) Unless clearly unsuitable, each vessel must have one storm trysail of appropriate size. It must be sheeted independently of...

  15. 46 CFR 169.721 - Storm sails and halyards (exposed and partially protected waters only).

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 46 Shipping 7 2014-10-01 2014-10-01 false Storm sails and halyards (exposed and partially... § 169.721 Storm sails and halyards (exposed and partially protected waters only). (a) Unless clearly unsuitable, each vessel must have one storm trysail of appropriate size. It must be sheeted independently of...

  16. 46 CFR 169.721 - Storm sails and halyards (exposed and partially protected waters only).

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 46 Shipping 7 2013-10-01 2013-10-01 false Storm sails and halyards (exposed and partially... § 169.721 Storm sails and halyards (exposed and partially protected waters only). (a) Unless clearly unsuitable, each vessel must have one storm trysail of appropriate size. It must be sheeted independently of...

  17. Proceedings, 10th Central Hardwood Forest Conference

    Treesearch

    Kurt W. Gottschalk; Sandra L.C., eds. Fosbroke

    1995-01-01

    Two invited papers, 57 volunteer papers, and 22 volunteer poster summaries presented at the 10th Central Hardwood Forest Conference. Presentation topics included economics, forest amenities, harvesting, logging safety, utilization, physiology, genetics, ecology, regeneration, silviculture, protection, management, hydrology, soils, nutrient cycling, and hardwood markets...

  18. Proceedings of the 7th central hardwood conference; 1989 March 5-8; Carbondale, IL.

    Treesearch

    George Rink; Carl A. Budelsky

    1989-01-01

    Proceedings of the seventh central hardwood forest conference, March 5-8, 1989 at Carbondale, Illinois. Includes 48 manuscripts dealing with silviculture, biology, management, protection, regeneration, utilization, structure, hydrology, and research policy in the central hardwood forest.

  19. Strategies, Research Priorities, and Partnerships for Community IPM to Prevent Tick-Borne Diseases--2011 Conference

    EPA Pesticide Factsheets

    The U.S. Environmental Protection Agency (EPA) held the Promoting Community Integrated Pest Management to Prevent Tick-Borne Diseases Conference on March 30th and 31st, 2011 in Arlington, Virginia. Read the meeting summary.

  20. Report on the 2015 US Environmental Protection Agency ...

    EPA Pesticide Factsheets

    Report The 2015 U.S. Environmental Protection Agency (EPA) International Decontamination Research and Development Conference brought together scientists, practitioners, and policymakers related to chemical, biological, and radiological (CBR) remediation.

  1. Inverse Scattering and Applications. Proceedings of Conference on Inverse Scattering on the Line, Held in Amherst, Massachusetts on June 7 - 13, 1990

    DTIC Science & Technology

    1990-01-01

    J. Laurie Snell S. A. Amitsur, D. J. Saltman, and 2 Proceedings of the conference on G. B. Seligman , Editors integration, topology, and geometry in...Rational constructions of modules 17 Nonlinear partial differential equations. for simple Lie algebras, George B. Joel A. Smoller, Editor Seligman 18...number theory, Michael R. Stein and Linda Keen, Editor R. Keith Dennis, Editors 65 Logic and combinatorics, Stephen G. 84 Partition problems in

  2. Proceedings, 8th Central Hardwood Forest Conference

    Treesearch

    Larry H. McCormick; Kurt W., eds. Gottschalk

    1991-01-01

    Two invited papers, forty-five volunteer papers, and twenty volunteer poster summaries presented at the 8th Central Hardwood Forest Conference. Presentations were on economics, forest amenities, harvesting, utilization, physiology, genetics, ecology, regeneration, silviculture, protection, management, hydrology, soils, nutrient cycling, and hardwood markets of central...

  3. Electronic Warfare / Electronic Protection (EW/EP) S&T Priority Steering Council

    DTIC Science & Technology

    2011-11-08

    Office Office of the Assistant Secretary of Defense (Research and Engineering) NDIA 8th Annual Disruptive Technologies Conference 8 November 2011...the NDIA Disruptive Technologies Conference, November 8, 2011 Washington, DC 14. ABSTRACT 15. SUBJECT TERMS 16. SECURITY CLASSIFICATION OF: 17

  4. 76 FR 11473 - Notice of Agreements Filed

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-03-02

    ...)-523-5793 or [email protected] . Agreement No.: 011346-022. Title: Israel Carrier Association... Shipping Services, Ltd. Filing Party: Howard A. Levy, Esq.; Chairman; Israel Trade Conference; 80 Wall... Agreement from a conference to a service contract with Israel's Ministry of Defense, changes the Agreement's...

  5. Threats, protests greet conference.

    PubMed

    Struck, D

    1994-09-04

    In preparation for the 1994 International Conference on Population and Development, Egypt has deployed 14,000 police to protect participants from threatened violence. The Vatican has joined forces with Muslim fundamentalists to condemn the conference as a vehicle for imposing Western ideals, particularly abortion, on Third world countries. In addition, the opposition is raising the specter of a descent of homosexuals onto Cairo and Muslim fundamentalists have threatened to murder Western representatives. A suit filed by Islamic lawyers, aimed at stopping the conference, failed. Sudan and Saudi Arabia plan to boycott the conference, and it remains uncertain whether Libya will be represented. Conference organizers have not been deterred by the threats and note that the controversy has drawn public attention to the central issues under debate.

  6. Influenza Virus-Like Particles Containing M2 Induce Broadly Cross Protective Immunity

    PubMed Central

    Song, Jae-Min; Wang, Bao-Zhong; Park, Kyoung-Mi; Van Rooijen, Nico; Quan, Fu-Shi; Kim, Min-Chul; Jin, Hyun-Tak; Pekosz, Andrew; Compans, Richard W.; Kang, Sang-Moo

    2011-01-01

    Background Current influenza vaccines based on the hemagglutinin protein are strain specific and do not provide good protection against drifted viruses or emergence of new pandemic strains. An influenza vaccine that can confer cross-protection against antigenically different influenza A strains is highly desirable for improving public health. Methodology/Principal Findings To develop a cross protective vaccine, we generated influenza virus-like particles containing the highly conserved M2 protein in a membrane-anchored form (M2 VLPs), and investigated their immunogenicity and breadth of cross protection. Immunization of mice with M2 VLPs induced anti-M2 antibodies binding to virions of various strains, M2 specific T cell responses, and conferred long-lasting cross protection against heterologous and heterosubtypic influenza viruses. M2 immune sera were found to play an important role in providing cross protection against heterosubtypic virus and an antigenically distinct 2009 pandemic H1N1 virus, and depletion of dendritic and macrophage cells abolished this cross protection, providing new insight into cross-protective immune mechanisms. Conclusions/Significance These results suggest that presenting M2 on VLPs in a membrane-anchored form is a promising approach for developing broadly cross protective influenza vaccines. PMID:21267073

  7. Pertussis Maternal Immunization: Narrowing the Knowledge Gaps on the Duration of Transferred Protective Immunity and on Vaccination Frequency

    PubMed Central

    Gaillard, María Emilia; Bottero, Daniela; Zurita, María Eugenia; Carriquiriborde, Francisco; Martin Aispuro, Pablo; Bartel, Erika; Sabater-Martínez, David; Bravo, María Sol; Castuma, Celina; Hozbor, Daniela Flavia

    2017-01-01

    Maternal safety through pertussis vaccination and subsequent maternal–fetal-antibody transfer are well documented, but information on infant protection from pertussis by such antibodies and by subsequent vaccinations is scarce. Since mice are used extensively for maternal-vaccination studies, we adopted that model to narrow those gaps in our understanding of maternal pertussis immunization. Accordingly, we vaccinated female mice with commercial acellular pertussis (aP) vaccine and measured offspring protection against Bordetella pertussis challenge and specific-antibody levels with or without revaccination. Maternal immunization protected the offspring against pertussis, with that immune protection transferred to the offspring lasting for several weeks, as evidenced by a reduction (4–5 logs, p < 0.001) in the colony-forming-units recovered from the lungs of 16-week-old offspring. Moreover, maternal-vaccination-acquired immunity from the first pregnancy still conferred protection to offspring up to the fourth pregnancy. Under the conditions of our experimental protocol, protection to offspring from the aP-induced immunity is transferred both transplacentally and through breastfeeding. Adoptive-transfer experiments demonstrated that transferred antibodies were more responsible for the protection detected in offspring than transferred whole spleen cells. In contrast to reported findings, the protection transferred was not lost after the vaccination of infant mice with the same or other vaccine preparations, and conversely, the immunity transferred from mothers did not interfere with the protection conferred by infant vaccination with the same or different vaccines. These results indicated that aP-vaccine immunization of pregnant female mice conferred protective immunity that is transferred both transplacentally and via offspring breastfeeding without compromising the protection boostered by subsequent infant vaccination. These results—though admittedly not necessarily immediately extrapolatable to humans—nevertheless enabled us to test hypotheses under controlled conditions through detailed sampling and data collection. These findings will hopefully refine hypotheses that can then be validated in subsequent human studies. PMID:28932228

  8. A recombinant chimeric Ad5/3 vector expressing a multi-stage Plasmodium antigen induces protective immunity in mice using heterologous prime-boost immunization regimens1

    PubMed Central

    Cabrera-Mora, Monica; Fonseca, Jairo Andres; Singh, Balwan; Zhao, Chunxia; Makarova, Natalia; Dmitriev, Igor; Curiel, David T.; Blackwell, Jerry; Moreno, Alberto

    2016-01-01

    An ideal malaria vaccine should target several stages of the parasite life cycle and induce anti-parasite and anti-disease immunity. We have reported a Plasmodium yoelii chimeric multi-stage recombinant protein (PyLPC/RMC), engineered to express several autologous T cell epitopes and sequences derived from the circumsporozoite protein (CSP) and the merozoite surface protein 1 (MSP-1). This chimeric protein elicits protective immunity, mediated by CD4+ T cells and neutralizing antibodies. However, experimental evidence from pre-erythrocytic vaccine candidates and irradiated sporozoites has shown that CD8+ T cells play a significant role in protection. Recombinant viral vectors have been used as a vaccine platform to elicit effective CD8+ T cell responses. The human adenovirus serotype 5 (Ad5) has been tested in malaria vaccine clinical trials with excellent safety profile. Nevertheless, a major concern for the use of Ad5 is the high prevalence of anti-vector neutralizing antibodies in humans, hampering its immunogenicity. To minimize the impact of anti-vector pre-existing immunity we developed a chimeric Ad5/3 vector in which the knob region of Ad5 was replaced with that of Ad3, conferring partial resistance to anti-Ad5 neutralizing antibodies. Furthermore, we implemented heterologous adenovirus/protein immunization regimens which include a single immunization with recombinant Ad vectors. Our data show that immunization with the recombinant Ad5/3 vector induces protective efficacy indistinguishable from that elicited by Ad5. Our study also demonstrate that the dose of the Ad vectors has an impact on the memory profile and protective efficacy. The results support further studies with Ad5/3 for malaria vaccine development. PMID:27574299

  9. Thioredoxin Uses a GSH-independent Route to Deglutathionylate Endothelial Nitric-oxide Synthase and Protect against Myocardial Infarction*

    PubMed Central

    Subramani, Jaganathan; Kundumani-Sridharan, Venkatesh; Hilgers, Rob H. P.; Owens, Cade; Das, Kumuda C.

    2016-01-01

    Reversible glutathionylation plays a critical role in protecting protein function under conditions of oxidative stress generally and for endothelial nitric-oxide synthase (eNOS) specifically. Glutathione-dependent glutaredoxin-mediated deglutathionylation of eNOS has been shown to confer protection in a model of heart damage termed ischemia-reperfusion injury, motivating further study of eNOS deglutathionylation in general. In this report, we present evidence for an alternative mechanism of deglutathionylation. In this pathway thioredoxin (Trx), a small cellular redox protein, is shown to rescue eNOS from glutathionylation during ischemia-reperfusion in a GSH-independent manner. By comparing mice with global overexpression of Trx and mice with cardiomyocyte-specific overexpression of Trx, we demonstrate that vascular Trx-mediated deglutathionylation of eNOS protects against ischemia-reperfusion-mediated myocardial infarction. Trx deficiency in endothelial cells promoted eNOS glutathionylation and reduced its enzymatic activity, whereas increased levels of Trx led to deglutathionylated eNOS. Thioredoxin-mediated deglutathionylation of eNOS in the coronary artery in vivo protected against reperfusion injury, even in the presence of normal levels of GSH. We further show that Trx directly interacts with eNOS, and we confirmed that Cys-691 and Cys-910 are the glutathionylated sites, as mutation of these cysteines partially rescued the decrease in eNOS activity, whereas mutation of a distal site, Cys-384, did not. Collectively, this study shows for the first time that Trx is a potent deglutathionylating protein in vivo and in vitro that can deglutathionylate proteins in the presence of high levels of GSSG in conditions of oxidative stress. PMID:27587398

  10. Effects of Postchallenge Administration of ST-246 on Dissemination of IHD-J-Luc Vaccinia Virus in Normal Mice and in Immune-Deficient Mice Reconstituted with T Cells

    PubMed Central

    Shotwell, Elisabeth; Scott, John; Cruz, Stephanie; King, Lisa R.; Manischewitz, Jody; Diaz, Claudia G.; Jordan, Robert A.; Grosenbach, Douglas W.; Golding, Hana

    2013-01-01

    Whole-body bioimaging was used to study dissemination of vaccinia virus (VACV) in normal and in immune deficient (nu−/nu−) mice protected from lethality by postchallenge administration of ST-246. Total fluxes were recorded in the liver, spleen, lungs, and nasal cavities of live mice after intranasal infection with a recombinant IHD-J-Luc VACV expressing luciferase. Areas under the flux curve were calculated for individual mice to assess viral loads. Treatment for 2 to 5 days of normal BALB/c mice with ST-246 at 100 mg/kg starting 24 h postchallenge conferred 100% protection and reduced viral loads in four organs compared to control mice. Mice also survived after 5 days of treatment with ST-246 at 30 mg/kg, and yet the viral loads and poxes were higher in these mice compared to 100-mg/kg treatment group. Nude mice were not protected by ST-246 alone or by 10 million adoptively transferred T cells. In contrast, nude mice that received T cells and 7-day treatment with ST-246 survived infection and exhibited reduced viral loads compared to nonreconstituted and ST-246-treated mice after ST-246 was stopped. Similar protection of nude mice was achieved using adoptively transferred 1.0 and 0.1 million, but not 0.01 million, purified T cells or CD4+ or CD8+ T cells in conjunction with ST-246 treatment. These data suggest that ST-246 protects immunocompetent mice from lethality and reduces viral dissemination in internal organs and poxvirus lesions. Furthermore, immune-deficient animals with partial T cell reconstitution can control virus replication after a course of ST-246 and survive lethal vaccinia virus challenge. PMID:23468500

  11. DNA Vaccination Partially Protects against African Swine Fever Virus Lethal Challenge in the Absence of Antibodies

    PubMed Central

    Argilaguet, Jordi M.; Pérez-Martín, Eva; Nofrarías, Miquel; Gallardo, Carmina; Accensi, Francesc; Lacasta, Anna; Mora, Mercedes; Ballester, Maria; Galindo-Cardiel, Ivan; López-Soria, Sergio; Escribano, José M.; Reche, Pedro A.; Rodríguez, Fernando

    2012-01-01

    The lack of available vaccines against African swine fever virus (ASFV) means that the evaluation of new immunization strategies is required. Here we show that fusion of the extracellular domain of the ASFV Hemagglutinin (sHA) to p54 and p30, two immunodominant structural viral antigens, exponentially improved both the humoral and the cellular responses induced in pigs after DNA immunization. However, immunization with the resulting plasmid (pCMV-sHAPQ) did not confer protection against lethal challenge with the virulent E75 ASFV-strain. Due to the fact that CD8+ T-cell responses are emerging as key components for ASFV protection, we designed a new plasmid construct, pCMV-UbsHAPQ, encoding the three viral determinants above mentioned (sHA, p54 and p30) fused to ubiquitin, aiming to improve Class I antigen presentation and to enhance the CTL responses induced. As expected, immunization with pCMV-UbsHAPQ induced specific T-cell responses in the absence of antibodies and, more important, protected a proportion of immunized-pigs from lethal challenge with ASFV. In contrast with control pigs, survivor animals showed a peak of CD8+ T-cells at day 3 post-infection, coinciding with the absence of viremia at this time point. Finally, an in silico prediction of CTL peptides has allowed the identification of two SLA I-restricted 9-mer peptides within the hemagglutinin of the virus, capable of in vitro stimulating the specific secretion of IFNγ when using PBMCs from survivor pigs. Our results confirm the relevance of T-cell responses in protection against ASF and open new expectations for the future development of more efficient recombinant vaccines against this disease. PMID:23049728

  12. Migration confers winter survival benefits in a partially migratory songbird

    PubMed Central

    Zúñiga, Daniel; Gager, Yann; Kokko, Hanna; Fudickar, Adam Michael; Schmidt, Andreas; Naef-Daenzer, Beat; Wikelski, Martin

    2017-01-01

    To evolve and to be maintained, seasonal migration, despite its risks, has to yield fitness benefits compared with year-round residency. Empirical data supporting this prediction have remained elusive in the bird literature. To test fitness related benefits of migration, we studied a partial migratory population of European blackbirds (Turdus merula) over 7 years. Using a combination of capture-mark-recapture and radio telemetry, we compared survival probabilities between migrants and residents estimated by multi-event survival models, showing that migrant blackbirds had 16% higher probability to survive the winter compared to residents. A subsequent modelling exercise revealed that residents should have 61.25% higher breeding success than migrants, to outweigh the survival costs of residency. Our results support theoretical models that migration should confer survival benefits to evolve, and thus provide empirical evidence to understand the evolution and maintenance of migration. PMID:29157357

  13. The Alzheimer Disease Protective Mutation A2T Modulates Kinetic and Thermodynamic Properties of Amyloid-β (Aβ) Aggregation*

    PubMed Central

    Benilova, Iryna; Gallardo, Rodrigo; Ungureanu, Andreea-Alexandra; Castillo Cano, Virginia; Snellinx, An; Ramakers, Meine; Bartic, Carmen; Rousseau, Frederic; Schymkowitz, Joost; De Strooper, Bart

    2014-01-01

    Missense mutations in alanine 673 of the amyloid precursor protein (APP), which corresponds to the second alanine of the amyloid β (Aβ) sequence, have dramatic impact on the risk for Alzheimer disease; A2V is causative, and A2T is protective. Assuming a crucial role of amyloid-Aβ in neurodegeneration, we hypothesized that both A2V and A2T mutations cause distinct changes in Aβ properties that may at least partially explain these completely different phenotypes. Using human APP-overexpressing primary neurons, we observed significantly decreased Aβ production in the A2T mutant along with an enhanced Aβ generation in the A2V mutant confirming earlier data from non-neuronal cell lines. More importantly, thioflavin T fluorescence assays revealed that the mutations, while having little effect on Aβ42 peptide aggregation, dramatically change the properties of the Aβ40 pool with A2V accelerating and A2T delaying aggregation of the Aβ peptides. In line with the kinetic data, Aβ A2T demonstrated an increase in the solubility at equilibrium, an effect that was also observed in all mixtures of the A2T mutant with the wild type Aβ40. We propose that in addition to the reduced β-secretase cleavage of APP, the impaired propensity to aggregate may be part of the protective effect conferred by A2T substitution. The interpretation of the protective effect of this mutation is thus much more complicated than proposed previously. PMID:25253695

  14. Acylated and unacylated ghrelin confer neuroprotection to mesencephalic neurons.

    PubMed

    Wagner, Johanna; Vulinović, Franca; Grünewald, Anne; Unger, Marcus M; Möller, Jens C; Klein, Christine; Michel, Patrick P; Ries, Vincent; Oertel, Wolfgang H; Alvarez-Fischer, Daniel

    2017-12-04

    The polypeptide ghrelin is an endogenous ligand at the growth hormone secretagogue receptor 1a. To ghrelin multiple functions have been ascribed including promotion of gastrointestinal motility. Postprandial ghrelin levels have been reported to be reduced in patients suffering from Parkinson disease (PD). Experimental studies revealed neuroprotective effects of ghrelin in different PD models. The purpose of the present study was (i) to further elucidate the mechanism underlying the neuroprotective action of ghrelin and (ii) to determine whether these effects occur with both the acylated and the unacylated form. The study was conducted in primary mesencephalic cultures treated with mitochondrial complex I and complex II inhibitors. We show that protective effects of ghrelin against complex I inhibition with MPP + were independent of the acylation status of ghrelin, although acylated ghrelin appeared to be more potent. Protection by both forms was also observed when neurons were exposed to the complex II inhibitor 3-NP. Both forms led to higher oxygen consumption rates upon electron transport chain uncoupling, indicating that the two peptides may exert uncoupling effects themselves. We demonstrate that the rescue provided by ghrelin required calcium influx through L-type voltage-gated calcium channels. Whereas the protective effects of acylated ghrelin required receptor binding, effects of the unacylated form remained unaffected by treatment with a ghrelin receptor antagonist. Importantly, inhibition of ghrelin O-acyltransferase failed to reduce the activity of unacylated ghrelin. Overall, our data suggest that both acylated and unacylated ghrelin afford protection to dopamine neurons but through mechanisms that only partially overlap. Copyright © 2017 IBRO. Published by Elsevier Ltd. All rights reserved.

  15. Consumer Problems of Older Americans. New Directions for Government and Business. Background Papers and Recommendations from a Mini-Conference for the White House Conference on Aging (Washington, DC, January 29-30, 1980).

    ERIC Educational Resources Information Center

    National Retired Teachers Association, Washington, DC.

    These background papers and recommendations from a mini-conference on the consumer problems of older Americans and new directions that government and business should take to protect the consumer rights of the elderly address the following areas: credit, food, insurance, investments, prescription drugs and medical appliances, and primary health…

  16. Proceedings, 9th Central hardwood forest conference; 1993 March 8-10; West Lafayette, IN.

    Treesearch

    Andrew R. Gillespie; George R. Parker; Phillip E. Pope; George Rink

    1993-01-01

    Proceedings of the Ninth Central Hardwood Forest Conference includes one invited paper, 39 volunteer papers, and 13 volunteer poster abstracts. Presentations encompassed forest biology, protection, silviculture, ecology, inventory, yield, economics, marketing, wildlife management, soils, and nutrition of the central hardwood forests.

  17. 75 FR 12252 - Conference Call Meeting of the Manufactured Housing Consensus Committee

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-03-15

    ... DEPARTMENT OF HOUSING AND URBAN DEVELOPMENT [Docket No. FR-5406-N-01] Conference Call Meeting of...'s Consensus Committee Administering Organization, the National Fire Protection Association (NFPA... Housing Consensus Committee and the Administering Organization. The link can be found at: http://www.nfpa...

  18. 76 FR 2109 - Next Generation Risk Assessment Public Dialogue Conference

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-01-12

    ... ENVIRONMENTAL PROTECTION AGENCY [FRL-9246-7] Next Generation Risk Assessment Public Dialogue Conference Correction In notice document 2010-32977 appearing on page 82387 in the issue of Thursday, December 30, 2010, make the following correction: In the second column, below the signature date, the...

  19. MONTHLY HIGHLIGHTS (SUBSURFACE PROTECTION AND REMEDIATION DIVISION)

    EPA Science Inventory

    The Subsurface Protection and Remediation Division (SPRD) produces monthly highlights describing research accomplishments, involvement in current technical assistance activities, and staff participation in scientific meetings and conferences. Announcements of the release and avai...

  20. The host defense peptide beta-defensin 1 confers protection against Bordetella pertussis in newborn piglets.

    PubMed

    Elahi, Shokrollah; Buchanan, Rachelle M; Attah-Poku, Sam; Townsend, Hugh G G; Babiuk, Lorne A; Gerdts, Volker

    2006-04-01

    Innate immunity plays an important role in protection against respiratory infections in humans and animals. Host defense peptides such as beta-defensins represent major components of innate immunity. We recently developed a novel porcine model of pertussis, an important respiratory disease of young children and infants worldwide. Here, we investigated the role of porcine beta-defensin 1 (pBD-1), a porcine defensin homologue of human beta-defensin 2, in conferring protection against respiratory infection with Bordetella pertussis. In this model, newborn piglets were fully susceptible to infection and developed severe bronchopneumonia. In contrast, piglets older than 4 weeks of age were protected against infection with B. pertussis. Protection was associated with the expression of pBD-1 in the upper respiratory tract. In fact, pBD-1 expression was developmentally regulated, and the absence of pBD-1 was thought to contribute to the increased susceptibility of newborn piglets to infection with B. pertussis. Bronchoalveolar lavage specimens collected from older animals as well as chemically synthesized pBD-1 displayed strong antimicrobial activity against B. pertussis in vitro. Furthermore, in vivo treatment of newborn piglets with only 500 mug pBD-1 at the time of challenge conferred protection against infection with B. pertussis. Interestingly, pBD-1 displayed no bactericidal activity in vitro against Bordetella bronchiseptica, a closely related natural pathogen of pigs. Our results demonstrate that host defense peptides play an important role in protection against pertussis and are essential in modulating innate immune responses against respiratory infections.

  1. Immune Protection of Nonhuman Primates against Ebola Virus with Single Low-Dose Adenovirus Vectors Encoding Modified GPs

    PubMed Central

    Geisbert, Joan B; Shedlock, Devon J; Xu, Ling; Lamoreaux, Laurie; Custers, Jerome H. H. V; Popernack, Paul M; Yang, Zhi-Yong; Pau, Maria G; Roederer, Mario; Koup, Richard A; Goudsmit, Jaap; Jahrling, Peter B; Nabel, Gary J

    2006-01-01

    Background Ebola virus causes a hemorrhagic fever syndrome that is associated with high mortality in humans. In the absence of effective therapies for Ebola virus infection, the development of a vaccine becomes an important strategy to contain outbreaks. Immunization with DNA and/or replication-defective adenoviral vectors (rAd) encoding the Ebola glycoprotein (GP) and nucleoprotein (NP) has been previously shown to confer specific protective immunity in nonhuman primates. GP can exert cytopathic effects on transfected cells in vitro, and multiple GP forms have been identified in nature, raising the question of which would be optimal for a human vaccine. Methods and Findings To address this question, we have explored the efficacy of mutant GPs from multiple Ebola virus strains with reduced in vitro cytopathicity and analyzed their protective effects in the primate challenge model, with or without NP. Deletion of the GP transmembrane domain eliminated in vitro cytopathicity but reduced its protective efficacy by at least one order of magnitude. In contrast, a point mutation was identified that abolished this cytopathicity but retained immunogenicity and conferred immune protection in the absence of NP. The minimal effective rAd dose was established at 1010 particles, two logs lower than that used previously. Conclusions Expression of specific GPs alone vectored by rAd are sufficient to confer protection against lethal challenge in a relevant nonhuman primate model. Elimination of NP from the vaccine and dose reductions to 1010 rAd particles do not diminish protection and simplify the vaccine, providing the basis for selection of a human vaccine candidate. PMID:16683867

  2. Mechanisms of Cross-protection by Influenza Virus M2-based Vaccines.

    PubMed

    Lee, Yu-Na; Kim, Min-Chul; Lee, Young-Tae; Kim, Yu-Jin; Kang, Sang-Moo

    2015-10-01

    Current influenza virus vaccines are based on strain-specific surface glycoprotein hemagglutinin (HA) antigens and effective only when the predicted vaccine strains and circulating viruses are well-matched. The current strategy of influenza vaccination does not prevent the pandemic outbreaks and protection efficacy is reduced or ineffective if mutant strains emerge. It is of high priority to develop effective vaccines and vaccination strategies conferring a broad range of cross protection. The extracellular domain of M2 (M2e) is highly conserved among human influenza A viruses and has been utilized to develop new vaccines inducing cross protection against different subtypes of influenza A virus. However, immune mechanisms of cross protection by M2e-based vaccines still remain to be fully elucidated. Here, we review immune correlates and mechanisms conferring cross protection by M2e-based vaccines. Molecular and cellular immune components that are known to be involved in M2 immune-mediated protection include antibodies, B cells, T cells, alveolar macrophages, Fc receptors, complements, and natural killer cells. Better understanding of protective mechanisms by immune responses induced by M2e vaccination will help facilitate development of broadly cross protective vaccines against influenza A virus.

  3. Vaccination with human amniotic epithelial cells confer effective protection in a murine model of Colon adenocarcinoma.

    PubMed

    Tabatabaei, M; Mosaffa, N; Ghods, R; Nikoo, S; Kazemnejad, S; Khanmohammadi, M; Mirzadeghan, E; Mahmoudi, A R; Bolouri, M R; Falak, R; Keshavarzi, B; Ramezani, M; Zarnani, A H

    2018-04-01

    As a prophylactic cancer vaccine, human amniotic membrane epithelial cells (hAECs) conferred effective protection in a murine model of colon cancer. The immunized mice mounted strong cross-protective CTL and antibody responses. Tumor burden was significantly reduced in tumor-bearing mice after immunization with hAECs. Placental cancer immunotherapy could be a promising approach for primary prevention of cancer. In spite of being the star of therapeutic strategies for cancer treatment, the results of immunotherapeutic approaches are still far from expectations. In this regard, primary prevention of cancer using prophylactic cancer vaccines has gained considerable attention. The immunologic similarities between cancer development and placentation have helped researchers to unravel molecular mechanisms responsible for carcinogenesis and to take advantage of stem cells from reproductive organs to elicit robust anti-cancer immune responses. Here, we showed that vaccination of mice with human amniotic membrane epithelial cells (hAECs) conferred effective protection against colon cancer and led to expansion of systemic and splenic cytotoxic T cell population and induction of cross-protective cytotoxic responses against tumor cells. Vaccinated mice mounted tumor-specific Th1 responses and produced cross-reactive antibodies against cell surface markers of cancer cells. Tumor burden was also significantly reduced in tumor-bearing mice immunized with hAECs. Our findings pave the way for potential future application of hAECs as an effective prophylactic cancer vaccine. © 2017 UICC.

  4. The green vaccine: A global strategy to combat infectious and autoimmune diseases

    PubMed Central

    Davoodi-Semiromi, Abdoreza; Samson, Nalapalli; Daniell, Henry

    2009-01-01

    Plant derived oral green vaccines eliminate expenses associated with fermenters, purification, cold storage/transportation and sterile delivery. Green vaccines are expressed via the plant nuclear or chloroplast genomes. Chloroplast expression has advantages of hyper-expression of therapeutic proteins (10,000 copies of trans-gene per cell), efficient oral delivery and transgene containment via maternal inheritance. To date, 23 vaccine antigens against 16 different bacterial, viral or protozoan pathogens have been expressed in chloroplasts. Mice subcutaneously immunized with the chloroplast derived anthrax protective antigen conferred 100% protection against lethal doses of the anthrax toxin. Oral immunization (ORV) of F1-V antigens without adjuvant conferred greater protection (88%) against 50-fold lethal dose of aerosolized plague (Yersinia pestis) than subcutaneous (SQV) immunization (33%). Oral immunization of malarial vaccine antigens fused to the cholera antigen (CTB-AMA1/CTB-Msp1) conferred prolonged immunity (50% life span), 100% protection against cholera toxin challenge and inhibited proliferation of the malarial parasite. Protection was correlated with antigen-specific titers of intestinal, serum IgA & IgG1 in ORV and only IgG1 in SQV mice, but no other immunoglobulin. High level expression in edible plant chloroplasts ideal for oral delivery and long-term immunity observed should facilitate development of low cost human vaccines for large populations, at times of outbreak. PMID:19430198

  5. 76 FR 72902 - Emerging Technology and Research Advisory Committee; Notice of Partially Closed Meeting

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-11-28

    ... Controls on the conduct of U.S. science and technology activities in the United States. 2. Public Comments... serve basis. To join the conference, submit inquiries to Ms. Yvette Springer at [[Page 72903

  6. Understanding how social networking influences perceived satisfaction with conference experiences

    USGS Publications Warehouse

    van Riper, Carena J.; van Riper, Charles; Kyle, Gerard T.; Lee, Martha E.

    2013-01-01

    Social networking is a key benefit derived from participation in conferences that bind the ties of a professional community. Building social networks can lead to satisfactory experiences while furthering participants' long- and short-term career goals. Although investigations of social networking can lend insight into how to effectively engage individuals and groups within a professional cohort, this area has been largely overlooked in past research. The present study investigates the relationship between social networking and satisfaction with the 10th Biennial Conference of Research on the Colorado Plateau using structural equation modelling. Results partially support the hypothesis that three dimensions of social networking – interpersonal connections, social cohesion, and secondary associations – positively contribute to the performance of various conference attributes identified in two focus group sessions. The theoretical and applied contributions of this paper shed light on the social systems formed within professional communities and resource allocation among service providers.

  7. Fifteenth Space Simulation Conference: Support the Highway to Space Through Testing

    NASA Technical Reports Server (NTRS)

    Stecher, Joseph (Editor)

    1988-01-01

    The Institute of Environmental Sciences Fifteenth Space Simulation Conference, Support the Highway to Space Through Testing, provided participants a forum to acquire and exchange information on the state-of-the-art in space simulation, test technology, thermal simulation and protection, contamination, and techniques of test measurements.

  8. 78 FR 29318 - Notice of Public Meeting of the Assembly of the Administrative Conference of the United States

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-05-20

    ...: articulation of questions to be informed by science information; attribution for agency personnel who... FURTHER INFORMATION CONTACT: Shawne McGibbon, General Counsel (Designated Federal Officer), Administrative...-480-2088; email [email protected] . SUPPLEMENTARY INFORMATION: The Administrative Conference of the...

  9. Fourteenth Space Simulation Conference: Testing for a Permanent Presence in Space

    NASA Technical Reports Server (NTRS)

    Stecher, Joseph L., III (Editor)

    1986-01-01

    The Institute of Environmental Sciences Fourteenth Space Simulation Conference, Testing for a Permanent Presence in Space, provided participants a forum to acquire and exchange information on the state-of-the-art in space simulation, test technology, thermal simulation, and protection, contamination, and techniques of test measurements.

  10. Proceedings: North American forest insect work conference.

    Treesearch

    D.C. Allen; L.P. Abrahamson

    1992-01-01

    A proceedings of a conference held to stimulate interaction among people working in areas of forest protection and silviculture and on issues of national and international concern relative to forest insect and disease management, education, and research. National issues addressed were forest productivity, stewardship, biological diversity, and new perspectives and how...

  11. 76 FR 38409 - Conference Call Meeting of the Manufactured Housing Consensus Committee

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-06-30

    ... DEPARTMENT OF HOUSING AND URBAN DEVELOPMENT [Docket No. FR-5496-N-03] Conference Call Meeting of... Committee Administering Organization, the National Fire Protection Association (NFPA). Interested parties... Committee and the Administering Organization. The link can be found at: http://www.nfpa.org/categoryList.asp...

  12. The 68th Session of the International Labour Conference, June 1982.

    ERIC Educational Resources Information Center

    International Labour Review, 1982

    1982-01-01

    This year's session adopted new standards such as maintenance of migrant workers' social security rights, protection of workers against unjustified dismissal, and vocational rehabilitation. This article describes the conference's examination of these technical agenda items, and its annual review of the application of Conventions and…

  13. 78 FR 34035 - Forest Resource Coordinating Committee

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-06-06

    ... morning of each conference call. Written comments may be submited by mail to Attn: Maya Solomon, 1400... Maya Solomon via phone at 202-205-1376 or via email at [email protected] prior to the conference call to facilitate distribution of support materials. FOR FURTHER INFORMATION CONTACT: Maya Solomon...

  14. 2008 Tactical Wheeled Vehicles Conference (TWV) Volume 1

    DTIC Science & Technology

    2008-02-05

    additional LSAC cabs FMTV Gunners Restraint (2,022 LSAC; 1,855 RACK) Counterweight bumper for M1078 Cargo with LSAC Cab and GPK 3 Jan 08NDIA TWV Conference...Objective Gunner Protection Kits to support Up-Armored HMMWV’s GPK Upgrade Program. Partnerships: Ensured partnerships with commercial manufacturers

  15. FORUM ON INNOVATIVE HAZARDOUS WASTE TREATMENT TECHNOLOGIES: DOMESTIC AND INTERNATIONAL. Third, Dallas, Texas, June 11-13, 1991 - TECHNICAL PAPERS

    EPA Science Inventory

    On June 11 -13,1991, the U.S. Environmental Protection Agency's Technology Innovation Office and Risk Reduction Engineering Laboratory hosted an international conference in Dallas, TX, to exchange solutions to hazardous waste treatment problems. This conference, the Third Forum...

  16. Consumer Protection in Postsecondary Education: A National Invitational Conference. Program Handbook.

    ERIC Educational Resources Information Center

    Albanese, Frank N.; And Others

    Twelve preconference papers and background articles that identify issues in consumer protection in postsecondary education are presented. The papers and articles include "Recruitment Practices of Postsecondary Schools" (Frank N. Albanese); "The Role of a State Agency in Consumer Protection" (Philip F. Ashler); "The Three R's of Postsecondary…

  17. Protective Predictors of Alcohol Use Trajectories among Canadian Aboriginal Youth

    ERIC Educational Resources Information Center

    Rawana, Jennine S.; Ames, Megan E.

    2012-01-01

    Some Aboriginal youth are at disproportionate risk of using substances and developing abuse and dependence disorders. However, not all Aboriginal youth misuse substances and limited research has examined the protective factors conferring against substance use among these youth. The present study aimed to identify protective factors related to the…

  18. Development of a broadly protective modified-live virus vaccine candidate against porcine reproductive and respiratory syndrome virus

    USDA-ARS?s Scientific Manuscript database

    Modified-live virus (MLV) vaccines are widely used to protect pigs against porcine reproductive and respiratory syndrome virus (PRRSV). However, current MLV vaccines do not confer adequate levels of heterologous protection, presumably due to the substantial genetic diversity of PRRSV isolates circul...

  19. 40 CFR 304.24 - Intervention and withdrawal.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 27 2010-07-01 2010-07-01 false Intervention and withdrawal. 304.24 Section 304.24 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SUPERFUND, EMERGENCY... Intervention and withdrawal. (a)(1) No later than thirty days prior to the pre-hearing conference (see § 304.31...

  20. 40 CFR 304.24 - Intervention and withdrawal.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 28 2014-07-01 2014-07-01 false Intervention and withdrawal. 304.24 Section 304.24 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SUPERFUND, EMERGENCY... Intervention and withdrawal. (a)(1) No later than thirty days prior to the pre-hearing conference (see § 304.31...

  1. 40 CFR 304.24 - Intervention and withdrawal.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 40 Protection of Environment 29 2012-07-01 2012-07-01 false Intervention and withdrawal. 304.24 Section 304.24 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SUPERFUND, EMERGENCY... Intervention and withdrawal. (a)(1) No later than thirty days prior to the pre-hearing conference (see § 304.31...

  2. 40 CFR 304.24 - Intervention and withdrawal.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 Protection of Environment 28 2011-07-01 2011-07-01 false Intervention and withdrawal. 304.24 Section 304.24 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SUPERFUND, EMERGENCY... Intervention and withdrawal. (a)(1) No later than thirty days prior to the pre-hearing conference (see § 304.31...

  3. 40 CFR 304.24 - Intervention and withdrawal.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 29 2013-07-01 2013-07-01 false Intervention and withdrawal. 304.24 Section 304.24 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SUPERFUND, EMERGENCY... Intervention and withdrawal. (a)(1) No later than thirty days prior to the pre-hearing conference (see § 304.31...

  4. Gut Immune Maturation Depends on Colonization with a Host-Specific Microbiota

    PubMed Central

    Chung, Hachung; Pamp, Sünje J.; Hill, Jonathan A.; Surana, Neeraj K.; Edelman, Sanna M.; Troy, Erin B.; Reading, Nicola C.; Villablanca, Eduardo J.; Wang, Sen; Mora, Jorge R.; Umesaki, Yoshinori; Mathis, Diane; Benoist, Christophe; Relman, David A.; Kasper, Dennis L.

    2012-01-01

    SUMMARY Gut microbial induction of host immune maturation exemplifies host-microbe mutualism. We colonized germ-free (GF) mice with mouse microbiota (MMb) or human microbiota (HMb) to determine whether small intestinal immune maturation depends on a coevolved host-specific microbiota. Gut bacterial numbers and phylum abundance were similar in MMb and HMb mice, but bacterial species differed, especially the Firmicutes. HMb mouse intestines had low levels of CD4+ and CD8+ T cells, few proliferating T cells, few dendritic cells, and low antimicrobial peptide expression–all characteristics of GF mice. Rat microbiota also failed to fully expand intestinal T cell numbers in mice. Colonizing GF or HMb mice with mouse-segmented filamentous bacteria (SFB) partially restored T cell numbers, suggesting that SFB and other MMb organisms are required for full immune maturation in mice. Importantly, MMb conferred better protection against Salmonella infection than HMb. A host-specific microbiota appears to be critical for a healthy immune system. PMID:22726443

  5. A novel recombinant Leishmania donovani p45, a partial coding region of methionine aminopeptidase, generates protective immunity by inducing a Th1 stimulatory response against experimental visceral leishmaniasis.

    PubMed

    Gupta, Reema; Kushawaha, Pramod K; Tripathi, Chandra Dev Pati; Sundar, Shyam; Dube, Anuradha

    2012-05-01

    The development of a vaccine against visceral leishmaniasis (VL) conferring long-lasting immunity remains a challenge. Identification and proteomic characterization of parasite proteins led to the detection of p45, a member of the methionine aminopeptidase family. To our knowledge the present study is the first known report that describes the molecular and immunological characterization of p45. Recombinant Leishmania donovani p45 (rLdp45) induced cellular responses in cured hamsters and generated Th1-type cytokines from peripheral blood mononuclear cells of cured/endemic VL patients. Immunization with rLdp45 exerted considerable prophylactic efficacy (∼85%) supported by an increase in mRNA expression of iNOS, IFN-γ, TNF-α and IL-12 and decrease in TGF-β and IL-4, indicating its potential as a vaccine candidate against VL. Copyright © 2012. Published by Elsevier Ltd.

  6. The bright and the dark side of human antibody responses to flaviviruses: lessons for vaccine design.

    PubMed

    Rey, Félix A; Stiasny, Karin; Vaney, Marie-Christine; Dellarole, Mariano; Heinz, Franz X

    2018-02-01

    Zika and dengue viruses belong to the Flavivirus genus, a close group of antigenically related viruses that cause significant arthropod-transmitted diseases throughout the globe. Although infection by a given flavivirus is thought to confer lifelong protection, some of the patient's antibodies cross-react with other flaviviruses without cross-neutralizing. The original antigenic sin phenomenon may amplify such antibodies upon subsequent heterologous flavivirus infection, potentially aggravating disease by antibody-dependent enhancement (ADE). The most striking example is provided by the four different dengue viruses, where infection by one serotype appears to predispose to more severe disease upon infection by a second one. A similar effect was postulated for sequential infections with Zika and dengue viruses. In this review, we analyze the molecular determinants of the dual antibody response to flavivirus infection or vaccination in humans. We highlight the role of conserved partially cryptic epitopes giving rise to cross-reacting and poorly neutralizing, ADE-prone antibodies. We end by proposing a strategy for developing an epitope-focused vaccine approach to avoid eliciting undesirable antibodies while focusing the immune system on producing protective antibodies only. © 2017 Institut Pasteur. Published under the terms of the CC BY NC ND 4.0 license.

  7. Aerothermodynamics and planetary entry; Aerospace Sciences Meeting, 18th, Pasadena, CA, January 14-16, 1980 and Thermophysics Conference, 15th, Snowmass, CO, July 14-16, 1980, Technical Papers

    NASA Astrophysics Data System (ADS)

    Crosbie, A. L.

    Aspects of aerothermodynamics are considered, taking into account aerodynamic heating for gaps in laminar and transitional boundary layers, the correlation of convection heat transfer for open cavities in supersonic flow, the heat transfer and pressure on a flat plate downstream of heated square jet in a Mach 0.4 to 0.8 crossflow, the effect of surface roughness character on turbulent reentry heating, three-dimensional protuberance interference heating in high-speed flow, and hypersonic flow over small span flaps in a thick turbulent boundary layer. Questions of thermal protection are investigated, giving attention to thermochemical ablation of tantalum carbide loaded carbon-carbons, the catalytic recombination of nitrogen and oxygen on high-temperature reusable surface insulation, particle acceleration using a helium arc heater, a temperature and ablation optical sensor, a wind-tunnel study of ascent heating of multiple reentry vehicle configurations, and reentry vehicle soft-recovery techniques. Subjects examined in connection with a discussion of planetary entry are related to a thermal protection system for the Galileo mission atmospheric entry probe, the viscosity of multicomponent partially ionized gas mixtures associated with Jovian entry, coupled laminar and turbulent flow solutions for Jovian entry, and a preliminary aerothermal analysis for Saturn entry.

  8. Ecological effects of full and partial protection in the crowded Mediterranean Sea: a regional meta-analysis.

    PubMed

    Giakoumi, Sylvaine; Scianna, Claudia; Plass-Johnson, Jeremiah; Micheli, Fiorenza; Grorud-Colvert, Kirsten; Thiriet, Pierre; Claudet, Joachim; Di Carlo, Giuseppe; Di Franco, Antonio; Gaines, Steven D; García-Charton, José A; Lubchenco, Jane; Reimer, Jessica; Sala, Enric; Guidetti, Paolo

    2017-08-21

    Marine protected areas (MPAs) are a cornerstone of marine conservation. Globally, the number and coverage of MPAs are increasing, but MPA implementation lags in many human-dominated regions. In areas with intense competition for space and resources, evaluation of the effects of MPAs is crucial to inform decisions. In the human-dominated Mediterranean Sea, fully protected areas occupy only 0.04% of its surface. We evaluated the impacts of full and partial protection on biomass and density of fish assemblages, some commercially important fishes, and sea urchins in 24 Mediterranean MPAs. We explored the relationships between the level of protection and MPA size, age, and enforcement. Results revealed significant positive effects of protection for fisheries target species and negative effects for urchins as their predators benefited from protection. Full protection provided stronger effects than partial protection. Benefits of full protection for fish biomass were only correlated with the level of MPA enforcement; fish density was higher in older, better enforced, and -interestingly- smaller MPAs. Our finding that even small, well-enforced, fully protected areas can have significant ecological effects is encouraging for "crowded" marine environments. However, more data are needed to evaluate sufficient MPA sizes for protecting populations of species with varying mobility levels.

  9. The sleep-modulating peptide orexin-B protects midbrain dopamine neurons from degeneration, alone or in cooperation with nicotine.

    PubMed

    Guerreiro, Serge; Florence, Clélia; Rousseau, Erwann; Hamadat, Sabah; Hirsch, Etienne C; Michel, Patrick P

    2015-01-01

    To determine whether orexinergic hypothalamic peptides can influence the survival of brainstem dopamine (DA) neurons, we used a model system of rat midbrain cultures in which DA neurons degenerate spontaneously and progressively as they mature. We established that orexin (OX)-B provides partial but significant protection to spontaneously dying DA neurons, whereas the homologous peptide OXA has only marginal effects. Importantly, DA neurons rescued by OXB accumulated DA efficiently by active transport, suggesting that they were functional. G-protein-coupled OX1 and OX2 receptors were both present on DA neurons, but the protective effect of OXB was attributable solely to OX2 receptors; a selective inhibitor of this receptor subtype, N-ethyl-2-[(6-methoxy-3-pyridinyl)[(2-methylphenyl)sulfonyl]amino]-N-(3-pyridinylmethyl)-acetamide (EMPA), suppressed this effect, whereas a selective agonist, [Ala(11), d-Leu(15)]OXB, reproduced it. Survival promotion by OXB required intracellular calcium mobilization via inositol-1,4,5-triphosphate and ryanodine receptors. Nicotine, a well known neuroprotective molecule for DA neurons, improved OXB-mediated rescue through the activation of α-bungarotoxin-sensitive (presumably α7) nicotinic receptors, although nicotine had no effect on its own. Altogether, our data suggest that the loss of hypothalamic orexinergic neurons that occurs in Parkinson's disease might confer an increased vulnerability to midbrain DA neurons in this disorder. Copyright © 2015 by The American Society for Pharmacology and Experimental Therapeutics.

  10. Building physiological toughness: Some aversive events during extinction may attenuate return of fear.

    PubMed

    Culver, Najwa C; Stevens, Stephan; Fanselow, Michael S; Craske, Michelle G

    2018-03-01

    Although exposure therapy is an effective treatment for anxiety disorders, fear sometimes returns following successful therapy. Recent literature in animal models indicates that incorporating some aversive events into extinction training may offset these return of fear effects. The effect of occasional reinforced extinction trials was investigated in a sample of thirty-nine participants using a fear conditioning and extinction paradigm. Participants either underwent traditional extinction procedures during which the conditional stimulus which had been paired with the unconditional stimulus (US) during acquisition training (CS+) was presented alone with no presentations of the US or partially reinforced extinction during which there were several unpredicted CS+/US pairings. As measured by skin conductance responses, physiological fear responding remained elevated during extinction for participants who experienced partially reinforced extinction; however, these participants demonstrated protection from rapid reacquisition effects. Results from the subjective US-expectancy ratings did not provide evidence of protection against rapid reacquisition in the partially reinforced extinction group; however, there was evidence of protection from spontaneous recovery effects. Lastly, as measured by valence ratings, it was unclear whether partially reinforced extinction provided protection from fear recovery effects. Although participants who experienced partially reinforced extinction demonstrated protection from rapid reacquisition as measured by skin conductance responses, they also demonstrated significantly higher levels of physiological fear responding during extinction which made the results of the spontaneous recovery test more difficult to interpret. Occasional CS-US pairings during extinction may protect against return of fear effects. Clinical implications are discussed. Published by Elsevier Ltd.

  11. Vaccine-induced protection against anthrax in cheetah (Acinonyx jubatus) and black rhinoceros (Diceros bicornis).

    PubMed

    Turnbull, P C B; Tindall, B W; Coetzee, J D; Conradie, C M; Bull, R L; Lindeque, P M; Huebschle, O J B

    2004-09-03

    Institution of a policy of vaccination in endangered species with a vaccine not previously administered to it cannot be undertaken lightly. This applies even more in the case of cheetah (Acinonyx jubatus) with their unusually monomorphic gene pool and the potential restrictions this places on their immune responses. However, the recently observed mortalities from anthrax in these animals in the Etosha National Park, Namibia, made it imperative to evaluate vaccination. Black rhinoceros (Diceros bicornis), another endangered species in the park, have been vaccinated for over three decades but the effectiveness of this has never been evaluated. Passive protection tests in A/J mice using sera from 12 cheetahs together with enzyme immunoassay indicated that cheetah are able to mount seemingly normal primary and secondary humoral immune responses to the Sterne 34F2 live spore livestock vaccine. Overall protection rates in mice injected with the sera rose and fell in concert with rises and declines in antibody titres, although fine analysis showed that the correlation between titre and protection was complex. Once a high level of protection (96% of mice 1 month after a second booster in the cheetahs) had been achieved, the duration of substantial protection appeared good (60% of the mice 5 months after the second booster). Protection conferred on mice by sera from three of four vaccinated rhino was almost complete, but, obscurely, none of the mice receiving serum from the fourth rhino were protected. Sera from three park lions with naturally acquired high antibody titres, included as controls, also conferred high levels of protection. For the purposes of wildlife management, the conclusions were that vaccination of cheetah with the standard animal anthrax vaccine causes no observable ill effect in the animals and does appear to confer protective immunity. At least one well-separated booster does appear to be desirable. Vaccination of rhino also appears to be justified from the limited data obtained.

  12. 11th National Conference on Science, Policy, and the Environment: Our Changing Oceans

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Peter Saundry

    2012-04-17

    On January 19-21, 2011, The National Council for Science and the Environment (NCSE) successfully convened its 11th National Conference on Science, Policy and the Environment: Our Changing Oceans in Washington, DC at the Ronald Reagan Building and International Trade Center. Over 1,247 participants attended the conference, representing federal, state and local governments, university and colleges across the US, civil society organizations, the business community, and international entities. In addition, the conference was webcast to an audience across several states. The conference provided a forum to examine the profound changes our ocean will undergo over the next 25-50 years and sharemore » various perspectives on the new research, tools, and policy initiatives to protect and sustain our ocean. Conference highlights and recommendations are available to the public on NCSE's conference website, www.OurChangingOceans.org.« less

  13. Japanese encephalitis virus replicon-based vaccine expressing enterovirus-71 epitope confers dual protection from lethal challenges.

    PubMed

    Huang, Yi-Ting; Liao, Jia-Teh; Yen, Li-Chen; Chang, Yung-Kun; Lin, Yi-Ling; Liao, Ching-Len

    2015-09-11

    To construct safer recombinant flavivirus vaccine, we exploited Japanese encephalitis virus (JEV) replicon-based platform to generate single-round infectious particles (SRIPs) that expressed heterologous neutralizing epitope SP70 derived from enterovirus-71 (EV71). Such pseudo-infectious virus particles, named SRIP-SP70, although are not genuine viable viruses, closely mimic live virus infection to elicit immune responses within one round of viral life cycle. We found that, besides gaining of full protection to thwart JEV lethal challenge, female outbred ICR mice, when were immunized with SRIP-SP70 by prime-boost protocol, could not only induce SP70-specific and IgG2a predominant antibodies but also provide their newborns certain degree of protection against EV71 lethal challenge. Our results therefore exemplify that this vaccination strategy could indeed confer an immunized host a dual protective immunity against subsequent lethal challenge from JEV or EV71.

  14. [The protective efficacy of BCG against leprosy in São Paulo, Brazil].

    PubMed

    Lombardi, C; Pedrazzani, E S; Pedrazzani, J C; Ferreira Filho, P; Zicker, F

    1995-11-01

    The protection against leprosy conferred by BCG vaccination was evaluated in a case-control study. Selected for the study were 97 patients under 16 years of age who had been diagnosed with leprosy (cases) and 385 healthy persons (controls), who were matched according to sex, age, place of residence, and type of contact (intra- or extradomicilliary). The cases were selected from a register of active cases as well as a series of new leprosy patients treated in 50 centers in the city of São Paulo, Brasil. To estimate the protective effect of BCG, the prevalences of BCG scars among cases and controls were compared. The presence of one or more scars was associated with a protective efficacy of 90% (95% confidence interval: 78%-96%). Stratified analysis by age group, sex, socioeconomic level, and clinical form of leprosy did not reveal any important differences in the protection conferred by the vaccine. The significance of these findings and the appropriateness of using BCG in leprosy control programs is discussed.

  15. Fake news. Fake journals. Fake conferences. What we can do.

    PubMed

    Darbyshire, Philip

    2017-12-05

    It is time to take the gloves off in the fight against predatory publishers, predatory journals and the ever-increasing number of predatory conferences. There was a time when I believed that education and awareness, coupled with some basic policy 'signals' would be enough to bring most Universities and Schools of Nursing & Midwifery to the table (Darbyshire, McKenna, Lee, & East, 2016). It is quite touching that I could still be this naive at my age. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  16. NATIONAL CONFERENCE ON URBAN STORM WATER: ENHANCING PROGRAMS AT THE LOCAL LEVEL - PROCEEDINGS CHICAGO, IL FEBRUARY 17-20, 2003

    EPA Science Inventory

    A wide array of effective storm water management and resource protection tools have been developed for urban environments, but their implementation continues to be hampered by a lack of technology transfer opportunities. At the national conference Urban Storm Water: Enhancing Pro...

  17. Proceedings, 16th central hardwood forest conference

    Treesearch

    Douglass F. Jacobs; Charles H., eds. Michler

    2008-01-01

    Proceedings of the 16th Central Hardwood Forest Conference held April 8-9, 2008, in West Lafayette, IN. Includes 64 papers pertaining to forest regeneration and propagation, forest products, ecology and forest dynamics, human dimensions and economics, forest biometrics and modeling, silviculture and genetics, forest health and protection, and soil and mineral nutrition...

  18. PHYTOREMEDIATION: STATE OF THE SCIENCE CONFERENCE AND OTHER DEVELOPMENTS. EDITORIAL INTRODUCTION AND SPECIAL COMMENTARY

    EPA Science Inventory

    It is a pleasure to present six papers in this issue, selected from presentations at the U.S. Environmental Protection Agency (EPA) Conference, Phytoremediation: State of the Science held May 1-2, 2000 in Boston, MA, USA. These papers highlight some of the many advances reported...

  19. Proceedings, 15th central hardwood forest conference

    Treesearch

    David S. Buckley; Wayne K. Clatterbuck; [Editors

    2007-01-01

    Proceedings of the 15th central hardwood forest conference held February 27–March 1, 2006, in Knoxville, TN. Includes 86 papers and 30 posters pertaining to forest health and protection, ecology and forest dynamics, natural and artificial regeneration, forest products, wildlife, site classification, management and forest resources, mensuration and models, soil and...

  20. Eighteenth annual offshore technology conference. Volume 1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Not Available

    1986-01-01

    These sixty papers were given at a conference on offshore technology. Topics covered include friction effects of driving piles into sea beds of various compositions, wave forces on offshore platforms, stability, materials testing of various components such as plates, legs, wellheads, pipe joints, and protection of offshore platforms against ice and collision with icebergs.

  1. 75 FR 34734 - Improving Market and Planning Efficiency Through Improved Software; Notice of Agenda and...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-06-18

    ... Market and Planning Efficiency Through Improved Software; Notice of Agenda and Procedures for Staff Technical Conference June 10, 2010. This notice establishes the agenda and procedures for the staff[email protected] . Kimberly D. Bose, Secretary. Agenda for AD10-12 Staff Technical Conference on Enhanced Power...

  2. Report of the 2014 Cent Gardes HIV Vaccine Conference-Part 2: Cell-mediated immunity, mucosal protection, and clinical trials: Fondation Mérieux Conference Center, Veyrier du Lac, France, 5-7 October, 2014.

    PubMed

    Girard, Marc P; Picot, Valentina; Longuet, Christophe; Nabel, Gary J

    2015-08-07

    The 2014 Cent Gardes Conference took place on October 5-7, 2014, at the Fondation Mérieux Conference Center, on the shores of the Annecy Lake and aimed to review the progress and promise of HIV vaccines. The elicitation of broadly neutralizing antibodies (bNAbs), their use in passive immunization, as well as their genetic delivery (vector immunoprophylaxis) by a recombinant Adenovirus-associated virus (AAV) vector were reviewed in a preceding article [1]. Approaches to the elicitation of long-lasting T cell or mucosal immunity were also discussed and are now reviewed here. The possibility of eliciting mucosal IgAs was discussed, since it was demonstrated that transcytosis-blocking IgAs can protect monkeys against repeated vaginal challenge with a pathogenic chimeric simian and human immunodeficiency virus (SHIV). The possibility of purging the HIV reservoirs from HIV-infected persons and developing a cure of the disease was also discussed. Copyright © 2015. Published by Elsevier Ltd.. All rights reserved.

  3. Intestinal epithelial cell secretion of RELM-beta protects against gastrointestinal worm infection

    USDA-ARS?s Scientific Manuscript database

    IL-4 and IL-13 protect against parasitic helminths, but little is known about the mechanism of host protection. We show that IL-4/IL-13 confer immunity against worms by inducing intestinal epithelial cells (IEC) to differentiate into goblet cells that secrete resistin-like molecule beta (RELMB). R...

  4. 76 FR 76937 - Emerging Technology and Research Advisory Committee; Notice of Partially Closed Meeting-Room Change

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-12-09

    ... of Export Controls on the conduct of U.S. science and technology activities in the United States. 2... come, first serve basis. To join the conference, submit inquiries to Ms. Yvette Springer at Yvette...

  5. Telecommunications Policy Research Conference. Standards and Standardization Section. Papers.

    ERIC Educational Resources Information Center

    Telecommunications Policy Research Conference, Inc., Washington, DC.

    These three papers consider various models and mechanisms for the achievement of industrial standardization. The first, "Duopoly Compatibility Standards with Partial Cooperation and Standards Leadership" (Sanford V. Berg, University of Florida) presents a model of duopolists producing differentiated substitutes, and considers the…

  6. Interleukin-12- and Gamma Interferon-Dependent Protection against Malaria Conferred by CpG Oligodeoxynucleotide in Mice

    PubMed Central

    Gramzinski, Robert A.; Doolan, Denise L.; Sedegah, Martha; Davis, Heather L.; Krieg, Arthur M.; Hoffman, Stephen L.

    2001-01-01

    Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-γ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-γ. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria. PMID:11179339

  7. International Conference: Milky Way Surveys: The Structure and Evolution of Our Galaxy

    NASA Technical Reports Server (NTRS)

    Clemens, Dan

    2004-01-01

    We were granted NASA support for partial sponsorship of an international conference on Galactic science, held June 15-17, 2003 and hosted by the Institute for Astrophysical Research at Boston University. This conference, entitled 'Milky Way Surveys: The Structure and Evolution of Our Galaxy' drew some 125 scientific experts, researchers, and graduate students to Boston to: (1) Present large area survey plans and findings; (2) Discuss important remaining questions and puzzles in Galactic science; and (3) To inform and excite students and researchers about the potential for using large area survey databases to address key Galactic science questions. An international Scientific Organizing Committee for this conference crafted a tightly packed two-day conference designed to highlight many recent and upcoming large area surveys (including 2MASS, SDSS, MSX, VLA-HI, GRS, and SIRTF/GLIMPSE) and current theoretical understandings and questions. By bringing together experts in the conduct of Galactic surveys and leading theorists, new ways of attacking long-standing scientific questions were encouraged. The titles of most of the talks and posters presented are attached to the end of this report.

  8. A Recombinant Rabies Virus Encoding Two Copies of the Glycoprotein Gene Confers Protection in Dogs against a Virulent Challenge

    PubMed Central

    Sun, Zhaojin; Chen, Jing; Ai, Jun; Dun, Can; Fu, Zhen F.; Niu, Xuefeng; Guo, Xiaofeng

    2014-01-01

    The rabies virus (RABV) glycoprotein (G) is the principal antigen responsible for the induction of virus neutralizing antibodies (VNA) and is the major modality of protective immunity in animals. A recombinant RABV HEP-Flury strain was generated by reverse genetics to encode two copies of the G-gene (referred to as HEP-dG). The biological properties of HEP-dG were compared to those of the parental virus (HEP-Flury strain). The HEP-dG recombinant virus grew 100 times more efficiently in BHK-21 cell than the parental virus, yet the virulence of the dG recombinant virus in suckling mice was lower than the parental virus. The HEP-dG virus can improve the expression of G-gene mRNA and the G protein and produce more offspring viruses in cells. The amount of G protein revealed a positive relationship with immunogenicity in mice and dogs. The inactivated HEP-dG recombinant virus induced higher levels of VNA and conferred better protection against virulent RABV in mice and dogs than the inactivated parental virus and a commercial vaccine. The protective antibody persisted for at least 12 months. These data demonstrate that the HEP-dG is stable, induces a strong VNA response and confers protective immunity more effectively than the RABV HEP-Flury strain. HEP-dG could be a potential candidate in the development of novel inactivated rabies vaccines PMID:24498294

  9. Alum adjuvanted rabies DNA vaccine confers 80% protection against lethal 50 LD50 rabies challenge virus standard strain.

    PubMed

    Garg, Rajni; Kaur, Manpreet; Saxena, Ankur; Prasad, Rajendra; Bhatnagar, Rakesh

    2017-05-01

    Rabies is a serious concern world-wide. Despite availability of rabies vaccines for long; their efficacy, safety, availability and cost effectiveness has been a tremendous issue. This calls for improvement of rabies vaccination strategies. DNA vaccination has immense potential in this regard. The DNA vaccine pgp.LAMP-1 conferred 60% protection to BALB/c mice against 20 LD 50 rabies challenge virus standard (CVS) strain challenge. Upon supplementation with Emulsigen-D, the vaccine formulation conferred complete protection against lethal challenge. To assess the feasibility of this vaccine formulation for human use, it was tested along with other FDA approved adjuvants, namely, Alum, Immuvac, Montanide ISA720 VG. Enhanced immune response correlated with high IgG antibody titer, Th2 biased response with a high level of rabies virus neutralizing antibodies (RVNAs) and IgG1/IgG2a ratio >1, observed upon alum supplementation of the rabies DNA vaccine. The total IgG antibody titer was 2IU/ml and total RVNA titer was observed to be 4IU/ml which is eight times higher than the minimum protective titer recommended by WHO. Furthermore, it conferred 80% protection against challenge with 50 LD 50 of the rabies CVS strain, conducted in compliance with the potency test for rabies recommended by the National Institutes of Health (NIH), USA. Previously, we have established pre-clinical safety of this vaccine as per the guidelines of Schedule Y, FDA as well as The European Agency for evaluation of Medicinal Products. The vaccine showed no observable toxicity at the site of injection as well as at systemic level in Wistar rats when administered with 10X recommended dose. Therefore, supplementation of rabies DNA vaccine, pgp.LAMP-1 with alum would lead to development of a non-toxic, efficacious, stable and affordable vaccine that can be used to combat high numbers of fatal rabies infections tormenting developing countries. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Protective Immunity to Ricin Toxin Conferred by Antibodies against the Toxin’s Binding Subunit (RTB)

    PubMed Central

    Yermakova, Anastasiya; Mantis, Nicholas J.

    2011-01-01

    The B subunit (RTB) of ricin toxin is a galactose-/N-acetyl galactosamine-specific lectin that promotes attachment and entry of ricin into host cells. RTB is also the archetype of the so-called R-type lectin family, whose members include haemagglutinins of botulinum neurotoxin (BoNT) progenitor toxins, as well as the binding subunits of cytolethal distending toxins. Although RTB is an appealing subunit vaccine candidate, as well as a potential target for immunotherapeutics, the degree to which RTB immunization elicits protective antibodies against ricin toxin remains unresolved. To address this issue, groups of mice were immunized with RTB and then challenged with 5xLD50s of ricin administered intraperitoneally. Despite high RTB-specific serum antibody titers, groups of RTB immunized mice were only partially immune to ricin challenge. Analysis of a collection of RTB-specific B cell hybridomas suggested that only a small fraction of antibodies against RTB have demonstrable neutralizing activity. Two RTB-specific neutralizing monoclonal IgG1 antibodies, 24B11 and SylH3, when passively administered to mice, were sufficient to protect the animals against a 5xLD50 dose of ricin. Both 24B11 and SylH3 blocked ricin attachment to terminal galactose residues and prevented toxin binding to the surfaces of bone marrow-derived macrophages (BMM), suggesting that they function by steric hindrance and recognize epitopes located on RTB’s carbohydrate recognition sub-domains (1α or 2γ). These data raise the possibility of using specific RTB sub-domains, rather than RTB itself, as antigens to more efficiently elicit neutralizing antibodies and protective immunity against ricin. PMID:21872634

  11. Bolstering Components of the Immune Response Compromised by Prior Exposure to Adenovirus: Guided Formulation Development for a Nasal Ebola Vaccine

    PubMed Central

    2014-01-01

    The severity and longevity of the current Ebola outbreak highlight the need for a fast-acting yet long-lasting vaccine for at-risk populations (medical personnel and rural villagers) where repeated prime-boost regimens are not feasible. While recombinant adenovirus (rAd)-based vaccines have conferred full protection against multiple strains of Ebola after a single immunization, their efficacy is impaired by pre-existing immunity (PEI) to adenovirus. To address this important issue, a panel of formulations was evaluated by an in vitro assay for their ability to protect rAd from neutralization. An amphiphilic polymer (F16, FW ∼39,000) significantly improved transgene expression in the presence of anti-Ad neutralizing antibodies (NAB) at concentrations of 5 times the 50% neutralizing dose (ND50). In vivo performance of rAd in F16 was compared with unformulated virus, virus modified with poly(ethylene) glycol (PEG), and virus incorporated into poly(lactic-co-glycolic) acid (PLGA) polymeric beads. Histochemical analysis of lung tissue revealed that F16 promoted strong levels of transgene expression in naive mice and those that were exposed to adenovirus in the nasal cavity 28 days prior to immunization. Multiparameter flow cytometry revealed that F16 induced significantly more polyfunctional antigen-specific CD8+ T cells simultaneously producing IFN-γ, IL-2, and TNF-α than other test formulations. These effects were not compromised by PEI. Data from formulations that provided partial protection from challenge consistently identified specific immunological requirements necessary for protection. This approach may be useful for development of formulations for other vaccine platforms that also employ ubiquitous pathogens as carriers like the influenza virus. PMID:25549696

  12. Numerical grid generation techniques. [conference

    NASA Technical Reports Server (NTRS)

    1980-01-01

    The state of the art in topology and flow geometry is presented. Solution techniques for partial differential equations are reviewed and included developments in coordinate transformations, conformal mapping, and invariant imbeddings. Applications of these techniques in fluid mechanics, flow geometry, boundary value problems, and fluidics are presented.

  13. Aerobic exercise protects against pressure overload-induced cardiac dysfunction and hypertrophy via β3-AR-nNOS-NO activation

    PubMed Central

    Li, Wenju; Li, Xiaoli; Zheng, Qiangsun; Niu, Xiaolin

    2017-01-01

    Aerobic exercise confers sustainable protection against cardiac hypertrophy and heart failure (HF). Nitric oxide synthase (NOS) and nitric oxide (NO) are known to play an important role in exercise-mediated cardioprotection, but the mechanism of NOS/NO stimulation during exercise remains unclear. The aim of this study is to determine the role of β3-adrenergic receptors (β3-ARs), NOS activation, and NO metabolites (nitrite and nitrosothiols) in the sustained cardioprotective effects of aerobic exercise. An HF model was constructed by transverse aortic constriction (TAC). Animals were treated with either moderate aerobic exercise by swimming for 9 weeks and/or the β3-AR-specific inhibitor SR59230A at 0.1 mg/kg/hour one day after TAC operation. Myocardial fibrosis, myocyte size, plasma catecholamine (CA) level, cardiac function and geometry were assessed using Masson’s trichrome staining, FITC-labeled wheat germ agglutinin staining, enzyme-linked immuno sorbent assay (ELISA) and echocardiography, respectively. Western blot analysis was performed to elucidate the expression of target proteins. The concentration of myocardial NO production was evaluated using the nitrate reductase method. Myocardial oxidative stress was assessed by detecting the concentration of myocardial super oxidative dismutase (SOD), malonyldialdehyde (MDA), and reactive oxygen species (ROS). Aerobic exercise training improved dilated left ventricular function and partially attenuated the degree of cardiac hypertrophy and fibrosis in TAC mice. Moreover, the increased expression of β3-AR, activation of neuronal NOS (nNOS), and production of NO were detected after aerobic exercise training in TAC mice. However, selective inhibition of β3-AR by SR59230A abolished the upregulation and activation of nNOS induced NO production. Furthermore, aerobic exercise training decreased the myocardial ROS and MDA contents and increased myocardial levels of SOD; both effects were partially attenuated by SR59230A. Our study suggested that aerobic exercise training could improve cardiac systolic function and alleviate LV chamber dilation, cardiac fibrosis and hypertrophy in HF mice. The mechanism responsible for the protective effects of aerobic exercise is associated with the activation of the β3-AR-nNOS-NO pathway. PMID:28622359

  14. Aerobic exercise protects against pressure overload-induced cardiac dysfunction and hypertrophy via β3-AR-nNOS-NO activation.

    PubMed

    Wang, Bin; Xu, Ming; Li, Wenju; Li, Xiaoli; Zheng, Qiangsun; Niu, Xiaolin

    2017-01-01

    Aerobic exercise confers sustainable protection against cardiac hypertrophy and heart failure (HF). Nitric oxide synthase (NOS) and nitric oxide (NO) are known to play an important role in exercise-mediated cardioprotection, but the mechanism of NOS/NO stimulation during exercise remains unclear. The aim of this study is to determine the role of β3-adrenergic receptors (β3-ARs), NOS activation, and NO metabolites (nitrite and nitrosothiols) in the sustained cardioprotective effects of aerobic exercise. An HF model was constructed by transverse aortic constriction (TAC). Animals were treated with either moderate aerobic exercise by swimming for 9 weeks and/or the β3-AR-specific inhibitor SR59230A at 0.1 mg/kg/hour one day after TAC operation. Myocardial fibrosis, myocyte size, plasma catecholamine (CA) level, cardiac function and geometry were assessed using Masson's trichrome staining, FITC-labeled wheat germ agglutinin staining, enzyme-linked immuno sorbent assay (ELISA) and echocardiography, respectively. Western blot analysis was performed to elucidate the expression of target proteins. The concentration of myocardial NO production was evaluated using the nitrate reductase method. Myocardial oxidative stress was assessed by detecting the concentration of myocardial super oxidative dismutase (SOD), malonyldialdehyde (MDA), and reactive oxygen species (ROS). Aerobic exercise training improved dilated left ventricular function and partially attenuated the degree of cardiac hypertrophy and fibrosis in TAC mice. Moreover, the increased expression of β3-AR, activation of neuronal NOS (nNOS), and production of NO were detected after aerobic exercise training in TAC mice. However, selective inhibition of β3-AR by SR59230A abolished the upregulation and activation of nNOS induced NO production. Furthermore, aerobic exercise training decreased the myocardial ROS and MDA contents and increased myocardial levels of SOD; both effects were partially attenuated by SR59230A. Our study suggested that aerobic exercise training could improve cardiac systolic function and alleviate LV chamber dilation, cardiac fibrosis and hypertrophy in HF mice. The mechanism responsible for the protective effects of aerobic exercise is associated with the activation of the β3-AR-nNOS-NO pathway.

  15. National Conference on Campus Safety (15th, University of Vermont, Burlington, June 21-26, 1968).

    ERIC Educational Resources Information Center

    Green, Jack N., Ed.

    Presentations made at the fifteenth National Conference on Campus Safety. The following topics are dealt with--(1) Occupational Health on Campus, (2) Teacher Liability in School Accidents, (3) Indoctrinating Students in Fire Safety, (4) Computer Installations Safety and Fire Protection, (5) The Design of Laboratory Buildings, (6) A Uniform System…

  16. Water Conservation with Water Saving Devices, Proceedings of a Conference. Extension Bulletin 421.

    ERIC Educational Resources Information Center

    Shelton, Theodore B., Ed.

    Presented are six papers on water conservation which were presented at a conference in New Jersey. The first two papers present recommendations of the New Jersey Department of Environmental Protection on water conservation and a master plan for New Jersey's water supply needs. The following four papers discuss water conservation with water-saving…

  17. Approaches to Privacy and Security in Computer Systems. Publication No. 404.

    ERIC Educational Resources Information Center

    Renninger, Clark R., Ed.

    A conference was held at the National Bureau of Standards on March 4-5, 1974 to continue the dialogue in search of ways to protect confidential information in computer systems. Proposals were presented for meeting governmental needs in safeguarding individual privacy and data confidentiality that were identified at a conference held in November…

  18. Case of Computer Conference at California College Pits Free Speech against Civil-Rights Protection.

    ERIC Educational Resources Information Center

    DeLoughry, Thomas J.; Wilson, David L.

    1994-01-01

    Santa Rosa Junior College (California) is in dispute with the Department of Education's Office of Civil Rights over comments about women students, termed sexual harassment, made in a men-only computer conference. The college is negotiating with the federal agency over what it must do to respond to student complaints. (MSE)

  19. Report on the Desirability of Adopting an International Instrument for the Protection of Translators.

    ERIC Educational Resources Information Center

    United Nations Educational, Scientific, and Cultural Organization, Paris (France).

    This report contains the formal documents leading to the inclusion on the provisional agenda of UNESCO's 1972 General Conference of a discussion considering the desirability of adopting an instrument for the protection of translators. Included in the document is the "Preliminary Study of the Technical and Legal Aspects of Copyright Protection for…

  20. 40 CFR 721.10146 - Partially fluorinated condensation polymer (generic).

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 31 2014-07-01 2014-07-01 false Partially fluorinated condensation... Specific Chemical Substances § 721.10146 Partially fluorinated condensation polymer (generic). (a) Chemical... as partially fluorinated condensation polymer (PMN P-07-87) is subject to reporting under this...

  1. 40 CFR 721.10146 - Partially fluorinated condensation polymer (generic).

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 40 Protection of Environment 32 2012-07-01 2012-07-01 false Partially fluorinated condensation... Specific Chemical Substances § 721.10146 Partially fluorinated condensation polymer (generic). (a) Chemical... as partially fluorinated condensation polymer (PMN P-07-87) is subject to reporting under this...

  2. 40 CFR 721.10146 - Partially fluorinated condensation polymer (generic).

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 32 2013-07-01 2013-07-01 false Partially fluorinated condensation... Specific Chemical Substances § 721.10146 Partially fluorinated condensation polymer (generic). (a) Chemical... as partially fluorinated condensation polymer (PMN P-07-87) is subject to reporting under this...

  3. 40 CFR 721.10146 - Partially fluorinated condensation polymer (generic).

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 Protection of Environment 31 2011-07-01 2011-07-01 false Partially fluorinated condensation... Specific Chemical Substances § 721.10146 Partially fluorinated condensation polymer (generic). (a) Chemical... as partially fluorinated condensation polymer (PMN P-07-87) is subject to reporting under this...

  4. Proceedings: Conference on asbestos control and replacement for electric utilities

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Not Available

    An EPRI conference on Asbestos Control and Replacement for Electric Utilities was held April 6--7, 1993 in conjunction with the Environmental Information Association`s (formerly National Asbestos Council) Environmental Management `93 Conference and Exposition. The high cost and potential liabilities of asbestos removal projects, compounded by concerns over the health effects of asbestos replacement materials, was the main motivation for the conference. The objective of the conference was to assemble guidance and information that will help utilities manage asbestos and to effectively prioritize EPRI research in this area. Eleven papers covered such topics as changes in the Environmental Protection Agency`s (EPA)more » ban on asbestos, utility experience with asbestos management and abatement, asbestos monitoring and disposal, and asbestos replacement materials. Utility feedback received at the conference indicates that present and planned EPRI research activities in this area will effectively meet industry needs.« less

  5. Response of rice genotypes to weed competition in dry direct-seeded rice in India.

    PubMed

    Mahajan, Gulshan; Ramesha, Mugalodi S; Chauhan, Bhagirath S

    2014-01-01

    The differential weed-competitive abilities of eight rice genotypes and the traits that may confer such attributes were investigated under partial weedy and weed-free conditions in naturally occurring weed flora in dry direct-seeded rice during the rainy seasons of 2011 and 2012 at Ludhiana, Punjab, India. The results showed genotypic differences in competitiveness against weeds. In weed-free plots, grain yield varied from 6.6 to 8.9 t ha(-1) across different genotypes; it was lowest for PR-115 and highest for the hybrid H-97158. In partial weedy plots, grain yield and weed biomass at flowering varied from 3.6 to 6.7 t ha(-1) and from 174 to 419 g m(-2), respectively. In partial weedy plots, grain yield was lowest for PR-115 and highest for PR-120. Average yield loss due to weed competition ranged from 21 to 46% in different rice genotypes. The study showed that early canopy closure, high leaf area index at early stage, and high root biomass and volume correlated positively with competitiveness. This study suggests that some traits (root biomass, leaf area index, and shoot biomass at the early stage) could play an important role in conferring weed competitiveness and these traits can be explored for dry-seeded rice.

  6. Response of Rice Genotypes to Weed Competition in Dry Direct-Seeded Rice in India

    PubMed Central

    Mahajan, Gulshan; Ramesha, Mugalodi S.; Chauhan, Bhagirath S.

    2014-01-01

    The differential weed-competitive abilities of eight rice genotypes and the traits that may confer such attributes were investigated under partial weedy and weed-free conditions in naturally occurring weed flora in dry direct-seeded rice during the rainy seasons of 2011 and 2012 at Ludhiana, Punjab, India. The results showed genotypic differences in competitiveness against weeds. In weed-free plots, grain yield varied from 6.6 to 8.9 t ha−1 across different genotypes; it was lowest for PR-115 and highest for the hybrid H-97158. In partial weedy plots, grain yield and weed biomass at flowering varied from 3.6 to 6.7 t ha−1 and from 174 to 419 g m−2, respectively. In partial weedy plots, grain yield was lowest for PR-115 and highest for PR-120. Average yield loss due to weed competition ranged from 21 to 46% in different rice genotypes. The study showed that early canopy closure, high leaf area index at early stage, and high root biomass and volume correlated positively with competitiveness. This study suggests that some traits (root biomass, leaf area index, and shoot biomass at the early stage) could play an important role in conferring weed competitiveness and these traits can be explored for dry-seeded rice. PMID:25093205

  7. 75 FR 20828 - Availability for Non-Exclusive, Exclusive, or Partially Exclusive Licensing of U.S. Patent...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-04-21

    ... Partially Exclusive Licensing of U.S. Patent Application Concerning a Chimeric Ebola and Marburg Virus Glycoproteins Virus Like Particle Vaccine To Protect Against Diverse Ebola and Marburg Viruses AGENCY... Ebola and Marburg Virus Glycoproteins Virus Like Particle Vaccine To Protect Against Diverse Ebola and...

  8. Report on the 2013 US Environmental Protection Agency ...

    EPA Pesticide Factsheets

    Report This report summarizes presentations and discussions from the “2013 U.S Environmental Protection Agency (EPA) International Decontamination Research and Development Conference,” held November 5–7, 2013 at the U.S. EPA facilities in Research Triangle Park, North Carolina.

  9. Tetanus vaccination with a dissolving microneedle patch confers protective immune responses in pregnancy.

    PubMed

    Esser, E Stein; Romanyuk, AndreyA; Vassilieva, Elena V; Jacob, Joshy; Prausnitz, Mark R; Compans, Richard W; Skountzou, Ioanna

    2016-08-28

    Maternal and neonatal tetanus claim tens of thousands lives every year in developing countries, but could be prevented by hygienic practices and improved immunization of pregnant women. This study tested the hypothesis that skin vaccination can overcome the immunologically transformed state of pregnancy and enhance protective immunity to tetanus in mothers and their newborns. To achieve this goal, we developed microneedle patches (MNPs) that efficiently delivered unadjuvanted tetanus toxoid to skin of pregnant mice and demonstrated that this route induced superior immune responses in female mice conferring 100% survival to tetanus toxin challenge when compared to intramuscular vaccination. Mice born to MNP-vaccinated mothers showed detectable tetanus-specific IgG antibodies up to 12weeks of age and complete protection to tetanus toxin challenge up at 6weeks of age. In contrast, none of the 6-week old mice born to intramuscularly vaccinated mothers survived challenge. Although pregnant mice vaccinated with unadjuvanted tetanus toxoid had 30% lower IgG and IgG1 titers than mice vaccinated intramuscularly with Alum®-adjuvanted tetanus toxoid vaccine, IgG2a titers and antibody affinity maturation were similar between these groups. We conclude that skin immunization with MNPs containing unadjuvanted tetanus toxoid can confer potent protective efficacy to mothers and their offspring using a delivery method well suited for expanding vaccination coverage in developing countries. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. Proceedings SPIE: Conference Digest, International Conference on Infrared and Millimeter Waves (18th) Held in Colchester, United Kingdom on 6-10 September 1993. Volume 2104

    DTIC Science & Technology

    1993-09-10

    effective dielectric constant appears to decrease upon the substitution of PbO, 1. INRODUCTION In V2 05 - TeO2 glasses several studies on equilibrium... glass increases as TeOg is partially replaced by PbO. Previous studies on V20 5 - TeO2 system 4.5 have reported three Infrared absorption bands at 1010...Laboratory, Dr, K,S. Krishnan Road, New Delhi 110012, India. Th4., REFLECTANCE STUDY OF TM,O. GLASSES - AMemon, M,N.Khan, SAI-Dallal, Department of

  11. Incorporating Conservation Zone Effectiveness for Protecting Biodiversity in Marine Planning

    PubMed Central

    Makino, Azusa; Klein, Carissa J.; Beger, Maria; Jupiter, Stacy D.; Possingham, Hugh P.

    2013-01-01

    Establishing different types of conservation zones is becoming commonplace. However, spatial prioritization methods that can accommodate multiple zones are poorly understood in theory and application. It is typically assumed that management regulations across zones have differential levels of effectiveness (“zone effectiveness”) for biodiversity protection, but the influence of zone effectiveness on achieving conservation targets has not yet been explored. Here, we consider the zone effectiveness of three zones: permanent closure, partial protection, and open, for planning for the protection of five different marine habitats in the Vatu-i-Ra Seascape, Fiji. We explore the impact of differential zone effectiveness on the location and costs of conservation priorities. We assume that permanent closure zones are fully effective at protecting all habitats, open zones do not contribute towards the conservation targets and partial protection zones lie between these two extremes. We use four different estimates for zone effectiveness and three different estimates for zone cost of the partial protection zone. To enhance the practical utility of the approach, we also explore how much of each traditional fishing ground can remain open for fishing while still achieving conservation targets. Our results show that all of the high priority areas for permanent closure zones would not be a high priority when the zone effectiveness of the partial protection zone is equal to that of permanent closure zones. When differential zone effectiveness and costs are considered, the resulting marine protected area network consequently increases in size, with more area allocated to permanent closure zones to meet conservation targets. By distributing the loss of fishing opportunity equitably among local communities, we find that 84–88% of each traditional fishing ground can be left open while still meeting conservation targets. Finally, we summarize the steps for developing marine zoning that accounts for zone effectiveness. PMID:24223870

  12. Becoming an Environmental Professional 1990. Articles from Leading Environmental Professionals on Employment and Career Trends in the 1990s--Plus Proceedings from the CEIP Fund's Annual Environmental Careers Conference, "What on Earth Can You Do?" (6th, Boston, Massachusetts, October 22, 1989).

    ERIC Educational Resources Information Center

    CEIP Fund, Inc., Cleveland, OH.

    Presented in this collection are proceedings from a conference focused on how to go about preserving and protecting the environment and attended by over 120 colleges and universities and some 60 environmental organizations, as well as 10 additional articles on careers in areas related to the environment. Included in the conference proceedings are:…

  13. 11th International Conference on Atmospheric Electricity

    NASA Technical Reports Server (NTRS)

    Christian, H. J. (Compiler)

    1999-01-01

    This document contains the proceedings from the 11th International Conference on Atmospheric Electricity (ICAE 99), held June 7-11, 1999. This conference was attended by scientists and researchers from around the world. The subjects covered included natural and artificially initiated lightning, lightning in the middle and upper atmosphere (sprites and jets), lightning protection and safety, lightning detection techniques (ground, airborne, and space-based), storm physics, electric fields near and within thunderstorms, storm electrification, atmospheric ions and chemistry, shumann resonances, satellite observations of lightning, global electrical processes, fair weather electricity, and instrumentation.

  14. Intra-muscular and oral vaccination using a Koi Herpesvirus ORF25 DNA vaccine does not confer protection in common carp (Cyprinus carpio L.).

    PubMed

    Embregts, Carmen W E; Tadmor-Levi, Roni; Veselý, Tomáš; Pokorová, Dagmar; David, Lior; Wiegertjes, Geert F; Forlenza, Maria

    2018-03-19

    Koi Herpes Virus (KHV or Cyprinid Herpesvirus 3, CyHV-3) is among the most threatening pathogens affecting common carp production as well as the highly valuable ornamental koi carp. To date, no effective commercial vaccine is available for worldwide use. A previous study reported that three intramuscular injections with an ORF25-based DNA vaccine, led to the generation of neutralizing antibodies and conferred significant protection against an intraperitoneal challenge with KHV. In the present study, we set out to optimize an ORF25-based DNA vaccination protocol that required fewer injections and would confer protection upon a challenge that better resembled the natural route of infection. To this end, ORF25 was cloned in pcDNA3 either as a soluble protein or as a full-length transmembrane GFP-fusion protein. We tested our ORF25-based DNA vaccines in multiple vaccination trials using different doses, vaccination routes (i.m. injection and oral gavage) and challenge methods (bath and cohabitation). Furthermore, we analysed local and systemic responses to the i.m. injected DNA vaccine through histological and RT-qPCR analysis. We observed a strong protection when fish received three injections of either of the two DNA vaccines. However, this protection was observed only after bath challenge and not after cohabitation challenge. Furthermore, protection was insufficient when fish received one injection only, or received the plasmid orally. The importance of choosing a challenge model that best reflects the natural route of infection and the possibility to include additional antigens in future DNA vaccination strategies against KHV will be discussed. Copyright © 2018 The Author(s). Published by Elsevier Ltd.. All rights reserved.

  15. Accounting for Clare.

    ERIC Educational Resources Information Center

    Zimmerman, Sarah M.

    2000-01-01

    Notes that the minor Romantic poet John Clare commands increasing attention at academic conferences, in essay collections, and on college syllabi. Argues the practices that have kept Clare in view have also rendered him partially inaccessible to students, scholars and general readers. Suggests readers are now in possession of the materials with…

  16. Partial trisomy of chromosome 22 resulting from a supernumerary marker chromosome 22 in a child with features of cat eye syndrome.

    PubMed

    Bélien, Valérie; Gérard-Blanluet, Marion; Serero, Stéphane; Le Dû, Nathalie; Baumann, Clarisse; Jacquemont, Marie-Line; Dupont, Céline; Krabchi, Kada; Drunat, Séverine; Elbez, Annie; Janaud, Jean-Claude; Benzacken, Brigitte; Verloes, Alain; Tabet, Anne-Claude; Aboura, Azzedine

    2008-07-15

    Small supernumerary marker chromosomes are present in about 0.05% of the human population. In approximately 28% of persons with these markers (excluding the approximately 60% derived from one of the acrocentric chromosomes), an abnormal phenotype is observed. We report on a 3-month-old girl with intrauterine growth retardation, craniofacial features, hypotonia, partial coloboma of iris and total anomalous pulmonary venous return. Cytogenetic analysis showed the presence of a supernumerary marker chromosome, identified by fluorescence in situ hybridization as part of chromosome 22, and conferring a proximal partial trisomy 22q22.21, not encompassing the DiGeorge critical region (RP11-154H4 + , TBX1-). This observation adds new information relevant to cat eye syndrome and partial trisomy of 22q. 2008 Wiley-Liss, Inc.

  17. Single shot of 17D vaccine may not confer life-long protection against yellow fever.

    PubMed

    Vasconcelos, Pedro Fc

    2018-02-01

    The yellow fever (YF) vaccine has been used since the 1930s to prevent YF, which is a severe infectious disease caused by the yellow fever virus (YFV), and mainly transmitted by Culicidae mosquitoes from the genera Aedes and Haemagogus . Until 2013, the World Health Organization (WHO) recommended the administration of a vaccine dose every ten years. A new recommendation of a single vaccine dose to confer life-long protection against YFV infection has since been established. Recent evidence published elsewhere suggests that at least a second dose is needed to fully protect against YF disease. Here, we discuss the feasibility of administering multiple doses, the necessity for a new and modern vaccine, and recommend that the WHO conveys a meeting to discuss YFV vaccination strategies for people living in or travelling to endemic areas.

  18. 40 CFR 721.10603 - Epoxy modified alkyd resin, partially neutralized (generic).

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 31 2014-07-01 2014-07-01 false Epoxy modified alkyd resin, partially... Specific Chemical Substances § 721.10603 Epoxy modified alkyd resin, partially neutralized (generic). (a... generically as epoxy modified alkyd resin, partially neutralized (PMN P-11-280) is subject to reporting under...

  19. 40 CFR 721.10603 - Epoxy modified alkyd resin, partially neutralized (generic).

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 32 2013-07-01 2013-07-01 false Epoxy modified alkyd resin, partially... Specific Chemical Substances § 721.10603 Epoxy modified alkyd resin, partially neutralized (generic). (a... generically as epoxy modified alkyd resin, partially neutralized (PMN P-11-280) is subject to reporting under...

  20. DESIGNING A COMPREHENSIVE, INTEGRATED WATER RESOURCES MONITORING PROGRAM FOR FLORIDA

    EPA Science Inventory

    Proceedings of the National Water Quality Monitoring Conference "Monitoring Critical Foundations to Protect Our Waters," 7-9 July 1998, Reno, NV.

    In late 1996, Florida Department of Environmental Protection (FDEP) initiated an effort to design a multi-tiered monitoring and...

  1. International Aerospace and Ground Conference on Lightning and Static Electricity, 10th, and Congres International Aeronautique, 17th, Paris, France, June 10-13, 1985, Proceedings

    NASA Astrophysics Data System (ADS)

    1985-12-01

    The conference presents papers on statistical data and standards, coupling and indirect effects, meteorology and thunderstorm studies, lightning simulators, fuel ignition hazards, the phenomenology and characterization of lightning, susceptibility and protection of avionics, ground systems protection, lightning locators, aircraft systems protection, structures and materials, electrostatics, and spacecraft protection against static electricity. Particular attention is given to a comparison of published HEMP and natural lightning on the surface of an aircraft, electromagnetic interaction of external impulse fields with aircraft, of thunderstorm currents and lightning charges at the NASA Kennedy Space Center, the design of a fast risetime lightning generator, lightning simulation tests in FAA CV-580 lightning research aircraft, and the energy requirements of an aircraft triggered discharge. Papers are also presented on aircraft lightning attachment at low altitudes, a new form of transient suppressor, a proving ground for lightning research, and a spacecraft materials test in a continuous, broad energy-spectrum electron beam.

  2. The Role of Social Connectedness and Sexual Orientation in the Prevention of Youth Suicide Ideation and Attempts Among Sexually Active Adolescents.

    PubMed

    Stone, Deborah M; Luo, Feijun; Lippy, Caroline; McIntosh, Wendy LiKamWa

    2015-08-01

    The impact of types of social connectedness-family, other adult, and school-on suicide ideation and attempts among all youth, the relative impact of each type, and effect modification by sexual orientation was assessed. Data were from the 2007-2009 Milwaukee Youth Risk Behavior Surveys. Multivariable logistic regression analyses calculated the risk of suicide ideation and attempts by sexual orientation, types of social connectedness, and their interaction. Among all youth, each type of connectedness modeled singly conferred protective effects for suicide ideation. Family and other adult connectedness protected against suicide attempts. When modeled simultaneously, family connectedness protected against ideation and attempts. Sexual orientation modified the association between other adult connectedness and suicide ideation. Findings suggest that family connectedness confers the most consistent protection among all youth and sexual orientation does not generally modify the association between connectedness and suicidal behavior. © Published 2014. This article is a U.S. Government work and is in the public domain in the USA.

  3. Interaction of colicin E7 with the major coat protein (g8p) may confer limited protection on colicinogenic Escherichia coli against M13 bacteriophage infection.

    PubMed

    Chen, Yuh-Ren; Yang, Tsung-Yeh; Lei, Guang-Sheng; Liao, Chen-Chung; Chak, Kin-Fu

    2010-11-01

    Colicin release provides producer strains with a competitive advantage under certain circumstances. We found that propagation of M13 bacteriophage in cells producing colicin E7 is impaired, without alteration in the efficiency of bacteriophage adsorption, as compared with non-producing cells. In contrast to the protective effect of the colicin against M13 bacteriophage infection, the endogenously expressed colicin does not confer limited protection against transfection with M13 bacteriophage DNA. Furthermore, it was found that the translocation-receptor-binding domain and toxicity domain of the colicin are able to interact with the M13 major coat protein, g8p, during bacteriophage infection. Based on these observations, we propose that interaction between colicin E7 and g8p during infection interferes with g8p depolymerizing into the cytoplasmic membrane during bacteriophage DNA penetration, thus resulting in the limited protection against M13 bacteriophage infection.

  4. The Five E's: Ethnicity, Education, Economy, Equity, and Environment. Proceedings [of the] Annual Conference of the Global Awareness Society International (Chicago, Illinois, June 1994).

    ERIC Educational Resources Information Center

    Huber, James H., Ed.; And Others

    The 23 conference papers in this proceedings include: (1) "Global Awareness Society International: Retrospectives and Prospectives" (Chang Shub Roh); (2) "Technology Transfer in Developing Countries: The Case of Turkey (1989-1994)" (Huseyin Ates; Asim Sen); (3) "Indigenous People, Environmental Protection and Globalization" (Edward D. Barker); (4)…

  5. Wood-destroying organisms in the new millennium : where have we gone since Bend 1989?

    Treesearch

    Michael Haverty; Jessie Micales-Glaeser

    2004-01-01

    At the joint meeting of the Western International Forest Disease Work Conference and the Western Forest Insect Work Conference, held in Bend, OR, on September 13, 1989, a symposium was convened entitled "Current Research on Wood-destroying Organisms and Future Prospects for Protecting Wood in Use. "Presentations were made by three pathologists and nine...

  6. Making Connections, Building Communities. Proceedings of the Annual Rural & Small Schools Conference (19th, Manhattan, Kansas, October 26-27, 1997).

    ERIC Educational Resources Information Center

    Kansas State Univ., Manhattan. Center for Rural Education and Small Schools.

    This proceedings contains 26 summaries of conference presentations and discussions. Titles and authors are: "Is a Sexual Harassment Policy Enough To Protect Against Liability?" (Camille Barnett); "Recreating the Communities of Our Youth" (Marlyn Benson); "Creating a Language of Ethics in Rural Schooling" (Terry R. Berkeley, Linda P. Thurston);…

  7. Toll-like Receptor 4 Signaling Confers Cardiac Protection Against Ischemic Injury via Inducible Nitric Oxide Synthase- and Soluble Guanylate Cyclase-dependent Mechanisms

    PubMed Central

    Wang, E; Feng, Yan; Zhang, Ming; Zou, Lin; Li, Yan; Buys, Emmanuel S.; Huang, Peigen; Brouckaert, Peter; Chao, Wei

    2011-01-01

    Background Prior administration of a small dose of lipopolysaccharide confers a cardiac protection against ischemia-reperfusion injury. However, the signaling mechanisms that control the protection are incompletely understood. We tested the hypothesis that TLR4 mediates the ability of lipopolysaccharide to protect against cardiac ischemia-reperfusion injury through distinct intracellular pathways involving myeloid differentiation factor 88 (MyD88), TIR-domain-containing adaptor protein inducing interferon-β–mediated transcription-factor (Trif), inducible nitric-oxide synthase (iNOS), and soluble guanylate cyclase (sGC). Methods Wild-type mice and the genetically modified mice, i.e., TLR4-deficient (TLR4-def), TLR2 knockout (TLR2−/−), MyD88−/−, Trif−/−, iNOS−/−, and sGCα1−/−, were treated with normal saline or 0.1 mg/kg of lipopolysaccharide, intraperitoneally. Twenty-four hours later, isolated hearts were perfused in a Langendorff apparatus and subsequently subjected to 30 min of global ischemia and reperfusion for up to 60 min. Left ventricular function and myocardial infarction sizes were examined. Results Compared to saline-treated mice, lipopolysaccharide-treated mice had markedly improved left ventricular developed pressure and dP/dtmax (P < 0.01) and reduced MI sizes (37.2 ± 3.4% vs. 19.8 ± 4.9%, P < 0.01) after ischemia-reperfusion. The cardiac protective effect of lipopolysaccharide was abolished in the TLR4-def and MyD88−/− mice, but remained intact in TLR2−/− or Trif−/− mice. iNOS−/− mice or wild-type mice treated with the iNOS inhibitor 1400W failed to respond to the TLR4-induced nitric oxide production and were not protected by the lipopolysaccharide preconditioning. While sGC 1−/− mice had robust nitric oxide production in response to lipopolysaccharide, they were not protected by the TLR4-elicited cardiac protection. Conclusions TLR4 activation confers a potent cardiac protection against ischemia-reperfusion injury via a MyD88-dependent, but Trif-independent mechanism. iNOS/sGC are essential for the TLR4-induced cardiac protection. PMID:21270629

  8. Using ClinicalTrials.gov to supplement information in ophthalmology conference abstracts about trial outcomes: a comparison study.

    PubMed

    Scherer, Roberta W; Huynh, Lynn; Ervin, Ann-Margret; Dickersin, Kay

    2015-01-01

    Including results from unpublished randomized controlled trials (RCTs) in a systematic review may ameliorate the effect of publication bias in systematic review results. Unpublished RCTs are sometimes described in abstracts presented at conferences, included in trials registers, or both. Trial results may not be available in a trials register and abstracts describing RCT results often lack study design information. Complementary information from a trials register record may be sufficient to allow reliable inclusion of an unpublished RCT only available as an abstract in a systematic review. We identified 496 abstracts describing RCTs presented at the 2007 to 2009 Association for Research in Vision and Ophthalmology (ARVO) meetings; 154 RCTs were registered in ClinicalTrials.gov. Two persons extracted verbatim primary and non-primary outcomes reported in the abstract and ClinicalTrials.gov record. We compared each abstract outcome with all ClinicalTrials.gov outcomes and coded matches as complete, partial, or no match. We identified 800 outcomes in 152 abstracts (95 primary [51 abstracts] and 705 [141 abstracts] non-primary outcomes). No outcomes were reported in 2 abstracts. Of 95 primary outcomes, 17 (18%) agreed completely, 53 (56%) partially, and 25 (26%) had no match with a ClinicalTrials.gov primary or non-primary outcome. Among 705 non-primary outcomes, 56 (8%) agreed completely, 205 (29%) agreed partially, and 444 (63%) had no match with a ClinicalTrials.gov primary or non-primary outcome. Among the 258 outcomes partially agreeing, we found additional information on the time when the outcome was measured more often in ClinicalTrials.gov than in the abstract (141/258 (55%) versus 55/258 (21%)). We found no association between the presence of non-matching "new" outcomes and year of registration, time to registry update, industry sponsorship, or multi-center status. Conference abstracts may be a valuable source of information about results for outcomes of unpublished RCTs that have been registered in ClinicalTrials.gov. Complementary additional descriptive information may be present for outcomes reported in both sources. However, ARVO abstract authors also present outcomes not reported in ClinicalTrials.gov and these may represent analyses not originally planned.

  9. Infant feeding practices and prevalence of obesity in eight European countries - the IDEFICS study.

    PubMed

    Hunsberger, Monica; Lanfer, Anne; Reeske, Anna; Veidebaum, Toomas; Russo, Paola; Hadjigeorgiou, Charalampos; Moreno, Luis A; Molnar, Dénes; De Henauw, Stefaan; Lissner, Lauren; Eiben, Gabriele

    2013-02-01

    To assess the association between exclusive breast-feeding and childhood overweight. Cross-sectional data are from the baseline survey of the longitudinal cohort study IDEFICS. Exclusive rather than partial breast-feeding is the focus of the study due to the theoretical relationship between exclusive breast-feeding and development of dietary self-regulation. Children's measured heights and weights were used to calculate weight status, while waist-to-height ratio (WtHR) and skinfold measures were examined as alternative indicators of adiposity and fat patterning. Examination centres in eight European countries (Italy, Estonia, Cyprus, Belgium, Sweden, Hungary, Germany and Spain). The analysis included 14 726 children aged 2-9 years for whom early feeding practices were reported by parents in standardized questionnaires. After controlling for education, income and other potential confounders, breast-feeding exclusively for 4-6 months was protective of overweight (including obesity) when compared with children never exclusively breast-fed (OR = 0·73; 95 % CI 0·63, 0·85) across all measures of overweight. Exclusively breast-feeding for 6 months offered slightly more protection than for 4 and 5 months combined (OR = 0·71; 95 % CI 0·58, 0·85). The associations could not be explained by socio-economic characteristics or maternal overweight. This multi-country investigation indicated that exclusive breast-feeding for 4-6 months may confer protection against overweight in addition to other known benefits. There was no demonstrated benefit of exclusive breast-feeding for more than 6 months or combination feeding for any duration across all measures of overweight examined.

  10. Biochemical analysis of plant protection afforded by a nonpathogenic endophytic mutant of Colletotrichum magna

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Redman, R.S.; Rodriguez, R.J.; Clifton, D.R.

    1999-02-01

    A nonpathogenic mutant of Colletotrichum magna (path-1) was previously shown to protect watermelon (Citrullus lanatus) and cucumber (Cucumis sativus) seedlings from anthracnose disease elicited by wild-type C. magna. Disease protection was observed in stems of path-1-colonized cucurbits but not in cotyledons, indicating that path-1 conferred tissue-specific and/or localized protection. Plant biochemical indicators of a localized and systemic (peroxidase, phenylalanine ammonia-lyase, lignin, and salicylic acid) plant-defense response were investigated in anthracnose-resistant and-susceptible cultivars of cucurbit seedlings exposed to four treatments: (1) water (control), (2) path-1 conidia, (3) wild-type conidia, and (4) challenge conditions (inoculation into path-1 conidia for 48 h andmore » then exposure to wild-type conidia). Collectively, these analyses indicated that disease protection in path-1-colonized plants was correlated with the ability of these plants to mount a defense response more rapidly and to equal or greater levels than plants exposed to wild-type C. magna alone. Watermelon plants colonized with path-1 were also protected against disease caused by Colletotrichum orbiculare and Fusarium oxysporum. A model based on the kinetics of plant-defense activation is presented to explain the mechanism of path-1-conferred disease protection.« less

  11. Biochemical analysis of plant protection afforded by a nonpathogenic endophytic mutant of Colletotrichum magna

    USGS Publications Warehouse

    Redman, R.S.; Freeman, S.; Clifton, D.R.; Morrel, J.; Brown, G.; Rodriguez, R.J.

    1999-01-01

    A nonpathogenic mutant of Colletotrichum magna (path-1) was previously shown to protect watermelon (Citrullus lanatus) and cucumber (Cucumis sativus) seedlings from anthracnose disease elicited by wild-type C. magna. Disease protection was observed in stems of path-1-colonized cucurbits but not in cotyledons, indicating that path-1 conferred tissue-specific and/or localized protection. Plant biochemical indicators of a localized and systemic (peroxidase, phenylalanine ammonia-lyase, lignin, and salicylic acid) 'plant-defense' response were investigated in anthracnose-resistant and -susceptible cultivars of cucurbit seedlings exposed to four treatments: (1) water (control), (2) path-1 conidia, (3) wild-type conidia, and (4) challenge conditions (inoculation into path-1 conidia for 48 h and then exposure to wild-type conidia). Collectively, these analyses indicated that disease protection in path-1 colonized plants was correlated with the ability of these plants to mount a defense response more rapidly and to equal or greater levels than plants exposed to wild-type C. magna alone. Watermelon plants colonized with path-1 were also protected against disease caused by Colletotrichum orbiculare and Fusarium oxysporum. A model based on the kinetics of plant-defense activation is presented to explain the mechanism of path-1-conferred disease protection.

  12. TYLOXAPOL CONFERS DURABLE PROTECTION AGAINST HYPEROXIC LUNG INJURY IN THE RAT

    EPA Science Inventory

    We tested the hypothesis that the non-lipid components of ExosurfR, tyloxapol (TY) and cetyl alcohol (CA), protect against hyperoxic lung injury by either 1) direct radical scavenging activity or 2) induction of the animals? endogenous anti-oxidant defenses. Adult rats were in...

  13. Expected epidemiological impact of the introduction of a partially effective HIV vaccine among men who have sex with men in Australia.

    PubMed

    Gray, Richard T; Ghaus, Mohammad H; Hoare, Alexander; Wilson, David P

    2011-08-18

    A trial of the ALVAC-AIDSVAX HIV vaccine was recently found to be partially effective in preventing HIV transmission among study participants in Thailand. The success of this trial means that vaccination may become a viable intervention for the prevention of HIV infection in the medium-term future. Assuming that the vaccine has similar relative protective effectiveness per exposure event for reducing transmission among men who have sex with men (MSM) in high-income settings we investigated the potential population-level impact of rolling out such a vaccine among MSM in New South Wales, Australia. Using a detailed individual-based transmission model that simulates a population of sexually active MSM it was found that one-off intervention of 60% or 30% coverage of a vaccine with characteristics like the ALVAX-AIDSVAX vaccine would likely reduce the cumulative incidence of HIV by 9.6% and 5.1%, respectively, over a 10-year period. Due to the waning of vaccine efficacy, a booster vaccination could be required to maintain this reduction in incidence over the long term. If the previously vaccinated population is given a booster vaccine, with the same protection conferred as with the initial vaccination, every 5 years or every 2 years then the cumulative incidence over 10 years for 60% coverage could be reduced by 14.4% and 22.8%, respectively. Such a weak vaccine, with boosting, may be a potential intervention strategy for the prevention of HIV infection in MSM in high-income countries if further trials show boosting to be safe, acceptable, and cost-effective. However, the moderately low population-level impact suggests that a public health strategy involving such a vaccine should be supplemented with other biomedical and educational strategies. Crown Copyright © 2011. Published by Elsevier Ltd. All rights reserved.

  14. Cross-protective efficacy of Leishmania infantum LiHyD protein against tegumentary leishmaniasis caused by Leishmania major and Leishmania braziliensis species.

    PubMed

    Lage, Daniela Pagliara; Martins, Vívian Tamietti; Duarte, Mariana Costa; Costa, Lourena Emanuele; Tavares, Grasiele de Sousa Vieira; Ramos, Fernanda Fonseca; Chávez-Fumagalli, Miguel Angel; Menezes-Souza, Daniel; Roatt, Bruno Mendes; Tavares, Carlos Alberto Pereira; Coelho, Eduardo Antonio Ferraz

    2016-06-01

    Vaccination can be considered the most cost-effective strategy to control neglected diseases, but nowadays there is not an effective vaccine available against leishmaniasis. In the present study, a vaccine based on the combination of the Leishmania-specific hypothetical protein (LiHyD) with saponin was tested in BALB/c mice against infection caused by Leishmania major and Leishmania braziliensis species. This antigen was firstly identified in Leishmania infantum and showed to be protective against infection of BALB/c mice using this parasite species. The immunogenicity of rLiHyD/saponin vaccine was evaluated, and the results showed that immunized mice produced high levels of IFN-γ, IL-12 and GM-CSF after in vitro stimulation with rLiHyD, as well as by using L. major or L. braziliensis protein extracts. After challenge, vaccinated animals showed significant reductions in the infected footpad swellings, as well as in the parasite burden in the infection site, liver, spleen, and infected paws draining lymph nodes, when compared to those that were inoculated with the vaccine diluent (saline) or immunized with saponin. The immunization of rLiHyD without adjuvant was not protective against both challenges. The partial protection obtained by the rLiHyD/saponin vaccine was associated with a parasite-specific IL-12-dependent IFN-γ secretion, which was produced mainly by CD4(+) T cells. In these animals, a decrease in the parasite-mediated IL-4 and IL-10 responses, associated with the presence of high levels of LiHyD- and parasite-specific IgG2a isotype antibodies, were also observed. The present study showed that a hypothetical protein that was firstly identified in L. infantum, when combined to a Th1 adjuvant, was able to confer a cross-protection against highly infective stationary-phase promastigotes of two Leishmania species causing tegumentary leishmaniasis. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. Does encapsulation protect embryos from the effects of ocean acidification? The example of Crepidula fornicata.

    PubMed

    Noisette, Fanny; Comtet, Thierry; Legrand, Erwann; Bordeyne, François; Davoult, Dominique; Martin, Sophie

    2014-01-01

    Early life history stages of marine organisms are generally thought to be more sensitive to environmental stress than adults. Although most marine invertebrates are broadcast spawners, some species are brooders and/or protect their embryos in egg or capsules. Brooding and encapsulation strategies are typically assumed to confer greater safety and protection to embryos, although little is known about the physico-chemical conditions within egg capsules. In the context of ocean acidification, the protective role of encapsulation remains to be investigated. To address this issue, we conducted experiments on the gastropod Crepidula fornicata. This species broods its embryos within capsules located under the female and veliger larvae are released directly into the water column. C. fornicata adults were reared at the current level of CO2 partial pressure (pCO2) (390 μatm) and at elevated levels (750 and 1400 μatm) before and after fertilization and until larval release, such that larval development occurred entirely at a given pCO2. The pCO2 effects on shell morphology, the frequency of abnormalities and mineralization level were investigated on released larvae. Shell length decreased by 6% and shell surface area by 11% at elevated pCO2 (1400 μatm). The percentage of abnormalities was 1.5- to 4-fold higher at 750 μatm and 1400 μatm pCO2, respectively, than at 390 μatm. The intensity of birefringence, used as a proxy for the mineralization level of the larval shell, also decreased with increasing pCO2. These negative results are likely explained by increased intracapsular acidosis due to elevated pCO2 in extracapsular seawater. The encapsulation of C. fornicata embryos did not protect them against the deleterious effects of a predicted pCO2 increase. Nevertheless, C. fornicata larvae seemed less affected than other mollusk species. Further studies are needed to identify the critical points of the life cycle in this species in light of future ocean acidification.

  16. Scientific and ethical issues related to deep brain stimulation for disorders of mood, behavior, and thought.

    PubMed

    Rabins, Peter; Appleby, Brian S; Brandt, Jason; DeLong, Mahlon R; Dunn, Laura B; Gabriëls, Loes; Greenberg, Benjamin D; Haber, Suzanne N; Holtzheimer, Paul E; Mari, Zoltan; Mayberg, Helen S; McCann, Evelyn; Mink, Sallie P; Rasmussen, Steven; Schlaepfer, Thomas E; Vawter, Dorothy E; Vitek, Jerrold L; Walkup, John; Mathews, Debra J H

    2009-09-01

    A 2-day consensus conference was held to examine scientific and ethical issues in the application of deep brain stimulation for treating mood and behavioral disorders, such as major depression, obsessive-compulsive disorder, and Tourette syndrome. The primary objectives of the conference were to (1) establish consensus among participants about the design of future clinical trials of deep brain stimulation for disorders of mood, behavior, and thought and (2) develop standards for the protection of human subjects participating in such studies. Conference participants identified 16 key points for guiding research in this growing field. The adoption of the described guidelines would help to protect the safety and rights of research subjects who participate in clinical trials of deep brain stimulation for disorders of mood, behavior, and thought and have further potential to benefit other stakeholders in the research process, including clinical researchers and device manufactures. That said, the adoption of the guidelines will require broad and substantial commitment from many of these same stakeholders.

  17. Legally Brown: Using Ethnographic Methods to Understand Sun Protection Attitudes and Behaviours among Young Australians "I Didn't Mean to Get Burnt--It Just Happened!"

    ERIC Educational Resources Information Center

    Potente, Sofia; Coppa, Kay; Williams, Ainslie; Engels, Rob

    2011-01-01

    Sun protection is not commonly perceived as an important issue by adolescents yet this behaviour would, if adopted, confer significant lifelong protection against skin cancer. Despite the world's highest skin cancer rates, Australia remains a culture which values sun seeking, tanning and outdoor activities. This qualitative study used ethnographic…

  18. Dietary resveratrol confers apoptotic resistance to oxidative stress in myoblasts.

    PubMed

    Haramizu, Satoshi; Asano, Shinichi; Butler, David C; Stanton, David A; Hajira, Ameena; Mohamed, Junaith S; Alway, Stephen E

    2017-12-01

    High levels of reactive oxygen species (ROS) contribute to muscle cell death in aging and disuse. We have previously found that resveratrol can reduce oxidative stress in response to aging and hindlimb unloading in rodents in vivo, but it was not known if resveratrol would protect muscle stem cells during repair or regeneration when oxidative stress is high. To test the protective role of resveratrol on muscle stem cells directly, we treated the C2C12 mouse myoblast cell line with moderate (100 μM) or very high (1 mM) levels of H 2 O 2 in the presence or absence of resveratrol. The p21 promoter activity declined in myoblasts in response to high ROS, and this was accompanied a greater nuclear to cytoplasmic translocation of p21 in a dose-dependent matter in myoblasts as compared to myotubes. Apoptosis, as indicated by TdT-mediated dUTP nick-end labeling, was greater in C2C12 myoblasts as compared to myotubes (P<.05) after treatment with H 2 O 2 . Caspase-9, -8 and -3 activities were elevated significantly (P<.05) in myoblasts treated with H 2 O 2 . Myoblasts were more susceptible to ROS-induced oxidative stress than myotubes. We treated C2C12 myoblasts with 50 μM of resveratrol for periods up to 48 h to determine if myoblasts could be rescued from high-ROS-induced apoptosis by resveratrol. Resveratrol reduced the apoptotic index and significantly reduced the ROS-induced caspase-9, -8 and -3 activity in myoblasts. Furthermore, Bcl-2 and the Bax/Bcl-2 ratio were partially rescued in myoblasts by resveratrol treatment. Similarly, muscle stem cells isolated from mouse skeletal muscles showed reduced Sirt1 protein abundance with H 2 O 2 treatment, but this could be reversed by resveratrol. Reduced apoptotic susceptibility in myoblasts as compared to myotubes to ROS is regulated, at least in part, by enhanced p21 promoter activity and nuclear p21 location in myotubes. Resveratrol confers further protection against ROS by improving Sirt1 levels and increasing antioxidant production, which reduces mitochondrial associated apoptotic signaling, and cell death in myoblasts. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Protecting intellectual property in space; Proceedings of the Aerospace Computer Security Conference, McLean, VA, March 20, 1985

    NASA Technical Reports Server (NTRS)

    1985-01-01

    The primary purpose of the Aerospace Computer Security Conference was to bring together people and organizations which have a common interest in protecting intellectual property generated in space. Operational concerns are discussed, taking into account security implications of the space station information system, Space Shuttle security policies and programs, potential uses of probabilistic risk assessment techniques for space station development, key considerations in contingency planning for secure space flight ground control centers, a systematic method for evaluating security requirements compliance, and security engineering of secure ground stations. Subjects related to security technologies are also explored, giving attention to processing requirements of secure C3/I and battle management systems and the development of the Gemini trusted multiple microcomputer base, the Restricted Access Processor system as a security guard designed to protect classified information, and observations on local area network security.

  20. Relative importance of complement-mediated bactericidal and opsonic activity for protection against meningococcal disease.

    PubMed

    Granoff, Dan M

    2009-06-24

    Killing of Neisseria meningitidis can result from complement-mediated serum bactericidal activity (SBA) or opsonophagocytosis (OPA), or a combination of the two mechanisms. While SBA titers > or =1:4 confer protection, recent evidence suggests that this threshold titer may not be required. For example, the incidence of meningococcal disease declines between ages 1 and 4 years without evidence of acquisition of SBA titers > or =1:4. Meningococcal polysaccharide vaccination also elicited OPA and lowered the risk of disease in patients with late complement component deficiencies whose sera did not support SBA. Sera from healthy adults immunized with an outer membrane vesicle vaccine showed OPA killing of N. meningitidis with C6-depleted complement, and whole blood from complement-sufficient non-immunized adults with SBA titers <1:4 also frequently had killing activity. Collectively the data indicate that SBA titers <1:4 and/or vaccine-induced OPA can confer protection against meningococcal disease.

  1. Relative importance of complement-mediated bactericidal and opsonic activity for protection against meningococcal disease

    PubMed Central

    Granoff, Dan M.

    2009-01-01

    Killing of Neisseria meningitidis can result from complement-mediated bactericidal activity (SBA) or opsonophagocytosis (OPA), or a combination of the two mechanisms. While SBA titers ≥1:4 confer protection, recent evidence suggests that this threshold titer may not be required. For example, the incidence of meningococcal disease declines between ages 1 and 4 years without evidence of acquisition of SBA titers ≥1:4. Meningococcal polysaccharide vaccination also elicited OPA and lowered the risk of disease in patients with late complement component deficiencies whose sera did not support SBA. Sera from healthy adults immunized with an outer membrane vesicle vaccine showed OPA killing of N. meningitidis with C6-depleted complement, and whole blood from complement-sufficient non-immunized adults with SBA titers <1:4 also frequently had killing activity. Collectively the data indicate that SBA titers <1:4 and/or vaccine-induced OPA can confer protection against meningococcal disease. PMID:19477054

  2. Protective Bars? Report on the EPEA International Conference on Prison Education (6th, Budapest, Hungary, November 1-5, 1997).

    ERIC Educational Resources Information Center

    Boros, Janos, Ed.

    This document contains 16 papers on practices in correctional education in Central and Eastern Europe, presented at a conference in Hungary in 1997. The papers center around these four topics: (1) Prison System and Humanization; (2) New Challenges in Prison Life and Prison Education; (3) Nothing Works? Something Works; and (4) Beyond 2000. The…

  3. 2007 Joint Chemical Biological, Radiological and Nuclear (CBRN) Conference and Exhibition - Combating Weapons of Mass Destruction

    DTIC Science & Technology

    2007-06-27

    Selected CB Defense Systems SHAPESENSE Joint Warning and Reporting Network JSLIST CB Protected Shelter Joint Vaccine Acquisition Program Joint Effects...military can operate in any environment, unconstrained by chemical or biological weapons. 21 SHIELD SUSTAIN Selected CB Defense Systems SHAPESENSE Joint...28070625_JCBRN_Conference_Reeves UNCLASSIFIED Decontamination Vision Strippable Barriers Self-Decontaminating Fabrics/Coatings Reduce Logistics Burden

  4. Proceedings of the American power conference: Volume 59-1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McBride, A.E.

    1997-07-01

    This is Volume 59-1 of the proceedings of the American Power Conference, 1997. The contents include environmental protection; regulatory compliance and permitting; convergence of electric and gas industries; renewable/wind energy; improving operations and maintenance; globalization of renewable, generation, and distribution technologies; diagnostics; battery reliability; access to power transmission facilities; software for competitive decision making and operation; transmission and distribution; and nuclear operations and options.

  5. Southern Extension Water Training Workshop: Actions for Working Together. Proceedings of a Regional Conference (Birmingham, Alabama, November 13-15, 1989).

    ERIC Educational Resources Information Center

    Southern Rural Development Center, Mississippi State, MS.

    A training workshop for Southern Extension faculty and staff addressed aspects of water quality and related issues. Conference papers discussed: (1) basic information on hydrology--the science of water transport through the natural environment; (2) sources and impacts of water pollution; (3) the role of public policy in water quality protection;…

  6. Combining biomedical preventions for HIV: Vaccines with pre-exposure prophylaxis, microbicides or other HIV preventions

    PubMed Central

    McNicholl, Janet M.

    2016-01-01

    ABSTRACT Biomedical preventions for HIV, such as vaccines, microbicides or pre-exposure prophylaxis (PrEP) with antiretroviral drugs, can each only partially prevent HIV-1 infection in most human trials. Oral PrEP is now FDA approved for HIV-prevention in high risk groups, but partial adherence reduces efficacy. If combined as biomedical preventions (CBP) an HIV vaccine could provide protection when PrEP adherence is low and PrEP could prevent vaccine breakthroughs. Other types of PrEP or microbicides may also be partially protective. When licensed, first generation HIV vaccines are likely to be partially effective. Individuals at risk for HIV may receive an HIV vaccine combined with other biomedical preventions, in series or in parallel, in clinical trials or as part of standard of care, with the goal of maximally increasing HIV prevention. In human studies, it is challenging to determine which preventions are best combined, how they interact and how effective they are. Animal models can determine CBP efficacy, whether additive or synergistic, the efficacy of different products and combinations, dose, timing and mechanisms. CBP studies in macaques have shown that partially or minimally effective candidate HIV vaccines combined with partially effective oral PrEP, vaginal PrEP or microbicide generally provided greater protection than either prevention alone against SIV or SHIV challenges. Since human CBP trials will be complex, animal models can guide their design, sample size, endpoints, correlates and surrogates of protection. This review focuses on animal studies and human models of CBP and discusses implications for HIV prevention. PMID:27679928

  7. Combining biomedical preventions for HIV: Vaccines with pre-exposure prophylaxis, microbicides or other HIV preventions.

    PubMed

    McNicholl, Janet M

    2016-12-01

    Biomedical preventions for HIV, such as vaccines, microbicides or pre-exposure prophylaxis (PrEP) with antiretroviral drugs, can each only partially prevent HIV-1 infection in most human trials. Oral PrEP is now FDA approved for HIV-prevention in high risk groups, but partial adherence reduces efficacy. If combined as biomedical preventions (CBP) an HIV vaccine could provide protection when PrEP adherence is low and PrEP could prevent vaccine breakthroughs. Other types of PrEP or microbicides may also be partially protective. When licensed, first generation HIV vaccines are likely to be partially effective. Individuals at risk for HIV may receive an HIV vaccine combined with other biomedical preventions, in series or in parallel, in clinical trials or as part of standard of care, with the goal of maximally increasing HIV prevention. In human studies, it is challenging to determine which preventions are best combined, how they interact and how effective they are. Animal models can determine CBP efficacy, whether additive or synergistic, the efficacy of different products and combinations, dose, timing and mechanisms. CBP studies in macaques have shown that partially or minimally effective candidate HIV vaccines combined with partially effective oral PrEP, vaginal PrEP or microbicide generally provided greater protection than either prevention alone against SIV or SHIV challenges. Since human CBP trials will be complex, animal models can guide their design, sample size, endpoints, correlates and surrogates of protection. This review focuses on animal studies and human models of CBP and discusses implications for HIV prevention.

  8. Using Private Demand Studies to Calculate Socially Optimal Vaccine Subsidies in Developing Countries

    ERIC Educational Resources Information Center

    Cook, Joseph; Jeuland, Marc; Maskery, Brian; Lauria, Donald; Dipika, Sur; Clemens, John; Whittington, Dale

    2009-01-01

    Although it is well known that vaccines against many infectious diseases confer positive economic externalities via indirect protection, analysts have typically ignored possible herd protection effects in policy analyses of vaccination programs. Despite a growing literature on the economic theory of vaccine externalities and several innovative…

  9. S2 expressed from recombinant virus confers broad protection against infectious bronchitis virus

    USDA-ARS?s Scientific Manuscript database

    We previously demonstrated that overexposing the IBV (infectious bronchitis virus) S2 to the chicken immune system by means of a vectored vaccine, followed by boost with whole virus, protects chickens against IBV showing dissimilar S1. We developed recombinant Newcastle disease virus (NDV) LaSota (...

  10. Newcastle disease virus vectored infectious laryngotracheitis vaccines protect commercial broiler chickens in the presence of maternally derived antibodies

    USDA-ARS?s Scientific Manuscript database

    Newcastle disease virus (NDV) recombinants expressing the infectious laryngotracheitis virus (ILTV) glycoproteins B and D have previously been demonstrated to confer complete clinical protection against virulent ILTV and NDV challenges in naive chickens. We extended this study to assess whether mate...

  11. 78 FR 19460 - Marine Protected Areas Federal Advisory Committee; Public Meeting

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-04-01

    ... Areas Federal Advisory Committee; Public Meeting AGENCY: Office of National Marine Sanctuaries (ONMS... meeting via web conference call of the Marine Protected Areas Federal Advisory Committee (Committee). The... presentations as they are being given. Members of the public wishing to listen in should contact Lauren Wenzel...

  12. PROTECTING CHILDREN FROM ENVIRONMENTAL THREATS - A CONTINUING EDUCATION PROGRAM FOR NURSES OF THE AMERICAN NURSES FOUNDATION/ASSOCIATION

    EPA Science Inventory

    The American Nurses Association/Foundation will develop online, in print and pre conference continuing education (CE) children's environmental health protection programs to meet the objective of the program. The first CE program is on school environments, the second on home and ...

  13. RTS,S vaccination is associated with serologic evidence of decreased exposure to Plasmodium falciparum liver- and blood-stage parasites.

    PubMed

    Campo, Joe J; Aponte, John J; Skinner, Jeff; Nakajima, Rie; Molina, Douglas M; Liang, Li; Sacarlal, Jahit; Alonso, Pedro L; Crompton, Peter D; Felgner, Philip L; Dobaño, Carlota

    2015-03-01

    The leading malaria vaccine candidate, RTS,S, targets the sporozoite and liver stages of the Plasmodium falciparum life cycle, yet it provides partial protection against disease associated with the subsequent blood stage of infection. Antibodies against the vaccine target, the circumsporozoite protein, have not shown sufficient correlation with risk of clinical malaria to serve as a surrogate for protection. The mechanism by which a vaccine that targets the asymptomatic sporozoite and liver stages protects against disease caused by blood-stage parasites remains unclear. We hypothesized that vaccination with RTS,S protects from blood-stage disease by reducing the number of parasites emerging from the liver, leading to prolonged exposure to subclinical levels of blood-stage parasites that go undetected and untreated, which in turn boosts pre-existing antibody-mediated blood-stage immunity. To test this hypothesis, we compared antibody responses to 824 P. falciparum antigens by protein array in Mozambican children 6 months after receiving a full course of RTS,S (n = 291) versus comparator vaccine (n = 297) in a Phase IIb trial. Moreover, we used a nested case-control design to compare antibody responses of children who did or did not experience febrile malaria. Unexpectedly, we found that the breadth and magnitude of the antibody response to both liver and asexual blood-stage antigens was significantly lower in RTS,S vaccinees, with the exception of only four antigens, including the RTS,S circumsporozoite antigen. Contrary to our initial hypothesis, these findings suggest that RTS,S confers protection against clinical malaria by blocking sporozoite invasion of hepatocytes, thereby reducing exposure to the blood-stage parasites that cause disease. We also found that antibody profiles 6 months after vaccination did not distinguish protected and susceptible children during the subsequent 12-month follow-up period but were strongly associated with exposure. Together, these data provide insight into the mechanism by which RTS,S protects from malaria. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  14. Sialidase-Inhibiting Antibody Titers Correlate with Protection from Heterologous Influenza Virus Strains of the Same Neuraminidase Subtype.

    PubMed

    Walz, Lisa; Kays, Sarah-Katharina; Zimmer, Gert; von Messling, Veronika

    2018-06-20

    Immune responses induced by currently licensed inactivated influenza vaccines are mainly directed against the hemagglutinin (HA) glycoprotein, the immunodominant antigen of influenza viruses. The resulting antigenic drift of HA requires frequent updating of the vaccine composition and annual revaccination. On the other hand, the level of antibodies directed against the neuraminidase (NA) glycoprotein, the second major influenza virus antigen, vary greatly. To investigate the potential of the more conserved NA protein for the induction of a subtype-specific protection, vesicular stomatitis virus-based replicons expressing a panel of N1 proteins from prototypic seasonal and pandemic H1N1 strain and human H5N1 and H7N9 isolates were generated. Immunization of mice and ferrets with the replicon carrying the matched N1 protein resulted in robust humoral and cellular immune responses and protected against challenge with the homologous influenza virus with similar efficacy as the matched HA protein, illustrating the potential of the NA protein as vaccine antigen. The extent of protection after immunization with mismatched N1 proteins correlated with the level of cross-reactive sialidase-inhibiting antibody titers. Passive serum transfer experiments in mice confirmed that these functional antibodies determine subtype-specific cross-protection. Our findings illustrate the potential of NA-specific immunity for achieving broader protection against antigenic drift variants or newly emerging viruses carrying the same NA but a different HA subtype. IMPORTANCE Despite the availability of vaccines, annual influenza virus epidemics cause 250,000 to 500,000 deaths worldwide. Currently licensed inactivated vaccines, which are standardized for the amount of the hemagglutinin (HA) antigen, primarily induce strain-specific antibodies whereas the immune response to the neuraminidase (NA) antigen, which is also present on the viral surface, is usually low. Using NA-expressing single-cycle vesicular stomatitis virus replicons, we show that the NA antigen not only conferred protection of mice and ferrets to the matched influenza strains, but also against viruses carrying NA proteins from other strains of the same subtype. The extent of protection correlated with the level of cross-reactive NA-inhibiting antibodies. This highlights the potential of the NA antigen for the development of more broadly protective influenza vaccines. Such vaccines may also provide partial protection against newly emerging strains with the same NA but a different HA subtype. Copyright © 2018 American Society for Microbiology.

  15. The challenge for Beijing.

    PubMed

    Farrow, C

    1995-01-01

    It is time for women's environmental needs to be placed firmly on the agenda of the world's conferences. While connections were made at the 1994 International Conference on Population and Development between women's rights, economics, sustainable development, and environmental issues, the document being prepared for the Beijing Women's Conference reduces the strength of the links. Internationally, the connections between women as environmental managers, farmers, consumers, food producers, laborers, wives, and mother are still not being made. Women are being excluded from the planning process in ways that increase environmental degradation and women's workload and remove the resource base upon which women depend. While women produce more than half of the world's food supply, they have title to only 1% of the world's land. Misunderstanding the role of women during the project design stage can result in the exclusion of women from project benefits. When the project is the designation of a protected area, it must be recognized that the only way to protect an area is to protect those whose livelihoods depend upon maintaining the biodiversity of the protected area. Environmental degradation has also forced women to provide for their families alone as their husbands migrate to find work. Eventually, the women must also migrate and cope with inadequate living conditions. The most urgent environmental problems faced by rural women are caused by deforestation and desertification which lead to a lack of fuelwood, water, and a less diverse diet of wild foods. The involvement of women in the planning and delivery of integrated conservation and development schemes is essential.

  16. JV Task 94 - Air Quality V: Mercury, Trace Elements, SO3, and Particulate Matter Conference

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Thomas A. Erickson

    2007-01-31

    This final report summarizes the planning, preparation, facilitation and production, and summary of the conference entitled 'Air Quality V: Mercury, Trace Elements, SO{sub 3}, and Particulate Matter,' held September 18-21, 2005, in Arlington, Virginia. The goal of the conference was to build on the discussions of the first four Air Quality Conferences, providing further opportunity for leading representatives of industry, government, research institutions, academia, and environmental organizations to discuss the key interrelationships between policy and science shaping near-term regulations and controls and to assist in moving forward on emerging issues that will lead to acceptable programs and policies to protectmore » human health, the environment, and economic growth. The conference was extremely timely, as it was the last large conference prior to publication of the U.S. Environmental Protection Agency's final regulations for mercury control from coal-fired utilities, and provided a forum to realistically assess the status of mercury controls in relation to the new regulations.« less

  17. Prevention of herpes zoster and its complications: from the clinic to the real-life experience with the vaccine.

    PubMed

    Giovanni, Gabutti; Nicoletta, Valente; Parvanè, Kuhdari; Silvia, Lupi; Armando, Stefanati

    2016-12-01

    The erpes zoster is an acute viral illness characterized by a vesicular rash of unilateral distribution, which can eventually cause severe complications, such as post-herpetic neuralgia, ophthalmic zoster, stroke or other neurological complications. In Europe, an incidence of between 2.0 and 4.6 cases per 1000 person-years is estimated, with an increase after 50 years of age. Currently, the therapeutic options for are only partially effective in limiting the acute phase, while the management of complications is frequently complex and not satisfactory. The overall burden of the disease and the elevated costs associated with diagnosis and clinical and therapeutic management led to the development of a new preventive approach through a live attenuated virus vaccine. The vaccine now available decreases the incidence of the disease, post-herpetic neuralgia and the burden of illness. Moreover, the vaccine is safe and well tolerated and it seems to confer long-term protection. Based on the clinical results and evidence provided by the Health Technology Assessment, several countries introduced immunization although with different recommendations and methods of funding.

  18. Reappraisal and suppression mediate the contribution of regulatory focus to anxiety in healthy adults.

    PubMed

    Llewellyn, Nicole; Dolcos, Sanda; Iordan, Alexandru D; Rudolph, Karen D; Dolcos, Florin

    2013-08-01

    Theory and research link regulatory focus (RF) in the form of promotion and prevention goal orientation with internalizing symptoms (e.g., anxiety), but the relevant mechanisms are not well understood. This study investigated the role of two emotion regulation (ER) strategies (cognitive reappraisal and expressive suppression) as possible mediators. Path analysis using data from 179 healthy young participants (110 women, 69 men) revealed that stronger promotion orientation was significantly associated with less anxiety, and that the use of reappraisal and suppression partially mediated this association. Prevention was associated with more suppression but was not directly associated with anxiety. There were no gender differences in these effects. Collectively, these findings suggest that effective ER, through heightened use of reappraisal and dampened use of suppression, serves as a mechanism through which promotion confers protection against anxiety. This research provides empirical support to initiatives aimed at promoting healthy psychological adjustment and preventing anxiety, by optimizing ER strategies with respect to RF goal orientations. PsycINFO Database Record (c) 2013 APA, all rights reserved.

  19. Evaluation of Chromosomal Instability in Diabetic Rats Treated with Naringin

    PubMed Central

    A. Bakheet, Saleh; M. Attia, Sabry

    2011-01-01

    We used the bone marrow DNA strand breaks, micronucleus formations, spermatocyte chromosomal aberrations, and sperm characteristic assays to investigate the chromosomal instability in somatic and germinal cells of diabetic rats treated with multiple doses of naringin. The obtained results revealed that naringin was neither cytotoxic nor genotoxic for the rats at all tested doses. Moreover, naringin significantly reduced the diabetes-induced chromosomal instability in somatic and germinal cells in a dose-dependent manner. In addition, diabetes induced marked biochemical alterations characteristic of oxidative stress including enhanced lipid peroxidation, accumulation of oxidized glutathione, reduction in reduced glutathione, and accumulation of intracellular reactive oxygen species. Treatment with naringin ameliorated these biochemical markers dose-dependently. In conclusion, naringin confers an appealing protective effect against diabetes-induced chromosomal instability towards rat somatic and germinal cells which might be explained partially via diminishing the de novo free radical generation induced by hyperglycemia. Thus, naringin might be a good candidate to reduce genotoxic risk associated with hyperglycemia and may provide decreases in the development of secondary malignancy and abnormal reproductive outcomes risks, which seems especially important for diabetic patients. PMID:21941606

  20. A genetic screen reveals a periplasmic copper chaperone required for nitrite reductase activity in pathogenic Neisseria.

    PubMed

    Jen, Freda E-C; Djoko, Karrera Y; Bent, Stephen J; Day, Christopher J; McEwan, Alastair G; Jennings, Michael P

    2015-09-01

    Under conditions of low oxygen availability, Neisseria meningitidis and Neisseria gonorrhoeae are able to respire via a partial denitrification pathway in which nitrite is converted to nitrous oxide. In this process, nitrite reductase (AniA), a copper (Cu)-containing protein converts nitrite to NO, and this product is converted to nitrous oxide by nitric oxide reductase (NorB). NorB also confers protection against toxic NO, and so we devised a conditional lethal screen, using a norB mutant, to identify mutants that were resistant to nitrite-dependent killing. After random-deletion mutagenesis of N. meningitidis, this genetic screen identified a gene encoding a Cu chaperone that is essential for AniA function, AccA. Purified AccA binds one Cu (I) ion and also possesses a second binding site for Cu (II). This novel periplasmic Cu chaperone (AccA) appears to be essential for provision of Cu ions to AniA of pathogenic Neisseria to generate an active nitrite reductase. Apart from the Neisseria genus, AccA is distributed across a wide range of environmental Proteobacteria species. © FASEB.

  1. European Science Notes, volume 40, number 2

    NASA Astrophysics Data System (ADS)

    Shaffer, L. E.

    1986-02-01

    ESN is a monthly publication with brief articles on recent developments in European scientific research. Its partial contents are: Biotechnology Research at GBF, and at the Inst. of Technical Chemistry, Univ. of Hanover, West Germany; 7th European Immunology Congress; Biotechnia '85 - First International Congress for Biotechnology; Acoustic Cavitation Generated by Clinical Ultrasound; Advances in Chemical Reaction Dynamics; Geophysics Research in Israel; Fiber Composite Research at Paisley College of Technology, Scotland; A review of International Research on the Physical Metallurgy of Welding; Silicon Metallurgy at the Helsinki Technical Univ.; A Conference on Guided Optical Structures and Their Applications; Optoelectronics Research at Oxford Univ.; and Fractal Conferences in Europe.

  2. Numerical methods for the unsymmetric tridiagonal eigenvalue problem

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jessup, E.R.

    1996-12-31

    This report summarizes the results of our project {open_quotes}Numerical Methods for the Unsymmetric Tridiagonal Eigenvalue Problem{close_quotes}. It was funded by both by a DOE grant (No. DE-FG02-92ER25122, 6/1/92-5/31/94, $100,000) and by an NSF Research Initiation Award (No. CCR-9109785, 7/1/91-6/30/93, $46,564.) The publications resulting from that project during the DOE funding period are listed below. Two other journal papers and two other conference papers were produced during the NSF funding period. Most of the listed conference papers are early or partial versions of the listed journal papers.

  3. Neonatal Infection with G10P[11] Rotavirus Did Not Confer Protection against Subsequent Rotavirus Infection in a Community Cohort in Vellore, South India

    PubMed Central

    Banerjee, Indrani; Gladstone, Beryl Primrose; Le Fevre, Andrea M.; Ramani, Sasirekha; Iturriza-Gomara, Miren; Gray, James J.; Brown, David W.; Estes, Mary K.; Muliyil, Jaya Prakash; Jaffar, Shabbar; Kang, Gagandeep

    2008-01-01

    Background Various observational studies have suggested that neonatal rotavirus infection confers protection against diarrhea due to subsequent rotavirus infection. We examined the incidence of rotavirus infection and diarrhea during the first 2 years of life among children infected with the G10P[11] rotavirus strain during the neonatal period and those not infected with rotavirus. Methods Children were recruited at birth and were followed up at least twice weekly. Stool samples, collected every 2 weeks for surveillance and at each episode of diarrhea, were screened by enzyme-linked immunosorbent assay and were genotyped by polymerase chain reaction. Results Among 33 children infected neonatally with G10P[11] and 300 children not infected with rotavirus, there was no significant difference in the rates of rotavirus-positive diarrhea (rate ratio [RR], 1.05 [95% confidence interval {CI}, 0.61–1.79]), moderate or severe rotavirus-positive diarrhea (RR, 1.42 [95% CI, 0.73–2.78]), or asymptomatic rotavirus shedding (RR, 1.25 [95% CI, 0.85–1.83]). Conclusion Neonatal G10P[11] infection with a strain resembling a vaccine candidate did not confer protection against subsequent rotavirus infection or diarrhea of any severity in this setting. PMID:17262703

  4. Affinity Maturation of an Anti-V Antigen IgG Expressed In Situ Via Adenovirus Gene Delivery Confers Enhanced Protection Against Yersinia pestis Challenge

    PubMed Central

    Van Blarcom, Thomas J.; Sofer-Podesta, Carolina; Ang, John; Boyer, Julie L.; Crystal, Ronald G.; Georgiou, George

    2013-01-01

    Genetic transfer of neutralizing antibodies has been shown to confer strong and persistent protection against bacterial and viral infectious agents. While it is well established that for many exogenous neutralizing antibodies increased antigen affinity correlates with protection, the effect of antigen affinity on antibodies produced in situ following adenoviral gene transfer has not been examined. The mouse IgG2b monoclonal antibody 2C12.4 recognizes the Yersinia pestis Type III secretion apparatus protein LcrV (V antigen) and confers protection in mice when administered as an IgG intraperitoneally or, following genetic immunization with engineered, replication-defective serotype 5 human adenovirus (Ad) 1. 2C12.4 was expressed as a scFv fragment in E. coli and was shown to display a KD=3.5 nM by surface plasmon resonance (SPR) analysis. The 2C12.4 scFv was subjected to random mutagenesis and variants with increased affinity were isolated by flow cytometry using the Anchored Periplasmic Expression (APEx) bacterial display system. After a single round of mutagenesis, variants displaying up to 35-fold lower KD values (H8, KD=100 pM) were isolated. The variable domains of the H8 scFv were used to replace those of the parental 2C12.4 IgG encoded in the Ad vector, AdαV giving rise to AdαV.H8. The two adenoviral vectors resulted in similar titers of anti-V antigen antibodies 3 days post-immunization with 109, 1010 or 1011 particle units. Following intranasal challenge with 363 LD50Y. pestis CO92, 54% of the mice immunized with 1010 pu of AdαV.H8 survived at the 14 day end point compared to only 15% survivors for the group immunized with AdαV expressing the lower affinity 2C12.4 (P<0.04, AdαV versus AdαV.H8). These results indicate that affinity maturation of a neutralizing antibody delivered by genetic transfer may confer increased protection not only for Y. pestis challenge but possibly for other pathogens. PMID:20393511

  5. Radiofrequency use and management. Impacts from the World Administrative Radio Conference of 1979

    NASA Astrophysics Data System (ADS)

    1982-01-01

    The impacts on the United States of key decisions taken at the general World Administrative Radio Conference (WARC-79) and options for preparation and participation in future international telecommunication conferences were evaluated. Congressional concern for the adequacy of existing machinery and procedures for U.S. policymaking and preparation for such conferences were reflected. WARC-79 and related international conferences demonstrate that contention for access to the radio spectrum and its important collateral element, the geostationary orbit for communication satellites, presents new and urgent challenges to vital U.S. national interests. Given the complexities of spectrum management in a changing world environment and the increased importance of telecommunications to both developed and developing nations, it is unlikely that traditional U.S. approaches to these issues are sufficient to protect vital U.S. interests in the future. Problems require strategies not yet developed or tested.

  6. Long-term evaluation of mucosal and systemic immunity and protection conferred by different polio booster vaccines.

    PubMed

    Xiao, Yuhong; Daniell, Henry

    2017-09-25

    Oral polio vaccine (OPV) and Inactivated Polio Vaccine (IPV) have distinct advantages and limitations. IPV does not provide mucosal immunity and introduction of IPV to mitigate consequences of circulating vaccine-derived polio virus from OPV has very limited effect on transmission and OPV campaigns are essential for interrupting wild polio virus transmission, even in developed countries with a high coverage of IPV and protected sewer systems. The problem is magnified in many countries with limited resources. Requirement of refrigeration for storage and transportation for both IPV and OPV is also a major challenge in developing countries. Therefore, we present here long-term studies on comparison of a plant-based booster vaccine, which is free of virus and cold chain with IPV boosters and provide data on mucosal and systemic immunity and protection conferred by neutralizing antibodies. Mice were primed subcutaneously with IPV and boosted orally with lyophilized plant cells containing 1μg or 25μg polio viral protein 1 (VP1), once a month for three months or a single booster one year after the first prime. Our results show that VP1-IgG1 titers in single or double dose IPV dropped to background levels after one year of immunization. This decrease correlated with >50% reduction in seropositivity in double dose and <10% seropositivity in single dose IPV against serotype 1. Single dose IPV offered no or minimal protection against serotype 1 and 2 but conferred protection against serotype 3. VP1-IgA titers were negligible in IPV single or double dose vaccinated mice. VP1 antigen with two plant-derived adjuvants induced significantly high level and long lasting VP1-IgG1, IgA and neutralizing antibody titers (average 4.3-6.8 log2 titers). Plant boosters with VP1 and plant derived adjuvants maintained the same level titers from 29 to 400days and conferred the same level of protection against all three serotypes throughout the duration of this study. Even during period, when no plant booster was given (∼260days), VP1-IgG1 titers were maintained at high levels. Lyophilized plant cells expressing VP1 can be stored without losing efficacy, eliminating cold chain. Virus-free, cold-chain free vaccine is ready for further clinical development. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  7. A Safe Vaccine (DV-STM-07) against Salmonella Infection Prevents Abortion and Confers Protective Immunity to the Pregnant and New Born Mice

    PubMed Central

    Negi, Vidya Devi; Nagarajan, Arvindhan G.; Chakravortty, Dipshikha

    2010-01-01

    Pregnancy is a transient immuno-compromised condition which has evolved to avoid the immune rejection of the fetus by the maternal immune system. The altered immune response of the pregnant female leads to increased susceptibility to invading pathogens, resulting in abortion and congenital defects of the fetus and a subnormal response to vaccination. Active vaccination during pregnancy may lead to abortion induced by heightened cell mediated immune response. In this study, we have administered the highly attenuated vaccine strain ΔpmrG-HM-D (DV-STM-07) in female mice before the onset of pregnancy and followed the immune reaction against challenge with virulent S. Typhimurium in pregnant mice. Here we demonstrate that DV-STM-07 vaccine gives protection against Salmonella in pregnant mice and also prevents Salmonella induced abortion. This protection is conferred by directing the immune response towards Th2 activation and Th1 suppression. The low Th1 response prevents abortion. The use of live attenuated vaccine just before pregnancy carries the risk of transmission to the fetus. We have shown that this vaccine is safe as the vaccine strain is quickly eliminated from the mother and is not transmitted to the fetus. This vaccine also confers immunity to the new born mice of vaccinated mothers. Since there is no evidence of the vaccine candidate reaching the new born mice, we hypothesize that it may be due to trans-colostral transfer of protective anti-Salmonella antibodies. These results suggest that our vaccine DV-STM-07 can be very useful in preventing abortion in the pregnant individuals and confer immunity to the new born. Since there are no such vaccine candidates which can be given to the new born and to the pregnant women, this vaccine holds a very bright future to combat Salmonella induced pregnancy loss. PMID:20161765

  8. VP2 (PTA motif) encoding DNA vaccine confers protection against lethal challenge with infectious pancreatic necrosis virus (IPNV) in trout.

    PubMed

    Ahmadivand, Sohrab; Soltani, Mehdi; Behdani, Mahdi; Evensen, Øystein; Alirahimi, Ehsan; Soltani, Elahe; Hassanzadeh, Reza; Ashrafi-Helan, Javad

    2018-02-01

    IPNV in Atlantic salmon is represented by various strains with different virulence and immunogenicity linked to various motifs of the VP2 capsid. IPNV variant with P 217 , T 221 , A 247 (PTA) motif is found to be avirulent in Atlantic salmon, but virulent in rainbow trout, and other salmonid species. This study describes a DNA vaccine delivered intramuscularly encoding the VP2 protein of infectious pancreatic necrosis virus (IPNV) with PTA motif that confers high protection in rainbow trout (Oncorhynchus mykiss). Intramuscular injection of 2, 5 and 10 μg of DNA (pcDNA3.1-VP2) in rainbow trout fry (4-5 g), confers relative protection of 75-83% in the different vaccine groups at 30 days post vaccination (450° days). The VP2 gene is expressed in spleen, kidney, muscle and liver at day 30 post-vaccination (RT-PCR), and IFN-1 and Mx-1 mRNA are upregulated at early time post vaccination, and so also for IgM, IgT, CD4 and CD8 in the head kidney of vaccinated fish compared to controls, 15 and 30 days post vaccination. Significant increase of serum anti-IPNV antibodies was found 30-90 days post-vaccination that was correlated with protection levels. Mortality corresponded with viral VP4 gene expression were significantly decreased in vaccinated and challenged fish. This shows for the first time that a VP2-encoding DNA vaccine delivered intramuscularly elicits a high level of protection alongside with high levels of circulating antibodies in rainbow trout and a lowered viral replication. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Gut Microbiota Elicits a Protective Immune Response against Malaria Transmission

    PubMed Central

    Yilmaz, Bahtiyar; Portugal, Silvia; Tran, Tuan M.; Gozzelino, Raffaella; Ramos, Susana; Gomes, Joana; Regalado, Ana; Cowan, Peter J.; d’Apice, Anthony J.F.; Chong, Anita S.; Doumbo, Ogobara K.; Traore, Boubacar; Crompton, Peter D.; Silveira, Henrique; Soares, Miguel P.

    2014-01-01

    Summary Glycosylation processes are under high natural selection pressure, presumably because these can modulate resistance to infection. Here, we asked whether inactivation of the UDP-galactose:β-galactoside-α1-3-galactosyltransferase (α1,3GT) gene, which ablated the expression of the Galα1-3Galβ1-4GlcNAc-R (α-gal) glycan and allowed for the production of anti-α-gal antibodies (Abs) in humans, confers protection against Plasmodium spp. infection, the causative agent of malaria and a major driving force in human evolution. We demonstrate that both Plasmodium spp. and the human gut pathobiont E. coli O86:B7 express α-gal and that anti-α-gal Abs are associated with protection against malaria transmission in humans as well as in α1,3GT-deficient mice, which produce protective anti-α-gal Abs when colonized by E. coli O86:B7. Anti-α-gal Abs target Plasmodium sporozoites for complement-mediated cytotoxicity in the skin, immediately after inoculation by Anopheles mosquitoes. Vaccination against α-gal confers sterile protection against malaria in mice, suggesting that a similar approach may reduce malaria transmission in humans. PaperFlick PMID:25480293

  10. Vaccine approaches conferring cross-protection against influenza viruses

    PubMed Central

    Vemula, Sai V.; Sayedahmed, Ekramy E; Sambhara, Suryaprakash; Mittal, Suresh K.

    2018-01-01

    Introduction Annual vaccination is one of the most efficient and cost-effective strategies to prevent and control influenza epidemics. Most of currently available influenza vaccines are strong inducer of antibody responses against viral surface proteins, hemagglutinin (HA) and neuraminidase (NA), but are poor inducers of cell-mediated immune responses against conserved internal proteins. Moreover, due to the high variability of viral surface proteins because of antigenic drift or antigenic shift, many of the currently licensed vaccines confer little or no protection against drift or shift variants. Areas covered Next generation influenza vaccines that can induce humoral immune responses to receptor-binding epitopes as well as broadly neutralizing conserved epitopes, and cell-mediated immune responses against highly conserved internal proteins would be effective against variant viruses as well as a novel pandemic influenza until circulating strain-specific vaccines become available. Here we discuss vaccine approaches that have potential to provide broad spectrum protection against influenza viruses. Expert opinion Based on current progress in defining cross-protective influenza immunity, it seems that the development of a universal influenza vaccine is feasible. It would revolutionize the strategy for influenza pandemic preparedness, and significantly impact the shelf-life and protection efficacy of seasonal influenza vaccines. PMID:28925296

  11. Virus-like Particles Containing Multiple M2 Extracellular Domains Confer Improved Cross-protection Against Various Subtypes of Influenza Virus

    PubMed Central

    Kim, Min-Chul; Song, Jae-Min; O, Eunju; Kwon, Young-Man; Lee, Youn-Jeong; Compans, Richard W; Kang, Sang-Moo

    2013-01-01

    The extracellular domain of M2 (M2e), a small ion channel membrane protein, is well conserved among different human influenza A virus strains. To improve the protective efficacy of M2e vaccines, we genetically engineered a tandem repeat of M2e epitope sequences (M2e5x) of human, swine, and avian origin influenza A viruses, which was expressed in a membrane-anchored form and incorporated in virus-like particles (VLPs). The M2e5x protein with the transmembrane domain of hemagglutinin (HA) was effectively incorporated into VLPs at a several 100-fold higher level than that on influenza virions. Intramuscular immunization with M2e5x VLP vaccines was highly effective in inducing M2e-specific antibodies reactive to different influenza viruses, mucosal and systemic immune responses, and cross-protection regardless of influenza virus subtypes in the absence of adjuvant. Importantly, immune sera were found to be sufficient for conferring protection in naive mice, which was long-lived and cross-protective. Thus, molecular designing and presenting M2e immunogens on VLPs provide a promising platform for developing universal influenza vaccines without using adjuvants. PMID:23247101

  12. Discovering naturally processed antigenic determinants that confer protective T cell immunity

    PubMed Central

    Gilchuk, Pavlo; Spencer, Charles T.; Conant, Stephanie B.; Hill, Timothy; Gray, Jennifer J.; Niu, Xinnan; Zheng, Mu; Erickson, John J.; Boyd, Kelli L.; McAfee, K. Jill; Oseroff, Carla; Hadrup, Sine R.; Bennink, Jack R.; Hildebrand, William; Edwards, Kathryn M.; Crowe, James E.; Williams, John V.; Buus, Søren; Sette, Alessandro; Schumacher, Ton N.M.; Link, Andrew J.; Joyce, Sebastian

    2013-01-01

    CD8+ T cells (TCD8) confer protective immunity against many infectious diseases, suggesting that microbial TCD8 determinants are promising vaccine targets. Nevertheless, current T cell antigen identification approaches do not discern which epitopes drive protective immunity during active infection — information that is critical for the rational design of TCD8-targeted vaccines. We employed a proteomics-based approach for large-scale discovery of naturally processed determinants derived from a complex pathogen, vaccinia virus (VACV), that are presented by the most frequent representatives of four major HLA class I supertypes. Immunologic characterization revealed that many previously unidentified VACV determinants were recognized by smallpox-vaccinated human peripheral blood cells in a variegated manner. Many such determinants were recognized by HLA class I–transgenic mouse immune TCD8 too and elicited protective TCD8 immunity against lethal intranasal VACV infection. Notably, efficient processing and stable presentation of immune determinants as well as the availability of naive TCD8 precursors were sufficient to drive a multifunctional, protective TCD8 response. Our approach uses fundamental insights into T cell epitope processing and presentation to define targets of protective TCD8 immunity within human pathogens that have complex proteomes, suggesting that this approach has general applicability in vaccine sciences. PMID:23543059

  13. Discovering naturally processed antigenic determinants that confer protective T cell immunity.

    PubMed

    Gilchuk, Pavlo; Spencer, Charles T; Conant, Stephanie B; Hill, Timothy; Gray, Jennifer J; Niu, Xinnan; Zheng, Mu; Erickson, John J; Boyd, Kelli L; McAfee, K Jill; Oseroff, Carla; Hadrup, Sine R; Bennink, Jack R; Hildebrand, William; Edwards, Kathryn M; Crowe, James E; Williams, John V; Buus, Søren; Sette, Alessandro; Schumacher, Ton N M; Link, Andrew J; Joyce, Sebastian

    2013-05-01

    CD8+ T cells (TCD8) confer protective immunity against many infectious diseases, suggesting that microbial TCD8 determinants are promising vaccine targets. Nevertheless, current T cell antigen identification approaches do not discern which epitopes drive protective immunity during active infection - information that is critical for the rational design of TCD8-targeted vaccines. We employed a proteomics-based approach for large-scale discovery of naturally processed determinants derived from a complex pathogen, vaccinia virus (VACV), that are presented by the most frequent representatives of four major HLA class I supertypes. Immunologic characterization revealed that many previously unidentified VACV determinants were recognized by smallpox-vaccinated human peripheral blood cells in a variegated manner. Many such determinants were recognized by HLA class I-transgenic mouse immune TCD8 too and elicited protective TCD8 immunity against lethal intranasal VACV infection. Notably, efficient processing and stable presentation of immune determinants as well as the availability of naive TCD8 precursors were sufficient to drive a multifunctional, protective TCD8 response. Our approach uses fundamental insights into T cell epitope processing and presentation to define targets of protective TCD8 immunity within human pathogens that have complex proteomes, suggesting that this approach has general applicability in vaccine sciences.

  14. Titan Cells Confer Protection from Phagocytosis in Cryptococcus neoformans Infections

    PubMed Central

    Okagaki, Laura H.

    2012-01-01

    The human fungal pathogen Cryptococcus neoformans produces an enlarged “titan” cell morphology when exposed to the host pulmonary environment. Titan cells exhibit traits that promote survival in the host. Previous studies showed that titan cells are not phagocytosed and that increased titan cell production in the lungs results in reduced phagocytosis of cryptococcal cells by host immune cells. Here, the effect of titan cell production on host-pathogen interactions during early stages of pulmonary cryptococcosis was explored. The relationship between titan cell production and phagocytosis was found to be nonlinear; moderate increases in titan cell production resulted in profound decreases in phagocytosis, with significant differences occurring within the first 24 h of the infection. Not only were titan cells themselves protected from phagocytosis, but titan cell formation also conferred protection from phagocytosis to normal-size cryptococcal cells. Large particles introduced into the lungs were not phagocytosed, suggesting the large size of titan cells protects against phagocytosis. The presence of large particles was unable to protect smaller particles from phagocytosis, revealing that titan cell size alone is not sufficient to provide the observed cross-protection of normal-size cryptococcal cells. These data suggest that titan cells play a critical role in establishment of the pulmonary infection by promoting the survival of the entire population of cryptococcal cells. PMID:22544904

  15. Titan cells confer protection from phagocytosis in Cryptococcus neoformans infections.

    PubMed

    Okagaki, Laura H; Nielsen, Kirsten

    2012-06-01

    The human fungal pathogen Cryptococcus neoformans produces an enlarged "titan" cell morphology when exposed to the host pulmonary environment. Titan cells exhibit traits that promote survival in the host. Previous studies showed that titan cells are not phagocytosed and that increased titan cell production in the lungs results in reduced phagocytosis of cryptococcal cells by host immune cells. Here, the effect of titan cell production on host-pathogen interactions during early stages of pulmonary cryptococcosis was explored. The relationship between titan cell production and phagocytosis was found to be nonlinear; moderate increases in titan cell production resulted in profound decreases in phagocytosis, with significant differences occurring within the first 24 h of the infection. Not only were titan cells themselves protected from phagocytosis, but titan cell formation also conferred protection from phagocytosis to normal-size cryptococcal cells. Large particles introduced into the lungs were not phagocytosed, suggesting the large size of titan cells protects against phagocytosis. The presence of large particles was unable to protect smaller particles from phagocytosis, revealing that titan cell size alone is not sufficient to provide the observed cross-protection of normal-size cryptococcal cells. These data suggest that titan cells play a critical role in establishment of the pulmonary infection by promoting the survival of the entire population of cryptococcal cells.

  16. Operator dermal exposure and protection provided by personal protective equipment and working coveralls during mixing/loading, application and sprayer cleaning in vineyards.

    PubMed

    Thouvenin, Isabelle; Bouneb, Françoise; Mercier, Thierry

    2017-06-01

    The efficiency of a working coverall combined with personal protective equipment to protect operators against dermal exposure to plant protection products under field conditions was studied. Operators wore a non-certified water-repellent finish polyester/cotton coverall plus a certified gown during the mixing/loading and the cleaning phases. Insecticide foliar application to a vineyard was selected as the exposure scenario. The overall dermal residue levels measured in this study were in the range of data recently collected in Europe. The water-repellent finish working coverall reduced body exposure by a factor of approximately 95%. Wearing a Category III Type 3 partial body gown during mixing/loading and cleaning of the application equipment led to a further protective effect of 98.7%. The combination of a water-repellent finish working coverall and partial body protection during specific tasks provided satisfactory levels of protection and can be considered as suitable protection for the conditions of use studied.

  17. A resident conference for systems-based practice and practice-based learning.

    PubMed

    Sultana, Carmen J; Baxter, Jason K

    2011-02-01

    Improving patient safety and quality of care is part of systems-based practice and practice-based learning for residents. We expanded our obstetrics and gynecology department's regularly scheduled morbidity and mortality conferences to teach quality assurance concepts based on patient care on obstetrics and gynecology fourth-year resident rotations. Obstetrics and gynecology fourth-year residents on one of the two rotations each presented and analyzed a systems-based problem they encountered during patient care. They used an online learning module and proposed solutions, many of which were effectively implemented. Over 5 years, case presentations from 33 conferences were available with problems identified in emergency preparedness, coordination of care, scheduling and supervision, communication, medical practice, documentation, and lack of equipment or facilities. Twenty-two of the suggested solutions were partially or totally implemented. Barriers to implementation were identified. In conclusion, a conference presentation by fourth-year residents can identify patient safety problems, aid in their resolution, and suggest changes to patient care while teaching the principles of systems-based practice and practice-based learning.

  18. Combination of Pneumococcal Surface Protein A (PspA) with Whole Cell Pertussis Vaccine Increases Protection Against Pneumococcal Challenge in Mice

    PubMed Central

    Ferreira, Daniela M.; Moreno, Adriana T.; Ferreira, Patricia C. D.; Lima, Fernanda A.; Santos, Fernanda L.; Sakauchi, Maria Aparecida; Takata, Célia S.; Higashi, Hisako G.; Raw, Isaías; Kubrusly, Flavia S.; Ho, Paulo L.

    2010-01-01

    Streptococcus pneumoniae is the leading cause of respiratory acute infections around the world. In Latin America, approximately 20,000 children under 5 years of age die of pneumococcal diseases annually. Pneumococcal surface protein A (PspA) is among the best-characterized pneumococcal antigens that confer protection in animal models of pneumococcal infections and, as such, is a good alternative for the currently available conjugated vaccines. Efficient immune responses directed to PspA in animal models have already been described. Nevertheless, few low cost adjuvants for a subunit pneumococcal vaccine have been proposed to date. Here, we have tested the adjuvant properties of the whole cell Bordetella pertussis vaccine (wP) that is currently part of the DTP (diphtheria-tetanus-pertussis) vaccine administrated to children in several countries, as an adjuvant to PspA. Nasal immunization of BALB/c mice with a combination of PspA5 and wP or wPlow – a new generation vaccine that contains low levels of B. pertussis LPS – conferred protection against a respiratory lethal challenge with S. pneumoniae. Both PspA5-wP and PspA5-wPlow vaccines induced high levels of systemic and mucosal antibodies against PspA5, with similar profile, indicating no essential requirement for B. pertussis LPS in the adjuvant properties of wP. Accordingly, nasal immunization of C3H/HeJ mice with PspA5-wP conferred protection against the pneumococcal challenge, thus ruling out a role for TLR4 responses in the adjuvant activity and the protection mechanisms triggered by the vaccines. The high levels of anti-PspA5 antibodies correlated with increased cross-reactivity against PspAs from different clades and also reflected in cross-protection. In addition, passive immunization experiments indicated that antibodies played an important role in protection in this model. Finally, subcutaneous immunization with a combination of PspA5 with DTPlow protected mice against challenge with two different pneumococcal strains, opening the possibility for the development of a combined infant vaccine composed of DTP and PspA. PMID:20523738

  19. An Overview: Consumer Protection in Higher Education. Why? For Whom? How?

    ERIC Educational Resources Information Center

    Willett, Sandra L.

    The protection of the student and prospective student at the postsecondary level is examined. Twenty-five possible educational abuses and concerns, such as discriminatory refund policies and misrepresentation, identified by the Federal Interagency on Education are listed. Ten issues selected as the thrust of the first National Conference on…

  20. From Punishment to Education: The International Debate on Juvenile Penal Reform before World War I

    ERIC Educational Resources Information Center

    Fuchs, Eckhardt

    2015-01-01

    The article addresses international efforts at child protection, emphasizing the criminal law on juveniles before 1914, and focuses on key international organizations and their various conferences and congresses. Although there was an institutional divide between welfare in general, child protection and youth crime, the organizations covered…

  1. Early protection events in swine immunized with an experimental live attenuated classical swine fever marker vaccine, FlagT4G

    USDA-ARS?s Scientific Manuscript database

    Prophylactic vaccination using live attenuated classical swine fever (CSF) vaccines has been a very effective method to control disease in endemic regions and during outbreaks in previously disease-free areas. These vaccines confer effective protection against the disease at early times post-vaccina...

  2. Proceedings of papers presented at the 2nd international symposium on applications of biotechnology to tree culture, protection, and utilization.

    Treesearch

    Charles H. Michler; Michael R. Becwar; Daniel Cullen; Warren L. Nance; Ronald R. Sederoff; James M. Silvicek

    1994-01-01

    Contains 38 oral presentation abstracts, 34 poster abstracts, and 18 manuscripts on applications of biotechnology to tree research in the areas of stress resistance, protection, and wood utilization presented at an international conference in Bloomington, Minnesota, October 2-6, 1994.

  3. African swine fever virus serotype-specific proteins are significant protective antigens for African swine fever

    USDA-ARS?s Scientific Manuscript database

    African swine fever (ASF) is an emerging disease threat for the swine industry worldwide. No ASF vaccine is available and progress is hindered by lack of knowledge concerning the extent of African swine fever virus (ASFV) strain diversity and the viral antigens conferring type specific protective im...

  4. Maternally derived antibodies in commercial broiler chickens did not significantly interfere with protection of Newcastle disease virus vectored infectious laryngotracheitis vaccines

    USDA-ARS?s Scientific Manuscript database

    Newcastle disease virus (NDV) recombinants expressing the infectious laryngotracheitis virus (ILTV) glycoproteins B and D have previously been demonstrated to confer complete clinical protection against virulent ILTV and NDV challenges in naive chickens. However, there was a general concern that the...

  5. [Human milk, immune responses and health effects].

    PubMed

    Løland, Beate Fossum; Baerug, Anne B; Nylander, Gro

    2007-09-20

    Besides providing optimal nutrition to infants, human milk contains a multitude of immunological components. These components are important for protection against infections and also support the development and maturation of the infant's own immune system. This review focuses on the function of some classical immunocomponents of human milk. Relevant studies are presented that describe health benefits of human milk for the child and of lactation for the mother. Relevant articles were found mainly by searching PubMed. Humoral and cellular components of human milk confer protection against infections in the respiratory--, gastrointestinal--and urinary tract. Human milk also protects premature children from neonatal sepsis and necrotizing enterocolitis. There is evidence that human milk may confer long-term benefits such as lower risk of certain autoimmune diseases, inflammatory bowel disease and probably some malignancies. Human milk possibly affects components of the metabolic syndrome. Recent studies demonstrate long-term health benefits of lactation also for the mother. A reduced incidence of breast cancer is best documented. An increasing number of studies indicate protection against ovarian cancer, rheumatoid arthritis and type II diabetes.

  6. Microneedle delivery of an M2e-TLR5 ligand fusion protein to skin confers broadly cross-protective influenza immunity.

    PubMed

    Wang, Bao-Zhong; Gill, Harvinder S; He, Cheng; Ou, Changbo; Wang, Li; Wang, Ying-Chun; Feng, Hao; Zhang, Han; Prausnitz, Mark R; Compans, Richard W

    2014-03-28

    Influenza vaccines with broad cross-protection are urgently needed to prevent an emerging influenza pandemic. A fusion protein of the Toll-like receptor (TLR) 5-agonist domains from flagellin and multiple repeats of the conserved extracellular domain of the influenza matrix protein 2 (M2e) was constructed, purified and evaluated as such a vaccine. A painless vaccination method suitable for possible self-administration using coated microneedle arrays was investigated for skin-targeted delivery of the fusion protein in a mouse model. The results demonstrate that microneedle immunization induced strong humoral as well as mucosal antibody responses and conferred complete protection against homo- and heterosubtypic lethal virus challenges. Protective efficacy with microneedles was found to be significantly better than that seen with conventional intramuscular injection, and comparable to that observed with intranasal immunization. Because of its advantages for administration, safety and storage, microneedle delivery of M2e-flagellin fusion protein is a promising approach for an easy-to-administer universal influenza vaccine. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. Protective efficacy of a novel recombinant Marek's disease virus vector vaccine against infectious bursal disease in chickens with or without maternal antibodies.

    PubMed

    Li, Kai; Liu, Yongzhen; Zhang, Yanping; Gao, Li; Liu, Changjun; Cui, Hongyu; Qi, Xiaole; Gao, Yulong; Zhong, Li; Wang, Xiaomei

    2017-04-01

    Infectious bursal disease (IBD) causes significant clinical and economic losses to the poultry industry worldwide. Current vaccine programs using live attenuated and inactivated vaccines have numerous drawbacks. As an alternative solution to control IBD, a Marek's disease virus (MDV) vector vaccine (rMDV-VP2) expressing the VP2 gene of infectious bursal disease virus (IBDV) has been developed. In this study, the protective efficacy of rMDV-VP2 was evaluated in a dose-related experiment which showed that a single dose of 1000 PFU was sufficient to fully protect chickens against IBDV infection. Chickens inoculated with lower doses of rMDV-VP2 (250 or 500 PFU) conferred 80 and 90% protection against IBDV. Next, rMDV-VP2 vaccine provided 90% protection against IBDV in commercial layer chickens with maternal antibodies, which was higher than the protective efficacy using the B87 live vaccine of IBDV. Additionally, rMDV-VP2 conferred effective protection against very virulent MDV challenge in chickens (95% for chickens vaccinated with 250 or 500 PFU and 100% for chickens vaccinated with 1000 or 2000 PFU). These results demonstrated that rMDV-VP2 may be a novel bivalent vaccine against IBD and Marek's disease in chickens. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Design and Development of a High Altitude Protective Assembly.

    DTIC Science & Technology

    CWU-3/P ANTIGRAVITY SUITS, CWU-12/P ANTIEXPOSURE SUITS, HAPA(HIGH ALTITUDE PROTECTIVE ASSEMBLIES), *HIGH ALTITUDE PROTECTIVE ASSEMBLIES, LPU-3/P LIFE PRESERVERS, MA-3 VENTILATION GARMENTS, PARACHUTE HARNESSES, PARTIAL PRESSURE SUITS.

  9. CD4 T cell-mediated protection from lethal influenza: perforin and antibody-mediated mechanisms give a one-two punch.

    PubMed

    Brown, Deborah M; Dilzer, Allison M; Meents, Dana L; Swain, Susan L

    2006-09-01

    The mechanisms whereby CD4 T cells contribute to the protective response against lethal influenza infection remain poorly characterized. To define the role of CD4 cells in protection against a highly pathogenic strain of influenza, virus-specific TCR transgenic CD4 effectors were generated in vitro and transferred into mice given lethal influenza infection. Primed CD4 effectors conferred protection against lethal infection over a broad range of viral dose. The protection mediated by CD4 effectors did not require IFN-gamma or host T cells, but did result in increased anti-influenza Ab titers compared with untreated controls. Further studies indicated that CD4-mediated protection at high doses of influenza required B cells, and that passive transfer of anti-influenza immune serum was therapeutic in B cell-deficient mice, but only when CD4 effectors were present. Primed CD4 cells also acquired perforin (Pfn)-mediated cytolytic activity during effector generation, suggesting a second mechanism used by CD4 cells to confer protection. Pfn-deficient CD4 effectors were less able to promote survival in intact BALB/c mice and were unable to provide protection in B cell-deficient mice, indicating that Ab-independent protection by CD4 effectors requires Pfn. Therefore, CD4 effectors mediate protection to lethal influenza through at least two mechanisms: Pfn-mediated cytotoxicity early in the response promoted survival independently of Ab production, whereas CD4-driven B cell responses resulted in high titer Abs that neutralized remaining virus.

  10. Is new always better than old?: The development of human vaccines for anthrax.

    PubMed

    Baillie, Leslie W

    2009-12-01

    Anthrax is caused by a Gram-positive aerobic spore-forming bacillus called Bacillus anthracis. Although primarily a disease of animals, it can also infect man, sometimes with fatal consequences. As a result of concerns over the illicit use of this organism, considerable effort is focused on the development of therapies capable of conferring protection against anthrax. while effective concerns over the toxicity of the current vaccines have driven the development of second-generation products. Recombinant Protective Antigen (rPA), the nontoxic cell-binding component of anthrax lethal toxin, is the principal immunogen of the vaccines currently undergoing human clinical trials. While these new vaccines are likely to show reduced side effects they will still require multiple needle based dosing and the inclusion of the adjuvant alum which will make them expensive to administer and stockpile. To address these issues, researchers are seeking to develop vaccine formulations capable of stimulating rapid protection following needle-free injection which are stable at room temperature to facilitate stockpiling and mass vaccination programs. Recent concerns over the potential use of molecular biology to engineer vaccine resistant strains has prompted investigators to identify additional vaccine targets with which to extend the spectrum of protection conferred by rPA. While the injection of research dollars has seen a dramatic expansion of the anthrax vaccine field it is sobering to remember that work to develop the current second generation vaccines began around the time of the first gulf war. Almost two decades and millions of dollars later we still do not have a replacement vaccine and even when we do some argue that the spectrum of protection that it confers will not be as broad as the vaccine it replaces. If we are to respond effectively to emerging biological threats we need to develop processes that generate protective vaccines in a meaningful time frame and yield products in months not decades!

  11. Extended abstracts for an international conference on the development of the North and problems of recultivation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Everett, K.R.

    1994-12-31

    Ecological problems in many regions on Earth are the result of increasing technological pressure on the environment. These problems concern many of us and cause mankind to unite in order to search for means to protect the environment. Scientists, especially are responsible for the protection of the biosphere. The objective of this conference was to discuss the results of studies on the present condition of the environment in the Far North where the industrial pressure is increasing. The participants of this conference also offered and suggested various necessary measures for the protection of the region and restoration of its disturbedmore » sites. The specific structural characteristics of the environment of the Far North, tundra and northern taiga, cause its fragility and vulnerability to anthropogenic impact. The destruction of the thin, weak layer of soil and vegetation cover changes the thermal balance and thus causes the development of erosion process, which in their turn increase the zone of the direct technogenous destruction. Self restoration processes in this harsh climate usually are slow. The preservation of the ecological integrity in the Far North is essential for the stability of the biosphere of the planet. The specifics of the natural conditions must be taken into account so that man will be able to develop the means of intensive agro-technology that can speed up the process of restoration of the biocenosis in the damaged areas. The extended abstracts of the conference reports that constitute this volume contain both theoretical discussions of problems of recultivation as well as accounts of experimental studies and applied explorations.« less

  12. PREFACE: Inhaled Particles X: 23-25 September 2008, Sheffield UK

    NASA Astrophysics Data System (ADS)

    Kenny, Lee; Hurley, Fintan

    2009-07-01

    Multi-disciplinary research is vital to the science of particle-mediated lung disease and a distinctive feature of the Inhaled Particles Conference series. Continuing this tradition, Inhaled Particles X brought together world-renowned and up-and-coming researchers from a wide range of specialist disciplines, but with a common interest and purpose: to understand better the nature of inhalable particles and their effects once inhaled, for the protection of workers' and public health. IPX was an integrative Conference, in three ways. First, as usual with Inhaled Particles, IPX welcomed the full range of disciplines and scientists concerned with protection of health from inhaled particles. This included engineers concerned with dust control; scientists characterising and modelling emissions; exposure measurement, in the field and in the laboratory; experts in particle deposition and clearance; toxicologists discovering mechanisms of damage; epidemiologists developing and applying methods to link exposure with risk; and those concerned with policy - with setting standards, with protection of individuals. Secondly, IPX was concerned with particles in the workplace, in outdoor air, and in the general indoor environment; and tried to find common threads and encourage cross-over of ideas between these three broad fields. And thirdly, IPX integrated experience and perspectives internationally, including issues such as silicosis and pneumoconiosis that are now unfashionable as research topics in the developed Western economies but still constitute a major public health risk internationally. Contributors to IPX were invited to submit extended abstracts for publication in these Proceedings; in addition, all authors were asked to prepare a short abstract. These short abstracts (including those attached to extended abstracts and papers) are collected and published together in this Conference Overview, to maintain the integrity of the Proceedings as a record of the Conference as a whole.

  13. Advocating for efforts to protect African children, families, and communities from the threat of infectious diseases: report of the First International African Vaccinology Conference.

    PubMed

    Wiysonge, Charles Shey; Waggie, Zainab; Hawkridge, Anthony; Schoub, Barry; Madhi, Shabir Ahmed; Rees, Helen; Hussey, Gregory

    2016-01-01

    One means of improving healthcare workers' knowledge of and attitudes to vaccines is through running vaccine conferences which are accessible, affordable, and relevant to their everyday work. Various vaccinology conferences are held each year worldwide. These meetings focus heavily on basic science with much discussion about new developments in vaccines, and relatively little coverage of policy, advocacy, and communication issues. A negligible proportion of delegates at these conferences come from Africa, home to almost 40% of the global burden of vaccine-preventable diseases. To the best of our knowledge, no major vaccinology conference has ever been held on the African continent apart from World Health Organization (WHO) meetings. The content of the first International African Vaccinology Conference was planned to be different; to focus on the science, with a major part of discussions being on clinical, programmatic, policy, and advocacy issues. The conference was held in Cape Town, South Africa, from 8 to 11 November 2012. The theme of the conference was "Advocating for efforts to protect African children, families, and communities from the threat of infectious diseases". There were more than 550 registered participants from 55 countries (including 37 African countries). There were nine pre-conference workshops, ten plenary sessions, and 150 oral and poster presentations. The conference discussed the challenges to universal immunisation in Africa as well as the promotion of dialogue and communication on immunisation among all stakeholders. There was general acknowledgment that giant strides have been made in Africa since the global launch of the Expanded Programme on Immunisation in 1974. For example, there has been significant progress in introducing new and under-utilised vaccines; including hepatitis B, Haemophilus influenza type b, pneumococcal conjugate, rotavirus, meningococcal A conjugate, and human papillomavirus vaccines. In May 2012, African countries endorsed the Global Vaccine Action Plan at the World Health Assembly. However, more than six million children remain incompletely vaccinated in Africa leading to more than one million vaccine-preventable deaths annually. In addition, there are persistent problems with leadership and planning, vaccine stock management, supply chain capacity and quality, provider-parent communication, and financial sustainability. The conference delegates agreed to move from talking to taking concrete actions around children's health, and to ensure that African governments commit to saving children's lives. They would advocate for lower costs of immunisation programmes in Africa, perhaps through bulk buying and improved administration of vaccine rollout through the New Partnership for Africa's Development.

  14. Advocating for efforts to protect African children, families, and communities from the threat of infectious diseases: report of the First International African Vaccinology Conference

    PubMed Central

    Wiysonge, Charles Shey; Waggie, Zainab; Hawkridge, Anthony; Schoub, Barry; Madhi, Shabir Ahmed; Rees, Helen; Hussey, Gregory

    2016-01-01

    One means of improving healthcare workers’ knowledge of and attitudes to vaccines is through running vaccine conferences which are accessible, affordable, and relevant to their everyday work. Various vaccinology conferences are held each year worldwide. These meetings focus heavily on basic science with much discussion about new developments in vaccines, and relatively little coverage of policy, advocacy, and communication issues. A negligible proportion of delegates at these conferences come from Africa, home to almost 40% of the global burden of vaccine-preventable diseases. To the best of our knowledge, no major vaccinology conference has ever been held on the African continent apart from World Health Organization (WHO) meetings. The content of the first International African Vaccinology Conference was planned to be different; to focus on the science, with a major part of discussions being on clinical, programmatic, policy, and advocacy issues. The conference was held in Cape Town, South Africa, from 8 to 11 November 2012. The theme of the conference was “Advocating for efforts to protect African children, families, and communities from the threat of infectious diseases”. There were more than 550 registered participants from 55 countries (including 37 African countries). There were nine pre-conference workshops, ten plenary sessions, and 150 oral and poster presentations. The conference discussed the challenges to universal immunisation in Africa as well as the promotion of dialogue and communication on immunisation among all stakeholders. There was general acknowledgment that giant strides have been made in Africa since the global launch of the Expanded Programme on Immunisation in 1974. For example, there has been significant progress in introducing new and under-utilised vaccines; including hepatitis B, Haemophilus influenza type b, pneumococcal conjugate, rotavirus, meningococcal A conjugate, and human papillomavirus vaccines. In May 2012, African countries endorsed the Global Vaccine Action Plan at the World Health Assembly. However, more than six million children remain incompletely vaccinated in Africa leading to more than one million vaccine-preventable deaths annually. In addition, there are persistent problems with leadership and planning, vaccine stock management, supply chain capacity and quality, provider-parent communication, and financial sustainability. The conference delegates agreed to move from talking to taking concrete actions around children's health, and to ensure that African governments commit to saving children's lives. They would advocate for lower costs of immunisation programmes in Africa, perhaps through bulk buying and improved administration of vaccine rollout through the New Partnership for Africa's Development. PMID:27217879

  15. Electromagnetic Devices and Processes in Environment Protection: Post-Conference Materials.

    DTIC Science & Technology

    1994-09-09

    the Response of Power Transmission and Distribution Lines to a Nuclear Detonation at a High Altitude" 5. R. Goleman, M. Pahczyk, M. Pawlot...processes are unfortunately endothermal ones. However, if necessary energy is produced via a C02-free way(e.g. using solar, hydro, wind, nuclear or...POST-CONFERENCE MATERIALS 31 DETERMINING THE RESPONSE OF POWER TRANSMISSION AND DISTRIBUTION LINES TO A NUCLEAR DETONATION AT A HIGH ALTITUDE

  16. Proceedings of the symposium on current research on wood-destroying organisms and future prospects for protecting wood in use; September 13, 1989; Bend, OR.

    Treesearch

    Michael I. Haverty; W. Wayne Wilcox

    1991-01-01

    In 1989 the Western International Forest Disease Work Conference and the Western Forest Insect Work Conference met jointly in Bend, Oregon, during the week of September 11-15, 1989. One of the 90-minute, concurrent workshops scheduled during this period was a discussion of the biology and present and future control strategies of wood-destroying organisms. This subject...

  17. Security Games Applied to Real-World: Research Contributions and Challenges

    DTIC Science & Technology

    2012-01-01

    Marecki, J.: GUARDS and PROTECT: Next Generation Applications of Security Games . SIGECOM 10 (March 2011) 31–34 4. Shieh, E ., An, B., Yang, R., Tambe...Steigerwald, E .: GUARDS - Game Theoretic Security Allocation on a National Scale. In: Proc. of The 10th International Conference on Autonomous Agents...Shieh, E ., Kiekintveld, C.: Refinement of Strong Stackelberg Equilibria in Security Games . In: Proc. of the 25th Conference on Artificial Intelligence

  18. Serum- and Glucocorticoid-Inducible Kinase 1 Confers Protection in Cell-Based and in In Vivo Neurotoxin Models via the c-Jun N-Terminal Kinase Signaling Pathway

    PubMed Central

    Iqbal, Sarah; Howard, Shannon

    2015-01-01

    Serum glucocorticoid kinase 1 (SGK1) has been shown to be protective in models of Parkinson's disease, but the details by which it confers benefit is unknown. The current study was designed to investigate the details by which SGK1 confers neuroprotection. To do this we employed a cellular neurodegeneration model to investigate c-Jun N-terminal kinase (JNK) signaling and endoplasmic reticulum (ER) stress induced by 6-hydroxydopamine. SGK1-expressing adenovirus was created and used to overexpress SGK1 in SH-SY5Y cells, and dexamethasone was used to increase endogenous expression of SGK1. Oxidative stress, mitochondrial dysfunction, and cell death were monitored to test the protective effect of SGK1. To investigate the effect of SGK1 overexpression in vivo, SGK1-expressing adenovirus was injected into the striatum of mice treated with 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine, and protection of dopaminergic neurons was quantitatively assessed by tyrosine hydroxylase immunohistochemistry. SGK1 overexpression was found to decrease reactive oxygen species generation, alleviate mitochondrial dysfunction, and rescue cell death in vitro and in vivo by inactivating mitogen-activated protein kinase kinase 4 (MKK4), JNK, and glycogen synthase kinase 3β (GSK3β) and thereby decreasing ER and oxidative stress. These results suggest that therapeutic strategies for activation of SGK1 may have the potential to be neuroprotective by deactivating the JNK and GSK3β pathways. PMID:25825522

  19. Male killing Spiroplasma protects Drosophila melanogaster against two parasitoid wasps

    PubMed Central

    Xie, J; Butler, S; Sanchez, G; Mateos, M

    2014-01-01

    Maternally transmitted associations between endosymbiotic bacteria and insects are diverse and widespread in nature. Owing to imperfect vertical transmission, many heritable microbes have evolved compensational mechanisms to enhance their persistence in host lineages, such as manipulating host reproduction and conferring fitness benefits to host. Symbiont-mediated defense against natural enemies of hosts is increasingly recognized as an important mechanism by which endosymbionts enhance host fitness. Members of the genus Spiroplasma associated with distantly related Drosophila hosts are known to engage in either reproductive parasitism (i.e., male killing) or defense against natural enemies (the parasitic wasp Leptopilina heterotoma and a nematode). A male-killing strain of Spiroplasma (strain Melanogaster Sex Ratio Organism (MSRO)) co-occurs with Wolbachia (strain wMel) in certain wild populations of the model organism Drosophila melanogaster. We examined the effects of Spiroplasma MSRO and Wolbachia wMel on Drosophila survival against parasitism by two common wasps, Leptopilina heterotoma and Leptopilina boulardi, that differ in their host ranges and host evasion strategies. The results indicate that Spiroplasma MSRO prevents successful development of both wasps, and confers a small, albeit significant, increase in larva-to-adult survival of flies subjected to wasp attacks. We modeled the conditions under which defense can contribute to Spiroplasma persistence. Wolbachia also confers a weak, but significant, survival advantage to flies attacked by L. heterotoma. The host protective effects exhibited by Spiroplasma and Wolbachia are additive and may provide the conditions for such cotransmitted symbionts to become mutualists. Occurrence of Spiroplasma-mediated protection against distinct parasitoids in divergent Drosophila hosts suggests a general protection mechanism. PMID:24281548

  20. Association for Education of the Visually Handicapped Biennial Conference (Forty-Ninth, Toronto, Canada, June 1968).

    ERIC Educational Resources Information Center

    Association for Education of the Visually Handicapped, Philadelphia, PA.

    Essays on the visually handicapped are concerned with congenital rubella, an evaluation of multiply handicapped children, the use and abuse of the IQ, visual perception dysfunction, spatial perceptions in the partially sighted, programs in daily living skills, sex education needs, and physical activity as an enhancement of functioning. Other…

  1. WaterlooClarke: TREC 2015 Clinical Decision Support Track

    DTIC Science & Technology

    2015-11-20

    questions (diagnosis, test and treatment articles). The two different full-text search engines we adopted in order to search over the collection of articles...two different search engines using reciprocal rank fusion. The evaluation of the submitted runs using partially marked results of Text Retrieval Conference (TREC) from the previous year shows that the methodologies are promising.

  2. Role of a gamma-aminobutryic acid (GABA) receptor mutation in the evolution and spread of Diabrotica virgifera virgifera resistance to cyclodiene insecticides

    USDA-ARS?s Scientific Manuscript database

    An alanine to serine amino acid substitution within the Rdl subunit of the gamma-aminobutyric acid (GABA) receptor confers resistance to cyclodiene insecticides in many species. The corn rootworm, Diabrotica virgifera virgifera, is a damaging pest of cultivated corn that was partially controlled by ...

  3. Mobile code security

    NASA Astrophysics Data System (ADS)

    Ramalingam, Srikumar

    2001-11-01

    A highly secure mobile agent system is very important for a mobile computing environment. The security issues in mobile agent system comprise protecting mobile hosts from malicious agents, protecting agents from other malicious agents, protecting hosts from other malicious hosts and protecting agents from malicious hosts. Using traditional security mechanisms the first three security problems can be solved. Apart from using trusted hardware, very few approaches exist to protect mobile code from malicious hosts. Some of the approaches to solve this problem are the use of trusted computing, computing with encrypted function, steganography, cryptographic traces, Seal Calculas, etc. This paper focuses on the simulation of some of these existing techniques in the designed mobile language. Some new approaches to solve malicious network problem and agent tampering problem are developed using public key encryption system and steganographic concepts. The approaches are based on encrypting and hiding the partial solutions of the mobile agents. The partial results are stored and the address of the storage is destroyed as the agent moves from one host to another host. This allows only the originator to make use of the partial results. Through these approaches some of the existing problems are solved.

  4. Metallothionein plays a prominent role in the prevention of diabetic nephropathy by sulforaphane via up-regulation of Nrf2

    PubMed Central

    Wu, Hao; Kong, Lili; Cheng, Yanli; Zhang, Zhiguo; Wang, Yangwei; Lou, Manyu; Tan, Yi; Chen, Xiangmei; Miao, Lining; Cai, Lu

    2015-01-01

    Sulforaphane (SFN) prevents diabetic nephropathy (DN) in type 1 diabetes via up-regulation of nuclear factor (erythroid-derived 2)-like 2 (Nrf2). However, it has not been addressed whether SFN also prevents DN from type 2 diabetes or which Nrf2 downstream gene(s) play(s) the key role in SFN renal protection. Here we investigated whether Nrf2 is required for SFN protection against type 2 diabetes-induced DN and whether metallothionein (MT) is an Nrf2 downstream antioxidant using Nrf2 knockout (Nrf2-null) mice. In addition, MT knockout mice were used to further verify if MT is indispensable for SFN protection against DN. Diabetes-increased albuminuria, renal fibrosis, and inflammation were significantly prevented by SFN, and Nrf2 and MT expression was increased. However, SFN renal protection was completely lost in Nrf2-null diabetic mice, confirming the pivotal role of Nrf2 in SFN protection from type 2 diabetes-induced DN. Moreover, SFN failed to up-regulate MT in the absence of Nrf2, suggesting that MT is an Nrf2 downstream antioxidant. MT deletion resulted in a partial, but significant attenuation of SFN renal protection from type 2 diabetes, demonstrating a partial requirement for MT for SFN renal protection. Therefore, the present study demonstrates for the first time that as an Nrf2 downstream antioxidant, MT plays an important, though partial, role in mediating SFN renal protection from type 2 diabetes. PMID:26415026

  5. Partial protection from organophosphate-induced cholinesterase inhibition by metyrapone treatment.

    PubMed

    Swiercz, Radosław; Lutz, Piotr; Gralewicz, Sławomir; Grzelińska, Zofia; Piasecka-Zelga, Joanna; Wąsowicz, Wojciech

    2013-08-01

    Organophosphates are cholinesterase (ChE) inhibitors with worldwide use as insecticides. Stress response, evidenced by a dramatic and relatively long-lasting (several hours) rise in the plasma glucocorticoid concentration is an integral element of the organophosphate (OP) poisoning symptomatology. In rodents, corticosterone (CORT) is the main glucocorticoid. There are several reports suggesting a relationship between the stressor-induced rise in CORT concentration (the CORT response) and the activity of the cerebral and peripheral ChE. Thus, it seems reasonable to presume that, in OP intoxication, the rise in plasma CORT concentration may somehow affect the magnitude of the OP-induced ChE inhibition. Metyrapone (MET) [2-methyl-1,2-di(pyridin-3-yl)propan-1-one] blocks CORT synthesis by inhibiting steroid 11β-hydroxylase, thereby preventing the CORT response. Chlorfenvinphos (CVP) [2-chloro-1-(2,4-dichlorophenyl) ethenyl diethyl phosphate] is an organophosphate insecticide still in use in some countries. The purpose of the present work was to compare the CVP-induced effects - the rise of the plasma CORT concentration and the reduction in ChE activity - in MET-treated and MET-untreated rats. Chlorfenvinphos was administered once at 0.0, 0.5, 1.0 and 3.0 mg/kg i.p. Metyrapone, at 100 mg/kg i.p., was administered five times, at 24-h intervals. The first MET dose was given two hours before CVP. The following was observed in the MET-treated rats: i) no rise in plasma CORT concentration after the CVP administration, ii) a reduced inhibition and a faster restitution of blood and brain ChE activities. The results suggest that MET treatment may confer significant protection against at least some effects of OP poisoning. The likely mechanism of the protective MET action has been discussed.

  6. Synergistic Effects of the GATA-4-Mediated miR-144/451 Cluster in Protection against Simulated Ischemia/Reperfusion-Induced Cardiomyocyte Death

    PubMed Central

    Zhang, Xiaowei; Wang, Xiaohong; Zhu, Hongyan; Zhu, Cheng; Wang, Yigang; Pu, William T.; Jegga, Anil G.; Fan, Guo-Chang

    2010-01-01

    Among the identified microRNAs (miRs) thus far, ~50% of mammalian miRs are clustered in the genome and transcribed as polycistronic primary transcripts. However, whether clustered miRs mediate non-redundant and cooperative functions remains poorly understood. In this study, we first identified activation of the promoter of miR-144/451 by GATA-4, a critical transcription factor in the heart. Next, we observed that ectopic expression of miR-144 and -451 individually augmented cardiomyocyte survival, which was further improved by overexpression of miR-144/451, compared to control cells in response to simulated ischemia/reperfusion. In contrast, knockdown of endogenous miR-144 and -451 revealed opposite effects. Using luciferase reporter assay and western blot analysis, we also validated that both miR-144 and miR-451 target CUG triplet repeat-binding protein 2 (CUGBP2), a ubiquitously expressed RNA-binding protein, known to interact with COX-2 3′-UTR and inhibit its translation. Accordingly, protein levels of CUGBP2 were greatly reduced and COX-2 activity was markedly increased in miR-144-, miR-451- and miR-144/451-overexpressing cardiomyocytes, compared to GFP-cells. Furthermore, inhibition of COX-2 activity by either NS-398 or DUP-697 partially offset protective effects of the miR-144/451 cluster. Together, these data indicate that both partners of the miR-144/451 cluster confer protection against simulated I/R-induced cardiomyocyte death via targeting CUGBP2-COX-2 pathway, at least in part. Thus, both miR-144 and miR-451 may represent new therapeutic agents for the treatment of ischemic heart disease. PMID:20708014

  7. L-Ascorbate Protects Against Methamphetamine-Induced Neurotoxicity of Cortical Cells via Inhibiting Oxidative Stress, Autophagy, and Apoptosis.

    PubMed

    Huang, Ya-Ni; Yang, Ling-Yu; Wang, Jing-Ya; Lai, Chien-Cheng; Chiu, Chien-Tsai; Wang, Jia-Yi

    2017-01-01

    Methamphetamine (METH)-induced cell death contributes to the pathogenesis of neurotoxicity; however, the relative roles of oxidative stress, apoptosis, and autophagy remain unclear. L-Ascorbate, also called vitamin (Vit.) C, confers partial protection against METH neurotoxicity via induction of heme oxygenase-1. We further investigated the role of Vit. C in METH-induced oxidative stress, apoptosis, and autophagy in cortical cells. Exposure to lower concentrations (0.1, 0.5, 1 mM) of METH had insignificant effects on ROS production, whereas cells exposed to 5 mM METH exhibited ROS production in a time-dependent manner. We confirmed METH-induced apoptosis (by nuclear morphology revealed by Hoechst 33258 staining and Western blot showing the protein levels of pro-caspase 3 and cleaved caspase 3) and autophagy (by Western blot showing the protein levels of Belin-1 and conversion of microtubule-associated light chain (LC)3-I to LC3-II and autophagosome staining by monodansylcadaverine). The apoptosis as revealed by cleaved caspase-3 expression marked an increase at 18 h after METH exposure while both autophagic markers, Beclin 1 and LC3-II, marked an increase in cells exposed to METH for 6 and 24 h, respectively. Treating cells with Vit. C 30 min before METH exposure time-dependently attenuated the production of ROS. Vitamin C also attenuated METH-induced Beclin 1 and LC3-II expression and METH toxicity. Treatment of cells with Vit. C before METH exposure attenuated the expression of cleaved caspase-3 and reduced the number of METH-induced apoptotic cells. We suggest that the protective effect of Vit. C against METH toxicity might be through attenuation of ROS production, autophagy, and apoptosis.

  8. Plant-Produced Subunit Vaccine Candidates against Yellow Fever Induce Virus Neutralizing Antibodies and Confer Protection against Viral Challenge in Animal Models.

    PubMed

    Tottey, Stephen; Shoji, Yoko; Jones, R Mark; Chichester, Jessica A; Green, Brian J; Musiychuk, Konstantin; Si, Huaxin; Manceva, Slobodanka D; Rhee, Amy; Shamloul, Moneim; Norikane, Joey; Guimarães, Rosane C; Caride, Elena; Silva, Andrea N M R; Simões, Marisol; Neves, Patricia C C; Marchevsky, Renato; Freire, Marcos S; Streatfield, Stephen J; Yusibov, Vidadi

    2018-02-01

    Yellow fever (YF) is a viral disease transmitted by mosquitoes and endemic mostly in South America and Africa with 20-50% fatality. All current licensed YF vaccines, including YF-Vax ® (Sanofi-Pasteur, Lyon, France) and 17DD-YFV (Bio-Manguinhos, Rio de Janeiro, Brazil), are based on live attenuated virus produced in hens' eggs and have been widely used. The YF vaccines are considered safe and highly effective. However, a recent increase in demand for YF vaccines and reports of rare cases of YF vaccine-associated fatal adverse events have provoked interest in developing a safer YF vaccine that can be easily scaled up to meet this increased global demand. To this point, we have engineered the YF virus envelope protein (YFE) and transiently expressed it in Nicotiana benthamiana as a stand-alone protein (YFE) or as fusion to the bacterial enzyme lichenase (YFE-LicKM). Immunogenicity and challenge studies in mice demonstrated that both YFE and YFE-LicKM elicited virus neutralizing (VN) antibodies and protected over 70% of mice from lethal challenge infection. Furthermore, these two YFE-based vaccine candidates induced VN antibody responses with high serum avidity in nonhuman primates and these VN antibody responses were further enhanced after challenge infection with the 17DD strain of YF virus. These results demonstrate partial protective efficacy in mice of YFE-based subunit vaccines expressed in N. benthamiana . However, their efficacy is inferior to that of the live attenuated 17DD vaccine, indicating that formulation development, such as incorporating a more suitable adjuvant, may be required for product development.

  9. Using ClinicalTrials.gov to Supplement Information in Ophthalmology Conference Abstracts about Trial Outcomes: A Comparison Study

    PubMed Central

    Scherer, Roberta W.; Huynh, Lynn; Ervin, Ann-Margret; Dickersin, Kay

    2015-01-01

    Background Including results from unpublished randomized controlled trials (RCTs) in a systematic review may ameliorate the effect of publication bias in systematic review results. Unpublished RCTs are sometimes described in abstracts presented at conferences, included in trials registers, or both. Trial results may not be available in a trials register and abstracts describing RCT results often lack study design information. Complementary information from a trials register record may be sufficient to allow reliable inclusion of an unpublished RCT only available as an abstract in a systematic review. Methods We identified 496 abstracts describing RCTs presented at the 2007 to 2009 Association for Research in Vision and Ophthalmology (ARVO) meetings; 154 RCTs were registered in ClinicalTrials.gov. Two persons extracted verbatim primary and non-primary outcomes reported in the abstract and ClinicalTrials.gov record. We compared each abstract outcome with all ClinicalTrials.gov outcomes and coded matches as complete, partial, or no match. Results We identified 800 outcomes in 152 abstracts (95 primary [51 abstracts] and 705 [141 abstracts] non-primary outcomes). No outcomes were reported in 2 abstracts. Of 95 primary outcomes, 17 (18%) agreed completely, 53 (56%) partially, and 25 (26%) had no match with a ClinicalTrials.gov primary or non-primary outcome. Among 705 non-primary outcomes, 56 (8%) agreed completely, 205 (29%) agreed partially, and 444 (63%) had no match with a ClinicalTrials.gov primary or non-primary outcome. Among the 258 outcomes partially agreeing, we found additional information on the time when the outcome was measured more often in ClinicalTrials.gov than in the abstract (141/258 (55%) versus 55/258 (21%)). We found no association between the presence of non-matching “new” outcomes and year of registration, time to registry update, industry sponsorship, or multi-center status. Conclusion Conference abstracts may be a valuable source of information about results for outcomes of unpublished RCTs that have been registered in ClinicalTrials.gov. Complementary additional descriptive information may be present for outcomes reported in both sources. However, ARVO abstract authors also present outcomes not reported in ClinicalTrials.gov and these may represent analyses not originally planned. PMID:26107924

  10. 77 FR 41984 - Meeting Notice for the President's Advisory Council on Faith-based and Neighborhood Partnerships

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-07-17

    ... to Ben O'Dell at [email protected] . There will also be a conference call line available for those... contact Ben O'Dell for any additional information about the President's Advisory Council meeting at... sent in advance to [email protected] . Dated: July 12, 2012. Ben O'Dell, Designated Federal Officer...

  11. Charter for the Protection of Children and Young People.

    ERIC Educational Resources Information Center

    Momentum, 2002

    2002-01-01

    Provides the text for United States Conference of Catholic Bishops Charter for the Protection of Children and Young People. This document is part of a special collection of resources in the journal that address sexual abuse and the growing number of both confirmed and alleged cases of pedophilia and sexual abuse within the Catholic Church. (RC)

  12. Gut Microbiota-Induced Immunoglobulin G Controls Systemic Infection by Symbiotic Bacteria and Pathogens

    PubMed Central

    Zeng, Melody Y.; Cisalpino, Daniel; Varadarajan, Saranyaraajan; Hellman, Judith; Warren, H. Shaw; Cascalho, Marilia; Inohara, Naohiro; Núñez, Gabriel

    2016-01-01

    The gut microbiota is compartmentalized in the intestinal lumen and induces local immune responses, but it remains unknown whether the gut microbiota can induce systemic response and contribute to systemic immunity. We report that selective gut symbiotic gram-negative bacteria were able to disseminate systemically to induce immunoglobulin G (IgG) response, which primarily targeted gram-negative bacterial antigens and conferred protection against systemic infections by E. coli and Salmonella by directly coating bacteria to promote killing by phagocytes. T cells and Toll-like receptor 4 on B cells were important in the generation of microbiota-specific IgG. We identified murein lipoprotein (MLP), a highly conserved gram-negative outer membrane protein, as a major antigen that induced systemic IgG homeostatically in both mice and humans. Administration of anti-MLP IgG conferred crucial protection against systemic Salmonella infection. Thus, our findings reveal an important function for the gut microbiota in combating systemic infection through the induction of protective IgG. PMID:26944199

  13. Nuclear instrumentation and measurement: a review based on the ANIMMA conferences

    NASA Astrophysics Data System (ADS)

    Giot, Michel; Vermeeren, Ludo; Lyoussi, Abdallah; Reynard-Carette, Christelle; Lhuillier, Christian; Mégret, Patrice; Deconinck, Frank; Gonçalves, Bruno Soares

    2017-12-01

    The ANIMMA conferences offer a unique opportunity to discover research carried out in all fields of nuclear measurements and instrumentation with applications extending from fundamental physics to fission and fusion reactors, medical imaging, environmental protection and homeland security. After four successful editions of the Conference, it was decided to prepare a review based to a large extent but not exclusively on the papers presented during the first four editions of the conference. This review is organized according to the measurement methodologies: neutronic, photonic, thermal, acoustic and optical measurements, as well as medical imaging and specific challenges linked to data acquisition and electronic hardening. The paper describes the main challenges justifying research in these different areas, and summarizes the recent progress reported. It offers researchers and engineers a way to quickly and efficiently access knowledge in highly specialized areas.

  14. Proceedings of the International Conference on Cyclic Nucleotides, Calcium and Protein Phosphorylation (6th) Held in Bethesda, Maryland on September 2-7, 1986. Advances in Second Messenger and Phosphorprotein Research. Volume 21A. Abstracts Volume

    DTIC Science & Technology

    1988-11-16

    oxoireamorine. Oxotremorine inhibited Ach release for a shorter duration. The ACh release-inhibition induced by 50 PH Aech-M was only acutely blocked...and the partial agonist oxotresorine in the presence of 59K of Lit. Carbacbol showed a 10-fold lover ECS0-value (3.7liM) and oxotremorine a 3-fold...however, only a decrease in the maximal response was seen. In both tissues, the maximal, response of the partial agonist oxotremorine was suppressed

  15. A Guide to Intellectual Property Protection, Third Edition.

    ERIC Educational Resources Information Center

    Minnesota Small Business Assistance Office, St. Paul.

    Protecting an idea is often a difficult process. Some ideas and inventions cannot be protected, while others are eligible for only narrow or partial immunity from potential competition and imitation. Obtaining even minimal protection can often be expensive, time consuming, and ultimately result in uncertain or even negative benefits to the…

  16. Protective role of brain water channel AQP4 in murine cerebral malaria

    PubMed Central

    Promeneur, Dominique; Lunde, Lisa Kristina; Amiry-Moghaddam, Mahmood; Agre, Peter

    2013-01-01

    Tragically common among children in sub-Saharan Africa, cerebral malaria is characterized by rapid progression to coma and death. In this study, we used a model of cerebral malaria appearing in C57BL/6 WT mice after infection with the rodent malaria parasite Plasmodium berghei ANKA. Expression and cellular localization of the brain water channel aquaporin-4 (AQP4) was investigated during the neurological syndrome. Semiquantitative real-time PCR comparing uninfected and infected mice showed a reduction of brain AQP4 transcript in cerebral malaria, and immunoblots revealed reduction of brain AQP4 protein. Reduction of brain AQP4 protein was confirmed in cerebral malaria by quantitative immunogold EM; however, polarized distribution of AQP4 at the perivascular and subpial astrocyte membranes was not altered. To further examine the role of AQP4 in cerebral malaria, WT mice and littermates genetically deficient in AQP4 were infected with P. berghei. Upon development of cerebral malaria, WT and AQP4-null mice exhibited similar increases in width of perivascular astroglial end-feet in brain. Nevertheless, the AQP4-null mice exhibited more severe signs of cerebral malaria with greater brain edema, although disruption of the blood–brain barrier was similar in both groups. In longitudinal studies, cerebral malaria appeared nearly 1 d earlier in the AQP4-null mice, and reduced survival was noted when chloroquine rescue was attempted. We conclude that the water channel AQP4 confers partial protection against cerebral malaria. PMID:23277579

  17. Squalene-containing licensed adjuvants enhance strain-specific antibody responses against the influenza hemagglutinin and induce subtype-specific antibodies against the neuraminidase.

    PubMed

    Schmidt, Rebecca; Holznagel, Edgar; Neumann, Britta; Alex, Nina; Sawatsky, Bevan; Enkirch, Theresa; Pfeffermann, Kristin; Kruip, Carina; von Messling, Veronika; Wagner, Ralf

    2016-10-17

    While seasonal influenza vaccines are usually non-adjuvanted, H1N1pdm09 vaccines were formulated with different squalene-containing adjuvants, to enable the reduction of antigen content thus increasing the number of doses available. To comparatively assess the effects of these adjuvants on antibody responses against matched and mismatched strains, and to correlate antibody levels with protection from disease, ferrets were immunized with 2μg of commercial H1N1pdm09 vaccine antigen alone or formulated with different licensed adjuvants. The use of squalene-containing adjuvants increased neutralizing antibody responses around 100-fold, and resulted in a significantly reduced viral load after challenge with a matched strain. While all animals mounted strong total antibody responses against the homologous H1N1 hemagglutinin (HA) protein, which correlated with the respective neutralizing antibody titers, no reactivity with the divergent H3, H5, H7, and H9 proteins were detected. Only the adjuvanted vaccines also induced antibodies against the neuraminidase (NA) protein, which were able to also recognize NA proteins from other N1 carrying strains. These findings not only support the use of squalene-containing adjuvants in dose-sparing strategies but also support speculations that the induction of NA-specific responses associated with the use of these adjuvants may confer partial protection to heterologous strains carrying the same NA subtype. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. Induction of homologous and cross-reactive GII.4-specific blocking antibodies in children after GII.4 New Orleans norovirus infection.

    PubMed

    Blazevic, Vesna; Malm, Maria; Vesikari, Timo

    2015-10-01

    Noroviruses (NoVs) are major causative agents of acute gastroenteritis (AGE) in children worldwide and the most common viral cause of AGE in countries where rotavirus incidence has been eliminated by vaccination. Previous infections with the dominant GII.4 NoV genotype confer only partial protection against evolving immune escape variants that emerge every few years. The objective of this work was to investigate GII.4-specific homologous and cross-reactive antibody responses in young children after NoV GII.4-2009 New Orleans (NO) infection. Virus-like particles (VLPs) representing GII.4-1999, GII.4-2009 NO, and GII.4-2012 Sydney genotypes were used in ELISA and histo-blood group antigen blocking assays to examine acute and convalescent sera of five children <2 years of age infected with GII.4-2009 NO. GII.4-2009 NO infection induced IgG seroconversion to all three tested NoV GII.4 variants. Homologous blocking antibodies to GII.4-2009 NO were detected in each convalescent sera. Fourfold increase in cross-blocking antibodies to GII.4-2012 Sydney was observed in 4/5 subjects, but no child developed cross-blocking antibodies to GII.4-1999. In conclusion, antibodies induced in young children after norovirus GII.4 infection are targeted against the causative variant and may cross-protect against strains that are closely related, but not with more distinct and earlier GII.4 genotypes. © 2015 Wiley Periodicals, Inc.

  19. Mumps Parotitis and Ovarian Cancer: Modern Significance of an Historic Association

    DTIC Science & Technology

    2009-10-01

    ligation or a breast mastitis , found to protect against ovarian cancer, might do so by causing overexpression of the hypoglycosylated form of MUC1...negative plates were incubated overnight and washed three times with PBS before addition of 100 μl of 2.5% bovine serum albumin in PBS. Serially...a breast mastitis which have been shown to protect against ovarian cancer(10), might confer protection because of injury to the tissue causing

  20. Vaccination with Leishmania histone H1-pulsed dendritic cells confers protection in murine visceral leishmaniasis.

    PubMed

    Agallou, Maria; Smirlis, Despina; Soteriadou, Ketty P; Karagouni, Evdokia

    2012-07-20

    Visceral leishmaniasis is the most severe form of leishmaniases affecting millions of people worldwide often resulting in death despite optimal therapy. Thus, there is an urgent need for the development of effective anti-infective vaccine(s). In the present study, we evaluated the prophylactic value of bone marrow-derived dendritic cells (BM-DCs) pulsed with the Leishmania (L.) infantum histone H1. We developed fully mature BM-DCs characterized by enhanced capacity of IL-12 production after ex vivo pulsing with GST-LeishH1. Intravenous administration of these BM-DCs in naive BALB/c mice resulted in antigen-specific spleenocyte proliferation and IgG1 isotype antibody production and conferred protection against experimental challenge with L. infantum independently of CpG oligonucleotides (ODNs) co-administration. Protection was associated with a pronounced enhancement of parasite-specific IFNγ-producing cells and reduction of cells producing IL-10, whereas IL-4 production was comparable in protected and non-protected mice. The polarization of immune responses to Th1 type was further confirmed by the elevation of parasite-specific IgG2a/IgG1 ratio in protected mice. The above data indicate the immunostimulatory capacity of Leishmania histone H1 and further support its exploitation as a candidate protein for vaccine development against leishmaniasis. Copyright © 2012 Elsevier Ltd. All rights reserved.

  1. Recent progress in the development of anthrax vaccines.

    PubMed

    Kaur, Manpreet; Bhatnagar, Rakesh

    2011-12-01

    Bacillus anthracis is the etiological agent of anthrax. Although anthrax is primarily an epizootic disease; humans are at risk for contracting anthrax. The potential use of B. anthracis spores as biowarfare agent has led to immense attention. Prolonged vaccination schedule of current anthrax vaccine and variable protection conferred; often leading to failure of therapy. This highlights the need for alternative anthrax countermeasures. A number of approaches are being investigated to substitute or supplement the existing anthrax vaccines. These relied on expression of Protective antigen (PA), the key protective immunogen; in bacterial or plant systems; or utilization of attenuated strains of B. anthracis for immunization. Few studies have established potential of domain IV of PA for immunization. Other targets including the spore, capsule, S-layer and anthrax toxin components have been investigated for imparting protective immunity. It has been shown that co-immunization of PA with domain I of lethal factor that binds PA resulted in higher antibody responses. Of the epitope based vaccines, the loop neutralizing determinant, in particular; elicited robust neutralizing antibody response and conferred 97% protection upon challenge. DNA vaccination resulted in varying degree of protection and seems a promising approach. Additionally, the applicability of monoclonal and therapeutic antibodies in the treatment of anthrax has also been demonstrated. The recent progress in the direction of anthrax prophylaxis has been evaluated in this review.

  2. Effectiveness of monovalent rotavirus vaccine in Bolivia: case-control study.

    PubMed

    Patel, Manish M; Patzi, Maritza; Pastor, Desiree; Nina, Aleida; Roca, Yelin; Alvarez, Leovigildo; Iniguez, Volga; Rivera, Rosario; Tam, Ka Ian; Quaye, Osbourne; Bowen, Michael; Parashar, Umesh; De Oliveira, Lucia Helena

    2013-06-19

    To evaluate the effectiveness of two doses of a monovalent rotavirus vaccine (RV1) against hospital admission for rotavirus in Bolivia. Case-control study. Six hospitals in Bolivia, between March 2010 and June 2011. 400 hospital admissions for rotavirus, 1200 non-diarrhea hospital controls, and 718 rotavirus negative hospital controls. Odds of antecedent vaccination between case patients and controls; effectiveness of vaccination ((1-adjusted odds ratio)×100), adjusted for age and other confounders; and stratified effectiveness by dose, disease severity, age group, and serotype. In comparison with non-diarrhea controls, case patients were more likely to be male and attend day care but less likely to have chronic underlying illness, higher level maternal education, and telephones and computers in their home. Rotavirus negative controls were somewhat more similar to case patients but also were more likely to be male and attend day care and less likely to have higher level maternal education and computers in their homes. The adjusted effectiveness of RV1 against hospital admission for rotavirus was 69% (95% confidence interval 54% to 79%) with rotavirus negative controls and 77% (65% to 84%) with non-diarrhea controls. The effectiveness of one dose of RV1 was 36% and 56%, respectively. With both control groups, protection was sustained through two years of life, with similar efficacy against hospital admission among children under 1 year (64% and 77%) and over 1 year of age (72% and 76%). RV1 provided significant protection against diverse serotypes, partially and fully heterotypic to the G1P[8] vaccine. Effectiveness using the two control groups was 80% and 85% against G9P[8], 74% and 93%% against G3P[8], 59% and 69% against G2P[4], and 80% and 87% against G9P[6] strains. The monovalent rotavirus vaccine conferred high protection against hospital admission for diarrhea due to rotavirus in Bolivian children. Protection was sustained through two years of life against diverse serotypes different from the vaccine strain.

  3. Mucosal immunization with PspA (Pneumococcal surface protein A)-adsorbed nanoparticles targeting the lungs for protection against pneumococcal infection

    PubMed Central

    Rodrigues, Tasson C.; Oliveira, Maria Leonor S.; Soares-Schanoski, Alessandra; Chavez-Rico, Stefanni L.; Figueiredo, Douglas B.; Gonçalves, Viviane M.; Ferreira, Daniela M.; Kunda, Nitesh K.; Saleem, Imran Y.

    2018-01-01

    Burden of pneumonia caused by Streptococcus pneumoniae remains high despite the availability of conjugate vaccines. Mucosal immunization targeting the lungs is an attractive alternative for the induction of local immune responses to improve protection against pneumonia. Our group had previously described the development of poly(glycerol adipate-co-ω-pentadecalactone) (PGA-co-PDL) polymeric nanoparticles (NPs) adsorbed with Pneumococcal surface protein A from clade 4 (PspA4Pro) within L-leucine microcarriers (nanocomposite microparticles—NCMPs) for mucosal delivery targeting the lungs (NP/NCMP PspA4Pro). NP/NCMP PspA4Pro was now used for immunization of mice. Inoculation of this formulation induced anti-PspA4Pro IgG antibodies in serum and lungs. Analysis of binding of serum IgG to intact bacteria showed efficient binding to bacteria expressing PspA from clades 3, 4 and 5 (family 2), but no binding to bacteria expressing PspA from clades 1 and 2 (family 1) was observed. Both mucosal immunization with NP/NCMP PspA4Pro and subcutaneous injection of the protein elicited partial protection against intranasal lethal pneumococcal challenge with a serotype 3 strain expressing PspA from clade 5 (PspA5). Although similar survival levels were observed for mucosal immunization with NP/NCMP PspA4Pro and subcutaneous immunization with purified protein, NP/NCMP PspA4Pro induced earlier control of the infection. Conversely, neither immunization with NP/NCMP PspA4Pro nor subcutaneous immunization with purified protein reduced bacterial burden in the lungs after challenge with a serotype 19F strain expressing PspA from clade 1 (PspA1). Mucosal immunization with NP/NCMP PspA4Pro targeting the lungs is thus able to induce local and systemic antibodies, conferring protection only against a strain expressing PspA from the homologous family 2. PMID:29360883

  4. Utilization of lightflecks by seedlings of five dominant tree species of different subtropical forest successional stages under low-light growth conditions.

    PubMed

    Zhang, Q; Chen, Y J; Song, L Y; Liu, N; Sun, L L; Peng, C L

    2012-05-01

    We selected five typical tree species, including one early-successional species (ES) Pinus massoniana Lamb., two mid-successional species (MS) Schima superba Gardn. et Champ. and Castanopsis fissa (Champ. ex Benth.) Rehd. et Wils. and two late-successional species (LS) Cryptocarya concinna Hance. and Acmena acuminatissima (BI.) Merr et Perry., which represent the plants at three successional periods in Dinghushan subtropical forest succession of southern China. Potted seedlings of the five species were grown under 12% of full sunlight for 36 months. The ES and MS showed the slowest and fastest responses to lightflecks, respectively, which correlated with the rate of stomatal opening. In contrast to P. massoniana and C. concinna, the other three species exhibited a high induction loss. Early-successional species showed the lowest specific leaf area and chlorophyll content, the highest photosynthetic capacity (A(max)) and respiratory carbon losses (R(d)). Compared with ES and MS, LS showed lower A(max) and R(d). The five tree species showed a similar chlorophyll a/b ratio after long-term low-light adaptations. On the other hand, LS had a relatively higher de-epoxidation state to protect themselves from excess light during lightflecks. Our results indicated that (i) slower responses to lightflecks could partially explain why ES species could not achieve seedling regeneration in low-light conditions; (ii) fast responses to lightflecks could partially explain why MS species could achieve seedling regeneration in low-light conditions; and (iii) smaller respiratory carbon losses might confer on the LS species a competitive advantage in low-light conditions.

  5. "I Have a Dream, Too!": The American Dream in Coretta Scott King Award-Winning Books

    ERIC Educational Resources Information Center

    Parsons, Linda T.; Castleman, Michele

    2011-01-01

    The Coretta Scott King (CSK) Award, instituted in 1969 and recognized as an official award by the American Library Association (ALA) in 1982, is conferred annually to an African American author and an illustrator for their outstanding contributions to literature about the Black experience for children and young adults. A partial impetus for the…

  6. Wheat stripe rust resistance protein WKS1 reduces the ability of the thylakoid-associated ascorbate peroxidase to detoxify reactive oxygen species

    USDA-ARS?s Scientific Manuscript database

    Stripe rust is a devastating fungal disease of wheat caused by Puccinia striiformis f. sp. tritici(Pst). The WKS1 resistance gene has an unusual combination of serine/threonine kinase and START lipid-binding domains and confers partial resistance to Pst. Here we show that wheat plants transformed w...

  7. Ectopic expression of Arabidopsis genes encoding salicylic acid- and jasmonic acid-related proteins confers partial resistance to soybean cyst nematode (Heterodera glycines) in transgenic soybean roots

    USDA-ARS?s Scientific Manuscript database

    Background. Extensive studies using the model system Arabidopsis thaliana to elucidate plant defense signaling and pathway networks indicate that salicylic acid (SA) is the key hormone triggering the plant defense response against biotrophic and hemi-biotrophic pathogens, while jasmonic acid (JA) an...

  8. Vaccination of chickens with recombinant salmonella expressing the M2e and CD154 increase protection and decrease viral shedding following low pathogenic avian influenza challenge

    USDA-ARS?s Scientific Manuscript database

    Avian influenza (AI) is a significant public health concern and serious economic threat to the commercial poultry industry worldwide. Previous research demonstrates that antibodies against M2e confer protection against influenza challenge. Using the Red recombinase system in combination with overl...

  9. The Value of Family Welfare Conferencing within the Child Protection and Welfare System

    ERIC Educational Resources Information Center

    Devaney, Carmel; Byrne, Paul

    2015-01-01

    The Family Welfare Conference (FWC) is a model used within the child protection and welfare services to address concerns about the needs of children and their family's ability to respond to these needs. The FWC model operates in partnership with family members, who participate in identifying both the issues of concern and potential responses to…

  10. 76 FR 26333 - U.S. Department of State Advisory Committee on Private International Law (ACPIL); Notice of...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-05-06

    ... contact Tricia Smeltzer or Niesha Toms of the Department of State Legal Adviser's Office at [email protected] or Toms[email protected] and provide your name, affiliation, e-mail address, and mailing address... teleconferencing, please contact Tricia Smeltzer or Niesha Toms at 202-776-8420 to receive the conference call- in...

  11. 76 FR 19826 - U.S. Department of State Advisory Committee on Private International Law (ACPIL): Notice of...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-04-08

    ... is controlled; persons wishing to attend should contact Tricia Smeltzer or Niesha Toms of the Department of State Legal Adviser's Office at [email protected] or Toms[email protected] and provide your name... Niesha Toms at 202-776-8420 to receive the conference call-in number and the relevant information. Dated...

  12. Incorporation of a recombinant Eimeria maxima IMP1 antigen into nanoparticles confers protective immunity against E. maxima challenge infection

    USDA-ARS?s Scientific Manuscript database

    The purpose of this study was to determine if incorporating a recombinant Eimeria maxima protein, namely rEmaxIMP1, into gold nanoparticles (NP) could improve the level of protective immunity against E. maxima challenge infection. Recombinant EmaxIMP1 was expressed in Escherchia coli as a poly-His f...

  13. Full protection against African horsesickness (AHS) in horses induced by baculovirus-derived AHS virus serotype 4 VP2, VP5 and VP7.

    PubMed

    Martínez-Torrecuadrada, J L; Díaz-Laviada, M; Roy, P; Sánchez, C; Vela, C; Sánchez-Vizcaíno, J M; Casal, J I

    1996-06-01

    African horsesickness virus serotype 4 (AHSV-4) outer capsid protein VP2, or VP2 and VP5 plus inner capsid protein VP7, derived from single or dual recombinant baculovirus expression vectors were used in different combinations to immunize horses. When the proteins were purified by affinity chromatography, the combination of all three proteins induced low levels of neutralizing antibodies and conferred protection against virulent virus challenge. However, purified VP2 or VP2 and VP5 in the absence of VP7 failed to induce neutralizing antibodies and protection. Immunization with non-purified proteins enhanced the titres of neutralizing antibodies. Again, the combination of the three proteins was able to confer total protection to immunized horses, which showed absence of viraemia. The antigenicity of recombinant VP2 was analysed with a collection of 30 MAbs. Both purified and unpurified recombinant VP2 proteins showed different antigenic patterns in comparison to that of VP2 on virions. An immunization experiment with four more horses confirmed these results. The vaccine described here would not only prevent the disease, but would drastically reduce the propagation of the virus by vectors.

  14. From Immunologically Archaic to Neoteric Glycovaccines

    PubMed Central

    Cavallari, Marco; De Libero, Gennaro

    2017-01-01

    Polysaccharides (PS) are present in the outermost surface of bacteria and readily come in contact with immune cells. They interact with specific antibodies, which in turn confer protection from infections. Vaccines with PS from pneumococci, meningococci, Haemophilus influenzae type b, and Salmonella typhi may be protective, although with the important constraint of failing to generate permanent immunological memory. This limitation has in part been circumvented by conjugating glycovaccines to proteins that stimulate T helper cells and facilitate the establishment of immunological memory. Currently, protection evoked by conjugated PS vaccines lasts for a few years. The same approach failed with PS from staphylococci, Streptococcus agalactiae, and Klebsiella. All those germs cause severe infections in humans and often develop resistance to antibiotic therapy. Thereby, prevention is of increasing importance to better control outbreaks. As only 23 of more than 90 pneumococcal serotypes and 4 of 13 clinically relevant Neisseria meningitidis serogroups are covered by available vaccines there is still tremendous clinical need for PS vaccines. This review focuses on glycovaccines and the immunological mechanisms for their success or failure. We discuss recent advances that may facilitate generation of high affinity anti-PS antibodies and confer specific immunity and long-lasting protection. PMID:28134792

  15. Protection from Staphylococcus aureus mastitis associated with poly-N-acetyl β-1,6 glucosamine specific antibody production using biofilm-embedded bacteria

    PubMed Central

    Pérez, M. M.; Prenafeta, A.; Valle, J.; Penadés, J.; Rota, C.; Solano, C.; Marco, J.; Grilló, M.J.; Lasa, I.; Irache, J.M.; Maira-Litran, T.; Jiménez-Barbero, J.; Costa, L.; Pier, G.B.; de Andrés, D.; Amorena, B.

    2010-01-01

    Staphylococcus aureus vaccines based on bacterins surrounded by slime, surface polysaccharides coupled to protein carriers and polysaccharides embedded in liposomes administered together with non-biofilm bacterins confer protection against mastitis. However, it remains unknown whether protective antibodies are directed to slime-associated known exopolysaccharides and could be produced in the absence of bacterin immunizations. Here, a sheep mastitis vaccination study was carried out using bacterins, crude bacterial extracts or a purified exopolysaccharide from biofilm bacteria delivered in different vehicles. This polysaccharide reacted specifically with antibodies to poly-N-acetyl-β-1,6-glucosamine (PNAG) and not with antibodies to other capsular antigens or bacterial components. Following intra-mammary challenge with biofilm-producing bacteria, antibody production against the polysaccharide, milk bacterial counts and mastitis lesions were determined. Bacterins from strong biofilm-producing bacteria triggered the highest production of antibodies to PNAG and conferred the highest protection against infection and mastitis, compared with weak biofilm-producing bacteria and non-cellular inocula. Thus, bacterins from strong biofilm bacteria, rather than purified polysaccharide, are proposed as a cost-efficient vaccination against S. aureus ruminant mastitis. PMID:19428854

  16. Biocontrol of tomato wilt disease by Bacillus subtilis isolates from natural environments depends on conserved genes mediating biofilm formation

    PubMed Central

    Liu, Hongxia; Kolter, Roberto; Losick, Richard; Guo, Jian-hua

    2014-01-01

    Summary Bacillus subtilis and other Bacilli have long been used as biological control agents against plant bacterial diseases but the mechanisms by which the bacteria confer protection are not well understood. Our goal in this study was to isolate strains of B. subtilis that exhibit high levels of biocontrol efficacy from natural environments and to investigate the mechanisms by which these strains confer plant protection. We screened a total of sixty isolates collected from various locations across China and obtained six strains that exhibited above 50% biocontrol efficacy on tomato plants against the plant pathogen Ralstonia solanacearum under greenhouse conditions. These wild strains were able to form robust biofilms both in defined medium and on tomato plant roots and exhibited strong antagonistic activities against various plant pathogens in plate assays. We show that plant protection by those strains depended on widely conserved genes required for biofilm formation, including regulatory genes and genes for matrix production. We provide evidence suggesting that matrix production is critical for bacterial colonization on plant root surfaces. Finally, we have established a model system for studies of B. subtilis-tomato plant interactions in protection against a plant pathogen. PMID:22934631

  17. Metallothionein plays a prominent role in the prevention of diabetic nephropathy by sulforaphane via up-regulation of Nrf2.

    PubMed

    Wu, Hao; Kong, Lili; Cheng, Yanli; Zhang, Zhiguo; Wang, Yangwei; Luo, Manyu; Tan, Yi; Chen, Xiangmei; Miao, Lining; Cai, Lu

    2015-12-01

    Sulforaphane (SFN) prevents diabetic nephropathy (DN) in type 1 diabetes via up-regulation of nuclear factor (erythroid-derived 2)-like 2 (Nrf2). However, it has not been addressed whether SFN also prevents DN from type 2 diabetes or which Nrf2 downstream gene(s) play(s) the key role in SFN renal protection. Here we investigated whether Nrf2 is required for SFN protection against type 2 diabetes-induced DN and whether metallothionein (MT) is an Nrf2 downstream antioxidant using Nrf2 knockout (Nrf2-null) mice. In addition, MT knockout mice were used to further verify if MT is indispensable for SFN protection against DN. Diabetes-increased albuminuria, renal fibrosis, and inflammation were significantly prevented by SFN, and Nrf2 and MT expression was increased. However, SFN renal protection was completely lost in Nrf2-null diabetic mice, confirming the pivotal role of Nrf2 in SFN protection from type 2 diabetes-induced DN. Moreover, SFN failed to up-regulate MT in the absence of Nrf2, suggesting that MT is an Nrf2 downstream antioxidant. MT deletion resulted in a partial, but significant attenuation of SFN renal protection from type 2 diabetes, demonstrating a partial requirement for MT for SFN renal protection. Therefore, the present study demonstrates for the first time that as an Nrf2 downstream antioxidant, MT plays an important, though partial, role in mediating SFN renal protection from type 2 diabetes. Copyright © 2015 Elsevier Inc. All rights reserved.

  18. S1 of distinct IBV population expressed from recombinant adenovirus confers protection against challenge.

    PubMed

    Toro, H; Zhang, J F; Gallardo, R A; van Santen, V L; van Ginkel, F W; Joiner, K S; Breedlove, C

    2014-06-01

    Protective properties of three distinct infectious bronchitis virus (IBV) Ark Delmarva poultry industry (ArkDPI) S1 proteins encoded from replication-defective recombinant adenovirus vectors were investigated. Using a suboptimal dose of each recombinant virus, we demonstrated that IBV S1 amino acid sequences showing > or = 95.8% amino acid identity to the S1 of the challenge strain differed in their ability at conferring protection. Indeed, the S1 sequence of the IBV population previously designated C4 (AdIBVS1.C4), which protected the most poorly, differs from the S1 sequence of population C2 (AdIBVS1.C2), which provided the highest protection, only at amino acid position 56. The fact that a change in one amino acid in this region significantly altered the induction of a protective immune response against this protein provides evidence that the first portion of S1 displays relevant immunoprotective epitopes. Use of an optimal dose of AdIBVS1.C2 effectively protected chickens from clinical signs and significantly reduced viral load after IBV Ark virulent challenge. Moreover, increased numbers of both IgA and IgG IBV-specific antibody secreting lymphocytes were detected in the spleen after challenge. The increased response detected for both IgA and IgG lymphocytes after challenge might be explained by vaccine-induced B memory cells. The fact that a single vaccination with Ad/IBVS1.C2 provides protection against IBV challenge is promising, because Ad-vectored vaccines can be mass delivered by in ovo inoculation using automated in ovo injectors.

  19. The Conference Proceedings of the 2001 Air Transport Research Society (ATRS) of the WCTR Society. Volume 1

    NASA Technical Reports Server (NTRS)

    Lee, Yeong-Heok (Editor); Bowen, Brent D. (Editor); Tarry, Scott E. (Editor)

    2001-01-01

    The ATRS held its Annual conference at Jeju Island, Korea in July 2001. The conference was a success with nearly 140 participants including 70 presenters. This report contains presentations from Volume 1 on the following: Airline and Travel Agent Relationships in Asia;Benchmarking Aviation Safety in the Commercial Airline Industry;Impact of Frequent Flyer Program on the Demand for Air Travel; Application of Genetic Algorithm on Airline Schedule;The Effects of Dual Carrier Designation and Partial Liberalization: The Case of Canada;Defense of Air Carriers and Air Agencies in FAA Enforcement proceedin gs - Damage Control Before the Case Arises; Cost Incentives for Airline Mergers? - An examination on the cost impact of U.S. airline mergers and acquisitions;Airport Regulation, Airline Competition and Canada's Airport System; Airline Competition: The Case of Israel's Domestic Doupoly; Non-Financial Indicators of Airline Distress: A Conceptual Approach;and Airport Privatization: An Empirical Analysis of Financial and Operational Efficiency.

  20. Receptor protection studies comparing recombinant and native nicotinic receptors: Evidence for a subpopulation of mecamylamine-sensitive native alpha3beta4* nicotinic receptors.

    PubMed

    Free, R Benjamin; Kaser, Daniel J; Boyd, R Thomas; McKay, Dennis B

    2006-01-09

    Studies involving receptor protection have been used to define the functional involvement of specific receptor subtypes in tissues expressing multiple receptor subtypes. Previous functional studies from our laboratory demonstrate the feasibility of this approach when applied to neuronal tissues expressing multiple nicotinic acetylcholine receptors (nAChRs). In the current studies, the ability of a variety of nAChR agonists and antagonists to protect native and recombinant alpha3beta4 nAChRs from alkylation were investigated using nAChR binding techniques. Alkylation of native alpha3beta4* nAChRs from membrane preparations of bovine adrenal chromaffin cells resulted in a complete loss of specific [(3)H]epibatidine binding. This loss of binding to native nAChRs was preventable by pretreatment with the agonists, carbachol or nicotine. The partial agonist, cytisine, produced partial protection. Several nAChR antagonists were also tested for their ability to protect. Hexamethonium and decamethonium were without protective activity while mecamylamine and tubocurarine were partially effective. Addition protection studies were performed on recombinant alpha3beta4 nAChRs. As with native alpha3beta4* nAChRs, alkylation produced a complete loss of specific [(3)H]epibatidine binding to recombinant alpha3beta4 nAChRs which was preventable by pretreatment with nicotine. However, unlike native alpha3beta4* nAChRs, cytisine and mecamylamine, provide no protection for alkylation. These results highlight the differences between native alpha3beta4* nAChRs and recombinant alpha3beta4 nAChRs and support the use of protection assays to characterize native nAChR subpopulations.

  1. High Temperature Resistant Organopolysiloxane Coating for Protecting and Repairing Rigid Thermal Insulation

    NASA Technical Reports Server (NTRS)

    Leiser, Daniel B. (Inventor); Hsu, Ming-Ta S. (Inventor); Chen, Timothy S. (Inventor)

    1999-01-01

    Ceramics are protected from high temperature degradation, including high temperature, oxidative, aeroconvective degradation by a high temperature and oxidation resistant coating of a room temperature curing, hydrolyzed and partially condensed liquid polyorganosiloxane to the surface of the ceramic. The liquid polyorganosiloxane is formed by the hydrolysis and partial condensation of an alkyltrialkoxysilane with water or a mixture of an alkyltrialkoxysilane and a dialkyldialkoxysilane with water. The liquid polyorganosiloxane cures at room temperature on the surface of the ceramic to form a hard, protective, solid coating which forms a high temperature environment, and is also used as an adhesive for adhering a repair plug in major damage to the ceramic. This has been found useful for protecting and repairing porous, rigid ceramics of a type used on reentry space vehicles.

  2. Application of Remote Sensing to the Chesapeake Bay Region. Volume 1: Executive summary

    NASA Technical Reports Server (NTRS)

    Chen, W. T.; Freas, G. W., Jr.; Hickman, G. D.; Pemberton, D. A.; Wilkerson, T. D.; Adler, I.; Laurie, V. J.

    1978-01-01

    The proceedings are presented of a conference, jointly sponsored by the National Aeronautics and Space Administration, the U.S. Environmental Protection Agency, and the University of Maryland. The purpose of the Conference was to assemble representatives of federal and state government agencies engaged in research on the condition and evolution of the Chesapeake Bay to compose a status report, to present current activities and future plans, and to recommend a long-range future course of policies and programs.

  3. DoD High Performance Computing Modernization Program Users Group Conference (HPCMP UGC 2011) Held in Portland, Oregon on June 20-23, 2011

    DTIC Science & Technology

    2011-06-01

    4. Conclusion The Web -based AGeS system described in this paper is a computationally-efficient and scalable system for high- throughput genome...method for protecting web services involves making them more resilient to attack using autonomic computing techniques. This paper presents our initial...20–23, 2011 2011 DoD High Performance Computing Modernzation Program Users Group Conference HPCMP UGC 2011 The papers in this book comprise the

  4. The Impact of Environmental Protection on the Operational Commander’s Warfighting Decisions

    DTIC Science & Technology

    1993-05-17

    as well as the testing of any type of weapons."’ The 1982 United Nations Convention on the Law of the Sea places restrictions on the discharge of oil ...Janeiro, Brazil . The conference, which was sponsored by the United Nations, was a global environmental conference which was attended by a number of...were of mangrove areas along the Saigon River and that a single spraying of defoliants was sufficient to kill the mangrove trees. They estimated that

  5. Ninth Conference on Space Simulation

    NASA Technical Reports Server (NTRS)

    1977-01-01

    The papers presented in this conference provided an international dialogue and a meaningful exchange in the simulation of space environments as well as the evolution of these technological advances into other fields. The papers represent a significant contribution to the understanding of space simulation problems and the utilization of this knowledge. The topics of the papers include; spacecraft testing; facilities and test equipment; system and subsystem test; life sciences, medicine and space; physical environmental factors; chemical environmental factors; contamination; space physics; and thermal protection.

  6. A Disruption of ctpA Encoding Carboxy-Terminal Protease Attenuates Burkholderia mallei and Induces Partial Protection in CD1 Mice

    DTIC Science & Technology

    2008-06-03

    etiologic agent of glanders in solipeds (horses, mules and donkeys), and incidentally in carnivores and humans. Little is known about the molecular...disintegrated cell envelopes. Furthermore, relative to the wild type, the ctpA mutant displayed slower growth in vitro and less ability to survive in...IgG2a and were partially protected against chal- lenge with wild type B. mallei ATCC 23344. These findings suggest that CtpA regulates in vitro growth

  7. Editorial Commentary: Chondrocytes Trump Ligaments! Partial Release of the Medial Collateral Ligament During Knee Arthroscopy Protects Chondrocytes.

    PubMed

    Leland, J Martin

    2016-10-01

    With knee arthroscopy being the most common orthopaedic procedure performed in the United States, it is crucial to be able to access the entire knee without iatrogenic injury. Frequently orthopaedic surgeons encounter tight medial compartments, creating difficulty in accessing the posterior horn of the medial meniscus without damaging the articular cartilage. Partial release of the medial collateral ligament during knee arthroscopy protects chondrocytes. Copyright © 2016 Arthroscopy Association of North America. Published by Elsevier Inc. All rights reserved.

  8. Overexpression of a Medicago truncatula stress-associated protein gene (MtSAP1) leads to nitric oxide accumulation and confers osmotic and salt stress tolerance in transgenic tobacco.

    PubMed

    Charrier, Aurélie; Planchet, Elisabeth; Cerveau, Delphine; Gimeno-Gilles, Christine; Verdu, Isabelle; Limami, Anis M; Lelièvre, Eric

    2012-08-01

    The impact of Medicago truncatula stress-associated protein gene (MtSAP1) overexpression has been investigated in Nicotiana tabacum transgenic seedlings. Under optimal conditions, transgenic lines overexpressing MtSAP1 revealed better plant development and higher chlorophyll content as compared to wild type seedlings. Interestingly, transgenic lines showed a stronger accumulation of nitric oxide (NO), a signaling molecule involved in growth and development processes. This NO production seemed to be partially nitrate reductase dependent. Due to the fact that NO has been also reported to play a role in tolerance acquisition of plants to abiotic stresses, the responses of MtSAP1 overexpressors to osmotic and salt stress have been studied. Compared to the wild type, transgenic lines were less affected in their growth and development. Moreover, NO content in MtSAP1 overexpressors was always higher than that detected in wild seedlings under stress conditions. It seems that this better tolerance induced by MtSAP1 overexpression could be associated with this higher NO production that would enable seedlings to reach a high protection level to prepare them to cope with abiotic stresses.

  9. Usage of the Heterologous Expression of the Antimicrobial Gene afp From Aspergillus giganteus for Increasing Fungal Resistance in Olive.

    PubMed

    Narvaez, Isabel; Khayreddine, Titouh; Pliego, Clara; Cerezo, Sergio; Jiménez-Díaz, Rafael M; Trapero-Casas, José L; López-Herrera, Carlos; Arjona-Girona, Isabel; Martín, Carmen; Mercado, José A; Pliego-Alfaro, Fernando

    2018-01-01

    The antifungal protein (AFP) produced by Aspergillus giganteus , encoded by the afp gene, has been used to confer resistance against a broad range of fungal pathogens in several crops. In this research, transgenic olive plants expressing the afp gene under the control of the constitutive promoter CaMV35S were generated and their disease response against two root infecting fungal pathogens, Verticillium dahliae and Rosellinia necatrix , was evaluated. Embryogenic cultures derived from a mature zygotic embryo of cv. 'Picual' were used for A. tumefaciens transformation. Five independent transgenic lines were obtained, showing a variable level of afp expression in leaves and roots. None of these transgenic lines showed enhanced resistance to Verticillium wilt. However, some of the lines displayed a degree of incomplete resistance to white root rot caused by R. necatrix compared with disease reaction of non-transformed plants or transgenic plants expressing only the GUS gene. The level of resistance to this pathogen correlated with that of the afp expression in root and leaves. Our results indicate that the afp gene can be useful for enhanced partial resistance to R. necatrix in olive, but this gene does not protect against V. dahliae .

  10. 78 FR 49749 - Trailblazer Pipeline Company LLC; Notice of Technical Conference

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-08-15

    ... technical, engineering, and operational support for its proposed gas quality specifications. Consistent with... Rehabilitation Act of 1973. For accessibility accommodations please send an email to [email protected] or...

  11. 75 FR 2140 - Columbia Gulf Transmission Company; Notice of Technical Conference

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-01-14

    ... in the protests, and if necessary, to provide additional technical, engineering and operational... Rehabilitation Act of 1973. For accessibility accommodations please send an e-mail to [email protected] or...

  12. Testing Antifungal Vaccines in an Animal Model of Invasive Candidiasis and in Human Mucosal Candidiasis.

    PubMed

    Segal, Esther

    2017-01-01

    The following article will concentrate on the NDV-3 anti-Candida and Staphylococcus vaccine. The vaccine is composed of the N-terminal portion of the Candida albicans agglutinin-like sequence 3 protein (Als3p) and aluminum hydroxide as adjuvant. The vaccine conferred protection to mice against experimental vaginal, oral, and intravenous challenge with C. albicans. Due to the sequence and structural homology of the Als3p with Staphylococcus aureus surface proteins, the vaccine also protected against experimental skin and IV infection with S. aureus. The vaccine has reached the stage of human trials: phase 1 clinical studies have shown that the vaccine is safe and immunogenic. The latest brief conference abstract reports of vaccination in women suffering from recurrent vaginal candidiasis, indicating that the recurrence rates were lower in the women receiving the vaccine.

  13. Effects of wine, alcohol and polyphenols on cardiovascular disease risk factors: evidences from human studies.

    PubMed

    Chiva-Blanch, Gemma; Arranz, Sara; Lamuela-Raventos, Rosa M; Estruch, Ramon

    2013-01-01

    The aim of this review was to focus on the knowledge of the cardiovascular benefits of moderate alcohol consumption, as well as to analyze the effects of the different types of alcoholic beverages. Systematic revision of human clinical studies and meta-analyses related to moderate alcohol consumption and cardiovascular disease (CVD) from 2000 to 2012. Heavy or binge alcohol consumption unquestionably leads to increased morbidity and mortality. Nevertheless, moderate alcohol consumption, especially alcoholic beverages rich in polyphenols, such as wine and beer, seems to confer cardiovascular protective effects in patients with documented CVD and even in healthy subjects. In conclusion, wine and beer (but especially red wine) seem to confer greater cardiovascular protection than spirits because of their polyphenolic content. However, caution should be taken when making recommendations related to alcohol consumption.

  14. Protection by Flavanol-Rich Foods Against Vascular Dysfunction and Oxidative Damage: 27th Hohenheim Consensus Conference1

    PubMed Central

    Sies, Helmut; Hollman, Peter C.H.; Grune, Tilman; Stahl, Wilhelm; Biesalski, Hans K.; Williamson, Gary

    2012-01-01

    Criteria for assessing the purported protection by flavanol-rich foods against vascular dysfunction and oxidative damage to biomolecules was the subject of the 27th Hohenheim Consensus Conference held on July 11, 2011. State-of-the-art evidence was put into perspective, focusing on several questions that were followed by a consensus answer. Among the topics addressed were the major sources of flavanols in the human diet, the bioavailability of flavanols, biomarkers for “health benefit,” and the biological function of flavanols. Consensus was reached on these topics. No conclusion was reached on the design of randomized, controlled trials for substantiation of health claims for flavanol-rich foods as to the necessity of a study arm with an isolated pharmacologically active compound, e.g., (−)-epicatechin. PMID:22516731

  15. Current controversies and challenges in robotic-assisted, laparoscopic, and open partial nephrectomies.

    PubMed

    Laviana, Aaron A; Hu, Jim C

    2014-06-01

    Recent studies demonstrate that partial versus radical nephrectomy confers a survival advantage while lowering the risk of severe chronic kidney disease. Open partial nephrectomy remains the gold standard, but the use of minimally invasive approaches is expanding. Using a MEDLINE literature search, we reviewed all relevant literature between 2000 and 2014. Fifty-one articles were left for review after filtering for inclusion of trends, learning curve, perioperative outcomes, warm ischemia time, and costs. Partial nephrectomy use has increased over the past decade accounting for 24.7 % of all surgeries performed for the treatment of organ-confined renal masses in 2008. The introduction of robotic technology has continued to alter the landscape accounting for 47 % of all partial nephrectomies at academic US centers in 2011, though a center bias and publication bias likely exist. A slower adoption rate has been seen at non-academic centers and those in low-income areas. The learning curve for robotic-assisted laparoscopic nephrectomy has been shorter than for laparoscopic partial nephrectomy, explaining, in part, why the rate of partial nephrectomy remained relatively stagnant before the robotic-assisted laparoscopic nephrectomy, despite an increase in the detection of small renal masses. Operative and warm ischemia time remain shortest for open partial nephrectomy, though it is associated with the highest blood loss and longest hospital stay. Finally, open partial nephrectomy remains the least costly modality. Each approach to partial nephrectomy has its advantages and disadvantages, and continued effort must be applied to comparative effectiveness research for nephron-sparing treatments for renal cell carcinoma.

  16. Interfamily Transfer of Dual NB-LRR Genes Confers Resistance to Multiple Pathogens

    PubMed Central

    Narusaka, Mari; Kubo, Yasuyuki; Hatakeyama, Katsunori; Imamura, Jun; Ezura, Hiroshi; Nanasato, Yoshihiko; Tabei, Yutaka; Takano, Yoshitaka; Shirasu, Ken; Narusaka, Yoshihiro

    2013-01-01

    A major class of disease resistance (R) genes which encode nucleotide binding and leucine rich repeat (NB-LRR) proteins have been used in traditional breeding programs for crop protection. However, it has been difficult to functionally transfer NB-LRR-type R genes in taxonomically distinct families. Here we demonstrate that a pair of Arabidopsis (Brassicaceae) NB-LRR-type R genes, RPS4 and RRS1, properly function in two other Brassicaceae, Brassica rapa and Brassica napus, but also in two Solanaceae, Nicotiana benthamiana and tomato (Solanum lycopersicum). The solanaceous plants transformed with RPS4/RRS1 confer bacterial effector-specific immunity responses. Furthermore, RPS4 and RRS1, which confer resistance to a fungal pathogen Colletotrichum higginsianum in Brassicaceae, also protect against Colletotrichum orbiculare in cucumber (Cucurbitaceae). Importantly, RPS4/RRS1 transgenic plants show no autoimmune phenotypes, indicating that the NB-LRR proteins are tightly regulated. The successful transfer of two R genes at the family level implies that the downstream components of R genes are highly conserved. The functional interfamily transfer of R genes can be a powerful strategy for providing resistance to a broad range of pathogens. PMID:23437080

  17. 10th Annual Systems Engineering Conference: Volume 2 Wednesday

    DTIC Science & Technology

    2007-10-25

    intelligently optimize resource performance. Self - Healing Detect hardware/software failures and reconfigure to permit continued operations. Self ...Types Wake Ice WEAPON/PLATFORM ACOUSTICS Self -Noise Radiated Noise Beam Forming Pulse Types Submarines, surface ships, and platform sensors P r o p P r o...Computing Self -Protecting Detect internal/external attacks and protect it’s resources from exploitation. Self -Optimizing Detect sub-optimal behaviors and

  18. Veterinarians in Environmental Health: Opportunities for Veterinarians at the Environmental Protection Agency

    EPA Science Inventory

    The United States Environmental Protection Agency (EPA) was created in 1970 partially in response to widespread public concern about environmental degradation. The EPA mission is to protect human health and the environment and the Agency is tasked with enforcing our nation's envi...

  19. Fundamental Processes in Partially Ionized Plasmas

    DTIC Science & Technology

    1988-08-01

    thermal plasma chemistry , may significantly underestimate Lie importance of radiation losses. Also shown in Figure 4 are the earlier measurements of Emmons...in Thermal Plasma Chemistry ," 8th Int’l Symposium on Plasma Chemistry , Tokyo Japan, August 1987. 4. Kruger, Charles H., "Nonequilibrium Effects in...Annual Gaseous Electronics Conference, Minneapolis, MN, October 1988. 7. Kruger, C. H., "Nonequilibrium Effects in Thermal Plasma Chemistry ," Submitted

  20. Proceedings of the Conference Arctic '85; Civil Engineering in the Artic offshore

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bennett, F.L.; Machemehl, J.L.

    1985-01-01

    Topics of the 1985 Conference included: Arctic construction, Arctic foundation, Arctic structures, and ocean effects. Arctic terminals and coastal offshore bases, protecting the Arctic environment, and probabilistic methods in Arctic offshore engineering were also discussed. Ice mechanics, marine pipelines in the Arctic, and the role of universities in training civil engineers for Arctic offshore development were highlighted. Sessions on remote sensing, surveying, and mapping were included, and offshore installations in the Bering Sea were discussed. Another topic of discussion was research in Civil Engineering for development of the Arctic offshore. The overall thrust of the conference was the application ofmore » Arctic offshore engineering principles and research in the field of oil and gas exploration and exploitation activity.« less

  1. The Deterioration Seen in Myelin Related Morphophysiology in Vanadium Exposed Rats is Partially Protected by Concurrent Iron Deficiency.

    PubMed

    Usende, Ifukibot Levi; Leitner, Dominque F; Neely, Elizabeth; Connor, James R; Olopade, James O

    2016-08-30

    Oligodendrocyte development and myelination occurs vigorously during the early post natal period which coincides with the period of peak mobilization of iron. Oligodendrocyte progenitor cells (OPCs) are easily disturbed by any agent that affects iron homeostasis and its assimilation into these cells. Environmental exposure to vanadium, a transition metal can disrupt this iron homeostasis. We investigated the interaction of iron deficiency and vanadium exposure on the myelination infrastructure and its related neurobehavioural phenotypes, and neurocellular profiles in developing rat brains. Control group (C) dams were fed normal diet while Group 2 (V) dams were fed normal diet and pups were injected with 3mg/kg body weight of sodium metavanadate daily from postnatal day (PND) 1-21. Group 3 (I+V) dams were fed iron deficient diet after delivery and pups injected with 3mg/kg body weight sodium metavanadate from PND1-21. Body and brain weights deteriorated in I+V relative to C and V while neurobehavioral deficit occurred more in V. Whereas immunohistochemical staining shows more astrogliosis and microgliosis indicative of neuroinflammation in I+V, more intense OPCs depletion and hypomyelination were seen in the V, and this was partially protected in I+V. In in vitro studies, vanadium induced glial cells toxicity was partially protected only at the LD 50 dose with the iron chelator, desferroxamine. The data indicate that vanadium promotes myelin damage and iron deficiency in combination with vanadium partially protects this neurotoxicological effects of vanadium.

  2. Single multivalent vaccination boosted by trickle larval infection confers protection against experimental lymphatic filariasis

    PubMed Central

    Joseph, SK; Ramaswamy, K

    2013-01-01

    The multivalent vaccine BmHAT, consisting of the Brugia malayi infective larval (L3) antigens heat shock protein12.6 (HSP12.6), abundant larval transcript-2 (ALT-2) and tetraspanin large extra cellular loop (TSP-LEL), was shown to be protective in rodent models from our laboratory. We hypothesize that since these antigens were identified using protective antibodies from immune endemic normal individuals, the multivalent vaccine can be augmented by natural L3 infections providing protection to the vaccinated host. This hypothesis was tested using single dose of DNA and Protein or Protein alone of the BmHAT vaccination in gerbils followed by live trickle L3 infection as booster dose. Vaccine-induced protection in gerbils was determined by worm establishment, micropore chamber assay and by antibody dependant cell cytotoxicity (ADCC) assay. Results were compared with the traditional prime-boost vaccination regimen. Gerbils vaccinated with BmHAT and boosted with L3 trickle infection were protected 51% (BmHAT DNA-Protein) and 48% (BmHAT Protein) respectively. BmHAT vaccination plus L3 trickle booster generated significant titer of antigen-specific IgG antibodies comparable to the traditional prime boost vaccination approach. BmHAT vaccination plus L3 trickle booster also generated antigen-specific cells in the spleen of vaccinated animals and these cells secreted predominantly IFN-γ and IL-4 in response to the vaccine antigens. These studies thus show that single dose of BmHAT multivalent vaccination followed by L3 trickle booster infection can confer significant protection against lymphatic filariasis. PMID:23735679

  3. Cross-protection among lethal H5N2 influenza viruses induced by DNA vaccine to the hemagglutinin.

    PubMed Central

    Kodihalli, S; Haynes, J R; Robinson, H L; Webster, R G

    1997-01-01

    Inoculation of mice with hemagglutinin (HA)-expressing DNA affords reliable protection against lethal influenza virus infection, while in chickens the same strategy has yielded variable results. Here we show that gene gun delivery of DNA encoding an H5 HA protein confers complete immune protection to chickens challenged with lethal H5 viruses. In tests of the influence of promoter selection on vaccine efficacy, close correlations were obtained between immune responses and the dose of DNA administered, whether a cytomegalovirus (CMV) immediate-early promoter or a chicken beta-actin promoter was used. Perhaps most important, the HA-DNA vaccine conferred 95% cross-protection against challenge with lethal antigenic variants that differed from the primary antigen by 11 to 13% (HA1 amino acid sequence homology). Overall, the high levels of protection seen with gene gun delivery of HA-DNA were as good as, if not better than, those achieved with a conventional whole-virus vaccine, with fewer instances of morbidity and death. The absence of detectable antibody titers after primary immunization, together with the rapid appearance of high titers immediately after challenge, implicates efficient B-cell priming as the principal mechanism of DNA-mediated immune protection. Our results suggest that the efficacy of HA-DNA influenza virus vaccine in mice extends to chickens and probably to other avian species as well. Indeed, the H5 preparation we describe offers an attractive means to protect the domestic poultry industry in the United States from lethal H5N2 viruses, which continue to circulate in Mexico. PMID:9094608

  4. A novel vaccination strategy mediating the induction of lung-resident memory CD8 T cells confers heterosubtypic immunity against future pandemic influenza virus

    PubMed Central

    Lee, Yu-Na; Lee, Young-Tae; Kim, Min-Chul; Gewirtz, Andrew T.; Kang, Sang-Moo

    2016-01-01

    The currently used vaccine strategy to combat influenza A virus (IAV) aims to provide highly specific immunity to circulating seasonal IAV strains. However, the outbreak of 2009 influenza pandemic highlights the danger in this strategy. Here, we tested the hypothesis that universal vaccination that offers broader but weaker protection would result in cross protective T-cell responses after primary IAV infection, which would subsequently provide protective immunity against future pandemic strains. Specifically, we used tandem repeat M2e epitopes on virus-like particles (M2e5x VLP) that induced heterosubtypic immunity by eliciting antibodies to a conserved M2e epitope. M2e5x VLP was found to be superior to strain-specific current split vaccine in conferring heterosubtypic cross protection and in equipping the host with cross-protective lung-resident nucleoprotein-specific memory CD8+ T cell responses to a subsequent secondary infection with a new pandemic potential strain. Immune correlates for subsequent heterosubtypic immunity by M2e5x VLP vaccination were found to be virus-specific CD8+ T cells secreting IFN-γ and expressing lung-resident memory phenotypic markers CD69+ and CD103+ as well as M2e antibodies. Hence, vaccination with M2e5x VLP may be developable as a new strategy to combat future pandemic outbreaks. PMID:26864033

  5. Food safety evaluation for R-proteins introduced by biotechnology: A case study of VNT1 in late blight protected potatoes.

    PubMed

    Habig, Jeffrey W; Rowland, Aaron; Pence, Matthew G; Zhong, Cathy X

    2018-06-01

    Resistance genes (R-genes) from wild potato species confer protection against disease and can be introduced into cultivated potato varieties using breeding or biotechnology. The R-gene, Rpi-vnt1, which encodes the VNT1 protein, protects against late blight, caused by Phytophthora infestans. Heterologous expression and purification of active VNT1 in quantities sufficient for regulatory biosafety studies was problematic, making it impractical to generate hazard characterization data. As a case study for R-proteins, a weight-of-evidence, tiered approach was used to evaluate the safety of VNT1. The hazard potential of VNT1 was identified from relevant safety information including history of safe use, bioinformatics, mode of action, expression levels, and dietary intake. From the assessment it was concluded that Tier II hazard characterization was not needed. R-proteins homologous to VNT1 and identified in edible crops, have a history of safe consumption. VNT1 does not share sequence identity with known allergens. Expression levels of R-proteins are generally low, and VNT1 was not detected in potato varieties expressing the Rpi-vnt1 gene. With minimal hazard and negligible exposure, the risks associated with consumption of R-proteins in late blight protected potatoes are exceedingly low. R-proteins introduced into potatoes to confer late blight protection are safe for consumption. Copyright © 2018 Elsevier Inc. All rights reserved.

  6. Protection against Experimental Cryptococcosis following Vaccination with Glucan Particles Containing Cryptococcus Alkaline Extracts

    PubMed Central

    Lee, Chrono K.; Huang, Haibin; Shen, Zu T.; Lodge, Jennifer K.; Leszyk, John; Ostroff, Gary R.

    2015-01-01

    ABSTRACT A vaccine capable of protecting at-risk persons against infections due to Cryptococcus neoformans and Cryptococcus gattii could reduce the substantial global burden of human cryptococcosis. Vaccine development has been hampered though, by lack of knowledge as to which antigens are immunoprotective and the need for an effective vaccine delivery system. We made alkaline extracts from mutant cryptococcal strains that lacked capsule or chitosan. The extracts were then packaged into glucan particles (GPs), which are purified Saccharomyces cerevisiae cell walls composed primarily of β-1,3-glucans. Subcutaneous vaccination with the GP-based vaccines provided significant protection against subsequent pulmonary infection with highly virulent strains of C. neoformans and C. gattii. The alkaline extract derived from the acapsular strain was analyzed by liquid chromatography tandem mass spectrometry (LC-MS/MS), and the most abundant proteins were identified. Separation of the alkaline extract by size exclusion chromatography revealed fractions that conferred protection when loaded in GP-based vaccines. Robust Th1- and Th17-biased CD4+ T cell recall responses were observed in the lungs of vaccinated and infected mice. Thus, our preclinical studies have indicated promising cryptococcal vaccine candidates in alkaline extracts delivered in GPs. Ongoing studies are directed at identifying the individual components of the extracts that confer protection and thus would be promising candidates for a human vaccine. PMID:26695631

  7. Summary of the Italian inter-society recommendations for radiation protection optimization in interventional radiology.

    PubMed

    Compagnone, Gaetano; Padovani, Renato; D'Avanzo, Maria Antonietta; Grande, Sveva; Campanella, Francesco; Rosi, Antonella

    2018-05-01

    A Working Group coordinated by the Italian National Institute of Health (Istituto Superiore di Sanità) and the National Workers Compensation Authority (Istituto Nazionale per l'Assicurazione contro gli Infortuni sul Lavoro, INAIL) and consisting of 11 Italian scientific/professional societies involved in the fluoroscopically guided interventional practices has been established to define recommendations for the optimization of patients and staff radiation protection in interventional radiology. A summary of these recommendations is here reported. A multidisciplinary approach was used to establish the Working Group by involving radiologists, interventional radiologists, neuroradiologists, interventional cardiologists, occupational health specialists, medical physicists, radiation protection experts, radiographers and nurses. The Group operated as a "Consensus Conference". Three main topics have been addressed: patient radiation protection (summarized in ten "golden rules"); staff radiation protection (summarized in ten "golden rules"); and education/training of interventional radiology professionals. In the "golden rules", practical and operational recommendations were provided to help the professionals in optimizing dose delivered to patients and reducing their own exposure. Operative indications dealt also with continuing education and training, and recommendations on professional accreditation and certification. The "Consensus Conference" was the methodology adopted for the development of these recommendations. Involvement of all professionals is a winning approach to improve practical implementation of the recommendations, thus getting a real impact on the optimization of the interventional radiology practices.

  8. Prevention of mammary carcinogenesis by short-term estrogen and progestin treatments

    PubMed Central

    Rajkumar, Lakshmanaswamy; Guzman, Raphael C; Yang, Jason; Thordarson, Gudmundur; Talamantes, Frank; Nandi, Satyabrata

    2004-01-01

    Introduction Women who have undergone a full-term pregnancy before the age of 20 have one-half the risk of developing breast cancer compared with women who have never gone through a full-term pregnancy. This protective effect is observed universally among women of all ethnic groups. Parity in rats and mice also protects them against chemically induced mammary carcinogenesis. Methods Seven-week-old virgin Lewis rats were given N-methyl-N-nitrosourea. Two weeks later the rats were treated with natural or synthetic estrogens and progestins for 7–21 days by subcutaneous implantation of silastic capsules. Results In our current experiment, we demonstrate that short-term sustained exposure to natural or synthetic estrogens along with progestins is effective in preventing mammary carcinogenesis in rats. Treatment with 30 mg estriol plus 30 mg progesterone for 3 weeks significantly reduced the incidence of mammary cancer. Short-term exposure to ethynyl estradiol plus megesterol acetate or norethindrone was effective in decreasing the incidence of mammary cancers. Tamoxifen plus progesterone treatment for 3 weeks was able to confer only a transient protection from mammary carcinogenesis, while 2-methoxy estradiol plus progesterone was effective in conferring protection against mammary cancers. Conclusions The data obtained in the present study demonstrate that, in nulliparous rats, long-term protection against mammary carcinogenesis can be achieved by short-term treatments with natural or synthetic estrogen and progesterone combinations. PMID:14680498

  9. New Small-Molecule Inhibitors Effectively Blocking Picornavirus Replication

    PubMed Central

    Ford Siltz, Lauren A.; Viktorova, Ekaterina G.; Zhang, Ben; Kouiavskaia, Diana; Dragunsky, Eugenia; Chumakov, Konstantin; Isaacs, Lyle

    2014-01-01

    ABSTRACT Few drugs targeting picornaviruses are available, making the discovery of antivirals a high priority. Here, we identified and characterized three compounds from a library of kinase inhibitors that block replication of poliovirus, coxsackievirus B3, and encephalomyocarditis virus. Using an in vitro translation-replication system, we showed that these drugs inhibit different stages of the poliovirus life cycle. A4(1) inhibited both the formation and functioning of the replication complexes, while E5(1) and E7(2) were most effective during the formation but not the functioning step. Neither of the compounds significantly inhibited VPg uridylylation. Poliovirus resistant to E7(2) had a G5318A mutation in the 3A protein. This mutation was previously found to confer resistance to enviroxime-like compounds, which target a phosphatidylinositol 4-kinase IIIβ (PI4KIIIβ)-dependent step in viral replication. Analysis of host protein recruitment showed that E7(2) reduced the amount of GBF1 on the replication complexes; however, the level of PI4KIIIβ remained intact. E7(2) as well as another enviroxime-like compound, GW5074, interfered with viral polyprotein processing affecting both 3C- and 2A-dependent cleavages, and the resistant G5318A mutation partially rescued this defect. Moreover, E7(2) induced abnormal recruitment to membranes of the viral proteins; thus, enviroxime-like compounds likely severely compromise the interaction of the viral polyprotein with membranes. A4(1) demonstrated partial protection from paralysis in a murine model of poliomyelitis. Multiple attempts to isolate resistant mutants in the presence of A4(1) or E5(1) were unsuccessful, showing that effective broad-spectrum antivirals could be developed on the basis of these compounds. IMPORTANCE Diverse picornaviruses can trigger multiple human maladies, yet currently, only hepatitis A virus and poliovirus can be controlled with vaccination. The development of antipicornavirus therapeutics is also facing significant difficulties because these viruses readily generate resistance to compounds targeting either viral or cellular factors. Here, we describe three novel compounds that effectively block replication of distantly related picornaviruses with minimal toxicity to cells. The compounds prevent viral RNA replication after the synthesis of the uridylylated VPg primer. Importantly, two of the inhibitors are strongly refractory to the emergence of resistant mutants, making them promising candidates for further broad-spectrum therapeutic development. Evaluation of one of the compounds in an in vivo model of poliomyelitis demonstrated partial protection from the onset of paralysis. PMID:25008939

  10. The Solanum tuberosum KST1 partial promoter as a tool for guard cell expression in multiple plant species.

    PubMed

    Kelly, Gilor; Lugassi, Nitsan; Belausov, Eduard; Wolf, Dalia; Khamaisi, Belal; Brandsma, Danja; Kottapalli, Jayaram; Fidel, Lena; Ben-Zvi, Batsheva; Egbaria, Aiman; Acheampong, Atiako Kwame; Zheng, Chuanlin; Or, Etti; Distelfeld, Assaf; David-Schwartz, Rakefet; Carmi, Nir; Granot, David

    2017-05-17

    To date, guard cell promoters have been examined in only a few species, primarily annual dicots. A partial segment of the potato (Solanum tuberosum) KST1 promoter (KST1 partial promoter, KST1ppro) has previously been shown to confer guard cell expression in potato, tomato (Solanum lycopersicum), citrus [Troyer citrange (C. sinensis×Poncirus trifoliata)], and Arabidopsis (Arabidopsis thaliana). Here, we describe an extensive analysis of the expression pattern of KST1ppro in eight (previously reported, as well as new) species from five different angiosperm families, including the Solanaceae and the Cucurbitaceae, Arabidopsis, the monocot barley (Hordeum vulgare), and two perennial species: grapevine (Vitis vinifera) and citrus. Using confocal imaging and three-dimensional movies, we demonstrate that KST1ppro drives guard cell expression in all of these species, making it the first dicot-originated guard cell promoter shown to be active in a monocot and the first promoter reported to confer guard cell expression in barley and cucumber (Cucumis sativus). The results presented here indicate that KST1ppro can be used to drive constitutive guard cell expression in monocots and dicots and in both annual and perennial plants. In addition, we show that the KST1ppro is active in guard cells shortly after the symmetric division of the guard mother cell and generates stable expression in mature guard cells. This allows us to follow the spatial and temporal distribution of stomata in cotyledons and true leaves. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  11. 49 CFR 375.707 - If a shipment is partially lost or destroyed, what charges may I collect at delivery?

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... MOTOR CARRIER SAFETY REGULATIONS TRANSPORTATION OF HOUSEHOLD GOODS IN INTERSTATE COMMERCE; CONSUMER PROTECTION REGULATIONS Delivery of Shipments § 375.707 If a shipment is partially lost or destroyed, what...

  12. 78 FR 11660 - Eunice Kennedy Shriver National Institute of Child Health & Human Development; Notice of Closed...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-02-19

    ... Boulevard, Rockville, MD 20852 (Telephone Conference Call). Contact Person: Peter Zelazowski, Ph.D..., peter[email protected] . (Catalogue of Federal Domestic Assistance Program Nos. 93.864, Population...

  13. Inter-Clade Protection Offered by Mw-Adjuvanted Recombinant HA, NP Proteins, and M2e Peptide Combination Vaccine in Mice Correlates with Cellular Immune Response.

    PubMed

    Ingle, Nilesh B; Virkar, Rashmi G; Arankalle, Vidya A

    2016-01-01

    We documented earlier that Mw (heat-killed suspension of Mycobacterium indicus pranii ) adjuvant when used with conserved antigens, nucleoprotein (NP), and ectodomain of matrix (M2) protein (M2e) provided complete protection against homologous (clade 2.2) virus challenge in mice. The present study extends these observations to inter-clade challenge (clade 2.3.2.1) H5N1 virus and attempts to understand preliminary immunologic basis for the observed protection. Female BALB/c mice immunized with a single or two doses of vaccine formulations (clade 2.2 antigens) were challenged with 100LD50 homologous or heterologous (clade 2.3.2.1) virus. To understand the preliminary immunologic mechanism, we studied proportions of selected immune cell types, immune response gene expression, and Th1/Th2 cytokines induced by antigen-stimulated splenocytes from immunized mice, at different time points. Complete protection was conferred by Mw-HA, Mw-HA + NP, and Mw-HA + NP + M2e against homologous challenge. The protection correlated with IgG2a antibody titers indicating important role of Th1 response. Despite high inter-cladal antigenic differences, complete protection against the heterologous strain was achieved with Mw-HA + NP + M2e. Of note, a single dose with higher antigen concentrations (50 µg HA + 50 μg NP + 50 μg M2e) led to 80% protection against clade 2.3.2.1 strain. The protection conferred by Mw-HNM correlated with induction of IFN-γ, CD8 + T cytotoxic cells, and CD4 + T helper cells. Mw-adjuvanted HA + NP + M2e combination represents a promising vaccine candidate deserving further evaluation.

  14. A polyvalent Clade B virus-like particle HIV vaccine combined with partially protective oral preexposure prophylaxis prevents simian-human immunodeficiency virus Infection in macaques and primes for virus-amplified immunity.

    PubMed

    Ross, Ted M; Pereira, Lara E; Luckay, Amara; McNicholl, Janet M; García-Lerma, J Gerardo; Heneine, Walid; Eugene, Hermancia S; Pierce-Paul, Brooke R; Zhang, Jining; Hendry, R Michael; Smith, James M

    2014-11-01

    Vaccination and preexposure prophylaxis (PrEP) with antiretrovirals have shown only partial protection from HIV-1 infection in human trials. Oral Truvada (emtricitabine/tenofovir disoproxil fumarate) is FDA approved as PrEP but partial adherence reduces efficacy. If combined as biomedical preventions (CBP), an HIV vaccine could protect when PrEP adherence is low and PrEP could prevent vaccine breakthroughs. The efficacy of combining oral PrEP with an HIV vaccine has not been evaluated in humans. We determined the efficacy of combining a DNA/virus-like particle (VLP) vaccine with partially effective intermittent PrEP in Indian rhesus macaques (RM). Eight RM received intramuscular inoculations of five DNA plasmids encoding four HIV-1 Clade B primary isolate Envs and SIVmac239 Gag (at weeks 0 and 4), followed by intramuscular and intranasal inoculations of homologous Gag VLPs and four Env VLPs (at weeks 12, 16, and 53). At week 61, we initiated weekly rectal exposures with heterologous SHIV162p3 (10 TCID50) along with oral Truvada (TDF, 22 mg/kg; FTC 20 mg/kg) dosing 2 h before and 22 h after each exposure. This PrEP regimen previously demonstrated 50% efficacy. Five controls (no vaccine, no PrEP) received weekly SHIV162p3. All controls were infected after a median of four exposures; the mean peak plasma viral load (VL) was 3.9×10(7) vRNA copies/ml. CBP protected seven of eight (87.5%) RM. The one infected CBP RM had a reduced peak VL of 8.8×10(5) copies/ml. SHIV exposures during PrEP amplified Gag and Env antibody titers in protected RM. These results suggest that combining oral PrEP with HIV vaccines could enhance protection against HIV-1 infection.

  15. Atomic oxygen protective coating with resistance to undercutting at defect sites

    NASA Technical Reports Server (NTRS)

    Banks, Bruce A. (Inventor); Rutledge, Sharon K. (Inventor)

    1994-01-01

    Structures composed at least partially of an organic substrate may be protected from oxidation by applying a catalyst onto said substrate for promoting the combination of atomic oxygen to molecular oxygen. The structure may also be protected by applying both a catalyst and an atomic oxygen shielding layer onto the substrate. The structures to be protected include spacecraft surfaces.

  16. TSCA Section 21 Petition for Section 8(a) Partial Exemption

    EPA Pesticide Factsheets

    This petition requests EPA to amend the TSCA Section 8 Chemical Data Reporting (CDR) partially exempted chemical list set forth in the U.S. Environmental Protection Agency’s (EPA) regulations at 40 C.F.R. Section 711.6(b)(1).

  17. Effect of temperature modulations on TEMPO-mediated regioselective oxidation of unprotected carbohydrates and nucleosides.

    PubMed

    Yadav, Mahipal; Liotta, Charles L; Krishnamurthy, Ramanarayanan

    2018-02-02

    Regioselective oxidation of unprotected and partially protected oligosaccharides is a much sought-after goal. Herein, we report a notable improvement in the efficiency of TEMPO-catalyzed oxidation by modulating the temperature of the reaction. Mono-, di-, and tri-saccharides are oxidized regioselectively in yields of 75 to 92%. The present method is simple to implement and is also applicable for selective oxidations of other mono- and poly-hydroxy compounds including unprotected and partially protected nucleosides. Copyright © 2018 Elsevier Ltd. All rights reserved.

  18. [Protection against laryngotracheobronchial obstruction and anaphylaxis with ketotifen and DSCG (disodium chromoglycate) in patients with food allergy].

    PubMed

    De Luca, L

    1988-01-01

    The authors studied in 30 allergic children to foods the protection of fall of spirometric flow (FEV1) after food challenge, caused by ketotifen and DSCG. The first showed a greater number of total protection = 60% in comparison with DSCG = 53.3%. The supply of both drugs at the same time showed a great amplification of protective action: total protection 73.3%, partial 20%; amount of two protections = 93.3%.

  19. Examining Application Components to Reveal Android Malware

    DTIC Science & Technology

    2013-03-01

    RGBDroid: a novel response-based approach to android privilege escalation attacks ”. Proceedings of the 5th USENIX conference on Large-Scale Exploits and...Wetherall. “These aren’t the droids you’re looking for: retrofitting android to protect data from imperious applications”. Proceedings of the 18th ACM...copyright protection in the United States. AFIT-ENG-13-M-19 EXAMINING APPLICATION COMPONENTS TO REVEAL ANDROID MALWARE THESIS Presented to the Faculty

  20. Vaccination with NS1-truncated H3N2 swine influenza virus primes T cells and confers cross-protection against an H1N1 heterosubtypic challenge in pigs

    USDA-ARS?s Scientific Manuscript database

    The diversity of contemporary swine influenza virus (SIV) strains impedes effective immunization of swine herds. Mucosally delivered, attenuated virus vaccines are one approach with potential to provide broad cross-protection. Reverse genetics-derived H3N2 SIV virus with truncated NS1 (NS1delta126 T...

  1. A recombinant iron transport protein from Bordetella pertussis confers protection against Bordetella parapertussis.

    PubMed

    Alvarez Hayes, Jimena; Oviedo, Juan Marcos; Valdez, Hugo; Laborde, Juan Martín; Maschi, Fabricio; Ayala, Miguel; Shah, Rohan; Fernandez Lahore, Marcelo; Rodriguez, Maria Eugenia

    2017-10-01

    Whooping cough, which is caused by Bordetella pertussis and B. parapertussis, is a reemerging disease. New protective antigens are needed to improve the efficacy of current vaccines against both species. Using proteomic tools, it was here found that B. parapertussis expresses a homolog of AfuA, a previously reported new vaccine candidate against B. pertussis. It was found that this homolog, named AfuA Bpp , is expressed during B. parapertussis infection, exposed on the surface of the bacteria and recognized by specific antibodies induced by the recombinant AfuA cloned from B. pertussis (rAfuA). Importantly, the presence of the O-antigen, a molecule that has been found to shield surface antigens on B. parapertussis, showed no influence on antibody recognition of AfuA Bpp on the bacterial surface. The present study further showed that antibodies induced by immunization with the recombinant protein were able to opsonize B. parapertussis and promote bacterial uptake by neutrophils. Finally, it was shown that this antigen confers protection against B. parapertussis infection in a mouse model. Altogether, these results indicate that AfuA is a good vaccine candidate for acellular vaccines protective against both causative agents of whooping cough. © 2017 The Societies and John Wiley & Sons Australia, Ltd.

  2. Cognitive and Neuroplasticity Mechanisms by Which Congenital or Early Blindness May Confer a Protective Effect Against Schizophrenia

    PubMed Central

    Silverstein, Steven M.; Wang, Yushi; Keane, Brian P.

    2013-01-01

    Several authors have noted that there are no reported cases of people with schizophrenia who were born blind or who developed blindness shortly after birth, suggesting that congenital or early (C/E) blindness may serve as a protective factor against schizophrenia. By what mechanisms might this effect operate? Here, we hypothesize that C/E blindness offers protection by strengthening cognitive functions whose impairment characterizes schizophrenia, and by constraining cognitive processes that exhibit excessive flexibility in schizophrenia. After briefly summarizing evidence that schizophrenia is fundamentally a cognitive disorder, we review areas of perceptual and cognitive function that are both impaired in the illness and augmented in C/E blindness, as compared to healthy sighted individuals. We next discuss: (1) the role of neuroplasticity in driving these cognitive changes in C/E blindness; (2) evidence that C/E blindness does not confer protective effects against other mental disorders; and (3) evidence that other forms of C/E sensory loss (e.g., deafness) do not reduce the risk of schizophrenia. We conclude by discussing implications of these data for designing cognitive training interventions to reduce schizophrenia-related cognitive impairment, and perhaps to reduce the likelihood of the development of the disorder itself. PMID:23349646

  3. Chondracanthus tenellus (Harvey) hommersand extract protects the human keratinocyte cell line by blocking free radicals and UVB radiation-induced cell damage.

    PubMed

    Piao, Mei Jing; Hyun, Yu Jae; Oh, Tae-Heon; Kang, Hee Kyoung; Yoo, Eun Sook; Koh, Young Sang; Lee, Nam Ho; Suh, In Soo; Hyun, Jin Won

    2012-12-01

    The aim of this study was to investigate the protective effects of the ethanol extract of the red algae Chondracanthus tenellus (Harvey) Hommersand (CTE) on cultured human keratinocyte cell line. The cellular protection conferred by CTE was evidenced by the ability of the extract to absorb ultraviolet B (UVB; 280-320 nm) and to scavenge the radical 1,1-diphenyl-2-picrylhydrazyl, as well as intracellular reactive oxygen species (ROS), induced by either hydrogen peroxide (H(2)O(2)) or UVB radiation. In addition, both superoxide anion generated by the xanthine/xanthine oxidase system and hydroxyl radical generated by the Fenton reaction (FeSO(4) + H(2)O(2)) were scavenged by CTE, as confirmed using electron spin resonance spectrometry. In the human keratinocyte cell line, CTE decreased the degree of injury resulting from UVB-induced oxidative stress to lipids, proteins, and DNA. CTE-treated cells also showed a reduction in UVB-induced apoptosis, as exemplified by fewer apoptotic bodies and less DNA fragmentation. Taken together, these results suggest that CTE confers protection on the human keratinocyte cell line against UVB-induced oxidative stress by absorbing UVB ray and scavenging ROS, thereby reducing injury to cellular constituents.

  4. Protective Role of Dietary Berries in Cancer

    PubMed Central

    Kristo, Aleksandra S.; Klimis-Zacas, Dorothy; Sikalidis, Angelos K.

    2016-01-01

    Dietary patterns, including regular consumption of particular foods such as berries as well as bioactive compounds, may confer specific molecular and cellular protection in addition to the overall epidemiologically observed benefits of plant food consumption (lower rates of obesity and chronic disease risk), further enhancing health. Mounting evidence reports a variety of health benefits of berry fruits that are usually attributed to their non-nutritive bioactive compounds, mainly phenolic substances such as flavonoids or anthocyanins. Although it is still unclear which particular constituents are responsible for the extended health benefits, it appears that whole berry consumption generally confers some anti-oxidant and anti-inflammatory protection to humans and animals. With regards to cancer, studies have reported beneficial effects of berries or their constituents including attenuation of inflammation, inhibition of angiogenesis, protection from DNA damage, as well as effects on apoptosis or proliferation rates of malignant cells. Berries extend effects on the proliferation rates of both premalignant and malignant cells. Their effect on premalignant cells is important for their ability to cause premalignant lesions to regress both in animals and in humans. The present review focuses primarily on in vivo and human dietary studies of various berry fruits and discusses whether regular dietary intake of berries can prevent cancer initiation and delay progression in humans or ameliorate patients’ cancer status. PMID:27775562

  5. Protective Role of Dietary Berries in Cancer.

    PubMed

    Kristo, Aleksandra S; Klimis-Zacas, Dorothy; Sikalidis, Angelos K

    2016-10-19

    Dietary patterns, including regular consumption of particular foods such as berries as well as bioactive compounds, may confer specific molecular and cellular protection in addition to the overall epidemiologically observed benefits of plant food consumption (lower rates of obesity and chronic disease risk), further enhancing health. Mounting evidence reports a variety of health benefits of berry fruits that are usually attributed to their non-nutritive bioactive compounds, mainly phenolic substances such as flavonoids or anthocyanins. Although it is still unclear which particular constituents are responsible for the extended health benefits, it appears that whole berry consumption generally confers some anti-oxidant and anti-inflammatory protection to humans and animals. With regards to cancer, studies have reported beneficial effects of berries or their constituents including attenuation of inflammation, inhibition of angiogenesis, protection from DNA damage, as well as effects on apoptosis or proliferation rates of malignant cells. Berries extend effects on the proliferation rates of both premalignant and malignant cells. Their effect on premalignant cells is important for their ability to cause premalignant lesions to regress both in animals and in humans. The present review focuses primarily on in vivo and human dietary studies of various berry fruits and discusses whether regular dietary intake of berries can prevent cancer initiation and delay progression in humans or ameliorate patients' cancer status.

  6. Differential Trafficking of TLR1 I602S Underlies Host Protection Against Pathogenic Mycobacteria§

    PubMed Central

    Hart, Bryan E.; Tapping, Richard I.

    2012-01-01

    We have recently identified I602S as a frequent single nucleotide polymorphism of human TLR1 which greatly inhibits cell surface trafficking, confers hyporesponsiveness to TLR1 agonists, and protects against the mycobacterial diseases leprosy and tuberculosis. Since mycobacteria are known to manipulate the TLR system to their advantage, we hypothesize that the hyporesponsive 602S variant may confer protection by enabling the host to overcome this immune subversion. We report that primary human monocytes and macrophages from homozygous TLR1 602S individuals are resistant to mycobacterial-induced downregulation of macrophage MHCII, CD64, and IFNγ responses compared to individuals who harbor the TLR1 602I variant. Additionally, when challenged with mycobacterial agonists, macrophages from TLR1 602S/S individuals resist induction of host arginase-1; an enzyme that depletes cellular arginine stores required for production of antimicrobial reactive nitrogen intermediates. The differences in cell activation mediated by TLR1 602S and TLR1 602I are observed upon stimulation with soluble mycobacterial-derived agonists but not with whole mycobacterial cells. Taken together, these results suggest that the TLR1 602S variant protects against mycobacterial disease by preventing soluble mycobacterial products, perhaps released from granulomas, from disarming myeloid cells prior to their encounter with whole mycobacteria. PMID:23105135

  7. 6-HYDROXYDOPAMINE INDUCES MITOCHONDRIAL ERK ACTIVATION

    PubMed Central

    Kulich, Scott M.; Horbinski, Craig; Patel, Manisha; Chu, Charleen T.

    2007-01-01

    Reactive oxygen species (ROS) are implicated in 6-hydroxydopamine (6-OHDA) injury to catecholaminergic neurons; however, the mechanism(s) are unclear. In addition to ROS generated during autoxidation, 6-OHDA may initiate secondary cellular sources of ROS that contribute to toxicity. Using a neuronal cell line, we found that catalytic metalloporphyrin antioxidants conferred protection if added 1 hour after exposure to 6-OHDA, whereas the hydrogen peroxide scavenger catalase failed to protect if added more than 15 min after 6-OHDA. There was a temporal correspondence between loss of protection and loss of the ability of the antioxidant to inhibit 6-OHDA-induced ERK phosphorylation. Time course studies of aconitase inactivation, as an indicator of intracellular superoxide, and MitoSOX red, a mitochondria targeted ROS indicator, demonstrate early intracellular ROS followed by a delayed phase of mitochondrial ROS production, associated with phosphorylation of a mitochondrial pool of ERK. Furthermore, upon initiation of mitochondrial ROS and ERK activation, 6-OHDA-injured cells became refractory to rescue by metalloporphyrin antioxidants. Together with previous studies showing that inhibition of the ERK pathway confers protection from 6-OHDA toxicity, and that phosphorylated ERK accumulates in mitochondria of degenerating human Parkinson’s disease neurons, these studies implicate mitochondrial ERK activation in Parkinsonian oxidative neuronal injury. PMID:17602953

  8. HsfA1a upregulates melatonin biosynthesis to confer cadmium tolerance in tomato plants.

    PubMed

    Cai, Shu-Yu; Zhang, Yun; Xu, You-Ping; Qi, Zhen-Yu; Li, Meng-Qi; Ahammed, Golam Jalal; Xia, Xiao-Jian; Shi, Kai; Zhou, Yan-Hong; Reiter, Russel J; Yu, Jing-Quan; Zhou, Jie

    2017-03-01

    Melatonin regulates broad aspects of plant responses to various biotic and abiotic stresses, but the upstream regulation of melatonin biosynthesis by these stresses remains largely unknown. Herein, we demonstrate that transcription factor heat-shock factor A1a (HsfA1a) conferred cadmium (Cd) tolerance to tomato plants, in part through its positive role in inducing melatonin biosynthesis under Cd stress. Analysis of leaf phenotype, chlorophyll content, and photosynthetic efficiency revealed that silencing of the HsfA1a gene decreased Cd tolerance, whereas its overexpression enhanced plant tolerance to Cd. HsfA1a-silenced plants exhibited reduced melatonin levels, and HsfA1a overexpression stimulated melatonin accumulation and the expression of the melatonin biosynthetic gene caffeic acid O-methyltransferase 1 (COMT1) under Cd stress. Both an in vitro electrophoretic mobility shift assay and in vivo chromatin immunoprecipitation coupled with qPCR analysis revealed that HsfA1a binds to the COMT1 gene promoter. Meanwhile, Cd stress induced the expression of heat-shock proteins (HSPs), which was compromised in HsfA1a-silenced plants and more robustly induced in HsfA1a-overexpressing plants under Cd stress. COMT1 silencing reduced HsfA1a-induced Cd tolerance and melatonin accumulation in HsfA1a-overexpressing plants. Additionally, the HsfA1a-induced expression of HSPs was partially compromised in COMT1-silenced wild-type or HsfA1a-overexpressing plants under Cd stress. These results demonstrate that HsfA1a confers Cd tolerance by activating transcription of the COMT1 gene and inducing accumulation of melatonin that partially upregulates expression of HSPs. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  9. Identification of Genes Upregulated by the Transcription Factor Bcr1 That Are Involved in Impermeability, Impenetrability, and Drug Resistance of Candida albicans a/α Biofilms

    PubMed Central

    Srikantha, Thyagarajan; Daniels, Karla J.; Pujol, Claude; Kim, Elena

    2013-01-01

    Candida albicans forms two types of biofilm, depending upon the configuration of the mating type locus. Although architecturally similar, a/α biofilms are impermeable, impenetrable, and drug resistant, whereas a/a and α/α biofilms lack these traits. The difference appears to be the result of an alternative matrix. Overexpression in a/a cells of BCR1, a master regulator of the a/α matrix, conferred impermeability, impenetrability, and drug resistance to a/a biofilms. Deletion of BCR1 in a/α cells resulted in the loss of these a/α-specific biofilm traits. Using BCR1 overexpression in a/a cells, we screened 107 genes of interest and identified 8 that were upregulated by Bcr1. When each was overexpressed in a/a biofilms, the three a/α traits were partially conferred, and when each was deleted in a/α cells, the traits were partially lost. Five of the eight genes have been implicated in iron homeostasis, and six encode proteins that are either in the wall or plasma membrane or secreted. All six possess sites for O-linked and N-linked glycosylation that, like glycosylphosphatidylinositol (GPI) anchors, can cross-link to the wall and matrix, suggesting that they may exert a structural role in conferring impermeability, impenetrability, and drug resistance, in addition to their physiological functions. The fact that in a screen of 107 genes, all 8 of the Bcr1-upregulated genes identified play a role in impermeability, impenetrability, and drug resistance suggests that the formation of the a/α matrix is highly complex and involves a larger number of genes than the initial ones identified here. PMID:23563485

  10. The metal transporter SMF-3/DMT-1 mediates aluminum-induced dopamine neuron degeneration.

    PubMed

    VanDuyn, Natalia; Settivari, Raja; LeVora, Jennifer; Zhou, Shaoyu; Unrine, Jason; Nass, Richard

    2013-01-01

    Aluminum (Al(3+)) is the most prevalent metal in the earth's crust and is a known human neurotoxicant. Al(3+) has been shown to accumulate in the substantia nigra of patients with Parkinson's disease (PD), and epidemiological studies suggest correlations between Al(3+) exposure and the propensity to develop both PD and the amyloid plaque-associated disorder Alzheimer's disease (AD). Although Al(3+) exposures have been associated with the development of the most common neurodegenerative disorders, the molecular mechanism involved in Al(3+) transport in neurons and subsequent cellular death has remained elusive. In this study, we show that a brief exposure to Al(3+) decreases mitochondrial membrane potential and cellular ATP levels, and confers dopamine (DA) neuron degeneration in the genetically tractable nematode Caenorhabditis elegans (C. elegans). Al(3+) exposure also exacerbates DA neuronal death conferred by the human PD-associated protein α-synuclein. DA neurodegeneration is dependent on SMF-3, a homologue to the human divalent metal transporter (DMT-1), as a functional null mutation partially inhibits the cell death. We also show that SMF-3 is expressed in DA neurons, Al(3+) exposure results in a significant decrease in protein levels, and the neurodegeneration is partially dependent on the PD-associated transcription factor Nrf2/SKN-1 and caspase Apaf1/CED-4. Furthermore, we provide evidence that the deletion of SMF-3 confers Al(3+) resistance due to sequestration of Al(3+) into an intracellular compartment. This study describes a novel model for Al(3+)-induced DA neurodegeneration and provides the first molecular evidence of an animal Al(3+) transporter. © 2012 International Society for Neurochemistry.

  11. Substance abuse prevention and treatment within the criminal justice system: an overview of the issues.

    PubMed

    Campbell-Heider, Nancy; Baird, Carolyn

    2012-02-01

    Many nurses, especially those in addictions, work directly in the prison system and or relate to inmates before or after institutionalization for criminal activity. This connection led to the theme of the 2009 Annual Education Conference held in Albuquerque, New Mexico, entitled "Substance Abuse Prevention and Treatment: Working with the Criminal Justice Systems." The conference was partially funded through an award from the Substance Abuse and Mental Health Services Administration (SAMHSA), Center for Substance Abuse Prevention (grant # SP015963) and focused on identifying the special risk factors for and barriers to the treatment of addictions for those who enter the criminal justice system. The conference, presented in collaboration with the American Association of Nurse Attorneys (AANA) highlighted the tremendous need for more access to addictions and mental health providers in the criminal justice system. Papers presented at that conference confirmed that nurses can make a real difference in the health of inmates, especially those of us engaged in addictions and mental health practices, and inspired this specially focused edition of the Journal of Addictions Nursing. The purpose of this editorial is to provide an overview of the addictions problems affecting individuals under supervision in the criminal justice system, barriers to treatment within this system, and the cost-benefits of evidence based treatment.

  12. 78 FR 36778 - Pesticide Program Dialogue Committee; Notice of Public Meeting

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-06-19

    ... Pollinator Protection; PPDC Work Group on Integrated Pest Management; PPDC Work Group on Comparative Safety... Management Work Group, 9:30 a.m. to noon in Conference Room S-4370-80; Comparative Safety Statements Work...

  13. NASA Fire Protection Coordinators' Conference

    NASA Technical Reports Server (NTRS)

    Clark, Theodore

    2001-01-01

    Fire prevention activities at NASA's Stennis Space Center are reviewed in this viewgraph presentation. The Fire Prevention Office of the Fire Department at NASA Stennis conducts inspections and issues small appliance permits, while the Operations Section responds to emergencies.

  14. 76 FR 46822 - Center for Scientific Review; Notice of Closed Meeting

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-08-03

    ... (Telephone Conference Call). Contact Person: Ronald Adkins, PhD, Scientific Review Officer, Center for... 20892, 301-495- 4511, ronald[email protected] . This notice is being published less than 15 days prior to...

  15. 77 FR 60447 - Eunice Kennedy Shriver National Institute of Child Health & Human Development; Notice of Closed...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-10-03

    ..., 6100 Executive Boulevard, Rockville, MD 20852 (Telephone Conference Call). Contact Person: Peter..., 301-435-6902, peter[email protected] . (Catalogue of Federal Domestic Assistance Program Nos. 93.864...

  16. A missing voice: the human rights of children to a tobacco-free environment.

    PubMed

    Toebes, Brigit; Gispen, Marie Elske; Been, Jasper V; Sheikh, Aziz

    2018-01-01

    In this commentary, we flag the importance of taking a child-rights approach in the context of tobacco control, which is thus far unprecedented. This text was written in response to the Seventh Conference of States Parties of WHOs Framework Convention on Tobacco Control held in India from 7 to 12 November 2016.While the links between tobacco control and human rights were emphasised at this conference, a child-rights approach was missing. We argue that this novel angle provides important legal tools to protect the health and well-being of children. Because children are seen as 'replacement smokers' by the tobacco industry, protecting children in this context is key to haltering the devastating effects of tobacco use and exposure worldwide. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  17. Vaccination with a feline immunodeficiency virus multiepitopic peptide induces cell-mediated and humoral immune responses in cats, but does not confer protection.

    PubMed Central

    Flynn, J N; Cannon, C A; Neil, J C; Jarrett, O

    1997-01-01

    Cats were immunized with a 46-residue multiepitopic synthetic peptide of feline immunodeficiency virus (FIV) comprising immunodominant epitopes present in the third variable domain of the envelope glycoprotein, transmembrane glycoprotein (TM), and p24 Gag core protein, using Quil A as an adjuvant. All vaccinated cats developed a humoral response which recognized the synthetic peptide immunogen and the intact viral core and envelope proteins. A FIV Gag- and Env-specific effector cytotoxic T-lymphocyte response was also detected in the peripheral blood of vaccinated cats, which peaked at week 30. This response appeared to be major histocompatibility complex restricted. Epitope mapping studies revealed that both the cellular and humoral immune responses were directed principally to a peptide within the TM glycoprotein, CNQNQFFCK. However, vaccination did not confer protection when cats were challenged with the Petaluma isolate of FIV at week 35. PMID:9311839

  18. Identification of viral genes associated with the interferon-inducing phenotype of a synthetic porcine reproductive and respiratory syndrome virus strain.

    PubMed

    Sun, Haiyan; Pattnaik, Asit K; Osorio, Fernando A; Vu, Hiep L X

    2016-12-01

    We recently generated a fully synthetic porcine reproductive and respiratory syndrome virus strain (designated as PRRSV-CON), which confers unprecedented levels of heterologous protection. We report herein that the synthetic PRRSV-CON possesses a unique phenotype in that it induces type-I interferons (IFNs) instead of suppressing these cytokines as most of the naturally occurring PRRSV isolates do. Through gain- and loss- of-function studies, the IFN-inducing phenotype of PRRSV-CON was mapped to the 3.3kb genomic fragment encoding three viral nonstructural proteins: nsp1α, nsp1β and the N-terminal part of nsp2. Further studies indicated that a cooperation among these 3 proteins was required for effective induction of IFNs. Collectively, this study constitutes the first step toward understanding the mechanisms by which the synthetic PRRSV-CON confers heterologous protection. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. 77 FR 34382 - Meetings of the National Drinking Water Advisory Council-Notice of Public Meetings

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-06-11

    ...The U.S. Environmental Protection Agency (EPA or agency) is announcing one public webinar/conference call and one in-person meeting of the National Drinking Water Advisory Council (NDWAC or Council), established under the Safe Drinking Water Act (SDWA). The Council will consider various issues associated with drinking water protection and public water systems. For the webinar/conference call, the Council will discuss a draft guidance for EPA permit writers relative to hydraulic fracturing using diesel fuels under the SDWA's Underground Injection Control (UIC) Program and also options for assisting small water systems in achieving sustainable practices. For the in-person meeting, the primary focus will be for the Council to discuss the proposed regulation of perchlorate under the SDWA. Also at this in-person meeting, the Council will discuss assistance to small water systems among other program issues.

  20. Teamwork and team decision-making at multidisciplinary cancer conferences: barriers, facilitators, and opportunities for improvement.

    PubMed

    Lamb, Benjamin W; Sevdalis, Nick; Arora, Sonal; Pinto, Anna; Vincent, Charles; Green, James S A

    2011-09-01

    Anecdotally, multidisciplinary cancer conferences (MCCs) do not always function optimally. MCC members' experiences with and attitudes toward MCCs are explored, and barriers to and facilitators of effective team-working are identified. A total of 19 semistructured interviews were conducted with surgeons, oncologists, nurses, and administrators. Interviews explored participants' opinions on MCC attendance, information presentation, case discussion, leadership, team decision-making, and possible improvements to MCC meetings. Nonattendance was associated with not having protected time to attend the MCC. Contributions to MCC discussions were unequal among the participants, and patient-centered information was ignored. Good leadership was necessary to foster inclusive case discussion. Members were positive about MCCs, but protected time, improved case selection, and working in a more structured way were possible improvements. Results are consistent with previous research: Members of the MCC are positive about the benefits of MCCs, although improving the way MCCs work is a goal.

  1. GOES-S Prelaunch News Conference

    NASA Image and Video Library

    2018-02-27

    In the Kennedy Space Center's Press Site auditorium, Tim Dunn, NASA launch director at Kennedy, speaks to members of the media at a prelaunch news conference about National Oceanic and Atmospheric Administration's, or NOAA's, Geostationary Operational Environmental Satellite, or GOES-S. The GOES series of satellites will significantly improve the detection and observation of environmental phenomena that directly affect public safety, protection of property and the nation's economic health and prosperity. GOES-S is slated to lift off at 5:02 p.m. EST on March 1, 2018 aboard a United Launch Alliance Atlas V rocket.

  2. [Comparative study of the antigens of Streptococcus group A. Rport I. Comparative characteristics of the immunologic activity of partially purified M-protien and the cytoplasmic protective antigen].

    PubMed

    Evseev, V A; Avdeeva, Zh I; Kondrashov, G I

    1975-12-01

    Experiments were conducted on mice. A study was made of the protective properties of the cytoplasmic fraction of streptococcus, group A, Type 1 and of an antigen isolated from it by sedimentation with ammonium sulfate, in comparison with M-protein partially purified by the method of Lancefield and Perlman. Cytoplasmic antigen was not inferior by immunogenicity in comparison with M-protein. In difference from the latter, it was thermolabile and sensitive to the action of hydrochloric acid. The protective antigen was revealed in the cytoplasm not only of the virulent, but also of avirulent strains of streptococcus devoid of M-protein.

  3. Partial reconstitution of the CD4+-T-cell compartment in CD4 gene knockout mice restores responses to tuberculosis DNA vaccines.

    PubMed

    D'Souza, Sushila; Romano, Marta; Korf, Johanna; Wang, Xiao-Ming; Adnet, Pierre-Yves; Huygen, Kris

    2006-05-01

    Reactivation tuberculosis (TB) is a serious problem in immunocompromised individuals, especially those with human immunodeficiency virus (HIV) coinfection. The adaptive immune response mediated by CD4+ and CD8+ T cells is known to confer protection against TB. Hence, vaccines against TB are designed to activate these two components of the immune system. Anti-TB DNA vaccines encoding the immunodominant proteins Ag85A, Ag85B, and PstS-3 from Mycobacterium tuberculosis are ineffective in mice lacking CD4+ T cells (CD4-/- mice). In this study, we demonstrate that reconstitution of the T-cell compartment in CD4-/- mice restores vaccine-specific antibody and gamma interferon (IFN-gamma) responses to these DNA vaccines. The magnitude of the immune responses correlated with the extent of reconstitution of the CD4+-T-cell compartment. Reconstituted mice vaccinated with DNA encoding PstS-3, known to encode a dominant D(b)-restricted CD8+-T-cell epitope, displayed CD8+-T-cell responses not observed in CD4-/- mice. M. tuberculosis challenge in reconstituted mice led to the extravasation of IFN-gamma-producing CD4+ and CD8+ T cells into lungs, the primary site of bacterial replication. Importantly, a reconstitution of 12 to 15% of the CD4+-T-cell compartment resulted in Ag85B plasmid DNA-mediated protection against a challenge M. tuberculosis infection. Our findings provide evidence that anti-TB DNA vaccines could be effective in immunodeficient individuals after CD4+-T-lymphocyte reconstitution, as may occur following antiretroviral therapy in HIV+ patients.

  4. Ginsenoside Rb1 protects against 6-hydroxydopamine-induced oxidative stress by increasing heme oxygenase-1 expression through an estrogen receptor-related PI3K/Akt/Nrf2-dependent pathway in human dopaminergic cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hwang, Yong Pil; College of Pharmacy, Chosun University, Gwangju; Jeong, Hye Gwang, E-mail: hgjeong@cnu.ac.k

    Phytoestrogens are polyphenolic non-steroidal plant compounds with estrogen-like biological activity. Ginseng, the root of Panax ginseng C.A. Meyer (Araliaceae), is a popular traditional herbal medicine. Ginsenoside Rb1 (Rb1), an active component commonly found in ginseng root, is a phytoestrogen that exerts estrogen-like activity. In this study, we demonstrate that the phytoestrogen Rb1 inhibits 6-hydroxydopamine (6-OHDA)-induced oxidative injury via an ER-dependent Gbeta1/PI3K/Akt and heme oxygenase-1 (HO-1) pathway. Pretreatment of SH-SY5Y cells with Rb1 significantly reduced 6-OHDA-induced caspase-3 activation and subsequent cell death. Rb1 also up-regulated HO-1 expression, which conferred cytoprotection against 6-OHDA-induced oxidative injury. Moreover, Rb1 induced both Nrf2 nuclear translocation,more » which is upstream of HO-1 expression and PI3K activation, a pathway that is involved in induced Nrf2 nuclear translocation, HO-1 expression and cytoprotection. Also, Rb1-mediated increases in PI3K activation and HO-1 induction were reversed by co-treatment with ICI 182,780 and pertussis toxin. Taken together, these results suggest that Rb1 augments the cellular antioxidant defenses through ER-dependent HO-1 induction via the Gbeta1/PI3K/Akt-Nrf2 signaling pathway, thereby protecting cells from oxidative stress. Thus our study indicates that Rb1 has a partial cytoprotective role in dopaminergic cell culture systems.« less

  5. Withaferin A inhibits experimental epithelial-mesenchymal transition in MCF-10A cells and suppresses vimentin protein level in vivo in breast tumors.

    PubMed

    Lee, Joomin; Hahm, Eun-Ryeong; Marcus, Adam I; Singh, Shivendra V

    2015-06-01

    We have shown previously that withaferin A (WA), a bioactive component of the medicinal plant Withania somnifera, inhibits growth of cultured and xenografted human breast cancer cells and prevents breast cancer development and pulmonary metastasis incidence in a transgenic mouse model. The present study was undertaken to determine if the anticancer effect of WA involved inhibition of epithelial-mesenchymal transition (EMT). Experimental EMT induced by exposure of MCF-10A cells to tumor necrosis factor-α (TNF-α) and transforming growth factor-β1 (TGF-β) was partially reversed by treatment with WA but not by its structural analogs withanone or withanolide A. Combined TNF-α and TGF-β treatments conferred partial protection against MCF-10A cell migration inhibition by WA. Inhibition of TNF-α and TGF-β-induced MCF-10A cell migration by WA exposure was modestly attenuated by knockdown of E-cadherin protein. MCF-7 and MDA-MB-231 cells exposed to WA exhibited sustained (MCF-7) or transient (MDA-MB-231) induction of E-cadherin protein. On the other hand, the level of vimentin protein was increased markedly after 24 h treatment of MDA-MB-231 cells with WA. WA-induced apoptosis was not affected by vimentin protein knockdown in MDA-MB-231 cells. Protein level of vimentin was significantly lower in the MDA-MB-231 xenografts as well as in MMTV-neu tumors from WA-treated mice compared with controls. The major conclusions of the present study are that (a) WA treatment inhibits experimental EMT in MCF-10A cells, and (b) mammary cancer growth inhibition by WA administration is associated with suppression of vimentin protein expression in vivo. © 2013 Wiley Periodicals, Inc.

  6. Role of Systematic Formative Assessment on Students' Views of Their Learning (El papel de la evaluación formativa en las percepciones de los estudiantes sobre su aprendizaje)

    ERIC Educational Resources Information Center

    Areiza Restrepo, Hugo Nelson

    2013-01-01

    This article presents a partial report of a small qualitative research study that explored the students' views of their learning during and after the implementation of formative procedures such as self-assessment, feedback, and conferences. The article also includes their perceptions about this implementation. The research was carried out with a…

  7. 29 CFR 4206.1 - Purpose and scope.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... protects the other employers in the plan from becoming responsible for unfunded vested benefits properly..., for adjusting the partial or complete withdrawal liability of an employer that previously partially withdrew from the same multiemployer plan. Section 4206(b)(1) provides that when an employer that has...

  8. 75 FR 27736 - Availability for Non-Exclusive, Exclusive, or Partially Exclusive Licensing of U.S. Provisional...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-05-18

    ... Cooling Method for Protective Clothing Ensembles AGENCY: Department of the Army, DoD. ACTION: Notice... Protective Clothing Ensembles,'' filed March 30, 2010. The United States Government, as represented by the... to a two- stage evaporative cooling method for use in protective clothing ensembles. Brenda S. Bowen...

  9. Corrosion protection for silver reflectors

    DOEpatents

    Arendt, Paul N.; Scott, Marion L.

    1991-12-31

    A method of protecting silver reflectors from damage caused by contact with gaseous substances which are often present in the atmosphere and a silver reflector which is so protected. The inventive method comprises at least partially coating a reflector with a metal oxide such as aluminum oxide to a thickness of 15 .ANG. or less.

  10. Recombinant α-actinin subunit antigens of Trichomonas vaginalis as potential vaccine candidates in protecting against trichomoniasis.

    PubMed

    Xie, Yi-Ting; Gao, Jiang-Mei; Wu, Ya-Ping; Tang, Petrus; Hide, Geoff; Lai, De-Hua; Lun, Zhao-Rong

    2017-02-16

    Human trichomoniasis caused by Trichomonas vaginalis is one of the most common sexually transmitted diseases with more than 200 million cases worldwide. It has caused a series of health problems to patients. For prevention and control of infectious diseases, vaccines are usually considered as one of the most cost-efficient tools. However, until now, work on the development of T. vaginalis vaccines is still mainly focused on the screening of potential immunogens. Alpha-actinin characterized by high immunogenicity in T. vaginalis was suggested as a promising candidate. Therefore, the purpose of this study was to evaluate the protective potency of recombinant α-actinin against T. vaginalis infection in a mouse intraperitoneal model. Two selected coding regions of α-actinin (ACT-F, 14-469 aa and ACT-T, 462-844 aa) amplified from cDNA were cloned into pET-32a (+) expression vector and transfected into BL21 cells. After induction with IPTG and purification with electroelution, the two recombinant fusion proteins were emulsified in Freund's adjuvant (FA) and used to immunize BALB/C mice. Following intraperitoneal inoculation with T. vaginalis, the survival rate of mice was monitored for the assessment of protective potency. After immunization, the antibody level in mouse serum was assessed by ELISA, splenocyte proliferation response was detected with CCK8 and cytokines in the supernatant of splenocytes were quantified with a cytometric bead-based assay. We successfully obtained purified ACT-F (70.33 kDa) and ACT-T (61.7kDa). Both recombinant proteins could provide significant protection against T. vaginalis challenge, especially ACT-T (with 100% protection within one month). Meanwhile, high levels of specific total IgG and subtypes (IgG1 > IgG2a) were detected in sera from the immunized mice. Our results also revealed a statistically significant increase in splenocyte proliferation and related cytokine (IFN-γ, IL-6, IL-17A and IL-10) production after repeated stimulation with the corresponding antigens in vitro. Immunization with both ACT-F and ACT-T could confer partial to complete protection and trigger strong Th1/Th2 mixed humoral and cellular immune responses in the mouse host. This suggested that recombinant α-actinin subunit antigens may be promising vaccine candidates against trichomoniasis.

  11. Ebola GP-specific monoclonal antibodies protect mice and guinea pigs from lethal Ebola virus infection.

    PubMed

    Qiu, Xiangguo; Fernando, Lisa; Melito, P Leno; Audet, Jonathan; Feldmann, Heinz; Kobinger, Gary; Alimonti, Judie B; Jones, Steven M

    2012-01-01

    Ebola virus (EBOV) causes acute hemorrhagic fever in humans and non-human primates with mortality rates up to 90%. So far there are no effective treatments available. This study evaluates the protective efficacy of 8 monoclonal antibodies (MAbs) against Ebola glycoprotein in mice and guinea pigs. Immunocompetent mice or guinea pigs were given MAbs i.p. in various doses individually or as pools of 3-4 MAbs to test their protection against a lethal challenge with mouse- or guinea pig-adapted EBOV. Each of the 8 MAbs (100 µg) protected mice from a lethal EBOV challenge when administered 1 day before or after challenge. Seven MAbs were effective 2 days post-infection (dpi), with 1 MAb demonstrating partial protection 3 dpi. In the guinea pigs each MAb showed partial protection at 1 dpi, however the mean time to death was significantly prolonged compared to the control group. Moreover, treatment with pools of 3-4 MAbs completely protected the majority of animals, while administration at 2-3 dpi achieved 50-100% protection. This data suggests that the MAbs generated are capable of protecting both animal species against lethal Ebola virus challenge. These results indicate that MAbs particularly when used as an oligoclonal set are a potential therapeutic for post-exposure treatment of EBOV infection.

  12. Proceedings of the third USGS modeling conference, June 7-11, 2010, Broomfield, Colorado-Understanding and predicting for a changing world

    USGS Publications Warehouse

    Brady, Shailaja R.

    2011-01-01

    The Third USGS Modeling Conference was held June 7th-11, 2010, in Broomfield, Colorado. The conference focused on the development and application of analytical and theoretical models and data availability that support managing the Nation's resources and help protect lives and property. Participants at the conference included scientists and managers from Department of the Interior (DOI) Bureaus; national and international Federal, State, and local agencies; academic institutions; and nongovernmental organizations. The conference was organized according to DOI priorities and the strategic directions of the USGS Science Strategy; the following themes were emphasized: (1) Understanding Ecosystems and Restoring America's Treasured Landscapes; (2) Climate Change and Impact; (3) New Energy Frontier and Minerals for America; (4) A National Hazards, Risk, and Resilience Assessment Program; (5) Role of Environment and Wildlife in Human Health; (6) A Water Census of the United States; and (7) New Methods of Investigation and Discovery. The conference theme-"Understanding and Predicting for a Changing World"-focused on the following goals: advance development and application of models; provide tools that address management issues; present state-of-the-art models ranging from individual phenomena to integrated systems; and foster a working community among scientists and managers.

  13. Mortality predictors in a 60-year follow-up of adolescent males: exploring delinquency, socioeconomic status, IQ, high-school drop-out status, and personality.

    PubMed

    Trumbetta, Susan L; Seltzer, Benjamin K; Gottesman, Irving I; McIntyre, Kathleen M

    2010-01-01

    To examine whether socioeconomic status (SES), high school (HS) completion, IQ, and personality traits that predict delinquency in adolescence also could explain men's delinquency-related (Dq-r) mortality risk across the life span. Through a 60-year Social Security Death Index (SSDI) follow-up of 1812 men from Hathaway's adolescent normative Minnesota Multiphasic Personality Inventory (MMPI) sample, we examined mortality risk at various ages and at various levels of prior delinquency severity. We examined SES (using family rent level), HS completion, IQ, and MMPI indicators simultaneously as mortality predictors and tested for SES (rent level) interactions with IQ and personality. We ascertained 418 decedents. Dq-r mortality peaked between ages 45 years to 64 years and continued through age 75 years, with high delinquency severity showing earlier and higher mortality risk. IQ and rent level failed to explain Dq-r mortality. HS completion robustly conferred mortality protection through ages 55 years and 75 years, explained IQ and rent level-related risk, but did not fully explain Dq-r risk. Dq-r MMPI scales, Psychopathic Deviate, and Social Introversion, respectively, predicted risk for and protection from mortality by age 75 years, explaining mortality risk otherwise attributable to delinquency. Wiggins' scales also explained Dq-r mortality risk, as Authority Conflict conferred risk for and Social Maladjustment and Hypomania conferred protection from mortality by age 75 years. HS completion robustly predicts mortality by ages 55 years and 75 years. Dq-r personality traits predict mortality by age 75 years, accounting, in part, for Dq-r mortality.

  14. Proceedings, 17th Central Hardwood Forest Conference

    Treesearch

    Songlin Fei; John M. Lhotka; Jeffrey W. Stringer; Kurt W. Gottschalk; Gary W., eds. Miller

    2011-01-01

    Includes 64 papers and 17 abstracts pertaining to research conducted on forest regeneration and propagation, forest products, ecology and forest dynamics, human dimensions and economics, forest biometrics and modeling, silviculture genetics, forest health and protection, and soil and mineral nutrition.

  15. Protection against Chlamydia psittaci in mice conferred by Lyt-2+ T cells.

    PubMed Central

    Buzoni-Gatel, D; Guilloteau, L; Bernard, F; Bernard, S; Chardès, T; Rocca, A

    1992-01-01

    A murine model was used to study the respective roles of L3T4+ and Lyt-2+ T cells in protection against Chlamydia psittaci. Donor mice were intravenously (i.v.) infected with 1 x 10(5) plaque-forming units (PFU) per mice of live C. psittaci. One month after inoculation, splenic cells from donors were transferred into syngenic recipients (5 x 10(7) cells/mouse). As measured by splenic colonization on Day 6 after i.v. challenge (1 x 10(5) PFU/mouse), transfer with primed (untreated) cells conferred a 3 log protection in this model. In vitro treatment, before transfer, of splenic cells with anti-Lyt-2 monoclonal antibody (mAb) and complement, markedly impaired the protection in comparison with control mice transferred with primed untreated cells, whereas treatment with anti-L3T4 mAb did not reduce the transferred protection. Resistance to a reinfection with C. psittaci was also studied after selective in vivo depletion of L3T4+ and Lyt-2+ T cells. One month after primary infection, mice were treated with anti-L3T4 or anti-Lyt-2 mAb and challenged thereafter (i.v., 1 x 10(5) PFU). The splenic colonization on Day 6 after challenge demonstrated that treatment with anti-Lyt-2 mAb impaired resistance against a subsequent infection with C. psittaci. Treatment with anti-L3T4 mAb in vivo had no effect on protection, as previously described in vitro. The mechanisms by which Lyt-2+ T cells could participate in the elimination of bacteria were discussed. PMID:1427980

  16. The axon-protective WLD(S) protein partially rescues mitochondrial respiration and glycolysis after axonal injury.

    PubMed

    Godzik, Katharina; Coleman, Michael P

    2015-04-01

    The axon-protective Wallerian degeneration slow (WLD(S)) protein can ameliorate the decline in axonal ATP levels after neurite transection. Here, we tested the hypothesis that this effect is associated with maintenance of mitochondrial respiration and/or glycolysis. We used isolated neurites of superior cervical ganglion (SCG) cultures in the Seahorse XF-24 Metabolic Flux Analyser to determine mitochondrial respiration and glycolysis under different conditions. We observed that both mitochondrial respiration and glycolysis declined significantly during the latent phase of Wallerian degeneration. WLD(S) partially reduced the decline both in glycolysis and in mitochondrial respiration. In addition, we found that depleting NAD levels in uncut cultures led to changes in mitochondrial respiration and glycolysis similar to those rescued by WLD(S) after cut, suggesting that the maintenance of NAD levels in Wld(S) neurites after axonal injury at least partially underlies the maintenance of ATP levels. However, by using another axon-protective mutation (Sarm1(-/-)), we could demonstrate that rescue of basal ECAR (and hence probably glycolysis) rather than basal OCR (mitochondrial respiration) may be part of the protective phenotype to delay Wallerian degeneration. These findings open new routes to study glycolysis and the connection between NAD and ATP levels in axon degeneration, which may help to eventually develop therapeutic strategies to treat neurodegenerative diseases.

  17. Dexamethasone protection from TNF-alpha-induced cell death in MCF-7 cells requires NF-kappaB and is independent from AKT.

    PubMed

    Machuca, Catalina; Mendoza-Milla, Criselda; Córdova, Emilio; Mejía, Salvador; Covarrubias, Luis; Ventura, José; Zentella, Alejandro

    2006-02-21

    The biochemical bases for hormone dependence in breast cancer have been recognized as an important element in tumor resistance, proliferation and metastasis. On this respect, dexamethasone (Dex) dependent protection against TNF-alpha-mediated cell death in the MCF-7 cell line has been demonstrated to be a useful model for the study of this type of cancer. Recently, cytoplasmic signaling induced by steroid receptors has been described, such as the activation of the PI3K/Akt and NF-kappaB pathways. We evaluated their possible participation in the Dex-dependent protection against TNF-alpha-mediated cell death. Cellular cultures of the MCF-7 cell line were exposed to either, TNF-alpha or TNF-alpha and Dex, and cell viability was evaluated. Next, negative dominants of PI3K and IkappaB-alpha, designed to block the PI3K/Akt and NF-kappaB pathways, respectively, were transfected and selection and evaluation of several clones overexpressing the mutants were examined. Also, correlation with inhibitor of apoptosis proteins (IAPs) expression was examined. Independent inhibition of these two pathways allowed us to test their participation in Dex-dependent protection against TNF-alpha-cytotoxicity in MCF-7 cells. Expression of the PI3K dominant negative mutant did not alter the protection conferred by Dex against TNF-alpha mediated cell death. Contrariwise, clones expressing the IkappaB-alpha dominant negative mutant lost the Dex-conferred protection against TNF-alpha. In these clones degradation of c-IAP was accelerated, while that of XIAP was remained unaffected. NF-kappaB, but not PI3K/Akt activation, is required for the Dex protective effect against TNF-alpha-mediated cell death, and correlates with lack of degradation of the anti-apoptotic protein c-IAP1.

  18. 41 CFR 60-40.7 - Partial disclosure.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 41 Public Contracts and Property Management 1 2014-07-01 2014-07-01 false Partial disclosure. 60-40.7 Section 60-40.7 Public Contracts and Property Management Other Provisions Relating to Public.... If a requested record contains some materials which are protected from disclosure and other materials...

  19. The Base Zone Protection Problem

    DTIC Science & Technology

    2008-12-01

    The Base Zone Protection Problem Dinesh C. Verma IBM T. J. Watson Research Center Hawthorne, NY 10549 Theodore Brown, Amotz Bar Noy and...al. 2008 have tried to develop the impact of terrain on the coverage area of a sensor and simulated its impact on sensor coverage. Kumar et al...conference on Wireless sensor networks and applications. WSNA 03, ACM Press, 2003, pp. 115--121. Kumar S., Lai T. and Arora A., “Barrier Coverage

  20. Sterile Immunity to Malaria after DNA Prime/Adenovirus Boost Immunization Is Associated with Effector Memory CD8+T Cells Targeting AMA1 Class I Epitopes

    PubMed Central

    Sedegah, Martha; Hollingdale, Michael R.; Farooq, Fouzia; Ganeshan, Harini; Belmonte, Maria; Kim, Yohan; Peters, Bjoern; Sette, Alessandro; Huang, Jun; McGrath, Shannon; Abot, Esteban; Limbach, Keith; Shi, Meng; Soisson, Lorraine; Diggs, Carter; Chuang, Ilin; Tamminga, Cindy; Epstein, Judith E.; Villasante, Eileen; Richie, Thomas L.

    2014-01-01

    Background Fifteen volunteers were immunized with three doses of plasmid DNA encoding P. falciparum circumsporozoite protein (CSP) and apical membrane antigen-1 (AMA1) and boosted with human adenovirus-5 (Ad) expressing the same antigens (DNA/Ad). Four volunteers (27%) demonstrated sterile immunity to controlled human malaria infection and, overall, protection was statistically significantly associated with ELISpot and CD8+ T cell IFN-γ activities to AMA1 but not CSP. DNA priming was required for protection, as 18 additional subjects immunized with Ad alone (AdCA) did not develop sterile protection. Methodology/Principal Findings We sought to identify correlates of protection, recognizing that DNA-priming may induce different responses than AdCA alone. Among protected volunteers, two and three had higher ELISpot and CD8+ T cell IFN-γ responses to CSP and AMA1, respectively, than non-protected volunteers. Unexpectedly, non-protected volunteers in the AdCA trial showed ELISpot and CD8+ T cell IFN-γ responses to AMA1 equal to or higher than the protected volunteers. T cell functionality assessed by intracellular cytokine staining for IFN-γ, TNF-α and IL-2 likewise did not distinguish protected from non-protected volunteers across both trials. However, three of the four protected volunteers showed higher effector to central memory CD8+ T cell ratios to AMA1, and one of these to CSP, than non-protected volunteers for both antigens. These responses were focused on discrete regions of CSP and AMA1. Class I epitopes restricted by A*03 or B*58 supertypes within these regions of AMA1 strongly recalled responses in three of four protected volunteers. We hypothesize that vaccine-induced effector memory CD8+ T cells recognizing a single class I epitope can confer sterile immunity to P. falciparum in humans. Conclusions/Significance We suggest that better understanding of which epitopes within malaria antigens can confer sterile immunity and design of vaccine approaches that elicit responses to these epitopes will increase the potency of next generation gene-based vaccines. PMID:25211344

  1. Light deficiency confers breast cancer risk by endocrine disorders.

    PubMed

    Suba, Zsuzsanna

    2012-09-01

    North-America and northern European countries exhibit the highest incidence rate of breast cancer, whereas women in southern regions are relatively protected. Immigrants from low cancer incidence regions to high-incidence areas might exhibit similarly higher or excessive cancer risk as compared with the inhabitants of their adoptive country. Additional cancer risk may be conferred by incongruence between their biological characteristics and foreign environment. Many studies established the racial/ethnic disparities in the risk and nature of female breast cancer in United States between African-American and Caucasian women. Mammary tumors in black women are diagnosed at earlier age, and are associated with higher rate of mortality as compared with cancers of white cases. Results of studies on these ethnic/racial differences in breast cancer incidence suggest that excessive pigmentation of dark skinned women results in a relative light-deficiency. Poor light exposure may explain the deleterious metabolic and hormonal alterations; such as insulin resistance, deficiencies of estrogen, thyroxin and vitamin-D conferring excessive cancer risk. The more northern the location of an adoptive country the higher the cancer risk for dark skinned immigrants. Recognition of the deleterious systemic effects of darkness and excessive melatonin synthesis enables cancer protection treatment for people living in light-deficient environment. Recent patents provide new methods for the prevention of hormonal and metabolic abnormities.

  2. Comparative Evaluation of Two Vaccine Candidates against Experimental Leishmaniasis Due to Leishmania major Infection in Four Inbred Mouse Strains▿

    PubMed Central

    Benhnini, Fouad; Chenik, Mehdi; Laouini, Dhafer; Louzir, Hechmi; Cazenave, Pierre André; Dellagi, Koussay

    2009-01-01

    Experimental leishmaniasis in BALB/c and C57BL/6 mice are the most investigated murine models that were used for the preclinical evaluation of Leishmania vaccine candidates. We have previously described two new inbred mouse strains named PWK and MAI issued from feral founders that also support the development of experimental leishmaniasis due to L. major. In this study, we sought to determine whether different mouse inbred strains generate concordant or discordant results when used to evaluate the potential of Leishmania proteins to protect against experimental leishmaniasis. To this end, two Leishmania proteins, namely, LACK (for Leishmania homolog of receptor for activated C kinase) and LmPDI (for L. major protein disulfide isomerase) were compared for their capacity to protect against experimental leishmaniasis in PWK, MAI, BALB/c, and C57BL/6 inbred mouse strains. Our data show that the capacity of Leishmania proteins to confer protection depends on the mouse strain used, stressing the important role played by the genetic background in shaping the immune response against the pathogen. These results may have important implications for the preclinical evaluation of candidate Leishmania vaccines: rather than using a single mouse strain, a panel of different inbred strains of various genetic backgrounds should be tested in parallel. The antigen that confers protection in the larger range of inbred strains may have better chances to be also protective in outbred human populations and should be selected for clinical trials. PMID:19726616

  3. Comparative evaluation of two vaccine candidates against experimental leishmaniasis due to Leishmania major infection in four inbred mouse strains.

    PubMed

    Benhnini, Fouad; Chenik, Mehdi; Laouini, Dhafer; Louzir, Hechmi; Cazenave, Pierre André; Dellagi, Koussay

    2009-11-01

    Experimental leishmaniasis in BALB/c and C57BL/6 mice are the most investigated murine models that were used for the preclinical evaluation of Leishmania vaccine candidates. We have previously described two new inbred mouse strains named PWK and MAI issued from feral founders that also support the development of experimental leishmaniasis due to L. major. In this study, we sought to determine whether different mouse inbred strains generate concordant or discordant results when used to evaluate the potential of Leishmania proteins to protect against experimental leishmaniasis. To this end, two Leishmania proteins, namely, LACK (for Leishmania homolog of receptor for activated C kinase) and LmPDI (for L. major protein disulfide isomerase) were compared for their capacity to protect against experimental leishmaniasis in PWK, MAI, BALB/c, and C57BL/6 inbred mouse strains. Our data show that the capacity of Leishmania proteins to confer protection depends on the mouse strain used, stressing the important role played by the genetic background in shaping the immune response against the pathogen. These results may have important implications for the preclinical evaluation of candidate Leishmania vaccines: rather than using a single mouse strain, a panel of different inbred strains of various genetic backgrounds should be tested in parallel. The antigen that confers protection in the larger range of inbred strains may have better chances to be also protective in outbred human populations and should be selected for clinical trials.

  4. Towards a human oral vaccine for anthrax: the utility of a Salmonella Typhi Ty21a-based prime-boost immunization strategy.

    PubMed

    Baillie, Leslie W J; Rodriguez, Ana L; Moore, Stephen; Atkins, Helen S; Feng, Chiguang; Nataro, James P; Pasetti, Marcela F

    2008-11-11

    We previously demonstrated the ability of an orally administered attenuated Salmonella enterica serovar Typhimurium strain expressing the protective antigen (PA) of Bacillus anthracis to confer protection against lethal anthrax aerosol spore challenge [Stokes MG, Titball RW, Neeson BN, et al. Oral administration of a Salmonella enterica-based vaccine expressing Bacillus anthracis protective antigen confers protection against aerosolized B. anthracis. Infect Immun 2007;75(April (4)):1827-34]. To extend the utility of this approach to humans we constructed variants of S. enterica serovar Typhi Ty21a, an attenuated typhoid vaccine strain licensed for human use, which expressed and exported PA via two distinct plasmid-based transport systems: the Escherichia coli HlyA haemolysin and the S. Typhi ClyA export apparatus. Murine immunogenicity studies confirmed the ability of these constructs, especially Ty21a expressing the ClyA-PA fusion protein, to stimulate strong PA-specific immune responses following intranasal immunization. These responses were further enhanced by a subsequent boost with either parenterally delivered recombinant PA or the licensed US human alum-adsorbed anthrax vaccine (AVA). Anthrax toxin neutralizing antibody responses using this prime-boost regimen were rapid, vigorous and broad in nature. The results of this study demonstrate the feasibility of employing a mucosal prime with a licensed Salmonella Typhi vaccine strain followed by a parenteral protein boost to stimulate rapid protective immunity against anthrax.

  5. The future of exposure assessment: perspectives from the X2012 Conference.

    PubMed

    De Vocht, Frank; Northage, Christine; Money, Chris; Cherrie, John W; Rajan-Sithamparanadarajah, Bob; Egeghy, Peter; Niven, Karen; Demers, Paul; Van Tongeren, Martie

    2013-04-01

    The British Occupational Hygiene Society, in collaboration with the Institute of Occupational Medicine, the University of Manchester, the UK Health and Safety Executive, and the University of Aberdeen hosted the 7th International Conference on the Science of Exposure Assessment (X2012) on 2 July-5 July 2012 in Edinburgh, UK. The conference ended with a special session at which invited speakers from government, industry, independent research institutes, and academia were asked to reflect on the conference and discuss what may now constitute the important highlights or drivers of future exposure assessment research. This article summarizes these discussions with respect to current and future technical and methodological developments. For the exposure science community to continue to have an impact in protecting public health, additional efforts need to be made to improve partnerships and cross-disciplinary collaborations, although it is equally important to ensure that the traditional occupational exposure themes are still covered as these issues are becoming increasingly important in the developing world. To facilitate this the 'X' conferences should continue to retain a holistic approach to occupational and non-occupational exposures and should actively pursue collaborations with other disciplines and professional organizations to increase the presence of consumer and environmental exposure scientists.

  6. Anticonvulsant activity of a mGlu(4alpha) receptor selective agonist, (1S,3R,4S)-1-aminocyclopentane-1,2,4-tricarboxylic acid.

    PubMed

    Chapman, A G; Talebi, A; Yip, P K; Meldrum, B S

    2001-07-20

    The metabotropic Group III agonist, (1S,3R,4S)-1-aminocyclopentane-1,2,4-tricarboxylic acid (ACPT-1), selective for the mGlu(4alpha) receptor, suppresses sound-induced seizures in DBA/2 mice following its intracerebroventricular (i.c.v.) administration (ED(50) 5.6 [2.9-10.7], nmol i.c.v., 15 min, clonic phase) and in genetically epilepsy-prone (GEP) rats following focal administration into the inferior colliculus (ED(50) 0.08 [0.01-0.50], nmol, 60 min, clonic phase). ACPT-1 also protects against clonic seizures induced in DBA/2 mice by the Group I agonist, (RS)-3,5-dihydroxyphenylglycine (3,5-DHPG) (ED(50) 0.60 [0.29-1.2], nmol i.c.v.) and by the Group III antagonist, (RS)-alpha-methylserine-O-phosphate (MSOP) (ED(50) 49.3 [37.9-64.1], nmol i.c.v.). Another Group III agonist, (RS)-4-phosphonophenyl-glycine (PPG), preferentially activating the mGlu(8) receptor, previously shown to protect against sound-induced seizures in DBA/2 mice and GEP rats, also protects against seizures induced in DBA/2 by 3,5-DHPG (ED(50) 3.7 [2.4-5.7], nmol i.c.v.) and by the Group III antagonist, MSOP (ED(50) 40.2 [21.0-77.0], nmol i.c.v.). At very high doses (500 nmol i.c.v. and above), Group III antagonists have pro-convulsant and convulsant activity. The anticonvulsant protection against sound-induced seizures in DBA/2 mice provided by a fully protective dose (20 nmol, i.c.v.) of the mGlu(4) receptor agonist ACPT-1, is partially reversed by the co-administration of the Group III antagonists, MSOP, (RS)-alpha-methyl-4-phosphonophenylglycine (MPPG) or (S)-2-amino-2-methyl-4-phosphonobutanoic acid (MAP4), in the 20-50 nmol dose range. At doses of 50-200 nmol, MPPG and MAP4 cause further reversal of the ACPT-1 anticonvulsant protection, while the MSOP effect on ACPT-1 protection is abolished at higher doses. In contrast, the anticonvulsant protection against sound-induced seizures in DBA/2 mice provided by a fully protective dose (20 nmol, i.c.v.) of the mGlu(8) receptor agonist PPG, is not significantly affected by the co-administration of the same Group III antagonists, MSOP, MPPG or MAP4. We conclude that activation of either mGlu(4alpha) or mGlu(8) receptors confer anticonvulsant protection in DBA/2 mice. Furthermore, the metabotropic Group III receptor antagonists, MSOP, MPPG, and MAP4 appear to be functionally selective for the mGlu(4) receptor in this system.

  7. Filling-enforced nonsymmorphic Kondo semimetals in two dimensions

    NASA Astrophysics Data System (ADS)

    Pixley, J. H.; Lee, SungBin; Brandom, B.; Parameswaran, S. A.

    2017-08-01

    We study the competition between Kondo screening and frustrated magnetism on the nonsymmorphic Shastry-Sutherland Kondo lattice at a filling of two conduction electrons per unit cell. This model is known to host a set of gapless partially Kondo screened phases intermediate between the Kondo-destroyed paramagnet and the heavy Fermi liquid. Based on crystal symmetries, we argue that (i) both the paramagnet and the heavy Fermi liquid are semimetals protected by a glide symmetry; and (ii) partial Kondo screening breaks the symmetry, removing this protection and allowing the partially Kondo screened phase to be deformed into a Kondo insulator via a Lifshitz transition. We confirm these results using large-N mean-field theory and then use nonperturbative arguments to derive a generalized Luttinger sum rule constraining the phase structure of two-dimensional nonsymmorphic Kondo lattices beyond the mean-field limit.

  8. Early Life Stress and the Anxious Brain: Evidence for A Neural Mechanism Linking Childhood Emotional Maltreatment to Anxiety in Adulthood

    PubMed Central

    Fonzo, Gregory A.; Ramsawh, Holly J.; Flagan, Taru M.; Simmons, Alan N.; Sullivan, Sarah G.; Allard, Carolyn B.; Paulus, Martin P.; Stein, Murray B.

    2016-01-01

    Background Childhood emotional maltreatment (CEM) increases likelihood of developing an anxiety disorder in adulthood, but the neural processes underlying conferment of this risk have not been established. Here, we test the potential for neuroimaging the adult brain to inform understanding of the mechanism linking CEM to adult anxiety symptoms. Methods One hundred eighty-two adults (148 females, 34 males) with a normal-to-clinical range of anxiety symptoms underwent structural and functional magnetic resonance imaging while completing an emotion-processing paradigm with facial expressions of fear, anger, and happiness. Participants completed self-report measures of CEM and current anxiety symptoms. Voxelwise mediation analyses on gray matter volumes and activation to each emotion condition were used to identify candidate brain mechanisms relating CEM to anxiety in adulthood. Results During processing of fear and anger faces, greater amygdala and less right dorsolateral prefrontal (dlPFC) activation partially mediated the positive relationship between CEM and anxiety symptoms. Greater right posterior insula activation to fear also partially mediated this relationship, as did greater ventral anterior cingulate (ACC) and less dorsal ACC activation to anger. Responses to happy faces in these regions did not mediate the CEM-anxiety relationship. Smaller right dlPFC gray matter volumes also partially mediated the CEM-anxiety relationship. Conclusions Activation patterns of the adult brain demonstrate the potential to inform mechanistic accounts of the CEM conferment of anxiety symptoms. Results support the hypothesis that exaggerated limbic activation to negative valence facial emotions links CEM to anxiety symptoms, which may be consequent to a breakdown of cortical regulatory processes. PMID:26670947

  9. The Legal Aspects of College Health Nursing

    ERIC Educational Resources Information Center

    Dutton, Ruth C.

    1970-01-01

    Discusses do's and dont's of profession, emphasizing protective measures nurses can take to guard against legal action by students, including continuing education and malpractice insurance. Presented at General Conference of Seventh Day Adventists, Andrews University, Berrien Springs, Michigan, August 1968. (CJ)

  10. 75 FR 4828 - Eunice Kennedy Shriver National Institute of Child Health and Human Development; Notice of Closed...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-01-29

    ..., (Telephone Conference Call). Contact Person: Peter Zelazowski, PhD, Scientific Review Officer, Division of... Executive Boulevard, Rm. 5B01, Bethesda, MD 20892-7510, 301-435- 6902, peter[email protected] . (Catalogue...

  11. 75 FR 39698 - Eunice Kennedy Shriver National Institute of Child Health and Human Development; Notice of Closed...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-07-12

    ..., (Telephone Conference Call). Contact Person: Peter Zelazowski, PhD, Scientific Review Officer, Division of... Executive Boulevard, Room 5B01, Bethesda, MD 20892-7510, 301-435- 6902, peter[email protected] . This...

  12. 76 FR 17928 - Eunice Kennedy Shriver National Institute of Child Health & Human Development; Notice of Closed...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-03-31

    ... Conference). Contact Person: Peter Zelazowski, PhD, Scientific Review Officer, Division of Scientific Review...., Room 5B01, Bethesda, MD 20892, 301-435-6902, peter[email protected] . (Catalogue of Federal Domestic...

  13. 76 FR 5593 - Eunice Kennedy Shriver National Institute of Child Health & Human Development; Notice of Closed...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-02-01

    ... Conference Call). Contact Person: Peter Zelazowski, PhD, Scientific Review Officer, Division Of Scientific... Executive Blvd., Room 5B01, Rockville, MD, 301-435-6902, peter[email protected] . (Catalogue of Federal...

  14. Feasibility study on partial insulation winding technique for the development of self-protective MgB2 magnet

    NASA Astrophysics Data System (ADS)

    Kim, Y. G.; Kim, J. C.; Kim, J. M.; Yoo, B. H.; Hwang, D. Y.; Lee, H. G.

    2018-06-01

    This study investigates the feasibility of using the partial insulation winding technique for the development of a self-protective MgB2 MRI magnet with a fast charge-discharge rate. Charge-discharge and quench tests for a prototype PI MgB2 magnet confirmed that the magnet was successfully operated at full-field performance and exhibited self-protecting behavior in the event of a quench. Nonetheless, the required time to charge the 0.5-T/300-mm PI MgB2 magnet was almost five days, implying that the charge-discharge delay of the PI MgB2 magnet still needs to be ameliorated further to develop a real-scale MgB2 MRI magnet with a fast charge-discharge rate.

  15. Classification of symmetry-protected phases for interacting fermions in two dimensions

    NASA Astrophysics Data System (ADS)

    Cheng, Meng; Bi, Zhen; You, Yi-Zhuang; Gu, Zheng-Cheng

    2018-05-01

    Recently, it has been established that two-dimensional bosonic symmetry-protected topological (SPT) phases with on-site unitary symmetry G can be completely classified by the group cohomology H3( G ,U (1 ) ) . Later, group supercohomology was proposed as a partial classification for SPT phases of interacting fermions. In this work, we revisit this problem based on the algebraic theory of symmetry and defects in two-dimensional topological phases. We reproduce the partial classifications given by group supercohomology, and we also show that with an additional H1(G ,Z2) structure, a complete classification of SPT phases for two-dimensional interacting fermion systems with a total symmetry group G ×Z2f is obtained. We also discuss the classification of interacting fermionic SPT phases protected by time-reversal symmetry.

  16. Worldwide Emerging Environmental Issues Affecting the U.S. Military. August 2005 Report

    DTIC Science & Technology

    2005-08-01

    Frozen Areas Accelerates Siberia’s melting accelerates global warming . Scientists recently discovered that in the last three or four years the...melting, considered to be partially caused by global warming , becomes in its turn an accelerating factor of it. This finding follows a similar...Greenland Conference on Global Warming Environmental ministers and other officials from 23 countries around the world and the EU met on the edge of a

  17. Combining Offline and Online Computation for Solving Partially Observable Markov Decision Process

    DTIC Science & Technology

    2015-03-06

    David Hsu and Wee Sun Lee, Monte Carlo Bayesian Reinforcement Learning, International Conference on Machine Learning (ICML), 2012. • Haoyu Bai, David...and Automation (ICRA), 2015. • Zhan Wei Lim, David Hsu, and Wee Sun Lee, Adaptive Informative Path Planning in Metric Spaces. Submitted to Int. J... Automation (ICRA), 2015. 2. Bai, H., Hsu, D., Kochenderfer, M. J., and Lee, W. S., Unmanned aircraft collision avoidance using continuous state POMDPs

  18. Resistance to hepatitis C virus: potential genetic and immunological determinants.

    PubMed

    Mina, Michael M; Luciani, Fabio; Cameron, Barbara; Bull, Rowena A; Beard, Michael R; Booth, David; Lloyd, Andrew R

    2015-04-01

    Studies of individuals who were highly exposed but seronegative (HESN) for HIV infection led to the discovery that homozygosity for the Δ32 deletion mutation in the CCR5 gene prevents viral entry into target cells, and is associated with resistance to infection. Additionally, evidence for protective immunity has been noted in some HESN groups, such as sex workers in The Gambia. Population studies of individuals at high risk for hepatitis C virus infection suggest that an HESN phenotype exists. The body of evidence, which suggests that protective immunity allows clearance of hepatitis C virus without seroconversion is growing. Furthermore, proof-of-principle evidence from in-vitro studies shows that genetic polymorphisms can confer resistance to establishment of infection. This Review discusses the possibility that genetic mutations confer resistance against hepatitis C virus, and also explores evidence for protective immunity, including via genetically programmed variations in host responses. The data generally strengthens the notion that investigations of naturally arising polymorphisms within the hepatitis C virus interactome, and genetic association studies of well characterised HESN individuals, could identify potential targets for vaccine design and inform novel therapies. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. Leptin confers protection against TNF-α-induced apoptosis in rat cardiomyocytes.

    PubMed

    Yu, Lu; Zhao, Yanbo; Xu, Shengjie; Jin, Chongying; Wang, Min; Fu, Guosheng

    2014-12-05

    Leptin, an important adipose-derived hormone, is recognized as a crucial protein in energy homeostasis. Recent studies indicated that leptin is associated with cardiac pathophysiology, however, the role and mechanisms of leptin in cardiomyocytes apoptosis are poorly understood. Here we investigated whether leptin exerted protective effect on cardiomyocytes exposed to tumor necrosis factor-alpha (TNF-α) and the possible mechanisms. Neonatal rat cardiomyocytes were subjected to TNF-α in the presence or absence of leptin. By FITC/Annexin V flow cytometry and Western blot, we noticed that TNF-α increased Annexin V binding and cleaved caspase-3/PARP, which were attenuated by leptin pretreatment. Moreover, leptin protected cardiomyocytes against mitochondrial apoptosis by inhibiting cytochrome C elevation and Bcl-2 decreasing. TNF-α-induced P38 MAPK and NF-κB activation were abolished by leptin addition, and the P38 and NF-κB inhibitor, SB203580 and Bay117082, also mitigated the apoptotic effect of TNF-α, indicating that their activation might be responsible for the apoptosis in TNF-α-treated cardiomyocytes. Therefore, leptin conferred anti-apoptotic effect in cardiomyocytes exposed to TNF-α possibly by inhibiting TNF-α-activated P38 MAPK and NF-κB pathways.

  20. D25V apolipoprotein C-III variant causes dominant hereditary systemic amyloidosis and confers cardiovascular protective lipoprotein profile

    PubMed Central

    Valleix, Sophie; Verona, Guglielmo; Jourde-Chiche, Noémie; Nédelec, Brigitte; Mangione, P. Patrizia; Bridoux, Frank; Mangé, Alain; Dogan, Ahmet; Goujon, Jean-Michel; Lhomme, Marie; Dauteuille, Carolane; Chabert, Michèle; Porcari, Riccardo; Waudby, Christopher A.; Relini, Annalisa; Talmud, Philippa J.; Kovrov, Oleg; Olivecrona, Gunilla; Stoppini, Monica; Christodoulou, John; Hawkins, Philip N.; Grateau, Gilles; Delpech, Marc; Kontush, Anatol; Gillmore, Julian D.; Kalopissis, Athina D.; Bellotti, Vittorio

    2016-01-01

    Apolipoprotein C-III deficiency provides cardiovascular protection, but apolipoprotein C-III is not known to be associated with human amyloidosis. Here we report a form of amyloidosis characterized by renal insufficiency caused by a new apolipoprotein C-III variant, D25V. Despite their uremic state, the D25V-carriers exhibit low triglyceride (TG) and apolipoprotein C-III levels, and low very-low-density lipoprotein (VLDL)/high high-density lipoprotein (HDL) profile. Amyloid fibrils comprise the D25V-variant only, showing that wild-type apolipoprotein C-III does not contribute to amyloid deposition in vivo. The mutation profoundly impacts helical structure stability of D25V-variant, which is remarkably fibrillogenic under physiological conditions in vitro producing typical amyloid fibrils in its lipid-free form. D25V apolipoprotein C-III is a new human amyloidogenic protein and the first conferring cardioprotection even in the unfavourable context of renal failure, extending the evidence for an important cardiovascular protective role of apolipoprotein C-III deficiency. Thus, fibrate therapy, which reduces hepatic APOC3 transcription, may delay amyloid deposition in affected patients. PMID:26790392

Top